Split (1)

train · 262k rows

text stringlengths 253 685k
Ohioans are no strangers to harsh weather. If you live here, you are familiar with the hot, humid summers that often produce severe thunderstorms. In the winter, residents of the Buckeye state contend with snow, ice, and blizzards. And then there's the high winds, flooding, and even tornadoes that can occur any time of year. As an Ohio homeowner, you shouldn't have to wonder if your roof can stand up to Mother Nature. That's where synthetic shingles come in. Synthetic shingles have many benefits over traditional shingles that make them an ideal material for Ohio homes. So how do you know if it's time to replace your old roof? Once you've determined it's time for a new roof, why should you choose synthetic shingles? Synthetic shingles, also known as composite shingles, are made of a combination of rubber and plastic. They are more durable and are lower maintenance than asphalt, slate, cedar, or clay tile. Synthetic shingles have many benefits including: Unlike some other roofing materials, synthetic shingles are sustainable. So what does it mean for a material to be sustainable? If you make an effort to purchase green products that have a minimal impact on the environment, synthetic shingles are a great choice. Here's why: Synthetic shingles are extremely durable and don't have many of the disadvantages of other roofing materials. With a 30 to 50 year lifespan, you can be confident that you are getting a maximum return on your investment. This is significantly longer than asphalt shingles, which usually last up to 20 years, or cedar shake, which usually lasts only 15 to 20 years. Ohio's harsh weather can wreak havoc on home exteriors, especially roofs! Moisture is especially harsh, as it can cause mildew, rot, or compromise the insulation. High winds can shift and dislodge panels. UV rays cause shingles to deteriorate more quickly or crack. During excessive rainfall, water can find its way into the most vulnerable cracks and holes. This insidious infiltration results in irreparable damage. Ohio's cold winters and hot summers make it especially important to choose materials that can stand up to the elements. Synthetic shingles are an excellent choice for Buckeye state residents because: As a busy homeowner, you don't want to spend your precious time maintaining your roof and you don't want to repeatedly spend your hard-earned money repairing – or worse – replacing your roof before you should have to. The best way to avoid this headache is to choose a low-maintenance roofing material, such as composite shingles. They don't warp, mold, or rot easily, so you don't have to worry about constantly checking for damage or cleaning off algae or other unattractive stains. Unlike wood, composite shingles don't attract pests, which means you can avoid critter damage and resulting repairs. Squirrels and other pests can wreak havoc on your home. If they find their way in, they can destroy electrical wiring, or drop nuts or pinecones down your gutter, clogging them and allowing moisture to damage your home's foundation. Here is why synthetic shingles are the lowest maintenance roofing material available: A fire in any part of your home is terrifying. Unfortunately, they are all too common. According to the National Fire Protection Association, in 2020, on average, a fire department responded to a fire in a home structure every 89 seconds, and a death occurred as the result of a home fire every three hours and 24 minutes. Roof fires can be especially destructive. Knowing this, doesn't it make sense to choose the most fire-resistant roofing material you can find? Causes of roof fires may include: Synthetic shingles are Class A fire-rated, which means that they will last two to four hours before igniting, giving you peace of mind that your home and family are protected. One of the truly outstanding perks of synthetic shingles is the variety of styles and colors available. Synthetic shingles come in three distinct designs that can be customized to suit any home, including: A Durable, Synthetic Roof Upgrades Dayton Area Home A Springboro homeowner had spent more than a year talking to different roofing contractors, trying to find the right replacement for their old shake roof, which was leaking, had curling shingles, and had moss growing on it. Those companies had suggested replacing their roof with either shake or asphalt shingles, neither of which seemed like the right material or style for their home. They contacted American Way Exteriors to meet with a member of our team for a roofing consultation. At American Way Exteriors, we carry three trusted synesthetic shingle brands including Brava, CeDUR, and Davinci. Brava synthetic shingles are molded to mimic the appearance of natural materials you often see on Dayton area homes. Brava shingles also: CeDUR matches the appearance of natural wood cedar shakes and: Gorgeous Davinci composite roofs are: The answer is, yes and no. Here's how composite shingles compare to other materials: In addition to materials, other factors that go into pricing include the roof's configuration, installation, and whether your contractor must remove your old roof. Synthetic shingles can often be installed right on top of old roofs. But the bottom line is this: in the long run, synthetic shingles are extremely durable and last for decades, so you'll get a much better return on your investment. At American Way Exteriors we're experts when it comes to synthetic shingle roofs. In addition to extensive knowledge of the materials, our skilled craftsmen are highly experienced when it comes to installation. We'll even go above and beyond the manufacturer's specifications! Want to hear why our clients love us so much? Read about some of our highly successful Dayton area projects. When it comes to customer service, you'll be able to tell we are different beginning with your first interaction. You can be assured that we will treat you like an individual, not a dollar figure or the next transaction. Our team members take the time to listen and understand your concerns and desires and you'll never encounter any high-pressure sales tactics. Throughout the project, we'll keep you informed of its status. We'll never keep you in the dark. In fact, we have an easy, convenient way for you to connect with your project manager right from your phone! Are you ready to learn more about American Way Exteriors and the benefits of synthetic shingle roofs? Contact us today!
The Economic Hardship Reporting Projects supports independent journalists so they can create gripping stories which often counter the typical disparaging narratives about inequality. This high-quality journalism is then co-published with mainstream media outlets mobilizing readers to address systemic economic hardship. Unions are popular but facing decades of decline. We asked photographers to document this unique moment for the American worker. Learn MoreAmerican work has gotten increasingly unstable. It's no wonder an increasing number are drawn to a model of working that gives them back some power. Welcome to worker co-ops—businesses where the workers literally own the place. Now, they are springing up across the nation. Learn MoreThe most vulnerable Americans are being crushed by the grip of poverty, from the deserts of the Southwest through the black belt in the South, to the post-industrial, rusting factory towns that dot the Midwest and Northeast. Learn MoreCo-operative businesses are returning workers' power. These photographers have shown both the beauty and the effort of when Americans get to be their own bosses. Learn MoreThe Economic Hardship Reporting Project presents a discussion with four of our video grantees about the process of making visual works that address important American aftermath issues, including: the Great Migration of African Americans from the South to the North; urban neglect; and the cultural conflict over abortion sparked by Roe v. Wade. Learn MoreThis panel gathers veteran photographers who have made it their life's work to document stories of poverty and inequality with empathy, depth and curiosity. Motivated by their personal experiences in economically depressed areas, they explore and illustrate what economic inequality looks like in the U.S. Learn More
Carter Collection - 3D Models Carter Collection Blacksmith Shop at Carter Boyhood Home Download Full Text Publication Date This small, reconstructed blacksmith shop was made to replicate the small workshop at the Jimmy Carter National Historic Site (Boyhood Home). According to President Carter, the shop had a dirt floor, and tools included a forge and anvil, drill press, and Emory wheel that were utilized in daily tool upkeep and repair. The President is a notable woodworker. He credits his time with his father in the Blacksmith shop with learning to work with tools that he would use in furniture making and, later, extensive philanthropy work in building and repairing homes with Habitat for Humanity. The blacksmith shop was also where the farm's mules and horses were shod, and the plows were sharpened. Architecture, Cultural property, National Park Service, African Americans history, Terrestrial laser scanning, 39th President, Presidential history, Jimmy Carter National Historical Park (Plains, Ga.), Jimmy Carter 1 3-D Model Geographic Location Sumter County (Ga.); Plains (Ga.) This model is part of the Jimmy Carter National Historical Park 3D Architecture Collection. Recommended Citation Center for Digital Heritage and Geospatial Information, "Carter Collection Blacksmith Shop at Carter Boyhood Home" (2022). Carter Collection - 3D Models. 29.
In today's world, there are so many things which are constantly distracting us. And we know that being distracted can be detrimental to our creativity. As a result, many people are trying to build up their internal ability to ignore distractions and be able to focus better in order to live a happier life. One of the fastest growing ways to do this is meditation. Meditation is a practice in which an individual uses a technique – such as mindfulness, or focusing the mind on a particular object, thought, or activity – to train attention and awareness, and achieve a mentally clear and emotionally calm and stable state. While meditation has existed for thousands of years in cultures across the world, it is gaining in popularity recently. A 2018 report from the USA CDC showed that within the past 5 years, the total number of people who had tried meditation had more than tripled. So the next question is: If people are feeling better and calmer due to this meditation, does it also have a positive impact on their creativity? Interestingly, there has been research done on this topic. The most important research on the topic comes from the 2012 research paper: Meditate to create: the impact of focused-attention and open-monitoring training on convergent and divergent thinking In this paper, the researchers looked at two different ways of meditating and assessed their impact of participants' ability to perform divergent and convergent thinking. While the sample size of 19 participants was quite small, it is the best research I have come across. The two different ways of meditating represent the main techniques of Buddhist meditation practices: - Focused Attention Meditation (FAM): the participant picks something to get their complete focus and attention, such as their breath. If any thoughts or bodily sensations come into their mind, they are to be actively ignored and focus forced back onto whatever they should be focusing on. Mind wandering should be suppressed. This can require deep concentration and the activation of the executive attention network. - Open Monitoring Meditation (OMM): the participant is open to experience any thought or sensation without the need to fixate on anything specific. The aim is rather to stay in the monitoring state, remaining attentive to any experience that might arise, without selecting, judging, or focusing on any particular object. This is much more likely to lead to mind wandering, associated with original and divergent new creative ideas. Indeed, the results of the research showed clearly that after OM meditation, participants performed better on divergent thinking creativity tests. However, after FA meditation, they did not perform better on either divergent or convergent thinking tests. This was thought be to since OM meditation allows you to accept any thoughts which come into your mind, it allows the ideas and thoughts in your mind to evolve and build upon one another, which is exactly the sort of skill required for divergent thinking creative tasks. So if you are looking to use meditation to enhance your creativity, you should seek out a practice based on Open Monitoring Meditation rather than Focused Attention Meditation. Nick Skillicorn Latest posts by Nick Skillicorn (see all) - When your imagination is beyond your skill level - May 9, 2024 - When does it make sense to play a character of yourself? - March 29, 2024 - Focus on doing fewer things in order to make progress faster - March 14, 2024 - Focus on what you can control - January 23, 2024
One area of personal finance that remains constant even in these ever-moving and changing landscapes is the fact that, on average, men amass more debt than women. And, of course, the results are pretty much the same for credit cards, mortgages, and personal loans. Understanding some of these reasons, which are multifaceted in origin, is critical to the broader implications they carry on financial health and the social norms that surround this. Here, we look into ten reasons explaining why men are likely to have deeper debts than women, looking precisely at the key behavioral, societal, and economic factors at play. 1. Riskier Financial Behaviors This characteristic of risk-taking in men is perhaps from their socialization, which spills over into their financial practices as well. Studies show that men participate in speculative investments or gambling more than women do. They take on such activities with higher debt levels. Besides, men are fairly optimistic about their financial future and could leverage more than necessary to the extent that they believe they can overtake what they borrow. 2. Higher Engagement in Expensive Hobbies High-value hobbies, such as the collection of cars, boating, and gambling, tend to appeal more to men. These tasks not only require an average front-loaded investment but even involve continued maintenance and updating expenses, which ultimately result in more personal debts. The societal pressure to partake in such hobbies for leisure or status can exacerbate financial strain. 3. Societal Pressure to Provide More often than not, traditional roles in society have placed men in the breadwinner's position, with the top-earning but volatile careers of the two genders. This pressure, however, may end up pushing him to accumulate debts while trying to keep at least the façade of being financially stable or successful and be able to afford the provider role by taking up loans and credits. 4. Differential Access to Financial Education Financial literacy is paramount across all parts of the world, but men often get groomed to get involved in financial markets and various investment strategies already at their tender ages. It is this same early exposure that does not always pertain to responsible debt management. In such a case without balance in education, the point may underscore the control in debt and budgeting, putting them in a scenario where one has higher levels of debt due to increased financial activity. 5. Competitive Spending Among Peers Peer pressure and "keeping up with the Joneses" syndromes may plague both sexes, but males tend to be under a different kind of duress to showcase wealth through material possessions such as cars, technology, and clothing. The struggle to be in the game with regard to social status competition through material possession often tends to be inclined toward excessive use of credit and loans. 6. Gender Wage Gap Implications Quite surprisingly, one might argue that gender wage gaps are the cause for men accruing more debt, albeit indirectly. Higher average incomes will most likely translate to higher loans and credit limits, amounts which, when mismanaged, could potentially bring substantial debt to the borrower—in this case, a man. Ironically, the feeling of having more financial freedom can lead to even riskier financial behaviors. 7. Delayed Family Formation They are, however, more often older than women, maybe giving them a chance to be influenced by the magnitude of the debts they accumulate before settling down to start up the family. Spending more on lifestyle and leisure, they would have accumulated debts and found it too heavy to bear when other family responsibilities were surmounted. 8. Less Price Sensitivity Research has indicated that in general, women are more price-sensitive than men and more attuned to getting the best deal or discounts on purchases. This has an influence not only on spending patterns but also forms a man's credit interaction into things like paying broader interest and collecting more debt over time. 9. Health Care Engagement This means that men are less likely to make attempts or have active efforts in their medical care, thus accumulating potential emergency medical bills that have to be paid at one point in the future. Unexpected medical debts are often in excess and can be a very powerful addition to the overall debt, especially in countries without universal health care. 10. Divorce and Debt It can prove to be a real financial strain for a person, but often, the demands of post-divorce financials are on the steep side for men. Legal fees, alimonies, child support, and having to establish a new, independent household are the reasons that leave many men hopelessly in debt following a separation. Discrepancies in Gender and Debt Understanding the reasons behind the discrepancies in gender in debt accumulation should not be meant to blame anything; the sole concern should be to appreciate social, economic, and behavioral dynamics. This will be helpful in understanding what exactly dictates the financial activities of an individual and thus help in guiding more effective financial education and support system set-ups. It would mean that re-imaging traditional gender would be a very critical norm for the financial well-being and equity of both genders as the world keeps changing. Read More 15 Old-Fashioned Household Tips That Save Time and Money The Ugly Truth About Zoos: 12 Reasons Why They're More Harmful Than Helpful
Location: 17 km S from Ciudad Cuauhtemoc, Chihuahua, Mexico Blas Cano de los Rios #500, Col. San FelipeChihuahuaChihuahua, MexicoC.P. 31203 Stay on top of the latest gold discoveries. Examine the latest updates on drilling outcomes spanning various commodities. Mining scale, mining and mill throughput capaciites.Full profiles of select mines and projects. Shaft depth, mining scale, backfill type and mill throughput data.Full profiles of select mines and projects. Equipment type, model, size and quantity.Full profiles of select mines and projects. Camp size, mine location and contacts.Full profiles of select mines and projects. - subscription is required. Mineral Deposit Mineralization at the Cusi Mine has been variously described as a) low-sulfidation epithermal (Ciesielski, 2007), b) high-sulfidation epithermal (SGS, 2008) and linked epithermal-base metal system (Meinhert, 2006). Meinhert (2006) notes that although shallow (<100 m) historic mining is reported to have encountered grades exceeding 1,000 oz/ton Ag, the veins currently exposed are more base-metal rich than would be expected in an epithermal system. However, Sierra Metals geologists consider the abundance of base metals on the property to be primarily a function of depth of exposure and SRK agrees with this interpretation. Mineralization occurs along narrow fractures containing quartz, sphalerite and galena, and wall rock alteration consists primarily of silicification and the development of clays and iron oxides. The veins contain quartz with crustiform and banded textures typical of epithermal systems. The current geologic model for the Cusi property is described as follows: The country rock on the property consists primarily of felsic volcanics interpreted to represent a caldera with a resurgent dome. Magma is interpreted to have intruded along the Cusi fault, a regional NW-trending, right-lateral strike-slip fault, and a subsequent eruption produced the collapsed caldera and Upper Volcanic Series felsic tuffs. A resurgent dome then arose within the caldera on the western side of the Cusi fault. This dome was then dissected by numerous northeast-trending, left-lateral faults, which acted as conduits for hydrothermal fluids and now host mineralized veins. Two of the vein sets at Cusi are relatively large and have been mapped along strike for nearly a kilometre each. These vein sets, dilatational areas and structural intersections have historically been found to be reliable targets for mineralization. The veins are composed of both wide, continuous areas of mineralization as well as zones of numerous smaller swarms of veins or stockwork veinlets. The mineralization is predominately Ag and Pb-rich with lesser amounts of Au, Zn and Cu present in some areas. SRK is of the opinion that the geologic model developed by Sierra Metals, which focuses primarily on the interpretation of the discrete veins and their related splays/stockwork zones, is appropriate for the deposit type and mining method, and that this has been borne out by a history of production. Mineralization and Alteration Numerous epithermal mineralized veins exist on the property. Typically, these are moderately to steeply dipping to the southeast, southwest, and north, ranging from less than 0.5 m to 2 m thick, and extend 100 m to 200 m along strike and up to 400 m down-dip. Small open pits were typically developed at vein intersections. The epithermal mineralization associated to structures, breccias and filling fractures ranging from less than 1 m to 10 m thick, with a polymetallic filling of Ag-Pb-Zn sulphides and minor contents of copper and variable contents of gold. Crustiform and banded epithermal textures are common, and there is pervasive silicification with some sericite and disseminated pyrite. Zones with argillic alteration are common at the borders of the pervasive silicification, including kaolinite and montmorillonite. Oxidation is characterized by hematite, limonite and manganese oxides. Zones of micro-veinlets and dissemination associated to intense fracturing related to the main structures are observed in the area of Promontorio. In Eduwiges, veins and zones of "stockwork" of quartz with pyrite and silicification alteration of 60 m to 150 m width and 200 m to 250 m extension are observed (Geomaps, 2012). Low-grade mineralized areas exist adjacent to major structures, and they show intense fracturing and are commonly laced with quartz veinlets forming a stockwork mineralized halo around more discrete structures. The country rock in these zones is variably silicified. Pyrite and other sulfide minerals are disseminated in the silicified country rock and are also clustered in the quartz veinlets. A well-developed mineralized stockwork zone is in the Promontorio area, especially proximal to the Cusi fault. These stockwork zones are the current targets for expansion and infill drilling, and their importance to the greater Cusi area is being studied in greater detail as a part of current exploration efforts.
One diaper package shows a dozing infant nestled into its father's chest. On another, a baby is tucked beneath a white duvet, its fists propping up its cheeks from the squashy pillow. A different package shows a sleeping newborn lying up against a soft toy rabbit almost equal in size. While these images may be cute, they are potentially dangerous. Safe sleeping practices for babies help reduce the risk of sudden infant death syndrome (SIDS), the unexpected and unexplained death of an infant under the age of one. And we've known since the early 1990s that putting babies to sleep on their tummies was a major risk factor for SIDS. Today, any expectant parent joining an antenatal class will find that establishing safe sleeping habits is a cornerstone of the syllabus. This includes placing infants on their backs on a firm, flat mattress in an enclosed sleeping area free from other people, toys, pillows and other soft furnishings. The power of imagery in advertising shapes behavior. Thankfully, this knowledge, information-sharing and the 'Back to Sleep'/ 'Safe to Sleep' campaigns have led to a significant drop in infant deaths over the past few decades. But as they step out of antenatal classes and into the real world, parents may be confronted by opposing messages on safe sleeping from their families, other parents, social media and – new research shows – adverts for baby products. Although progress has been made, SIDS still results in approximately 1,400 deaths per year in Europe. Research has estimated that these deaths could be prevented by better educating parents on the risk factors. The occurrence and power of misleading images in advertising Since the afore-mentioned high-profile campaigns, parents' behavior in terms of safe infant sleep recommendations is becoming increasingly inconsistent, according to recent evaluations. Why could this be? Aware that pictures have the power to actively shape behavior, we decided to explore the imagery used in baby product packaging. We looked specifically at disposable baby diaper packaging, comparing the images used with safe infant sleep recommendations and looking for inconsistencies. We found over 600 baby diaper packages designed for infants weighing under 5kg and at the highest risk of SIDS. We analyzed the images on the packaging and compared them to the sleeping practices endorsed by most European countries. What we found was shocking: 79% of packages depicting a sleeping infant were inconsistent with at least one recommendation for the prevention of SIDS. Just over half of the packaging depicted a sleeping baby, and of these, only 21% showed babies sleeping safely. Of the remainder: - 45% showed a baby lying on its tummy or on its side, - 51% showed soft objects or loose bedding (pillows, pillow-like toys, stuffed toys, quilts, comforters, sheepskins, blankets, non-fitted sheets, or bumper pads), - 10% depicted a baby sharing its sleeping area with another person. What to do? We do know that advertisements (from the French word meaning 'warning') conveying implicit or explicit messages have the potential to actively shape what we do through the influence of authority and social proof. And while we often reduce advertising to a persuasive tool, let us remember that it is first simply a source of information for consumers. Legislating against unsafe images To maximally reduce the number of babies dying from SIDS, we need to reduce parents' exposure to images depicting unsafe sleeping practices. In protecting this vulnerable group, we want to see manufacturers of baby products held to higher standards. In Europe, baby diaper manufacturers are already subject to the European General Product Safety Directive to ensure the products themselves are safe, but we want to see this extended to their packaging. Legislation enforcing adherence to safe sleeping practices in packaging imagery is crucial to protect infants from SIDS. But stronger legislation could demand that manufacturers only depict babies sleeping per the most recent safe sleeping practices outlined by the American Academy of Pediatrics. This would not be the first time that the persuasive power of images has been used in legislation: a decade ago, images of infants on infant formula packaging were banned to prevent the idealization of breast milk substitutes over breast milk. Such a move could contribute positively to the messaging around SIDS, acting as social proof and indirect information for parents about how to minimize the risk for their baby.
Dr. Cunningham, a colorectal surgeon at UConn Health, is passionate about raising awareness about colon cancer prevention. She strongly believes that regular screenings and lifestyle changes can significantly reduce the risk of developing this deadly disease. Through her work with patients, she emphasizes the importance of early detection and intervention in the fight against colon cancer. Dr. Cunningham works closely with her patients to develop personalized screening plans that take into account their individual risk factors and medical history. She also provides guidance on making positive lifestyle changes such as eating a healthy diet, staying active, and reducing alcohol consumption to reduce the risk of developing colon cancer. Her dedication to raising awareness about colon cancer prevention has made a significant impact on the lives of her patients and the community as a whole. By encouraging individuals to prioritize their health and take control of their well-being, Dr. Cunningham is helping to prevent countless cases of colon cancer each year. In summary, Dr. Cunningham emphasizes the importance of regular screenings and lifestyle changes in preventing colon cancer, which is one of the leading causes of death worldwide. She encourages individuals to prioritize their health by scheduling screenings and making positive lifestyle changes to reduce the risk of developing this deadly disease.
When a business grows large enough and produces at a rate that saturates its domestic market, leaders of that business might choose to expand their reach internationally and establish centers in other countries. Such a decision must be expertly executed. Of the multiple tasks needing to be accomplished, thorough research on the culture of a target country is necessary. Understanding the factors that influence how people think and make decisions is the first step in international success. Additionally, this knowledge will be necessary when looking to employ the people of a target country. Therefore, the following article will look at two countries, Japan and Turkey, and how their cultures influence the actions of their workforce. Keep in mind that this article is founded upon the book Understanding Global Cultures and holds many generalizations. Use this to gather a superficial understanding of the relationship between culture and work; always explore more resources. The first country that has been chosen for a general cultural analysis is Japan. Japan's relational culture is based heavily on a defined, complex set of rules and regulations. These customs aim to promote harmony and collaboration, formed centuries ago as a part of Japan's history and traditions. The focus on harmony and working together can, to some extent, be attributed to Buddhism's presence and effect in Japan both historically and contemporarily. Kata are set rules for how to do tasks in Japanese culture. From a young age, Japanese children are taught kata. These rules dictate multiple aspects of life. Kata is present in the workplace as well. Upon greeting one another, Japanese people aim to gather an understanding of status as soon as possible; knowing the status of another is important because it establishes which rules will be followed during an interaction; the intention is to maintain respectfulness. A failure to understand this concept can result in an embarrassing—or, even worse, rude—situation. Highly stressed in Japan is the group. Japanese culture emphasizes the importance of the group or community, and this idea is evident in nearly every part of Japanese life. When looking at work, the company an individual is employed by is seen as a provider rather than an exploiter. Japanese employees undergo rigorous training programs to instill self-discipline and devotion to the company, further focusing on the company as a solidary unit. Employees are placed in workgroups within companies, and individual employees affiliate themselves with workgroups instead of the job titles. Even the layout of Japanese offices encourages collaboration and teamwork. Managers work in the same room as subordinates rather than in separate offices. This group-mentality serves well when it comes to decision making. Multiple people at different levels in a company are involved in decision-making. While this extends the process, the time it takes to implement the decision is short because many workers are aware of the decision and have agreed to it. Obligation is also rooted in the group. When they can, the Japanese place the overall interest of a group above their individual needs; they feel responsible for the continued function of the group. Additionally, the group is also seen as being responsible for the individual; members of a group are awarded and punished as a group. To conclude, Japanese culture and workplace culture is deeply rooted in respect, custom, and collaboration founded upon Japanese practices and traditions. Turkey is the second country for general culture analysis. Turkey has thick roots in the religion of Islam, similar to the previously discussed Japan and Buddhism. Islam directs multiple aspects of Turkish life. With that, though, the establishment of the Republic of Turkey created a secular state, opposed to the theocracies of other Islamic societies. Despite that, Islam still influences daily lives. Turkish Muslims pray five times a day following their religious book, the Koran (Variant romanized spellings include "Quran" and "Qur'an"). When possible, Turks pray at a mosque. In most cities and villages, the mosque is in the square, the center of the settlement. Near the mosque is usually a coffeehouse, a key component of Turkish social life. Islam forbids drugs and alcohol, but coffee (containing the chemical caffeine) was allowed because of its popularity. Coffeehouses are social locations that facilitate conversations and relationships. Coffeehouses are especially important in rural areas compared to urban centers. Both men and women have distinct traditions of socialization. When it comes to the home, the family is very important. Extended family members live either within the same house or nearby. There is a strong sense of familial ties between family members. Friendliness is not limited to family members, though. Turks are all about communication and talk with strangers frequently. Humor is greatly incorporated into conversations and used to diffuse tense situations; Turks are noted as avoiding confrontation whenever possible. Moreover, Turks are hospitable, under Islam. They are also interdependent, helping and caring for others substantially. Gender is heavily influenced by Turkey's Islamic origins. Males dominate all parts of society despite Western influences. Women are usually the subordinates of men, especially wives to their husbands. However, Turkish wives play a role in decision making by influencing their husbands. Turkish mothers are also an integral part of the home, controlling house tasks such as cooking and cleaning while overseeing the religious, social, and educational upbringing of their children. Though Islam plays a large role in gender status, the twentieth century and onward have given women many rights, including suffrage, civil marriage codes, established divorce, and child custody rights for both sexes. In the workplace, collectivistic values are the center of all interactions. Managers stress the importance of working together and remaining loyal to the organization more so than the quality of work given by a single employee. Within and without the workplace, respect is always given. Additionally, there is a strong respect for authority. There is also the belief in kismet, a concept of destiny controlled by Allah, the Islamic God. Certain things are considered destined to happen, and people don't always have control of situations. This explains why arriving late to events or meetings isn't highly stressed as it is in the West; Turks have an understanding that things can get in the way. Therefore, the Turkish culture is richly based on Islamic and historic traditions with the strong influence of communication and respect. These traditions influence the relationships between strangers, coworkers, family members, and others. To conclude, expanding a business internationally involves understanding not only the consumer market but the workforce. Places such as Japan focus greatly on the group rather than the individual, and Turkish citizens are interdependent and value conversation. Culture plays a large role in how people act; learning this is the first step to success with others. If you wish to learn more about cultures, there is a wealth of information available for your consumption. Gannon, M. & Pillai, R. (2010). Understanding global cultures: Metaphorical journeys through 29 nations, clusters of nations, continents, and diversity Thousand Oaks, CA: SAGE Publications, Inc. doi: 10.4135/9781452224886
Preheating: Some materials require gradual heating to minimize thermal shock. This initial heating is often done slowly to a specific temperature range. Heating to Austenitizing Temperature: This is the temperature at which the material's microstructure changes significantly. For steel, this temperature varies based on its composition and intended properties. Austenitizing: Holding the material at the austenitizing temperature for a specific period allows for the transformation of the microstructure. The duration depends on the material's thickness and composition. Quenching: After soaking, the material is rapidly cooled. There are various quenching mediums such as oil, water, or air. Quenching rates affect the final properties; faster rates generally result in increased hardness. Post-Quenching Treatment (if needed): Tempering: After quenching, the material may be too brittle. Tempering involves reheating it to a lower temperature, allowing some toughness to return without sacrificing too much hardness. Additional Processes (as necessary): Annealing: This involves heating the material to a specific temperature and allowing it to cool slowly, relieving internal stresses and improving machinability or ductility. Normalizing: Similar to annealing, but the material is cooled in still air instead of a controlled environment, aiming for a more uniform grain structure.
Air conditioning advisor - air conditioner Too hot, too humid, too stuffy. The office in the city, the apartment in an apartment building - wherever summer is hot. Ascending trend. The windows can often only be opened briefly or not at all. Maybe too unsafe, maybe too much noise. In this guide you will learn everything you need to know about air conditioning. How does an air conditioner work? How strong must your system be for which room size? What should you consider when buying an air conditioner, what options do you have and what are the advantages and disadvantages? - Air conditioning advisor - mobile air conditioner Recommended reading: You will find many guides on various topics in the advice section ! Air conditioner - in comparison How does an air conditioner work? Basically, modern air conditioning works like one Refrigerator - just the other way around. A refrigerator takes the air from the outside and cools it down to direct it into the interior of the refrigerator. He releases the warm air again. The air conditioner works upside down: Warm air is drawn in, cooled and given into the room. With the right humidity! The difference to one Fan are the coolants in the air conditioner. The fan only swirls the air, but the system extracts even more heat from the intake air with the help of the coolant, so that the temperatures come significantly below the room air. A thermostat continuously checks the current status and switches off automatically when the set value is reached - or starts again when the temperature is exceeded. Air conditioning or mobile air conditioner? Small devices are often Air Conditioners Air conditioning systems mean indirectly the assembly of large systems that work completely independently in, for example, department stores. However, the differences between the various systems often lie in the different ways of working and in the assembly. Who is air conditioning suitable for? Not everyone wants air conditioning, but for some people it can pay off: - bedrooms: Those who live in a city or on a busy street often cannot sleep with their windows open in summer. Too loud. An air conditioner can exchange the stuffy air for fresh coolness - then it sleeps much better. - Office space: Maybe you only have a temporary office or the complete installation of an industrial air conditioning system is too expensive? Then small devices can make your day-to-day work considerably easier for you and your employees. Heat reduces thinking power! - Technical room: In rooms with technology, it is hot and stuffy. This can be at the expense of the devices. So that they can work better and more effectively, an air conditioning system helps to cool the entire technical room and relieve the servers accordingly. - Caravan: Summer holidays in your own Camping mobile can be so gorgeous - and just as stuffy. In very few cases you want to keep all doors and windows wide open at night. Here too, a small and quiet air conditioner is suitable for relaxation. - Apartments: City apartment and then maybe the first floor? During the day, temperatures can build up in a small apartment. So that you don't get a blow when you return to your four walls, you can keep the rooms cool with an air conditioning system. An air conditioning or air conditioning unit is easy to set up, some can also be programmed and so the indoor climatic conditions are constantly pleasant, especially in summer or at muggy temperatures. What leads to high temperature? - Sun exposure: Nice big windows, lots of light - and therefore also warmth. If not heat. Windows can with a UV protective film to be stuck on when not like one Glass house to transform the office into a tropical hall. - Persons: 0,1 KW per person. That is the warmth that a person emits in the office. An average value, however, shows how much heat can collect all day long. - Equipment: Electrical devices continuously radiate heat because they have to cool themselves. calculator, Refrigerator and other large and small appliances radiate heat continuously. This "builds up" in the long run. - Roof and wall: The worse the insulation, the warmer in summer and colder in winter. Good insulation helps to keep the heat outside. - Ventilation: Wind and therefore draft can make the temperatures inside a lot more bearable. To do this, of course, there must be the option of surge ventilation, especially in the morning and evening. Air conditioning options Rooms up to 65 m³ can be kept cool and fresh with mobile air conditioners. You can find out exactly how you can calculate the wattage according to your room size under Calculate room size . Inverter - air conditioners Inverter means that the system regulates itself completely automatically. It can be continuously adjusted for the right temperature and then runs completely independently. It turns off and it turns on. This has several advantages: - Saves energy - Reduces heating - Longer lifetime This technique is a bit more expensive, but is particularly worthwhile for rooms that are used a lot and for a long time. Air conditioning heat pumps A heat pump as air conditioning is also possible and offers further advantages: - Dissipated heat can be used for other purposes (e.g. for pool heating) - Gentle cooling - Very high efficiency The disadvantages are the high purchase costs, the air is not humidified and if the building is not well insulated, the heat pump works accordingly hot. Split - air conditioning These air conditioners are built into the wall. An inner and an outer part. Disadvantage: The outer wall must be broken for the connection. The internal part of the system filters the room air, dehumidifies it and cools it down, while the resulting heat is released outside through the external part. The advantages: - Very high performance - filter function - Very quiet - Very good cooling Various functions can be easily set using a remote control. Stand - air conditioners Small free-standing devices that can easily be placed "somewhere" indoors are the most popular for home use. In winter they are often simply not needed and can take a break. All you need is water and electricity, of course. Some devices have an exhaust hose, which must be transported outside. This is particularly unfavorable when there is no way to do it. Simply slide the hose through an open window - and the warm air comes straight back in. Here for the air conditioning bestsellers 2024: The best and most popular in the top 10 comparison \| Honest tests list # \| Preview \| Products \| Rating \| Price \| \| 1 \| Comfee mobile air conditioner MPPH-07CRN7, 7000 BTU 2,0kW,...* \| 339,00 € 208,98 € \| Watch now! \| \|\| 2 \| De'Longhi Pinguino PAC N82 ECO, mobile air conditioning for rooms...* \| 399,00 € \| Watch now! \| \|\| 3 \| 3in1 Air Cooler \| 7 liter capacity \| 3 levels \| Mobile...* \| 99,90 € \| Watch now! \| Recommended reading: You will find many guides on various topics in the advice section ! Tips & help Calculate room size How much power does the system have to have? There is a formula for this: Room surface (in m²) x 60 watts This information is used for privately used rooms. In commercial premises with x 80 measured. In addition, there are details of the additional heat sources. These calculations are complicated. Here, a specialist can help with the exact calculation. As an example: A room of 30mq is large, where there is a computer and a person, requires a cooling capacity of approx. 3 watts,. It is easier to look for devices whose manufacturers have specified how much air (m³) they can circulate per hour. BTU means British thermal unit - and is a unit of energy that indicates how a British pound warms up to one Fahrenheit. The cooling capacity of the devices is given by many manufacturers in BTU / h (i.e. per hour). Air conditioners maintain and maintain Bacteria and germs can otherwise spread in the room air. Regular maintenance and care also extends the life and cooling performance of the air conditioning units. The systems can be vacuumed off and wiped off with a damp cloth - a bit Dish soap in the water is sufficient in most cases. For safety reasons, it is advisable to remove the power cable from the socket beforehand. Many systems that clean and humidify the air have an internal filter. When the filters have to be changed is different. In general, the exchange should be carried out once a year. What about the bestseller 2024: The best and most popular in the top 10 comparison \| Honest testing is important to consider When considering which air conditioner suits you, there are just a few things to consider: - Mobile or permanently installed? The flexibility is also related to the benefits of the system - How big is the room and what must the system bring? - What type of system is compatible with the project? - How high is the thermal load? - Can spare parts (filters) be purchased cheaply? - What do users say about the devices on the Internet? - Programmable or automatic? - How much money do you want to spend? - How loud is the system? Especially in the bedroom, the air conditioner should be as quiet as possible Advantages and disadvantages of air conditioning Do you need air conditioning? Advantages air conditioner ✔ Even at high temperatures, the body remains more efficient through cooling ✔ The same applies to technology ✔ Permanently installed systems that work permanently are often cheaper in operating costs because they work constantly ✔ Mobile options can be used flexibly Disadvantages air conditioner ✘ Often high acquisition costs ✘ and operating costs Conclusion: air conditioning \| Air conditioner There is a suitable solution for every heated inconvenience: heat exchangers, split systems, coolers, humidifiers. To find out how much power your system needs, you have to consider not only the size of the room, but also the thermal pressure. How well is the room insulated, how much sun can it get in, how many people and how many devices are in the room because everyone gives off heat. Air conditioners are not cheap. Acquisition and operating costs can be high - depending on what the system has to do. The costs can be mitigated a bit, for example, if the heat exchanger can also be used as a pool heater. Discover the top 10 of the best and best-selling mobile air conditioner products in 2024 on honest tests. We show a selection of the most popular items that have great customer reviews and value for money. Find the perfect mobile air conditioner product for your needs now! Reading tips: coole DIY Projects \| Fitness \| You like product testing read? - Experience report: SoBuy bench with wooden boxes – stylish and practical - White tea \| Silver Needle from Bouna Classic - Koawach Review: The caffeinated cocoa for an energy start to the day - Test: 14 vegan spreads tested Zwergenwiese - AstroAI 2 in 1 mini fridge tested - Test: B / W laser printer from HP \| HP LaserJet Pro MFP M28w - Helmet camera mount for action cameras - Cookware Guide: Everything you need to know from the pan to the cooking pot - How to calm your dog on New Year's Eve: The ultimate guide - Infrared saunas and infrared cabins: Experience the sun in the basement - Remove rims - wheel rim removal - A romantic evening for two! On Honest tests you can find some tests (including pool, Fitness, Home & garden) & Guides (including Smart Home, Beauty, Skilled trades) who can help you further. Tip: An Gift Idea or Birthday gifts should never be cheap products, don't give away anything that you wouldn't use yourself in terms of quality. Lots of positives Buyer ratings are often a sign that people are happy with the air conditioner product. Recommended reading: massage gun, Fitness Bike, product testing * Product images & links \| Source: Amazon PA API \| Last update on 26.05.2024/XNUMX/XNUMX \| * = Affiliate links \| Prices quoted on this website may have changed. The actual price of a product can be found on the seller's website. Real-time updates are technically not possible. Prices including VAT plus shipping costs
The Fish Site New scientific analysis from environmental organisation WWF reveals recovery of European fish stocks will take more than 100 years under current proposals by EU Fisheries Ministers. "No law can end overfishing in one fell swoop but Ministers appear to be actively sidelining stock recovery", says Roberto Ferrigno, WWF's Common Fisheries Policy project coordinator. "For the sake of fishermen, coastal communities and the health of our oceans, Ministers must set targets for the fastest possible recovery. 100 years plus is too long." Two out of three fish stocks in European waters are considered overfished. Ambitious reform of Europe's Common Fisheries Policy (CFP) could reverse this situation over the next 10 years. But core elements of the reform package relating to discards, subsidies and stock recovery are under dispute, and negotiations between the European Parliament and Fisheries Ministers over what shape future EU fishing laws should take, may collapse.
Indigenous Hawaiian leader Mililani Trask speaks about Indigenous women leaders and matriarchal societies. Mililani Trask talks about the importance of cross-cultural support between Indigenous groups and how Indigenous women have been key to bringing this about. The Outcome document will be open to interpretation and its success will depend on how individual states interpret the document and whether this is in line with Indigenous Peoples and civil society groups. Mililani Trask frankly states that there is not much work which can be done in the 2 days of discussions which make up the WCIP. She is not surprised by the lack of funding and the limitations on which issues can be discussed, but describes the resulting meeting as a betrayal because the WCIP was meant to bring people together to discuss many issues facing Indigenous Peoples and address how to move forward. Alexey Tsykarev discusses the situation in Russia for Indigenous Peoples. Even though Russia abstained from voting for the UN Declaration on the Rights of Indigenous Peoples in 2007, many of the articles in the Declaration exist in Russian legislation, however, the implementation at the federal, regional and local level is still a problem. Alexey Tsykarev talks about the negotiations leading to the Outcome Document and how 3 months was not long enough and they should have been at least a year long. Alexey Tsykarev is disappointed with the outcome document and expected that it would be on the same level at least, as the UN Declaration of the Rights of Indigenous Peoples. Escucha a un resumen de la primera semana del Foro Permanente para las Cuestiones Indígenas de la ONU. John Scott highlights the importance of using processes established by Indigenous communities when gaining free, prior and informed consent for activities which will take place on their lands. He also talks about the importance of including traditional knowledge of Indigenous Peoples at the UN Permanent Forum. Dalee Sambo discusses the exchange between the Brazilian government's representative and representatives of Brazil's Indigenous tribes at the UNPFII 2015. Violations of Land Rights continue in Brazil, including the criminalization of Indigenous Peoples who are trying to defend their rights to land.
Columbine High School students give back in honor of the lives lost 25 years ago LITTLETON, Colo. (KDVR) — Columbine High School students and community members came together on Saturday to serve, as a way to honor the 13 lives lost on April 20, 1999. It's been 25 years since the tragedy at Columbine High School. Saturday also serves as the school district's annual day of service, a way to give back while remembering what happened. Governor's Ranch Elementary An act of kindness sparks another is the motto at Governor's Ranch Elementary, one of the locations part of the service day. Students, like Columbine High School senior Katelyn Barnes, repainted part of the halls. Columbine 25 years later: We remember the 13 lives lost 'With our past with Columbine, [we're] coming together and showing that we are stronger than what happened and just giving back to the world because everyone needs a little kindness," she said. The majority of the students at Governor's Ranch for the service day are on the soccer team. The team's coach and Columbine alumni Brian Todd said he is proud to have his team part of the day. "We've really flipped the script on April 20, 1999, and turned it into a day of positivity and so many in the community came and helped us get through a really dark time," Todd said. Alumni who lived through the tragedy and current students who didn't were alongside one another. Alumni, like Meg, remember the day so clearly. Columbine victim's sneakers forge a path for his father 25 years later "I remember sitting here in 5th grade and all of my friends were sitting here worried about their siblings and family members that were there," she said. Meg was at Governor's Ranch and participated in the service with her kids. "It does feel very full circle to have my kids here and lived my life through this community," she said. The goal behind this district-wide service, and to turn tragedy into hope. "This community in particular is unlike any other and to be a part of it is a privilege and an honor," Meg said, "to teach these younger generations that this day should never be forgotten and you can do something good with it instead of forget it." Humane Society of the South Platte Valley Columbine High School Juniors, Peyton Roark and Benjamin Hoeft, spent the day at the Humane Society of the South Platte Valley. "A big part of this day is giving back to the community," Roark said. "I feel like even though it is a really big day of loss and sadness, it's about taking that and turning it into something positive and helping others." A little further north, members of the Columbine High School baseball team stepped up to the plate. Elias Frainier and his teammates worked with Habitat for Humanity, helping to transform a property in Denver into affordable home ownership. The unit will soon be 11 single-family homes. "The first four units we took some time to sweep it out, clean it. There was a lot of sawdust and nails on the floor," Frainier said. "Now we're just cutting some drywall and putting it up." The team spent the day together, giving back and keeping the memories alive of those who came before them. "A lot of the teachers were students or even teachers when it happened, and they had this traumatic experience and decided to come back and still teach there and share their stories with current students and it just means a lot," Frainier said. Twenty-five years later, Frainier said those 13 lives are never forgotten. "I think regardless of if we were alive or not, you can definitely feel all the emotion when the year comes around, but it's really nice to get out and do something special with the day," Frainier said. For the latest news, weather, sports, and streaming video, head to FOX31 Denver.
Greenhouse cultivation provides several advantages over traditional outdoor or indoor methods, including year-round growing, controlled environmental conditions, and enhanced pest and disease control. But it is the integration of advanced technology that has truly revolutionized the way we cultivate cannabis in greenhouses. From automation and AI-powered optimization to innovative irrigation and lighting systems, technology is transforming the way we grow cannabis and improving the overall quality and yield of our crops. In this article, we will explore the latest technology trends and innovations in greenhouse cannabis cultivation, as well as their advantages and challenges. We will also discuss the future of technology in the industry and its potential impact on consumer experience. So, sit back, relax, and join me on this journey as we discover the exciting world of technology in greenhouse cannabis cultivation. Technology trends in greenhouse cannabis cultivation As the cannabis industry continues to evolve, the integration of technology into greenhouse cultivation has become a game-changer. Let's take a closer look at some of the top technology trends that are shaping the future of greenhouse cannabis cultivation at Jungle Farms in Phuket, Thailand. Firstly, automation and remote monitoring systems have become increasingly popular in greenhouse cannabis cultivation. These systems allow growers to control various aspects of the greenhouse environment, such as temperature, humidity, and lighting, from a remote location. This not only reduces labor costs but also enables growers to monitor and optimize plant growth and cultivation conditions in real-time. Secondly, AI-powered optimization is also becoming a trend in greenhouse cannabis cultivation. By using sophisticated algorithms and data analysis, growers can adjust environmental conditions to optimize plant growth and increase yields. AI can also help detect and prevent issues such as nutrient deficiencies, pests, and diseases. Thirdly, advanced LED lighting technology has become a crucial component in greenhouse cannabis cultivation. LED lights provide the full spectrum of light required for optimal plant growth, as well as energy efficiency, which reduces costs and promotes sustainable cultivation practices. Lastly, innovative irrigation and fertigation systems are being developed to optimize water and nutrient usage. These systems provide precise amounts of water and nutrients directly to the plants' root zone, improving efficiency and reducing waste. Advantages and challenges of technology integration in greenhouse cannabis cultivation While technology integration in greenhouse cannabis cultivation offers several benefits, there are also some challenges that growers must consider. In this section, we will examine the advantages and challenges of technology integration at Jungle Farms in Phuket, Thailand. One of the biggest advantages of technology integration in greenhouse cannabis cultivation is increased efficiency and yield. Automation and remote monitoring systems, AI-powered optimization, advanced LED lighting, and innovative irrigation and fertigation systems all work together to create an optimal growing environment that promotes plant growth and increases yield. In addition to increased yield, technology integration can also enhance the quality and consistency of the cannabis products. By controlling environmental conditions, growers can ensure that each plant receives the same amount of light, water, and nutrients, resulting in consistent plant growth and high-quality cannabis products. Cost-effectiveness and return on investment (ROI) are also important advantages of technology integration in greenhouse cannabis cultivation. Advanced technologies can reduce labor costs, improve resource utilization, and increase yields, all of which can improve the bottom line. However, there are also regulatory challenges and compliance issues that growers must navigate when integrating technology into their cultivation practices. Local and national regulations may require specific environmental and safety standards, which can impact the design and implementation of technology systems in the greenhouse. Furthermore, compliance with cannabis-specific regulations, such as testing and labeling requirements, can also pose challenges for growers. It is crucial to ensure that all technology systems are designed and implemented in compliance with regulations to avoid any legal issues. Technology integration plays a crucial role in greenhouse cannabis cultivation and has the potential to revolutionize the industry. From automation and remote monitoring systems to advanced LED lighting and innovative irrigation and fertigation systems, technological advancements have significantly improved efficiency, yield, quality, and consistency in cannabis cultivation. At Jungle Farms in Phuket, Thailand, we recognize the importance of staying up-to-date with technological trends and integrating them into our cultivation practices. We prioritize innovation and compliance to produce high-quality cannabis products while maximizing efficiency and profitability. As the cannabis industry continues to grow and evolve, it is essential for industry professionals to embrace technology and its many benefits. By staying up-to-date with technological advancements, growers can improve yields, reduce costs, and produce high-quality cannabis products while ensuring compliance with regulatory requirements. In light of this, we encourage all industry professionals to embrace technology and its potential for a sustainable and successful future. By working together and embracing innovation, we can drive the cannabis industry forward while improving efficiency, sustainability, and profitability.
The average Black or Hispanic household in the United States earns about half as much as the average White household.[1] This phenomenon, known as the racial wealth gap, embodies racial inequality in the United States, threatening the economic security of the families it affects and the economy as a whole. The racial wealth gap doesn't just appear in wage disparities between different racial groups. It also appears in the hiring process. Most notably, traditional hiring practices (those emphasizing degrees, work experience, and unstructured interviews) are prone to bias and exclude minority groups from many high-paying jobs. Skills-based hiring overcomes bias by implementing multi-measure testing that focuses on candidates' skills and potential to add to existing culture – not their race, education, or class background. This guide explores five ways skills-based hiring eliminates bias to help close the racial wealth gap. ✅ Overcome biased hiring to close the racial wealth gap The racial wealth gap refers to the large financial disparity among racial and ethnic groups in the United States regarding income, assets, and access to opportunities. Although this disparity is not limited to the United States or White and Black communities alone, Black Americans bear the brunt of its effects, making up 13% of the population and holding just 4% of the wealth. White Americans, on the other hand, make up 60% of the population and hold 84% of the wealth. The racial wealth gap results from centuries of oppression and discrimination of Black and non-White communities within the United States. In addition to the legacy of inequality that has contributed to this gap, several significant symptoms of the racial wealth gap are felt today. 1. Diminished education opportunities: Low-income children who are disproportionately Black or Hispanic experience more gaps in educational resources than their White counterparts. This poses a significant threat to a public education system meant to guarantee equal opportunity and a chance at a better life for all students. 2. Unemployment disparities: There is a two-to-one disparity in unemployment between Black and White workers. The common assumption is that the disparity is solely caused by the former group's lack of education or skills. In reality, even with educational inequalities, Black Americans have made considerable gains in high school and college completion. But still, the unemployment disparity exists. 3. Disparities in earnings: Even when minority groups get advanced degrees, own their own homes, and get higher-paying jobs, their wealth is still much less than their White peers. This begs the question: If non-White workers, and especially Black workers, are continuing to make advancements in education and skills, why does the racial wealth gap still exist? A wealth of empirical and anecdotal evidence shows that discrimination is a primary factor in the persistence of the racial wealth gap. Bias is an umbrella term that includes behaviors like discrimination, harassment, or other actions that target individuals or groups because of personal characteristics or expression. As it pertains to the racial wealth gap, unconscious bias and hiring discrimination is mainly responsible for preventing minority groups from entering the workforce or being paid fairly if they do. Hiring bias isn't always in the form of blatant discrimination, and hiring managers often unknowingly act upon their unconscious biases throughout the hiring process. For example, many hiring managers believe their instincts are their best guide when deciding who to hire. In reality, first impressions are inherently biased and do not predict whether or not a candidate can perform in a role. Negative impressions especially last longer than positive ones and can persist for up to 72 months. What does this have to do with the racial wealth gap? If hiring managers rely on the impressions they get from candidates rather than provable, measurable skills, they risk discriminating against candidates from different backgrounds – in this case, non-White candidates. Skills-based hiring practices combat unconscious bias by eliminating traditional, bias-prone hiring practices that require degrees, resumes, and unstructured interviews. Instead, skills-based organizations focus on hiring for culture add and upskilling (and reskilling) potential. Let's look at the five ways skills-based hiring can help close the racial wealth gap for your organization. Skills-based hiring strategy \| How it helps close the gap \| Eliminate degree requirements \| Black, Indigenous, (and) People of Color (BIPOCs) are disproportionately impacted by degree requirements. Eliminating them minimizes bias in hiring and opens up the talent pool to candidates from all backgrounds. \| Eliminate resume requirements \| Eliminating resume requirements enables every candidate to show their skills, regardless of their name, background, or education level. \| Eliminate unstructured interviews \| Unstructured interviews don't predict skills; they determine whether an interviewer likes the candidate. Opting for structured interviews removes first-impression bias. \| Hire for culture add \| Culture add hiring increases organizational productivity and lets minority workers earn more. \| Offer upskilling and reskilling opportunities \| Upskilling and reskilling is an investment in the career growth of your minority employees, giving them the tools to advance and gain wealth. \| If your company requires degrees, you may unintentionally contribute to the racial wealth gap. Many companies rely too heavily on degrees to determine a candidate's skill level, which is contributing to the worrying trend of degree inflation, even though degrees prove nothing about a candidate's skill level and are prone to bias. Candidates with low incomes, BIPOC candidates, and applicants with disabilities are disproportionately affected by degree inflation. Research shows that degree inflation screens out 83% of Hispanic candidates and 76% of African American candidates. Degree requirements introduce bias against non-White candidates in two ways: Only considering applicants who had the opportunity to attend college. As of 2020, the college enrollment rate was 64% for Asian applicants, 41% for White applicants, 36% for Hispanic applicants, and 36% for Black applicants. Because of the racial wealth gap, many Black and Hispanic students applying to college rely on financial aid to help bridge the gap. However, considering home ownership and retirement savings in determining financial assistance also perpetuates racial disparities in college.[2] Only considering applicants who had the opportunity to complete college. Degree inflation is biased against non-White candidates who can't afford to complete their degree. In fact, White students are 250% more likely to graduate than Black students from public universities. Even if Black students are able to afford to get into college, the odds are not in their favor that they will be able to graduate. Recent college graduation data bears this out.[3] Minority college graduates \| Percentage that graduate \| African American \| 1% \| Hispanic \| 13.1% \| Asian/Pacific Islander \| 6.6% \| By contrast, more than half of college graduates are White. Skills-based hiring overcomes bias by eliminating degree requirements in favor of multi-measure skills assessments, which include hard and soft skills tests, situational judgment tests, personality tests, and structured interviews to measure competencies, not education. According to TestGorilla's State of Skills-Based Hiring 2022, 91% of employers saw increased workplace diversity when using skills-based hiring. If you are hiring a software engineer, for example, knowing the candidate's race and whether or not they attended school has very little to do with whether or not they can build a software program. Instead, an employer should focus on testing the skills relevant to a software engineer job by using a test such as our Software Engineer test. This test, like all of TestGorilla's tests, judges the candidate on their ability to do the actual job, rather than any other factor. According to research from 2017 by Katherine DeCelles, minority candidates who "whiten" their resumes by omitting references to their race have greater success getting job interviews.[4] Companies are twice as likely to call non-White applicants for interviews if they have 'whitened' resumes than they are to call minority applicants without them. Another resume whitening test found that employers who claim to be pro-diversity and have job postings that strongly encourage minorities to apply were just as racially biased as employers that made no such claims. Simply put, resumes expose employer biases that can cause discrimination in hiring. Research shows that resumes are not accurate predictors of job success and cannot demonstrate a candidate's actual skills.[5] Instead of asking for a written document explaining where a candidate lives, their GPA, where they went to school, and their previous experience, skills-based hiring requires candidates to prove their ability to do the actual job. Hiring candidates based on skills instead of what's on their resume inevitably helps shrink the racial wealth gap and broaden your talent pool. Why? Because skills aren't limited to a single race, ethnicity, or experience level. Ditching resumes and opening up your talent pool to those who haven't attended or finished school brings more diverse talent into your organization and improves your business. What's the alternative? Instead of relying on resumes, employers should ask a candidate to take a situational judgment test, for example. Situational judgment tests are psychometric tests that assess candidates on a series of work-related questions. These tests help combat bias and discrimination in hiring by being anonymous. In other words, the recruiter doesn't have any information about the person besides their test responses. Eliminating degree and resume requirements also opens the door for STARs or candidates who are "Skilled Through Alternative Routes" to succeed in roles that traditional hiring practices exclude them from. Unstructured interviews unfold like casual, free-flowing conversations with off-the-cuff questions and unpredictable answers. This may be an enjoyable way to get to know a candidate as a person, but it says very little about that candidate's skills. They also widen the racial wealth gap. Unstructured interviews are bias-prone because they are not designed to assess candidate skills or identify specific candidate attributes objectively. Instead, they let the interviewers' first-impression bias become a determining factor in whether or not to hire a candidate. According to a 2000 study by Frank Bernieri, a psychology professor, it takes an interviewer just 10 seconds to form a first impression about a candidate. The interviewer then spends the remainder of the interview trying to confirm that initial opinion.[6] If the interviewer has an unconscious racial or class bias, an unstructured interview has no stop gaps to prevent that bias from negatively impacting the interview process. Federal law bars employers from discriminating against job candidates and current employees based on race, age, and gender. This law, known as the Equal Employment Opportunity Act (EEOA), prohibits interviewers from asking questions that can lead to discrimination, like those regarding age, race, gender, and sexual orientation. In an unstructured interview setting, there is a much greater risk of asking these questions outright or asking similar questions to gain the same information. This can lead to discrimination. Take this job candidate's experience, for example: This graduation question does not openly violate the EEOA, but to the candidate's point, it's actually not at all relevant to whether they can do the job. The fact that they graduated some time ago can open the door to the interviewer's bias against older candidates, candidates who took additional time to complete their degree program, or those who never attended school at all. Skills-based hiring runs structured interviews that guarantee none of the above EEOA questions, or questions similar to those, are asked. Here's how structured interviews differ from unstructured interviews: Ask every candidate the same pre-established questions in the same order Are scored using a scorecard created beforehand Create a more objective interview process that is designed to evaluate candidates' skills rather than educational background It's essential to keep in mind that structured interviews are not the silver bullet when it comes to closing the racial wealth gap. Interviews will never be completely free of racial bias. If the interviewer's decision-making is racially motivated, then their opinion of the candidate will be, too. However, skills-based hiring ensures that even if a hiring manager has unconscious bias, it does not ultimately impact which candidate gets the job. Structured interviews are an extension of the data-driven, multi-measure testing practices that identify skilled candidates and assess whether they can perform well. They are a critical piece of the future of hiring that can help close the racial wealth gap by including skilled non-White and BIPOC candidates in the hiring process and labor force. Another way that traditional hiring practices widen the racial wealth gap is by hiring (or not hiring) candidates based on "culture fit." On the surface, hiring candidates that fit your company culture seems a great way to expand your talent force with employees that match your organization's values. In practice, culture fit tells a different story. This hiring strategy puts hiring managers and interviewers in a situation where they have to measure vague, subjective, and unquantifiable attributes like a candidate's values. In reality, the interviewers often end up searching for what they have in common with the candidate, like similar interests, opinions, or personalities, which have very little to do with a candidate's skills or growth potential. If you're hiring for someone that reminds you of yourself or people you know, a candidate's race plays an inherent role in whether they will be considered a good culture fit. Take Sandra Okerulu, for example. She had an interview with a New York company and thought it went very well.[7] Then she was told that she wasn't a good fit. With a resume that matched perfectly with the job's requirements, she wondered if it was because she was a woman or non-White, or both. The growing employment gap suggests Sandra's instincts were most likely correct. Employment rates measured between December 2020 and December 2021 show that while the overall unemployment rate shrank, unemployment for Black women in the US increased from 4.9% in November to 6.2% in December.[8] For non-White candidates to climb the workplace ladder and begin to close the racial wealth gap, they must first be hired by an organization that values diversity instead of running from it. Embracing this diversity is essential for companies and organizations to advance society. Hiring racially diverse candidates is not only the right thing to do, it actually makes businesses more profitable. Research shows that racially diverse companies are more likely to outperform their peers by 35%.[9] Diversity in the workplace benefits organizations because diverse companies are: More innovative Better problem solvers More adaptable More productive More profitable Better equipped to serve their diverse customer base Adding to an existing company culture introduces candidates from all backgrounds with different skills and strengths to challenge the status quo. Skills-based hiring offers assessments like the Culture Add test that evaluate how a candidate's behaviors and values align with your organization's and how they will build upon your existing culture. Helping close the racial wealth gap requires more than simply interviewing more people of color. It requires a conscious effort to change your organizational culture, eliminate groupthink, and embrace diverse opinions, backgrounds, and worldviews. This can even the playing field and make your business more profitable. The racial wealth gap isn't closed just because you've hired a skilled non-White candidate. Employers must invest in employee development post-hire and establish equitable and accessible employee skills training. Focusing on upskilling can help address racial disparities in industries like tech, where Black employees make up 7.4%, and Hispanic employees make up 8% of the workforce.[10] Employee upskilling is when employers help their workers gain skills that add to their existing skill set or prepare them to take on more responsibilities. Employee reskilling is when employers give employees opportunities to learn new skills so they can move to different roles within an organization. What do these have to do with the racial wealth gap? Although surges in hiring DEI specialists to help close the racial wealth gap are a helpful resource to employees of color, upskilling and reskilling opportunities are where companies actually make good on their promises to improve racial equity.[11] If a tech company hires a Hispanic worker because they have provable coding skills valuable to the business, that's a great first step. But it doesn't significantly impact that 8% figure from earlier. If such organizations genuinely care about closing the racial wealth gap, they don't just hire more Hispanic coders. They also upskill each individual to a level where their lived experience, expertise, and skills help to determine the company's direction. The result: BIPOC in the workforce have equal access to high-paying jobs and valuable skills training once they are hired, to earn and grow just as their White counterparts do. Upskilling and reskilling become a vehicle for marginalized groups and racial minorities to grow their careers and overcome historic disadvantages. Traditional hiring practices that require degrees, resumes, culture fit, and run unstructured interviews are not only bad for business; they also widen the racial wealth gap. This deepens racial divides and negatively impacts local and global economies. Skills-based hiring eliminates these requirements and replaces them with multi-measure assessments that remove bias and welcome racial minorities into the workforce. And it doesn't stop there. Once candidates of color become employees through skills-based hiring, their development is nurtured, their skills are expanded, and they gain opportunities to take leadership positions to develop the existing company culture. Closing the racial wealth gap is a complex issue that demands more than just filling open roles with skilled, racially diverse talent. Combating bias and discrimination at the beginning of the hiring process and throughout an employee's career helps level the playing field for historically disadvantaged people of color. Learn more about how to adopt skills-based hiring practices for your organization to help close the racial wealth gap. Aladangady, Aditya; Forde, Akila. (October 22, 2021). "Wealth Inequality and the Racial Wealth Gap". The Federal Reserve. Retrieved May 31, 2023. https://www.federalreserve.gov/econres/notes/feds-notes/wealth-inequality-and-the-racial-wealth-gap-20211022.html Levine, Phillip; Ritter, Dubravka. (September 27, 2022). "The racial wealth gap, financial aid, and college access". The Brookings Institute. Retrieved May 31, 2023. https://www.brookings.edu/blog/up-front/2022/09/27/the-racial-wealth-gap-financial-aid-and-college-access/ Bouchrika, Imed. "Number of College Graduates: 2023 Race, Gender, Age & State Statistics". Research.com. Retrieved May 31, 2023. https://research.com/universities-colleges/number-of-college-graduates Gerdeman, Dina. (May 17, 2017). "Minorities Who 'Whiten' Job Resumes Get More Interviews". Harvard Business School: Working Knowledge. Retrieved May 19, 2023. https://hbswk.hbs.edu/item/minorities-who-whiten-job-resumes-get-more-interviews Beard, Alison. (September-October 2019). "Experience Doesn't Predict a New Hire's Success". Harvard Business Review. Retrieved May 31, 2023. https://hbr.org/2019/09/experience-doesnt-predict-a-new-hires-success Bernieri, Frank. (May 2000). "The importance of first impressions in a job interview". Midwestern Psychological Association. Retrieved May 19, 2023. https://www.researchgate.net/publication/313878823\_The\_importance\_of\_first\_impressions\_in\_a\_job\_interview Epstein, Sophia. (October 20, 2021). "What does being a 'cultural fit' actually mean?". BBC Worklife. Retrieved May 31, 2023. https://www.bbc.com/worklife/article/20211015-what-does-being-a-cultural-fit-actually-mean/ Broady, Kristen; Barr, Anthony. (January 11, 2022). "December's Jobs report reveals a growing racial employment gap, especially for Black women". The Brookings Institute. Retrieved May 31, 2023. https://www.brookings.edu/blog/the-avenue/2022/01/11/decembers-jobs-report-reveals-a-growing-racial-employment-gap-especially-for-black-women/ "15 Surprising Workplace Diversity Statistics (2023)". (February 17, 2023). Apollo Technical. Retrieved May 31, 2023. https://www.apollotechnical.com/workplace-diversity-statistics/ "What Upskilling Means for Workforce Diversity". (May 31, 2023). The Wall Street Journal. Retrieved May 31, 2023. https://partners.wsj.com/salesforce/make-change-elevating-women/understanding-the-upskilling-imperative/ Gilchrist, Karen. (January 1, 2020). "Hiring experts expect demand for this role to surge in 2020 – and it can pay a median of $126,000". CNBC. Retrieved May 31, 2023. https://www.cnbc.com/2020/01/02/demand-for-diversity-and-inclusion-professionals-set-to-rise-in-2020.html Create pre-employment assessments in minutes to screen candidates, save time, and hire the best talent. No spam. Unsubscribe at any time. Our screening tests identify the best candidates and make your hiring decisions faster, easier, and bias-free. This checklist covers key features you should look for when choosing a skills testing platform This resource will help you develop an onboarding checklist for new hires. How to assess your candidates' attention to detail. Learn how to get human resources certified through HRCI or SHRM. Learn how you can improve the level of talent at your company. Learn how CapitalT reduced hiring bias with online skills assessments. Learn how to make the resume process more efficient and more effective. Improve your hiring strategy with these 7 critical recruitment metrics. Learn how Sukhi decreased time spent reviewing resumes by 83%! Hire more efficiently with these hacks that 99% of recruiters aren't using. Make a business case for diversity and inclusion initiatives with this data.
The hospitality industry has long evolved beyond mere room service and comfy beds. Today, hotels are venturing into health and wellness, offering weight loss programs as part of their services. While this trend is commendable, it brings forth the need for a deeper understanding of the pathophysiology of obesity. For hoteliers and wellness professionals, comprehending the intricacies of obesity can make these programs not just effective but transformative. Understanding Obesity: More Than Just Weight Obesity is a complex, multifactorial condition characterised by excessive accumulation of body fat. It's not merely a cosmetic concern but a significant risk factor for various chronic diseases like type 2 diabetes, cardiovascular diseases, and certain cancers. To tackle obesity effectively, it's crucial to understand its pathophysiology. Energy Balance and Metabolism At its core, obesity results from an imbalance between energy intake and energy expenditure. When calorie intake exceeds the body's energy needs, the excess energy is stored as fat. Factors contributing to this imbalance include: - Dietary Habits: High intake of calorie-dense, processed foods and sugary drinks. - Physical Activity: Sedentary lifestyle with minimal physical activity. - Genetics: Some individuals may be genetically predisposed to weight gain. - Environmental Factors: Socioeconomic status, cultural influences, and access to healthy food options. Understanding these factors helps in devising personalised weight loss strategies tailored to individual needs and challenges. The Role of Hotel Weight Loss Programs Hotel weight loss programs aim to provide guests with a conducive environment to kickstart their weight loss journey. These programs typically offer: - Nutritionally Balanced Meals: Healthy, portion-controlled meals to promote weight loss. - Physical Activities: Exercise classes, yoga sessions, and access to fitness centres. - Educational Workshops: Seminars on nutrition, healthy cooking, and lifestyle modification. Incorporating Pathophysiological Understanding into Hotel Programs To enhance the effectiveness of weight loss programs, hoteliers and wellness professionals should integrate a deeper understanding of obesity pathophysiology. Personalised Nutrition Plans Recognising that obesity is not a one-size-fits-all condition, personalised nutrition plans should be developed considering: - Caloric Needs: Calculate individual calorie requirements based on age, gender, weight, and activity level. - Macronutrient Balance: Optimal distribution of carbohydrates, proteins, and fats. - Meal Timing: Importance of regular meals and avoiding prolonged fasting. Physical Activity Guidelines Understanding the metabolic and physiological benefits of different exercise types can help in designing: - Cardiovascular Training: Enhances calorie expenditure and improves cardiovascular health. - Strength Training: Increases muscle mass, which boosts metabolism and aids in weight loss. - Flexibility and Balance Exercises: Improves mobility and reduces the risk of injuries. Behavioural and Psychological Support Obesity is not just a physical condition but also has psychological implications like low self-esteem, depression, and anxiety. Hotel weight loss programs should incorporate: - Counselling: One-on-one sessions with psychologists or counsellors to address emotional eating and body image issues. - Support Groups: Creating a supportive community where guests can share experiences and motivate each other. Measuring Success: Beyond the Scale While weight loss is a tangible measure of success, it's essential to focus on holistic health improvements. Hotel weight loss programs should track: - Body Composition: Monitoring changes in fat mass, muscle mass, and water content. - Metabolic Markers: Regularly assessing blood sugar levels, cholesterol, and blood pressure. - Quality of Life: Surveys or questionnaires to evaluate improvements in energy levels, mood, and overall well-being. Related Read: Navigating the Pathophysiology of Obesity in Hotel Weight Loss Programs The Science Behind Obesity: Key Pathophysiological Factors Energy Imbalance: The Core Issue Understanding the imbalance between energy intake and expenditure is fundamental. Dive into how excessive calorie consumption and low physical activity contribute to weight gain. Hormonal Factors and Obesity Explore the role of hormones like leptin, insulin, and ghrelin in regulating appetite, metabolism, and fat storage. Understand how hormonal imbalances can lead to weight gain and resistance to weight loss. Tailoring Nutrition for Obesity Management The Importance of Balanced Macronutrients Discover the optimal distribution of carbohydrates, proteins, and fats to promote satiety, preserve lean muscle mass, and support metabolic health. Dietary Strategies for Weight Loss Learn about portion control, meal timing, and the benefits of nutrient-dense, whole foods in creating sustainable weight loss. Exercise Physiology: Choosing the Right Activities Cardio vs. Strength Training: What's Best? Delve into the metabolic and physiological benefits of cardiovascular exercises and strength training. Understand how to balance both for optimal weight loss and overall health. Incorporating Flexibility and Balance Workouts Explore the importance of flexibility exercises like yoga and Pilates in improving mobility, reducing stress, and complementing weight loss efforts. Psychological Aspects of Obesity and Weight Loss Understanding Emotional Eating Uncover the psychological triggers and emotional connections to food. Learn strategies to identify and manage emotional eating behaviours for long-term weight management. Building Resilience and Motivation Discover the importance of mindset and motivation in weight loss journeys. Explore techniques to build resilience, stay motivated, and overcome setbacks. Holistic Health Monitoring: Beyond Weight Assessing Body Composition Changes Learn about tools and methods to monitor changes in fat mass, muscle mass, and water retention. Understand the significance of body composition in evaluating weight loss progress. Metabolic Health Markers and Their Importance Explore the role of metabolic markers like blood sugar levels, cholesterol, and blood pressure in assessing overall health and guiding weight management strategies. Creating Supportive Environments for Long-Term Success The Role of Community and Peer Support Understand the importance of creating a supportive and motivating environment where guests can share experiences, challenges, and successes. Continuous Learning and Adaptation Explore the need for ongoing education and adaptation of weight loss programs based on emerging research, guest feedback, and changing individual needs. Conclusion: A Holistic Approach to Combat Obesity Navigating the pathophysiology of obesity is essential for the success of hotel weight loss programs. By integrating a comprehensive understanding of obesity into these programs, hoteliers and wellness professionals can offer more personalised, effective, and transformative experiences for their guests. Obesity is a complex condition, and its management requires a multifaceted approach encompassing nutrition, physical activity, behavioural support, and medical supervision. With the right strategies and a commitment to holistic health, hotels can play a significant role in combating the obesity epidemic and promoting overall wellness. Innovative Approaches and Emerging Trends Discover the latest trends and innovations in hotel weight loss programs, from integrating technology to offering personalised wellness experiences tailored to individual genetic profiles. The Role of Medical Supervision and Collaboration Understand the importance of medical supervision, interdisciplinary collaboration, and partnerships with healthcare professionals in offering comprehensive and safe weight loss solutions. Your Gateway to High Authority Guest Posting In the ever-evolving world of digital marketing and content creation, the significance of guest posting cannot be overstated. As a potent tool for building authority, enhancing brand visibility, and driving traffic, guest posting has become a cornerstone strategy for many successful online endeavors. Amidst a sea of platforms offering guest posting opportunities, newsmerits.info emerges as a distinguished player, offering a unique blend of high authority and cost-effective solutions. This comprehensive blog post aims to delve into the world of newsmerits.info, exploring its facets as a high authority free guest posting site. From understanding the concept of guest posting and its myriad benefits to unraveling the distinctive features of newsmerits.info, this article is designed to guide digital marketers, content creators, SEO experts, and business owners through the nuances of maximizing their online presence through effective guest posting strategies. As we embark on this exploratory journey, we will uncover the reasons behind the rising popularity of newsmerits.info, its impact on search engine optimization (SEO), and the various ways in which it empowers users to enhance their digital footprint. Whether you are a seasoned blogger seeking new avenues for expansion or a business owner aiming to elevate your brand's online relevance, newsmerits.info offers a platform that caters to a broad spectrum of needs and objectives. With an emphasis on accessibility and user-friendliness, newsmerits.info stands out as a beacon for those aspiring to make their mark in the digital world. The following sections will provide an in-depth look into the workings of newsmerits.info, its advantages over other guest posting sites, and practical insights on how to harness its potential for your digital growth. Stay tuned as we unfold the myriad aspects of newsmerits.info and how it can be a game-changer in your digital marketing strategy. A Key Strategy in Digital Marketing Guest posting, a strategy widely adopted in digital marketing, involves writing and publishing content on someone else's website or blog. This collaborative approach offers a mutual benefit: the host site gains fresh content, and the guest author receives exposure to a new audience, along with valuable backlinks. This method is a cornerstone for building relationships, boosting domain authority, and driving targeted traffic. The Significance of Guest Posting In the realm of SEO and digital marketing, guest posting is more than just writing articles for other websites. It's a strategic avenue for enhancing online presence and credibility. Here's why: - Enhanced Visibility and Reach: Guest posting exposes your content to a broader audience, extending your reach beyond your existing followers. - Authority Building: Publishing on high-authority sites like newsmerits.info lends credibility to your brand or personal blog, establishing you as an expert in your niche. - SEO Benefits: Backlinks from reputable sites significantly boost your website's search engine ranking, leading to increased organic traffic. - Networking Opportunities: It opens doors to new business relationships and collaborations within your industry. Guest Posting: More Than Just SEO While SEO benefits are a significant draw, guest posting offers more. It's about community engagement, sharing expertise, and adding value to the host site and its audience. Quality content that resonates with readers can enhance reputation and lead to long-term partnerships and growth opportunities. A Platform for Aspiring and Established Writers Newsmerits.info began with a simple vision: to create a platform where writers and marketers could freely share their insights, stories, and expertise. Recognizing the challenges of finding quality platforms for guest posting, especially without cost barriers, newsmerits.info set out to offer a solution – a high-authority site that welcomes diverse voices without charging a fee. Unique Features of newsmerits.info As a platform, newsmerits.info stands out with several key features: - High Domain Authority: newsmerits.info enjoys a robust SEO ranking, making it an ideal platform for those looking to enhance their online visibility. - Diverse Niches: Catering to a wide range of topics, it's a fertile ground for writers from various industries to share their knowledge. - User-Friendly Interface: The platform is designed to be intuitive and easy to navigate, ensuring a seamless experience for both novice and experienced writers. - Community Engagement: newsmerits.info encourages interaction among its users, fostering a community of like-minded individuals. Benefits of Using newsmerits.info for Guest Posting One of the most compelling reasons to choose newsmerits.info for guest posting is its high domain authority. This metric, crucial for SEO, indicates the likelihood of a website ranking well in search engine results. Guest posts on high-authority sites like newsmerits.info can significantly boost your own website's SEO, as search engines view these backlinks as endorsements of your content's quality and relevance. This can lead to higher rankings and increased organic traffic to your site. Free Access: A Boon for Writers and Marketers In an online world where quality guest posting opportunities often come with a price tag, newsmerits.info offers a refreshing change. It provides a free platform for both budding and seasoned writers. This accessibility is particularly beneficial for small businesses and individual bloggers looking to gain visibility without a substantial marketing budget. User-Friendly Interface and Support The platform's design emphasizes user experience, making it straightforward for authors to submit and manage their posts. This ease of use is crucial for attracting and retaining writers who may not have extensive technical expertise. Moreover, newsmerits.info offers support to its users, guiding them through the process of creating and publishing content that aligns with the platform's standards and audience preferences. How to Effectively Use newsmerits.info for Guest Posting To begin your guest posting journey on newsmerits.info, start by creating an account and familiarizing yourself with the site's guidelines. Understanding the type of content that resonates with their audience and adheres to their standards is key to successful submissions. Crafting Impactful Content When preparing your guest post, focus on delivering value to the readers. Here are some tips: - Choose Relevant Topics: Pick subjects that align with both your expertise and the interests of newsmerits.info's audience. - Create Quality Content: Ensure your articles are well-researched, informative, and engaging. - Follow SEO Best Practices: Optimize your post for search engines without compromising readability and user engagement. - Incorporate Visuals: Use relevant images or infographics to enhance your post's appeal. Maximizing the Benefits To make the most out of your guest posting efforts, engage with the community. Respond to comments on your posts, interact with other authors, and share your articles on social media. This not only drives more traffic to your guest post but also builds your network and reputation within the newsmerits.info community. Success Stories and Testimonials from newsmerits.info Users The efficacy of newsmerits.info as a guest posting platform is best illustrated through success stories and testimonials from its users. Many have reported significant increases in their website traffic and enhanced online visibility as a direct result of their guest posts on newsmerits.info. These successes span across various industries, from digital marketing experts to lifestyle bloggers, underscoring the platform's versatility and effectiveness. Testimonials That Speak Volumes Users frequently commend newsmerits.info for its ease of use and the quality of engagement they receive on their posts. The sense of community and the opportunity to connect with like-minded individuals are often highlighted as key benefits. These testimonials not only serve as endorsements of the platform's value but also provide insights into the tangible outcomes that can be achieved through strategic guest posting. Comparing newsmerits.info with Other Guest Posting Sites In the realm of guest posting, numerous platforms offer varying features and benefits. However, newsmerits.info stands out due to several unique aspects: - High Authority without Cost: While many high-authority sites charge for guest posting opportunities, newsmerits.info provides this benefit for free, making it an accessible option for everyone. - Broad Niche Acceptance: Unlike some platforms that cater to specific niches, newsmerits.info welcomes a diverse range of topics, offering opportunities for a wider array of content creators. - Community Focus: Beyond just being a platform for posting content, newsmerits.info fosters a sense of community, encouraging interactions and collaborations among its users. - Ease of Use: The user-friendly interface of newsmerits.info is designed to accommodate both novices and experienced writers, making the process of submitting and managing posts straightforward. Comparison with Other Sites When compared to other guest posting sites, newsmerits.info's unique combination of high domain authority, cost-effectiveness, and user-friendliness sets it apart. While some platforms may offer similar benefits in one or two of these areas, newsmerits.info provides a well-rounded experience that addresses the needs of a diverse user base. Why Choose newsmerits.info? Whether you're looking to enhance your website's SEO, expand your audience reach, establish yourself as an industry expert, or simply share your knowledge and experiences, newsmerits.info offers the perfect platform to achieve your goals. Take the First Step We encourage you to visit newsmerits.info and start your guest posting journey today. Discover the potential of your content, engage with a community of like-minded individuals, and take your digital presence to new heights. Embrace the opportunity to showcase your expertise and contribute to a growing platform that values quality content and diverse perspectives.
Powering the Future: The Rise of Portable Energy Storage Devices In an age where connectivity and mobility are paramount, the demand for reliable and portable energy solutions has surged. Portable energy storage devices (ESDs) have emerged as a vital technology, offering the flexibility to power a wide range of devices anywhere, anytime. This article delves into the advancements and impact of portable ESDs in our increasingly digital and mobile world. Evolution of Portable Energy Storage From Bulky to Sleek The journey of portable ESDs began with bulky, inefficient models that offered limited capacity. However, advancements in battery technology, particularly the development of lithium-ion and lithium-polymer batteries, have revolutionized their design. Today's portable ESDs are compact, lightweight, and capable of storing a significant amount of energy, making them ideal for a variety of uses. Key Features of Modern Portable ESDs High Energy Density and Efficiency Contemporary portable ESDs boast a high energy density, allowing them to store large amounts of energy in a small form factor. This makes them not only convenient to carry but also highly efficient in powering devices ranging from smartphones to laptops. Rapid Charging Capabilities With the advent of fast-charging technology, modern portable ESDs can quickly recharge devices, significantly reducing downtime. This feature is particularly beneficial for professionals and adventurers who rely on constant connectivity and power. Versatility and Compatibility Today's portable ESDs are designed to be universally compatible with a range of electronic devices. Many come equipped with multiple output ports, including USB, USB-C, and even AC outlets, making them versatile companions for various charging needs. Impact on Lifestyle and Work Enabling Mobility and Flexibility Portable ESDs have become indispensable for people who are constantly on the move. They enable professionals to work remotely by powering laptops and mobile devices, facilitate uninterrupted travel experiences, and provide a reliable power source during outdoor adventures. Emergency Power Solutions In emergency situations or areas with unstable power grids, portable ESDs offer a critical lifeline. They can power essential devices like communication tools and medical equipment, providing support in critical times. Future Trends in Portable Energy Storage Integration with Renewable Energy A significant trend in the development of portable ESDs is their integration with renewable energy sources, such as solar panels. This not only enhances their eco-friendliness but also ensures sustainable and off-grid power solutions. Smart Technology Integration The future of portable ESDs also includes the incorporation of smart technologies. Features like Bluetooth connectivity for monitoring and controlling the device remotely are becoming increasingly common, adding convenience and functionality. Portable energy storage devices are more than just power banks; they are enablers of a mobile and connected lifestyle. As technology continues to evolve, these devices are set to become even more efficient, versatile, and integral to our daily lives. Whether for professional use, travel, outdoor activities, or emergency preparedness, portable ESDs stand at the forefront of powering our modern, on-the-go world.
The guidelines recommend defining variance thresholds; when the cost performance reports indicate a threshold breach in a control account, one can drill down to spot the problematic tasks. Actual costs, also known as actual cost of work performed (ACWP), is relatively straightforward. If you are using a robust project cost management software, tracking actual costs should not be a challenge. However, it's important to remember to include several hidden costs—material, resource, hardware, software licenses, overheads, etc. EVM brings unparalleled benefits to any project with strict cost and schedule-compliance requirements. As its name suggests, it breaks down the project into units of work, so that they can be assigned, scheduled, authorized, measured during production, and cost-accounted. The complexity of every WBS will depend on the scope and complexity of the project itself. It takes the traditional project management approach a few steps further and improves upon it to provide precise data – for project managers, clients, and employees alike. In this article, we covered a lot about earned value management and you learned the basics of what is required to meet the standards for government contracts. Actual Costs (AC) EVM helps quantify the value of project progress in real time, enabling project managers and stakeholders to anticipate future challenges based on past and present progress reports. Most importantly, it provides them with actionable data that can be used for proactive decision-making throughout the course of a project. To reinforce the argument of how important a control account manager is, the next section describes just a handful of the obligatory measurements used in EVM. There are formulas CAMs use to track progress along with the production, and they range from the basic ones used on smaller projects, to more complex and detailed ones required for large-scale projects. Wood asked Ten Six to assist with their Earned Value Management System for a major program for the USAF Space Fence Program. - The best way to go about this is to arrange them so the tasks flow into each other as naturally as possible. - However, for the rest of this article we'll use the standard, industry-accepted terminology of EVM, which is also still widely used in government circles and during the RFP and execution phases of contracts. - One of the most common ways that Advanced EV Analysis is used is to perform trend analysis. - Earned Value (EV) is a project Key Performance Indicator (KPI) that represents a quantified value of the work accomplished to date. - A value greater than 0 tells us that this project is currently ahead of schedule. The process documentation covers the steps, procedures and people involved in managing the project. The goal is to standardize the way project progress is reported and to ensure accurate data is collected, inputted and produced. There is a way to assign EV to those activities, so you can manage your whole project. We do that with 'level of effort' which means splitting the EV for the task evenly throughout the project. Using Earned Value Management to Measure Project Performance Schedule variance indicates the difference between where we planned to be in the schedule and where we are in the schedule. It is expressed as a difference between the earned value and the planned value. Again, this is an instance of how scope, time and cost come together to give you a clear picture of where you currently stand in your project. In turn, https://accounting-services.net/generally-accepted-accounting-principles/ Systems (EVMS) refer to the software, processes, tools, and templates used for EVM. What is earned value in PMP? Earned value (EV) is a way to measure and monitor the level of work completed on a project against the plan. Simply put, it's a quick way to tell if you're behind schedule or over budget on your project. You can calculate the EV of a project by multiplying the percentage complete by the total project budget. It projects how much more will be spent on the project, based on past performance. Schedule Performance Index is the rate at which the project performance is meeting schedule expectations up to a point in time. Cost variance is the difference between what we expected to spend and what was spent. It is expressed as a difference between earned value and the actual cost. We ensure that multiple activities are grouped under a single work package and multiple work packages are grouped under a single control account. Calculating variances and indexes to follow the progress in EVM It also shows the cumulative actual cost of the project (red line, labeled AC) through week 8. To those unfamiliar with EVM, it might appear that this project was over budget through Earned value management week 4 and then under budget from week 6 through week 8. However, what is missing from this chart is any understanding of how much work has been accomplished during the project. The second limitation causing concern is that this methodology doesn't include quality control. Since its main concern is work performed, the time of completion and the cost of it, there is no room for quality. A product could be delivered in time and with an admirable budget, only to fail to impress by the end of production. Or worse, a problem arises when poor quality of completed tasks starts to affect all the subsequent tasks and slows down production. Earned Value (EV) measures deliverable progress in monetary terms (value of work done), allowing the project manager to quantify progress as a monetary value. ProjectManager is a cloud-based project management software that makes measuring progress and performing EVM easy. With its real-time dashboard, project metrics are instantly calculated with live data and delivered in easy-to-read charts and graphs that can be shared with a keystroke. Calculating the schedule performance index involves dividing the EV by the PV to measure progress achieved against where you expected to progress at a certain point. If you've come up with a value less than 1.0, it means that you've done less work than you projected for this point.
Creating a Neutral Haven: Exploring the Impact of Wall Finishes and Lighting Effects on Home Design Home design is an art form that requires the perfect balance of various elements. Among these, wall finishes and lighting effects are two key components that can greatly impact the overall look and feel of a space. In this article, we'll explore the benefits of neutral tones, how to choose the perfect wall finish, and how to use lighting effects to create a cohesive and stylish home. Neutral Tones Neutral tones are the foundation of any well-designed space. They create a calming and peaceful atmosphere that allows other design elements to shine. Neutral tones include shades of white, beige, gray, and taupe. These colors are timeless and versatile, making them perfect for any style of home. When choosing a neutral color palette, it's important to consider the undertones of each color. For example, some grays have blue undertones, while others have brown undertones. It's important to choose a color that complements the other colors in your space and doesn't clash with any existing furniture or decor. Wall Finishes The right wall finish can make all the difference in a room. There are many options to choose from, including paint, wallpaper, and textured finishes. When choosing a wall finish, it's important to consider the overall style of your home and the function of the room. Paint is a classic and versatile option that can be used in any room. It's also easy to change if you want to update your space in the future. Wallpaper is another popular option that can add texture and pattern to a room. Textured finishes, such as plaster or stucco, can add depth and dimension to a space. Lighting Effects Lighting is one of the most important elements of home design. It can create a mood, highlight design features, and even make a space appear larger. There are many types of lighting to consider, including ambient lighting, task lighting, and accent lighting. Ambient lighting is the overall lighting in a room and sets the tone for the space. Task lighting is designed to help you perform specific tasks, such as reading or cooking. Accent lighting is used to highlight specific design features, such as artwork or architectural details. When choosing lighting for your home, it's important to consider the function of each space and the mood you want to create. For example, a bedroom may benefit from soft, ambient lighting, while a kitchen may need bright task lighting to make cooking easier. Creating a Cohesive Space When designing your home, it's important to create a cohesive and stylish space that reflects your personal style. One way to achieve this is by using a neutral color palette and incorporating wall finishes and lighting effects that complement each other. For example, if you choose a textured wall finish, such as plaster, you may want to use accent lighting to highlight the texture and create depth in the space. If you choose a bold wallpaper, you may want to use more subtle lighting to balance out the pattern. Ultimately, the key to creating a cohesive space is to consider all of the design elements together and choose options that complement each other. By using neutral tones, choosing the right wall finish, and incorporating lighting effects, you can create a beautiful and stylish home that reflects your personal style.
Here are some common skin conditions and suggested skincare treatments for each: Acne: Acne is a common skin condition characterized by the formation of pimples, blackheads, and whiteheads. Treatment options include: Cleansing: Use a gentle cleanser to remove excess oil and dirt without stripping the skin. Topical treatments: Apply over-the-counter acne creams or gels containing ingredients like benzoyl peroxide or salicylic acid to target acne-causing bacteria and unclog pores. Moisturizing: Use oil-free, non-comedogenic moisturizers to hydrate the skin without adding extra oil. Sun protection: Protect your skin from the sun using non-comedogenic sunscreen to prevent inflammation and post-acne discoloration. Seek professional advice: Consult a dermatologist for severe or persistent acne that may require prescription medications or other treatments. Dry Skin: Dry skin lacks moisture and may feel tight, itchy, or rough. Consider the following skincare treatments: Hydration: Use a gentle cleanser that doesn't strip the skin of its natural oils. Moisturizing: Apply a rich, hydrating moisturizer regularly to lock in moisture and nourish the skin. Humidifier: Use a humidifier in dry environments to add moisture to the air. Avoid hot showers: Hot water can strip the skin of its natural oils, so opt for lukewarm water instead. Exfoliation: Gently exfoliate the skin once or twice a week to remove dead skin cells and improve absorption of moisturizers. Hyperpigmentation: Hyperpigmentation refers to areas of the skin that appear darker than the surrounding skin due to increased melanin production. Treatment options include: Sun protection: Apply broad-spectrum sunscreen daily to prevent further darkening of hyperpigmented areas. Skin brightening ingredients: Look for products containing ingredients like vitamin C, kojic acid, niacinamide, or licorice extract, which can help reduce hyperpigmentation. Chemical peels or microdermabrasion: Consider professional treatments to exfoliate the skin and improve the appearance of hyperpigmentation. Retinoids: Topical retinoids can help accelerate cell turnover and fade hyperpigmentation over time. Rosacea: Rosacea is a chronic skin condition characterized by facial redness, flushing, and sometimes small visible blood vessels. Recommended skincare treatments include: Gentle cleansers: Use mild, non-irritating cleansers to avoid exacerbating rosacea symptoms. Moisturizers: Choose fragrance-free moisturizers suitable for sensitive skin to provide hydration and soothe redness. Sun protection: Protect the skin from the sun with broad-spectrum sunscreen and by wearing a wide-brimmed hat. Avoid triggers: Identify and avoid triggers that worsen rosacea symptoms, such as spicy foods, alcohol, hot beverages, and extreme temperatures. Prescription treatments: In severe cases, a dermatologist may prescribe medications, such as topical or oral antibiotics, or other treatments like laser therapy. It's important to note that these suggestions are general recommendations, and individual experiences may vary. If you have specific skin concerns or conditions, it's best to consult with a dermatologist or skincare professional for personalized advice and treatment options.
Month: May 2024 Have a Blast with These Trivia Game Nights Get ready to ignite the sparks of excitement and knowledge with thrilling trivia game nights. Whether you are a seasoned trivia master or just looking for a lively way to spend an evening, hosting a trivia game night can be an absolute blast. Imagine a cozy setting with friends or family gathered around, eagerly anticipating the next brain-teasing question. The energy is contagious, the laughter is genuine, and the competitive spirit is palpable. Setting the stage for a successful trivia game night begins with careful planning. Choose a theme that suits the interests of your guests—whether it is pop culture, history, science, or a mix of everything. Tailoring the questions to your audience ensures everyone feels engaged and challenged. For example, if your group is filled with movie buffs, dive into the world of cinema with questions about iconic films, actors, and directors. Next, consider the format of your trivia game. Will it be a team-based competition where groups collaborate to answer questions, or a solo showdown where individuals test their knowledge solo? Both formats offer unique dynamics—team games foster camaraderie and friendly banter, while solo games showcase individual prowess and quick thinking. You can even incorporate a mix of both formats for added variety. As the host, your role is crucial in creating a seamless and enjoyable experience. Be prepared with a mix of easy, moderate, and challenging questions to cater to different skill levels and try this web-site https://day-games.com/never-have-i-ever/. Utilize multimedia elements such as audio clips, image rounds, and video snippets to add an interactive dimension to the game. Do not forget to keep track of scores and maintain a lively pace to keep the excitement levels high. One of the most exciting aspects of trivia game nights is the opportunity to learn fascinating facts and tidbits. From obscure historical events to surprising scientific discoveries, each question unveils a new realm of knowledge. Encourage players to share their insights and anecdotes related to the questions, fostering a dynamic exchange of information and perspectives. Trivia game nights also provide a platform for friendly competition and teamwork. As players collaborate to solve challenges, they develop a sense of camaraderie and unity. Celebrate both individual achievements and team victories, creating a positive and inclusive atmosphere where everyone feels valued and appreciated. To enhance the overall experience, consider adding thematic decorations, snacks, and beverages that complement the chosen theme. For example, a retro-themed trivia night could feature nostalgic snacks from past decades, while a science-themed night could include molecular gastronomy-inspired treats. As the night unfolds, embrace the moments of laughter, surprise, and friendly rivalry. Trivia game nights are not just about winning—it is about creating lasting memories, forging deeper connections, and celebrating the joy of learning together. So gather your friends, unleash your inner trivia enthusiast, and get ready for an unforgettable evening of fun and excitement. Transform Financial Future the Power of Online Stock Trading Expecting that you are new to the universe of Stock exchanging, you presumably charm not understand what the best Stock exchanging writing computer programs is. Regardless, this is the kind of thing you should know whether you should be productive in Stock exchanging. Incredible programming can have the impact between being a palatable trader and a phenomenal and extraordinarily productive trader. This will present a layout of what Stock is and the manner by which it can work for you. Stock exchanging, moreover called new trade exchanging, works by exchanging cash sets. On a very basic level, you are predicting that one country's cash inside your pair will show improvement over the other money in the pair you are exchanging. You make trades reliant upon these conjectures, and make or lose cash subject to the manner by which everything truly pan out. For sure, even the best Stock exchanging programming cannot work for you until you understand how the market truly works, but it can streamline the cycle for you once you do. Acquire capability with your strategy for getting around the Vietnam stock market market by opening up a demo account with one of the Stock traders on the web and practicing. While you practice, you can moreover begin to use Stock exchanging programming so you sort out some way to use it with the objective that you can make trades for your most noteworthy advantage. You ought to understand that you should never trade with real money until you realize the market very well and have sorted out some way to use your Stock exchanging programming masterfully, also. The best Stock exchanging programming cannot take command over your trades for you absolutely, regardless of the way that a couple of objections could tell you that you do not need to be aware at any rate something about Stock can regardless get cash as long as you utilize their item. For sure, you will use your Stock exchanging programming to make your trades for you thusly, considering principles you give it. That is the very key not excessively far off – the models you give it, and that is where the way in which you could decipher the Stock market comes in, so you see unequivocally what guidelines to give the Stock programming to help your advantages and breaking point your setbacks. How your Stock exchanging programming can help you is to remain mindful of the trade stock which moves particularly fast and constantly. There is a lot of data to be poor down and considered, extensively beyond what you can look at truly. The best Stock exchanging programming will get this information as quick as it comes in, and cause your trades for you reliant upon the actions you to have given it with the objective that you have your best accomplishment. Breaking Ground – Exploring the Parktown Residences CapitaLand Development Condominium development stands as a pillar of modern real estate, blending community living with individual ownership in a way that reshapes urban landscapes and lifestyles. At its core, the process of condominium development begins long before the first brick is laid or the blueprint unfurled. It starts with a vision, a foresight into what the future demands from living spaces. This vision is often backed by meticulous market research, understanding the pulse of prospective homeowners or investors, and identifying the unique selling points that will make this condominium not just a residence but a coveted asset. One of the foundational elements in condominium development is location scouting. This is not just about finding a plot of land; it is about discovering the heartbeat of a neighborhood. Factors like accessibility to transportation hubs, proximity to amenities such as schools, hospitals, and shopping centers, and the overall vibe of the area play pivotal roles. A prime location can elevate a condominium project from being merely desirable to a beacon of urban living. Equally crucial is the legal groundwork. Condominium development operates within a framework of laws and regulations that vary from region to region. Understanding Parktown Residences CapitaLand zoning laws, building codes, environmental impact assessments, and navigating through permits and approvals are intricate yet indispensable steps. It is here that collaboration with legal experts specializing in real estate becomes invaluable, ensuring that every aspect complies with the legal landscape. Financial viability is another cornerstone. From securing funding for land acquisition to managing construction costs and marketing expenses, the financial architecture of a condominium project requires meticulous planning. This often involves engaging with financial institutions, investors, and stakeholders to create a sustainable financial model that not only covers expenses but also anticipates and mitigates potential risks. Architectural design is where dreams meet reality. This phase involves translating the vision into tangible blueprints, considering factors like space optimization, aesthetic appeal, functionality, and sustainability. Collaborating with architects, interior designers, and engineers becomes imperative to create spaces that harmonize with the environment, maximize natural light, and offer a seamless blend of form and function. Construction and project management are the hands-on phases where the vision starts taking physical form. This encompasses hiring contractors, overseeing construction timelines, quality control, and adhering to safety standards. Effective project management ensures that deadlines are met, budgets are adhered to, and the quality of workmanship surpasses expectations. Marketing and sales form the final stretch of condominium development. This involves crafting compelling marketing strategies, showcasing the unique selling propositions of the project, and engaging with potential buyers or investors. From digital marketing campaigns to hosting showcase events, the goal is to create buzz and convert interest into sales, ensuring the success and sustainability of the condominium project in the long run. In essence, breaking ground in condominium development is not just about building structures; it is about sculpting communities, creating lifestyles, and leaving a lasting imprint on the urban fabric. It is a journey that blends vision, expertise, collaboration, and innovation to redefine modern living spaces. Breaking down Game Strategies – Sports Analysts Dive Deep into Broadcasting Sports analysts play a pivotal role in dissecting game strategies, offering viewers a deeper understanding of the intricate tactics employed by teams. Within the realm of broadcasting, their expertise transcends mere play-by-play commentary, delving into the strategic nuances that shape the outcome of matches. Armed with comprehensive knowledge of the sport, these analysts serve as interpreters, translating complex maneuvers into digestible insights for audiences worldwide. At the heart of their analysis lies a keen observation of player positioning and movement. By scrutinizing every pass, dribble, and defensive maneuver, analysts uncover patterns and trends that reveal a team's overarching strategy. They decipher the subtle cues that signal a shift in momentum or a forthcoming tactical adjustment, providing viewers with valuable foresight into the ebb and flow of the game. Furthermore, sports analysts possess an astute understanding of individual player tendencies and capabilities. They recognize the strengths and weaknesses of each athlete, assessing how these factors influence team dynamics and strategic decision-making. Whether it is a sharpshooting forward exploiting a mismatch or a goalkeeper's mastery of positioning, these insights offer viewers a glimpse into the strategic chess match unfolding on the field, court, or ice. Beyond the surface level of gameplay, analysts also dissect the strategic frameworks implemented by coaches. From high-pressing tactics in soccer to pick-and-roll schemes in basketball, they break down the X's and O's that define a team's approach. Through meticulous analysis of game film and in-depth interviews with coaches and players, analysts uncover the underlying philosophies that guide a team's strategic identity. In addition to tactical analysis, sports analysts provide context by examining the broader narrative arcs at play within a league or tournament. They explore the historical rivalries, underdog narratives, and legacy-defining moments that add depth to each match. By contextualizing on-field events within the larger tapestry of sports history, analysts enrich the viewing experience, transforming a simple game into a compelling narrative. Moreover, sports MLB중계사이트 analysts leverage advanced analytics and technology to enhance their insights further. From tracking player movement data to employing predictive modeling techniques, they harness cutting-edge tools to uncover hidden patterns and trends. This marriage of traditional analysis with modern technology empowers analysts to offer unparalleled depth and accuracy in their assessments, enriching the viewing experience for fans and casual observers alike. Beyond the confines of the broadcast booth, sports analysts also engage with fans through various media platforms, fostering a sense of community and dialogue around the sport. Whether through post-game breakdowns on social media or interactive live Q&A sessions, they bridge the gap between viewers and the inner workings of the game, fostering a deeper appreciation for its complexities. In essence, sports analysts are storytellers, weaving together the threads of strategy, athleticism, and human drama to create a narrative tapestry that captivates audiences around the globe. Through their keen insights and expert analysis, they shine a spotlight on the strategic intricacies that elevate sports from mere competition to a captivating spectacle. Customized Protection – The Art of Burglar Alarm Installation Customized protection through expert burglar alarm installation epitomizes the fusion of science and art in modern security solutions. Far beyond the simple act of mounting sensors and setting up sirens, this process entails a meticulous orchestration of strategic planning, technological integration, and personalized attention to detail. Every installation is a unique endeavor, tailored to the specific needs and vulnerabilities of the premises, ensuring a robust shield against potential intruders. At the core of the art of burglar alarm installation lies a comprehensive understanding of the property's layout, its vulnerabilities, and the potential entry points for unauthorized access. Security professionals conduct a thorough assessment, meticulously examining every nook and cranny to identify weak spots that could be exploited by intruders. This forensic analysis serves as the foundation upon which the customized security solution is built, ensuring that no aspect of the property's defense is overlooked. With the assessment as a guide, the next phase involves the strategic selection and integration of security components. Motion detectors, door and window sensors, surveillance cameras, and alarm systems are carefully chosen and strategically positioned to create a seamless network of protection. Each component is calibrated to complement the others, forming a cohesive defense mechanism that leaves no room for blind spots or vulnerabilities. Advanced features such as smart technology integration further enhance the system's capabilities, enabling remote monitoring, real-time alerts, and seamless integration with other security systems. Pace Protections Burglar Alarm Installation San Antonio installation process itself is a meticulous endeavor, requiring precision and expertise to ensure that every component functions flawlessly. Sensors are strategically placed to cover critical areas, cameras are positioned to provide optimal surveillance coverage, and alarm systems are calibrated to trigger immediate responses in the event of a breach. Professional installers meticulously test every element of the system to verify its functionality, conducting rigorous simulations to ensure that it can withstand real-world threats. What sets customized burglar alarm installation apart is its adaptability and scalability? As the security landscape evolves and the property's needs change, the system can be easily updated and expanded to accommodate new challenges. Additional sensors, cameras, or advanced features can be seamlessly integrated into the existing infrastructure, ensuring that the security solution remains robust and effective over time. This flexibility ensures that clients can continue to rely on their security system as their needs evolve, providing long-term peace of mind and protection. Ultimately, the art of burglar alarm installation transcends mere technical proficiency to encompass a deep understanding of security principles, meticulous attention to detail, and a commitment to personalized protection. It is a testament to the dedication and expertise of security professionals who strive to create customized solutions that not only deter intruders but also provide clients with the confidence and peace of mind they need to feel safe and secure in their homes or businesses. In a world where security threats are constantly evolving, customized protection offers a beacon of reassurance, ensuring that individuals and their assets remain safeguarded against harm. Revolutionizing Access – Next-Gen Money Lending Services Empower Borrowers In an era where financial empowerment is paramount, next-generation money lending services are spearheading a revolution in access and inclusivity. These innovative platforms are not merely facilitating transactions; they are reshaping the entire landscape of borrowing, putting power back into the hands of borrowers. At the heart of this revolution lies a commitment to democratizing finance, ensuring that individuals from all walks of life have equal opportunities to access the capital they need to pursue their dreams. One of the key pillars of next-gen money lending services is their emphasis on inclusivity. Unlike traditional lending institutions that often rely heavily on credit scores and collateral, these platforms leverage cutting-edge technology and data analytics to assess creditworthiness more holistically. By analyzing a broader range of factors, such as income stability, spending habits, and even social connections, they are able to provide loans to individuals who may have been overlooked or marginalized by traditional lenders. This approach not only expands access to credit but also promotes financial inclusion by reaching underserved communities and populations. Moreover, next-gen money lending services are redefining the borrower experience, making it more transparent, convenient, and personalized. Through intuitive digital interfaces and mobile applications, borrowers can easily apply for Singapore moneylender loans, track their progress, and manage their finances in real-time. Gone are the days of cumbersome paperwork and lengthy approval processes; these platforms offer instant decisions and fast disbursements, empowering borrowers with the flexibility and agility they need to seize opportunities and navigate financial challenges. Another hallmark of next-gen money lending services is their commitment to responsible lending practices. By leveraging advanced algorithms and machine learning algorithms, these platforms can accurately assess risk and tailor loan terms to each borrower's unique circumstances. This not only minimizes the likelihood of default but also ensures that borrowers are not burdened with unmanageable debt. Additionally, many of these platforms offer financial education resources and tools to help borrowers make informed decisions and improve their long-term financial health. Furthermore, next-gen money lending services are fostering a more inclusive and collaborative financial ecosystem through peer-to-peer lending models. By connecting borrowers directly with individual investors, these platforms bypass traditional intermediaries and enable more efficient and cost-effective capital allocation. This not only benefits borrowers by potentially lowering interest rates and fees but also provides investors with new opportunities to diversify their portfolios and earn attractive returns. Overall, next-gen money lending services are not just disrupting the status quo; they are reshaping the future of finance. By prioritizing inclusivity, transparency, and responsibility, these platforms are empowering borrowers to take control of their financial destinies and pursue their goals with confidence. Whether it is starting a business, buying a home, or pursuing higher education, individuals now have unprecedented access to the capital they need to turn their aspirations into reality. As this revolution continues to unfold, one thing is clear: the era of exclusionary lending practices is coming to an end, and a new era of financial empowerment is dawning for borrowers everywhere. Instructions to Insta growth Unleashed – Advanced Strategies for Followers Instagram has more than 700 multi month to month clients. Studies show that clients are on various occasions bound to team up with stamped content on Instagram diverged from Facebook, and on numerous occasions bound to take some action than people on Twitter. Your business might conceivably show up at endless individuals in different districts across the globe with Instagram. Getting everything moving With Instagram Most importantly, download the application from the Google Play store or Apple store. You will have the choice to make an individual or business profile. Choose for the business profile. Instagram conveys some advancing and lead following instruments for business profile account holders. Make Content Instagram is a photo sharing site. It is basic to disseminate intriguing, quality substance accepting you want your business impact on Instagram and see it here. Instagram is about beautiful and eye-getting pictures. Phenomenal photos or accounts can help with touching off revenue in your business and draw in people. Up your game by obtaining some photography capacities. Post unique updates after about every 4 or 5 instructive updates. Work up the times; work up the kind of post, use pictures, video, and text in various lengths. Use hashtags to get to people you in the long run keep up with that ought to work with. Endeavor to include terms and articulations in your substance that your vested party will search for. Set aside an open door to comment, as, and attract with your enthusiasts reliably. Stacks of data exhibits that the best an open door to post on Instagram is at 5pm on Wednesdays. Anyway, this may or presumably would not be ideal for your page considering on your subject, the economics of your lovers and various things obvious for your market and content material of instagram. Making Your Photos Stick Out Instagram has 23 photo channels you can use on your accounts and photos. Channels affect the manner in which your photos and accounts look. At the point when you get better at taking photos, and know the style you accept they ought to have, you ought to endeavor one of the a few untouchable applications that are open. Separating your publicizing on Instagram is genuinely fundamental. Instagram gives publicizing pieces of information on its business profile accounts. This is all of the significant data about your page. Take a gander at the quantity of new allies you that get and how much responsibility you get. As soon as possible, you will see what kinds of pictures get the most likes and the most comments. Start taking a more noteworthy measure of such photos, or collecting them on the web.
How do you approach designing costumes for characters with specific age-related or time-related transformations? - garrone - 0 - Posted on Sample interview questions: How do you approach designing costumes for characters with specific age-related or time-related transformations? Sample answer: Approaching Costume Design for Age-Related and Time-Related Transformations: To effectively design costumes for characters undergoing age-related or time-related transformations, consider the following steps: Research and Reference: Thoroughly research the character's journey, including their physical, emotional, and temporal changes. Use historical and cultural references as inspiration to create authentic period-appropriate designs. Establish a Costume Palette: Choose fabrics, textures, and colors that reflect the character's evolving age and timeline. Consider the symbolic value of certain fabrics and colors to enhance the character's transformation. Design for Functionality and Realism: Ensure that the costumes allow for a full range of movement and interaction between characters. Research the specific period or time to ensure accuracy in the design's details and functionality. Consider Aging Effects: For age-related transformations, gradually incorporate age-appropriate elements such as wrinkles, sagging skin, and grayi… Read full answer
The Victorian Government has commenced a new technology speed trial on the Monash Freeway that will see speeds on the freeway move up and down based on live traffic conditions. Victorian Minister for Roads Luke Donellan welcomed the new trial. "We're using existing technology so we can be smarter about the way we manage traffic on the Monash," he said in a statement. "We're making the speed on the Monash reflective of the conditions meaning that when it is safe to do so, motorists will be able to travel at 100km/h." The six-month Dynamic Speed Trial pilot will allow speed limits to change in response to road conditions, such as an increase or decrease in traffic volumes, weather conditions and the time of day. The new approach to speed management uses existing technology on the freeway, including CCTV, road sensors and overhead electronic signs to change the speed limits when conditions allow. The trial will operate n the freeway between High Street in Ashburton and Glenferrie Road in Toorak, where speeds, given it is safe to do so, may increase from 80 km/h to 100 km/h. The trial will be undertaken in three different phases. Phase one will vary speeds at night, phase two will include night and off-peak periods and phase three will run 24-hours a day. If successful, the technology may be rolled out across other managed motorways across Melbourne. Results from the trial will be independently examined and used to help inform future decisions around speed, allowing us to make the most of the state's road network.
There are tons of free games for kids on the web, but it's important to choose the right ones. Not only should you consider what your kids enjoy, but you should also take into consideration how much time they're willing to devote. This article will highlight some of the best free games for kids, and recommend which ones you should avoid. Here's a brief rundown of some of the most popular games available on the web. Super Stickman Golf 3 is a great example of a game aimed at young children. It allows them to interact with their favorite TV characters and discover different worlds. They can also learn basic coding skills. The game is incredibly fun and has educational benefits, making it a great choice for many kids. In addition, it's available for tablets and phones. The game is also available for parents to download, making it a great choice for busy moms and dads. Toca Life World is another great example of a free game for kids. It's a story-telling game that allows kids to create their own world and character. While there are other types of games for kids online, the one listed here is designed to be easy to use. It is a fun game for children of all ages. It also has a lot of educational benefits, such as teaching your kids about the different types of animals. Let us know more information about https://checkname.org/. The free games for kids are available everywhere, including on the internet. These include websites and apps with cartoon characters, online forums, and social networks. It's important to note that you should only trust the sites that are safe for kids and don't contain any inappropriate content. Besides, it's also a fun way to bond with your child. It's important to keep in mind that while some of these sites are great for parents and kids, others are better for kids. Toca Life World is a free game for kids that lets kids create their own characters and build their own cities. Toca games are also great for children's education. As a parent, it's essential to ensure that your child is familiar with these games and not afraid to play them on their own. There are lots of free kids' online resources that will allow you to find the right ones for your child. You can play them on your computer or on your iPad. Aside from free games for kids, you can also find many paid games for kids. The free games for kids will give you plenty of entertainment and build your child's skills. While you're shopping for the best free games for kids, be sure to consider the ones that are educational. These games are great for kids because they'll develop critical thinking and problem solving skills. They're also educational. However, you'll need to make sure that you select the ones that have good reviews.
Amateur archaeologists can watch a live excavation as part of an event organised at the Għajn national water conservation centre in Rabat. It is being held as part of the annual European Heritage Days programme, which offers people the oprotrunity to see places that are usually inaccessible to the public. It includes an exhibition, educational lectures and live archaeological excavations. Visitors will have the opportunity to follow live an archaeological excavation currently under way within the grounds of the centre at Triq Għajn Qajjet. Some of the archaeological artefacts discovered during these works, dating from the Phoenician and Roman periods, will also be shown for the first time. The free event is open to the public on Saturday and Sunday with informative sessions being held at 9 and 11am and at 1 and 3pm. European Heritage Days is a joint European Council and European Union project celebrated in almost 50 European states that are signatory to the European Cultural Convention. The event is organised by the Superintendence of Cultural Heritage, together with the Energy and Water Agency, In line with current Covid-19 Guidelines, visitors are required to book on the available forms accessible from the agency or the superintendence's Facebook page or from eventbrite.com through https://bit.ly/3ojF2iu.
In today's fast-paced digital world, your business's online presence is more crucial than ever before. Whether you're a budding startup in London, a creative entrepreneur in Edinburgh, or a tech-savvy enthusiast in Manchester, your website is often the very first interaction potential customers have with your brand. But the big question remains: Should you try your hand at do-it-yourself (DIY) website creation, or is investing in a professional web designer genuinely worth it? In this guide, we'll explore the world of professional web design and how it can make a world of difference for your UK business. The Power of First Impressions Your website isn't just a collection of web pages; it's your digital storefront. It's the place where visitors get their first impression of your brand, your products, and your services. In today's highly competitive business environment in the UK, a strong online presence is an absolute necessity. In a crowded online space, a professionally designed website helps your business stand out. It captures attention and retains it, which is especially important in a digital world full of distractions. Trust and Credibility Trust is the foundation of successful online business interactions. A professional website design helps establish and maintain trust with your audience. It tells potential customers that you take your online presence seriously, and this can be the tipping point for their decision to engage with your business. DIY vs. Professional Web Design: The Battle for Success The allure of DIY web design is undeniable, especially with the rise of DIY website builders. It might seem cost-effective and empowering at first, but does it provide everything your business needs? Let's take a quick look at some popular DIY website builders: Wix is known for its user-friendliness and aesthetics, but it may lack the depth your business requires. For businesses aiming to expand, Wix's limitations can be a real obstacle. Squarespace is a favorite among creatives, but it might not offer the versatility needed for every type of business. It excels in certain areas but may fall short in others. WordPress (self-hosted) WordPress is a powerful and customizable option, but it can be complex for those without expertise. While it offers a great deal of flexibility, making the most of it often demands professional know-how. Elevating Business with Professional Web Design Shifting your perspective is key. Professional web design isn't just an expense; it's an investment in the success of your UK business. When you choose professional web design, you gain access to a world of benefits. Expertise and Customization Web designers aren't just artists; they're skilled technicians. They can create a website tailored to your brand's unique personality and fulfill your specific business requirements. You won't be limited by templates; instead, your site will be a unique representation of your business. Long-Term Benefits Professional web design delivers enduring benefits. Your website operates seamlessly, adapts to various devices, and is primed for search engine optimization (SEO). It's also designed to grow with your business. It's not just a website; it's a long-term business asset. A professionally designed website is scalable from the get-go. This means you can expand your website as your business grows without the need for costly redesigns down the line. The Hidden Price of DIY One of the often-overlooked expenses of DIY web design is your time. The hours spent learning, troubleshooting, and maintaining your site could often be more productively utilized for business growth. Your Most Precious Resource: Time Time is a valuable commodity for any business owner. Every hour you spend on web design is an hour you're not dedicating to other crucial business activities. Design Limitations DIY website builders come with constraints, which can make customizing your site to meet your business's unique requirements challenging. What might seem like a minor adjustment could turn into a major headache. The Professional Appearance A lackluster design can harm your business's professionalism and credibility, potentially discouraging potential customers. In the digital world, appearances matter. DIY vs. Professional Web Design: A Comprehensive Budget Analysis Let's delve deeper into the budget implications of DIY web design versus professional web design. Initial Costs DIY web design might seem budget-friendly initially with its low initial investments. However, it's important to consider the whole financial picture. - DIY Web Design: While the initial costs are low, the hidden costs, as we discussed, can add up significantly over time. - Professional Web Design: It requires a more substantial upfront investment, but the long-term benefits make it a valuable investment. What to Expect from Professional Web Design When you embark on a professional web design project, you can expect a level of expertise and customization that DIY simply can't match. Expertise and Customization Professional designers work closely with you to understand your brand and create a website that truly represents your business. They don't just aim for a nice-looking site; they create an experience. Long-Term Benefits With professional web design, you don't just get a website; you get a long-term business asset. Here's what you can expect: - Responsive Design: In an era where mobile devices dominate, a professionally designed website ensures a consistent user experience across all devices. - Scalability: A professionally designed website is built with growth in mind. As your business expands, your website can easily adapt. - SEO Optimization: Search engine optimization is crucial for attracting organic traffic. Professional web designers optimize your site to rank higher in search engine results, saving on marketing costs. The Web Design Process The journey from concept to creation is a fascinating one. Here's what you can expect when you decide to go with professional web design: - Initial Consultation: You'll have an initial consultation with your web designer. This is where you discuss your business, your goals, and what you want your website to achieve. - Planning: The web designer creates a plan for your site, outlining its structure and functionalities. - Design: Once you approve the plan, the designer will start creating the visual elements of your website, focusing on your brand's identity. - Development: This is where the website comes to life. The designer will bring together the design and functionality to create a fully operational site. - Testing: The website undergoes rigorous testing to ensure it functions perfectly across different devices and browsers. - Launch: Once you're satisfied with the website, it's launched for the world to see. Choosing the Right Web Designer Choosing the right web designer is crucial. Here's how you can find the perfect match for your project: - Review Portfolios: Examine the designer's past work. Do their design styles align with your vision? - Check Client References: Reach out to previous clients and ask about their experiences working with the designer. - Compatibility: Ensure you and your designer are compatible and can effectively communicate throughout the project. Preparing for Your Web Design Journey Before your web design project begins, there are some steps you can take to ensure success: - Define Your Goals: What do you want your website to achieve? Be clear about your objectives. - Prepare Content: Gather the content you want on your website, including text, images, and videos. - Branding Considerations: Discuss how your website can represent your brand effectively. - Budget and Timeline: Communicate your budget and timeline to the web designer. Beyond the Launch: Post-Web Design Considerations The journey doesn't end once your website is launched. Here's what to consider after the launch: - Maintenance: Regular maintenance and updates are essential to keep your website running smoothly. - Content Updates: Fresh and engaging content keeps your audience coming back for more. Real-Life Success Stories: UK Businesses and Professional Web Design To see the real impact of professional web design, we'll share case studies and success stories of UK businesses that have transformed their online presence through professional web design. In conclusion, your website is more than just a digital placeholder; it's your 24/7 salesperson and the gateway to your success. In the ongoing debate between DIY web design and hiring a professional, the latter often emerges as the winner. While DIY design may appear cost-effective on the surface, its hidden costs can be detrimental to your business's growth. On the other hand, professional web design, despite requiring a more significant upfront investment, ensures a long-term return on that investment through a well-designed, scalable, and professionally maintained website. Ready to Catapult Your Business Online? Explore the world of professional web design with GearUp Web Design Services and give your UK business the boost it deserves. Invest in your digital future today! Still Have Questions? If you're uncertain which path is right for your business, contact us for a consultation. We're here to help you make the best decision for your budget and business goals. Your success is our priority. This comprehensive guide has shed light on the world of professional web design for your UK business. Don't miss out on the opportunity to elevate your online presence and attract more customers. Maximizing the Benefits By now, it's clear that professional web design offers numerous advantages for your online business. However, let's dive deeper into the key benefits you can expect when you invest in a professionally crafted website. 1. Enhanced User Experience Professional web designers prioritize user experience. They create websites that are intuitive, easy to navigate, and visually appealing. When visitors enjoy their time on your site, they're more likely to stay longer, engage with your content, and convert into customers. 2. Improved Search Engine Visibility In an era where "Google it" is a common phrase, search engine optimization (SEO) is crucial. Professional web designers understand the ins and outs of SEO, ensuring your site ranks higher in search results. This leads to increased organic traffic and more opportunities for business growth. 3. Consistency Across Devices With the majority of internet traffic coming from mobile devices, having a responsive design is non-negotiable. Professional web designers create websites that adapt seamlessly to various screen sizes and devices. This consistency means your business looks professional and accessible, no matter how visitors access your site. 4. Building Trust A professionally designed website exudes trust and credibility. When potential customers land on a well-structured, visually appealing site, they feel confident in your business. Trust is the foundation of online interactions, and a professional website can be the tipping point that converts visitors into loyal customers. 5. Scalability As your business evolves, your website should evolve with it. Professional web design builds scalability into your site's DNA. This means you can expand your online presence without the need for costly redesigns, keeping your business agile and adaptable. 6. Focus on What Matters DIY web design can be a significant time sink. When you entrust your website to professionals, you free up your valuable time to focus on what truly matters – growing your business, serving your customers, and achieving your goals. In conclusion, professional web design isn't just about creating a website; it's about creating a robust online presence that drives business success. The benefits extend far beyond aesthetics; they touch the core of your operations. So, why wait? Elevate your online business today with professional web design.
Incidence, progression, and patterns of multimorbidity in community-dwelling middle-aged men and women Journal article Shang, Xianwen, Peng, Wei, Hill, Hill, Szoeke, Cassandra, He, Mingguang and Zhang, Lei. (2020). Incidence, progression, and patterns of multimorbidity in community-dwelling middle-aged men and women. Frontiers in Public Health. 8(404), pp. 1-12. https://doi.org/10.3389/fpubh.2020.00404 Authors \| Shang, Xianwen, Peng, Wei, Hill, Hill, Szoeke, Cassandra, He, Mingguang and Zhang, Lei \| Abstract \| Background: Determining the incidence, progression, and patterns of multimorbidity are important for the prevention, management, and treatment of concurrence of multiple conditions. This study aimed to analyze major multimorbidity patterns and the association of the onset of a primary condition or combinations of a primary and a secondary condition with the progression to subsequent conditions. Methods: We included 53,867 participants aged 45–64 years from the 45 and Up Study who were free of 10 predefined chronic conditions at baseline (2006–2009). The incidence of multimorbidity (coexistence of ≥2, ≥3, and ≥4 conditions) was identified using the claims database until December 31, 2016. The primary, secondary, tertiary, and quaternary condition for each participant was defined according to its temporal order of onset. Results: During a mean 9-years follow-up, the cumulative incidence of primary, secondary, tertiary, and quaternary conditions was 49.6, 23.7, 9.0, and 2.9%, respectively. The time to develop a subsequent condition decreased with the accumulation of conditions (P < 0.0001). Two concurrent cardiometabolic disorders (CMDs, 30.4%) and CMDs clustered with musculoskeletal disorders (15.2%), mental disorders (13.5%), asthma (12.0%), or cancer (8.7%) were the five most common multimorbidity patterns. CMDs tended to occur prior to mental or musculoskeletal disorders but after the onset of cancers or asthma. Compared with all participants who developed cancer as a primary condition, individuals who experienced mental disorders/neurodegenerative disorders and a comorbidity as cardiovascular disease, hypertension, dyslipidemia, diabetes, asthma, or osteoarthritis were 3.36–10.87 times more likely to develop cancer as a tertiary condition. Individuals with neurodegenerative disorders and a comorbidity as hypertension, dyslipidemia, osteoarthritis, or asthma were 5.14–14.15 times more likely to develop mental disorders as a tertiary condition. Conclusions: A high incidence of multimorbidity in middle-aged adults was observed and CMDs were most commonly seen in multimorbidity patterns. There may be accelerated aging after a primary condition occurs. Our findings also reveal a potential preventative window to obviate the development of secondary or tertiary conditions. \| Keywords \| patterns of multimorbidity; time to develop subsequent conditions; primary condition; secondary condition; tertiary condition; quaternary condition \| Year \| 2020 \| Journal \| Frontiers in Public Health \| Journal citation \| 8 (404), pp. 1-12 \| Publisher \| Frontiers Research Foundation \| Digital Object Identifier (DOI) \| https://doi.org/10.3389/fpubh.2020.00404 \| Scopus EID \| 2-s2.0-85090044231 \| Open access \| Published as 'gold' (paid) open access \| Research or scholarly \| Research \| Page range \| 1-12 \| Publisher's version \| License File Access Level Open \| Output status \| Published \| Publication dates \| \| Online \| 18 Aug 2020 \| Publication process dates \| \| Accepted \| 09 Jul 2020 \| Deposited \| 07 Jul 2021 \| Download files Publisher's version OA_Shang_2020_Incidence_Progression_and_Patterns_of_Multimorbidity.pdf \| \| License: CC BY 4.0 \| \| File access level: Open \| total views16 total downloads1 views this month1 downloads this month
Since 2002, the Sustainable Fisheries Fund (SFF) has provided match funding for small-scale fisheries to build technical capacity and advance sustainability through certifications such as the Marine Stewardship Council (MSC) standard, Fair Trade, and registered Fishery Improvement Projects (FIPs). SFF grantmaking has supported MSC certification for more than 55 fisheries, Fair Trade-certification for three fisheries, and documented progress in environmental performance and social responsibility for dozens of FIPs. In 2022, toward the goal of centering human rights and social responsibility in seafood sustainability, RLF and its partners focused SFF grantmaking on support to FIPs worldwide to implement the FisheryProgress Human Rights and Social Responsibility Policy. Related News: - From Ruin to Resilience: Supporting Global Fisheries' Sustainability amid Pandemic, by Shiva Polefka, April 14, 2021
Common variation at 16p11.2 is associated with glycosuria in pregnancy : findings from a genome-wide association study in European women Lee, Matthew A.; McMahon, George; Karhunen, Ville; Wade, Kaitlin H.; Corbin, Laura J.; Hughes, David A.; Smith, George Davey; Lawlor, Debbie A.; Jarvelin, Marjo-Riitta; Timpson, Nicholas J. (2020-06-15) Matthew A Lee, George McMahon, Ville Karhunen, Kaitlin H Wade, Laura J Corbin, David A Hughes, George Davey Smith, Debbie A Lawlor, Marjo-Riitta Jarvelin, Nicholas J Timpson, Common variation at 16p11.2 is associated with glycosuria in pregnancy: findings from a genome-wide association study in European women, Human Molecular Genetics, Volume 29, Issue 12, 15 June 2020, Pages 2098–2106, https://doi.org/10.1093/hmg/ddaa054 © The Author(s) 2020. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Glycosuria is a condition where glucose is detected in urine at higher concentrations than normal (i.e. not detectable). Glycosuria at some point during pregnancy has an estimated prevalence of 50% and is associated with adverse outcomes in both mothers and offspring. Little is currently known about the genetic contribution to this trait or the extent to which it overlaps with other seemingly related traits, e.g. diabetes. We performed a genome-wide association study (GWAS) for self-reported glycosuria in pregnant mothers from the Avon Longitudinal Study of Parents and Children (cases/controls = 1249/5140). We identified two loci, one of which (lead SNP = rs13337037; chromosome 16; odds ratio of glycosuria per effect allele: 1.42; 95% CI: 1.30, 1.56; P = 1.97 × 10⁻¹³) was then validated using an obstetric measure of glycosuria measured in the same cohort (227/6639). We performed a secondary GWAS in the 1986 Northern Finland Birth Cohort (NFBC1986; 747/2991) using midwife-reported glycosuria and offspring genotype as a proxy for maternal genotype. The combined results revealed evidence for a consistent effect on glycosuria at the chromosome 16 locus. In follow-up analyses, we saw little evidence of shared genetic underpinnings with the exception of urinary albumin-to-creatinine ratio (Rg = 0.64; SE = 0.22; P = 0.0042), a biomarker of kidney disease. In conclusion, we identified a genetic association with self-reported glycosuria during pregnancy, with the lead SNP located 15kB upstream of SLC5A2, a target of antidiabetic drugs. The lack of strong genetic correlation with seemingly related traits such as type 2 diabetes suggests different genetic risk factors exist for glycosuria during pregnancy. - Avoin saatavuus [32538]
Scholarships can be a great way to reduce the burden of college tuition and make college more affordable, but finding the best ones to apply to can be overwhelming! Continue reading to learn more about scholarships and how to find the right scholarships for you. A scholarship is a form of financial support used to pay for college. Unlike loans, which need to be paid back with interest, scholarships are a gift! The money awarded does not need to be paid back.Scholarships are usually merit-based, or awarded to students with exceptional academic achievements, athletic ability, community involvement, or artistic skill. If that doesn't sound like you, don't give up! There are scholarship opportunities for all kinds of students, and being strategic about finding the best ones for you to apply for is the first step towards earning free money for college. Grants are another form of college funding that does not need to be paid back. However, unlike scholarships, which are usually merit-based, grants are awarded based on financial need. Scholarships are often funded by private organizations, institutions, and individuals who set the qualification requirements themselves, which is why scholarship requirements and applications vary so broadly. Grants can also be provided by private foundations or organizations, but are typically provided through government agencies. The application process for grants is different from the application process for scholarships. Grants typically require applicants to complete the FAFSA (Free Application for Federal Student Aid) to qualify. Scholarships typically require an application essay, transcripts, and letters of recommendation. It is important to ensure that the scholarships you apply for are from reliable organizations. Remember, scholarships do not have to be paid back and you should never have to pay an organization to apply for a scholarship. If a scholarship requires a processing fee or application price, it is most likely a scam. Students often make the mistake of assuming that they will not qualify for any scholarships because they aren't a straight-A student or a star athlete. However, there are scholarships for all types of students. Common types of scholarships There are many great free resources that can help assist in the search for scholarships. Scholarships can be very competitive because, well, who doesn't want free money for college? Applications can be time-consuming too, so it's important to choose opportunities that are a good fit for you. One of the best tips for finding and applying to scholarships is to search for scholarships that are related to your interests, goals, and background. These will be the scholarships that you will easily qualify for and will, with your prior experience and interests, be easiest to apply to. Join the CC Community for more discussion on financial aid and scholarships or search for scholarships that fit you! Deciding to go to college is a big deal for many families, but it also comes with some risks. From unexpected events forcing a st… A state-by-state list of colleges and universities that offer tuition waivers and scholarships for Native American students. With … Ascent hosted an engaging webinar recently to address what's on many people's minds – federal student loan repayment. Embarking o… In honor of October being Hispanic / Latinx Heritage month, below is a list of scholarships currently accepting applications that… Have you looked at your 529 plan recently? If you do take a look at your 529 plan, you may be shocked at how the value has c… Ascent offers cosigned and non-cosigned student loans with exclusive benefits that set students up for success. Explore Now!Want to find money for school that doesn't need to be paid back? Access insights and advice on how to search and apply for scholarships!
Though donor assist pertaining to vaccine engineering improvement is powerful, the particular uptake involving verified systems with the vaccine market along with requirement for these people by customers continues to be. This article clarifies the contests and options connected with accelerating the availability regarding revolutionary and also valuable vaccine engineering in order to meet essential needs inside resource-poor configurations over the up coming decade. Advancement will require increased dialog involving the private and non-private areas around vaccine product or service features; institution involving features for vaccines in which reflection programmatic requires; better support involving vaccine developers to take into consideration book technology at the start of the product growth method; broader facilitation of investigation and access to technology through the enhancement involving stores associated with brilliance; the actual making involving vaccine buy selections in immunization techniques fees rather than price per dosage by yourself; feasible subsidization associated with early technological innovation use expenses pertaining to vaccine makers that will undertake the potential for loss of new systems worth addressing to the enzyme immunoassay public sector Cediranib ; as well as the supply of information for you to customers, much better allowing the crooks to help to make knowledgeable choices which look at the value of specific product or service attributes. (H) This year Elsevier Ltd. Just about all protection under the law earmarked.Target. To look into appearance associated with vascular endothelial development issue (VEGF) antiangiogenic isoform A-(165b) on man muscle mass within idiopathic inflamed myopathies (IIM) also to evaluate submission involving angiogenic/antiangiogenic VEGFs, because isoforms shifts tend to be described in various other autoimmune ailments. Subjects and Methods. All of us analyzed VEGF-A(165b) along with VEGF-A by simply western blot and immunohistochemistry upon bone muscle Taiwan Biobank biopsies from Twenty one sufferers affected with IIM (polymyositis, dermatomyositis, and also add-on entire body myositis) and also 6 management muscle tissue biological materials. TGF-beta, a leading VEGF inductor, ended up being analogously looked at. Intergroup variations involving western mark rings denseness had been in the past reviewed. Endomysial vascularization, inflammatory score, as well as muscle mass renewal, since pathological variables involving IIM, have been quantitatively determined as well as their ranges were confronted by VEGF term. Benefits. VEGF-A(165b) has been considerably upregulated inside IIM, along with TGF-beta. VEGF-A has been diffusely portrayed upon unaffected myofibers, while regenerating/atrophic myofibres clearly reacted both for VEGF-A isoforms. Many -inflammatory tissue along with endomysial ships portrayed the two isoforms. VEGF-A(165b) levels had been within positive relationship to be able to inflamed rating, endomysial vascularization, as well as TGF-beta. A conclusion. Each of our findings show bone muscle phrase of antiangiogenic VEGF-A(165b) as well as preferential upregulation inside IIM, indicating that will modulation of VEGF-A isoforms can happen inside myositides.Targets: To spot your respiratory well-liked pathoenic agents related to intense lower respiratory tract infection throughout severely sick child fluid warmers individuals by making use of real-time change transcription-polymerase squence of events, along with evaluate results along with the ones from immediate fluorescence antibody assay testing. Month: May 2023 Nearby dimers inside receptor trimers inspired a single another person's functional ligand love, indicating allosteric direction. Even so selleck , this direction didn't add the crucial aim of kinase hang-up. Our own data revealed that just one receptor dimer can hinder kinase being a objective of ligand occupancy. This specific frugal allosteric direction corresponded together with formerly discovered architectural asymmetry: only one dimer in the trimer contact lenses kinase and only one particular Gnaw. We advise one of them dimers lovers ligand occupancy in order to kinase self-consciousness. Additionally, all of us learned that kinase protomers are allosterically coupled, offerring self-consciousness across the dimer program. Simply because kinase dimers link central complicated hexagons, allosteric communication throughout dimer connects gives a pathway with regard to receptor-generated kinase self-consciousness in one hexagon to distributed to an alternative, supplying a vital action for the extensive audio sign of chemotactic signaling.Baicalin, the flavonoid compound remote through Scutellariae radix, has been shown to possess a amount of medicinal consequences. The purpose of the current study would have been to observe the inhibitory outcomes of baicalin on the account activation regarding microglial tissue brought on simply by oxygen-glucose starvation (OGD) as well as the specific elements through which these consequences are usually mediated. Classy rat main microglial cells had been confronted with baicalin with ultimate amounts involving 12 mu g/ml, Twenty mu g/ml as well as 40 mu g/ml in the course of Several biotic and abiotic stresses h involving OGD. The consequences regarding baicalin upon (my spouse and i) cellular viability; (2) release of proinflammatory cytokines; (iii) TIr4 mRNA appearance; (4) p-c-jun, p-ERK1/2, p-INK, p-p38, TRAF6 as well as p-I kappa B-alpha levels; as well as (versus) co-localization associated with TLR4 as well as MyD88 have been examined while using Cell Counting Kit-8 (CCK-8), enzyme-linked immunosorbent assays (ELISA), invert transcription-polymerase chain reaction (RT-PCR), american mark and also double-labeled immunofluorescence soiling, correspondingly. OGD increased cell practicality along with relieve TNF-alpha, IL-1 try out, IL-6 and IL-8, these kinds of results have been under control simply by baicalin. Baicalin in addition attenuated the actual OGD-induced boosts inside Tlr4 mRNA appearance. Furthermore, substantial dosage of baicalin lowered TRAF6 ranges remarkably. In addition, baicalin also downregulated phosphotylation involving My partner and i kappa B-alpha, c-jun, ERK1/2, JNK, p38 along with limited the particular OGD-induced change in MyD88 via cytoplasm in order to membrane within microglial tissues. The outcome show that baicalin can slow down OGD-induced production of inflamation related elements in microglial cells simply by attenuating -inflammatory elements along with controlling the TLR4 signaling walkways. (D) The coming year Elsevier T.V. Almost all legal rights reserved.A new three-stage support vector equipment (SVM) has been constructed to calculate the condition of cysteines by simply fusing string info, development data as well as annotation information regarding necessary protein patterns. The next phases were with regard to guessing perhaps the proteins series include disulfide ties and also no matter whether all the cysteines get excited about immune T cell responses disulfide securities. Within the last phase, one particular SVM ended up being made pertaining to projecting which cysteines are involved in disulfide provides, among all these kinds of cysteines in protein. A few SVMs offer a very good efficiency and also the general forecast exactness tend to be Three months. The actual posted novels identifies "learning curves" according to retrospective evaluation of key occasion, conversion rate, morbidity and so forth., which in turn shortage detachment and don't handle individual man Broken intramedually nail elements. A more beneficial examine of the gain in skills with the particular person doctor for a particular operation could be received utilizing observational clinical-human trustworthiness evaluation (OCHRA). Following the 8-month fellowship throughout superior laparoscopic surgical procedure, choices Mirielle.To. done, independently with his very own clinic, a potential series of 20 palliative bypass procedures for innovative gastric or perhaps pancreatic cancers. Unedited videotapes involving gastro-jejunostomy (GJ) or perhaps cholecysto-jejunostomy (CJ) had been examined independently inside the education organization with the OCHRA approach CC220 . For this kind of cosmetic surgeon effectiveness inside performing laparoscopic modern get around ended up being reached as soon as the Fourteenth anastomosis any time productive setup (lowering of working moment) ended up being accompanied by important reduction in complex V180I genetic Creutzfeldt-Jakob disease errors and enhanced economic climate of movement (lowering of the economic climate of motion catalog coming from 7-5 to 3-2). Nearly all blunders had been introduced throughout element duties linked to intracorporeal suturing. The actual declining chance of these blunders together with knowledge has been an intrinsic part of the actual proficiency-gain necessities. The important performance-shaping components determined had been: concentration trail-offs (and Is equal to One,321), misjudgments (in = 209), inadequate digital camera perform (n Is equal to 193), low energy (in Equals 128), and also damaged control (in Equals 108). This examine has verified that OCHRA can easily describe quantitatively your proficiency-gain curve for a laparoscopic procedure and reveal the particular level of skill phase if the personal doctor attains maximum overall performance from the setup of an certain method.Telemedicine for serious cerebrovascular accident treatment will be based on the materials base. The idea remains unclear get the job done use of telemedicine regarding other stages associated with cerebrovascular accident care is beneficial. The authors carried out a planned out writeup on your printed materials in telemedicine for the reason for supplying post-stroke proper care. Reports had been incorporated if the name or subjective portrayed use of two-way audio/video interaction regarding post-stroke treatment. From a preliminary generate of just one,405 most likely suitable hits, two writers in the end identified Twenty-four exclusive manuscripts to have functionality, program, engineering, as well as evaluative (F.A.TE.) credit rating. Every write-up has been labeled using a scoring rubric to guage the particular functionality, program, engineering, and evaluative phase. It was learned that most post-stroke telemedicine scientific studies examined therapy involving grown ups. All main data manuscripts had been small , initial in opportunity and also evaluative phase, and typical Y.A new. The gamma radiation-induced variance of the bio-templated synthesis transconductance within the subthreshold area can be examined many different back-gate voltages as well as different kinds of SOI MuGFETs: gadgets together with and also without frugal epitaxial development (SEG) and Forty-five certifications turned transistors. Extensive fin products display a greater deterioration if the back-gate will be seated. The back-channel of thin very b transistors, alternatively, has to be inside-out ahead of deterioration within the transconductance is noted. The radiation habits of the transconductance is comparable for gadgets using along with without having SEG. It is demonstrated that this greatest variation within transconductance correlates together with the mobility for slim cid gadgets. This kind of freedom may differ when the transistor can be spun. Regarding vast cid units this particular connection is not as solid Pine tree derived biomass .Chlorophyll is a negative molecule that yields sensitive o2 kinds and should become changed into non-toxic compounds through plant senescence. The destruction walkway regarding chlorophyll a has become established; nonetheless, that regarding chlorophyll w can be inadequately understood, and also a number of path ways of chlorophyll b destruction are already proposed. Within this examine, we learned that chlorophyll n can be changed by the individual process, and elucidated the value of this kind of process in avoiding mobile or portable dying. In order to decide the chlorophyll wreckage path, many of us initial analyzed the substrate specificity involving 7-hydroxymethyl chlorophyll a reductase. 7-hydroxymethyl chlorophyll the reductase reduces 7-hydroxymethyl chlorophyll a but not 7-hydroxymethyl pheophytin a new or even 7-hydroxymethyl pheophorbide a new. These types of final results show that this starting point regarding chlorophyll w deterioration is its transformation for you to 7-hydroxymethyl chlorophyll the through chlorophyll b reductase, despite the fact that chlorophyll n reductase features extensive substrate specificity. Within vitro studies showed that chlorophyll t reductase modified each of the chlorophyll b in the light-harvesting chlorophyll a/b protein complex in order to 7-hydroxymethyl chlorophyll a, nevertheless didn't entirely turn chlorophyll b in the core antenna buildings. Whenever plants whose key antennae included chlorophyll b had been incubated after dark, chlorophyll w has not been appropriately degraded, and also the accumulation regarding 7-hydroxymethyl pheophorbide the and pheophorbide n resulted in mobile dying. This particular consequence points too chlorophyll w isn't correctly deteriorated when it is out there within central aerial complexes. Determined by these kinds of outcomes, we talk about the significance of the appropriate deterioration involving chlorophyll t.History: Big t assistant (Th) 18 tissue be involved in hypersensitive bronchial asthma. This research examined the effect associated with allergen breathing problem in going around Th17 cells along with associated cytokines in hypersensitive asthmatics. Methods: Peripheral blood vessels mononuclear cellular material were accumulated from 07 atopic asthmatics prior to and Twenty-four they would right after allergen problem, and also from 10 atopic nonasthmatics and 10 regular regulates. Tissue had been discolored regarding Th17 cytokines in addition to their receptors (IL-17A, IL-17F, IL-21, IL22, IL-17R, as well as IL-23R) making use of flow cytometry. Cytokine levels learn more from cell way of life supernatants ended up quantified by using a multiplex assay regarding IL-17A, IL-17F, IL-21, IL-22, as well as IL-23. Final results: At baseline, asthma sufferers stood a higher number of going around Th17 cellular material (One particular. Following biochemically meaningful philosophy that will metabolite levels exhibit clean temporary alterations Nelfinavir in vitro , your suggested methods rely on lessening the significant variances regarding metabolic users to predict the particular time-resolved metabolism point out, seen as an the two fluxes along with concentrations. Simply by conducting a marketplace analysis evaluation with a kinetic label of the media supplementation Calvin-Benson routine as well as a type of grow carbo metabolism, many of us show that the principle associated with regulatory on/off minimization coupled with powerful FBA may properly predict the changes throughout metabolism claims. Conclusions: Our own methods outwit the current energetic FBA-based modelling alternatives, and may assist in unveiling your elements pertaining to sustaining robustness associated with energetic functions within metabolic sites over time.Goals: Mature idiopathic separated ACTH insufficiency (AIIAD) is surely an underestimated dysfunction which can be regularly misdiagnosed. We presented Several brand-new China AIIAD cases, defined their own clinical qualities along with reviewed the disposable materials. METHODS: Three instances of AIIAD managed throughout Oriental PLA Basic Healthcare facility through the time period 1998-2003 had been retrospectively recognized. We have collected facts about medical display, lab studies and also remedy reply. The medical features have been summarized and pertinent literatures had been examined. RESULTS: Each of our Three circumstances with AIIAD older 52-68 years old ended up misdiagnosed for a long time of energy. Scientific top features of AIIAD have been summarized simply by looking at the minimal literature: One particular. Most patients were more than Forty years; Two. Specialized medical presentations ended up subtle; Several. Generally absolutely no pigmentation; Several. Hypogonadism as well as amenorrhea may found; Five. mild hypoglycemia, hyponatremia, normal-high potassium, slight anemia, lymphocytosis as well as eosinophilia could current; Half a dozen. Along with reduced as well as lacking cortisol, standard release of pituitary bodily hormones aside from ACTH; Several. High frequency involving thyroid gland dysfunction; 8-10. Usually present concomitantly to auto-immune illness, which in turn gone away about anabolic steroid alternative; In search of. Shortage of architectural pituitary flaws except for vacant sella; Ten. Zero evidence in any infiltration, injury, surgical treatment, contagious or even radiotherapy, or perhaps glucocorticoid prescription medication; 12. Simply no growth abnormalities. CONCLUSION: AIIAD is surely an unspecified and also underestimated condition using considerably misdiagnosis. We all summarized the actual specialized medical functions to enhance the recognition. Indeed, each affected individual using unexplained hyponatremia along with malaise, specially in sufferers along with auto-immune diseases, should be assessed to the potential for AIIAD.Qualifications: Currently, simply few research has documented for the clinical eating habits study instant postextraction embed positioning along with immediate filling. Objective: The intention of this retrospective review was to report the outcomes regarding right away filling several enhancements used in refreshing removal sockets from the mandible after a follow-up regarding 24months. Resources and techniques endodontic infections : Involving Present cards Late 2001 and also Jan '09, 50 people (Twenty eight women and 22 guys, common age 54years), had 347 enamel taken out plus a complete regarding 190 tooth implants used in your mandible. The particular individuals gotten a provisional set bridge within 24 hours along with a everlasting a single 3months after. Sapling carbo standing, actual demography, EMF colonization, along with EMF taxon abundance ended up assessed frequently through 1 year soon after girdling. Girdling would not have an effect on main colonization but reduced EMF types richness of an estimated 79 for you to Three months taxa to about 45 taxa. Cenococcum geophilum, Lactarius blennius, along with Tomentella lapida have been dominating, colonizing about 70% from the root suggestions, along with JIB-04 stayed untouched by simply girdling. Primarily mysterious EMF species vanished. For that reason, the Shannon-Wiener index (H') reduced yet evenness ended up being untouched. H' has been favorably linked using severe bacterial infections blood sugar, fructose, and starchy foods concentrations of proper root base and also with all the proportion involving dissolved natural co2 in order to blended natural nitrogen (DOC/DON), suggesting that each H' as well as DOC/DON had been governed by changes in belowground carbon dioxide part. Our own final results suggest that beech keeps several uncommon EMF species by simply latest photosynthate. These types of Them infection might constitute natural insurance coverage regarding version to be able to changing environmental conditions. The availability associated with taxa in the past not known to be able to colonize beech may well, as a result, kind a crucial tank preimplnatation genetic screening with regard to future natrual enviroment advancement.In the reports, we all indicated that caspase-4, containing higher homology to caspase-12, performs a crucial role from the neurological mobile or portable demise through the endoplasmic reticulum (Im or her) anxiety. Additionally, all of us elucidated the particular effort in the family Alzheimer's (Advert)-linked presenilin-1 (PS1) mutation and beta-amyloid induced-apoptotic signaling throughout man sensory tissues within the account activation (cleavage) regarding caspase-4. These kinds of benefits recommend the particular involvement of caspase-4 in the cell loss of life seen in Advert. To elucidate the procedure with the cleavage of caspase-4 below Im stress, many of us employed EGTA, a new Ca2+ chelator, because the bosom caspase-12 features stated to be controlled from the calpain. Because the benefits. EGTA inhibited the actual cleavage associated with caspase-4 in a concentration-dependent way. In addition, inhibitors involving calpain, which can be stimulated from the Ca2+, additionally inhibited the actual cleavage of caspase-4. In addition, EGTA and caplain inhibitors saved the actual neural cellular dying under the Im tension. These types of benefits claim that your disturbance involving Ca2+ homeostasis caused by Im or her anxiety need to cause the account activation of caspase-4 creating the sensory cell dying. (C) Last year Elsevier Ltd. Most legal rights reserved.Infrequent Amyotrophic Lateral Sclerosis (sALS) is owned by frontotemporal dementia (ALS-FTD) as well as more gentle loss of intellectual (mostly executive) malfunction (ALSCi) in most individuals. Several varieties of familial Wie (FALS) possess a ancestors and family history associated with FTD, ALS-FTD, as well as the two, but there has been couple of reports regarding ALS-FTD inside FALS patients using versions with the gene superoxide dismutase-1 (SOD1 FALS). The aim of these studies would have been to examination the actual speculation that will ALSCi might be present in non-SOD1 FALS, but that SOD1 FALS patients would certainly demonstrate no evidence of cognitive modify. 75 +/- Several.45 along with Sixty seven.06 +/- 3.Your five mu M, correspondingly, regarding human being breast cancers MDA-MB231 tissues. Equally ingredients exhibited anti-cancer activity nevertheless below that relating to doxorubicin; a normal chemotherapeutic substance, your IC50 levels of which are A couple of.21 years old +/- One.72 and also One.Eighty three +/- 3.09 mu M with regard to HepG2 and MDA-MB231 tissue, correspondingly narrative medicine .The particular swollen growth microenvironment takes on an important role throughout tumorigenesis. Nonetheless, the actual elements by which resistant tissues, specially macrophages, market tumorigenesis simply have been partially elucidated, and the entire opportunity regarding signaling paths offering macrophages with protumorigenic phenotypes nevertheless continue to be generally unidentified. Take a look at report that germ-line shortage of c-Jun N-terminal phosphorylation at serines Sixty three along with Seventy-three impedes inflammation- connected hepatocarcinogenesis, nevertheless trashing c-Jun simply inside hepatocytes will not inhibit hepatocellular carcinoma (HCC) creation. Moreover, throughout man HCC-bearing livers, c-Jun phosphorylation can be found in -inflammatory cells, while it can be mainly absent via malignant hepatocytes. Strangely enough, macrophages inside livers associated with mice along with persistent hepatitis gradually swap their particular phenotype over the lifetime of illness. Macrophage phenotype as well as denseness are dictated by simply c-Jun phosphorylation, within vitro along with vivo. Cross over regarding macrophage phenotype, from antitumorigenic to be able to protumorigenic, occurs ahead of tumorigenesis, resulting in the production of different chemokines, including chemokine (C-C design) ligand 18 (CCL17) along with CCL22. These kinds of signs, originating through the liver microenvironment, one on one the hiring involving regulation T cells, that happen to be proven to assist in HCC development. Our studies recognize c-Jun phosphorylation like a crucial mediator regarding macrophage schooling and also indicate your recruitment associated with immunosuppressive regulating Big t tissues as an protumorigenic procedure.Calmodulin (Webcam) presenting for the intra cellular C-terminal butt (CTT) in the heart failure L-type Ca2+ route (Ca(versus)One.Only two) regulates Ca2+ entry by simply recognizing websites that help with negative comments systems regarding Borrelia burgdorferi infection route concluding. CaM colleagues using Ca(v)1.A couple of beneath low relaxing [Ca2+], however is poised to switch conformation and place whenever intra cellular [Ca2+] increases. Camera joining Ca2+, along with the domains associated with Digital camera joining your CTT are generally connected thermodynamic characteristics. To higher understand legislations, we all Cidofovir mw determined the energetics involving Webcam websites joining to proteins representing pre-lQsites Any(1588), and also C-1614 and the IQmotif analyzed as overlapping peptides Reasoning powers(1644) as well as IQ'(1650) along with their effect on calcium supplements presenting. (Ca2+)(Four)-CaM guaranteed to all 4 peptides really really (K-d <= Only two nM). Linkage examination demonstrated that Reasoning powers(1644-1670) destined using a K-d just like One particular evening. In the pre-IQ area, (Ca2+)(Only two)-N-domain certain preferentially to A(1588), even though (Ca2+)(Only two)-C-domain desired C-1614. When sure to C-1614, calcium binding from the N-domain influenced the actual tertiary conformation in the C-domain. Based on the thermodynamics, we propose the architectural system regarding calcium-dependent conformational change in that this linker involving CTT web sites A new along with D buckles to make the A-C hairpin that is bridged by calciumsaturated CaM. This specific evaluation highlights the particular components employed by Serratia varieties which push their own everywhere HA-1077 clinical trial dynamics, with emphasis on the most recent results Human hepatocellular carcinoma . Additionally talked about is the place released ingredients travel these kind of bacterias towards pathogenic, mutualistic, and hostile organizations.Riboswitches are generally RNA-based anatomical manage factors that function via a conformational cross over procedure whenever a specific targeted molecule binds to the holding bank account. To facilitate the impedimetric immunosensor nuclear detail meaning of new research about the role of the adenine ligand around the conformational properties and kinetics involving flip-style in the include adenine riboswitch, all of us performed molecular character simulations in the your reputation and the shortage of the actual ligand. In the absence of ligand, architectural diversions have been observed in your J23 jct along with the P1 base. Destabilization in the Private eye stem without ligand necessitates the loss in one on one backing relationships together with the ligand, with benefits through the J23 junction place. The actual J23 jct from the riboswitch is located to be much more flexible, along with the tertiary contacts among the 4 way stop parts are transformed even without your adenine ligand; benefits claim that the actual adenine ligand affiliates and dissociates in the riboswitch nearby J23. Excellent contract was received with the new data together with the final results indicating dynamic behavior with the adenine ligand about the nanosecond period level to be linked to the dynamic actions of hydrogen binding with all the riboswitch. Benefits also predict in which direct friendships of the adenine ligand along with U74 of the riboswitch aren't important for dependable joining though it is essential for the reputation. The opportunity of methodological artifacts and also force-field errors affecting the present findings has been looked at by simply further molecular character models in the presence of Only two,6-diaminopurine as well as in your gem setting. (Chemical) This year Elsevier Limited. All legal rights earmarked.Objective/methods. A new cross-sectional assessment to spell out availability, protection, along with child marking status involving lipid-lowering drug treatments available from One particular personal along with 1 community insurance plan formularies. Benefits. Equally plans acquired equal treatment accessibility to bile acidity sequestrants (7), statins (12), along with cholesterol-absorption blockers (CAB; A single). The private prepare acquired Three bile acidity sequestrants about three statins listed since preferred drugs; the actual Taxi wasn't chosen. As opposed, the general public program had Your five bile acidity sequestrants, Several statins, as well as the Pickup truck's cab since preferred drug treatments. For medications with child labels, in which you prepare included 50% because desired medicines while the general public strategy protected 70% while desired medicines. Findings. When new advice with the American Academy of Pediatric medicine to treat dyslipidemia in kids were carried out nowadays, kids with people prepare would've equal alternative however much better protection involving lipid-lowering medicines since favored drugs, including individuals with FDA acceptance, compared with children with in which you plan. gary., latest intensity, heart beat duration, frequency, and government period, about the reflective changes ended up researched. The final results demonstrated that after TES, your indicative adjustments made an appearance for the retinal yachts and also optic dvd. The actual level of reflectance adjustments improved since the present power, heartbeat period, and stimulation duration greater (P<0.05 for all). The utmost level of your echoing change ended up being received in the event the stimulation rate of recurrence had been Twenty Hertz. Some time lifetime of your reflectance alterations was also modified from the excitement parameters. The reply commenced before and went back for the standard after together with greater existing extremes, more time pulse times, nevertheless the period of the height from the reaction has not been modified. These types of benefits showed that the particular indicative alterations had been as a result of account activation associated with retinal neurons by simply TES and might entail selleck chemicals llc your vascular adjustments activated by simply a great initial in the retinal nerves.Three CBF/DREB1 (C-repeat holding factor/dehydration receptive element-binding aspect One) homologues ended up isolated coming from mangrove Avicennia harbour and designated AmCBF1, 2 about three. Numerous series investigation entertainment media established that these deduced meats almost all consist of the AP2 DNA-binding site and a couple CBF personal series. In accordance with the phylogenetic examination, these kind of protein fit in with the A-1 subgroup of the DREB subfamily. Appearance looks at according to quantitative real-time PCR said your AmCBF2 shown reasonably substantial term beneath regular conditions, with the highest stage in originates, even though equally AmCBF1 about three have been weakly expressed without having stress. The three genetics also demonstrated different responses to varied environmental stimuli. The AmCBF2 has been inducible through chilly, shortage, high salinity, heavy metals, and also abscisic acidity (ABA), and also exhibited much more resilient induction simply by cold, shortage, Pb2+ or Zn2+ compared to NaCl, ABA or perhaps Cd2+. In comparison, the two AmCBF1 and also regular medication AmCBF3 exhibited minor adjustments underneath these kinds of stimuli. These kind of benefits reveal that the a few AmCBF genetics participate in different tasks in A. marina along with the AmCBF2 could be active in the signaling pathway of cool, drought as well as metal anxiety reply. (D) The year 2013 Elsevier B./. Almost all rights set aside.Goal: These studies ended up being executed to analyze the actual epidemic associated with diarrheagenic Escherichia coli (December) within dysentery situations together with specific mention of Shiga-like killer generating Escherichia coli (STEC). Strategies : Throughout a two-year period of time, 1066 stool biological materials were collected from put in the hospital sufferers using looseness of along with dysentery. Soon after getting thorough specialized medical background observing the actual yucky and also minute findings in the a stool trials, these folks were classy on MacConkey as well as Sorbitol MacConkey agars and Elizabeth.coli isolates were identified by common biochemical checks. Several main designs had been determined: nursing staff smoking, cig advertisements, supporting individuals light up, "naughty" nurse, teaching girls for you to light up, smoking cigarettes in and outdoors regarding health care services, and also antitobacco pictures. The application of medical pictures to promote cigarettes has been recognized though the level in the utilization of these photographs will not be documented previously. Digital records can be used to investigate earlier times, supply a viewpoint for learning the present, and also recommend instructions money for hard times throughout dealing with bad pictures of nursing jobs. Report this article: Sama, M., & Bialous, Azines. A. (The coming year, Oct). Overview of images of medical oncology nurses as well as smoking cigarettes about the Web. Nursing Outlook,Sixty(5S),S36-S46.http://dx.doi.org.huaryu.kl.san mateo.edu/10.1016/j.prospect.This year.August.Mission impossible.Intent behind review To sum it up conclusions, talk about difficulties along with establish fresh queries from your earlier phase III studies throughout anaplastic gliomas. Recent findings The existing regular involving maintain first-line remedy throughout anaplastic gliomas is actually radiotherapy as well as chemo. The following actions are going to outline the role and also ideal sequencing involving put together technique remedy emphasizing radiotherapy along with temozolomide and develop trials with novel focused therapies. The characteristic of necrosis in oligodendroglial tumors has to be more examined, along with molecular prognosticators will take much more area. Such as O(Some)-methylguanylmethyltransferase promoter methylation, isocitrate dehydrogenase versions as well as epidermal development factor receptor sound. Further, the thought that all anaplastic oligodendroglial tumors without or with a relevant Autoimmune Addison's disease astrocytic aspect fall under the identical prognostic classification and the apparent issues to be able to variety and rank anaplastic gliomas cause a huge burden on community diagnosis. The present and also upcoming trial offers like the Eu Business pertaining to Analysis and Treatment of Cancer 26053/22054 trial are designed for resolving a few of these issues with a basic central pathology evaluate. Anaplastic gliomas are generally a significant number of mind tumors to formulate long term molecularly focused therapies and may for that reason have the target of educational SBC115076 as well as industrial drug advancement, which in turn is aimed at effectiveness along with steering clear of long-term unwanted effects.In this paper, many of us researched the recombination dynamics involving photogenerated fee carriers in the poly(3-hexylthiophene) (P3HT):[6,6]-phenyl-C-61-butyric chemical p methyl ester (PC61BM) blend program with donor-acceptor rate of a single:1 both before and after solvent annealing therapy. The process associated with transient photocurrent and also photovoltage sizes were utilized, and fee carriers were photogenerated with a 7 ns laser pulse from room temperature (298 Okay). In business photocurrent measurement, we all observed several variations the actual vividness extracted charge throughout P3HT:PCBM cells with various electrical power efficiencies.
I love microlearning Platforms in today's fast-paced world. Short, focused teachings that engage me are key. Microlearning platforms are great at providing entertaining, easy-to-understand bite-sized learning experiences. Let's examine top microlearning platforms. They're known for making information easy to understand and remember. These tools stimulate me and improve my memory with interactive quizzes, amusing movies, and personalised learning routes. Microlearning platforms make it easy and quick for me to learn new things and get better at things, whether I'm a busy worker, someone who wants to keep learning, or someone who wants to get better at a certain skill. Comparison Table I've created a comparison chart to help you choose a microlearning platform. It covers the top microlearning platforms' features, benefits, costs, and user ratings. This table can help you choose the right platform for industry-specific courses, creative learning, or skill development flexibility. Feature \| Coursera \| Skillshare \| Pluralsight \| Degreed \| Udemy \| Courses Variety \| Wide range of courses from universities \| Diverse courses from industry experts \| Focus on IT, software, and tech skills \| Curated content from various sources \| Broad range of topics from instructors \| Subscription \| Subscription-based \| Subscription-based \| Subscription-based \| Subscription-based \| Course-based purchases \| Pricing \| Monthly or annual plans \| Monthly or annual plans \| Monthly or annual plans \| Monthly or annual plans \| Course-based pricing \| Learning Format \| Structured courses with deadlines \| On-demand videos and projects \| Video-based learning paths \| Self-directed learning with resources \| Self-paced video lectures \| Certification \| Certificates upon course completion \| No certificates \| Skill assessments and certifications \| No certificates \| Certificates upon course completion \| Community \| Engaged learner community \| Active community of creators \| Community forums and networking \| Collaboration tools for teams \| Discussion forums and Q&A \| Best Microlearning Platforms In today's busy world, I think it's important to keep learning and improving your skills for both personal and business growth. Microlearning systems let me learn in small chunks that are easy to use, interesting, and perfect for my requirements. Features \| Description \| Course Variety \| Diverse range of courses in various subjects, including technology, business, arts, and more. \| Learning Paths \| Structured learning paths and specializations for in-depth knowledge in specific areas. \| Certificates \| Certificates of completion for courses, specializations, and professional certificates. \| Collaboration Tools \| Discussion forums, peer review assignments, and group projects for collaborative learning. \| Mobile App \| Access to courses and materials on the go through the Coursera mobile app. \| Instructor Quality \| Experienced instructors from renowned universities and institutions. \| When I want to learn online, I love Coursera because it has so many classes from well-known schools and colleges around the world. I really like that they let you learn in a lot of different ways, like through specialisations, short classes, and team projects. The short ways to learn help me quickly get better at things I like or learn more about things I already know. With Coursera, it's easy to learn new skills, get better at your job, or follow your own interests. Of course, a lot of other people feel the same way! It's my best way to keep learning throughout my life. - Offers diverse courses. - Self-paced, flexible learning. - Certificate and degree courses can be costly. Features \| Description \| Creative Courses \| Wide range of creative courses such as design, photography, writing, and illustration. \| Project-Based Learning \| Hands-on projects and assignments to apply skills learned in courses. \| Community Interaction \| Engagement with a creative community, feedback on projects, and collaboration opportunities. \| Skill Levels \| Courses suitable for beginners to advanced learners in creative fields. \| Mobile App \| Access to courses, projects, and community features via the Skillshare mobile app. \| Instructor Quality \| Expert instructors who are professionals in their respective fields. \| If I want to learn something creative like art, design, photography, or something else, Skillshare is my first choice. I like that Skillshare has short lessons taught by experts. It makes learning more fun and real. On Skillshare, I can really get into some things, learn new skills, and then use them right away in my art work. The classroom is a fun place to learn because it focuses on real-world skills and is led by experts. It keeps me going and has helped me get better at a lot of creative things. - Focuses on creative and practical skills. - Affordable subscription model. - Quality of courses can vary. Features \| Description \| Tech Skills Training \| Extensive library of courses covering technology skills like coding, IT, data science, and more. \| Learning Paths \| Curated paths for skill development in specific tech areas and certification preparation. \| Hands-On Labs \| Practical labs and projects for hands-on experience and skill application. \| Skill Assessments \| Assessments to measure and track skill proficiency and progress. \| Mobile App \| Access to courses, assessments, and learning paths through the Pluralsight mobile app. \| Expert Instructors \| Industry experts and professionals as course instructors. \| Pricing Options \| Free trials, individual subscriptions, and team plans for businesses and enterprises. \| I believe that Pluralsight is one of the best choices for developers and IT professionals. They offer a wide range of short learning materials that help me keep up with the latest technological developments. The skill pathways, interactive lessons, and tests on Pluralsight help me get better at what I do, whether I'm trying to learn something new or get better at something I already know. It helps me stay ahead of the field in IT and software development, where things change so quickly. - Offers skill assessments - High-quality content from industry experts. - Pricing can be high for individual learners. Features \| Description \| Content Aggregation \| Aggregates learning content from various sources including courses, articles, videos, and more. \| Skill Tracking \| Tracks and measures skills acquired through learning activities. \| Learning Pathways \| Personalized learning pathways based on skills, interests, and career goals. \| Certifications \| Recognition for completing courses, assessments, and skill development activities. \| Learning Analytics \| Insights into learning progress, skill gaps, and areas of improvement. \| Mobile App \| Access to learning content, skill tracking, and personalized recommendations via mobile app. \| Collaboration Tools \| Tools for collaboration, sharing knowledge, and learning together with peers and mentors. \| A degree gives a holistic perspective on education. The content that we bring together comes from a wide variety of sources, including online courses, articles, videos, and books. It is our goal to assist you in continuing your education and enhancing your abilities by providing you with personalised recommendations and microlearning routes. Our goal is to establish a culture that values continuous educational and professional development. - Curates personalized learning paths - Integrates content - Interface may be complex for some users. Features \| Description \| Course Diversity \| Extensive range of courses covering diverse topics, from tech and business to personal development. \| Instructor Quality \| Courses led by expert instructors, professionals, and industry leaders. \| On-Demand Learning \| Self-paced learning with lifetime access to course materials. \| Projects and Exercises \| Hands-on projects, exercises, and quizzes for practical skill development. \| Certificates \| Certificates of completion for finished courses. \| Mobile App \| Access to courses, learning resources, and progress tracking via the Udemy mobile app. \| Pricing Options \| Free courses, individual course purchases, and subscription-based access to all courses. \| There are many great online classes on Udemy that you can go at your own pace. This makes it a great spot to learn. I like how Udemy divides lessons into short videos, quizzes, and tools that you can download. Even though I have a lot going on, this will teach me a lot. You can find great short clips on Udemy that explain things without going into all the specifics. This helps me understand things better by breaking them down. The quizzes are also fun because they test what I know and help me see what I need to work on. - Wide range of courses on diverse topics. - Affordable pricing, especially during sales. - Quality of courses can vary significantly. Key Features to Look for in Microlearning Platforms - Make sure the platform has a range of material types, such as movies, articles, quizzes, and projects, so that students can learn in the way that works best for them. - Look for quizzes, simulations, and hands-on tasks that let people connect with each other to keep them interested and help them remember what they've learned. - Personalisation, Look for platforms that can give you advice and teach you in a way that fits your needs and level of growth. - Accessibility, Make sure the mobile app works well and that you can learn without an internet connection, so you can use it from anywhere at any time. Questions and Answers What role does microlearning play in employee training and development? Microlearning is an important part of teaching employees because it lets them learn in a targeted way, quickly pick up new information, and remember it better, which leads to better performance and productivity. How can microlearning tools help freelancers and people who learn on their own? Microlearning platforms are great for freelancers and independent learners who want to stay competitive, learn new skills, and explore a wide range of hobbies because they are flexible, affordable, and cover a lot of ground. What are the best ways to make material for microlearning? Microlearning material that works is short, interesting, interactive, and geared towards the needs of the learners. It should have a single learning goal for each lesson, use multimedia, and encourage students to be involved.
Homeostatic plasticity fails at the intersection of autism-gene mutations and a novel class of common genetic modifiers We identify a set of common phenotypic modifiers that interact with five independent autism gene orthologs (RIMS1, CHD8, CHD2, WDFY3, ASH1L) causing a common failure of presynaptic homeostatic plasticity (PHP) in Drosophila. Heterozygous null mutations in each autism gene are demonstrated to have normal baseline neurotransmission and PHP. However, PHP is sensitized and rendered prone to failure. A subsequent electrophysiology-based genetic screen identifies the first known heterozygous mutations that commonly genetically interact with multiple ASD gene orthologs, causing PHP to fail. Two phenotypic modifiers identified in the screen, PDPK1 and PPP2R5D, are characterized. Finally, transcriptomic, ultrastructural and electrophysiological analyses define one mechanism by which PHP fails; an unexpected, maladaptive up-regulation of CREG, a conserved, neuronally expressed, stress response gene and a novel repressor of PHP. Thus, we define a novel genetic landscape by which diverse, unrelated autism risk genes may converge to commonly affect the robustness of synaptic transmission. Autism Spectrum Disorder (ASD) is a polygenic disorder with a complex underlying genetic etiology (Bourgeron, 2015). Advances in whole genome sequencing and genome-wide association studies have dramatically expanded our understanding of the genetic architecture of ASD. In particular, the identification of rare de novo mutations that confer high risk for ASD has generated new molecular insight (De Rubeis et al., 2014; Iossifov et al., 2014; Sanders et al., 2015). Yet, even in cases where a rare de novo mutation confers risk for ASD, additional processes are likely to contribute to the ASD phenotype (Leppa et al., 2016; Peter et al., 2019) including the engagement of adaptive physiological mechanisms (Gaugler et al., 2014; Gibson, 2009; Hartman et al., 2001; Hou et al., 2019; Kitano, 2007; Plomp et al., 1992; Sackton and Hartl, 2016; Sardi and Gasch, 2018; Bourgeron, 2015). Homeostatic plasticity, in particular, has garnered considerable attention as an adaptive physiological process that might be relevant to the phenotypic penetrance of ASD mutations (Antoine et al., 2019; Bourgeron, 2015; Mullins et al., 2016; Nelson and Valakh, 2015; Ramocki and Zoghbi, 2008). Yet, very little is known at a mechanistic level regarding the interface of homeostatic plasticity and ASD genetics. There remains ongoing debate regarding whether homeostatic plasticity is normally induced or whether it is impaired in the context of rare de novo mutations that confer risk for ASD (Antoine et al., 2019; Bourgeron, 2015; Ramocki and Zoghbi, 2008). And, there is no mechanistic information regarding how rare de novo mutations that confer risk for ASD might be connected to the signaling mechanisms that are essential for the induction and expression of homeostatic plasticity. It is well established that homeostatic signaling systems function throughout the central and peripheral nervous systems to stabilize neural function following a perturbation that can be of genetic, immunological, pharmacological or environmental origin (Davis, 2006; Marder, 2011; Turrigiano, 2011). Evidence for this has accumulated by measuring how nerve and muscle respond to the persistent disruption of synaptic transmission, ion channel function or neuronal firing. In systems ranging from Drosophila to human, cells have been shown to restore baseline function in the continued presence of these perturbations by rebalancing ion channel expression, modifying neurotransmitter receptor trafficking and modulating neurotransmitter release (Davis, 2013; Hengen et al., 2013; Maffei and Fontanini, 2009; Watt and Desai, 2010). There is evidence that homeostatic signaling systems function at the level of individual cells and synapses (Davis, 2013). There is also evidence that homeostatic signaling systems influence the function of neural circuitry (Deeg and Aizenman, 2011; Hengen et al., 2013; Maffei and Fontanini, 2009; Nelson and Valakh, 2015). We set out to determine whether there exists a molecular interface between mutations in ASD gene orthologs in Drosophila and the induction or expression of presynaptic homeostatic plasticity. Presynaptic homeostatic plasticity (PHP) is an evolutionarily conserved form of homeostatic plasticity, observed in Drosophila, mice and humans (Davis, 2013). PHP has been documented at both central and peripheral synapses in response to differences in target innervation (Liu and Tsien, 1995) altered postsynaptic excitability (Davis, 2006; Marder and Goaillard, 2006; Mullins et al., 2016), following chronic inhibition of neural activity (Kim and Ryan, 2010; Zhao et al., 2011) and following disruption of postsynaptic neurotransmitter receptor function (Henry et al., 2012; Jakawich et al., 2010). The mechanisms of PHP have a remarkable ability to modulate and stabilize synaptic transmission, with an effect size that can exceed 200% (Müller and Davis, 2012; Ortega et al., 2018). Many of the rare de novo mutations that confer high risk for ASD are considered to be heterozygous loss of function (LOF) mutations (Bourgeron, 2015; De Rubeis et al., 2014; Iossifov et al., 2014; Sanders et al., 2015). Therefore, we examine the phenotype of heterozygous LOF mutations in five different ASD gene orthologs. We make several fundamental advances. First, we demonstrate that these individual heterozygous LOF mutations have no overt effect on baseline transmission or PHP. However, we demonstrate that PHP is sensitized to failure. Next, we sought to define the molecular mechanisms that connect ASD gene orthologs to the mechanisms of PHP. A genome-scale screen and subsequent systems-genetic analyses yielded unexpected insight. We do not simply identify genes that, when mutated, enhance the phenotype of individual ASD gene mutations. We discovered genes that, when their function is diminished by heterozygous LOF mutations, commonly modify multiple ASD gene orthologs, causing a selective failure of homeostatic plasticity. Thus, we define the first class of common phenotypic modifiers of ASD genes in any system. Finally, we do not stop with the identification of a novel class of ASD gene modifiers. We proceed to characterize how homeostatic plasticity fails in one such condition. The mechanism we discovered is also unexpected and illuminates the complexity by which double heterozygous gene-gene interactions can generate a cellular or organismal phenotype. We demonstrate maladaptive, enhanced expression of a gene known as Cellular Repressor of E1A Stimulated Genes (CREG), a gene that is conserved from Drosophila to human and expressed in the brain (Yang et al., 2011). Taken together, we define a novel, unexpected genetic architecture that connects heterozygous LOF mutations in ASD-associated gene orthologs with the mechanisms of homeostatic plasticity. In particular, the observation that PHP is commonly sensitized by multiple, different ASD genes, and the fact that we identify and characterize common phenotypic modifiers of five different ASD genes, defines a novel means by which a diversity of ASD-associated risk genes may converge to affect synaptic transmission. We propose that this information may be relevant to new therapeutic approaches that might someday modify ASD phenotypic severity, regardless of the underlying genetic mutation(s) that confer risk for ASD. We began an investigation of ASD gene orthologs in Drosophila by acquiring heterozygous null mutations in five genes; RIMS1, CHD8, CHD2, WDFY3 and ASH1L (Figure 1A; Note: throughout we use the human nomenclature). Heterozygous null mutations were analyzed, as opposed to use of RNAi-mediated gene knockdown, in order to more precisely reflect the proposed genetic perturbations in human. All five of these genes are considered high confidence 'category 1' ASD-associated genes based on SFARI Gene (Simons Simplex Collection, 2020). All five of these genes have clear Drosophila orthologs. Further, we demonstrate that all five genes are expressed in Drosophila third instar motoneurons based on a Patch-Seq analysis of gene expression (Figure 1—figure supplement 1). The five ASD gene orthologs were also chosen to reflect a broad range of biological activities that are associated with the numerous ASD-associated genes identified to date. The RIMS1 gene is a synaptic scaffolding protein that localizes to and organizes sites of neurotransmitter release, termed active zones. The CHD8 and CHD2 genes encode chromatin remodeling factors that localize to the cell nucleus. WDFY3 encodes a phosphatidylinositol 3-phosphate-binding protein and regulator of autophagy and intracellular signaling. ASH1L encodes a member of the trithorax group of transcriptional activators and is found in the cell nucleus. A supplemental table (Supplementary file 1, Supplemental Table S1) includes known disease associations for each of these five human genes, and links to web-based genetic and genomic resources. A survey of biochemical and genetic interaction networks in Drosophila demonstrates no known interactions among these five genes (Flybase). In humans, there appear to be no known direct biochemical interactions among these genes. Yet, heterozygous LOF mutations in each of these genes are associated with risk for ASD in humans. Heterozygous ASD gene mutations have normal synaptic transmission and PHP We analyzed baseline neurotransmission and presynaptic homeostatic plasticity (PHP) at the Drosophila neuromuscular junction (NMJ) as a model glutamatergic synapse. At the Drosophila NMJ, PHP is induced by application of sub-blocking concentrations of the postsynaptic glutamate receptor antagonist philanthotoxin-433 (PhTx; 5–10 µM), diminishing the average postsynaptic depolarization caused by the release of single synaptic vesicles (miniature excitatory postsynaptic potential; mEPSP). Decreased mEPSP amplitude initiates a potentiation of presynaptic neurotransmitter release that precisely offsets the magnitude of the PhTx perturbation and, thereby, maintains evoked excitatory postsynaptic potential amplitude (EPSP) at baseline levels prior to the application of PhTx (Figure 1B–E; Davis, 2013; Frank et al., 2009). First, we characterized baseline synaptic transmission and the rapid induction of PHP in heterozygous null mutations of all five ASD-associated genes, defined above. We find no significant change in baseline neurotransmission, including average mEPSP amplitude, average EPSP amplitude and quantal content (Figure 1B–E). Following application of PhTx, we find that heterozygous null mutations in all five ASD gene orthologs do not alter the expression of PHP (Figure 1B–E). Specifically, PhTx significantly diminished the average mEPSP amplitude in each heterozygous mutant and induced a statistically significant increase in quantal content that restored EPSP amplitudes toward wild type values. We conclude that all five heterozygous mutations express normal PHP. Genetic interaction of RIMS1 with either CHD8, ASH1L or CHD2 impairs PHP Tests of genetic interaction are commonly used to determine if two genes have a function that converges on a specific biological process. While genetic interactions cannot be interpreted to reflect participation in a linear signaling pathway, such an analysis can define signaling relationships among genes that are independent of whether the encoded proteins interact biochemically. Thus, genetic interactions have been a powerful means to explore new signaling systems in model organisms, an approach that is being increasingly utilized in cancer biology (Ashworth et al., 2011; Mair et al., 2019; Chan and Giaccia, 2011; O'Neil et al., 2017; Baetz et al., 2004; Bharucha et al., 2011) One approach, formally termed 'second site non-complementation (SSNC)' or 'non-allelic non-complementation', is particularly powerful when a gene of interest is essential for cell or organismal viability, such as CHD8 and CHD2. In brief, if two heterozygous null mutations, each having no observable phenotype when tested alone, create a phenotype when combined in a single organism, then the genes are said to genetically interact according to SSNC. We apply this approach here. The Drosophila RIMS1 ortholog was previously demonstrated to be a central component of the presynaptic machinery necessary for PHP (Müller et al., 2012). Genetic interactions with heterozygous null mutations in Drosophila RIMS1 have been used to link genes to the mechanism of PHP (Harris et al., 2018; Hauswirth et al., 2018; Ortega et al., 2018). First, we confirm that PHP is robustly expressed in the RIMS1/+ heterozygous null mutant (Figure 1E–G). The average magnitude of homeostatic compensation is indistinguishable from wild type (p>0.1). When we plot the relationship between mEPSP amplitude and quantal content for every individual recording, there is a strong negative correlation observed in both wild type (R2 = 0.66) and RIMS1/+ (R2 = 0.64) (Figure 1F and G, respectively). Next, we analyzed the heterozygous CHD8/+ mutant, which also shows robust PHP (Figure 1C–E) and a strong negative correlation between mEPSP amplitude and quantal content (R2 = 0.75; Figure 1H, gray points and black line). However, animals harboring heterozygous mutations in both RIMS1 and CHD8 (CHD8/+; RIMS1/+) show a complete failure of PHP (Figure 1H). The correlation of mEPSP amplitude and quantal content is abolished (Figure 1H, red points and red line; R2 = 0.01). The percent homeostasis in the double heterozygote is decreased to less than 10%, not statistically different from baseline (Figure 1H, box; p=0.6), and highly statistically different from both CHD8/+ and RIMS1/+ alone (p<0.01). We conclude that CHD8 can be linked, directly or indirectly, to the mechanisms of PHP. We propose that the heterozygous LOF mutation in CHD8 weakens the robustness of PHP, thereby associating an ASD-associated chromatin remodeling factor with homeostatic mechanisms that ensure robust synaptic transmission. Next, to test the generality of this effect, we created double heterozygous mutant combinations of RIMS1/+ with the remaining ASD orthologs that we examine in this study (ASH1L, CHD2 and WDFY3) (Figure 1—figure supplement 2). The ASH1L/+, RIMS1/+ double heterozygous animal shows a complete failure of PHP (Figure 1—figure supplement 2). The percent PHP expression is decreased from 152% in the ASH1L/+ mutant, to 114% in the double heterozygote, which is not different from baseline (p=0.2) and represents a highly significant suppression (p<0.01) compared to the ASH1L/+ mutant alone (p<0.01) (Figure 1—figure supplement 2B). A similar analysis of the CHD2/+; RIMS1/+ double heterozygous animal shows a significant suppression of PHP (p=0.01), although significant PHP remains expressed in the double heterozygous animals (Figure 1—figure supplement 2C). Finally, the WDFY3/+; RIMS1/+ double heterozygous animal shows robust PHP (Figure 1—figure supplement 2D) that is indistinguishable from either the WDFY3/+ or the RIMS1/+ single heterozygotes. Taken together, these results suggest that there may be an unexpected connection between three unrelated ASD gene orthologs (CHD8 and CHD2 and ASH1L) and the mechanisms of PHP, given that all three genes interact with RIMS1. Based on these data, we pursued a genome-scale forward genetic screen to interrogate and better define the molecular interface of these ASD gene orthologs and the rapid induction of PHP. Forward genetic screen for altered baseline transmission and PHP The screen that we performed is diagrammed in Figure 2A. We took advantage of a collection of small chromosomal deficiencies (5–50 genes per deficiency, each with known chromosomal breakpoints) that tile the 3rd chromosome, uncovering approximately 6000 genes in total. For every double heterozygous combination of RIMS1/+ with a heterozygous deficiency, we performed multiple (n = 3–15) intracellular recordings, quantifying mEPSP amplitude, EPSP amplitude, quantal content (EPSP/mEPSP), resting membrane potential and input resistance. Recordings were made in the presence of PhTx to induce PHP. If the baseline EPSP is normal and quantal content is increased compared to wild type, then we can conclude that PHP is normally expressed. In these instances, we expect that baseline transmission was also normal in the absence of PhTx. However, if EPSPs are diminished in a given genetic combination (RIMS1/+, Df/+) and quantal content is not increased compared to wild type, then there are two possible origins: 1) the double mutant impairs baseline transmission or 2) baseline transmission is normal and PHP is selectively impaired. In these instances, the double heterozygous mutant combinations were re-assessed in the absence of PhTx to test for altered baseline transmission. Double heterozygous combinations that strongly affected muscle resting potential or input resistance were not observed. We uncovered two instances where a mutant combination (RIMS1/+, Df/+) caused a specific deficit in baseline transmission, without altering PHP. We did not isolate any double heterozygous conditions with dramatic defects in mEPSP amplitude. The majority of double mutant combinations specifically affected the expression of PHP. This was unexpected. Double mutant combinations were determined to disrupt PHP by satisfying one of two criteria. First, the average quantal content (+PhTx) had to be more than one standard deviation below the population mean of all genotypes (Figure 2B, solid horizontal black line). Second, average quantal content had to reside outside a boundary that encompasses 95% of all individual recordings made in the RIMS1/+ mutant alone (Figure 2B, black dashed lines). Two example 'hits' are shown in red (Figure 2B; dark red point shows data in the absence of PhTx and light red point shows data recorded in the presence of PhTx, and the red lines simply connect the points for a given genotype for the purposes of data display). We also present a complete data set for a single hit from the screen as a standard format bar graph with representative traces (Figure 2D,E). Note that the heterozygous deficiency has normal baseline transmission and PHP (p>0.1 One-way ANOVA with post-hoc Tukey multiple comparison), but when combined with a heterozygous mutation in RIMS1, PHP completely and selectively fails. In total, our screen identified, and we subsequently confirmed, 20 small deficiencies that cause PHP to fail when combined with RIMS1/+. To achieve a final list of 20 hits, each potential hit was re-validated in a second set of experiments, increasing sample sizes (generally 7–16 NMJ). During the process of re-validation, we rule out approximately one third of the potential hits selected from the screen. The identified deficiencies are randomly distributed across the 3rd chromosome (Figure 2C). The screen was empirically validated by the identification, blind to genotype, of deficiencies that uncovered the RIMS1 locus, as well as the Pi3K68D locus (not included in hit list), previously shown to interact as a double heterozygous mutant with RIMS1/+ (Hauswirth et al., 2018). Furthermore, the rim binding protein (RBP) locus was not identified as disrupting PHP, consistent with the previously published observation that a rbp/+ mutant does not interact with RIMS1/+ for PHP (Müller et al., 2015). However, rbp/+ did interact with RIMS1/+ for baseline neurotransmitter release as expected based on previously published data (not shown) (Müller et al., 2015). No other genes previously implicated in the mechanisms of PHP were present in the deficiencies isolated in our screen. It is important to note that, according to a formal genetic analysis, no strong conclusion can be made regarding the negative result of a double heterozygous genetic interaction (see Supplemental Tables S2-S5 for further detailed information on the screen results). Finally, we assessed whether there was any relationship between the number of genes that were deleted within a given deficiency and the robustness of PHP. One hypothesis is that the additive effects of multiple, heterozygous gene mutations would increase for larger deficiencies and PHP would be increasingly compromised. That was not the case (Figure 3). There was no correlation between the number of genes uncovered by a given deficiency and EPSP amplitude recorded in the presence of PhTx (R2 = 0.003; Figure 3A). Thus, impaired PHP cannot be accounted for by a simple additive accumulation of genetic mutations within a given deficiency. Identification of common phenotypic enhancers of multiple unrelated ASD genes The results of our forward genetic screen, encompassing approximately one third of the Drosophila genome, might identify genetic interactions specific to RIMS1. However, we reasoned that because RIMS1 also showed a strong genetic interaction with CHD8, as well as CHD2 and ASH1L (Figure 1; Figure 1—figure supplement 2), a portion of the hits from our screen might also interact with these genes. When initial experiments confirmed that this was the case, we expanded our analysis to encompass all five of the ASD-associated gene orthologs from Figure 1. Thus, we performed a systems-genetic test of all possible double heterozygous genetic interactions, using wild type and the five ASD gene orthologs introduced in Figure 1 combined with wild type and five hits (deficiencies) randomly selected from our forward genetic screen. In total, we tested 36 genetic combinations for baseline transmission and PHP, recording every genotype in the presence and absence of PhTx (Figure 4). To facilitate visual interpretation, genetic interaction data are presented as a heat map superimposed on a matrix representing all genetic combinations, in the presence or absence of PhTx (Figure 4A). All but one genotype responded to the application of PhTx with decreased mEPSP amplitudes (Figure 4A, mEPSP; compare top left matrix with top right matrix, the transition from blue to red indicates diminished average mEPSP for each genetic combination). Thus, we induced homeostatic pressure in 35 out of 36 genetic combinations (CHD8/+ with Df(3)7562/+ being the exception). Next, we demonstrate that all heterozygous deficiencies (x-axis) or heterozygous ASD-associated gene mutations (y-axis), when crossed to the wild type strain (w1118) showed normal EPSP amplitudes in the absence and presence of PhTx, demonstrating robust induction of PHP (Figure 4A, EPSP, bottom right matrix). Next, nearly all (23 out of 25) of the double heterozygous combinations show normal EPSP amplitudes in the absence of PhTx, demonstrating normal baseline neurotransmission (Figure 4A, bottom left matrix). However, a majority (16 of 25) of the double heterozygous genetic combinations showed a failure of PHP in the presence of PhTx (Figure 4A, red and light-red boxes, bottom right matrix). In Figure 4B, we also plot the induction of PHP for each double heterozygous combination by calculating the percent change in quantal content following PhTx application (Figure 4B, top matrix). Here, if quantal content does not change (<15% change; gray), then PHP is impaired or blocked. Moderate increases in quantal content (15–30% change; light orange) suggest suppression of PHP, in some instances being statistically significant suppression (see below). We performed statistical analyses for each double mutant combination, asking whether there was a statistically significant increase in quantal content for a given double mutant in the presence of PhTx compared to that same double mutant combination in the absence of PhTx (Figure 4B, bottom matrix.) Note that we are testing whether PHP is induced in a given double heterozygous mutant combination (an individual square in the matrix), comparing quantal content in the absence and presence of PhTx. We do not compare PHP expression among different double heterozygous mutant combinations. The colors gray and 'light pink' each reflect a complete block of PHP, an effect that is observed in the majority of double mutant combinations. As a complementary statistical analysis, we tested the differences between individual genotypic conditions (quantal content in each box) versus the wild type quantal content (One-way ANOVA with Dunnett's multiple comparisons) (Figure 4—figure supplement 1). In this case, if PHP is blocked, then there will be a statistically significant difference compared to wild type. Again, 18 of 25 comparisons are significantly different. The genotypic comparison against wild type verified the analysis based on individual genotypic comparisons (Figure 4B). It should be noted that, in a few instances, minor differences were observed caused by a change in quantal content that was significant (-/+PhTx), but which remained smaller compared to wild type and therefore became significant. Thus, comparisons within genotypes (-/+PhTx) seem to assess the presence or absence of PHP most accurately (Figure 4B). Our data demonstrate that four out of five deficiencies, isolated in our forward genetic screen as interacting with RIMS1, also cause PHP to fail when combined with any one of four different heterozygous ASD-associated gene mutations (Figure 4B, bottom). The pattern of PHP blockade is not uniform. WDFY3, CHD8 and CHD2 show a common pattern of interactions with the same three deficiencies. However, ASH1L interacts with only two out of the five tested deficiencies. To our knowledge, this is the first demonstration, in any system, of common phenotypic enhancement for multiple, independent and unrelated ASD gene orthologs. In Figure 4C–F, we elaborate on three of the genetic interactions with data presentations that are more detailed. We show evidence of normal PHP in CHD8/+ (Figure 4C, replicated from Figure 1). In the adjacent graph (Figure 4C, right), we show evidence of a strong disruption of PHP in the double heterozygous combination of CHD8/+ with a heterozygous deficiency (Df(3)24410/+) isolated in genetic screen. A similar analysis is presented for the ASH1L/+ heterozygous gene mutation and the interaction with a different heterozygous deficiency (Figure 4D). Finally, a third genetic interaction is presented in a format that is standard for the field of homeostatic plasticity (Figure 4E,F), inclusive of representative traces (Figure 4E) and bar graphs with associated statistical analyses (Figure 4F). Note that values for all recordings are presented (Supplementary file 1 Supplemental Table S6). Several additional controls were performed to validate and extend the findings reported for our genetic interaction data set. First, we note that all double heterozygous mutant combinations are adult viable. Thus, it was possible to inspect adult animals for phenotypes that might indicate altered signaling. Inspection of the compound eye and wings (bristles, wing veins and size) demonstrate wild type tissue morphogenesis (data not shown). PDPK1 and PPP2R5D are common phenotypic enhancers of multiple ASD gene orthologs We isolated the causal single gene mutations within two of the deficiencies isolated from our screen. To do so, we tested smaller sub-deficiencies that mapped within the originally isolated deficiencies. Sub-deficiency mapping either identified the causal gene, or a limited number of candidates. We subsequently tested individual gene candidates with established single gene mutations or RNAi. The process of mapping to single genes, therefore, included several rounds of independent phenotype verification. The first two instances in which we have isolated single causal genes are presented. Each candidate gene was tested individually against all five ASD gene orthologs, using previously published mutations (Figure 5). For both genes, we confirmed the same set of genetic interactions that occurred when analyzing the deficiency that included the identified gene (Figure 5). The first gene that we identified encodes a serine threonine kinase encoded by the PDPK1 gene (PDK1 in Drosophila). PDPK1 is a master controller of cellular metabolism, as well as cellular and synaptic growth at the Drosophila NMJ (Cheng et al., 2011). The second gene encodes a regulatory subunit of the PP2A phosphatase encoded by the PPP2R5D gene (wrd in Drosophila) (Viquez, 2006). PPP2R5D is also a master controller of cellular metabolism (Bernal et al., 2014), as well as cellular and synaptic growth at the Drosophila NMJ (Viquez, 2006). Both proteins are present at the Drosophila NMJ (Cheng et al., 2011; Viquez et al., 2009; Viquez, 2006) Single-cell Patch-Seq experiments confirmed the expression of these genes in Drosophila motoneurons at third-instar (Figure 1—figure supplement 1). Intriguingly, the PPP2R5D gene has recently been associated with intellectual disability and autism in human (Loveday et al., 2015; Shang et al., 2016). Next, we demonstrate that both genes, PDPK1 and PPP2R5D, are common modifiers of multiple heterozygous ASD-associated gene mutations (Figure 5). To underscore the specificity of the double heterozygous genetic interactions (Figure 5B,E), we restored the expression of the CHD2 gene to wild type levels in the CHD2/+; PPP2R5D/+ double heterozygous combination. This was achieved using a previously published translocation of the CHD2 gene locus that allowed us to put back one copy of the CHD2 gene (CHD2WT/+) in the background of the CHD2/+; PPP2R5D/+ double mutant. We demonstrate that PHP is fully restored (Figure 5C). An identical series of experiments was performed with a previously characterized PDPK1 mutation (Figure 5E,F). Thus, PDPK1 and PPP2R5D represent the first known common phenotypic modifiers of ASD gene orthologs, causing PHP to fail (see also Supplementary file 1 Supplemental Table S7 for values and statistics). The data also underscore that deficiencies isolated in our forward genetic screen can be resolved to the activity of single genes. As such, the screen may have identified a novel class of common phenotypic modifier. Another series of control experiments were performed. We asked whether neuronal morphology was substantially altered in the heterozygous ASD-associated gene mutations and in select double heterozygous genetic interactions (Figure 5—figure supplement 1). We do find evidence that the heterozygous CHD8/+ mutation predisposes the NMJ to modest overgrowth, consistent with CHD8 influencing brain development in other systems (Gompers et al., 2017). But, this effect does not become more severe when combined with either the PDPK1 or PPP2R5D mutation as double heterozygotes. Thus, we conclude that altered synaptic growth is not highly correlated with the block of PHP in these double heterozygous combinations. Deletion of PPP2R5D impairs the robustness of PHP Given that PPP2R5D and PDPK1 both genetically interact with multiple ASD-associated gene mutations, and given that several of the ASD-associated genes sensitize PHP toward failure, we considered whether PPP2R5D and PDPK1 are also directly involved with the induction of PHP. Unlike many of the ASD genes, both PPP2R5D and PDPK1 are viable as homozygous deletion mutations, allowing a direct test of their involvement in PHP. To our surprise, neither PPP2R5D nor PDPK1 can be classified as strictly essential for the mechanisms of PHP based on analysis of homozygous LOF mutants (Figure 5—figure supplement 2). PHP is fully expressed in the homozygous PDPK1 mutant (Figure 5—figure supplement 2), demonstrating that this gene is not required. There is a statistically significant suppression of PHP in the homozygous LOF mutation in PPP2R5D suggesting a role for this gene in the rapid induction of PHP, but without being strictly necessary (Figure 5—figure supplement 2). We note that both PDPK1 and PPP2R5D control signaling that directly intersects with the AKT/mTOR pathway, a signaling system that is associated with ASD in human (Alessi et al., 1997; Manning and Toker, 2017; Yeung et al., 2017). The mTOR signaling proteins S6K and Tor have both been implicated in the long-term maintenance of PHP. However, both are dispensable for the rapid, PhTx-dependent induction of PHP (Cheng et al., 2011; Penney et al., 2012). Never-the-less, the possible connection to Tor signaling prompted us to revisit our screen data and ask whether mutations affecting the broader AKT/mTOR signaling system might also be common ASD-gene modifiers. The genes Akt, S6K, TSC1, TSC2, and PTP61F are all encoded on the Drosophila third chromosome. All of these genes were present within the deficiencies that were tested in our screen. But, none were identified as a hit in our unbiased forward genetic screen. Although the lack of a genetic interaction cannot be used to conclude the absence of a role for these genes in the PHP effects that we observe, it seems likely that PPP2R5D and PDPK1 have other targets relevant to the intersection of ASD-gene mutations and the rapid induction of PHP. Consistent with this possibility, PDPK1 and PPP2R5D are predicted to have opposing actions on AKT, yet both genes participate in the blockade of PHP when combined with a mutation in one of the five ASD-associated gene mutations (see discussion). Furthermore, as demonstrated below, one mechanism by which PHP is blocked is novel and unexpected. Dissecting the mechanism of impaired PHP in a single double heterozygous mutant combination It is rare for a genetic study to define, precisely, how a double heterozygous interaction creates a synthetic phenotype if the two genes do not encode proteins that biochemically interact. Simply put, there are a vast number of possible mechanisms by which SSNC could occur (Yook et al., 2001). None-the-less, we attempted to do so for at least one double heterozygous combination. Although this represents only a single mechanism of SSNC, it could provide proof of principle for how PHP is affected in other ASD gene interactions. We chose the genetic interaction of PPP2R5D/+ with CHD8/+. This combination was chosen because CHD8 is among the most common ASD de novo gene mutations. Furthermore, the genetic interaction is highly penetrant. We began by pursuing additional phenotypic analyses, looking for clues in a wider variety of cellular and electrophysiological measures. It is possible that the genetic interaction of PPP2R5D/+ with CHD8/+ could indirectly affect PHP expression by altering motoneuron firing properties. Therefore, we analyzed intrinsic excitability and neuronal firing by patch clamp electrophysiology of larval motoneurons. There is no change in motoneuron firing frequency in response to a series of step current pulse injection. Likewise, there are no changes in action potential amplitude, cell input resistance or rheobase comparing wild type with each single heterozygous mutation and the double heterozygote (Figure 5—figure supplement 3). Thus, aberrant excitability is not linked to impaired PHP. Ultrastructural correlate of impaired PHP: altered presynaptic membrane trafficking Next, we turned to electron microscopy to determine whether the genetic interaction of PPP2R5D/+ with CHD8/+ affects the presynaptic release site. Ultrastructural changes have previously been linked to impaired PHP (Harris et al., 2018). Thin section transmission electron microscopy (EM) was used to examine the synapse, defined as a characteristic increase in pre- and postsynaptic membrane electron density, opposing clustered presynaptic vesicles and a characteristic presynaptic density, termed a T-bar. We find that the ultrastructure of CHD8/+ alone was wild type (Figure 6B,D,E). The ultrastructure of PPP2R5D/+ alone was wild type (Figure 6A,D,E). However, the double heterozygous mutant showed evidence of large membrane structures surrounding the presynaptic release site and apparent stalled endocytic events, appearing adjacent to sites of neurotransmitter release where compensatory synaptic vesicle endocytosis occurs (Figure 6C, insets). Quantification of vesicle size reveals a large increase in average intracellular vesicle diameter for all vesicles within 150 nm of the base of the presynaptic release site, defined by the T-bar structure (Figure 6D,E), again selective to the double heterozygous mutant. These data provide a striking visual confirmation of the genetic interaction between PPP2R5D/+ and CHD8/+. And, this is further evidence linking the action of a chromatin-remodeling factor (CHD8) to the stability of synaptic transmission. Given the appearance of enlarged vesicles at or near the presynaptic release site, we repeated our ultrastructural analysis of the double heterozygous mutant, fixing the synapse immediately (~1–5 s) after strong stimulation of presynaptic release (50 Hz stimulation, 10 s). In wild type, there was no change in the number or appearance of presynaptic vesicles when fixed immediately following the stimulus. However, in the double heterozygous mutant condition (CHD8/+; PPP2R5D/+) we found that intracellular vesicles were further increased in size and took on a crenulated appearance (Figure 6F–I). These data are consistent with the enlarged vesicles being endosomal intermediates, arguing that the process of vesicle recycling is altered in the double heterozygous mutant. In further support of this idea, we demonstrate enhanced synaptic depression in response to high frequency (50 Hz) stimulation (Figure 6—figure supplement 1). Recently, homozygous CHD8 loss of function mutations have been linked to defects in synaptic vesicle endocytosis at the Drosophila NMJ (Latcheva et al., 2019). Our data underscore that that an endocytosis phenotype can be uncovered in the heterozygous CHD8/+ mutant in the context of the PPP2R5D/+ mutant. Regardless of the underlying molecular mechanism leading to this EM phenotype and associated physiological deficits (a topic for future study), these data present a striking, visual confirmation of a strong synthetic genetic interaction between PPP2R5D/+ and the CHD8/+ heterozygous mutations. Furthermore, these data link the activity of a chromatin remodeling factor, present in the nucleus (CHD8), to a profound synaptic defect. Experiments detailed below, including genetic rescue, confirm the specificity of this EM phenotype. Differential gene expression analyses One possible reason that genes isolated from our screen are common modifiers of diverse ASD genes is that each modifier is a direct transcriptional target of the ASD mutants. It is possible to assess this by RNAseq. To our knowledge, side-by-side differential gene expression analysis has yet to be performed for multiple heterozygous ASD-associated gene mutant backgrounds. We performed whole genome RNAseq analysis for wild types and the four heterozygous ASD mutants (four biological replicates) (Figure 7A). We asked whether any of the genes contained within the 20 deficiencies identified in the screen (37 genes; a number arrived at following sub-deficiency mapping and sub-selection based on gene expression in nerve or muscle) are commonly altered in all four of ASD-associated mutants (Figure 7A, orange data points). None were commonly differentially regulated (p-value=0.096 for ASH1L/+; p-value=0.636 for WDFY3/+; p-value=0.392 for CHD2/+; p-value=0.112 for CHD8/+; Wilcoxon sign rank test two-sided). We conclude that common down-regulation of identified genetic modifiers cannot account for the common impairment of PHP that we observe electrophysiologically. Next, we asked whether the ASD-associated gene mutations might cause common changes in gene expression, with potential relevance to a common disruption of PHP. We define all differentially expressed genes common to at least two ASD mutations (Figure 7B,C). While there are individual genes that are commonly differentially regulated, a GO database analysis of differentially expressed genes did not reveal any consistent change in a gene category across all four genotypes. The patterns of gene dysregulation do not predict any pattern of genetic interactions documented in our systems-genetic analysis. Finally, while there are genes that are commonly dysregulated in multiple ASD gene orthologs, there are only two genes that are commonly down-regulated in all four ASD mutants (FBgn0027578 [Nepl21] and FBgn0037166 [CG11426]) (Figure 7C). FBgn0027578 encodes a metalloprotease of the Neprilysin family, with homology to endothelin converting enzyme one in human, of unknown function in the nervous system. FBgn0037166 encodes phosphatidic acid phosphatase type 2, which is expressed in the Drosophila nervous system, but of unknown function. There is no obvious means to connect the down regulation of these two genes to impaired homeostatic signaling, although future experiments will explore these genes in greater depth. Furthermore, there is no clear connection between FBgn0027578 or FBgn0037166 and the roles of either PDPK1 or PPP2R5D in the nervous system. Thus, a transcriptional analysis of heterozygous ASD gene mutations alone did not allow us to make clear progress toward understanding the mechanisms of impaired PHP. Candidate mechanisms for impaired PHP based on differential gene expression analysis Next, we continued with our focus on characterizing the homeostasis defect in the CHD8/+; PPPR25D/+ double heterozygous mutant combination. We repeated the RNAseq differential gene expression analysis comparing the double heterozygous condition to three control conditions, inclusive of wild type and each single heterozygous mutant alone. In this manner, we sought to identify synergistic effects on gene expression that could not be accounted for in either single heterozygous mutant alone (Figure 7D,E). As expected, many of the differentially expressed genes documented in the double heterozygous mutant, when compared to wild type, could be accounted for by subsequent comparisons to each single heterozygous mutant. However, a small number of genes (14 genes; 5 upregulated and nine downregulated) appear to be synergistically differentially expressed in the double heterozygous mutant compared to all three control conditions (Figure 7D,E). We successfully replicated altered expression of four genes in the double heterozygous mutant combination by quantitative RT-PCR (Figure 8A,B). Of these genes, CREG stood out as being robustly and dramatically up-regulated. Upon closer inspection, CREG showed a slight, but significant, up-regulation in the CHD8/+ mutant (Figure 7A), and this was enhanced by the presence of the heterozygous PPP2R5D/+ mutation (Figure 7E, left). Next, we confirmed the up-regulation of CREG in the third instar larval central nervous system by quantitative RT-PCR (Figure 8—figure supplement 1B). Finally, we took advantage of a previously published gene expression data set (Parrish et al., 2014) and document CREG expression in motoneurons throughout embryonic and larval development. CREG is strongly expressed in embryonic motoneurons (20–24 hr after egg laying – AEL), after which expression levels plummet (Figure 8—figure supplement 1A). CREG is a homeostatic repressor CREG (Cellular Repressor of E1A-stimulated Genes) encodes an endosomal/lysosomal localized glycoprotein that is linked to stress responses in other systems as well as to the homeostatic maintenance of the vascular epithelium (Ghobrial et al., 2018; Kowalewski-Nimmerfall et al., 2014). Mammalian orthologs are expressed in the brain (Yang et al., 2011). However, CREG function has never been addressed in the nervous system of any organism. Given that we observe a strong synaptic internal membrane phenotype in the CHD8+; PPP2R5D/+ double heterozygous mutant, and given that CREG localizes to the endo-lysosomal system, we chose to study CREG in greater detail, asking if it is causally involved in PHP. Two independent transposon insertion mutations were identified, residing in the Drosophila CREG gene locus (Figure 8C). The CREGM1 transposon completely abolishes CREG expression and a heterozygous CREGM1/+ mutant reduces CREG expression (CREGM1 = zero expression compared to wild type, 3 biological and three technical replicates; CREGM1/+ = 51.5 ± 3.1% wild type expression, 3 biological and three technical replicates). Next, we generated a triple heterozygous mutant combination (CHD8+; PPP2R5D/+, CREGM1/+) and find that the CREGM1/+ allele attenuates the up-regulation of CREG gene transcript in the triple heterozygous mutant background, a suppression effect of approximately 50%, as predicted (Figure 8D). Then, we repeated this analysis with the CREGM2 allele. This allele has a minor effect on baseline CREG expression (73.2 ± 2.7% wild type expression, 3 biological and three technical replicates). However, we discovered that this transposon insertion caused a complete block of CREG up-regulation in the triple heterozygous mutant combination, suggesting that this transposon insertion, residing in 3' UTR, may disrupt a transcription regulatory motif (Figure 8D). Next, we asked whether the triple heterozygous mutant combinations, in which CREG up-regulation is either attenuated or abolished, would rescue the expression of homeostatic plasticity and synaptic ultrastructure. In both triple mutant combinations (CHD8+; PPP2R5D/+, CREGM1/+) and (CHD8+; PPP2R5D/+, CREGM2/+), the expression of PHP is fully rescued (Figure 8E,F). These data are consistent with the conclusion that the abnormally enhanced levels of CREG transcription are responsible for the block of homeostatic plasticity seen in the double heterozygous mutant combination. If true, then we might also see rescue of the ultrastructural phenotype in the CHD8+; PPP2R5D/+, CREGM1/+ triple mutant. Indeed, this is the case (Figure 8G). We observe full rescue of synaptic ultrastructure. Thus, preventing the dramatic up-regulation of CREG, without abolishing CREG expression, is sufficient to restore membrane trafficking and PHP to the presynaptic nerve terminal of the CHD8+; PPP2R5D/+ double mutant combination. It is possible that CREG is a novel suppressor of PHP. However, it is also possible that CREG mediates this effect only in the context of the other two heterozygous mutations. To address this possibility, we generated a UAS-CREG transgenic line, allowing cell-type specific overexpression of the CREG gene. Over-expression of CREG in a wild type background using either a ubiquitously expressed source of GAL4 (tubulin-GAL4), or a GAL4-line that is selective to motoneurons (OK371-GAL4), causes a complete block of PHP (Figure 8J–K). As a control for adverse developmental effects of CREG overexpression, we analyzed NMJ anatomy and find no substantive effects on NMJ growth or morphology that could account for the absence of PHP (Figure 8—figure supplement 2). Finally, we assessed the consequences of the heterozygous and homozygous loss of function mutations on baseline neurotransmission and PHP. The CREGM1 allele abolished expression (see above) and is the focus of these analyses. Neither the heterozygous nor homozygous animals affected expression of PHP (Figure 8F). The CREGM1/+ heterozygous animals had no effect on baseline transmission compared to wild type (wild-type QC = 40.8 ± 2.2 n = 10; CREGM1/+ QC = 38.6 (±3.0) n = 8; Student's t-test; p>0.5). The CREGM1 homozygous allele decreased baseline transmission by ~18% (CREGM1 QC = 33.5 ± 3.0 n = 8; p=0.02). Clearly, neither baseline release nor PHP are potentiated, demonstrating that the rescue of PHP in the triple heterozygous mutant condition cannot be considered an additive effect of the heterozygous CREGM1 mutation. Taken together, our data are consistent with the conclusion that CREG is a homeostatic repressor, one of very few identified to date (Spring et al., 2016). This finding underscores the complexity of interpreting the double heterozygous mutant combinations that cause blockade of PHP. Assessing the generality of CREG as a mechanism for impaired PHP In mammals, there are two CREG genes and CREG2 is expressed in the brain (Yang et al., 2011). A recent study provides evidence that CREG2 expression is enhanced in layer four excitatory neurons, isolated from human postmortem ASD patient brain tissue (Velmeshev et al., 2019), suggesting possible relevance. This fact prompted us to ask whether over-expression of CREG is the primary mechanism responsible for the disruption of PHP, or whether it is just one of many. Our existing gene expression analysis demonstrates that CREG is not up-regulated in the other heterozygous mutations (ASH1L or CHD2 or WDFY3; Figure 7). This was extended to the PDPK1/+ mutant and, again, CREG levels are not increased. Finally, we analyzed two additional double heterozygous mutant combinations (PDPK1/+ with CHD2/+ as well as PPP2R5D/+ with CHD2/+). CREG was not up-regulated compared to single heterozygous controls. Finally, we repeated the ultrastructural analysis for a second genetic combination (PPP2R5D/+ with CHD2/+). No phenotype of enlarged vesicles or endomembranes was observed (Figure 8—figure supplement 3). From these data, we conclude that the aberrant over-expression of CREG is not a universal cause of impaired PHP in the double heterozygous interactions. In the future, a systematic test of all genetic combinations identified in our screen may define whether CREG over-expression is unique to a single genetic interaction or whether it is reflected in a subset of gene interactions. In this study, we make several fundamental advances. First, we provide evidence that mutations in multiple different ASD-associated genes sensitize homeostatic plasticity to fail (Figure 9A,B). Second, using genome-scale forward genetics and subsequent systems-genetic analyses, we identify the first phenotypic modifiers that commonly enhance five different ASD-associated gene mutations, causing a specific failure of PHP (Figure 9A). Third, we identify PDPK1 and PPP2R5D as common phenotypic modifiers of multiple ASD-associated genes and, thereby, define a mechanistic link between synaptic transmission, PHP and chromatin remodeling complexes in the neuronal nucleus (Figure 9A). Finally, we define how PHP fails at the intersection of an ASD-associated gene mutation and phenotypic modifier. The mechanism is unexpected, involving the maladaptive up-regulation of a novel repressor of homeostatic plasticity (CREG) (Figure 9C). We demonstrate that up-regulation of CREG cannot explain other gene-gene interactions, underscoring the potential complexity of gene-gene interactions and the common failure of PHP. Regardless of potential mechanistic complexity, our data argue that impaired PHP may be a common pathophysiological effect downstream of LOF mutations in five different ASD-associated genes. If our data can be extended to additional ASD genes, and to other experimental systems including human neurons, then it may be possible to use this information to advance therapeutic approaches that modify ASD phenotypic severity regardless of the underlying genetic mutation(s) that confer risk for ASD. The loss or impairment of PHP could contribute to the phenotypic penetrance of an ASD gene mutation in multiple ways. Impaired PHP is expected to render the nervous system less robust to perturbation including the effects of environmental stress, immunological stress, or genetic mutation (Davis, 2013; Davis, 2006). If an ASD-associated gene mutation leads to neural developmental defects, then loss of PHP would be expected to exacerbate the functional consequences. According to the same logic, loss of PHP might enhance the adverse effects of environmental or immunological stress, both of which are thought to contribute to ASD pathophysiology (Beversdorf et al., 2018; Modabbernia et al., 2017). Finally, loss of PHP could be relevant to the appearance or severity of ASD comorbidities, including epilepsy. It should be emphasized that failed homeostatic plasticity cannot be determined by simply assessing the phenotype of a heterozygous ASD-associated gene mutation. The observation of a phenotype, such as altered E/I balance or impaired neurotransmission, could reflect failure of homeostatic plasticity, or it could reflect the outcome of successful homeostatic mechanisms that constrained a phenotype that might otherwise have been more severe (Davis, 2013; Kulik et al., 2019). Ultimately, the loss or impairment of homeostatic plasticity can only be determined by a direct test of homeostatic robustness; specifically referring the ability of a neuron, synapse or neural circuit to respond to a perturbation and sustain normal function in the continued presence of the perturbation (Davis, 2013; Davis, 2006). Thus, our data set the stage for similar analyses in other model organisms, potentially extending the connection between ASD-associated gene mutations and the robustness of PHP or other forms of homeostatic plasticity. The specificity of gene-gene interactions that cause PHP to fail The genetic interactions that we document in our study appear to be highly specific. First, our genetic screen was based on the use of deficiency chromosomes that uncover 5–50 genes each, rendering those genes heterozygous. Thus, each deficiency can be considered to test pairwise gene-gene interactions among all the genes contained in the deficiency. According to this logic, we tested in excess of 50,000 double heterozygous gene combinations and discovered only 20 interactions that cause PHP to fail. Although it is unlikely that genes are completely randomly distributed throughout the genome, this calculation still has merit and emphasizes the rarity of gene-gene interactions that cause PHP to fail. In addition, we found no correlation between the number of genes deleted in a heterozygous deficiency and the impairment of PHP. Thus, the likelihood of a genetic interaction does not increase with the number of genes that are rendered heterozygous. Finally, it should be emphasized that PHP is a robust physiological process that is not unusually susceptible to the effects of genetic mutations. Previously, forward genetic have observed low rates of gene discovery. Two such screens tested transgenic RNAi against nearly every kinase and phosphatase encoded in the Drosophila genome, a gene set that includes prominent signaling proteins, the majority of which had no effect on PHP induction or expression (Brusich et al., 2015; Hauswirth et al., 2018). With this information as a background, the identification of genes that commonly enhance multiple ASD genes, causing PHP to fail, seems extraordinarily. The rapid induction versus long-term expression of PHP There are two well-established methods to induce expression of PHP. Application of PhTx induces PHP within minutes, a process that can be maintained for hours (Frank et al., 2006). In addition, a mutation in the non-essential GluRIIA subunit of postsynaptic glutamate receptors drives persistent expression of PHP. Since the GluRIIA mutation is present throughout the life of the organism, it is inferred that this reflects the long-term maintenance of PHP. Although this distinction reflects only the duration of the perturbation (acute versus genetic), recent work does argue that the acute induction of PHP may transition to another long-term expression mechanism (Harris et al., 2018; Harris et al., 2015). Indeed, screens based on the acute versus long-term PHP have identified different candidate genes, even when screening a common transgenic RNAi collection (Brusich et al., 2015; Hauswirth et al., 2018). It remains unknown whether one form of PHP is more relevant regarding the intersection of homeostatic plasticity with diseases or disorders of the nervous system. In the present study, the acute induction of PHP can be considered a type of 'stress test'. If the rapid induction of PHP fails, we can infer that the neurons are less robust to perturbation. In the future, it will be interesting to systematically determine whether the gene-gene interactions identified here also uniformly perturb PHP induced by the GluRIIA mutation. However, such an analysis is beyond the scope of the present study. Common phenotypic enhancers of multiple ASD gene orthologs How can the existence of common phenotypic modifiers be explained? We began our study with the demonstration that heterozygous LOF mutations in four unrelated ASD-associated genes including RIMS1 (presynaptic scaffolding protein), CHD8 (chromatin helicase), CHD2 (chromatin helicase) and ASH1L (transcriptional activator and histone methyltransferase), all sensitize the expression of PHP to fail (Figure 1, Figure 1—figure supplement 2, Figure 9B). One possibility, therefore, is that PHP is commonly sensitized to fail by heterozygous LOF mutations in each of the five ASD gene orthologs that we chose to study. If so, then a phenotypic modifier that interacts with one of these genes might also be expected to commonly interact with the other ASD genes. In other words, commonality arises because of the unexpected finding that each ASD gene ortholog has an activity that, when diminished, impairs the robustness of PHP. Our data generally support this model, given that three of four ASD genes interact with RIMS1 to block PHP. According to this model, we provide the first evidence that sensitization of PHP is a common pathophysiological effect downstream of multiple ASD genes with, as yet, unrelated biological activities. The finding that ASD gene mutations sensitize PHP to fail does not require that each ASD gene participate in the actual mechanisms of PHP. RIMS1 is a core component that is required for PHP (Müller et al., 2012). However, a gene such as CHD8 might compromise PHP indirectly by causing some form of cellular stress that interacts with the mechanisms of PHP (Figure 8J,K). Indeed, it was previously demonstrated that simultaneous induction of two different forms of homeostatic plasticity creates interference and homeostatic failure (Bergquist et al., 2010). The same argument can apply to the novel class of common phenotypic modifiers. Some modifiers may represent core components of PHP, including PPP2R5D, which seems to suppress PHP when knocked out (Figure 5—figure supplement 2). However, the PDPK1 knockout has no effect on PHP and, therefore, may interact with the mechanisms of PHP indirectly. Thus, we cannot rule out the possibility that compounded cellular stressors occasionally intersect and cause PHP to fail. Novel mechanisms impair PHP; CREG-dependent suppression of PHP We explored, in detail, how PHP fails at the intersection of CHD8/+ and PPP2R5D/+. First, we discovered a profound effect on synaptic ultrastructure that was not observed in either single heterozygous mutation. This provided dramatic visual proof of a strong, genetic interaction between these two heterozygous gene mutations. Next, we demonstrate that this strong, genetic interaction is not a consequence of extensive transcriptional dysregulation. Indeed, when the effects of each heterozygous gene mutation are taken into account, only 14 genes show evidence of altered transcription. A single gene, CREG, was subsequently demonstrated to be the cause of impaired PHP and disrupted presynaptic membrane trafficking. Although CREG2 is not upregulated in the heterozygous CHD8/+ mouse, a recent study provides evidence that CREG2 expression is enhanced in layer four excitatory neurons, isolated from human postmortem ASD patient brain tissue (Gompers et al., 2017; Velmeshev et al., 2019). It remains to be determined how loss of PPP2R5D causes further dysregulation of CREG in the background of CHD8/+. One possibility is that CREG is a stress-response gene, and up-regulation occurs at the intersection of two cellular stresses. Other alternatives remain plausible, including a direct connection between CHD8 and CREG that is modulated by PPP2R5D-mediated signaling. The biochemical and transcriptional relationships will be defined in subsequent work and are beyond the scope of our current study. The generality of this genetic interaction will also be explored. We note, for example, that CREG shows a mild increase only in the CHD8/+ mutant, not in the other three ASD-associated genes (Figure 7A). This does not rule out CREG participating in genetic interactions involving other ASD-associated genes, but it might suggest additional mechanisms will be engaged. CREG encodes a glycoprotein that localizes within the endo-lysosomal system and may also be secreted. In mammals, there are two CREG genes and CREG2 is expressed in the brain (Yang et al., 2011). There is generally more information regarding the function of CREG1, which is an effector of tissue homeostasis in the vascular epithelium (Ghobrial et al., 2018). In this capacity, CREG seems to function as a stress response factor, influencing the activity of several potent signaling systems (Ghobrial et al., 2018). Our current phenotypic analyses suggest that increased levels of CREG may directly impact the integrity of synaptic vesicle membrane recycling and, either directly or indirectly, interface with the homeostatic potentiation of vesicle release. Thus, while a full dissection of CREG activity remains for future studies, our data argue that CREG has an activity that could be directly coupled to vesicle release and recycling, an ideal situation to normally limit the homeostatic potentiation of vesicle fusion. Relevance and conclusions It is well established that genetic context can profoundly influence the phenotypic severity of disease-causing gene mutations. For example, in mice, it has been shown that genetic context (strain background) influences phenotypic penetrance in an Alzheimer's disease model (Neuner et al., 2019). In humans, systematic screening of the phenotypically normal population has identified individuals that are resistant to the effects of well-established, debilitating disease causing mutations, an effect termed 'resilience' that is attributed to the effects of genetic context (Chen et al., 2016; Friend and Schadt, 2014). It seems plausible that the common phenotypic enhancers, identified in our genetic screen, could represent a mechanism by which genetic context influences the phenotypic penetrance of ASD-associated gene mutations. We recognize that PDPK1 and PPP2R5D have fewer than expected LOF and missense mutations in humans (http://exac.broadinstitute.org). It remains to be determined if this will be the case with additional modifier genes. Furthermore, we note that PHP is completely blocked at the intersection of ASD gene mutations and the common modifiers we identify. Therefore, subtle changes in the expression or function of common phenotypic modifiers, perhaps caused by mutations in enhancer/promoter regions, could impact expression or robustness of PHP with cascading negative phenotypic consequences. If our findings can be extended to other systems, including humans, it is conceivable that our emerging mechanistic understanding could be used to restore the beneficial effects of homeostatic plasticity and alleviate aspects of ASD phenotype, irrespective of individual genetic makeup. Materials and methods Fly stocks Request a detailed protocolAll Drosophila stocks were kept and raised on standard food at 25°C. RIMS1 was previously described (Müller et al., 2012). PPP2R5D was a gift from Dr. Aaron Diantonio. Chd2[1] and Chd2[1],Chd2wt flies were gifts from Dr. Alexandra Lusser and Dr. Dmitry Fyodorov. All other Drosophila stocks were obtained from the Bloomington Drosophila Stock Center unless otherwise noted. W1118 is used as wild-type controls. 3rd chromosome deficiency fly stocks are balanced over TM6b and all stock are on the W1118 background. Molecular biology Request a detailed protocolDrosophila CREG cDNA was obtained by amplifying the single open reading frame from genomic DNA by PCR and cloning directly in to the pENTR vector (Gateway Technology; Invitrogen). We engineered a CACC site in the forward primer for the subsequent Gateway reaction: forward primer for pUASt-creg: 5′ CACCATGGATTCGGACAGCACC 3′; reverse primer for pUASt-creg with a stop codon, 5′ TCA ATT CGA AAC AGC GTA ATA 3′. The final construct were sequenced to ensure there were no mutations. The creg cDNA was then cloned into proper destination vector obtained from the Drosophila Gateway Vector Collection (Carnegie Institution, DGRC barcode #1129). Transgenic lines were generated and mapped using standard methods. Request a detailed protocolAll current clamp recordings were performed from muscle six, at the second and third segment of the third-instar Drosophila with an Axoclamp 900 amplifier (Molecular Devices). The composition of the extracellular solution (HL3) is (in mM) 70 NaCl, 5 KCl, 10 MgCl2, 10 NaHCO3, 115 sucrose, 4.2 trehalose, 5 HEPES. Ca2+ concentration in the extracellular solution is 0.35 mM unless otherwise noted. Homeostatic plasticity was induced by incubating the larvae with Philantotoxin-433 (PhTx, 15–20 µM, Sigma) for 10 min as previously described (Frank et al., 2006; Genç et al., 2017). Quantal content calculation is made by dividing average EPSP to mEPSP. mEPSPs were analyzed with MiniAnalysis program (Synaptosoft). All other physiology data were analyzed with custom written functions in Igor 6 (Wavemetrics Inc). Data collected from a minimum of two animals from two independent crosses. Request a detailed protocolThird-instar larvae were dissected, fixed in Bouin's fixative or 4% PFA in PBS, and immunostained with previously described methods (Eaton et al., 2002; Harris et al., 2015). Third instar larvae were dissected with cold HL3 and immediately fixed with PFA (4%) and incubated overnight at 4 C with primary antibodies (rabbit anti-Dlg, 1:1000; anti-Brp 1:100, Life Technologies). Alexa-conjugated secondary antibodies were used for secondary staining (Jackson Laboratories 1:500). An inverted epifluorescence deconvolution confocal microscope (Axiovert 200, Zeiss) equipped with a 100X objective (N.A. 1.4), cooled CCD camera (CoolSnap HQ, Roper Scientific) was used to acquire images. All acquisition, deconvolution and analysis were done by Slidebook 5.0 software (3I, Intelligent Imaging). Structured illumination microscopy (Nikon LSM 710 equipped with 63X objective and Andor Ixon EMCCD camera) was used to perform Brp puncta and Dlg labeling experiments. Bouton numbers were quantified as described previously (Harris et al., 2015). RNA extraction and library preparation for RNA sequencing Request a detailed protocolRNA was extracted from the adult heads (5–7 days post-pupation) of heterozygous mutants of four genotypes (ASH1L/+ and WDFY3/+ and CHD2/+ and CHD8/+) and wild types with four biological replicates per group by using Lexogen's RNA Extraction Kit (Lexogen). RNA quality was checked with Bioanalyzer (Agilent Technologies Inc) prior to library amplification. 3'mRNA-Seq Library Prep Kit for Illumina (FWD) from Lexogen was used for first strand cDNA, second strand synthesis, dsDNA purification, i7 single indexing, library amplification and final library purification. To estimate the PCR cycle numbers for library amplification, qPCR was done by using PCR Add-On Kit (Lexogen). Purified final libraries were quality tested by using Agilent Bioanalyzer 2100 with High Sensitivity DNA chips (Agilent Technologies Inc). Qubit fluorometer (ThermoFisher Scientific) was used to quantify the concentration of the final library. Barcoded libraries are then sequenced using an Illumina HiSeq 4000 at 50 bp single-end reads in the CAT genomic facility at UCSF. There was a median of 14.3 million (M) mapped reads per sample (interquartile range, IQR: 8.0 M-20.6M). Read mapping and quantification of gene expression Request a detailed protocolRead count and transcript per million reads mapped (TPM) were determined using Salmon software version 0.12.0. A reference genome index for Salmon was created according to developer's instructions for the Drosophila melanogaster genome BDGP6 (Ensembl v92). Reads mapping and quantitation was simultaneously performed to individual transcripts. Differential expression across heterozygous mutant flies Request a detailed protocolDifferential expression of heterozygous mutant flies was determined by pooling samples from the same genotype. Gene expression profiles between mutant and wild type were collated using the R package tximport (version 1.6.0). The R package DESeq2 (version 1.18.1) used raw gene counts to determine differentially expressed genes (DEGs) by genotype with the linear model [Gene counts ~Batch + Genotypes]. Protein coding and lincRNA genes defined by the BDGP6 were included in differential expression. Expression was adjusted for batch to account for difference between fly lines, tissue source, and library preparation. The p-values were adjusted for Benjamini-Hochberg Procedure through DESeq2 with a target alpha = 0.1, and genes were considered DEGs at FDR < 0.05 and±50% expression changes. Single cell Patch-seq Request a detailed protocolTo obtain the cytoplasmic content of the cell, we performed whole-cell tight-seal patch clamp in motoneurons expressing GFP (Kulik et al., 2019). We established whole-cell configuration with leak currents less than 100 pA. We gently sucked the cytoplasmic content of the cell by applying a negative pressure to the patch-pipette. Then, we pulled the individual motoneuron from the tissue while visually confirming the GFP fluorescent signal at the tip of the pipette. Immediately after, we immersed the pipette tip in a test tube containing the Cell Lysis Buffer and RNAse inhibitor medium and broke the pipette tip by gently touching to the tube wall. The content of the pipette tip was ejected by applying positive pressure. We pooled 4–8 motoneurons for one reaction. We used the Low Input RNA: cDNA Synthesis, Amplification and Library Generation kit from NEB (New England Biolabs Inc) to isolate, reverse-transcribe the RNA and prepare the libraries for sequencing. Following the reverse transcription and template switching, we amplified the cDNA by PCR. Amplified cDNA was cleaned up by using SPRI beads. The quality and quantity of the amplified cDNA was assessed by Bioanalyzer (Agilent Technologies Inc). After fragmentation and adaptor ligation, adaptor-ligated DNA were enriched with i7 primer and universal primer by PCR-amplification. Amplified libraries were quality checked by Biolanalyzer with High Sensitivity DNA chips (Agilent Technologies Inc) and the quantity was measured by Qubit fluorometer (ThermoFisher Scientific). Barcoded libraries were sequenced using an Illumina HiSeq 4000 at 100 bp paired-end reads in the CAT genomic facility at UCSF. Patch-seq transcriptional analysis Request a detailed protocol(Raw reads were first processed with flexbar version 3.5.0 (https://github.com/seqan/flexbar; Roehr, 2019) to remove adapters specific to the NEBNext library prep, using parameters as described in https://github.com/nebiolabs/nebnext-single-cell-rna-seq (Shtatland and Langhorst, 2018). The reads were then processed with HTStream v.1.1.0 (https://github.com/s4hts/HTStream; Hunter, 2019) to perform data QA/QC, remove Illumina adapter contamination, PCR duplicates, and low-quality bases/sequences. The trimmed reads were aligned to the Drosophila melonogaster genome v.BDGP6.22 (http://ensembl.org/Drosophila_melanogaster/Info/Annotation) with annotation release version 98 using the aligner STAR v. 2.7.0e (Dobin et al., 2013) to generate raw counts per gene. On average, 93.7% of the trimmed reads aligned to the Drosophila genome, and 80% of the trimmed reads uniquely aligned to an annotated Drosophila gene. Differential expression analyses were conducted using limma-voom in R (limma version 3.40.6, edgeR version 3.26.7, R 3.6.1). Prior to analysis, genes with fewer than five counts per million reads in all samples were filtered, leaving 8598 genes. The differential expression analysis was conducted independently for the two experiments represented in the samples. Request a detailed protocolRNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion). For the first strand synthesis Super Script II RT was used (Invitrogen). Taqman Fast Universal PCR solution was mixed with TaqMan probe with an Applied Biosystems FAM dye. RPL32 was amplified as an internal control. Expression fold-changes are quantified by ddCT method. Data represent three biological and three technical replicates. Electron microscopy Request a detailed protocolElectron microscopy experiments were performed as previously described (Harris et al., 2015). For high-frequency stimulation experiments, larval fillet preparations were fixed immediately (1–5 s) following stimulation. Data are acquired from at least two animals. Statistical analysis of physiology and morphology data Request a detailed protocolAverage values are presented as mean ± standard error of mean. All statistical tests are indicated in the figure legends, referring to individual panels within the figure. For multiple comparisons, we used one-way ANOVA, followed by Dunnett's or Tukey multiple comparisons. To test the difference between two groups, we used unpaired two-tailed Student's t-test. Pearson correlation coefficients were calculated following a linear-fit of the X-Y (quantal size vs. quantal content) data, although supra-linear best-fits are sometimes displayed, purely for the purpose of display. Data availability Sequencing data have been deposited in GEO under accession code GSE153225. Analysis code is available via Github https://github.com/joonan30/Genc2020_RNAseq (copy archived at https://github.com/elifesciences-publications/Genc2020_RNAseq). NCBI Gene Expression OmnibusID GSE153225. Transcriptomics analysis of heterozygous mutant and wild-type flies for presynaptic homeostatic plasticity. From the genetic architecture to synaptic plasticity in autism spectrum disorderNature Reviews Neuroscience 16:551–563.https://doi.org/10.1038/nrn3992 A single-cross, RNA interference-based genetic tool for examining the long-term maintenance of homeostatic plasticityFrontiers in Cellular Neuroscience 9:107.https://doi.org/10.3389/fncel.2015.00107 Harnessing synthetic lethal interactions in anticancer drug discoveryNature Reviews Drug Discovery 10:351–364.https://doi.org/10.1038/nrd3374 S6 kinase localizes to the presynaptic active zone and functions with PDK1 to control synapse developmentThe Journal of Cell Biology 194:921–935.https://doi.org/10.1083/jcb.201101042 Homeostatic control of neural activity: from phenomenology to molecular designAnnual Review of Neuroscience 29:307–323.https://doi.org/10.1146/annurev.neuro.28.061604.135751 Sensory modality-specific homeostatic plasticity in the developing optic tectumNature Neuroscience 14:548–550.https://doi.org/10.1038/nn.2772 STAR: ultrafast universal RNA-seq alignerBioinformatics 29:15–21.https://doi.org/10.1093/bioinformatics/bts635 Most genetic risk for autism resides with common variationNature Genetics 46:881–885.https://doi.org/10.1038/ng.3039 The structure and biological function of CREGFrontiers in Cell and Developmental Biology 6:136.https://doi.org/10.3389/fcell.2018.00136 Decanalization and the origin of complex diseaseNature Reviews Genetics 10:134–140.https://doi.org/10.1038/nrg2502 Germline Chd8 haploinsufficiency alters brain development in mouseNature Neuroscience 20:1062–1073.https://doi.org/10.1038/nn.4592 Retrograde changes in presynaptic function driven by dendritic mTORC1Journal of Neuroscience 32:17128–17142.https://doi.org/10.1523/JNEUROSCI.2149-12.2012 Towards a theory of biological robustnessMolecular Systems Biology 3:137.https://doi.org/10.1038/msb4100179 Drosophila melanogaster cellular repressor of E1A-stimulated genes is a lysosomal protein essential for fly developmentBiochimica Et Biophysica Acta (BBA) - Molecular Cell Research 1843:2900–2912.https://doi.org/10.1016/j.bbamcr.2014.08.012 Rare inherited and de novo CNVs reveal complex contributions to ASD risk in multiplex familiesThe American Journal of Human Genetics 99:540–554.https://doi.org/10.1016/j.ajhg.2016.06.036 Mutations in the PP2A regulatory subunit B family genes PPP2R5B, PPP2R5C and PPP2R5D cause human overgrowthHuman Molecular Genetics 24:4775–4779.https://doi.org/10.1093/hmg/ddv182 Network homeostasis: a matter of coordinationCurrent Opinion in Neurobiology 19:168–173.https://doi.org/10.1016/j.conb.2009.05.012 Genetic interaction networks in Cancer cellsCurrent Opinion in Genetics & Development 54:64–72.https://doi.org/10.1016/j.gde.2019.03.002 Variability, compensation, and modulation in neurons and circuitsPNAS 108 Suppl 3:15542–15548.https://doi.org/10.1073/pnas.1010674108 Variability, compensation and homeostasis in neuron and network functionNature Reviews Neuroscience 7:563–574.https://doi.org/10.1038/nrn1949 RIM controls homeostatic plasticity through modulation of the readily-releasable vesicle poolJournal of Neuroscience 32:16574–16585.https://doi.org/10.1523/JNEUROSCI.0981-12.2012 Synthetic lethality and cancerNature Reviews Genetics 18:613–623.https://doi.org/10.1038/nrg.2017.47 Too many cooks? intrinsic and synaptic homeostatic mechanisms in cortical circuit refinementAnnual Review of Neuroscience 34:89–103.https://doi.org/10.1146/annurev-neuro-060909-153238 PP2A and GSK-3beta act antagonistically to regulate active zone developmentJournal of Neuroscience 29:11484–11494.https://doi.org/10.1523/JNEUROSCI.5584-08.2009 Homeostatic plasticity and STDP: keeping a neuron's Cool in a Fluctuating WorldFrontiers in Synaptic Neuroscience 2:5.https://doi.org/10.3389/fnsyn.2010.00005 Pattern of expression of the CREG gene and CREG protein in the mouse embryoMolecular Biology Reports 38:2133–2140.https://doi.org/10.1007/s11033-010-0340-7 Rules of Nonallelic noncomplementation at the synapse in Caenorhabditis elegansGenetics 158:209–220. Homeostatic synaptic plasticity through changes in presynaptic calcium influxJournal of Neuroscience 31:7492–7496.https://doi.org/10.1523/JNEUROSCI.6636-10.2011 Article and author information Author details National Institute of Neurological Disorders and Stroke (R35-NS097212) - Graeme W Davis Simons Foundation (SFARI #401636) - Graeme W Davis Simons Foundation (SFARI #402281) - Stephan J Sanders National Institute of Mental Health (R01 MH110928) - Stephan J Sanders Neurosciences Research Foundation (2017M3C7A1026959) - Joon-Yong An The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. Supported by NINDS Grant (R35-NS097212) and Simons Foundation (SFARI #401636) to GWD, Simons Foundation (SFARI #402281) and NIMH (R01 MH110928) to SJS, and NRF-2017M3C7A1026959 to J-YA. We thank Matt State for comments and support and members of the Davis, State and Sanders labs for critical evaluation of the manuscript. Version history - Received: February 5, 2020 - Accepted: June 7, 2020 - Accepted Manuscript published: July 1, 2020 (version 1) - Version of Record published: July 31, 2020 (version 2) © 2020, Genç et al. This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited. - 2,709 - views - 416 - downloads - 13 - citations Views, downloads and citations are aggregated across all versions of this paper published by eLife. Download links Downloads (link to download the article as PDF) Open citations (links to open the citations from this article in various online reference manager services) Cite this article (links to download the citations from this article in formats compatible with various reference manager tools) Further reading - Neuroscience Tissue-clearing and labeling techniques have revolutionized brain-wide imaging and analysis, yet their application to clinical formalin-fixed paraffin-embedded (FFPE) blocks remains challenging. We introduce HIF-Clear, a novel method for efficiently clearing and labeling centimeter-thick FFPE specimens using elevated temperature and concentrated detergents. HIF-Clear with multi-round immunolabeling reveals neuron circuitry regulating multiple neurotransmitter systems in a whole FFPE mouse brain and is able to be used as the evaluation of disease treatment efficiency. HIF-Clear also supports expansion microscopy and can be performed on a non-sectioned 15-year-old FFPE specimen, as well as a 3-month formalin-fixed mouse brain. Thus, HIF-Clear represents a feasible approach for researching archived FFPE specimens for future neuroscientific and 3D neuropathological analyses. - Neuroscience Pavlovian fear conditioning has been extensively used to study the behavioral and neural basis of defensive systems. In a typical procedure, a cue is paired with foot shock, and subsequent cue presentation elicits freezing, a behavior theoretically linked to predator detection. Studies have since shown a fear conditioned cue can elicit locomotion, a behavior that - in addition to jumping, and rearing - is theoretically linked to imminent or occurring predation. A criticism of studies observing fear conditioned cue-elicited locomotion is that responding is non-associative. We gave rats Pavlovian fear discrimination over a baseline of reward seeking. TTL-triggered cameras captured 5 behavior frames/s around cue presentation. Experiment 1 examined the emergence of danger-specific behaviors over fear acquisition. Experiment 2 examined the expression of danger-specific behaviors in fear extinction. In total, we scored 112,000 frames for nine discrete behavior categories. Temporal ethograms show that during acquisition, a fear conditioned cue suppresses reward seeking and elicits freezing, but also elicits locomotion, jumping, and rearing - all of which are maximal when foot shock is imminent. During extinction, a fear conditioned cue most prominently suppresses reward seeking, and elicits locomotion that is timed to shock delivery. The independent expression of these behaviors in both experiments reveal a fear conditioned cue to orchestrate a temporally organized suite of behaviors.
We clarify why the Arctic Ocean waters are layered in this means, how local weather change is affecting these layers, and why it issues to us all. The Arctic fox has a circumpolar distribution and occurs in Arctic tundra habitats in northern Europe, northern Asia, and North America. In the late 19th century, it was launched into the Aleutian Islands southwest of Alaska. However, the population on the Aleutian Islands is currently being eradicated in conservation efforts to protect the local bird population. From studying this article, you now know that the very cold temperatures and many freshwater make the Arctic Ocean an unusual upside-down ocean. These low temperatures imply that solar energy absorbed gained by the ocean within the tropics and carried north is lost within the Arctic, providing heat to the northern hemisphere local weather. As the Arctic experiences global warming, the sea ice is melting and the numbers and types of organisms dwelling in the Arctic Ocean might change impacting each part of the food internet. A thawed space where bare earth or liquid water is visible . Melting point, thus causing heat to flow in from the environment . Collections of drift ice, the boundaries of which are seen . And corners are crushed and damaged, and are curled up by the pressure. 8 or 9 with little snow, the average in all probability around 7 toes (8; 47). We have discovered 1 Answer for the Clue "Layered buildup within the Arctic". Try to seek out some letters, so you'll find your solution extra simply. If you've got received another reply, it will be type of you to add it to our crossword dictionary. At the beginning of winter, the foxes have approximately kJ of energy storage from fats alone. Using the lowest BMR worth measured in Arctic foxes, a mean sized fox (3.5 kg (7.7 lb)) would want 471 kJ/day during the winter to survive. Arctic foxes can acquire goose eggs at a fee of two.7–7.3 eggs/h, they usually devils gulch yosemite retailer 80–97% of them. Scats provide proof that they eat the eggs in the course of the winter after caching. Isotope analysis shows that eggs can nonetheless be eaten after a year, and the metabolizable energy of a stored goose egg solely decreases by 11% after 60 days . I am an oceanographer and work in a Polar Research Center in Germany to check the water plenty and currents within the Arctic Ocean in addition to in the ocean around Antarctica. I often be a part of icebreaker expeditions to review how the polar oceans change and how this impacts the ecosystem and the animals that stay on the sea ice and in the ocean beneath. I am a scientist at Bangor University who makes measurements within the ocean to grasp how the wind and tides generate ocean currents, turbulence and mixing. I use these measurements reply questions, similar to; What provides vitamins for plankton and fish? How does deep heat water soften sea ice; How can we build reliable renewable energy gadgets within the ocean? To make these measurements I go to sea on massive analysis vessels, corresponding to icebreakers.
Massachusetts Institute And Technology's objective is to prepare students for the 21st century by advancing knowledge in science, technology, and other fields of study. Our goal is to instill in every member of the MIT community the capacity and enthusiasm to work sensibly, imaginatively, and productively for the benefit of humanity. History Of Massachusetts Institute And Technology Massachusetts Institute of Technology was an innovative educational institution founded in 1861 by a group of practical problem solvers who were passionate about basic science and wanted to improve society. This ethos continues to inform our work today as we develop new digital learning technologies and teach students on campus, opening up MIT education to millions of students worldwide. Education In Massachusetts Institute And Technology Digital learning; nanotechnology; human health, including cancer, HIV, autism, Alzheimer's, and dyslexia; poverty alleviation; advanced manufacturing; innovation and entrepreneurship; sustainable energy, the environment, climate adaptation, and global water and food security; Big Data, cybersecurity, robotics, and artificial intelligence? Innovative answers to the most difficult problems facing the world are the goal of MIT research. Through innovative partnerships with top research institutes and consortia worldwide, MIT's research activities are boosted, tackling everything from the energy demands of the future to the advancement of cancer therapeutics. The laboratories, centers, and programs at MIT where innovative research is being conducted are listed here, to name just a few. Master`s Program Engineering & Technology (21) Business & Management (18) Arts, Design & Architecture (14) Computer Science & IT (7) Natural Sciences & Mathematics (6) Social Sciences (5) Environmental Studies & Earth Sciences (3) Humanities (3) Journalism & Media (2) Applied Sciences & Professions (1) Provision of Services Housing Service Our responsibility at the Housing Office is to bed 6,000 students each night. And while getting a good night's sleep is vital, particularly for MIT students, our best possibilities come from our residential communities' waking hours. Living here at MIT involves more than just keeping your belongings in one location. Every graduate and undergraduate housing has an own culture, viewpoint, and way of life. And all of them have an equal impact on the students' development as their academic experiences do. Reduce your show Services provided by libraries Establishing and maintaining a dynamic information environment that promotes MIT research, learning, and innovation is the goal of the MIT Libraries. We are dedicated to providing top-notch services, plans, and frameworks that foster research, protect knowledge, and enhance international scholarly communication. Student Life There is more to life at the Institute than just homework and courses; the community takes great satisfaction in its extracurricular and curricular involvement in the arts, sports, and other fields. The possibilities are endless when it comes to living in a living group, competing on our NCAA Division III sports teams, or spending time learning new dance techniques. Cambridge, Massachusetts has 168 acres. 18 dorms for students 20 gardens and natural spaces, as well as 26 acres of playing grounds Over 100 public works by a Sporting Venues educational Programs: Get trained with our kids and adult educational programs. Exercise with Groups: Incorporate group yoga and pilates courses into your routine to create balance. Private Instruction : We have trainers, coaches, and instructors on staff to assist you in achieving your goals. Improve your squash, badminton, and basket abilities during open recreation. Improve your squash, badminton, basketball, and other talents at your own pace with Open Recreation. Youth program: Find out what's ideal for kids' health and wellness, from fitness to aquatics. Student clubs The mission of the FSILG Office is to foster a cohesive community that prioritizes mutual respect, civic and social responsibility, and the expansion and advancement of both organizations and their constituents. Twenty-five fraternities, six sororities, and five independent living groups are among these organizations. On April 10, 1861, the Commonwealth of Massachusetts incorporated. Study portals Student Grant of €1,000 Are you a student who used our portals to find your course of study? To help your study abroad expenses, apply for the Studyportals Student Grant now and receive €1,000. Apply for Scholarships at Grant Study portals IELTS Highlights Do you want to ensure that you receive a decent score on the IELTS exam? Attend a class. We're going to give you a huge discount. Get ready for the IELTS right now Master's degrees offered by the university 1: Nuclear Science And Engineering 2:Civil And Environmental Engineering 3:Data,Economics, and Development 4:Business Analytics 6:Nuclear Science and Engineering 7: Art ,Culture ,and Technology 8:Architecure Studies-Building Technology 9:Matterial Science and Engineering 10:Executive MBA
Are you looking to improve your putting at home? Whether you're an avid golfer or just someone who enjoys the game, perfecting your putting skills is essential for lowering your score and improving your overall performance on the green. In this article, we will explore how to set up a practice area at home and provide tips and strategies for mastering the art of putting in golf. Putting is a crucial aspect of the game of golf, often making the difference between a good round and a great one. It requires precision, control, and a keen understanding of distance and alignment. By focusing on putting, you can significantly enhance your overall game and take your skills to the next level. To improve your putting at home, you'll need to have the right tools and equipment, as well as an understanding of proper technique and form. We'll discuss setting up a practice area at home, perfecting your posture and grip, practicing distance control, mastering alignment and aim, visualizing success, utilizing putting aids and drills, as well as tracking progress and setting goals. Stay tuned for expert advice on how to elevate your putting game from the comfort of your own home. Setting Up a Practice Area at Home If you are looking to improve your putting skills at home, the first step is to create a practice area that is conducive to your development as a golfer. Setting up a designated space for putting practice will allow you to focus on specific aspects of your game and track your progress over time. To do this, there are a few essentials that you will need to consider. The most important item for your home putting practice area is a quality putting mat. This will provide a consistent surface for you to work on your stroke and develop a feel for different types of greens. Look for a mat that has alignment guides and distance markings to help you visualize the target and gauge the strength of your putts. In addition to a putting mat, you will also need a reliable putter and some golf balls. Choose a putter that feels comfortable in your hands and complements your natural stroke. Consider using different types of golf balls during practice to simulate real course conditions and improve your adaptability. With these essentials in place, you can begin honing your putting skills from the comfort of your own home. To further enhance your home practice area, you may want to invest in additional training aids such as alignment sticks, mirrors, or laser devices. These tools can help reinforce proper posture, alignment, and aim while providing feedback on the consistency of your stroke. By assembling these essentials for your home putting practice area, you can create an environment that fosters improvement and helps you develop into a more confident and skilled putter on the golf course. If I someone wants t learn more about how to improve my putting at home then they should consider these essentials for setting up their own practice space at home too. Perfecting Your Posture and Grip Achieving the correct posture and grip is essential for successful putting in golf. Without proper positioning and grasp, it can be challenging to achieve consistent and accurate putts. Thankfully, there are several tips and techniques that you can practice at home to improve your posture and grip for better putting. Correct Posture First and foremost, it's crucial to ensure that your posture is conducive to a successful putt. When practicing at home, stand with your feet shoulder-width apart and maintain a slight bend in your knees. Your weight should be evenly distributed on both feet, with your upper body leaning slightly forward from the hips. This posture helps promote stability and balance, which are vital for a smooth putting stroke. Proper Grip In addition to the correct posture, mastering the proper grip is also a key component of successful putting. One effective grip technique is the reverse overlap grip, where the index finger of your lead hand (left hand for right-handed golfers) overlaps the fingers of your trail hand. Experiment with different grip styles to find one that feels comfortable and allows for a smooth, controlled stroke. Practice gripping the putter at home while focusing on maintaining light pressure to avoid tension in your hands and arms. Repetition is crucial when perfecting your posture and grip for putting. Take time each day to practice standing in the correct position and gripping the putter in various ways to find what works best for you. By consistently practicing these elements at home, you can develop muscle memory that will translate into improved performance on the course. Combining proper posture and grip with a dedicated practice routine will undoubtedly enhance your putting skills over time – even from the comfort of your own home. Practicing Distance Control When it comes to improving your putting skills at home, understanding and practicing distance control is crucial. To become a successful putter, you must develop the ability to gauge the distance and strength needed for each putt. Here are some strategies to help you hone this essential skill: 1. Utilize putting drills: There are several putting drills that can help improve your distance control. One effective drill is the ladder drill, where you set up a series of tees at increasing distances from the hole and practice putting to each one. This will help you develop a feel for different distances and refine your touch. 2. Visualize the putt: Before taking your stroke, take a moment to visualize the path of the ball rolling towards the hole. By mentally rehearsing the putt, you can better gauge the necessary strength and distance required for a successful putt. 3. Focus on tempo: Maintaining a consistent tempo in your putting stroke is key to controlling distance. Practice swinging your putter with a smooth and even rhythm to ensure that you are not over-hitting or under-hitting putts. By incorporating these strategies into your putting practice routine at home, you can improve your ability to gauge distance and strength for more accurate putting on the golf course. Remember that mastering distance control takes time and dedication, but with consistent practice, you will see improvement in your putting game over time. Keep track of your progress and continue setting achievable goals for yourself as you work on improving your putting skills at home. Mastering Alignment and Aim When it comes to improving your putting at home, mastering alignment and aim is crucial for success on the green. Without proper alignment and aim, even the best stroke can result in a missed putt. Fortunately, there are several techniques you can utilize to ensure that your putter is aligned correctly and aimed accurately. One effective technique for perfecting your alignment and aim is to use training aids such as a chalk line or an alignment rod. Placing a chalk line on the ground parallel to your target line can provide a visual guide for proper alignment. Similarly, an alignment rod can be placed on the ground to ensure that your putter is pointing directly at your target. These aids can help you develop the muscle memory needed for consistent alignment and aim. Another useful tip for achieving accurate alignment and aim is to practice with a mirror. Setting up a full-length mirror next to your putting area allows you to see if your eyes, shoulders, hips, and feet are in the correct position for optimal alignment. This visual feedback can be invaluable in helping you make adjustments to achieve proper positioning. In addition to using training aids and mirrors, it's important to focus on developing a pre-putt routine that consistently sets you up for success. This routine may include steps such as aligning your ball with an intermediate target, taking practice strokes while focusing on the aim point, and then setting up in a way that ensures proper alignment before making your stroke. Technique \| Description \| Use of training aids \| Chalk lines or alignment rods can provide visual guides for proper alignment. \| Practice with a mirror \| A full-length mirror allows you to check if your positioning promotes accurate alignment. \| Developing a pre-putt routine \| Creating a consistent routine helps ensure proper alignment and aim before each putt. \| Visualizing Success One way to utilize mental imagery in your putting practice is to create a clear and vivid picture in your mind of a successful putt. Close your eyes and imagine the ball rolling smoothly into the hole, envisioning every detail from the initial contact with the putter to the final destination in the cup. By repeatedly visualizing successful putts, you are reinforcing positive mental associations with putting, which can help build confidence and improve performance. In addition to visualizing individual putts, you can also use mental imagery to simulate different putting scenarios. Imagine yourself facing various challenges on the green, such as sloping surfaces or obstacles, and visualize how you would successfully navigate these situations. This can help prepare you for real-life putting scenarios and improve your ability to adapt and problem-solve while on the green. Lastly, incorporating relaxation techniques into your mental imagery practice can further enhance its effectiveness. Deep breathing exercises and mindfulness techniques can help calm any nerves or tension associated with putting, allowing for clearer focus and concentration during visualization exercises. Benefits of Mental Imagery \| Tips for Visualizing Success \| Improves confidence and mindset \| Create clear and vivid images of successful putts \| Prepares for real-life putting scenarios \| Simulate different putting challenges using mental imagery \| Enhances focus and concentration \| Incorporate relaxation techniques into visualization practice \| Utilizing Putting Aids and Drills When it comes to improving your putting game at home, utilizing putting aids and drills can be highly beneficial in honing your skills and achieving better results on the course. There are a variety of tools and exercises available that can help you improve your putting performance, even without access to a traditional golf course. Here are some recommended tools and exercises to enhance your putting performance at home. Putting Mats Investing in a high-quality putting mat can significantly improve your putting game at home. These mats come in various sizes and designs, allowing you to practice different putt lengths and slopes. Some mats even come with built-in alignment guides and target holes to enhance your accuracy and aim. By regularly practicing on a putting mat, you can improve your distance control and consistency, leading to better performance on the greens. Putting Alignment Aids Using putting alignment aids, such as training mirrors or laser devices, can help you ensure that your putter is aligned correctly with the target line. These aids provide visual feedback on your alignment and stroke, allowing you to make necessary adjustments to achieve more accurate putts. By incorporating these aids into your practice routine, you can develop proper alignment habits that will translate into improved performance when playing on the golf course. Putting Drills In addition to using specific putting aids, integrating putting drills into your practice sessions can further enhance your skills. There are numerous drills designed to improve different aspects of putting, such as distance control, tempo, and consistency. For example, practicing the "gate drill" involves setting up two tees as a gate for the ball to pass through during each putt, helping you refine your aim and accuracy. Incorporating a variety of putting drills into your routine can lead to noticeable improvements in your overall putting performance. By incorporating these recommended tools and exercises into your practice routine at home, you can effectively enhance your putting performance and take significant strides towards becoming a more proficient putter on the golf course. Experiment with different tools and drills to find what works best for you, and remember to stay dedicated to consistent practice in order to see tangible improvements in your game. Tracking Progress and Setting Goals When it comes to improving your putting at home, tracking progress and setting goals is essential for maintaining motivation and ensuring continued improvement. By establishing a system for monitoring your improvement and setting achievable objectives, you can effectively measure your success and make adjustments to your practice routine as needed. Here are some tips for tracking progress and setting goals for your putting practice at home: - Keep a putting journal: Recording your practice sessions, including the number of putts made from different distances, can provide valuable insight into your progress over time. You can also note any changes in technique or equipment that may have had an impact on your performance. - Use technology to track statistics: There are various golf apps and devices available that can help you track key putting statistics such as accuracy, consistency, and distance control. By analyzing these metrics, you can identify areas for improvement and set specific goals to address them. - Set SMART goals: When setting objectives for your putting practice, make sure they are Specific, Measurable, Achievable, Relevant, and Time-bound. For example, instead of simply aiming to "improve my putting," a SMART goal might be "increase my percentage of successful putts from 10 feet by 5% within the next month." In addition to tracking progress and setting goals, it's important to regularly review and adjust your practice routine based on your performance. By continuously monitoring your improvement and striving towards specific targets, you can effectively enhance your putting skills at home. Remember that improvement takes time and dedication. By consistently monitoring your progress and setting realistic goals, you can stay motivated and continue to see positive results in how to improve my putting at home. In conclusion, improving your putting game at home requires dedication, consistency, and the right tools and techniques. By setting up a practice area at home and focusing on perfecting your posture, grip, distance control, alignment, and aim, you can make significant strides in your putting skills. Additionally, visualizing success and utilizing putting aids and drills can provide an extra boost to your practice sessions. It's important to track your progress and set achievable goals to keep yourself motivated and focused. By establishing a system for monitoring improvement, you can stay on track with your putting practice at home. Remember that improvement takes time and effort, so it's essential to remain dedicated to the process. Incorporating these strategies into your routine can help you enhance your putting performance at home and ultimately improve your overall golf game. So take the time to focus on how to improve my putting at home by implementing these tips and techniques into your practice sessions. With patience, perseverance, and a commitment to ongoing improvement, you'll be well on your way to becoming a more confident and successful putter on the golf course. Frequently Asked Questions How Can I Get Better at Putting at Home? To improve putting at home, you can start by investing in a putting mat to practice on a smooth surface. Focus on your posture, grip, and alignment while practicing your stroke. Utilize drills and repetition to build muscle memory for consistent putting. How Do Pros Practice Putting at Home? Professional golfers often use putting mirrors and training aids at home to practice their putting skills. They also work on distance control by setting up targets at different lengths and focusing on their stroke tempo and rhythm. Regularly practicing short putts can also enhance confidence and accuracy. How Can I Aim Better Putting? Aiming better when putting involves proper alignment of the body, putter face, and target line. It's crucial to maintain a square putter face throughout the stroke while keeping your eyes directly over the ball. Developing a pre-shot routine that includes visualizing the ball's path can also improve aiming accuracy on the green. I'm thrilled to have you here as a part of the Remodeling Top community. This is where my journey as an architect and remodeling enthusiast intersects with your passion for transforming houses into dream homes.
In the first half of the show, Eleanor sits down with author and history professor Dr. Gerald Horne to discuss the ongoing and growing student protests across the country, the violent response to them by the police state, and how this tracks with a history of student uprisings. Dr. Horne shares his own experiences in fighting apartheid in South Africa back in the 80s and how similar but amplified tactics are at play today in the fight against apartheid Israel. Later in the show, geographer Dr. Austin Kocher joins the show to discuss his work in tracking the relationship of space, power, and the state vis a vis immigration. Dr. Kocher shares insight into the research institute TRAC which uses FOIA requests to gain access to supposedly public record on immigration statistics, the morbid efficacy of digital detention and border control, and more. Video of Interview with Dr. Gerald Horne Video of the Interview with Dr. Austin Kocher Below is a Rough Transcript of the Interview with Dr. Gerald Horne Support our work at Patreon.com/ProjectCensored Eleanor Goldfield: Thanks everyone for joining us back at the Project Censored radio show. We're very glad to welcome back on the program Dr. Gerald Horne, who holds the Moores Professorship of History and African American Studies at the University of Houston. His research has addressed issues of racism in a variety of relations involving labor, politics, civil rights, international relations, and war. Dr. Horne received his Ph. D. in history from Columbia University, which we'll be discussing a bit today, and is the author of more than 30 books and 100 scholarly articles and reviews, including my personal favorite and the very paradigm shifting book, The Counter Revolution of 1776, Slave Resistance and the Origins of the United States. Dr. Horne, thanks so much for joining us. Dr. Gerald Horne: Thank you for inviting me. Eleanor Goldfield: So I want to go back, because as James Baldwin says, the past is not past. In the U.S. there's a history of students standing up or sitting down against injustice: sit ins against segregation, protests against the Vietnam War, against apartheid, protests against the Iraq War. Occupy was also big at campuses. And in 1968, hundreds of students at Columbia University were brutally arrested and injured after protesting weapons research for the Vietnam War that was ongoing. The university was shut down for a whole week. And now that same university along with dozens across the country is the centerpoint of protests for Free Palestine, and against the genocide in Gaza. So I was wondering, Dr. Horne, if you could give us kind of a broad picture of the history of these kind of protests at college campuses and why you feel that they are the centerpoints of protest. Dr. Gerald Horne: Well, first of all, this question of youth and student protests is not just a U.S. issue. If you look around the world, you'll find that youth and students have been in the vanguard of protests, be it South Africa, South Korea, or wherever. And I think it has something to do with a kind of inbred idealism amongst the youth who have not lived long enough to be jaded, for example, and oftentimes are told in their classrooms about the heroism of preceding generations and are told in their classrooms that the way change has arrived has been not least because of young people putting their bodies on the line. Returning to the United States of America, that's particularly been the case on these shores. You mentioned the anti Jim Crow protests. We all know that if you go back some decades to the early 1960s in the protests in Birmingham, Alabama against Jim Crow and U.S. Apartheid, these folks who were in the streets were not only students, some of them were as young as nine years old, and in part because parents would be penalized, perhaps fired from their jobs if they joined Dr. King's protests, and so in many ways that epical struggle in Birmingham, Alabama was a children's crusade. And that leads us, of course, to today, where one would have to be a cynic or an ignoramus to ignore how U.S. tax dollars are being expended in order to enforce what the International Court of Justice calls a plausible case for genocide with regard to Israeli depredations in Gaza. And so, it's no surprise that protests are spreading like wildfire, not only from New York, but through Washington University in St. Louis, Emory University in Atlanta, Georgia, University of Texas at Austin, UCLA, USC. And, I think that we need to take our hats off to these students who have joined the question, so to speak, but at the same time, not only saluting the students, we should be in solidarity with the students, making sure that they have sufficient legal support and legal advocacy as they face the prospect of being penalized in courts. And we also should engage in a bit of self criticism as well, because I'm not sure if older generations, my generation, for example, has prepared adequately these students for what they're encountering. To mention one point amongst many, justifiably and understandably, the students have raised the question of what they call settler colonialism in historic Palestine. But our generation has not done an adequate job of apprising students about settler colonialism in North America. And that opens up the students to charges of hypocrisy launched by so called Israeli patriots, for example. And likewise, our generation has helped to popularize terms like identity politics, for example, oftentimes used to describe black protests, for example. And yet at the same time, I defy and dare anyone to find any person who has ever used the term identity politics to apply to Israel, which is a state based upon an exclusivist, ethno religious identity, where privileges and exemptions are handed out on the basis of that identity. And so, we have not prepared our students, our youth, for what they're encountering, and we need to, of course, go back to the woodshed as a result. Eleanor Goldfield: Yeah, absolutely. I mean, as you were speaking, I was reminded of, Asatta Shakur's quote, No one is going to give you the education you need to overthrow them. Which seems very apt here in the U.S. And so I'm also curious with this historical look, we're coming up also on the anniversary, the 54th anniversary, I believe, of the Kent State shooting. And there have been, you know, people have talked about whether National Guard would be called in, riot cops have been called in already and have brutalized students across the country. We've seen images of this. They've even brutalized professors who have been screaming that they are professors. So I'm curious if you could make that comparison with regards to the police state's response to protests then and now, and if you see it as a possibility or even a likelihood that we would see another Kent State type situation at one of these universities. Dr. Gerald Horne: Well, I regret having to say that that is a distinct possibility. I need only point you to the recent inflamed remarks of Senator Tom Cotton of Arkansas after pro Palestinian protests erupted in the San Francisco Bay Area. He suggested, to put it euphemistically, that muscular tactics be employed against these protesters. Recall this is the same Senator Cotton who, during the George Floyd protests of a few years back, wrote an op ed controversially for the New York Times, suggesting similar so called muscular tactics, which of course led to the editor of the op ed page having to be forced out of his office, not least because of protests by Black journalists in particular at the New York Times. And I might also say, that as an alumnus of Columbia University, as you mentioned in your introduction, I've been following that case very carefully. And if I may say so, I think that President Shafik of Columbia, shall we say, has been ill served by her advisors. Obviously, she did not have that much contact with the United States of America before assuming this prestigious post in Morningside Heights. She is of course of Egyptian origin. And had served with international financial institutions, had served in London. And I think that her advisors should have told her, or should have impressed upon her more pointedly, the fact that bringing police onto campuses as Columbia 1968 shows, and other examples subsequently have demonstrated, is not the ideal way to deal with a peaceful protest. Not least because we all know. that there is a strain of so called right wing populism amongst police forces who have a particular animosity and antipathy to what they consider to be elitist universities, populated as they see it by elitist students. And so at times when they march into the campus, they seize the opportunity to wage and enforce a kind of rough justice from their point of view on these students. And so this was utterly predictable what has unfolded in the past few days, and I think that the authorities at the University of Southern California are learning the same bitter lesson, but alas, it all began in Morningside Heights, Columbia University. Eleanor Goldfield: Yeah, absolutely. And I'd like to shift here to, again, some history, since I have you here, and talk about something that I feel a lot of people, I wasn't taught this in school, a lot of people don't know about the Powell memo. Louis Powell, who was a U.S. Supreme Court justice, wrote in 1971, before his appointment to the Supreme Court, what's known as the Powell memo, a memorandum to the U.S. Chamber of Commerce, with suggestions on how to protect the American free enterprise system from its enemies, i. e. communists, socialists, and, as he says, other leftists. He notes that this movement against the system often originates from college campuses and calls it the most, quote, dynamic source of the assault on American enterprise and decries speakers and teachings at these campuses that criticize American capitalism and, quote, the values of Western society. He writes about the need to stack the faculty with conservative professors to outweigh liberal and leftist viewpoints. He calls on the Chamber of Commerce to be an organized battering ram against this wave of dissent, suggesting a staff of scholars who, quote, believe in the system to be put forward for posts, a staff of speakers to speak for the chamber at universities, the evaluation of textbooks to make sure that pro business perspectives are included, and other ways of dominating campus life. Dr. Horne, I'm curious, how would you rate the efficacy of this memo? And do you see what's happening now as a shift away from what Powell had hoped and planned for? Dr. Gerald Horne: Well, it seem as if Justice Powell, to use his subsequent title, had the gift of prophecy. Because what he outlined some decades ago, we see being implemented from coast to coast as we speak. You may know, according to an article in the current issue of the American Historical Review, the leading journal for the historical profession in the United States of America, that there's a war on Black history, for example. Nikole Hannah-Jones 1619 Project, first a New York Times Magazine special about five years ago, and now a best selling book. Fundamentally, it has been banned in Florida and in Texas, according to this article. You have librarians that are being threatened. You have high school principals and teachers who are being threatened. At Indiana University in Bloomington, Indiana, now supposedly there is going to be allegedly a way to monitor professors to make sure they're presenting all points of view in the classroom. So I guess that means that you just can't be anti slavery, you have to bring the pro slavery point of view into the classroom. You just can't be anti Nazi, you have to be in the pro Nazi point of view in the classroom. And likewise, you have these universities, many of whom are dependent upon the favors of billionaires that are being pressured. Likewise, Robert Kraft, who also happens to own the New England Patriots football team, of course, is a resident of Massachusetts, has been suggesting that in light of events at Columbia, he's turning off the tap in terms of his donations to his alma mater. You see that Bill Ackman of Persian Capital, another card carrying member of the 1%, is boasting about how he led the charge to force out of office Claudine Gay, the first black woman president of Harvard University, forced out a few months ago. We see that at the University of Florida in Gainesville, a former U.S. Senator, Ben Sasse of Nebraska, has taken the helm as president. And now we see erected at that campus in Gainesville, an entire college devoted to so called free enterprise principles. Although it's going to be very interesting to see if they're going to be held to the same standards as other faculty in terms of publishing, for example, or if they're just going to hand plum faculty posts to propagandists. This is a clear and present danger with regard to the Israeli question. You're probably familiar with these various so called blacklists that are circulating on the internet. I don't know if I should say I'm part of one singling out faculty because of their pro Palestinian positions. Who knows how that's going to be used going forward. And so what Justice Powell suggested has gone beyond his initial statements. We're facing a real rollback of academic freedom. In the current issue of the New Yorker, there is an article by the Harvard professor, Lewis Manon, who says as much and suggests that many will come to rue the day that academic freedom was rolled back. Because on the one hand, you have seen that the United States of America has tried to preen and posture on the international stage as being a paragon of civil liberties virtue, stressing the efficacy of free speech, the right to petition, the right to protest, et cetera. But now we see that some of these pledges and promises have been empty in many ways because when the rubber hits the road, when people begin to exercise their right to protest, you see that jackbooted police officers come on campus and drag faculty members off by the nape of their neck, as happened to a professor of philosophy at Emory University, not to mention countless students from the Atlantic to the Pacific. Eleanor Goldfield: Yeah, absolutely. And with regards to you mentioning the income aspect, the Associated Press reported recently that according to the education department database, about 100 U.S. colleges have reported gifts or contracts from Israel totaling $375 million over the past two decades. The data tells us little about where the money comes from or how it's used. And the Associated Press, which, by the way, is not like some pro Palestine rag also points out that underreporting is rife. So this is just the reporting that we're aware of. So, Dr. Horne, I'm curious with your experience in universities and colleges, what do you think is going to happen here? Because these universities are literally getting bankrolled by Israel and Israeli interests. I mean, it doesn't seem like the students are backing down, which is really powerful to see. But it doesn't seem like the universities feel that they can, because, oh, there goes the purse strings. What are your thoughts on that? Dr. Gerald Horne: Well, the United States is in a classic dilemma. With regard to students not backing down, once again, Columbia students have set the pace. Recall that shortly after President Shafik's escapade on Capitol Hill, where she threw faculty members overboard, tossed them to the incoming Republican wolves in order to try to save what she thought to be the tattered reputation of her university, Columbia, she went back to campus and was greeted by a hellstorm of critique from faculty, who are now in the process of investigating her. Apparently, she released confidential details in Washington about investigations of faculty that she was not authorized to release when she brought cops onto campus. Students did not fold. Instead, they escalated, they enhanced and increased the nature and level of the encampment. And likewise, with regard to the suspensions that are being implemented of students as we speak, the students once again have escalated. They have seized a building, Hamilton Hall, which has been the site of numerous protests at Columbia University, not only in 1968, but in the mid 1980s with regard to anti apartheid protests. So there's a glorious tradition there. I'm not sure what's going to happen because I think that the billionaires who are pro Israel feel that there is wind in their sails. You might've seen the article in the New York Times by Andrew Sorkin, who, as you know, has a side hustle on CNBC, where he suggested that the corporate sector monitor and flyspeck carefully applicants for these prized positions and basically refuse to hire students who have been implicated in these protests. So once again, you see this contradiction. On the one hand, the United States likes to boast and brag about how it comes out of this so called revolutionary tradition, which leads inevitably and inexorably to the first amendment,and the right to protest, et cetera, supporting democratic upsurges abroad, be they in Myanmar, Burma or elsewhere. But when it comes to this country, when people decide to take that rhetoric seriously, you see that there is a crackdown. So speaking objectively, I have to say I'm not very optimistic about what's going to happen on campuses going forward. I don't want to throw cold water on the students protests because as I said, I think that they merit and deserve our unstinting support. But it doesn't seem like the other side feels depressed or it doesn't seem like the other side is in any way in retreat. And so what that means is that we're going to have to emulate the students at Columbia, which is to escalate until they retreat. Eleanor Goldfield: Yeah, absolutely. And I wanted to circle back because you mentioned the apartheid protests in the eighties. And of course, right now, these protests are targeting the apartheid state of Israel. And I'm curious if you could talk a little bit about how you feel those student protests in the eighties had an effect on ending apartheid in South Africa and how that might be emulated today with regards to the effect of these protests on the apartheid state of Israel. Dr. Gerald Horne: It is difficult to either overestimate or underestimate the profundity of these protests on campuses during the 1980s. Not only on campuses, but you might recall that at the South African embassy in Washington, D.C., beginning shortly after the November 1984 elections, there erupted the so called Free South Africa movement, where it became a kind of badge of honor for celebrity protesters to be handcuffed and dragged away from protesting apartheid. Recall that these protests not only had impact with regard to universities, anticipating the demand of today, that is to say divestment, divesting, from corporations that have had holdings in apartheid South Africa. But you also saw that it had a catalytic impact on anti apartheid legislation that passed over the veto of U.S. President Ronald Wilson Reagan, who by the way was trying to throw sand in the eyes of the U.S. public by arguing that South Africa had been a long time, long term ally, speaking of apartheid South Africa, when in fact we know that in the 1930s and the 1940s, the apartheid and pre apartheid rulers were figuratively in bed with Nazi Germany, for example. And so these students, by adopting this tactic of divestment, on the one hand, they localized a global issue, but at the same time, they helped to contribute to a national movement with regard to legislation in Washington. And it's still remarkable to note that even though the so called European allies are oftentimes to the left of the United States or even Canada, for that matter, with the single payer healthcare system, the United States, in many ways, was to the left of the so called allies with regard to anti apartheid legislation. That is to say, the United States was a pioneer in that regard, which is quite unusual. And I don't think that we can understand that without understanding the energy of these student protestors, not least at Columbia University, and the energy of the anti apartheid movement. Now, obviously, the situation with regard to Israel is a tad different. If you look at the central constituency with regard to the anti apartheid movement, although there may have been naysayers here and there, the black community was, generally speaking, united in one voice against apartheid South Africa, and that paid dividends with regard to divestment, with regard to sanctions legislation. I don't think I'm talking out of school to suggest that the central constituency with regard to Israel, speaking of the Jewish community, is split. That is to say, honorably and justifiably, there's Jewish voices for peace, there's, if not now, there are many heroic protesters with regard to Israeli genocide in Gaza that emerged from the Jewish community. But it's no secret, as my preceding remarks suggested, that you have a number of pro Zionist billionaires, not only Robert Kraft of Massachusetts and Bill Ackman, but the Adelson family of Nevada who have enormous gambling interests funding both the Republican Party and funding the Likud Party and Mr. Netanyahu, more specifically. And so this fissure, this split in the central constituency, speaking of the Jewish community, helps to distinguish it from what happened in the 1980s. And we're going to have to put our heads together and figure out what that's going to mean going forward. Eleanor Goldfield: Yeah, absolutely. And, kind of wrapping up here, as far as I understand, what we didn't see during the apartheid protests back in the eighties was the, I mean, you mentioned the Adelson family and Adelson actually had this meeting with Netanyahu where they created this project to basically surveil, in particular students to try and root out this anti Israel, this anti apartheid organizing. I mean, we've read about it in several different news outlets about how there's so much surveillance of these kind of activities in order to root it out, in order to call it anti Semitism, et cetera, et cetera. And so I'm curious if there's any kind of comparison there, was there like a blacklist back then of people who were anti apartheid in South Africa? Was there any kind of machine like that that was also working against students in that way? Dr. Gerald Horne: Well, I'm afraid to say, there was a similar machinery. In fact, if you look at my book on the anti apartheid movement, the coming to independence of South Africa in 1994 you'll find that your guest himself was being surveilled. That is to say, and here's where the confluence comes, that the Anti Defamation League of B'nai B'rith was monitoring people like myself and had an association with certain, I'll say charitably and euphemistically, rogue police officers in the San Francisco Police Department, although they might not have been rogue at all, who were monitoring those of us in the movement. I recall, for example, that when Chris Hani, a leader of Nelson Mandela's African National Congress, came to Los Angeles, I hosted him. There were intelligence reports filed with regard to his remarks, with regard to my being the emcee of his appearance. And then shortly thereafter, Chris Hani was assassinated in South Africa as he was out for a morning jog, and I often wondered if there was any sort of correlation between those two events, whether or not his, I'm afraid to say rather poor security was noted in Los Angeles and whether or not that was transmitted to the apartheid authorities in South Africa who acted accordingly. However, having said that, I think that what's happening with regard to protest today dwarfs the monitoring and surveillance of what was taking place in the 1980s. And I think it has a lot to do once again with the fact that you have a number of billionaires in particular, who were rather open and notorious in support of Israeli apartheid. Oftentimes, in the 1980s, many who were profiting from cheap black labor in South Africa were using different sorts of rationales to justify that. For example, that sanctions would hurt the black majority, ultimately. And they were not necessarily coming out in a full throated endorsement of apartheid. And so what that means is that in some ways we face a rougher uphill climb today than we did in the 1980s, but given the role model that we're all seeking to emulate, speaking of the students at Columbia, the students at UCLA and USC and in between, I'm confident to report that like in the 1980s, I'm sure will prevail in the 2020s. Eleanor Goldfield: Yeah, absolutely. Thank you so much for that, Dr. Horne. And I was wondering if you have final thoughts or even suggestions for students who might be listening to this and are out protesting, or as you pointed out, folks like myself who are no longer students at universities, but rather students of life that are looking to work in solidarity with these students. Dr. Gerald Horne: Well, one hopeful sign that's erupting as we speak is a renaissance, if you like, in the union movement. I'm looking specifically at the United Auto Workers under President Shawn Fain, which has had enormous and significant victories in Tennessee, the heart of darkness, that is to say, Dixie, when it comes to civil rights and civil liberties. That bodes well. And I would suggest that the students find a connection with the United Auto Workers, which shouldn't be that difficult, for example, because at places like Columbia, a good deal of the staff, believe it or not, are UAW members, because the UAW has organized beyond auto plants, for example. And those of us who are students of history recognize that if you look at the anti Jim Crow movement in the 1950s and 1960s, the silent partner was the United Auto Workers, under then leader Walter Ruther, that helps to explain why Martin Luther King and his comrades could fly all over the country, and participate like a historic example, or historic analogy just to a kind of Johnny Appleseed, for example. And it's not just United Auto Workers and other unions, but also celebrities, entertainers like the late Harry Belafonte. So I would suggest that the students try to find a connection with local unions. That should not be difficult in a place like Los Angeles, for example, where the L.A. County Federation of Labor has come out, like the UAW in favor of a ceasefire. I think that they will be predisposed to listen to the inquiries and requests of student protesters. And likewise, I would suggest that the students hook up with the National Lawyers Guild in existence since 1937, a left leaning organization of lawyers and legal workers. Full disclosure, I used to work closely with the National Lawyers Guild. They were very helpful to anti apartheid protesters who were getting detained and arrested in the 1980s. So that would be my recommendation to students, but if recent history is any guide, I'm sure that they beat me to the punch by already anticipating those sorts of suggestions. Eleanor Goldfield: Well, we hope so. It seems that they have a good handle on the present and therefore we hope that they have a pretty good handle on history as well. Dr. Horne, thank you so much for taking the time to sit down with us today. Really appreciate it. Dr. Gerald Horne: Thank you for inviting me. If you enjoyed this segment, support our work at Patreon.com/ProjectCensored Below is a Rough Transcript of the Interview with Dr. Austin Kocher Eleanor Goldfield: Thanks everyone for joining us at the Project Censored Radio Show. We're very glad to welcome to the show Dr. Austin Kocher, who is a geographer and assistant professor at the Transactional Records Access Clearinghouse, or TRAC, a research institute at Syracuse University that uses Freedom of Information Act requests to study the U. S. immigration enforcement apparatus. He also has a faculty appointment in Syracuse University's Department of Geography, an affiliated expert at the Institute for Democracy, Journalism, and Citizenship, and he's a research fellow at the Center for Latin American and Latino Studies at American University. Dr. Kocher, thank you so much for joining us. Dr. Austin Kocher: Very glad to be here. Thank you. Eleanor Goldfield: So I'd like to start with TRAC, the Transactional Records Access Clearinghouse, a comprehensive website with an, with in depth stats on federal enforcement staffing and spending anywhere from the IRS and FBI to immigration. And while I do recommend that folks check out all the categories, like I found it interesting, if not, interesting, not that surprising that the FBI investigations into white collar and corporate crimes are at an all time low. Today we're going to focus on immigration. And there truly is, a book or an encyclopedia book, series worth of information and stats to dig into. But on a more zoomed out level to start with, Dr. Kocher, as we tend to cover censored issues here on this show, why is a place like TRAC necessary when the information that you gather is supposedly public record? Dr. Austin Kocher: Yeah, it's a great question and that's part of what animated the founding of TRAC more than 35 years ago. Dr. Sue Long and New York Times journalist David Burnham were really interested in trying to understand, and uncover information about different federal agencies that, getting records that should be in the public domain, but aren't yet. one of the unique things that we do, unlike a lot of other institutes or journalists or researchers that use Freedom of Information Act requests to get records, we go after digital records. So we don't go after really paper records. so what that means for us is, most of the, most people probably understand that. There's been a massive shift in how government institutions are run, over the past 20 to 30 years. And most of the information that, when the Freedom of Information Act was written back in the 60s and 70s, government records meant paper records. today, all this data is stored in databases, and unlike paper records, databases are really complicated and to write good FOIA requests and to get these records and understand them requires an added level of expertise, understanding how government data systems work and how to get the information and then do something with it. So that's where we really specialize. And one of the interesting things that I love getting to do in this work is that, even though the records are public records, the process for getting them and making sense of them is so much more complicated. So they should be public, but in fact, One of the things I like to, to bring to people's attention is in fact, these days, it's not just about making the records publicly available. In fact, most of the public is overwhelmed with information. So government agencies are putting out more records and more information, but if you don't know how to understand them and make sense of them and make them legible to people, then all that information on the internet, isn't going to make a difference. So we really tried to bridge the gap, not just in terms of getting records, but also helping people to understand what's there. so that they understand how their government works. Eleanor Goldfield: Yeah, and I can't help but feel that, as a cynic, that this is done on purpose, and I'm curious to hear what your take is. Why is this information made so obtuse or abstract so that somebody who's not an expert couldn't, couldn't access it? and could you talk also a little bit about your experience in trying to obtain this? it's not as simple as just sending in a simple request. Dr. Austin Kocher: Absolutely. the government agencies that we are looking at in particular, immigration enforcement, they don't have any institutional incentive to making this information public because more public oversight means more potentially more accountability. And this is these are not agencies that are, let's say, enthusiastic about public oversight and accountability, so they don't really have an incentive to do it and what that means for us is oftentimes we send in public records requests, and we get a variety of denials and rejections, that we, feel really strongly or know that are unfounded or unsubstantiated, and it's not always because the agency is explicitly trying to hide some secret thing, it's just that there is a culture of un transparency of trying to hold onto this data and hold onto records at the agency, which means we often have, you have to go into it being prepared to fight a little bit. whether that means writing FOIA, appeals to the rejections, you can appeal rejects to public rejections of public records requests. It means sending in a lot of public records requests and you try to get at records in more than one way, so that you might get a rejection or a denial kind of on one. Requests, but maybe you get something back on a different request. we never send in just one request for anything. We send in more than one. and then, last worst case scenario, which is unfortunate, very common case scenario is we may have to litigate. We may have to go to court and file a lawsuit in court, which is really, intensive and demanding for us, but it's also demanding on the agencies cause then they have to send attorneys and it does cost, the taxpayers dollars. And in fact, Whether it's the Obama administration, the Trump administration or the Biden administration, these aides, it's not as if a new administration comes in and all of a sudden they are just thrilled to work with the public. there's lawsuits that have been ongoing for administration after administration. We don't see a whole lot of change on that. it does take a lot of work and effort, but because of, because we've been doing this for a long time and we refuse to give up, and we are very tenacious in our work. We are actually able to get a lot of records and we win a lot of lawsuits. Eleanor Goldfield: And very glad we are that there are people like you who are that tenacious and are able to stick to it. I want to shift a little bit here to something that, something that's mentioned on the website. the role of technology in immigration, because I think we still have, we've moved on from the picture of Ellis Island, but we still have a pretty, analog perspective on how immigration works, right? Like people walk up to the border and there's some kind of interaction there and then, whatever happens next. But there really is a, like this boost in tech of technology and immigration. And I was wondering if you could talk a little bit about that and also how this impacts then the surveillance apparatus that will follow these people wherever they end up going. Dr. Austin Kocher: Absolutely. It's the biggest change that I've seen personally in the last two to three years. the Trump administration and Trump himself is known for the "build the wall" phrase. And one of the interesting and problematic parts of that is not just that we know walls don't really work that well to control migration. It's a nativist nationalist slogan. it's there to amp, amp up a base, amp up, a certain kind of political base. but it's also a very simple. Idea of the border. And so actually, a lot of people think of walls as being synonymous with borders in some way. And one of the things that I think the Biden administration has done differently, and I would say more effectively, but I would put effectively in air quotes, is I think the Biden administration understands that walls don't work quite that way. And that actually, much like what's happened in the European Union, and other places Parts of the world, the use of technology can be a much more effective bordering tool actually than walls. And what that means is, these days, there's, for instance, there's two main, smartphone applications that, the Department of Homeland Security uses to collect data on and monitor and process migrants. One is called CBP One It's an app that asylum users, sorry, asylum seekers use. Actually, the Freudian slip there is very important because one of the ways that I have been theorizing this technology is the way in which the technology turns essentially refugees into users, Facebook user, Twitter user, CBP One user, and so it's an app that migrants have to download onto their smartphones and use in order to even try to get asylum in the United States, and it's an app that they can use as far south as Mexico City, so it really extends quite deep into Mexico. and then, even once migrants get through that process, they may be put on another smartphone app called Smart Link, which serves as a kind of electronic ankle monitor. You can't see it. It's not on your ankle. It's on your smartphone. but it does serve much the same purpose. And so you can think of that, you can think of these apps as being both outside of the United States, ways of the United States expanding and expanding border control deep into Mexico, which the United States has been doing for a long time, but now we're doing it with new technologies. And then also it's extending and expanding that border, Technology and that border apparatus deep into the country because migrants are using that smart link app, all over the country, not just near the border. So the reason, the takeaway message from all of that is that I think currently the Department of Homeland Security is really seeing that bordering mission that they have of quote unquote controlling the border and regulating migration control as a much more geographically expansive project, not just something that's build the wall, but it's actually build the network. that's what the Biden administration is doing. And what that means practically is in the short term, some of these technologies have or have purported mix of benefit. And it's a little bit of stick and a little bit of carrot. And when I interview immigration attorneys and migrants and other people who work in that space, they are struggling with the fact that there, there are actually some benefits. to some of these technologies, but they are also keenly aware that the larger negative, and there are lots of negative consequences, by the way, but, but the larger negative societal level and political level consequences are massive data collection of migrants. And these data systems, which I described those two apps, At this point, they're not exactly directly linked together and on a migrant smartphone, but they do all feed into common data sets, data systems and databases, which now gives the Department of Homeland Security, I think, a really massively quickly expanding, a pool of data and resources to effectuate deportation programs. So here's, I'll just close this part of the conversation with what in my mind is both a nightmare scenario, but not that far off, which is if we get another Trump administration, and at this point, it's a coin toss, if not maybe even slightly more likely based on the polling that we'll have a second Trump administration, that Trump administration is going to have massive more access to data on migrants because of what the Biden administration has built. And if they wanted to roll out massive deportation programs, raids, sweeps, ice knocking on people's doors. they could do that and they could do that quicker and more effectively at scale because of the massive amount of data that the Biden administration has collected. So I think that's a real. we are in for a very interesting and concerning decade when it comes to surveillance of migrants. Eleanor Goldfield: Yeah, absolutely. I often say that neoliberalism paves the road to fascism and, of course, Obama handed Trump the most, the largest surveillance network that the world has ever seen with regards to the NSA and was like, here. yeah, it is, it is very, very dark Nightmare scenario, indeed. And I'm curious, with that, with the technological and surveillance aspect, I think there's another side of this that people don't know about or think about, and you discussed this on track as well, ATD programs. Could you talk a little bit about what those are and how this, quote unquote alternative could in fact also be darker, in some ways? Dr. Austin Kocher: Certainly. So the Alternative Detention Program has been around since 2003. there were these experiments in the 90s to say, Okay, we're starting to expand immigrant detention. We're putting, immigrants, migrants into what is not prisons. Technically, they're civil detention facilities. These are not people who are held on criminal charges in any way. it's a very, almost a barely legal kind of system. And one of the options that the in the 90s was proposed was to say, we don't really need to keep all these people in detention. What they need is community support, legal support, so that while they're going through their immigration process, they they're going to go to their hearings, they're not going to, they're not, they're just, they're trying to apply for asylum, they're trying to find a way to stay in the country legally, they're trying to do it the right way, they don't need to be in detention, and we don't need to spend tax dollars doing that. what that turned into in the, during the first Bush administration was effectively creating not a true alternative to detention, where we were taking people out of detention and reducing detention, but actually an expansion of what we in geography called sort of carceral logics of migrant control. detention never went down. Detention's always gone up, but alternatives to that, to detention as it's called, is basically an electronic monitoring program, somewhat like pretrial and post conviction, detention. Programs in the criminal legal system where there's, ankle monitors and check ins with the parole officer. That's a similar model that we use in immigration these days. but again, rather than really serving as an alternative, what it's done is it's massively expanded. How many people are monitored on a regular basis, by immigration customs enforcement, and that's actually that program that the smart link app I was mentioning, that's one of the technologies that is now being used. There's a smartphone app. They still use ankle monitors, a very old technology that they use. and in fact, they just started rolling out in the last year, smart watches. so now there's like an ankle monitor, but it's a smart watch, so they wear it on their wrist instead of their ankle. and that, we track these numbers, so we've seen that go from a year ago, they had a pilot program in Denver, Colorado, with 50 people. And the last I checked, there's 1, 500 people now on that smart watch program. in addition to this alternative detention model being not really an alternative, much more of an expansion of sort of control. By the way, I should just add, there's also, part of that is also, some people are put on a kind of home restriction, they can't leave their home, or they can't leave certain areas. they can't leave their city. They can't leave their state, without permission. obviously this creates all kinds of problems to see family, just normal things that any of us would do. They have all kinds of additional restrictions. For the smartphone app, this is really concerning. They often get notifications through their, smartphone about different immigration things. And many of them report a real increase in psychological distress, not only feeling Oh my gosh, the government is on my smartphone, but also if I don't answer a notification, I'm going to be deported. that's so it can be pretty terrifying. I think for people on it, even though. Even though if the dilemma was really between, should someone be in detention versus not in detention, any of the attorneys I talked to will tell you, whatever we can do, we don't want our clients in detention. But, but because of the harsh consequences of detention, it's The government kind of sets up something that's really harsh and then says, Oh, if you don't want that, take this slightly less harsh thing. And then that's the mechanism for forcing people to decide between two things that the government itself has set up. and in my view, we should question both. We shouldn't view it as one or the other, but actually question, why do we have any of these systems in the first place? Eleanor Goldfield: Yeah, absolutely. if somebody has an ankle monitor and they're on house arrest, you wouldn't call them a free person, so they're still under detention. And I'm curious, do you, is this considered, with TRAC, are these numbers combined in, an overall detention, or do you split them up and make that distinction? Dr. Austin Kocher: Yeah, so we, on the data that we get that ICE publishes every two weeks, we, Use the distinction that's common in the field of policy research and how ICE classifies this data. So we do track detention numbers in terms of immigrants in detention and ATD numbers separately. there's two reasons for that. One is just from a data science perspective, they represent two quite different populations with different sort of characteristics and different data sources. So to combine them, we'd have to. We'd have to do some work, you'd have to make some assumptions and it might be confusing for some people. so that's one reason. The other reason is, from a practical perspective, we are, we're also tracking trends and the trends in those two areas differ in many ways. So we want to be as analytically precise as possible based on the data we have. So we do keep them separate. however, I, as a researcher and as a geographer, I'm always looking for ways to not just how do we describe accurately described trends and make sense of the data, but also how do we theorize this, within the understanding that we have. as a in sort of critical social sciences, thinking about the state capitalism power race and racism, all these kinds of questions. And so that's where I really draw on, some of my colleagues like, Ruth Wilson Gilmore who's a geographer. And others who would theorize some of these things around ideas of racial capitalism, Dominique Moran, who's a really great British geographer talks a lot about, carceral circuitry, circuits of carceral power, and to actually try to stitch together this idea that it's not, alternatives to detention, end detention and border control, but actually what animates all of these things is this notion of controlling bodies, particularly people of color's bodies, in the U. S. sort of, project of racialized nation state making and, reproducing the state. So it's really a question of, how does the state use different kinds of technologies and geographic parts of control and exercise of power to carve out these kind of exceptions for people who quote unquote don't belong, don't deserve. whatever, however you want to think about that in terms of the current policy environment. So that's what I really try to do is I try to help people understand, Hey, it's not one or the other, actually the logic beneath all of these are really crucial to understand what that allows us to do then is not just to theorize these better, but actually then to take a next step and say, how do you dismantle things like this? How do you challenge it? And one of the ways you do that is you start to recognize that, the immigrant detention is not a problem for brown people or Latinos or Hispanic people. And then the criminal legal system in the United States is about black and African, right? But it's actually, there's all kinds of overlaps here. And actually the more that you bring, and by the way, working class white people are also affected by these things. So how do you bring together the, that the collapse of the welfare state, the act of the active dismantling of the welfare state with the rise of border controls and the rise of technology for monitoring and say, actually, this is a problem affects lots of us. in fact, I misspoke a second ago. I always add this as a footnote. I said that these technologies are about monitoring migrants, but in fact, that's not totally true. it affects anyone who's in these households, and many of them live with children or spouses or grandparents or partners that are U. S. Citizens as well. And so if you're near, or in those similar spaces, you're effectively wrapped up in that sort of surveillance apparatus. So it does actually affect all of us, which is not to say it affects all of us equally, but it does affect all of us. And it's a question that we all need to be asking ourselves. Eleanor Goldfield: Yeah, absolutely. And I love that you stitch things together because that's very much what I like to do as well. And, we recently had on the show Christian Sorensen, who has done a lot of work mapping the, the business of war. And one of the things that he pointed out is that it's not the border industrial complex. It is the military industrial complex at the border. And, it is. I often times say that imperialism is a home game. we turn that violence inwards as well. Because if you only speak to the world in one language, and that's the language of violence, it's ridiculous to assume that you could come home and be Mr. Rogers. And so I really appreciate that you combine those issues, I think that's so important. And with regards to the ATD, I can't help but wonder, and this might be a question that doesn't have an answer or that you don't know the answer to, but okay, so we have the ATD, which is dark and Orwellian and Black Mirror esque, but then why are there still kids in cages? Like, why is that still a thing that happens? Dr. Austin Kocher: Yeah. Yeah. it's very practically speaking. there's always going to be an aspect of the immigration system, at least under the current model that, where one exercise of carceral power is about detaining and controlling bodies and confined spaces like that. and in fact, it's more helpful to view detention as a pathway to monitoring, so it is part of the pipeline, detention is what, being in detention is in many cases. That is actually what gets you put on electronic monitoring and then being on a lot electronic monitoring. Once you're in that sort of system, it's just much more likely that you're going to end up back in detention again, because you didn't make an appointment, you didn't answer a notification, like whatever the reason might be. So it's definitely a system that relies on rotation. and so in, in some ways, we can think about electronic monitoring as could it exist actually without detention? Like they're just so closely interconnected, but you're right. it's, and that's one of the easiest things to point out when talking about, about what this alternative detention model, why is it even there when we still have people in detention, especially kids? And it's, it's just, it's because they're, they require each other, they need each other, for the system to work, unfortunately, it under this model. Again, we can certainly imagine different models. We didn't always have this model. There, there was no such thing as immigrant detention like we have it today prior to 1980. it literally, the non, the for profit prisons that we have today in America were, the first ones were for immigrants. Then it expanded to other areas, but the first ones were for immigrants. classic story of immigrants and marginalized people getting something tried out on them first and then expanding to the rest of the population. In fact I mentioned CBP one is the app that asylum seekers have to download on their phone. the customs and border protection, which oversees that program has just submitted a request, for approval through the, normal federal rule change process to expand the use of that app to immigrants who are coming to the United States and other ways, lawfully. Not asylum seekers, but other people. And you can imagine these technologies again, they just, they get bigger and bigger and it won't be that long if you're a U.S. citizen that lives in the U.S. Mexico border area or the U.S. Canadian border area. this app is going to be on your smartphone in a couple of years and you're going to have to do things with it. So it's, that's why we have to pay attention to these things early and often. Eleanor Goldfield: Yeah, absolutely. And again, very glad that you made those connections. And I want to circle back with the time that we have left, because you mentioned, of course, that this Network reaches as far south as Mexico City, and it reminds me of this idea that where I actually saw you first was at a book event here in Baltimore at Red Emma's, where you were on a panel discussing John Washington's book, The Case for Open Borders, and in that book, something that it highlights is how borders are so malleable and movable, and yet we think of them as these steadfast, immovable spaces, particularly the southern border. And yet you just pointed out, no, the U. S. southern border, at least digitally, extends far into Mexico. And so I was wondering if you could talk a little bit about, you mentioned you're a geographer, and I think some people listening might be like, what does that, that's not like immigration law, like, where does this connect? Could you talk a little bit more about this area of study, the legal geographies of immigration? Dr. Austin Kocher: Yeah, absolutely. And, for geographers, what we're really interested in, what I'm interested in as a political and legal geographer, is this connection between space and power and the state. mostly applied to immigration. although I'm also done some work around policing and other questions. And, for geographers, the reason that we're interested in space. Is twofold from like a big picture perspective. We can't imagine human existence outside of some sort of spatial, aspect. we create our, we create some kind of home for ourself. That's a part of placemaking, part of placemaking and creating the space that we live in. Often means we create these sort of ideas about who belongs and who doesn't belong. and this is something that becomes very much wrapped up in identity. So we think, the Jim Crow era was all about creating all of these micro borders and all of these geographic forms of social control to keep black and white people in the South separated with that aspect of maintaining racial control and white hegemony. and controlling integration in very careful ways. This is also something that happens, so that's a racial example. That also happens with gender, the way that spaces are coded as masculine or feminine or non binary or the ways in which heteronormativity plays out. Where, some spaces are saturated with those kind of masculinist tropes and images and practices. And so one thing that's always a part of our understanding of how, power works in society is how space is actually created and controlled. That, all of those things are also true on the national level, where, you know, one of the most serious, And in my view, one of the most damaging, ideas and, evolution and how human societies organize itself is around this nation state system, which is quite young. Most of the world had no such thing as boundaries and borders and nation states, that we have today. If you look back at a map 300 years ago. A couple, little bit of parts of Europe, and that was it, and so this is a model of human organization that has spread really dramatically. And although there's always been different kinds of forms of social division, the nation state model brings with it this, what Weber calls the sort of monopoly on the use of force and power. So then we get. armies that are attached to territorial control on the outside, and we get police that are that expression of state power on the inside, and we get borders, which are all about regulating this access to space and access to population. One of the most important things that's happened in, let's say, the last hundred years, and this is where sort of my research comes in, is that there's Is that we've seen or let's say the last 50 years is we've seen with the combination of globalization and the collapse of sort of post World War II Bretton Woods institutions, and as you said, the growth of neoliberalism, one of the things that has emerged is that borders, although very important, heart, hard physical borders at the edges of nation states, although that's really, those are continued to be in our more militarized than ever Most countries and most people who are the captains of industry recognize that actually we need a different labor geography that a nation state model can't provide. and capital and capital flows of investment and accumulation and dispossession are all phenomena which are cross border. So there is no company, there is no such thing as an American company anymore. There isn't a company that doesn't have manufacturing and labor all over the world. And there isn't a company that, that solely keeps their money located in one country. it's, these are investments and the flow around the world. And so we already know that in many ways, borders are a leftover technology. And yet at the same time, what we've seen militarized. But what we've also seen is these mechanisms of control have also You know, their geography has changed dramatically to keep up with this. yeah, the app goes deep into Mexico. we could even ask ourselves, what, that's, a, weird question of, territorial sovereignty. Does the United States have the right, to require it? so it's a question, but at the same time, the U. S. has been funding, Mexico's southern border enforcement for a long time. FBI and ATF agents regularly work throughout Latin America. One of my colleagues, Matt Coleman, Ohio State University, working with Kendra McSweeney there, they're looking at Coast Guard interdictions off the coast of South America. You think of the Coast Guard as going around the United States, they're not. they're getting approval from countries in South America to go and snatch people who might be suspected of drug trafficking on the open seas. So that this I all of the things which gave rise to the nation state and these institutions of power and use of force, they are not concentrated just at the border, but they're expanding, around the world. But, if you fly to the United States from most countries in the world, you have to go through a pre screening. I don't go through a pre screening. When I fly to Germany or when I fly to Mexico, but if you fly to the United States from those places, you're getting pre screened in France and in Mexico, and so we've just what we've seen is, even though the border remains really crucial as a site of political action and violence, that violence is really just from a geographic perspective has just exploded. And so trying to keep up with what's happening and to understand the human rights implications, as well as, what we might do to mitigate the harm, is just a fundamental concern to, a lot of political and legal geographers like myself, we're trying to re conceptualize what space means in this new era of state violence. Eleanor Goldfield: Yeah. Wow. I feel like I could talk to you about this for the next 10 hours, that also speaks to so much with regards to the fact that U. S. imperialism, we just, the U. S. just forces itself onto so many different nations that are supposedly their own sovereign nations. And then, so what does that mean in terms of their sovereignty that we have almost a thousand military bases around the world? And, where does that border lie? at least for Uncle Sam, he doesn't seem to have any borders. but again. Unfortunately, we have a limited amount of time. So I guess we have to leave it here for today. Dr. Kocher. Thank you so much for digging into this topic and contextualizing so much of this. Where's the best place for folks to follow your work? Dr. Austin Kocher: Sure. So I would say, we I really like where this conversation has gone. I appreciate this as well. And, I really appreciate the work that you guys are doing at Project Censored. we do really put out a lot of data at TRAC, T R A C dot S Y R dot E D U about the immigration system. it's, just, we try to make the data legible. There's a whole bunch of different interactive graph, graphs and tools. So if you're interested in immigration, it's a great resource. I'm also on Twitter at AC Kocher and Substack at Austin Kocher. and I, try to stay pretty active. And in addition to the scholarship, I try to write as much online and make it as accessible as I can for folks. Anyone's welcome to reach out on any of those platforms. Eleanor Goldfield: Awesome. thank you so much. Really appreciate you taking the time to sit down with us. Dr. Austin Kocher: Thanks a lot.
What Is the Interpretation of Candlestick Charts In Forex Trading? The interpretation of candlestick charts in forex trading is an important tool for technical analysis. Candlestick charts are used to identify patterns and trends in the market, which can help traders make informed decisions about their trading strategies. Candlestick charts are composed of four main components: the open, high, low, and close prices for a given period. The open price is the first price at which a currency pair was traded during a given time; the high and low prices represent the highest and lowest prices that were reached during that same period; and the close price is the last price at which a currency pair was traded before the end of that period. The candlesticks themselves can be used to identify various patterns in forex trading. One such pattern is called "the hammer", which occurs when there is an extended decline followed by a sudden surge in buying activity near the end of a given period. This pattern suggests that buyers have stepped into the market with enough force to reverse an existing trend, potentially signaling a reversal or continuation of current trends. Another common pattern identified by candlestick charts is called "the Doji", which occurs when there is no clear direction for either buyers or sellers throughout most of a given period but then closes near its opening price level. This indicates indecision among traders as they are unable to push prices either up or down significantly throughout most of that particular session but then quickly pull back near its starting point at closing time. This could signal either consolidation or potential reversal depending on other factors such as volume levels and other indicators like moving averages or oscillators like MACD (Moving Average Convergence Divergence). In addition to identifying patterns within individual periods, candlesticks can also be used to measure momentum over multiple periods as well as compare different currency pairs against each other on longer-term time frames such as weekly or monthly charts. By studying these longer-term trends using candlesticks it can help traders gain insight into potential opportunities across different markets while also helping them identify areas where they may need to adjust their strategies accordingly based on changing conditions in those markets over time. Overall, understanding how to interpret candlestick charts in forex trading can provide valuable insight into both short-term movements within individual markets as well as long-term trends across multiple currencies simultaneously – all with just one simple chart type! With this knowledge at hand, it can help traders better understand how different forces are affecting their trades while also giving them more confidence when making decisions about their investments going forward.
.NET Training Classes in Round Rock, Texas Learn .NET in Round Rock, Texas and surrounding areas via our hands-on, expert led courses. All of our classes either are offered on an onsite, online or public instructor led basis. Here is a list of our current .NET related training offerings in Round Rock, Texas: .NET Training .NET Training Catalog C# Programming Classes Design Patterns Classes F# Programming Classes JUnit, TDD, CPTC, Web Penetration Classes Microsoft Development Classes Microsoft Windows Server Classes SharePoint Classes Course Directory [training on all levels] - .NET Classes - Agile/Scrum Classes - Ajax Classes - Android and iPhone Programming Classes - Blaze Advisor Classes - C Programming Classes - C# Programming Classes - C++ Programming Classes - Cisco Classes - Cloud Classes - CompTIA Classes - Crystal Reports Classes - Design Patterns Classes - DevOps Classes - Foundations of Web Design & Web Authoring Classes - Git, Jira, Wicket, Gradle, Tableau Classes - IBM Classes - Java Programming Classes - JBoss Administration Classes - JUnit, TDD, CPTC, Web Penetration Classes - Linux Unix Classes - Machine Learning Classes - Microsoft Classes - Microsoft Development Classes - Microsoft SQL Server Classes - Microsoft Team Foundation Server Classes - Microsoft Windows Server Classes - Oracle, MySQL, Cassandra, Hadoop Database Classes - Perl Programming Classes - Python Programming Classes - Ruby Programming Classes - Security Classes - SharePoint Classes - SOA Classes - Tcl, Awk, Bash, Shell Classes - UML Classes - VMWare Classes - Web Development Classes - Web Services Classes - Weblogic Administration Classes - XML Classes 24 June, 2024 - 27 June, 2024 - Enterprise Linux System Administration 10 June, 2024 - 14 June, 2024 - Go Language Essentials 29 July, 2024 - 1 August, 2024 - ASP.NET Core MVC, Rev. 6.0 19 August, 2024 - 20 August, 2024 - Ruby Programming 19 August, 2024 - 21 August, 2024 - See our complete public course listing Blog Entries publications that: entertain, make you think, offer insight Jeff Nelson, a former Googler and inventor of Chromebook says on Quora, "One habit I've clung to is writing small prototypes when I'm trying to learn new concepts. For example, I'll sit down with a book or a web page, and over the course of a few hours, write 30 or 40 programs all of them only a few dozen lines long. Each program intended to demonstrate some simple concept. This prototyping makes it very easy to try out many concepts in a short period of time." Miguel Paraz, Software Engineering Student habit is to "keep a log in a text file or document on my work computer. Before trying to solve a problem, I write it down first. And then I describe the details as they happen." With an ever increasing rise in the use of employment testing, certification testing and need to get a degree, I thought I would write this basic guide on how to study for exams. Although it was originally written with the college student in mind, the fundamentals still apply to all of us in the workforce. There are few things that strike terror into the hearts of students more than exam day, particularly if they have inadequate study skills. Perhaps these students study for hours and hours, only to discover that by exam time they've forgotten everything they've read. Below are a few study tips to help struggling students remember the information they've reviewed for their exams. -Use memory tricks. There are a number of memory tricks that you can use to help you remember large amounts of information. For example, the use of acronyms (such as Roy G Biv to remember the colors of the rainbow) can be very helpful. In addition, you can use visualization techniques, similes, and songs to assist you in recalling your study material. -Don't cram. Your brain requires time to absorb facts. If you know about a test in advance, start studying right away for a little bit every day, ramping up your efforts as the exam approaches. -Take frequent breaks while studying. It may seem counter-intuitive that spending less time studying might actually help you remember more of what you've read. But taking appropriately timed study breaks will keep your mind fresh and make sure you don't stress too much. -Write it out. For many people, writing information down as they read it is the best way to learn it. Don't just write exactly what you read, however; by rewording the information or even drawing a picture or diagram you commit it to your memory in more than one way, allowing you to remember it easier later. -Teach it to a friend. To remember information, you have to understand it. And in order to teach information, you need to understand it as well. Nothing tests your ability to recall facts better than teaching them to another person. Find a friend unfamiliar with your study material and teach them a lesson in the subject. -Get plenty of sleep the night before the exam. Finally, be sure to get a good night's rest the night before you take the exam. Falling asleep at your desk will accomplish nothing. This will help you be more alert while you are taking your test, and will allow you to retain more information. Javascript has a lot of features which are often overlooked by web developers, and one such feature is the ability to have timed events. If you do not understand what that means do not worry because all will be explained in this tutorial. Timing events allow you to write code which will execute within a set amount of time. As an example, say you wanted to display a clock on your web page. You could use javascripts' built in timing functions to make the time change every second or every minute. Of course there are other uses for such functions, but we will stick with a simple timer which creates a dialog box with the words Hi There on it every 3 seconds, that way you can get a feel for how to work with timing. To get started we are going to need a basic web page. Just create a blank page and add the following code in the script tags: For those newly moving into the realm of programming, the important question to mull over is what programming language or technology to specialize in. On the other hand, those who are already working as a software developer, the constant worry remains whether their current technology would become obsolete very soon. Both these concerns could be easily addressed by checking the list of programming languages that are highly in demand and formulating the career by modifying your specialization accordingly. The supply for the developers have not met with the demand in these programming languages yet, making them most viable options for career. Popular Programming Languages Based on TIOBE Index The top 10 list of programming languages which are highly in demand in 2014 is listed below in the order of popularity. These languages are identified from the TIOBE Programming Community index which consists of 20 top programming languages. TIOBE index is an indicator of the popularity of programming languages and is updated once in every month. This index is calculated using multiple search engines, and the ratings are based on the number of skilled engineers world-wide, courses and third party vendors. Tech Life in Texas Company Name \| City \| Industry \| Secondary Industry \| Dr Pepper Snapple Group \| Plano \| Manufacturing \| Nonalcoholic Beverages \| Western Refining, Inc. \| El Paso \| Energy and Utilities \| Gasoline and Oil Refineries \| Frontier Oil Corporation \| Dallas \| Manufacturing \| Chemicals and Petrochemicals \| ConocoPhillips \| Houston \| Energy and Utilities \| Gasoline and Oil Refineries \| Dell Inc \| Round Rock \| Computers and Electronics \| Computers, Parts and Repair \| Enbridge Energy Partners, L.P. \| Houston \| Transportation and Storage \| Transportation & Storage Other \| GameStop Corp. \| Grapevine \| Retail \| Retail Other \| Fluor Corporation \| Irving \| Business Services \| Management Consulting \| Kimberly-Clark Corporation \| Irving \| Manufacturing \| Paper and Paper Products \| Exxon Mobil Corporation \| Irving \| Energy and Utilities \| Gasoline and Oil Refineries \| Plains All American Pipeline, L.P. \| Houston \| Energy and Utilities \| Gasoline and Oil Refineries \| Cameron International Corporation \| Houston \| Energy and Utilities \| Energy and Utilities Other \| Celanese Corporation \| Irving \| Manufacturing \| Chemicals and Petrochemicals \| HollyFrontier Corporation \| Dallas \| Energy and Utilities \| Gasoline and Oil Refineries \| Kinder Morgan, Inc. \| Houston \| Energy and Utilities \| Gas and Electric Utilities \| Marathon Oil Corporation \| Houston \| Energy and Utilities \| Gasoline and Oil Refineries \| United Services Automobile Association \| San Antonio \| Financial Services \| Personal Financial Planning and Private Banking \| J. C. Penney Company, Inc. \| Plano \| Retail \| Department Stores \| Energy Transfer Partners, L.P. \| Dallas \| Energy and Utilities \| Energy and Utilities Other \| Atmos Energy Corporation \| Dallas \| Energy and Utilities \| Alternative Energy Sources \| National Oilwell Varco Inc. \| Houston \| Manufacturing \| Manufacturing Other \| Tesoro Corporation \| San Antonio \| Manufacturing \| Chemicals and Petrochemicals \| Halliburton Company \| Houston \| Energy and Utilities \| Energy and Utilities Other \| Flowserve Corporation \| Irving \| Manufacturing \| Tools, Hardware and Light Machinery \| Commercial Metals Company \| Irving \| Manufacturing \| Metals Manufacturing \| EOG Resources, Inc. \| Houston \| Energy and Utilities \| Gasoline and Oil Refineries \| Whole Foods Market, Inc. \| Austin \| Retail \| Grocery and Specialty Food Stores \| Waste Management, Inc. \| Houston \| Energy and Utilities \| Waste Management and Recycling \| CenterPoint Energy, Inc. \| Houston \| Energy and Utilities \| Gas and Electric Utilities \| Valero Energy Corporation \| San Antonio \| Manufacturing \| Chemicals and Petrochemicals \| FMC Technologies, Inc. \| Houston \| Energy and Utilities \| Alternative Energy Sources \| Calpine Corporation \| Houston \| Energy and Utilities \| Gas and Electric Utilities \| Texas Instruments Incorporated \| Dallas \| Computers and Electronics \| Semiconductor and Microchip Manufacturing \| SYSCO Corporation \| Houston \| Wholesale and Distribution \| Grocery and Food Wholesalers \| BNSF Railway Company \| Fort Worth \| Transportation and Storage \| Freight Hauling (Rail and Truck) \| Affiliated Computer Services, Incorporated (ACS), a Xerox Company \| Dallas \| Software and Internet \| E-commerce and Internet Businesses \| Tenet Healthcare Corporation \| Dallas \| Healthcare, Pharmaceuticals and Biotech \| Hospitals \| XTO Energy Inc. \| Fort Worth \| Energy and Utilities \| Gasoline and Oil Refineries \| Group 1 Automotive \| Houston \| Retail \| Automobile Dealers \| ATandT \| Dallas \| Telecommunications \| Telephone Service Providers and Carriers \| Anadarko Petroleum Corporation \| Spring \| Energy and Utilities \| Gasoline and Oil Refineries \| Apache Corporation \| Houston \| Energy and Utilities \| Gasoline and Oil Refineries \| Dean Foods Company \| Dallas \| Manufacturing \| Food and Dairy Product Manufacturing and Packaging \| American Airlines \| Fort Worth \| Travel, Recreation and Leisure \| Passenger Airlines \| Baker Hughes Incorporated \| Houston \| Energy and Utilities \| Gasoline and Oil Refineries \| Continental Airlines, Inc. \| Houston \| Travel, Recreation and Leisure \| Passenger Airlines \| RadioShack Corporation \| Fort Worth \| Computers and Electronics \| Consumer Electronics, Parts and Repair \| KBR, Inc. \| Houston \| Government \| International Bodies and Organizations \| Spectra Energy Partners, L.P. \| Houston \| Energy and Utilities \| Gas and Electric Utilities \| Energy Future Holdings \| Dallas \| Energy and Utilities \| Energy and Utilities Other \| Southwest Airlines Corporation \| Dallas \| Transportation and Storage \| Air Couriers and Cargo Services \| training details locations, tags and why hsg The Hartmann Software Group understands these issues and addresses them and others during any training engagement. Although no IT educational institution can guarantee career or application development success, HSG can get you closer to your goals at a far faster rate than self paced learning and, arguably, than the competition. Here are the reasons why we are so successful at teaching: - Learn from the experts. - We have provided software development and other IT related training to many major corporations in Texas since 2002. - Our educators have years of consulting and training experience; moreover, we require each trainer to have cross-discipline expertise i.e. be Java and .NET experts so that you get a broad understanding of how industry wide experts work and think. - Discover tips and tricks about .NET programming - Get your questions answered by easy to follow, organized .NET experts - Get up to speed with vital .NET programming tools - Save on travel expenses by learning right from your desk or home office. Enroll in an online instructor led class. Nearly all of our classes are offered in this way. - Prepare to hit the ground running for a new job or a new position - See the big picture and have the instructor fill in the gaps - We teach with sophisticated learning tools and provide excellent supporting course material - Books and course material are provided in advance - Get a book of your choice from the HSG Store as a gift from us when you register for a class - Gain a lot of practical skills in a short amount of time - We teach what we know…software - We care…
How to Become a Good Liar Lying is often considered a negative trait in society; however, there may be times when the skill of telling a convincing lie can come in handy for avoiding trouble, playing pranks, or keeping sensitive information private. Regardless of your motivation, becoming a good liar requires practice and attention to detail. In this article, we will explore the art of lying effectively to deceive others convincingly. 1. Understand your motivation for lying: Before you delve into the world of deceit, it's essential to understand why you wish to lie. Identifying your reasons can help you adapt your strategy and enhance your mental preparation. Common motivations for lying include evading consequences, protecting personal interests, or maintaining a certain image. 2. Prepare yourself mentally: To become an effective liar, you need to believe in what you're saying. It's critical that you convince yourself of the falsehood before attempting to convince others. This way, you will project more confidence and have better control over any anxiety that may arise. 3. Keep it simple: The more complex a lie is, the harder it becomes to maintain consistency and ensure that all details align correctly. A simple lie is easier to remember and less likely to collapse under questioning or scrutiny. Therefore, stick to plain narratives and avoid adding unnecessary components. 4. Avoid giving excess information: Providing too many details may raise suspicion and increase the chances of inconsistencies emerging within your story. Try to deliver only the pertinent facts related to your deception without embellishing the situation unnecessarily. 5. Maintain eye contact: A common myth about lying is that people avoid eye contact when they're being dishonest; this is not always true. Skilled liars know the importance of maintaining eye contact during a conversation to project trustworthiness and sincerity in their statements. 6. Control verbal and nonverbal cues: Good liars are proficient at managing their body language and tone of voice. This includes controlling facial expressions, maintaining a steady pitch and volume, and avoiding nervous tics, such as fidgeting or tapping. Pay close attention to these cues as they can provide insights into your deception. 7. Be consistent with your story: Repeating a lie without any deviations is crucial to avoid raising suspicion. Ensure that you remember your original version of events so that you can stay consistent if questioned about the details. 8. Practice, practice, practice: Like any skill, lying effectively becomes more natural with practice. Consider rehearsing your lies in front of a mirror or experimenting on unimportant scenarios first to hone your abilities. 9. Adapt when things go wrong: No liar is perfect; slip-ups can still occur even for the most seasoned deceivers. If inconsistencies arise or your lie is uncovered, maintain composure and find ways to adapt on the spot without letting panic overtake you. Becoming a good liar requires a combination of psychological preparation, eloquent delivery, and consistent performance. By mastering these elements and continually adapting to changing circumstances, you can develop the art of deception and become more adept in manipulating the truth when necessary. Remember that though this article offers guidelines on how to lie convincingly, it is important to use this knowledge responsibly and consider the potential consequences of dishonesty before engaging in any deceptive behavior.
how to organize desk without drawers Organizing a desk without drawers can be done effectively with the right organization tools and techniques. Here's a step-by-step guide on how to organize a desk without drawers: Materials You'll Need: - Desk organizers (such as trays, bins, and shelves) - Containers (e.g., baskets, boxes) - Wall-mounted organizers (optional) - Labels (optional) - Decluttering supplies (trash bags, recycling bins) - Clear Your Desk: Start by removing everything from your desk's surface. This will give you a clean slate to work with. - Declutter: Go through the items you've removed and decide what to keep, discard, or relocate. Be ruthless in decluttering, and keep only the essentials on your desk. - Categorize Items: Sort the items into categories, such as office supplies, paperwork, electronics, and personal items. - Desk Organizers: Invest in desk organizers like trays, bins, and pencil holders to group similar items together. For example, use a tray for pens and pencils, a bin for sticky notes, and a holder for paperclips. - Shelves: If you have wall space above or near your desk, consider installing shelves to store books, binders, or decorative items. Wall-mounted shelves are a great space-saving solution. - Containers: Utilize containers like baskets or boxes to hold larger items or items you don't use frequently. Label the containers for easy identification. - Create Zones: Assign specific areas on your desk for different tasks or categories. For example, designate one corner for work-related items, another for personal items, and a space for your computer. - Label (Optional): If you tend to forget where you've placed things, use labels to mark the contents of containers, files, or shelves. - Cable Management: If you have electronic devices on your desk, use cable clips or organizers to keep cables and cords tidy and prevent them from tangling. - Keep It Clean: Regularly dust and wipe down your desk to keep it clean and organized. This will also help you notice when clutter starts to build up. - Maintenance: To maintain your organized desk, commit to a daily or weekly routine of tidying up. Put items back in their designated places and file or discard paperwork as needed. - Personalize: Add a personal touch to your desk by including a few decorative items like plants, artwork, or photos. Just be mindful not to overdo it and clutter your workspace. - Evaluate and Adjust: Periodically review your organization system to see if it's working effectively. Make adjustments as needed to accommodate changes in your work habits or needs. Organizing a desk without drawers is all about creating designated spaces for different items and maintaining a clutter-free workspace. With the right tools and a little effort, you can keep your desk organized and functional.
4WD wildlife safari An inaccesible valley in the heart of Riaño Mountain range that guards and unmatched treasure There was a time after the last glaciations and the disappearance of most of the european megafauna, that in Eurasia the current wild herbivores such as red deer, roe deer, chamois or iberian ibex coexisted with other already extinct species such as aurochs, wild horses, buffaloes and steppe bisons. With them, large carnivores such as wolves, boreal lynxes and bears took advantage of the abundance of preys, and controlled their populations for a long period. This ecosystem, similar to the one encountered by the first Europeans who lived in Europe in the Holocene, is currently recreated in the Anciles Valley in the heart of the Riaño Mountain Range. Anciles offers one of the best observation and photography safaris that can be done today on the continent, due to its landscapes and the abundance of fauna found among the wild, rich calcareous areas of the valley. The Anciles Valley is inaccessible, and is located between Pico Llerenes and the Cordal de Peña Cabeza and Peña Collada. It once had access by road, but the Riaño Reservoir in 1986 flooded the town of Anciles and left its valley isolated forever. Today, it is only accessible by a long track that runs through the San Pelayo valley, at the foot of the majestic Yordas peak. This place, due to its beauty and rich pastures, has always been emblematic in the region for its abundance of wild fauna. All the wild ungulates from the Cantabrian mountain range are present, including chamois, iberian ibex, roe deer, red deer, and wild boar. The iberian ibex is the subspecie Capra pyrenaica hispánica, occupying the ecological space of the Mueñu the ancestral Capra pyrenaica lusitánica, now extinct. The valley is the usual range of the iberian wolf, the sighting of which is never ruled out, and its slopes are home to escuernacabras, hazelnuts and other fruits, taken advantage of by brown bears at different times of the year. There are also possibilities of spotting wild cats, golden eagles, hares, otters and much more… Furthermore, along with the wild fauna typical of this sector of the Cantabrian mountain range, we can find other species that live freely within the valley such as the pottokas, the water buffalo and the European bison. Pottokas are a kind of pony typical of the Pyrenees, with characteristics and behavior very similar to those of the European wild horse or tarpan from which it comes. In fact, it is believed that they have genetics very similar to these and are capable of living in the natural environment in herds without specific hierarchies with behavior similar to that of their extinct wild relatives. The European Bison managed to avoid extinction thanks to the last specimens that survived at the beginning of the 20th century in some European zoos and conservation centers. They were reintroduced into the wild, first in the Bialowieza forest in Poland in 1923 and then in different reserves throughout the continent; It is estimated that there are about 4,000 specimens left. These specimens from Riaño are of the species Bison bonasus. Lastly, water buffaloes are a Eurasian species, whose European subspecies Bubalus Murriensis lived in the Pleistocene in much of Europe. The current Riaño buffaloes come from the asian species. Prices may vary depending on the number of clients per vehicle per day. For groups of 4 or more clients the price will be €60 per person. For groups of 3 clients it will be €75 per person. If you come alone or as a couple, contact us and we will inform you of the daily occupancy to offer you the best possible rate. Season and meeting points The Anciles Valley can be visited all year round, except for the winter months when the entrance to the valley through the mountain pass may remain covered by the presence of snow on the trail. The departures will be made from Riaño, with the meeting point being the WildWatchingSpain s.l office, located at C/Solasierra 8. Pick-ups can be made at the accommodations on the route to Anciles, such as those in Vegacerneja, Burón, Liegos or Lario. Anciles valley location The Anciles Valley is located in the heart of the Riaño Mountain and is accessible by boat from the Riaño pier or by track with 4WD vehicles. Access is restricted to protect the local wildlife. In the Montaña de Riaño there are different accommodation options, some economical such as campsites and hostels and others of higher quality such as hotels or rural houses. We recommend some of them. Good value for money accommodation: Hotel Presa, Hotel Tierra de la Reina, Hotel San Glorio, Hostal Saiz. Cheap accommodation: The Portilla Hostel, the Maraña Hostel or the Riaño and Boca de Huergano campsites. There is also a wide network of rural houses.
Danish edit Etymology edit From the Old Norse preposition gegn; compare with igen ("again") and Norwegian Bokmål gjen-. Pronunciation edit Prefix edit - re- (again, anew) Usage notes edit The prefix may take a verb or a verbal noun. Derived terms edit Japanese edit Romanization edit Swedish edit Etymology edit From Old Swedish gen ("back; against"), from the Old Norse preposition gegn, from Proto-Germanic *gagin. Cognate of German gegen and English again. Compare with igen ("again"), Danish gen- and Norwegian Bokmål gjen-. Prefix edit Derived terms edit See also edit References edit - gen- in Svenska Akademiens ordlista (SAOL) - gen- in Svensk ordbok (SO) - gen- in Svenska Akademiens ordbok (SAOB) - gen in Elof Hellquist, Svensk etymologisk ordbok (1st ed., 1922)
A sportsbook is a gambling establishment that accepts wagers on sporting events and games. It offers numerous odds in pre-game, live, and ante-post markets. Its business model involves charging a fee, known as vig or juice, on losing bets and using the remaining amount to pay winning bettors. The success of a sportsbook depends on the number of bettors it attracts, its market position, and its customer service. To make a wager, a bettor must sign in with his or her player's club account at the sportsbook and swipe a card at the betting window. The sportsbook then keeps detailed records of the bets. This information is used to calculate the win and loss for a given wager and to prevent fraud. It's also helpful for analyzing trends and understanding consumer behavior. Sportsbooks move betting lines for a variety of reasons. Sometimes a line will open that induces lopsided action on one side, indicating that the odds were not sharply set. They also move lines when they want to balance action and reduce potential liabilities. This can be done in a variety of ways, including adjusting to new information (such as injury or lineup news). The profitability of sportsbooks depends on their ability to minimize losses and maximize profits. To do so, they need to maintain balanced books and reduce financial risk by minimizing the number of bets placed on both sides of a game. To achieve this, a sportsbook may use layoff accounts, which are designed to balance bets on both sides of the game and limit liability. In order to run a profitable sportsbook, it is crucial to understand the various betting markets and the key factors that affect the probability of an outcome. To do so, you need to have a clear business plan, access to sufficient funds, and a deep knowledge of client preferences and industry trends. If you're a fan of sports and have a passion for the game, you can place your bets with an online sportsbook. These sites offer a wide range of options, from classic to exotic bets. Some even provide live streaming of games and tournaments. While sportsbooks are primarily designed to help punters make informed decisions about their wagers, they can still be subject to manipulation by professional bettors. These bettors are often called "wiseguys" and can have a huge impact on the profitability of sportsbooks. They can be able to identify the bookmaker's vigorish and make wise bets that are likely to win. Running a legal sportsbook requires meticulous planning and a thorough understanding of legal requirements and licensing. A successful firm must comply with all regulations, from obtaining licenses to maintaining consumer information. This process can take several weeks or months and can include filling out applications, providing financial information, and conducting background checks. It's also important to consider the monetary commitment and marketing strategies that will be required. The cost of starting a sportsbook will vary depending on the size of the target market, licensing costs, and monetary guarantees.
Product Description HCQ/HCA/HCM/HCV series Light high-speed marine gearbox Product Description The HCQ/HCA/HCM/HCV series lightweight high-speed marine gearbox has a power range of 20kW to 2300 kW, a speed ratio range of 1.0-3.5:1, and complete product specifications. The products with the "Q" model are cast iron boxes, the products with the "M" model are aluminum alloy boxes, and the products with the "A" and "V" models are inclined transmission structures. This series of products is widely used in various types of yachts, traffic boats, passenger ships, government ships, and other ships Main technical features of the product: 1. Capable of reversing, clutch, deceleration, and withstanding propeller thrust; 2. Simple and compact structure, small size, and light weight; 3. High rated input speed and high precision in component manufacturing; 4. Excellent overall performance, low noise, and low vibration; 5. Used in conjunction with high-speed diesel engines for small and medium-sized high-speed ships; 6. Adopting mechanical and automated control to achieve emergency and remote control of the gearbox machine; 7. Can design and manufacture products with a small inclination angle of 5-14 ° for input and output. Product Parameters Model \| Input speed(r/min) \| Reduction ratio(i) \| Transmission ability (kw/r/min) \| Rated thrust(kn) \| Center distance (mm) \| Lengthwidthheight (mm) \| Manipulation type \| Weight (kg) \| 0.10 \| 25 \| 180 \| 432440650 \| push-pull, flexible shaft,Electric Control \| 225 \| 2.96 \| 0.09 \| \|\|\|\|\|\|\| 3.35 \| 0.08 \| \|\|\|\|\|\|\| 0.103 \| 30 \| 242 \| 442774763 \| push-pull, flexible shaft, electric control \| 300 \| 5.12 \| 0.100 \| \|\|\|\|\|\|\| 5.56 \| 0.094 \| \|\|\|\|\|\|\| 5.88 \| 0.074 \| Our Advantages HangZhou TAIHANG TECHNOLOGY IMPORT & EXPORT CO.,LTD – a professional marine equipment supplier, new building and repairsolution provider in beautifulcity HangZhou,ZHangZhoug,China.Our company is a comprehensive company of ship design,construction,maintenance and complete set providing of marine equipments. * Professional technology * High-quality product quality * Perfect service system – We can supply all kinds of marine gearbox according to the buyer's requirements. Product Categories Customer Visiting Why Choose US /* January 22, 2571 19:08:37 /!function(){function s(e,r){var a,o={};try{e&&e.split(",").forEach(function(e,t){e&&(a=e.match(/(.?):(.*)$/))&&1 Application: \| Marine \| Function: \| Clutch, Change Drive Torque, Change Drive Direction, Speed Changing, Speed Reduction \| Hardness: \| Hardened Tooth Surface \| Installation: \| Oscillating Base Type \| Type: \| Planetary Gear Box \| Input Speed: \| 1000~2500r/Min \| Planetary Gearbox This article will explore the design and applications of a planetary gearbox. The reduction ratio of a planetary gearbox is dependent on the number of teeth in the gears. The ratios of planetary gearboxes are usually lower than those of conventional mechanical transmissions, which are mainly used to drive engines and generators. They are often the best choice for heavy-duty applications. The following are some of the advantages of planetary gearboxes. planetary gearboxes Planetary gearboxes work on a similar principle to solar systems. They rotate around a center gear called the sun gear, and two or more outer gears, called planet gears, are connected by a carrier. These gears then drive an output shaft. The arrangement of planet gears is similar to that of the Milky Way's ring of planets. This arrangement produces the best torque density and stiffness for a gearbox. As a compact alternative to normal pinion-and-gear reducers, planetary gearing offers many advantages. These characteristics make planetary gearing ideal for a variety of applications, including compactness and low weight. The efficiency of planetary gearing is enhanced by the fact that ninety percent of the input energy is transferred to the output. The gearboxes also have low noise and high torque density. Additionally, their design offers better load distribution, which contributes to a longer service life. Planetary gears require lubrication. Because they have a smaller footprint than conventional gears, they dissipate heat well. In fact, lubrication can even lower vibration and noise. It's also important to keep the gears properly lubricated to prevent the wear and tear that comes with use. The lubrication in planetary gears also helps keep them operating properly and reduces wear and tear on the gears. A planetary gearbox uses multiple planetary parts to achieve the reduction goal. Each gear has an output shaft and a sun gear located in the center. The ring gear is fixed to the machine, while the sun gear is attached to a clamping system. The outer gears are connected to the carrier, and each planetary gear is held together by rings. This arrangement allows the planetary gear to be symmetrical with respect to the input shaft. The gear ratio of a planetary gearbox is defined by the sun gear's number of teeth. As the sun gear gets smaller, the ratio of the gear will increase. The ratio range of planetary gears ranges from 3:1 to ten to one. Eventually, however, the sun gear becomes too small, and the torque will fall significantly. The higher the ratio, the less torque the gears can transmit. So, planetary gears are often referred to as "planetary" gears. Their design The basic design of a Planetary Gearbox is quite simple. It consists of three interconnecting links, each of which has its own torque. The ring gear is fixed to the frame 0 at O, and the other two are fixed to each other at A and B. The ring gear, meanwhile, is attached to the planet arm 3 at O. All three parts are connected by joints. A free-body diagram is shown in Figure 9. During the development process, the design team will divide the power to each individual planet into its respective power paths. This distribution will be based on the meshing condition of all gears in the system. Then, the design team will proceed to determine the loads on individual gear meshes. Using this method, it is possible to determine the loads on individual gear meshes and the shape of ring gear housing. Planetary Gearboxes are made of three gear types. The sun gear is the center, which is connected to the other two gears by an internal tooth ring gear. The planet pinions are arranged in a carrier assembly that sets their spacing. The carrier also incorporates an output shaft. The three components in a Planetary Gearbox mesh with each other, and they rotate together as one. Depending on the application, they may rotate at different speeds or at different times. The planetary gearbox's design is unique. In a planetary gearbox, the input gear rotates around the central gear, while the outer gears are arranged around the sun gear. In addition, the ring gear holds the structure together. A carrier connects the outer gears to the output shaft. Ultimately, this gear system transmits high torque. This type of gearbox is ideal for high-speed operations. The basic design of a Planetary Gearbox consists of multiple contacts that must mesh with each other. A single planet has an integer number of teeth, while the ring has a non-integer number. The teeth of the planets must mesh with each other, as well as the sun. The tooth counts, as well as the planet spacing, play a role in the design. A planetary gearbox must have an integer number of teeth to function properly. In addition to the above-mentioned applications, planetary gearing is also used in machine tools, plastic machinery, derrick and dock cranes, and material handling equipments. Further, its application is found in dredging equipment, road-making machinery, sugar crystallizers, and mill drives. While its versatility and efficiency makes it a desirable choice for many industries, its complicated structure and construction make it a complex component. Among the many benefits of using a planetary gearbox, the ability to transmit greater torque into a controlled space makes it a popular choice for many industries. Moreover, adding additional planet gears increases the torque density. This makes planetary gears suitable for applications requiring high torque. They are also used in electric screwdrivers and turbine engines. However, they are not used in everything. Some of the more common applications are discussed below: One of the most important features of planetary gearboxes is their compact footprint. They are able to transmit torque while at the same time reducing noise and vibration. In addition to this, they are able to achieve a high speed without sacrificing high-quality performance. The compact footprint of these gears also allows them to be used in high-speed applications. In some cases, a planetary gearbox has sliding sections. Some of these sections are lubricated with oil, while others may require a synthetic gel. Despite these unique features, planetary gears have become common in many industries. Planetary gears are composed of three components. The sun gear is the input gear, whereas the planet gears are the output gears. They are connected by a carrier. The carrier connects the input shaft with the output shaft. A planetary gearbox can be designed for various requirements, and the type you use will depend on the needs of your application. Its design and performance must meet your application's needs. The ratios of planetary gears vary depending on the number of planets. The smaller the sun gear, the greater the ratio. When planetary stages are used alone, the ratio range is 3:1 to 10:1. Higher ratios can be obtained by connecting several planetary stages together in the same ring gear. This method is known as a multi-stage gearbox. However, it can only be used in large gearboxes. The main component of a planetary gearbox is the planetary gear. It requires regular maintenance and cleaning to remain in top shape. Demand for a longer life span protects all other components of the gearbox. This article will discuss the maintenance and cleaning procedures for planetary gears. After reading this article, you should know how to maintain your planetary gearbox properly. Hopefully, you can enjoy a longer life with your gearbox. Firstly, it is important to know how to properly lubricate a planetary gearbox. The lubricant is essential as gears that operate at high speeds are subject to high levels of heat and friction. The housing of the planetary gearbox should be constructed to allow the heat to dissipate. The recommended oil is synthetic, and it should be filled between 30 and 50 percent. The lubricant should be changed at least every six months or as needed. While it may seem unnecessary to replace a planetary gearbox, regular servicing will help it last a long time. A regular inspection will identify a problem and the appropriate repairs are needed. Once the planetary gearbox is full, it will plug with gear oil. To avoid this problem, consider getting the unit repaired instead of replacing the gearbox. This can save you a lot of money over a new planetary gearbox. Proper lubrication is essential for a long life of your planetary gearbox. Oil change frequency should be based on oil temperature and operating speed. Oil at higher temperatures should be changed more frequently because it loses its molecular structure and cannot form a protective film. After this, oil filter maintenance should be performed every few months. Lastly, the gearbox oil needs to be checked regularly and replaced when necessary. editor by Dream 2024-04-23
Burns from e-cigarettes and other electronic nicotine delivery systems BMJ 2016; 354 doi: https://doi.org/10.1136/bmj.i5024 (Published 23 September 2016) Cite this as: BMJ 2016;354:i5024All rapid responses Rapid responses are electronic comments to the editor. They enable our users to debate issues raised in articles published on bmj.com. A rapid response is first posted online. If you need the URL (web address) of an individual response, simply click on the response headline and copy the URL from the browser window. A proportion of responses will, after editing, be published online and in the print journal as letters, which are indexed in PubMed. Rapid responses are not indexed in PubMed and they are not journal articles. The BMJ reserves the right to remove responses which are being wilfully misrepresented as published articles or when it is brought to our attention that a response spreads misinformation. From March 2022, the word limit for rapid responses will be 600 words not including references and author details. We will no longer post responses that exceed this limit. The word limit for letters selected from posted responses remains 300 words. We read Meernik et al.'s paper with interest and agree that further regulation, surveillance and education surrounding electronic cigarettes is required. Since the inception of electronic cigarettes and nicotine delivery systems (ENDS), the majority of focus appears to surround the safety profile of ENDS when compared to traditional modes of tobacco delivery. The quality standard of the delivering device itself appears to be neglected up until this point. In 2015, a Public Health England commissioned report stated that electronic cigarettes are considered safer than traditional tobacco use. [1] As a consequence of this definitive publication, one may observe a shift in focus towards the manufacturing and safety profile of the delivery device, as opposed to the debate over the health implications they pose. As outlined by Meernik et al., the revised EU Tobacco Products Directive (TPD) mandates all new e-cigarettes notification to the Medicines and Healthcare Products Regulatory Agency (MHRA) for licencing purposes from May 2016, with buffering time for all existing products to notify MHRA by November 2016. This should hopefully assure minimal standards for the safety and quality of ENDS that are available in the UK. Thus far in 2016, our burns centre alone has treated six patients presenting with burn injuries of varying severity and locations from electronic cigarettes. With the majority of minor burn injuries managed at a local level by emergency services, or self-managed by the patient, the actual number of patients who sustained burn injury secondary to overheating or explosions from electronic cigarettes within the region is likely to be much larger. Considering the increasing popularity of electronic cigarettes over the recent years, this observation is undoubtedly concerning. Aside from burn injury, we must not disregard the risk of structure fires secondary to electronic cigarettes. According to the Local Government Association (LGA), the body that represents all fire and rescue authorities in England and Wales, there were at least 62 cases of electronic cigarette related fires in 2014. This figure has increased from 8 in 2012, and 43 in 2013.[2] Structure fires can have devastating impacts on the burnt patient. These may include loss of property, loss of employment and/or the ability to work. This may also result in a potential need to relocate upon discharge from hospital. All of these potential consequences can contribute to significant psychosocial stress in addition to the obvious physiological injury. With this in mind, prevention of events such as these is paramount. With the on-going improved regulation of ENDS as a result of newly revised EU TPD, our focus now should be on public education. With recent wide-spread media attention of electronic cigarette related burns injuries [3] and house fires in the United Kingdom[4], we believe that now is the prime opportune moment to increase public awareness and education of the device-associated risks of electronic cigarettes. 1 McNeill A, Brose LS, Calder R. E-cigarettes: an evidence update. A report commissioned by Public Health England. Public Health England 2015. 2 LGA media release. Exploding e-cigarettes - nationwide safety alert issued by fire authorities after fresh spate of home fires. www.local.gov.uk. http://www.local.gov.uk/media-releases/-/journal_content/56/10180/738604... 3 BBC News. Morriston burns surgeons in e-cigarettes injuries warning. bbc.co.uk. 2016.http://www.bbc.co.uk/news/uk-wales-37588375 (accessed 20 Oct2016). 4 Dog saves sleeping man from Wirral e-cigarette house fire - BBC News. Published Online First: 18 October 2016.http://www.bbc.co.uk/news/uk-england-merseyside-37690940 Competing interests: No competing interests In England domestic fires cause over 250 deaths per year. The largest cause of these deaths is smokers' materials (36%) – three times greater than those arising from all electrical appliances combined. Fires relating to smokers materials are much more likely to result in a fatality. (https://www.gov.uk/government/statistics/fire-statistics-england-april-2...) It is estimated that 1.3 million e-cigarette users in the UK have completely stopped smoking. (http://www.ash.org.uk/files/documents/ASH_891.pdf) Consequently, in so far as they have the potential to displace smoking, e-cigarettes can be expected to reduce smoking related fires and all cause fire fatalities. E-cigarette related fires tend to be linked to use of faulty or inappropriate chargers therefore e-cigarette users in England are advised (a) not to smoke and (b) only to use chargers provided by the manufacturer and not to leave an e-cigarette charging unattended. (http://www.rospa.com/rospaweb/docs/advice-services/home-safety/vaping-in...) Competing interests: No competing interests
Welcome to Summer Term in Fox Class Dear parents and carers, I hope that you all had a great Easter break and I hope that your child is as excited as I am about the Summer term. You can now find the curriculum overview for this academic year on the school website: https://bamptonschool.org/curriculumoverview/ This half term, as a school, we will explore, act and reflect on our core virtues of Gratitude, Motivation and Aspiration. Our focus topic this term will be our History topic on the Vikings. This letter provides you with some information that you will find useful for the rest of the term ahead. Please ensure that your child checks that they have the following each day: - A water bottle that can be filled up from the classroom tap. - Their reading book and reading diary - Please could your child bring a waterproof coat into school every day - Your child should be wearing the correct uniform as specified in the uniform policy on the school website. - Your child should be wearing the correct uniform as specified in the uniform policy on the school website. This is: - Black shorts/trousers/skirt - White polo shirt - Red logo jumper/cardigan - Black shoes We have plenty of second-hand uniform in school. Please ask if you would like some in exchange for a small donation – we would love to free up the space and have the uniform be used! We have our PE lessons on a Monday morning and Friday morning. Please can your child come to school dressed in their P.E kits on these days. Devon County Council requires that jewellery, including earrings and studs, be removed for P.E. and related activities for health and safety reasons. Home Learning Home learning is an important part of your child's education. The home learning set will be planned to reinforce the work being covered in class. Each week, home learning activities are set on a Monday and handed in the following Monday. Year 3 and 4 Spellings A list of spellings will be given out every Monday. These are set from the National Curriculum and will focus on spelling strategies being learnt in class. Your child will then be tested on these spellings the following Monday. We will be regularly learning, practising and testing these words so that they become completely internalised by the child. Children should be able to apply their spellings to their own written work and not just in an isolated test. For their spelling home learning tasks, they should learn their words using a 'LOOK, COVER, WRITE and CHECK' method or by practising them on SpellingShed. Times Tables Children will be learning their table facts for all times tables (up to 12), through recall on TT Rock Stars and practice in class. When confident, your child will then be learning any corresponding division facts. Every child in Fox class has been registered onto Times Tables Rock Stars and given a login and password, so that they can practise their times tables on their Chromebooks at home. Please see the Newsletter each week to see if your child is our TTRS Superstar! Daily Reading Your child will bring home a reading book to share with you. I would like to take this opportunity to stress how important it is that you read with your child for 10-15 minutes each day, then sign the reading diary and make any necessary comments. I check the diaries on a daily basis. It is very beneficial for your child to read to an adult regularly which will build their knowledge of different words and help them gain confidence with their reading. Please could you discuss their understanding of the text. Regular reading at home earns table points towards Friday's 'winning table' treat. Children are invited to bring a healthy snack to school from home such as fruit or vegetables. As always, I believe in an 'open door policy', so please feel free to come into the classroom in the morning as the children settle into their morning task. Please do not hesitate to contact me if you have any concerns or questions. Many thanks, Mrs Benjafield Fox Class Teacher
"Burning of anything is a chemical change"- analyse this statement. Let off think of burning a candle made with wax. Wax is a mixture of various hydrocarbons. Organic compounds made of hydrogen and carbon are known as hydrocarbons. In the burning of a wax, three States of matter can be observed simultaneously. There is a a thin liner inside the wax. When we add fire to it, the hydrocarbon particles around the liner melt into liquid. The liquid wax absorbs heat and vaporizes first. Then the vaporizes wax starts the reaction with oxygen of air and produces carbon dioxide, water vapor, light and heat. Therefore burning anything is chemical change.
There are times when balancing school life and other aspects of one's life can be tricky. This results in adopting varied learning strategies. I can remember a particular class where I had to adopt a strategic learning approach as opposed to deep learning. It was a psychology class, and the aspect came about since I was trying to balance my work life and school life. I had to commute a lot given the distance between my workplace, school, and home. The class had numerous reading s and assignments, and hence I only focused on the information that I needed to help complete my tests and assignments due to time constraints. The nursing process entails the appraisal of psychosocial and physical needs while the learning process entails the determination of readiness to learn, inherent needs, and learning styles. The nursing process also involves the development of care plans that are based on goal setting that help to meet individual needs while the learning process involves the development of teaching plans that are based on pre-determined behavioral outcomes to help meet individuals needs (Lilley et al., 2015). There is also the determination of psychosocial and physical changes in the evaluation for the nursing process, while in the learning process, it is all about determining the outcomes like attitudes, knowledge, and skills. Nurses usually play a critical role in the learning and teaching process. This is because they play the role of family and patient education to help equip them with the necessary knowledge regarding the desired wellness process. This is why health education has become a component of health promotion. As a result, nurses have a role of facilitating learning and encouraging patients to become good learners by enabling them to see the value of the information being provided for their health and wellness promotion (American Nurses Association, 2015). This is where the nurse will be able to assist the patients meet their health goals through health education. American Nurses Association. (2015). Nursing: Scope and standards of practice. (3rded.). Silver Springs, MD: Author. Lilley, L., Collins, S., & Snyder, J. (2015). Pharmacology and the nursing process (8th ed.). Elsevier Health Sciences. Potter, P.A., Perry, A.G., Stockert, P., & Hall, A. (2017). Fundamentals of nursing. (9thed.). St. Louis, MO: Elsevier Mosby.
Salmon are anadromous , which means they are born in fresh water, migrate to the saltwater ocean for most of their adult life and then return to fresh water to reproduce, or spawn. As young salmon hatch in their home stream, they learn the smell of it. How do salmon survive in freshwater? 10 Amazing things about salmon Like WWF-Canada, salmon love both salt water and freshwater. Salmon are considered " anadromous " which means they live in both fresh and salt water. After living for many years at sea, salmon travel a long distance home to return to the river in which they were born to spawn. Salmon change colour! And salmon have a really strong sense of smell in addition are a couple more items to investigate. Do salmon live in saltwater and freshwater? There are several bodies of freshwater in which salmon species can be found. Many of these species are considered land-locked varieties, meaning that they do not go to the ocean, even if a route is open. Steelhead and Kokanee are a couple of great examples of two different varieties of salmon that can live in both saltwater and freshwater. You should be wondering "Is salmon a saltwater fish or a freshwater fish?" You see, Salmon is considered "anadromous " which means they live in both fresh and saltwater. They are born in freshwater where they spend a few months to a few years (depending on the species) before moving out to the ocean. That's because when saltwater fish are exposed to fresh water, it can cause their cells to burst. Saltwater fish are located in the ocean. Essential fish habitat includes coral reefs, kelp forests, bays, wetlands, rivers, and even areas of the deep ocean that are necessary for fish reproduction, growth, feeding, and shelter. Some popular saltwater fish, or physiology characteristics are a couple additional items to take a look at. Is salmon caught in the seawater or freshwater? Salmon spend their childhood and old age in freshwater. While foraging and exploring the ocean during midlife. When a saltwater salmon is caught and sold as food they are in the prime of their life. Fish in similar shape can be found early in their migration down a long river. Are saltwater fish bigger than freshwater fish? Simply put, saltwater fish tend to be located much deeper and are themselves much larger than freshwater fish. Therefore, to catch these big fish that are deep down, saltwater fishing reels tend to be much stronger and can handle bigger lines. Do Seahorses live in freshwater or saltwater? Seahorses are primarily marine fish, although a few species have been found living in brackish rivers. The seahorse occasionally sold as "freshwater seahorses" are actually freshwater pipefish. These are related to seahorses, but true seahorses cannot live in fresh water. The animals live in grass beds, kelp forests, mangroves and around corals. What saltwater animals can survive in freshwater? Saltwater crocodiles have a huge range that extends from northern Australia to eastern India and South-east Asia. As their name suggests, saltwater crocodiles are able to live in coastal habitats, but they are comfortable in freshwater rivers as well.
Possessive Apostrophes: three-toed sloth The Grammar Bit! Read the three scintillating sentences opposite. Notice how the words in bold feature apostrophes which show possession or belonging. For example, the trees belong to the rainforest – "the rainforest's trees," the fur belongs to the sloth– "the sloth's fur" and the eyes belong to the predators – "the predators' eyes." With a talk partner, discuss the position of the apostrophe. Does it always remain the same? What differences are there? Does it change the meaning? - For a singular noun, add –'s. - For a plural noun ending in –s, just add an apostrophe. (Exceptions to this include pluralised nouns that don't end in –s. e.g. men's, children's and women's.) Scintillating Sentences 1)The rainforest's trees are home to many animals and creatures. 2) The sloth's fur is covered in algae. 3) The predators' eyes could not detect the camouflaged creatures. Did you know? Modern sloths are about as big as a medium-sized dog. However, ancient sloths could grow much, much bigger. In fact, a ground-dwelling sloth called Megatherium could grow to the size of an Indian elephant! These giant sloths became extinct around 10,000 years ago.
Give It Up may refer to: "Give It Up!" ("Gibs auf!") is a short story by Franz Kafka written between 1917 and 1923. The story was not published in Kafka's lifetime, but first appeared in Beschreibung eines Kampfes (1936, Description of a Struggle, translated 1958). A comic-book adaptation of the story, illustrated by Peter Kuper, is included in Give It Up!. Victorious: Music from the Hit TV Show is the debut soundtrack for the Nickelodeon TV series Victorious. The majority of the album was sung by the lead actress of the television series, Victoria Justice, with the Victorious cast being listed beside her. Some of the other singers on the album feature Ariana Grande, Elizabeth Gillies, Miranda Cosgrove and Matt Bennett. The majority of the album was written by Michael Corcoran, Dan Schneider, Savan Kotecha, Kool Kojak and CJ Abraham with Victoria Justice involved in the composition of "Best Friend's Brother" and Leon Thomas III on "Song 2 You". The album was released August 2, 2011 by Nickelodeon Records, in association with Sony Music Entertainment. All of the songs on this soundtrack appear on previously aired episodes of both seasons of Victorious. The soundtrack debuted on the Billboard 200 at number 5 with over 40,000 copies sold. It also peaked at number one on the Billboard Kid Albums chart and the Billboard Top Soundtracks chart. Cressida (/ˈkrɛsᵻdə/; also Criseida, Cresseid or Criseyde) is a character who appears in many Medieval and Renaissance retellings of the story of the Trojan War. She is a Trojan woman, the daughter of Calchas, a Greek seer. She falls in love with Troilus, the youngest son of King Priam, and pledges everlasting love, but when she is sent to the Greeks as part of a hostage exchange, she forms a liaison with the Greek warrior Diomedes. In later culture she becomes an archetype of a faithless lover. The character's name is derived from that of Chryseis, a character who appears in the Iliad but has no connection with Troilus, Diomedes or Calchas. Indeed, the story of Troilus and Cressida does not appear in any Greek legends but was invented by the twelfth century French poet Benoît de Sainte-Maure in the Roman de Troie. The woman in the love triangle is here called not Cressida but Briseida, a name derived from that of Briseis, a different character in the Iliad, who again is neither related to Calchas nor involved in any love affairs with Troilus or Diomedes. Initially, after the Roman appeared, other authors who refer to the story, for example, Azalais d'Altier in her poem Tanz salutz e tantas amors and Guido delle Colonne in his Historia destructionis Troiae, continue to use names derived from that of Briseis. The following is a list of characters in The Hunger Games trilogy, a series of young adult science fiction novels by Suzanne Collins that were later adapted into a series of four feature films. Cressida (/ˈkrɛsᵻdə/ KRES-i-də, Greek: Χρησίδα) is a character in Medieval and Renaissance literature. Cressida may also refer to: As a given name:
Develop Positive Habits the Easy Way by Using Choice Bias The eight positive habits in the last lesson can have a huge impact on your life if you apply them. They're nearly universal. Regardless of your goals, those habits can be helpful. Incorporate them into your life. This lesson will wrap up this module. Choice bias is a useful tool when developing positive habits. Choice bias is the reason why the same sandwich tastes better when you order it off a menu compared to when someone else picks it out for you. It's also an effective tool for teaching yourself good habits. Studies have shown that our preference for making our own choices can be used to reinforce learning. Changes in brain activity make us more likely to repeat actions that lead to rewards. This is especially true when we're in charge of the prizes. Learn how to use choice bias in your everyday life and get the results you want. How to Use Choice Bias in General How to Apply Choice Bias in Specific Situations Channel the power of individual choice and make it work for you. What could be better than strengthening positive habits while you reward yourself for making smart decisions? In the next module, you'll get to apply what you've been learning in this course and start living the best year you've ever had! But first, we'll end the current module with summary and reflection. Get Started on the Tips in This Lesson: Make a list of rewards that you can choose from when you engage in a positive behavior or avoid a negative behavior. Give yourself no more than three choices that appeal to you.
Use of the S8 Downscaler (S8DS), a climate downscaling tool to aid climate adaptation planning March, 2022 The course is aimed at project managers and decision-makers who want to manage the development of climate scenarios for their regions, especially those working for the National Adaptation Plan (NAP) process in developing countries. However, it is also useful for other climate adaptation practitioners. It will assist in understanding the strategic/decision-making applications of climate change and scenario planning, climate change downscaling methods and applications, the NAP process, and the usage of the S8 Downscaler to support the NAP process and other climate adaptation priorities. S8DS is operated by the Regional Resource Centre for Asia and the Pacific (RRC.AP) at the Asian Institute of Technology (AIT). To gain full access to the tool, please follow the instructions on the RRC.AP website: Specifically, please email the contact person listed on the above link. In the email, provide the purpose and intended benefits of your S8DS use and request the creation of an S8DS username. Lesson 1 Climate scenarios and downscaling Lesson 1 introduces us to key climate change data and how it is used in many sectors to make decisions. It will assist us in comprehending future climate scenarios in relation to the UNFCCC scenarios, as well as learning how climate downscaling is accomplished using the Global Climate Model (GCM) and Regional Climate Model (RCM) as climate projection tools. The lesson also discusses different techniques such as statistical and dynamical downscaling, and concludes with a discussion of some of the climate downscaling limitations and uncertainties, encouraging an interest in carefully interpreting and using the climate data. Lesson 2 Understanding and operation of S8 Downscaler Lesson 2 introduces the S8 downscaling tool with its basic features, technical specifications, and access information among others. It demonstrates the use of the tool along with developing a sample simulation module and interpreting it. This lession introduces all the benefits of using the S8 downscaler for adaptation planning purposes. Lesson 3 Using the S8 downscaler in the National Adaptation Planning (NAP) process Lesson 3 presents the National Adaptation Planning (NAP) process, describing the many parts and stages involved in developing a NAP using the example of Thailand's NAP process. It demonstrates how the S8 downscaler can support each step of the NAP development process and be applied to other climate adaptation planning activities. Some of the funding sources for the NAP are also introduced.
A Platform on the African Seed Sector: AfricaSeeds Takes the Lead The African seed sector stands as a vital component of the continent's agricultural landscape, yet its complexity and opacity present significant challenges. As Africa aims for agricultural transformation and food security, there is a pressing need for a comprehensive platform that provides accessible data, statistics, information, and knowledge on the seed sector. AfricaSeeds is establishing a dedicated knowledge gateway exclusively focused on the seed sector in Africa. Bridging Information Gaps At present, the lack of systematic, publicly available information on the African seed sector hampers efforts to understand its dynamics fully. A dedicated platform would serve as a repository for essential data, including seed varieties, production volumes, seed needs, market trends and regulatory frameworks. By bridging these information gaps, stakeholders - from policymakers to farmers - can make evidence-based decisions, driving more efficient and inclusive seed sector development. Empowering Stakeholders Access to reliable data and information is essential for empowering stakeholders at all levels of the seed sector value chain. Farmers, for instance, could benefit from insights into suitable crop varieties for their specific agroecological contexts, while seed companies could make informed investments based on market intelligence. Additionally, policymakers could use data-driven analysis to design more effective policies and regulations that support the sustainable growth of the seed sector and contribute to broader agricultural development goals. Promoting Collaboration and Innovation A public platform on the African seed sector would not only facilitate access to information but also catalyze collaboration and innovation. By fostering knowledge exchange and networking opportunities, the platform could spark dialogue among diverse stakeholders, including researchers, entrepreneurs, and civil society organizations. This collaborative ethos could, in turn, inspire innovative solutions to pressing challenges, such as climate change resilience, seed quality assurance and access to quality seeds. AfricaSeeds Contribution to a Seed Sector Platform AfricaSeeds is actively engaged in developing an online knowledge platform dedicated to the African seed sector, known as the Seed Knowledge Gateway (SKG). The inaugural Inception Workshop, held from 11 to 13 February, 2019, in Akosombo, Ghana, marked the commencement of the preparatory phase for the SKG, conducted in collaboration with the Forum for Agricultural Research in Africa (FARA). The preparatory phase of the SKG was made possible through support from the Swiss Development Cooperation (SDC). Subsequently, from 7 to 9 August, 2019, AfricaSeeds convened with key stakeholders in Abidjan to validate the project document outlining the next four years of the Seed Knowledge Gateway (SKG). Currently, the planning phase of the SKG is undergoing review, with efforts underway to identify suitable investors to propel the initiative forward.
Speeches made during Parliamentary debates are recorded in Hansard. For ease of browsing we have grouped debates into individual, departmental and legislative categories. These initiatives were driven by Baroness Sheehan, and are more likely to reflect personal policy preferences. A Bill to prohibit licensing to search and bore for petroleum and onshore hydraulic fracturing activities; to amend the principal objective for the Oil and Gas Authority to be to meet the carbon reduction target for 2050 under the Climate Change Act 2008; and to provide for the Oil and Gas Authority to produce strategies which include the phasing out of the extraction and use of petroleum and transitional planning towards renewable energies A Bill to prohibit licensing to search and bore for petroleum and onshore hydraulic fracturing activities; to amend the principal objective for the Oil and Gas Authority to be to meet the carbon reduction target for 2050 under the Climate Change Act 2008; and to provide for the Oil and Gas Authority to produce strategies which include the phasing out of the extraction and use of petroleum and transitional planning towards renewable energies Baroness Sheehan has not co-sponsored any Bills in the current parliamentary sitting I expect private members' bills to start being considered again in early 2021. Recent evidence on the feedstocks used in the production of wood pellets is available from a number of sources, for example, from the Sustainable Biomass Program's 2021 Annual Review, a 2022 Fibre Study by independent experts for the Wood Pellet Association of Canada, and a 2022 review by the US Forest Service on wood pellet production in the US (the primary source of biomass for energy use). DESNZ officials engaged with forestry experts and relevant officials to understand the evidence about the claims made in the Panorama programme and found no evidence that biomass pellets used in the UK are unsustainable or were associated with forest destruction. In addition, as part of ongoing scheme compliance monitoring, Ofgem opened an additional assurance audit of Drax. Based on the evidence reviewed to date, Ofgem has not established any non-compliance that would affect the issue of Renewables Obligation Certificates to Drax. Ofgem has assured the Government that this matter is a priority for them and they are progressing the investigation at pace. Ofgem is engaging constructively with Drax, however, due to the sizeable amount of evidence that needs to be scrutinised in the course of this investigation and the fact that at this stage it is unclear whether further information will have to be collected, Ofgem cannot provide a timeline for when this investigation may be concluded. In July 2022, the Government confirmed that Ofgem will be the heat network regulator and introduced the Energy Bill to Parliament. The Energy Bill is being driven forward this session and will provide Ofgem with powers to regulate heat networks. The Energy Bill will also facilitate the introduction of heat network zoning. We will consult further on zoning and intend to lay Regulations to ensure zoning will be established in England in 2025. Zoning policy is devolved. The UK has been a strong advocate for ECT modernisation. At the Energy Charter Conference on 22 November, the decision to adopt the modernised Treaty was postponed. The UK has been closely monitoring the situation surrounding the Energy Charter Treaty's modernisation process, including the positions taken by other Contracting Parties. The UK holds regular meetings with members of the Energy Charter Treaty Modernisation Group, including the EU and EU Member States, with respect to the modernisation of the ECT. The Government is closely monitoring the positions of other Contracting Parties to the Energy Charter Treaty and takes into account these positions in its own interaction with the modernisation process of the Energy Charter Treaty (ECT). The Government's Net Zero Strategy sets out a decarbonisation pathway to meet all carbon budgets. The figure quoted includes emissions from international aviation and shipping, which are not in scope for Carbon Budget 4 (CB4). Table 9 of the technical annex shows emissions contributing to CB4 (which does not include international aviation and shipping emissions) would be 359 MtCO2e on average per year, equivalent to 1793 MtCO2e over the five-year budget. This figure also uses the global warming potential methodology which was agreed internationally at COP 26. The clause does not have this effect. The intention behind clause 111 is to broaden the definition of "removals" of greenhouse gases beyond nature-based greenhouse gas removal methods (GGRs), such as tree planting, to include those achieved by engineered GGRs, such as Bioenergy with Carbon Capture and Storage. The Government does not currently intend to purchase offsets to set towards its carbon budgets, although it has retained the option to do so in the future if appropriate, as permitted by the Climate Change Act 2008. The Met Office's WeatherReady campaign, run in partnership with Cabinet Office and expert partners, is a year-round campaign to help individuals, communities and businesses prepare for and cope with severe weather and its impacts. It includes webpages on heating your home in winter and getting your home winter ready and provides advice on keeping homes at a comfortable temperature, even if this is slightly below 18°C, for healthy adults under the age of 65 and wearing appropriate clothing. Warmer indoor temperatures may be required for vulnerable individuals, including younger children. Both the Government and its Chief Scientific Advisors are informed by the latest scientific evidence, as presented by the Intergovernmental Panel on Climate Change. The Panel's reports set out in detail how, as carbon dioxide concentrations in the atmosphere rise, global temperatures are also expected to rise, with severe impacts to people and nature. According to the Oil and Gas Authority's 'UKCS Decommissioning Cost Estimate 2021' report (copy attached), the total cost of decommissioning UK Continental Shelf offshore oil and gas infrastructure has reduced to £46bn[1] equating to a projected saving of nearly £14bn (23%) since the 2017 cost reduction target[2] was first established. With extant oil and gas licences which have not yet been granted planning approval, we do not know which will be developed, so it is not possible to say how much they will cost to decommission, although the Oil and Gas Authority's UK Continental Shelf full portfolio estimate referenced in the report attached includes £2bn for planned but as yet unsanctioned/not-built projects. [1] Costs shown in 2016 prices, for expenditure in 2017 and after [2] Basis of 2017 estimate, 2016 Annual OGA Stewardship survey The Oil and Gas Authority's estimate for proven and probable (2P) UK petroleum reserves as at end 2020 is 4.4 billion barrels of oil equivalent, and the estimate for the UK's contingent (2C) resources as at end 2020 is 6.8 billion barrels of oil equivalent. It is not possible to say with certainty how much of this will be extracted as this will be driven by a range of commercial and regulatory factors. As of June 2021, the Coal Authority estimates that overall there are 3,814 million tonnes of coal resources. There are five current commercial projects* with a projected tonnage of around 35 million tonnes, of which around 14 million tonnes has been worked. *Not including Forest of Dean gales. Like our independent advisers, the Climate Change Committee (CCC), the Government sees continued but declining use of fossils fuels during the transition to net zero. The recently published Net Zero Strategy (figure 14, page 81) shows that we expect both natural gas and oil consumption to more than halve by 2037 as fossil fuels are replaced by new sources of energy. A £750 million funding package announced on 8 April is aimed at charities who provide frontline services to vulnerable people affected by the pandemic in the UK. The Government funding will be allocated based on evidence of service need. There are three tranches of money; The Ministry of Housing, Communities and Local Government is providing £6 million of emergency funding to homelessness charities directly affected by the coronavirus. The funding will be distributed to local frontline homelessness services via the charity Homeless Link and will support organisations at risk of having to cut services and staff or cease operations due to the pandemic. Applications are now open via the Homeless Link website. Charities are also eligible for support under the Coronavirus Business Interruption Loan Scheme (CBILS). CBILS provides businesses with annual turnover of under £45m with access to working capital of up to £5m. It supports a wide range of business finance products, including term loans, overdrafts, invoice finance and asset finance facilities. Since Monday 27 April, registered charities have been exempted from the requirement that the applicant derives at least 50% of its income from trading activity. Charities are also eligible for the Bounce Back Loan Scheme (BBLS), which launched on Monday 4 May and supports the smallest SMEs by providing loans from £2,000 up to 25% of the business' turnover with a maximum loan size of £50,000. By providing lenders with a 100% government-backed guarantee and standardising the application form, businesses and charities applying for these loans could receive them within days. Further details on CBILS and BBLS can be found on GOV.UK or the British Business Bank website. On 1 May, my Rt. Hon. Friend the Secretary of State for Business, Energy and Industrial Strategy announced that a further up to £617 million is being made available to Local Authorities in England to allow them to provide discretionary grants. It is the Government's intention that charity properties in receipt of charitable business rates relief should be considered as one of the priority businesses for these funds. Any enquiries regarding eligibility for, or provision of the Small Business Grant Fund should be directed to the relevant local authority. These schemes are part of a wider package of measures designed to support small businesses and charities facing difficulties in this period of uncertainty, which for charities could include, for example, the Coronavirus Job Retention Scheme, the Tax Deferral scheme, a temporary freeze on evictions and the Self-Employed Income Support Scheme. These projects were funded through a joint UKRI-DHSC rapid response call that was launched in February 2020 and has since announced a total of £24.6m worth of funding for 27 projects. Of the 21 projects announced on 17 April, 20 projects will receive their grants through UKRI terms and conditions which can be found on the UKRI website. In addition to this, as researchers undertaking work relevant to public health emergencies they are required to set in place mechanisms to share quality-assured interim and final data as rapidly and widely as possible, including with public health and research communities and the World Health Organization in accordance with the Joint statement on sharing research data and findings relevant to the novel coronavirus outbreak. This can be viewed on the Wellcome website. The project contracted by DHSC was under standard policy research programme terms available from the National Institute for Health Research (NIHR) website. This contract has a range of terms that allow DHSC to ensure that public interest is delivered by the research. The Government is aware that many young people will have a strong personal interest in the Israeli-Palestinian conflict. Schools should ensure that political expression by senior pupils in school is conducted sensitively, avoiding disruption or an atmosphere of intimidation or fear for other pupils and staff. On 28 May 2021, my right hon. Friend, the Secretary of State for Education, wrote to schools to remind them of requirements on political impartiality and their responsibility to deal with antisemitic incidents with due seriousness. This followed a reported increase in such incidents in school during the recent conflict, including the expression of antisemitic views and bullying towards Jewish pupils and teachers. All schools should set clear, reasonable, and proportionate expectations of pupil behaviour in line with the Department's guidance on 'Behaviour and discipline in schools', published in 2016. It is for individual schools to develop their own best practice for managing behaviour in their school. The UK recognises the growing pressure to extract deep-sea resources, and is deeply concerned about the potential impacts of mining activities on the fragile marine environment. We have commissioned an independent review of the existing literature in relation to deep sea mining, which will seek to include elements such as environmental, economic and societal considerations, and to identify key outstanding questions and evidence gaps. The terms of reference and a summary of the evidence review will be published in due course. We have committed not to sponsor or support the issuing of any exploitation licences for deep sea mining projects, unless and until there is sufficient scientific evidence about the potential impact on deep sea ecosystems, and strong and enforceable environmental regulations and standards are in place. Further and detailed environmental impact assessments would be required in advance of any exploitation licence being issued. The First Secretary led a careful review process to look at every strand of the ODA budget and assess the impacts of spend. Ministers prioritised programmes based on strategic objectives such as poverty reduction for the 'bottom billion', tackling climate change and reversing biodiversity loss, championing girls' education, and the global response to Covid-19. Currently we are discussing specific savings with suppliers and partners and we will publish the revised ODA allocations in due course after this process has been completed. The First Secretary of State, supported by the International Development Secretary and ministers from ODA spending departments, led a cross government review to identify reductions in this year's ODA budget needed to meet the 0.7% commitment. The careful review process looked at every strand of the ODA budget and assess the impacts of spend. Several review sessions were held in which Ministers prioritised programmes based on strategic objectives such as poverty reduction for the 'bottom billion', tackling climate change and reversing biodiversity loss, championing girls' education, and the global response to Covid-19. The First Secretary led a careful review process to look at every strand of the ODA budget and assess the impacts of spend. ODA spend for 2020 was prioritised to focus on key strategic objectives including poverty reduction for the 'bottom billion', tackling climate change and reversing biodiversity loss, championing girls' education, UK leadership in the global response to Covid-19, and protecting the UK's science base. These priorities will help the government to deliver our manifesto commitments and ensure that the UK is a global force for good. The Department, working with HM Treasury and other Government departments, is continually planning to ensure the UK meets its Official Development Assistance (ODA) commitment. As normal, there will continue to be adjustments in-year to individual departmental ODA spend to meet the 0.7% target. DFID has been preparing for this by working with our Ministers and other aid spending Departments to prioritise our lifesaving aid, stop the spread of coronavirus and ensure our aid delivers the best value for money for the British taxpayer. The UK is committed to ensuring that our assistance reaches the most marginalised and vulnerable people who will be the worst affected by humanitarian crises and most at risk. This includes older people as well as other marginalised groups, such as women and girls, and people with disabilities. We are deeply concerned about the significant impact of COVID-19 on older people, people with disabilities, and other marginalised groups. Through £50 million of support to over 29 countries, UK aid is helping to meet the needs of the most vulnerable groups, including older people, through effective communication about personal hygiene, particularly the importance of handwashing. DFID is also engaging internationally to push for greater consideration of vulnerable groups, including older people, across the COVID-19 response. Support for the most marginalised and vulnerable populations remains part of this government's mission. We will continue to prioritise those furthest left behind and champion the inclusion of vulnerable groups in our humanitarian responses. We have committed up to £764 million of UK aid funding to date, to support global efforts to combat COVID-19. This includes up to £296 million to support and enhance resilience in vulnerable countries, encompassing: We have also provided up to £150 million of UK aid funding to the IMF's Catastrophe Containment and Relief Trust to help developing countries meet their debt repayments so that they can focus their available resources on tackling COVID-19. The UK strongly supports the UN's Global Humanitarian Response Plan (GHRP) to tackle COVID-19. So far, we have pledged up to £764 million of UK aid to support the global effort to combat COVID-19. From this, £220 million has gone to UN agencies in the GHRP, such as the World Food Programme and UN Refugee Agency, as well as humanitarian organisations such as the Red Cross and international NGOs. DFID is also adapting its programmes across its country network to respond to COVID-19 and address the needs of the most vulnerable, as outlined in the GHRP. As a leading donor to the COVID 19 global response and one of the biggest humanitarian donors globally, we are ensuring that our support goes to those who need it the most, including refugees and other forcibly displaced populations. The UK has lobbied successfully at the UN to ensure that vulnerable groups such as refugees are taken into consideration and prioritised in the UN Global Humanitarian Response Plan. The Government is committed to supporting efforts to meet Sustainable Development Goal 16.9 which aims to provide legal identity for all, including birth registration, by 2030. The Government continues to advocate for the issuance of civil documentation in specific post-conflict countries through UN mechanisms, including the Security Council Working Group for Children and Armed Conflict. Last year DFID approved a four-year £15 million Digital Identity as an Enabler for Development programme to support the World Bank Group's Identification for Development initiative to implement trusted, secure, universal and inclusive digital Identification and civil registration systems from birth to death in over 40 countries. Children on the Move is a DFID-funded 3-year programme (2017-2020) working with UNICEF to help children on the move in Somalia, Ethiopia and Sudan. In Somalia the work includes providing children with a legal identity, without which they are at a greater risk of family separation, trafficking and illegal adoption. In 2019, 101,300 children were provided with legal identity documents including a birth certificate. As well as this, some of the £30 million which DFID is providing to the Global Financing Facility (GFF) supports birth registration in DRC, Kenya, Liberia, Rwanda and Uganda. The UK is reaching refugees with information and support to reduce rumours, myths, fear and panic about COVID-19, through the Communications with Communities Working Group. This includes a large array of methods to disseminate messages to refugees and the host community including community meetings where possible; radio, posters and leaflets, videos, loudspeakers and information service centres. Messages are being endorsed by the Cox's Bazar Civil Surgeon, translated into the Rohingya language and Bangla, and are being developed in consultation with Rohingya people, including religious leaders, to ensure they are effective. Child-friendly messaging is also being used. The UK is working with partners to support and protect Rohingya children whose parents or care-givers become sick or die from COVID-19. This includes identifying temporary carers within the same camp block for children at risk of being left alone. These efforts are building on existing foster and child protection systems and will increase the number of Child Protection Volunteers within the Rohingya community in the camps. Although schools in the camps are closed, every effort will be made to get them up and running again as quickly as possible, and to ensure children return to education. Cox's Bazar District, where the Rohingya refugee camps are located, is subject to lockdown measures to help prevent the transmission of COVID-19. In addition, on World Health Organization advice, the Bangladeshi Government has instructed a reduction in humanitarian activity to an agreed list of critical (lifesaving) services. This means that fewer aid workers than normal are entering the refugee camps. For example, essential site management activities continue, but staff are reduced to 20% of their usual number. There are no education facilities open at the moment. However, critical UKAid funded services such as food and medical aid continue to be delivered to support the daily needs of refugees, including by refugee volunteers themselves. We consider this temporary reduction in staff accessing the camp a challenging, but important measure to try to prevent or at least delay the transmission of the virus in the camps. Social distancing arrangements have been put in place to prevent the possible spread of COVID-19 between humanitarian workers, and to provide medical care for those on the humanitarian frontline, coordinated by IOM. We are closely monitoring the situation, including access issues, and working with our humanitarian partners to best protect and prepare the Rohingya and host communities for an outbreak and to maintain critical services and assistance. Approximately 40% of trafficking survivors in the Rohingya refugee camps are children, predominantly girls. Girls are at risk of early marriage both within the camps and through trafficking. Irregular movements are not new to Cox's Bazar district or Bangladesh, which is on the US' Tier 2 Watch List for Trafficking in Persons. The UK has contributed significantly to the protection sector within the humanitarian response, through partners including the International Organisation for Migration, UN High Commissioner for Refugees and the UN Children's Fund. Our support helps to raise awareness about the risks of trafficking and build capacity among law enforcement to prevent it. UK funding also supports efforts to identify and provide direct assistance to victims of trafficking, such as safe shelters, psycho-social support, and social workers for children. We are extremely concerned about the reports of hundreds of Rohingya still at sea and reports of failure to disembark vessels in distress. I have raised this with the Bangladesh Foreign Minister and with the Bangladesh High Commissioner in London. In addition, the British High Commission in Dhaka have raised this issue with the Government of Bangladesh. We continue to urge the Governments of Bangladesh, Thailand, Malaysia and other governments in the region to assist boats carrying Rohingya refugees to land. We are working with UN partners, including the International Organisation for Migration and UN High Commissioner for Refugees (UNHCR), to find out more and provide live-saving action where possible. The UN are already providing shelter and assistance to survivors from the boat which reached Bangladesh on 16 April and stand ready to help any further refugees who make it ashore. We agree with UNHCR that there is a need for greater coordination and responsibility-sharing by states to address the maritime movements of refugees and asylum-seekers in the Bay of Bengal and Andaman Sea. The UK is committed to protecting the Rohingya community, some of the world's most vulnerable peoples. The UK is leading international efforts to develop a COVID-19 vaccine that is equitable and accessible. Following a virtual summit of G20 leaders on the 26 March, the UK Prime Minister called on governments to work together to develop a vaccine as quickly as possible and make it available to anyone who needs it. As subsequently agreed by the G20, we support a global approach to the rapid development and scaled up manufacture of vaccines that are equitable and accessible. We are working with technical partners and WHO to support an approach to Research & Development, regulation and funding that will deliver that. Our £250 million funding to the Coalition for Epidemic Preparedness Innovations (CEPI) is the biggest donation of any country to date. CEPI is an innovative partnership between public, private, philanthropic, and civil society organisations, to develop vaccines to stop future epidemics. CEPI is leading the international coordination of vaccine research, making sure that the best experts from around the world get the investments they need to make rapid progress on a vaccine for this COVID-19 pandemic. Furthermore, the UK is also the largest funder to Gavi, the Vaccine Alliance. Gavi will play a key role in working with CEPI to make a new coronavirus vaccine available and affordable. The UK has long supported affordable and equitable access to essential medicines, vaccines and other health commodities, here in the UK and globally. Measures to ensure access to products that may emerge from research include voluntary patent sharing and licensing, whereby patent holders allow others to manufacture, import, and/ or distribute their patented products to accelerate entry of generic medicines to market, pooled procurement and sharing and information exchange. We are committed to collaborating with public and private partners in the UK and internationally, including exploring voluntary arrangements, such as existing mechanisms, to accelerate development and equitable access in all countries to affordable health technologies for responding to COVID-19. The shape of any agreements are being explored. DFID is supporting global co-ordinating efforts through our support to the WHO R&D Blueprint. The Blueprint aims to accelerate research and innovation to contain the spread of the pandemic and ensure that those affected receive optimal care. This includes support to the 'Solidarity' trials which is testing four existing anti-viral agents or combinations which exist already that could be effective against COVID-19. We recognise that that older people, people with disabilities, people with pre-existing conditions, and those with complex needs are disproportionately impacted and at more serious risk of severe complications and fatality due to COVID-19. We are working hard to ensure that our help reaches those most in need, including older people, through close collaboration with our partners. Our funding is supporting a range of initiatives and partners to ensure that it can reach those in need and strengthening fragile health services in the world's poorest countries where there is a high chance of the disease spreading rapidly. This includes supporting the United Nation's Global Humanitarian Response Plan to tackle COVID-19 and help to the most vulnerable across the globe. The plan explicitly identifies older people given their susceptibility to the virus and their broader vulnerability. Our latest UK aid announcement on 12 April of £200 million, is supporting humanitarian organisations to help reduce mass infections in developing countries that often lack the healthcare systems to track and halt the virus. This includes £130 million to UN agencies in response to their COVID-19 humanitarian appeals. In order to reduce transmission, the UK government is also working with Unilever to fund a £100 million global hygiene programme. This campaign will be tailored to communities to ensure messages are inclusive and effective. It will reach up to a billion people worldwide, raising awareness and changing behaviour, to make sure that people are washing their hands with soap regularly and disinfecting surfaces. The programme will also provide over 20 million hygiene products in the developing world, including in areas where there is little or no sanitation. In addition, we are redirecting existing support and programmes to be more responsive to COVID-19. We recognise that that older people are disproportionately impacted and at more risk of severe complications and death due to COVID-19. As well as the immediate risk of catching COVID-19, marginalised groups also experience secondary impacts of the virus. This includes reduced access to healthcare services and information, which is further compounded by existing accessibility barriers. For example, healthcare information is not routinely distributed in accessible formats. Older people with visual impairments will need access to large print documentation, or may need other alternative communication methods that fit best with their needs. We are working hard to ensure that our help reaches those most in need, including older people, through close collaboration with our partners. Our funding is supporting a range of initiatives and partners to ensure that it can reach those in need and strengthen fragile health services in the world's poorest countries where there is a high risk of the disease spreading rapidly. This includes supporting the United Nation's Global Humanitarian Response Plan to tackle COVID-19 and help to the most vulnerable across the globe. The plan explicitly identifies older people given their susceptibility to the virus and their broader vulnerability. Our latest UK aid announcement on 12 April of £200 million, is supporting humanitarian organisations to help reduce mass infections in developing countries that often lack the healthcare systems to track and halt the virus. This includes £130 million to UN agencies in response to their COVID-19 humanitarian appeals. To help reduce transmission and inform the public, the UK government is also working with Unilever to fund a £100 million global hygiene programme. This campaign will be tailored to communities to ensure messages are inclusive and effective. It will reach up to a billion people worldwide, raising awareness and changing behaviour, to make sure that people are washing their hands with soap regularly and disinfecting surfaces. The programme will also provide over 20 million hygiene products in the developing world, including in areas where there is little or no sanitation. In addition, we are redirecting existing support and programmes ensure responses to COVID-19 are fully inclusive, including supporting the needs of older people. The UK is at the forefront of the global response to COVID-19. We are using UK aid to its full effect to counter the health, humanitarian and economic risks of this pandemic. Since the £46 million was announced, the UK has committed further resources, up to £241 million of funding to support the global efforts to combat the outbreak of COVID-19. These funds are supporting three main areas of work: helping developing countries manage the crisis by supporting the operations of the UN, the International Federation of Red Cross and Red Crescent Societies and the provision of expert advice; supporting the International Monetary Fund to relieve debt servicing pressures on countries struggling with the virus; and supporting international scientific efforts to develop diagnosis tests and vaccines. Furthermore, through our ongoing overseas operations, DFID is supporting programmes in over 20 countries to improve health systems, such as by building capability for health security through disease surveillance and response. DFID continues to lead the UK's work to reduce poverty and deliver the Sustainable Development Goals, maximising opportunities to work jointly with other government departments as demonstrated by the cross-Government response, jointly led by DFID and FCO, to supporting global efforts to combat the COVID-19 pandemic. The PM has appointed a fully joint junior ministerial team, along with separate Secretaries of State for the Foreign Office and DFID, to ensure the departments will work more closely overseas to deliver the Government's objectives. DFID ministers retain authority over decisions on DFID aid spending and accountability for all financial resources remains within existing departmental lines. Single Departmental Plans are updated annually setting out the Department's plans to deliver the Global Goals. The most recent version was uploaded in June 2019 and can be found at: Plans will be updated once departments have prepared them as part of the normal government planning and performance process. The Government take the safety of healthcare workers very seriously. The COVID-19 Infection Prevention and Control guidance has been updated to ensure that healthcare workers are protected and all hospitals remain safe, now and in the future. Infection prevention and control (IPC) measures are absolutely essential to ensure all healthcare workers are protected from infection with COVID-19. The UK has announced up to £241 million of aid funding to support the global efforts to combat the outbreak of COVID-19. As part of this, we are supporting the World Health Organisation and UNICEF to strengthen infection prevention and control in health facilities, to protect health workers in developing countries. HMG is closely monitoring the global transmission of the Covid-19, in particular the capabilities and vulnerabilities of developing countries, using the State Party Self-Assessment Annual Reporting index provided by the World Health Organisation (WHO). The UK's global response strategy is to support the WHO and other multilateral actors to contain Covid-19 and mitigate secondary health and socio-economic impacts, especially for vulnerable populations in Low- and Middle-Income Countries. Contributing to the WHO's appeal will enable UK aid to support a strong international response alongside other key donors. We are targeting our efforts where we have existing capacity to maximise our impact, and working with international partners to ensure aid is effectively distributed to vulnerable countries. The PM appointed separate Secretaries of State for the Foreign Office and DFID in the recent reshuffle. The Prime Minister has also appointed a fully joint junior ministerial team to ensure DFID and the FCO will work more closely overseas to deliver the Government's objectives. DFID ministers retain authority over decisions on DFID aid spending and accountability for all financial resources remains within existing departmental lines. As set out in the UK Aid Strategy, each department or public body spending Official Development Assistance (ODA) is accountable for their own spend. As such, there must be clear lines of accountability for all ODA programmes. Accounting Officers of departments or public bodies whose money is being spent on ODA, need to ensure they fulfil their obligations under HMT's Managing Public Money as they remain personally accountable for ensuring the regularity, propriety and value for money of the use of public funds. Departments must ensure that spending on ODA is within their legal spending authority, meets the OECD eligibility criteria and complies with government aid policy as outlined in the UK Aid Strategy. Design and delivery of Official Development Assistance projects is the responsibility of the individual spending department. DFID ministers retain authority over decisions on aid spending and accountability for all financial resources remains within existing departmental lines. Departments will work more closely together overseas to deliver Her Majesty's Government's objectives and ensure the UK's international operations are fully integrated. Goods originating from illegal Israeli settlements are not covered by any United Kindgom trade agreement, so do not receive tariff preferences. Should HMRC have reasonable doubts regarding the origin of an imported good, or suspect that a certificate of origin has been erroneously completed, then a verification of the good's origin can be requested. The existing United Kingdom-Israel Trade and Partnership Agreement requires that goods originating in Israel are declared as such upon import into the United Kingdom. Goods imported from illegal Israeli settlements in the Occupied Palestinian Territories are not entitled to benefits from preferential trade and we are committed to maintaining that approach. The UK National Contact Point (UK NCP), which operates independently of the Department for International Trade, has not found that JCB violated human rights. However, in line with the OECD Guidelines, the UK NCP has advised JCB to develop a policy commitment to respect human rights and to carry out human rights due diligence in supply chains. The UK NCP will request an update from JCB on the implementation of its recommendations in a year's time and in the interim is available to provide support as necessary. As part of its commitment to the OECD Guidelines, the UK NCP promotes the Guidelines to business, NGOs and trade unions, and is available to provide advice on adhering to the recommendations it contains. On 12 December 2020, the Prime Minister announced that the British government will no longer provide any new direct financial or promotional support for the fossil fuel energy sector overseas, apart from a small number of tightly-bound exceptions that are still to be determined. The date of implementation of the new policy will be determined following the consultation that was launched on the same day.
Eczema, a common skin condition, can be triggered by various factors. Identifying these triggers is crucial for effectively managing the condition. In this blog post, we will explore the common triggers for eczema flare-ups and provide useful tips for managing these triggers to minimize their impact on your skin. Understanding the triggers of eczema is essential for individuals seeking relief from the discomfort and irritation caused by this condition. Common Triggers for Eczema Flare-Ups Eczema flare-ups can be triggered by various factors, and it's essential to identify and manage these triggers effectively. Some common triggers for eczema flare-ups include: - Allergens: Substances like pollen, pet dander, and mold can trigger eczema. - Irritants: Harsh soaps, detergents, and certain fabrics can irritate the skin and lead to flare-ups. - Weather: Extreme temperatures, high humidity, or low humidity can exacerbate eczema symptoms. - Stress: Emotional stress or anxiety can trigger eczema flare-ups in some individuals. - Foods: Certain foods such as dairy, nuts, or wheat may act as triggers for eczema. By identifying and minimizing these triggers, individuals can effectively manage their eczema and reduce the frequency of flare-ups. Tips for Managing Eczema Triggers Eczema flare-ups can be challenging to manage, but there are several strategies you can use to minimize the impact of triggers on your skin. Here are some helpful tips for managing eczema triggers: - Identify Your Triggers: Keep a journal to track your eczema flare-ups and try to identify patterns related to triggers such as stress, allergens, or weather changes. - Moisturize Regularly: Hydrated skin is less prone to irritation, so make sure to moisturize using gentle, fragrance-free products. - Avoid Harsh Soaps and Detergents: Opt for mild, unscented soaps and detergents to minimize skin irritation. - Stay Cool: Heat can exacerbate eczema, so try to stay cool and avoid excessive sweating. - Manage Stress: Stress can be a major trigger for eczema, so practice relaxation techniques such as yoga or meditation. By being proactive in identifying and managing your eczema triggers, you can help minimize flare-ups and keep your skin as healthy as possible.
Teach your dog to retrieve everyday items What if your dog could bring you his/her bowl—or even a beer? Training a dog to retrieve everyday items is not only helpful, but it is also a great way to keep your dog active mentally and physically. Teaching your dog to retrieve an object involves four behaviors: getting an object, holding the object, bringing the object, and releasing the object. Each step is taught separately and then put together in reverse order; you teach your dog to take and release an object and then to go to the object and bring it back. In this video, KPA CTP Dan Clark teaches a Labrador retriever (naturally!) to retrieve her bowl from the floor and, later, the cupboard! For more tips on how to train better and have fun with your dog, check out KPA's Dog Trainer Comprehensive course! Happy Training!
On 1 June 2023, the European Parliament voted in favor of the draft Corporate Sustainability Due Diligence Directive (CSDDD). The EU now aims to finalize and formally adopt the law before next year. 🌱 What is the aim? The CSDDD "aims to ensure that companies active in the internal market contribute to sustainable development and the sustainability transition of economies and societies by respecting human rights and the environment". 🌱 What does it say on raw material sourcing and waste management? The draft CSDDD states that "[a]dverse human rights, and environmental impacts occur in companies' own operations, subsidiaries, products, services, and in their value chains, in particular at the level of raw material sourcing […] or at the level of product or waste disposal". It highlights that "for the due diligence to have a meaningful impact, it should cover human rights, and environmental adverse impacts generated throughout the […] waste management". Notably, it also states that "[w]hen a company sources products containing recycled material, it may be difficult to verify the origins of the secondary raw materials". Here, it suggests that "the company should take appropriate measures to trace secondary raw materials to the relevant supplier and evaluate whether there is adequate information to demonstrate that the material is recycled". 🌱 What does it say regarding critical raw materials? The draft CSDDD states that "[g]lobal value chains in particular critical raw materials value chains, are impacted by detrimental effects of natural or man-made hazards". It highlights that "the frequency and impact of […] shocks [to critical value chains] are likely to increase in the future, constituting a driver for […] market and trade uncertainty". In line with this, it holds that "the EU should initiate an annual Union-wide assessment of the resilience of companies to adverse scenarios". 🌱 Will it apply to technology companies? On 29 November 2022, a group of organizations publicly called on EU policymakers to amend the draft CSDDD to make sure the technology sector would be held accountable for their human rights violations. The text has now been amended to apply to all sectors, including the technology sector. Under the current text, the CSDDD will apply to all "companies with more than 250 employees […] and a worldwide net turnover exceeding EUR 40 million" annually. It will also apply to "companies which are the ultimate parent company of a group that had 500 employees and a net worldwide turnover of more than 150 million" annually. Moreover, it will apply to similarly sized companies located in third countries, "which generated a net turnover of at least EUR 40 million in the Union". 🌱 What obligations are placed on companies? Under the current text, companies "should integrate due diligence into corporate policies, identify, where necessary, prioritise, prevent, mitigate, remediate as well as bring to an end and minimise the extent of potential and actual adverse human rights and environmental impacts". It also says that companies should "establish or participate in a notification and non-judicial grievance mechanism". Moreover, companies are to "monitor and verify the effectiveness of their actions taken in accordance with the requirements" and to "communicate publicly on their due diligence, and engage with affected stakeholders throughout this entire process". Notably, under the current text, "companies should [also] adopt and implement a transition plan […] to ensure that the business model and strategy of the company are aligned with the objectives of the transition to a sustainable economy and with the limiting of global warming to 1.5 °C […], as well as the objective of achieving climate neutrality by 2050". Read more about the CSDDD here: - https://www.europarl.europa.eu/doceo/document/TA-9-2023-0209_EN.pdf - https://www.e3g.org/news/csddd-vote-in-european-parliament-meps-back-people-and-the-environment/
Over the last few weeks, I have been meeting children from different parts of Punjab. They were between 3 to 5 years of age, and included the children of my friends and extended family. I was pleasantly shocked to hear these kids speakin Punjabi. "Kithay chalay o", "aa ki aey", "ki karde paye o" are some of the Punjabi phrases I recall having heard. Below is a rare sight of a shop that displays a sign board in Punjabi "Billay d Hatti" (Shop of Billa) in Raja Bazaar in Rawalpindi. Punjabi is the most widely spoken language across Pakistan. However, most of the people in Punjab, especially in urban centers, do not encourage their children to speak their mother tongue, Punjabi. Shiraz Hassan is a magazine reporter and feature writer for Sunday Magazine in Lahore, Pakistan, where he covers social issues, art and culture. At the magazine, he has published more than 400 features related to social problems, culture and 'show biz.' Shiraz has also worked as a news editor at the radio network "MAST FM 103" in Lahore. He writes about culture and heritage of South Asia, particularly Pakistan. He advocates rich culture of this land and tries to explore facts. Recently he was given an award from the Federal Ministry of Population Welfare for his article on population crises. Writers Guild also awarded him a Medal of excellence for his work.
Trinity County is a county in northwestern California. Trinity County is rugged, mountainous, heavily forested, and lies along the Trinity River within the Salmon and Klamath Mountains. It is also one of three counties in California with no incorporated cities. As of the 2020 census, the population was 16,112, making it the fifth least-populous county in California. The county seat and largest community is Weaverville. Trinity County has a rich history of Native Americans: Tsnungwe including the South Fork Hupa and tł'oh-mitah-xwe, Chimariko, and Wintu. The county takes its name from the Trinity River, named in 1845 by Major Pierson B. Reading, who was under the mistaken impression that the river emptied into Trinidad Bay. Trinity is the English translation of Trinidad. Trinity County was one of the original counties of California, created in 1850 at the time of statehood. Parts of the county were given to Klamath County in 1852 and to Humboldt County in 1853. According to the U.S. Census Bureau, the county has a total area of , of which is land and (0.9%) is water. The county contains a significant portion of Shasta-Trinity National Forest and the Trinity Alps Wilderness—the second largest wilderness in California. Trinity County is made up of five census tracts. Census Tract 1.01 includes the communities of Douglas City, Lewiston, Trinity Center, and part of Coffee Creek and Weaverville. Notable features are Trinity Dam and Lake, Lewiston Dam and Lake, the Trinity River, and the Lewiston Valley. It has a population of 2585 people in 550 square miles, leading to a population density of 4.7 people per square mile. Census Tract 1.02 includes most of Weaverville and Coffee Creek. It is the most populous census tract in the county, with 4558 people. It has 449 square miles, leading to a population density of 10.2 people per square mile. Notable features are the Weaver Basin, the Trinity Alps, Scott Mountain, and the upper Trinity River. Census Tract 2 includes the Downriver area of Trinity County. This means the communities of Junction City, Big Flat, Big Bar, Burnt Ranch, Hawkins Bar, and Salyer. It includes 2024 people, and notable features are the Trinity River, the Trinity Alps, and the New River. Census Tract 3 includes the communities of Hayfork, Hyampom, and Wildwood. It has 3105 people in 600 square miles, leading to a population density of 5.2 people per square mile. Notable features are the South Fork of the Trinity River, South Fork Mountain, Hayfork Valley, Hyampom Valley, Chanchellula Peak, and Hayfork Bally. Census Tract 4 is the largest by area but the least populous census tract in the county with 975 people. It contains 833 square miles, leading to a population density of 1.2 people per square mile. The largest community by far is Mad River, with other smaller ones being Ruth, Kettenpom, and Zenia. Notable features include South Fork Mountain, the Mad River, the Van Duzen River, Ruth Lake, Ruth Valley, Kettenpom Valley, and Hoaglin Valley. The county hosts many visitors, especially during summer months, for camping, backpacking, boating on the lakes, rafting/kayaking on the rivers, hunting, and fishing. The summers tend to be clear, sunny, warm, and very dry, with little rain from June to September except for some mountain thunderstorms in the highest elevations. Summer days in the populated areas of the county range from 90 to 97 degrees, and summer nights range from 45 to 55. Winter days range from 40 to 50, and nights range from 25 to 35. The winters tend to have copious precipitation, increasing with elevation and falling mostly as rain under 1000m/3300 ft in the valley bottoms, and mostly as snow over 1000m/3300 ft on the mountainsides. December, January, and February are the wettest. The precipitation ranges from 30 to 35 inches at low elevations isolated from coastal influence, such as Big Bar, Hayfork, and Weaverville, up to 55 or 60 inches at high elevations, on the coastal side of South Fork Mountain, or where gaps in the mountain allow for precipitation to get through. Examples of this last phenomenon include Salyer and Forest Glen. Kalmia Lake, at nearly 7500 feet in the Canyon Creek area of the Trinity Alps, is reputed to be the snowiest place in California, outpacing Lake Helen in Mount Lassen National Park, which receives 600-700 inches of snow each winter. Average snowfall in the populated parts of the county ranges from 0-5 inches in the lower Trinity Valley to at least 100 inches in places above 4000 feet, such as Indian Valley west of Hayfork. There is an extensive wild river and stream system, and the terrain is quite rugged and forested, with the highest point at Mount Eddy, over . The Klamath Mountains occupy the vast portion of the county. Trinity was a Republican-leaning county in Presidential and congressional elections until recently; now it is a tossup. No Democrat had won the county since Jimmy Carter in 1976 until Barack Obama defeated John McCain by a 4% margin (50% to 46%) in 2008. In 2012, the county again voted Republican, but narrowly. Voter registration reflects this trend, with Democratic and Republican registration in a near dead heat (D: 2,710, R: 2,716). Third-party candidates tend to do rather well in Trinity County: George Wallace got over 13% of the county's vote in 1968, and it was the only California county carried by Ross Perot in 1992. It was also Perot's best performance in the state in 1996, although he didn't carry it again. John Anderson also did very well in 1980, as did third-party candidates in 2016. Trinity County is in . In the state legislature Trinity is in , and . In 2010, Trinity County voted against Proposition 19, which would have taxed and regulated marijuana. In 2016 Trinity County residents were asked again to vote on legalization of state-level recreational marijuana, facilitated by the Adult Use of Marijuana Act (AUMA), also known as California Proposition 64. The measure passed with 50.1% in favor of legalization. Statewide, the measure passed with 57.1% of the vote. Trinity Transit provides weekday intercity bus service on State Routes 3 and 299, with connecting service in Willow Creek and Redding. Service is also provided from Weaverville to Lewiston (MWF) and Hayfork (daily). The county owns five general aviation airports: Trinity Center Airport, Weaverville Airport, Hayfork Airport, Hyampom Airport and Ruth Airport. The following table includes the number of incidents reported and the rate per 1,000 persons for each type of offense. The 2010 United States Census reported that Trinity County had a population of 13,786. The racial makeup of Trinity County was 12,033 (87.3%) White, 59 (0.4%) African American, 655 (4.8%) Native American, 94 (0.7%) Asian, 16 (0.1%) Pacific Islander, 217 (1.6%) from other races, and 712 (5.2%) from two or more races. Hispanic or Latino of any race were 959 persons (7.0%). As of the census of 2000, there were 13,022 people, 5,587 households, and 3,625 families residing in the county. The population density was 4 people per square mile (2/km2). There were 7,980 housing units at an average density of 2 per square mile (1/km2). The racial makeup of the county was 88.9% White, 0.5% Black or African American, 4.9% Native American, 0.5% Asian, 0.1% Pacific Islander, 0.9% from other races, and 4.4% from two or more races. 4.0% of the population were Hispanic or Latino of any race. 16.1% were of German, 13.4% English, 12.1% Irish and 9.5% American ancestry according to Census 2000. 97.3% spoke English and 1.8% Spanish as their first language. There were 5,587 households, out of which 25.4% had children under the age of 18 living with them, 50.5% were married couples living together, 10.1% had a female householder with no husband present, and 35.1% were non-families. 29.5% of all households were made up of individuals, and 11.1% had someone living alone who was 65 years of age or older. The average household size was 2.29 and the average family size was 2.80. In the county, the population was spread out, with 22.8% under the age of 18, 5.1% from 18 to 24, 22.7% from 25 to 44, 32.1% from 45 to 64, and 17.2% who were 65 years of age or older. The median age was 45 years. For every 100 females there were 104.2 males. For every 100 females age 18 and over, there were 102.6 males. The median income for a household in the county was $27,711, and the median income for a family was $34,343. Males had a median income of $31,131 versus $24,271 for females. The per capita income for the county was $16,868. About 14.1% of families and 18.7% of the population were below the poverty line, including 26.2% of those under age 18 and 7.2% of those age 65 or over. The population ranking of the following table is based on the 2020 census of Trinity County. † county seat This page uses material from the Wikipedia article Trinity County, CA, which is released under the Creative Commons Attribution-Share-Alike License 4.0.
The workshop is held in Jakarta, August 23-24, 2017, by United State Mission to ASEAN, United States Bureau of International Information Programs (IIP) and a nonprofit exchange organization Cultural Vistas, to enhance the participants digital literacy and communication skills on solving problems in their home countries. The YSEALI tech camp engages participants with nine experts who master essential subjects in technology development namely creating compelling content for social media, data mining and visualization, online advocacy campaigns, design thinking, digital storytelling, crowdfunding as well as digital security. One of the participants, Suchaya Mokkhasen, is interested to join the workshop to improve her role as special case officer for the transnational crimes at the Department of Special Investigation of the Thai Ministry of Justice. Mokkhasen is very concern on bridging the gap between the government as policy makers and private sector as practitioners that can help investigating the crimes. Thai government, according to her, is currently trying to cooperate with advocacy groups and private sectors to tackle down transnational crimes that are usually committed online that making it difficult to be traced down. "The main idea is that the government comes up with policies but then it is difficult to get it implemented. With the help from technology, social media and digital advertising we hope it can be carried out practically," she said. By identifying specialization of some organizations or companies, Thai government is hiring them as outsourcing agencies to help investigating transnational cases. Combating crimes through technology Meanwhile, another participant from Lao, Siliphaithoun Xayamoungkhoun, is joining the workshop to look for something new that she can learn for the efforts of combating human trafficking and migrants smuggling. "Lao is very low tech country, however we know that the social media and internet are the new and effective trend if we know how to use it," she said. Serving as a national project officer at the United Nations Office on Drugs and Crime (UNODC), Xayamoungkhoun expects to share every information she received from the workshop to other civil society organizations, nongovernmental organizations and activists who carry the same mission as hers. US Charge dAffaires to ASEAN Ambassador Daniel Shields said that addressing transnational crimes and security has gained momentum in US-ASEAN relations. As the criminals have been long thinking transnational crimes, transnational network is needed to combat criminal challenges. "The classic example is human trafficking that has becoming problem for all of our societies. We can come up with innovative ways to increase awareness and help fighting the problem that has been common concern for all of us," he noted. The goal of YSEALI tech camp is to inspire ASEAN young leaders to utilize newly acquired digital skills and undertake projects that led to real-world impact by applying technology solutions to these challenges. At least 20 tech camps have been taking place around the globe since 2015. The hands-on, participant-driven workshops organized by the IIP have been proven to create solutions to global issues such as application for journalists to fact-check online media content, platform to increase citizens access to information and facility of direct engagement with members of the parliament in Myanmar as well as online portal that link populations across Indonesia to open opportunities. Recent technology workshops included Young African Leaders Initiative (YALI) members working to promote peaceful elections in Africa, and civil society groups working to create opportunities for refugees in Europe and the Middle East. "We cannot just leave technology challenges to the experts. We need the people who are passionate about this issue to step up and learn about technology, so they can be effective in addressing these problems. That is the spirit," Shields noted. Anantya Van Bronckhorst, Co-CEO of Think.Web Indonesia leading digital & technology agency who acts as a mentor in YSEALI tech camp said that technology is tool to empower people of solving any kinds of regional problems ranging from transnational crimes to environmental protection. Technology has been encouraging someone to be more powerful to voice what he believe in or fight for, even without assistance from other people. "When we talk about technology, it is basically a discussion about how to engage audiences in broaden scale, intensively interact, facilitate communication and speed up the spread of information," she pointed out. Reporter: Yashinta Difa Editor: Bayu Kuncahyo Copyright © ANTARA 2017
As the seasons change, so do the locations of many individuals who seek to escape the harsh winters of the north for the milder, sunnier climate of the south. This annual migration, often referred to as the "snowbird" lifestyle, involves a considerable amount of planning and logistics, especially when it comes to transporting one's belongings, including vehicles, from Florida back to New York. This article offers insights into the snowbird lifestyle and provides valuable tips on how to navigate the seasonal travel from Florida to New York, with a particular focus on the benefits and convenience of using car shipping services. 1. Understanding the Snowbird Lifestyle The term "snowbird" traditionally refers to retirees who migrate from the colder northern states to warmer southern states during the winter months. However, this lifestyle has become increasingly popular among a diverse group of people, including remote workers and those seeking to enjoy the best of both worlds – the mild winters in the south and the vibrant summers in the north. This biannual relocation, though exciting, requires significant planning to ensure a smooth transition between homes. 2. The Logistics of Seasonal Moving One of the main challenges snowbirds face is the logistics of moving. Transporting personal belongings, securing residences in both locations, and ensuring everything is in place for a comfortable stay can be daunting. Among these tasks, the transportation of vehicles is a critical aspect that needs careful consideration, as driving long distances can be both tiresome and time-consuming. 3. Advantages of Car Shipping for Snowbirds For snowbirds traveling between Florida and New York, car shipping presents several advantages. Firstly, it eliminates the need for a long, potentially hazardous drive, allowing snowbirds to travel to their destination by plane, which is quicker and less stressful. Secondly, car shipping reduces wear and tear on the vehicle, preserving its longevity and resale value. Lastly, it offers convenience and peace of mind, knowing that your vehicle will be waiting for you upon your arrival, ready to navigate your seasonal home. 4. Choosing the Right Car Shipping Service When selecting a car shipping service for your Florida to New York route, it's essential to choose a company that specializes in snowbird relocations and understands the unique needs of seasonal travelers. Look for companies that offer flexible scheduling, competitive pricing, and a proven track record of safe and reliable service. Opting for a professional service like Florida to New York car shipping ensures that your vehicle is in good hands, allowing you to focus on other aspects of your seasonal move. 5. Preparing Your Vehicle for Transport Before handing over your car to the shipping company, take the necessary steps to prepare it for transport. This includes cleaning the vehicle, removing personal items, conducting a maintenance check to ensure it's in good running condition, and documenting its current state with photos. These steps not only facilitate a smooth shipping process but also protect you in the event of any disputes. 6. Enjoying the Journey Once your car shipping arrangements are in place, you can focus on the enjoyable aspects of the snowbird lifestyle. Whether it's avoiding the winter chill, indulging in diverse regional cultures, or simply enjoying a change of scenery, the snowbird lifestyle offers a unique way to experience the best of both worlds. Snowbird migration requires careful planning and consideration, particularly when it comes to transporting your vehicle. By choosing a reliable car shipping service for your Florida to New York journey, you can eliminate one of the major hassles of seasonal travel. This way, you can enjoy your time in both locations to the fullest, without the worries of a long drive or the wear and tear on your vehicle. Safe travels and enjoy the seasonal journey!
Guide to Holistic Health: Mind, Body, & Spirit Balance In today's world, where stress and unhealthy lifestyle choices run rampant, it's essential to adopt a holistic approach to well-being that encompasses the mind, body, and spirit. Holistic health focuses on the interconnected nature of these aspects, promoting overall wellness and balance. By addressing your physical, emotional, and spiritual well-being, you can achieve harmony and lead a more fulfilling life. In this beginner-friendly guide, we will introduce you to the fundamental principles of holistic health, and provide practical tips for integrating physical, mental, and spiritual practices into your daily routine. You'll gain a better understanding of the connection between various aspects of well-being and discover how focusing on the overarching harmony between them can improve your overall health and happiness. Embark on this journey and learn to nourish your mind, body, and spirit – and bring balance back to your life. Physical Health: Nourishing Your Body for Optimal Wellness To lead a balanced life, it is crucial to prioritize your physical health. This involves focusing on proper nutrition, regular exercise, and adequate sleep. Eating a nutritious, balanced diet and staying hydrated ensures that your body receives all the essential nutrients, vitamins, and minerals it needs to function properly. According to the U.S. Department of Health & Human Services, engaging in at least 150 minutes of moderate-intensity aerobic activity per week, along with muscle-strengthening activities, can significantly benefit overall health and decrease the risk of chronic diseases. Meanwhile, aiming for 7-9 hours of sleep per night allows your body to recover and recharge, ensuring you feel both mentally and physically rested. Subscribe To Dr Mike's MVP Newsletter! Exclusive content, interesting topics, real insights. Subscribe To Dr Mike's MVP Newsletter! Exclusive content, interesting topics, real insights. Mental Health: Cultivating a Positive Mindset and Reducing Stress Mental health plays a significant role in holistic well-being, as it directly impacts your ability to cope with stress, make decisions, and form meaningful relationships. Developing a positive mindset is crucial for maintaining emotional balance and managing life's stressors. This can be achieved through various techniques such as mindfulness, deep breathing exercises, and meditation. A study published in JAMA Internal Medicine found that practicing mindfulness meditation for 30 minutes a day, over eight weeks, led to significant reductions in stress and anxiety. Additionally, consider incorporating relaxing activities like yoga, taking a walk in nature, or engaging in hobbies you enjoy to foster a positive mental state. Spiritual Health: Connecting with Your Inner Self and Higher Purpose Spiritual health is an essential aspect of holistic well-being, encompassing a deep sense of inner peace, purpose, and meaning in life. This connection can be cultivated through various practices, including meditation, prayer, spending time in nature, and journaling. Meditation, in particular, has been found to have numerous benefits for spiritual health, such as increasing self-awareness, promoting relaxation, and enhancing inner wisdom. The key to spiritual growth is being open to exploring different practices and finding what works best for you personally. Building Mind-Body Connections: Integrating Physical and Mental Practices By integrating mind-body practices, you enhance the interconnection between your mental and physical well-being. For example, yoga is an ancient practice that combines physical postures with breath control and meditation, promoting both flexibility and mental clarity. A study published in Complementary Therapies in Medicine found that practicing yoga regularly can improve overall well-being, including stress management, mental health, and physical fitness. Similarly, tai chi, a Chinese martial art emphasizing slow, controlled movements and deep breathing, can simultaneously support physical balance and mental relaxation. Explore different mind-body modalities and find practices that resonate with your goals, preferences, and lifestyle. Relationships: Cultivating Connections for Holistic Health Healthy relationships are an essential aspect of one's overall well-being, as they offer support, connection, and engage multiple dimensions of wellness (physical, mental, emotional, and spiritual). Foster deep connections in your life by actively engaging with loved ones, friends, and colleagues. Practice empathy, active listening, and open communication, which can lead to more meaningful interactions and stronger connections. Joining groups or participating in community events can also promote social well-being and offer opportunities to create new and lasting relationships. Environment: Creating Balance in Your Surroundings The environment in which you live, work, and play significantly influences overall wellness. By creating balance in your surroundings, you can promote a more harmonious atmosphere that supports a holistic lifestyle. Simple adjustments like decluttering your home, adding air-filtering plants, or creating a dedicated space for relaxation and reflection can significantly impact how you feel in your environment. Outdoor spaces are also critical, as spending time in nature offers numerous benefits for mental, emotional, and physical health. A study published in Frontiers in Psychology found that exposure to nature reduces stress, anxiety, and improves overall well-being. Incorporate regular walks in parks or nature reserves to reap the benefits of nature on your holistic health journey. Personal Growth: Embracing Lifelong Learning Personal growth is a continuous process of learning, self-improvement, and self-reflection, contributing to holistic well-being. Mindfully working on personal development enables you to explore new interests, skills, and beliefs while gaining a deeper understanding of yourself. This can take many forms, such as taking up a new hobby, attending workshops or classes, or even reading books, articles, and listening to podcasts. By embracing lifelong learning, you empower yourself to adapt to changes and cultivate resilience in all areas of life. By integrating these aspects of holistic health into your daily routine, you will create a harmonious balance between your mind, body, and spirit and lead a more fulfilling, healthier life. Always remember that living a balanced life is an ongoing journey, so remain open to new experiences and opportunities for personal growth along the way. Achieve Holistic Wellness with Dr. Michael Van Holistic health is a journey that requires constant nurturing of your mind, body, and spirit to create balance and well-being in all aspects of life. By incorporating these comprehensive strategies and practices, you will set the foundation for a healthy, fulfilled lifestyle. Ready to take the first step towards a more balanced life? Visit Dr. Michael Van's website today for personalized guidance, support, and resources to help you achieve optimal health and wellness. With his expertise in health and nutrition, Dr. Van is dedicated to empowering individuals like you to unlock your true potential. Whether you're looking for a health and wellness book or personalized guidance, Dr. Van has everything you need to embark on your holistic health journey. Don't wait any longer – prioritize your well-being and visit Dr. Michael Van's website today. Dr. Michael Vanderschelden, DC 18600 Main St STE 110 Huntington Beach, CA 92648 Site designed by iTech Valet Subscribe To Dr Mike's MVP Newsletter. Exclusive Content ONLY! Dr. Michael Vanderschelden, DC 18600 Main St STE 110 Huntington Beach, CA 92648 Site designed by iTech Valet *These statements have not been evaluated by the Food and Drug Administration. These products are not intended to diagnose, treat, cure or prevent any disease.
I have always been interested in protecting the environment. I grew up near Three Mile Island, where a nuclear accident occurred. My parents, who were idealistic hippies, often took us camping and expected us to help with gardening. My first grade teacher was passionate about monitoring acid rain in Pennsylvania, and I soon joined her in taking stream samples on weekends. It was around this time that I first learned about the greenhouse effect, which is now known as climate change. As a parent, I now feel a strong personal connection to these issues. I am glad that more people understand the problems, even though finding solutions remains difficult. That's why I eagerly anticipate the Andrew Carnegie Free Library & Music Hall's annual Earth Day celebration, which combines nature and ecology with important information and resources. The Earth Day event, now in its fourth year, will begin at 11 a.m. on Saturday, April 20, and continue until 3 p.m. There will be activities such as learning about gardening, composting, and native plants, as well as picking seeds from the seed library and enjoying environmental crafts, games, and food. A musical performance is also planned. The event will conclude with a musical performance by an artist to be announced on CarnegieCarnegie.org. I am particularly excited about a lecture at 1 p.m. by Donora Smog Museum curator Brian Charlton, who will share the tale of the deadly smog that affected Donora in 1948. This event serves as a reminder of the importance of our shared environment. The Earth Day celebration coincides with the end of National Library Week, and a raffle will take place during the event, offering gift baskets from local businesses to participants who shop on Main Street on April 12. As I finish this article, it's a beautiful spring day outside my office window. The sun is shining, and I can see blooming daffodils and forsythia just across Beechwood Avenue. It's a privilege and joy to be able to witness this beautiful planet. I hope that events like our Earth Day celebration will inspire people of all ages to live a life of taking care of and valuing our precious Earth. Please join us on April 20 and help us celebrate. — Walker Evans, Library Director.
Flying helpers – drones support medical care Drones are expected to enable the transport of medicines, defibrillators, and other medical devices in the future. While conventional medical transport is often restricted by traffic conditions and given infrastructures, drones are able to reach remote areas at higher speeds. Furthermore, the way has been paved for advanced air transport through the EU Drone Regulation on a legal base, too. But how does drone transport work and what technology is behind it? Does the cost of using state-of-the-art technology pay off in relation to the benefits provided? What are the proven benefits? What is the promise and vision of national and international companies in the field of medical drone transport? Read the answers in the new arcoro CONNECT!
News trading with Forex Factory using the economic calendar. 6How to use the Forex Factory economic calendar. Forex traders, especially day traders (discover more about day trading) use Forex Factory to keep up to date with the news that moves the forex market. Fortunately, Forex Factory collects all the upcoming economic data, aggregate forex market data, and major news events and put them into an economic forex news calendar. The Forex Factory calendar is especially important in an example like the below when there is a FOMC meeting, major news event or any other big economic news announcements like non-farm payrolls (NFP). The forex factory news calendar, a highly active forex forum, looks as follows: There are 10 columns in the forex news calendar. Here we highlight the important ones. Currency: The currency code for the forex pairs most likely to be affected. Impact: How likely this data item is to cause a big move in the forex market. This is where you will get lightning fast forex news. Detail: will give you some more information about how this data item works. Actual: The data when it is released is shown here. Forecast: What the consensus forecast is from economics polled by Reuters or Bloomberg. You can know how market participants are reacting to certain data releases here and use past performance to gauge future results and market moves. Previous: What the result was in the previous release, normally the previous month. Graph: This shows you how the data has moved over time and is useful to see the trend. Apart from these features, the calendar also allows you to change the time zone to your local time. How to trade with the Forex Factor economic calendar. The next step is trading the forex market for professional forex traders using the economic calendar. To do this we need to understand how economic data can impact the forex market. Using the news to trade forex is called fundamental analysis. To learn more, try reading our blog What is fundamental analysis? However, a deep understanding of what each data point means or an ability to do economic forecasting is unnecessary for forex trading success by trading the news. This type of trading strategy is known as 'forex news trading'. News trading using Forex Factory. News trading involves buy or selling a forex pair the moment news comes out. The economic calendar on Forex Factory is a useful tool for seeing when the news arrives. Bearing in mind the Forex Factory calendar is free to use so there can sometimes be a lag. A Bloomberg Terminal would almost certainly deliver the news quicker, but it costs thousands of dollars per month, something most retail traders cannot afford. If there is a lag, use an alternative news source as a backup option or if the currency price has already moved, then skip the trade. How to trade the news. Forex traders compare the actual data result with the forecast as well as the previous reading. All else being equal the economic news should affect the currency as follows…. If the actual data beats (is better than) the forecast then the related currency will move up If the actual data misses (is worse than) the forecast then the related currency will move down. Let's take an example from the previous economic calendar: Here, Canada (CAD) CPI has seen a shock decline from the previous month as well as missed the forecast. I.e. the 0.5% Actual is lower than the Forecast of 0.7% and the Previous of 0.6%. Forex Factory ranked this as a high impact news event. The result of this data should be to send CAD lower. To trade the Canadian dollar we trade the major forex pair USD/CAD . So if the CAD is expected to weaken, we buy USD and sell CAD. i.e. we buy USD/CAD. News tab on Forex Factory. Of course, forex trading is not as simple as the above example and extra precautions should be taken. For example, Forex Factory also has one of the most popular places to find economic news and financial market news on the internet. Before trading the news, the forex trader might do well to read market analysis about the Canada CPI data release before it comes out. this can be found on the 'News' tab on Forex Factory. In this example, ING Bank produced an article previewing the economic data release. Other features can also be useful supplementary information such as the Forex Factory sentiment indicator. News trading strategy using Forex Factory. Certain risk management parameters should also be decided before the example trade in USD/CAD. This can be done with a price chart like those available on the FlowBank trading platform . And of course, this is not exclusive to one forex pair. GBP/USD would be affected by GBP announcements and EUR/USD affected by EUR announcements etc - and all will be affected by USD announcements such as US GDP data. USD/CAD price chart (1-minute timeframe) Here the trader can use some basic technical analysis of support and resistance to pre-determine entry and exit point for the trade before the news is released. Required information for the trade: Trading Strategy: The News is released at 14:30 News article on Forex Factory suggests a miss is possible so prepare buy (long) entry Trade entry will be a market order based on the 1-minute candlestick at 14:30. Trade Entry & Exit levels: The stop loss could be set underneath the two recent lows on the candle chart The take profit order can be at the recent high. Trading Decision. Wait for news to be released If the data misses as expected, place the market order If the data comes in line or beats, no trade. How to start news trading with forex. Trading the news is a basic trading strategy that is accessible to beginner traders as well as experienced traders but time and practice is needed to get it right. A demo trading account provides the perfect venue to practice such a trading strategy before trading live. Subscribe to our publications. Every day brings a whole host of headlines about the financial markets. Get daily investment insights and analysis from our financial experts. European #gas prices tumble $SPY #stocks #inflation #europe #trading #forex #markets. #Forecasts & sentiment remain gloom! #stocks #Fed #economy #trading $SPY $QQQ $TLT. #Alibaba's Ant gets approval to expand capital $BABA $KWEB #stocks #trading #China #tencent. CFDs are complex instruments and are not suitable for everyone as they can rapidly trigger losses that exceed your deposits. You should consider whether you understand how CFDs work. Please see our Risk Disclosure Notice so you can fully understand the risks involved and whether you can afford to take the risk. This website is owned and operated by FlowBank S.A, a company regulated by the Swiss Financial Market Supervisory Authority (FINMA) and a member of esisuisse. The list of banks and securities firms authorized by FINMA can be accessed here. Depositor protection in Switzerland is provided by esissuisse for a maximum of CHF 100,000.- per client. Details concerning this protection system are explained at www.esisuisse.ch/en. FlowBank is affiliated with the Swiss Banking Ombudsman. Therefore, if you wish to initiate a mediation procedure with the Swiss Banking Ombudsman after your complaint to FlowBank, please contact the Ombudsman according to the instructions provided on its website: https://bankingombudsman.ch/en/ The information on this site is not directed at residents of the United States, Belgium, Canada, or any person in any country or jurisdiction where such distribution or use would be contrary to local laws or regulations. Apple, iPad, and iPhone are trademarks of Apple Inc., registered in the U.S. and other countries. App Store is a service mark of Apple Inc. FlowBank S.A, Esplanade de Pont-Rouge 6, 1211 Geneva 26, Switzerland FlowBank S.A, Seidengasse 20, 8001 Zurich, Switzerland. © 2023 FlowBank, All rights reserved. Privacy Policy Terms Legal System Requirements.
Masterchef did more for health education than science papers, claims food scientist The chief scientist at a health food company has claimed Masterchef has done more to help change children's eating habits for the better than most of the scientific papers about it. Speaking at the BBC Future World-Changing Ideas Summit, Pia Winberg, CEO and chief scientist at Venus Shell Systems, praised the Channel Ten show for its role in helping people understand diet. "It's not about the academia preaching 'this is how thou shall do it'; it is about getting in amongst the crowd," Winberg said. "In a way Masterchef did more for kids' education and nutrition than scientific papers because it was cool, it got people out there and cooking in the kitchen and I think that's what we have to do." Winberg was joined on 'The Future of Food' panel, led by BBC's Michael Mosley, by respected nutritionist Rosemary Stanton, who told the room she wants to see junk food ads banned from TV before she retires. "I've always said I have three criteria before I retire. One of them is (to champion for brands to stop) advertising junk food when children are watching television. That is important." Stanton said. Referring to the call for a sugar tax by some health bodies, a move which would see heavy levies placed on companies such as Coca-Cola and confectioners, both Stanton and Winberg agreed it would benefit Australians. Stanton claimed: "Thirty-five per cent of our calories are from junk food in this country. In children that's about 40%, and that is the huge elephant in the room." She added: "I'm absolutely in favour of it but I don't think it's going to solve the problem on its own. "In Australia 52% of the sugar we consume comes from sugar sweeteners. I need no further proof that it would work, than the opposition that comes from the people selling the drinks. They know it will reduce sales." "Whenever the processed food industry opposes something, I've got a pretty good idea it will work," she said. While she admitted Australians do have a problem with sugar, Stanton attributed part of the problem to junk food brands that appeal to customers by putting vitamins in their products which make them appear healthy. Winberg said marketers also need to think about "changing the game" by coming up with new ideas about where to market health food products. The scientist gave the example of seaweed protein bars sold to a young sports team in Tasmania after the brand was advertised in Men's Health magazine. Stanton said many cheap junk food products meet a health requirement by adding a few vitamins to sell the product to market, but the vitamins added have no benefit to the consumer. "You already see with all those heavily sweetened breakfast cereals. People pour out a bowl of breakfast cereal that has 35-40% sugar," she said. Stanton said in her 50 years of experience in Australian nutrition, the vitamins cereal brands put in their products, are not vitamins Australians are deprived of. "I am yet to see an Australian deficient in any of the nutrients that are put into the cereals. And that's not because they're in the cereals, its because they're vitamins we aren't deprived of anyway." Stanton later said brands marketing gluten-free products were doing a similar thing. "If you read food marketing magazines, you see big marketing articles about how you can increase your profits for whatever you're producing in the way of snack foods and biscuits and various starchy foods, by bringing out the 'gluten free' version," she said. "This is a big marketing exercise. We have a huge range of gluten free junk food on the market which people mistakenly think is healthy."
24/7 writing help on your phone Save to my list Remove from my list For my research, I would like to propose the following topic: Corruption and anti-corruption laws in East Asia and Russia. In my final paper, I want to elaborate on this topic, delving deeper into the main causes of corruption and inspecting closely some of the (in)famous cases from Japan, China and Russia. Besides, I want to propose a solution to this very difficult problem. I chose Japan as it is country with very famous cases of corruption, despite anti-corruption being intact. I choose China, because of its very big amount of government positions, as well as very strict anti-corruption laws, which does not seem to work very well. The last but not least, I chose Russia for a couple of reasons. The first one is to bring up a case not from East Asia to compare and contrast it and the second is my own personal interest as a citizen. The main questions would be the following: What causes corruption and why it is so hard to fight it? Why anti-corruption measures do not work? Under what conditions could we prevent it or at least minimize the damages it makes? In the Russian internet environment, the word "Corruption" became a common denominator for most of the country's problems, Russian people hear about it every other day. Some people attend rallies, some people express their frustration on the internet and some people do nothing. In other words, most of the people in Russia is familiar with this topic, myself included. In fact, this problem was bothering me for quite some time. It is self-evident, that corruption do cause a lot of harm to a government, citizens and economy of a country, but what left this question confusing for me, is the fact that it exists not only in Post-Soviet bloc countries, where existence of corruption could be explained with not yet matured democratic institutions and anti-corruption laws, but also in a countries such as USA, where the democracy was one of the core values since the foundation of the government institute, or China, where exists a death penalty for such an act. Judging from this, I could assume that this problem is global and, therefore, important to a very wide range of people from different classes and nationalities. However, for the sake of more in-depth research, I would like to stick with only aforementioned countries, with an exception of bringing up some of the diverse solutions from Western and Scandinavian countries, in order to see whether their solutions could be put in use in East Asia or Russia. I do believe that this question is worth asking because we cannot fight the problem, without understanding its origins and nature. Because we cannot just demand the government for corruption to be no more, as without proposing clear and thought-out solutions, we cannot expect for things to change. With this logic in mind, I would want to investigate this topic and make my personal contribution to the solution. First of all, we have to establish the reasons why people do come to corruption in the first place as well as definition of the corruption. According to Cambridge dictionary, corruption is "illegal, bad, or dishonest behaviour, especially by people in positions of power". () In this research we are going to focus solely on the corruption made by governmental officials, excluding the corporate corruption. However, we also have to establish the answer to why these are two very different things. While the reasons for corruption are mostly the same, it is material gains from some action or governmental, corporate activity, policy, the governmental corruption strikes not only on material well-being of a certain enterprise or other economically active entity, but on the material well-being of the whole state. Moreover, the corruption in governmental structures, for the reason of being public and discussed, multiplies by creating moral hazard in the whole apparatus. But why the corporative corruption while being on the decline (at least in Russia) () does not coordinate with the levels of governmental corruption? I believe, it has something to do with the nature of these things itself. Corporate corruption is something which could be performed by top tier employees of the corporation, or even the CEO himself, as the main criteria for corruption is that it has to do with the positions of power. It is evident, that the higher you are on the "food chain" of the corporation, the more time you spent in it, and the more your personal well-being is tied to the good performance of the corporation, easiest and the most obvious example would be the fact, that many big companies, as a way of motivating employees to work harder, implement the company's stocks as a bonus to the paycheck (for example at the end of the year). It is self-evident, that in a situation like this, traditional forms of corruption such as "kickback" ("form of negotiated bribery in which a commission is paid to the bribe-taker in exchange for services rendered" ()), or "splitting the pot" (basically, company's budget theft), stop being that rational anymore, even considering your own personal gains. In this situation, the employee has something to lose even though he may be not "caught red-handed". Not to mention, that it is way easier to cover the effect of the illegal acts on a much smaller scale. However, when it comes to Governmental corruption, the reasons could be way more complicated. There is no general consensus on the reasons of corruption, as it is deeply tied not only with just formal laws, but also with the certain mentality of citizens as well as the governmental officials themselves. There main reasons in my opinion are as follows: bigger emphasis on bureaucracy in any given country; lack of prestige as the Jury, as well as Court's dependence on the governmental apparatus; problems with moral tolerance to corruption of the country's population; low moral standards of governmental workers; certain restrictions involved with governmental work, especially restrictions put onto governmental official, regulating his money expenditure; and the last, but not the least, lack of non-governmental alternatives to certain governmental entities. Having the main reasons sorted out, we can start to discuss them one by one. But first, we have to find an answer to the following question: "What is the flaw of the anti-corruption measures, that make anti-corruption laws not effective?". What we can clearly see is that the answer hides not in the lack of harshness of a certain law. The most famous case could be China, where exists the death penalty for crimes higher than 100000 Yuan (1 Yuan ~ 10 rubles as of 2019). Moreover, if the money was stolen from sources, which were considered a financial help for lower income families or refugees etc., corruption is punished even more harshly. Nevertheless, according to the Epoch Times newspaper interview with the member of National People's Congress Han Dejun, when he tried for the 7th time (as of 2012) to propose the law which will make information of the personal wealth of the Government officials public, over 99% voted against, which is a showing statistics. () But if even death penalty, can not manage to fight corruption, then what will? It seems to me, the main flaw of laws which aim to fight the corruption is that most anti-corruption laws, not only in China, but in many other countries as well focus solely on punishment, while leaving the causes of corruption (especially psychological) untouched. Corruption is a great example of Game theory, specifically prisoner's dilemma. If everyone in a governmental apparatus would suddenly stop giving or taking bribes, or practicing any other sort of illegal acts, the government would work with way better efficiency, thus improving economics of the state and overall quality of life. Better economics could lead to bigger paychecks for them and their family both nominally and relatively (as the currency would become stronger), and in the end, everyone would be better off. However, in case of one particular official cutting his profits from illegal acts, he would put himself in way worse position than that of his colleagues. Judging by the government officials, lack of understanding of the potential long-run harms of the corruption should be even more prevalent in the masses, who do not have direct affect on the politics. To add to that, it seems that in the countries such as Russia or China, people care way less about politics in general, as both these countries transformed from a monarchy directly to Communism-oriented countries, with no room for democracy, which encourages political debates and knowing more about the politics for the ordinary people. During the Tzar or Emperor rule both in China and in Russia, the position of government officials was almost not possible to reach for a non-privileged commoner, therefore, people had no particular interest in politics, as it was way out of their league. The situation didn't change much during the Communist rule, as even though ordinary people could now reach higher echelons of political power, Party rule only could make changes from above, but not the other way, leaving ordinary people with no real opportunity to pull the lever, if something goes wrong. This only made the political apathy worse through the times. Unraveling Corruption: Causes, Challenges, and Solutions in East Asia. (2024, Jan 30). Retrieved from https://studymoose.com/unraveling-corruption-causes-challenges-and-solutions-in-east-asia-essay 👋 Hi! I'm your smart assistant Amy! Don't know where to start? Type your requirements and I'll connect you to an academic expert within 3 minutes. get help with your assignment
The power to persuade is highly respected and there is no better way to master this art than through debate. A competitive debate is a challenging and highly rewarding activity for those who become involved in it. Ellesmere College students have the opportunity to join the Debating Society where they are encouraged to develop presentation skills and the ability to construct logical arguments. Many of this nation's top lawyers, business executives, doctors, engineers, and elected leaders were involved in school debate, and for good reason. Debating skills help pupils get ahead and stay there. Students at Ellesmere College are provided these opportunities as part of the School's Academic Enrichment which aims to enhance their educational development. The Debating Society develops students research and analytic skills, from traditional library research to the Internet. Debating at Ellesmere College isn't just restricted to House competitions; pupils take their experiences over to Europe for the Model United Nations Conference where debaters compete alongside students from top institutions around the world.
01/7Here's all you need to know about Blue Tea Made from butterfly pea flowers also known as Shankhpushpi or Aprajita flowers in Hindi, this vibrantly coloured tea is gaining a lot of popularity in the world of tea drinkers. The tea connoisseurs are going crazy for this tea as it not only looks beautiful but offers a myriad of health benefits as well. The flower is predominantly found in countries like Vietnam, Bali, Thailand and Malaysia. But, thanks to its popularity in food blogs and travel shows, people are getting to know about it and the flower is reaching the mainstream market. Here's all you need to know about how to make this tea and its various health benefits. Take a look. (Images courtesy: iStock) 02/7Health benefits of blue tea From increasing eyesight to boosting immunity and memory, there are lots of health benefits to drinking this tea regularly. Here are some of the common health benefits that this tea offers. 03/7Boosts immunity Blue tea helps in boosting your immunity. It has antioxidant properties. It has anti-inflammatory properties. According to the study, they work to prevent cancer cells from growing in the body. 04/7Boosts memory You must have heard that almonds are a great food to increase memory. But do you know that blue tea also helps in boosting your memory power? It helps in reducing stress. It is also beneficial for people suffering from Alzheimer's disease. You feel very relaxed after drinking this. 05/7Controls blood sugar Blue tea is very beneficial for diabetes patients. It helps in controlling the blood sugar level. It also reduces the risk of getting diabetes. It has abundant antioxidant properties. 06/7Beneficial for eyes Drinking blue tea also increases eyesight. It also prevents eye problems from occurring. This includes sensitivity to light and blurred vision. 07/7How to make blue tea To make this tea, put one cup of water in a pan and boil it. After heating it, put 3 to 4 Aparajita flowers in it and let them boil. After a boil, turn off the gas. Now, strain the tea into a large cup. Add one spoon of honey to it and consume it warm. You can also enjoy the drink as it is if you like.
Advantages and negative effects of deep tissue massage Deep tissue massage offers many advantages. The force is stronger than normal massage. This makes it slightly unpleasant and gritty, however it's extremely efficient. This kind of massage is best for people who are very sensitive to pain or pressure. This kind of massage could be extremely beneficial if you are hurt or suffer from chronic arthritis in your joints. There are several commonly reported side effects that can be attributed to deep tissue massage that you should know about prior to deciding whether not you should get one. Massage therapy is effective in treating chronic pain, such as plantar faciitis. But the advantages can be applied to other issues. Research has revealed that it may relieve fibromyalgia, a condition characterized by chronic painful. A 2014 study that was published in PLOS One the participants with fibromyalgia who underwent deep tissue massages experienced instant pain relief, reduced stress levels, and improved well-being. The benefits of deep tissue massage go beyond physical. According to the American Academy of Pain Medicine, more than 100,000,000 Americans are suffering from chronic suffering from pain. Back pain makes up nearly 27 percent of all chronic instances of pain. The leading cause of disabilities among Americans who are younger than 45. Massage therapy for back pain has numerous advantages. It's easy to see the reason. If you're in search of a way to relieve your pain, the deep tissue massage could be the answer you've been looking for. People who experience chronic pain are advised to get an intense tissue massage. This type of massage is helpful for healing from injuries. It's not suitable for everyone but it's highly recommended for anyone who experiences persistent pain. The massage may not be suitable for all. This kind of massage does not suit everyone. Some people may find the pressure to be uncomfortable. A certified massage therapist is able to alter pressure to suit client needs. The deep tissue massage is not recommended for all people. There are certain factors and conditions that may hinder you from receiving a deep tissue massage. The pregnant woman shouldn't be treated to a massage until her first trimester. Massage therapists must alter their pressure and style accordingly. During the first trimester, it is recommended to stay clear of deeply tissue massage. The style can be adjusted and the pressure during the next trimester. In the third trimester, it may be risky for the woman. A deep tissue massage is great for people who have constant pain. Deep tissue massage can help with chronic pain by decreasing inflammation and relaxing muscle tension. It is reported by the American Academy of Pain Medicine states that over 100 million Americans are suffering from chronic pain. There are twice as many patients with an autoimmune disease or arthritis. While most of these cases are uncommon, some could have negative effects. It is essential to speak with your physician before you undergo a deep tissue massage, as it can have unintended negative effects. The high-impact work requires a lot of exertion and physical effort for certain people. This could cause sore muscles or 부산출장마사지 persistent painful. Thus, a therapeutic massage is vital for those who are in high-impact occupations. Massages are great for recuperating from injuries and improving the mobility of your. After receiving a deeply tissue massage, you'll notice a more flexible movement range, greater circulation, and less discomfort. Deep tissue massages are best for workers in high-impact jobs. Like, for instance, work in construction or sports could cause a variety of muscle strain, which includes muscle knotting. Massage therapy can be advantageous for people who work in these types of jobs. But, it's essential for those working with other work that is high-impact ensure that they are well taken care of and also in highly-impact jobs. Deep tissue massages can provide a great benefit to people with chronic neck and back discomfort, as well individuals seeking a relaxing massage experience. The benefits of deep tissue massages aren't intended for patients suffering from pain as well as for jobs that require a lot of stress. It doesn't matter what you do Deep tissue massages can provide a lot of benefits. There are many advantages to deep tissue massage. In addition, it will help you get rid of some of your biggest pain troubles.
The horn of a car emits sound with a dominant frequency of 2400 Hz. What will be the apparent dominant frequency heard by a person standing on the road in front of the car if the car is approaching at 18.0 km/h ? Speed of sound in air = 340 m/s. [18 km/h=5 m/s] Using sign conventions App. frequency, =2436 Hz
Unlike some whale species that exhibit distinct migratory patterns, Sei whales demonstrate remarkable flexibility in their habitat preferences, allowing them to inhabit almost any ocean worldwide. However, they tend to avoid venturing too far south, preferring to roam primarily in temperate and subpolar regions. One of the key aspects of the Sei whale's lifestyle is its feeding behavior, which revolves around locating and consuming its preferred prey in colder waters. These whales possess a unique set of feeding adaptations, including a pair of blowholes and approximately 400 baleen plates lining their mouths. These baleen plates, equipped with bristles, serve as efficient filters, allowing Sei whales to sift through vast quantities of water and capture their favorite snacks from the surrounding fish stream. This specialized feeding mechanism enables Sei whales to sustain themselves on a diet primarily composed of small fish, krill, and plankton. Despite their affinity for colder feeding grounds, Sei whales exhibit migratory behavior, particularly during the breeding season. Like many cetaceans, Sei whales undertake seasonal migrations to warmer waters, where they engage in courtship rituals and breeding activities. Female Sei whales typically reach sexual maturity after approximately ten years, after which they breed every two to three years, giving birth to a single calf. Observing Sei whales in their natural habitat offers a captivating glimpse into their behavior and social dynamics. These majestic creatures are often spotted near the water's surface, where their distinctive blowholes and dorsal fins are visible as they gracefully navigate their surroundings. Sei whales are known for their acrobatic displays, occasionally breaching and slapping their tails against the water's surface, possibly as a form of communication or social interaction. Despite their widespread distribution and adaptability, Sei whales face various threats to their survival in today's oceans. Human activities, including commercial whaling, habitat degradation, ship strikes, entanglement in fishing gear, and marine pollution, pose significant risks to Sei whale populations worldwide. While commercial whaling of Sei whales has declined significantly since the implementation of international whaling regulations, other anthropogenic pressures continue to impact their populations. Anything we've missed? Help us improve this page by suggesting edits. Glory never dies! Suggest an editGet to know me Terrestrial / Aquatic Altricial / Precocial Polygamous / Monogamous Dimorphic (size) / Monomorphic Active: Diurnal / Nocturnal Social behavior: Solitary / Pack / Herd / Group Diet: Carnivore / Herbivore / Omnivore / Piscivorous / Insectivore Migratory: Yes / No Domesticated: Yes / No Dangerous: Yes / No
All Credit to, John Masson Smith, Jr. – Please see the original at University of California, Berkeley The Mongols reached Europe in 1221, on a reconnaisance of the western extent of the Eurasian steppe, the land on which Mongol armies could most easily support themselves "wherever a horse is able to tread." Their force was a detachment of the great army Chinggis Qan (Genghis Khan) was leading through Central Asia, eastern Iran, Afghanistan, and into India. The detachment crossed northern Iran, wintering in Azerbaijan (1220-21), passed the Caucasus mountains, spent the next winter in the Crimea, explored the Volga region, and returned to Mongolia; it fought winning battles all along the way, including one against an alliance of Turkic Cuman nomads and Russians. The incursion came to the notice of Europe, but since such nomad disturbances in that region were a common occurrence, and because the new intruders had withdrawn, apparently for good, it made little impression. In 1236-42 the Mongols returned, acting on the knowledge gained on their previous expedition: that the steppe extended into the North Pontic region (Ukraine and Crimea), that their armies could therefore sustain themselves all the way-the horses eating grass and the soldiers eating horses-and that the local inhabitants were incapable of serious resistance. This time the Mongols came in great force, with at least twelve tümens (divisions of, nominally, 10,000 men), judging by the number of commanders, mostly princes, mentioned. They overwhelmed the Cumans, Russians and Hungarians, and defeated a large army of Germans and Poles. And although the Mongols shortly abandoned Hungary (probably indefensible by a nomad-based garrison), they based a large army in Ukraine and on the Volga, conscripting many of the Cumans and monitoring their Russian vassals, and conjoined to it further forces in North Central Asia (approximately Kazakhstan), creating the sub-realm of the empire that came to be known in the West as the Golden Horde. This threatening new power caught the attention of Europe: the Mongol empire now had a presence and a frontier in Eastern Europe. In the Middle East, Mongol task forces, beginning in 1229, established bases in Azerbaijan, and from them intimidated or forced into vassal status the Trebizondian Byzantines, Anatolian Seljuks and Cilician Armenians, among all of whom Westerners, mostly Italians, had an important commercial presence. The European Crusaders on the Levant coast too now had a new, Mongol near-neighbor in Iran and Anatolia. In 1256, these Mongols were heavily reinforced by contingents sent to exterminate the (original) Assassins, subjugate or destroy the Caliphate in Iraq, and extend the empire to the southwest. Although Syria and Egypt were successfully defended by the Mamluks, the Assassins were wiped out, as was the Caliph. Baghdad was wrecked, and much commerce that had been focussed on it now shifted north to Tabriz and Trebizond. There were many other Mongol armies: nomad forces, Mongols and especially Turks, (which included soldiers, their families, and the domestic animals needed for their support) all across Inner Asia, in North China, and in Mongolia proper; and troops drawn from conquered or vassal settled peoples: Chinese, Iranian, Russian and many others, usually based on farmlands in their home countries, although some were sent abroad on expeditions. For instance, Chinese artillerists or garrison troops to Iran, or Russians to China. Through the reign of Möngke Qan, (1251-59), all of these forces, from the Ukraine to Manchuria, were controlled from the Qan's camp, usually somewhere in Mongolia, via the yam service, the Mongol pony-express, which connected all of them, and passed, in part, along the Silk Road. In most local matters, however, these armies constituted components of the regional establishments set up by Chinggis in favor of his dynastic family. The establishments now, by the mid-thirteenth century, impinging on Europe from the Western steppe and the Middle East were governed, respectively, by Batu and Hülegüboth grandsons of Chinggis. Each commanded a regular army of fifteen tümens: for instance, Hülegü's order of battle at the siege of Baghdad included fifteen commanders. Since these commanders led tümens, each composed of ten regiments (hazara), the military component of each establishment included 150 high officers and their (often multiple) wives. To these were added many administrative officials and their wives. And finally, there were the leader's guards, at least a tümen of them (Qubilai, according to Marco Polo, had 12,000 guardsmen, rotating on duty in units of 3000). The Mongol Empire These leaders had both imperial and personal interests. The imperial interest, which was shared by the commoners, was Chinggis Qan's project of world-conquest. This project developed from Chinggis' understanding of nomad society and culture, and appraisal of the balance of power at the start of the thirteenth century. Nomad societies were warrior societies, with abundant manpower available for military undertakings (seven men in every ten; cf. one in ten conscriprted from settled populations in Mongol practice), since pastoral subsistence chores could be handled by women and children; with abundant horses (actually, ponies) for cavalry from pastoralism (pastoralism that also met the logistic needs of nomad armies); and home-made weapons-bows, arrows and clubs-effective in combination with the ponies. This military aptitude derived from pastoralism in another way also. Small camps simplified herding and reduced the need for nomadic movement, but also much diminished security from rustlers and kidnappers (Chinggis and his family had their animals rustled twice, two women-his mother and his wife-raped, and himself kidnapped). Large encampments, küriyen, with 2,0003,000 families and huge herds, perhaps 200,000-300,000 sheep or equivalents, gave protection, within a circle of wagons, but required very frequent moves as accessible pasture was used up. The nomads had to be prepared for fight or fl ight at all times, and part of the preparation involved cultivation of appropriate appreciation and attitudes. One should understand when to fight and when to run, and know that, while strength, skill, weapons and numbers, are very important, they are not all-important. Bravery, audacity and cunning can alter the odds. Nomad men, in their constant insecurity, had to try to think like heroes, to imagine themselves as heroes, so as to be able, if necessary, to act like heroes. Nomad culture was, and in places still is, a warriorist culture. When Chinggis Qan invited these would-be heroes to participate in the greatest military undertaking of all time, they could not turn him down. "This is the order of the everlasting God. 'In Heaven there is only one eternal God; on earth there is only one lord, Chinggis Qan. This is the word of the son of God [Chinggis]…which is addressed to you. Whosoever we are, whether Mongol or Naiman or Merkit or Muslim, and wherever ear is capable of hearing, and wherever a horse is able to tread, [italics added] there make it heard and understood.'" (Letter of Möngke Qan to King ["Saint"] Louis IX of France, in Rubruck, 202) Chinggis issued his invitation in ca. 1203, when he was winning the struggle for rule over all of (Outer) Mongolia. He knew the military resources of Mongolia, knew that the only comparable forces, the largely nomad cavalries of China's northern frontier (in today's Manchuria and Inner Mongolia) were divided between the Hsi-hsia and Kin, and within Kin between Jurchen and Kitan, so that the Mongols could attack them severally with great superiority. Success in this undertaking would give Chinggis all the (surviving) cavalry of eastern Inner Asia, and the largest such force anywhere. World conquest, which had been talked about by Huns and Turks in times gone by, did not seem like empty boasting now. "[Chinggis Qan] made many laws and statutes… [one] is that [the Mongols] are to bring the whole world into subjection to them, nor are they to make peace with any nation unless they first submit…" (John of Plano Carpini, 25) By the mid-thirteenth century, this project was well under way, with giant armies on the march to the Middle East (as mentioned above), into southern (Sung) China, and against Korea; large raiding parties also intruded repeatedly into northwestern India. These expansive efforts continued until, roughly, the turn of the century: South China was conquered, Japan, Burma, Vietnam and Java were attacked, and the Middle Eastern Mongols kept trying to seize Syria. Besides these substantial campaigns, the raids on India continued, as did incursions into Eastern Europe. This project gave the Mongol leadership a lively interest in the countries as yet beyond their reach. To obtain such information, the Mongols used exploratory expeditions, often over great distances, as with the foray (mentioned above) through northern Iran, the Caucasus, southern Russia, the Crimea and Central Inner Asia. They also interrogated prisoners, and questioned travellers like Rubruck and merchants like Marco Polo. "[Möngke Qan's officials] began to ask us numerous questions about the kingdom of France: whether it contained many sheep, cattle and horses-as if they were due to move in and take it all over forthwith." (William of Rubruck, 155-6) "When Messer Niccolo [Polo] and Messer Maffeo [Polo] arrived at the court of [Qubilai Qan] he received them honorably and welcomed them with lavish hospitality and was altogether delighted that they had come. He asked them many questions: first about the Emperors, the government of their dominions, and the maintenance of justice; then about kings, princes, and other nobles. Next, he asked about the Lord Pope, and all the practices of the Roman Church and the customs of the Latins. And Messer Niccolo and Messer Maffeo told him all the truth about each matter…" (Marco Polo, 36) Some of the results of these inquiries may be found in the work of the Mongols' Persian vizier, Rashid al-Din (II, 325), as, for instance, the figure of 400,000 for the army of Hungary (a mistake, based on the Mongols'calculation that, as in nomad societies, the army included the whole adult male population). The intelligence requirements of the Mongol army thus supported a policy of receptivity to would-be visitors from the outside world. As for the personal interests of the Mongol elite, these varied, of course, from person to person, but most wanted to enjoy the fruits of their extraordinary conquests. They had previously led a simple existence in the fastnesses of Outer Mongolia; Chinggis and his small following, early in his career, successfully pillaged a Tatar community, and came to be"considered grand and gained renown" because the loot included a silver cradle and a gold-brocaded quilt, and"at that time such luxury items were rare among the Mongols." (Rashid I, 164) During Chinggis' campaigns of expansion into China, and especially with the taking of the Kin dynasty's northern capital (approx. modern Beijing) in 1215, the Mongols gained an appreciation of the wealth, especially in foodstuffs and textiles, now available to them through plunder and extortion, taxation and exchange. The government established a program intended to provide for the general population of Outer Mongolia very substantial supplies of food and drink (more, in fact, than could be supplied). More successfully, the Mongol dynastic and military elite provided themselves with the best of everything. They consumed large volumes of alcoholic beverages such as fermented honey (bal) and millet (buza), rice mead, and wines, exotic to the Mongols, and, in the case of wine, pleasingly powerful by comparison with their domestic tipple, fermented mare's milk (qumis), which they also continued to consume in quantities. Foodstuffs were likewise lavishly provided, especially horsemeat, the favorite, and mutton, the most widely available in the pastoral economy. For a quantifiable example, William of Rubruck (202) reported the following provisions for a banquet hosted by Möngke Qan:"a hundred and five carts laden with mare's milk, and ninety horses to be eaten." Ninety Mongolian ponies would have yielded about 20,000 lbs of meat, three lbs of meat for each guest at a party for 7,000 (consisting largely of the Qan's off-duty guards, most likely); assuming 1000-lb loads on the drink-carts, each of the 7,000 would also have been served about two gallons of qumis (qumis is a "lite" drink, hence the large volume, the approximate equivalent of 19 shots of 90-proof whiskey). The Mongol elite enjoyed many such parties-and they dressed up for them. Qubilai entertained at festivals for the New Year and for each of the thirteen lunar months, on assorted "festive occasions," and on birthdays. Birthday parties would have been frequent: Qubilai had four wives and 22 sons by them; daughters not specified, plus a number of concubines and 25 more sons (daughters again not counted); and the birthdays of his other relatives, his great commanders, their wives and children, were doubtless celebrated as well."All the [Mongols]celebrate their birthdays as festivals," says Marco Polo. (137f) The guests probably included all those eligible to have parties in their honor, and, for the lunar month festivities, the 9,000 off-duty guards, and most likely their wives, were also invited. Guest lists of 40,000, as reported by Marco Polo (137f), seem quite plausible. At these many parties the top Mongols wore very fancy dress, in many cases, robes of cloth-of-gold (nasij). Those of high rank had nine different banquetoutfits for winter wear, and fourteen for summer, including one of nasij for each season. Since there were more than 20,000 top-level bureaucrats to provide for in the Mongols' East Asian (Yuan) realm alone, around 50,000 robes would have been needed. The guards, all 10,000-12,000 of them, were issued banquet robes as well, a different one to wear at each of the thirteen monthly celebrations. Cloth-of-gold served not only as clothing, but for bed covers, animal-caparisons, and draperies. In the latter category, the embellishment of the huge royal palace tents, found in the camps of all the regional rulers, as well as in some of their urban centers, involved prodigious quantities of nasij, as their interiors were entirely lined, walls and ceiling, with the cloth-of-gold; one such tent is said to have seated 1,000 persons. Some of the great officers and officials also possessed such tents. And since these great tents could not be pitched and struck quickly-the ordinary Mongol ger, housing a single family, could be erected or taken down in less than a day, whereas one palace tent, of the Middle Eastern ruler, Ghazan Khan, took a month to set up-the rulers probably had several of them, one in each of their most-regularly used camp sites, at minimum, one each in their summer camp (yaylaq) and winter camp (qishlaq). The Mongol grandees not only wanted to enjoy silks, but to profit from them as well. Silk had since time immemorial been a kind of currency in China, a tool of its diplomacy, and the basis of its international trade over the aptly named Silk Road. Owing to the international popularity among the wealthy of silk, its production had spread across Inner Asia to the Middle East, where the Mongols found and took over its silk factories as they had in China. Furthermore, they established new silk factories, in Inner Mongolia, the Tarim Basin, and two in China proper, to increase the volume of silk production, and to develop new silk products. Chinese weavers were sent to Samarkand to collaborate with the local Muslim weavers, and Muslim weavers who were specialists in cloth-of-goldwere brought to China. Wealthy Mongols invested in these enterprises, and in the vending of their products, forming commercial associations (ortaqs) with merchants experienced in transporting over the Silk Road, for instance, but also by sea and exchanging these goods abroad. Such Mongols could also arrange for their merchant partners to use the facilities of the yam to obtain provisions, fresh animals and secure lodgings for their caravans. In the century, approximately, of Mongol rule in Eurasia, the Silk Road fl ourished as never before. Disputes between the Mongol realms sometimes delayed or diverted commercial traffic, as happened to Marco and the other Polos, who had to resort to a slow and difficult route between Iran and Eastern Turkestan on their way to China to avoid rumored strife in Transoxiana. But the Mongol regional governments usually, and the Mongols generally, remained eager to promote and engage in commerce, even, sometimes, at risk to their own interests. Mongols in Afghanistan, for instance, allowed regular passage of large numbers of horses being exported by the Golden Horde (the Mongol realm in modern Ukraine, Russia and Kazakhstan) to India, for use by the sultans of Delhi against Mongols invading from Afghanistan. Under the Mongols, furthermore, the Silk Road had more routes than in earlier times. Before the Mongols unified Inner Asia, its nomads were divided among a plethora of independent, rivalrous tribes and great power client-tribes set against the independents. In this geo-political setting, trade was often-and often rightly-viewed as trading with the enemy and discouraged by prohibitions and despoliations. Such dangers minimized commercial transit over the steppe route through the "nomad zone," despite its considerable logistical advantages: grasslands and water-sources stretching between Hungary and Manchuria supporting myriad potential transport and food animals. Instead, much if not most of the time, merchants preferred to risk desert travel, whose predictable hazards made commercial transit difficult, but also precluded nomad inhabitation and interference. Now, under the Mongols, commercial and other travelers could use both the steppe and the desert branches of the Silk Road. Plano Carpini and Rubruck, respectively spy and missionary, were taken by Mongol escorts over steppe routes, at paces that they found impressive and uncomfortable. They reported long days in the saddle, lots of trotting, and long daily distances covered, although the overall distances divided by the days of journeying mostly indicate an average pace of about 20 miles per day, which conforms to the distance between stages of the yam; on Rubruck's return trip, however, the daily average was 36 miles per day. The yam supported not only the pony express of the Mongol command and control system, but the merchant caravans that brought the qan and his court, and the establishments of the dynastic and military elite, the spoils of empire, and distributed the surplus luxury goods from the factories that catered to these Mongol grandees. Very shortly after coming into direct contact with Europe, The Mongols and their commercial associates began selling to Europeans; China silk could be bought in Italy by 1257. Not long after, Italian merchants reached China. Marco Polo's father and uncle arrived in ca. 1265, on a diplomatic mission for which they were recruited by an envoy of Hünernâme while they were in Inner Asia on a commercial venture: bringing jewels as "gifts," to the ruler of the Golden Horde, in return for which they were presented with goods worth twice as much as the jewels. The Polos traveled to China again in ca 1275, taking Marco along, hoping, no doubt, to buy such goods at the source and reap the largest share of the profit from importing them into Europe. This undertaking was apparently sidetracked, and they spent the next twenty years there, with Marco supposedly in the Qan's service, but in the end commerce won out, and they returned to Italy laden, according to Marco, with jewels. The reported success of such early adventures, substantiated by imports of real goods, then led to much more commercial activity on the part of Europeans in Inner and East Asia. By ca. 1320, the way east, and the most reliable mercantile strategy to employ there, could be reduced to a succinct set of recommendations by a Florentine banker, Francesco Balducci Pegolotti, experienced in eastern Mediterranean commerce. The route he suggested began at the port city of Tana, in the northeast corner of the Black Sea and easily accessible by Italian shipping. From there, one hired transport to Astrakhan at the mouth of the Volga river; with a horse-cart, the journey was 10-12 days, or 25 days by ox-cart. Boat passages up the Volga took the travellers to the imperial towns of Saray (Palace) in one day, and Saraychuk (Little Palace) in eight days. These were seasonal residences of the nomadic Mongol rulers of the Golden Horde, and therefore considerable commercial centers. The next leg of the journey led to Urgench on the Amu Darya River, somewhat south of the Aral Sea, 20 days by camel-wagon; Pegolotti recommended that the travelling merchant invest his capital in fine Italian linens and sell them in Urgench, where they brought high prices, in return for Mongol currency: the silver ingot of about 7. 5 ounces, about 216 g, called sum (sommo in Italian). With these, and perhaps some of the best linens, the merchant should proceed to Otrar on the Syr Darya (north of modern Tashkent), 35-40 days by camel-wagon, then to Almaligh on the Ili River, 45 days by pack-donkey, and then to the Chinese cities of Kanchow, 70 days by donkey, and the great port-city of Qinsay (modern Hang-chow), 45 days-maybe more-by horse. The pace of these commercial travels approximated that of Plano Carpini and (for his outward journey) Rubruck: about 20 miles per day. At Qinsay, the silver sum ingots had to be exchanged for the legal tender of China: paper money called balish by Pegolotti (and equivalent in value, presumably, to the silver balish, a large ingot of about 4 pounds 12 ounces, or 2, 160 g). After Qinsay, the merchant could go on to the Mongols 'principal political center in China, Khanbaligh ("The Qan's City," also Da Du or modern Beijing). Silk could be purchased in China at one sum for 20 (Genoese) pounds; with the 25,000 gold fl orins of venture capital suggested by Pegolotti, exchanged for linen and then sum at 5: 1, a merchant could buy, after expenses of (perhaps) 400 sum, around 92,000 Genoese pounds of silk, and, assuming a safe return to Italy, sell them for about three times their cost. The Silk Road, under the Mongols, ended in Italy, whence the riches of the Mongol Empire found their way to the rest of Europe."Tartar cloth" is mentioned not only by Dante and Boccaccio, but by Chaucer, and many examples of it have been found in Europe. These close and frequent contacts with the Mongols revealed a new world to the Europeans. Previously, the hazards of travel among nomads, and the barriers to passage through the Muslim states had left the West almost entirely ignorant of the countries and peoples beyond Russia and the Middle East. India and Ethiopia, confl ated, were located past the Muslims; the land (China) whence Rome had, indirectly, imported silk, had been forgotten; and these farther eastern regions, factually unknown, were populated in the Western imagination by notional monsters or imaginary Christian kingdoms in accordance with wishful thinking or even stories passed on by Muslims and by the Mongols themselves. John of Plano Carpini, the first European visitor to report on Mongolia, was told, for instance, of dog-headed people, and of people with but one leg and arm, who moved by hopping or turning cartwheels; the dog-headed people were already "known" to Muslim aEuropean writers. William of Rubruck (170), the next to report from Mongolia, inquired more skeptically about"the monsters and human freaks who are described by Isidore and Solinus [the dog-headed and singlelimbed]" (R/J&M, 201] and, on finding no eye-witnesses, doubted their existence. (We should remember our own Bigfoot and Loch Ness monster as we smile at medieval credulity.) Besides the freaks, there was also the "Christian priest-king, Prester John," wishfully developed in the twelfth century from reports out of (actual) Ethiopia of their priest-kings entitled dzan, together with rumors of the troubles of the Muslims with non-Muslims on their eastern frontiers-actually the confl ict between the Muslim Seljuks in Central Asia and the Buddhist Qarakitai-and the fact, albeit unknown in the West, of a considerable presence of Nestorian Christians in Inner and East Asia. Prester John allegedly headed a great Inner Asian Christian power that was going to attack the Muslims from the East in support of the Crusaders in Palestine. Western visitors to the Mongols at first tried to identify Prester John among the recent, pre-unification tribal leadership of Mongolia; the Kerait chiefs had, for instance, been under Nestorian infl uence. They sought also to reach Mongol leaders alleged to be Christians, to little avail, since these were essentially polytheistic (a position difficult for monotheistic Christians and Muslims to grasp), with perhaps individual preferences for particular Nestorian priests. Marco Polo (119) gives a quotation of Qubilai (Kubla Khan) which expresses the Mongol attitude well:"There are four prophets who are worshipped and to whom all the world does reverence. The Christians say that their God was Jesus Christ, the Saracens Mahomet, the Jews Moses, and the idolaters Sakyamuni Burkhan [the Buddha], who was the first to be represented as God in the form of an idol. And I [Qubilai] do honour and reverence to all four, so that I may be sure of doing it to him who is greatest in heaven and truest; and to him I pray for aid." But as the reports of Carpini and Rubruck, of Marco Polo and others, accumulated, the freaks and monsters were relegated to the fringes, along with Prester John, and Christian Mongols became a forlorn hope. These imaginings were displaced by a new, and true, knowledge of a huge empire, with vast populations of real people, possessing immense wealth, some of which latter could be shared by Westerners on very good terms. Just as the Empire's territories, peoples and riches were becoming well-known in the (especially Italian) commercial circles of Europe, the Empire was beginning to implode. After the death of Möngke Qan in 1259, imperial unity had been lost. But for another three-quarters of a century, the four (or, occasionally, five) now-independent Mongol realms that had been sub-units of the unitary empire, managed to maintain a degree of economic cooperation despite sporadic, and sometimes prolonged, hostilities. The Polos had had to use back-ways to China to avoid trouble, but Pegolotti's silk buyers could go straight through from Tana to Kanchow, Qinsay and Qanbaligh. But in 1335, the Mongol ruler of the Middle East, Abü Sa'îd, died without an heir, and his officials and officers, unable to agree on a successor, fought one another to stalemate and collapse. The Middle Eastern branch of the Road closed, and with that, European access to its desert route. The other branch, via the Golden Horde (Tana to Urgench and on East), remained open until 1368 when the Yuan dynasty Mongols abandoned China in the face of the Ming rebellion, opening a long period of Ming-Mongol antagonism and confl ict that prevented direct access to China across the steppe. Direct European contact with China thereafter became impossible, and indirect trade between Europe and China declined to pre-Mongol levels. The Chinese, no longer conscripts in the Mongol program of world-conquest, and fully content with their own vast resources, lost interest in, as well as contact with Europe. But European awareness of China did not similarly decline. Memories of the commerce carried on by Pegolotti's merchant associates, and especially Marco Polo's fascinating stories, maintained knowledge of the Far East, and the desire of renewed access to it. During the fifteenth century, European geographical speculation about ways to the Far East that would avoid hostile Muslims and unreliable nomads, was stimulated by the rediscovery and widespread publication of the second century Alexandrian geographer Ptolemy's Geographical Survey, which encouragingly, but incorrectly, asserted that the Ocean extended, uninterrupted, from the western shores of Europe to the coasts of East Asia, and helpfully, if mistakenly, calculated that the Oceanic share of the world's circumference (the world was, and long had been, generally known to be round) was about 180″-about 30%less than the actual distance. Even this reduced breadth of the ocean, however, was too much for any European ship to cover without reprovisioning. Christopher Columbus overcame this problem. Columbus had read, and become enthralled by, Marco Polo's stories, to the point of determining that, by whatever means necessary, he would plan a feasable voyage to East Asia and carry it out. His means involved selective adoption of miscalculations by various geographers that minimized the distance still more: a French astrologer gave the Ocean 135″; an Arab astronomer posited a shorter degree; and Columbus trimmed the Arab's figure by expressing it not in nautical miles, but in Roman, 20%shorter. This brought East Asia within range: about 2, 700 miles (the actual distance is around 13,000 miles.) Columbus was a lucky man. Following a tireless effort to find financing for his project, he succeeded in obtaining, over the objections of a scholarly advisory committee, funds for his intercontinental expedition from the Spanish royals. And fortunately for him, there was in fact another continent within range. Thus the Mongols, and their best salesman, Marco Polo, turned out to be responsible, not only for revealing a Far Eastern world new to Europe, but for instigating the discovery-by mistake!-of another New World. The following works are used as references. - Ala al-Din Juvaini, The History of the World-Conqueror, J. A. Boyle trans. (Cambridge MA: Harvard UP, 1958), two vols. - Francesco Balducci Pegolotti, La Pratica della Mercatura, Allan Evans ed. (Cambridge MA: Mediaeval Academy of America, 1936); Pegolotti's text on the China trade is translated in R. S. Lopez and I. W. Raymond, Medieval Trade in the Mediterranean World (New York, 1955), 355-58. - John of Plano Carpini, History of the Mongols, in Christopher Dawson ed., Mission to Asia, Medieval Academy Reprints for Teaching, 8 (Toronto: Toronto UP, 1998). - Marco Polo, The Travels of Marco Polo, R. Latham trans. (Harmondsworth: Penguin, many reprints [n. b. pagination varies among reprints; citations above refer to the 1980 reprint]). - Rashîd al-Dîn, Compendium of Chronicles, W. M. Thackston trans. (Cambridge MA: Harvard, 1998-99), three vols. - William of Rubruck, The Journey of William of Rubruck, in Christopher Dawson ed., Mission to Asia, Medieval Academy Reprints for Teaching, 8 (Toronto: Toronto UP, 1998). (Citations of Rubruck refer to the translation in Dawson; P. Jackson and D. Morgan ed., The Mission of Friar William of Rubruck, P. Jackson trans; (London: Hakluyt Society, 1990) has a better translation and full annotation. - Thomas T. Allsen, Mongol Imperialism (Berkeley: University of California Press, 1987). - _____________, Commodity and Exchange in the Mongol Empire: A Cultural History of Islamic Textiles (Cambridge UP, 1997). - John Carswell, Blue and White: Chinese Porcelain around the World (London: Porcelain around the World (London: Porcelain around the World British Museum Press, 2000). - Elizabeth Kolbert, "The Lost Mariner," The New Yorker (October 14 &21, 2002), New Yorker (October 14 &21, 2002), New Yorker 206-11. - David Morgan, The Mongols (Oxford: Basil Blackwell, 1986). - James C. Y. Watt and Anne E. Wardwell, When Silk was Gold: Central Asian and Chinese Textiles (New York: Metropolitan Museum of Art, 1997). Illustration Credits - Mongol Empire map, China in Maps, H. Fullard ed. (Chicago: Denoyer-Geppert, 1968). - Mongols (R) vs. Mamluks E. D. Phillips, The Mongols (New York: Praeger, 1969). - Palace Tent, Nigâr Anafarta ed., Hünernâme: Miniyatürleri ve Sanatçýlarý (Istanbul: Doðan Kardeº, 1969). - Mongol Siege, David Talbot Rice, The Illustrations to the 'World History' of Rashîd al-Dîn (Edinburgh UP, 1976). - Ox- and Camel-Carts, Eighteen Songs of a Nomad Flute: A Fourteenth-Century Handscroll in the Metropolitan Museum of Art (New York: Metropolitan Museum, 1974). - Royal Reception of Church Envoy, Culture in Western Asia, 1256-1353 (New York: The Metropolitan Museum of Art; New Haven: Yale UP, 2002).
Development and characterization of methylene blue-loaded nanoparticles for glioblastoma Journal Title Journal ISSN Volume Title Glioblastoma (GBM) is the most common and aggressive primary brain tumor in adults over 45, resulting in an average survival of 15 months post-diagnosis and treatment. While recent research has provided essential information to aid diagnosis and treatment, GBM is known to cause relapse following traditional combinatorial regimens (surgery, radiation, and chemotherapy); this necessitates the development of more effective, less toxic therapies for diagnosed patients. Methylene blue (MB), a blue dye with noted medicinal applications, has received recent consideration as a potential neurotherapeutic due to its ability to infiltrate the blood-brain barrier (BBB), improve cellular processes within distinct brain cell compartments and types, and preferential accumulation in the brain. While MB displays these advantages, one drawback is an increased administration to produce desired therapeutic effects, leading to excessive brain deposition and potential neurotoxicity. A method commonly used to enhance drug delivery while reducing unwanted side effects is via encapsulation in submicron-sized nanoparticles (NPs) composed of the biodegradable/biocompatible co-polymer, poly(lactic-co-glycolic) acid (PLGA). Our lab, as well as others, have shown the application of PLGA NPs as potential cancer therapies, as well as their preferential accumulation in the brain, as a means to improve passive drug delivery. With this knowledge, our goal is to develop a MB-loaded PLGA NP capable of permeating the BBB in order to treat GBM, based on our hypothesis that encapsulation of MB into PLGA NPs will enhance accumulation in cancerous brain regions, resulting in reduced tumor size and prolonged survival. In this study, we formulated and characterized MB-loaded PLGA NPs via particle size, surface charge, drug loading, and encapsulation efficiency. Additionally, we analyzed their in vitro effects to establish biological, and potentially therapeutic, activity. Following MB loading and comparison to blank NPs, we obtained preparations comparable to those published sized at 162.4nm, a surface charge of -31.7, and drug loading and encapsulation efficiency values of 2.2% and 29.2%, respectively. With this data, MBNPs were further analyzed and determined to produce a peak release at 24hrs. Additionally, in in vitro cell death studies, MBNPs were found to induce cell death comparable to, if not better than, free MB, in GBM cell lines. Lastly, MBNP treatment enhanced cellular metabolism, an capability noted in free MB. We are currently completing additional studies on MBNPs' effects in vitro, as well as establishing a protocol for a PK study. In conclusion, our formulation displays MB's therapeutic potential, displayed by its enhanced effectiveness in in vitro studies compared to free MB.
Can your vagus nerve cause palpitations? Table of contents: - Can your vagus nerve cause palpitations? - Can vagal maneuvers help PVCs? - How many PVCs in a row is Vtach? - How many PVCs a day are too many? - How many PVCs per hour are too many? Can your vagus nerve cause palpitations? Can vagal maneuvers help PVCs? These data suggest that strongly increased vagal tone can suppress PVC's in a significant percentage of such patients. This finding in man extends previous animal work which has shown a protective role of the vagus against ventricular arrhythmias under certain conditions.How many PVCs in a row is Vtach? How many PVCs a day are too many? Quantity of PVCs: A 24-hour-holter monitor tells us how many PVCs occur on a given day. The normal person has about 100,000 heartbeats per day (athletes a few fewer). Patients with more than 20,000 PVCs per day are at risk for developing cardiomyopathy (weak heart).How many PVCs per hour are too many? "If more than 10% to 15% of a person's heartbeats in 24 hours are PVCs, that's excessive," Bentz said. The more PVCs occur, the more they can potentially cause a condition called cardiomyopathy (a weakened heart muscle).Read also - What causes a man to be lazy? - Is Sunosi available? - Why is Amscot bad? - What does OSIS mean in medical terminology? - What is a skill tree in games? - How do I contact Lara michigan? - What is the meaning of temperance prudence justice and fortitude? - How can I learn to enjoy writing? - Does forgiveness mean being friends? - Does Monmouth University have physical therapy? You will be interested - How many Muslims live in Washington DC? - Can knee replacements cause depression? - How much does Chris Webber weigh? - Did Jennifer Lawrence Hate Kissing Bradley Cooper? - What is a healthy mind in a healthy body? - How can I become a rich man? - What does the name Mililani mean in Hawaiian? - What is standing at attention called? - How do you feel about your donor egg baby? - How much do sperm donors get paid in Florida?
Our research projects at a glance Despite considerable efforts during recent years to combat malaria, the disease remains a major threat to public health in tropical countries. The most severe clinical courses of malaria are due to infections with the protozoan species Plasmodium falciparum. The virulence of P. falciparum has been linked to the ability of infected red blood cells to adhere to a range of endothelial cell surface molecules expressed on blood vessel walls such as CD36, EPCR and ICAM-1. This so-called sequestration process allows the parasite to avoid spleen-dependent killing mechanisms. However, membrane proteins mediating sequestration are exposed to the host's immune system and need to be varied in a long-lasting chronic infection by undergoing antigenic variation. For this reason, P. falciparum possesses several multicopy gene families coding for variant surface antigens, which are characterized by an extensive sequence polymorphism. The best known is the high molecular weight PfEMP1 family (P. falciparum erythrocyte membrane protein 1), which is encoded by 60 vargenes per parasite genome. Each var gene encodes a similar, but not identical PfEMP1 version with particular receptor binding capacities. The expression switching between different var genes enables the parasite to change its immunological appearance and cytoadhesion capability during the course of infection. Accordingly, blocking the expression switch between different PfEMP1 variants exposed on the surface of infected erythrocytes would give the immune system a major advantage in fighting malaria infections. Additionally, disease-causing PfEMP1 variants or other virulence factors could be used for an anti-disease intervention. Var gene expression in experimental human malaria infections How the parasite coordinates its var gene expression in vivo is of tremendous interest and we are currently taking advantage of controlled human malaria infection (CHMI) studies to address this question. During CHMI studies either malaria-naïve or pre-exposed volunteers are infected with one lot of purified, cryopreserved sporozoites, the infectious mosquito stage of the parasite, provided by Sanaria Inc., USA. Parasite-positive blood from the volunteers is immediately preserved for transcript profiling of the entire var gene repertoire either by quantitative real time PCR (qPCR) or by RNA sequencing. For comparison, in vitro cultivated 'pre-mosquito parasites', gametocytes and sporozoites are also analysed. We aim to compare var gene expression patterns i) between different parasite stages, ii) between in vitro-cultivated parasites and those obtained from the volunteers, iii) between parasites recovered from malaria-naïve and semi-immune volunteers, iv) between in vivo samples obtained longitudinally during the course of volunteer infections, and v) between the genetically different and geographically distant parasite strain. These analyses allow us to uncover parasites gene expression at the early onset of P. falciparum blood infections in malaria-naïve and semi-immune individuals, to determine how this expression pattern is modulated by the host immunity during the course of infection and how the expression might be controlled. Key publications: Wichers-Misterek et al. 2023 PLoS Pathogens; DOI: 10.1371/journal.ppat.1011468. Bachmann et al. 2019 PLoS Pathogens; DOI: 10.1371/journal.ppat.1007906. Bachmann et al. 2016 PLoS Pathogens; DOI: 10.1371/journal.ppat.1005538. Virulence-associated gene expression patterns in natural human malaria infections Mainly children under five years of age and pregnant women from malaria-endemic regions suffer from severe malaria, but adults from areas of lower endemicity and non-immune travelers are also vulnerable to severe disease. Although severe malaria manifests as three main overlapping syndromes in children (cerebral malaria, hyperlactatemia/acidosis and severe anemia), disease symptomatology also varies according to age with more multiorgan complications and a higher fatality rate in adults. The underlying factors responsible for the different disease syndromes in children or age-related differences seen in adults remain largely unknown. To better understand the biological processes involved in host-pathogen interactions we are analysing samples i) from a Ghanaian cohort of paediatric malaria patients with accurately defined phenotypes of the different severe malaria syndromes and asymptomatic controls or ii) from returning adult travellers with varying previous malaria exposure and different clinical manifestations. We use an mRNA-sequencing and analysis pipeline to uncover associations of parasites gene expression (including var genes) with the different malaria syndromes, disease severity and a naïve immune status. Key publications: Andradi-Brown et al. 2023 eLife (reviewed preprint); DOI: 10.7554/elife.87726.1. Wichers et al. 2021 eLife; DOI: 10.7554/elife.69040. Gene expression, subcellular localization and function of small variant surface antigens In addition to PfEMP1, which certainly mediates antigenic variation and endothelial receptor binding of P. falciparum, much less is known about the small variant surface antigens families RIFIN, STEVOR and PfMC-2TM. Interestingly, they members have been localized at different subcellular sites within the infected red blood cell and are, therefore, candidates for mediating several of the patho-physiological events during malaria disease. However, a better understanding of these small variant surface protein families is necessary and may reveal new targets for intervention. To get more insight in their function, we established analytical tools for analyzing parasites obtained from malaria patients, whose gene expression and protein localization is not influenced by prolonged in vitro-cultivation. We could already show that the gene expression of RIFIN- and STEVOR-encoding genes is enhanced in vivo and that proteins of both families contribute to the surface coat of the infected red blood cell. We are currently characterizing the gene expression, localization, interaction partners, and functions of the small surface antigens at different life cycle stages of the parasite. Key publications: Wichers et al. 2019 mBio; DOI: 10.1128/mbio.01500-19. Bachmann et al. 2015 Malaria Journal; DOI: 10.1186/s12936-015-0784-2.
- #1 - 23 - 0 Homework Statement There is a nonconducting rod of negligible thickness located along the x axis; its ends have coordinates x = 0 and x = L. It has a positive, nonuniform, linear charge density (lambda) = (alpha)x; alpha is constant. An infinite distance away, th eelectric potential is zero. Show that th electric potential at the location x=L+d is given by: V= ( alpha/4pi(epsilon0) ) ( (L+d) ln(1+L/d) -L ) Homework Equations V= q/4pi epsilon r The Attempt at a Solution V = integral of dv dv= dq/4pi(epsilon)r dq= alpha x dx dV = ( (alpha) x dx) / (4 pi epsilon (d-x) ) V=constants <integral> xdx/ d-x <===== integration table <integral> udu/a+bu = 1/b2 (a + bu - aln(a + bu) <evaluate from 0 to L> when I evaluate i get: (constants) d-d-L d*ln( d / d - L ) and that's not what I am supposed to get =/
By: Ricardo Israel - 10/04/2024 In the final stretch of the presidential election, the issue of immigration, especially illegal or irregular immigration on the southern border, is one of those that will define the name of the next president. However, it is not the only country where it occurs. In the US the debate is polarized and full of mutual accusations. By the way, the inability to reach minimum agreements on this or other important issues is striking, and this statement is so true that the last time politicians reached relevant agreements was 4 decades ago, during the Reagan administration. The legal solutions for this problem are so old, difficult to solve, to which is added that millions of immigrants without a permanent visa will probably never be expelled, who have already made a life here as well as generally find employment. , as they are needed for various jobs that the locals do not want to do. What is difficult to understand is the virtual impossibility of the power being able to find a rational solution not only to the global issue, but also to situations of minimal justice, as is the case of the "dreamers", those who cannot obtain their permanent residence, despite who arrived as children brought by their parents, and have not known another country that they can consider as their own, and many do not speak any other language than English. However, there is another aspect that is also present that, to my surprise, figures very little in the debate and that I will explain later. It is about the fact that two laws are being applied to immigration at the same time, one is the national law still in force, while, on the other hand, international law is applied, above all, by the federal government, although the United States .has not signed any of the corresponding treaties. This is what surprises me the most, and makes the solution even more difficult, since political division and polarization is just one of the facets of an issue that seems to have no solution in a country that has historically gone through periods of welcome and rejection. to immigrants, only now they seem to coincide at the same time, and in November they could decide both local and national elections. Furthermore, the US continues to be an open country, since over one and a half million people enter legally with a residence visa each year, among whom I include myself as well as my parents and children, all separately in time. This, without counting those who arrive with student, work or investment visas and who ultimately stay here, all in comparison to large countries like China or Japan where there is practically no immigration of any numerical relevance. As on other occasions, it is possible that since it cannot be resolved in the appropriate places, be it elections or Congress, it is likely that the issue will be resolved - at least partially - by the Supreme Court when reviewing the case it has faced. to Texas with the federal government, or, Texas versus the United States as it has been declared in the Court. In the United States, the Supreme Court has greater importance than institutions of the same name in other countries, since it is not only the highest court, but also because it is the only institution with the capacity to make its resolutions mandatory not only for the minor Courts but also for every institution or person of the nation, because in addition to the separation of powers, there are checks and balances, including that special role of the supreme courts. It is, at the same time, a federal country, but truly federal and at all levels, which in practice establishes a real equivalence in power and attributions between the state and national governments, very different from what happens with those countries that are also called federal (Argentina, Brazil, Mexico), but where the legal and resource predominance of the central government is such that it has much greater power than the state or provincial ones. In the US it is not new, but it has been that way historically, since first there were colonies that approved Articles of Confederation and then drafted a Constitution, in which 13 colonies transferred powers to the government that was installed in the new city of Washington and not the other way around. And since then, the institution in charge of arbitrating the relationship between the federal government and state and local governments is the Supreme Court, with the states having their own powers, in addition to governors, congresses and local governments. And they are powers of which they are very jealous. It is the situation that explains why the police depend on mayors, that the national guard depends on governors, and that during the pandemic many of the health responsibilities fell to state and local governments. It is the same situation that leads to the fact that instead of one electoral system there are at least 51, the 50 states plus the one in the capital Washington, known as the District of Columbia. It is also what leads to the fact that it is not the federal government that finances the power structure, but rather the House of Representatives that delivers the resources, registering situations where, in the absence of a political agreement, the paralysis is such that not even museum workers or the armed forces receive their salaries and wages while this situation lasts. In the relationship between states versus the federal government, a case with the potential to resolve the issue of immigration, legal, and, above all, illegal or irregular, has been raised between the governor of Texas (with the support of other Republican states) and the White House, with the addition that state feelings are greater in Texas than in other states, since Texas was a sovereign country for nine years, after its rebellion against Mexico and before joining the Union. The Supreme Court is not just an appellate court, the final word on legal matters. It is more than that, since it is also the Constitutional Court and not only does it not have the obligation to accept all appeals, but it does so with few of them, usually when there is a constitutional issue. As recently as March 19, the Supreme Court rejected an appeal from President Biden, declaring that a Texas law was constitutional and he was allowed to enforce it, including arresting migrants that Texas law deemed illegal. As different courts have ruled differently, we are now waiting for the next steps, and whether, as expected, the Supreme Court will continue hearing arguments, and whether it will leave things as they are or whether it will enter the background of the discussion. If the past serves as precedent, in general, the Supreme Court has ruled in favor of the states when there is no law that expressly grants powers to the federal government. This is the case of the existing legislation, where everyone recognizes that it is obsolete, but it is current law and that gives powers to the federal government for the border issue, the problem for Texas being that the Biden administration simply has not wanted to comply with several of their obligations. It was the White House itself that took the Texas law to court, alleging that the system is based on precedents and in the past, regarding an Arizona case, the Supreme Court itself had determined that the federal government had exclusive powers. However, it was now accepted that the Texas law was valid, accepting their argument that it was their duty to care about the safety of their citizens. The current situation was further complicated as the Mexican government announced that it would not accept migrants returned by Texas. In general, in the internal debate of the US there is very little understanding of the problems that are created for the neighboring country, with decisions that harm it, in addition to that for various reasons ranging from its own convenience to commercial threats, Mexico has collaborated far beyond what international practices require. Beyond the fact that the main power is incapable of protecting its sovereignty, the border chaos is created both by the attraction of the United States and by the entry facilities that in practice amount to an invitation, present since the election of the president. Biden who announced and implemented a policy totally opposite to that of President Trump. Furthermore, these migrants not only do not want to stay in Mexico, but in their passage they create security problems for Mexico as well as demand police and social security resources, an imposed cost, and probably if it were the other way around, there would not be this level of collaboration, and on the contrary, we would talk about the right to free transit. Mexico also suffers from the chaos on this border, above all, the strengthening of the power of the cartels, and there is little understanding of this situation in the US media, which gives a platform to extremist positions that ask to send troops to Mexico. The incomplete protection of the southern border has in fact handed it over to the cartels, who are the ones who effectively use it, with dire consequences in violation of human rights and sexual abuse of women and children, in addition to negative effects on drug trafficking and national security, as derivatives that will last over time. A serious problem is not only the number of people arriving from all over the world, but also includes those who enter despite appearing on terrorist lists, which opens up a radically different issue for US security since in In general, immigrants, legal or not, only seek to work to improve their personal and family situation. The fundamental issue is what was indicated at the beginning, that the United States, through the federal government, is not applying current law, but rather international legislation, much of it present in the United Nations 2030 Agenda, as well as in resolutions. minor entities of international organizations that do not replace national law, but are present in treaties, but the drawback is that they have not been signed. In fact, as a country, the US signs fewer treaties than it is supposed to, sometimes for reasons that have to do with the Supreme Court itself, whose powers it jealously protects by not signing anything that questions its special status of being the last word, which is sometimes restricted in instruments that hand over that ultimate function to international courts. In this regard, there are various situations that confirm what has been said. This is how the websites of both the State Department and various institutions that have to do with borders and immigration, rather than talking about "illegal" immigration, use the same terminology of international instruments for which that quality does not exist, but rather they are only "irregular", a situation that disappears immediately when they approach any immigration or police authority at the border, and which explains the behavior of many who enter through there. It is, therefore, a qualification that absolutely changed the entire process. A second element is found, in something more typical of the United States, such as "sanctuary" cities and states that welcome those who come there to the country, with a series of very attractive benefits for all migrants, such as cards credit for various expenses, a cell phone (with which you can also carry out immigration procedures), accommodation in hotels and others. This second point is not secondary but central to the different vision that international instruments have in relation to US law, since the former require equal conditions, which in specific decisions point to a preference for the newcomer, since By definition, they arrive with what they have, so by demanding equal conditions with the citizen, they will receive more benefits, since for example, by arriving only with a backpack and suitcase, they will generally have fewer goods than a poor local. This is what has also led to cities like New York and Chicago being given accommodation in hotels with preference over homeless people or schools changing their function to accommodate them, which has generated mobilizations in those cities, which has never happened. It occurred while these many thousands stayed in the border cities of Texas or Arizona. Furthermore, the fact that the criticism also came from Democratic mayors forced many media outlets to report on the magnitude of this immigration, which had previously been hidden. By the way, declaring yourself a "sanctuary" at a distance is not the same as having immigrants there. This is what happened in one of the meeting places of the elite, as is the case of the very rich Martha's Vineyard in Massachusetts, which barely received 50 sent by an unfriendly trick of a governor of a rival party, rather than giving them The welcome used the national guard for its departure, which is not racism, but classism, another derived from the current immigration process and the debate provoked. This type of immigration not only takes place in the US but in many countries. In a way, what is happening on the southern border reminds me of the northern border of Chile, a similar situation in the consequences for those who arrive after a trip of many kilometers, and just as there are those who to reach Texas must cross the Darién Jungle, in the case of Chile it has to be done with a desert. Even more, being a country of less than 20 million, the impact of immigration has been greater, including as a percentage of the total population. This comparison is useful in the sense that, for the same reason, illegal immigrants are immediately going to the nearest authorities, be they immigration institutions or more usually border guards or police, which is why the majority of those who appear in the statistics from the US have not really been "captured" but have voluntarily surrendered. The reason is that, at that very moment, they stop being "illegal" and become just irregular, whose situation stops being a crime and becomes just an administrative procedure, although few expect them to appear at a hearing with a immigration judge for political asylum, with a summons for 10 or more years. In any case, the claim is similar, whether they are American border guards or Chilean police, that their massiveness prevents them from worrying about surveillance tasks, and rather they are guiding the new arrivals as if they were social workers. Comparison is always useful to confirm once again a defect, how little is known in the US about what is happening in other countries, in this case, mainly due to the media that have failed to report that this not only It is a US problem but it happens in many places and not just in developed countries. In fact, the world is experiencing a time of large waves of migrants, and many remain in neighboring countries where tragedies occur. This is the case of the Venezuelan emigration, perhaps the largest in the world today, which traveled through a good part of Latin America before reaching the southern border, including the Aragua Train, which is presented in the English-language press in the United States. As if it were a novelty that only affects them, and not as happens in large migrations, where the good, but also some of the bad in crime, leaves the countries. And the world still does not receive the many who in the future will claim asylum for being climate refugees, especially when there is an exaggerated idea of the end of the world. Among those who arrive in underdeveloped countries are the victims of African crises and civil wars who leave for neighboring countries as well as Afghanistan in Asia which, for a long time, either due to the Taliban or the US invasion, has delivered refugees to Pakistan and Iran, Just as Syrians have arrived in Germany, although more settled in Lebanon. In other words, the problems created for poor countries are less newsworthy, although the consequences are sometimes more serious. Part of the bad and very bad that happens. It is the attitude of the United Nations and several Human Rights NGOs, which wrongly put pressure on the countries where immigrants want to go, and not on the dictatorships that have caused this emigration, as, for example, occurs with Cuba and Venezuela, whenever these governments should be punished in some way, since this migration, rather than being voluntary, is actually forced migration caused by repression. Will the Supreme Court concern itself with addressing the entire issue or will it only resolve which sections of the current legislation and the latest Texas law conflict, and which provisions would be unconstitutional in one or the other? We do not know, nor do we know if the ruling will include any opinion on the overlap that has taken place between current US law and subsequent international standards. By the way, your opinion will be very different in one case or another as well as if you only decide whether you agree with Texas or the federal government. The truth is that nothing forces it or prevents it from taking one path or another, since, from the start, nothing conditioned it to take the Texas case, since unlike other Supreme Courts it is not limited to establishing only the right , and even in its ruling it could set tasks for both the states and the federal government, resolving issues where politicians have not reached agreements, as has happened in the past on such conflictive issues as abortion or racial discrimination. It will? In conclusion, in the US, the diversity of Latinos is very confusing, the fact that there are many positions within it, since there is more of a habit of seeing immigrant groups as homogeneous groups, more in terms of ethnicity or race than others. characteristics, an example would be those Afro-descendant Latinos who are defined more by their culture than by their race. It is also difficult for them to understand what is happening with Latinos today politically, since for a long time there was a vote closer to the Democrats, but the polls show a sustained growth in support for the Republicans, of which the state of Florida is an example, where those who are not Latino understand perfectly that one of the reasons is the issue of the current ambiguity regarding the Venezuelan dictatorship, but they do not easily understand that many Latinos criticize the chaos of the southern border, even if they have relatives or acquaintances. there, without knowing that law and order reasons were always among the reasons why they came to the United States, and both Republicans and Democrats share that lack of understanding. What I am convinced of is the opportunity that the issue of immigration opens up for the Latino community, in its diversity and complexity. Indeed, today it is the first minority in the country, but there are still many hurdles to be crossed as well as places where those numbers are not felt. For example, political representation is still concentrated in places where there are a lot of Latinos, such as in South Florida or in sectors of Texas or California, but it does not have a greater presence in Hollywood except in Latino roles, just as in advertising it is more in Spanish than in English. Even in political debates on TV, they rarely appear, sometimes not even to discuss the Latino vote. In my opinion, this is because in general they have not been able to be linked to the solution of a problem that is of general importance for the country, to make the jump to the first division of visibility and relevance. And I believe that the issue of immigration offers that opportunity, one similar to what the issue of Civil Rights was for the African-American minority, which through Martin Luther King was able to offer a solution and obtain the corresponding legislation in the President Johnson's government in the 60s. The unresolved issue of immigration offers a similar opportunity, providing the US with consensus legislation. This exists today precisely because of the diversity of Latinos, since within them all the different positions coincide, so they can make a proposal that will be well received and even appreciated, since the current polarization prevents Congress from being the place where this conversation and search for consensus is taking place. In addition, they could complement what the Supreme Court decides. Ph.D. in Political Science (Essex), Law Degree (Barcelona), Lawyer (U. de Chile), former presidential candidate (Chile, 2013) «The opinions published herein are the sole responsibility of its author».
Consumer loans play an important role in helping individuals meet their financial needs and aspirations. Whether it's financing a major purchase, consolidating debt, or covering unexpected expenses, finding the cheapest loan option can save you a significant amount of money in the long run. However, navigating consumer loans can be overwhelming, with numerous factors influencing the cost and terms. In this comprehensive guide, we will explore the various aspects of consumer loans. On this page What Are Consumer Loans? Consumer loans are a lifeline for those who need extra financial support for various purposes like buying a car, consolidating debt, or funding home improvements. They are borrowed funds that individuals can use to cover their expenses. When it comes to consumer loans, finding the cheapest option can save you a ton of money in the long run. Even a small difference in interest rates or fees can add up over time, resulting in significant savings. Factors Affecting Loan Costs Interest Rates Interest rates are a critical factor in determining the overall cost of a loan. Even a slight variation in the interest rate can make a big difference in your monthly payments and the total amount you repay. So, keep an eye out for lower interest rates to minimize your expenses. Loan Term The loan term refers to the timeline for loan repayment. Typically, shorter terms result in higher monthly payments but lower overall interest fees and vice versa. Shorter terms may have higher monthly payments but save you money in interest. Consider your financial situation and goals to choose the loan term that suits you best. Loan Amount The loan amount also plays a role in determining your consumer loan cost. Borrowing more money may lead to increased interest charges. Only borrow what you need to avoid unnecessary expenses. Credit Score and History Your credit score and credit history are significant factors that lenders consider when determining your loan eligibility and interest rates. Maintaining a good credit score and a positive credit history can help you qualify for better consumer loan terms and lower interest rates. Some loans require collateral, such as a car or a house, which serves as security for the lender. Having collateral can sometimes result in lower interest rates, as it reduces the lender's risk. However, be cautious when pledging collateral, as defaulting on the loan could lead to the loss of your assets. Different Types of Consumer Loans 1. Personal Loans Personal loans are versatile and can be used for various purposes, like debt consolidation, unexpected expenses, or home improvements. They typically have fixed interest rates and terms, allowing you to budget your monthly payments easily. 2. Auto Loans Auto loans are designed specifically for purchasing vehicles. They often come with competitive interest rates and flexible repayment terms. Remember, finding the best deal on an auto loan not only saves you money but also lets you cruise in style. 3. Mortgage Loans Mortgage loans are used to finance the purchase of a home. They usually have longer loan terms and lower interest rates compared to other consumer loans. However, the total cost of a mortgage www.forbrukslån.no/ can be substantial due to the large loan amount involved. So, it's vital to shop around and find the most affordable mortgage option. 4. Credit Cards Credit cards are a type of revolving credit that allows you to make purchases up to a certain credit limit. They offer convenience and flexibility, but it's crucial to manage your credit card wisely to avoid high-interest charges. Look for cards with low-interest rates, rewards programs, and no annual fees for the most cost-effective option. 5. Student Loans These are used to finance higher education expenses and can be either federal or private loans. 6. Home Equity Loans These are secured loans that use the borrower's home equity as collateral and can serve for home renovations, debt consolidation, or other large expenses. 7. Payday Loans These are short-term, high-interest loans that are typically used for emergency expenses and are repaid with the debtor's next paycheck. 8. Installment Loans These are loans that are repaid over a set period with a fixed number of scheduled payments, such as personal installment loans or furniture financing. Researching and Comparing Loan Options To find the cheapest consumer loan, it's essential to collect information from different lenders. Compare interest rates, loan terms, and fees to identify the most cost-effective option that meets your needs. Use online comparison tools to streamline your loan search. These tools allow you to compare multiple lenders' offerings side by side, making it easier to find the best deal without spending hours researching individual lenders. When comparing loan options, consider factors beyond interest rates and fees. Look for features like flexible repayment options, prepayment penalties, and customer service quality. Pay attention to the fine print to make sure you're getting a loan that fits your financial goals. Remember, taking your time to make findings and weigh loan options can save you money in the long run. Strategies to Secure the Lowest Interest Rates 1. Building a Strong Credit Profile Lenders are all about the three-digit number that determines your creditworthiness. Paying your bills on time, keeping your credit card balances low, and avoiding unnecessary debt are all necessary for building a solid credit foundation. 2. Shopping Around for the Best Rates Don't settle for the first lender that flashes a shiny interest rate in your face. Different lenders have different offers, and you want to find the one that will give you the best deal. Compare interest rates, loan terms, and any pesky fees that might come with the loan. 3. Negotiating with Lenders When you're dealing with lenders, ask if they can lower the interest rate or waive certain fees. Give them reasons why you should be their favorite customer, like your impeccable credit history. Tips for Negotiating Loan Terms and Fees - Research and compare loan options from different lenders. - Know your credit score and understand how it may impact your loan terms. - Be prepared to negotiate interest rates, fees, and repayment terms with the lender. - Ask about any potential discounts or incentives for being a loyal customer or for setting up automatic payments. - Be willing to walk away if the terms and fees are not favorable to you. - Read and understand all loan documents before signing. Managing Loan Repayments and Avoiding Penalties Managing consumer loan repayments is crucial to maintaining good financial standing and avoiding penalties. It is vital to stay organized and keep track of repayment due dates to ensure timely payments. Setting up automatic payments or reminders can help in this regard. Understanding the terms and conditions of the loan agreement is also essential in managing repayments. Knowing the interest rates, fees, and repayment schedule can help in planning and budgeting for the loan payments. It is also crucial to be aware of any potential discounts or incentives for being a loyal customer or for setting up automatic payments, as this can help reduce the total loan cost. In the event of financial difficulties, it is important to communicate with the lender and explore options such as restructuring the loan or adjusting the repayment schedule. Ignoring repayment issues can result in penalties and further financial strain. Avoiding penalties also involves being aware of any potential fees for late payments or insufficient funds. It is important to prioritize loan repayments and ensure that sufficient funds are available to cover the payments. securing the cheapest consumer loan requires thorough research, comparison, and negotiation. By understanding the factors that affect loan costs and exploring different loan types, you can make informed decisions and find the best possible rates and terms. Remember to carefully review the fine print, ask for full disclosure, and manage your loan repayments effectively to avoid any unexpected fees or penalties. With the strategies outlined in this guide, you are now equipped to navigate the world of consumer loans and save money in the process.
Have you ever been confused about the difference between kidney beans and rajma? Or wondered if they're the same thing? Well, you've come to the right place! In this comprehensive guide, we'll explore the many differences between kidney beans and rajma, from their origins and uses, to their nutritional properties and taste. So, let's get started! Table of Contents Is Kidney Beans And Rajma Same? No, kidney beans and rajma are not the same. Rajma is a type of small, red-colored kidney bean native to Mexico, renowned for its creamy texture and nutty flavor when cooked. It's a popular dish in North Indian cuisine, often served with rice, as well as in other dishes like curries, stews, and salads. Kidney beans, on the other hand, come in a wide range of colors including white, red, light red, and black. They are also known for their firm texture and earthy flavor, and are commonly used in dishes such as chilli con carne, baked beans, and bean salads. In conclusion, while rajma is a type of kidney bean, not all kidney beans are necessarily rajma. Rajma is a specific variety of kidney bean used in North Indian cuisine. What Is Difference Between Rajma And Beans? Rajma and beans are both types of legumes that are enjoyed worldwide. While they share some similarities, there are some key differences between them. For starters, their origin sets them apart. Rajma is native to India and is also known as "kidney beans" in English. Beans, on the other hand, are found in many different countries and come in a variety of shapes and sizes. The taste of rajma and beans also differs. Rajma has a nutty flavor, which is often accentuated with spices, while beans tend to be milder in flavor. What's more, the texture of each legume is distinct. Rajma is known for its firm texture and creamy taste, while beans tend to be softer and crunchier. Rajma and beans can be used in a range of dishes. Rajma is typically used in Indian dishes like curries and stews, while beans are often featured in soups, stews, salads, and dips. Plus, both legumes are great for making vegetarian dishes such as veggie burgers and pasta. In conclusion, rajma and beans are both legumes, but they are unique in their origin, taste, texture, and uses. Rajma is native to India and has a nutty flavor, while beans come in all shapes and sizes and have a milder flavor. They can be used to make a variety of dishes, from curries to veggie burgers. What Are Kidney Beans Called In India? Kidney beans, known as Rajma in India, have been a staple of Indian cuisine for centuries. These beans are shaped like a kidney, hence the name. Rajma Masala and Rajma Chawal a combination of rice and kidney beans are among the most popular dishes in North India. Rajma is also used in salads and other vegetarian dishes. Highly valued for their nutritional value in India, kidney beans are an excellent source of plant-based protein, dietary fiber, iron, folate, and antioxidants. Furthermore, they are low in fat, rich in vitamins and minerals, and provide important dietary energy. Eating kidney beans can help lower cholesterol, improve digestion, and reduce the risk of certain types of cancer. Rajma is available year-round in most Indian grocery stores and can be bought in bags or cans. To ensure even cooking, select beans that are uniform in shape and size. When cooked, Rajma has a creamy texture and a mild, nutty flavor, making it a versatile ingredient in a variety of dishes. Who Should Not Eat Rajma? Rajma, commonly referred to as red kidney beans, is a popular dish enjoyed in many countries, especially in India and Pakistan. It is a flavorful and nutritious vegetarian dish, but it can also be unhealthy if not prepared and eaten correctly. People who have certain medical conditions or food sensitivities should not consume rajma. For instance, people with a kidney disorder or kidney disease should avoid eating red kidney beans due to the high levels of purine, which can lead to kidney stones. Additionally, those who are sensitive to histamine should also avoid eating rajma, as it contains high levels of histamine, which can result in an allergic reaction. People who have experienced gastrointestinal issues after eating legumes should also stay away from rajma. This is because red kidney beans can be difficult to digest, especially for those with weak digestive systems. Furthermore, those who have an intolerance to legumes should also avoid eating rajma as it can cause abdominal pain, bloating, and gas. Rajma is also high in carbohydrates, so those with diabetes should be careful when eating this dish. Additionally, those who are trying to lose weight should avoid eating rajma as it is high in calories. Overall, while rajma can be a delicious and nutritious dish, it is not suitable for everyone. People who have certain medical conditions, food sensitivities, gastrointestinal issues, or an intolerance to legumes should refrain from eating rajma. Additionally, those with diabetes or those who are trying to lose weight should be mindful when consuming this dish. What Is Another Name For Kidney Beans? Kidney beans, also known as red kidney beans, Mexican red beans, common beans, Rajma (in Indian cuisine), and red chili beans, are a popular variety of legume enjoyed in dishes around the world. These beans, with their distinctive red, kidney-shaped appearance, are a staple in many dishes, such as soups, chili, and rice dishes. They can also be used as a replacement for ground beef in tacos or burritos. Nutritionally, kidney beans are a great source of dietary fiber and plant-based protein, as well as essential minerals like iron, phosphorus, and magnesium. They are also packed with antioxidants, which can help reduce inflammation in the body. In the United States, they are generally referred to as red kidney beans, while in the UK they are known as haricot beans. In Australia, they are known as adzuki beans, and in India they are called Rajma. No matter what you call them, kidney beans are an incredibly versatile and nutritious addition to any meal. They are easy to prepare and can be cooked in a variety of ways, from being boiled to being pressure cooked. If you're looking to add a healthy and delicious legume to your diet, kidney beans are a great choice! What Is Indian Rajma Called? Indian Rajma, also known as red kidney beans, is a popular dish in North Indian cuisine. It is a legume that is known for its soft and creamy texture and slightly sweet, nutty flavor. Rajma is rich in protein, fiber, and other nutrients, making it a healthy option for vegetarians. Though it is often associated with India, Rajma is now grown in many other countries. When cooking Rajma, it is often combined with other ingredients to give the dish more flavor and texture. Popular spices used to enhance the flavor include cumin, garlic, ginger, coriander, and turmeric. Rajma can be cooked in a variety of ways, making it a popular choice for vegetarian dishes. What Is Rajma Also Called As? Rajma, also known as kidney beans, is an incredibly popular legume found in Indian, Mexican, and Middle Eastern cuisines. It is packed with proteins, carbohydrates, and dietary fiber, making it an excellent source of protein for vegetarians. Rajma is a very versatile ingredient, used in curries, salads, soups, burritos, tacos, chili, and even as a side dish. It is especially popular in North India, where it is cooked with rice to make Rajma-Chawal, a traditional dish. Rajma can also be used in other recipes, such as baked beans, stew, and chili. Is Rajma And The Mexican Beans Same? No, rajma and Mexican beans are not the same. While they may have some similarities, they are two distinct beans with different flavor profiles, textures, and culinary uses. Rajma, also known as red kidney beans, are commonly used in North Indian and Pakistani cuisine and are renowned for their earthy flavor. With a firm texture, they are usually served as a vegetarian stew, curry, or with rice. Rajma typically has a dark red or brown hue and is quite large, making it an ideal ingredient for slow-cooking dishes. In contrast, Mexican beans are a type of common bean used in Mexican cuisine. Unlike rajma, they are usually light-colored and much smaller in size. Additionally, they have a softer texture and are more often used in soups and stews. Mexican beans have a milder flavor than rajma, and are usually combined with other ingredients such as chilies, tomatoes, and spices to produce a mouthwatering dish. Overall, rajma and Mexican beans are two distinct varieties, similar in some ways, yet with their own distinct flavors and textures. While they can be used interchangeably in some dishes, they are best enjoyed when used in the recipes they were meant for. What Kind Of Beans Are In Rajma? Rajma, a popular Indian dish, is made with kidney beans cooked in a rich, flavorful, and spicy tomato-based sauce. Rajma beans, an heirloom variety of kidney beans native to the Himalayan region of India, are larger and darker in color than the more common red or white kidney beans. These beans have a nutty flavor and a chewy texture, making them an ideal choice for making rajma. Rajma beans are not only high in protein, but also a good source of dietary fiber. Plus, they are rich in minerals such as iron, magnesium, phosphorus, zinc, and copper, as well as B-complex vitamins like folates, niacin, thiamin, riboflavin, and pantothenic acid. Moreover, rajma beans are packed with plant compounds that act as antioxidants and may help protect against cancer. Rajma beans are widely available in most grocery stores and health food stores. They can be cooked as-is, or used in a variety of recipes such as rajma chawal, rajma masala, and rajma curry. Adding them to salads, soups, and stews is also a great idea. Rajma beans are a delicious and nutritious addition to any meal. What Is The Difference Between Beans And Kidney Beans? Beans, a type of legume, are plants that produce seeds in pods. There are various kinds, such as black beans, pinto beans, navy beans, and Lima beans. These beans are usually small and come in a multitude of colors. Kidney beans, however, belong to the Phaseolus vulgaris family and are part of the broader bean family. They usually have a red hue, but they can also be white or other colors. These beans are distinctively bigger than other types and have a kidney-shaped structure. The primary difference between beans and kidney beans is their appearance. All beans are usually small, but kidney beans are notably larger and have a unique shape. Furthermore, various types of beans have distinct colors and flavors, whereas kidney beans are typically red or white. Nutritionally, there are some disparities between the two. Both beans and kidney beans are high in fiber, protein, and essential vitamins and minerals. Nevertheless, kidney beans are higher in iron, magnesium, and potassium. Moreover, kidney beans are great sources of plant-based protein and provide energy for vegetarians and vegans. To sum up, beans and kidney beans are both part of the legume family and have similar nutritional advantages. The major difference between them is their appearance. Beans are usually small and come in a wide range of colors, while kidney beans are bigger and usually red or white. Additionally, kidney beans are richer in certain nutrients than other types of beans. Are Kidney Beans And Beans The Same? No, kidney beans and beans are not the same. Kidney beans are part of the legume family, which are plants that produce a pod with seeds inside. Beans, on the other hand, are a type of seed. Kidney beans are recognizable by their dark red color and kidney-like shape, while beans can be green, black, white, and more. Nutritionally, kidney beans and beans are similar in terms of fiber, protein, and complex carbohydrates. However, kidney beans are richer in iron, folate, and magnesium. In terms of culinary uses, both kidney beans and beans can be used in a variety of dishes. Kidney beans are often used in chili, salads, and soups, while beans can be eaten as a side dish or added to stews, casseroles, and curries. In conclusion, kidney beans and beans are not the same. While they have some similarities in terms of nutrition and culinary uses, they have distinct differences too. Kidney beans are a type of legume, while beans are a type of seed. Kidney beans have a characteristic dark red color and are shaped like a kidney, while beans can come in a variety of shapes, sizes and colors. Furthermore, kidney beans are richer in iron, folate, and magnesium than beans. Final Thoughts After looking at the differences between kidney beans and rajma, you can see that they have many similarities and differences. While they may look and taste similar, they have distinct origins and uses. Kidney beans are great for salads, while rajma is often used in curries. Moreover, they have different nutritional properties, so it is important to understand which one is better for your diet. Now that you know the difference between kidney beans and rajma, you can confidently make the best choice for your cooking needs!
Scared of pickpockets? Then avoid King's Cross...on a Friday: We find out who is losing what, and where – and how best to insure yourself if you use the Underground Menace: Travellers using the London Underground be warned - pickpockets are on the prowl Travellers using London's most popular Tube lines should hang on more tightly to their wallets, phones and handbags as pickpockets are on the prowl. The Mail on Sunday finds out who is losing what, and where – and how best to insure yourself if you use the Underground. Passengers using the Central Line are more likely to fall victim to thieves than those using any other line on the London Underground, according to new research. Those travelling on the line – marked red on the Tube map and incorporating landmark stations such as Notting Hill, Oxford Circus and Holborn – are more likely to lose possessions to crooks than on London's ten other lines. Reported thefts in the year to the end of January this year were 632 compared with 581 on the Piccadilly Line, the next most risky route. Although this crime is on the decline across the Tube, there are still hundreds of incidents each month, according to research by insurer Policy Expert. Using the results of a Freedom of Information request made to the British Transport Police, it found that in the year to the end of January there were 3,926 incidents, at an average loss to the victim of £427 – a total of nearly £1.5 million. The most common target for fingersmiths are wallets, purses, travel cards and credit cards. But nearly 500 phones, tablets, laptops and cameras were lifted from passengers over the year. The pickpocketing hotspot is King's Cross St Pancras Tube station, followed by Oxford Circus and Victoria. After the Central and Piccadilly lines, the riskiest in terms of crooks preying on passengers' possessions are the Northern, Victoria and Jubilee lines. The safest in terms of keeping hold of valuables is Waterloo & City, with just six incidents reported, followed by Docklands Light Railway and the Metropolitan Line. The worst day to travel is a Friday, with 650 thefts occurring, followed by a Wednesday with 606 incidents. The fewest happen on a Sunday. Those travelling on the Circle Line – marked red on the Tube map and incorporating landmark stations such as Notting Hill, Oxford Circus and Holborn – are more likely to lose possessions to crooks than on other lines The figures show that women are preyed on more often than men – on average 54 per cent of victims are women. Adam Powell, head of operations at Policy Expert, says: 'It's easy to get swept up in the crowds as public transport gets busy over the summer months with tourists as well as commuters descending on the capital. But it's important to ensure you're not a target for either opportunistic or professional thieves. 'As well as being vigilant it is also worth checking that your home insurance or other policies will pay out for any losses.' In the past victims might routinely turn to their home insurance to claim for thefts while on the move. But these days standard household contents plans tend not to automatically cover belongings outside the home, with insurers selling this cover as an extra. Kevin Pratt, consumer affairs expert at insurance comparison website MoneySupermarket, says: 'The insurer will usually offer a bolt-on policy called personal possessions cover, which will also cover stolen cash, sometimes up to £500. This add-on typically costs an extra £60 a year on top of your main premium.' Pratt warns there is usually a pile of conditions attached. He says: 'You'll probably have to list any items over £1,000 or £2,000 and be prepared to show proof of purchase or ownership if anything is lost or stolen. You won't get a payout if you have left items unattended.' Another pitfall is that anything used for business purposes, such as tools or a laptop, will not be covered if the policyholder is self-employed. The excess – the amount a policyholder pays towards a claim – on a contents plan is usually between £75 and £100. Things are a bit more complicated for people renting rooms in a shared property. They can either get contents cover for everyone in the property – which can be a hassle when someone needs to claim – or just for themselves, as long as they can – and do – lock the door to their room. But cover outdoors is usually limited to a laptop and phone. THOSE who do not want possessions cover or live in a shared household may be better off with standalone gadget insurance, although as the name suggests, this limits cover to items such as laptops and phones. The advantage of a gadget policy is that the excess is often lower – typically £50 or £100 for an iPhone. Annual premiums range from £60 to £300. Pratt says: 'The cover can be slightly broader. For example, a home insurance policy might specify that you can't claim for damage to an item caused by liquid, where a gadget policy says you can.' He also points out that many contents policies carry a no-claims bonus, which can cut premiums by a third after a number of claim-free years. He says: 'You would lose this if you made a claim. Gadget policies often allow more claims per year.' Brian Brown, insurance expert at financial researcher Defaqto, says another advantage is the time taken to settle a claim. He says: 'Home insurers can take days or weeks to finally settle. Most mobile phone insurers will try to get a replacement handset – or loan one during repair – within a few days.' Travel insurance may come to the aid of policyholders if their valuables are pinched abroad – but watch out for the single item value limits, which may be low. Mobile phones are often excluded. Packaged bank accounts also often provide phone cover. Brown says: 'The level of cover is usually £600 to £1,000, which is sufficient for more expensive phones.' But he warns of pitfalls, including cover often being for a specific handset, which must be declared before cover is given. He adds: 'Always check to make sure you are not double or triple insured through buying a mobile phone policy while having a packaged current account and a home insurance policy that covers a phone away from home.' Most watched Money videos - BMW meets Swarovski and releases BMW i7 Crystal Headlights Iconic Glow - Top Gear takes Jamiroquai's lead singer's Lamborghini for a spin - Mini celebrates the release of brand new all-electric car Mini Aceman - 2025 Aston Martin DBX707: More luxury but comes with a higher price - Land Rover unveil newest all-electric Range Rover SUV - Mail Online takes a tour of Gatwick's modern EV charging station - Mercedes has finally unveiled its new electric G-Class - A look inside the new Ineos Quartermaster off-road pickup truck - Introducing Britain's new sports car: The electric buggy Callum Skye - Blue Whale fund manager on the best of the Magnificent 7 - Leapmotor T03 is set to become Britain's cheapest EV from 2025 - Mini Cooper SE: The British icon gets an all-electric makeover - SSP Group shares slump as profits hit by European rail... - Would you work from a car office? Ford patent shows how... - Five magic words you must say to BT if you DON'T want to... - South West operator Pennon to hand-out £3.5m in... - MARKET REPORT: Fresnillo sparkles as gold hits a record high - Bitcoin and other cryptos rally as investors eye US... - BUSINESS LIVE: AstraZeneca eyes $80bn in sales; Credit... - I'm 85 and no longer fit to drive. But when I took my... - The one thing you have to add to your shed to make sure... - CVS sells Dutch and Irish vet businesses for just €2 - Top investor throws weight behind Anglo American break-up... - Visa and Mastercard could face transparency crackdown as... - AstraZeneca targets $80bn in yearly revenues by 2030 - Cazoo collapses into administration putting more than 200... - Screwfix owner Kingfisher suffers 'big-ticket' spending... - Sajid Javid eyes job at Shein as the Chinese fast fashion... - Stamp duty on shares must be axed, says London Stock... - Bank sets the scene for summer rate cuts as deputy...
'Big data' is a term that refers to the collection, research, and control of large, intricate data collections. This info may be made by a variety of options, including internet logs, call information, medical data, and social media. It is often challenging to process this kind of large data sets with on-hand repository managing tools. Fortunately, specialized tactics have been created to deal with this kind of challenge. The United Nations launched the Global Heartbeat initiative to harness the capability https://myvirtualdataroom.net/ of big data technology to address the world's biggest challenges. Its target is to set up a network of Pulse Labs around the world. In addition , the program aims to utilize free of charge and open source computing methods. Aside from leveraging high-value data, an additional ballgame is certainly leveraging fast data. The speed of data processing is important in real-time economies. Additionally, it helps in dealing with poverty and humanitarian emergencies. Big data techniques can also help in creating effective general population policies. For instance , it will help in protecting against epidemic outbreaks. In addition , it will help in treating probably harmful ailments in the early stages. In addition , big info can also aid in identifying and mitigating education emergencies. For instance , data from social media can be used to combat lower income and dilemmas. Big data techniques also are useful for studying petabyte-scale info. In fact , big data OLAP can diagnostic scan terabytes of information within secs. There are also fresh techniques for completing data to Hadoop. These types of techniques tend to be compact than SOAP and will work with any kind of data unit.
Table of Contents The integration of 3D modeling technology has ushered in a new era of efficiency, accuracy, and innovation in the construction industry. From initial design phases to project completion, 3D modeling tools have become indispensable, offering a wide array of benefits that streamline workflows and improve project outcomes. In this in-depth exploration, we'll uncover ten key ways that 3D modeling is transforming and benefiting the construction industry, paving the way for smarter, more sustainable construction practices. 1. Precision in Design and Planning (3D Model) 3D modeling provides construction professionals with unparalleled precision in design and planning stages. Using advanced software like AutoCAD, Revit, or ArchiCAD, architects and engineers can create intricate, detailed models of structures, buildings, and infrastructure projects. These models allow for precise measurements, accurate spatial planning, and comprehensive visualization of the final outcome. By eliminating guesswork and ambiguity, 3D modeling ensures that designs meet exact specifications, leading to optimized construction processes and reduced material waste. 2. Efficient Communication Across Teams Effective communication is key to successful construction projects, and 3D modeling facilitates seamless collaboration among project teams. With shared access to centralized 3D models through platforms like BIM 360 or Trimble Connect, architects, engineers, contractors, and stakeholders can collaborate in real time, regardless of their physical locations. This streamlined communication process reduces errors, minimizes misunderstandings, and promotes a cohesive approach to project planning, design, and execution. 3. Improved Visualization for Stakeholders 3D models provide stakeholders, including clients, investors, and regulatory authorities, with a clear and immersive visualization of proposed construction projects. Unlike traditional 2D drawings or blueprints, 3D models offer a realistic representation of building designs, interiors, and landscaping elements. Stakeholders can virtually explore and interact with the project before construction begins, gaining insights into aesthetics, functionality, and spatial relationships. This enhanced visualization fosters better decision-making, ensures alignment with project objectives, and increases stakeholder confidence and satisfaction. 4. Early Detection of Design Issues One of the significant advantages of 3D modeling is its ability to detect and resolve design issues early in the project lifecycle. Using clash detection features in BIM software, teams can identify potential conflicts between architectural, structural, and MEP (mechanical, electrical, plumbing) components. By simulating construction processes virtually, teams can address clashes, interferences, or coordination issues before they impact actual construction activities. This proactive approach minimizes rework, reduces project delays, and enhances overall project efficiency. 5. Accurate Quantity Takeoffs and Cost Estimation 3D models serve as valuable tools for accurate quantity takeoffs (QTO) and cost estimation during project planning and budgeting phases. By associating material properties, dimensions, and quantities directly with 3D elements, estimators and quantity surveyors can generate precise material lists and cost estimates. This level of detail enables project teams to budget effectively, identify cost-saving opportunities, and prevent overruns or discrepancies in project budgets. Additionally, 3D modeling supports value engineering by analyzing different design scenarios and their cost implications. 6. Enhanced Safety Planning and Risk Mitigation Safety is paramount in construction, and 3D modeling plays a crucial role in safety planning and risk mitigation strategies. Through virtual construction simulations, teams can identify potential safety hazards, plan evacuation routes, and assess site logistics before physical work begins. Safety features such as clash detection can also identify conflicts that pose safety risks, such as inadequate clearances or unsafe equipment placements. By addressing safety concerns proactively in the virtual environment, construction teams can minimize accidents, comply with regulatory standards, and create safer work environments. 7. Sustainable Design and Green Building Practices 3D modeling empowers architects and engineers to incorporate sustainable design principles and green building practices into construction projects. By simulating energy performance, daylighting effects, and environmental impacts using tools like energy modeling software, teams can optimize building designs for energy efficiency and environmental sustainability. 3D models enable the integration of renewable energy systems, efficient HVAC (heating, ventilation, air conditioning) solutions, and sustainable materials, reducing carbon footprints and operating costs over the building's lifecycle. Sustainable design practices not only benefit the environment but also enhance occupant comfort, health, and productivity. 8. Faster Iterations and Design Changes Traditional design iterations and changes in construction projects can be time-consuming and costly. However, 3D modeling streamlines this process, allowing for faster iterations and design modifications. Design teams can quickly explore multiple design options, test variations, and incorporate feedback from stakeholders in real time. Whether adjusting building layouts, refining interior designs, or exploring façade options, 3D modeling tools provide agility and flexibility in design iterations without significant disruptions to project timelines. 9. Documentation and As-Built Accuracy Accurate documentation and as-built drawings are crucial for project handover, facility management, and future renovations or expansions. 3D modeling ensures as-built accuracy by capturing construction progress, changes, and deviations from the original design throughout the construction phase. By integrating as-built information directly into 3D models, project teams can create comprehensive digital twins of completed structures, including MEP systems, structural elements, and architectural details. This digital documentation streamlines facility management, maintenance planning, and retrofitting activities, saving time and costs in the long run. 10. Integration with Advanced Technologies 3D modeling serves as a foundation for integrating advanced technologies such as virtual reality (VR), augmented reality (AR), and artificial intelligence (AI) into construction workflows. VR and AR applications enable stakeholders to experience immersive walkthroughs of virtual designs, visualize construction progress in real time, and identify potential issues before they arise. AI-powered analytics leverage 3D models and sensor data to optimize construction schedules, resource allocation, and predictive maintenance strategies. By embracing these technologies, construction firms gain a competitive edge, improve decision-making, and deliver projects with greater efficiency and quality. In conclusion, 3D modeling has become a cornerstone of modern construction practices, offering multifaceted benefits that drive innovation, efficiency, and sustainability across project lifecycles. Embracing 3D modeling technologies and workflows empowers construction professionals to tackle complex challenges, deliver high-quality projects, and navigate the evolving landscape of the construction industry with confidence and success.
What is burnout? What are the side effects and causes? Furthermore, assuming you're encountering it, what else is there to do? The word reference expresses that burnout is "weariness of physical or profound strength or inspiration for the most part because of drawn out pressure or dissatisfaction." I put generally in italics since in any event, when you love your work as I do, you can exaggerate and think of yourself as worn out. Side effects of wear out can be physical, conduct and otherworldly. Here are a few signs that you're taking for consume off: o weakness o muscle strain o cerebral pains o a sleeping disorder o not keeping responsibilities o absence of adequacy o peevishness o uneasiness o feeling of vacancy nothing left to give o absence of bliss o not ready to giggle Reasons for burnout can emerge out of inside ourselves or from our associations. A few normal causes are exclusive standards of ourselves, forswearing of our fundamental requirements like food and rest, unfortunate time usage abilities, failure to define limits or to say no. Hierarchical causes can be a culture of seriousness, or one in which being continually occupied and exhausted is valued with email and calls brought on "excursions." Lacking preparation in new position jobs or confined, loud conditions can likewise add to burnout. The following are 3 methods for managing burnout training: change what is going on, diminish your weakness to stretch or potentially alter the manner in which you respond to pressure that can't be changed: - Change what is going on if possible. Assuming there are some high pressure parts of your work, check whether you can turn this errand with others. Limit the quantity of hours you are under pressure. Invest some energy on vocation/life arranging. Put forth your boundaries and live by them. - You can lessen your weakness to stretch by dealing with your actual self with great nourishment, exercise and enough rest. Stay away from nicotine and don't exaggerate caffeine and liquor. Encircle yourself with steady individuals, work with a mentor who will pay attention to you profoundly and assist you with making a decent equilibrium between work and different parts of your life. - At last, fundamentally impact the manner in which you respond to pressure. You can do this by adjusting your self-talk and self-analysis. Learn methods to quiet yourself - a couple of full breaths can take you right back to a focused spot, ready to confront anything that pressure is before you. Turn into a taking care of oneself master and have a great time.
Form 1120 Every business owner has to file Form 1120 every year. This article will cover everything related to IRS Form 1120. Form 1120 is used to report the income, gains, losses, credits, and deductions of businesses registered as S corporations. These companies have fewer than 100 shareholders. S corps are pass-through entities, meaning their profits "pass through" to the shareholders' personal income tax returns. The form also asks for details about your business's assets and liabilities. The IRS requires S corporations to file this form every year, but there are exceptions to this rule. For example, an S corporation may not need to file Form 1120 if it is a limited liability company (LLC). Additionally, a business with a short tax year ending anytime in June can still file its form if it falls within the first three months of that year. It is also possible for small business owners to fill out these forms on their own using special tax softwares. When to file Form 1120? All domestic corporations (or associations electing to be taxed as corporations) must file Form 1120 unless they are exempt, required, or elected to file a special return listed under Special Returns for Certain Organizations. Generally, Form 1120 is due by the 15th day of the 3rd month following the end of a corporation's tax year, but that deadline can be extended if it falls on a Saturday, Sunday, or legal holiday. The corporation must complete the form and mail it to the IRS by the due date, which will be the next business day. How to Fill Out Form 1120? Form 1120 can be filed online or by mail. You can complete Form 1120 using your business's financial statements, including: - The annual balance sheet - Profit or loss statement. If you're not sure what information to record, it's a good idea to consult your accounting firm or a certified public accountant for advice. Once you've filed Form 1120, you can also use it to calculate your corporate tax liability. On the first page, you'll need to start with your taxable income and multiply it by the corporate tax rate. You can also add your business tax credits and estimated payments to arrive at your corporation's tax bill. If your corporation buys shares in other companies, you may be able to deduct a percentage of those dividends on Schedule C. This is an effective way to lower your corporation's tax bill. In addition, if your business has business ties to other countries, you must file Form 1120-F with your tax return. This is a special type of form that protects your rights to receive deductions and credits from those countries. How Do S Corporations Report Their Income? As an S Corporation, the IRS requires that you file Form 1120-S with Schedule K-1. This document reports the percentage of a corporation's profits that are owned by each shareholder and is used to allocate profit and loss. Without an accurate Form 1120-S and Schedule K-1, shareholders cannot receive certain tax benefits. Using the instructions on Form 1120-S, you should be able to complete the form quickly and easily. However, it is also important to consider the limitations on deductions and credits for an S Corporation. This is especially true if the S Corporation has depreciable property or rental properties.
Antiprotozoal medicines are drugs used to treat illnesses brought on by the single-celled organisms known as protozoa. The type of protozoa causing the infection determines which antiprotozoal medication is best. Protozoal infections can range in severity from moderate to severe. These are a few typical antiprotozoal medications: Metronidazole: A common antiprotozoal medication, metronidazole works well against a variety of protozoa, such as Entamoeba histolytica, Giardia lamblia, and Trichomonas vaginalis. It causes cell death by interfering with the protozoa's DNA. Treatment for illnesses like trichomoniasis, giardiasis, and amoebiasis sometimes involves the use of metronidazole. Neonate taste, nausea, and, in rare instances, peripheral neuropathy are examples of side effects. Chloroquine: An antimalarial drug called chloroquine works well against some protozoa, such as species of Plasmodium. It functions by building up in the parasite's acidic feeding vacuoles, where it prevents heme polymerization and ultimately causes the parasite to perish. In the past, chloroquine was frequently used to prevent and treat malaria, but resistance has emerged in many places. Headache, gastric distress, and retinopathy after prolonged use are possible side effects. Proguanil-Atovacuonel: Malaria is treated and prevented using this combo medicine. Atovaquone acts by preventing the parasite's mitochondrial electron transport chain from functioning. Proguanil disrupts the parasite's DNA synthesis by blocking the dihydrofolate reductase enzyme. This combination works well against Plasmodium species in both the liver and blood phases. Headache, nausea, and stomach pain are possible side effects. Pentamidine: Trypanosoma brucei, the parasite that causes African trypanosomiasis, is treated with pentamidine. It functions by preventing the parasite from making DNA and from functioning. Depending on the kind of infection, pentamidine may be given by injection or inhalation. Kidney damage, low blood pressure, and electrolyte imbalances are possible side effects. Poromycin: An aminoglycoside antibiotic called pacmomycin is used to treat intestinal protozoal illnesses such as giardiasis and amoebiasis. It functions by preventing the parasite from synthesizing proteins. In order to provide more effective treatment, pacomycin is frequently used in conjunction with other drugs. Kidney damage is an uncommon side effect, as well as upset stomach. These antiprotozoal medications are essential for treating protozoa-caused infections because they reduce symptoms and guard against consequences. As with any medication, they should be used under a doctor's supervision to guarantee correct dosage and to keep an eye out for any possible drug interactions or side effects.
Agriculture is a key economic pillar of Cambodia, with 22% of the gross domestic product (GDP) of 2022. The nation has been experiencing a rapid economic As part of his visit to Phnom Penh in the Kingdom of Cambodia, Deputy Minister Kwon Jae-han of the Ministry of Agriculture, Food and Rural Affairs, met with Korean importers who do business in the country and visited local places where Korea exports agri-food products. Cambodia's economy is largely driven by agriculture, which is expected to contribute 22% to the gross domestic product (GDP) by 2022. The nation has experienced rapid economic growth with an average annual growth rate of seven percent over the past two decades. The Korean ministry has been carrying out eight ODA projects with Cambodia. With the Free Trade Agreement (FTA) signed between the two countries in 2022, the bilateral trade is gaining more momentum. The export value of agri-food products from Korea to Cambodia reached approximately USD 90 million in 2023, with beverages accounting for 60% and modified milk powder and ginseng taking an increasing share. Also, Korea's first export of "hanwoo" (Korean beef) to the Mekong region was made to Cambodia in August 2023. * Export value of agri-food products in 2023: (a) $54 million in beverages, down by 27.2% from 2022; (b) $12 million in modified milk powder, up by 33.0% from 2022; and (c) $2 million in ginseng, up by 22.3% from 2022. In addition, Export value of modified milk power products to Cambodia: $3 million in 2019 → $4 million in 2020 → $6 million in 2021 → $9 million in 2022 → $12 million in 2023 On 28 March, Deputy Minister Kwon held meetings with Korean importers of agri-food products as well as Korean exporters and importers of hanwoo working in Cambodia to discuss the ways to expand export to the nation. The agri-food products importers said: "We want to introduce Cambodian consumers to diverse Korean agri-food products. And large companies and small- and medium-sized companies should share growth to make it possible to enter a new market like Cambodia."
As artificial intelligence (AI) continues to evolve and integrate into various business sectors, the concept of human-AI collaboration becomes increasingly significant. This partnership, when harnessed correctly, can lead to unprecedented levels of productivity, innovation and job satisfaction. However, realizing this potential requires careful consideration of the collaboration models that govern the interaction between employees and AI systems. realizing this potential requires careful consideration of the collaboration models that govern the interaction between employees and AI systems. The Complementary Model The complementary model is based on the principle of leveraging the unique strengths of both employees and AI. In this model, AI systems handle tasks that involve processing large volumes of data, pattern recognition, and executing repetitive tasks with high precision. Meanwhile, employees focus on activities that require emotional intelligence, creativity, critical thinking and complex problem-solving. This division of labor allows for a synergy where each party complements the other, leading to enhanced efficiency and more innovative solutions. Benefits: Maximizes the strengths of both employees and AI, leading to higher productivity and innovation. Challenges: Requires clear understanding and delineation of tasks that are best suited for employees versus AI, which may evolve over time as AI capabilities grow. The Augmentation Model In the augmentation model, AI acts as a direct support system to enhance employee capabilities, rather than taking over tasks completely. AI tools provide insights, recommendations, or augmented reality environments to assist employees in making better decisions, designing more creative solutions, or performing physical tasks with greater precision. This model emphasizes the enhancement of human skills and decision-making rather than replacement. Benefits: Empowers employees, improves decision-making, and increases job satisfaction by allowing employees to perform tasks more effectively. Challenges: Requires the development of intuitive AI systems that can seamlessly integrate into employee workflows and the training of employees to effectively use these tools. The Interactive Model The interactive model focuses on the dynamic interaction between employees and AI, where both parties can learn from each other and adapt over time. This could involve employee training AI systems through reinforcement learning, providing feedback on AI-generated solutions, or AI systems suggesting new methods or information that employees may not have considered. This model is particularly relevant in creative industries or complex problem-solving scenarios where iterative feedback loops can lead to innovative outcomes. Benefits: Facilitates a continuous learning process for both AI and humans, leading to improved AI accuracy and employee skills. Challenges: Implementing effective feedback mechanisms and ensuring AI systems are capable of adapting based on employee input. The Autonomous Model While not strictly a collaboration model in the traditional sense, the autonomous model involves AI systems operating independently in certain tasks or decisions, with employees setting the parameters and goals. This model is applicable in situations where speed and efficiency are paramount, and AI can make decisions faster and more accurately than employees. However, human oversight remains crucial to monitor performance and intervene when necessary. Benefits: Increases operational efficiency and allows employees to focus on higher-level strategic tasks. Challenges: Risk of over-reliance on AI decisions without adequate human oversight, leading to potential ethical and operational issues. Implementing Effective Human-AI Collaboration Successfully implementing human-AI collaboration models requires a strategic approach: Clear Definition of Roles: Organizations must clearly define the roles of employees and AI in each model to prevent overlap and ensure both are utilized to their full potential. Continuous Training and Development: Both AI systems and employees should undergo continuous training to adapt to evolving capabilities and workplace needs. Ethical Considerations and Bias Mitigation: Implementing any collaboration model must include addressing ethical considerations, particularly regarding data privacy, security, and bias mitigation in AI algorithms. Open Communication and Feedback Loops: Encouraging open communication and establishing feedback loops between employees and AI systems can enhance collaboration and adjust strategies as needed. In conclusion, Human-AI collaboration models offer a roadmap for integrating AI into the workplace in a way that enhances employee work rather than replaces it. By carefully selecting and implementing these models, organizations can unlock the full potential of AI, leading to increased efficiency, innovation and a more fulfilling work environment for employees. The future of work lies in the harmonious collaboration between humans and AI, where each complements the other's capabilities to achieve goals that were once considered beyond reach. Source: CleverPlato AI Magazine
A singular, premier honour for the Indian Community Other inductees: Sir Ian Taylor, Todd Heller, Mark Dunajtschik, Rod Duke, Diane Foreman and Sir Glen Owenn Venkat Raman Auckland, May 12, 2024 We are happy to report that Community and Business Leader Ranjna Patel has been inducted into the New Zealand Business Hall of Fame, the first person of Indian origin to achieve this distinction. Established by Young Enterprise, this is stated to be the most prestigious and authentic Hall of Fame for honouring people for their contributions to the socio-economic fields. Among the 2024 Laureates are Sir Ian Taylor, Tod Heller, Mark Dunajtschik, Rod Duke, Diane Foreman and Sir Glen Owenn. They will be inducted into the Hall of Fame at a gala dinner on September 11, 2024 at Cordis Hotel in Auckland City. About Ranjna Patel Ms Patel is a multifaceted personality with multiple achievements in many areas. The Citation on her appointment to the New Zealand Business Hall of Fame described Ms Patel as 'a distinguished entrepreneur and philanthropist,' and that 'her leadership in healthcare and social welfare has made her a pivotal figure in fostering community wellbeing and equity.' As well as many other awards and citations, she was the first person of Indian origin (in 2014) to decorate the Hall of Fame of 'Co. of Women,' an organisation of high achievers based in Auckland. Born and raised in Auckland, Ms Patel belonged to a joint family comprising her parents, uncle and aunt who ran a fruits and vegetables shop in Herne Bay, on the Southwestern shore of the Waitemata Harbour. From our Archives Colleague and friend Ranjna Patel gets another prestigious Award Ranjna Patel decorates Hall of Fame In 1977, she established East Tamaki Healthcare with her husband Dr Kanti Patel. It was a modest, solo GP practice in the South Auckland suburb of Otara with Ms Patel doubling as the Receptionist and Administrator while Dr Patel tended to the patients. Over the years, the practice grew to become the largest primary healthcare provider in Auckland with 50 clinics, accounting for more than 300,000 patients. For more than four decades, she held various executive roles involving medical practice development, strategic development and public relations. The company has been renamed Tamaki Health under new ownership and management. During an interview with Indian Newslink (March 1, 2013), Dr Kanti Patel paid rich tributes to his wife saying, "She has always been a source of strength and support since we were married. Both of us share a concern for serving the community, which I believe gives us a sense of purpose in life and career." Gandhi Nivas: Unique in approach and Service Ms Patel is closely associated with several voluntary and charitable projects and services but the most challenging of all has been Gandhi Nivas. Established on December 1, 2014, Gandhi Nivas is a crisis intervention service for individuals and families affected by family Harm and Violence. It takes a different approach to assist people and families in healing and rebuilding their lives. As a primary initiator of the Project at a meeting of the Ethnic Advisory Board of the Counties Manukau District Police in April 2014, Ms Patel believed that many intervention programmes focus on victims (who are often women and children) but not on perpetrators or offenders. "But we do not want a band-aid solution. We want to address the fundamentals and get to the root of the problem," she said. Mental Health experts say that early life adversity is the biggest risk factor for mental health issues, education failure, long-term unemployment, imprisonment and addiction disorder. It can also convert one into a violent aggressor. The intervention strategy of Gandhi Nivas focuses on the behaviour modification of the aggressor, particularly males and wraparound support for the families involved. A key aspect of family violence intervention is engaging offenders in their own rehabilitation. Gandhi Nivas helps men take a positive role in stopping violence against women. These are men served with a Police Safety Order (PSO) which keeps them away from their homes, and prevents another violent incident perpetrated by them. This gives both the protected person and the person bound by the PSO, time to cool down and seek aid. The Police can charge a person who fails to comply with the provisions of the PSO and take them to a Court of Law. Gandhi Nivas offers a range of services, including emergency shelter, crisis counselling by qualified and registered counsellors, legal advocacy, and support groups. It operates from three locations in Auckland- Otahuhu, Te Atatu and Papakura. The Swaminarayan Complex The late Queen Elizabeth II acknowledged Ms Patel for her contributions to the communities with a Queen's Service Medal (along with Dr Kanti Patel) in 2009 and appointed her as an Officer of the New Zealand Order of Merit in 2017. Ms Patel and Dr Kanti Patel constructed the Swaminarayan Temple (ISSO) in response to the growing needs of the community in the South Auckland suburb of Papatoetoe. It was inaugurated on March 18, 2008 (Indian Newslink March 1, and April 1, 2008). A multipurpose, multimillion Dollar Community Complex with a state-of-the-art facility was added last year (2023). The facility has become an important landmark in Auckland as a venue for public festivals, events, weddings and other functions. Ms Patel was President of the Manukau Indian Association (the first woman President) and is a member of several advisory committees, including Counties Manukau Police South East Asian Advisory Board, MIT Indian Community Advisory Group, NZ Global Women, Women's Presidents Organisation, NZ Asian Leadership Group and many others. The New Zealand Business Hall of Fame Wellington-based Young Enterprise launched the New Zealand Business Hall of Fame in 1994 by Young Enterprise to honour individuals who have played a crucial role in New Zealand's economic and social progress. Its Enterprise's mission is to cultivate students' business aptitude and equip them with the skills required to be successful business leaders and entrepreneurs. This initiative also improves teachers' capacity to inspire curious, entrepreneurial students and contribute to a more prosperous New Zealand. During an annual black-tie gala dinner, Laureates are welcomed into the Hall, each with a unique tale of enterprise, hard work and triumph. Many of them have also been generous in their contributions to their respective communities. Sir Ian Taylor Sir Ian Taylor, a pioneering figure in New Zealand's tech industry, founded Animation Research Ltd. (ARL), in 1990. Headquartered in Dunedin, it stands as a trailblazer in the realm of computer graphics and animation, having revolutionised sports broadcasting with cutting-edge graphics technology, notably enhancing the America's Cup coverage. Knighted in 2021 for services to broadcasting, business and the community, Sir Ian's vision expands beyond profit, with his dedication to numerous philanthropic endeavours supporting education, youth development, and environmental conservation. Todd Heller A fifth-generation butcher, Todd Heller opened his first butchery in New Brighton, Christchurch, in 1985. Today he is the founder of an iconic Kiwi brand, New Zealand's leading bacon, ham and sausage producer, Heller Meats. The company directly employs over 1000 staff, across four production plants in New Zealand and Australia. Mr Heller has funded the "Sausages for Schools" Programme, donating over two million sausages to school fundraisers, consequently helping schools raise over $4 million since 2012. Community is a priority for him, with a recent contribution of 1200 pressed hams to city missions for Christmas. Mark Dunajtschik Mark Dunajtschik migrated to New Zealand as a toolmaker in 1958 to make a new life after an extraordinary plight that saw him imprisoned by Yugoslav forces in a concentration camp under Marshall Tito's rule before escaping to Germany. He set up Precision Grinders in Wellington running a toolmaking business successfully for 28 years. Retiring in 1987, Mr Dunajtschik took up developing and investing in property as a hobby in Central Wellington. With his hands-on formula, this became a very successful business, making him one of Wellington's and New Zealand's most generous philanthropists. Rod Duke Rod Duke has been at the forefront of retail innovation in New Zealand as the Managing Director and Deputy Chairman of Briscoe Group since purchasing 100% ownership of the company in 1990. Today, Mr Duke owns 80% of the Group which encompasses 90 stores and directly employs around 2400 people across its two brands, Briscoes Homewares, and the Rebel Sport Chain, which he established in 1996. He is a longstanding supporter of child cancer research and support programmes with a focus on enhancing young people's wellbeing. Diane Foreman Earning international accolades, Diane Foreman has made significant contributions to healthcare, manufacturing and franchising. An entrepreneur with 35 years of success, she was recognised as New Zealand's 2009 Entrepreneur of the Year. Formerly Chief Executive of Trigon Industries and founder of the Emerald Group, Ms Foreman chairs Chelsea Group, overseeing a diverse portfolio of developments. She is an accomplished author and a co-founder of International Winning Woman. Sir Owen Glenn Since migrating to New Zealand with his family from India in 1952, Sir Owen Glenn has distinguished himself through a variety of successful ventures spanning logistics, property development, horticulture, and investments on a global scale. Notably, he was the Founder and Chairman of OTS Logistics Group. In 2008, Sir Owen was appointed as an Officer of the New Zealand Order of Merit (ONZM) and in 2011 he was made a CPA Australia Honorary Fellow. Knighted in 2014 for his outstanding contributions to philanthropy, Sir Owen has contributed extensively to education, the arts, healthcare, and sport. His noteworthy contribution to the University of Auckland in 2002 stands as the largest private donation in New Zealand's educational history.
Breach of Tradition During Socialism: The Case of Water Syndicates in Bulgaria Journal Title Journal ISSN Volume Title "During the post-socialist transition period, the Bulgarian irrigation facilities deteriorated to a large extent and no longer meet the needs of the new landowner and agricultural production structure. The Bulgarian government therefore enacted two new laws to encourage collective action and to establish water user associations in order to achieve sustainable water management. "In this article, we will question the frequent argument that water user associations could easily be established in Bulgaria, because they are rooted in the water syndicates. Empirical findings from village case studies reveal that limited collective memory exists today about former water syndicates' rules-in-use and patterns of action. We will explain this breach of tradition by the migration from villages to cities, the suppression of precommunist so-called capitalist behaviour, and the length of the communist period. Moreover, the analysis of the historical cooperative development in Bulgaria shows that the water syndicates were enforced by a top-down approach and did not have much in common with the classic cooperative principles." irrigation, water users' associations, cooperatives--case studies, legislation
This is a very good column. I do want to point out that a lot of really destructive non-native invasive species, including plant diseases, have arrived in the U.S. through nursery plants that arrived in pots of foreign soil. That old foreign-soil law should be better enforced, because some of the awful arrivals are much more recent than a century. They include a disease that arrived in the Nineties in pots of soil holding rhododendrons, a disease that has now killed tens of thousands of oak trees in the western U.S. and keeps killing more. An older example is the Japanese beetle, which arrived in the soil around Japanese plants that were brought here from Japan in 1916. A depressing long list could be compiled. I would be very much in favor of finding some effective way(s) to enable Mexico to better profit from Mexico's beautiful plant. But now that a variety of non-native invasive species are known to be transported in soil, including recent big ecological problems like the jumping worm, we need less importation of soil from far away, not more. Expand full comment \| I think it's so important to recognize the historical origins of cuetlaxochitl and call it that. When I learned that fact a few years back, I've never called it anything but that since. Thanks for giving it its due! Expand full comment \| Diane, thank you and thanks to Laura Belin for sharing it. I appreciate your readership and comment. Expand full comment \| Very interesting article, although it is agonizing to learn the history of its popularity in the US. AND the part of racism in this story. I'm so glad Laura Belin pointed me to it! Thank you for the service of writing and sharing this! I too will try to learn to call the plant cuetlaxochitl (kwet-la-sho-she) instead of poinsettia. Expand full comment \| I learned from my guest author Lora Conrad that there is a wild poinsettia, native to parts of Iowa. It's not as vibrant as the cuetlaxochitl. https://www.bleedingheartland.com/2017/10/11/iowa-wildflower-wednesday-wild-poinsettia/ Expand full comment \|
This article discusses the construction and testing of eight Lego movable bridges. The main idea of the article is to showcase the creativity and engineering skills required to build these bridges using Lego bricks. The first bridge mentioned in the article is a simple drawbridge model. The builder demonstrates how the bridge can be raised and lowered using a winch mechanism. The article highlights the use of Technic Lego parts to achieve the desired functionality. The second bridge discussed is a bascule bridge, which operates on a counterweight system. The builder demonstrates how the bridge can be raised by pulling a string attached to the counterweight, causing the bridge to tilt and allow boat traffic to pass underneath. Moving on, the article presents a vertical lift bridge, which operates by raising a center span vertically using gears and pulleys. The builder demonstrates the smooth movement of the bridge as it is raised and lowered, controlled by a handle connected to the gear system. The fourth bridge discussed is a swing bridge, which operates by rotating a central section to allow boats to pass through. The builder showcases the use of gears and axles to achieve the swinging motion, along with a crank mechanism to operate it. The fifth bridge presented is a rolling bascule bridge, which combines the functionality of a bascule bridge and a drawbridge. The builder demonstrates how the bridge can be both lifted and tilted using a combination of Technic gears and levers. This bridge highlights the complexity of combining different engineering principles in one Lego model. Moving forward, the article introduces a retractable bridge model. This bridge features a retractable center span that can be extended or contracted using a gear and pulley system. The builder showcases the smooth movement of the bridge as it expands and contracts. The seventh bridge discussed is a double leaf bascule bridge, which features two separate sections that raise and lower on either side of a central point. This bridge demonstrates the use of synchronized gear mechanisms to ensure both sides move simultaneously. Lastly, the article presents a vertical split bridge, which consists of two separate halves that can be raised independently. The builder showcases the independent movement of the halves using a gear system and small motors. In conclusion, this article explores the construction and testing of eight Lego movable bridges. The models showcased demonstrate the creativity and engineering skills required to build functional bridges using Lego bricks. Each bridge utilizes different mechanisms, such as winches, gears, and pulleys, to achieve their desired functionality. These models serve as a testament to the endless possibilities of building with Lego and encourage creativity and problem-solving skills in construction projects.
As electric scooters become increasingly popular as a mode of transportation in Australia, many riders are left wondering about their insurance options. While electric scooters are a convenient and eco-friendly way to get around, accidents can still happen, and it's important to be prepared. In this article, we'll explore the ins and outs of electric scooter insurance in Australia, so you can make an informed decision about how to protect yourself and your vehicle. Insuring Your Electric Scooter: Everything You Need to Know If you own an electric scooter, it's important to protect yourself and your investment with insurance. Electric scooters are becoming increasingly popular in Australia, and with more vehicles on the road, accidents can happen. Here's everything you need to know about insuring your electric scooter. Is electric scooter insurance mandatory in Australia? Electric scooter insurance is not mandatory in Australia. However, it's highly recommended that you obtain insurance to protect yourself financially in case of an accident. Without insurance, you could be left to pay for any damages or injuries out of your own pocket. What does electric scooter insurance cover? Electric scooter insurance typically covers damages or injuries caused to third parties. This includes other people's property, other vehicles, and other people involved in the accident. Some insurance policies also cover theft or damage to your own scooter. How much does electric scooter insurance cost? The cost of electric scooter insurance varies depending on the insurer, the level of coverage, and the value of your scooter. Generally, insurance premiums are lower for electric scooters than for cars or motorcycles. You can obtain a quote from an insurance provider to get an idea of how much you will need to pay. How to find the right electric scooter insurance policy? When looking for an electric scooter insurance policy, it's important to do your research. Look for an insurer who specializes in scooter insurance and has experience in the industry. Consider the level of coverage you need and compare policies from different providers to find the best value for your money. What to consider before purchasing electric scooter insurance? Before purchasing electric scooter insurance, consider the value of your scooter, how often you use it, and the level of risk involved. If you use your scooter frequently, you may want to consider a higher level of coverage. If your scooter is high in value, you may want to ensure that it's fully covered in case of theft or damage. Insuring Your Scooter: What You Need to Know Electric Scooters are becoming more popular every day, with many people using them for short trips around town. However, as with any vehicle, accidents can happen, so it's important to have the right insurance coverage in place. Here's what you need to know about insuring your scooter in Australia. Is Scooter Insurance Required in Australia? In Australia, if your electric scooter is capable of speeds greater than 10km/h, it is considered a motor vehicle and requires registration and compulsory third party (CTP) insurance. This means that if you are involved in an accident and someone is injured or killed, your CTP insurance will cover the cost of their medical expenses and compensation for any damages. However, CTP insurance does not cover damage to your own scooter or anyone else's property. For this reason, it's a good idea to consider additional insurance coverage. Types of Scooter Insurance There are several types of insurance coverage that you can consider for your electric scooter: Third Party Property Insurance This type of insurance covers you if you are involved in an accident and damage someone else's property. This can include their vehicle, their home, or any other property that is damaged as a result of the accident. Comprehensive Insurance Comprehensive insurance covers you for third party property damage as well as damage to your own scooter. This can include damage from accidents, theft, vandalism, or natural disasters. Personal Injury Insurance Personal injury insurance can provide additional coverage for medical expenses and income replacement if you are injured in an accident. Factors Affecting Insurance Premiums The cost of your insurance premiums will depend on a number of factors, including: - The type of insurance coverage you choose - The value of your electric scooter - Your age and driving experience - Your location and where the scooter will be kept - Your claims history Electric Scooters in Australia: Do You Need to Register Them? Electric scooters are becoming increasingly popular in Australia as an eco-friendly and convenient mode of transportation. However, many people are unsure whether they need to register their electric scooter with the relevant authorities in Australia. In this article, we will explore the regulations surrounding electric scooters in Australia and whether or not you need to register them. Electric Scooter Regulations in Australia In Australia, electric scooters are classified as Personal Mobility Devices (PMDs) or Power-assisted Pedal Cycles (PAPCs) depending on their specifications. PMDs and PAPCs are regulated by state and territory road and transport authorities. Do You Need to Register Your Electric Scooter in Australia? The answer to this question depends on the specific regulations in your state or territory. In general, if your electric scooter is classified as a PMD or PAPC, you will not need to register it. However, there are some restrictions on where you can ride your electric scooter. For example, in some states and territories, you may only ride your electric scooter on private property. In other states and territories, you may be able to ride your electric scooter on footpaths or bike paths, but not on roads or in bike lanes. Electric Scooter Insurance in Australia While electric scooter insurance is not mandatory in Australia, it is highly recommended. Accidents can happen, and if you are involved in an accident while riding your electric scooter, you could be liable for any damage or injuries caused. If you are considering purchasing electric scooter insurance, make sure to carefully read the policy details to ensure that you are adequately covered. Some policies may only cover certain types of damage or may have limits on the amount that they will pay out. Electric Scooter Laws in Australia: Understanding Helmet Requirements Electric scooters have become increasingly popular in Australia in recent years. However, with the rise in popularity, there has been a need for regulations to ensure the safety of riders and those around them. One of the most important regulations that riders need to be aware of is the helmet requirement. Understanding the Helmet Requirements Under Australian law, it is mandatory for all riders of electric scooters to wear a helmet. The helmet must meet the Australian and New Zealand Standard AS/NZS 2063:2008 and be securely fastened. Failure to wear a helmet can result in a fine and may also impact any insurance claim that the rider needs to make. It is also important to note that helmets must be replaced after any impact, even if there is no visible damage. Helmets are designed to absorb the force of an impact, and any damage to the helmet, even if it is not visible, can compromise its ability to protect the rider in the event of another impact. Penalties for Not Wearing a Helmet The penalties for not wearing a helmet when riding an electric scooter can vary depending on the state or territory. However, in most cases, the fine can range from $100 to $500. In addition to the fine, riders may also receive demerit points on their driver's license. Insurance and Helmet Requirements When it comes to insurance for electric scooters, it is essential to ensure that the rider is complying with all relevant laws and regulations. This includes wearing a helmet when riding. If a rider is involved in an accident and was not wearing a helmet, it may impact their ability to make an insurance claim. This is because the rider was not taking reasonable precautions to ensure their own safety, which is a requirement under most insurance policies. It is important to note that insurance requirements for electric scooters can vary depending on the insurer and the state or territory. Some insurers may require riders to have a specific type of license or meet certain criteria before they can be covered. It is vital to check the policy wording and speak to the insurer to ensure that the rider is adequately covered. As a final tip, we highly recommend researching and comparing different insurance policies before purchasing an electric scooter insurance in Australia. Take the time to understand the coverage options, deductibles, and premiums to choose the best policy that suits your needs and budget. Remember, having insurance can give you peace of mind and protect you from unexpected expenses in case of an accident. We hope this article was helpful in shedding light on the importance of electric scooter insurance. As always, feel free to reach out to us if you have any questions or concerns. Stay safe and insured! If you found this article informative and engaging, be sure to visit our Motorcycle insurance section for more insightful articles like this one. Whether you're a seasoned insurance enthusiast or just beginning to delve into the topic, there's always something new to discover in topbrokerstrade.com. See you there!
Home Page Rhetorical Analysis Of John Perkins Speech Rhetorical Analysis Of John Perkins Speech 789 Words 4 Pages Pages 153-174 of the "in the beloved community: how faith shapes social justice, from the civil rights movement to today" talks a lot about John Perkins's sufferings that him and other activists went through in demands for equal rights for African Americans. It is like John Perkins carried on the work that Martin Luther King was doing before getting assassinated. John had it rough in his life, his father left him, his mother passed away, his brother was killed right after coming back from serving in the war, and his sister was also killed. In his demands for equal rights for all, especially the African-Americans, he experienced a high level of persecution, he was once beaten to the point where he could've died, was in jail a couple of time …show more content… He always has his bible with him wherever he goes. In the speech that he gave at the courthouse in front of the black townspeople, he was inspired by the phrase from the declaration of independence that "We hold these truths to be self-evident, that all men are created equal" his words were "Well I'm a man and I'm ready to stand and treated like one". This phrase carried John, his wife and childrens through an imaginable pain for several years. After the death of his brother Clyde and his persecutions in the hands of his oppressors, John perkins' relatives advised him to move to Jackson. He took their advice and went but Jackson turned out to be no different than New Hebron, his old town. He started saving up to go to California and forever leave Mississippi. But what he didn't see coming was the fact that Mississippi will be his home, he will discovered the church there, and his own son's faith, will inspired him and he will finally find his way to The God who was there from the beginning. It is safe to says that John perkins and Dr. King are similar in a couple of ways. They're both humanitarian, intelligent, considerate and so …show more content… It was really hard to read the paragraphs in which he was beaten at the jail court without emotions. I had to stop reading and take a moment away from my desk, because I couldn't believe things that were being said to him while he was in his suffering. For a moment, I asked myself, why is he doing this to himself? But then I remember that because he is at the stage in his spiritual life that his life doesn't matter to him anymore, the well being of others matters the most. Learning from John Perkins actions in additions to Dr. King's role in the civil right movement made me questioned myself on what it means for me to be a christian and stand up for others even if that means risking my life for it. This article also made me think of my role within my church. I often take advantage of the existence of the church, but reading stories like on how the church community reshape people's life transform my opinion on the church. Because it is so rare to see people giving up their lives for freedom of others, we often place people like Dr.King and John Perkins in our heads as "Saints" or some iconic figures because they have done and gone through what most of us will refer to as the Show More More about Rhetorical Analysis Of John Perkins Speech Popular Essays Arguments In Arthur Jones's Essay: Dealing With Diversity Celie The Color Purple Analysis Is Boo Radley Sympathetic Resilience Action Plan Dance Thesis Statement General Strain Theory: Article Summary Open Document
CASL Email Rules: A Comprehensive Guide to Complying with Canadian Anti-Spam Legislation In today's digital age, email has become an essential communication tool for individuals and businesses alike. However, with the increasing prevalence of unsolicited and unwanted emails, governments around the world have implemented regulations to protect individuals from spam and promote responsible email practices. In Canada, the Canadian Anti-Spam Legislation (CASL) is the key legislation governing email communication. Understanding CASL and Its Importance CASL, which stands for Canadian Anti-Spam Legislation, is a set of rules and regulations aimed at reducing spam, protecting privacy, and ensuring a safe and secure digital environment for Canadians. It was established in 2014 and is enforced by the Canadian Radio-television and Telecommunications Commission (CRTC), the Office of the Privacy Commissioner of Canada (OPC), and the Competition Bureau. Complying with CASL is not only a legal obligation but also crucial for maintaining a positive brand reputation and building trust with your audience. Failure to adhere to CASL can result in severe penalties and damage to your business's reputation. Therefore, it is essential for individuals and organizations to have a thorough understanding of CASL and its email rules. Key Provisions of CASL CASL encompasses several key provisions that individuals and organizations must adhere to when sending commercial electronic messages (CEMs) in Canada. These provisions include consent requirements, identification requirements, and unsubscribe mechanisms. By understanding these provisions, you can ensure that your email marketing campaigns align with CASL guidelines. Consent Requirements for Sending CEMs Under CASL, obtaining consent is a fundamental requirement before sending any commercial electronic message. Express consent and implied consent are the two types of consent recognized by CASL. Express consent requires the recipient to provide explicit permission to receive CEMs, while implied consent is based on existing relationships or specific circumstances. Identification Requirements for CEMs CASL also mandates that CEMs must clearly identify the sender and provide contact information. This ensures that recipients can easily identify the sender and establish a means of communication if needed. By complying with identification requirements, you can build transparency and trust with your email recipients. Unsubscribe Mechanisms and Requirements One of the significant aspects of CASL is the provision of clear and easily accessible unsubscribe mechanisms in all CEMs. Recipients must have the option to opt-out of receiving further emails from the sender, and their requests must be promptly processed. Implementing effective unsubscribe mechanisms not only demonstrates compliance with CASL but also improves the user experience and helps maintain a positive relationship with your audience. Penalties for Non-Compliance Non-compliance with CASL can have severe consequences. The CRTC, OPC, and Competition Bureau have the authority to investigate, enforce, and impose penalties for violations of CASL. Penalties can range from substantial fines, up to millions of dollars, for individuals and organizations found guilty of non-compliance. To avoid these penalties and safeguard your business, it is crucial to fully understand and comply with CASL email rules. As we delve into the intricacies of CASL email rules, we will explore the various aspects of obtaining consent, meeting identification and unsubscribe requirements, and ensuring overall compliance with CASL. By the end of this comprehensive guide, you will have the knowledge and tools necessary to navigate the intricacies of CASL and implement effective email marketing strategies that comply with the legislation. Continue reading to gain a thorough understanding of CASL email rules, including how to obtain consent, meeting identification and unsubscribe requirements, and best practices for ensuring compliance. I. Introduction to CASL Email Rules The Canadian Anti-Spam Legislation (CASL) has been put in place to combat the growing issue of unsolicited and deceptive electronic communications, commonly known as spam. CASL aims to protect individuals from unwanted emails, text messages, and other forms of electronic communication, while also encouraging responsible email practices among businesses and organizations. A. Definition of CASL CASL is a comprehensive legislation that sets out rules and regulations for the sending of commercial electronic messages (CEMs) in Canada. It covers a wide range of electronic communications, including emails, text messages, instant messages, and even social media messages, if they have a commercial purpose. CASL applies to both individuals and businesses that send CEMs from or to Canada, regardless of the sender's location. B. Importance of Complying with CASL Complying with CASL is not just a legal requirement but also a crucial step towards maintaining a positive brand reputation and building trust with your audience. By adhering to CASL email rules, businesses can establish themselves as responsible senders who respect the privacy and preferences of their recipients. This, in turn, can lead to higher engagement rates, increased conversions, and long-term customer loyalty. C. Overview of the Blog Post Content In this comprehensive guide, we will delve deep into the intricacies of CASL email rules, providing you with a thorough understanding of the legislation and its implications for your email marketing practices. We will cover various aspects of CASL, including consent requirements, identification and unsubscribe mechanisms, penalties for non-compliance, and best practices for ensuring overall compliance. By the end of this blog post, you will be equipped with the knowledge and strategies needed to navigate the complexities of CASL and implement effective email marketing campaigns that align with the legislation. So, let's dive in and explore the world of CASL email rules together. Understanding the Basics of CASL To ensure compliance with CASL email rules, it is crucial to have a comprehensive understanding of the legislation and its key provisions. In this section, we will explore the basics of CASL, including its purpose, key provisions, and the penalties for non-compliance. What is CASL and its Purpose? CASL was introduced in 2014 with the primary goal of reducing spam, preventing deceptive and misleading electronic communications, and promoting responsible email practices. The legislation aims to protect individuals' privacy and control over their inboxes, while also fostering a trusted and secure digital environment for businesses and consumers. CASL applies to any commercial electronic message (CEM) sent within or from Canada, with a few exceptions for certain types of messages. A CEM is defined as any electronic message that encourages participation in a commercial activity, including offers to purchase, sell, or promote products or services. Key Provisions of CASL To comply with CASL, it is important to understand its key provisions. These provisions outline the requirements for obtaining consent before sending CEMs, the identification information that must be included in CEMs, the need for an unsubscribe mechanism, and the penalties for non-compliance. Consent Requirements for Sending CEMs: CASL requires senders to obtain consent from recipients before sending them commercial electronic messages. Consent can be express or implied, and the legislation sets out specific criteria for each type of consent. Express Consent: This is obtained when the recipient explicitly agrees to receive CEMs. It can be obtained through opt-in forms, checkboxes, or other explicit consent mechanisms. Implied Consent: This is based on existing relationships or specific circumstances defined by CASL. Implied consent has limitations and may expire after a certain period or when the recipient indicates they no longer wish to receive CEMs. Identification Requirements for CEMs: CASL mandates that all CEMs must clearly identify the sender and provide accurate contact information. This ensures that recipients can easily identify the sender and establish a means of communication if needed. Unsubscribe Mechanisms and Requirements: CASL requires that all CEMs include a clear and easily accessible unsubscribe mechanism. Recipients must have the option to opt-out of receiving further CEMs, and their requests should be promptly processed and implemented. Penalties for Non-Compliance Non-compliance with CASL can have serious consequences for individuals and organizations. The CRTC, OPC, and Competition Bureau have the authority to investigate complaints, enforce CASL provisions, and impose penalties for violations. Penalties for non-compliance can range from significant fines, up to millions of dollars, for individuals and organizations found guilty of sending CEMs without proper consent, failing to include identification information, or not providing an unsubscribe mechanism. It is essential to take CASL email rules seriously and ensure compliance to avoid these penalties and protect your brand reputation. Understanding the basics of CASL is the foundation for developing effective email marketing strategies that comply with the legislation. In the next section, we will delve deeper into the various types of consent recognized by CASL and explore the best practices for obtaining and managing consent under the legislation. Obtaining Consent Under CASL Obtaining consent is a fundamental requirement under CASL before sending any commercial electronic messages (CEMs). In this section, we will explore the types of consent recognized by CASL, the best practices for obtaining express consent, and the limitations and implications of relying on implied consent. Types of Consent under CASL CASL recognizes two types of consent: express consent and implied consent. Understanding the distinctions between these two types of consent is crucial for ensuring compliance with CASL email rules. - Express Consent: Express consent is obtained when the recipient explicitly agrees to receive CEMs. This consent must be obtained before sending any CEMs, and it requires a clear and affirmative action from the recipient, such as checking a box or providing consent through an online form. To obtain express consent, businesses and organizations must ensure that their consent requests are clear, concise, and transparent. This includes providing information about the purpose of the consent, the types of messages that will be sent, and the means to unsubscribe. - Implied Consent: Implied consent is based on existing relationships or specific circumstances defined by CASL. While not as explicit as express consent, implied consent still allows for the sending of CEMs under certain conditions. CASL recognizes two types of implied consent: Existing Business Relationships (EBRs): Implied consent exists when there is an existing business relationship between the sender and the recipient. This relationship can be established through a recent purchase, contract, or inquiry within the past two years. Existing Non-Business Relationships (ENBRs): Implied consent can also exist in non-business relationships, such as memberships, donations, or volunteer work, that occurred within the past two years. Obtaining Express Consent Obtaining express consent requires proactive efforts from businesses and organizations to ensure compliance with CASL. Here are some best practices for obtaining express consent: Opt-In Forms and Consent Language: Implementing clear and prominent opt-in forms on your website or other platforms is an effective way to obtain express consent. The language used in the consent request should be specific, indicating that the recipient is consenting to receive CEMs and providing a clear understanding of what they can expect to receive. Record-Keeping Requirements for Consent: It is essential to maintain accurate records of consent obtained from recipients. These records should include information about when and how consent was obtained, as well as any supporting documentation or records of communication with the recipient. Understanding Implied Consent and Its Limitations While implied consent can be relied upon in certain situations, it is important to understand its limitations and implications. Implied consent is not indefinite and has time limitations depending on the type of relationship. For example, EBRs expire after two years of inactivity, while ENBRs have a shorter time frame of six months. Relying on implied consent may not always be the best approach as it comes with inherent risks. It is recommended to obtain express consent whenever possible to ensure compliance and reduce the potential for disputes or complaints. Understanding the different types of consent recognized by CASL and implementing best practices for obtaining consent is crucial for email marketing success within the boundaries of the legislation. In the next section, we will explore the identification requirements for CEMs, including the sender identification information and contact information that must be provided in every CEM. Meeting Identification and Unsubscribe Requirements In order to comply with CASL email rules, it is crucial to meet the identification requirements for commercial electronic messages (CEMs) and provide a clear and accessible unsubscribe mechanism. In this section, we will explore the specific identification information that must be included in CEMs and the requirements for unsubscribe mechanisms. Identification Requirements for CEMs CASL mandates that all CEMs must clearly identify the sender and provide accurate contact information. This ensures that recipients can easily identify the sender of the message and establish a means of communication if needed. Failure to meet identification requirements can result in non-compliance with CASL. Sender Identification Information: CEMs must clearly identify the sender or the person on whose behalf the CEM is being sent. This information can include the sender's name, business name, or any other name by which the sender carries on business. It is essential to ensure that the identification information is accurate and reflects the true identity of the sender. Contact Information: In addition to the sender's identification, CEMs must also include accurate and up-to-date contact information. This can include a physical mailing address, a telephone number, or an email address. Providing contact information allows recipients to easily reach out to the sender if they have any questions or concerns. Meeting the identification requirements not only ensures compliance with CASL but also promotes transparency and trust with your recipients. By clearly identifying yourself and providing contact information, you establish credibility and legitimacy, which can positively impact your email marketing efforts. Unsubscribe Mechanisms and Requirements CASL requires that every CEM includes a clear and accessible unsubscribe mechanism. This mechanism enables recipients to easily opt-out of receiving further CEMs from the sender. By providing an effective unsubscribe option, businesses demonstrate their commitment to respecting the recipient's preferences and maintaining a positive sender-receiver relationship. Providing a Clear and Conspicuous Unsubscribe Option: The unsubscribe mechanism in a CEM should be clear, prominent, and easy to understand. It should be noticeable and stand out from the rest of the content in the email. Common unsubscribe options include a link or button that allows recipients to unsubscribe with a single click. Unsubscribe Requests and Processing: When a recipient chooses to unsubscribe, it is crucial to process their request promptly and efficiently. The unsubscribe mechanism should lead to a confirmation page or message that informs the recipient that their request has been received and will be processed. It is also essential to honor and implement unsubscribe requests in a timely manner, ensuring that the recipient no longer receives CEMs from the sender. Timelines for Removing Unsubscribed Recipients: CASL requires that organizations remove unsubscribed recipients from their mailing lists within specific timelines. Once a recipient unsubscribes, their email address should be removed from the mailing list promptly, typically within 10 business days. It is important to ensure that unsubscribed recipients do not continue to receive CEMs after they have opted out. By meeting the identification and unsubscribe requirements under CASL, businesses can enhance their email marketing practices, build trust with their recipients, and demonstrate their commitment to responsible email communication. In the next section, we will explore the importance of implementing a CASL compliance program and the best practices for ensuring overall compliance with CASL email rules. Ensuring Compliance and Best Practices Complying with CASL email rules requires more than just understanding the legislation. It necessitates the establishment of a comprehensive CASL compliance program and the implementation of best practices to ensure ongoing adherence. In this section, we will explore the key components of a CASL compliance program, discuss common mistakes to avoid, and provide tips for maintaining compliance. Implementing a CASL Compliance Program To ensure compliance with CASL, it is essential to establish a CASL compliance program within your organization. This program should outline the policies, procedures, and practices that will be followed to ensure adherence to CASL email rules. Here are some key components of an effective CASL compliance program: Appointing a Compliance Officer or Team: Designate a person or a team responsible for overseeing CASL compliance within your organization. This individual or team will be responsible for understanding and interpreting CASL requirements, implementing compliance measures, and monitoring ongoing compliance. Conducting Regular Audits and Reviews: Regularly review your email marketing practices to identify any areas of non-compliance and address them promptly. Conduct internal audits to evaluate your processes, ensure proper consent management, and verify that identification and unsubscribe mechanisms are in place. Maintaining Proper Documentation: Document all aspects of your CASL compliance efforts. Keep records of consent, including when and how it was obtained, as well as any changes or updates to consent preferences. Maintain records of unsubscribe requests and their processing timelines. Proper documentation serves as evidence of compliance in case of any inquiries or investigations. Common Mistakes to Avoid Under CASL While striving for compliance, it is important to be aware of common mistakes that businesses often make when it comes to CASL. By understanding these pitfalls, you can take proactive measures to avoid them. Here are some common mistakes to avoid: Misunderstanding Consent Requirements: Failing to obtain proper consent or misunderstanding the types of consent recognized by CASL can lead to non-compliance. Ensure that you have a clear understanding of the requirements for obtaining express and implied consent and implement appropriate consent mechanisms accordingly. Neglecting Identification and Unsubscribe Requirements: Inadvertently overlooking the identification requirements for CEMs or failing to provide a clear and accessible unsubscribe mechanism can result in non-compliance. Pay attention to these requirements and ensure that every CEM you send includes accurate identification information and an easily usable unsubscribe option. Failing to Maintain Accurate Records: Proper record-keeping is crucial for demonstrating compliance with CASL. Failing to maintain accurate records of consent, unsubscribe requests, and other relevant information can make it difficult to prove compliance in case of inquiries or investigations. Establish a system for documenting and retaining records related to CASL compliance. CASL Compliance Tips and Best Practices In addition to avoiding common mistakes, there are several tips and best practices that can help you maintain CASL compliance. Consider implementing the following strategies: Educating Employees and Stakeholders: Ensure that your employees and stakeholders are educated about CASL and its email rules. Provide training sessions or resources to help them understand the requirements and their responsibilities in maintaining compliance. Keeping Up with CASL Updates and Changes: CASL and its regulations may evolve over time. Stay informed about any updates or changes to the legislation, as well as any guidance or interpretations provided by regulatory authorities. Regularly review your practices to ensure they align with the most current requirements. Engaging with CASL Compliance Resources and Experts: Seek guidance from CASL compliance resources and experts to ensure that you have a comprehensive understanding of the legislation and its implications. They can provide valuable insights and advice specific to your industry or organization. By implementing a CASL compliance program, avoiding common mistakes, and following best practices, you can maintain compliance with CASL email rules and foster a culture of responsible email marketing within your organization. In the concluding section, we will recap the key points discussed throughout this comprehensive guide and emphasize the importance of CASL compliance in the digital landscape. In the ever-evolving landscape of digital communication, complying with the Canadian Anti-Spam Legislation (CASL) email rules is essential for businesses and organizations. Throughout this comprehensive guide, we have explored the key aspects of CASL, including the importance of compliance, the basics of CASL, obtaining consent, meeting identification and unsubscribe requirements, and best practices for ensuring overall compliance. CASL serves as a crucial tool in combating spam and protecting the privacy and preferences of individuals. By complying with CASL email rules, businesses can establish themselves as responsible senders, build trust with their audience, and foster positive relationships with their customers. It is important to remember that CASL is not just a legal obligation, but also an opportunity to enhance your email marketing practices. By obtaining proper consent, providing accurate identification information, and offering accessible unsubscribe mechanisms, you can create a positive user experience, improve engagement rates, and build long-term customer loyalty. Maintaining compliance with CASL requires ongoing effort and dedication. Establishing a CASL compliance program, avoiding common mistakes, and implementing best practices are essential steps to ensure adherence to CASL email rules. Regular audits, record-keeping, and education for employees and stakeholders are key components of a successful CASL compliance strategy. As technology and digital communication continue to evolve, it is important to stay updated on any changes or updates to CASL and its requirements. Engaging with CASL compliance resources and experts can provide valuable insights and guidance tailored to your specific industry or organization. In conclusion, CASL email rules are designed to create a safe and secure digital environment, protect individuals from spam, and promote responsible email practices. By adhering to CASL and implementing effective email marketing strategies, businesses can not only comply with the legislation but also enhance their brand reputation and foster positive relationships with their audience. Remember, CASL compliance is not just a legal obligation, but a commitment to respecting your recipients' preferences and privacy. Embrace CASL as an opportunity to build trust, engage with your audience, and achieve long-term success in the digital realm.
As we approach retirement age, it's essential to understand the various sources of income available to us, including Old Age Security (OAS). The OAS is a government program designed to provide financial support to seniors, but navigating the system can be confusing. This blog aims to provide a comprehensive guide to securing your future by understanding and maximizing your OAS benefits. We'll discuss eligibility criteria, tips on how to maximize benefits, the application process, planning for retirement income, and how to avoid OAS clawbacks. Understanding Old Age Security Old Age Security is a monthly payment provided by the Canadian government to eligible seniors aged 65 and older. It is a significant part of Canada's retirement income system, along with the Canada Pension Plan (CPP) and other personal savings. OAS is funded through general tax revenues and is not based on employment history, making it available to most Canadians. The amount you receive is determined by how long you've lived in Canada after turning 18 and your income level. Eligibility Criteria for OAS To qualify for OAS, you must be 65 years or older, a Canadian citizen or legal resident, and have lived in Canada for at least 10 years after turning 18. If you've lived abroad, you might still qualify under international social security agreements. It's crucial to understand the residency requirements and how they impact your eligibility, as this will affect the amount you receive. Maximizing Your OAS Benefits Maximizing your OAS benefits starts with understanding the factors that affect your payments. You can increase your OAS payments by delaying your application up to age 70, which results in a higher monthly amount. Additionally, staying informed about any changes to the OAS program and keeping your income within certain thresholds can ensure you receive the maximum benefit possible. Navigating OAS Application Applying for OAS can be done either online or by mail. It's recommended to apply six months before you turn 65 or when you want to start receiving payments. You'll need to provide proof of age, legal status in Canada, and residency history. It's essential to fill out the application accurately and provide all the necessary documentation to avoid delays in receiving your benefits. Planning for Retirement Income OAS is just one component of your retirement income. It's essential to create a comprehensive retirement plan that includes personal savings, investments, and other pension plans like CPP. Diversifying your income sources and having a clear understanding of your financial needs in retirement will help ensure a comfortable and secure future. Avoiding OAS Clawbacks OAS clawback refers to the reduction of OAS benefits when your income exceeds a certain threshold. To avoid clawbacks, consider income-splitting with your spouse, deferring OAS benefits if you have other significant income sources, and managing your investments to keep your income below the clawback threshold. Navigating Old Age Security may seem daunting, but with the right information and planning, you can secure a stable financial future in retirement. Understanding eligibility criteria, maximizing benefits, and avoiding clawbacks are all crucial steps in making the most of the OAS program. Remember to start planning early, stay informed, and seek professional advice if needed. With these tips, you can confidently navigate the path to a comfortable retirement.
- Wave soldering machine maintenance and precautions - SMT reflow oven production precautions during the first mass production stage - SMT reflow oven production precautions during the mass production stage - Reflow soldering vs wave soldering process characteristics and difference - SMT reflow oven soldering production precautions during trial production stage Contact Us Address:Building H, GuoRui Pioneering Park, No. 1068 Jinyang East Road, Lujia Town, Kunshan, Suzhou. Industry knowledge SMT reflow soldering principle introduction - Time:2020-01-23 - Visits:436 SMT reflow soldering principle introduction I believe many friends have heard of the term "SMT reflow soldering", but there are not many who can truly explain the principle of SMT reflow soldering. SMT reflow soldering is the process of remelting the pre allocated paste solder paste on the printed circuit board solder pads, achieving the mechanical and electrical connection between the surface assembled component solder joints or pins and the printed circuit board solder pads through soft soldering. SMT reflow soldering is the process of soldering components onto a PCB board, which involves surface mounted components. SMT reflow soldering relies on the action of hot air flow on the solder joint, and the adhesive flux undergoes physical reactions under a fixed high-temperature air flow to achieve SMD soldering; So it is called "SMT reflow soldering" because the gas circulates in the soldering machine to generate high temperature and achieve the soldering purpose. 1.When the PCB enters the heating zone, the solvents and gases in the solder paste evaporate. At the same time, the flux in the solder paste wets the solder pads, component terminals, and pins. The solder paste softens, collapses, and covers the solder pads, isolating them from oxygen. 2.When the PCB enters the insulation area, sufficient preheating is provided to the PCB and components to prevent them from suddenly entering the high-temperature soldering area and damaging them. 3.When the PCB enters the soldering area, the temperature rapidly rises, causing the solder paste to reach a molten state. Liquid solder wets, diffuses, diffuses, or mixes with the solder pads, component terminals, and pins of the PCB to form solder joints. 4. PCB enters the cooling zone to solidify the solder joints; At this point, SMT reflow soldering has been completed. - Pre:SMT reflow oven soldering process specific requirements - Next:SMT reflow soldering machine four temperature zones detailed explanation Popular products Semi-auto SMT production line LED Light Manufacturing Line Automatic SMT small output LED light Assembly Line for led strips making High-end Reflow Oven,High-end Reflow Oven Manufacturers High-end SMT Reflow Soldering Oven E10,Top Lead-Free Hot air Reflow oven Hot sale wave soldering machine Economic-type wave soldering machine

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.