text stringlengths 213 24.6k | id stringlengths 47 47 | dump stringclasses 1 value | url stringlengths 14 499 | file_path stringlengths 138 138 | language stringclasses 1 value | language_score float64 0.9 1 | token_count int64 51 4.1k | score float64 1.5 5.06 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
The Environmental Community headquarters is located in downtown Hot Springs, AR. Congress established Hot Springs Reservation to protect the natural hot springs in 1832 which was 40 years before Yellowstone National Park. For over 200 years people have used the therapeutic baths from these hot springs and have dubbed them “The American Spa.” Congress changed the name to Hot Springs National Park in1921. Hot Springs, Arkansas is a global destination for wealthy people as well as health seekers that travel from around the world to enjoy the benefits of the hot springs. The area is also well known for its camping, hiking and water activities.
This location was carefully chosen for numerous business and environmental reasons:
- Effects of climate change should be minimal
- Arkansas is known as “The Natural State”
- Hot Springs National Park protects a large area
- Natural resources are still relatively clean
- People in Arkansas are generally eco-minded
- TEC’s impact in Arkansas will be very positive
- The odds of catastrophic events in Arkansas are low
The Environmental Community has created a unique environmental platform to create new waves of eco-activity. Our unique formula combines education, entertainment, and advocacy. This synergistically designed platform acts as a gateway for activism while creating a new generation of activists.
In time, this dynamic system will become the model for all results-oriented activist groups and will create an ever-growing wave of eco-minded individuals. By design, the system unites like-minded groups and individuals. Ultimately, this concentration of people will lead to more comprehensive solutions to prevent further ecological destruction.
Our broad environmental education and activist network includes 65 member organizations, advocacy groups, and other strategic businesses. Together all of these groups collectively enlighten and engage the public by changing how people live, the products they buy, and the companies they support. This process creates social change for the betterment of people while safeguarding our home here on Earth.
We are asking all individuals and companies that are willing to assume responsibility to lend us your full support. By working together, as if our lives depended upon it, we can create the changes that are needed to save humanity and our Earth.
This is your invitation to join The Environmental Community to support our Race To Save Earth!
Note: All platform and eco-business strategies are highly confidential. Because these strategies are essential to our success they will NOT be shared or publicized until such time as we implement them. | <urn:uuid:615ea459-ccf9-4b83-8902-67bb1fce6869> | CC-MAIN-2013-20 | http://theenvironmentalcommunity.org/?tab=9 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368705559639/warc/CC-MAIN-20130516115919-00024-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.950208 | 496 | 2.046875 | 2 |
When are you at your happiest? Research published this week shows that we are most happy when we’re concentrating on the job at hand, rather than allowing our minds to wander. But, oddly, people seem to spend almost half of their waking hours thinking about something other than what they’re currently doing.
Matthew Killingsworth and Daniel Gilbert, from Harvard University, developed a free application for smartphone users that contacted it’s users at random intervals to ascertain their happiness, what they were doing and, importantly, what they were thinking about. They asked if they were thinking about what they were currently doing or, if not, was it something pleasant, neutral or unpleasant.
It’s thought that our ability to contemplate events in the past, as well as possible future events, is a vital part of the human condition. It helps us to learn, reason and make plans, but this study, published in the journal Science this week, set out to see how it affects our happiness.
Reports of mind-wandering, or “stimulus independent thought” were strikingly common in their results. For 21 of the 22 different categories of activity, people reported that their minds were wandering no less than 30% of the time. The only activity where people didn’t report this much mind wandering was when making love. Contrary to what you might expect, the activity in hand didn’t actually affect how pleasant the daydreaming was.
But how does this relate to happiness? By performing a multilevel regression analysis, which is a statistical analysis that can show causal relationships in sets of data, the researchers were able to show that people were less happy when allowing their minds to wander. In fact, even thinking pleasant thoughts was no more likely to make you happy than staying “in the moment”.
So it seems that there may be some truth in the philosophical and religious teachings that tell us happiness is attained by “concentrating on the moment” but, still, a wandering mind is a useful one. The authors argue that “the ability to think about what is not happening is a cognitive achievement that comes at an emotional cost”.
Part of the show The Science of Sustainable Shipping from the 14th Nov 2010 | <urn:uuid:a74294ed-6662-421b-8a05-ac2d24f6ce20> | CC-MAIN-2013-20 | http://www.thenakedscientists.com/HTML/news/news/2095/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368707435344/warc/CC-MAIN-20130516123035-00020-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.978831 | 463 | 2.734375 | 3 |
Andrew Brown, writing in the Guardian newspaper, sees something of where England might be headed, should the present cries for disestablishment be heeded.
These cries for the disestablishment of the Church of England are especially strong at the moment, given the recent dustup over the Archbishop of Canterbury's remarks on proper role of Sharia law in English society.
"It is time to look at the damage he has done to others, and not just himself; one of the things that his flameout has illuminated is just how dangerous disestablishment might prove. The last thought-provoking thing that I heard him say was at a radio award ceremony where he had to present himself, or at least his producer, with a third place prize for religious radio. He said that it was not true that religion must always lead to conflict, but almost always true that in any sufficiently serious conflict you would find religion.
I wish he had developed and made more explicit that line of thought, because it provides the beginning of a justification for the existence of the Church of England. The defenders of a place for religion in public life do not have to suppose that religious belief is true, and many of them don't - in fact all of them suppose that most religious dogma must be false. The question is not whether irrationality is irrational; it is how it can best be managed.
Irrationality won't be abolished just because life would be simpler without it. Whether you prefer to think we live in a fallen world or a Darwinian one, it isn't rational. There are some conflicts that can be resolved only by force and many where real interests are at stake and it is crucial to win. Humans, being the animals we are, tell ourselves that the reasons for which we are prepared to fight -to die or to kill- are the most important causes in the world; so naturally our stories about them will get attached to other tales of the same sort. That means religion. We have watched this happening even in the secular 20th century."
Brown then argues that the level of hysteria surrounding the rhetoric calling for the Archbishop's removal reveals a fundamental intolerance in the broadest part of the English public, especially toward "foreign" faiths and practices. To Brown's way of thinking, it's the Church of England with its broad practice of tolerance based on the Elizabethan Settlement and its sense of duty toward all that has kept England free of the worst sort of religious based jingoism; such as one finds, according to Brown, here in the USA.
One of the things that has emerged from the debacle is that there is a very strong body of opinion in this country which holds that you can't be truly Muslim and truly British. This isn't just the belief of the Islamist nutters, though they make it their central claim. It also animates an astonishing number of people writing in or to the media who would describe themselves as Christians. It is as if three quarters of the country had risen to sing "Land of hope and glory" at the Last Night of the Proms.
It is at moments like that that we need an established church, precisely because it dampens zeal down. The undemocratic privileges of the Church of England are much better for everyone than democratically won privilege would be. Bishops in the Lords are infinitely preferable to priests who tell people how to vote.
If, say, the Economist got its way and the Church of England were disestablished, and replaced by the American model of a confusion of sects all competing for votes, what could stop them responding to the popular demand for a condemnation of Islam? What could give them anything of the Church of England's woolly, incoherent but essential belief that it has a duty to everyone in this country, no matter what their beliefs are. Can any sane person want a hundred English Paisleys competing against each other for the nationalist Christian congregations, and their money, and at last their votes? Because that is the spectre that rose from the debacle caused by Williams' speech and interview
Read the full essay here. | <urn:uuid:9fd6c639-6c76-4ad1-9028-4634f22d50cc> | CC-MAIN-2013-20 | http://www.episcopalcafe.com/lead/church_of_england/no_to_disestablishment.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708766848/warc/CC-MAIN-20130516125246-00074-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.978408 | 824 | 2 | 2 |
The United Arab Emirates has ranked first regionally and 32nd globally in the Human Development Report 2010. It was also rated as one of only two countries from the region in the most advanced category or the category of "very high human development". United Nations Development Programme announced the new rankings during a special ceremony held today in Abu Dhabi to launch the 20th anniversary edition of the report.
The ceremony included a review of the main findings of the report for the year 2010, and an illustration of the long-term progress in the UAE, in particular and the region in general, as documented in the 20th anniversary edition of the report.
On this occasion, Hazza Mohammed Falah Al Qahtani, Director-General of the Office for the Coordination of Foreign Aid said: "We are pleased to see the UAE is now the highest ranking Arab country and has moved up to 32nd globally in the UN Development Programme's Human Development Index for 2010. Since its foundation in 1971, the UAE has always prioritized the development of its people, thanks largely to the enlightened vision of Sheikh Zayed, who believed development is about releasing human potential. The fact that the UAE was rated in the category "very high human development" reflects once again the country's continuous efforts to develop and raise the quality of life of its people."
Dr. Elissar Sarrouh, the UN Resident Coordinator and UNDP Resident Representative in the UAE said "It is only fitting to launch the 20th anniversary edition of the Human Development Report here in the capital of the United Arab Emirates, which leads the region in human development terms and is working to build further on its impressive achievements in health care, educational opportunities and overall quality of life.". "We at UNDP look forward to working to assist the UAE in its visionary pursuit of continued human development progress," Dr. Sarrouh added.
Mohammed Omar Abdullah, the Undersecretary, of the Department of Economic Development in Abu Dhabi in a speech during the ceremony, expressed in turn, his delight on the results of the Human Development Report 2010 for the UAE which occupied the first place at the level of the Arab World, and the 32nd place worldwide, amongst 169 countries covered by the Report, as UAE climbed up five ranks from its position in 2009. He also expressed that "such remarkable progress has been achieved, thanks to God Almighty and the guidance of the wise leadership, headed by His Highness Sheikh Khalifa bin Zayed Al Nahyan, President of the UAE; and his brothers their Highnesses the Sheikhs, Rulers of the Emirates, in the various fields of life, placing the UAE within the category of countries with high human development; based on the principles of sustainability and empowerment of community members, which constitute some of the mainstays and values of Abu Dhabi Economic Vision 2030, and the other strategies adopted in different emirates. "
For the first time, the 2010 Report measures human development in terms of the distribution of achievements and opportunities within societies, with an inequality-adjusted Human Development Index (HDI) assessing relative progress among national groups in health, education and income. The Arab countries together suffer a large HDI decline of 27% because of substantial inequality in all the said three areas.
In addition to the new HDI, which includes some technical refinements of its traditional indicators for income, health and education, the 2010 Human Development Report introduces three new indices to measure the extent and impact of inequality, gender gaps, and extreme poverty.
The UAE ranked first regionally and 45th globally among 138 countries covered by the Gender Inequality Index, which measure gender gaps in reproductive health, empowerment and participation in the labor force. This performance is attributable to gender equality in education, with 77% of adult women in the UAE attaining secondary or higher level of education, the same as for men.
The Multidimensional Poverty Index, which identifies serious simultaneous deprivations in health, education and living standards, shows that the Arab region is home for an estimated 39 million poor people. | <urn:uuid:c3ffac35-e1f4-4e8d-97c0-b512ddfa03df> | CC-MAIN-2013-20 | http://www.albawaba.com/print/main-headlines/united-nations-development-programme-uae-ranks-first-human-development-among-arab-cou | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702448584/warc/CC-MAIN-20130516110728-00061-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.946366 | 820 | 1.640625 | 2 |
This section contains 30 daily lessons. Each one has a specific objective and offers at least three (often more) ways to teach that objective. Lessons include classroom discussions, group and partner activities, in-class handouts, individual writing assignments, at least one homework assignment, class participation exercises and other ways to teach students about the text in a classroom setting. Use some or all of the suggestions provided to work with your students in the classroom and help them understand the text.
Objective: Eduardo was excited about the idea of being a part of an exclusive club, the Phoenix. Today's objective is to discuss the idea of becoming a part of an important group and why it's so important for some people to become a part of something like this.
1) 1. Have each student make a list of the groups they are in.
2. In smaller...
This section contains 5,691 words|
(approx. 19 pages at 300 words per page) | <urn:uuid:7959cd00-01c1-4d12-ba6c-d269bdeb8faa> | CC-MAIN-2013-20 | http://www.bookrags.com/lessonplan/the-accidental-billionaires/lessons.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368705559639/warc/CC-MAIN-20130516115919-00045-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.951221 | 197 | 3.859375 | 4 |
People in the U.S. have a choice in the election in November. We can continue the injustice with a $93 billion profit-driven, private-insurance healthcare system that leaves many millions to languish without care and many millions more to face the frustrations of systemic delays in care delivery, service diminishment and denials of promised benefits. We need to build a healthcare system that provides necessary care to everyone.
The belief in healthcare for all is deeply embedded in American conscience and culture. Across America, local communities regularly hold fund-raising events for children and adults without health insurance who are faced with expensive medical needs. This belief in health care as a human right requires us to remove the private health insurance companies from the system and institute single-payer, national healthcare for all Americans.
In times of crisis, the American people have joined social movements to demand justice and government action. The progressive movement in the early 20th century resulted in stronger regulations on medicines, medical education and healthcare delivery systems. During the Depression, the labor movement won the Social Security Act with the expansion of disability and health care benefits for employees. The Civil Rights movement and the war on poverty led to Medicare and Medicaid. It is time for the American people to collectively stand on the belief that healthcare is a basic human right, the healthcare system can be changed to provide necessary benefits for all.
Michael C. Deanhardt, Anderson | <urn:uuid:9d059cd4-320b-4b95-9c52-85308242599f> | CC-MAIN-2013-20 | http://www.independentmail.com/news/2008/oct/12/calling-healthcare-all-americans/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708766848/warc/CC-MAIN-20130516125246-00060-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.945691 | 283 | 2.28125 | 2 |
You are here:
Objectives & vision
The objectives of the Trust are to provide financial assistance for medical research and teaching in the field of gynaecology, obstetrics and related fields in paediatrics. The Trust is organised in order to promote, by all available means, the study of healthy childbearing and diseases of women.
Our teaching programme is internationally recognised and the work produced has the highest reputation amongst academics and researchers. Our courses and symposia are attended by approximately 3000 full and part-time students per year.
Advances in the wellbeing of women and babies can only be achieved by research into the disorders which can affect anyone. Our primary aim is to improve the health of the unborn child and its mother. | <urn:uuid:c5698ac4-eb7b-4613-b51d-0b572523214d> | CC-MAIN-2013-20 | http://www.women-for-women.org/about-us/objectives-a-vision | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368710006682/warc/CC-MAIN-20130516131326-00028-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.963944 | 149 | 1.625 | 2 |
row2k is proud to be a sponsor of the EAWRC and EARC, the ECAC National Invitational and IRA championships, the ECAC Collegiate Rowing Series, and the NCAA/CRCA results efforts.
April 18, 2012
The results rank teams, and more importantly, provide a relative estimate of how fast a team is. The rankings are intended for entertainment purposes, and are not intended to replace official league and coaches polls.
On each spreadsheet, you will see tabs at the bottom of the file; clicking through the tabs will show you this week's results in different presentations, including by rank, alpha by team, and by division for women's eights.
This week's rankings:
Men's Eight, through April 18, 2012
Women's Eight, through April 18, 2012
The "Secs Back" figures predict how much each ranked team will be behind the #1 ranked boat in an average "standardized" race; approximately six minutes for men's eights, seven minutes for women's eights. So, if Team A is 12 "Secs Back", then they are predicted to be 12 seconds behind the #1 team in a standardized race. To compare two teams, just look at the difference in their "Secs Back" numbers. If A is 12 seconds back and B is 16 seconds back, then the model predicts that, on average for the standardized races, A will beat B by 4 seconds.
You'll see that there is much more information in the "Secs Back" than in the rankings. In some cases, closely ranked teams have very different "Secs Back" and are thus not likely to be very competitive... and in other cases, 10 teams are within 1 second of one another.
The model uses a well-known statistical technique called OLS (ordinary least squares). It is based on the premise that although individual race results may vary, if Team A is on average 2 seconds better than Team B, and if B is on average 2 seconds better than Team C, then, on average, Team A will beat Team C by 4 seconds.
In addition to head-to-head race times, the model considers 1) general race conditions (distance, current, wind, etc.), 2) date of the race (more recent races count more than races earlier in the season), and 3) whether the team was "pressed" in the race (was there another boat close by at the finish or did they win by open water?).
Heat results, which are given less weight than Finals results, are included in the analysis only to the extent that an outcome was "pivotal." So, for instance, if the top three boats in a six-team race go to the Finals, and the bottom three go to the Petites, only the heat race times for the third and fourth place boats that battled to get into the Finals are included in the model. The model does not consider "home-court" or lane advantages, but does consider equipment failure to the extent that is reported at www.row2k.com .
The statistical model is based solely on the current season Varsity 8's race results as reported at www.row2k.com , beginning with races in February and continuing through last weekend. Some effort is made to clean up the data, as there can be errors in the posted results. Teams are included in the final rankings only if they have raced at least twice against other teams that have raced at least twice.
cMax collegiate crew ratings were developed by Chris Maxwell. Chris
currently teaches Sports Economics and Game Theory at Boston College. He
has a BA in Mathematics and Economics from Penn and a Ph.D. in Economics
Andrew Kirk does an amazing job pulling the race results database together on a weekly basis. Chris has been producing cMax collegiate crew ratings since 2002. He has fallen out of a single into the Charles many times and does not pretend to know much about rowing or sculling. Fortunately, others have helped in the development of the model -- most notably, Tom Murray with rowing and Chris Cavanagh with statistics.
Any comments or questions can be sent to Chris by writing row2k. | <urn:uuid:408935ef-23fc-48bc-8ef7-27c97b103ccd> | CC-MAIN-2013-20 | http://www.row2k.com/polls/index.cfm?cat=college&ID=353&type=cMax%20Rankings | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368697974692/warc/CC-MAIN-20130516095254-00008-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.96618 | 862 | 1.554688 | 2 |
The planned suspension of activity at the Eel River biomass plant could ripple beyond the biomass industry, adding more complexity to the North Coast's waste management issues.
Eel River Power has subsidized the hauling of much of Humboldt County's recycling to Willits.
In a press release, Eel River Power, LLC, which operates the plant, cited the lack of a long-term power sales agreement, uncertainty regarding state regulations and the lack of a stable supply of wood fiber that crippled further investment in the plant as the reasons behind the decision to idle the facility starting on Nov. 1.
Two years ago, the Humboldt Waste Management Authority entered into a five-year contract with Solid Waste of Willits, which underbid long-time contractor Arcata Community Recycling Center to process HWMA's recycling.
Willits was able to bid low on the contract partly because it hauled biomass collected in Mendocino to Eel River Biomass' plant.
Willits' costs will rise as the company now has to drive empty trucks up to Eureka to haul HWMA's recyclables away.
Solid Waste of Willits Owner Jerry Ward said his company is looking to alternative biomass customers, but declined to comment who the company was in talks with.
”In the meantime, we'll be honoring our contract with Humboldt Waste Management Authority,” Ward said.
According to HWMA Interim Executive Director Patrick Owen, Willits has sent some test materials to Blue Lake Power --
Humboldt County 3rd District County Supervisor and HWMA chairman Mark Lovelace said Solid Waste of Willits is affected now, but that there are opportunities for trucking materials that could replace the loss of biomass.
Owen added that HWMA will not see increased costs from Solid Waste of Willits.
”There's no immediate impact,” Owen said. “He plans on honoring the contract.”
Owen said the five-year contract just entered its second year, and while HWMA was given a 180-day cancellation clause, Willits does not have that option.
”This was always viewed as an interim solution,” Owen said.
Jud Elinwood, a board member of Zero Waste Humboldt -- a group of local residents that works with local agencies and businesses on waste management issues -- said the closure of the power plant could affect recycling ratepayers in the long term as HWMA decides how to process recycling.
”I think ratepayers may be involved in the decision,” Elinwood said, adding that he would like to see a nonprofit or government agency oversee a cooperative approach to recycling. | <urn:uuid:938452ac-1eb8-41d8-bbb6-0512b88ab623> | CC-MAIN-2013-20 | http://www.willitsnews.com/ci_21771362/eel-river-plant-stoppage-could-affect-willits-recycling | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368699273641/warc/CC-MAIN-20130516101433-00053-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.955587 | 556 | 1.617188 | 2 |
§ Sir Philip Goodhart
To ask the Chancellor of the Duchy of Lancaster what instructions he has given for the modification of cars used by his Department so that they can use unleaded petrol.
§ Mr. Atkins
None. The Department's policy is that where practicable new vehicles should either be diesel-powered or run on lead-free petrol. Existing petrol engined vehicles should be converted to lead-free petrol at a convenient major service where that can be done at no significant cost.
§ Mr. Atkins
It is Government policy to establish the use of unleaded petrol as the dominant fuel in the United408W Kingdom as quickly as possible. From October 1989 all new models of cars, and from October 1990 all new cars, must be able to run on unleaded petrol. The duty differential introduced in the last Budget gives the fuel a retail price advantage of some 6p compared with four-star petrol. In addition, the Government support the activities of the Campaign for Lead Free Air (CLEAR), which runs campaigns to encourage the use of the fuel. As a result, demand for cars which can run on unleaded petrol is growing, and this means that it is in the commercial interests of car manufacturers to provide them as quickly as they can. | <urn:uuid:86fbfa9f-5129-4358-9e13-7b6ffe02d803> | CC-MAIN-2013-20 | http://hansard.millbanksystems.com/written_answers/1988/nov/14/unleaded-petrol-5 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368699273641/warc/CC-MAIN-20130516101433-00022-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.965704 | 256 | 2.296875 | 2 |
© Jonathan Hillyer / Atlanta
The concept of stewardship – the belief that people are charged with maintaining their environment for future generations – is a fundamental tenant of both environmental conservation and historic preservation. While these different fields often diverge in details, their primary goals are in harmony. As the physical reminder of cultural heritage, historic buildings are more than the sum of their materials. The approach when working with historic buildings is one of thoroughly understanding the building: its history, unique significance and characteristics that contribute to that significance; how it has been modified over time; its materials and their condition. This knowledge is used to guide recommendations that are respectful of the historic building and which serve to retain important qualities of the building over time. This knowledge-based decision-making process is similar in approach to scientific research and investigation – both of which underpin conservation of the natural environment.
Minimizing changes to historic buildings and their settings are the goals, which are first and foremost in the decision-making process. These include: retaining the location and historic configurations of buildings; maximizing retention of features, components and materials; and repairing materials to ensure longevity and long-term preservation of the building as a whole. These goals are akin to the environmentally sustainable goals of conserving eco-systems, viewsheds and raw materials.
Despite this philosophical alignment, in practice preservation of cultural resources and conservation of natural resources often find themselves at odds. Issues, such as alterations to historic building envelopes for improved efficiency of mechanical systems, are often at the root of these differences. Rating systems used to measure a building’s environmental sustainability were designed with new construction in mind and, therefore, give relatively small weight to reuse of existing materials and no weight to durability of materials. Only by looking past these differences and working to use shared values to full advantage can solutions be developed that synthesize conservation of the natural and cultural environment and yield results richer as a result.
To create a “win-win” solution for both cultural and environmental sustainability, it is first critical to understand the historic building’s characteristics contributing to sustainability and to use those characteristics to full advantage. This philosophy guided a recent restoration at Hardman Farm in north Georgia.
Hardman Farm is a unique cultural resource located in the foothills of the Appalachian Mountains. It is composed of a main house and outbuildings, which supported a working dairy operation. The buildings are nestled in a picturesque valley with cultural significance as an early Native American trading route and game trail called the “Unicoi Turnpike.” In an ironic turn of events, European settlers adopted this path as a wagon route and advertised it in 1819 as “safe passage through Indian lands.” The tree-lined bed of this path can still be seen cutting through a large meadow near the house. The main house and a number of its outbuildings were constructed in 1870 by Captain James H. Nichols, a central Georgia pharmacist who moved his family to the area to take advantage of the quiet rural lifestyle. In 1893 Atlanta businessman Calvin W. Hunnicutt purchased the property. The Hunnicutt family used the property mainly as a summer retreat.
© Jonathan Hillyer / Atlanta
Left: Central hallway promotes “stack effect” ventilation up through cupola.
Right: Interior showing 1870s finishes and gasolier modified for electricity in
the early 20th century, all after conservation.
The last family to live in the house was that of Dr. Lamartine G. Hardman, who purchased the property in 1903. Hardman was a physician with many interests, including experimental farming techniques, which he practiced at Hardman Farm. He operated a working dairy farm on the property from 1907 through the late 1920s. The physician maintained several residences with the main house at Hardman Farm only periodically used as a family residence, primarily during summer months. From 1927 to 1931, Hardman served as governor of the State of Georgia and during this time the farm served as a summer governor’s mansion. The property remained in the Hardman family until 1998 when it was deeded to the State of Georgia to ensure its long-term preservation. It was placed under the care of the Georgia Department of Natural Resources (DNR), and the Agency plans to operate the property as an interpreted historic site.
DNR is dedicated to the preservation of historic resources under its care, but it also has a broader mandate to conserve the state’s natural resources. As a result, it is committed to making every facility under its care as environmentally sustainable as possible. This commitment shaped the direction of the Hardman Farm restoration.
As mentioned, for significant parts of its 140-year history the main house was used only in summer months. This sporadic use contributed to its unique condition. Unlike most houses renovated throughout the years to keep up with current styles and technologies, Hardman Farm changed very little since 1870, thus making it a rare and valuable historic resource. The house still retains its original configuration, materials and features. The original uncoated plaster and painted wood trim finishes are still exposed throughout the interior. The house is exemplary for its early technological artifacts, such as its original gasolier lighting, early 1900s electrical lighting and an array of early plumbing systems. Its pristine condition led to a project approach of gentle renewal: cleaning, conserving and repairing while striving to minimize impact to historic fabric.
One result of the house’s unchanged nature is that it never received mechanical heating or cooling systems. The historic fireplaces, located in every room, remained the only heat source. Cooling was achieved as it has always been – by solar control and natural ventilation. Deep porches, projecting roof overhangs, operable exterior shutters and interior draperies all worked in harmony to shade windows. Operable windows were large to maximize air flow and located to ensure cross-ventilation. High ceilings allowed warm air to rise. A central stairway, open vertically through the house and capped with a cupola, created a path for warm air to escape.
The project to restore the main house at Hardman Farm began like many house museum projects. The goal was to create a museum quality interior environment with tightly controlled temperature and humidity ranges. However, it soon became clear to both owner and design team that the house museum approach was not the best for this unique house. Having never been climate controlled, the materials of both the house and its collections had acclimated to the natural conditions of the north Georgia environment. Changing temperature and humidity could have an adverse effect on these materials. Installing and integrating mechanical heating and cooling system components would also impact the house. And, with environmental sustainability a primary goal, it seemed fundamentally wrong to implement a mechanical solution adding energy consumption to a building that, until present, used energy only to power lights.
The team intuitively believed the house should continue to function as it always had by relying on its passive cooling system. However, more than intuition was needed to depart from the objective of tight temperature and humidity control in favor of the passive system. To better understand the effectiveness of the historic passive cooling system, the design engineer developed a 3-D Computational Fluid Dynamics (CFD) model. Assumptions for occupancy and lighting loads were based on the proposed operation of the building as a house museum with occupancy limited to small guided tour groups and no permanent occupants. While CFD analysis can provide a highly accurate prediction of interior temperatures at specific environmental conditions, further evaluation of mechanical systems required a model that could evaluate building performance across an entire year. For this process, the house was modeled in eQuest®, a whole building energy simulation tool capable of calculating building energy usage utilizing annual weather data.
View Larger Image – Courtesy of EMC Engineering
CFD analysis showing air stratification within high ceilings of rooms.
The house was modeled without mechanical systems to verify results of the CFD model’s space temperature predictions. The results of these analyses indicated, during the cooling season, house temperatures may exceed 85 degrees for fewer than approximately 215 hours within the proposed annual operating hours with temperature peaks beyond human comfort range typically occurring after normal hours of operation. Given the nature of the building use with transient occupancy, it was decided that the few instances when temperature would reach a point of discomfort would be acceptable. Therefore, a decision was made not to provide mechanical cooling. This decision allowed for the desired use of historic passive cooling features and the potential interpretation of these features.
The question then remained: How to approach heating the building? Two primary thermal goals existed for heating. The first one was to avoid temperatures reaching freezing to prevent damage to interior materials. The second one was to achieve a certain amount of comfort for visitors on cool days. No nighttime occupancy was anticipated. For reasons of safety and property protection, use of the historic fireplaces was not considered. Multiple system options were analyzed to determine energy usage and utility costs. Systems under consideration included: baseboard heating, hydronic radiant heating with in-line electric water heater, hydronic radiant heating with high-efficiency liquid propane gas (LPG) fired boiler, forced air with LPG furnace and no mechanical heating. The systems were analyzed against a baseline case (a forced air system consisting of 4 - 14 SEER, 8.2 HSPF heat pumps).
For systems evaluations, several assumptions were made about the building’s envelope and operating conditions. To address both issues of human comfort and long-term stability of newly conserved materials, the team established design criteria of target ambient temperatures of 65 degrees for the first floor, which is where staff would be located, and 55 degrees for the second floor. The house was modeled with R-19 insulation installed below the first floor structure and R-30 insulation in the attic at the level of the ceiling joists. Southface Energy Institute performed a blower door test to determine level of infiltration, uncontrolled air leakage through cracks and gaps in the building’s exterior. This infiltration rate was used for the analyses, but it was anticipated the restoration work would tighten the envelope and reduce this variable. Each system was then evaluated based upon several criteria, which included initial operating and life-cycle cost, energy efficiency, impact on the historic resource, maintenance and human comfort.
This evaluation led to selection of an underfloor hydronic radiant system to heat the first floor and no heating on the second floor, which received benefit from the first floor heat. To offset energy consumed by the heating system, an onsite solar array was installed to provide power to the grid.
© Jonathan Hillyer / Atlanta
Solar array was enclosed with a fence to blend into the cultural landscape.
As with heating and cooling, each project decision was carefully studied to minimize environmental impact while never compromising appropriate preservation of this important structure. Historic materials were conserved rather than replaced, often using locally acquired or recycled materials. An example is use of reclaimed heartwood timber for repairs to the existing structural framing. This choice combines compatibility with historic materials, recycled content and exceptionable durability.
This exploration of preservation and sustainability at Hardman Farm allowed the team to conserve a significant historic resource in a manner which assures that both past construction activities and future operations will have minimal environmental impact. As such, the cultural conservation approach of “touching lightly” also becomes an environmental approach, allowing an historic resource to become an interpretive tool for both cultural and environmental conservation.Issue No. 18, 2012
Susan Turner is a principal at architecture firm Lord, Aeck & Sargent. With 29 years of experience leading and working on award-winning historic preservation projects, she is a frequent speaker at restoration conferences nationwide and a recipient of the Atlanta Urban Design Commission’s Jenny Thurston Memorial Award for Outstanding Preservation Professional. A LEED Accredited Professional, Turner is a member of the American Institute of Architects, National Trust for Historic Preservation, Georgia Trust for Historic Preservation and Association for Preservation Technology. She can be reached at email@example.com or 404-253-1442.
NOTE: On February 9, 2012, the Advisory Council on Historic Preservation (ACHP), an independent federal agency, presented it prestigious Chairman’s Award for Achievement in Historic Preservation to the General Services Administration (GSA) for restoration, rehabilitation and reuse of the LEED Gold-certified Martin Luther King, Jr., Federal Building in Atlanta. Atlanta’s former main post office, now Southeast Region headquarters for GSA, was built during the Great Depression and is now a contemporary workplace. The Atlanta offices of Lord, Aeck & Sargent and The Beck Group served respectively as architect and construction manager on this project. | <urn:uuid:3a874164-3a10-4a4a-8554-fc5945ff05f9> | CC-MAIN-2013-20 | http://livebettermagazine.com/eng/magazine/print_article.lasso?id=283 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702448584/warc/CC-MAIN-20130516110728-00009-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.962552 | 2,584 | 3.5 | 4 |
By Laura Cowen
Preliminary study data show that axitinib may be an effective first-line treatment for metastatic renal cell carcinoma (mRCC), particularly in patients with high therapeutic drug exposure and a rise in blood pressure during the first 2 weeks of treatment, researchers report.
Brian Rini (Cleveland Clinic, Ohio, USA) reported at the American Society of Clinical Oncology's Annual Meeting, held in Chicago, Illinois, USA, that between 40% and 56% of patients with treatment-naïve mRCC experienced an objective response following treatment with axitinib.
The researchers explain that axitinib is a potent selective vascular endothelial growth factor receptor inhibitor, but pharmacokinetic and phramcodynamic variability can mean that some patients have suboptimal drug exposures at the standard 5 mg twice daily dose.
Rini and team hypothesized that dose titration based on individual tolerability may optimize exposure and improve outcomes.
To test this hypothesis, the researchers initially treated 203 mRCC patients with axitinib 5 mg twice daily for a 4-week lead-in period (cycle 1).
Then, patients with blood pressure (BP) at or below 150/90 mmHg for 2 consecutive weeks, no axitinib-related toxicities above grade 2, no dose reductions, and two or fewer antihypertensive medications were randomly assigned to receive axitinib 5 mg twice daily plus dose titration with either axitinib to a maximum of 10 mg twice daily (arm A) or placebo (arm B). Those ineligible for randomization continued with the same dose (arm C).
In all, 112 patients were randomly assigned to arms A or B, and 91 to arm C.
Rini reported that the objective response rate (ORR) was 40.2% in arms A+B combined and 56.0% in C. Median progression-free survival (mPFS) was 13.7 months in arms A+B and 12.2 months in arm C.
He said that it is currently unknown whether the lower ORR was driven by the patients assigned to placebo titration. This question will be answered in the final analysis of study data.
A subanalysis performed on day 15 of cycle 1 showed that patients with drug exposure above therapeutic threshold (area under the curve at 24 hours ≥300 ng/h per mL; n=27) had significantly longer mPFS and higher ORR than those with sub-therapeutic exposure (n=25), at 13.9 versus 8.3 months, and 59% versus 48%, respectively.
In addition, patients with mean diastolic BP (DBP) increases of 15 mmHg or more (n=18) per ambulatory BP measurement had higher ORR than those with mean DBP increases below 15 mmHg (n=36), at 61% versus 53%.
Licensed from medwireNews with permission from Springer Healthcare Ltd. ©Springer Healthcare Ltd. All rights reserved. Neither of these parties endorse or recommend any commercial products, services, or equipment. | <urn:uuid:3f1d5c8b-413b-46d6-83df-6695ddb5e923> | CC-MAIN-2013-20 | http://www.news-medical.net/news/20120612/Promising-preliminary-data-for-axitinib-in-metastatic-kidney-cancer.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368699881956/warc/CC-MAIN-20130516102441-00061-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.910392 | 642 | 1.875 | 2 |
BRUNSWICK, Md. - The city of Brunswick is forcing a resident to get rid of more than 20 quail and pigeons she keeps in a backyard coop.
She calls them pets. But city officials say the animals violate a prohibition on outdoor livestock.
Martha Caldwell told The Frederick News Post ( http://bit.ly/UUWkQF) Thursday that she's shipping the birds to a friend in Florida.
Caldwell says she doesn't eat or sell the birds. She likens them to fish in a backyard pond.
Mayor Karin Tome says the coop in Caldwell's yard violates an ordinance prohibiting livestock enclosures.
City Councilman Ellis Burruss is on Caldwell's side. He offered a proposal Tuesday allowing people to keep backyard animals as pets unless the city proves they're livestock. The motion failed for lack of a second.
Information from: The Frederick (Md.) News-Post, http://www.fredericknewspost.com
(Copyright 2013 The Associated Press. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.)
More cursing happens in Maryland than across the Potomac River.
So, who won "American Idol"? Click here to find out.
Emma Watson revels in her post-"Potter" freedom at Cannes.
What you probably shouldn't buy your kids on Amazon. (Photos) | <urn:uuid:dbf19447-f202-4cc6-ac12-50adf9ea2fc6> | CC-MAIN-2013-20 | http://www.wtop.com/41/3189264/Md-woman-forced-to-give-up-backyard-birds- | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696381249/warc/CC-MAIN-20130516092621-00000-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.917053 | 289 | 1.679688 | 2 |
Iran has already crossed several “red lines,” Defence Minister Peter MacKay said Friday.
At a joint news conference at the Pentagon with U.S. Defence Secretary Leon Panetta, Mr. MacKay said: “There have been a number of red lines placed already, and Iran has edged closer and stepped over those red lines on a number of occasions.”
In international affairs red lines – such as the one drawn out a day earlier at the United Nations by Israeli’s Prime Minster Benjamin Netanyahu – amount to ultimatums that military action will result if they are crossed, so Mr. MacKay’s claim that Iran’s ruling mullahs have already crossed several with their controversial nuclear program was puzzling.
Asked if he endorsed Mr. Netanyahu’s ultimatum, Mr. MacKay said: “The more important question [is] …‘Is it the red line in the minds of the Israelis?’”
Aides travelling with Mr. McKay declined to respond.
Israel’s red line, Mr. Netanyahu said, will be when Iran’s enrichment program reaches the point that it has 90 per cent of the amount of weapons-grade uranium needed for the first warhead. The United States has not drawn similar explicit red lines, although President Barack Obama has repeatedly said Iran will not be permitted to develop nuclear weapons.
Responding to a question during the press conference, Mr. MacKay did say he hoped war could be averted. “The preferred option always will be and remains these alternatives to keeping the pressure on Iran to bring about more acceptable behaviour,” he said.
The minister was in Washington to collect the William J. Perry prize for his contribution to “education, research, outreach and knowledge-sharing in defence and security issues in the Western Hemisphere,” an annual award in honour of a former U.S. Defence Secretary. The bilateral with Mr. Panetta, the seventh time the two have met, was added to the agenda. | <urn:uuid:48a2a354-b670-41b2-a0e2-0c63ce2c4653> | CC-MAIN-2013-20 | http://www.theglobeandmail.com/news/world/peter-mackay-draws-his-own-red-lines-on-iran/article4576376/?cmpid=rss1 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368706499548/warc/CC-MAIN-20130516121459-00057-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.957283 | 422 | 1.828125 | 2 |
Big Bear, Ca, April 12, 2011, 3:00pm – The City of Big Bear Lake, along with the State of California, and the federal government, are recognizing April as Child Abuse Prevention Month. The purpose of this month is to promote community involvement in preventing child abuse, by spreading the message that all children have the right to receive care, protection and guidance a family provides. They have the right to be free from harm and to have their physical, emotional and educational needs met. In 2010 more than 37,000 children in the County of San Bernardino were referred to the Children and Family Services for suspected child abuse and neglect. Mayor Jahn and the rest of the Big Bear City Council are encouraging citizens to help end child abuse. | <urn:uuid:9eb001c5-2ffc-4a70-aadf-052659100c1c> | CC-MAIN-2013-20 | http://kbhr933.com/current-news/april-national-child-abuse-prevention-month/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368706499548/warc/CC-MAIN-20130516121459-00031-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.966483 | 150 | 2.125 | 2 |
Learn something new every day More Info... by email
A skip-payment mortgage is a type of loan for the purchase of a house with terms that allow the borrower to skip a loan payment without going into default. The loan terms specify how many payments the borrower can skip, how often he can avail himself of this option and under what conditions. Although the lender allows the borrower to skip a loan payment, the interest on the loan continues to accrue. It is added to the principal balance of the loan, and the payment schedule is recalculated to account for the change in the outstanding loan balance.
The way the home mortgage industry operates in a particular country tends to be a reflection of public policy. In some countries, the mortgage industry is only lightly regulated. Lenders have the freedom to craft loan products that suit their own interests, and are not obligated to add consumer-friendly options. In other countries, the government has set standards that protect homeowners against default and predatory lending practices. Mortgage lenders in these countries are more likely to design loan products that are sensitive to consumer needs.
In certain countries, like Canada, the mortgage industry has designed a loan product that gives the borrower some flexibility if he has a major life issue that impacts his ability to pay the loan on a monthly basis. The skip-payment mortgage allows the borrower to skip as many as four payments. The number of payments that can be skipped and the circumstances that can trigger the option vary by lender. Some lenders only allow the borrower to skip one payment. Others let the borrower initiate the skip at his own discretion, while certain lenders require proof of a qualifying event, such as a death in the family, sickness or job loss.
Regardless of how the lender structures the right to skip a payment, skipping the payment does not mean that the payment has been waived. On the contrary, a skip-payment mortgage continues to charge the borrower interest over the period of time that no payment is made. Interest for that time period is added to the principal balance of the loan, increasing the total amount that the borrower owes. The lender then recalculates the borrower's monthly payment or payment schedule to add in this additional amount.
This process of increasing the principal balance of a loan with excess interest owed from an insufficient or missed loan payment is called negative amortization. Although a skip-payment mortgage can be a benefit in times of emergency, the impact of skipping payments on the total amount owed must also be taken into account. A borrower can end up paying interest on the interest that has been added to the principal balance, significantly impacting the borrower's balance owed and the equity in the property. | <urn:uuid:7ae147dc-18c0-46ad-bacd-27b37bf4d3ee> | CC-MAIN-2013-20 | http://www.wisegeek.com/what-is-a-skip-payment-mortgage.htm | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368707435344/warc/CC-MAIN-20130516123035-00018-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.966285 | 533 | 2.421875 | 2 |
The Boy Scouts have a rule: leave the camp cleaner than you found it. This does not mean that all the trash has to be cleaned up now, but you can’t let it get worse, and it must get at least a little better. In Bob Martin’s book, Clean Code, he asks, “What if code got a little better every time you change it?” I’ll answer it: the industry would not find itself in the mess it’s in. The industry norm is for code to incrementally worsen with each change.
Much of the time, following the Boy Scout Rule won’t be hard. It’s an incremental strategy. It’s easy to start and easy to sustain. Here are some typical challenges and ideas on how to be a Boy Scout.
Adding to a Long Function
Extract something; there must be plenty of opportunities to pull out some idea and name it. You want to add 3 lines, take out 5. Net improvement leaves a function 2 lines shorter. But I bet you can easily do better. Fix another complex conditional nearby to start a pattern of improvement.
Adding to a complex conditional
Extract the conditional into a helper function. Name it and its parameters well. Write a few tests for it. That’s picking up the obvious beer cans.
Look at the extracted code carefully. Does the conditional really belong with some other module? If so, the complex conditional is likely to be duplicated and the newly extracted function should be moved. Do the work or add it to your technical debt list.
You see a copy/paste/tweak opportunity that meets the functional requirements. Don’t do it, except maybe to test your hypothesis. Before, or after the change, do what the code is telling you: extract the common code into a helper function. Generalize and parameterize it so it handles both cases. Write tests around the code to be extracted to guard against breaking existing functionality. Make a list of the other previous cut/paste/tweaks of the same code for conversion.
Cryptic Local Variable Name
Once you figure out what the variable is for, rename it to help you, and your teammates, on the next code visit.
Pull out a nesting level or two into a helper function.
Broken Glass and Beer Cans in the Fire Pit
Put on some gloves. Clean out the big pieces of glass and cans. Bag the trash. A heavy duty bag is best. Be careful not to put any embers in the bag. Take the trash back to the boat. | <urn:uuid:a67c86c1-d49f-4263-9bcd-fcca9d669209> | CC-MAIN-2013-20 | http://www.renaissancesoftware.net/blog/archives/90 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368705195219/warc/CC-MAIN-20130516115315-00019-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.909406 | 539 | 2.3125 | 2 |
Thousands of primary and secondary school teachers across Tanzania are on strike, which has left hundreds of thousands of their students wondering what to do next.
Digging into the whys and wherefores of the sad and costly development may help, but it would pay more handsome dividends engaging in efforts likely to lead to realistic modalities of ending the current strike and minimising the possibility of similar incidents recurring.
Teachers who have decided to stay away from work, with some making little more than technical appearances largely for convenience’s sake, have done so chiefly because no deal has been struck with the government on their demands for better working conditions.
This is not the first time negotiations on the matter have ended in deadlock, with teachers either threatening to resort to “industrial action” or actually downing their tools.
So, we are by no means short of experience in dealing with strikes by disgruntled workers, only that it doesn’t appear that we have learnt enough lessons from this history to handle repeats of the scenarios less clumsily or more professionally and efficiently.
Could casting glances across our borders help, perhaps? For instance, teachers in Kenya staged a strike in September last year, citing overcrowding of classrooms.
Associated Press reported that the 200,000-plus teachers were protesting the diversion of government funds meant to hire more teachers and ease classroom overcrowding. Apparently, the money was directed to the Defence ministry, whose spending is never publicly scrutinised.
The news agency quoted the Kenya National Union of Teachers as vowing that the protest, which was set to affect more than 10 million children in primary and secondary schools, would continue until the government agreed to hire more teachers.
In a situation where some 79,000 teachers were needed to reach the internationally recommended teacher-to-student ratio of one teacher to 35 students, when the average in public schools then was 50 to 100 students per teacher, many had no problem buying the teachers’ position.
This was especially so because they found the consequences of such a scenario as clear as daylight, one relating to the fact that teachers usually have hardly any time for poor children in overcrowded public school classrooms while children in private schools enjoy top-level attention.
It would be interesting to see how this compares with what teachers in Tanzania see as their main reservations – and how seriously the government and the larger society take those concerns.
As noted, workers’ demands for a better deal in the face of harsh working conditions including “starvation wages” are only to be expected and are therefore perfectly understandable.
Therefore, we stand convinced that negotiations should continue to seriously address the factors hindering the relevant parties from agreeing on a formula to ensure the problems in question do not recur – at least not with the viciousness they often are known for, including denying innocent school children their right to education.
One of the all-important questions is: Who will compensate these children and their parents or guardians for the massive loss they will have suffered at the end of it all? The fact is that no amount or level of compensation would be good enough. | <urn:uuid:b9efaa81-be20-4fc8-b540-ef3bb519ba60> | CC-MAIN-2013-20 | http://www.ippmedia.com/frontend/index.php/2thisrock/quickquestions/keyword/b.=23info.pl/frontend/functions/function.fopen?l=44300 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368700264179/warc/CC-MAIN-20130516103104-00057-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.975169 | 631 | 2.25 | 2 |
DEVIN STEWART: Going to the big picture here for the Thought Leaders Forum that we're hosting at Carnegie Council: Looking at the big picture and the planet, looking back at your experiences in Europe and the United States and Asia—you have been based all around the world; you have government, NGO, international organization experience—what do you see as distinct about the time that we live in today? Is there an ethical or moral dimension to what makes it distinct?
NOBUO TANAKA: Sure. It is true that in a global world there are very rich countries and poor countries, and very rich people, while there are very poor and starving people on the other side, those who are living only on one dollar a year.
It is amazing that more than 2 billion people do not have access to electricity. It's Africa, it's India, some parts of Latin America. All people equally, let's say, have a right to have a very healthy and comfortable life. Access to energy, access to electricity, is a very important part of the issue—or a solution or a program—that we have to tackle. IEA analyzes how many people do not have this access, how many populations do not have healthy cooking devices, for example?
The cost of achieving this energy access, solving the energy problem, is not huge—just $25 billion, $26 billion a year. Compared to the amount of consumption that we do in the developed economies, this is a minuscule amount of money. Also, we know how to do that.
Of course, the demand for energy is getting more and more in these countries. Emerging economies, growing economies consume more energy. So the price of energy is going up. But also abundant energy sources are the renewables, like solar, wind, et cetera, and a more decentralized system, not the huge nuclear reactor combined with grid lines. These are very costly options. For the poorer economies, more decentralized renewables—mini-hydro is another one—this kind of decentralized system of electricity supply could be a good solution.
How to provide enough financing to this kind of activity is key. It's not easy. The big economy model does not work in this kind of situation. There are plenty of good examples which are successful. Grameen Bank is one. Mini-financing through the women collaboratively—this is a very interesting idea. India is using this kind of mechanism, using women for providing solar power battery and lighting in the very poor, rural areas. So that gives a huge opportunity to the people for access to electricity.
This is one of the ethical issues which I am acquainted with in my capacity as executive director of this energy agency.
DEVIN STEWART: What's at stake, Mr. Tanaka, if we fail to provide more people with access to electricity? What could we see?
NOBUO TANAKA: These people who don't have access to electricity cannot grow or cannot enjoy a much more healthy and comfortable life, which they deserve to do. It's also a problem for everybody, because if these people are isolated out from the growth path, then destabilization happens eventually. Instability of the global community will happen.
If people do not have anything to lose, the only thing they do is just go to the violence. It's inevitable. So how to maintain the healthy life, or at least something to lose—we have to have a common agenda and necessity to tackle this issue.
DEVIN STEWART: Looking ahead a little bit, what do you predict will be one of the biggest choices that government and people will have to make in your area? Do we have to make a tradeoff between the future of the environment for generating electricity today? Are there going to be big tradeoffs? What are the tough choices that we're going to have to make?
NOBUO TANAKA: That is interesting. Yes, probably. It depends on what kinds of goals you set. For example, if we have to achieve so-called climate change mitigation—CO2 emission reduction or greenhouse gas reduction—maybe we need to use much, much less energy in the future, in the process of economic growth. It means that the lifestyle of the people would be very different from what we see today.
So those big, emerging economies, like China, India, cannot use the same model or path which OECD [Organisation for Economic Co-operation and Development] countries, including Europe, Japan, or the United States, have enjoyed. It should be restructured in a more innovative way of building or a lifestyle, like appliances. A much more energy-efficient way of life is mandatory. Also in that sense, the developed economy should do some part of this obligation by changing its lifestyle.
DEVIN STEWART: Along with the other part—
NOBUO TANAKA: Because otherwise we cannot convince China, India, or African people to do differently.
DEVIN STEWART: It's not fair.
NOBUO TANAKA: It's not fair. So we have to change, ourselves, our way of life, and then let them do their thing.
But also it is true that a country like China is now investing very heavily in renewable energy—wind, solar cells. They are the largest producer of the solar photovoltaic cells, the biggest deployment of the windmills. They are much more serious about the electric vehicle in China, because they know that petroleum will not be abundant in the future to use in billions of cars there. It's simply impossible.
DEVIN STEWART: Am I getting that you are saying that we're going to have to have a more conservative way of living?
NOBUO TANAKA: Well, not conservative. It is more an environmentally friendly or sustainable way of life. It's not necessarily the more humble. It could be a different way of life—more electrification, but an efficient way of using cooling systems. The U.S. is a typical case. Don't drive the big car, is one thing, more public transportation, live closer, in the one segment of the economy using cogeneration power and heating.
So there are plenty of existing technologies which make the use of energy much more efficient. So deploy all of these technologies or mechanisms into the way of life, and the way of life could be very different from what we do now.
If China successfully introduces these technologies or lifestyle, China can be a good leader, a very, very important leader of these new technologies—the so-called green paradigm of the future. China can use these technologies or knowhow, way of life, as a model to export to the countries who are coming after—India or Africa. China's green model could be a very interesting test case, how they establish all-electric vehicles on the ground or gas vehicles or a different way of living, a way of eating, dining.
So we'll see. China cannot grow without this kind of tremendous change of the lifestyle.
DEVIN STEWART: Is that essentially how you see leadership?
NOBUO TANAKA: Yes, leadership plays a very important role to give incentives sometimes for the renewable energy sources or electric vehicles at the beginning of the technologies. Premature technology needs some government assistance. The market cannot really make this happen. So at least at the beginning, some kind of government assistance is probably necessary.
DEVIN STEWART: If you were advising people listening to this, from a variety of organizations—if you are looking at organizations like companies or NGOs or universities—or even as individuals, if you could just give them one piece of advice on what moral facet of the decision making to focus on, what would it be?
NOBUO TANAKA: You mean moral issues they have to focus on?
DEVIN STEWART: Yes.
NOBUO TANAKA: It is difficult to say. Is there any one single moral issue in the world to solve all the problems? It cannot easily be said. But I can say that each person, each country, or each region has its own right to make a comfortable life. That is for everybody the same.
But historical reality makes some countries to make this new way of life very difficult and costly. The energy price is getting higher and higher. These newcomers cannot enjoy the cheap energy price for their economic growth as we did in the 19th, 20th centuries. Countries who have already grown up are responsible to help these countries, the newcomers, to enjoy the growth as much as possible.
DEVIN STEWART: That means leadership? Does it also mean direct assistance?
NOBUO TANAKA: Leadership of the governments, yes, NGOs, the private sector. Each has its own different responsibilities probably. I cannot easily say this is the common feature.
But at least, when we have to build our policies or business models or an NGO's perspective, we simply just put these issues of the global issue into consideration, to make it a part of the simultaneous equation. At least we make an assessment of the impact of our regular decisions. That is probably the way to give some kind of understanding and notion: If this decision is taking place, what would be the impact on the other part of the world? Then at least you can think about it and make a proper decision.
We cannot decide only for the emerging economy, the growing economy. We have to decide for ourselves also. But at the same time, this kind of global context is very important to be input into our policymaking. That is what probably we have to do.
DEVIN STEWART: Which issues are being ignored that concern you? What are the roadblocks to tackling those issues?
NOBUO TANAKA: Sometimes we call it the global governance issue—global governance in energy, global governance in whatever thing you call. Of course, there are plenty of trials that happened in the history—G7, G8, G5, whatever Gs, G20, or OECD, et cetera, APEC [Asia-Pacific Economic Cooperation], ASEAN [Association of Southeast Asian Nations]. You can name many, many international organizations or frameworks trying to at least solve part of the problem.
DEVIN STEWART: So there's a governance problem.
NOBUO TANAKA: Yes, it is a governance problem. But there's no single silver bullet to this kind of question. We have to use all of these different layers of organization, sometimes bilateral, sometimes multilateral, sometimes regional—try to use all these different layers of the international bodies to achieve at least the similar objective of this economic growth, with access to electricity, whatever you call it. By doing so, we can harmonize the discussion.
Each has different roles or missions given. It's very difficult to say that we just simply are coordinating to one direction. But remember that we are always meeting each other from time to time in very different international occasions and talking about their programs and consolidate and try to understand and try to find out some solutions.
Governance mechanisms—there's no silver bullet, as I said, but at least there are plenty of international bodies who are motivated to do that. How we can use these international bodies is the key. It's up to the individual countries or major economies or people who can use these international organizations.
Very often these international bodies are underutilized. They can do much more than they think. So how to wisely use these international bodies is probably the very important issue for anybody.
DEVIN STEWART: Earlier you talked about transparency as a key to restoring trust of the public. Would you say that's your most valued ethical principle or moral principle that you have discovered in your career?
NOBUO TANAKA: Yes, transparency is certainly the one. But in my career, an important ethic is don't run away from the problem. Just cope with it. Just face it. That is the kind of ethics which I always maintain myself. Don't run away. Just face it and try to solve the problem. It's not easy to solve the problem, but if you don't run away, you will eventually find the solution, or at least part of it.
Transparency is a part of the method of showing the way and convincing others, to achieve some consensus. Yes, transparency is probably the best way to achieve this consensus direction. But to make this happen, any leader should not give up, should just try.
DEVIN STEWART: That's a great ethic, Mr. Tanaka. Have you witnessed this same sense in others? Part of this project is to try to explore a sense of a global ethic. What does that mean to you, "a global ethic"?
NOBUO TANAKA: Is there collective thinking about how we can collectively achieve ethics? Human beings have always had certain common goodwill, good understanding. We can rely on the goodwill of people. Ethics is how we can maintain the good living of people and keep good relations with each other. Ethics is a way to harmonize the way of life for all the human beings around the world. Japanese ethics is how to maintain this kind of harmonization, to harmonize with others. Sometimes you must be humble to make a good collaboration.
So ethics is sometimes used as a symbol to do something just or your right to do justly. But maybe it's not always easy to say there's only one right thing to do, just thing to do. Different people have different ethics. Different people may have different value systems.
Accepting some different systems in the world is probably very important to make a good harmonization and good coexistence of the world. That's the basics of ethics. You must not define ethics as just one. There are plenty of different ethics or value systems in the world.
DEVIN STEWART: We like to call that pluralism.
NOBUO TANAKA: Yes, pluralism is one. Each has different a historical ground to make it. How to accommodate these different systems into a more harmonious existence is the wisdom of people, wisdom of leaders probably.
DEVIN STEWART: Last question, Mr. Tanaka. This is a fun one. Use your imagination and sort of think about science fiction here. Imagine 100 years into the future. How would you like it to look, and how would we get there?
NOBUO TANAKA: I'll certainly be dead, so it's not my job. But if my children's children's children may come back, and if I have a chance, as a science fiction time, to exist and go there and see how my descendants are enjoying their lives or leadership, I think I want everybody to kind of accommodate each other and understand each other, a more harmonious way of coexistence, friendly relationships. I hope this kind of society, community, can be created.
This is another value probably. Diversity is very important for the growth or development of our creativity, innovation. How to maintain these diversified sources of energy is energy security. But for the society, how to maintain these diversified human beings in one community is the key for the success of the growth of the community. The United States is one of the best models so far. We want to see many different models of this kind of creativity that may happen in a different part of the world.
DEVIN STEWART: That's a great note to end on, Mr. Tanaka. Thank you so much.
NOBUO TANAKA: You're most welcome. A very interesting, innovative way of thinking. This is a very interesting project. Good luck.
DEVIN STEWART: I appreciate it. Thank you. | <urn:uuid:43b5ca8c-2664-42ee-b311-d9a478091287> | CC-MAIN-2013-20 | http://www.globalethicsnetwork.org/profiles/blogs/thought-leader-nobuo-tanaka | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703682988/warc/CC-MAIN-20130516112802-00043-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.959099 | 3,286 | 1.953125 | 2 |
1 O give a unto the Lord; call upon his name: b his deeds among the people.
2 Sing unto him, sing psalms unto him: a ye of all his wondrous works.
3 Glory ye in his holy name: let the heart of them rejoice that seek the Lord.
4 Seek the Lord, and his strength: seek his face evermore.
5 Remember his marvellous works that he hath done; his wonders, and the judgments of his mouth;
6 O ye seed of Abraham his servant, ye children of Jacob his chosen.
7 He is the Lord our God: his judgments are in all the earth.
8 He hath remembered his a for ever, the word which he commanded to a thousand generations.
9 Which a he made with Abraham, and his b unto Isaac;
10 And confirmed the same unto Jacob for a law, and to Israel for an a:
11 Saying, Unto thee will I give the a, the lot of your inheritance:
12 When they were but a few men in number; yea, very few, and strangers in it.
13 When they went from one nation to another, from one kingdom to another people;
14 He suffered no man to do them wrong: yea, he a kings for their sakes;
15 Saying, Touch not mine a, and do my b no harm.
16 Moreover he called for a a upon the land: he brake the whole b of bread.
17 He a a man before them, even Joseph, who was b for a servant:
18 Whose feet they hurt with a: he was laid in iron:
19 Until the time that his a came: the word of the Lord tried him.
20 The a sent and loosed him; even the ruler of the people, and let him go free.
21 He made him a of his house, and ruler of all his substance:
22 To bind his princes at his pleasure; and teach his a wisdom.
23 Israel also came into a; and Jacob sojourned in the land of b.
24 And he a his people greatly; and made them stronger than their enemies.
25 He turned their heart to hate his people, to deal a with his servants.
26 He sent Moses his servant; and Aaron whom he had chosen.
27 They shewed his signs among them, and wonders in the land of Ham.
28 He sent darkness, and made it dark; and they rebelled not against his word.
29 He turned their waters into a, and slew their fish.
30 Their land brought forth a in abundance, in the chambers of their kings.
31 He spake, and there came divers sorts of flies, and a in all their b.
32 He gave them a for rain, and flaming fire in their land.
33 He smote their vines also and their fig trees; and brake the trees of their coasts.
34 He spake, and the a came, and caterpillers, and that without number,
35 And did eat up all the herbs in their land, and devoured the fruit of their ground.
36 He smote also all the a in their land, the chief of all their strength.
37 He brought a forth also with b and gold: and there was not one feeble person among their tribes.
38 Egypt was a when they departed: for the fear of them fell upon them.
39 He spread a a for a covering; and fire to give light in the night.
40 The people asked, and he brought a, and satisfied them with the bread of heaven.
41 He opened the rock, and the waters gushed out; they ran in the dry places like a river.
42 For he remembered his holy a, and Abraham his servant.
43 And he brought forth his a with joy, and his chosen with gladness:
44 And gave them the lands of the heathen: and they inherited the labour of the people;
45 That they might observe his statutes, and keep his laws. Praise ye the Lord. | <urn:uuid:3a3477ff-404e-4bdb-92cd-8ae5fdd6118b> | CC-MAIN-2013-20 | http://www.lds.org/scriptures/ot/ps/105.7-11?lang=eng | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368704392896/warc/CC-MAIN-20130516113952-00075-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.991915 | 851 | 1.632813 | 2 |
The Council of Governors is comprised of thirty nine Governors
who represent the Trust's public and staff constituencies and those
stakeholder organisations who are entitled to appoint Governors
under the terms of the Trust's constitution.
The Council of Governors has a number of statutory duties,
including the appointment and removal of the Chairman and
Non-Executive Directors, the appointment of the Trust's auditors
and the approval of changes to the constitution of the Trust. They
also hold to account the Board for its management of the Trust.
The Trust values the contribution of its Governors and the
particular perspectives that they bring to the development of
services. Consequently, Governors are active in developing the
Trust's strategies and its annual plan.
The Council of Governors has strong working links with the
Board. A joint meeting with the Board is held twice a year and
board members attend relevant Council of Governors committees and
participate in joint seminars. The Board considers that these
arrangements are an effective way to understand the views of the
Council of Governors and maintain engagement with its members.
Governors from the public and staff constituencies are elected to
office for varying terms up to three years and may seek election
for further terms up to a maximum of three.
Foundation trust status gives the Trust greater freedom to plan
local services allowing us to respond to the needs and wishes of
our service users and local communities.
Foundation trusts recruit members and, from these members,
Governors are elected to represent the views of local service users
and staff. County Durham and Darlington NHS Foundation Trust
currently has over 6,000 public members and 5,000 staff members. I'd
like to become a Foundation Trust Member.
The Public Governors represent the geographic area covered by
the Trust , which is split into nine constituencies.
These constituencies are:
Staff Governors represent the following staff groups:
We also has a number of Governors nominated by our partner
organisations. Appointed Governors represent the following
Governors provide advice to and influence how the Trust develops
services to meet the needs of local communities. Governors are
elected by patients, public and staff, or nominated by our partner
organisations. Governor elections take place every year with
Governors normally serving a three year term.
Governors attend meetings of the Council of Governors in which
they represent their local communities. The Council of Governors
holds four meetings a year, one of which is the Annual General
Meeting (AGM). Governors are therefore involved in discussing
important issues such as any major new service developments, the
Annual Report and Accounts and the means employed by the Trust to
recruit members and to ensure that they are kept up to date on
The Council of Governors works alongside the Trust's Board of
Directors to ensure that local communities and staff have a greater
say in how services are developed and delivered by the Trust. The
Council of Governors is made up of local people, staff members and
representatives of the local partner organisations.
The Council of Governors plays a major role in the governance of
the Trust. Its main responsibilities include:
Public and Staff Governors are elected by the members of the
Trust. Each Governor is responsible for representing the interests
and views of their particular group of members. Public Governors
represent local people in their constituencies. Staff Governors
represent the views of their colleagues. Governors appointed by
partner organisations provide input from their organisations.
The Trust holds elections to the Council of
Governors every year. If you are a member of the Trust and
over the age of sixteen years then you are eligible to stand for
election in the public constituency in which you live.
Equally if you are employed by the Trust you are eligible to stand
for election in the appropriate staff constituency.
If would like to stand for election then you can self nominate
by filling in the nomination form. If you would like
further information about how to participate in the election
process please contact the Foundation Trust Office.
For each Governor the time commitment required will be
different. As a minimum, a Governor is required to attend four
meetings of the Council of Governors each year, including the AGM.
These meetings are held quarterly. Governors need time to prepare
for these meetings and to also deal with any queries raised by
their constituents. Check the latest Council of Governors meeting
details in our Events Calendar.
In addition, Governors are required to sit on at least one
sub-committee of the Council of Governors and participate in the
work of that sub-committee.
Currently, the sub-committees of the Council of Governors are as
Governors are usually appointed for three years. Governors will
be eligible to stand for re-election and may serve up to a maximum
of nine years.
Governors do not get paid for the work they do. However,
expenses properly incurred in the performance of their duties are
The Trust provides support to Governors via the staff in the
Foundation Trust Office.
The Foundation Trust Office is staffed as follows:
Donna Swan - Trust Secretary;
Gaye Ferguson-Boyes - Trust
Secretariat Co-ordinator; and
Shelly Regan - Committee Administrator
Page last updated on 18 February 2013 | <urn:uuid:5de27180-4b9d-4605-ba25-d8e04074e6a6> | CC-MAIN-2013-20 | http://www.cddft.nhs.uk/about-us/council-of-governors.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368709037764/warc/CC-MAIN-20130516125717-00003-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.955666 | 1,093 | 1.59375 | 2 |
This morning we got a triple threat of bad news on the econ front:
- Case-Shiller showed home prices in March fell more than expected.
- Chicago PMI saw a big fall.
- Consumer confidence is on the wane
And yet... stocks are higher across the board.
What's going on?
Basically, there's a huge disconnect. But it's not a disconnect between the economy and stocks. It's a disconnect between the economy and earnings.
These two charts from Morgan Stanley show it all.
EPS estimates just keep trending up.
And GDP estimates keep going down...
Again, the key here is that stocks are rallying based on fundamentals, even if the earnings appear to be disconnected from reality.
There are a couple reasons for this, of course:
- International sales are booming, and that revenue has been amplified by the weak dollar.
- Companies are still (amazingly) finding room to cut spending.
- In some areas, sales really have been fantastic.
So if you're waiting for stocks to catch up to the "reality" of the economy, watch for cuts to earnings estimates. | <urn:uuid:a0acd88b-3ad3-4404-a134-c26bd0f0ab53> | CC-MAIN-2013-20 | http://www.businessinsider.com/the-chasm-between-the-economy-and-earnings-2011-5 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368701459211/warc/CC-MAIN-20130516105059-00075-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.947124 | 238 | 1.5625 | 2 |
A recent online discussion over what defines a "Superhero", inspired me to take those ideas and drag them out as a journal post here.
It started with me discussing that while the main character of my comic, "The Wellkeeper", has incredible powers that she uses in heroic ways, I don't think of her as a "superhero". If you simply that the word itself and break it down, it's definition should simply be that. A hero with "super" abilities. Andi it's implied in the term that these abilities should be beyond the scope of a normal human.
But that's not the cultural definition of a superhero, is it? Batman is called a "superhero" in spite of having zero powers. The only real thing that separates him from James Bond is the costume, (And the habit to recruit teenage sidekicks) but nobody would ever think to call Bond a superhero. Why not? His identity as an MI6 agent is not public knowledge, he uses intense fighting skills and gadgets to fight crime and stop evildoers. He just tends to wear nice suits rather then tights and a mask.
The more I think about what defines a "superhero", the more I realize that the defining traits are totally superficial and have nothing to do with what the word itself describes. The distinctions are largely subtle (an interesting word combo, to be sure) and often arbitrary. There are a ton of very popular heroes with fantastic powers that aren't considered "superheroes", mostly because of superficial tropes that have become permanently linked with the definition of a superhero.
By all accounts, Luke Skywalker, Harry Potter, Frodo and even characters like "The Wellkeeper's" Zoe are by every literal translation of the term, "Superheroes". But they don't have melodramatic costumes, secret identities or any of the other trappings that define the cultural idea of what is a superhero. It's strange and slightly disrespectful of the term to limit it like that.
Hell, by the most straight forward interpretation of the term "superhero", even the ever-so-hated Edward Cullen from "Twilight" is one. He has special powers that he uses in a variety of heroic ways. But it's interesting to note that if you used this criteria to define him as such, you'd probably raise the ire of both superhero fans AND Twilight fans as each tends to consider their interest as somehow better then the other, when they're really the same damn thing.
Are the superficial trappings of a silly costume and secret identity THAT essential? Or is it more tied to the medium of comics? Most people don't define characters like the Power Rangers as "Super heroes" when they meet ALL the criteria, both literal and cultural. Except that that was a TV show and not a comic book first and foremost. (I admit that unlike most of the other examples I've made, there are far more people that DO include the Power Rangers as "superheroes" then, say, Bond or Harry Potter) It seems to me, that for American superhero fans, a superhero is defined as someone who wears a costume to fight crime/evil as created and seen first and foremost in an American comic book.
Now, sometimes, the media will cover something like a comic book movie and get it right, but still infuriate comic fans because of the arbitrary definitions. I recall news stories about "Hellboy II: The Golder Army" that defined Mike Mignola's iconic character as a superhero. And damn it, he TOTALLY is. But some comic fans I know cried foul because... well... I don't quite get why. Because heroing is actually his job? Because he doesn't wear tights? Why are these distinctions so dang arbitrary?
It's like some kind of infinity loop of nonsense designed to BE purposefully difficult to understand. | <urn:uuid:f34815f0-c184-4d3c-8b29-60518e211fa0> | CC-MAIN-2013-20 | http://derrickfish.deviantart.com/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702810651/warc/CC-MAIN-20130516111330-00037-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.96536 | 792 | 1.859375 | 2 |
WASHINGTON--On March 23, 2010..two years ago today...President Obama signed his new health care law Republicans and critics deride as "Obamacare." The Supreme Court will hear a challenge of the law next week.
House Democratic leader Rep. Nancy Pelosi said Thursday the health law is "ironclad" constitutional.
"No it is not constitutional," said Rep. Michele Bachmann (R-Mn.) on FOX and friends on Friday morning.
The Republican National Committee released a taunting video (above) on Friday.
Mitt Romney's campaign also put out hits on "Obamacare," as a major issue Romney is battling is the health care law he signed while Massachusetts governor.
below, from the Romney campaign....
TWO YEARS OF BROKEN PROMISES FROM OBAMACARE
"Whatever the Supreme Court decides about the constitutionality of Obamacare, we already know that it is bad policy and wrong for America. Abolishing it and putting sensible changes in its place will be one of my highest priorities as president." -Mitt Romney
Read Governor Romney's Op-Ed On Repealing Obamacare
President Obama Promised To Bring Down Health Care Costs, But He Has Made It "Less Affordable":
President Obama Promised Obamacare Would "Bring Down [Health Care] Costs" For Americans. "The Affordable Care Act will bring down costs, improve the quality of health care delivered to all Americans and expand coverage to 32 million Americans." (White House Website, www.whitehouse.gov, Accessed 3/15/12)
"No Matter What They Said About Rising Health Care Costs, Those Costs Aren't Actually Going To Go Down Under Health Care Reform." (David Nather, "Health Care Reform: 4 Inconvenient Truths," Politico, 3/16/12)
Factcheck.org On Obamacare: "Falls Short Of Making Health Care 'Affordable And Available To Every Single American,' As Promised." "Furthermore, the law falls short of making health care 'affordable and available to every single American,' as promised. The law provides subsidies to help some Americans buy insurance, expands Medicaid and doesn't allow insurance companies to exclude persons with preexisting conditions." (D'Angelo Gore, "Promises, Promises," Factcheck.org, 1/4/12)
· "[T]he Director Of The Nonpartisan Congressional Budget Office Projected 23 Million Persons Will Remain Uninsured - Some Because They Can't Afford Coverage." (D'Angelo Gore, "Promises, Promises," Factcheck.org, 1/4/12)
Obamacare Has Made Health Care "Less Affordable" And Has Caused "Insurance Premiums To Rise." "At the moment, the new law is making health care slightly less affordable. Independent health care experts say the law has caused some insurance premiums to rise. As we wrote in October, the new law has caused about a 1 percent to 3 percent increase in health insurance premiums for employer-sponsored family plans because of requirements for increased benefits. Last year's premium increases cast even more doubt on another promise the president has made - that the health care law would 'lower premiums by up to $2,500 for a typical family per year.'" (D'Angelo Gore, "Promises, Promises," Factcheck.org, 1/4/12)
President Obama Promised Individuals They Could Keep Their Existing Insurance Plans, But Obamacare Could Cause As Many As 20 Million Americans To Lose Employer Coverage:
President Obama Promised Obamacare Would Allow Individuals To Keep Their Existing Insurance Plans: "If You Like Your Plan, Keep Your Plan." OBAMA: "If you like your doctor, you're going to be able to keep your doctor. If you like your plan, keep your plan. ... I think it's time to give you, the American people, more control over your health." (President Barack Obama, Remarks On Health Insurance Reform, Fairfax, VA, 3/19/10)
· President Obama: "If Your Employer Is Providing You Good Health Insurance, Terrific, We're Not Going To Mess With It." (President Barack Obama, Press Conference, 6/23/09)
"For A Lot Of People, [President Obama's Promise] Isn't True." "President Barack Obama promised over and over during the health care debate that 'if you like your health care plan, you can keep your health care plan.' It turns out that, for a lot of people, that isn't true." (David Nather, "Health Care Reform: 4 Inconvenient Truths," Politico, 3/16/12)
According To The Nonpartisan Congressional Budget Office, Obamacare Could Cause As Many As 20 Million Americans To Lose Their Employer-Provided Coverage. "A Congressional Budget Office report issued this week says that 3 million to 5 million people could move from employer-based health care plans to government-based programs as the Affordable Care Act takes effect. And in the worst-case scenario, it could be as many as 20 million." (David Nather, "Health Care Reform: 4 Inconvenient Truths," Politico, 3/16/12)
· Even The CBO's "Best Estimate" Shows That "3 Million To 5 Million Fewer People Will Obtain Coverage Through Their Employer." "The best estimate, subject to a 'tremendous amount of uncertainty,' is that about 3 million to 5 million fewer people will obtain coverage through their employer each year from 2019 through 2022." (Julian Pecquet, "CBO Report Says Healthcare Law Could Cause As Many As 20M To Lose Coverage," The Hill, 3/15/12)
President Obama Promised To Not Give Government "More Control Over Health Care," But Obamacare Created A New Bureaucracy "With Vast Powers" Over Health Care:
President Obama Promised To Not Give Government "More Control Over Health Care In America." OBAMA: "I don't believe we should give government or the insurance companies more control over health care in America." (President Barack Obama, Remarks On Health Insurance Reform, Fairfax, VA, 3/19/10)
Obamacare Created A "Controversial Medicare Cost-Cutting Panel" To Cut Medicare "If Spending Grows Too Fast." "The White House defended a controversial Medicare cost-cutting panel Wednesday, just as a House committee was set to pass a bill that would repeal the board. The Independent Payment Advisory Board, established by the healthcare reform law, would comprise 15 experts with the power to cut Medicare payments to doctors if spending grows too fast." (Sam Baker, "White House Defends IPAB Ahead Of Repeal Vote," The Hill, 2/29/12)
· The Independent Payment Advisory Board (IPAB) Is "The New ObamaCare Bureaucracy With Vast Powers To Control Health Care And Health Markets." "The vehicle is a bill from Tennessee Republican Phil Roe that would repeal the Independent Payment Advisory Board, or IPAB, the new ObamaCare bureaucracy with vast powers to control health care and health markets starting next year." (Editorial, "Independent Payment Advisory Revolt," The Wall Street Journal, 3/9/12)
Obamacare's IPAB Empowers A Bureaucracy To Impose Judgments Through "Medicare's Price Controls On All U.S. Medicine." "Instead, supposedly independent experts will run a battery of small experiments, figure out which ones 'work' and then impose them through Medicare's price controls on all U.S. medicine. When health spending in a given year exceeds a budget benchmark, as it always does and will, the 15 White House-appointed wise men will work their miracles." (Editorial, "Independent Payment Advisory Revolt," The Wall Street Journal, 3/9/12)
Experts Have Warned That IPAB Cuts "Could Lead To Rationed Care" And Could Have An Effect On The Ability To Treat Patients. "Expert witnesses warned lawmakers Tuesday that a provision in President Obama's health care law could lead to rationed care or even prevent physicians from treating Medicare patients. ... Dr. Scott Gottlieb, M.D., a resident fellow at the nonpartisan American Enterprise Institute, told Rep. Peter Roskam (R., Ill.) that the ability of health care providers to treat patients would 'absolutely' be effected by the cuts likely to be imposed by IPAB." (Andrew Stiles, "Obamacare Could Lead To Rationed Care, Experts Warn," The Washington Free Beacon, 3/6/12) | <urn:uuid:6e8bda6e-d29f-4567-97ad-54c917e5bf5e> | CC-MAIN-2013-20 | http://blogs.suntimes.com/sweet/2012/03/mitt_gop_rip_obamacare_on_seco.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703298047/warc/CC-MAIN-20130516112138-00040-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.925179 | 1,754 | 1.585938 | 2 |
Tradition-oriented firm expands portfolio by offering new services.
Changing market demands have prompted a major satellite telecommunications company to diversify its services. Moving beyond its traditional niche leasing transponder space on its large constellation of spacecraft, the company is branching into new areas such as broadband and cellular services. The Washington, D.C.-based firm also is a major provider of video, data and voice communications to the U.S. government.
In recent years, the commercial satellite communications industry has been troubled by technological change and stiff competition from terrestrial fiber optic networks. To survive, many companies acquired smaller regional firms or diversified their portfolios into other communications markets. Commercial profits stagnated, but the industry has benefited from increased government business since 2001.
As a leading global satellite telecommunications firm, Intelsat Limited has weathered the changing market environment and has evolved into a flexible organization actively seeking new business opportunities. Founded in 1964, it was originally an intergovernmental organization known as the International Telecommunications Satellite Consortium. In its decades of existence, the firm helped create live international television links and pioneered early Internet demonstrations.
Intelsat became a private company in 2001 after more than 35 years as an intergovernmental body. While the firm has adapted to the times, the entire telecommunications industry has changed since 2001, explains Ramu V. Potarazu, Intelsat’s chief operating officer. Privatization has permitted the company to diversify its portfolio beyond satellite communications to provide end-to-end solutions such as teleports, fiber optic lines, broadband and wireless services. Other offerings include Internet protocol gateway services, end-to-end broadcasting and bundled networking. He adds that the company is concentrating on broadband services in 2004.
With a constellation of more than 25 satellites in geosynchronous orbit, Intelsat provides communications coverage for 99 percent of the planet. The firm also has acquired additional business since its privatization, with a list of more than 600 clients worldwide compared to the 420 it had when it was an intergovernmental organization, he says.
While this large fleet of spacecraft makes the company a leading provider of commercial services, government sector applications also represent a major source of business. Intelsat formerly provided telecommunications services to the U.S. government through Comsat, its North American service branch. Because Intelsat was an intergovernmental organization, satellite capabilities were sold through the signatory nations and bodies that made up the organization. But in 1998, when Intelsat obtained rights to provide direct satellite access to the United States, Comsat ceased to exist.
In 2003, the company launched a new subsidiary called the Intelsat Government Solutions Corporation. According to its president, Susan Miller, although Intelsat had provided government services for decades, it lacked a specialized branch to meet specific customer needs in the federal marketplace. Today, all Government Solutions personnel are cleared to work with classified information, she says.
Aside from traditional satellite telecommunications services, the company provides managed solutions and end-to-end services such as network design. Miller notes that these packaged offerings are becoming more important as government demand increases.
Intelsat’s Government Solutions branch has a variety of government customers, from major departments and bureaus to defense contractors and small businesses. The company provides similar services in Europe, where it works with individual governments and their ministries, including the U.K. Ministry of Defence, and with major international bodies such as NATO.
The company supports U.S. military operations across the Middle East and Southeast Asia with satellite capability for video, data and telephony. The demand for these services is very steep and will continue well into the future, she says. In the past decade, beginning with the first Gulf War, the need for military satellite communications services outstripped the capability of the government’s fleet of dedicated spacecraft. This forced the U.S. Defense Department to augment up to 70 percent of its bandwidth capabilities through leased services on commercial satellites, she says.
Although there was a brief lull in demand during the mid-1990s, it jumped again after 2000. From 1991 to 2001, government demand for satellite bandwidth grew more than tenfold. Miller adds that projections out to 2015 indicate this consumption will increase by another order of magnitude. A major technological cause for this demand is the expansion of high-quality video capabilities out to front line tactical units. “You are talking about tons of bandwidth. Some of the UAVs [unmanned aerial vehicles] like Global Hawk have satellite links for high-speed video resolution that require multiple transponders for just one unit,” she explains.
Intelsat’s Government Solutions is working with contractors such as the Bechtel Company to provide communications services to contractors and U.S. forces operating in Iraq. Intelsat has provided Bechtel facilities with earth stations for voice and voice over Internet protocol communications back to the United States and Europe. As a service provider for the region, Intelsat takes customer orders and configures, exports and licenses the equipment. Once the equipment arrives, the company then installs and maintains it. “We grow with them [contractors] as they’re opening up operations in camps. If they are moving from Baghdad to Tikrit, we follow along and put in the capability and grow it to meet their demands,” Miller says.
Besides an active government market, the company is poised to increase its presence across the continental United States with the acquisition of Loral Space and Communications Limited’s North American satellites. Pending Federal Communications Commission approval, the $1.1 billion purchase will add five additional Telstar satellites—four in orbit and one scheduled for launch this year—to Intelsat’s constellation.
The purchase permits the company to cover all of the 50 states, which will greatly enhance its voice, data and government business units, Potarazu says. Before privatizing, Intelsat was not permitted to provide service to the Midwest—its service restricted to the territory east of the Mississippi River and west of the Rocky Mountains.
The Loral acquisition and an initial public offering scheduled for this summer place Intelsat in a position to enter new areas, such as the burgeoning wireless market, aggressively. The company is concentrating on services such as cellular backhaul, the connection of two wireless cells to a main communications backbone. Potarazu notes that Intelsat expects cellular backhaul to be a major revenue generator in 2004.
The ubiquity of wireless communications devices such as personal digital assistants and cellular telephones also is driving changes in the satellite telecommunications market. Emerging bandwidth-sensitive applications, such as broadband, are driving commercial demand. These new technologies demonstrate that, while the need for communications has not changed, the mechanisms have, Potarazu explains. “The fundamental question that each one [operator] needs to ask is, Is anyone communicating less? The answer is no. It’s the means that are changing, and people want more bandwidth and faster speeds,” he says.
Many global markets also are just beginning to open to these services. He notes that a large part of the world is not yet connected to the Internet. Other areas, such as Asia, present growth opportunities for applications such as broadband.
Potarazu predicts in the next two to three years the industry will undergo a round of consolidations as many regional telecommunications providers are acquired. This is an attractive option for many companies because of the high cost of entering the market from scratch, he explains. Consolidation also will help ease the oversupply problems that have affected the satellite telephony market over the past few years. He adds that this overabundance exists in markets that are already saturated, while many parts of the world are only lightly connected to the global telecommunications grid.
Government use also will continue to rise. Potarazu notes that five or six years ago, U.S. troops were not sending e-mail home. Satellite communications enables these links. Because of the changing needs, one of Intelsat’s challenges is determining future applications and services. “Whether it’s Internet access through broadband, direct to home [satellite service], bundled services or new applications like cellular backhaul, distance learning and telemedicine—we need to be able to provide solutions to the right people on those networks,” he says.
A new generation of more powerful and capable satellites also is helping the company provide more services to its customers. New Ka-band spacecraft with multiple spot beams are more capable of meeting market changes. Digitalization and compression technologies also enable the spacecraft to react to service requests, he says.
Because it takes an average of 36 months to put a satellite in orbit, the entire constellation must be able to react to market changes, but achieving this is an evolutionary process. “A lot happens in the marketplace in 36 months. You need to bring some flexibility to this model,” Potarazu offers.
Potarazu foresees a continuing convergence of video, data and voice telecommunications services. These changes will lead to the development of new applications and products. “Because users do not want multiple antennas or telephone lines for separate applications, there is a growing convergence of services and equipment to meet their needs,” he says.
Additional information on Intelsat is available on the Word Wide Web at http://www.intelsat.com. | <urn:uuid:ce0a9463-4a7d-4f8e-8379-c474edb0d3eb> | CC-MAIN-2013-20 | http://www.afcea.org/content/?q=node/84 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368701459211/warc/CC-MAIN-20130516105059-00071-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.951222 | 1,933 | 1.875 | 2 |
Click to enlarge
Arcventure The Egyptians
Grades 2-6, Win/Mac
Discover the world of Ancient Egypt, first by excavating and discovering ruins, then travel back in time to ask the Ancient Egyptians about the objects you have found! Arcventure: The Egyptians is designed to help students (aged 7-11 years) explore Ancient Egyptian life. When time traveling in Ancient times students are able to explore the area, talk to and ask questions of the people who live and work in Giza, Memphis and El-Amarna. The students are also able to access a journal throughout the adventure, which allows them to make notes about their progress and their findings. Student journals can also be accessed through the teacher controls, from which you can print or copy/paste it into a word-processing document such as Word. Arcventure: The Egyptians is a fantastic way to bring history to life!
Teacher controls are available to control difficulty levels, turn the narration and sound effects on or off, or protect access to teacher controls with a password. Student records are available that show each students progress in the program.
• Excavation - You are allowed a total of 14 days for the excavation and are allotted a spade, trowel, brush, and magnifying glass in which to dig! Choose your instruments wisely for each takes a different amount of time away from your day so clever strategy would be helpful here!
• Information Hut - At the end of each day's digging you can return to the information hut to look more closely at the objects you have found. The computer database contains information about most of the objects found in the excavation.
• Expeditions - If you find an object that is listed as unknown in the information hut, you will need to travel back to Ancient Egypt to find more about it. In the expedition you will find yourself in the pyramids you have just been excavating. Remember that you are on a fact-finding mission and you should keep a careful note of the information you find.
Minimum system requirements
Win 95+, Pentium 233 MHz, 64 MB RAM, sound card
Mac OS 8.6+, OSX
Arcventure 3 CD Set
Arcventure The Romans
Arcventure The Vikings | <urn:uuid:5bc13f8f-645a-496a-87f4-5c8bee249a97> | CC-MAIN-2013-20 | http://www.turningpointtechnology.com/Software/TF/02284.asp | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703298047/warc/CC-MAIN-20130516112138-00062-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.926962 | 456 | 2.546875 | 3 |
These paper ornaments are a classic craft that many of us probably made in school when we were kids. But they have a modern-vintage feel to them (I may have just made that up…) that I love, and you could use these as gifts or to decorate your home for an inexpensive and festive touch. In fact, we’re going to put a second tree up this year in my office, and I’m thinking about decorating it entirely in these paper ornaments in various sizes. Fun!
What makes this project really fun, though, is the use of double-sided scrap paper. For example, in my picture you see a bright red ornament with aqua polka dots from one angle, and a smooth aqua ornament from the other.
Don’t worry — if red and aqua isn’t your style, you’ll find tons of double-sided craft paper at your local craft store in a variety of styles and colors.
- double-sided scrapbook paper
- 1/4″ metal eyelets
- eyelet setter
Cut five 1-1/2″ strips from your scrapbook paper: (2) 12″, (2) 10″ and (1) 8.5″.
Carefully line up all of the strips at one end and punch a hole through all 5 strips. (You can use a 1/4″ hole punch for this, but I just used the sharp end of my scissors to punch the hole.)
Insert the eyelet into the hole and secure with the eyelet setter and hammer.
Turn the ornament around and carefully align the ends of the strips so your ornament looks like the picture above.
Punch a hole and secure with an eyelet, being careful not to bend or crease the strips.
Use a ribbon, string or ornament hook to hang your ornament and you’re done.
Scale the strips to make ornaments in various sizes:
- five 2″ strips: (2) 15″, (2) 12.5″, (1) 10.75″
- five 1-1/4″ strips: (2) 9″, (2) 7.5″, (1) 6.25″
- five 1″ strips: (2) 6″, (2) 5″, (1) 4.25″
Join us as we celebrate 101 Days of Christmas with new DIY projects, gift ideas, traditions and more every day from now through Christmas!
|Mandi Ehman is the founder and publisher behind Life Your Way as well as a wife and homeschooling mom to four beautiful girls. She lives with her family on a little slice of heaven in wild, wonderful West Virginia and loves coffee, chocolate, easy meals, beautiful things and minimalist spaces.| | <urn:uuid:2d4fdb31-ad9f-4b14-bdd5-89cf4c7eb6a8> | CC-MAIN-2013-20 | http://christmas.yourway.net/paper-ornaments/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368706499548/warc/CC-MAIN-20130516121459-00022-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.935648 | 588 | 1.992188 | 2 |
Lannan Events for the 2012-2013 Season
View event details
Again features artworks where repetition, obsession or meditation, are key elements to the artist’s process, sometimes obvious in the resulting artwork, sometimes not. 20 April - 16 June 2013 in the Lannan Gallery. Continue reading.
In support of a panel featuring Palestinian writers, part of their World Voices Festival of International Literature. Read more.
Victoria Sambunaris: Taxonomy of a Landscape Exhibition Museum of Contemporary Photography, Columbia
The Museum of Contemporary Photography in Chicago received support for the exhibition Victoria Sambunaris: Taxonomy of a Landscape. For more than a decade, Sambunaris has set out on the highway alone, for months at a time, to photograph the United States.
Doug Peacock is the author of Grizzly Years, Baja, and Walking It Off: A Veteran’s Chronicle of War and Wilderness. His latest book, co-written with Andrea Peacock, is The Essential Grizzly: The Mingled Fates of Men and Bears.
ʻAha Punana Leo was formed in 1983 to reestablish and develop the Hawaiian language. During the 1920’s the Hawaiian language ceased to be spoken by children when schools began mandating that the curriculum be taught only in English. Since its formation, ʻAha Punana Leo has been a key force in changing legislation in the state of Hawaii, and also at the federal level, to lift the bans that formerly existed regarding the use of Hawaiian in schools. | <urn:uuid:0ab4c848-96eb-4e8e-8454-4842510b98de> | CC-MAIN-2013-20 | http://www.lannan.org/lf/rc/event/david-foster-wallace/residency/experience/david-foster-wallace/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368711005985/warc/CC-MAIN-20130516133005-00037-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.944027 | 320 | 1.632813 | 2 |
Advocacy & Public Awareness
Ø The role of communities as stakeholders in identifying and prioritizing problems and formulating policies that affect their lives
Ø The right-based approach to lobby for certain policies and to influence the government
Ø Developing and educating people on better ways and methods of presenting cases, defending them, and organizing to make people more effective in influencing those involved in local and/or national decision-making processes.
Ø Increasing the level of community awareness targeting the disabled, the elderly, poverty and the environment.
In the year 2000, PMRS lobbied on the local level to increase efforts in Community-Based Rehabilitation and was more involved in addressing community attitudes towards the handicapped. It assisted health centers in conducting health promotion campaigns that lobby for better health practices at the community level, conducted meetings with local councils in more than 200 localities to influence their policies regarding health conditions in these localities, and it worked to enhance the role of Youth Centers and conduct Small Community Projects.
The National Level:
On the national level, we work with various groups to influence policy decisions and to ensure proper implementation of laws. We also focus on information dissemination, coordination and cooperation among the government and civil society. Preparation and dissemination of protocols and guidelines are strong and important components to our approach, as is training and education. In 2000, we contributed to the following national committees:
Ø The National Committee for Human Resource Development and Education in Health
Ø The Preparatory board for the National Committee for promotion of Breast-feeding
Ø Women's Health Committee
Ø National Secretariat for Palestinian Children
Ø The National School Health Committee
Ø The Central National Committee for Rehabilitation
Ø The Palestinian NGO Network
Palestinian NGO Network:
PMRS helped to found the Palestinian NGO Network (PNGO), and continues to be an active member. We hold leading roles in four aspects of PNGO's work:
Ø Coordination and cooperation between NGOs;
Ø Capacity building of NGOs;
Ø Formulation of policies in different sectors (including health);
Ø Monitoring human rights violations though the Jerusalem Watch initiative.
A major activity of PNGO in 2000 was to develop a draft set of rules and regulations to be incorporated as part of the Palestinian NGO law. PNGO also served as a focal point for negotiations with the government on the issues related to the implementation of the article stipulated in the NGO Law on eligibility for formal registration.
The Rational Use of Drugs Policy:
In the year 2000, PMRS also worked to support the adoption of a national policy for the Rational Use of Drugs. The Rational Use of Drugs program at PMRS seeks to limit the use of unnecessary and potentially harmful drugs, train doctors and drug prescribers on appropriate drug prescription and dispensation methods, create a system of continuing education to keep medical personnel up to date on drug information, and support the adoption of a policy for the rational use of drugs.
Equal Rights for the Disabled:
PMRS supported the adoption of a law to protect the rights of the disabled to achieve equal opportunities in social life, education and employment. Its lobbying efforts targeted the Palestinian Legislative Council, Ministries of Interior and Social Affairs and disability organizations. It also continued lobbying to implement policies that prevent road accidents through its Road Safety Program, targeting the Ministry of Transport, Traffic Police Departments, Ministry of Local Governance, municipalities, insurance companies, and the media.
The National Insurance System:
PMRS signed more agreements and subcontracts with the Ministry of Health to provide quality health services to patients insured through the national health insurance system, and enhanced coordination with government ministries, international agencies and other NGOs at the district and national level through the Emergency Task Force during the Intifada for Independence.
The Regional level:
PMRS is involved in regional coordination committees in the field of disability and rehabilitation with other NGOs and governmental bodies. Coordination committees have been established in 5 regions and aim to promote coordination between government and non-government organizations working in the field of disability and rehabilitation in addition to influencing rehabilitation policies at the regional level.
In 2000, PMRS also became involved in a joint health education network that operates in seven regions. The objective of the network is to influence policies and practices of regional directorates within the Ministries of Health and Education. It further networked with women's groups to lobby on issues related to women in general and women's health in particular, and increased activities in regional NGO networks. This was particularly important during the last three months of 2000 to influence policies related to crisis management and the emergency situation. Networks at this level were instrumental in enhancing the formation of emergency committees and developing emergency plans.
PMRS is known internationally as a premiere health organization in Palestine. As such, we are involved in numerous global advocacy efforts.
The Middle East/North Africa (MENA) Regional Group of the NGO Working Group on the World Bank. In 1998, PMRS was elected to coordinate this group as well as sit as a member of the group's global steering committee. In 2000, PMRS held a successful regional meeting in Cairo with NGO representatives from over 9 countries in the region.
The purpose of the MENA Regional Group is to facilitate the dialogue between the civil society organizations and the World Bank and assure that the voices of the people and communities affected by the World Bank are heard and reflected by the Bank, and represented in its policies and operations. In addition, the group works to ensure that there are sufficient mechanisms for dialogue on the national and regional level, as well as ensuring that the voices of civil society at local and regional levels are integrated into the global processes.
The People's Health Assembly (PHA) MENA regional group. PMRS participated in the Assembly in December 2000, held in Bangladesh. The aim of the PHA is to re-establish health and equitable development as top priorities in local, national and international policy-making, with primary health care being the strategy to achieve these priorities. As a leading health organization in Palestine, PMRS played an important role in the preparations for the meeting and during the actual assembly proceedings. At the close of the Assembly, participants decided to regionalize the PHA process and PMRS was chosen to head efforts in the MENA region.
PMRS has contributed to various international conferences that shape the global development agenda such as Social Summit preparations, Children's Summit, and others.
PMRS is also contributing to the Arab NGO Network for Development as a member of the Steering Committee.
Through its directs service provision work, PMRS is in the position of collecting vast amounts of information concerning the health consequences of Occupation and of the Intifada. Because of its position, PMRS feels a responsibility to inform the international community of the developments taking place in the Palestinian territories in order to garner international support for the Palestinian people living under occupation.
As a leading health institution in Palestine, PMRS has developed over the years as both an organization committed to providing quality services for all Palestinians and an organization dedicated to cooperation, coordination, lobbying and advocacy with the aim to influence national policies and formulate better strategies to achieve Health for All. As such, we continue to build partnerships and cooperate with numerous organizations such as community groups, local and international NGOs, government ministries, coordinating committees, multi-lateral funding agencies, regional groups and international forums in order to effect policy change. We work on many levels: local, national, regional and global, through a variety of lobbying and advocacy methods. | <urn:uuid:5d59b459-cf79-4835-95cc-7fbb53008a08> | CC-MAIN-2013-20 | http://www.pmrs.ps/details.php?id=eci898a1528y91e2tsxel | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708766848/warc/CC-MAIN-20130516125246-00038-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.947376 | 1,530 | 2.21875 | 2 |
Non-oil activity was the biggest driver of Abu Dhabi's GDP last year despite rising oil output, signalling the emirate's mission to diversify its economy is bearing fruit.
Growth in the non-oil sector reached 5.6 per cent in current prices, according to an annual report released yesterday by the Statistics Centre Abu Dhabi (Scad). Overall GDP grew by 15.9 per cent in current prices to Dh620.2 billion (US$168.85bn), up from Dh546.5bn the year before.
"The non-oil sector is growing relatively well," said Said Hirsh, the Middle East economist at Capital Economics. "The Government has handled its reserves well to invest in Abu Dhabi and help attract foreign companies."
Higher oil prices and rises in crude production pushed up the oil sector's contribution to the economy to 49.7 per cent of GDP last year, from 49 per cent the year before.
Non-oil activity, however, still accounted for more than half of growth, contributing 50.3 per cent of GDP, down from 51 per cent the year before.
Under Abu Dhabi's Economic Vision 2030, officials hope to cut the emirate's reliance on oil to 36 per cent of GDP by 2030. As a result, it is investing billions of dollars in stimulating new growth sectors such as tourism, finance, industry and property.
The capital's economy suffered in 2009 as lower oil prices and reduced business activity caused an 18 per cent drop in GDP in current prices. Scad says it will release next month the GDP estimates for the past five years in real prices, which is the most commonly used GDP data because they take into account inflation.
Activity rebounded last year across all sectors, however, Scad's data show.
Mining and quarrying, which include oil production, rose 28.9 per cent in current prices. Financial sector activity rose by 14.4 per cent, manufacturing 10.8 per cent, property and business activity 6.4 per cent, wholesale and retail trade and repair services 5.3 per cent, and hotels and restaurants 4.6 per cent.
Overall, salaries for workers in Abu Dhabi last year rose 9.1 per cent to Dh117.4bn.
UAE crude production, the bulk of which Abu Dhabi accounts for, rose to about 2.32 million barrels per day (bpd) last year, up from 2.17 million bpd in the previous year, according to a recent report from Opec. Export earnings rose to US$74bn, up nearly 30 per cent from the year before, the report said. Average oil prices accelerated by almost $15 above levels of $60 per barrel in 2009.
With Nymex oil prices now at about $100, along with a broader improvement in non-hydrocarbon activity, analysts expect stronger economic prospects again this year.
"We have forecast GDP for Abu Dhabi to be significantly higher mainly due to higher oil production," said Khatija Haque, a GCC economist at Emirates NBD.
One of the keys to driving faster growth in the non-oil economy is stronger bank lending to the private sector, say economists.
Bank lending rose 3 per cent on an annual basis last month from the same period the year before, Central Bank data released yesterday showed. Loan growth remains weaker than in Saudi Arabia and Qatar.
"There's more liquidity in the market and deposit are OK, but banks are still a little bit cautious, and high retail lending rates are dissuading lending," said Ms Haque.
Bank deposits last month rose to Dh1.12 trillion, up 10.9 per cent from June last year.
Last month, "M2" money supply, an indicator of future inflation pressures, rose at an annualised rate of 12.5 per cent, down slightly from the previous month's 13 per cent annualised rate of increase. "M3", the broadest measure of money supply, increased at an annual rate of 12.4 per cent last month, down 0.7 per cent from the previous month as government deposits dropped. | <urn:uuid:70982a38-8ac9-4ef0-8a61-484f74318147> | CC-MAIN-2013-20 | http://www.thenational.ae/events/areas/abu-dhabi/non-oil-drove-abu-dhabis-gdp-growth-last-year | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703682988/warc/CC-MAIN-20130516112802-00002-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.939838 | 840 | 1.921875 | 2 |
It’s not unreasonable to be suspicious of the United Nations. It is, after all, run by politicians. And it’s definitely good to be vigilant against threats to liberty whenever regulations are being written. However, much of the scare surrounding the Arms Trade Treaty currently being discussed at the United Nations appears unwarranted.
I wouldn’t consider myself an authority on the Treaty. However, I have spent some time looking at the documents of the negotiations. In general, the treaty involves establishing universal guidelines for international shipments of weapons, including small arms.
Three issues that immediately came to mind:
1) It could be interpreted that abiding by the treaty would involve the expansion of domestic laws concerning the prevention of arms transfers to international criminal organizations, thus providing a justification to tighten regulations on private firearms sales. However, from what I’ve read there is currently no intention to ban private sales.
2) Weapons embargoes can make it harder for one side of a conflict to acquire arms it needs to defend itself against the other side. This was a factor in the Spanish Civil War and the wars in the former Yugoslavia. It’s unclear how the Arms Trade Treaty would address this issue.
3) The whole thing could be a feel-good statement by politicians who will manipulate language as much as their power allows to get what they want for themselves and their cronies anyway.
Official documents can be found at the United Nations Website. I spent the most time perusing the Compilation of views on the elements of an arms trade treaty. Certainly, there is always closed-door diplomacy going on that the public will not be permitted to see for some time, but public documents are valuable in understanding the positions of the players.
On Page 3 of the Compilation, the Algerians discuss their idea of the treaty:
Assuming that since the future arms trade treaty must facilitate the legal trade
in arms and prevent their illicit transfer and trafficking, it should be founded on:
• The purposes and principles of the Charter of the United Nations
• The right of self-defence in accordance with Article 51 of the Charter of the
• The right of all States to manufacture, import, export, transfer and possess
conventional arms for their legitimate self-defence and security needs and for
the maintenance of order
• The obligation for States to take steps to prevent the diversion of conventional
arms from legal channels to the illicit market
• The need to prevent, combat and eradicate the illicit trade in conventional
arms, including small arms and light weapons, and their ammunition.
The Canadian statement emphasizes the need to explicitly protect lawful gun ownership by individuals (15-16):
Canada believes that the primary goals of an arms trade treaty should be:
• To prevent transfers of conventional arms that breach Security Council
• To prevent arms transfers that contribute to serious violations of human rights
• To prevent arms transfers that contribute to serious violations of international
• To prevent transfers of conventional arms that provoke, prolong or aggravate
• To prevent transfers of conventional arms that support or facilitate terrorist
• To prevent transfers of conventional arms that would be used in the
commission of transnational organized crime
• To prevent the diversion of conventional weapons to unauthorized end users
• To promote transparency and due diligence in transfers of conventional arms.
These should be the core criteria of any future arms trade treaty. While other
criteria may be considered, it is these that should form the foundation of an effective
Recognizing legitimate trade and ownership
The goal of the treaty should be to curtail illicit and irresponsible transfers of
conventional arms, and their diversion from legal trade into the illicit market. The
treaty should not impede the legitimate trade in conventional arms, nor should it
discourage or undermine the use of firearms for recreational activities or other
forms of lawful and responsible ownership and use as recognized by States parties.
Canada is particularly concerned that the treaty not place new burdens on lawful
Canada therefore believes that the goal of the treaty should be clearly stated in
its preamble and requests the inclusion of the following two (or similar) preambular
“Recognizing that the purpose of the Arms Trade Treaty is to prevent,
combat and eradicate the illicit and irresponsible transfer of conventional arms
and their diversion into the illicit market, including for use in transnational
organized crime and terrorism,
“Noting that the Arms Trade Treaty acknowledges and respects
responsible and accountable trans-national use of firearms for recreational
purposes, such as sport shooting, hunting and other forms of similar lawful
activities, whose legitimacy is recognized by the States Parties”.
Presumably, self-defense and militia drilling would be lawful activities whose legitimacy is (officially) recognized by the US Government.
The Canadians go further on page 18:
Many States participating in the arms trade treaty process have called for a ban
on transfers to non-State actors. While it is clear that those advocating this wording
are referring to illegal armed groups such as terrorist organizations and transnational
criminal groups, this wording could also be interpreted to mean legitimate and
responsible private companies and individuals. Accordingly, to clarify the intent of
this position, Canada would prefer the term “illegal armed groups” to “non-State
actors” as it better captures the intended meaning and provides clarity regarding which actors in particular the arms trade treaty seeks to prevent obtaining access to arms.
Much hinges on what makes an armed group illegal according to the treaty. In the current political situation this passage does not appear to threaten individual gun ownership.
The Swedish submission discusses encouraging states to create national systems to control the arms trade (86):
In practical terms, the main operational goals of an arms trade treaty are to
create international norms in the area of arms transfer controls and, through
obligations in the treaty, encourage as many United Nations Member States as
possible to enact and maintain a national system to control the trade in arms and
military equipment. The illegal trade in arms that causes so much human suffering
and societal disruption around the globe is, by definition, a problem that straddles
national boundaries and requires international cooperation to address. An arms trade treaty which fulfils these goals should significantly improve prospects for curbing the illegal trade in arms and enhance responsibility in the legal arms trade.
On Page 88, it is apparent that the Swedish are referring to international arms shipments:
Sweden favours a numerical ratification requirement for entry into force. All
countries, whether they are mainly exporters, importers or transit States, have an
important role to play in the treaty…
The treaty should not regulate the movement or possession of controlled items
within the territory of a State party, or their transfer to a State’s own armed forces
While the politicians at the UN certainly put their own interests first, so do the politicians, pundits, and industry representatives who cry out against the treaty. The average American gun owner might experience more regulation as a result of the treaty, and an increase in red tape for international transfers could affect the availability of firearms from foreign countries. While these are not good things for liberty, they don’t spell out the nightmare scenario some are concerned about. | <urn:uuid:bfd7bff3-4e9b-44b4-a56b-e0fc992d1c7b> | CC-MAIN-2013-20 | http://darianworden.com/blog/category/current-event/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368705953421/warc/CC-MAIN-20130516120553-00000-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.936278 | 1,490 | 2 | 2 |
Fall for Gorgeous Skin
Get Perfect Skin
Even if you've sworn off baking in the sun, everyday exposure to UV rays can cause dark spots, breakouts, and fine lines. Fortunately, these superficial problems can be corrected. "A consistent routine can reverse some post-summer issues," says Soren M. White, MD, dermatology advisor for skinmdny.com. Our damage-control plan will restore your complexion to its healthy, gorgeous, pre-sun state.Hydrate Dry Skin
Months of sun, heat, and chlorine can leave your skin dehydrated. "If you've been using an oil-free face lotion, switch to a cream and apply a moisturizing mask weekly," suggests Dawn Wetherbee, an aesthetician with the Spa at Equinox in New York City. Get your body in shape by buffing scaly areas with a gentle scrub, then spritz on an oil spray while your skin is damp. "Oil locks in moisture better than cream," explains Dr. White. Repair hands with a treatment that contains lactic acid to exfoliate and glycerin to hydrate.Even Out Tone
"After your summer glow fades, some areas continue to create pigment, causing dark patches," explains David Colbert, MD, founder of the NY Dermatology Group. Restore your complexion with an at-home peel that contains salicylic or glycolic acid. "Chemical exfoliators help disperse dark spots," says Dr. White. If that isn't enough, try a cream that contains 2 percent hydroquinone. "This lightening agent helps your skin stop producing color," says Dr. Colbert. Use a daily face cream with at least an SPF 15 to prevent future damage.Banish Breakouts
"Your skin's natural exfoliation process speeds up in the summer because skin is producing more oil, but slows down in the fall," says Dr. White. Sloughing off surface layers prevents blockages that cause blemishes. Use a face cleanser that contains 2 percent salicylic acid. "It goes deep into pores to dissolve dirt and bacteria," explains Dr. White.Erase Fine Lines
"UVA rays break down the fibers that keep skin firm," says Bruce Katz, MD, founder and medical director of the JUVA Skin & Laser Center in New York City. To promote collagen and elastin formation, apply a vitamin C antioxidant serum on clean skin, then follow with your face moisturizer. Repair crow's-feet with a daily antiaging eye cream that contains ingredients like minerals and seaweed.
What do you think of this story? Leave a Comment.
SAVE EVEN MORE! Say "Yes" to Fitness® Magazine today and get a second year for HALF PRICE – 2 full years (20 issues) for just $15. You also get our new Fitness Band and Total Body Express Band Workout ABSOLUTELY FREE! (U.S. orders only) | <urn:uuid:f9973c81-99d7-4681-99de-755eb935314c> | CC-MAIN-2013-20 | http://www.fitnessmagazine.com/beauty/skin-care/clear/fall-for-gorgeous-skin/?page=1 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703298047/warc/CC-MAIN-20130516112138-00033-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.913369 | 610 | 1.640625 | 2 |
Like Martin Scorsese's "Hugo" last year, Ang Lee's "Life of Pi" is a daring fable about a boy learning to survive after the loss of his parents. It's also an adaptation of a beloved book rendered in fantastical detail by an Oscar-winning director experimenting with 3-D imagery in the most fascinating way.
Before we meet the boy, Lee and screenwriter David Magee (adapting Yann Martel's acclaimed novel) introduces us to the man he will become: Pi Patel (played by the Indian actor Irrfan Khan). Pi invites a journalist (Rafe Spall) into his Montreal home to tell him the amazing story of his life. Every aspect of Pi's life, even his unusual name, is the springboard for a fascinating yarn and Khan, as Pi, spins them gracefully and charmingly.
The teen Pi (played by newcomer Suraj Sharma) is a self-taught student of many religions, and the son of a zookeeper (Adil Hussain) in Pondicherry, India. When the Patels leave India for Canada, many of Father's animals accompany the family on their freighter. One night, a raging storm sinks the ship, and the only survivors are Pi and a handful of zoo animals including a ravenous Bengal tiger named Richard Parker. (Yes, there's a story to explain how the tiger got that name.)
The bulk of the movie takes place on the open ocean, on a lifeboat that Pi must share with the tiger. What happens to the other animals is the basis for another story, one that provides the movie a thought-provoking punchline. Pi must build a raft, so he can sleep safely away from Richard Parker. He also learns to fish, not only for his own sustenance but to feed the tiger so that the beast doesn't eat him.
Lee captures both the harrowing realities of Pi's survival tale and the moments of wonder when Pi experiences the ocean's harsh beauty from iridescent sea life to a floating island of algae, all beautifully rendered in 3-D. And he makes the technical challenges of capturing Martel's story seem almost effortless in their artistry. (The ocean scenes were shot in a Taiwan water tank, and both a real tiger and a computer-generated facsimile were used to simulate Richard Parker's noble ferocity)
Lee is a master storyteller, as proved by his long and varied resume that includes the kung-fu spectacle "Crouching Tiger, Hidden Dragon" and the emotional "Brokeback Mountain." With "Life of Pi," Lee tells a story about the power of storytelling and how those stories don't just illuminate a life, they can sometimes save one.
'Life of Pi'
A teen and a tiger survive a shipwreck in this visually wondrous and emotionally riveting adaptation of Yann Martel's beloved novel.
Where • Theaters everywhere.
When • Opens Wednesday, Nov. 21.
Rating • PG for emotional thematic content throughout, and some scary action sequences and peril.
Running time • 125 minutes. | <urn:uuid:9da411cf-036b-425e-8861-c4c4e8b96f4d> | CC-MAIN-2013-20 | http://archive.sltrib.com/printfriendly.php?id=55309281&itype=cmsid | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368699273641/warc/CC-MAIN-20130516101433-00065-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.950485 | 641 | 1.546875 | 2 |
The type and quality of the cloth used in fine bespoke tailoring is crucial to the finished garment. No amount of tailoring skill is able to disguise the use of inferior materials. The production of luxury cloth, from the initial shearing of the sheep to the supplying of it to the tailors of Savile Row, is a meticulous, time-honoured process.
First the sheep is sheared of its wool, which tends to happen once a year. The wool then goes through a process called ‘top making’, where the raw fibres are prepared using five separate stages, namely blending, scouring, rinsing, carding and finally combing.
Once a ‘wool top’ has been created, the wool is then dyed to give the desired colour. Alternatively, wool can be yarn dyed or piece dyed. Wool holds dye very well, which is highlighted when looking at the wonderful archives held by the associate members of our organisation, Dormeuil and Fox Brothers.
The dyed wool is then spun into yarns, which go to the woollen mill for weaving. Once woven, each cloth is then inspected before it goes to the finishers to set before it can be used in tailoring. Other superb cloths such as pure or blended cashmere, mohair and angora are used, but pure British wool remains the Savile Row tailors’ staple.
Britain has a long, illustrious history of making fine pure woollen cloths for tailoring. Members of Savile Row Bespoke Association are proud to support the Campaign for Wool, as well as the British woollen mills that continue to produce world-class woollen cloths. | <urn:uuid:73622e74-a8f2-438a-b86f-34c7dbb3b606> | CC-MAIN-2013-20 | http://www.savilerowbespoke.com/about-us/cloth-and-wool/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698924319/warc/CC-MAIN-20130516100844-00019-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.957392 | 347 | 2.203125 | 2 |
Every year it seems a deer hunter takes a white buck from Logan County and this year is no exception.
Carl Moore of Oklahoma City bagged the unique trophy on the fourth day of muzzleloader season on his hunting lease north of Guthrie.
Moore had seen the white buck each of the last three years during the bow season, but the animal never came within range for a shot.
This year, the buck emerged from the cedars with three other regular whitetail bucks during the muzzleloader season, Moore said.
“The others (bucks) had nicer horns, but I probably would never get another shot at him,” Moore said of the white buck.
There are a few pockets of white deer around the state, but the largest is probably in Logan County. In fact, Moore said there is another buck in the area that is half-brown and half-white.
White deer are the same as other whitetails except for the color. The white color of the deer is the result of a recessive gene that occurs once in about 10,000 whitetails.
Many times, such animals are stunted or deformed and don’t reach adulthood because they are more susceptible to predators.
However, Moore said this white buck was the fattest deer he has ever killed. It weighed between 150 and 160 pounds field dressed.
It had three white hooves, a black one with a white tip and brown eyes, Moore said.
Hunters must obtain written permission from the director of the Oklahoma Department of Wildlife Conservation to hunt white deer.
That law was passed in 1998 after a hunter took a white buck in Logan County in 1997, upsetting some who attempted to pass a law to protect them. White deer, much like a white buffalo, are viewed as sacred animals by some Native Americans.
A bill was introduced in the state Legislature in 1998 to make it unlawful for Oklahoma hunters to kill a white deer, but what passed was a compromise where hunters first had to obtain written permission.
About a dozen requests are made each year to the Wildlife Department to hunt white deer. At least one and or two are killed by hunters in Oklahoma each year, state wildlife officials said. | <urn:uuid:f62fd4e0-5f81-4c9c-9d54-756813120c9d> | CC-MAIN-2013-20 | http://blog.newsok.com/outdoors/2010/11/10/the-white-buck/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368701852492/warc/CC-MAIN-20130516105732-00051-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.975388 | 453 | 2.375 | 2 |
| || |
December 14, 2010 - Meg Alexander
Using up the last of my vacation time before the end of the year, I spent much of the past few days on the couch, getting our money's worth from our Netflix membership. It was an uneventful, relaxing, enlightening experience. Yes, enlightening, for it was during this slothfulness that I stumbled across the truly, truly, mad, mad genius (?) of Hunter S. Thompson, the pioneer of gonzo journalism.
At this point in time, you, the reader, are likely thinking one of two thoughts: "Who the heck is Hunter S. Thompson and what the devil does 'gonzo' mean?" or "How the heck did she not know who Hunter S. Thompson is and what is this world coming to?"
Let's assume for the purpose of this blog that you, the reader, share my ignorance, in which case I will gladly give you a brief synopsis, courtesy of Wikipedia: "Hunter S. Thompson was an American journalist and author, most famous for his works Fear and Loathing in Las Vegas and Fear and Loathing on the Campaign Trail '72. He is credited as the creator of Gonzo journalism, a style of reporting where reporters involve themselves in the action to such a degree that they become central figures of their stories.
"... The term "'Gonzo' was first used in connection with Hunter S. Thompson by The Boston Globe magazine editor Bill Cardoso in 1970. He described Thompson's "The Kentucky Derby Is Decadent and Depraved," which was written for the June 1970 Scanlan's Monthly, as 'pure Gonzo journalism.'
"... Thompson based his style on William Faulkner's idea that 'fiction is often the best fact.' While the things that Thompson wrote about are basically true, he used satirical devices to drive his points home. He often wrote about recreational drugs and alcohol use which added additional subjective flair to his reporting."
Regardless of your take on him and his mad methods, there’s no doubt Thompson was a fascinating character in and of himself and one hell of a writer. For an easy intro, I strongly recommend the documentary “Gonzo: The Life and Work of Dr. Hunter S. Thompson.” A fascinating followup is “Fear and Loathing in Las Vegas,” starring Johnny Depp and Benicio del Toro, in which Depp freaking nails Thompson. Not as good, but interesting nonetheless, was the documentary, “Buy the Ticket, Take the Ride,” also about Thompson. Not to be forgotten, wrap it all up with Bill Murray playing Thompson in “Where the Buffalo Roam.”
Having watched everything readily available on the man, I’ve also added his books to my Amazon wishlist and I’m off to the library to see what’s available.
No comments posted for this article.
Post a Comment
News, Blogs & Events Web | <urn:uuid:184e0801-622c-4683-b1db-7b68b01aa9f0> | CC-MAIN-2013-20 | http://fairmontsentinel.com/page/blogs.detail/display/544/Gonzo.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696382584/warc/CC-MAIN-20130516092622-00013-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.967012 | 612 | 1.75 | 2 |
Sharad Poornima or Sharath Purnima is the full moon day in the month of October and is closely associated with Lord Krishna and Radha and Gopis. According to Srimad Bhagvad Purana, the famous Raas Lila of Lord Krishna with Radha and Gopis took place on the night of Sharad Poornima. In 2012, date of Sharad Poornima is October 29.
The showering of Bhakti Raas on the Sharad Poornima night by
Krishna on Gopis and Radha has been a main theme for poets and philosophers and still continues to attract the fantasies of common man. The Sharad Poornima night is also seen as the night of love and couples come out at night to face the moon and express their love.
It is also said that the moon is close to the earth on the day and due to this the rays of the moon has several curative properties.
In some regions, Poha, puffed rice, and kheer, sweet, is prepared and left in the moonlight and is consumed later. In some areas, the full moon is not seen directly instead it seen on a vessel filled with boiling milk.
Sharad Poornima is of great significance in
, Braj, Vrindavan and Nathdwara. Mathura
You may also like to read | <urn:uuid:1e288fb2-b25d-4dcb-9885-ecdcf6f53082> | CC-MAIN-2013-20 | http://www.hindu-blog.com/2007/10/significance-of-sharad-poornima.html?showComment=1318324133491 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698207393/warc/CC-MAIN-20130516095647-00022-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.963725 | 290 | 2.109375 | 2 |
From this moment on, it will never be too late to help the citizens of Haiti. The physical and psychological devastation to the Haitian people, and the many reparations to Haiti’s infrastructure will take years and years to mend. We have assembled ten comprehensive activities we believe will have the most prominent positive impact for the country of Haiti.
1. Volunteer Opportunities for Disaster Relief
People interested in volunteering to help the Haitian people should consider this advice from the Center for International Disaster Information before calling agencies to request actually traveling to Haiti to donate your time:
“Volunteers without prior disaster relief experience are generally not selected for relief assignments. Candidates with the greatest chance of being selected have fluency in the language of the disaster-stricken area, prior disaster relief experience, and expertise in technical fields such as medicine, communications logistics, water/sanitation engineering. In many cases, these professionals are already available in-country. Most agencies will require at least ten years of experience, as well as several years of experience working overseas. It is not unusual to request that volunteers make a commitment to spend at least three months working on a particular disaster. Most offers of another body to drive trucks, set up tents, and feed children are not accepted. Keep in mind that once a relief agency accepts a volunteer, they are responsible for the volunteer’s well-being -i.e., food, shelter, health and security. Resources are strained during a disaster, and another person without the necessary technical skills and experience can often be a considerable burden to an ongoing relief effort.”
2. Insist Haitian Debt Be Canceled
Haiti currently owes over $891 million in debt to the International Monetary Fund and other international bodies. IMF chief Dominique Strauss-Kahn has shamelessly proposed loaning Haiti 100 million dollars to rebuilt Haiti as was done with the “Marshall Plan” in Europe after World War II. Haiti doesn’t need another loan. Haiti should be excused from the debt they already struggle to repay. Call, write, or email the head of the IMF Dominique Strauss-Kahn to demand that the IMF cancel Haiti’s debt immediately. Any and all money needed to rebuild Haiti should be donated, not loaned. For IMF Contact information click here.
3. Pressure Haitian Officials
Pressure must be put on Haitian officials to ensure that the millions of dollars donated actually get to the Haitian people. Haitian leaders are notoriously corrupt and must be held accountable. Call, write or email your representatives to ensure that the citizens of Haiti get every single dollar pledged not only for food, but to rebuild their homes and the country’s infrastructure. For contact information click here.
4. Create a Permanent Signature In Your Email
Create a signature boiler plate at the bottom of all your emails that will be automatically transmitted with every email you send. If you’re using Hotmail or Yahoo mail, go to “Options/Signature”. Be creative. You can include contact information for donations or just a short note to serve as a reminder for people to assist Haiti.
5. Blog For Haiti
If you write for your own blog or a blog owned by someone else, considering writing an informative piece on Haitian history, Haitian culture, or any Haitian topic of interest you’re drawn to related to Haiti. Reading about Haiti personalizes the people of Haiti. The televised coverage of the Haitin tragedy tells us nothing about who the people of Haiti really are.
6. Never Assume the U.S. Government or any Relief Agency Will Transport Unsolicited Relief Items Free of Charge
It is important to make arrangements for the transportation before collecting any kind of material donations. Never assume that the government or any relief agency will transport donations free of charge (or even for a fee). In the majority of cases, the collecting agency will be responsible for paying commercial rates for the transportation and warehousing of items gathered. (excerpts from Managing Resource Coordination for Sudden-Onset Foreign Disasters: A Case Study Focusing on the United States’ Response to Hurricane Gilbert/Jamaica by David Callahan. VITA. 1989.)
7. Submit Your Ideas
You may have a creative solution to one of the many problems the Haitian people are confronted with but aren’t sure who to contact. The Center for International Disaster Information is interested in your ideas. Tweet Arturo A. Valenzuela with your thoughts on how they can help the citizens of Haiti: @WHAAsstSecty
8. ebay for Haiti
So many of us have been adversely effected by the economy that any excess cash is used to survive and pay bills. But if you’ve ever considered auctioning off items on ebay for extra cash, now is a goof time to rummage through household items and sell them them on ebay. With the extra cash you earn, you can donate a portion of your earnings to the organizations listed below.
Little is said about help in the form of prayer. The power of prayer cannot be understated. You don’t have to be religious to pray. You can think of prayer as positive group energy directed at, and for the Haitian people in what Carl Jung referred to as the Collective Unconscious. Many believe — as I do –that all living things are interconnected. Visualize a positive outcome for Haiti and the Haitian people. Sixty seconds of a thought stream blessing the Haitian people cannot hurt.
10. When Donating Cash is Best
As Interaction.org points out, “the best way to help is to donate financially to organizations responding to a disaster. Cash allows relief professionals to procure exactly what is needed in a disaster situation and ensure that donations are culturally, dietary, and environmentally appropriate. Cash donations do not use up other scarce resources, such as transportation, staff time or warehouse space. As needed, cash can also be transferred quickly to where needed, helping bolster the economy of the disaster-stricken region.”
We really need for all the organizations that are trying to help to speak to each other so that they can maximize their efforts to be truly effective in helping.
Want to help, below are links to reputable organizations that are involved in helping. The American Red Cross www.redcross.org
Text “Haiti” to 90999 to donate $10 (billed to your phone)
The United Nations World Food Program www.wfp.org
The Salvation Army www.salvationarmyusa.org
Action Against Hunger www.actionagainsthunger.org
Project HOPE www.projecthope.org
Partners in Health www.pih.org
January 21st, 2010 | <urn:uuid:ba94019b-5961-472b-aba2-f6e914198de0> | CC-MAIN-2013-20 | http://blog.friendseat.com/top-ten-ways-to-help-haiti/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368697974692/warc/CC-MAIN-20130516095254-00047-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.928243 | 1,386 | 2.265625 | 2 |
Ask The Expert
April 19, 2010
Shooting pain down the arm with numbness suggests a nerve problem.
Possible causes include a pinched or compressed nerve in the neck or in branches of nerves that travel through the shoulder or arm. Arthritis in the neck or a bulging ("slipped") disc can also be the cause.
Another possibility is a muscle strain or tear. A muscle injury may cause swelling that irritates a nearby nerve, causing numbness. Shoulder injuries commonly cause pain that is felt in the upper arm rather than in the shoulder itself. This phenomenon is called referred pain.
Other causes of pain after exercise include tendonitis, a stress fracture, or a joint injury, but these are less likely to cause pain that radiates from the shoulder to the fingertips.
Your workouts could have triggered your symptoms, so it's probably a good idea to give the weights a rest. You may also want to consider working with a trainer or physical therapist to make sure your exercise program and technique are right for you.
If your symptoms continue, see your doctor for an evaluation, as there are many possible causes and treatments for your symptoms. | <urn:uuid:1cf3682d-9920-4e7e-ae02-3d05b76b79ae> | CC-MAIN-2013-20 | http://www.intelihealth.com/IH/ihtPrint/WSIHW000/7165/8464/1364930.html?hide=t&k=basePrint | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368704132298/warc/CC-MAIN-20130516113532-00051-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.956278 | 236 | 2.546875 | 3 |
Werner Fuetterer as the Archangel in Faust (1926, dir. F. W. Murnau)
“I think Murnau’s imperturbable calm in the studio was due not only to a sense of discipline, but also because he possessed that passion for ‘play’ itself which is necessary and essential to any kind of artistic activity.
For instance, I’d made a steam apparatus for the heaven scene in the Prologue to Faust. Steam was ejected out of several pipes against a background of clouds; arc-lights arranged in a circle lit up the steam to look like rays of light. The archangel was supposed to stand in front and raise his flaming sword. We did it several times, and each time it was perfectly all right, but Murnau was so caught up in the pleasure of doing it that he forgot all about time. The steam had to keep on billowing through the beams of light until the archangel — Werner Fuetterer — was so exhausted he could no longer lift his sword. When Murnau realized what had happened, he shook his head and laughed at himself, then gave everyone a break.”
-Faust art director Robert Herlth, quoted in Lotte Eisner’s Murnau. The scene Herlth is discussing is online here. | <urn:uuid:6b0eabe3-4d2d-4ea9-a677-5600605df181> | CC-MAIN-2013-20 | http://oldhollywood.tumblr.com/post/3631536042/werner-fuetterer-as-the-archangel-in-faust-1926 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696382584/warc/CC-MAIN-20130516092622-00056-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.982057 | 280 | 2.078125 | 2 |
Councilman urges schools to teach rail dangers
In the aftermath of this month's death of 14-year-old Anna Marie Stickel (right) along the Amtrak tracks in Middle River, Baltimore County Councilman John Olszewski Sr. is weighing in to ask the county school system to do a better job of educating students about the dangers of intruding in the railroad right-of-way.
According to students at Kenwood High School, where Anna was a freshman, the school administration had said little or nothing to them about the dangers of the tracks before Anna's death. Past students at the school report that in the past, school authorities would hold assemblies to emphasize the hazards -- a practice that apparently fell by the wayside in recent years. The councilman makes a good point. Here's his letter:
January 21, 2010
Dr. Joe Hairston
Department of Education
6901 N. Charles Street
Towson, Maryland 21204
Dear Dr. Hairston:
The recent tragedy in Middle River that took the life of one of our students is cause for much sadness and concern. It is not the first tragedy involving the railroad tracks and fast moving trains.
Anna Marie Stickel age 14 lost her life as she walked to school with her friend. We know she shouldn’t have been walking so near the train, but many of the students use this as a short cut. Many of our youngsters don’t fully realize the dangers of this type of action. It is up to us to help them with this and put in place warnings and information about the dangers. We cannot blame Anna Marie for her immaturity in making a foolish choice of how to get to school. She is gone and her family and friends are left to grieve.
In the wake of her death, lets begin to take measures to hopefully prevent another tragedy from happening. I believe the Baltimore County school system can play an important role in this. I would like to see this added to the student handbook, perhaps a page devoted to safety measures if you live in a community that is close to any railway. I also recommend that this be included in morning announcements. A warning should be made to students to stay away from train tracks. It should be stressed, especially in the Middle River area, that there are no safe short cuts to school. School assemblies would be a good place to emphasize this.
Lastly, if this could be highlighted in public TV spots that the Board of Education sponsors, it would catch the attention of the general public. Perhaps there are more measures that could be taken. I don’t think we could overdo the precaution messages.
I know that everyone needs to take responsibility for his or her own actions. Parents should be talking with their children and making them aware of the dangers of coming near the fast moving trains. In a perfect world this would all take place. I don’t want Anna Marie’s death to be in vain. We mourn her loss, but we will do what we can to make sure another student doesn’t lose his or her own life.
I know you have the best interests of our students in your heart and mind. Thank you for your assistance and attention.
Sincerely, John Olszewski, Sr. | <urn:uuid:1eebf6de-c9db-43c0-8ef6-cf44ef58c95c> | CC-MAIN-2013-20 | http://weblogs.baltimoresun.com/news/traffic/2010/01/councilman_urges_schools_to_te.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368699881956/warc/CC-MAIN-20130516102441-00006-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.972301 | 676 | 2.140625 | 2 |
Jonah Peretti, a founder of the Huffington Post and viral content site Buzzfeed, says the sun is setting on display ads, and publishers should focus instead on ads tailored for social media.
“People are trying to get back to the way it was,” said Peretti in a recent interview. “With traditional display, people have figured out clever ways to get more clicks out of ads that don’t perform well.”
Peretti sees display ads as artifacts of an earlier internet era when people went to portals to find content. That era — and its skyscraper and banner ads — has long passed as readers instead turned to search and, more recently, to social networks to find stories.
Peretti is not the only one to remark on the portal-search-social evolution. But his observations on the ad industry’s response to the changes are intriguing.
He compares online advertising to the paradigm shifts Thomas Kuhn described in his seminal book, “The Structure of Scientific Revolutions.” In this model, progress doesn’t occur incrementally but in a series of jumps. Everyone works under the same (often wrong) assumption for a long time until a new and better idea emerges; when a tipping point finally arrives, everyone eventually gathers around a new plateau of knowledge.
This is what’s happening in advertising, according to Peretti.
“Social is a Copernican revolution but it’s still in its early stages,” he said, noting that the new paradigm — social-based ads — is based on the right idea but that the infrastructure to support it is still young and unsophisticated. Meanwhile, many in the industry continue to plug away at the old paradigm, using statisticians and advanced behavioral techniques to wring more dollars out of display ads.
So what will the online advertising industry look like when it catches up to the new paradigm? One possibility can be found in Buzzfeed’s own office where a creative team works with the site’s advertisers to help make their content as social as possible.
On the Buzzfeed site, ads are seeded in the stream of stories and are supposed to be appealing in the same ways as the site’s native content. This is consistent with Peretti’s mantra that a publisher should ensure the ad type is native to the platform (advertorials in print newspapers, for instance).
Another possibility is the New York Times’ clever new Ricochet product which allows brands to strap their ads onto a Times article. The ads then travel with the article as it bounces around the social sphere of Twitter and Facebook.
Peretti and other media leaders will be talking about these issues and more at paidContent 2012, May 23 in New York City. | <urn:uuid:fd45db79-9434-4113-95eb-04578e6012ab> | CC-MAIN-2013-20 | http://paidcontent.org/2012/04/28/buzzfeeds-jonah-peretti-display-dollars-arent-coming-back/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698924319/warc/CC-MAIN-20130516100844-00013-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.94372 | 575 | 1.742188 | 2 |
Jan. 19, 2010 Researchers in Freiburg have developed a highly-sensitive, miniaturized mobile ozone sensor which can be used not only in air, but also in water and in the vicinity of explosive gases.
The Fraunhofer Institute for Applied Solid State Physics IAF in Freiburg is developing improved chemical sensors that are not prohibitively expensive. One particularly important area of application involves the regular measurement of ozone content in air and other media. This gas is a powerful oxidizing agent and can cause a wide range of symptoms in humans, including lacrimation, irritation of the mucous membranes in the mouth, throat, and bronchial tubes, headaches, coughing and even deterioration in lung function. The main sources of ozone pollution are industrial and transport emissions; particularly in warmer weather, these react with intensive UV radiation to form ground-level ozone. But laser printers and copiers, machines so prevalent in modern-day offices, can also emit ozone.
The European Commission has announced its intention to cut the guideline value for ozone in the air from the current level of 90 parts per billion to 60 parts per billion by 2010, and when this new regulation comes into force, there will be an increased demand for inexpensive ozone sensors. But as project manager Dr. Volker Cimalla of the IAF explains: "Since ozone is, at the same time, an agent with high application potential, novel sensors are required, which have to be compact and affordable." Sensors are essential equipment in industrial settings such as wastewater treatment facilities and water sterilization units, where they are used to monitor the ozone concentration -- firstly to ensure the required concentration for the relevant application is maintained, and secondly to guard against exceeding hazardous thresholds for humans.
Project manager Cimalla says: "The ozone sensors currently available on the market employ extremely laborious and complex measuring procedures such as UV absorption and are therefore very expensive. By contrast, the more affordable ozone sensors have to be heated up to 300 degrees Celsius and produce inaccurate readings or only work in limited areas of application. We've done away with the need for heating by instead applying blue/violet light radiation to trigger the chemical process necessary for regeneration on the sensor surface -- this allows the sensors to operate at room temperature." The scientists built on the existing knowledge that molecules absorbed on the surface of a sensing layer alter its electrical resistance -- and can also be removed again by light irradiation. The result is a highly-sensitive, miniaturized sensor capable of measuring the low ozone levels that occur in environmental and ambient air monitoring just as accurately as the high levels associated with industrial process control. And since the sensor is extremely small, it can even be integrated into mobile equipment.
Other social bookmarking and sharing tools:
Note: If no author is given, the source is cited instead. | <urn:uuid:27e7fcda-8822-4c28-872c-df6615f07c72> | CC-MAIN-2013-20 | http://www.sciencedaily.com/releases/2010/01/100118091915.htm | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368710006682/warc/CC-MAIN-20130516131326-00059-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.929391 | 573 | 3.203125 | 3 |
September 25, 2008
Avaz Twist Tower in Sarajevo
Some readers were pretty amazed about the Project in Pristina of my last post. It seems hard to believe that in the Balkans there are some new and modern office buildings. So I decided to dedicate some attention to this peculiar buildings that grow optimistically in an area where nobody would expect economical prosperity.
The Avaz Twist Tower will be the new headquarters for Avaz, the popular Bosnian newspaper company. It’s located in Marin Dvor, Sarajevo's business district which has recently been totally renovated.
The new tower went under construction in 2006 and it is expected to be completed some time in 2008. The Avaz Twist Tower will hold the record for being the Balkan's tallest tower and the 88th highest tower in Europe.
It is made up of a twisting glass facade and will be 142 meters tall (40 floors) with a 30 meter antenna reaching a total height of 172 meters.
At a height of 100 meter there will be a panorama-restaurant.
Before the Avaz Twist Tower, the Bosmal City Center (about this later) twin towers held the record for being the tallest towers in the Balkans, standing at a height of 128 meters. Avaz's current headquarters have been turned into a 5 star hotel and offices.
The architect of this tower is Faruk Kapidžić. The panorama of Sarajevo looks funny with this Si-Fi-Tower in the middle. Where is urban planning? | <urn:uuid:eb4deb74-df4f-4af8-9a56-7827a7b17537> | CC-MAIN-2013-20 | http://www.sajkaca.blogspot.com/2008/09/avaz-twist-tower-in-sarajevo_25.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708142388/warc/CC-MAIN-20130516124222-00026-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.948514 | 318 | 1.601563 | 2 |
Highest court in land has spoken Chief Justice Roberts tips balance in favor of upholding Obamas health-care statute
WASHINGTON — Chief Justice John Roberts joined the liberal wing of the Supreme Court Thursday to save the heart of President Barack Obama’s landmark health-care law, agreeing that the requirement for nearly all Americans to secure health insurance is permissible under Congress’ taxing authority.
What it means
What does the U.S. Supreme Court’s decision mean for South Carolinians? Among other things:
Expect more political fighting over how to implement health-care reform. Despite the high court’s ruling, Gov. Nikki Haley’s administration said Thursday the state will “opt out” of a provision of the bill that would have extended Medicaid coverage to an estimated half-million of the state’s poorest residents beginning in 2014.
Also in 2014, residents will be able to buy health insurance on “exchanges” or websites for comparison shopping. South Carolina officials have decided the federal government and not the state should manage that website. The federal government has not said specifically how the exchanges will work.
Insurance companies must spend at least 80 percent of premium dollars on health care and quality improvements instead of overhead, executive salaries or marketing. If they do not, they must provide rebates or reduce premiums to customers. This summer, more than a quarter-million South Carolinians with private insurance coverage will receive more than $19.6 million in rebates from insurance companies, according to the U.S. Department of Health and Human Services. The rebates will average a reported $131 per family.
Even as it upheld that central component of the Patient Protection and Affordable Care Act, however, the court modified another key provision of the law, ruling that the federal government cannot withdraw existing Medicaid funding from states that decide not to participate in a broad expansion of Medicaid eligibility.
The court’s historic compromise, which will affect the health-care choices of millions of Americans, amounts to a major victory for the White House less than five months before the November elections, although the Medicaid decision sets new limits on the power of the national government.
Obama welcomed the ruling, which he called “a victory for people all over this country whose lives will be more secure.”
He said the decision would allow the health-care law to offer millions of currently uninsured Americans “an array of quality, affordable health-insurance plans to choose from” starting in 2014.
“Today the Supreme Court also upheld the principle that people who can afford health insurance should take the responsibility to buy health insurance,” Obama said in speech at the White House.
He said he knew that this individual mandate “wouldn’t be politically popular” and that the debate over the law “has been divisive.” But he said the law was “good for the country” and “good for the American people.”
“The highest court in the land has now spoken,” Obama said. “We will continue to implement this law. And we’ll work together to improve on it where we can.
“But what we won’t do, what the country can’t afford to do, is refight the political battles of two years ago or go back to the way things were. With today’s announcement, it’s time for us to move forward.”
Illustrating the divided nature of the ruling, Justice Anthony Kennedy, representing the court’s most consistent conservatives, read a scathing dissent, while Justice Ruth Bader Ginsburg, representing the liberals, issued a separate opinion supporting Roberts but differing with him on key aspects of the case.
Still, Ginsburg’s summation seemed to serve as the bottom line: “In the end, the Affordable Health Care Act survives largely unscathed.”
Joined by Justices Antonin Scalia, Clarence Thomas and Samuel Alito, Kennedy called the majority’s decision a “vast judicial overreaching” that “creates a debilitated, inoperable version of health care regulation that Congress did not enact and the public does not expect.”
The Medicaid ruling, Kennedy said, leaves state governments in a difficult position. “States must choose between expanding Medicaid or paying huge tax sums ... for the sole benefit of expanding Medicaid in other states.”
The high court rejected the argument, advanced by the Obama administration, that the individual mandate was constitutional under the commerce clause of the Constitution.
But Roberts joined the court’s four liberal justices — Ginsburg, Sonia Sotomayor, Stephen Breyer and Elena Kagan — in ruling that a penalty for refusing to buy health insurance amounts to a tax and thus is permitted.
Passage of the legislation by the Democratic-controlled Congress in 2010 capped decades of efforts to implement a national program of health care.
Eventually, the act is supposed to extend health-care coverage to more than 30 million Americans who currently lack it.
“No longer will Americans be a heart attack or a car crash away from bankruptcy,” Senate Majority Leader Harry Reid, D-Nev., said in a speech on the Senate floor Thursday after the ruling. “No longer will Americans live in fear of losing their health insurance because they lose their job.”
Republicans in Congress and GOP presidential challenger Mitt Romney have vowed to try to repeal the measure.
“What the court did not do on its last day in session, I will do on my first day as president,” Romney said Thursday. “And that is, I will act to repeal Obamacare.”
The health-care issue thrust the Supreme Court into the public spotlight unlike anything since its role in the 2000 presidential election. The court’s examination of the law received massive media coverage, especially during three days of oral arguments in March, and its outcome remained Washington’s most closely guarded secret. | <urn:uuid:0b8b6052-1968-4a6f-b34d-46a9afb8b051> | CC-MAIN-2013-20 | http://www.postandcourier.com/apps/pbcs.dll/article?AID=/20120629/PC1601/120629078/1031 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702448584/warc/CC-MAIN-20130516110728-00001-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.948004 | 1,246 | 1.765625 | 2 |
In an effort to reduce HIV rates, the Center for Disease Control said this week that it may recommend that all boys born in the United States be circumcised. In The Daily Dish, Hanna Rosin called
the angry responses to the CDC's potential recommendation, "hysterical," and argued that the medical benefits make a good case for routine circumcision. "Scientifically speaking, it's not remotely controversial," she said. That may be, but her post was met with a very intimate kind of outcry from male commentators who said the procedure was a more personal one than Rosin could understand.
- Mind Your Business, writes Freddie at The League of Ordinary Gentlemen. Freddie says "heterosexual men who don't use intravenous drugs, with very few exceptions, don't get HIV or AIDS." So the idea of recommending that all baby boys be circumcised to prevent a disease that afflicts only a small percentage of people is illogical. "Circumcision is still a surgical procedure; it's permanently altering
to those with no capacity to choose or ability to prevent the surgery;
and it is changing the natural human form in the service of pursuing
health gains that benefit a statistically tiny portion of the American
- Our Foreskin, Ourselves, says The Economist. "For men, for deep-seated psychic and
cultural reasons, ensuring that your son's equipment looks like your
own, and does not renounce his membership in a tribe you belong to, can
be a very big deal."
- Circumcision Isn't So Bad, says Robert Stacy McCain at The Other McCain blog. He says Rosin was just trying to make a point about public health. "The advantages in terms of hygiene are well-known." And besides, McCain says, "familiarity with the fact of foreskinless functionality (i.e., I've fathered six kids) indicate my circumcised state is entirely adequate to the rigors of the task." But what about sexual pleasure? Chris Bodenner asks at The Daily Dish. He's optimistic. "But what if a slight decrease in sensitively actually heightens sex overall? In other words: The guy lasts longer. And that's generally better for everyone involved, no?"
- Circumcision Violates Human Rights, says Tony at the RollingDoughnut blog. "American culture gets it wrong on what should be permitted on healthy
children who do not need medical intervention and can't consent to
- There are Strong, Visceral Emotions Here I Don't Understand, Hannah Rosin writes in a lighthearted response. She seems unfazed. "I'd forgotten how passionate Dish readers, and Andrew, are on the subject of circumcision. Andrew once published a photo of this 'gruesome procedure' which has the feel of one of those pro-life placards - after which I probably rescinded his invitation to my son's bris."
Want to add to this story? Let us know in comments
or send an email to the author at
mgay at theatlantic dot com.
You can share ideas for stories on the Open Wire. | <urn:uuid:427b0823-6f25-45d7-a4f6-4110727e10ae> | CC-MAIN-2013-20 | http://www.theatlanticwire.com/politics/2009/08/the-row-over-circumcision/27155/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708766848/warc/CC-MAIN-20130516125246-00045-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.955077 | 637 | 1.867188 | 2 |
Microsoft's new Windows 8 OA 3.0 verification system will add complication and costs for ODMs (Original Device Manufacturers) who create and build PCs for the big name OEMs (Original Equipment Manufacturers). These costs will, undoubtedly, be passed on to us, the consumers.
Note: The DigiTimes piece inaccurately refers to OA 3.0 as being incorporated into the BIOS. What we are actually talking about here is UEFI firmware, which all Windows 8 certified systems must have.
According to DigiTimes, the issue revolves around Microsoft's new activation system for Windows 8.
For the OA 3.0, Microsoft plans to pre-install the Windows 8 operating system into PC's BIOS and will have consumers key-in the authorization key to activate the software through an Internet connection and will completely abandon its previous method of using a COA [Certificate of Authenticity] label.
OEM BIOS activation is nothing new. OA was first seen in Windows XP, and OA 2.0 with Windows Vista and Windows 7. Both of these mechanisms are now easily bypassed by pirates looking to install/sell unlicences copies of Windows.
However, now rather than shipping PCs with a COA, keys will be incorporated in the system's UEFI firmware, and this will increase production costs for ODMs because each machine will require individual attention to squirt the key into the UFI firmware (rather than just sticking on the COA). Technicians will also require more training. Finally, the absence of a certificate on the machine could also increase costs because of installation overlap (Microsoft charges a per-install fee, so having to install a second key because of an error would increase costs.
There's also concern about who will bear these extra costs:
The sources also revealed that the ODMs believe Microsoft is playing a two-faced game with the notebook players - on the one hand, the software giant has told notebook ODMs that brand vendors will pay all the increased cost, while they told the brand vendors that ODMs will be responsible for the cost.
One thing is for sure ... you and I will be the ones ultimately footing this bill.
(Image credit: jollyUK)
- Windows 8: An installation walk-through
- Windows 8 to feature 'fast startup mode'
- Microsoft does an awesome job of revamping the Windows 8 Task Manager
- Yes, UEFI 'secure boot' could lock out Linux from Windows 8 PCs
- Do you STILL trust Microsoft to build antivirus support into Windows 8?
- Windows 8 certification will make it 'difficult or impossible' to install Linux on PCs
- Windows 8 design flaws Microsoft MUST address
- Gartner: Late arrival of Windows 8 might limit its appeal
- Windows 8: 'Refresh' and 'Reset' your PC | <urn:uuid:dfa5bc83-349b-43f8-94eb-027403387be4> | CC-MAIN-2013-20 | http://www.zdnet.com/blog/hardware/windows-8-to-increase-pc-production-costs/15766 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708766848/warc/CC-MAIN-20130516125246-00065-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.928246 | 584 | 1.953125 | 2 |
Posted by: Joshua Wood
A friend recently was very frustrated about wired/wireless options on her laptop. She has a hard network connection at her home office, but also uses the laptop elsewhere in the house. What she was doing was just using wireless wherever she was (including her desk) and never plugging in. Then… one day, she plugged in and realized how much greater the Internet speed was. “But I have to turn off the wifi to use it!” she said. “I don’t want to keep manually turning it off and on every day!”
Her computer was using wireless as the primary connection. But… since Windows uses the network connection with the lowest metric when there is more than one connection available, this means you can force it to use wired by changing the metrics. We went ahead and changed her settings to prefer wired… meaning no manual changes needed as she went from wireless to wired and the assurance she would be using the faster wired connection when she was plugged in. (She says it changed her life. Perhaps a bit dramatic, but nonetheless, it’s a fantastic tip to be aware of to ensure a good Internet speed experience.)
Here’s how you do it with Windows 7:
1. Go to the Start menu. Type in Run, hit enter and type ncpa.cpl then OK.
2. Right click on your Wireless Connection.
3. Choose “Properties.”
4. Doubleclick “Internet Protocol Version 4 (TCP/IPv4).”
5. Click on “Advanced.”
6. Uncheck “Automatic Metric.”
7. Enter the number 15 in “Interface Metric.”
8. Click OK on all windows.
9. Next, right click the Wired Connection.
10. Choose “Properties.”
11. Doubleclick “Internet Protocol Version 4 (TCP/IPv4).”
12. Click on “Advanced.”
13. Uncheck “Automatic Metric.”
14. Enter the number 10 in “Interface Metric.”
15. Click OK on all windows.
Essentially, you can enter any value under “Interface Metric” as long as the Wired is lower than the Wireless. Then Windows 7 will choose Wired when you have both on. And… no more manual switching.
Until next time, | <urn:uuid:dbb21ac9-34cf-46b0-815f-04dc0fd79536> | CC-MAIN-2013-20 | http://itknowledgeexchange.techtarget.com/techstop/how-to-prefer-wired-connections-on-windows-7/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368710006682/warc/CC-MAIN-20130516131326-00039-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.943303 | 520 | 2.046875 | 2 |
After several years of prosperous growth and a major housing boom, the Inland Empire has become emblematic of the recent economic crisis, giving it the name "Foreclosure Alley". The area owes its high concentration of economic distress to its birth as a commuter "convenience": ten years ago, new real estate and loose financing lured families who work in Los Angeles and San Diego to invest in the exurb communities with pools and swathes of lawn, at the cost of two-to four- hour commutes per day. Banks facilitated the surge with generous loans, and families built expensive backyards for their children, and new cars for their gas-consuming commutes. In 2005, the Inland Empire boomed with 52% of Southern California's new home development; from 2000 to 2007, population expanded by 25%. Buoyed by fiscal optimism and pursuit of the American Dream, people refinanced their homes and spent hundreds of thousands of dollars on pools, spas, tiki bars and fire pits. Lake Elsinore, a city in the Inland Empire, launched its urban identity campaign with the exhortation, "Dream Extreme", a slogan that didn't anticipate the effects of variable-rate mortgages, falling property values, and rising gas prices. The terms of its growth have made it particularly vulnerable to the national downturn, and the region has recently embarked on what forecasts to be a long arc of economic suffering. Between 2004 and 2007, over 360 000 homes were purchased. By November 2008, virtually all are worth less than what is still owed on them, and over a third have defaulted. As a correlating factor, the Inland Empire also boasts the highest jobless rate in America (over 10%).
The landscape of the Inland Empire is a wasteland of empty homes and ghosts of the American Dream. Local signs offer tours of foreclosed homes and aid: "Stop the F-Word! 1-800-RESCUE-ME." Residential streets are lined with "bank owned" signs, and forelosure notices mark windows. The epidemic has yielded some odd industries: laid-off real estate agents have turned to businesses that "trash out" foreclosed homes. Some people abandon a full furnishing of goods: large TVs, leather sofas, family photos, 401k statements, and even an urn. Other industrious workers freshen dead lawns with green spray paint, while code enforcement officers drain abandoned pools. As one says, "You know something is wrong when the lawns are brown and the pools, green."
Multimedia piece is photographed and directed by Lauren Greenfield.
Lauren Greenfield, who is represented by INSTITUTE for Artist Management, directed this multimedia short (it was produced INSTITUTE for Artist Management). For more info on INSTITUTE and Lauren Greenfield, please visit instituteartistmanagement.com or her personal website at laurengreenfield.com
Loading more stuff…
Hmm…it looks like things are taking a while to load. Try again? | <urn:uuid:c0dff250-83ec-4821-9e6b-73a45a1feb5c> | CC-MAIN-2013-20 | http://vimeo.com/6977075 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368706153698/warc/CC-MAIN-20130516120913-00074-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.953201 | 614 | 1.921875 | 2 |
Race relations: Blacks, Republicans see problems since '08, poll says
But a majority of Americans don't believe Obama has affected race relations in the US one way or the other, according to a new Monitor/TIPP poll.
Blacks and Republicans are more likely than anyone else to say that the presidency of Barack Obama, America's first black chief executive, has impaired race relations in the United States and made race more difficult to discuss.Skip to next paragraph
Subscribe Today to the Monitor
But more broadly, according to a new Christian Science Monitor/TIPP poll, a majority of Americans – in both genders and across all ages, incomes, political persuasions, and races – don't believe the Obama presidency has had any effect on race relations in the US beyond affirming the country's willingness to move past race as a factor in presidential electability.
"The majority of Americans polled felt [Mr. Obama's race] was not a factor [in race relations]," says Raghavan Mayur, the TIPP pollster in Ramsey, N.J. "Most people look at him not in terms of race; they look to him as the president of the country."
Since his inauguration, Obama has walked a tightrope, dividing America more by class than by race when he's talked about forcing the rich to pay a larger share of the US tax burden. His comments on race have been both eloquent – for example, the Philadelphia "race" speech during the 2008 primary season – and awkward, as in last year's episode in which he said that Cambridge, Mass., police "acted stupidly" in arresting his friend, Harvard professor Henry Louis Gates Jr.
"Obama's liberal supporters have made a big deal about him becoming the first black president, and his detractors have made a big deal about him supposedly practicing reverse discrimination," says political historian Jason Sokol. "He's always been in a difficult spot."
But at least some black scholars hold Obama accountable for raising the racial stakes.
Carol Swain, a law professor and race expert at Vanderbilt University in Nashville, Tenn., raises several examples, including the Gates affair and Sonia Sotomayor's appointment to the Supreme Court. In these examples, she says, "it seems like Obama has made race more salient in a negative sort of way that will make white people feel like they're not represented."
The poll findings come on the heels of several high-profile racial flash points this summer and ahead of midterm elections that will determine the balance of power in Washington. Thirty-two percent of Republicans say race relations have worsened (and 8 percent say they've improved), while 37 percent of Democrats say they're better (16 percent say they're worse).
Some liberal groups, such as the National Association for the Advancement of Colored People (NAACP), have publicly chided one of Obama's main opposition groups, the "tea party" movement, for allegedly harboring racists.
Conservatives have fired back, saying that what experts call "nonfalsifiable claims of racism" – i.e., using the race card – has become an irrelevant tactic in the eyes of most Americans.
The divisions in race attitudes, says Professor Alexander, goes back to the birth of the modern conservative movement in the 1950s and to the perception by many liberals that the right's ideas are mean-spirited and intellectually corrupt. With a black president in office and conservatives staging a challenge to his policies, the divides in perceptions have flared up in earnest.
One newsy example: Indian-born author Dinesh D'Souza's recent Forbes story about Obama entitled, "How he thinks." Mr. D'Souza proposed that Obama's estranged Kenyan father inspired the president to adopt "the cause of anticolonialism."
The Columbia Journalism Review called D'Souza's article "the worst kind of smear journalism – a singularly disgusting work."
Given such reactions, many conservatives feel it's better not to speak their piece at all. "When conservatives want to chip into conversations – race being the most obvious one – they find themselves getting their heads bitten off," Alexander says.
But if mostly white conservatives are feeling put upon by the current tenor of the race debate, they are joined by blacks – 26 percent of whom said race relations have gotten worse under Obama (versus 22 percent who said they felt it's better).
(Hispanics felt differently, with 36 percent saying race relations are better and 22 percent saying they're worse. White men are nearly evenly split on the question, with 21 percent believing relations are worse and 20 percent believing things are better.)
Blacks, too, are reacting to the "racialized" political and cultural battles – but from a vastly different vantage point.
The tea-party insurgency has demoralized many African-Americans, especially after hotly contested allegations earlier this year that a group of tea partyers shouted racial epithets to a group of black politicians near the Capitol, says William Boone, a political science professor at historically black Clark Atlanta University.
For blacks, "some of the things these folks are supporting would be interpreted as being antiblack or detrimental to black progress," even though many blacks share some of the same conservative values politically, says Professor Boone.
He adds, "Black folk in general indicate that a lot of hits [Obama] has taken is solely because he's black. Whether that's factual or not, that's the perception."
By region in the poll, New England and the West offered the starkest contrast on perceptions of race relations: Twenty-seven percent of New Englanders said relations have improved, while 26 percent of Westerners said relations have worsened. Within one region, the disparity in beliefs was largest in the South: Twenty-four percent of respondents said Obama has worsened race relations, and 16 percent said the president has helped calm racial tensions.
The poll of 908 US adults took place between Sept. 9 and 12. The poll has a 3.3 percent margin of error. | <urn:uuid:ad02f048-e1fc-4ffe-a017-1db7b49cb418> | CC-MAIN-2013-20 | http://www.csmonitor.com/USA/Politics/2010/0918/Race-relations-Blacks-Republicans-see-problems-since-08-poll-says | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368706499548/warc/CC-MAIN-20130516121459-00024-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.968155 | 1,233 | 2.09375 | 2 |
Saudi Arabia is on its way to the future of farming; a brand new aeroponic, soil-less, sunless, pesticide-less, low-energy farm was just installed in the town of Jeddah. The farm was created by AeroFarm, a company that manufactures a new type of hydroponic growing unit that uses a recyclable cloth material, instead of soil to anchor plants. The system provides nutrition to plants with air circulation, a nutrient rich mist and an array of low-energy, LED lighting. The farms can grow fresh local produce indoors year-round in cold climates and because of their low-water usage are perfect for desert climates — with soil degradation and climate change becoming a problem around the world these things might come in handy.
AeroFarm units are unique in the hydroponic world because they can be vertically stacked and can be scaled up to grow a vast amount of food. The farms use less than 10% of the water needed for conventional farming and a water vapor reclamation system can be installed — the farm in Jeddah has one — to maximize water usage and minimize the need for an outside water source. With Earth’s population centers moving more toward cities these farming systems could provide fresh, local produce to people living in urban centers without incurring transportation expenses — and carbon emissions. The farms are easy to maintain, have low operating costs and provide predictable yields throughout the year making them highly profitable.
“Our goal is to grow indoors without the use of a greenhouse or sunlight, and to provide 100 percent of our own water by collecting humidity from the air. This is step one,” noted Luke Sestito, president of The DeLeon Group, which commissioned the Jeddah farm. “We then want to use solar and wind power to make our farms fully self-sustaining.” The Jeddah farm is the first aeroponic farm in the Middle East. It is meant to be a beacon of sustainable farming in that area of the world, hopefully showing other communities that fresh, local produce is entirely possible as long as you’ve got a roof and some electricity — preferably from a wind turbine or solar panel. Though we would love to solve this ruining our natural resources problem first, at least we know that if we demolish all our farmland and our climate, we’ve got a backup plan.
WHY THIS MATTERS:
Transporting food from farms to people’s plates emits tons of carbon each year. Aerofarms could be the key to providing fresh, local produce to people living in urban centers in a way that saves carbon emissions – and makes for fresher, healthier food.
Via Saudi Gazette | <urn:uuid:d950318d-3b5b-494a-8b0a-80c28abbb9d9> | CC-MAIN-2013-20 | http://inhabitat.com/low-energy-indoor-farm-in-saudi-arabia-uses-no-pesticides-soil-or-sunlight/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696383156/warc/CC-MAIN-20130516092623-00024-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.942284 | 554 | 3 | 3 |
Profiles in Scholarship
Robert J. Jackson Jr.
An unswerving empiricist, Professor Robert J. Jackson Jr. quantifies some of the most important corporate governance questions of our day
Professor Robert J. Jackson Jr. grew up watching his beloved Bronx Bombers at Yankee Stadium in the 1980s, and his passion for the pinstripes has not waned since. But even when contemplating his favorite team, Jackson’s mind never drifts far from the world of finance, a field that has inspired his scholarship and high-profile public service. When asked to name his favorite Yankee, Jackson settles on the peerless relief pitcher Mariano Rivera.
“Having lived through the financial crisis, there’s something almost romantic about knowing with utter certainty what’s going to happen in the ninth inning of a baseball game,” says Jackson, a noted authority on executive compensation and corporate governance. “Rivera is not risk-free, but he’s as close as an asset gets.”
A former investment banker, Jackson knows how to accurately evaluate assets. But it was the limited utility of such analysis in facilitating deals that propelled him toward a legal career. As a young college graduate working at Bear Stearns in 1999, Jackson advised a client to embark on a hostile takeover of an undervalued company. The client asked Jackson whether the targeted company might attempt to fend off the bid with a so-called “poison pill”—a defensive tactic forcing the buyer to negotiate with the board rather than with shareholders.
“I didn’t really know what he was talking about,” says Jackson. “There was a lawyer in the room who said, ‘Not only can they adopt a poison pill, but they will, and the courts will uphold it.’ At that moment, I saw I couldn’t be a thoughtful financial professional without an understanding of the law.”
Jackson enrolled at Harvard Law School, where he co-authored an article that reverberated in the halls of government. In the piece, Jackson used valuation techniques he honed on Wall Street to show that the pensions received by CEOs of large corporations were worth, on average, around $15 million to $20 million. The Securities and Exchange Commission took notice and immediately mandated disclosure of those arrangements.
“It was very rewarding for me that my academic work led to real changes in policy and the way shareholders and corporations interact with each other,” says Jackson.
After law school, Jackson practiced at Wachtell, Lipton, Rosen & Katz in New York City before joining the Columbia Law School faculty in 2009. The Law School deferred his appointment for a year while he served as an adviser at the U.S. Treasury Department, where he helped establish compensation rules for corporations bailed out by the government during the financial crisis. Jackson has used this insider’s experience to craft a unique Law School course training students on counseling investment bankers.
“If the lawyers who worked for the firms most involved in the crisis had understood a little more about what their clients were doing, we might have had a very different result in 2007 and 2008,” Jackson says, referring to the run-up to the financial meltdown.
While much of Jackson’s academic work has focused on the nuts and bolts of corporate pay structures, he approaches his field of expertise with a broad vision of how a society should stimulate productive behavior. “We should care about whether our society’s arrangement gives people a reason to try and improve our lot,” he says. “That’s what I spend the entire day thinking about.”
Of course, on game days, Jackson is also thinking about how to make it to his seats at Yankee Stadium. It is a task he tackles with the precision and predilection for data that distinguishes his academic work.
“One of the perks of my job is that I can get there in 27 minutes from here,” says Jackson, a season-ticket holder. “I’ve figured it out over time.” | <urn:uuid:79ffc01c-e500-4754-a393-e76acd86b3ef> | CC-MAIN-2013-20 | http://www.law.columbia.edu/magazine/61875/finding-value | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703298047/warc/CC-MAIN-20130516112138-00075-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.974679 | 848 | 1.507813 | 2 |
Before Nov. 14, the world knew nothing about Massachusetts’ greatest buck. It had lived in total secrecy.
The details of the hunter and the hunt by now have spread across the country and likely will be featured in several national magazines and documented in the record books. Today, though, we can piece together and celebrate much about the magnificent buck’s life and family.
We’ll never know, of course, the identity of his special mother and father — or even which of his two parents actually passed down the remarkable genes for his gigantic antlers. Many erroneously assume that it’s always the buck that bequeaths his son’s antler characteristics. While that may be true, just as human mothers carry their sons’ trait for baldness, deer mothers can pass on spectacular traits to their young as well.
Those who argue that shooting big bucks hurts the gene pool don’t understand genetics. Does sired by exceptional parents remain equally valuable repositories of DNA, and great bucks breed many times before they reach full, spectacular maturity. Superior antler growth is also largely dependent on habitat quality, nutrition, longevity and calcium content of soils.
We do know much about his parents’ relationship. Typical of all deer, they mated only one day during the doe’s 24-hour early November heat. A day later, their biological imperative having been satisfied, with mutual willingness and total lack of resentment, they permanently parted ways.
She would soon rejoin her maternal wintering group, destined to be a single mother in a little less than seven months, and he would obsessively continue seeking other neighboring hot does emitting irresistibly alluring perfumes of estrogen. His polygamous nature over the years likely resulted in the birth of several other Rutland-area giants.
Our Rutland buck’s mother was hyper-wary, having previously survived one or more bow hunting, shotgun and muzzle-loader seasons every year between Oct. 15 and Dec. 31. Her tentative movements would be largely crepuscular and nocturnal, as she customarily bedded down for most of the day to avoid most dangers. Her eyesight, well adapted for the night, would serve her well in her nocturnal movements and feeding. During the full moon, she would often forage all night.
She was also remarkably tough, having endured one if not more food-scarce winters. She benefited from a lowered metabolism, her species’ body response to diminishing hours of daylight. Those seasonal physiological changes — and her 20 percent-of-body-weight accumulated fat — would allow her to live on about 30 percent fewer calories and reduce her winter movements by 50 percent.
Buds and other slim pickings close to her bedding area would provide most of her nutrition when she wasn’t nocturnally browsing on someone’s landscape or couldn’t find her favorite acorns, open fields of winter rye, or patches of clover.
On the coldest days, she’d preferably bed on sunny, southern-facing slopes, often favoring pine groves that additionally afforded overhead cover. Looking down her hill, constantly testing the wind and independently focusing her ears, she would never totally be at rest.
Her remarkable digestive system, often compared to an internal boiler room, would provide her an amazing degree of body heat, keeping her warm on the coldest New England nights. Her dense, long, hollow body hair was so insulating, she typically didn’t melt the snow she had bedded in. In response to the dangers of predation, her four stomachs would allow her to eat and swallow large quantities of food fast, to regurgitate and chew later, extracting maximum nutrition in safety at her leisure.
Our special buck’s mother listened intently to the cacophonous music of the human world around her, recognizing snowmobiles, ATVs, chain saws, traffic, dogs and footsteps, knowing well which to ignore, and which to flee.
Her historically important pregnancy that significantly altered our record book occurred six years ago. Inside her, all that winter, her soon-to-be famous fawn developed, its emergence essentially timed for early June when she could get enough nourishment for milk production and find vegetation thick enough to hide him.
After being carried for almost seven months, like all fawns, Rutland’s great buck was raised by a totally devoted and mentoring, if not constantly doting, single mother. It’s likely he had a twin. Both would be left entirely alone for many hours each day, separated by a good distance, as their mother fed and bedded elsewhere, removing her scent and appearance from their sanctuary, and allowing their initially scent-free bodies to give them a degree of protection against predators.
For the first couple of weeks, much unlike human babies, they would instinctively remain totally quiet and motionless despite building hunger, patiently waiting to be nursed briefly only twice each day.
Rutland’s special fawn was lucky on too many occasions to even count. Many of his age class were discovered and devoured early by coyotes, bears and bobcats. When it reached a month old, it finally could outrun the ever-dangerous, always scavenging coyotes which would soon revert to eating mostly rodents.
Our little “skipper” or first-year “button buck” would keep his spots until around August, drinking his mother’s slightly bitter, tannin-tainted milk as late as November. All the while, he learned well from his mom a hundred edible forbs, wildflowers, grasses and buds. He would find ferns, barberry and certain other exotic plants most distasteful, eating everything but them and leading to their spread.
He would quickly discover he could eat poison ivy and poison mushrooms with impunity and that he really liked lady slippers, lilies and other wildflowers. The buck also enjoyed corn tops, apple buds, acorns and highly nutritious landscape plants like hostas and yews, which he’d dine on undetected in suburban back yards at night. He definitely loved first-year tree growth, too.
Annoying nuisances — including ticks, black flies, mosquitoes, bot flies and horseflies — plagued him from the start. His dense, short and wiry red hair would turn to gray-brown, well mimicking tree bark and insulating him during his first winter.
He was born with keen eyesight and hearing, but his sense of smell would prove phenomenal and key to his survival. He would learn to avoid human odor, amazingly able to detect it downwind several hundred yards from its source.
During his education, he certainly came close to several bow hunters’ tree stands. We’ll never know how many archers may have let him pass, patiently waiting for a fully mature buck or heavy doe to harvest. He definitely heard gunshots — some very close. All the while, our button buck skipper would learn to become a buck, displaying an ever-more phantom-like, reclusive nature until his second autumn, when diminishing daylight would trigger his testosterone production, drive him to leave his bachelor group, and mate with his first doe.
Our magnificent buck certainly mated with many Rutland does over the years, passing on his remarkable genes to dozens of fawns. His legacy will become apparent only with future Rutland hunters’ harvests.
Early on, as a wannabe stud of a mere year and a half, he had to be sneaky, risking being gored by the antlers of much bigger rutting bucks on territory. His neck was likely stabbed numerous times, and he was certainly tossed and bulled over on several occasions by much heavier adversaries. He would engage in antler-rattling skirmishes, becoming a serious contender by his third autumn.
By the wear on his teeth, we know our fully mature buck was 6-1/2 years old when taken. His spectacular, deciduous antlers likely would have never grown bigger, and in subsequent years actually would have begun to diminish progressively in size.
All aging bucks deteriorate. Had he lived to age 10, a feat of longevity rarely accomplished, his teeth would have ground down to the gums, a natural function of the abrasive minerals inadvertently chewed during his grazing. He would have died shortly after of starvation, unable to chew his food.
The great Rutland buck was tagged and claimed by an extraordinarily skilled and deserving bow hunter, Dan Daigle, without whom we might never have known of its existence, or what the growth potential of our Massachusetts herd can be.
Forever now, many across the country will refer to this supremely magnificent animal as the Daigle buck or the Rutland buck. But it truly belongs to Massachusetts, especially all of us in Worcester County who have proven good stewards of our land and proudly value our exceptional wildlife heritage.
Outdoors: Get a jump on tuna season (May 17, 2013)
Outdoors: Hoping someone can save this land from development by July (May 14, 2013)
Outdoors: Mother’s Day nature lesson (May 10, 2013)
Outdoors: Thousands of shad expected to ascend on Connecticut River (May 7, 2013)
Outdoors: Gold Pins for finest catches of 2012 (May 3, 2013)
Outdoors: The best way to hunt, and cook, a turkey (Apr 30, 2013)
Outdoors: Some setters still top-notch hunters (Apr 26, 2013)
Outdoors: Help needed to preserve our wild heritage (Apr 23, 2013)
Outdoors: High feather prices have fly tyers playing waiting game (Apr 19, 2013)
Outdoors: Prepare ahead for seasickness (Apr 16, 2013) | <urn:uuid:dc321b13-5cf3-4e87-b37d-203a5b8e836f> | CC-MAIN-2013-20 | http://www.telegram.com/article/20121204/COLUMN10/112049952/1009/SPORTS | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368700264179/warc/CC-MAIN-20130516103104-00055-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.978423 | 2,053 | 2.5 | 2 |
Mike emailed me the other day and asked a reasonable question, “What happens if everyone stops buying things, and tries to live with fewer things? Doesn't that destroy the economy even further?”
It’s a valid concern. In my forthcoming book, The 100 Thing Challenge, there’s a chapter that offers a high-level answer to this question. But since my book doesn’t hit store shelves and Kindles until December 28th (which doesn’t stop anyone from pre-ordering it, hint hint), I’d like to try to offer up a short answer to Mike’s question. Here are a few principles on how you can buy less and save the economy.
When we use our skills and resources well, it is always good for an economy. Buying stuff we cannot afford, manufactured out of materials that ruin the earth and made by people who are exploited, using credit backed by money we don’t really have isn’t good for the economy. The statistic we all know is that 70% of the U.S. economy is fueled by consumption. Unfortunately, too much of that consumption is unsustainable. It’s financially unsustainable. It’s environmentally unsustainable. It’s socially and morally unsustainable. Furthermore, it’s emotionally unsustainable - we who have bought all this consumer junk aren’t any happier. It’s not that buying stuff is wrong, it’s that American-style consumerism has created an unsustainable economy propped up by the guilt of average people who feel pressured, either by duty or by jealously, to consume unnecessarily using credit. The reaction isn’t to stop all commerce, rather it is to change the way commerce happens.
- The first principle is to spend our money well, which from here on out means to buy less stuff.
Money unspent can be money used well. If you’ve noticed, big business and banks have been stingy on lending their capital. That’s because for decades our economy has been fueled by you and me seeking unwise loans to buy overpriced and unnecessary things from unethical lenders who, if they did the math, should have known we could never pay them back. There is now a theme among some preachers of economic recovery that average people like you and me should start buying again in order to give confidence back to big business and banks. So that, you guessed it, we can start the whole ridiculous cycle again. Don’t participate! Even us lowly “consumers” can save money and invest. We have more to contribute to the economy with our money than our next purchase.
- The second principle is that it is good to save money and invest.
We are humans, not consumers. Now, let’s act like it! I must confess that sometimes I’m surprised by humans. There is simply nothing else on earth remotely like us. But we’re too content to act beneath ourselves. Dogs act like dogs. Birds act like birds. Snakes act like snakes. Bugs act like bugs. Even dolphins act like dolphins. Dolphins are scary smart. Even so, they still swim around and act like dolphins. But humans? We often act like jackasses. We’ll divorce the woman we once loved in order to pursue wealth. We’ll charge up a credit card in order to buy cute clothes to try to be more attractive for some guy who treats us like nothing. We’ll stop being friends with someone who’s no longer in our socio-economic strata. We sometimes act inhuman. We sometimes act as if things are more important than people. Just flip that around. Act like people are most important. You’ll find yourself buying less things and you’ll start making the world a more valuable place. And you’ll be a blessing to many people along the way, including yourself.
- The third principle is to love people, not things. You’ll buy less stuff and make the world around you more joyful.
I’m not an economic guru. I’m not a policy maker. I’m pretty much an average person like most of you reading this blog, which means I’ve got the same common sense that you do. If we people were to spend the next decade or two acting on these three principles, we’d save the economy and make the world a better place.
There would still be unethical big businesses. There would still be greedy bankers. There would still be foolish consumers. But if we didn’t play along with American-style consumerism, if we decided that life -- that every human life -- is worth more than material possessions, well, it would really be an amazing world for our grandchildren to live in. As it is, if you’re privileged enough to be reading this blog post on a computer, you’re likely living in a pretty good world yourself. But you know that it’s going in some wrong directions. The economic, ecological, social, and spiritual foundations of debt-fueled American-style consumerism are unsustainable. It’s not likely that we’ll be able to recover and reorder the economy on a global scale in the next decade or two. We can, however, recover and reorder our own economic priorities. And, at the end of our lives, we can leave the world a little bit better if we’ve focused on loving people more than anything else.
That’s why I truly believe that a 100 Thing Challenge is a great idea for people like you and me. It will change our behavior and help us form new habits. It will open up the possibilities of a whole new world: the possibility of spending less and avoiding economic disaster! | <urn:uuid:aa2a818c-8290-4307-9f04-f23af6666c3d> | CC-MAIN-2013-20 | http://guynameddave.typepad.com/david_michael_bruno/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698924319/warc/CC-MAIN-20130516100844-00046-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.956425 | 1,208 | 2.234375 | 2 |
Planners with the agency can consider academic programmes; students will have access to data
The Chennai Metropolitan Development Authority (CMDA) has been recognised as a research centre by the Centre for Research, Anna University.
With this, students, teachers and researchers in urban planning will have easy access to data and documents on these subjects. CMDA on Tuesday announced that the move will allow for “ collaborative research for the purpose of pursuing Ph.D/M.S (by research programme) under part time mode with effect from January 2013.”
The move is expected to specifically benefit planners who are currently employed with CMDA and who wish to pursue research. Many of them are pursuing research after retirement from CMDA as they were not able to do so while at work. “The officials of CMDA with relevant UG/PG qualification will also be permitted to register for Ph. D/M.S (by research programme) under part-time mode. This recognition is to be renewed once in three years in compliance with the required norms of Anna University,” the release said.
“Good research papers will get published by planners associated with CMDA. This will provide an answer to challenging aspects of urban planning and development in Chennai. In its first year, the centre is likely to churn out five to 10 research papers. We cannot expect a large number of research papers as the planners will also have to do their day-to-day job,” said S. Santhanam, former member-chief urban planner, CMDA.
The existing data generated by CMDA will be subjected to rigorous research by its own staff and other scholars. This is expected to solve challenges to urban planning.
“We need research in a number of topics. The best landuse and economics to promote public transportation; pollution and other benchmarks in planning to aid selection of appropriate projects; preservation and creation of water bodies, marshland and urban forestry in an expanding city; and very importantly planning to aid the expansion of the economy," said Raj Cherubal, Director of CityConnect.
“Institutions such as Harvard and MIT send their students to Chennai to study challenges to urban planning. The new status of CMDA may facilitate better access to data. Scholars can directly contact resource persons,” said a retired official of CMDA | <urn:uuid:929236d7-d412-46d2-8602-a6b7f2bc77ac> | CC-MAIN-2013-20 | http://www.thehindu.com/todays-paper/tp-national/tp-tamilnadu/cmda-declared-a-centre-for-research/article4409810.ece | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696381249/warc/CC-MAIN-20130516092621-00074-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.964662 | 475 | 1.679688 | 2 |
An Oregon dairy accused of dumping animal waste into the water is paying $12,000 in fines.
RSC Dairy in Tillamook has agreed to pay that amount to settle its violations.
The U.S. Environmental Protection Agency said the violations were discovered during an inspection in January 2010.
Investigators say animal waste was discharged from the dairy into Hall Slough, a tributary to the Wilson River, which flows into Tillamook Bay. RSC Dairy keeps around 500 cows at its Tillamook facility.
The EPA says samples of the waste showed a high concentration of E. coli bacteria. The agency adds that the dairy has taken steps to correct the situation. | <urn:uuid:7979fa4a-6f05-4287-93cb-2d5439447077> | CC-MAIN-2013-20 | http://www.kptv.com/story/14953406/dairy-fined-for-dumping-animal-waste | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703298047/warc/CC-MAIN-20130516112138-00039-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.977271 | 138 | 1.890625 | 2 |
extending mathematica's functionality
- To: mathgroup at christensen.cybernetics.net
- Subject: extending mathematica's functionality
- From: Jack Goldberg <Jack.Goldberg at math.lsa.umich.edu>
- Date: Tue, 18 Oct 1994 16:42:50 -0400 (EDT)
In a recent note to sci.math.symbolic, Richard Chen at Yale (I believe
this is correct) asked how to simplify the output of
This output leaves much to be desired in terms of simplicity. It appears
to me that the difficulty in simplifying the output is due to a more
pervasive issue which I would like to raise. There are two parts:
(1) There is no single command which combines sums of
logarithms into the logarithm of their product. That is, Log[a]+Log[b]
cannot be written as Log[a*b] without some sort of programming. The
command PowerExpand does the opposite: PowerExpand[Log[a*b]] =
Log[a]+Log[b]. Such a command would help in Chen's problem but I think
item (2) to follow is also necessary.
(2) Without the assist of PowerExpand, Log[Exp[x]] = x and
Sqrt[x^2] = x would not be possible without programming. But PowerExpand
will not simplify
ArcTrig[Trig[x]] = x, where Trig is any of Cos, Sin, Tan etc.
There is no single command that does this but I think there
ought to be. I'll go one step further. Let f be a function with an
inverse, InverseFunction[f]. Now f[InverseFunction[f][x]] = x but
this simplification does not occur in the other order
I would like to see GeneralPowerExpand which leads to
GeneralPowerExpand[InverseFunction[f][f[x]]] = x
If such an operation were available, Chen's problem would vanish.
While I'm on the topic of what I would like to see in Mathematica,
let me raise the following problem which I stumbled upon quite recently.
Let y = Sqrt[x/(1-x)]. Then
Integrate[y,x] = (x-1)y[x]-1/2ArcTan[y[x]*(1-2x)/2x]
This antiderivative of y[x] is correct subject to various comments about
where x is and which value of the multivalued functions you take.
However, Derive and Maple V2 give much simpler answers. Both contain the
term (x-1)*y[x], but the more complicated term in MMA's answer is
replaced by a signficantly simpler expression which differs (as it must)
from Mma's by a constant. I was unable to use Mma to simplfy the
expression involving ArcTan and found myself manipulating inverse trig
functions until at last I showed that all three answers do differ by a
constant. (Of course I graphed all three answers and differentiated all
3 to confirm my conclusion before I undertook the painstaking task of
manipulating them.) One of the reasons I was unsuccessful in using Mma
for this task is due to the fact that Mma is missing a package like
`trigonometry.m for the inverse trig functions.
Has anyone out there undertaken this chore or will inverse trig
functions always remain poor relatives.?
Please scatter amoung my sentences an appropriate number of "I
think", "if I'm not mistaken", "this is probably well-known" and so
Prev by Date:
Re: plots in reverse order
Next by Date:
Mac to IBM
Previous by thread:
Library of Signal processing routines
Next by thread:
Mac to IBM | <urn:uuid:490dbabb-3632-4590-933a-24817b1a0c7d> | CC-MAIN-2013-20 | http://forums.wolfram.com/mathgroup/archive/1994/Oct/msg00010.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702448584/warc/CC-MAIN-20130516110728-00052-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.931023 | 844 | 1.734375 | 2 |
It follows that this general-purpose bicycle makes a pretty good starting point for any cycling beginner – and for us to describe how other bikes are different.
But first let us define the middle ground of bicycle design. The wheels are large, commonly 622 or occasionally 559 size - see Tyre Sizes for an explanation of those numbers - and shod with tyres of medium width (32 to 42mm) for easy and comfortable rolling on roads and decent tracks, without the added weight of suspension – although an increasing number of upmarket hybrids also have this feature.
Almost all configurations of pedal cycle (i.e. tandems, tricycles …) are made in this style and some of those, e.g. folding bikes, necessarily involve smaller wheels - often with suspension to provide a big-wheeled level of comfort.
Hybrids have derailleur gears – it is the most common kind of gearing after all – with three front chainrings to provide a wide range. Beginners and less energetic riders do not have the knack of pedalling rapidly, so top gear will be over 100in, whilst a bottom gear under 30in is what anyone can deal with to get up steep hills.
Some kind of flattish handlebar is the norm, positioned quite high and close to the saddle for a fairly upright body position, as befits that kind of rider, and with all the gear and brake controls at the rider’s fingertips.
This jack-of-all-trades will do most things well enough, until and unless your cycling interests broaden to require another more specialised bicycle or two. It probably won’t come with much other equipment beyond the bare bike, but the frame should nevertheless incorporate the usual threaded eyes for mudguards and a rear carrier. If you’re lucky there may also be eyes on the fork for a front low-load carrier. Lighting will also have to be added.
If you are certain to want all or some of these 'accessories', it pays to look at trekking bikes or tourers where they are part of the original specification. | <urn:uuid:3610536c-58d1-4cd7-b6d3-2be299709a38> | CC-MAIN-2013-20 | http://www.ctc.org.uk/cyclists-library/bikes-and-other-cycles/cycle-styles/hybrid-bike | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696381249/warc/CC-MAIN-20130516092621-00058-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.927348 | 431 | 2.0625 | 2 |
Country similarity theory was developed by a Swedish economist named Steffan Linder. Country similarity refers to what? Is it similarity of location or culture or political/ economic interests or technological capability (that is acquired advantage) or natural advantage or lack of it? Traditional trade theories speak of difference in demand or supply conditions or both as a necessary condition for trade between countries. That is, the traditional trade theories are built upon differences. But the country similarity theory is built of identical features of nations in trade. 8 out of top 10 trading partners of the USA are developed economies. Globally 11 out of 12 largest players in world trade are developed nations.
Developed countries trade more with developed countries: Products of a developed country match demand and user conditions of another developed country only. Hence the similarity in development pace decides trade between countries. The reasoning is that a developed country introduces a new product and similarly developed countries find the product quite useful and hence go for the same. This is because needs become more or less common in countries with similar levels of development. The industrialized countries produce more; hence people’s spend power is high; the power is apportioned between domestic and foreign goods, both of course catering to similar need satisfaction.
Countries in same cultural milieu trade more amongst themselves: Countries in same cultural milieu will have similar demands as for as cultural products/services like family functions, rites, rituals, entertainments, religious ceremonies and so on. Cross country offerings are more. Countries with no similarity either by cultural, technological or other basis may not trade. While countries in the northern hemisphere trade intensively inter se, countries in the southern hemisphere do not trade intensively. The pointed out reason is that no historic ties amongst the countries. Perhaps the traders do not want to taste new shores.
Countries in similar geo-features trade inter se more: Countries in similar geo-features like ecological or climatic factors will mutually cater to cross border demands. A kind of cross-border monopolistic competition emerges with firms vying for cross-country market share with the thrust on product differentiation.
Countries with similar political and economic interests trade more inter se: Trade between countries with similar political and economic interests is more common than between countries that differ. Cuba and US are in the same continent, but due to political ideological differences they scarcely trade for over 5 decades. Cuba is a good source of supply of sugar. But US prefers not to taste Cuban sugar. EU countries amongst themselves pulled down all protectionist impediments to trade and intra-regional trade is highest, because they have similar geo-features.
Intra-industry trade abetted by similarity factor: Similarly placed countries’ capabilities as well as needs happen to be similar. So, quite a lot of intra-industry trade among these similarly placed countries happens. US exports good lot of road vehicles and imports much road vehicles as well too. Needs are same across the nations. Offerings are also same across the nations, but product differentiation is built through top gear promotion. Intra industry trade happens because of sheer dispersed desire for foreign brands. Intra industry trade accounts for approximately 40 per cent of world trade.
Steffan Linder believed that international trade of manufactured goods occurred between countries at the same stage of economic development that shared the same consumer preferences. Therefore the country similarity theory consists of the value that most trade in manufactured goods should be between nations with similar per capita income, and that intra industry trade in manufactured goods should be common.
Source: Managerial Economics Notes-PU | <urn:uuid:be7b36a1-7ce8-4deb-a74d-e55adcbed563> | CC-MAIN-2013-20 | http://www.mbaknol.com/international-business/country-similarity-theory-of-international-trade/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698207393/warc/CC-MAIN-20130516095647-00039-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.946046 | 719 | 3.34375 | 3 |
|Hunting & Fishing Licenses | Boat Registration Renewal | Alligator Hunt Registration|
Press ReleaseView print version
Shark Advisory - 8/26/04
August 26, 2004
Gulf Shores/Orange Beach, AL – Today on a routine flyover of Alabama’s beach, the Marine Resources Division of the Alabama Department of Conservation observed a larger than normal number of sharks of various lengths in the waters from the Florida state line to the west end of Little Lagoon.
The sharks were approximately 100 yards offshore and the increased number is believed to be related to large numbers of baitfish in the area. “We saw approximately 24 sharks in an area where seeing five to six is usual,” said Vernon Minton, director of the Marine Resources Division. “While we believe the increased activity is related to the increased number of baitfish, and not a direct threat to folks enjoying the waters, with these kind of numbers, we think it’s prudent to exercise increased caution.” Minton added that because an increased number of sharks was observed, his agency will make flights daily, weather permitting, to review the situation until the numbers return to usual levels.
The Marine Resources Division recommends that everyone enjoying Alabama’s coastline observe the following swimming safety tips at all times. | <urn:uuid:74adb136-940e-4737-a8bc-ee887e84d040> | CC-MAIN-2013-20 | http://www.outdooralabama.com/news/release.cfm?ID=188 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368710006682/warc/CC-MAIN-20130516131326-00052-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.938928 | 268 | 2.140625 | 2 |
Events planned in honor of MLK Day
Published: Monday, January 21, 2013 at 3:30 a.m.
Last Modified: Sunday, January 20, 2013 at 11:33 p.m.
TUSCALOOSA | The Mildred Westervelt Warner Transportation Museum will host a traveling exhibit from the Birmingham Civil Rights Institute, “Selma to Montgomery: A March for the Right to Vote.” The exhibit will officially open today, after the annual Unity March that will end with a ceremony at the museum.
The exhibit will feature photos from photographer Spider Martin, who was born in 1939 in Wylam, an immigrant community outside Birmingham. Before he was 25, he was already known for documenting the Selma-to-Montgomery march, known as Bloody Sunday. He died in 2003.
This exhibition of his work has traveled to Washington, D.C.; Atlanta; New Orleans; and Montgomery.
The Southern Christian Leadership Conference, along with numerous other local organizations, will celebrate the Martin Luther King Jr. holiday and the 50th anniversary of the civil rights movement today with a breakfast, a march and a mass rally.
-The Unity Day Breakfast will be at 7 a.m. at Stillman College. Arthur Dunning, vice chancellor of UA, will be the guest speaker. Tickets for the breakfast cost $10.
-At the conclusion of the breakfast, the Unity Day March will begin at 10 a.m. The Rev. Roy Ferguson, president of the Tuscaloosa chapter of the SCLC, is asking that 2,013 people participate in the march. Marchers will line up at Martin Luther King Jr. Elementary School at 9:30 a.m. and proceed to City Hall for prayer once the march begins. The march will end at the Mildred Westervelt Warner Transportation Museum, 1901 Jack Warner Parkway, where speeches will be given and the civil rights photography will be on display.
-The day will culminate at 6 p.m. with a rally at First African Baptist Church, 2621 Stillman Blvd. The Rev. James Williams, pastor of First Baptist Church in Newbern, will be the guest speaker.
Reach Lydia Seabol Avant at 205-722-0222 or firstname.lastname@example.org.
Reader comments posted to this article may be published in our print edition. All rights reserved. This copyrighted material may not be re-published without permission. Links are encouraged. | <urn:uuid:b9dc6187-a4bf-4b19-934b-4e815f4af74f> | CC-MAIN-2013-20 | http://www.tuscaloosanews.com/article/20130121/NEWS/130129990/1007/news?Title=Events-planned-in-honor-of-MLK-Day | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368701852492/warc/CC-MAIN-20130516105732-00065-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.942605 | 516 | 1.640625 | 2 |
MY RESCUE DOGS "DALCHI" SAYS COME ON OVER TO PLAY WITH HIS FRIENDS!
LILLY LOVES THE BABY KITTENS TOO! SHE HAS BIG EARA SO SHE CAN HEAR THEIR LITTLE MEOWS!
WHAT KITTY SHOULD I ADOPT?
This is an important question to ask yourself. Please take the time to consider your living situation, family needs, amount of time you will be able to dedicate to your cat and if you currently have a pet now.
SHOULD I ADOPT A BABY KITTEN OR A SINGLE KITTEN?
I do adoptions with kittens after 3 months old so they have time to get all of their vaccinations, medical work and testing done. It is not a good idea to get a kitten too young or have a single kitten to live all by themselves in your home. Kittens are social, active and loving animals that need to be groomed by other kitties and to have one to play with. At Krazy For Kats, we adopt kittens under 6 months old in pairs only.
DO MALE AND FEMALE CATS GET ALONG?
This will all depend on the cats, their age, temperament and if they are adopted as siblings or as a single cat/kitten for your current pet. It it not about their "breed." Keep in mind that there are some older cats that prefer to be "only pets" and if you already have a cat they may not tolerate any additions to the family no matter how hard you try. Please be respectful of that. You will need to allow anywhere from 1 to 4 weeks of adjustment time for a new companion pet.
Having 2 male cats:
- If you adopt 2 male cats/kittens who were raised together they will be loving companions.
- If you have an adult male, you should be able to bring in a male kitten without much of a problem.
- Rescued male cats that were living on the streets may be more assertive towards other male cats.
- Male cats that have lived with other male cats before in the past should be more inclined to accept a new male companion.
Having 2 female cats:
- Two female kittens raised together will be fine for adoption and make loving companions.
- If you have an adult female cat and looking to adopt another female, a younger kitty is your safest bet.
- There may be a lot of aggression if you adopt an adult female cat to be a companion to another female.
- Two adult female cats may be a very difficult pairing unless the current female has lived with other female cats before in the past.
The safest choice is to have a male and female pairing of a pet unless they are siblings or rescued kitties raised together! But remember, it is all up to the cat and their personality! | <urn:uuid:67cf4330-6271-4bb2-b704-235307e5086f> | CC-MAIN-2013-20 | http://krazyforkats.com/documents/baby_kittens_for__pre_adoption.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698924319/warc/CC-MAIN-20130516100844-00015-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.944911 | 601 | 1.6875 | 2 |
Understanding mortgage payment protection insurance
For most homeowners, being unable to make monthly mortgage payments and ultimately losing the roof over their head is their biggest fear.
Mortgage protection, more commonly known as Mortgage Payment Protection Insurance (MPPI) provides cover against this happening, meeting your mortgage payments if you are unable to.
This type of policy offers reassurance that in the event of accident, sickness or unemployment stopping you from working, your mortgage repayments will be met.
You don't legally have to have this type of cover, but if you are a homeowner it is definitely worth considering. However, many people pay over the odds for MPPI, so if you already have a policy in place you should review it and check the terms meet your requirements and that you could not obtain equivalent or better cover for less.
Why is MPPI important?
While, in some circumstances, there may be some help available from the state if you run into trouble and are unable to make your mortgage payments, not everyone will be eligible.
And even if you do qualify for help, it will usually only cover the cost of the interest on your mortgage only - not the repayment costs. Both these can be covered by an MPPI policy.
Do I need cover?
If you wouldn't be able to cover your mortgage payments and other outgoings with your savings in the event that you were unable to work due to accident, sickness or unemployment, then it may be suitable.
Bear in mind that most MPPI policies will only pay out for a maximum of a year, so if you do have sufficient savings in place to tide your over for this length of time, then you may not require cover.
Check how much your employer is likely to pay you in the event that you get made redundant. If you have worked at your company for several years, the chances are you may get a decent payout, which would mean you might be paying for the unemployment element of your mortgage payment protection policy unnecessarily. If this is the case, you may be better off going for accident and sickness MPPI cover only.
You should also consider the amount of sick pay you might be entitled to from your employer if you fall ill and are unable to work. Again, if this is generous, then it might be worth opting for unemployment cover only.
How do policies work?
As a general rule, mortgage payment protection policies will start paying out either 31 days or 60 days after you are unable to work. However, many policies are 'back to day one' plans. This means that the benefit you receive is backdated to the date you were first out of work.
Most polices only pay out for up to 12 months, although you can get policies which will only pay out for as little as three months. Monthly payments are capped, usually at £1,500 or £2,000 a month, so if you have a very large mortgage, you will need to think about how you will cover any surplus.
Policies won't usually allow claims for unemployment within the first three to six months.
What else should I know?
Remember that if you receive a payout from your MPPI policy, this could affect your entitlement to some income-related benefits. Find out whether the policy pays you directly, or your lender.
You should also check that you don't have any other kind of cover already in place which might protect you in the event you are unable to work. For example, if you have income protection cover, this will guarantee a regular income if you are unable to work for a protracted period due to illness or disability. It will pay out until you are well enough to return to work, or until the end of the policy .
Income protection won't, however, pay out in the event that you become unemployed, so if you already have this type of policy, you might also want to consider taking out an unemployment-only mortgage payment protection plan too so that you are fully protected.
Bear in mind that if you take out unemployment cover knowing that redundancy is on the cards, the chances are the policy won't pay out. | <urn:uuid:d0b17799-0419-407a-9adc-38db7dfb426c> | CC-MAIN-2013-20 | http://www.moneysupermarket.com/c/mortgage-protection/guide/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368711005985/warc/CC-MAIN-20130516133005-00025-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.970579 | 840 | 1.554688 | 2 |
Welcome to bites Guide
Photos De Bites Article
. For a permanent link to this article, or to bookmark it for further reading, click here.
You may also listen to this article by using the following controls.
Bear Bites Present The Need For Immediate Carefrom:
For anyone living or vacationing in bear country it is important to know how to stay safe and to treat bear bites, mauling and wounds.
Bears have great sense of smell, sight, and hearing, they are good runners and great swimmers. No doubt they can outrun a human when in pursuit.
The bear is a beautiful, intelligent, and curious creature. It is also highly predictable. With some education and a little common sense humans can avoid most bear bites and mauling. However, bears usually attack when they feel threatened; scared by humans, have their space infringed upon, are injured, or their food or cubs are in jeopardy.
However, if any one has seen pictures of the gross bites sustained by bears, its goes without saying these bears can be dangerous creatures. While looking at different kinds of bites and how disgusting they actually look, few bites and wounds can are more terrible than sustained from the attack of a bear. These gross bites can disfigure a person for life. Some people who have been lucky enough to survive a bear attack have had to have extensive plastic surgery. Bear bites can rip away the skin tearing cartilage and muscle, requiring several operations and years of therapy. The psychological aspect of the disfigurement especially if it is facial, not only is relative to the gross bites, but also to the feeling that the victim gets knowing that people are looking on and thinking how “gross looking” he or she has become.
When thinking about bear attacks we all tend to think about bear mauling, the scratching, biting, and squeezing and pulling limbs apart. The mental pictures we have are of gross bites so deep and painful that they leave permanent scars.
Not all bear bites are gross bites. People may not sustain life threatening injuries and escape from bear attacks. Some people have been known to receive only minor cuts and bruising.
Some dos and don’ts when traveling in bear country
Do not corner or provoke a bear
Never approach a bear especially if she has her cubs with her
Do not disturb a feeding animal, or disrupt it when it is mating
Do not leave any food or garbage around campsites which will attract hungry bears
Do not leave food in your tent and
Make sure your cooking quarters are far enough away from your sleeping tents
Cover all food in airtight containers to prevent the seepage of food odor that will attract the bears
Do not bury discarded food and trash; bears can dig it up
Bring leftovers and garbage back home with you for disposal there
Hike and travel in groups, never alone
Make noise, yell, and scream along the hiking path, throw rocks to scare bears away
Carry a can of bear spray with you at all times, it can be effective if used at close proximity in case of an attack.
Never try to run from a bear, it can run faster than you
Protect your head and back of the neck from an attack by covering them with your hands or elbows
Curl up on the ground, face to the ground, to protect your abdomen
Remain on the ground and be very still until you are sure that the bear has left the area, victims have tried to get up too soon only to be mauled a second time
• It is always best to be seen by a doctor after sustaining injury from a bear, even if the cuts and bruises seem to be minor. If there is excessive bleeding:
• Apply pressure to the area to stop the bleeding
• Clean with soap and water if you are near enough to camp site to do it
• And apply a bandage.
• Call 911 and get to a hospital as fast as you can.
Doctors will assess the severity of the wounds and do any or all of the following:
• Clean them up
• Apply antibiotics
• Suture cuts
• Plastic surgery
• Tetanus shot
• Blood transfusions
• Intravenous tube feeding
• Or whatever is necessary
Bear bites can be rather serious. To prevent complications, it is always wise to apply the right first aid and then seek medical treatment.
Photos De Bites News | <urn:uuid:972872dc-c933-4d85-ba31-1226db66c0bf> | CC-MAIN-2013-20 | http://firstaid.rbmarticles.com/bites/photos-de-bites.php | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368701459211/warc/CC-MAIN-20130516105059-00034-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.948493 | 962 | 2.296875 | 2 |
When news happens, text LT and your photos and videos to 80360. Or contact us by email or phone.
Belmont beauty spot fly-tipping clean-up to cost £1000
THE clean-up of a 20 tonnes of illegal rubbish dump will cost more than £1,000.
Flytippers used bolt-cutters to break off a padlock securing a farmer’s entrance to a dirt track on land close to Delph Hill Reservoir, Belmont, off Blackburn Road.
It is believed flytippers then reversed their van 100 metres up the track off Stones Bank Road before dumping two loads of rubbish.
The huge pile, which has been cleared by United Utilities, contained asbestos and rubble from a demolition site as well as cardboard rolls and material.
A United Utilities spokesman said: “We are working with Blackburn with Darwen Council to investigate this incident and we believe there may be an indication of who it was.
“It is a very dangerous practice and something we thoroughly condemn.”
The illegal rubbish tip appeared last weekend and was investigated by Blackburn with Darwen Council environmental crime officer Richard Waters.
Mr Waters said it was not uncommon for larger loads to be dumped out in the countryside, away from street lighting and CCTV.
Anyone with information is asked to contact Blackburn with Darwen Council on 01254 585585.
Comments are closed on this article. | <urn:uuid:9524c457-9787-4e81-be03-023ac9306af3> | CC-MAIN-2013-20 | http://www.lancashiretelegraph.co.uk/news/darwen/northturton/9352429.Belmont_beauty_spot_fly_tipping_clean_up_to_cost___1000/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368697380733/warc/CC-MAIN-20130516094300-00053-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.946775 | 290 | 1.523438 | 2 |
Enriched Format Text Categorization Using A Component Similarity Approach
Source: Academy Publisher
Text categorization has been widely studied for years. However, conventional plain text categorization approaches which work good in plain text behave poor when they are simply applied to enriched format texts. An categorization approach that is applicable to enriched format text is proposed. During feature selection, the authors get feature structure distribution weight by using extended structure model so that structure affections to categorization are fully considered. Text formats are also taken into account in feature weighting. The combined feature weighting approach strengthens important parts and weakens less important ones. | <urn:uuid:2f391d73-1be7-4251-b184-6eb3c55e85e2> | CC-MAIN-2013-20 | http://www.techrepublic.com/whitepapers/enriched-format-text-categorization-using-a-component-similarity-approach/3805971?scname=accounting-applications | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696381249/warc/CC-MAIN-20130516092621-00015-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.923805 | 125 | 1.914063 | 2 |
More Reasons to Ditch Your Antibacterial Soap
Image by Flickr / LuluP
Forget antibacterial - a plain 'ole soap bar works just as well
New research has uncovered yet another reason to stop using chemical-filled antibacterial soap - it may be doing you more harm than good
Warnings about things that may or may not be dangerous seem to come so frequently it can become overwhelming.
Especially because so much of the advice is contradictory.
Dangers of Antibacterial Soap
One of the more recent warnings caught my eye though—mainly because it seems indisputable. Triclosan, the active ingredient in antibacterial hand soap, has been found to impair muscle function in animals and humans.
A recently released study by researchers from the University of California, Davis, found triclosan impedes muscle contractions at the cellular level. In mice, a single dose of triclosan reduced heart muscle function by 25 percent, while muscle strength was reduced by as much as 18 percent.
This is on top of problems already identified with the chemical, which include endocrine disruption, skin and eye irritation, the growth or antibiotic-resistant bacteria and environmental concerns.
One argument in favour of triclosan is that it really does protect us from harmful bacteria—and it does, but only in the case of very specific skin infections such as impetigo or in the case of gingivitis. But the chemical, which is absorbed through the skin and is also found in antiperspirants, hand sanitizers, shaving cream and mouthwash, is not required in day-to-day use.
Use Regular Soap
In fact both the FDA and Health Canada find that washing your hands with regular soap and water is just as effective as using an antibacterial soap.
So the wise thing here is to skip the antibacterial additives and keep clean the old-fashioned way. | <urn:uuid:b69755fe-0e5e-423d-a54a-9e354f8df73b> | CC-MAIN-2013-20 | http://www.bcliving.ca/health/reasons-to-ditch-antibacterial-soap | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696382584/warc/CC-MAIN-20130516092622-00042-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.952891 | 396 | 2.375 | 2 |
"Getting A's Just Got Easier "
.....It's about strategy, sacrifice, and timing! In the game of chess this couldn't be farther from the truth. While chess is not for everyone, it is, however, for those who want to be challenged and strive to develop the skills necessary to think critically and analytically, especially in the real-world. If you're experienced or new, then you've come...
10+ subjects, including vocabulary | <urn:uuid:ecc2a5dc-d489-4e6e-8382-2d0076527a2e> | CC-MAIN-2013-20 | http://www.wyzant.com/Downey_CA_vocabulary_tutors.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698924319/warc/CC-MAIN-20130516100844-00039-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.955938 | 95 | 1.789063 | 2 |
Senate Majority Leader Harry Reid (D-Nev.) on Thursday said the American economy is “in a recovery” despite the decline in the nation’s gross domestic product (GDP).
Reid made the remark after Senate Minority Leader Mitch McConnell (R-Ky.) blamed the White House for the unexpected contraction in the economy.
“[McConnell] continues bad mouthing the recovery,” Reid said on the Senate floor. “We are in a recovery.”
On Wednesday, the Commerce Department announced that the nation’s economy unexpectedly shrank by 0.1 percent in the fourth quarter of 2012. Echoing the White House, Reid blamed the GOP’s “austerity and brinkmanship” for the plunge.
“Growth went down in the fourth quarter because of reduced government spending,” Reid said. “The economy was rejecting the austerity and brinkmanship.” | <urn:uuid:5a5b8fb9-8187-401c-8868-af7ba1724298> | CC-MAIN-2013-20 | http://conservatives4palin.com/2013/02/the-hill-harry-reid-we-are-in-a-recovery.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368710006682/warc/CC-MAIN-20130516131326-00049-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.930946 | 195 | 1.523438 | 2 |
Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.
1 post • Page 1 of 1
This is my first experience with any type of PCR. I've done a lot of reading and digging around but I need a little help to solidify my understanding of Real Time PCR from a mRNA sample (Real Time reverse transcription PCR).
The protocol I have in mind is to transfect my cells with my desired proteins and when I split my cell lysate I will keep one for protein and one to isolate RNA. Then I will extract mRNA and use reverse transcription to make cDNA.
I will be using the 2 step protocol. Do most people use premade primers for the reverse transcription step? Oligo dT are just for poly A tails, so you don’t have to customize those right?
I know this is a dumb question but I’m having trouble locating my exact gene sequence! My project is on IL6. I used NCBI to search and found IL6 [homo sapiens]. How do I find the sequence that I need? Is it under “NG_011640.1 RefSeqGene” OR “mRNA and proteins NM_000600.3”? When I click on NM_000600.3 it says it is mRNA but there are no U’s? Do I need to know the mRNA sequence for the reverse transcription step or do I just need to know the sequence of my cDNA so that I can make primers for the pcr step?
Once my mRNA is converted to cDNA, how do I make primers for cDNA? cDNA is the same orientation as DNA right? For example, lets say the NCBI website gives me the following sequence (please disregard if they are good primers or not due to GC% and Tm etc., I’m just trying to understand the theory):
I am under the impression that this is the sense strand, so it's 5' to 3', and that the cDNA is exactly the same sequence and orientation.
5' TCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACA 3' SENSE
3' CTCCATATGGATCTCATGGAGG 5' (Reverse Primer)
3' GGTTAGACCTAAGTTACTCCTCTGAACGGACCACCCTCAAACACCATATGGATCTCATGGAGGTCTTGT 5' ANTISENSE
5' AATCTGGATTCAATGAGGAGA 3' (Forward Primer)
Basically, I just make my primers like I would for a normal PCR, from the DNA sequence provided by NCBI?
Why do I need to write my reverse primer like this: 5' CCTCCATGAGATCCATATGGAG 3'?
I’ve read that you want the primers to be within an exon and also that you want the primers to be at an exon-exon junction because that would eliminate genomic DNA contamination. Which one is correct and why?
I think I understand the concept behind adding restriction sites. They are added to the 5' end and you need to add 2-4 random bases after it so that the restriction endonucleases will be able to cleave the site when you insert it into a plasmid later on. Since it's on the 5' end, it will be present on the new template but the polymerase never interacts with the restriction site and the site does not match the DNA template strand. If the restriction site does not match with the template does that part just not bind and it floats during the extension round?
Does the following look correct?
5' CCTCCATGAGATCCATATGGAG 3' = 5' TCGXXXXXXCCTCCATGAGATCCATATGGAG 3'
X= Restriction Site, TCG= extra bases added on
As for the detection method for Real Time PCR, I am using this method to detect the expression levels (upregulated or downregulated) of mRNA in different samples, is it better to use probes or SYBR Green? Why?
This is a stupid question, but when making primers, how does one decide whether to use the sequence from a mouse vs human etc.? It's based on the samples that the lab has right? So if you are using patient samples you would need to base it off of the human sequence for that gene but if you are just using cell lines it would have to be from the source of the cell line?
Thank you, your help is very much appreciated!
1 post • Page 1 of 1
Who is online
Users browsing this forum: No registered users and 0 guests | <urn:uuid:3fc51411-fd4e-4901-b65f-c018523295b0> | CC-MAIN-2013-20 | http://www.biology-online.org/biology-forum/about25109.html?p=142861&hilit=Exon | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368700958435/warc/CC-MAIN-20130516104238-00030-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.908561 | 1,022 | 2.0625 | 2 |
The 70th Doolittle Tokyo Raiders Reunion was held at the National Museum of the USAF in Dayton, OH, from April 17 through April 20, 2012.
The Doolittle Tokyo Raid was the first air raid by the United States to strike the Japanese Home Islands during World War II. It is also regarded as one the best examples of the cooperation between Chinese and American people in the war against fascism. After completing the raid on April 18, 1942, the Doolittle Raiders failed to land at Quzhou Airport as planned and had to crash land or parachute in Zhejiang, Jiangxi and neighboring provinces in eastern China. Sixty four out of 80 raiders were saved and rescued by Chinese soldiers and civilians who helped them return to the US safely. The Chinese people paid dearly for sheltering the American aviators. Approximately 250,000 Chinese civilians were killed by the Japanese Army in retaliation for assisting the American raiders.
The Reunion features various programs, including exhibition, memorial service, B-25 Flyover, etc. Some of them were open to the public and had drawn thousands of participants. Four surviving Doolittle raiders, families of Doolittle Raidiers, relatives of Chinese civilians who helped Doolittle Raiders and representatives from US air force and navy were invited to the event.
Counselor Zha Liyou from the Chinese Embassy attended the Reunion and delivered a special message from Ambassador Zhang Yesui at the Reunion Dinner. In his message, Ambassador Zhang pays his tribute to the surviving raiders and all relatives of Doolittle Raiders, and recalls the history of friendship when China and the United States fought side by side for the common cause of world peace and justice in World War II. He also expresses his hope that in the new era, the Chinese and American people will continue to join hands to further strengthen the traditional friendship, create a better future for both countries and contribute to world peace and prosperity.
Photo caption:1.Four surviving Doolittle raiders: Richard E. Cole, David J. Thatcher, Thomas C. Griffin and Edward J. Saylor. (from left to right).
2.He Shaoying from east China's Zhejiang Province, whose father He Yangling helped out some raiders, talks to Doolittle raider Thomas C. Griffin. | <urn:uuid:e87dd9d3-ddca-4e25-afa0-f875273ddbb0> | CC-MAIN-2013-20 | http://www.china-embassy.org/eng/sghd/t924947.htm | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368705195219/warc/CC-MAIN-20130516115315-00051-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.96263 | 474 | 2.625 | 3 |
1943 "Lubbers Don't Live" WWII Vintage Navy Poster Lubbers don't Lie US Navy WWII Poster is SOLD OUT!
1943 Lubbers Don't Live Small WWII Original Vintage Navy Poster
Printed by: (Bottom right) U.S. Navy, Bureau of Naval Personnel, Training Aids. Nav. Pers. 900,008 A-14 U.S. Government
Printing Office. 1943 )-561903 WW2
Age: dated 1943
Condition: B condition, unlined. Has some edge wear and folding as seen in pic, displays well. The paper is a light brown cardstock, lightweight, can be folded, has a light center crease as seen in photos.
A landlubber is an inexperienced sailor, and this is one of a cartoon series of US Navy military training aids during world war two called "Lubbers don't Live."These small posters tell the dangers of carelessness. This one has the poem:
We pause for Seaman Moore
He failed to close a water tight door
A mine that night sent the ship beneath foam
Now he never will get all his souvenirs home
The poster is printed in Black and white with green detail, nothing on reverse, ready for framing. We believe there were 14 in this original series, we only have this one.
Size: 14 x 10 inches
You'll deal directly with gallery owner Debra in your purchase: USPS Priority Shipping is FREE in US, Reduced rate for International USPS Priority shipping. We have a 100% approval policy. We want you to be happy with your poster purchase. A signed COA (Certificate of Authenticity) is included with each poster purchase. Debra has been selling original vintage antique posters on the web since 1995. We do not sell reproductions, only authentic antique posters. | <urn:uuid:283acc83-1614-4ad8-9cc8-b80d412e50e5> | CC-MAIN-2013-20 | http://www.vintageposterworks.com/products/1943-lubbers-dont-live-wwii-original-vintage-navy-poster | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703298047/warc/CC-MAIN-20130516112138-00069-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.953855 | 376 | 1.789063 | 2 |
New light on Malta during the Peace of Amiens, 1801-1803
D. F. Allen
SIR Charles William Pasley (1780-1861) is remembered today as a general in the British Army who earned distinction as a military engineer, writing manuals about field fortification, telegraphy, sapping, mining, pontooning, and how best to explode gunpowder under water for the salvage of wrecks. Pasley's distinction was recognized beyond the army by his election in 1816 as a Fellow of the Royal Society, by his appointment in 1841 as Inspector General of Railways and by the award in 1844 of an honorary D.C.L. by the University of Oxford. Less well known are the sympathetic impressions of Malta which he had formed between 1801 and 1804, when he was far from being a pillar of the Establishment but merely a twenty-one-year-old lieutenant from Minorca, recently posted to the Malta garrison. Lieutenant Pasley's unpublished journal and letters from Malta are buried in his personal papers which were bequeathed to the British Museum in the 1930s by his descendants. Pasley's comments on Malta now merit rehearsal for two reasons above all. First because they relate to that uneasy period of the Peace of Amiens, by which Britain had promised to hand back the Maltesse islands to the Order of St John, expelled by Bonaparte in 1798. Young Pasley's journal and letters from Malta are interesting secondly because at that stage in his career he enjoyed few social advantages and was correspondingly open to the customs of the Maltese. Pasley had been born a bastard in Scotland, from where the Dumfries schoolmaster and his own energy and ability as well as the patronage of his better born Malcolm cousins had propelled him into the Royal Military Academy at Woolwich. In short, Pasley was a philosophical and literary Scottish soldier, curious about the distinctive history and folklore of Malta. And his professional interest in mihtary fortification took renewed inspiration from the bastions of Valletta.
New light on Malta during the Peace of Amiens, 1801-1803 (PDF format), 6.7MB | <urn:uuid:9871f311-719f-4086-b1d0-e71bbda1ff50> | CC-MAIN-2013-20 | http://www.bl.uk/eblj/1994articles/article11.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368706499548/warc/CC-MAIN-20130516121459-00035-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.983802 | 446 | 2.484375 | 2 |
A Walk Down Hyde, 1950
by Graham Sharp
My memories of Hyde are that of a pleasant and safe place in which to grow up. In 1950, I was sixteen years old living on Laburnum Avenue with my parents and younger brother, and working at Hyde Station
World War Two had not been over very long and shortages were still widespread, but somehow, Hyde managed to be a good place to live and I think that one of the factors in making that so was the variety of shops. There was no need to go out of the town for anything.
Leaving the house to “go down Hyde” the first shop was an off license on the corner of Dowson Road and Grosvenor Road. Between there and Kirkley Street there was the large, deep Borough Tip on the left and open ground on the right. On the corner of Dowson and Markland Street was Bridges Bakery, my Dad worked there for a time, they sold lovely potted meat, I think the building is still there.
Looking down Dowson Road.
Bells chippy was on the corner of Green Street. On the left, opposite Bradbury Street was a double fronted shop set back from the houses, Torkingtons Hardware.[used to buy paraffin here for the portable heaters at home]. Next was Harndens Engineering and then on the corner of Dowson Road and Market Street was Whalleys Chemists [I think that corner has long gone] On the opposite corner was a branch of Hyde Co-op and if this was a Saturday, I would have crossed the road and gone down Queen Street to Ewen Fields. Jimmy Lovery would no doubt have scored a hat trick for Hyde against their dreaded rivals Stalybridge Celtic!
For some reason I always walked down Market Street on the left hand side and somehow with the exception of Meschias and Kinder’s green grocery I was not all that familiar with shops on the right
Barnfield Dance Academy on the right
Next to Whalleys on the left side of the street was Booth’s Dairy [Cheetham Fold Farm], a toffee shop and tucked away in the corner Robinson’s Funeral Home. Next was Pickfords Barnfield Dance Academy and a little lower down still on the left was the Shepherds Call.
Johnsons and Hopwoods Barbers
The other side of Tower Street was Johnsons baby clothes shop and next to that George Hopwoods barber shop. My memories of having my haircut there was that Mr. Hopwood always seemed to have a pint pot of tea in his hand and breathing tea all over me ,always using a lighted wax taper on the back of my head after cutting and strangely, a rack of umbrellas next to the door, I think a lot of barbers repaired umbrellas as a spare time side line. Then there were some high wooden billboards advertising many products [notably Guinness] and behind the billboards was a little wooden shack - a bookies!
Mr Hopwood standing in the doorway of his shop !
On the corner of Church Street was Rowbottoms. They sold all kinds of gift items, mostly ornaments and fine china, a really lovely shop.
Crossing Church Street there was a row of small shops that I think at one time must have been houses. The first one that I remember was a crumpet shop, you had to step down into this dark, stone floored front room where they made the crumpets. Even after sixty years I can still taste those hot buttered crumpets for tea! I think that Moscrops had a branch in this row where they sold prams and other baby stuff Andrews had a confectionary and upstairs a nice café where my wife’s Auntie Clara used to work. Then, another bakers and confectioners, Oldhams, great meat and potato pies and vanilla cuts!
In between there and the Cheshire Cheese was a really good hobby shop, forget the name. Although, I do remember the name of the hobby/sports shop across from Union Street and the P.S.A. as being Dawsons.[good place to buy fireworks] Just past this shop the row stepped back and in the corner was Togos herbalists. Togos for some reason, had a reputation, particularly if you were allowed in the “back room” there was some oriental mystery and danger about the place, but really all they sold was herbal drinks and I don’t remember him as being oriental! Nearby was Nanettes, a high class ladies shop.
On the corner of Croft Street was Higginbottoms ,one of the many newsagents that I delivered papers for.
There was then a row of mostly quite large shops among them Grundys shoe shop, Dewhursts and Redmans [great bacon] and on the corner of Corporation Street, Boots Chemist. This was a great corner to meet a girlfriend [or boyfriend] before going to the Theatre or the Alex after calling at Nightingales of course for some toffees.
The row in which Redmans stood.
Hyde really was a great place to live in those days and I am sure the same applies today although, there was something different back then.
Many Thanks. Graham , for the excellent account !! :)
Much appreciated ! | <urn:uuid:978b830b-fe88-42b7-83b1-be851aa67ba3> | CC-MAIN-2013-20 | http://hydonian.blogspot.com/2013/01/memories-of-hyde-in-1950s.html?showComment=1358630883191 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368697974692/warc/CC-MAIN-20130516095254-00026-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.978115 | 1,114 | 1.546875 | 2 |
I came across George Szirtes' "The Akhmatova Variations", subtitled "Sixteen variations on a couplet of Anna Akhmatova's" on his website, and liked it so much - both the sentiment and the technique - that I asked if he would mind me quoting part of it here. So, by kind permission of the author, here are the theme and the first eight variations:
THEMEFor me, praise from others is like ash,
from you, even abuse is praise
(tr. Richard McKane)
I can dismiss the praise of all the rest
But when you censure me I still feel blessed.
The praise I get from others is mere guff.
For me your slightest cavil’s praise enough.
I don’t take compliments from anyone:
Your mere abuse is worth a smug well done.
When others praise my poems, it makes me spit.
I just adore it when you say they’re shit.
When creeps such as McGarrigle praise my books
I’d give the world for one of your sour looks.
Why do those filthy bastards pat my back?
I’d sooner you frowned and told me what I lack.
Am I obsessed? I want your kicks and blows
Not slimy compliments in Grub Street prose.
Hit me again. Abuse me. Burn my books.
I hate their wimbly praise and simpering looks.
I felt awkward about using the whole poem: he might want to make money from it some time. I hope curiosity will drive at least one reader over to his website to finish reading it and discover more of the Szirtes oeuvre (try saying "Szirtes oeuvre" on half a pint of gin).
And we had an interesting exchange about the word "wimbly" - whether its archaism gives it a useful charm, or whether it is too quaint to work, and what it means. I think in the context it's pretty clear, though the OED only notices the word as the adverbal form of "wimble", a synonym for "nimble". George coined it from "wimbly-wambly", which crops up in Lawrence's poem Pansies. Here's what the OED has to say, complete with Lawrence reference:
Shaky, unsteady; feeble, effeminate.
1881 Leeds Loiners' Comic Olmenac 24, I went all wimley-wamley e me head. 1882 F. W. P. JAGO Ancient Lang. & Dial. Cornwall 312 I'm all wimbly-wambly. 1929 D. H. LAWRENCE Pansies 113 Flat-chested, crop-headed, chemicalised women, of indeterminate sex, And wimbly-wambly young men, of sex still more indeterminate.
Not much difficulty about the meaning, but it is northern or is it Cornish?
George gave me the option of substitution "piddling" or possibly "piss-pot" here; but the alliteration that would give is less attractive than the assonance of "wimbly" and "simpering" (and both have that hint of effeminacy). So "wimbly" it is. | <urn:uuid:518e3864-ef3c-4cda-aece-033d60f4a1e2> | CC-MAIN-2013-20 | http://roberthanks.typepad.com/zoo_in_the_head/hard-to-say-when-drunk/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368706153698/warc/CC-MAIN-20130516120913-00053-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.941151 | 702 | 1.617188 | 2 |
What is Meckel's diverticulum?
Meckel's diverticulum is a small pouch in the wall of the intestine, near the junction of the small and large intestines. The pouch is a remnant of tissue from the prenatal development of the digestive system. It is not made of the same type of tissue as the small intestine, but instead, is made of the type of tissue found in the stomach or the pancreas.
The tissue in Meckel's diverticulum can produce acid, just as the tissue of the stomach does. The intestinal lining is sensitive to being in contact with acid, and eventually an ulcer can form. The ulcer can perforate (rupture), causing waste products from the intestine to leak into the abdomen. A serious abdominal infection called peritonitis can result. The intestine can also become obstructed (blocked) by Meckel's diverticulum.
How often does Meckel's diverticulum occur?
Meckel's diverticulum is the most common birth defect of the digestive system. It is present in about 2 percent of the population.
Why is Meckel's diverticulum of concern?
When the intestine develops an ulcer, significant bleeding can result, causing anemia (low numbers of red blood cells in the bloodstream). If enough blood is lost, a child may go into shock, which is a life-threatening situation. A serious infection may also occur if the intestine perforates and leaks waste products into the abdomen.
What are the symptoms of Meckel's diverticulum?
The symptom seen most often with Meckel's diverticulum is the passage of a large amount of dark red blood from the rectum. There may also be brick-colored, jelly-like stool present. Passing the blood is usually painless, although some children may experience abdominal pain.
If your child passes blood or a bloody stool from the rectum, you should contact your child's doctor as soon as possible.
Symptoms of Meckel's diverticulum may resemble other conditions or medical problems. Please consult your child's doctor for a diagnosis.
How is Meckel's diverticulum diagnosed?
In addition to a complete medical history and physical examination, imaging tests may be done to evaluate the intestinal tract. Diagnostic procedures for Meckel's diverticulum may include the following:
Blood test. This test checks for anemia or infection. A stool sample may be checked for frank (obvious) or occult (hidden) blood.
Barium enema and small bowel series. A procedure performed to examine the large intestine for abnormalities. A fluid called barium (a metallic, chemical, chalky, liquid used to coat the inside of organs so that they will show up on an X-ray) is given into the rectum as an enema. An X-ray of the abdomen shows strictures (narrowed areas), obstructions (blockages), and other problems.
Meckel's scan. A substance called technetium is injected into your child's bloodstream though an intravenous (IV) line. The technetium can be seen on an X-ray in areas of the body where stomach tissue exists, such as the Meckel's diverticulum.
Rectosigmoidoscopy. A small, flexible tube with a camera on the end is inserted into your child's rectum and sigmoid colon (last part of the large intestine). The inside of the rectum and large intestine are evaluated for bleeding, blockage, and other problems.
What is the treatment for Meckel's diverticulum?
Specific treatment for Meckel's diverticulum will be determined by your child's doctor based on the following:
The extent of the problem
Your child's age, overall health, and medical history
Your child's tolerance for specific medications, procedures, or therapies
Expectations for the course of the problem
The opinion of the health care providers involved in the child's care
Your opinion and preference
Doctors will usually recommend that a Meckel's diverticulum that is causing symptoms (such as bleeding) be surgically removed. Under general anesthesia, an incision will be made in the abdomen and the abnormal tissue will be removed. Stitches and/or a special tape called steri strips will be used to close the incision when the operation is completed.
Your child's doctor or nurse will give you instructions to follow regarding your child's diet, pain medications, bathing, and activity at home.
Will a child with Meckel's diverticulum have problems in the future?
There are usually no long-term problems after Meckel's diverticulum is repaired. | <urn:uuid:97a85fc5-1de2-4d03-9f85-c992344bb7ce> | CC-MAIN-2013-20 | http://www.grhealth.org/health-encyclopedia/ContentPage.aspx?nd=810&type=200&parm1=P02010&parm2=90 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368700264179/warc/CC-MAIN-20130516103104-00067-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.926865 | 982 | 3.453125 | 3 |
As students across China prepared for their National Day vacation last week, President Hu Jintao ordered the Communist Party Politburo into the classroom. He arranged for two respected professors to lecture the leaders on a touchy curriculum: law and democracy. During a 90-minute talk, the professors discussed such sensitive notions as how "the power to rule derives from the constitution and from law," says a source who attended the meeting. Hu closed the session with his firmest comment to date on political reform: "The party must enrich forms of democracy, perfect democratic procedures, expand citizens' orderly political participation and ensure the people have democratic elections."
Still, comparing Hu to Thomas Jefferson is premature. At last week's meeting, Hu prefaced his comments by saying, "most important is maintaining party leadership." Moreover, the study session coincided with the detention of a local party official in southwestern China who organized a direct election for a township leader.
Hu's comments seemed designed to encourage political experimentation, especially at the grassroots level. In the countryside, some officials are already holding public hearings and various kinds of local elections. Hu's speech, says Wang Changjiang, a professor at the Central Party School, the leadership's top training academy, "suggests the party center is also steadily recognizing that it needs to supply more" political reform. "If it doesn't," Wang says, "it can create even bigger problems."
In the 1980s, Communist Party chief Zhao Ziyang arranged similar briefings for his staffersóuntil he was purged in 1989óbut kept them secret to avoid criticism. In contrast, a story on Hu's "study session" hit the front page of the People's Daily, the party's mouthpiece. Hu wants extra points for addressing political reformóbut hasn't aced the class yet. | <urn:uuid:1988919f-b1fe-443a-a0fd-817b15aa3c41> | CC-MAIN-2013-20 | http://www.time.com/time/magazine/article/0,9171,493347,00.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368700958435/warc/CC-MAIN-20130516104238-00070-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.963894 | 365 | 2.0625 | 2 |
Feeding Your Adult Cat: What You Need to Know
Get expert tips for keeping your cat healthy, happy, and well fed.
Canned vs. dry cat food: Which one is better? continued...
“There are a lot of people who believe that cats only need to eat canned
food and will be unhealthy if they eat dry food,” says Larsen, noting
that most cats can do fine on either.
The bottom line? “More research is needed to determine whether wet food is
better,” Bough says.
But the high moisture content in wet food can be beneficial to cats with
urinary tract problems, diabetes, or kidney disease. It can help
compensate for cats’ low thirst drive, which may be partly due to their
evolution as desert animals. More study is needed to confirm whether feeding
wet food can help prevent some of these problems from developing in the first
Higher protein levels more often found in wet food may be of benefit to
strict carnivores like cats, who depend on consuming animals to meet their
nutritional needs and require up to three times the protein of omnivores.
“But you can have a high-protein diet that’s still deficient in essential
amino acids,” says Larsen, citing taurine as an example. “And the same is true
for fats and essential fatty acids. So you need to make sure the subparts are
When and how much food should I feed my adult cat?
Mimicking a trend of many of their owners, one in five cats in
industrialized countries today is obese.
Many factors seem to contribute to this widespread problem, including
inactivity, overfeeding rich foods, and neutering (castrated cats are up to
four times more likely to be obese).
But you can take steps to help manage weight problems, including playing
with your cat and controlling food intake around the time of neutering.
As for feeding times and amounts, here are a few things to keep in mind.
“There are equations you can use to predict the energy needs of a cat,”
Larsen says. But many things -- including climate, activity, and the cat's
metabolism -- affect that.
You can simply evaluate your own cat by looking at his or her silhouette and
touching the belly from the top and sides, she says. If you can’t feel ribs,
you may need to adjust how much you’re feeding your cat. If you want more
guidance, you can find body condition scoring systems online.
Bough agrees that it’s difficult to evaluate the exact amount of food a cat
needs. “You can start by weighing your cat and looking at the product
packaging,” she says, “But watch your cat and work with your vet to determine
how much your cat should weigh.”
There are several types of feeding methods owners commonly use, which may
vary depending on the needs of their adult cats and their schedules:
Portion-control feeding involves measuring the food and offering it
as a meal. It can be used for weight control and for animals that tend to
overeat if allowed to feed at will.
Free-choice feeding means food - typically dry food, which is less
likely to spoil - is available around the clock. Nursing cats are commonly fed
free choice. But you can see why this method can turn into a problem for a cat
that doesn’t know when to stop.
Timed feeding involves making food available for a certain amount of
time, then picking it up after, say, 30 minutes. | <urn:uuid:a5525712-8ce6-4a84-875d-b34ff74ae04b> | CC-MAIN-2013-20 | http://pets.webmd.com/cats/guide/feeding-your-adult-cat-what-you-need-to-know?page=2 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702448584/warc/CC-MAIN-20130516110728-00034-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.944997 | 779 | 2.3125 | 2 |
School Staff Training
The diabetes health care professional community strongly supports the training of non-medical school personnel to provide supplementary diabetes care in schools.
It takes a team effort to ensure a student with diabetes can safely participate in all that school has to offer.
The school nurse is vital in coordinating and providing diabetes care at school. He or she is responsible for implementing the student's individual diabetes care plan, including performing and (or) assisting with routine diabetes care tasks and providing emergency care.
However, a school nurse cannot do it alone. Many nurses have multiple building assignments and aren't always on-site. Even when assigned to only one school a school nurse cannot be everywhere at all times. In addition, some students need assistance on field trips or during sports and other activities after school. Obviously one person can't do it all.
Trained non-medical school staff
For students with diabetes, staff trained to assist in routine and emergency care responsibilities, under the supervision of the school nurse, is the best—and safest—solution. Non-medical school personnel must first be trained, in both routine and emergency diabetes care.
ADA recommends the following related to school staff training:
- All school staff members who have responsibility for a student with diabetes should receive training that provides a basic understanding of the disease and know who to contact in an emergency.
- A small group of school staff members should receive training from a school nurse or another qualified health care professional such as a physician or a nurse with expertise in diabetes, and also in student-specific routine and emergency care.
- The school nurse or another qualified health professional should be involved with training of appropriate staff and providing ongoing professional supervision and consultation regarding routine and emergency care of students with diabetes.
School staff training and support resources are available for print and electronic distribution. NDEP Helping the Student with Diabetes Succeed, Tips to Help Teachers, and other resources.
If you have diabetes, you are a Red Strider. Register today.
Start summer with some sizzle! Recipes for fish tacos, grilled mango, and more.
This new cookbook is packed with more than 150 mouthwatering recipes for every occasion!
Custom invitations and table cards with your honor gift.
Our new meal planning tools made just for you.
Learn what BIG discounts on auto insurance may await you.
Order your Diabetes Forecast®! 12 Grilled Favorites and 35+ Travel Tips. Start Here
If you have diabetes, join us for the ride!
Sign up for our FREE recipe club and get cookin’!
Learn more about NASCAR driver Ryan Reed and his mission!
Are you incorporating fish into your diet? Learn why you should!
Learn more about how you can better manage your diabetes.
Fairness for kids with diabetes at camp and other programs
Visit our online community today!
Learn more about Dribble to Stop Diabetes | <urn:uuid:e42756c0-24b6-4744-a7ea-4a5f3176a875> | CC-MAIN-2013-20 | http://www.diabetes.org/living-with-diabetes/parents-and-kids/diabetes-care-at-school/school-staff-trainings/?loc=diabetesorg | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368709037764/warc/CC-MAIN-20130516125717-00013-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.954493 | 592 | 2.8125 | 3 |
Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole.
Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter. Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages.
Do not use for reproduction, copying, pasting, or reading; exclusively for search engines.
OCR for page 279
Appendix F A Public Health Action Plan to Combat Antimicrobial Resistance EXECUTIVE SUMMARY This Public Health Action Plan to Combat Antimicrobial Resistance (Action Plan) was developed by an interagency Task Force on Antimicrobial Resistance that was created in 1999. The Task Force is co-chaired by the Centers for Disease Control and Prevention, the Food and Drug Administration, and the National Institutes of Health, and also includes the Agency for Healthcare Research and Quality, the Health Care Financing Administration, the Health Resources and Services Administration, the Department of Agriculture, the Department of Defense, the Department of Veterans Affairs, and the Environmental Protection Agency. The Action Plan reflects a broad-based consensus of federal agencies on actions needed to address antimicrobial1 resistance (AR). Input from state and local health agencies, universities, professional societies, pharmaceutical companies, health care delivery organizations, agricultural producers, consumer groups, and other members of the public was important in developing the plan. While some actions are already underway, complete implementation of this plan will require close collaboration with all of these 1 In this document, the term “antimicrobial” is used inclusively to refer to any agent (including an antibiotic) used to kill or inhibit the growth of microorganisms (bacteria, viruses, fungi, or parasites.) This term applies whether the agent is intended for human, veterinary, or agricultural applications.
OCR for page 280
partners,2 a major objective of the process. The plan will be implemented incrementally, dependent on the availability of resources. The Action Plan provides a blueprint for specific, coordinated federal actions to address the emerging threat of antimicrobial resistance. This document is Part I of the Action Plan, focusing on domestic issues. Since AR transcends national borders and requires a global approach to its prevention and control, Part II of the plan, to be developed subsequently, will identify actions that more specifically address international issues. The Action Plan, Part I (Domestic Issues), includes four focus areas: Surveillance, Prevention and Control, Research, and Product Development. A summary of the top priority goals and action items in each focus area follows. Surveillance Unless AR problems are detected as they emerge—and actions are taken quickly to contain them—the world may soon be faced with previously treatable diseases that have again become untreatable, as in the pre-antibiotic era. Priority Goals and Action Items in this focus area address ways to: Develop and implement a coordinated national plan for AR surveillance; Ensure the availability of reliable drug susceptibility data for surveillance; Monitor patterns of antimicrobial drug use; and Monitor AR in agricultural settings to protect the public’s health by ensuring a safe food supply as well as animal and plant health. A coordinated national surveillance plan for monitoring AR in microorganisms that pose a threat to public health will be developed and implemented. The plan will specify activities to be conducted at national, state, and local levels; define the roles of participants; promote the use of standardized methods; and provide for timely dissemination of data to interested parties, e.g., public health officials, clinicians, and researchers. 2 Implementation of this Action Plan requires working with a wide variety of partners, e.g., state and local health agencies, universities, professional societies, pharmaceutical and biotechnology companies, health care delivery organizations, insurers, agricultural producers, consumer groups, and the public. A wide variety of expertise is needed, e.g., from clinicians, consumers, pharmacists, microbiologists, epidemiologists, behavioral and social scientists, economists, health policy researchers, and others. Partners and expertise needed will vary with different action items.
OCR for page 281
Needed core capacities at state and local levels will be defined and supported. When possible, the plan will coordinate, integrate, and build on existing disease surveillance infrastructure. All surveillance activities will be conducted with respect for patient and institutional confidentiality. The availability of reliable drug susceptibility data is essential for AR surveillance. The accuracy of AR detection and reporting will be improved through training and proficiency testing programs for diagnostic laboratories and by promoting and further refining standardized methods for detecting drug resistance in important pathogens, including bacteria, parasites, fungi, and viruses. Public and private sector partners will address barriers to AR testing and reporting, e.g., barriers due to changes in health care delivery. A plan to monitor patterns of antimicrobial drug use will be developed and implemented as an important component of the national AR surveillance plan. This information is essential to interpret trends and variations in rates of AR, improve our understanding of the relationship between drug use and resistance, identify and anticipate gaps in availability of existing drugs, and identify interventions to prevent and control AR. Improved surveillance for AR in agricultural settings will allow early detection of resistance trends in pathogens that pose a risk to animal and plant health, as well as in bacteria that enter the food supply. Agricultural surveillance data will also help improve understanding of the relationship between antimicrobial drug and pesticide use and the emergence of drug resistance. Prevention and Control The prevention and control of drug-resistant infections requires measures to promote the appropriate use3 of antimicrobial drugs and prevent the transmission of infections (whether drug-resistant or not). Priority Goals and Action Items in this focus area address ways to: Extend the useful life of antimicrobial drugs through appropriate use policies that discourage overuse and misuse; Improve diagnostic testing practices; 3 In this Action Plan, appropriate antimicrobial drug use is defined as use that maximizes therapeutic impact while minimizing toxicity and the development of resistance. In practice, this means prescribing antimicrobial therapy when and only when beneficial to a patient; targeting therapy to the desired pathogens; and using the appropriate drug, dose, and duration.
OCR for page 282
Prevent infection transmission through improved infection control methods and use of vaccines; Prevent and control emerging AR problems in agriculture and human and veterinary medicine; and Ensure that comprehensive programs to prevent and control AR involve a wide variety of nonfederal partners and the public so these programs become a part of routine practice nationwide. Appropriate drug-use policies will be implemented through a public health education campaign on appropriate antimicrobial drug use as a national health priority. Other actions in support of appropriate drug use will include reducing inappropriate prescribing through development of clinical guidelines and computer-assisted decision support, considering regulatory changes, supporting other interventions promoting education and behavior change among clinicians, and informing consumers about the uses and limitations of antimicrobial drugs. Improved diagnostic practices will be promoted by encouraging the use of rapid diagnostic methods to guide drug prescribing, facilitating direct consultation between clinicians and laboratory personnel with appropriate expertise and authority, and promoting the use of appropriate laboratory testing methods. Guidelines, training, and regulatory and reimbursement policies will be utilized to promote improved diagnostic practices. Reduced rates of infection transmission will be addressed through public health campaigns that promote vaccination and hygienic practices such as hand washing, safe food handling, and other behaviors associated with prevention of infection transmission. Infection control in health care settings will be enhanced by developing new interventions based on rapid diagnosis, improved understanding of the factors that promote cross-infection, and modified medical devices or procedures that reduce the risk of infection. The prevention and control of AR in agriculture and veterinary medicine requires 1) improved understanding of the risks and benefits of antimicrobial use and ways to prevent the emergence and spread of resistance; 2) development and implementation of principles for appropriate antimicrobial drug use in the production of food animals and plants; 3) improved animal husbandry and food production practices to reduce the spread of infection; and 4) a regulatory framework to address the need for antimicrobial drug use in agriculture and veterinary medicine while ensuring that such use does not pose a risk to human health. Comprehensive, multifaceted programs involving a wide variety of nonfederal partners and the public are required to prevent and control AR. The AR Task Force agencies will ensure ongoing input from, review by, and collaboration with nonfederal partners. The appropriate agencies will
OCR for page 283
support demonstration projects that use multiple interventions to prevent and control AR (e.g., through surveillance, appropriate drug use, optimized diagnostic testing, immunization practice, and infection control). The Task Force agencies will encourage the incorporation of effective programs into routine practice by implementing model programs in federal health care systems and promoting the inclusion of AR prevention and control activities as part of quality assurance and accreditation standards for health care delivery nationwide. Research Understanding the fundamental processes involved in antimicrobial resistance within microbes and the resulting impact on humans, animals, and the environment forms an important basis for influencing and changing these processes and outcomes. Basic and clinical research provides the fundamental knowledge necessary to develop appropriate responses to antimicrobial resistance emerging and spreading in hospitals, communities, farms, and the food supply. Priority Goals and Action Items in this focus area address ways to: Increase understanding of microbial physiology, ecology, genetics, and mechanisms of resistance; Augment the existing research infrastructure to support a critical mass of researchers in AR and related fields; and Translate research findings into clinically useful products, such as novel approaches to detecting, preventing, and treating antimicrobial-resistant infections. Needs in the field of AR research will be identified and addressed through a government-wide program review with external input. Additional research is needed, for example, on the epidemiology of resistance genes; on mechanisms of AR emergence, acquisition, spread, and persistence; and on the effects of antibiotics used as agricultural growth promoters on microbes that live in animals, humans, plants, soil, and water. Further study is also required to determine whether variations in drug use regimens may stimulate or reduce AR emergence and spread. Improved understanding of the causes of AR emergence will lead to the development of tools for reducing microbial resistance, as well as for predicting where AR problems are likely to arise. A comprehensive research infrastructure will help ensure a critical mass of AR researchers who will interact, exchange information, and stimulate new discoveries. This aim will be achieved through the appropriate strategies and scientific conferences that promote research on AR. The AR Task
OCR for page 284
Force agencies will work with the academic and industrial research communities to attract AR researchers, prioritize needs, identify key opportunities, and optimize the utilization of resources to address AR problems. The translation of research findings into innovative clinical products to treat, prevent, or diagnose drug-resistant infections is an area in which the federal government can play an important role, focusing on gaps not filled by the pharmaceutical industry or by other nongovernment groups. Special efforts will be placed on the identification, development, and testing of rapid, inexpensive, point-of-care diagnostic methods to facilitate appropriate use of antimicrobials. The AR Task Force agencies will also encourage basic research and clinical testing of diagnostic methods, novel treatment approaches, new vaccines, and other prevention approaches for resistant infections. Product Development As antimicrobial drugs lose their effectiveness, new products must be developed to prevent, rapidly diagnose, and treat infections. The Priority Goals and Action Items in this focus area address ways to: Ensure that researchers and drug manufacturers are informed of current and projected gaps in the arsenal of antimicrobial drugs, vaccines, and diagnostics and of potential markets for these products (designated here as “AR products”); Stimulate the development of priority AR products for which market incentives are inadequate, while fostering their appropriate use; and Optimize the development and use of veterinary drugs and related agricultural products that reduce the transfer of resistance to pathogens that can infect humans. Current and projected gaps in the arsenal of AR products and potential markets for these products will be reported to researchers and drug manufacturers through an interagency working group convened to identify and publicize priority public health needs. The development of urgently needed AR products will be stimulated throughout the process from drug discovery through licensing. The regulatory process for AR products will continue to be streamlined, and incentives that promote the production and appropriate use of priority AR products can be evaluated in pilot programs that monitor costs and assess the return on the public investment. The production of veterinary AR products that reduce the risk of development and transfer of resistance to drugs used in human clinical
OCR for page 285
medicine will be expedited through a streamlined regulatory and approval process. As with drugs for the treatment of human infections, pilot programs can be initiated to evaluate incentives that encourage the development and appropriate use of priority products that meet critical animal and plant health needs. Private and public partners will also evaluate ways to improve or reduce the agricultural use of particular antimicrobial drugs, as well as ways to prevent infection, such as the use of veterinary vaccines, changes in animal husbandry, and the use of competitive exclusion products (i.e., treatments that affect the intestinal flora of food animals). TOP PRIORITY ACTION ITEMS TO COMBAT ANTIMICROBIAL RESISTANCE (All 13 items have top priority, regardless of their order in the list.) Surveillance With partners, design and implement a national AR surveillance plan that defines national, regional, state, and local surveillance activities and the roles of clinical, reference, public health, and veterinary laboratories. The plan should be consistent with local and national surveillance methodology and infrastructure that currently exist or are being developed. (Action Item #2) Develop and implement procedures for monitoring patterns of antimicrobial drug use in human medicine, agriculture, veterinary medicine, and consumer products. (Action Item #5) Prevention and Control Conduct a public health education campaign to promote appropriate antimicrobial use as a national health priority. (Action Item #25) In collaboration with many partners, develop and facilitate the implementation of educational and behavioral interventions that will assist clinicians in appropriate antimicrobial prescribing. (Action Item #26) Evaluate the effectiveness (including cost-effectiveness) of current and novel infection-control practices for health care and extended care settings and in the community. Promote adherence to practices proven to be effective. (Action Item #39) In consultation with stakeholders, refine and implement the proposed FDA framework for approving new antimicrobial drugs for use in
OCR for page 286
food-animal production and, when appropriate, for re-evaluating currently approved veterinary antimicrobial drugs. (Action Item #58) Support demonstration projects to evaluate comprehensive strategies that use multiple interventions to promote appropriate drug use and reduce infection rates, in order to assess how interventions found effective in research studies can be applied routinely and most cost-effectively on a large scale. (Action Item #63) Research Provide the research community genomics and other powerful technologies to identify targets in critical areas for the development of new, rapid diagnostics methodologies, novel therapeutics, and interventions to prevent the emergence and spread of resistant pathogens. (Action Item #70) In consultation with academia and the private sector, identify and conduct human clinical studies addressing AR issues of public health significance that are unlikely to be studied in the private sector (e.g., novel therapies, new treatment regimens, and other products and practices). (Action Item #75) Identify, develop, test, and evaluate new rapid diagnostic methods for human and veterinary uses with partners, including academia and the private sector. Such methods should be accurate, affordable, and easily implemented in routine clinical settings (e.g., tests for resistance genes, point-of-care diagnostics for patients with respiratory infections and syndromes, and diagnostics for drug resistance in microbial pathogens, including in nonculture specimens). (Action Item #76) Encourage basic and clinical research in support of the development and appropriate use of vaccines in human and veterinary medicine in partnership with academia and the private sector. (Action Item #77) Product Development Create an Interagency AR Product Development Working Group to identify and publicize priority public health needs in human and animal medicine for new AR products (e.g., innovative drugs, targeted spectrum antibiotics, point-of-care diagnostics, vaccines and other biologics, anti-infective medical devices, and disinfectants). (Action Item #79) Identify ways (e.g., financial and/or other incentives or investments) to promote the development and/or appropriate use of priority AR products, such as novel compounds and approaches, for human and veterinary medicine for which market incentives are inadequate. (Action Item #80)
Representative terms from entire chapter: | <urn:uuid:fd1360d9-d7b8-41a4-9b6c-1a07fc134c4b> | CC-MAIN-2013-20 | http://books.nap.edu/openbook.php?record_id=10651&page=279 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368697974692/warc/CC-MAIN-20130516095254-00048-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.911949 | 3,403 | 2.46875 | 2 |
Eugenics as a Creed and the Last Decade of Galton's Life 313
7, WELL ROAD, N.W. Sunday, April 14, 1907.
MY DEAR FRANCIS GALTON, It was quite a) holiday seeing you on Thursday, and I came back with fresh vigour to my task. I have got about a quarter of the lecture now, done. I am sending you by parcel-post (a) Pollock's Spinoza, a fine book, which some day you will let me have back. (b) A series of my own Essays, which please do not return. In mitigation of anything which may offend you in them, I may say that most of them were written 25 years ago 'and all of them more than 20. The only ones that I suggest you should look at are Nos. 6 and 7, possibly No. 10 might interest you in a spare moment.
I enclose the proof of the wrapper for the Eugenics Memoirs. I hope you will approve it. Will you return it tome with suggestions of any changes you would like? I shall have to send it to the University for approval... .By the bye, I was amusing myself by trying to draw up a pedigree of Darwins and Wedgwoods on the basis of Noteworthy Families, pp. 18-19. On p. 18 Josiah Wedgwood is said to be George Darwin's, me me fa, and on p. 19 his me fa fa. Hence his mother's father and mother's mother must have been brother and sister! On p. 19, 1. 6, I read: "me fafa (she was her husband's fa bro dau)." Now the "she" is I suppose the me, hence the great Charles' wife was a Darwin, his father's brother's daughter, but her father's father was a Wedgwood. Hence she was a Wedgwood. Something seems to have gone wrong on pp. 18 and 19.
Will you put the W + D pedigree for me on a bit of paper? I have got very confused over it. Can you send me -'s address? It has occurred to me that it might possibly do good, if I sent a few lines. I think, perhaps, I am the only person, who knowing so much, could effectively say something more. It might not help, but I don't think it could harm. If you advise me not to, of course I shall not attempt it. But sometimes a call to the immediately obvious duty is really helpful. Affectionately, KARL PEARSON.
42, RUTLAND GATE, S. W. April 16, 1907.
MY DEAR KARL PEARSON, I am so glad that the pleasant visit you gave me was no hindrance to your work. Excuse delay in replying to your questions... .1 must postpone for another day the Darwin pedigree. The original papers are, I think, at 88, Gower Street, but I may succeed otherwise in working it out. The books are safely come ! Many thanks. I will read both of them leisurely.
As regards the entries on the wrapper, they seem to me to be quite clear and appropriate, except that the address given to applicants to exchange publications should be to some person. I have put "to the Editor" as a suggestion. As regards the colour of the wrapper, it may have distinctive merits, but not in the sense that the printing on it is distinct. At this moment I cannot read it in a darkish corner of the room, and I have often noticed in the heaps of periodicals on the tables at the clubs that the printing on the blue cover of the Edinburgh Review is by far the most indistinct of any. As regards size you naturally want to be constant to that of your other publications, so I say nothing against it, though my own unbiased feeling would be strongly in favour of Royal 8v°
The Vice-Chancellor of Oxford has attacked me about the Herbert Spencer lecture with such a kind and thoughtful letter,-assuring me that if when the time comes I should feel unequal to delivering it personally, or even of being present, he would arrange for its being read in my absence,-that I felt obliged to cancel my previous refusal. So I shall have to hold forth towards the end of May. I see that the first of these lectures was given in 1905 by Frederick Harrison. What may have occurred in 1906, I do not yet know.:. .I will be able to tell more when I write about the Darwin Pedigree. Ever affectionately, FRANCIS GALTON.
[HAMPSTEAD.] April 19, 1907.
- MY DEAR FRANCIS GALTON, I should have written yesterday only I was hoping to hear possibly from you again. I want to say how glad I am to hear you are going to undertake the Herbert Spencer Lecture after all. The only point I feel some compunction about is whether I have not, unwittingly, taken your subject from you. I had no idea at the time I sent them my title that you would be lecturing yourself in Oxford, and I would change it even now, if they had not posted it about the place. At least I judge they must have advertised it in some way, because I have received one or two letters already on the title. Now can you look upon me as
P O III | <urn:uuid:c5b56d2d-188a-4b6c-a7b9-c5021aaa0304> | CC-MAIN-2013-20 | http://galton.org/cgi-bin/searchImages/galton/search/pearson/vol3a/pages/vol3a_0366.htm | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368701459211/warc/CC-MAIN-20130516105059-00029-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.978979 | 1,128 | 2.015625 | 2 |
Mental Illness and the Death Penalty
The ACLU Capital Punishment Project is committed to challenging the application of the death penalty to the seriously mentally ill. Application of the death penalty to individuals suffering from serious mental illnesses does not comport with contemporary standards of decency and accordingly, violates the Eighth Amendment's prohibition on cruel and unusual punishment.
Courts have established that inmates who are insane – so out of touch with reality that they do not know right from wrong and cannot understand their punishment or the purpose of it – cannot be executed (Ford v. Wainwright ). The Supreme Court has also held that a mentally retarded individual cannot be executed (Atkins v. Virginia).
Make a Difference
Your support helps the ACLU oppose capital punishment and defend a broad range of civil liberties.
End the Death Penalty in Your State (map): The state of Georgia has executed Troy Davis, despite serious concerns that he was wrongly convicted in 1989 of killing a police officer. This case makes clear that the death penalty system in the United States is broken beyond repair. It is arbitrary, discriminatory and comes at an enormous cost to taxpayers, and it must be ended.
Mental Illness and the Death Penalty (2009 feature): There are significant gaps in the legal protection accorded severely mentally ill defendants charged with or convicted of a capital crime. Most notably, this country still permits the execution of the severely mentally ill. The problem is not a small one. A leading mental health group, Mental Health America, estimates that five to ten percent of all death row inmates suffer from a severe mental illness.
Mental Illness and the Death Penalty in North Carolina (2009 PDF): Significant numbers of individuals with serious mental illnesses are housed in North Carolina jails and prisons today. This is so despite the accepted fact that people with severe and debilitating mental illness are considered to be less responsible for their actions than those without such impairments, even when those actions violate the basic tenets of civil society.
The Case Against the Death Penalty: The American Civil Liberties Union believes the death penalty inherently violates the constitutional ban against cruel and unusual punishment and the guarantees of due process of law and of equal protection under the law. Furthermore, we hold that the state should not arrogate unto itself the right to kill human beings – especially when it kills with premeditation and ceremony, in the name of the law or in the name of its people, or when it does so in an arbitrary and discriminatory fashion.
Ryan v. Gonzales and Tibbals v. Carter: Supreme Court cases considering whether death row inmates who have been found incompetent are entitled to a stay of their federal habeas corpus proceedings. | <urn:uuid:abc2a1f9-870a-4bd3-b919-2a6098a82ceb> | CC-MAIN-2013-20 | http://www.aclu.org/capital-punishment/mental-illness-and-death-penalty-0 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708142388/warc/CC-MAIN-20130516124222-00013-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.940414 | 536 | 2.390625 | 2 |
Cars are shown here ranked according to the "Price Tax Ratio" . This
measure is simply the company car tax
payable at the top personal rate expressed as a percentage of the vehicle's
current list price. Of course this
is not the only way of measuring "tax efficiency", but it does act as
a simple guide.
Government policy is clearly promoting alternative fuelled vehicles, as
well as a few extremely expensive cars.
This anomaly arises because the maximum taxable value for a company car
cuts off at £80,000. The greater
the excess of the list price over this threshold, the higher the amount
of untaxed capital value.
NB: From April 2011 the £80,000 cap will be lifted, as well as the 3% discount for hybrids, so this table will change radically. To view these
changes please follow this link | <urn:uuid:f15a2b0e-c4bb-4c85-a3fb-dc39e205a1e9> | CC-MAIN-2013-20 | http://comcar.co.uk/newcar/companycar/poolresults/gtaxefficient.cfm?MakeModel=Empty%252CEmpty&OType=Make&fjs_fuel=ANY&clk=1 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708766848/warc/CC-MAIN-20130516125246-00065-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.920183 | 180 | 1.585938 | 2 |
The idea of Halloween as a year-round industry is growing, albeit slowly, she says. "I don't think it's everywhere but I do see more and more types of retailers carrying this type of product in the off-season."
Nearly three-quarters of Americans will celebrate Halloween this year, according to a survey conducted for the National Retail Federation (NRF). That's up from just over 50% in 2005.
The NRF estimates Halloween spending will reach a record $8 billion this year. The holiday is also growing outside of the U.S., notably in the UK, where Planet Retail estimates Halloween sales will rise to almost $549 million this year.
Patrick Konopelski, president of the Haunted Attraction Association, an organization representing more than 2,500 haunts, links the ever-growing popularity of Halloween to the desire to be entertained.
"People today more than ever want to experience life," he says. Halloween-inspired attractions like haunts aren't just a passing fad. They're "now part of the culture," says Konopelski.
Year-round attractions are still in the minority, but that's mainly due to their business models. It just isn't financially feasible for large attractions, which can be expensive to run, to stay open all year, Konopelski says.
For example, Shocktoberfest, a scream park he owns, employs as many as 100 people. "When you have that many people on payroll you have to put through thousands and thousands of people, and a short season is incredibly efficient," he says.
But the demand is there, he says. "This generation is a non-spectator generation. They want to participate in an experience."
For a small operator like Warfield, it makes sense to keep going the way he has. Up to a dozen people might help out around Halloween, but for the rest of the year, he's a one-man show. | <urn:uuid:3160d67e-a637-4995-b854-d6f81f135ce7> | CC-MAIN-2013-20 | http://www.wlwt.com/news/national/Halloween-s-year-round-business/-/9837944/17191380/-/item/1/-/11ihhph/-/index.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368697974692/warc/CC-MAIN-20130516095254-00066-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.97502 | 401 | 1.71875 | 2 |
Mandatory home energy audit could significantly hurt home sellers in an already tough economy
Ontario REALTORS® agree with the principle of energy efficiency for homes expressed in the
Government of Ontario’s proposed mandatory home energy audit, but they say that the additional
costs will hurt homeowners, especially in these economic times.
“This mandatory government regulation will impose a significant cost on home sellers. As with
most Canadians, we don’t believe in green at any cost,” said Gerry Weir, President of the Ontario
Real Estate Association. “It’s not the initial cost of these audits that concerns us,” he said. “Rather,
the results of these audits will be used by home buyers as bargaining chips to significantly reduce
the final selling price.
“Today’s economic downturn is a terrible time to introduce this measure. Home sellers are already
worried about lost equity in their homes. A move like this, which will reduce their value even further,
will not help them in any way,” Mr. Weir said.
Mark Imeson, President of The Windsor-Essex County Real Estate Board stated “not only will there
be the initial cost of the energy audit, but in the event there are deficiencies according to a
regulated energy audit the homeowner will now incur further costs to repair the deficiencies without
guarantee these expenses will be recouped in the sale of the home.”
REALTORS® favour government encouragement of energy efficiency in homes through expanded
tax breaks and other measures.
In addition, REALTORS® point out that there is no one standard for energy audits. Different firms
arrive at different assessments of the same house. “EnerGuide ratings of an existing home can and
do vary between energy auditors, depending on the assumptions they make and the extent of data
they collect on the building’s actual construction,” Mr. Weir said.
Furthermore, since there is no regulation of energy auditors, a conflict of interest can arise if a
contractor conducts the audit. There is a natural inclination for that contractor to find problems that
he can offer to repair for the homeowner.
Many details of the energy audit proposal have not been released. For instance, the government
has not said if an energy audit will be required if a property is transferred between family members.
Nor have they said how long an energy audit will be recognized as valid. For example, if a
homeowner sells within one year of buying a property, will the previous energy audit be
The Ontario Real Estate Association represents 45,000 brokers and salespeople who are members
of the 42 real estate boards throughout the province. Members of the association may use the
“REALTOR®” trademark, which identifies them as real estate professionals who subscribe to a high
standard of ethics and service.
OREA serves REALTORS® through a wide variety of professional publications, educational
programs, and government lobbying and other services. A division of the association, | <urn:uuid:60fb287b-d98a-46ca-a1c9-a69ec0ce10bf> | CC-MAIN-2013-20 | http://valenterealestate.wordpress.com/author/peterv1/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703298047/warc/CC-MAIN-20130516112138-00027-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.931488 | 637 | 2.109375 | 2 |
No New Issues Without Redress Of Uruguay Round Imbalances
Since former EU Trade Commissioner Sir Leon Brittan first floated the idea of a Millennium Round of trade talks, developing countries have remained steadfast in their demand that developed countries honour Uruguay Round commitments before moving forward full force with new trade negotiations.
Specifically, developing countries are concerned over developed countries’ compliance with agreements on market access for textiles, their use of antidumping measures against developing countries’ exports, and over-implementation of the WTO Agreement on Trade Related Aspects of Intellectual Property Rights (TRIPs).
Regarding anti-dumping, developing countries have called for a review of WTO rules, hoping to make anti-dumping measures more responsive to their needs. These countries argue that some developed countries misuse anti-dumping measures, which has resulted in significant trade barriers to developing countries’ exports. Japan and South Korea, frequent targets of anti-dumping investigations, have thus far been the strongest proponents amongst developed countries for including a review of anti-dumping measures in the next round. Canada has also joined the chorus calling for a review, while the EU has yet to take a definitive position on the matter. The U.S., however, has become increasingly isolated in its opposition to re-opening the anti-dumping agreement, especially as developing countries join strong trade powers in calling for a review of anti-dumping rules. There is tremendous political pressure within the U.S. from labour and industry groups to keep the anti-dumping rules unchanged in order to protect struggling U.S. industries (e.g. steel) against import surges. The U.S. has strongly criticised Japan for its position on the issue, accusing Japan of having a less than admirable record on dumping.
With regard to textiles, developing countries argue that restrictive implementation of developed countries’ commitments in textiles under the Uruguay Round Agreement on Textiles and Clothing (ATC), combined with the extensive use of trade remedies (such as anti-dumping measures), have resulted only in a minimal increase in market opening while reinforcing imbalances in competition between developed and developing countries.
India (for whom textiles account for more than 20 percent of total exports) intends to press developed countries to dismantle quotas in advance of the 2005 deadline. Under the ATC, textile-importing countries such as the U.S. and EU agreed to a ten-year phase-out period (until 2005) for restrictions on textile imports. Developing countries agreed to the phase-out period, even though developed countries back-loaded the most commercially meaningful products at the end of the period. Colombia, Egypt, Pakistan, and Bangladesh are among other Members pushing for improved implementation of the ATC.
Regarding the TRIPs Agreement, a number of developing countries have called for an extension of the implementation deadline for Art.27.3 (b) that calls for WTO Members to protect intellectual property (IPRs) over plant varieties either through patents, an effective sui generis system, or with a combination of the two. The deadline for implementation is 1 Jan 2000, but developing countries want to extend it to five years from the date of completion of the review of Art.27.3 (b) that is currently underway.
The U.S. has thus far rejected the idea of extending the TRIPs Agreement implementation deadline or of renegotiating aspects of the Agreement to address developing countries’ concerns. The U.S. argues that it has yet to benefit from the agreement and that an effective intellectual property protection system would be beneficial in stimulating research and development.
Meanwhile, some developing countries intend to place on the table at the WTO Ministerial access to lower cost pharmaceuticals (particularly HIV/AIDS treatment). Countries such as South Africa, Thailand, and others dealing with large HIV/AIDS populations want to protect their rights to price control mechanisms under the WTO Agreement on Trade Related Aspects on Intellectual Property Rights. These mechanisms help ensure affordable access to pharmaceuticals. Pharmaceutical firms, on the other hand, fear that mechanisms such as compulsory licensing and parallel importing would lower world prices for HIV/AIDS treatments (and all pharmaceuticals) and lead to a deterioration of product quality and a loss of control over regulatory standards.
“India leads fight for developing nations market access,” AGENCE FRANCE-PRESS, 16 November 1999; “The dumping, not the response, is the issue,” JOURNAL OF COMMERCE, 19 November 1999; “Canada sees anti-dumping review in WTO trade round,” REUTERS, 28 October 1999; “U.S. won’t discuss dumping at WTO,” WASHINGTON POST, 27 October 1999; “Japan defends its agenda at WTO,” REUTERS, 25 October 1999; “EU hesitant to collaborate with Japan on anti-dumping,” KYODO NEWS INTERNATIONAL, 9 November 1999; “Trade: implementation issues as important as agriculture,” SUNS, 2 November 1999; “India will not be browbeaten in WTO talks,” AGENCE FRANCE-PRESSE, 2 November 1999; “Traditional knowledge under commercial blanket,” SUNS, 5 November 1999; “Developing nations see trade battle on HIV drugs,” IPS, 27 October 1999. | <urn:uuid:c3fd09c6-31ad-4202-8b23-82b6b666b128> | CC-MAIN-2013-20 | http://ictsd.org/i/news/bridgesweekly/19192/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368700264179/warc/CC-MAIN-20130516103104-00000-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.941611 | 1,094 | 2.40625 | 2 |
There are many tools used today to make baskets. Some are modern and would not have been use by our forbears and others have fell into disuse. There are also various basketmaking techniques which require there own tools. I will start with willow and cane basketry which are similar.Stake and strand basketry
I suppose the only tool actually necessary to make this type of basket is a knife and this is a universal tool for most basketry projects. However man, being an extremely inventive animal, has gathered a great variety of other tools to help. I will start with the knife.The knife
If you are using a conventional knife then you will need a stone on which to sharpen it. The knife must be sharp. I use a Stanley knife and change the blade every now and again as necessary. For pricking up you need the blade to be a bit less pointy that the normal Stanley blade but this can be altered by modifying old blades on your stone. For trimming a curved blade is again better than the conventional Stanley blade. Pen knives and other knives with folding blades are not really suitable unless the blade can be locked into position. Shears or secateurs
These are very useful for trimming and cutting the willow. Ordinary garden secateurs will do but side cutters (wire cutters), if they are really sharp, do a better job.Bodkin
This is a tool (usually metal) for making holes. You can buy bodkins especially for basketry in various sizes. You can make bodkins by filing down an old screwdriver to a point. It is not necessary for this to be made of metal and you can also make perfectly satisfactory bodkins from wood. Hard woods are preferable which are just sharpened to a point.Ruler
This is quite useful for measuring heights and widths of baskets etc. I use a folding ruler but many basketmakers use a meter stick. A piece of willow cut to size is often very useful and you can mark the willow with notches if you want something more permanent.Lapboard
These can vary a bit in size but are used as a sloping table on which to make your basket. They are usually about 3 foot wide and about 3 to 4 foot long with short (2 to 3 inch ) legs at one end. The basketmaker either sits on the floor or a low bench and the lapboard is placed with its legs towards the basketmakers feet and supported by the basketmakers legs. The basket is then "nailed" to the board usually using the bodkin through the centre of the base in such a way that the basket can be turned around pivoting on the bodkin. It is a good idea to have some sort of back support when working in this position. Either work with your back against a wall or you can use a low seat (an old car seat perhaps). The lapboard itself can be modified by fixing a turntable on it for the basket to revolve on. The simplest idea for a revolving table is just a round piece of board with a piece of dowel fixed to the centre. The dowel is then dropped into a hole drilled into the lapboard and the basket is fixed to the revolving platform thus formed. Further modifications of this idea are bolting the platform to the table and having spikes coming upward through the platform onto which you spike the basket base. Some basketmakers use weights to steady the basket while they are working on it but I have never found this to be very satisfactory.Screw block
This is a couple of pieces of timber ( 2 to 32 inches thick) about 2 to 3 feet long which are bolted together in such a way that willow stakes can be clamped between them when making square bases. | <urn:uuid:eaf7dcb2-125b-41d9-ab66-81c49f1b4404> | CC-MAIN-2013-20 | http://website.lineone.net/~luichart.woollens/page14.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368710006682/warc/CC-MAIN-20130516131326-00071-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.957787 | 765 | 2.625 | 3 |
This 91 acre nature preserve contains one of the most important wetlands in Mecklenburg County. The preserve was purchased in October, 2008 and is home to a diverse array of amphibians and uncommon plants.
Location and Directions
West Branch Nature Preserve is located in northeastern Mecklenburg, north of Rte. 73
From I-77, take exit 25, Rte. 73/Sam Furr Rd. Proceed west on Rte. 73 for 5.8 miles. Turn left on Summerswalk Blvd. Proceed three-quarters of a mile on Summerswalk Blvd. to the intersection of Leavitt Lane. West Branch Nature Preserve lies just the north. There is no public parking and there are no public amenities.
History and Description
This 90.3 acre preserve in northern Mecklenburg County was purchased in October, 2008. It holds a significant wetland with a diverse array of amphibians. In fact, nearly every species of amphibian that has been found in Mecklenburg County has been documented here. There is also a population of beavers at the site.
Wetlands are extremely important for their ability to serve as flood control, filter pollutants, trap sediment and gather nutrients, and be a nursery and home to many species of plants and animals. Waters from West Branch Nature Preserve flow into the Rocky River, and thus this preserve helps maintain the health of the Rocky River watershed.
Education and Programs
Current access with guided walks led by Park and Recreation staff.
There are currently no public amenities.
Flora and Fauna
One of the most important species of wildlife in the preserve is the beaver. Although beavers are most active from dusk to dawn and are not usually seen, evidence of their presence is everywhere in the form of dams, gnawed trees, and stick lodges.
Nearly every species of amphibian in Mecklenburg County has been documented in West Branch Nature Preserve. The wetland also harbors a great diversity of plants and other animals. A complete assessment of the preserves biodiversity is still being undertaken. Maidenhair fern was discovered here in October, 2008. | <urn:uuid:67050461-5bfb-4d67-af9d-7bf663c92281> | CC-MAIN-2013-20 | http://charmeck.org/mecklenburg/county/ParkandRec/StewardshipServices/NaturePreserves/Pages/WestBranch.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702448584/warc/CC-MAIN-20130516110728-00053-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.953887 | 438 | 2.71875 | 3 |
Nurse Practitioner's Care Equal to Doc's, Review Finds
...In fact, states struggling to meet the growing demand for primary care services should expand scope-of-practice laws for NPs and other advanced practice registered nurses (APRNs), the National Governors Association said in its review of the issue.
The group looked at 22 articles, including 10 published since a 2008 review by the Colorado Healthcare Institute, which the current study sought to expand upon.
"Most studies showed that NP-provided care is comparable to physician-provided care on several process and outcome measures," the report, The Role of Nurse Practitioners in Meeting Increasing Demand for Primary Care, released late last week, stated. "Moreover, the studies suggest that NPs may provide improved access to care."
Specifically, the review found:
NPs provided care that compared with that of physicians in terms of patient satisfaction, time spent with patients, prescribing accuracy, and preventive education NPs were capable of successfully managing chronic conditions in patients suffering from hypertension, diabetes, and obesity Three analyses found NPs rated favorably in achieving patients' compliance with recommendations and reductions in blood pressure and blood sugar A 2003 review found NPs were more likely to work in underserved urban populations and rural areas
Read the full article here. Discuss below.
Posted on Dec. 30, 2012
connect with blueoregon | <urn:uuid:8d1e66a8-0cf1-4dd7-9037-756357d9ae18> | CC-MAIN-2013-20 | http://www.blueoregon.com/news/13347/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368709037764/warc/CC-MAIN-20130516125717-00029-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.96201 | 279 | 1.875 | 2 |
One in 10 surgical patients readmitted with post-op complications
About one in 10 general surgery patients return to the hospital, mostly due to postoperative complications, according to a study published in the September Journal of the American College of Surgeons.
Researchers looked at hospitals enrolled in the American College of Surgeons National Surgical Quality Improvement Program. Out of nearly 1,500 general surgery patients, 11.3 percent were readmitted to the hospital within 30 days. Although there are multiple risk factors for readmissions, particularly for surgical patients, researchers noted that postoperative complications were the biggest driver for frequent fliers: gastrointestinal problems/complications (27.6 percent), surgical infections (22.1 percent) and failure to thrive/malnutrition (10.4 percent).
"Hospital readmissions are the tip of the iceberg, but when you dig deeper, it is the postoperative complications that drive readmissions among general surgical patients," said senior study author John F. Sweeney, M.D., chief of division of general and gastrointestinal surgery at Emory University School of Medicine in Atlanta.
Patients who underwent pancreatectomy, colectomy and liver resection procedures saw the most readmissions.
Not surprisingly, the more postoperative complications a patient has, the higher the risk of readmission. Patients who had one or more complications after an operation were four times more likely to be readmitted to the hospital, compared with those who had no complications, the American College of Surgeons noted in a research announcement yesterday. The risk increases if the complication happens at home rather than at the hospital.
Complications also led to longer hospital stays. While patients with no complications had a median length of stay of five days, patients with one complication stayed for nine days; patients with three or more complications stayed in the hospital for 24 days.
The study comes just a couple months before hospitals will start to see reduced reimbursements because of high readmission rates. Starting in October, hospitals with high readmission rates could be dinged anywhere from 0.42 percent to 1 percent of revenue, which could run well into the high six or low seven figures a year for single, large facilities, FierceHealthFinance reported.
In 2009, about 12.7 percent of all U.S. patients discharged after surgery returned within 30 days, LifeHealthPRO reported. The states with higher-than-national-average readmission rates included New York (15.9 percent), New Jersey (14.9 percent) and Connecticut (13.3 percent).
"The biggest bang for the buck is going to be a combination of decrease of complications and decrease of length of stay, resulting in decrease of readmissions," Sweeney said. "Decreasing complications will benefit the patient, the hospital and the payer and will improve quality of care," he said. "It will decrease length of stay and decrease hospital readmissions," he concluded.
For more information:
- check out the study abstract
- read the research announcement
- see the LifeHealthPRO article
Hospitals put 7-figure price tag on readmission penalties
Leaders brace for October readmission penalties
More providers join CMS efforts to reduce readmissions
Hospitals: Readmission rate penalties misguided | <urn:uuid:8f4837a0-05b7-43bc-8ce8-0ff6ae7c1ae1> | CC-MAIN-2013-20 | http://www.fiercehealthcare.com/story/surgical-patients-bounce-back-post-op-complications/2012-08-29 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368704392896/warc/CC-MAIN-20130516113952-00021-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.949367 | 662 | 1.71875 | 2 |
The Government of Rwanda will continue to make the necessary investments to ensure that all Rwandans with good ideas can become entrepreneurs, President Paul Kagame has said.
The pledge is contained in the President's Labour Day message to Rwandans on the day the nation joins the rest of the world to mark this year's May Day.
"This is why the Business Development Fund, accessible all over Rwanda, was created - to support Rwandans to create jobs from innovative ideas, particularly those who have difficulty (in) accessing loans," Kagame said in a statement released by the State House today.
"I want to thank you for the work you do every day to advance your families, communities and our nation. Our efforts as Rwandans, in collaboration with our partners, have already started to show good results. In the past five years one million Rwandans raised themselves from poverty," he said.
But the Head of State added: "We still have more work to do together to take our nation and our people where we deserve to be."
Rwanda has set an ambitious economic agenda, with its sights firmly set on becoming a middle income economy by 2020.
In March this year, the government revised upwards its Vision 2020 targets, to the GDP per capita of US$1, 240, up from $900. Currently, the GDP per capita is hovering around $560.
To achieve that target, the country will need to register an average of 11.5 per cent economic growth, with agriculture growing at over 8.5 per cent, according to official estimates.
Currently, of the 47 listed Vision 2020 indicators, 60 per cent have been achieved or are on track, 17 per cent are achievable, while concerted efforts are needed to achieve the remaining 23 per cent.
In his message to the nation, President Kagame said that 125,000 young Rwandans enter the job market every year, adding that "their talents, energy and goodwill have to be matched by opportunity."
He congratulated the winners of this year's competition for Small and Medium Enterprises from all the districts, telling them "you are leading the way for the development of our country."
"Rwanda will be built by the hands of its citizens; we know already how far we can go when we work together. Let us continue to uphold the value of work because it goes hand in hand with dignifying ourselves and our country."
Rwanda is looking to weaning itself off aid, with more than 50 per cent of the country's budget now domestically funded. | <urn:uuid:ebc5b643-1989-4aca-94d6-285e7f9aeae4> | CC-MAIN-2013-20 | http://allafrica.com/stories/201205010490.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698924319/warc/CC-MAIN-20130516100844-00027-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.95679 | 520 | 1.890625 | 2 |
Journal of the Waterloo Campaign
Kept Throughout the Campaign of 1815
Date of publication: June 2012
Publisher: Pen and Sword
Mercer’s journal is one of the most outstanding eyewitness accounts of the Waterloo campaign ever published. It is a classic of military history. This new, fully illustrated edition, featuring an extensive introduction and notes by Andrew Uffindell, one of the leading authorities on the Napoleonic Wars, contains a mass of additional material not included in the original.
As the bicentenary of Waterloo approaches, this beautifully prepared, scholarly edition of Mercer’s work will be essential reading for anyone who wishes to know what it was really like to fight in the final, great battle against Napoleon. Captain Mercer was in acting command of G Troop, Royal Horse Artillery. His journal vividly describes the campaign, from his landing at Ostend as Wellington’s army began to assemble, through the excitement and confusion of the battle itself, and on to the occupation of Paris and the conclusion of the war.
His graphic account – which is just as readable and relevant today as it was when it was written – is full of telling, authentic detail, for Mercer was a gifted, sensitive writer and an acute observer, and he was equally adept at capturing the scenery, people’s characters, and his remarkable experiences while under fire. | <urn:uuid:58ba82a7-7735-40d6-abdd-9217d3524d27> | CC-MAIN-2013-20 | http://nationalarchives.gov.uk/BOOKSHOP/details.aspx?titleId=2687 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696381249/warc/CC-MAIN-20130516092621-00005-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.963785 | 278 | 2.15625 | 2 |
A crowd of 400 has gathered outside the Swiss Embassy in Tehran to protest against the American-made film denigrating the Prophet Muhammad that has sparked outrage in the world's Muslim community.“Death to the United States and death to Israel and death to England!”
was heard over a loudspeaker outside the Swiss diplomatic mission, which represents American diplomatic interests in Iran, following the breakup of diplomatic ties in the aftermath of the Islamic Revolution of 1979.
Riot police have cordoned off the are, causing traffic jams around the capital as the crowd voiced support for demonstrations in Egypt, Lebanon, Libya and Tunisia. Shouts of "Muslims, unite!" and "Mohammad is God's prophet" were heard.
Reacting to US Secretary of State Hillary Clinton’s claims that "the United States government had absolutely nothing to do with this video. We absolutely reject its content and message," Iran's Supreme Leader Ayatollah Ali Khamenei said that "if American politicians are honest in their claims that they were not involved, they have to hold responsible those who committed this obscene crime … and their financial supporters," Iran's official IRNA news agency quoted him as saying in a statement.
A day earlier, Iran’s Foreign Ministry condemned the "repulsive" film, deeming it offensive to Islam, and calling on Washington to take action.
"The US government's systematic and continued silence on such repulsive acts is the fundamental reason that they keep happening, The American government has the responsibility to stop this dangerous trend in the spreading of insults to Islamic Umma's highest sanctities," Iranian Foreign Ministry spokesman Ramin Mehmanparast said in a statement. | <urn:uuid:d6faa077-0884-4a7f-84e4-d83aed730773> | CC-MAIN-2013-20 | http://rt.com/news/iran-protest-islam-insulting-film-096/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708766848/warc/CC-MAIN-20130516125246-00028-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.963723 | 340 | 1.578125 | 2 |
Yellow Journalism is an unflattering term used to describe Newspaper or any media coverage that is sensationalized in order to bring about a desired result. While not necessarily outright lies, it plays rather loosely with the truth or presents information in a way where conclusions are reached that might not be drawn if all information was presented.
It downplays legitimate news in favor of eye-catching headlines that sell more newspapers. It may feature exaggerations of news events, scandals, sex, weird events or unprofessional practices by news media organizations or journalists. Campbell (2001) defines Yellow Press newspapers as having daily multi-column front-page headlines covering a variety of topics, such as sports and scandal, using bold layouts (with large illustrations and perhaps color), heavy reliance on unnamed sources, and unabashed self-promotion.
Mott defines Yellow Journalism in terms of five characteristics:
- scare headlines in huge print, often of minor news
- lavish use of pictures, or imaginary drawings
- use of faked interviews, misleading headlines, pseudo-science, and a parade of false learning from so-called experts
- emphasis on full-color Sunday supplements, usually with comic strips (which is now normal in the U.S.)
- dramatic sympathy with the "underdog" against the system.
The term was extensively used to describe certain major New York City newspapers about 1900 as they battled for circulation. By extension the term is used today as a pejorative to decry any journalism that treats news in an unprofessional or unethical fashion, such as systematic political bias.
Both Joseph Pulitzer and William Randolph Hearst are associated with bringing yellow journalism into American society through their newspapers in the later half of the nineteenth century. The prominence of yellow journalism was especially notable in coverage of the Spanish occupation of Cuba and Pulitzer and Hearst took credit for the Spanish American War that followed, but historians dispute the claim. Their papers reached only New York City readers, and it was the rest of the country that demanded war in 1898.
- Auxier, George W. "Middle Western Newspapers and the Spanish American War, 1895–1898," Mississippi Valley Historical Review (1940) v. 26 in JSTOR
- Campbell, W. Joseph. Yellow Journalism: Puncturing the Myths, Defining the Legacies, (2001) online edition
- Emory, Edwin and Michael Emory. The Press and America (4th ed. 1984)
- Nasaw, David. The Chief: The Life of William Randolph Hearst (2000)
- Rosenberg, Morton, and Thomas P. Ruff. Indiana and the Coming of the Spanish-American War, (1976), finds that Indiana papers were "more moderate, more cautious, less imperialistic and less jingoistic than their eastern counterparts."
- Smythe, Ted Curtis, and Sloan, W. David, eds. The Gilded Age Press, 1865–1900, (2003), online
- Sylvester, Harold J. "The Kansas Press and the Coming of the Spanish-American War", The Historian 31 (February 1969), finds no Yellow journalism influence on the newspapers in Kansas.
- Welter, Mark M. "The 1895–1898 Cuban Crisis in Minnesota Newspapers: Testing the 'Yellow Journalism' Theory", Journalism Quarterly 47: 719–724 (Winter 1970) | <urn:uuid:c3fcce1c-3517-48d7-865e-70a6d2aa4a26> | CC-MAIN-2013-20 | http://conservapedia.com/Yellow_Journalism | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696382584/warc/CC-MAIN-20130516092622-00028-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.922286 | 682 | 3.5625 | 4 |
Information for Patients and Caregivers
Cancer patients who are treated with chemotherapy are more likely to get infections through everyday activities, or from health care settings. One out of every 10 cancer patients who receives chemotherapy gets an infection that requires a hospital visit.
What Is an Infection?
You get an infection when germs enter your body and multiply, causing illness, organ and tissue damage, or disease. Bacteria and viruses cause infections.
- You can get bacteria from the air, water, soil, or food during the course of your medical treatment. Most bacteria come from your own body. Common bacterial infections include pneumonia, bronchitis, and ear infections.
- Viruses are passed from one person to another. Common viral infections include the common cold, herpes, and the flu.
How Does the Body Normally Fight Infections?
The immune system helps your body protect itself from getting an infection. Cancer and chemotherapy can damage this system, reducing your numbers of infection-fighting white blood cells and making it harder for your body to fight infections.
How Can I Prevent Infections During Chemotherapy?
1. Prepare: Watch Out for Fever
If you get a fever during your chemotherapy treatment, it's a medical emergency. Fever may be the only sign that you have an infection, and an infection during chemotherapy can be life-threatening.
You should take your temperature any time you feel warm, flushed, chilled, or not well. If your temperature is 100.4°F (38°C) or higher for more than one hour, or 101°F (38.3°C) or higher for any length of time, call your doctor right away, even if it happens in the middle of the night. You should also—
- Find out from your doctor when your white blood cell count is likely to the be the lowest, since this is when you're most at risk for infection.
- Keep a working thermometer in a convenient location and know how to use it.
- Keep your doctor's phone numbers with you at all times. Make sure you know what number to call when their office is open and closed.
- If you have to go to the emergency room, tell the person checking you in that you are a cancer patient undergoing chemotherapy. If you have a fever, you might have an infection. This is a life-threatening condition, and you should be seen quickly.
2. Prevent: Clean Your Hands
Clean hands help prevent infections. Many diseases are spread by not cleaning your hands, which is especially dangerous when you're getting chemotherapy treatment because your body may not be able to fight off infections like it used to. You and anyone who comes around you, including all members of your household, your doctors, and nurses, should clean their hands frequently. Don't be afraid to ask people to clean their hands. Use soap and water to wash your hands. If soap and water aren't available, it's OK to use an alcohol-based hand sanitizer.
Be sure to clean your hands—
- Before, during, and after cooking food.
- Before you eat.
- After going to the bathroom.
- After changing diapers or helping a child use the bathroom.
- After blowing your nose, coughing, or sneezing.
- After touching or cleaning up after your pet.
- After touching trash.
- Before and after treating a cut or wound or caring for your catheter, port, or other access device.
3. Protect: Know the Signs and Symptoms of Infection
During your chemotherapy treatment, your body may not be able to fight off infections like it used to. When your white blood cell counts are low, you must take infection symptoms seriously. Infection during chemotherapy can lead to hospitalization or death. Call your doctor right away if you notice any of the following signs and symptoms of an infection—
- Fever (this is sometimes the only sign of an infection).
- Chills and sweats.
- Change in cough or a new cough.
- Sore throat or new mouth sore.
- Shortness of breath.
- Nasal congestion.
- Stiff neck.
- Burning or pain with urination.
- Unusual vaginal discharge or irritation.
- Increased urination.
- Redness, soreness, or swelling in any area, including surgical wounds and ports.
- Pain in the abdomen or rectum.
- New onset of pain.
Find out from your doctor when your white blood cell count is likely to be the lowest, since this is when you're most at risk for infection. This usually occurs between 7 and 12 days after you finish each chemotherapy dose, and may last up to one week.
What Should I Do If I Think I Have an Infection?
Call your doctor right away, even if this happens in the middle of the night. This is considered an emergency. Don't wait until morning. Keep your doctor's phone numbers with you at all times. Make sure you know what number to call during your doctor's office hours, as well as after hours.
CDC produced materials to help promote awareness about the importance of preventing infections in cancer patients. The fact sheet is intended to be handed out to patients and caregivers. The posters can be placed in patient waiting areas, staff lounges, emergency rooms, and anywhere that patients and health care providers might view them. Selected materials can be ordered in limited quantities.
- NEW! Cancer Is a Fight. Don't Let the Flu Knock You Down poster [PDF-1.5MB]
- NEW! Cancer Is a Fight. Don't Let the Flu Knock You Down postcard [PDF-3.5MB]
- Out of Sight, Out of Mind poster [PDF-185KB]
High-resolution version for printing [PDF-181KB]
- Neutropenia and Risk for Infection: What You Need to Know fact sheet [PDF-174KB]
High-resolution version for printing [PDF-173KB]
- Prevent Infections During Chemotherapy podcast [2:52]
- Centers for Disease Control and Prevention
Division of Cancer Prevention and Control
4770 Buford Hwy NE
Atlanta, GA 30341
TTY: (888) 232-6348
- Contact CDC-INFO | <urn:uuid:e275f5d7-9a8d-4a4c-b4f7-a13120667980> | CC-MAIN-2013-20 | http://www.cdc.gov/cancer/preventinfections/patients.htm | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368702448584/warc/CC-MAIN-20130516110728-00018-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.918959 | 1,301 | 3.390625 | 3 |
Using pictures to show the before-and-after scenario he hopes to achieve, Wichita Falls Public Works Director Russell Schreiber walked City Council members through an idea for a pilot project aimed at reducing flooding in the future.
The city is looking at an eventual need to remove about 720 acres of vegetation from the area of the Wichita River in an effort to reduce the risk of flooding in the future, according to presentations that have followed a study of the Wichita River.
Schreiber on Tuesday focused on 23 acres in the northern part of Lucy Park as a pilot project to gauge how the picture might look on a larger scale when it comes to costs and a timeline.
Tuesday's presentation followed an update council members and city staff received during a strategic planning session in February.
The U.S. Geological Survey had presented its findings in the third phase of a study of the river in late 2010. Shreiber showed leaders maps in February indicating areas that might have and might not have flooded in 2007 had most of the vegetation not been there.
Overgrowth of vegetation on the bank of the river appeared to be the primary cause of flooding that occurred in 2007, and a model showed the need to remove 90 percent of the vegetation along a stretch of the river. The goal is to leave large trees but to clear out much of the other growth.
One of the major factors to consider is what this type of undertaking will cost, Schreiber told council members on Tuesday. The idea for the pilot project began to grow, and the search began for a piece of city property that fit what the project needed.
"Lucy Park fits the bill," Schreiber said.
He said he believes this effort, which he hopes would happen sometime in the late summer or early fall, would help the Parks Department as well as help with the efforts to reduce flooding.
"It's unmaintained, it's overgrown, a lot of deadfall in there," Schreiber said of the part of Lucy Park the city wants to use for this pilot project.
Schreiber compared photographs of places covered in growth and deadfall to an image of another spot that was clear of brush and deadfall; only large trees stood. The latter is the goal for this project.
He said there are two contractors, and he is looking at carving out a certain amount of money — somewhere in the ballpark of $20,000 at this point — to divide and have them get their machinery in the area and work on the project to see what this type of undertaking would involve.
"You're talking about large grinding equipment," Schreiber said. A lot depends on how thick the brush is and how much needs to be ground up.
"That's the whole reason we're trying to do Lucy Park is we think it is a nice representative sample of what we will encounter downstream and upstream," Schreiber said. "We'll be able to determine on a per-acre basis what that's going to cost."
Schreiber said he doesn't anticipate all of the acres identified would be addressed through this pilot project.
Steps that include looking at environmental issues need to come before any work could begin.
Schreiber believes this pilot project would make the park safer and more usable and would also help the city determine costs for this type of clearing to occur on a larger scale.
If things move ahead successfully, the goal would be to coordinate and hold some stakeholder meetings with private property owners, starting at the beginning of the issue and informing them about what the city wants to accomplish in that area, Schreiber said. Public works representatives are working with city legal staff and others to consider everything such a program would entail once it was completely put together.
At this point, Schreiber offered an idea similar to the program the city has in place for street overlay work.
He described a possibility of carving an amount out of the stormwater utility fund and allocating it to the Wichita River work, planning for certain amounts every year and working with property owners until the entire 15 miles were cleared.
Council members took action on a number of items during Tuesday's meeting. Councilors voted to:
— Approve a resolution awarding the bid for the 2011 street rehabilitation project to Zack Burkett Co. in an estimated amount of $2,727,734.45. The list of projects is longer than usual this year. Through a combination of street department funds, 4B funds, property management funds for Lake Arrowhead roads and parks department funds for cemetery roads, the city is able to use about $2.7 million, compared to the usual $1.6 million.
— Approve an ordinance finding certain structures dangerous and requiring demolition of those that remained on the list following a public hearing during which owners had a chance to talk to the council about their properties. | <urn:uuid:022fc2f7-2b6d-419e-89a8-4f73c99504d4> | CC-MAIN-2013-20 | http://www.timesrecordnews.com/news/2011/apr/06/pilot-project-meantto-reduce-flooding/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368708142388/warc/CC-MAIN-20130516124222-00046-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.974142 | 989 | 2.078125 | 2 |
In hurricanes' aftermath, keeping infection under control
As TLID goes to press, efforts to deal with public-health concerns in the aftermath of hurricanes Katrina and Rita continue. As residents return to New Orleans and its environs, “a number of public-health issues are looming”, according to the Centers for Disease Control and Prevention. “Health-care services aren't yet widely available, sewer and water services aren't 100%, and structural inspections aren't complete”. Ongoing concerns include raised concentrations of Escherichia coli in Lake Pontchartrain and elsewhere; mould, which is ubiquitous; Vibrio vulnificus, which can infect wounds exposed to water containing the bacterium; and hepatitis B, notes Matthew Mitchell of Steris, a company involved in disinfection, decontamination, and monitoring of the affected areas. | <urn:uuid:947565e6-6627-46af-9048-265c0b30ad76> | CC-MAIN-2013-20 | http://www.thelancet.com/journals/laninf/issue/vol5no11/PIIS1473-3099(05)X7016-5 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696383156/warc/CC-MAIN-20130516092623-00022-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.933129 | 175 | 2.625 | 3 |
Friday Puzzler: Why Take Credit for Shooting a Girl?
There are two blatant puzzles associated with the shooting of 14 year old Malala Yousafzai by the Taliban in Pakistan Tuesday. The first is the motive: what benefit could any organization, especially one that eventually hopes to lead the Pakistani population, gain from killing a young girl? The second has to do with strategy. Why would any organization ever publicly take credit for the shooting, especially after observing the worldwide outrage that resulted? Yet that’s exactly what the Pakistani Taliban did when it proudly took responsibility for the act.
So today’s puzzle is this: why is the Taliban so intent on killing this little girl? And why have they been so brazen as to claim responsibility, going so far to say that they will not stop until she is dead? Could any single child be that important?
Answer to last week’s puzzler
Last week we asked why the governments of Libya and Egypt reacted so differently to the attacks on US diplomatic facilities in their respective countries. Commenter Scott Monje suggested that the US “appears to be much more popular in Libya than in Egypt,” encouraging the Libyan government to quickly apologize for the attack. Daniel Rio Tinto added that the Libyan government was more dependent on the US because it came to power “with the aid of NATO intervention” which made them “much more careful on how to engage with the US and the West as a whole.” Both are true. The real question, however, is why the US enjoys greater popularity in Tripoli than Cairo despite the substantial aid both countries receive from the US. I believe the answer has more to do with domestic politics than anything the US does or does not do.
Both the current regimes in Egypt and Libya are in the midsts of domestic power struggles: Egyptian President Morsi and the Muslim Brotherhood are in a heated competition with the extreme but still popular Salafists for public support. In Libya the power struggle is much less severe, as it is between the newly elected president and legislature and the far less popular Al Qaida faction, but could still cause problems.
The govenrment in Libya had the luxury to quickly and immediately condemn the attacks because the perpetrators of the attacks — a wing of Al Qaida — are not popular in Libya and thus pose no threat to the regime. The attackers’ goal was not to undercut popular support for the existing regime — which they have no ability to do — but to convince the regime’s main supporter, the United States, to leave the country.
President Morsi is in an entirely different position. His Muslim Brotherhood won the most recent election, but faces a strong competitor from more extreme Salafists, who were behind the attacks in Egypt. The Salafists goal was not to convince the United States to leave — something that they will not be able to do — but to convince Egyptian voters that the Muslim Brotherhood is “in bed” with the US and thus not worthy of their support. Given this game, in the aftermath of the attack Morsi was in a difficult position. He could not immediately condemn the attackers and come out in support of the US, since this would signal to Egyptians where his allegiance lay. But he could not unequivocably support the attackers since the regime depends on continued US aid. Morsi, thus, behaved quite strategically when he initially condemned the video and its author, demanding an apology, but then a few days later quietly shut down further demonstrations. | <urn:uuid:6f4d6ba5-e297-4f49-b117-0e8674d81192> | CC-MAIN-2013-20 | http://politicalviolenceataglance.org/2012/10/19/friday-puzzler-why-take-credit-for-shooting-a-girl/ | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696382584/warc/CC-MAIN-20130516092622-00066-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.976435 | 713 | 1.6875 | 2 |
Artist, David Stone Martin 1913-1992 xpost pen & ink
I believe I have my hands on an original piece of old art by this artist. From what I gather on the internet, it's the art used for a 1955 album cover ("Ralph Burns Among the Jatps") and it is "exact." The paper is art paper (little bit of texture), and on the back is a lighter paper-colored image of the front. Is this a lithograph and possibly the back is an imprint from that? I've searched the internet and do not find one single "copy" of this particular art piece, which leads me to believe it could be the real deal. Anybody got any ideas? BTW, I came to this forum because David Stone Martin is a renowned illustrator, especially for jazz album covers, but I know very little about his medium... Thank you very much. | <urn:uuid:a5183cf8-6bcf-40dc-a6d7-bd3a088f8316> | CC-MAIN-2013-20 | http://www.wetcanvas.com/forums/showthread.php?s=ae1be4c1ba4e33534fbed7e1f8daeabe&p=16032252 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368707435344/warc/CC-MAIN-20130516123035-00057-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.960525 | 183 | 1.625 | 2 |
Like Water for Advertising
Continuing my theme today of all things wet, I saw this piece on OhGizmo, and found it completely mind-blowing. Apparently, the clever folk at the Akashima Labs in Japan have schemed up a way to actually "print" words on the surface of water using wave generators! Through insanely complex calculations, the generators force various waves to intersect, creating beautiful letters and images out of the water. And while each imprint only lasts a short while before fading away, the machine is capable of recreating the same image every three seconds. | <urn:uuid:4e8e96dd-76ec-4575-aa02-979bf2c7a590> | CC-MAIN-2013-20 | http://www.mentalfloss.com/article/14539/water-advertising | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368707435344/warc/CC-MAIN-20130516123035-00038-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.906852 | 118 | 1.828125 | 2 |