text stringlengths 160 608k | id stringlengths 47 47 | dump stringclasses 2
values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1
value | language_score float64 0.65 1 | token_count int64 48 145k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
In this brief guide, we will look at some Samwise Gamgee Quotes.
Samwise Gamgee Quotes
Samwise Gamgee is a character in the Lord of the Rings Trilogy, and he is a very well-known character that has some very noteworthy quotes.
Samwise is a servant, but he is courageous and willful despite that, and even though he is not meant to be extremely cunning or smart, and he does not display any signs of the kind of valor one usually tends to expect from heroes, he can be very heroic in his own way, because of how clear his thinking is.
Many people also think of Sam Gamgee as the “true hero” of The Lord of the Rings and Tolkien himself has expressed this view in one of his letters, calling him the “chief hero”, with special emphasis placed on Sam’s “rustic love” for Rosie, who he eventually marries.
Another important feature of Samwise Gamgee is the relationship between Frodo and Sam which is often considered to be at the centre of The Lord of the Rings.
To some readers, it can seem archaic because of how extremely class-oriented it is, which is seen over and over again in the way Sam speaks to Frodo, in Sam’s humbleness and “plain speaking” which is often seen in contrast to Frodo’s “gentility”, and sam also often shows deference to Frodo, calling him “Mister Frodo”.
However, despite this, they are always there for each other and they stand by each other no matter what, which may sometimes be considered a deep relationship.
With the basic character traits of Samwise Gamgee in mind, let us look at some of his most prolific quotes:
“I know. It’s all wrong. By rights we shouldn’t even be here. But we are. It’s like in the great stories, Mr. Frodo. The ones that really mattered. Full of darkness and danger, they were. And sometimes you didn’t want to know the end.
Because how could the end be happy? How could the world go back to the way it was when so much bad had happened? But in the end, it’s only a passing thing, this shadow. Even darkness must pass. A new day will come.
And when the sun shines it will shine out the clearer. Those were the stories that stayed with you. That meant something, even if you were too small to understand why. But I think, Mr. Frodo, I do understand. I know now. Folk in those stories had lots of chances of turning back, only they didn’t. They kept going. Because they were holding on to something.”
“Let him go, you filth! Let him go! You will not touch him again!”
“Even the smallest person can change the course of the future.”
“Frodo: Go back, Sam! I’m going to Mordor alone. Sam: Of course you are, and I’m coming with you!”
“Come, Mr. Frodo!’ he cried. ‘I can’t carry it for you, but I can carry you and it as well. So up you get! Come on, Mr. Frodo dear! Sam will give you a ride. Just tell him where to go, and he’ll go”
“Gandalf: Confound it all, Samwise Gamgee. Have you been eavesdropping?
Sam: I ain’t been droppin’ no eaves sir, honest. I was just cutting the grass under the window there, if you’ll follow me.
Gandalf: A little late for trimming the verge, don’t you think?
Sam: I heard raised voices. Gandalf: What did you hear? Speak. Sam: N-nothing important. That is, I heard a good deal about a ring, and a Dark Lord, and something about the end of the world, but… Please, Mr. Gandalf, sir, don’t hurt me. Don’t turn me into anything… unnatural.”
“Still, I wonder if we shall ever be put into songs or tales. We’re in one, of course; but I mean: put into words, you know, told by the fireside, or read out loud of a great big book with red and black letters, years and years afterwards. And people will say: ‘Let’s hear about Frodo and the Ring’ and they’ll say ‘Oh yes, that’s one of my favorite stories.”
Samwise Gamgee Quotes: Two Towers
Here are some of Samwise Gamgee’s best quotes from Two Towers:
“Samwise Gamgee: What we need is a few good taters.
Gollum: What’s taters, precious? What’s taters eh?
Samwise Gamgee: Po-tay-toes! Boil ’em, mash ’em, stick ’em in a stew
Samwise Gamgee: Po-tay-toes! Boil ’em, mash ’em, stick ’em in a stew.”
“Samwise Gamgee: I wonder if we’ll ever be put into songs or tales.
Frodo Baggins: What?
Samwise Gamgee: I wonder if people will ever say, ‘let’s hear about Frodo and the Ring’ and they’ll say, ‘yes, it’s one of my favorite stories. Frodo was really courageous, wasn’t he, Dad?’ ‘Yes, my boy. The most famousest of Hobbits and that’s saying a lot’.
Frodo Baggins: Ha, you’ve left out one of the chief characters: ‘Samwise the Brave’. I want to hear more about Sam. Frodo wouldn’t have gotten far without Sam.
Samwise Gamgee: Now, Mr. Frodo, you shouldn’t make fun. I was being serious.
Frodo Baggins: So was I.”
“Frodo Baggins: What are we holding on to, Sam?
Samwise Gamgee: That there’s some good in this world, Mr. Frodo … and it’s worth fighting for.”
“Have you thought of an ending?”
“Yes, several, and all are dark and unpleasant.”
“Oh, that won’t do! Books ought to have good endings. How would this do: and they all settled down and lived together happily ever after?”
“It will do well, if it ever came to that.”
“Ah! And where will they live? That’s what I often wonder.”
“Yes, they are elves,” Legolas said. “and they say that you breathe so loud they could shoot you in the dark.” Sam hastily covered his mouth.”
“His love for Frodo rose above all other thoughts, and forgetting his peril he cried aloud: ‘I’m coming Mr. Frodo!”
“Sméagol won’t grub for roots and carrotses and – taters. What’s taters, precious, eh, what’s taters?’
‘Po-ta-toes,’ said Sam. ‘The Gaffer’s delight, and rare good ballast for an empty belly. But you won’t find any, so you needn’t look. But be good Sméagol and fetch me some herbs, and I’ll think better of you. What’s more, if you turn over a new leaf, and keep it turned, I’ll cook you some taters one of these days. I will: fried fish and chips served by S. Gamgee. You couldn’t say no to that.’ ‘Yes, yes we could. Spoiling nice fish, scorching it. Give me fish now, and keep nassty chips!’
‘Oh, you’re hopeless,’ said Sam. ‘Go to sleep!”
“Well, you have now, Sam, dear Sam,’ said Frodo, and he lay back in Sam’s gentle arms, closing his eyes, like a child at rest when night-fears are driven away by some loved voice or hand. Sam felt that he could sit like that in endless happiness…”
Samwise Gamgee Quotes: Return of the King
Given below are some of Samwise Gamgee’s best quotes from Return of the King:
“Sam : [Both are overcome by exhaustion] Do you remember the Shire, Mr. Frodo? It’ll be spring soon. And the orchards will be in blossom. And the birds will be nesting in the hazel thicket. And they’ll be sowing the summer barley in the lower fields… and eating the first of the strawberries with cream. Do you remember the taste of strawberries?
Frodo : No, Sam. I can’t recall the taste of food… nor the sound of water… nor the touch of grass. I’m… naked in the dark, with nothing, no veil… between me… and the wheel of fire! I can see him… with my waking eyes!
Sam : Then let us be rid of it… once and for all! Come on, Mr. Frodo. I can’t carry it for you… but I can carry you!”
“Frodo : [after destroying the Ring] I can see the Shire. The Brandywine River. Bag End. The Lights in the Party Tree.
Sam : Rosie Cotton dancing. She had ribbons in her hair. If ever I were to marry someone, it would have been her. It would have been her.
[sits down and begins to cry]
Frodo : [leans over and hugs him] I’m glad to be with you, Samwise Gamgee, here at the end of all things.”
“Sam : [reading the book’s title] There and Back Again: A Hobbit’s Tale by Bilbo Baggins, and The Lord of the Rings by Frodo Baggins. You finished it.
Frodo : Not quite. There’s room for a little more.”
“Gollum : Wake up. Wake up. Wake up, sleepies. We must go, yeeees, we must go at once.
Sam : Haven’t you had any sleep, Mr. Frodo?
[Frodo shakes his head]
Sam : I’ve gone and had too much… it must be getting late.
Frodo : No, it isn’t. It isn’t midday, yet. The days are growing darker.
Gollum : Come on! We must go, no time!
Sam : Not before Mr. Frodo’s had something to eat.
Gollum : [impatiently] No time to lose, silly!
Sam : [Gives Frodo lembas] Here.
Frodo : What about you?
Sam : Oh, no, I’m not hungry. Leastways, not for lembas bread.
Frodo : Sam…
Sam : All right… we don’t have that much left. We have to be careful, we don’t want to run out. You go ahead and eat that, Mr. Frodo. I’ve rationed it… there should be enough.
Frodo : Enough for what?
Sam : The journey home.”
Samwise Gamgee Quotes: Fellowship of the Ring
Here are some of the Samwise Gamgee quotes from fellowship of the ring:
“Misery misery! Hobbits won’t kill us, nice hobbits.”
“’Rope! ‘ muttered Sam
“It’s the job that’s never started as takes longest to finish.”
“And you’re with me.”
“But I thought I’d have a look and see how Mrs.”
“Don’t leave me here alone!”
In this brief guide, we looked at some Samwise Gamgee Quotes. If you have any questions or comments about Samwise Gamgee or Lord of the Rings, please feel free to reach out to us.
If you’ve enjoyed the ”Samwise Gamgee Quotes” mentioned above, I would recommend you to take a look at ”I Am the Storm Quote” too.
Frequently Asked Questions (FAQs): Samwise Gamgee Quotes
What does Sam say to Frodo?
Sam Says to Frodo, “I made a promise, Mr. Frodo. A promise. Don’t you leave him, Samwise Gamgee.
What does Samwise Gamgee represent?
Samwise is meant to represent simplicity and authenticity, as the name Samwise means “simple minded” or “half-minded” while Gamgee is a corruption of the name Gammidgy, which is a village in the Shire.
These two names are presented as translations of the Westron form of Sam’s name Banazîr Galbasi which is also spelled Banazîr Galpsi.
Why does Sam always say Mr Frodo?
Sam always says Mr. Frodo, because Sam is Frodo’s gardener, and he was the son of Hamfast, or the old gaffer, and he was Bilbo’s gardener before him.
Because he grew up being the son of a servant of Bilbo’s and Frodo’s, and then became one himself, he continues to call him “Mr. … Frodo” all his life.
Is Samwise Gamgee the real hero?
Samwise Gamgee is a hero, but whether he is the real hero of the series is debatable, although some people tend to think that because of his simplicity and courage that is usually found in the least likely of people or when the situation calls for it, Samwise maybe one of the most significant characters.
Hobbits are considered to be the unexpected heroic race, and of that race, Samwise Gamgee may be the true hero of the entire adventure. | <urn:uuid:15ed5b4f-0717-4607-855c-9aad398d53bb> | CC-MAIN-2022-33 | https://psychreel.com/samwise-gamgee-quotes/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.939043 | 3,196 | 2.328125 | 2 |
There are many variables that can affect the price of your insurance policy quality for cars and trucks. Being Harmless and responsible will lessen your Value. When you’re comparing fees, it’s important to just take into consideration your automobile’s model and design, the value, in addition to the frequency you travel it. It is more very likely you be involved with a collision if you travel for very long distances. Getting the top policy for your requirements is the best system to lower your insurance plan expenses.
The standard vehicle proprietor pays amongst $one,one hundred and $5,000 per year for insurance plan. The charges can differ in between states and from 1 to a different. This is the reason It can be critical to be aware of this reality. In particular states, you’ll be paying far more for coverage that is definitely finish than nominal coverage. Here are several tips to obtain the most Price tag. In sure states there is a minimum legal responsibility Restrict that is not mandatory. The complete coverage ordinarily provides a $five hundred deductible.
It is vital to pick out the best automobile, as sure types are costlier than other designs. This could end in costlier insurance policy fees. Moreover, specific automobiles are dearer to restore and change, so insurance policies premiums could possibly be costlier. A clean driving report is much more likely to acquire decreased rates. The prices for coverage may also be influenced by gender and age. Drivers that are older are typically far more vulnerable to being linked to mishaps when compared with youthful motorists. Insurance policies firms may benefit from credit history scores to determine the price of coverage. Specific states have legislation prohibiting the usage of credit history scores.
You will find six forms of automobile coverage coverages which are simple. You can tailor your coverage to include many different scenarios. It is additionally crucial to make sure that your coverage policy consists of the liability coverage. Many states need the insurance policies of legal responsibility. But, you need to do have the option of choosing a distinct form of coverage. Legal responsibility insurance plan safeguards you in the event that you’re at fault in a mishap. Additionally, it addresses almost every other drivers who had been involved with the collision. It will pay for injuries and damages of other motorists and health-related expenditures.
An ordinary plan will contain a number of different types of protection, such as liability, collision, complete, uninsured/underinsured motorist, and medical payments. All of these are critical and you simply should have the right quantity. These insurances can be essential in certain states. Some states might not need. Freeway Insurance coverage is a wonderful web page to Identify the very best auto insurance coverage policy for you personally. This could let you lower time and charges by giving a variety of insurance plan possibilities.
Every condition has its very own list of minimal benchmarks for motor vehicle insurance. These rules could be damaged down into 3 quantities. California’s least requirements for auto insurance policy incorporate at minimal 15/30/5 bodily damage coverage together with 30/fifty/5 in assets destruction liability. It can be crucial to be aware of the requirements within your state just before driving. The figures can vary noticeably. Alternate insurance plan options are a choice, having said that it’s not generally the best choice.
Though your condition might require legal responsibility insurance coverage on the other hand, most lenders will require total protection. Should you be financing your automobile the lender may well demand total coverage. This addresses collision and comprehensive insurance coverage. Legal responsibility insurance handles damages to the home of Others within the occasion from the celebration of an accident having said that not your car. You may Incorporate the liability insurance policies for property damage with bodily personal injury liability insurance in order to get hold of probably the most in depth coverage at an affordable Value.
Your personal instances will identify in the event you need collision insurance policy in your car insurance policies policy. Though you are not needed to have it legally nevertheless, lenders could demand it In the event the intention should be to finance your car or truck. Should you be a borrower and lenders involve you purchase collision insurance coverage. This insurance plan is required for individuals who finance the acquisition of an auto, whether or not possibly new or used.
Collision insurance policies covers the overall worth of your car in the event that It truly is weakened or destroyed. The insurance company may possibly address your entire maintenance costs, having said that, it will not be able to exchange your automobile in case your automobile is harmed further than repair service or stolen. As a way to exchange your auto You may have to purchase it with all your have cash. Any time you purchase coverage for your vehicle, Be certain that you happen to be mindful of the plan. It can be critical to grasp the deductible. It is not a Element of the collision.
After you are trying to find insurance policy for your vehicle There are a lot of variables to look at. Specific states contain the minimal requirements to cover Residence as well as Uninsured Motorist insurance policy. The protection handles the difference between your charges and also the limit of your policy for the motive force at fault. Specified states don’t want coverage for drivers who usually are not insured. Here are a few recommendations to help you pick out the ideal insurance coverage plan that fulfills your necessities. These solutions will simplify the process and save you revenue.
The automobile coverage plan should really contain liability insurance plan to safeguard your individual residence and also you from promises for injuries or damages. Should you be identified to generally be for being the reason for the cause of an accident, this insurance policy will pay for settlement and authorized defense. There are a selection of alternatives readily available from which to choose for insurance policy. It can be crucial to understand the distinctions among them to avoid high priced unexpected fees. Point out Farm delivers a median Expense for various different types of protection. It can be done to select a moderate protection amount.
Nearly all of states need you consist of legal responsibility insurance plan on your own insurance policies plan. It covers damages to your residence of others as well as injuries to other people. This insurance will safeguard your legal rights in case you happen to be involved in an collision with other motorists. This sort of coverage is advised for almost any driver, regardless of the nation of origin. It is vital to recognize that the bounds for legal responsibility insurance coverage in Every single state vary. The amount you should go over damages is going to be contingent around the liability Restrict you may have established.
Each condition has regulations which makes it illegal to push without any insurance coverage. This guards the liability for property harm. Liability insurance policies will cover mend expenditures in case you trigger harm to property. The car insurance plan plan you might have ordered won’t be able to include damages towards your vehicle. It is possible to examine the coverage prior to purchasing it. To guarantee your financial safety, owning assets coverage is vital. This can help you stay away from significant insurance policy costs when you are wounded in a collision.
In order to pay for the cost of a mishap the insurance plan policy will have to consist of some sort of assets harm insurance. The coverage will cover the injury you induce for the car or truck of A further and contains repairs. It may even cover the expense of cleansing the debris remaining driving by a mishap. Generally, residence insurance policies is composed applying 3 numbers. These figures address bodily harm insurance for each incident plus the protection for house hurt for every incident. Larger limits supply increased defense. Make sure you go through the policy in detail and talk to your agent Should you have any fears.
Uninsured motorist insurance plan is obtainable in The big apple if one other driver is just not insured ample to safeguard the collision. The protection is out there when the driving force who induced the collision isn’t acknowledged and also the incident is successful-and-run. When the Coverage Legislation SS 5217 stipulates which the uninsured motorist insurance coverage will be able to include all Actual physical mishaps, courts have interpret this to get a reference to only making use of to Bodily collisions.
In certain states, the uninsured motorist as well as underinsured coverage are offered as an option. In other states, having said that the two are necessary to be ordered. You can also get supplemental insurance policy in case you need to pay out healthcare costs or other expenses by shopping for the two insurances. Uninsured motorist insurance policies will address repairs in the event that the motorist isn’t really insured. Although this protection just isn’t essential but it’s a superb choice to have at a minimum amount the minimal liability insurance plan.
Discount rates on car insurance policy are an excellent way to save money though aiding the surroundings. The expense of your insurance coverage is going to be decrease when you purchase an vehicle which has security measures including airbags and anti-lock brakes. Reductions can be negotiated for security features like alarms from theft or managing lights that happen to be noticeable during the daytime. Furthermore, you can receive 12 months of aid from payment by paying out your insurance policies top quality in comprehensive Every single and each and every year. Nearly half of all insurance businesses provide this kind of lower price.
If you have been with your coverage for a lengthy interval and also have a superb credit history score, you could potentially be capable to acquire discount rates. Savings supplied will vary based mostly the period of time you’ve been Using the coverage. But there are plenty of firms which provide discount rates for faithful customers. If you purchase your insurance coverage within just seven times with the day you renew you might be suitable for an extra 15 per cent lower price. Specific corporations present reductions for unique professions, along with these bargains. Teachers can save ten% on their Liberty Mutual premiums. Geico offers discounts of 15% for military services members.
Youthful motorists are looking for small-Price car insurance quotes. Here are some strategies to assist you in conserving hard cash on your insurance policy policy. These suggestions may help you help you save many dollars every year on your car coverage. These tips will assure you probably the most aggressive prices. Please read on to discover far more. You will be happy for it.
Youthful drivers can cut down on the expense of auto insurance plan by taking safer driving by driving less, and letting the insurance provider keep an eye on their driving behavior. Comparing automobile insurance plan fees might help minimize your month-to-month cost. Youthful motorists are usually becoming charged better fees by a range of insurance plan companies So, make sure you hunt for the best rate. It can be straightforward to get an online estimate for a no-Charge. You might also request discounts if you individual many vehicles that are covered by the identical insurance provider.
Obtain various prices to ascertain probably the most economical price and best quality if you are searching for an insurance policy coverage. A corporation which might be in a position to operate with you and permit you to change your policy Whenever your alterations in driving habits is an alternate. Consider procedures that provide comparable protection. Limitations and deductibles could produce a big distinction. It can be crucial to acquire adequate safety when you are a whole new driver.
No-promises special discounts on your auto insurance coverage is an excellent system to economize. It may be worthwhile to request your insurance provider how it may be utilized. The price reduction could volume to as many as thirty% following a 12 months, or as sixty five per cent in the next five years. It truly is dependent on the insurance company you select. The two-yr no-statements bonus while in the function of an accident. Multiple promises could eliminate the no-claims reward. Notifying your insurance provider quickly of any incident you could possibly are involved with is vital. Inside the absence of doing this, it could cause upcoming promises to be denied.
For a little expense of around PS25 Most coverage companies present no-statements price reduction insurance policies. This allows you to make a little level of promises per year, without worrying about the cost of your insurance policy rising. When you are a member of no-promises bonuses you could include it in the new policy. You may also shift your no-promises reward to an insurance company within your preference do you have to would like to. It is actually a great way to protect the no-statements low cost.
Probably the greatest strategies to cut down on the price of your insurance plan when searching for low-Expense auto insurance plan is usually to boost your deductibles. Deductibles could conserve you concerning 15 and 30 per cent off your insurance Expense. The savings you can find will rely upon your driving routines and your driving heritage and also the legislation of your respective condition. The cost of your annual top quality might be lowered by escalating your deductibles to nearly forty%.
Though raising your deductible may not be the right choice for each man or woman, it will make a distinction in saving you Countless dollars Ultimately. Industry experts counsel to avoid wasting at least two months of your bills for residing, despite the quantity you select to raise your deductible. This will likely lower the expense of insurance coverage you shell out month-to-month. If you ever really have to file an insurance coverage assert, you are going to help save a substantial number of sums of cash.
For anyone with bad credit rating scores, it may be beneficial to choose out an insurance policy plan from regional insurance plan firms. You will minimize the cost of your insurance policy every month Invoice as well as obtain prime-high quality customer care. A plan which has a regional insurance plan provider is accessible throughout every condition. It is additionally attainable to look at rates point out-by-state and uncover essentially the most economical costs. It truly is important to keep in mind that you could need making your credit rating above the training course of. Specified drivers with bad credit history scores can be charged greater than $400 yearly.
Erie Insurance plan, An additional regional insurance company, offers minimal-Charge automobile insurance coverage. The agency is located in Pennsylvania and is particularly operating given that. Erie presents insurance policies for house, auto and everyday living insurance policies. Erie offers insurance policies only in distinct states. You’ll find more than thirteen,000 unbiased brokers in the course of America. You can decide on in between an agent or an insurance company that is certainly regional based upon your necessities. It is crucial to review the compact print prior to creating a an financial investment.
It can be crucial to compare insurance coverage fees should you be a high hazard driver. Locate the best suited coverage for your requirements. Furthermore, you should study the coverage out there inside your region to discover no matter whether a decrease Expense may be feasible. Should you be more unlikely to get injured, or Use a lower deductible, it might be a lot more affordable to buy additional insurance policy. All of it is dependent on the protection you call for. There are a number of possibilities.
For anyone who is hunting for the best vehicle insurance policies policy for prime-danger motorists. It only will take two mouse clicks to locate one particular. You will find there’s broad variety of insurance coverage offers on the net which can be less expensive than the fee of normal auto insurance. It causes it to be less complicated to enroll in coverage. It is really all You should do is full an online software and pay back the quality. You can expect to receive a certificate within the insurance company to show evidence of one’s insurance safety. After that and you simply’re wanting to travel utilizing your insurance policy.
Plenty of insurance policy businesses perspective you as high-risk drivers When you’ve got a poor credit rating score. Because you’re less likely to have the ability to file an insurance policy claim like a one that has superior credit history. This is due to the fact that: Credit rating scores Engage in A serious affect on how insurance providers Assess your. A DUI or DWI conviction could raise your insurance Expense by as many as sixty five per cent. It can be a total of $477 to get a six-thirty day period insurance. The driving history of your respective driver is yet another component that insurance plan companies get into consideration. The price of insurance coverage can improve by approximately $174 if you are convicted of an arrest for DUI or DWI. The price of a dashing ticket could be a Consider a premium of somewhere around 45 per cent.
It is possible for getting car insurance coverage for significantly less when you have been convicted of an DUI. There are a variety of selections that come with American Loved ones, Progressive, State Farm and American Spouse and children. These companies present lower rates for drivers who are at risk. In generating your conclusion on the price of your insurance policies, they take into account your credit history score. These factors are regarded as by insurance firms in determining the amount you’ll have being required to pay back on your insurance coverage. A weak credit rating could lead to the cost of insurance policy growing dramatically. It is crucial to understand your credit score just before you select.
When you’re choosing to the best suited auto insurance coverage policy for youthful drivers, there are a variety of facets to just take into consideration. The price of insurance for youthful motorists are impacted via the position within your marriage in addition to the age of your respective. The cost of your insurance policies could also count on the kind of car or truck you push. As an example, large-performance motor vehicles are costlier to insure than motor vehicles with reduce efficiency. Step one to find affordable auto insurance coverage for motorists who will be younger is to look for an auto that includes numerous security measures.
You’ll be able to reduce the quantity of insurance coverage you have to minimize the cost of your vehicle coverage for motorists who will be younger. You could be a university student or using driver education and acquire savings out of your insurance provider. When you are wounded in a collision but reducing your insurance coverage could bring about important Expense outside of pocket. It is vital to weigh all potential dangers and obtain a much better deal.
It can be challenging for teens to search out affordable motor vehicle insurance policy. Whilst the coverage for your 16-calendar year-aged driver is costlier than one that is for Grown ups, the cost might be minimized after you add a teenager to the prevailing insurance policy. Although this will elevate the associated fee by at an average of $1461 yearly nonetheless, it’s usually cheaper than buying a independent insurance policies plan. Additionally it is a very good alternative when you’re an aspiring driver.
The price of car insurance policies can vary drastically dependent on your danger amount. This means that you have to lookup to discover the most affordable vehicle coverage coverage for motorists with reduced danger. When picking the correct insurance plan system for your needs, insurance policies organizations think about a variety of elements, which include your driving history and demographics, in addition to risk degrees and possibility Over-all. 5 essential areas to take into account when considering insurance coverage offers. There’s no need to sacrifice good quality as you are shelling out lessen for insurance coverage.
To start with, contemplate your zip code. The spots with higher crime fees are more likely to be costlier crime premiums. Insurance firms also just take the volume of targeted visitors into account. The cost of your insurance plan are influenced if you can find any mishaps or promises with your records. Bear in mind, nevertheless, that you choose to have to normally check your rates at the least just about every six months to be able to make sure that you’re not spending additional. For those who very own a number of insurance policies guidelines from your exact insurance provider it is achievable to avail a discount for several insurance policies.
Whilst credit score scores usually are not legally used by particular insurance policies providers in a few states, They are significant when it comes to comparing auto coverage premiums. Motorists with poor credit rating in Hawaii are envisioned to get charged in excess of individuals who have very good credit scores. drivers. Motorists with substantial danger in Massachusetts pay out 30% in excess of individuals who have clear documents. The charges for motorists who will be new are higher should they’ve had an DUI or dashing ticket, or have terrible credit history. Before you decide to produce a alternative be certain that you obtain various estimates.
The price of insurance coverage is influenced by the location you reside in. Insurance offers are larger in case you reside in a region having an abnormal rate of criminal offense and large accidents rates. The cost of insurance coverage might be impacted by other things like the amount of targeted visitors or record of mishaps. Insurance policy companies also just take into consideration the driving heritage of the driver in figuring out the cost they will be charging for his or her insurance policy. Motorists who definitely have very poor driving document are billed greater than anyone who has good driving record.
As the price of wellness treatment proceeds to extend, insurance plan for autos has increased by fifty-100% in the last five years. PIP and uninsured coverage is necessary for motorists. The necessities are much more than the average. Ny is the one state with a necessity to the insurance policies of legal responsibility. On the other hand most states You should not need drivers to carry insurance policy. The extra coverages may perhaps elevate insurance policy charges and likewise increase the cost of coverage. Motorists ought to also confirm the limits of their protection as some procedures may have less protection.
The standard New Yorker spends two.8 % of their earnings on insurance plan for their auto. It’s slightly higher than the common nationwide figure of two.40 per cent. The typical man or woman pays just a bit fewer than those people who are who’re within their 30s or 40s. Drivers with additional driving working experience can pay a lot more than those who are 70and in excess of. Partners pays a little bit better, even so nevertheless reduced than singles.
Drivers also can get minimized premiums after they just take defensive driving classes. The courses last for three several hours and center on the attitudes of drivers and targeted traffic procedures. They incorporate defensive driving competencies which will drastically decreased the price of insurance policies. The training course will assist in improving your driving record and also cut down the expense of insurance plan for cars and trucks. The Insurance plan Data Institute will help you determine the level of amount of coverage you may need.
Price ranges for gas can differ among states. up coming, however automobile coverage quotes from states other than yours might be a lot more costly or a lot less pricey than yours. This will likely end result from An array of factors, such as the rules of each and every state relating to insurance plan and premiums of theft, the proportion of motorists who are not insured and the quantity of theft, or maybe the proportion of drivers that are not insured. Climatic conditions can influence the cost of coverage. Here is a desk which illustrates the normal expense of car insurance policies for several states. The estimates are depending on an analysis in the insurance plan requirements of each and every condition.
Missouri would be the condition with the bottom cost for car insurance plan protection that is total-protection and has a expense of $944 lower than Louisiana. What’s more, it has the lowest Expense per capita and ranks fifth in the cost of living. Texas motorists, nonetheless, have to pay 33% in their whole annual cash flow to address their motor vehicles. This is likely due to The point that Texas is often a point out with lots of lawsuits, and also many drivers will not be insured.
The common cost for entire protection car or truck insurance policy is $1771 yearly. Louisiana is the condition with the highest premium for insurance of $2,839. This represents a 19% increase about 2020. Maine’s ordinary insurance policies cost on the other hand, is simply $858. This is because states with no fault typically have bigger insurance policy charges. It is usually achievable that the cost of insurance policies insurance policies for vehicles in several states to change significantly. Just take into consideration all elements, such as the legislation within your point out on insurance plan.
You may be hunting for substantial-chance coverage policies for drivers in your area. Here are a few guidelines to lessen your expenses. Large-danger drivers tend to be charged greater than the typical motorist. Superior-chance motorists are more likely to have a lot more incidents or violations on their history. The utmost may be up to 5 years, based The situation you reside in. You may be certified to receive bargains when the driving force protection program you took is concluded.
The national costs for top risk motorists’ vehicle insurance are pretty comparable. On the other hand, the price of coverage vary significantly among states and the next. Plenty of providers alter their charges based on the condition They’re in. If you live in a selected point out, it’s possible you’ll learn that one supplier supplies essentially the most coverage for An inexpensive Price tag. State Farm is the greatest large-risk driver insurance coverage near my residence. Point out Farm has a protracted record for giving outstanding customer care.
Enter your zip code to locate charges and Assess high-possibility insurance for vehicle motorists in your area. Whilst the cost of high-danger insurance policy on vehicles in close proximity to me could differ by point out, the majority of major insurance policies corporations provide this sort of insurance policy. These are specialists in large-danger insurance policy, like Nationwide Typical. If you’ve excellent grades, a minimal chance motor vehicle, so you are able to obtaining an insurance coverage that is definitely decrease you could possibly get one.
Comparing insurance policy companies for cars presents a lot of positive aspects. We’ll discuss a number of of essentially the most critical features like reviews, discount rates, and purchaser support. It is critical to pick the best plan for your personal security and protection. Be sure to examine policies from a variety of firms. You can know which insurance plan supplier offers one of the most protection at quite possibly the most affordable price tag within the summary of the publish. Below are a few suggestions that may help you pick the best one.
Evaluate quotations for automobile coverage from quite a few businesses to discover the most competitive charges. Insurance corporations acquire into account several different aspects when determining the price of your coverage. It truly is vital to ascertain your needs and Examine fees among insurance policies companies. For illustration, sporting activities autos tend to be more pricey to insure than standard vehicles. Your driving history and location of home can impact on the costs you fork out. It is feasible to match costs and figure out the bottom Expense While using the exact same protection in addition to the identical deductibles by making use of a Software for comparison.
The price of insurance policies rates is different, so it is crucial to fully know how Each and every plan operates. Credit rating background, driving history and age are just a couple factors that affect the cost of insurance policy. Check out the benefits supplied by Every agency like roadside assistance or incident forgiveness. It might be a little bit mind-boggling nonetheless It is possible to evaluate quotes from diverse corporations and choose the most suitable a person. Below are a few ideas to get you going.
It can be done to start by thinking about J.D. Rankings of the highest car insurance policies companies. The ratings are determined by fulfillment surveys of shoppers which were carried out on countless numbers of consumers of auto insurance through the US. The final results are then put alongside one another into numerical scores that are the normal satisfaction score for every organization. The rankings are unveiled yearly. The gold medals are awarded to the most beneficial vehicle insurance policies corporations in every single phase. How can you determine whether or not the insurance policies businesses you are looking at are trustworthy?
There are a variety of solutions To guage The soundness and economic energy of insurance coverage vendors for vehicles. One of them should be to lookup the AM Ideal ranking for vehicle insurance policies companies. This offers rankings of financial steadiness. It does not matter if the corporate’s labeled to be a B, C or C It can be critical to understand the stability of the organization prior to purchasing an insurance coverage. This is an important element of The shopper support. Prior to deciding to come up with a option be sure you undergo the many critiques and tiny particulars.
There are a number of discounts made available from car insurance policy organizations. They might not be made available to all so make sure you Examine the website of the corporation to verify your eligibility to receive reductions. A whole lot of businesses present numerous bargains. It is possible to inquire using your agent when you are skilled to acquire any bargains. It is simple and commonly will acquire under an hour or so. Here are some samples of bargains on car insurance coverage.
Legacy Savings Vehicle insurance policies firms can present discounts to new drivers who order their insurance policies through their parents. The discount generally is about 10 percent. This lower price can be used to express your gratitude on your mom and dad for their assistance all through the yrs, and could assist you in saving the cost of the cost of motor vehicle insurance. You will discover many enterprises that offer savings for legacy for motorists who are youthful. You should question your insurance plan service provider whether they have discounts for youthful drivers. You can even study insurance policies made available from American Household, Farmers, and USAA.
There are several companies from the coverage sector which excel in customer care. Esurance been given a score of 4 out of five around the J.D. It was awarded top scores on the Power Rankings of Customer support that is an impressive achievement for a business which does not have an guardian firm. The company was rated far better that its competitors did like pricing and guidelines and likewise the standard of support and client treatment made available by its Speak to Middle and Web-site agents. (personalized services)
For the majority of shoppers, the protection in their automobile insurance is easily the most critical facet. But, It really is customer care that is The most crucial. Shoppers expect prompt and helpful assistance from their insurance coverage corporations. Shoppers count on prompt, friendly company. They would want to have the ability to contact an agent and obtain answers for their issues. Although all insurance policies businesses for autos present excellent buyer assist, There are several which can be Outstanding. (Rideshare coverage) (just two clicks).
A lot of variables impact the rates of car insurance plan providers. Two of the most crucial things that impact the price of automobile insurance coverage are age and driving record. The premiums are higher for those who have lousy driving record or low credit score scores. The costs of living in the area you live in may also affect the cost of insurance plan. It can be important to match the fees of varied insurance policies companies to pick which one particular ideal is finest to your funds and wishes. It is possible to cut down on your insurance policy costs by way of defensive driving courses or reducing insurance coverage protection. You may additionally prefer to get an entire year of insurance policies upfront. (Invoice on the internet) (employee price cut)(on the fault injury)(lined accident
Besides the reasons which were outlined earlier You’ll find a myriad of other factors that would boost your cost. Insurance policy providers could revise your top quality when you’ve just lately built a assert or were being charged having a website traffic violation. You could also qualify to receive a discount if take a Risk-free driving class. Insurance plan businesses are constantly altering their styles to ascertain the premiums. It is possible to determine a change in the expense of your insurance Though your driving record hasn’t adjusted. (utilization-centered insurance) (rental cars);(automobile repairs);(safe driver price cut).
Comparing insurance policies for vehicles is an excellent technique to stay away from unreliable insurance policy vendors. The minimal quotes made available from one insurance policies company could be deceiving, As an example The point that they do not protect certain coverages, or make Wrong assumption about your driving history. It is achievable to think about the ranking of coverage corporations in addition to their A.M. Finest rankings to determine probably the most responsible coverage service provider within your region. This information will demonstrate the ways in which insurance plan comparisons could preserve you revenue on your vehicle insurance coverage. Then, you could Look at the best insurance policy businesses to find the most economical value for you personally. (accident absolutely free)
While your credit score could be a dependable indicator of the level of hazard you might be most likely to acquire, it should not be the only real aspect that decides the rates you fork out. Coverage businesses won’t be able to make full use of the credit rating score to lift the expense of insurance plan, According to the Federal authorities. California, Massachusetts and Oregon have regulations that prevent insurance coverage corporations from working with credit heritage in identifying their costs for insurance policies. (could save)(new automobile)(vehicle claim)
This kind of insurance plan is not presented in all states. Customers are unable to make your mind up if a business utilizes your credit rating to determine the amount they’re going to be charging. California, Hawaii and Massachusetts prohibit insurance policy dependant on credit rating. Other states also have related limitations. It is your choice to ascertain whether or not your score dependant on credit score is well suited for your requirements. (motorbike insurance policies),(roadside support protection),(bundling motor vehicle)(pet insurance),(precise worth of income worth),(excellent claim services) (yacht insurance policy).
Age is among the principal components that impression reductions on auto insurance policies. The speed you pay back is afflicted by age by more than 30 percent. In certain states, young motorists could fork out four times greater than an older driver of 30 a long time. Younger drivers are at greater the chance of getting involved in a collision than drivers of older a long time. Figuring out the elements that impact your insurance plan rates will guide you in negotiating reduced fees. Below are a few ways that the age of your respective motor vehicle can influence your insurance policy.
The price of your insurance plan will probably be decreased if you’re young than the normal. If you are male, your charges are larger When you’ve got insurance for your car. Male drivers who are youthful fork out below motorists of older age even so, the rates for motorists who are aged among 6 and seventy-8 and previously mentioned enhance radically. Studies reveal that males are two periods much more more likely to be associated with an collision as girls. The gap in between genders as we age also shrinks. (coverage options)(homeowners insurance policies)
It isn’t really shocking that males pay out more for car or truck insurance policies than Ladies. Adult males are more likely to make blunders when driving, which could result in additional accidents and promises. There are several factors that cause much more Price to insure males. These are The main reasons. Read on to understand more about The most crucial things that impact the expense of vehicle insurance plan In accordance with gender. These solutions can help you lower the cost of your insurance coverage if you are not confident. (vehicle coverage insurance policies)(auto insurance plan quotation)(motor vehicle coverage amount)
Oregon Division of Financial Regulation directed insurers of autos to simply accept buyers who Do not state their gender. Insurance policy organizations must report fees for motorists who are not gender-neutral beginning in January 2019, should they’re accused of unfair discrimination. The costs could possibly be more expensive for feminine drivers than These are for male motorists. Ladies can Slice expenditures so long as they are not also large. You should not be concerned by the “nonbinary” rate for more youthful motorists. (motor vehicle insurance plan claim) (gap insurance policy) Automobile plan | <urn:uuid:72fa21a8-9d4e-46f2-b8a8-c9bb0174f14b> | CC-MAIN-2022-33 | https://condiminds.com/car-insurance-in-loudonville-oh/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.95738 | 7,375 | 1.523438 | 2 |
COVID-19 Vaccine-Acquired vs. Disease-Acquired Immunity: Which is Better? — Deplatform Disease
The gist: Many seem to hold to the incorrect idea that immunity acquired through infection is superior to immunity acquired by vaccination but multiple examples show this isn’t true: recovery from tetanus generally does not confer any protection while vaccination induces protection in virtually everyone, vaccination is far more protective against HPV than infection, and some infectious diseases can recur or develop into chronic diseases like varicella (chickenpox) and hepatitis B. COVID-19 is among the most dangerous respiratory infections that any of us will ever face in our lives. It has killed at least 4 million people in the course of this pandemic (and this is almost certainly an undercount), many of whom were previously healthy, and it has also left uncountably many more struggling with prolonged disability that remains poorly understood and with very limited options as far as treatment. By comparison, any serious adverse events following vaccination are extremely rare- on the order of 1 to 10 per 1,000,000 doses of vaccine, and effectiveness across all variants to date has been largely preserved. Furthermore, mRNA vaccines against COVID-19 show much higher levels of neutralizing antibodies with better ability to cross-protect against variants than recovery from COVID-19, and comparable T cell responses. The durability of these vaccines furthermore looks to be robust. Data are more limited for other vaccine types (though recent data on the Johnson & Johnson/Janssen vaccine confirms excellent durability), but the fundamental point is that the proposition that we get to herd immunity through infection is utterly immoral and furthermore ignorant of history. If this were possible to do, measles would have accomplished it because it spreads very rapidly through the population and generates robust protective immunity in virtually everyone who survives it, but we saw regularly huge outbreaks every 2–5 years. That’s because of population turnover: eventually enough people who were immune died and enough people who weren’t were born, allowing for steady, regular outbreaks. Continuously allowing SARS-CoV-2 to infect people will also create new opportunities for the virus to evolve, potentially escaping pre-existing immunity altogether as the endemic common cold coronaviruses do; recent data shows that the delta variant appears to have a heightened risk of both reinfections and also infection post-vaccination. Though most people do seem to generate robust immune memory after recovery from COVID-19, there is no simple way to assess whether or not individual recovered patients have achieved this, and while reinfection is rare and usually milder when it does occur, this is not always the case with some reinfections being more severe and even fatal. Available evidence indicates that the quality of immunity against SARS-CoV-2 is drastically enhanced by vaccination with even a single dose of vaccine after recovery, and while side effects are more intense in recovered patients who are vaccinated, vaccination of recovered patients appears safe. Therefore, after recovery (or after a period of 90 days if convalescent plasma or monoclonal antibodies were received), even recovered patients should be vaccinated against COVID-19.
As the pandemic has progressed, so has our understanding of the immunity we develop against SARS-CoV-2. It does appear that most (but not all) cases of COVID-19 do result in a robust immune response and the generation of immunological memory (though this has many important caveats and has regrettably been weaponized as an instrument of politics rather than public health). I think some have engaged in revisionist history though in claiming that there was no other possible outcome; this is certainly great news, but this was in no way a guarantee. For one thing, in general the viruses that result in long-lived immunological memory are those that disseminate either through the blood or lymphatic system, but viremia is a rare phenomenon in COVID-19 and predicts severe disease (which is, as a proportion of infections, also rare). Note however that even though mild disease is so named, this does not necessarily mean a mild or self-limiting illness; mild disease can be extremely taxing but is mostly distinguished on the basis of not involving the lower respiratory tract or causing significant decline in oxygen saturation or requiring hospitalization. Additionally, common cold coronaviruses (CCCs) regularly reinfect people through antigenic drift (mutations in the proteins of the virus to escape antibodies) in as few as 6 months. This builds on prior work demonstrating that in human challenge studies, reinfection with the same CCC one year after initial encounter, reinfection can still occur though at reduced severity. We also see that for other respiratory viruses, durable immunological protection is not a certainty, e.g. RSV seems to be able to cause reinfection with antigenically similar isolates a significant proportion of the time for example (each challenge resulted in reinfection at least one-fourth of volunteers, with initially about half of these being symptomatic and progressively decreasing with subsequent challenges), and even though influenza A is classically regarded as producing long-lived immunity against similar strains, in a human challenge study, symptomatic reinfection occurred with most of the volunteers. Immunity to respiratory viruses generally is reviewed here. Concerns were further amplified when a study showed that in patients who died of COVID-19, germinal centers in the lymph nodes (a structure known to be important for the development of long-lasting humoral immunity) were atrophied (though of course this analysis does not tell us whether the outcome was a cause or effect of death from COVID-19 or whether it generalized to other milder cases; interesting a preprint has demonstrated that, in mice, despite absence of the TFH cells critical for the formation of germinal centers, high levels of potent, neutralizing antibodies do develop, though class switching is inhibited). In a broad sense, durable immunity against mucosal pathogens (like those that infect the respiratory tract) is a challenge as demonstrated by vaccination, because the default response at barrier tissues like the respiratory tract on exposure to antigen is tolerance, generally mediated by regulatory T cells.
It is also worthwhile to remind people that in terms of the quality of immunity generated by vaccination, as compared with infection, it is not a given that vaccination will elicit inferior protection (setting aside the dangers of the infection).
The Immune Response against SARS-CoV-2
SARS-CoV-2 is a positive-sense, unsegmented RNA virus in the Betacoronavirus genus which principally initiates infection of susceptible hosts through inhalation of infectious particles contained within respiratory droplets and aerosols (though primarily through close-range, prolonged contact with infected hosts), wherein it enters permissive and susceptible cells, principally through the ACE2 receptor. The early mucosal immune response to SARS-CoV-2 is reviewed here, though details on its specific interactions are not very well understood; recent data suggest epithelial cells in the nasopharynx have blunted antiviral responses and enhanced type II interferon production in severe disease. SARS-CoV-2 encodes within it a suite of proteins that are very effective for evading innate immune mechanisms of protection such as type 1 and type III interferons. The timing of the interferon response appears to be critical, as it appears that late production of interferon contributes to immunopathology, whereas early, rapid response is able to control viral replication. Indeed, COVID-19 is associated with a massive type 1 interferon response. One concern that has been raised with COVID-19 is that infection of the upper respiratory tract may facilitate neuroinvasion of the virus, which has been demonstrated on autopsies and in mouse models (though neuroinvasion in mouse models is a common feature of many coronavirus infections and thus the significance of this is not immediately clear, and autopsy findings are hard to extrapolate to the more common milder cases); however recent imaging studies show loss of greymatter in regions corresponding to neurological symptoms in COVID-19. The duration of neurological deficits in COVID-19 is not currently known, but this appears to be a more common phenomenon than for many viral infections and a substantial contributor to disease severity. COVID-19 also seemingly provokes a hypercoagulable state which can result in inappropriate clot formation, seemingly through immunothrombotic mechanisms discussed here and here. Another concern that has been raised with COVID-19 is the potential for the development of diabetes mellitus; autopsy samples of COVID-19 decedents are able to identify virus within the beta cells of the pancreas wherein it appears to cause transdifferentiation. In human pancreas cell culture models, SARS-CoV-2 is able to productively infect both the endocrine and exocrine pancreas. Glycometabolic control among some recovered patients appears to be impaired a significant proportion of the time for a period of at least 2 months. Furthermore, SARS-CoV-2 antibody responses seem to involve Tbet+ B cells as a source of neutralizing antibodies, which are generally associated with systemic lupus erythematosus where they are thought to be pathogenic; the extent of these B cell responses correlates with disease severity. In exoproteome profiling of patients with SARS-CoV-2 infection, diverse functional autoantibodies against tissue antigens and cytokines are elicited and in mice are able to worsen disease; it is possible that these autoantibodies may play a role in the post-acute consequences of COVID-19, which are manifold (see Box 1). The duration of these symptoms is variable but in one recent prospective study approximately one-fifth of patients were struggling with persistent symptoms after 12-months, with females being higher risk than males, though the overall cohort was small. Viral infection is a well-characterized trigger of autoimmune disease, and thus there is concern that SARS-CoV-2 may also do the same. SARS-CoV-2 is known to cause multisystem inflammatory syndrome (in children and more rarely in adults), a hyperinflammatory disease that remains poorly understood and is associated with substantial morbidity and occasionally mortality; recent data implicate a retained viral reservoir in the intestine which results in a loss of mucosal barrier integrity, endotoxemia, and viral antigenemia on top of a superantigen response. A CDC analysis of COVID-19 from January to May 2020 covering 1.5 million patients found that 14% were hospitalized and 5% died. Analysis of infection fatality rate shows a strong age gradient with values ranging from 0.002% for those aged 10 to 15% for those aged 85 or older. However, these data do not take into account novel variants, which some data suggest are associated with a higher risk of fatality. Overall it can be said that while most cases of COVID-19 are mild, in that they do not require hospitalization, the potential for deleterious outcomes is vast, ranging from post-acute consequences of infection in previously healthy people which can be literally disabling, to even death. While it is tempting and psychologically mollifying to presume that SARS-CoV-2’s virulence will attenuate over time, it is important to bear in mind that the primary selection pressure is in favor of enhanced transmissibility rather than lethality, and viruses can and have evolved heightened lethality if it was associated with a fitness advantage in the past.
The immune response to SARS-CoV-2 infection, as compared with vaccination, is broader in scope. SARS-CoV-2’s genome encodes approximately 30 proteins within it (see table 1), while most vaccines available contain just the spike protein (the exception being inactivated vaccines like the CoronaVac and BBIBP-CorV vaccines which use whole, inactivated virus), which results in exposure to many more epitopes from infection. The exact significance of this as far as protection is not entirely clear presently because a correlate of protection for SARS-CoV-2 is not yet defined, though presumably having more T cell epitopes which can be targeted makes evolving immune escape more improbable compared with having fewer epitopes; in studies of patient outcomes, robust T cell immunity is critical for recovery and sex disparities in patient outcomes may be related to differences in the T cell response between sexes throughout the lifespan (this may be related to sex differences in kynurenic acid metabolism). Nonetheless, for most vaccine-preventable diseases, antibodies are the principal correlate of protection, and it has been shown that in macaques, passive transfer of antibodies against the spike protein is sufficient to prevent the development of COVID-19, even at relatively low titers, and the earlier neutralizing antibodies appear in those with acute COVID-19, the better patients fare. Furthermore, multiple studies have demonstrated that antibodies directed against non-structural and accessory proteins of SARS-CoV-2 (which are excluded from most vaccines) correlates with worse outcomes. It is thought that prior coronavirus infections can bias towards the development of non-neutralizing antibodies in infection that associates with more severe disease, and this is more likely to occur in elderly patients who may be more experienced with prior coronavirus infection; this same study demonstrates that, in animals, antibodies against ORF8 and nucleocapsid protein are not protective against the development of COVID-19. Furthermore outpatients showed a higher ratio of anti-N to anti-S antibodies compared with hospitalized patients. Additionally, afucosylated antibodies in severe COVID-19 are thought to contribute to the hyperinflammatory state, these antibodies tending to target proteins on the viral surface such as spike protein, which may be related to the age of patients as these post-translational modifications decrease with age. Severe COVID-19 also tends to produce much higher antibody titers. There is notably a decrease in neutralizing antibody titer (though largely preserved Fc effector functions) among the those who recovered from mild COVID-19 over time, as well as a general trend towards decreasing antibody titers among most patients who recover; however this should not be used to infer a loss of protection, and indeed some data indicate an increase in the neutralization capacity of antisera against variants over time in spite of reduced absolute titer. At the respiratory mucosa, there also appears to be robust induction of secretory IgA, which has extremely potent neutralizing activity, and this persists well past the decline of antibodies in the sera. Antibodies continue to evolve over time in a manner that suggests persistence of viral antigens within the body.
A recent study has demonstrated that among patients who generally had mild cases of COVID-19, long-lived IgG-secreting plasma cells against spike protein were present in the bone marrows of 15 of 19 of them, suggesting durable humoral immunity, as well as circulating memory B cells; however what is commonly excluded from this very popular soundbite is that that also means that these markers of humoral immunity were absent among 4 of the 19 patients- about one-sixth of them. Interestingly, in the SIREN study of reinfections, over the seven-month observation period, there was an 84% reduced risk of confirmed reinfection which agrees very well with these results. A large analysis of PCR results in Denmark following 4 million people from March to December 2020 demonstrated that the risk of reinfection was reduced by about 80% in most individuals, but in those over 65 it was just 47.1%; however these are PCR data only and thus do not tell us about the clinical severity of COVID-19 in these patients (though presumably most of these PCRs do reflect patients who sought testing after developing symptoms). Still, the results deserve attention given how serious COVID-19 can be for the elderly and underscore the need for additional protection measures like vaccination even following recovery. Another study builds on the evidence that recovery from SARS-CoV-2 does generally seem to confer durable immunity by profiling patients’ antibody and T cell responses noting that responses are preserved for at least 8 months, which is encouraging (though notably the study assessed primarily those who had mild disease). Similar findings have been noted by other groups. Still though, it is important to keep in mind that in the latter study approximately 10% of patients did not have immunological memory across the 3 assessed compartments, and on a large population scale that could potentially result in significant disease and public health burden upon challenge with SARS-CoV-2. Real-world data on the immunological protection conferred by COVID-19 are subject to the key limitations of being of relatively short-duration (on the timescale of immunity) and with most studies having occurred before the emergence of novel variants of concern. While we do have data that suggests that T cell responses across variants are essentially invariant, it is hard to define the extent to which this is protective clinically, though it is likely that most recovered patients are protected from severe disease. The most recent data from Public Health England do show that the delta variant is associated with a heightened risk of reinfection among those whose primary infections occurred greater than 180 days prior.
Can we get to herd immunity against COVID-19 by infection? Insight from measles
It is tempting to wonder whether it might be feasible to attain herd immunity from infection alone, and indeed some have vociferously argued that we in fact should attempt this. Firstly, it’s important to define herd immunity here, as that term has gotten to be quite confusing. Herd immunity refers to a state where, within some population, a critical proportion of individuals have immunity against an infectious disease such that it cannot effectively spread throughout the population. When there are no endemic cases of a given infectious disease in some region, it is said to be eliminated from the region. When the only specimens of the pathogen in question exist in labs, and it does not circulate anywhere in the world, it is said to be eradicated (only two infectious diseases have been eradicated: smallpox and rinderpest- both via aggressive vaccination campaigns). If no specimens of the pathogen exist anywhere, the disease is considered extinct (no examples currently). Because of the wide range in hosts, SARS-CoV-2 is unlikely to ever be eradicated (though if a universal coronavirus vaccine ever emerges, that might change), but elimination is likely possible.
Measles is another respiratory virus of great public health importance that can help offer some insights into the situation we would be in if we attempted to reach herd immunity entirely through infection- a situation that is categorically unacceptable and would not work. Measles is transmitted in an airborne manner with a secondary attack rate greater than 90%, and aerosols can retain infectivity for hours; R0 for measles is commonly stated as being 12–18 but there are outbreaks where it has been measured to be over 700. However, in spite of its extraordinary contagiousness, measles generates extremely durable (generally lifelong) immunity in virtually all who survive it and though there are 24 genotypes recognized, the virus has a single serotype and is extremely unlikely to evolve to escape antibodies (note however that with SARS-CoV-2, novel variants demonstrate varying degrees of antibody evasion and each infection is an opportunity for variants to emerge which are more resistant to prior immunity and more transmissible, potentially becoming more virulent as a byproduct of those changes). These qualities would suggest that it is ideally suited for attaining herd immunity by infection: the virus could rapidly infect entire populations and induce lifelong immunity in virtually all survivors (though for the record the public health toll from measles is astonishingly great; measles also has the ability to erase previously-held immunological memory, thereby increasing all-cause mortality for years after infection). But we know it didn’t. Figure 16–4 shows epidemic cycles of measles in England and Wales from 1950 to 1979. There are massive outbreaks every 2–5 years, until the vaccine is introduced in 1968, after which cases begin to decline substantially and the inter-epidemic period gets longer. Why? Eventually the proportion of your population that is immune to measles dies, and eventually people with no immunity to measles are born. This results in a new niche for the virus to infect, causing outbreaks. Vaccination has successfully eliminated measles from much of the world and measles is thought to be a good candidate for eradication as humans are required for its sustained transmission.
Most immunologic data regarding vaccine acquired immunity focuses on mRNA vaccines. For the mRNA vaccines, neutralizing antibody titers appear to be higher than those of most convalescent patients, and they correlate with the extent of protection against COVID-19 per Khoury et al; the neutralization capacity of antibodies in sera of vaccinees also appears to be better in FRNT assays. It is furthermore observed that mRNA vaccines elicited antibodies are more resistant to changes in the SARS-CoV-2 spike protein, and can seemingly cause recall responses from prior coronavirus infections to target conserved regions of the spike protein. This may be related to the pre-fusion stabilization of the spike protein encoded by the mRNA vaccines (which would not occur with SARS-CoV-2 because this impairs the ability of the spike protein to enable fusion and cell entry and therefore be selected against), but the reasons are not understood. Furthermore, aspirates of the proximal lymph nodes of vaccinees demonstrate persistent germinal center responses suggestive of long-lived plasma cell production and durable memory B cells, indicating robust humoral immunity. At the nasopharynx, lavages have demonstrated that vaccinees have higher levels of antibodies than recovered patients, though data are limited on this point and mucosal immunity of vaccinees in the broad sense is not currently well characterized. The mechanism by which IgG may arise within the upper respiratory tract is incompletely understood; one thought is that it is actively transported in via FcRN in the lungs and then enters the upper airway through the mucociliary escalator. Recent data also further demonstrates continued affinity maturation of the B cells in recipients of mRNA vaccines. Profiling of the T cell responses in patients who received a quarter dose of the Moderna vaccine revealed responses similar in quality and magnitude to those who had recovered from COVID-19, and the responses across variants are similarly well conserved as the spike protein contains many T cell epitopes. Data also show mRNA vaccine T cell responses are similar across all variants. Furthermore, at the public health level, it has been demonstrated explicitly that higher levels of vaccination are associated with reduced SARS-CoV-2 genomic diversity across a population, and in comparing infections post-vaccination cases to primary infections, patients tend to have a reduced viral load and are infectious for shorter periods of time. Taken together, the available data suggest that mRNA vaccines produce an immune response that results in superior humoral immunity than infection and comparable T cell responses; more data are needed to assess how mucosal immunity compares with that from infection.
Questions remain about the extent to which protection from the vaccines is durable and how well it compares clinically over sufficiently long periods of time to reliably render conclusions, though there are several clinical studies of vaccine effectiveness in the real world (again focusing on mRNA vaccines). The half-life for Moderna vaccinees’ antibodies 6 months after vaccination was estimated to be 202 days for live virus neutralization, however, which is encouraging. An evaluation of high-risk patients measured an effectiveness of 96.2% for the Pfizer and 98.2% for the Moderna vaccines, though this preceded the emergence of some variants of concern. A single dose of mRNA vaccine offered substantial protection (80 and 85% respectively) against hospitalization and death from COVID-19 among older adults. Among adults over the age of 65, mRNA vaccines were found to be 94% effective against the risk of hospitalization following 2 doses. Another study found 90% effectiveness against infection of any severity with the mRNA vaccine series. One study of patients in Qatar found a slightly reduced risk of a positive PCR among recent vaccinees compared with those who had recovered from COVID-19, though the difference was not statistically significant. Data also show that the Pfizer/BioNTech vaccine retains effectiveness against the alpha and beta variants, the Moderna vaccine retains effectiveness against the beta variant, and the effectiveness of completed vaccine series against the Delta variant is largely preserved as well (provided both doses are given). Data regarding whether or not SARS-CoV-2 vaccines can prevent infection are discussed in this post. There is significant evidence demonstrating that COVID-19 vaccines reduce transmission of COVID-19. Real-world comparisons of vaccines vs. prior infection are limited as far as their protective efficacy, largely focusing on relatively short durations of time.
A salient point for vaccination is not only the attainment of herd immunity as described above, but fundamentally vaccination represents a far safer path to protection than does infection. While true that it is not without risk, serious adverse events following vaccination are exceptionally rare, although the mRNA vaccines in particular have significant reactogenicity. Anaphylaxis is measured to occur on the order of 1 to 10 per 1,000,000 doses of vaccine. The Johnson & Johnson/Janssen vaccine has been very rarely associated with thrombosis with thrombocytopenia syndrome which most recent numbers estimate a risk of approximately 3 per 1 million doses. Similarly, Guillain-Barre syndrome has been observed very rarely at a frequency of approximately 7.8 cases per million doses following both the Johnson & Johnson/Janssen vaccine and the Oxford/Astra-Zeneca vaccine (approximately 4.4 cases per million doses), though this has also been noted with COVID-19 (but the frequency is not yet well-defined). Among younger individuals and predominantly males, the mRNA vaccines have been associated with myocarditis with rates reported as high as 1 per 3000 cases in Israel among males 16 to 24, though numbers elsewhere are much lower; still, SARS-CoV-2 has been associated with myocarditis as frequently as 2.3% of cases in college athletes. It is untenable to argue that vaccination represents a greater danger to one’s health than does COVID-19. Furthermore, vaccines may be rapidly updated to account for the emergence of novel variants escaping immunity or waning protection (though there is presently no indication that this is needed for most people), whereas willfully contracting COVID-19 again to protect against it largely obviates the point of that protection.
Vaccination post-COVID-19 is recommended upon resolution of disease/conclusion of isolation, or following 90 days after the use of either monoclonal antibodies or convalescent plasma in the US. Some countries recommend a single dose of vaccine for recovered patients based on available immunologic data (detailed shortly) which do not indicate a benefit for a second dose; others however are more conservative and recommend both doses for vaccines with a 2-dose series as this is known to have superior protection than single doses as per clinical trials and questions linger about the durability of protection from a single dose of vaccine for COVID-19. Upon vaccination of recovered patients, there is a massive increase in the neutralizing antibody responses in significant excess of that of patients who have not had SARS-CoV-2 infections; these antibodies are furthermore more effective at cross-neutralization of variants of concern, and even significantly enhancing the ability to neutralize SARS-CoV-1’s spike protein. There is additionally a substantial boost to the T cell response. While certainly the vaccines are more reactogenic in those who have recovered from COVID-19 than those who have never had it, available evidence does not indicate a safety problem. Though reinfection is rare, it can happen, and it can even be fatal, and vaccination represents a reliable means by which to protect against those consequences. Hansen et al did note that just 47.1% of those over the age of 65 were protected from reinfection over a 3–6 month period of follow up, suggesting that vaccination following recovery may not only be beneficial but in fact critical in some patients. At the bedside, the key point is that there is no simple way to assess for any individual patient whether or not they have protection against COVID-19 following recovery, though it is probable that most will (for example, a study recently showed that cases post-vaccination with variants had similar antibody titers to patients who proved protected against COVID-19 on a fishing boat vessel). Therefore, vaccination of even recovered patients makes sense for their safety and at the public health level.
1.Yewdell, J. W. Individuals cannot rely on COVID-19 herd immunity: Durable immunity to viral disease is limited to viruses with obligate viremic spread. PLoS Pathog. 17, e1009509 (2021).
2.Li, Y. et al. SARS-CoV-2 viremia is associated with distinct proteomic pathways and predicts COVID-19 outcomes. J. Clin. Invest. 131, (2021).
3.Eguia, R. T. et al. A human coronavirus evolves antigenically to escape antibody immunity. PLoS Pathog. 17, e1009453 (2021).
4.Siggins, M. K., Thwaites, R. S. & Openshaw, P. J. M. Durability of immunity to SARS-CoV-2 and other respiratory viruses. Trends Microbiol. 29, 648–662 (2021).
5.Turner, J. S. et al. SARS-CoV-2 infection induces long-lived bone marrow plasma cells in humans. Nature 595, 421–425 (2021).
6.Hall, C. B., Walsh, E. E., Long, C. E. & Schnabel, K. C. Immunity to and frequency of reinfection with respiratory syncytial virus. J. Infect. Dis. 163, 693–698 (1991).
7.Gallo, O., Locatello, L. G., Mazzoni, A., Novelli, L. & Annunziato, F. The central role of the nasal microenvironment in the transmission, modulation, and clinical progression of SARS-CoV-2 infection. Mucosal Immunol. 14, 305–316 (2021).
8.Muñoz-Alía, M. Á., Nace, R. A., Zhang, L. & Russell, S. J. Serotypic evolution of measles virus is constrained by multiple co-dominant B cell epitopes on its surface glycoproteins. Cell Rep Med 2, 100225 (2021).
9.Society for Mucosal Immunology. Principles of mucosal immunology. (CRC Press, 2020).
10.Kaufmann, S. H. E., Rouse, B. T. & Sacks, D. L. The immune response to infection. (American Society for Microbiology, 2010).
11.Chen, J. S. et al. High-affinity, neutralizing antibodies to SARS-CoV-2 can be made in the absence of T follicular helper cells. bioRxiv (2021) doi:10.1101/2021.06.10.447982.
12.IDSA, G. Dana Wollins, DrPH, MGC. Idsociety.org https://www.idsociety.org/globalassets/idsa/media/clinician-call-slides--qa/07-17-21-clinician-call-slides-1.pdf.
13.CDC/IDSA COVID-19 clinician call: Update on variants & immunity. Idsociety.org https://www.idsociety.org/multimedia/clinician-calls/cdcidsa-covid-19-clinican-call-update-on-variants--immunity/.
14.Clinical Spectrum. Nih.gov https://www.covid19treatmentguidelines.nih.gov/overview/clinical-spectrum/.
16.Krammer, F. A correlate of protection for SARS-CoV-2 vaccines is urgently needed. Nat. Med. 27, 1147–1148 (2021).
17.McMahan, K. et al. Correlates of protection against SARS-CoV-2 in rhesus macaques. Nature 590, 630–634 (2021).
18.Li, Y. et al. Antibody landscape against SARS-CoV-2 reveals significant differences between non-structural/accessory and structural proteins. Cell Rep. 36, 109391 (2021).
19.Lucas, C. et al. Delayed production of neutralizing antibodies correlates with fatal COVID-19. Nat. Med. 27, 1178–1186 (2021).
20.Takahashi, T. et al. Sex differences in immune responses that underlie COVID-19 disease outcomes. Nature 588, 315–320 (2020).
21.Edridge, A. W. D. et al. Seasonal coronavirus protective immunity is short-lasting. Nat. Med. 26, 1691–1693 (2020).
22.Dowdle, W. R. The principles of disease elimination and eradication. Bull. World Health Organ. 76 Suppl 2, 22–25 (1998).
23.Swadling, L. et al. Pre-existing polymerase-specific T cells expand in abortive seronegative SARS-CoV-2 infection. (2021) doi:10.1101/2021.06.26.21259239.
24.Genetic analysis of measles virus. Cdc.gov https://www.cdc.gov/measles/lab-tools/genetic-analysis.html (2021).
25.Schaeffer, B., Taylor, B., Bushman, M. & Hanage, W. P. The devil in the details: Herd immunity and pandemic response. Cell Host Microbe 29, 1048–1051 (2021).
26.Nelson, K. E. & Williams, C. Infectious disease epidemiology. (Jones and Bartlett, 2013).
28.Moss, W. J. & Griffin, D. E. Global measles elimination. Nat. Rev. Microbiol. 4, 900–908 (2006).
29.Correlates of vaccine-induced protection: methods and implications. Who.int https://apps.who.int/iris/bitstream/handle/10665/84288/WHO_IVB_13.01_eng.pdf;sequence=1.
30.Plotkin, S. A. Updates on immunologic correlates of vaccine-induced protection. Vaccine 38, 2250–2257 (2020).
31.Röltgen, K. et al. Defining the features and duration of antibody responses to SARS-CoV-2 infection associated with disease severity and outcome. Sci. Immunol. 5, eabe0240 (2020).
32.Larsen, M. D. et al. Afucosylated IgG characterizes enveloped viral responses and correlates with COVID-19 severity. Science 371, eabc8378 (2021).
33.Hall, V. J. et al. SARS-CoV-2 infection rates of antibody-positive compared with antibody-negative health-care workers in England: a large, multicentre, prospective cohort study (SIREN). Lancet 397, 1459–1469 (2021).
34.Cai, Y. et al. Kynurenic acid may underlie sex-specific immune responses to COVID-19. Sci. Signal. 14, eabf8483 (2021).
35.Song, E. et al. Neuroinvasion of SARS-CoV-2 in human and mouse brain. J. Exp. Med. 218, (2021).
36.Douaud, G. et al. Brain imaging before and after COVID-19 in UK Biobank. medRxiv (2021) doi:10.1101/2021.06.11.21258690.
37.Ivanova, E. N. et al. Discrete immune response signature to SARS-CoV-2 mRNA vaccination versus infection. medRxiv 2021.04.20.21255677 (2021).
38.Ziegler, C. G. K. et al. Impaired local intrinsic immunity to SARS-CoV-2 infection in severe COVID-19. Cell (2021) doi:10.1016/j.cell.2021.07.023.
40.Taquet, M., Geddes, J. R., Husain, M., Luciano, S. & Harrison, P. J. 6-month neurological and psychiatric outcomes in 236 379 survivors of COVID-19: a retrospective cohort study using electronic health records. Lancet Psychiatry 8, 416–427 (2021).
41.Seeßle, J. et al. Persistent symptoms in adult patients one year after COVID-19: a prospective cohort study. Clin. Infect. Dis. (2021) doi:10.1093/cid/ciab611.
42.Woodruff, M. C. et al. Extrafollicular B cell responses correlate with neutralizing antibodies and morbidity in COVID-19. Nat. Immunol. 21, 1506–1516 (2020).
43.Nalbandian, A. et al. Post-acute COVID-19 syndrome. Nat. Med. 27, 601–615 (2021).
44.Getts, D. R., Chastain, E. M. L., Terry, R. L. & Miller, S. D. Virus infection, antiviral immunity, and autoimmunity. Immunol. Rev. 255, 197–209 (2013).
45.Sancho-Shimizu, V. et al. SARS-CoV-2-related MIS-C: A key to the viral and genetic causes of Kawasaki disease? J. Exp. Med. 218, (2021).
46.Yonker, L. M. et al. Multisystem inflammatory syndrome in children is driven by zonulin-dependent loss of gut mucosal barrier. J. Clin. Invest. 131, (2021).
47.Loo, J., Spittle, D. A. & Newnham, M. COVID-19, immunothrombosis and venous thromboembolism: biological mechanisms. Thorax 76, 412–420 (2021).
48.Bonaventura, A. et al. Endothelial dysfunction and immunothrombosis as key pathogenic mechanisms in COVID-19. Nat. Rev. Immunol. 21, 319–329 (2021).
49.Crotty, S. Hybrid immunity. Science 372, 1392–1393 (2021).
50.Frieman, M. et al. SARS-CoV-2 vaccines for all but a single dose for COVID-19 survivors. EBioMedicine 68, 103401 (2021).
51.Qureshi, A. I. et al. Re-infection with SARS-CoV-2 in patients undergoing serial laboratory testing. Clin. Infect. Dis. (2021) doi:10.1093/cid/ciab345.
52.Lowery, S. A., Sariol, A. & Perlman, S. Innate immune and inflammatory responses to SARS-CoV-2: Implications for COVID-19. Cell Host Microbe 29, 1052–1062 (2021).
53.Stokes, E. K. et al. Coronavirus disease 2019 case surveillance — United States, January 22-May 30, 2020. MMWR Morb. Mortal. Wkly. Rep. 69, 759–765 (2020).
54.Levin, A. T. et al. Assessing the age specificity of infection fatality rates for COVID-19: systematic review, meta-analysis, and public policy implications. Eur. J. Epidemiol. 35, 1123–1138 (2020).
55.Challen, R. et al. Risk of mortality in patients infected with SARS-CoV-2 variant of concern 202012/1: matched cohort study. BMJ 372, n579 (2021).
57.Freney, M. How Viruses Actually Evolve. Instagram.com https://www.instagram.com/p/CRayC6tjoD8/?utm_source=ig_web_copy_link.
58.Bradley, B. T. et al. Anti-SARS-CoV-2 antibody levels measured by the Advise Dx SARS-CoV-2 assay are concordant with previously available serologic assays but are not fully predictive of sterilizing immunity. J. Clin. Microbiol. JCM0098921 (2021).
59.Technical briefing. SARS-CoV-2 variants of concern and variants under investigation in England. Gov.uk https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/1005517/Technical_Briefing_19.pdf.
61.Wisnewski, A. V., Campillo Luna, J. & Redlich, C. A. Human IgG and IgA responses to COVID-19 mRNA vaccines. PLoS One 16, e0249499 (2021).
62.Niesen, M. J. M. et al. COVID-19 vaccines dampen genomic diversity of SARS-CoV-2: Unvaccinated patients exhibit more antigenic mutational variance. bioRxiv (2021) doi:10.1101/2021.07.01.21259833.
63.Wang, Z. et al. Enhanced SARS-CoV-2 neutralization by dimeric IgA. Sci. Transl. Med. 13, eabf1555 (2021).
64.Mades, A. et al. Detection of persistent SARS-CoV-2 IgG antibodies in oral mucosal fluid and upper respiratory tract specimens following COVID-19 mRNA vaccination. bioRxiv (2021) doi:10.1101/2021.05.06.21256403.
65.Doria-Rose, N. et al. Antibody persistence through 6 months after the second dose of mRNA-1273 vaccine for covid-19. N. Engl. J. Med. 384, 2259–2261 (2021).
66.Sanders, R. W. & Moore, J. P. Virus vaccines: proteins prefer prolines. Cell Host Microbe 29, 327–333 (2021).
67.Greaney, A. J. et al. Antibodies elicited by mRNA-1273 vaccination bind more broadly to the receptor binding domain than do those from SARS-CoV-2 infection. Sci. Transl. Med. 13, eabi9915 (2021).
68.Edara, V. V., Hudson, W. H., Xie, X., Ahmed, R. & Suthar, M. S. Neutralizing antibodies against SARS-CoV-2 variants after infection and vaccination. JAMA 325, 1896–1898 (2021).
69.Bliden, K. P. et al. Evolution of anti-SARS-CoV-2 IgG antibody and IgG avidity post Pfizer and Moderna mRNA vaccinations. bioRxiv (2021) doi:10.1101/2021.06.28.21259338.
70.Gaebler, C. et al. Evolution of antibody immunity to SARS-CoV-2. Nature 591, 639–644 (2021).
71.Marot, S. et al. Neutralization heterogeneity of United Kingdom and South-African SARS-CoV-2 variants in BNT162b2-vaccinated or convalescent COVID-19 healthcare workers. Clin. Infect. Dis. (2021) doi:10.1093/cid/ciab492.
72.Bertollini, R. et al. Associations of vaccination and of prior infection with positive PCR test results for SARS-CoV-2 in airline passengers arriving in Qatar. JAMA 326, 185–188 (2021).
73.Abu-Raddad, L. J., Chemaitelly, H., Butt, A. A. & National Study Group for COVID-19 Vaccination. Effectiveness of the BNT162b2 covid-19 vaccine against the B.1.1.7 and B.1.351 variants. N. Engl. J. Med. 385, 187–189 (2021).
74.Chemaitelly, H. et al. mRNA-1273 COVID-19 vaccine effectiveness against the B.1.1.7 and B.1.351 variants and severe COVID-19 disease in Qatar. Nat. Med. 1–8 (2021).
75.Thompson, M. G. et al. Prevention and attenuation of Covid-19 with the BNT162b2 and mRNA-1273 vaccines. N. Engl. J. Med. 385, 320–329 (2021).
76.Rosenblum, H. & Meeting, M. D. A. COVID-19 vaccines in adults: Benefit-risk discussion. Cdc.gov https://www.cdc.gov/vaccines/acip/meetings/downloads/slides-2021-07/05-COVID-Rosenblum-508.pdf.
77.Aladawi, M. et al. Guillain Barre Syndrome as a complication of COVID-19: A systematic review (1197). Neurology 96, (2021).
78.Polack, F. P. et al. Safety and efficacy of the BNT162b2 mRNA Covid-19 vaccine. N. Engl. J. Med. 383, 2603–2615 (2020).
79.Butt, A. A., Omer, S. B., Yan, P., Shaikh, O. S. & Mayr, F. B. SARS-CoV-2 vaccine effectiveness in a high-risk national population in a real-world setting. Ann. Intern. Med. (2021) doi:10.7326/M21–1577.
80.Tenforde, M. W. et al. Effectiveness of Pfizer-BioNTech and Moderna vaccines against COVID-19 among hospitalized adults aged ≥65 years — United States, January-march 2021. MMWR Morb. Mortal. Wkly. Rep. 70, 674–679 (2021).
81.Shimabukuro, T. T., Cole, M. & Su, J. R. Reports of anaphylaxis after receipt of mRNA COVID-19 vaccines in the US-December 14, 2020-January 18, 2021. JAMA 325, 1101–1102 (2021).
82.Richterman, A., Meyerowitz, E. A. & Cevik, M. Indirect protection by reducing transmission: Ending the pandemic with SARS-CoV-2 vaccination. Open Forum Infect. Dis. (2021) doi:10.1093/ofid/ofab259.
83.Lopez Bernal, J. et al. Effectiveness of the Pfizer-BioNTech and Oxford-AstraZeneca vaccines on covid-19 related symptoms, hospital admissions, and mortality in older adults in England: test negative case-control study. BMJ 373, n1088 (2021).
84. Slotnik, D. E. The world’s known Covid death toll passes four million. The New York times (2021).
85. Nasserie, T., Hittle, M. & Goodman, S. N. Assessment of the frequency and variety of persistent symptoms among patients with COVID-19: A systematic review: A systematic review. JAMA Netw. Open 4, e2111417 (2021).
Originally published at https://www.deplatformdisease.com on July 26, 2021. | <urn:uuid:b021a45a-ca15-4ef1-87af-58a6db6e3355> | CC-MAIN-2022-33 | https://edwardnirenberg.medium.com/covid-19-vaccine-acquired-vs-disease-acquired-immunity-which-is-better-deplatform-disease-4759e399c08e?source=user_profile---------9---------------------------- | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.923114 | 10,280 | 2.890625 | 3 |
The God chose its own country in the form of Kerala for several reasons and its quintessential beauty is one of them. If you are planning for a spiritual retreat, book your Kerala flight tickets now as the famous temples in Kerala will fill you with lots of positivity and spirituality. This wonderful place is a beacon for devotees who are in search of some peace. Apart from the beaches and backwaters in Kerala, the pristine temples will make you feel the essence of the almighty right in the land of warrior sage Parasurama. Kerala is loaded with legends and tales which depict its glorious history and as old as 2000 years old Kerala temples are the evidence of its fidelity. Here is the list of famous temples in Kerala which should be marked on your next spiritual and religious tour to the God’s own country.
Sree Padmanabhaswamy Temple, Thiruvananthapuram
Sree Padmanabhawamy Temple is one of the most famous temples in Kerala which dates back to the 8th century. This alluring temple is nestled in the East Fort in Trivandrum and dedicated to the deity Vishnu. As per the legends, presence of this rustic temple is mentioned in holy Hindu scriptures like Skanda Purana and Padma Purana. Even the city of Thiruvanantahpuram is said to be named after the main deity worshipped (Anantha) here in this pristine temple. This slice of paradise is soaked in intricate Dravidian architecture style. Inside the temple, there is an idol of Lord Vishnu reclining on Anantha, the hooded serpent.
Sabarimala Sastha Temple, Pathanamthitta
Sabarimala Sastha Temple nestled near Periyar Tiger Reserve is amongst most famous temples in Kerala. This pristine temple is always loaded with hundred of devotees. It is said that every year Sabarimala Temple receives around 50 million visitors from all around the world. The pilgrimage performed at Sabarimala is sacred with unbreakable belief of the devotees. The ones who are performing the pilgrimage to Sabarimala wears blue or black dress along with Chandan and have to stay unshaven till the end of pilgrimage. According to legends, Hindu God Ayyapan meditated for a long time here in Sabarimala Temple after killing demoness Mahishi.
Attukal Bhagavathy Temple, Thiruvananthapuram
Attukal Bhagavathy Temple is another gem Kerala is beaded with. It is just 2 km away from the Sree Padmanabhaswamy Temple and cynosure for the devotees of Goddess Kannaki (incarnation of Goddess Parvati). It is believed that Goddess Kannaki is the supreme power and mother who has created all the living beings. Attukal Temple is one the Kerala temples which holds a ripping Guinness World Record of singe largest gathering of women for religious activities. If you are coming for a Thiruvananthapuram religious tour, do not miss the chance to submerge in the quietness and peacefulness of this pristine temple.
Ambalapuzha Sree Krishna Temple, Ambalapuzha
Ambalapuzha Sree Krishna Temple is one of the most famous temples in Kerala which devoted to Lord Krishna. This temple is a bit special for all the Krishna devotees as they come here to worship Unni Krishna which is the child form of Krishna. Every day Palpayassam is served in this temple. There is an interesting legend attached to Palpayassam which is a scrumptious offering. Once Krishna came in the form of a sage to the king of that time and challenged him for the game of chess. Krishna asked the king to pay him rice for each square win and with every next square the number of rice will double. By the 20th chance king realized his kingdom was left with no rice. Lord Krishna gave him an option to feed Palpayassam in his kingdom till the debt is over. This is the reason why the delicious Palpayassam (made with rice and milk) is served every day in this temple.
Chottanikkara Temple, Chottanikkara
Travelers coming to Kerala for a religious retreat must visit Chottanikkara Temple nestled in Ernakulam district of Kerala. It is one of the most famous Hindu shrines in Kerala where Goddess Bhagwati – Sri Rajarajeswari is worshipped as the main idol of the temple. Devotees come to this temple with belief in its healing powers related to mental illness. There is an iconic tree right outside the temple which is beaten by the head of the devotees in order to cure mental illness.
Guruvayoor Sree Krishan Temple, Guruvayoor
South India is blessed with so many alluring temples and Guruvayoor Sree Krishan Temple is one of the Kerala temple which is very much popular amongst true devotes of Lord Krishna. This temple is titled as Dwarka of South which is nestled in the Thrissur district. As per the legends, this shrine is blessed with healing powers which can cure mental illness. A special kind of offering is made by devotes in this temple in which the devotees are weighed against things like sugar, coconut, banana and jiggery and then it is offered to the deity presiding in the temple. Guruvayoor Sree Krishna Temple is not open for non-Hindu visitors.
Ettumanoor Mahadev Temple, Kottayam
Ettumanoor Mahadev Temple is nestled 12 kilometers away from Kottayam. It is believed that the temple was built in the 16th century. The cynosure of this temple is their unique Ezharaponnan procession which is very famous and coaxes so many visitors to it. There is an annual festival of Ettumanoor Mahadev Temple which is celebrated for 10 days with ample of enthusiasm.
Tali Temple, Kozhikode
If you are someone who seeks to learn about the history of the prominent places and temples then you must visit this beautiful temple in Kerala which is not cynosure to devotees but also attracts people who thrive on history. This temple was built by the Zamorin King, Swamy Thirumulapad. It is one of the most visited places in Kerala. Tali Shiva Temple is evident of the alluring Kerala architecture beaded with wall paintings and wooden roof carvings.
Book your religious tour to Kerala with EaseMyTrip and get amazing discounts and offers on your booking. EaseMyTrip is the only platform to not charge convenience fee from their customers. Explore these beautiful temples in Kerala with your family and have a wonderful and peaceful time in lap of the almighty. | <urn:uuid:5db52e4e-bfa0-497d-bd97-c581f49bbb1a> | CC-MAIN-2022-33 | https://www.easemytrip.com/blog/most-famous-temples-in-kerala | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.958313 | 1,440 | 1.960938 | 2 |
Is clons a Scrabble word?
Yes, clons is a Scrabble word!
...and is worth 7 points in Scrabble, and 10 points in Words with Friends
Clons is a valid Scrabble word.
Table of Contents
1 definition of the word clons.
- A group of genetically identical cells or organisms derived from a single cell or individual by some kind of asexual reproduction
What Scrabble words can I make with the letters in clons?
Words that can be created with an extra letter added to clons:
There are 6 words that can be made by adding another letter to 'clons'. | <urn:uuid:2786f466-34c5-41bd-8167-a74bdad215fb> | CC-MAIN-2022-33 | https://wordfind.com/word/clons/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.916962 | 143 | 2.703125 | 3 |
Watch this amazin “Gayageum” cover of Pink Floyd’s The Great Gig In The Sky! This blow you away…
Within the mood for some music that is excellent for say, a live-action Ghost within the Shell movie, probably a Blade Runner sequel, or just about any movie that will have an odd, dystopian sci-fi rating combined with a couple of dashes of Northeast Asian twang? Then allow Luna Lee’s rendition of Pink Floyd’s “The Great Gig In The Sky” on gayageum fill your ears and transport you to a world where it’s in all probability dark on a regular basis and little schoolchildren run in a single file line with their yellow umbrellas bouncing below the rain.
Within the video above, which comes through Laughing Squid, gayageum master Luna Lee goes pluckin’ crazy with a cover of Pink Floyd’s classic 1973 song(s), and the result’s each marvelous and weird.
Lee, who’s covered an enormous library of up to date and classic rock songs on video sharing platforms since 2009, is reinventing the way in which the gayageum (pronounced kaya-goom) is utilized in trendy music. She notes on her Patreon web page that she has taken the gayageum, which is a standard Korean zither-like instrument with anyplace from 12 to 21 strings, and modified it to make it suitable with amplifiers and playable alongside loud devices just like the drums and bass guitar. She notes that this was obligatory as a result of the gayageum was historically performed by her ancestors in “a small room.”
What do you think about her “The Great Gig In The Sky” cover? Let us know your thoughts in the comments below!
Watch Pink Floyd’s The Great Gig In The Sky Gayageum Cover: | <urn:uuid:990831d9-e4c6-401b-b496-c62dc5d7fd10> | CC-MAIN-2022-33 | http://pinkfloyd.eu/videos/watch-video-her-the-great-gig-in-the-sky-gayageum-cover-it-is-amazing-and-completely-different.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.932277 | 397 | 1.664063 | 2 |
Around this time of the year Hector’s dolphins give birth. There are quite a number of little calves around at the moment, one of which is jet black. Crew on board the Canterbury Cat in Lyttelton have named the new born Obama! Calves are often quite dark when they are first born but quickly grow and lighten into the distinct three colours of adult Hectors.
Hector’s dolphins mature usually have one calf every two to three years. Hector’s dolphins mate in late spring (New Zealand spring = September/October/November) and calves are born about a year later. The calves are 50-60cm at birth and stay close to their mothers who provide them with milk and protection until they are old enough to fend for themselves, usually at about one year old. | <urn:uuid:1efe0ec9-2493-4016-92ee-f6f51578861f> | CC-MAIN-2022-33 | https://blackcat.co.nz/obama-the-dolphin/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.980151 | 166 | 2.375 | 2 |
Are you having financial difficulties and failing to save enough money? The 50-30-20 budget rule can certainly help you. It is an easy-to-follow plan that will assist you in meeting your financial objectives. Watch the video to learn how to put it into action and save more money each month.
In her book, All Your Worth: The Ultimate Lifetime Money Plan, Senator Elizabeth Warren popularized the so-called "50/20/30 budget rule" (also known as "50-30-20"). The basic rule is to divide after-tax income in half and spend it as follows: 50% on necessities, 30% on wants, and 20% on savings.
The 50-20-30 (or 50-30-20) budget rule is an easy-to-follow strategy for helping people achieve their financial goals.
According to the rule, you should spend up to 50% of your after-tax income on necessities and obligations that you must have or fulfil.
The remaining half should be divided as follows: 20% for savings and debt repayment, and 30% for anything else you desire.
The rule is a template designed to assist individuals in managing their money and saving for emergencies and retirement.
Americans have a massive amount of debt, totaling $14.9 trillion as of the third quarter of 2020. | <urn:uuid:51440b9c-2330-41f8-9a6e-913b8608e34b> | CC-MAIN-2022-33 | https://www.jagrantv.com/en-show/50-30-20-rule-of-savings-you-must-know-about-rc1033631 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.961216 | 274 | 2.171875 | 2 |
Analyzing Craft Moves
We know that graphic novels are all the rage, and they are incredible opportunities to engage reluctant readers, but they are also valuable tools for practicing those analytical skills by studying craft choices.
This post will share several strategies for examining craft to push readers to analyze the choices creators (authors) make when developing the plot, characters, themes, and even the effect on the reader.
Strategy 1 – Looking at the Height
One of the moves that a creator makes is utilizing the height or type of view from panel to panel. Readers can examine the height or type of view in a series of panels in one scene to determine the effect the scene has on the reader. The creator begins this scene with the reader having a bird’s eye view to show the setting but leaves the reader disconnected. This is followed by a series of eye level views that create a sense of feeling part of the scene and joking among friends. The scene then takes a sharp turn with a worm’s eye view making the reader feel as threatened as scared as the two joking boys who are about to experience a real problem.
Strategy 2 – Considering the Distance
The type of shot is examined when considering the distance of the subject from the camera in a panel. Each shot serves a purpose. By looking at a scene closely and examining each shot, the reader can determine what each shot is doing and why it was chosen.
Strategy 3 – Noticing Color Choices
Creators use color, much like authors use word choice, to evoke a feeling, mood, or atmosphere. On this page it’s the first day of school. Notice the absence of color of the students around the friends who are seeing each other for the first time after a long break. Even though the friends seem excited to catch up, there is a sense of dread in the air and the author evokes a feeling of doom and gloom. In just one page we are experiencing both the excitement and dread of going back to school.
Strategy 4 – Paying Attention to a Series of Panels
This strategy has readers examine the passage of time by determining the type of camera and why the creator chose it for the scene. The panels on the left show a static camera that slows down the story to emphasize the emotions in this important conflict between friends. The panels on the right, however, speed up the scene to show the drama and even evoke the anxiety that the character is experiencing.
Strategy 5 – Zooming Into Each Panel
Reading graphic novels includes a close reading of the pictures along with any text. Readers can determine a lot about characters, struggles, mood, atmosphere, etc. by asking not only what do I see but what don’t I see. In this scene we see up close a picture of a man and the boy, but what you may not know is that this is not the boy’s father. What we see (the picture of this man) and what we don’t see but hear arguing with his mother (the father) tells us that this son is disconnected from an absentee father and we will want to pay attention to how this impacts this character. .
These strategies are more specific to graphic novels than traditional text and are good to have in your toolbox when conferring with readers who are enjoying this type of text. These strategies can be used by graphic novel readers to focus reading and set a path for studying craft, identifying what patterns they are seeing, and determining what the patterns show to develop the plot, characters, themes, or even effect on reader. The next post will focus on the reading strategies that both graphic novels and traditional text share. | <urn:uuid:3e7820b9-26f8-42a3-b7b6-237d9ffdc5f6> | CC-MAIN-2022-33 | https://wondertwinworkshop.com/tag/active-engagement/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.94959 | 754 | 3.515625 | 4 |
New Proposed Law Could Have Massive Impact On Bills Stadium
As the debate continues on a new proposed Buffalo Bills stadium and who is going to end up paying for it, a new proposed bill by congress could have a massive impact on the proposed stadium.
Drive Home With Dave Fields Every Afternoon from 3-7pm on 106.5 WYRK
Early this week, three U.S. Representatives introduced a bill that would immediately eliminate a tax subsidy used by professional teams when constructing stadiums.
According to Pro Football Talk, this bill would eliminate the tax-exempt status of municipal bonds, which are used to finance professional stadiums.
Congressman Dan Beyer (D-Va) said that owners don't need public money to build new stadiums.
“Super-rich sports team owners like Dan Snyder do not need federal support to build their stadiums, and taxpayers should not be forced to fund them,” Beyer said in a statement. “Billionaire owners who need cash can borrow from the market like any other business.”
The Bill is called "No Tax Subsidies for Stadiums Act." and was inspired by the investigation into sexual harassment allegations at the Washington Commanders football team.
Since 2000 there have been 43 stadiums built across the county and based on a report from the National Tax Journal the US government lost around $4.3 billion dollars in revenue because of tax-exempt municipal bonds.
If the bill does get passed, it could have a major impact on the proposed Bills stadium. Currently, Terry and Kim Pegula, owners of the Buffalo Bills are looking for public tax money to finance the majority of the costs of building a new stadium.
Current estimates for building a new stadium are over $1 billion dollars. The Pegulas are hoping to have a stadium deal done with New York State by the end of March with stadium construction done by 2027. | <urn:uuid:3236f9ae-122f-4316-a777-3eaa90d3d73e> | CC-MAIN-2022-33 | https://wyrk.com/buffalo-bills-stadium/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.965164 | 386 | 1.734375 | 2 |
I'm just revisiting the MPF site, etc. today and saw our visit (2002).
I understand you have moved to a smaller place. I am finishing up the very first credible book on plan execution amazingly called "Plan Execution - How…"
In 2004, I wrote a book entitled "The CEO Challenge." In doing research for this book, I went back to the 1850's when formal management was first "born." I then re-traced who I thought were the major pioneers that have shaped management thought and action over the past 150 years.
Mary Parker Follett definitely falls into the category of a management pioneer. She was one of the first to bring the human dimension of management into play. She also pioneered what is termed today "Executive Coaching."
Peter Drucker has also stated she was way ahead of her time.
So, I am very interested in learning more about her life and her influence on field of management.
One more thought, she also pioneered the concept of integration and differences in management...which is very applicable to management in the 21t century!
No comments yet!
You need to be a member of The Mary Parker Follett Network to add comments! | <urn:uuid:fa1c8597-1069-4a9a-839a-3a30e572b086> | CC-MAIN-2022-33 | https://mpfollett.ning.com/profile/patrickjbelow | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.981207 | 253 | 1.640625 | 2 |
To save content items to your account,
please confirm that you agree to abide by our usage policies.
If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your account.
Find out more about saving content to .
To save content items to your Kindle, first ensure email@example.com
is added to your Approved Personal Document E-mail List under your Personal Document Settings
on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part
of your Kindle email address below.
Find out more about saving to your Kindle.
Note you can select to save to either the @free.kindle.com or @kindle.com variations.
‘@free.kindle.com’ emails are free but can only be saved to your device when it is connected to wi-fi.
‘@kindle.com’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.
Tuberculosis (TB) in immigrants is becoming a challenge in eliminating TB in Japan. We investigated the epidemiology of TB in foreign students in Japan in 2015–2019. A total of 2007 foreign students with TB whose median age was 22.5 years (1243 (61.9%) were males) were registered. The notification rates peaked in 2016 at 164.0 per 100 000 population and decreased towards 2019. Of the 2007, 535 were from Vietnam, 444 from China and 395 from Nepal. The notification rates were 596.6 per 100 000 person-years (PYs) for Myanmar, 595.4 for the Philippines and 438.6 for Cambodia. The rates were much higher than those of the general populations in their countries of origin for Myanmar, the Philippines, Cambodia, Indonesia, Nepal, Mongolia, Vietnam and China. In comparison with the years 2010–2014, the notification rates for foreign students decreased for the students from Nepal, Vietnam and China. The TB notification rate of the foreign students in Japan can be a good surrogate indicator for the risk of TB among the immigrant subpopulation in Japan and should continuously be monitored. Those who are at higher risk of TB may be annually screened for TB to prevent TB outbreaks.
Severe acute respiratory syndrome coronavirus-2 uses angiotensin-converting enzyme-2 as a primary receptor for invasion. This study investigated angiotensin-converting enzyme-2 expression in the sinonasal mucosa of patients with chronic rhinosinusitis, as this could be linked to a susceptibility to severe acute respiratory syndrome coronavirus-2 infection.
Ethmoid sinus specimens were obtained from 27 patients with eosinophilic chronic rhinosinusitis, 18 with non-eosinophilic chronic rhinosinusitis and 18 controls. The angiotensin-converting enzyme-2 and other inflammatory cytokine and chemokine messenger RNA levels were assessed by quantitative reverse transcription polymerase chain reaction. Angiotensin-converting enzyme-2 positive cells were examined immunohistologically.
The eosinophilic chronic rhinosinusitis patients showed a significant decrease in angiotensin-converting enzyme-2 messenger RNA expression. In the chronic rhinosinusitis patients, angiotensin-converting enzyme-2 messenger RNA levels were positively correlated with tumour necrosis factor-α and interleukin-1β (r = 0.4971 and r = 0.3082, respectively), and negatively correlated with eotaxin-3 (r = −0.2938). Angiotensin-converting enzyme-2 immunoreactivity was mainly localised in the ciliated epithelial cells.
Eosinophilic chronic rhinosinusitis patients with type 2 inflammation showed decreased angiotensin-converting enzyme-2 expression in their sinus mucosa. Angiotensin-converting enzyme-2 regulation was positively related to pro-inflammatory cytokines, especially tumour necrosis factor-α production, in chronic rhinosinusitis patients.
The basal ganglia represents a key component of the pathophysiological model for obsessive-compulsive disorder (OCD). This brain region is part of several neural circuits, including the orbitofronto-striatal circuit and dorsolateral prefronto-striatal circuit. There are, however, no published studies investigating those circuits at a network level in non-medicated patients with OCD. Resting state functional magnetic resonance imaging scans were obtained from 20 non-medicated patients with OCD and 23 matched healthy volunteers. Voxelwise statistical parametric maps testing strength of functional connectivity of three striatal seed regions of interest (ROIs) with remaining brain regions were calculated and compared between groups. We performed additional correlation analyses between strength of connectivity and the severity scores for obsessive-compulsive symptoms, depression, and anxiety in the OCD group. Positive functional connectivity with the ventral striatum was significantly increased (Pcorrected <.05) in the orbitofrontal cortex, ventral medial prefrontal cortex and dorsal lateral prefrontal cortex of subjects with OCD. There was no significant correlation between measures of symptom severity and the strength of connectivity (Puncorrected <.001). This is the first study to investigate the corticostriatal connectivity in non-medicated patients with OCD. These findings provide the first direct evidence supporting a pathophysiological model involving basal ganglia circuitry in OCD.
To conceptualize a “good end of life” for people with dementia from the perspectives of bereaved family caregivers in Japan.
Design and participants:
A qualitative study using in-depth, semi-structured interviews focused on the family caregivers’ perceptions of their loved one’s experiences. Family caregivers who had lost their relatives with dementia more than six months previously were recruited using maximum variation sampling by cultural subpopulation. A thematic analysis was conducted.
From 30 interviews held, four main themes emerged. A good end of life for people with dementia means experiencing a “Peaceful Death” while “Maintaining Personhood” at a “Preferred Place” allowing for feelings of “Life Satisfaction.” A “Preferred Place” emerged as a basic requirement to achieving a good end of life according to the three other themes, in particular, “Maintaining Personhood.” However, the interviewees experienced difficulties in ensuring that their loved ones stayed at a “Preferred Place.”
Despite different cultural backgrounds, perceptions of a good end of life with dementia were remarkably similar between Japan and Western countries. However, recent societal changes in family structures and long-term care access in Japan may explain the theme of a comfortable place taking a central position. We suggest that these themes be considered and translated into care goals. They could supplement established end-of-life care goals for quality of life in dementia, which aim to maximize functioning and increase comfort.
TRIAL REGISTRATION NUMBER
Ethics Committee of the Graduate School and Faculty of Medicine, Kyoto University (R0808-2)
In the collapsing phase of a molecular cloud, the molecular gas temperature is a key to understand the evolutionary process from a dense molecular cloud to stars. In order to know this, mapping observations in NH3 lines are required. Therefore, we made them based on the FUGIN (FOREST Unbiased Galactic plane Imaging survey with Nobeyama 45m telescope). The 6 maps were observed in NH3 (J,K) = (1,1), (2,2), (3,3) and H2O maser lines and obtained temperature maps; some show temperature gradient in a cloud. Additionally 72 cores were observed. These candidates were called as KAGONMA or KAG objects as abbreviation of KAgoshima Galactic Object survey with Nobeyama 45-M telescope in Ammonia lines. We show the results of two regions in W33 and discuss their astrophysical properties.
Coinfection with human immunodeficiency virus (HIV) and viral hepatitis is associated with high morbidity and mortality in the absence of clinical management, making identification of these cases crucial. We examined characteristics of HIV and viral hepatitis coinfections by using surveillance data from 15 US states and two cities. Each jurisdiction used an automated deterministic matching method to link surveillance data for persons with reported acute and chronic hepatitis B virus (HBV) or hepatitis C virus (HCV) infections, to persons reported with HIV infection. Of the 504 398 persons living with diagnosed HIV infection at the end of 2014, 2.0% were coinfected with HBV and 6.7% were coinfected with HCV. Of the 269 884 persons ever reported with HBV, 5.2% were reported with HIV. Of the 1 093 050 persons ever reported with HCV, 4.3% were reported with HIV. A greater proportion of persons coinfected with HIV and HBV were males and blacks/African Americans, compared with those with HIV monoinfection. Persons who inject drugs represented a greater proportion of those coinfected with HIV and HCV, compared with those with HIV monoinfection. Matching HIV and viral hepatitis surveillance data highlights epidemiological characteristics of persons coinfected and can be used to routinely monitor health status and guide state and national public health interventions.
Insufficient nutrition during the perinatal period causes structural alterations in humans and experimental animals, leading to increased vulnerability to diseases in later life. Japanese quail, Coturnix japonica, in which partial (8–10%) egg white was withdrawn (EwW) from eggs before incubation had lower birth weights than controls (CTs). EwW birds also had reduced hatching rates, smaller glomeruli and lower embryo weight. In EwW embryos, the surface condensate area containing mesenchymal cells was larger, suggesting that delayed but active nephrogenesis takes place. In mature EwW quail, the number of glomeruli in the cortical region (mm2) was significantly lower (CT 34.7±1.4, EwW 21.0±1.2); capillary loops showed focal ballooning, and mesangial areas were distinctly expanded. Immunoreactive cell junction proteins, N-cadherin and podocin, and slit diaphragms were clearly seen. With aging, the mesangial area and glomerular size continued to increase and were significantly larger in EwW quail, suggesting compensatory hypertrophy. Furthermore, apoptosis measured by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling analysis was higher in EwWs than in CTs on embryonic day 15 and postnatal day 4 (D4). Similarly, plasma glucocorticoid (corticosterone) was higher (P<0.01) on D4 in EwW quail. These results suggest that although nephrogenic activity is high in low-nutrition quail during the perinatal period, delayed development and increased apoptosis may result in a lower number of mature nephrons. Damaged or incompletely mature mesangium may trigger glomerular injury, leading in later life to nephrosclerosis. The present study shows that birds serve as a model for ‘fetal programming,’ which appears to have evolved phylogenetically early.
The transport of relativistic electron beam in compressed cylindrical targets was studied from a numerical and experimental point of view. In the experiment, cylindrical targets were imploded using the Gekko XII laser facility of the Institute of Laser Engineering. Then the fast electron beam was created by shooting the LFEX laser beam. The penetration of fast electrons was studied by observing Kα emission from tracer layers in the target.
The objective of this study was to examine temporal and regional variations of sporadic Creutzfeldt–Jakob disease (sCJD) in a retrospective study using Japanese national surveillance data from 2001 to 2010. We calculated the incidence of sCJD by age and sex, derived the standardized incidence in each of the 47 prefectures, and performed spatial disease clustering analysis. The average annual incidence of sCJD was 1·026 per million in men (637 patients) and 1·132 per million in women (733 patients), a significant sex difference after adjustment for age (P = 0·001). The ratios of familial CJD to sCJD apparently increased between 2001–2005 and 2006–2010, possibly as a result of the nationwide introduction of genetic testing after 2006. Based on the data of 2006–2010, certain geographical clusters of sCJD were identified. The incidence of sCJD was higher in several specific prefectures compared to the national average. Thus, sCJD appears to have regional variations, suggesting the existence of genetic or region-specific factors affecting the incidence of the disease.
Monitor of All-sky X-ray Image (MAXI) on board International Space Station is capable of
observing gamma-ray bursts (GRBs) and sending notices of GRBs or other transient events,
using real time connection to the ground. MAXI observed 32 GRBs or short X-ray transients
as of the end of September 2012. Among them, eleven events were simultaneously detected by
other satellites. The observed rate of the MAXI GRBs is about one event per month. This
rate is comparable to a past observation with larger effective area and larger field of
view. The fact indicates that MAXI has better sensitivity to observe GRBs because of low
background. The distribution of the spectral hardness of MAXI GRBs is similar to the
results of a past instrument, which is sensitive to similar energy range.
NEWAGE is a direction-sensitive dark matter search experiment with a gaseous
time-projection chamber. We improved the direction-sensitive dark matter limits by our
underground measurement. In this paper, R&D activities sinse the first underground
measurement are described.
We have investigated the revival of a shock wave by nuclear burning reactions at the central region of core-collapse supernovae. For this purpose, we performed hydrodynamic simulations of core collapse and bounce for 15 M⊙ progenitor model, using ZEUS-MP code in axi-symmetric coordinates. Our numerical code is equipped with a simple nuclear reaction network including 13 α nuclei form 4He to 56Ni, and accounting for energy feedback from nuclear reactions as well as neutrino heating and cooling. We found that the energy released by nuclear reactions is significantly helpful in accelerating shock waves and is able to produce energetic explosion even if the input neutrino luminosity is low.
Directional information should play a significant role
for a firm detection of the galactic dark matter.
We developed a prototype three-dimensional gaseous tracking device
for a direction-sensitive dark matter direct detection.
We investigated the performance of the prototype detector and demonstrated
a direction-sensitive dark matter search experiment in a
We set the first limit
on the spin-dependent WIMP (Weakly Interacting Massive Particles)-proton cross s
ection by a direction-sensitive method.
We analyze a main scheme for the suppression of GeO desorption by the high pressure oxidation which drastically improve the electrical quality of Ge/GeO2 capacitors. The inherent driving force for GeO to form at the Ge/GeO2 interface and to diffuse toward the GeO2 surface was realized by the concentration gradient in the GeO2 film, which was obtained from the thermodynamic calculation. Kinetic consideration based on the comparison with Si/SiO2 stacks suggests that GeO desorption at the GeO2 surface is the rate-limiting process under passive oxidation conditions. When O2 pressure is increased by high pressure oxidation, the vapor pressure of GeO at the GeO2 surface is reduced, restricting GeO desorption at the GeO2 surface.
Field surveys of supraglacial ponds on debris-covered glaciers in the Nepal Himalaya clarify that ice-cliff calving occurs when the fetch exceeds ∼80 m. Thermal undercutting is important for calving processes in glacial lakes, and subaqueous ice melt rates during the melt and freeze seasons are therefore estimated under simple geomorphologic conditions. In particular, we focus on the differences between valley wind-driven water currents in various fetches during the melt season. Our results demonstrate that the subaqueous ice melt rate exceeds the ice-cliff melt rate when the fetch is >20 m and water temperature is 2–4°C. Calculations suggest the onset of calving due to thermal undercutting is controlled by water currents driven by winds at the surface of the lake, which develop with expanding water surface.
This paper deals with a lithium/tin combined target to increase the conversion efficiency of extreme ultraviolet (EUV) of 13.5 nm emission from laser-produced plasma. The bilayer target of glass/lithium (20 nm)/tin (50 nm) exhibits a sharp and strong emission in comparison with a Sn bulk target. The reverse coating of glass/tin/lithium was unstable and EUV could not be observed. By using nano-porous SnO2 and an electrochemical deposition of lithium, nano-structured lithium/tin composite was prepared, and was stable without deliquescence of lithium.
The Ishigaki high-pressure schist belt in the southern Ryukyu Arc is correlated with the Suo high-pressure schist belt in southwest Japan. The former metamorphic sequence is composed mainly of basic and pelitic schists and is subdivided into three zones, the lower-grade zone A, the medium-grade zone B and the high-grade zone C, based on the mineral assemblages of the basic schists. The K–Ar phengite age gives 188–205 Ma for zone A, 196–206 Ma for zone B and 208–220 Ma for zone C, while the apparent d002 spacing of carbonaceous materials is 3.590–3.437 Å, 3.415–3.390 Å and 3.387–3.364 Å, respectively. The age–d002 relationships suggest that the ages become older with increasing metamorphic temperature. This positive age–temperature relationship in the Ishigaki area contrasts with a negative relationship in the Nishiki area in the Suo belt. The two areas also display a contrasting thermal structure with the former area having an inverted metamorphic gradient and the latter displaying a normal thermal structure. These contrasting age–temperature–structure relationships in the metamorphic belt could be due to different tectonic styles relating to the exhumation of the metamorphic sequences. We suggest that the ages obtained are related directly to the ductile deformation history of the matrix phengite below the closure temperature (500°C) during exhumation of the host rocks. The duration from the beginning of exhumation to the apparent resetting of the phengite K–Ar system was different between the two metamorphic sequences, and significantly longer in the Ishigaki than the Nishiki. | <urn:uuid:d06437b1-290f-4f67-8bf5-a51fe538c20b> | CC-MAIN-2022-33 | https://core-cms.prod.aop.cambridge.org/core/search?filters%5BauthorTerms%5D=T.%20NISHIMURA&eventCode=SE-AU | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.931893 | 4,026 | 1.695313 | 2 |
Helping you get online
See how our training and guidance can help you to use the internet safely and confidently.
Getting you started
Device set-up and digital support
We can help you set up a new smartphone, tablet, laptop or computer. This includes technical support for things like setting up an email account, connecting to wifi and staying safe online.
Affordable digital devices
We work with a range of suppliers that offer tablets, laptops and computers at affordable prices, as well as support on equipment and broadband packages.
Our volunteer digital champions can help you to build your confidence with technology and the internet. Through one-to-one sessions, they’ll show you how to do online shopping, fill in online application forms, discover local forums and help you access any other online services.
“Without digital skills I was feeling left behind. Now I’m able to keep in touch with people, create documents and manage my money.”
Digital skills courses
You can benefit from our range of digital skills courses, covering topics such as CV writing, job searching, and computer and internet basics.
We also offer personal courses, such as saving money online and using your Clarion online account.
You can even borrow devices such as laptops, tablets and mobile wifi units while you learn with us.
There are drop-in classes, workshops and accredited courses, with many now available online via Microsoft Teams or Zoom.
Our charitable foundation
Clarion Futures can help in lots of ways: from jobs and training to financial guidance and digital skills.
- Money and household bills.
- Jobs, apprenticeships and training.
- Digital skills.
- Mental health and wellbeing.
Being online can make such a difference to people in so many ways.
volunteer digital champion
Meet Hilary – award-winning digital champion
Hilary is a Clarion resident who volunteers as a digital champion at one of our LiveSmart schemes for older people. In 2019, her outstanding efforts were recognised when she was crowned Clarion Futures Digital Champion of the Year.
Hilary spends two days a week helping residents to get online and develop digital skills. She works with a range of residents, including people with sight impairments, epilepsy, arthritis and depression.
Her calm, friendly manner gives learners the confidence to use new technologies on their own. This enables them to see how digital skills can enhance their lives – helping them to stay in touch with family members, as well as to use online services.
“Being online can make such a difference to people in so many ways. It’s been great going from a learner myself to being able to share my knowledge with others,” says Hilary.
Find out more about becoming a digital champion | <urn:uuid:bee38668-5fa1-475b-8edb-4f2a2866f815> | CC-MAIN-2022-33 | https://www.myclarionhousing.com/help-and-guidance/personal-wellbeing/helping-you-get-online | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.939651 | 584 | 2 | 2 |
The MMA Design dragNET™ De-Orbit System is designed for LEO applications. It consists of an efficient and highly scalable packaging along with four compactly-stowed thin membranes that release using a single heater-powered actuator.
It has a mass of 2.8 kg and is designed with the capacity to de-orbit a 180 kg spacecraft from an altitude of 850 km in less than ten years.
The product meets the requirements of the Department of Defense (DoD) as well as the National Aeronautics and Space Administration (NASA) and successfully de-orbited the ORS-3 Minotaur I Upper Stage in a two-year time frame.
Disclaimer: satsearch is not responsible for any mistakes on this page, although we do our best to ensure correctness. Please report any mistakes to us.
Last updated: 2022-04-13 | <urn:uuid:3d63f6a9-63e3-4d79-9c92-cb1e28679fbc> | CC-MAIN-2022-33 | https://satsearch.co/products/mma-design-drag-net-de-orbit-system | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.933874 | 179 | 1.859375 | 2 |
06 • 18 • 2020
A Reality Check on Environmental Racism & Plastics
Environmental racism is not a new phenomenon, but due to the recent increased visibility of the Black Lives Matter movement, it may finally get the mainstream attention it deserves. Environmental racism often refers to the excessive impact that environmental hazards, such as plastic pollution, have on Black, Indigenous, and People Of Color (BIPOC) in this country. This imbalance calls for urgent anti-racism action in order to bring about environmental justice.
Speaking specifically through the lens of the plastics problem, environmental racism occurs at a number of junctures. Let’s start by first addressing where plastic comes from.
Plastic starts in the ground as a fossil fuel usually a mile or two beneath the surface. In order to reach it, the fossil fuel industry drills into the ground and injects a mixture of water and chemicals into the rock, forcing the oil to be released. This process, known as fracking, presents a number of potential hazards including groundwater contamination. That’s not surprising considering the drill passes straight through the water table and the wastewater is usually dumped nearby. This Beachapedia article explains the dangers of fracking in more detail.
Next, there’s the pipelines that carry the oil from the pump to the refinery. Pipelines destroy land in order to be placed into the ground and often result in leakage over time, or worse, rupture. Ruptures can result in dangerous fires that have a history of killing people and destroying homes. You can learn more about the risks of pipelines here. As outlined in a report by the Center for International Environmental Law, the oil refineries and ethane cracking facilities that transform oil into gas and gas into plastic resin release large amounts of toxic chemicals into the air, polluting the surrounding community. This results in a slew of health problems for local residents including cancer, cardiovascular and respiratory disease, and childhood leukemia. The report also raises the important connection between plastics and the climate crisis, as plastic refining is one of the most greenhouse-gas-intensive industries.
Importantly, these sites disproportionately affect BIPOC communities, as these studies from Texas and Pennsylvania clearly show. The industrial practices that systematically reinforce environmental racism remain ongoing. Currently, Formosa Plastics is constructing a new facility in Louisiana’s St. James Parish – where 87% of the residents of the 5th District, where Formosa is building, are Black. The construction not only threatens the health of residents, but it would also desecrate the burial site of enslaved African Americans. Join the effort to #StopFormosa to prevent the lasting, disastrous and widespread implications of this project. Watch the video here.
These families who are forced to live on the frontlines of Big Plastic’s polluting agenda are referred to as fenceline communities. They are given no voice in the corporate decision-making process and often receive serious threats when they try to fight back, as demonstrated in The Story of Plastic. The increased health risks of living near a plastic production site, mainly poor air quality of which Black people bear a “pollution burden” of 56% (excess exposure compared to consumption), also contributes to the death rate of COVID-19 being three times higher for Blacks when compared to white people.
Let’s move on to the consumerism portion of how plastic burdens Black people. We can start by analyzing the toxic cycle of extraction to market, resulting in more extraction. The fossil fuel industry produces the raw material from oil and sells it to corporations in order to make their products and packaging. Then, when we buy their products, it creates a demand which indirectly supports the extraction of fossil fuels and corresponding pollution of BIPOC communities to make more of that product.
These products gain traction in underserved communities due to the artificially low sale price of plastic. Since the cost does not account for the environmental damage it requires to be produced, it can be brought to market at a disproportionately low rate. This is further distorted by billions of dollars worth of taxpayer subsidies and huge government bailouts. The simple act of using a plastic product puts the consumer at risk due to the toxic chemicals that can transfer from plastic into our food, water and air, as well as the presence of microplastics that easily enter our bodies. To better understand these health risks, you can read our blog post titled, “Choose Reusables to Avoid Consuming Chemicals.”
As elaborated in The Washington Post, from discrimination in their hiring processes and a lack of diversity in senior leadership positions, to racial pay bias and discriminating against customers, systemic racism runs deep in some of America’s largest corporations. This is powerfully demonstrated in the documentary 13th. The film illuminates how ALEC, the American Legislative Exchange Council, has pushed for racist and white supremist policies for years. ALEC brings together conservative lawmakers and corporate lobbyists to create model legislation which is used across the country. As outlined in a report by the Center for Constitutional Rights, “conservative and corporate interests have captured our political process to harness profit, further entrench white supremacy in the law, and target the safety, human rights and self-governance of marginalised communities.”
As we know, ALEC is also behind many container preemption laws which block any local legislation that would aim to restrict the sale of single-use plastic. The environmental movement and social justice movement often share the same enemies. Therefore, our efforts and energies should be united under the more inclusive banner of environmental justice.
After your single-use plastic item is used for an average of a mere 12 minutes, it is disposed of in either a landfill, incinerator, the environment, or least likely, a recycling facility. Both landfills and incinerators come with hefty environmental tolls. Most of our trash heads to a landfill where it will sit for hundreds of years, all the while releasing toxic methane into the surrounding area. According to the EPA, there are at least 564 operational landfills and 480 candidate sites as of March 2020. Since as early as the 1960s, predominantly BIPOC communities have been targeted as sites where it has been acceptable to dump our trash.
The NRDC has archived these facts and the fenceline community-led resistance to these landfill developments, including the first documented arrests due to protesting a newly constructed site that occurred in Warren County, NC in 1982. Six weeks of nonviolent marches and protests were met with 500 arrests; but despite this unified, grassroots effort, ultimately the community lost and the landfill was used as a toxic waste dump. Another more recent example can be found at the Arrowhead Landfill in Uniontown, AL, where about 90% of the population is Black and half of the town lives below the poverty line. This landfill contains toxic coal ash and the citizens have experienced a corresponding increase in breathing difficulties, mental health issues, and cancer. The Guardian presents the details of this civil rights case that was ultimately dismissed by the EPA.
Even worse than landfills, incinerators often carry deadly consequences for BIPOC Americans. A 2019 report from the Global Alliance for Incinerator Alternatives (GAIA) found that 79% of the 73 incinerators in the US are located in BIPOC communities. Burning plastic is not only expensive due to the high costs to maintain and operate incinerators, it also releases heavy metals like lead and mercury directly into the air. This is a major human health risk and results in increased cases of asthma, cardiovascular disease and resulting mortality.
A Just Recovery
While reusable products may have a larger upfront cost to purchase, they will last much longer and save on resources over time. Wouldn’t our energy and financial resources be put to better use developing a new system based on reusables that is affordable and accessible by all?
Although a transition to reusables is our best way out of the plastic pollution crisis, it is unfortunately not yet an equitable solution. Reusable items do cost more initially and require an investment in both the items and the washing capacity. In addition, zero waste and refill shops, or “refilleries,” are not yet widespread due to the higher risk of opening and BIPOC communities are less likely to have a local shop. Costs at refilleries are also inflated right now due to a lack of demand. We must prioritize these businesses through economic incentives and shift our buying habits before they can reflect the true cost.
While promising models of consumer-based reuse are starting to pop up around the country, we still have a long way to go before these are widely available. That’s why the Surfrider Foundation, united with #BreakFreeFromPlastic members from around the world, is supporting these 5 Principles for a Just Recovery:
- Prioritize health for people and planet - Public health must be protected, prioritizing frontline workers, fenceline communities, and other vulnerable populations. Environments and human rights of impacted countries and communities cannot be compromised by the business interests of the global elite.
- Investment not bailouts - Deprioritize and divest from extractive industries and their boom and bust cycles. Transition the workforce into sustainable economies with free training programs. Bailouts must be investments in community resiliency, not corporate interests.
- Replace single-use with sustainable systems - Single-use must be replaced with sustainable product delivery systems. The externalized costs from extraction to disposal must be eliminated.
- Demand government and corporate accountability - Government policies must ensure countries manage their own waste. Policy must be informed by credible, third-party science. Corporate responsibility and accountability should be mandated and consistent in all regions where companies do business.
- Engage impacted communities - Support community efforts to hold industry accountable for its impacts. Regulators must measure and monitor emissions, as well as health impacts of frontline communities.
Environmental racism is deep-rooted in the issue of plastic pollution - from production to consumption to disposal - and it’s easy to feel overwhelmed by this magnitude of injustice. That’s why we must meet the challenge with equal strength as a united front for environmental justice and essential human rights.
June 19th represents Juneteenth, a day to honor Black freedom and Black resistance. Join the NAACP and your local social justice groups by participating in a weekend of action.
You don’t have to do anything extreme, but you need to do something. As Dr. Ayana Elizabeth Johnson so eloquently wrote for The Washington Post, “I need you to understand that our racial inequality crisis is intertwined with our climate crisis. If we don’t work on both, we will succeed at neither.” And since plastic pollution is a climate issue, we must address systemic racism if we are to make the progress needed to finally put a stop to Big Plastic. Join Surfrider in stepping up, in whatever way you can, to work towards a more just future both for people and the planet.
Plastic Pollution Manager | <urn:uuid:8741ef5e-95d6-4fb2-a663-fd94ca85c3d0> | CC-MAIN-2022-33 | https://www.surfrider.org/coastal-blog/entry/a-reality-check-on-environmental-racism-plastics?gclid=Cj0KCQiA6NOPBhCPARIsAHAy2zDb1RDHc7FXyZxlx3HWLTx5mFQMwgui-XpAcHXsoSBwzB-Gks_ElVsaAjcVEALw_wcB | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.948666 | 2,260 | 3.3125 | 3 |
Programme ➔ Main Programme ➔ Thomas Street Programme (2003-)
2017 May 12 (is beginning date)
2017 Jun 18 (has end date)
Exhibition of work by artist Michael Wolf looking at his photography which captured the hyperdensity of the city of Hong Kong for over 20 years. Distilled from an archive of thousands of photographs, which form a larger ongoing encyclopaedic project, Wolf organised images into groups, according to colour, rhythm, structure or shape – seeking to conserve and classify a disappearing cultural landscape. | <urn:uuid:ec050fe6-9b7c-4545-a95e-21a0b9d89a1f> | CC-MAIN-2022-33 | https://archive.cfcca.org.uk/index.php/Detail/occurrences/731 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.89903 | 126 | 1.609375 | 2 |
Committing to Quitting: Your Quit-Tobacco Plan
You've made up your mind that you want to quit using tobacco. You might be nervous or not sure you can quit. But try to focus on the fact that you want to quit—whether it's your first time or tenth time. And focus on creating your plan to quit. A quit plan can help you deal with your feelings now and ones that may come later.
Having a plan may help your chances of staying tobacco-free.
- Name your reasons for quitting.
Knowing why you want to quit can help you stay motivated. Do you hope to be more active, to look and feel better, or to lower your chances of a long-term disease? Whatever the reasons, they're your reasons so they're the most important.
- Set your goals.
To achieve a long-term goal like this, you may find it helpful to break the task into smaller goals. Every time you reach a goal, you feel a sense of pride along the path to becoming tobacco-free.
- Write down your goals, or tell someone what you are trying to do. It's important to include "by when" or "how long" as well as "what."
- Pace yourself. You may want or need to quit slowly by reducing the number of times you use tobacco each day over the course of several weeks.
- Be realistic. Be sure to set goals that you can meet, including a timeline for quitting.
- Set your quit date.
Try to pick a time when you don't have a lot of stress or change.
- Find all the resources you can to help you quit.
- Talk to your doctor and insurance provider to see what your treatment might be and if your insurance covers it.
- Think about whether you want to take medicine to help you quit. Using medicines and nicotine replacement products can increase your chances of quitting. They can relieve nicotine cravings and withdrawal symptoms.
- Find support.
In your plan, include those people who can support you. They are friends or family who will tell you to keep going or trying. They will help you deal with stress and bad moods. And they will join you to celebrate when you reach your goals.
- Review your past attempts to quit.
If you have tried to quit in the past, review those past attempts. Think of the three most important things that helped in those attempts, and plan to use those strategies again this time. Think of things that kept you from succeeding, and plan ways to deal with or avoid them. Write this down as a plan.
- Change your surroundings and routines.
- Throw out all your tobacco and anything that reminds you of using it, like ashtrays, lighters, or spit cups.
- Don't let people smoke or use tobacco in your home.
- Change your daily routine. Take a different route to work, or eat a meal in a different place. Every day, do something that you enjoy.
- Be aware of your tobacco cues, and plan how you'll avoid them.
Cues are things that remind you of using tobacco. You'll want to avoid or stay away from them. You may already know your cues. Common ones include drinking alcohol and being with friends who use tobacco.
- Prepare for emotions and cravings.
Withdrawing from nicotine can make you feel stressed, upset, or cranky. Here are some ideas:
- Tell yourself that these emotions are uncomfortable, but they will pass.
- Think about ways to avoid things that make you reach for tobacco (your triggers). Identify situations in which you will be at greatest risk.
- Plan for ways to handle a strong urge to use tobacco. You might try exercising, walking your dog, or calling or texting a friend.
- Start a hobby or activity.
- Calm yourself or release tension by reading a book, taking a hot bath, or digging in your garden.
- Be prepared for relapse.
Most people aren't successful the first few times they try to quit. If you start using tobacco again, don't feel bad about yourself. A slip or relapse is just a sign that you need to change your approach to quitting.
- Celebrate your successes.
You may have days when you wonder whether quitting is a good idea. Celebrations are reminders that can help when negative thoughts creep back.
In your quit plan, you'll want to include ways to remember and celebrate what you've done. You'll remind yourself why you wanted to quit and make quitting seem doable again.
To learn more about Healthwise, visit Healthwise.org.
© 1995-2022 Healthwise, Incorporated. Healthwise, Healthwise for every health decision, and the Healthwise logo are trademarks of Healthwise, Incorporated. | <urn:uuid:8196e2e3-c5a5-4f4d-828a-c3c034f7c2b7> | CC-MAIN-2022-33 | https://www.uvmhealth.org:443/medcenter/wellness-resources/health-library/ack9352 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571222.74/warc/CC-MAIN-20220810222056-20220811012056-00672.warc.gz | en | 0.94765 | 1,004 | 2.3125 | 2 |
Named in honor of the king of Latin pop Ricky Martin, the two-year-old gray cat is not in great shape.
“It was very stressful for him,” explains its owner Anastasiia Herasymchuk, recounting the 30-hour journey to flee the fighting that was getting ever closer to their village in the Donetsk region. “He ate nothing and drank nothing.”
The volunteers of the International Fund for Animal Welfare (Ifaw) give the feline an unsavory meal and place it in a cage which they cover with blankets to bring it a little serenity. And allow the young couple to eat and breathe too.
“Helping people through their animals”
“You know, we don’t just help the animals here,” says Andrew Yaroslaw Kushnir. “We help people through their animals”.
Himself the son of a Ukrainian refugee who, as a child, fled the Second World War for the United States, the 34-year-old veterinarian claims to have felt compelled to leave the comfort of his Californian life to help his neighbors — and their domestic companions– in the rusticity of a tent at Medyka, an important crossing point between Ukraine and Poland.
Here, we evaluate the health of the animals and we distribute, free of charge, everything necessary: harnesses, leashes, muzzles, cages, food.
Stress, dehydration, wounds, fleas and worms… Dogs, cats, rodents, parrots, ferrets and other reptiles also bear the scars of the war started by Russia on February 24.
“Some have experienced the sounds and smells of war and their owners tell us that now, as soon as there is noise, they react”, says Jennifer Gardner, program manager of Ifaw.
“That is why it is important that in our supplies there are suitable harnesses for the animals and cages so that they do not escape if they should suddenly be stressed”, she adds.
A little special menagerie
Every day, the tent welcomes about sixty animals. A somewhat special menagerie that also saw four snails pass by, each the size of a fist, transported in a pierced Tupperware. It is out of the question for their owner to let the war separate them.
“We cleaned them, put them in a new box, fed them lettuce and she was delighted,” testifies Diane Treedwell, another volunteer.
The refugees “would leave all their belongings behind to make sure their best friend gets out there”she says.
A cage is one hand less for carrying a suitcase.
“In reality”, emphasizes Andrew Yaroslaw Kushnir, “the animals that we see here, on this side of the border, are lucky: they are the ones who managed to cross”.
“While on the other side, the animals were abandoned by owners who could no longer take care of them”, he specifies.
Those are taken care of by Jakub Kotowicz. In Przemysl, about ten kilometers from Medyka, this 32-year-old Polish veterinarian, co-founder of the ADA foundation, devotes part of his clinic to animals left behind in Ukraine.
Together with other organisations, it organizes convoys to bring back from Lviv dogs and cats found in combat zones.
With his team, he works to get them back on their feet before offering them up for adoption.
“The transport is very long”, he observes. “From the east of Ukraine, it’s one or two days in small cages in which the Ukrainians have crammed three or four cats. So it’s very stressful for them.”
Around him, a room in his clinic lined with boxes – spacious – stacked on top of each other, in which around forty cats, including two young mothers, are awaiting the end of their health quarantine. Two young women provide them with food, fresh water and hugs.
In three weeks, Jakub Kotowicz claims to have examined 900 Ukrainian dogs and cats. As well as a small injured white goat and a stork with a broken beak.
Manage Cookie Consent
To provide the best experiences, we use technologies like cookies to store and/or access device information. Consenting to these technologies will allow us to process data such as browsing behavior or unique IDs on this site. Not consenting or withdrawing consent, may adversely affect certain features and functions.
The technical storage or access is strictly necessary for the legitimate purpose of enabling the use of a specific service explicitly requested by the subscriber or user, or for the sole purpose of carrying out the transmission of a communication over an electronic communications network.
The technical storage or access is necessary for the legitimate purpose of storing preferences that are not requested by the subscriber or user.
The technical storage or access that is used exclusively for statistical purposes.The technical storage or access that is used exclusively for anonymous statistical purposes. Without a subpoena, voluntary compliance on the part of your Internet Service Provider, or additional records from a third party, information stored or retrieved for this purpose alone cannot usually be used to identify you.
The technical storage or access is required to create user profiles to send advertising, or to track the user on a website or across several websites for similar marketing purposes. | <urn:uuid:ca476352-e4ea-413b-b41f-e3a57c5f36a7> | CC-MAIN-2022-33 | https://crestmeat.com/stress-dehydration-injuries-the-pets-of-refugees-cared-for-at-the-border/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.948501 | 1,147 | 1.945313 | 2 |
- Open Access
The instability of the BTB-KELCH protein Gigaxonin causes Giant Axonal Neuropathy and constitutes a new penetrant and specific diagnostic test
Acta Neuropathologica Communications volume 2, Article number: 47 (2014)
The BTB-KELCH protein Gigaxonin plays key roles in sustaining neuron survival and cytoskeleton architecture. Indeed, recessive mutations in the Gigaxonin-encoding gene cause Giant Axonal Neuropathy (GAN), a severe neurodegenerative disorder characterized by a wide disorganization of the Intermediate Filament network. Growing evidences suggest that GAN is a continuum with the peripheral neuropathy Charcot-Marie-Tooth diseases type 2 (CMT2). Sharing similar sensory-motor alterations and aggregation of Neurofilaments, few reports have revealed that GAN and some CMT2 forms can be misdiagnosed on clinical and histopathological examination. The goal of this study is to propose a new differential diagnostic test for GAN/CMT2. Moreover, we aim at identifying the mechanisms causing the loss-of-function of Gigaxonin, which has been proposed to bind CUL3 and substrates as part of an E3 ligase complex.
We establish that determining Gigaxonin level constitutes a very valuable diagnostic test in discriminating new GAN cases from clinically related inherited neuropathies. Indeed, in a set of seven new families presenting a neuropathy resembling GAN/CMT2, only five exhibiting a reduced Gigaxonin abundance have been subsequently genetically linked to GAN. Generating the homology modeling of Gigaxonin, we suggest that disease mutations would lead to a range of defects in Gigaxonin stability, impairing its homodimerization, BTB or KELCH domain folding, or CUL3 and substrate binding. We further demonstrate that regardless of the mutations or the severity of the disease, Gigaxonin abundance is severely reduced in all GAN patients due to both mRNA and protein instability mechanisms.
In this study, we developed a new penetrant and specific test to diagnose GAN among a set of individuals exhibiting CMT2 of unknown etiology to suggest that the prevalence of GAN is probably under-evaluated among peripheral neuropathies. We propose to use this new test in concert with the clinical examination and prior to the systematic screening of GAN mutations that has shown strong limitations for large deletions. Combining the generation of the structural modeling of Gigaxonin to an analysis of Gigaxonin transcripts and proteins in patients, we provide the first evidences of the instability of this E3 ligase adaptor in disease.
Gigaxonin is a BTB-KELCH protein that plays a central role in sustaining neuron integrity and cytoskeleton architecture. Indeed, recessive mutations in the Gigaxonin-encoding gene are responsible for a devastating neurodegenerative disorder in human, called Giant Axonal Neuropathy (GAN [MIM 256850]) , that leads to a wide deterioration of the nervous system and provokes a massive disorganization of the Intermediate Filament (IF) cytoskeleton.
Diagnosed early in infancy, the disease first touches the peripheral nervous system, altering both the motor and sensory tracts in teens, and closely resembles to the most common inherited peripheral neuropathy called Charcot-Marie-Tooth (CMT) diseases. Thus, patients exhibit weakness and severe wasting of the four limbs predominating in distal segments, sensory and motor loss, and reduced deep tendon reflexes. Symptoms evolve towards areflexia, loss of the deep and superficial sensitivity and loss of ambulation. Subsequently, the disease targets the central nervous system, leading to a wide range of symptoms encompassing ataxia, nystagmus, dysarthria and intellectual disability [2, 3]. Fatal in young adults, GAN is a progressive neurodegenerative disorder of axonal type. Although few milder cases of the disease with later onset, absence of central nervous system impairment, or longer survival have been described, GAN invariably causes the massive collapse of IFs in a variety of tissues, including Neurofilaments (NFs) in distended or “giant” axons in nerve biopsy [2, 3]. Up to recently, NF aggregation in giant axons constituted a powerful histological test towards the diagnosis of GAN, which is now compromised by similar histopathological findings in several forms of CMTs [4, 5].
While NF aggregation has been reported in many neurodegenerative disorders, including Alzheimer’s, Parkinson’s diseases and Amyotrophic Lateral Sclerosis, possibly as a results of neuron injury, the disorganization of all classes of IFs is unique to GAN and supports a crucial role of Gigaxonin in sustaining cytoskeleton architecture . In addition to neuronal IF defects, GAN patients display aggregation of GFAP, desmin, keratin and vimentin. In GAN patient-derived primary fibroblasts, vimentin aggregation has been shown to be reversible, conditional, and independent of microtubule overall stability [7, 8]. The central role of Gigaxonin in regulating IFs has been confirmed in GAN mouse models, although these only exhibit mild motor and sensory deficits with no signs of robust neurodegeneration [9, 10]. Indeed, Gigaxonin-depleted mice display a massive aggregation, spatial disorganization and increased abundance of several IF proteins throughout the central and peripheral nervous system [9, 10].
How this low abundance BTB-KELCH protein , preferentially expressed throughout the nervous system and during development , controls neuron survival and IF architecture remains unknown. One plausible hypothesis is that this would be mediated by the Ubiquitin Proteasome System (UPS) pathway. Indeed, BTB-containing proteins, including Gigaxonin have been identified as the substrate adaptors of Cul3-E3 ubiquitin ligases, mediating the addition of ubiquitin chains onto their targets prior to their degradation by the proteaseome [11–13]. Interacting with the E3 ligase complex to its N-terminal BTB domain, Gigaxonin is thought to promote the Ubiquitin tagging of the substrates through interaction with its C-terminal KELCH domain. Although Gigaxonin has been shown in cells to participate in regulating the abundance of three regulators of microtubules, the E3 ligase activity of Gigaxonin remains to be fully established. A first step towards this goal has been recently reached, in a study revealing that the overexpression of Gigaxonin induces the degradation of several IF proteins, including vimentin in primary fibroblasts and that this clearance involves the proteasome .
To better understand the disease mechanisms in GAN and provide a specific diagnostic tool able to discriminate GAN from closely related CMTs, we combine here a study on Gigaxonin abundance and stability in disease and a structural modeling of Gigaxonin to a prognostic study on new patients presenting a sensorimotor neuropathy of unknown etiology. We establish that in GAN patients, mutant Gigaxonin levels are greatly reduced in abundance. The quantification of Gigaxonin mRNA reveals nonsense mRNA decay as one of the disease mechanisms in GAN. In addition, the modelization of Gigaxonin structure allows us to map GAN mutations and predict a general destabilization of disease-associated mutants, which is further confirmed by reduced half-lives of mutant Gigaxonins. Finally, we establish that our immunodetection of Gigaxonin constitutes a robust, penetrant and specific new diagnostic test for GAN, circumventing the limitations of gene sequencing and the clinical and histopathological overlap between GAN and the frequent forms of axonal CMTs.
Materials and methods
Preparation of lymphoblast cell lines from patients
Blood samples were collected from patients with written informed consents and under the agreement n° DC-2010-1191 of the Bioethic comittee of the Ministère de l’Enseignement Supérieur et de la Recherche. Numbering of previously reported GAN patients matches publications [1, 15] for F1-F18 families, and for family F25. New families included in the study (F23, 24, 26–30) were addressed to banque d’ADN et de Cellules de Généthon (Evry, France) for the generation of immortalized cell lines.
Cell lines, expanded in RPMI 20% FBS, 1% P/S and 2 mM Glutamine (Invitrogen), were lysed and processed for western blotting as previously described in . Primary antibodies are: Gig A (1:150) , DM1α-tubulin from Merck Millipore n°CP06 (1:10000); GAPDH from Ambion n°4300 (1:4000). Quantification was performed on 3–5 independant experiments with Image Lab (Biorad) after normalization with Tubulin or GAPDH. Statistical analysis was performed using Prism GraphPad.
All coding exons and flanking intron sequences of the GAN gene were Sanger sequenced using primers described in , the Big Dye Terminator v3.1 sequencing kit and analyzed on an ABI3130 Genetic Analyzer (Applied Biosystems, USA). The reference sequence used for GAN was the NM_022041.2. Variants were compared to the known public databases (dbSNP, 1000 genomes), the Inherited Peripheral Neuropathies Mutation Database (IPNMDB; http://www.molgen.ua.ac.be/CMTmutations/default.cfm) and Human Gene Mutation Database (HGMD) to exclude polymporphisms in the normal population.
Genomic rearrangement on the GAN gene was analyzed on proband and family genomic DNA by High-resolution custom NimbleGen 135 k CGH microarray (probe spacing of 75 bp for exons and 200 bp for the introns) versus reference DNA (Kreatech, Amsterdam, The Nederlands). The array also included a genomic backbone probe set with an average probe spacing of 30 kb. DNA samples were labeled (test with Cy3 and reference with Cy5) and co-hybridised to the custom microarray in accordance with the manufacturer’s instructions (NimbleGen Arrays User’s Guide: CGH and CGH/LOH Arrays v9.1, Roche NimbleGen, Madison, WI USA). The microarray was washed and then scanned on an Axon GenePix 4400A Scanner using GenePix Pro 7 software (Molecular Devices, Sunnyvale, CA, USA). Raw data was normalized, LOESS correction applied and the data ratios calculated using DEVA v1.01 Software (Roche NimbleGen). The normalized data was processed using Infoquant Fusion v6.0 software (Infoquant, London, UK) with analysis call settings of 3 consecutive probes +/- 0.4 Cy3/Cy5 ratios. The arrays were used on affected and unaffected family individuals as well as normal controls.
Quantitative RT-PCR (qRT-PCR)
Total RNA from patients and control cell lines was isolated using the RNeasy MicroKit (Qiagen) according to the supplier’s recommendations. For each sample, 1 μg of RNA was used for reverse transcription with oligodT primers and SuperScriptIII (Invitrogen). SYBR green quantitative real-time PCR was performed with LightCycler 480 SYBR Green I Master (Roche) in a two-step cycling protocol on 100 ng of cDNA, using GAN-exon9-11 specific primers (GGGTAGCGAGATGGTAACTTG and CGGATGGAAGGAGTGGTTTAG) and HPRT1 quantitect primers (Qiagen). Carrying a deletion in the GAN exons 10 to 11, F24 mRNA level was determined by another set of primers, i.e. GAN-exon4-5 (QT00018774, Qiagen), together with appropriate positive and negative controls. The relative abundance of the patient’s mRNA was expressed as the fold change to the controls mRNAs. Fold changes were measured as the ratio of the ΔΔCT of each patient to the ΔΔCT of the controls after normalization with HPRT1. Three independent RT-PCR were performed in triplicate for each sample. Accordingly to the manufacturer’s instructions, only fold changes exceeding a value of 2 are considered significantly different.
The student’s t-Test was used to determine statistical significance. Error bars represent standard deviation and p values are reported in the Figure legends.
The structural model of the BTB-BACK domain Gigaxonin bound to the N-terminal domain of CUL3 was generated as follows. Residues 8–128 were used from the crystal structure of the BTB domain of Gigaxonin, which also included a partial model for the BACK domain (3HVE.pdb, ). A complete model for the BACK domain (residues 129–256) was obtained from the Phyre homology modeling server (http://www.sbg.bio.ic.ac.uk/phyre2/) based on the crystal structure of human KLHL11 (3I3N.pdb) . The BTB domain from Gigaxonin was superimposed on that from SPOP in complex with the N-terminal domain from CUL3 (4EOZ.pdb) to add this portion of CUL3 to the model . The KELCH domain of Gigaxonin (residues 273–577) was modeled with the crystal structure of the KELCH domain of the BTB-BACK-KELCH protein Keap1, using the Phyre server with 100% confidence for the fold and based on 1X2R.pdb (27% sequence identity) [20, 21].
Pulse chase assay
COS cells were transfected by plasmids expressing human wild type or mutated Gigaxonin tagged with a N-terminal Flag sequence, using Fugene 6 transfection (Promega). R138H, L309R, R477X and R15S correspond to mutations of families F13, F1, F16 and F2, respectively. WT, N-ter and C-ter correspond to the Full-length Gigaxonin, the BTB domain (residues 1 to 223) and the KELCH domain (residues 141 to 597), respectively. 24 hours post transfection, cells were washed twice with PBS, incubated in methionine- and cysteine-free DMEM (Sigma) supplemented with 10% FBS and 1% P/S for 1 h before labeling with 100 μCi of S35-methionine/cysteine (Perkin Elmer) for 45 min. Cells were subsequently washed twice with PBS and incubated with normal DMEM medium, containing serum and antibiotics. Cells were washed with PBS and collected by centrifugation at the beginning of the chase period (0 h) and at 2, 4, 6, 9, 24 hours. Protein extracts were lysed as previously described for lymphoblast cell lines and immunoprecipitation was performed on 60 μg of total proteins using anti Flag antibody (Flag-M2, sigma) and G-protein (Dynabeads, Fisher scientific). Immunoprecipates were recovered in Laemmi buffer and loaded on two identical gels for autoradiography and immunoblotting (for internal control). Because immunoblotting of Gigaxonin (using either the Flag-M2 or the mouse Gigaxonin antibody (GigA, ) hampered the detection of several mutants/truncated Gigaxonin due to cross reaction with mouse IgG, we used the supernatents recovered after the incubation of the Gigaxonin-Antibody complex with the G-protein as the best internal control, using tubulin (DM1α, 1:10000). Three independent labeling-immunoprecipitation experiments were performed per condition. All quantifications were performed with Image Lab (Biorad) after normalization with Tubulin. Half-lives were determined with Prism (Non linear regression).
Decreased abundance of GAN-linked Gigaxonin
Inherited through a recessive mode of inheritance, GAN is suspected to result from a Gigaxonin loss of function mechanism. We previously showed a dramatic decrease in the abundance of mutant Gigaxonin in few GAN patients using an immunodetection method on immortalized lymphoblast cell lines . To further confirm this finding on a larger group of patients and determine the levels of residual mutated Gigaxonin, we quantified the abundance of Gigaxonin in all GAN patients for which immortalized lymphoblast cell lines have been derived and mutations identified (Figure 1). Those include eight severely affected patients and two mild cases (R15S and R138H mutations, corresponding to family F2 and F13 in Figure 1A). Univocally, all mutated Gigaxonins, including severe but also mild cases were considerably less abundant than wild type proteins (Figure 1B). Thus, the levels of mutant Gigaxonin ranges from [0,73 to 36,6]% of the wild type counterparts, with a mean value of 13,1 ± 5,7 using normalization with tubulin, and a [0,6-37,6]% range with a mean value of 14,2 ± 10,9 with GAPDH (Figure 1C). In an attempt to determine whether heterozygous compounds, carrying one wild type Gigaxonin in addition to one mutated form may exhibit a dose effect in protein level, we quantified its abundance in patient’s relatives: unaffected brother of patient F6 and both parents of patient F11 (Figure 1B, C). Very interestingly, the level of Gigaxonin in heterozygous individuals ranges from [35,2-59,9] or [36,3-63,4]% of wild type Gigaxonin using tubulin or GAPDH normalizators, respectively. Whereas the mean values of 47,7 ± 14,2 or 53,0 ± 14,6 represent half of the abundance of healthy individual (carrying 100% of wild type proteins), this is not statistically significant, probably due to the intra-individual (as seen for mother of F11) and inter-individual variability between control samples. Therefore, we conclude that when mutated in both alleles, Gigaxonin is greatly reduced in abundance by 85,8% in average and by 99,3% in the most extreme case, but that additional control and heterozygous individuals should be tested to convincingly discriminate the latter from healthy individuals.
Gigaxonin abundance discriminates GAN from closely related CMT diseases
To assess whether the determination of Gigaxonin abundance could contribute to diagnose GAN, we included in the study seven new patients presenting a sensorimotor axonal neuropathy resembling GAN/CMT2 with unknown genetic etiology (Table 1). Some patients have simultaneously been evaluated clinically .
Among the seven new patients, five of them, namely patients F23, F24, F26, F28 and F30 present an early (<4 years) onset progressive neuropathy indicative of the typical severe form of GAN. As revealed by the reduction of nerve conduction velocities, they exhibit an axonal motor and sensory neuropathy with muscle weakness/tone, areflexia that evolves to the loss of ambulation and of the deep and superficial sensitivity during childhood. All patients subsequently develop central nervous system impairment encompassing nystagmus, dysarthria and ataxia. Concomitant with these clinical signs, GAN has been shown to induce a wide aggregation of the cytoskeletal IF network both in and out-side the nervous system, and severely affected patients F23, F24, F26, F28 and F30 all exhibit altered keratins (kinky hair) and aggregating NFs in enlarged axons (Table 1).
Two additional patients (F27 and F29) present a neuropathy differing from the GAN typical form, with ± late onset, mild central nervous system impairment, extended survival but with the presence of giant axons and NF aggregation that may suggest a milder form of GAN or another related sensori-motor neuropathy called type 2 Charcot-Marie-tooth (CMT) disease. Indeed, we previously identified two moderate forms of the disease with very slow progression, no central nervous impairment and extended survival (F2 in the present study, carrying a R15S mutation), or with a late onset at 10 years of age, slow evolution with no central system involvement for patient F13 (with a R138H mutation).
The quantification of Gigaxonin in patients suspected of bearing a GAN severe (F23, F24, F26 and F30) and mild (F27) forms revealed a considerable diminution of abundance using both normalization methods and that is comprised in the range established for GAN patients with identified mutation (Figure 2A). Thus, Gigaxonin levels reach 25,7 ± 14,8% of the wild type Gigaxonin for patients F23; 16,9 ± 15,4% for patient F26; 21,3 ± 12,3% for patient F27 and no detectable Gigaxonin could be detected for patient F24 and F30 (Figure 2A, left panels). Gigaxonin levels were compared to the mean abundance of wild type Gigaxonins and mutated Gigaxonins in known GAN cases (Figure 2, left and right panels, respectively). This analysis showed that all patients have Gigaxonin levels that differ from wild type but not from mutated Gigaxonins (Figure 2B), suggesting that they are genetically linked to GAN. Testing relatives of patient F24 revealed that only the mother and sister S1 show a different abundance in comparison to control individuals, therefore suggesting that, as the mother, this sister may carry one mutated allele, whereas the other sister may not.
Surprisingly, patient F28 who shows a severe clinical presentation similar to GAN presents level of Gigaxonin that differ both from the range of normal Gigaxonin and mutated Gigaxonin (Figure 2B, left and right panels, respectively). As for the atypical patient F29, our quantification method revealed intermediate levels of Gigaxonin that could reflect an inter-individual variation of wild type Gigaxonin, as suggested earlier (Figure 1). This assumption was reinforced by the fact that the healthy mother of patient F28 expresses the same amount of Gigaxonin than her affected child: respectively 71,1 ± 16% versus 63,3 ± 17,5 using tubulin noralization and 109,7 ± 25,1% versus 91,5 ± 19,1 for GAPDH.
To determine whether the decreased abundance of Gigaxonin found in some patients can be corroborated by genetic alteration in the GAN gene, a systematic screening for point mutations and genomic rearrangement was performed in the GAN locus. This analysis revealed that all patients with reduced Gigaxonin level below the 37,6% maximum level established for known GAN cases (from Figure 1), carry a mutation in the GAN gene (Figure 2C). More specifically, Gigaxonin displays a premature stop codon in amino acid position 242 (R242X) on both alleles for patient F23; a large homozygous deletion encompassing exon 10 and 11 in patient F24, the exact deletion is from chr16: 81,402,224 to 81,411,392; a A49E missense mutation at homozygous state for patient F26, a compound heterozygous mutations A324V/C464Y for patient F27 and a homozygous G332R for patient F30 (Figure 2C-F). Conversely, when Gigaxonin levels were not compatible with our GAN known range (as for patient F28 and F29), neither point mutation nor chromosomal rearrangement could be revealed in the GAN locus. It is interesting to note that the CGH analysis revealed that Sister S1 of patient F24, suspected from her Gigaxonin level to be heterozygous carrier displays indeed this large deletion on one allele, whereas sister 2 with normal Gigaxonin level does not carry any deletion. Thus, our study provides evidences that abundance of Gigaxonin is not only univocally considerably diminished in all GAN patients reported so far, but that its quantification constitutes an essential tool to discriminate GAN from other hereditary polyneuropathies.
Activation of non sense mediated mRNA decay in GAN
To determine whether the decreased abundance of GAN-linked Gigaxonins results from defects in mRNA and/or protein processing, we quantified the levels of Gigaxonin mRNA in the lymphoblast cell lines of GAN patients and their relatives, as presented in Figures 1 and 2. This analysis revealed that most of the patients present Gigaxonin mRNA levels that are in the range of wild type Gigaxonin mRNAs (Figure 3). Indeed, the fold changes, expressed as the ratio of the levels of the mutated GAN mRNAs to the average of four control mRNAs after normalization with HPRT mRNA levels, were comprised within an interval of 2, that is considered as statistically similar. Nevertheless, four patients displayed mRNA levels that are statistically different form the wild type mRNA levels and all of them carry nonsense or deletion mutations in both copies of their mRNAs (Figure 3A). Thus, the two patients F16.1 and F16.2 displaying both a homozygous R477X mutation present a fold change of 0,27 ± 0,12 and 0,34 ± 0,11, respectively. Affected by another homozygous nonsense mutation (R242X), patient F23 also has mRNA levels below the 2 fold range (0,38 ± 0,12). The patient F18 carrying K338X/Δ6-8 mutations displays the lowest mRNA levels (0,04 ± 0,01). Noteworthy, when present in only on allele, nonsense (C393X for patient F11) or deletion (Δ3-11 for patient F25) mutation does not affect the overall stability of Gigaxonin mRNA. Interestingly, patient F24 who carries a homozygous deletion encompassing exons 10–11 exhibits normal Gigaxonin mRNA level (Figure 3B). Thus, we conclude that nonsense mediated mRNA decay is one of the disease mechanisms leading to decreased abundance of few GAN linked Gigaxonin but that another mechanism is implicated.
Structural homology modeling of GAN-linked mutations
To date there is no structure of a full-length BTB-BACK-KELCH protein, and accordingly we could not produce the full-length Gigaxonin protein. Nonetheless, structures exist for the BTB-BACK domain of Gigaxonin, for complexes between other BTB-BACK domains and the N-terminal domain of Cul3, and for KELCH domains either alone or, in the case of Keap1, in complex with ubiquitination substrates [17–20, 23]. These structures were used as the basis for homology modeling, to examine potential effects of GAN disease mutations.
The existing structures of the BTB-BACK domain of Gigaxonin and its docking to Cul3 allowed us to generate hypotheses as to the potential effects of mutations (Figure 4A, D). In structures of the BTB domain from Gigaxonin, amino acid S79 caps the N-terminus of a helix from the BTB domain, S52 and V82 form contacts internal to the BTB domain, whereas R15 and A49 map to the homodimerization interface. R138 is buried between the BACK domain helices that form the Cul3 binding site. Thus, mutation of any of these residues might perturb the folding of Gigaxonin, either through altering packing of the monomer or of the dimer. Mutation of R138 may also directly impact Cul3 binding. Whereas truncation of Gigaxonin at position R242 is expected to produce an intact BTB-BACK fragment, we showed that the decreased abundance of Gigaxonin is caused by activation of nonsense mediated RNA decay in patient F23 (Figures 3, 4A, D).
The modeling suggested that L309, A324, G332, and C464 are all buried between blades of the 6-bladed propeller KELCH domain (Figure 4B, D). This could explain how missense mutations in these positions would destabilize the structure of the KELCH domain. Furthermore, all nonsense or mutations of deletion in Gigaxonin are likely severely destabilizing the structure, by improper folding of the β-propeller that constitutes the KELCH domain (Figure 4C). Non-targeted by nonsense mediated mRNA decay, the destabilization of truncated Gigaxonin is particularly relevant for the mutation C393X, deletions exons3-11 and exon10-11. Whereas all mutations reported earlier are expected to destabilize Gigaxonin by interfering with its homodimerization, its interaction with Cul3 or by impairing the proper folding of either the BTB or the KELCH domain, the mechanism of instability of Gigaxonin mutated at residue E486 may differ. Although the modeling of loops is less accurate due to variations in this region in KELCH domain structures , this residue may be located near the upper face of the propeller, and thus could impact protein-protein interactions of the propeller. Notably, the corresponding surface of another BTB-KELCH protein, Keap1, interacts with ubiquitin ligase substrates through this surface. Thus, one could hypothesize that impairing substrate binding may lead to Gigaxonin instability or that the unstable Gigaxonin on the other allele may destabilize the heterodimer E486K/Δ3-11. The R269Q mutation lies outside all regions modeled and its effect is therefore challenging to predict.
As predicted by Gigaxonin modelization, GAN-linked mutations exhibit shorter protein half-lives
To find out if the predicted instability of mutant Gigaxonins could account for the decreased abundance of Gigaxonin in patients, we determined the half-lives of wild type and mutated Gigaxonin. Extremely challenging to assess in patient’s cells due to the very low abundance of Gigaxonin , we combined an overexpressing system in Cos cells and a short-term incubation with 35S-methionine/cysteine to radiolabel newly synthetized proteins and to follow their stability over time (Figure 5). To cover the different mechanisms of Gigaxonin instability predicted by the 3D modelization, we selected patient’s mutations affecting the homodimerization domain (R15S), the BTB folding and Cul3 binding (R138H), the folding of the KELCH domain due to single missense mutation (L309R) or massive truncation (R477X). This analysis revealed a great instability of all the mutants tested. Indeed, whereas the estimated half-live of the wild type Gigaxonin is ≈ 10 hours, mutants exhibit half-lives ranging from 1 to 3,1 hours, representing a 3,1-8,8 fold destabilization. Accordingly to the 3D model, Gigaxonin is formed by two distinct folding structures, the BTB and the KELCH domains that are linked together by the BACK domain. To determine whether each domain may affect the stability of the full-length protein or in the contrary whether one folding unit is sufficient to promote stability, we determined the half-lives of both the BTB-BACK and the BACK-KELCH domains, respectively N-ter (corresponding to the R242X mutations in F23) and C-ter (Figure 5). This analysis showed that both fragments of Gigaxonin are less stable than the full protein, with a 2 and a 4,2 hours half-lives for the KELCH and the BTB domain, respectively.
Thus, altogether, the measurement of the stability of its mutant forms provide evidence that GAN mutations confer instability of Gigaxonin in patients, and this notion is corroborated by the homology modeling of mutant locations.
We previously identified Gigaxonin as the defective protein in Giant Axonal Neuropathy . Developing the first molecular diagnostic test for GAN by systematic sequencing of the 11 exons of the GAN gene, we identified 23 distinct mutations all along the gene in 22 unrelated families of various geographic origins [1, 15, 24]. This diagnostic method, complementing the clinical examination of patients is being used worldwide by many groups and proved to be successful in identifying most of the mutations, i.e. point mutations or small insertions/deletions in the coding sequence as well as splice mutations near the exons-introns junctions. Nonetheless, this method revealed its limitations in identifying potential non-coding mutations (promotor, intron) or large deletions, as revealed by our inability to detect the heterozygous mutations in patients F6 and F12 and the need to use CGH array for large deletion (patient F25 ). Hence, we develop and validate in this study a new diagnostic method specific for GAN, based on the immunodetection of Gigaxonin, that we prove to be very valuable in discriminating GAN from clinically related neuropathies.
We showed in this study that regardless of the type, the position of the mutations or the severity of the disease, all mutated Gigaxonins (as carried by both parental alleles) display a drastic reduction in their abundance, reaching 85,8% in average of the normal level. The effect was so impressive that we further assessed whether the method may be useful for diagnostic purpose. Indeed, the first phase of the disease progression of typical severe forms of GAN, as well as some GAN atypical mild forms -with no involvement of the central nervous system [25, 26]- presents a clinical picture closely resembling other frequent peripheral neuropathies such as CMT2. In addition, giant axons filled with aggregated NFs, initially constituting an histopathological hallmark for GAN can also been found in CMT2E and CMT4C patients [4, 5]. Thus, we collected seven new patients with a clinical presentation and nerve biopsy suggestive of the severe or milder form of GAN. The high diagnostic value of our new test was validated as univocally, all patients displaying a dramatic reduced level of Gigaxonin were further confirmed by the identification of the corresponding genetic alterations in the GAN gene. Combining systematic sequencing to CGH analysis, we identified all GAN mutations in 5 unrelated patients, encompassing missense, nonsense mutations and a large deletion. Interestingly, our test was able to suspect heterozygosity in a carrier (sister S1 of patient F24) that was further confirmed by the identification of the large GAN deletion on one allele. Noteworthy, patients suspected to bear a mild (F29) but also a severe (F28) form of GAN were excluded by our new test and may be tested for candidate genes in autosomal recessive forms of CMT2 or exome sequencing. Altogether, our study reveals that the clinical evaluation of patients and the histological examination are indeed important but not sufficient to diagnose GAN and differentiate this entity from other frequent peripheral neuropathies. Thus, it is conceivable that the prevalence of GAN is under-evaluated, and that our test will be useful in identifying GAN among related CMTs. Currently being adapted on fresh blood samples, our methodology will enable the community to identify GAN pathogenic variants from targeted diagnosis or following high-speed sequencing analysis, and this in a cost-less and fast manner.
Overcoming the limitation of gene sequencing, the determination of Gigaxonin abundance has proven to be a very important diagnostic tool -specific, reliable and robust- in all GAN families tested so far. Nevertheless, one has to be cautious as some mutations may confer loss of function without necessarily conferring transcript and protein instability. Thus, we propose to determine Gigaxonin abundance prior but in concert with the systematic screening for GAN mutations/deletions in patients, to define in the future the confidence of our methodology as a sufficient diagnostic test for GAN.
We previously determined that Gigaxonin is a new BTB-KELCH protein, predominantly and equally expressed throughout the nervous system but at very low level [8, 10]. A key question in understanding how GAN-linked recessive mutations in Gigaxonin cause the disease is to determine how the normal protein is structured and regulated and how patient’s mutations alter its properties. In particular, establishing whether Gigaxonin’s functions are truly mediated by a Cul3-E3 ubiquitin ligase activity requires some knowledge on the stability and the 3D structure of the normal protein. We investigated here the stability of this BTB-KELCH protein, modelized its 3D structure and analyzed the effect of disease-associated mutations on Gigaxonin to identify both mRNA and protein instability as disease mechanisms in GAN. The fact that only patients carrying truncated GAN gene on both alleles display a down regulation of their mRNA would indicate a compensatory mechanism in patients carrying compound missense and truncated mutations: either a stabilization or a enhanced transcription of the truncated and missense mRNA, respectively.
The homology modeling of normal Gigaxonin allowed us to predict the structural effects of GAN mutations. Regardless of the stability of the mRNA levels, the majority (85%) of the Gigaxonin mutations are predicted to map to buried surfaces, which could alter the folding of the BTB or KELCH domains, the homodimerization of the protein, and/or the interaction with the Cul3 subunit of the E3 ligase. The other 15% mutations may impair substrate binding, which may indirectly still confer instability. Indeed, as suggested for other BTB-KELCH proteins, many cullin-E3 ligase adaptors are destabilized by (auto)-ubiquitination in the absence of substrates, possibly to avoid constitutive activation of the E3 ligase . Accordingly to this hypothesis, mutations interfering with substrate binding might activate Gigaxonin (auto) ubiquitination in patients, leading to its degradation. With the aim to confirm instability of mutant Gigaxonin as the key mechanism in GAN, we demonstrated that all mutations tested, as well as isolated BTB or KELCH structural domains, decreased the half-live of the protein by 2 to 9 fold.
We have not only developed a new powerful method to diagnose GAN, we have also provided the first evidence that disease-associated mutations confer instability of Gigaxonin in the human pathology. Reconstitution of the E3 ligase activity of the Gigaxonin-Cul3 complex, together with the identification of its partners are now essential to unravel the mechanisms controlled by Gigaxonin in sustaining neuron survival and cytoskeleton architecture. This will shed light onto the role(s) of the BTB-KELCH protein Gigaxonin in Giant Axonal Neuropathy and may contribute in the understanding on how mutations in the UPS contribute to neurodegeneration, as exemplified in Parkinson, Spinocerebellar Ataxia, Angelman syndrome and CMT diseases.
Bomont P, Cavalier L, Blondeau F, Ben Hamida C, Belal S, Tazir M, Demir E, Topaloglu H, Korinthenberg R, Tuysuz B, Landrieu P, Hentati F, Koenig M: The gene encoding gigaxonin, a new member of the cytoskeletal BTB/kelch repeat family, is mutated in giant axonal neuropathy. Nat Genet 2000, 26: 370–374. 10.1038/81701
Asbury AK, Gale MK, Cox SC, Baringer JR, Berg BO: Giant axonal neuropathy: a unique case with segmental neurofilamentous masses. Acta Neuropathol 1972, 20: 237–247. 10.1007/BF00686905
Berg BO, Rosenberg SH, Asbury AK: Giant axonal neuropathy. Pediatrics 1972, 49: 894–899.
Azzedine H, Ravise N, Verny C, Gabreels-Festen A, Lammens M, Grid D, Vallat JM, Durosier G, Senderek J, Nouioua S, Hamadouche T, Bouhouche A, Guilbot A, Stendel C, Ruberg M, Brice A, Birouk N, Dubourg O, Tazir M, LeGuern E: Spine deformities in Charcot-Marie-Tooth 4C caused by SH3TC2 gene mutations. Neurology 2006, 67: 602–606. 10.1212/01.wnl.0000230225.19797.93
Lus G, Nelis E, Jordanova A, Lofgren A, Cavallaro T, Ammendola A, Melone MA, Rizzuto N, Timmerman V, Cotrufo R, De Jonghe P: Charcot-Marie-Tooth disease with giant axons: a clinicopathological and genetic entity. Neurology 2003, 61: 988–990. 10.1212/WNL.61.7.988
Prineas JW, Ouvrier RA, Wright RG, Walsh JC, McLeod JG: Giant axonal neuropathy: a generalized disorder of cytoplasmic microfilament formation. J Neuropathol Exp Neurol 1976, 35: 458–470. 10.1097/00005072-197607000-00006
Bomont P, Koenig M: Intermediate filament aggregation in fibroblasts of giant axonal neuropathy patients is aggravated in non dividing cells and by microtubule destabilization. Hum Mol Genet 2003, 12: 813–822. 10.1093/hmg/ddg092
Cleveland DW, Yamanaka K, Bomont P: Gigaxonin controls vimentin organization through a tubulin chaperone-independent pathway. Hum Mol Genet 2009, 18: 1384–1394. 10.1093/hmg/ddp044
Dequen F, Bomont P, Gowing G, Cleveland DW, Julien JP: Modest loss of peripheral axons, muscle atrophy and formation of brain inclusions in mice with targeted deletion of gigaxonin exon 1. J Neurochem 2008, 107: 253–264. 10.1111/j.1471-4159.2008.05601.x
Ganay T, Boizot A, Burrer R, Chauvin JP, Bomont P: Sensory-motor deficits and neurofilament disorganization in gigaxonin-null mice. Mol Neurodegene 2011, 6: 25. 10.1186/1750-1326-6-25
Furukawa M, He YJ, Borchers C, Xiong Y: Targeting of protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat Cell Biol 2003, 5: 1001–1007. 10.1038/ncb1056
Pintard L, Willis JH, Willems A, Johnson JL, Srayko M, Kurz T, Glaser S, Mains PE, Tyers M, Bowerman B, Peter M: The BTB protein MEL-26 is a substrate-specific adaptor of the CUL-3 ubiquitin-ligase. Nature 2003, 425: 311–316. 10.1038/nature01959
Xu L, Wei Y, Reboul J, Vaglio P, Shin TH, Vidal M, Elledge SJ, Harper JW: BTB proteins are substrate-specific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3. Nature 2003, 425: 316–321. 10.1038/nature01985
Mahammad S, Murthy SN, Didonna A, Grin B, Israeli E, Perrot R, Bomont P, Julien JP, Kuczmarski E, Opal P, Goldman RD: Giant axonal neuropathy-associated gigaxonin mutations impair intermediate filament protein degradation. J Clin Invest 2013, 123: 1964–1975. 10.1172/JCI66387
Bomont P, Ioos C, Yalcinkaya C, Korinthenberg R, Vallat JM, Assami S, Munnich A, Chabrol B, Kurlemann G, Tazir M, Koenig M: Identification of seven novel mutations in the GAN gene. Hum Mutat 2003, 21: 446.
Buysse K, Vergult S, Mussche S, Ceuterick-de Groote C, Speleman F, Menten B, Lissens W, Van Coster R: Giant axonal neuropathy caused by compound heterozygosity for a maternally inherited microdeletion and a paternal mutation within the GAN gene. Am J Med Genet A 2010, 152A: 2802–2804. 10.1002/ajmg.a.33508
Zhuang M, Calabrese MF, Liu J, Waddell MB, Nourse A, Hammel M, Miller DJ, Walden H, Duda DM, Seyedin SN, Hoggard T, Harper JW, White KP, Schulman BA: Structures of SPOP-substrate complexes: insights into molecular architectures of BTB-Cul3 ubiquitin ligases. Mol Cell 2009, 36: 39–50. 10.1016/j.molcel.2009.09.022
Canning P, Cooper CD, Krojer T, Murray JW, Pike AC, Chaikuad A, Keates T, Thangaratnarajah C, Hojzan V, Marsden BD, Gileadi O, Knapp S, von Delft F, Bullock AN: Structural basis for Cul3 assembly with the BTB-Kelch family of E3 ubiquitin ligases. J Biol Chem 2013, 288: 7803–7814. 10.1074/jbc.M112.437996
Errington WJ, Khan MQ, Bueler SA, Rubinstein JL, Chakrabartty A, Prive GG: Adaptor protein self-assembly drives the control of a cullin-RING ubiquitin ligase. Structure 2012, 20: 1141–1153. 10.1016/j.str.2012.04.009
Lo SC, Li X, Henzl MT, Beamer LJ, Hannink M: Structure of the Keap1:Nrf2 interface provides mechanistic insight into Nrf2 signaling. EMBO J 2006, 25: 3605–3617. 10.1038/sj.emboj.7601243
Padmanabhan B, Tong KI, Ohta T, Nakamura Y, Scharlock M, Ohtsuji M, Kang MI, Kobayashi A, Yokoyama S, Yamamoto M: Structural basis for defects of Keap1 activity provoked by its point mutations in lung cancer. Mol Cell 2006, 21: 689–700. 10.1016/j.molcel.2006.01.013
Roth LA, Johnson-Kerner BL, Marra JD, Lamarca NH, Sproule DM: The absence of curly hair is associated with a milder phenotype in Giant Axonal Neuropathy. Neuromuscul Disord 2014, 24: 48–55. 10.1016/j.nmd.2013.06.007
Tong KI, Padmanabhan B, Kobayashi A, Shang C, Hirotsu Y, Yokoyama S, Yamamoto M: Different electrostatic potentials define ETGE and DLG motifs as hinge and latch in oxidative stress response. Mol Cell Biol 2007, 27: 7511–7521. 10.1128/MCB.00753-07
Demir E, Bomont P, Erdem S, Cavalier L, Demirci M, Kose G, Muftuoglu S, Cakar AN, Tan E, Aysun S, Topcu M, Guicheney P, Koenig M, Topaloglu H: Giant axonal neuropathy: clinical and genetic study in six cases. J Neurol Neurosurg Psychiatry 2005, 76: 825–832. 10.1136/jnnp.2003.035162
Ben Hamida M, Hentati F, Ben Hamida C: Giant axonal neuropathy with inherited multisystem degeneration in a Tunisian kindred. Neurology 1990, 40: 245–250. 10.1212/WNL.40.2.245
Zemmouri R, Azzedine H, Assami S, Kitouni N, Vallat JM, Maisonobe T, Hamadouche T, Kessaci M, Mansouri B, Le Guern E, Grid D, Tazir M: Charcot-Marie-Tooth 2-like presentation of an Algerian family with giant axonal neuropathy. Neuromuscul Disord 2000, 10: 592–598. 10.1016/S0960-8966(00)00141-3
Petroski MD, Deshaies RJ: Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol 2005, 6: 9–20. 10.1038/nrm1547
We are grateful to the families and la banque d’ADN et de Cellules de Généthon (Evry, France) for their participation in this study. We thank A. Pelegrin, JP. Pouget and S. Tarton for hosting us at IRCM (Montpellier) to perform the pulse chase experiments, and members of the team for stimulating discussion. This work is funded by l’Institut National de la Santé et de la Recherche Médicale (INSERM, PB), subsequently Hannah’s Hope Fund and la Fondation pour la Recherche Médicale (FRM) to AB and l’Association Française contre les Myopathies (AFM) to YTA. HH receives funding from AFM, the MRC UK and the NIHR UCLH/UCL Biomedical Research Centre. PB is supported by grants from the Atip-Avenir program (INSERM-CNRS), the Région Languedoc-Roussillon and the AFM.
The authors declare that they have no conflict of interest.
AB performed the majority of the experiments, analyzed the data and contributed to writing of the manuscript. YTA realized and analyzed some experiments, and helped correcting the manuscript. BR performed a systematic sequencing analysis of the GAN gene in patients and identified all punctual mutations. BAS generated the structural model for Gigaxonin, provided prediction of Gigaxonin’s mutations and contributed to the writing of the manuscript. DM and HH developed and applied the CHG methodology for GAN patients. TS identified patients exhibiting inherited peripheral neuropathy, provided clinical data and contributed to the writing of the manuscript. NK, CH and BC identified patients and provided clinical data. PB designed the study, analyzed the data and wrote the manuscript. All authors corrected the manuscript. All authors read and approved the final manuscript.
About this article
Cite this article
Boizot, A., Talmat-Amar, Y., Morrogh, D. et al. The instability of the BTB-KELCH protein Gigaxonin causes Giant Axonal Neuropathy and constitutes a new penetrant and specific diagnostic test. acta neuropathol commun 2, 47 (2014). https://doi.org/10.1186/2051-5960-2-47
- E3 ligase | <urn:uuid:0b803cf7-e468-466d-934b-4a146723a495> | CC-MAIN-2022-33 | https://actaneurocomms.biomedcentral.com/articles/10.1186/2051-5960-2-47 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.879695 | 11,345 | 1.804688 | 2 |
Can Astrology Explain Me How do I Decide My Career Choice? Should I Follow My Mind or My Heart?
The success of our career determines the quality of our lives. While some people desire to work in the fortune 500 organizations, there are others who wish to become successful entrepreneurs in their preferred divisions.
Though you will witness different options throughout your career path, selecting the best one can be intricate and tough. But the good thing is that just like other divisions in life; astrology can be of great support to help you select the best career option for yourself.
You can avail career prediction from expert astrologers in order to select the best career for yourself, which is lucrative and promising.
According to the astrological experts and timing of the planets, there are numerous factors that influence the career direction of a person, like a zodiac sign of a person, House of Bhav’s position, and planetary positions. The career type, source of income, and the opportunities that occur in a person’s career life are based on these three factors.
Career Influences through Zodiac Signs
The zodiac signs can be divided into four forms.
The zodiac signs under this category are Aries, Sagittarius, and Leo ruling the 9th, 5th, and 1st house of the astrological chart. Individuals under this category are enthusiast, optimist, extrovert, and fun-loving. Also, such individuals are warm, idealistic, generous, and innovative.
People falling under this category are good for work related to cooking, restaurant, café, petroleum, engineering, and creativity, such as photography and movie making.
It includes Capricorn, Virgo, and Taurus and rules the 6th, 10th, and 2nd house of the astrological chart. According to the career astrology of this sign, a person is highly practical.
The best career options for this category are fashion designing, travel, politics, writer, telecommunication, research, interior decorator, and bookkeeping.
Scorpio, Cancer, and Pisces rule the 12th, 8th, and 4th house. Such people are energetic, fun-filled, and lively.
The best career option for such people is education, advertising, entertainment, transportation, public relations, beverages, laundry, fishing, and more.
Aquarius, Gemini, and Libra are the zodiac signs for this category and rule the 11th, 7th, and 3rd house of the astrological chart. Most of the individuals within this category are unstable and indefinable. They possess abstract from the tangible things and are intelligent, focused, and highly sociable.
The best career options for such people are a writer, politics, research, fashion designing, theoretical, sales, and research.
Houses in Job Astrology
There are total 12 houses in our astrological chart that influence our lives from various directions. The money and career-related issues are influenced mainly by the 2nd, 5th, 6th, 8th, 10th, 7th, and 11th houses.
The 5th house gives a clear idea of the gains through investments and opportunities.
The 6th house gives a clear image about your potential to earn money from others.
The 8th house shows possible works and obstacles in an individual life.
The 2nd house defines clearly the stream of money and income potential and even confirms the financial management that is ideal for you.
The 7th house illustrates the best options for performing business with others and even your potential to convince and work with people to create a business.
The 10th house defines the career potential of a person and gives a clear picture of which career option will be successful for a person.
The 11th house defines the profit levels and even the potentials. It also illustrates that how a person can use the accumulated money to gain more profits.
Planetary Movements Influencing Career Prediction
The three main planets influencing the career path of a person are Mercury, Jupiter, and Saturn.
The Saturn influences the ability and ethics of an individual to perform the quality service. Also, it highlights the obstacles that might be holding your career back.
The second planet influencing the career path of a person is Jupiter. This planet gives an indication of your wealth potential. It is Jupiter that influences the ability of a person to receive gains and benefit from the advice. It is possible that Jupiter may lead to troubles in an individual’s life if it is not located properly.
The third planet is Mercury and reveals the natural potentials for commercial success. It influences your talents of selling or buying your products or services in the marketplace, your communication skills, and your managing and marketing skills. Mercury also influences the new opportunities in the career and can even bring new prospects to you.
There are various factors in astrology that influence the job prediction for an individual. But the best thing is that astrology has solutions for each and every problem related to your career. So, if you are facing any sort of career related problem, then don’t panic and consult the expert astrologers who will be glad to serve you. | <urn:uuid:06da59aa-4da7-4602-bb5a-b6dba550272e> | CC-MAIN-2022-33 | https://akashvaani.com/blog/can-astrology-explain-me-how-do-i-decide-my-career | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.950378 | 1,091 | 1.507813 | 2 |
The five fingers of our feathered friends: New research results on the evolution of bird wings
In most tetrapods (land vertebrates) the fourth (ring) finger is the first to develop in the embryo. And in birds, the finger on the outside of the hand (posterior, the pinky side) appears first, which suggests that this is the ring finger. However, it can be shown that on the thumb side (anterior) an embryonic finger begins to develop, but quickly disappears—this would have to be digit I. These data argue for an identification of the fully-formed fingers as the index, middle, and ring fingers (II, III, IV).
However, the three fingers of the earliest known bird—Archaeopteryx—resemble those of the dinosaur Deinonychus, with whom Archaeopteryx was probably closely related (as was the famous Velociraptor). Successive fossils show the reduction of two fingers on the posterior side of the hand in the ancestor of Deinonychus, and thus support the thumb, index, and middle finger identification (I, II, III) of the bird fingers. Also, the genes active in first bird finger correspond with those of the developing thumb in other animals, and not those of the index finger.
To resolve this contradiction, three approaches had predominated: 1) Birds do not come from dinosaurs after all; 2) the dinosaur ancestors of birds had also the three middle fingers (II, III, IV); or 3) the three anterior fingers (I, II, III) of the birds were somehow moved to the middle three embryonic positions. In fact, none of these theories can explain all the existing data.
For the birds: Thumb, index, and middle fingers are actually index, middle, and ring fingers. "The appearance—the so-called phenotype—of the fingers is determined during embryonic development by the signalling protein Sonic Hedgehog, which emantes from the posterior side of the developing limb before any fingers appear. This simply means that the concentration of this protein on the little-finger side is highest and decreases toward the future thumb. Therefore each finger precursor (the cells that will develop into the finger) adjusts its gene expression—and in consequence, its phenotype—according to the Sonic Hedgehog concentration in its immediate environment. We have devised a hypothesis based on molecular and biomechanical mechanisms that is able to explain all the available data," said lead author Daniel Capek, who conducted research in the group of Dr. Brian Metscher and Prof. Gerd Müller in the Department for Theoretical Biology at the University of Vienna for this project and is currently a Ph.D. student at IST Austria.
According to this hypothesis, a posterior reduction in dinosaur evolution actually proceeded with the little finger being reduced and then lost, and the ring finger was partially reduced. However, it is generally much easier to reduce the outer fingers than the more central ones, as they appear later in development. Thus the first finger is reduced ("thumbs down") instead of the fourth finger, leaving an anterior area open for the early precursors of the other fingers to grow into. This would lead those developing fingers to encounter an anterior-like Sonic Hedgehog concentration and then to develop accordingly—more like I, II, and III.
"This mechanism explains why the fingers of Archaeopteryx and modern birds have the shapes of the anterior fingers (I, II, III), even though they are actually the central fingers (II, III, IV). At the same time, this hypothesis is consistent with the fossil findings and matches the current developmental genetics results," says Brian Metscher of the Department of Theoretical Biology at the University of Vienna. | <urn:uuid:479d0f6c-be98-4e46-8f9f-2f6ddb72fa65> | CC-MAIN-2022-33 | https://phys.org/news/2014-01-fingers-feathered-friends-results-evolution.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.936839 | 769 | 3.984375 | 4 |
The Flight quilt pattern is a beginner friendly foundation paper piecing pattern with a minimalist modern design that mimics curves. The pattern includes charts and clearly illustrated step-by-step instructions for making crib - king size quilts. The pattern also includes charts and directions for crib - king size two color quilts and an alternate baby quilt. There are so many ways to make this quilt reflect your unique style!
Pattern Sizes: Crib, Throw, Twin, Queen, King
Pattern level: Beginner
Sewing Techniques required: Foundation paper piecing
The PDF pattern links to video tutorials to guide new quilters through foundation paper piecing the quilt blocks.
+ Cutting chart
+ Clear step-by-step instructions and illustrations
+ Foundation paper piecing tips
+ Coloring page + Full size templates
+ 2 Alternate Versions with charts and directions
Share your makes! Use #flightquilt on Instagram to show off your quilt! The hashtag is also a great place to find inspiration and ideas for quilting. | <urn:uuid:f96490a2-e384-47af-ad20-8cf1328c98fc> | CC-MAIN-2022-33 | https://shop.quiltpatternmart.com/products/flight | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.862956 | 221 | 1.671875 | 2 |
CENTRAL-EUROPEAN JEWISH REFUGEES WHO DIED IN SHANGHAI, 1940-1945 (ID: 20780)
Electronic data regarding Central European Jewish refugees who died in Shanghai in the years 1940 to 1945. The index includes name, last place of residence before Shanghai, date of birth, and date of death.
- Death list
- Research project
Primary Source Creator:
Communal Association of Central European Jews
Council on the Jewish Experience in Shanghai
Between 4 Jan 1940 - 1 Feb 1946
Male and Female
Number of Persons (Exact):
Place of Death:
Indexing project assisted by Michael Haley Goldman and Peter Lande
Electronic indices of Holocaust survivors and victims, from various sources. | <urn:uuid:5b1844bc-462d-4ff1-a3f7-31a2acc49376> | CC-MAIN-2022-33 | https://www.ushmm.org/online/hsv/source_view.php?SourceId=20780 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.745525 | 206 | 2.03125 | 2 |
One thing I am starting to realize with 9rules is the value of social features on a site and how in the future more and more sites will want to adopt the features of social networks. Now I don’t think every site will want to create a full-fledged social network, but certain aspects of social networks are simply to appealing and useful to users to ignore.
Now don’t take any of these features as being new or thought up by social networks. They have been around long before web 2.0, but social networks helped make them famous. If your site involves an audience and discussion in any shape or form, what makes you think that the readers don’t want to know a little about each other or possibly interact without you being involved? So often people talk about forming a community around a site yet they don’t provide the tools to allow a community to grow.
A small minority are skilled enough to help a community grow through a site by actively participating in the discussions and making everyone feel as though they are part of a community. However, what about those large sites where you know nothing but the name online handle of a person? Maybe that’s how many people want to keep it because maintaining a profile on a social site/network can be a tedious task since we have so many. However, not providing the tools to help foster a community because we already have too much isn’t the way to look at things.
All of this starts to bring up the need for a decentralized social network where your central profile actually becomes useful and not just another place to tell friends to go. The web itself is a community and therefore any community you create should not be an isolated one, but a sub-community of the larger one. Of course many people already are thinking along these lines like USA Today, but you see what happens when social features get put in the hands of bad designers.
In the future your site will be more than just an entry and some comments. It will be your community where people socialize. It will truly become your house in the large web community where people stop by for tea (do people do that?) and then move onto the next house. | <urn:uuid:54dc8850-60e6-4d8b-ab0c-106a0d498a3e> | CC-MAIN-2022-33 | https://www.wisdump.com/in-the-future-everyone-is-a-social-network/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571222.74/warc/CC-MAIN-20220810222056-20220811012056-00672.warc.gz | en | 0.966508 | 449 | 1.9375 | 2 |
Cities are articulated through squares and urban spaces generated for citizens. Each of them are characterized by something peculiar, something that makes us remember … something that makes us want to come back to them.
Build up cities means to build from the public space, avoiding breaking and establishing continuity with the existing urban tissue.
We propose to rediscover the city of Germering through its streets. An analysis of the current situation let us to conclude that in this central area there are three unconnected spaces.
We therefore propose to build two new public spaces, crystallized in a system of squares capable of generating looping spaces as occurs in the historic centers of European cities. With the addition of these two new squares we clarify the reading of the city center. We can walk from one place to another, discovering the different urban spaces and their qualities.
The train tracks are an important showcase for Germering. Thousands of people cross dairy through the city. Therefore it turns essential to build a welcoming public space able to capture the attention of potential future residents. However, the tracks are infrastructures that generate significant barriers. Therefore is necessary to build another space able to establish a strong connection between the north and south of Germering.
Continuous public space
We propose a continuous public space free of architectonic barriers, a place where pedestrians have priority and where vehicles circulate at low speed.
The area is paved with granite pavers to create a homogeneous public space in which three squares stand out as a carpet over the cobblestones. Each square is conceived as a device and as an urban connection stop gap.
The square of the theatre creates a direct connection between the main north-south and theater itself. On the other hand, the space station generates a direct connection to the platforms, while the stepped square connects the northern part of the city with the south. The connections are constructed by topographies that generate seats and stay spaces. | <urn:uuid:518c4150-2082-4d51-984f-f0c10f78d584> | CC-MAIN-2022-33 | https://bakpakarchitects.com/en/portfolio/masterplan-in-germering-germany/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.9458 | 395 | 2.6875 | 3 |
Stratasys Materials: When to use Polycarbonate, PC-ABS, and Nylon
When you purchase a Stratasys FDM (Fused Deposition Modeling) 3D printer, your material options may seem endless, but it’s important to make sure you’re using the best Stratasys materials for your FDM applications. In my previous blog, I discussed understanding ABS, ASA, and PLA Stratasys FDM materials. Today, we’re going to focus on Polycarbonate, PC-ABS, and Nylon materials, available to Fortus customers as the Engineering Bundle. Let’s take a look.
Stratasys Polycarbonate Materials
Polycarbonate materials are so named for their structure of repeating carbonate monomers. Better known by the SABIC trademark Lexan®, Polycarbonate (PC) is extremely popular in industry due to its high strength, impact resistance, and ease of working. Like other Amorphous polymers, PC Stratasys material 3D prints quite well, as long as shrink is well controlled (as it is in Stratasys FDM 3D printers). For this reason, it is not commonly printed by open-frame consumer printers.
Polycarbonate (PC) is available in white on all Fortus Production systems (from Fortus 380 to F900) and prints with either breakaway PC Support (with standard T16 tips) or soluble SR-100 (with T12-SR100 tips), in layers 0.007-0.013in thick. From an operational standpoint, PC is easy to use, using the same foundation/build sheets as ABS and ASA. PC flows quite well, which lends itself well to solid prints or high-density sparse infills. Seams (e.g., start/stop points) tend to under-extrude in some situations, so it is worthwhile to process parts in Insight with multiple contours or consider building with a purge tower to prime the nozzle immediately prior to each layer. Also, it should be noted that PC is prone to thermal shock, so it’s best to avoid placing hot parts into a cold cleaning tank, or visa versa, to avoid cracking.
At 280°F (loaded to 66psi), PC has the highest Heat Deflection Temperature of any Stratasys thermoplastic short of the “High Performance” materials. It’s also exceptionally strong in compression, with solid parts loading without deformation up to five tons per cubic inch. This, along with great wear characteristics, makes it the go-to choice for hydroforming and stamping tools; and a great value (less than 15% higher price than ABS-M30 or ASA) as compared to traditional steel tooling. In addition to tooling, workholding/fixturing and part alignment are excellent high wear applications for Polycarbonate. It’s also an excellent electrostatic insulator. If printed parts are to be used in contact with food, a biocompatible ISO 10993 USP Class VI -certified Polycarbonate is available as PC-ISO.
Stratasys PC-ABS Material
PC-ABS is an alloy of Polycarbonate and ABS and represents a happy medium between the two. It’s 30% stronger than ABS, with a 13% higher heat tolerance, while more ductile and resilient than PC. Black PC-ABS is available on all Production FDM machines, using standard tips (T10-T20) and foundation sheets. And because PC-ABS is available on the Stratasys F370 (in black and white), it affords an upgrade in performance at a low equipment price point. While it can be considered a step-up from ABS in all applications, PC-ABS is especially well-suited to non-marring fixtures and nests, and the higher heat capacity can make it a good choice for some weld fixture applications. And, since PC-ABS can be solvent-smoothed/sealed, it’s a good choice for watertight parts, or prototyping applications requiring parts to be somewhat flexible.
Stratasys Nylon Material
Once a Du Pont trademark, the name Nylon is now synonymous with the class of polymers known as Polyamides. Whereas most Stratasys FDM materials are categorized as “amorphous” polymers, nylons are “semi-crystalline” since their molecular structure is able to form ordered crystalline structures. These crystalline structures are what allow nylon materials to remain exceptionally strong when drawn into extremely thin fibers; hence their popularity in the textile industry. In 3D printing, nylons mostly behave as amorphous polymers, but printed parts can be annealed to form crystalline structures, dramatically improving their strength, heat resistance, and isotropy.
Nylon12 is available in black on all Stratasys Production FDM machines. It prints with standard tips in 0.007-0.013in layers on special build sheets, with soluble SR-110 support material (T12-SR100 tip). Nylons are especially hygroscopic (they absorb moisture from the air) and must be kept dry to print well (same with the build sheets). Be sure to keep the canister sealed while in the machine by keeping the canister door closed (with the center seal removed), and keep the canister fully sealed when not in use. After printing, all Nylon parts should be soaked for at least 4hrs to rehydrate the part in order to ensure maximum part strength. Although Nylon parts generally print quite well, a sacrificial tower can help ensure good surface quality (especially when parts are relatively far from the purge position. Be sure to refer to Stratasys best practices to get the most out of Nylon12.
Nylon is tough! It’s more ductile and fatigue-resistant than PC-ABS, with better chemical resistance. For functional prototypes with living hinges and snap-fit features, Nylon12 is the best choice. But it also excels in low-heat, low-load fixturing applications where a non-marring surface is required.
Also available for the Fortus 900MC (and F900) is black Nylon6 for 0.010 and 0.013in layer heights. Like Nylon12, Nylon6 is exceptionally ductile, but has ~50% higher strength and heat resistance than Nylon12, with almost twice the stiffness. So, while it may be considered an upgrade from Nylon12 in many applications, it’s also better-suited to tooling applications. Jigs and ergos that need to be stiff but still survive rough handling and drops are great for Nylon6, as are high-load nests/cradles and applications in high ambient heat.
To summarize, engineering thermoplastics are ideal when strength, rigidity, and durability requirements rule out standard ABS, ASA, and PLA plastics, and are well-suited to functional prototypes and end-use parts. But for applications with very special requirements, it’s time to enter the realm of High-Performance Stratasys materials; that’ll be the subject of my next article.
About the Author
Dan Erickson is a student of life. With a BS in Mechanical Engineering Technology from Michigan Tech University and a penchant for tinkering, he is driven to understand how the world works and improve wherever possible. After several career iterations, Dan came to Fisher Unitech in 2011 as a SOLIDWORKS Support Engineer. He has since followed his passion for transformative technology to the 3D Printing department, supporting the Sales and Marketing teams as 3DP Application Engineer. | <urn:uuid:ee13a6b1-4e9a-40bc-bf23-e81cd69011aa> | CC-MAIN-2022-33 | https://www.cati.com/blog/stratasys-materials-use-polycarbonate-pc-abs-nylon12/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.915659 | 1,614 | 1.984375 | 2 |
Have you noticed how loud your breathing is when you’re swimming under water? It’s a muffled and eerie sound, but there is pleasure in the evenly timed movement of air through your lungs.
If you cover your ears, the same echoed inhalation and exhalation blows a gale inside your ear drums. Yet in our day to day lives, we often forget to be aware or pay attention to breath or to even hear the sound of our own breathing.
Deep Breathing: Resuscitation for the Reef, an installation by artist Janet Laurence, reminds us of the gift of life and to be more aware of how we live and function on the planet. As artist-in-residence of the Australian Museum, Laurence spent time on Lizard Island at the Museum’s reef station. She also had access to the Museum’s enormous collection of fish and other sea life specimens.
The work she created, which will be in the foyer of the Museum until early 2017, is a tall layering of open Perspex pigeon holes. A high wall of over six feet sits at the rear, with a smaller wall of transparent plastic in the front. They hide a deep channel in between where large specimen jars are heaped on the mirrored floor with incredible fish life from the Australian Museum collection.
Within the various scientific bottles, glass jars and laboratory flasks are myriad reef items – shells, sea sponges, fish. Other objects are wrapped in white fabric or connected with each other via medical tubing. The whole aggregated work is placed upon a mirror surface so that multiple reflections and spectral light are cast in every direction, including the massive whale skeleton suspended from the museum ceiling.
The effect of this mirroring is to reflect, both literally and philosophically. Every surface reflects another surface close by, which recalls for the viewer the endless sparkle and shimmer of the ocean.
The mirroring also fuels our reflections on how these water species are at risk, as well as the coral itself. The Great Barrier Reef is bleaching so quickly, it’s hard to see without wanting to shield your eyes. Its acceleration into extinction is irrefutable and so the multiplicity and diversity that we see in Laurence’s mirrors and reflections are a sleight of hand, a misleading trick.
Of course this is exactly the point that Laurence is making. She has been an advocate for animals, plants and at-risk ecologies for many years and her work has consistently drawn our attention to uncomfortable truths.
Laurence has had a long art career spanning thirty years, yet the science world is familiar with her work too. She has undertaken many collaborations with plant biologists, environmentalists, landscape designers and bush regeneration experts in Australia, the UK and Germany.
Her knowledge of the natural world has been developed after doing research, gathering film and photography footage in various locations such as Singapore, China, Japan and Germany. Laurence has an established role as an environmental advocate and member of various animal rights organisations and her artworks are a cry for better care and for a quicker response time.Supplied
She originally launched into the art world as a painter of landscapes but her alchemical curiosity soon led her to mix her media and build art installations out in the landscape. Since those early years, she is better known for bringing the landscape (or deep seascape) into the gallery space.
Her installations often include clutches of moss, various plant specimens sewn into white gauze, skulls and taxidermy, entire dead trees, live plants growing in test tubes, natural paint smeared on glass, mounds of biotic ash or samples of dirt from a compromised ecology.
In previous works, trees have been hooked up to intravenous bags, branches shrouded in bandage gauze, strange skulls of small species dipped in gold and collected reef fish in formaldehyde.
In Deep Breathing, medical tubing is threaded between the scientific jars and measuring flasks. This creates fluidity between the specimens (nature) and the scientific materials (culture). By attaching one sea sponge to some bleached coral to an endangered reef fish, Laurence also creates links between the various elements of any given ecology.
The installation reminds us of the fragility of the natural world and the equal fragility of the human condition. Why can’t we face these climate change issues and work together to apprehend disaster?
Can we really be so politically and economically bound by narcissistic tendencies that we can’t even slow the acceleration towards ecological crises? Laurence gives us pause to reflect but, be warned, you might not like what you see.
Deep Breathing: Resuscitation for the Reef will be at the Australian Museum until March 2017
Authors: Prudence Gibson, Art writer and Tutor, UNSW Australia | <urn:uuid:63901d83-555f-46e5-92a6-7fed2262b4b0> | CC-MAIN-2022-33 | https://dailybulletin.com.au/the-conversation/22265-here-s-looking-at-deep-breathing-resuscitation-for-the-reef-by-janet-laurence | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.946924 | 985 | 2.640625 | 3 |
Motorsports is a relatively young sport that gained popularity in the 20th century. The 10 most famous races are spread across the world and held regularly.
Notable races are the Formula One – which is currently probably the most popular motorsport – as well as the Monaco Grand Prix, Indianapolis 500 and 24 Hours of Le Mans. Motorsports are an increasingly popular sport with a large fan base.
There’s a race for almost everyone to enjoy, ranging from circuit racing to endurance off-road rallies. This article lists 10 famous car races you should know about.
The Indianapolis 500 is an annual race held in the United States where drivers race around a 2.5 mile circuit for a total of 500 miles. Their speeds reach up to 230 miles per hour and it is known as a risky track to face.
The track has been nicknamed the brick yard as it was originally paved with bricks in 1909 and a yard of the original brick is exposed at the start of the track. It is considered to be one of the top three races in the world, forming part of the Triple Crown.
It is a race that values its traditional roots and hosts pre and post ceremonies celebrations that are highly respected.
24 Hours of Le Mans
The 24 Hours of Le Mans is an incredible test of endurance where racers go for a straight 24 hours around a 2.5 mile circuit. It is won by the car that covers the greatest distance over the 24 hours.
The race is held on Circuit de la Sarthe that is made up of closed public roads and racing tracks. It is named after the city where it is held – Le Mans in France.
The largest distance covered was 5,410 km in 2010. Drivers normally drive for two hours before a relief driver can take over while they rest and eat.
The Daytona 500 is the first NASCAR race of the year. It is the first of two cup races that are held yearly. The total distance drivers will travel is 500 miles over 3.5 hours on average. The course is 2.5 miles long and drivers do a total of 400 laps around the course.
It has only been shortened four times due to rain and once due to an energy crisis. Daytona 500 is held at the Daytona International Speedway.
The Dakar Rally is not for the faint of heart. It is an exhilarating race held in deserts all over the world, however it has been exclusively held in Saudi Arabia since 2020. The race costs $75,000 to enter and has cost the lives of 28 of its participants since its inception in 1978.
It is an off-road endurance race that is open to anyone with the guts to enter. You only need to be 18 years old and have the funds to enter. There are a total of 5 classes of vehicles that take place in the event – quads, motorcycles, cars, trucks, and UTVs.
The distances of each stage differ from short distances up to 900 km (560 miles) per day.
The race was born after Thierry Sabine got lost in Ténéré Desest during the 1975 Abidjan-Nice Rally. Sabine decided that the desert would be a good place for a rally to take place.
In 1978, 182 participants set off at the start of the first race in Paris and only 74 completed the trip to Dakar, Senegal. It is a rally that attracts the bravest souls who crave adrenaline.
Monaco Grand Prix
The Monaco Grand Prix is arguably one of the popular events around the world. It is held annually at the Circuit de Monaco.
The track is one of the more dangerous tracks to race on due to its narrow turns. It is the only Grand Prix that does not stick to the 305 km/190-mile minimum race requirements for Formula One.
Pikes Peak Hill Climb
This annual car race is held on Pike Peak in Colorado. It climbs up to 4,720 ft/1,440 m starting at mile 7 of the Pikes Peak Highway. The drivers finish at 14,115 ft/4302.25 m above sea level at the end of the race.
Previously the track featured both paved and bare terrain. However, in August 2011 the entire track was completely paved. In total, the distance of the track covers 12.42 miles/19.98 km.
This supercar championship spans over 1000 km/621.37 miles and is annually held at Mount Panorama Circuit in Bathurst, Australia. It is viewed as one of the most popular motorsports events in Australia.
The race is affectionately known as The Great Race amongst its local fans. The trophy awarded to the winner of the race is named after Peter Brock, to honor the driver’s life and his achievements.
The track makes use of temporarily closed roads and the first corner is known as Hell Corner as it features a 90-degree turn. The elevation between the lowest and highest points reaches 174 m /571 ft difference in total.
In the heart of Finland at the Finnish Lakeland, the Rally Finland takes place every year from June to August. It is the largest public event in the Nordic region.
It was originally an endurance race that has been split into different categories. The course is made up of wide gravel roads with jumps among the track. It is vital that signage is correctly placed to ensure drivers safely navigate the course.
Monte Carlo Rally
Originally starting at a number of points across Europe and ending in Monaco, the Monte Carlo Rally takes place across the French Riviera in Monaco and into Southeast France.
The rally began under Prince Albert I in order to promote Monaco as well as celebrate and showcase the improvements and advances that car manufacturers have made. The rally occurs annually and is a part of the European Rally Championship.
The Formula One is a series of races annually held that form the Grand Prix. It is arguably one of the most popular sports worldwide, with the current top competitors to watch being Lewis Hamilton, Max Verstappen, and Lando Norris.
Each track is featured across Europe and varies in distance and difficulty. Drivers partake in these high-speed races to determine who has the best ability and the most efficient car.
Notable teams are Red Bull, Mercedes, and Ferrari.
Car racing is one of the most popular sports worldwide. It is an exhilarating sport that takes on a number of formats across the world.
Rally races are endurance races that take skill, stamina, and a strong mindset to complete while Grand Prix races take incredible skill and endurance to finish on top. There is a form of motorsports for every person to enjoy. | <urn:uuid:8e48ff7f-5f24-4ae4-a7c9-7cc84ec210ae> | CC-MAIN-2022-33 | https://lemonbin.com/famous-car-races/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.963699 | 1,381 | 2.125 | 2 |
The Teacher-Student-Parent Safety Committee (TSPSC) in Sri Lanka held an important online meeting on July 30. Entitled “How to win the teachers’ wage struggle,” the meeting was attended by about 100 people with several dozen watching via Facebook.
Teachers from across Sri Lanka, including Colombo, Kalutara, Kandy, Chilaw, Dankotuwa, Nawalapitiya, Polonnaruwa, Bandarawela, Kurunegala and Kuliyapitiya, participated, along with students from several other areas. So far more than 500 have watched the event.
Around 250,000 Sri Lanka teachers and principals are involved in an ongoing “online learning” strike to win higher pay and other demands. The industrial action has now entered its fourth week.
On July 26, a meeting of cabinet ministers overseen by Sri Lankan President Gotabhaya Rajapakse rejected the teachers’ pay demands. The following day Prime Minister Mahinda Rajapakse told the teacher unions’ leaders that the wage claims could not be granted because of the country’s “difficult economic situation.”
The TSPSC issued a statement at the very beginning of the strike, insisting that teachers needed to take control of their strike and go forward on the basis of an independent political perspective and an international socialist program.
TSPSC member Kapila Fernando, who is also a member of the Socialist Equality Party (SEP) Political Committee, chaired the online meeting. He reviewed the teachers’ determined action, pointing out that it had developed in response to increased living costs, unsafe working conditions created by the COVID-19 pandemic and the government’s refusal to provide the necessary facilities for online education.
“The starting monthly salary of a teacher is currently 32,500 rupees ($US163), while the salary of a senior teacher with over 20 years’ service is only 65,000 rupees,” Fernando said.
“While the net salary for a teacher, after deductions of loan instalments, is insufficient to provide the daily food and clothing needs of a family, teachers have to spend their own money to conduct online lessons,” he added.
Fernando explained that the Rajapakse government had reintroduced the Kotelawala National Defence University Act (KNDUA). The legislation, he said, would enable the military, which is controlling the facility, to establish fee-levying campuses as part of the government’s privatisation of education and militarisation of the country. The Rajapakse regime has rejected the opposition of teachers and students to this bill, as well as teachers’ salary demands.
The speaker insisted that teachers needed to break with the unions’ bankrupt perspective of pressuring the government and called on teachers to take forward the struggle by building their own action committees in schools and neighbourhoods.
Fernando pointed to initiative of the International Committee of the Fourth International (ICFI) for an International Workers Alliance of Rank-and-File Committees and referred to the recent support from the Educators Rank-and-File Committee in New York for the striking Sri Lankan teachers and the TSPSC’s July 28 statement.
Prageeth Aravinda presented the main report to the meeting, explaining how the unions have consistently betrayed teachers’ wage struggles over the past 24 years. The teachers’ unions, he said, had called the current industrial action only because they feared teachers’ opposition could escalate out of their control.
“According to the union leaders, the teachers’ struggle has now gone too far and they are seeking a way to betray this struggle. They have appealed to the government to accept a wage increase for teachers as a ‘policy’ decision, whilst agreeing that the government is in economic difficulties and cannot give a wage rise at this time,” Aravinda said.
The speaker reviewed how the current union leaderships behaved when teachers went on strike during the communal war against the separatist Liberation Tigers of Tamil Eelam (LTTE).
“In 2007, the then President Mahinda Rajapakse confronted teachers’ union officials, including Ceylon Teachers Union leader Joseph Stalin, by asking: ‘We do not have money to allocate for this [wage increase]. Do you say that we should withdraw the military from the North and East?’ Stalin and other union leaders retreated and called off the strike in order to support the war.
“Mahinda Jayasinghe, leader of the Ceylon Teacher Service Union (CTSU), which is controlled by Janatha Vimukthi Peramuna, says ‘governments have cheated us for 24 years.’ However, the same union leaders have presented successive governments’ false promises as victories!” Aravinda said.
The speaker said that the Rajapakse government, which is carrying out brutal austerity measures amid the crisis exacerbated by the global pandemic, was gutting social spending, including education and health, imposing tax burdens on the masses and privatising public enterprises. Aravinda pointed out that the government had reduced spending on education and health in this year’s budget by 40 billion and 28 billion rupees respectively.
The Rajapakse government, he continued, is moving towards a presidential dictatorship based on the military and on May 27 used essential public service orders to ban strikes and protests. “The unions have silently supported all these measures, including the government’s essential services decree,” he said.
Aravinda told the meeting that the unions function as sellers of labour power within the capitalist system and defend the major corporations and governments in every country. He referred to “Why are the trade unions hostile to socialism?” by WSWS international editorial board chairman David North and went on to explain how the health workers unions had betrayed their members, forcing them back to work in unsafe conditions amid the pandemic.
The speaker reviewed the TSPSC’s call for teachers’ minimum basic salary to be increased to 60,000 rupees, indexed to the cost of living, the provision of pensions, and for teachers and students to be given computers and internet data access.
“None of these demands,” Aravinda said, “can be met under the capitalist system. Only a workers’ and peasants’ government, implementing socialist policies, can grant them. We urge teachers and other workers to join the SEP, our action committees and read the WSWS.”
During the question session, a teacher from Chilaw in the Northwestern Province asked for more clarification of the SEP’s program to win the wages and defeat government repression. He suggested that the trade unions expected to “market” teachers’ wage demands by basing them on opposition to the KNDUA.
SEP General Secretary Wije Dias responded from the audience:
“The approach of the listener from Chilaw who commented on the struggle of the teachers, suffers from a fundamental fault. He says that the struggle was started by the union leaders, who thought that their arrest during the protest demonstration of teachers and university students against the KNDUA, was an opportune moment to ‘market’ their demand for the eradication of teachers’ salary anomalies.”
The subjective intentions of the union bureaucracies, Dias continued, cannot be used to assess the broad and militant struggle of the teachers who are angered by unbearable cost of living increases and 24 years of delays in correcting salary discrepancies, despite continuous demands and protests by teachers.
“As our listener acknowledges, he is deprived of about 35,000 rupees a month due to the salary anomalies. So these are the objective factors that drove the teachers into struggle, despite the hesitations and opposition of the union bureaucracy. This is part of the widespread struggles of the workers throughout the region of South Asia and internationally, at present.
“The capitalist system,” Dias continued, “is embroiled in an unprecedented economic and political crisis around the world, on which the speakers have spoken at length. This has created a situation where an unbridgeable gulf has been created between what the bourgeois ruling elites are preparing for the people and the aspirations of the working class and the oppressed masses. The answer of the ruling classes everywhere to the demands of the working people and youth is to prepare social counter-revolution and war.
“The working class, under these conditions must end its existence as an exploited class for the capitalist system and become a class for itself. This means overturning capitalist rule and the establishment of working-class power with the support of the rural poor and youth, to implement a socialist program.
“The existing left parties and trade union leaderships are not only totally inadequate for this but completely hostile to such a struggle. This is because they are tied, from head to foot, to the coat tails of the ruling classes. This is why the Socialist Equality Party is fighting to build a mass revolutionary party of international socialism to lead the working class in the socialist economic, political and cultural transformation of society to fulfil the needs of working people,” Dias said in conclusion. | <urn:uuid:9ef9db3f-2768-408c-84cc-d7c254cc0187> | CC-MAIN-2022-33 | https://www.wsws.org/en/articles/2021/08/06/slme-a06.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.959545 | 1,914 | 1.773438 | 2 |
What are three examples of symbolism
Symbolism in Everyday LifeBlack is used to represent death or evil.White stands for life and purity.Red can symbolize blood, passion, danger, or immoral character.Purple is a royal color.Yellow stands for violence or decay.Blue represents peacefulness and calm..
What is a symbol lesson
Symbolism is when the author uses an object or reference to add deeper meaning to a story. … This is a three-day lesson that explores the use of symbolism in spoken, written, graphic, and other visual forms. Students will analyze images, poems, songs, and works of literature that have examples of symbolism.
How do you know when something is being used as a symbol
Colors, numbers, objects, and names can all be literary symbols. And if certain descriptions of objects appear regularly throughout the text, they’re probably symbols.
How do you introduce symbols to students
Begin by exploring what a symbol is. Some key vocabulary words to define first are symbol, symbolic, symbolic image, and visual metaphor. Students should understand that symbols represent something else.
What is symbolism in simple terms
Symbolism is a literary device that uses symbols, be they words, people, marks, locations, or abstract ideas to represent something beyond the literal meaning.
What is example of symbolism
Symbolism Examples: An owl can be a symbol meaning wisdom. A rose can be a symbol meaning romance. Green can be a symbol meaning jealousy or greed.
How do you explain a symbol
A symbol is something that stands for or suggests something else; it represents something beyond literal meaning. In literature, a symbol can be a word, object, action, character, or concept that embodies and evokes a range of additional meaning and significance.
What are the two types of symbols
There are two kinds of Symbols: Presentational and Discursive.
What is a symbol in kid friendly language
A symbol is a drawing, shape, or object that represents an idea, object, or amount of something. The most common symbols are letters, which are symbols of words and sounds.
What is symbolism in art for kids
Symbolism was an art movement in response to Realism and Impressionism. Poets, musicians, artists, and writers all used Symbolism to express meaning in an indirect manner. Symbolist painters wanted their pictures to depict a meaning beyond just the figures they drew.
What is a symbol lesson for kids
Lesson Summary Symbolism is when an idea, feeling, emotion, or other concept is used to represent something else. Authors rely on the figurative meaning of symbols, when a word is used to mean or represent something other than its typical definition, to help communicate their message to readers.
What are the 3 types of symbolism
Types of symbolismMetaphor. A metaphor refers to one thing by directly mentioning another. … Simile. Rather than implying a comparison like a metaphor, a simile explicitly denotes comparison between two things. … Allegory. … Archetype. … Personification. … Hyperbole. … Metonymy. … Irony.Mar 8, 2021
What is another name for symbolism
In this page you can discover 20 synonyms, antonyms, idiomatic expressions, and related words for symbolism, like: relationship, metaphor, typology, analogy, comparison, symbolisation, allegory, imagery, archetype, symbolization and ritual.
What is the importance of symbols
Symbols facilitate understanding of the world in which we live, thus serving as the grounds upon which we make judgments. In this way, people use symbols not only to make sense of the world around them, but also to identify and cooperate in society through constitutive rhetoric. | <urn:uuid:621a1fcc-9a70-42b1-9c73-df51f001b496> | CC-MAIN-2022-33 | https://robert-wilschrey.com/qa/how-do-you-explain-symbolism-to-a-child.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.897619 | 772 | 3.359375 | 3 |
(JTA) — Murray Polner, the founding editor of the liberal Jewish magazine Present Tense who served as its editor until it folded, has died.
Polner, who also authored or edited eight books, died on Thursday at the age of 91. He was a resident of Great Neck, New York.
Polner founded Present Tense in 1973 and remained its editor until the American Jewish Committee ended the publication of the magazine during a cost-cutting restructuring in 1990.
Present Tense was widely seen as an alternative to Commentary, the conservative magazine also published by the AJC. The first issue described its mission as “expressing a wide diversity of opinion on the situation of Jews in countries around the world, the special problems of Israel, the relationships among Jewish communities, and those issues and events in the United States and abroad which affect Jewish life and institutions.” Regular contributors like Rabbis Arthur Hertzberg and Balfour Brickner and the novelist Anne Roiphe provided warts-and-all commentary on liberal politics, American Jewish life and the Israel-Diaspora relationship.
Polner later founded and ran a newsletter called “PS: The Intelligent Guide to Jewish Affairs,” in order to continue the same kind of work.
He was a pacifist, anti-war writer and activist, according to The Island Now blog, and often wrote magazine articles as well as letters to the editor about subjects of war and peace. Days before he died he dictated to his son a letter to the editor of The New York Times, asking why the editorial page had not warned about a possible U.S. war with Iran, according to a remembrance posted on the HNN website.
Polner also was a vegan, and he and his wife Louise hosted vegan Passover seders, writer Ralph Seliger recalled.
The child of Russian immigrants, he served in the U.S. Naval Reserve from 1947 to 1952 and then in the U.S. Army from 1953 until 1955, eventually becoming a pacifist and working with anti-war groups to prevent the reinstitution of a military draft.
He taught through the early 1960s at Thomas Jefferson High School in Brooklyn, and then at Brooklyn College, Queens College and Suffolk Community College. Polner received his undergraduate degree from the City College of New York. By the late 1960s he earned a Masters degree in history from the University of Pennsylvania and a Ph.D. in Russian history at Union Institute and University in 1972. He also worked as executive assistant to the first chancellor of the New York City public schools, Harvey Scribner.
He served as book editor for the History News Network until May 2017, and was the editor of Fellowship magazine, published by the Fellowship of Reconciliation, from 1991 to 1993.
He was until recently a regular contributor to the LA Progressive. In his last column, dated Jan. 27 of this year, he wrote of his lifelong love affair with The New York Times as a reader and contributor, and how it had begun to fade. “[A]t times the Times seems to fall for insider leaks from the huge and very secret ‘Intelligence Community’ in our post 9/11 national security state, a development embraced by our some of our most aggressive haters,” he wrote. “Add that to the growing hostility to Russia, China and Iran, which could bring us perilously close to triggering an accidental conflict.”
Polner also wrote a biography of Branch Rickey, the baseball executive who signed Jackie Robinson, the first black player in Major League Baseball, to Polner’s beloved Brooklyn Dodgers.
He is survived by his wife of 68 years, Louise; a daughter, Beth Polner Abrahams; sons, Rob and Alex; and six grandchildren. | <urn:uuid:b7f9f536-7f7d-4fdb-b90b-23630767254b> | CC-MAIN-2022-33 | https://www.jta.org/quick-reads/murray-polner-founding-and-only-editor-of-present-tense-magazine-dies-at-91 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.975566 | 778 | 1.585938 | 2 |
It has been a great few weeks getting to know so many of you. Thank you for such a warm welcome! I am really enjoying my time with the children on Sunday mornings, getting to know them better each week.
We are using the UUA curriculum Tapestry of Faith, Signs of Being a UU Everyday. This curriculum is geared for 3rd graders and I am adapting it for both younger and older children and youth. There will be something for everyone in the weeks to come! In this program the children and youth will examine how their lives do and can exhibit UU traits and values, and they will come to understand that their faith is a living faith whose histories and teachings are fortifications for living faithfully in a complex world.
Upcoming topics for RE classes in November are:
Nov. 2nd: As Unitarian Universalists, we believe life is sacred—not only human life, but all life that shares our planet. This session also looks at traditions and rituals to welcome new life into families and faith communities. We will be practicing a special song that will be presented at the 60th Anniversary Celebration on Nov. 16th!!
Nov. 9th: As Unitarian Universalists, we believe members of communities take care of each other. This session identifies ways we care for others in our families, at school, in the congregation, and in the wider world. Children learn about Unitarian Universalist ritual of sharing our joys and concerns. We will decorate candles to take home.
Nov. 16th: We will discuss the history of SKUU and create a special timeline poster to display at SKUU for all to see, and for all to add special thoughts.
Nov. 23rd, This Sunday will be an Intergenerational Service. The children will read a story “We Are Thankful Each Day” to the congregation during this special service.
Nov. 30th: The children and youth will explore contexts in which they can practice sharing as sign of Unitarian Universalist faith. They discuss ways they share with family, friends, neighbors, the congregation, and the world. Children learn about the flower, water, and bread rituals of Unitarian Universalist congregations and discover how these rituals highlight sharing as a UU value. We will be planting seeds and use the flowers for our flower ceremony in the Spring.
For more information or questions, please contact Rennie Tomley, Director of Religious Exploration at email@example.com or call 925-485-3652. | <urn:uuid:3c64a422-8a0b-4227-9be8-ec14caf752ce> | CC-MAIN-2022-33 | https://starrking.org/2014/blog/religious-exploration-news-november-2014/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.928622 | 518 | 1.804688 | 2 |
Recovery map for Oystercatcher FJ28689
This map shows the resighting and recapture history for the Oystercatcher ringed with metal ring FJ28689. At ringing it was aged as a fourth calendar year or older, in adult plumage (EURING code 8).
|Ringed||25 Sep 2021||Dawlish Warren, Exe Estuary, Devon, GB & NI|
|Colour marks read||31 Jul 2022||Dawlish Warren, Exe Estuary, Devon, GB & NI||0km||0y 10m 6d| | <urn:uuid:836fb70b-1ce6-42ba-94fd-d1df75c70ca5> | CC-MAIN-2022-33 | https://dcwrg.org.uk/recoveries/oystercatcher/bird/GBT-FJ28689 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.805512 | 144 | 1.835938 | 2 |
Of the various annals, the most important are the third part of the annals of Bertin, written by Hincmar of Rheims, and cited as his. A very curious work, already quoted, is the Libellas dc imp. M. 111 Urbe Roma, generally supposed to have been written in the middle of the tenth century, but which Lapétre (jean who has submitted it to a very critical examination, has, it would seem, proved to be the produc tion of a Lombard, probably of Rieti, who wrote it in 897 or 898 in the inbercsts of the imperial, royal, and ducal house of Spoleto. Ap. P. L, t. 129, under the name of Eutmpius, and in t. 139. | <urn:uuid:da2107de-a4b9-4689-9996-5c62c3c714e0> | CC-MAIN-2022-33 | https://www.forgottenbooks.com/en/books/TheLivesofthePopesintheEarlyMiddleAges_10239715 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.876165 | 253 | 1.726563 | 2 |
Who we are
Escape Intervention Services
We at Escape Intervention Services believe that everyone should have a chance to reach their true potential in life. We work with 4-25 year olds and their parents/carers. It is our goal to help and support as many children, young people and their families to overcome any barriers to personal success through using a holistic approach – treatment of the whole person, taking into account all factors that contribute to their problems, rather than just the symptoms of an illness.
It is important to us that you come to understand how you are feeling and find ways to feel better, rather than suffer and think that you have to, as your wellbeing and mental health is so very important to all areas of your life!
You will hear the word holistic a lot throughout your journey with Escape Interventions – it is a word that is important to us all here! It is what makes our service unique and a success, as we provide support that looks at the whole person which is vitally important in gaining balance in our lives to maintain mental and physical wellbeing.
We ensure your therapies with us are tailored to your needs; they are not time-limited as each person’s journey is different and you will receive as many sessions as necessary to improve your mental health.
How can I access Escape Intervention Services
You can refer yourself or be referred to us from another service e.g. Social Worker, School, Health professional. We take your details and a brief outline of the difficulties you are facing. An assessment will then be arranged for you to discuss our services further and how we can help meet your needs. This assessment usually takes one hour.
Your time with Escape Interventions is suited to your individual needs – so the assessment is very important in working out what is best to allow you to gain the full benefit of our services. Your therapy might be counselling on its own, or counselling alongside complementary therapies such as massage etc. We have a programme of free outdoor and creative activities for young people, aged 11-18years, to attend either with as a therapy in itself or alongside counselling. | <urn:uuid:131e27fa-8150-4bad-8e36-85f2d98db553> | CC-MAIN-2022-33 | https://www.escapeintervention.org.uk/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.976069 | 427 | 1.703125 | 2 |
How great companies think differently, insights by Rosabeth Moss Kanter
Rosabeth explores some interesting and valid points in her article which I believe all business owners can benefit from. Key points are discussed and I engourage you to take the time to look at her work if you are wanting to take a deper dive on this concept
Instead of being mere money generating machines, great companies combine financial and social logic to build enduring success.
Making money has long been the ultimate aim of a business. This capitalism vision has seen corporations to limit their goals to generating the highest profits, regardless of societal impacts.
Traditional financiers and economists have argued that the sole purpose of a business is to make money without giving thought to the societal cost. This disconnects firms from society, posing conflicts between them. Institutional logic is unlike traditional practices, defining a successful company as one which is a vehicle for enhancing societal welfares, rather than only a machine to make money.
Great companies believe that business is an intrinsic part of society, recognising society as a pillar like family, government and religion. They invest in the future and have a focus of meeting the needs of people and society.
They focus on their purpose and address all stakeholder needs by;
- Improving the lives of users through their products and service.
- Providing jobs and enhancing workers quality of life
- Developing strong networks of suppliers and business partners
- Financial viability that provides the resources required for the improvements, innovations and ROI.
Organisations need to change and adapt frequently in today’s ever-changing environment. The pressure that comes from the forever changeover of human capital possess many risks and burdens on firms.
A way to mitigate this risk and burden is to have a common purpose and a set of values that underpin the organisation. Purpose and values are the very core of an organisation’s identity! They guide people and foster the organisation’s direction, providing the firm with a valuable resource to engage all stakeholders who can assist in the development of diversity, inclusiveness and profit. It enables people to rise and foster a culture that endures and institutionalises firms.
Develop a long-term focus
Thinking of the company as a social institution it helps generate a long-term perspective that will help justify the short-term financial sacrifices that are often required to fulfil the firms’ purpose.
Great companies will sacrifice short term financial opportunities if they are incompatible with instrumental values. The values matter because they act as a guide, they identify the company and forms its reputation, it represents the product and helps form opinions of its customers, service and any by-products. The very best business owners and executives commit a great deal of their time to breathe life into the culture of their firm. Investing resources and time in communicating values maintains, in fact, grows social purpose by keeping it at the forefront of everyone’s mind. This makes the work of the company emotionally compelling. By mobilising everybody else to own these values and this ensures they become embedded into the very fabric of the products and services, in fact they become one with the tasks, goals and performance. This ensures that charisma is not solely dependent on the leader or leadership group but its routinise and spread throughout the company.
Partnering with the public
For many small to medium-size firms, partnering with the public which is a way great companies evolve may not be top of mind, or present itself as obvious. However, in my experience it’s an important area often overlooked. The kind of partnerships that are considered are international, national or local activities, large domestic projects as well as small community initiatives. You could do some R and D with your product or service that addresses a public interest or an unmet societal need. If you are a sole trader or an SME, consider volunteering efforts.
Partnering with the public is much more than sales and marketing. It’s about you and your firm having a high-level conversation that demonstrates your commitment to furthering the development of your community, state or countries in which you operate.
When leaders allocate time, talent and resources to community projects that serve the community without seeking profit it gives that company credibility and legitimacy. Placing attention on social needs it will often spawn ideas that lead to innovations. Similarly, with you produce business model innovation from institution building as it helps connect partners across ecosystems.
Great companies assume they can trust people and can rely on relationships, not just rules and structures. They are more likely to treat employees as self-determining professionals who coordinate and integrate activities by self-organising and generating new ideas. Great companies understand than a social investment is required to fully understand its social structure and informal networks to optimise performance. Leaders in these companies reconfigure the rigid formal structures to accommodate for multidirectional pathways for resource and ideal flow.
So, what makes great companies great? They look at the whole environment they operate in holistically and with a long-term vision. Great take action on societal purpose and are driven by values that change the very fabric of their products and services, investing in employee empowerment, emotional engagement, values based responsible leadership and related societal contributions.
Live with purpose,
Rosabeth Moss Kanter is the Ernest L. Arbuckle Professor of Business Administration at Harvard Business School, where she specialises in strategy, innovation and leadership for change. She is also the co-founder and former director and chair of the Harvard University Advanced Leadership Initiative, which was created to enhance and leverage the skills of already accomplished leaders for maximum impact on significant social problems. | <urn:uuid:abf26dd4-9aa4-4beb-8fe7-bd4a8d5bfff9> | CC-MAIN-2022-33 | https://businessgrowthmindset.com/2020/07/14/6078/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.952832 | 1,168 | 2.421875 | 2 |
Biochar charcoal is produced by heating organic material at a high temperature in limited oxygen. It is a stable product, very rich in carbon, which is used to lock carbon into the soil.
Anyone can make charcoal or biochar. Just burn some wood. At high temperatures you get a more pure product with additional beneficial qualities. Of these positive properties, the one we are focusing on is its ability to rejuvenate the planet and its soil.
Biochar charcoal has been described as.
“the single most important initiative for humanity’s environmental future. It allows us to address food security, the fuel crisis, and the climate problem, all in an immensely practical manner.” —Prof Tim Flannery, Australian of the Year 2007
What Are The Benefits of Biochar?
Digging Biochar into the earth has been shown to bring about many beneficial and long-term positive effects on soil.
- increase the water holding capacity of the soil.
- increase crop production.
- increase soil carbon levels.
- increase soil pH.
- decrease aluminum toxicity.
- positively change the microbiology of the soil.
- decrease soil emissions of the greenhouse gases CO2, N2O and CH4.
- improve soil conditions for earthworm populations.
- improve fertilizer use efficiency.
The effects of Biochar will vary with soil type and the qualities of the Biochar used. Studies so far have shown that the greatest positive effects of Biochar applications have been in highly degraded, acidic or nutrient-depleted soils. However our anecdotal evidence has show strong yields in highly nutrient rich soils as well. See my post on the Biochar project Hemp trials.
In Australia, both the CSIRO and NSW Department of Primary Industry are conducting field trials on Biochar.
How is Biochar charcoal made?
Biochar can be produced from any organic material such as household green waste, paper waste or agricultural waste. It is made in a specially constructed incinerator that heats the organic material under pressure at temperatures above 430°C. The process, called pyrolysis, efficiently decomposes the bio matter, producing the Biochar solid, a small amount of bio-oil, and gases whose heat can be use to create electricity. The production of Biochar is a carbon negative process overall.
How does Biochar Charcoal help with climate change?
Burning trees and agricultural waste contributes a large amount of carbon dioxide (CO2) to the atmosphere. The production and use of biochar breaks into the CO2 cycle, releasing oxygen and drawing carbon from the atmosphere to hold it in the soil. | <urn:uuid:5b75d75d-babd-4b95-9b70-ace965cb69e9> | CC-MAIN-2022-33 | http://biocharproject.org/tutorial/what-is-biochar-charcoal/?to=/r/TotesMessenger | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.902448 | 534 | 3.46875 | 3 |
Coventry Academy provides a training course in Evolution of Post COVID Business Models in Management & Leadership
|17 - 18 Oct 2022||Online||$1,100|
|26 - 27 Dec 2022||Online||$1,100|
Online Training Course Overview
Has the COVID-19 crisis halted globalisation? Is the world economy reverting from free trade to aggressive protectionism? What will be the next trends and developments in your business? What are the implications for your organisation? There are positive and negative answers to these and many other questions that will shape the future. This Coventry Academy intensive on-line course will examine these critical questions into a new context.
Globalisation has been the most powerful force influencing business in the 21st century. It has affected every activity of organisations from basic research through product creation into post-sale customer support. The opening of markets and the rapid diffusion of information, knowledge and capability have combined to influence our assessment of business potential and the ways in which we do business. However, we now perceive signs of a clear shift away from the trend of the past 30 years towards a return to uncertainty and protectionism. This Coventry Academy training course for senior executives, managers and specialists will enable participants to make a powerful personal impact on one of the most important and complex issues in contemporary business development. It will change the way you think about your company’s business and your personal role in taking this business forward into its future.
This intensive online training course will feature:
- Detailed analysis of the world economy and outlook to 2030
- The process of change from a national to a global organisation
- Analysing and dealing with value migration and structural change
- Balancing global and local decisions in developing your organisation
- Forecasting and planning in post-COVID business conditions | <urn:uuid:18461909-4e7a-4c8c-aad8-9fafeacf48d9> | CC-MAIN-2022-33 | https://coventryacademy.com/course/evolution-post-covid-business-models | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.907204 | 388 | 1.539063 | 2 |
Why nail biters don't cry
Scientists have just found out what you always wanted to know: why do fingernails, when nibbled or torn, tend to tear across the nail rather than downwards towards the nail bed?
By analyzing nails under the electron microscope, the reason became clear: nails are made of three layers containing the protein keratin. The keratin fibres have a specific arrangement that prevents breaks from running down the nail and also gives the nail tremendous strength. Without this arrangement, according to one of the researchers, 'every tear would damage our nail bed, inflicting great pain and incurring infection'. A similar pattern is seen in horses' hooves—which is just as well—because if cracks were to run upwards instead of across in a horse's hoof, it could lead to infection, lameness and death.
How could anyone say that this crucial design feature of hooves and fingernails has come about by accident? The evidence surely shouts 'Designer'. | <urn:uuid:3fb051ed-0fc7-42ab-863e-5b9ea0c93af5> | CC-MAIN-2022-33 | https://creation.com/media-center/youtube/why-nail-biters-dont-cry | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.963345 | 204 | 3.1875 | 3 |
Information for Parents: New Curriculum Resource for English Language Arts
WCPSS has excellent teachers, strong leaders and a wealth of support from parents and the community. We are dedicated to providing our teachers with the best resources possible to ensure students are learning what they must know to be prepared for college, career and life.
We have chosen EL Education as the new curriculum resource to support teachers of English Language Arts (ELA) in grades 3 through 8.
What is EL Education? EL Education is a curriculum written by and for teachers with emphasis placed on active learning and student engagement. Classrooms are structured with highly collaborative activities that allow students to engage in academic conversations and investigations of rich academic topics. EL aims to contribute to a student’s ability to be globally competitive and active contributors in building a better world.
What are the ‘Learning Paths’ for Students within EL Education?
Building Background Knowledge
Extended Reading and Research
● Learning and practicing collaborative structures to use throughout the learning;
● Discovering the purpose for learning new skills that build towards the standards;
● Identifying inquiry questions related to the task clearly and precisely; and
● Having extensive opportunities to build knowledge through texts so they can learn independently.
● Becoming experts on a compelling topic and texts;
● Gaining academic and content-specific vocabulary; reading, writing and speaking with evidence;
● Listening, understanding, evaluating and communicating effectively by adapting to different audiences, tasks and purposes; and
● Seeking out various viewpoints, respectfully listening to and considering the ideas of others, and then providing and using constructive feedback to improve the work.
Writing from sources about topics students understand deeply;
● Developing a vision of quality work in collaboration with their peers and revising their own work accordingly;
● Sharing their learning and excitement with peers, teachers and others beyond the classroom (authentic experiences);
● Synthesizing information and making connections between information and arguments; and
● Applying current research or knowledge in a unique way.
What resources will be provided? Each learning module comes with books – not textbooks -- which have been carefully selected by the authors as the best books for teaching grade level content. Students will be provided a central text for use during their study of a module. These central texts are supported by a list of recommended texts—books, articles, and primary source documents—that balance literary and informational texts at appropriate levels of complexity.
What should families see at home? Students will have homework assignments related to what they are reading at school. They will be expected to independently read at home and engage families in conversations about the topic. | <urn:uuid:8b2a0da7-4de4-40e6-b87c-7e361fc1d843> | CC-MAIN-2022-33 | https://www.wcpss.net/domain/14083 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.943531 | 546 | 3.859375 | 4 |
"Fifteen studies suggest a higher prevalence rate of ASDs [autism spectrum disorder] among children of immigrants in comparison to native children."
Those fifteen studies formed a large part of the seventeen studies included in the review by Rafal Kawa and colleagues who set out to look at the collected peer-reviewed literature on the topic of the "prevalence and risk for ASD in Europe among immigrants and ethnic minorities." Carried out as part of a European Union (EU) initiative titled 'Enhancing the Scientific Study of Early Autism' the Kawa review was a sort of first step to looking at whether the racial/ethnic disparities noted in autism rates in the United States for example, might also hold true for Europe. Evidently they did.
This is a topic covered before on this blog (see here for example) and so the results come as little surprise. One does have to be slightly cautious about how such data is interpreted, particularly in light of recent European history but outside of any politics there are some intriguing scientific questions posed by such data and some potentially important 'connections' with other independent datasets that could benefit autism research more generally (see here and see here). Given also some emerging research suggesting that autism may not be the only diagnostic label where risk is heightened according to immigrant status (see here), there are some further studies to be undertaken on this topic, in these days of overlapping labels (see here).
Kawa R. et al. European studies on prevalence and risk of autism spectrum disorders according to immigrant status-a review. Eur J Public Health. 2016 Dec 24. pii: ckw206.
Kawa R, Saemundsen E, Lóa Jónsdóttir S, Hellendoorn A, Lemcke S, Canal-Bedia R, García-Primo P, & Moilanen I (2016). European studies on prevalence and risk of autism spectrum disorders according to immigrant status-a review. European journal of public health PMID: 28013245 | <urn:uuid:f333043b-02f8-4f7d-a34c-bd733af7a0bf> | CC-MAIN-2022-33 | https://questioning-answers.blogspot.com/2017/01/on-autism-risk-and-immigrant-status.html?m=0 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.924071 | 421 | 2.59375 | 3 |
Many news sources have mentioned in passing the use of social media channels in organizing the nearly three weeks of demonstrations throughout Egypt that led to the resignation of the country’s president Hosni Mubarak earlier today.
One can be sure that the use of Facebook and Twitter and other SM in organizing the efforts will be studied for a while. The Twitter channel #Jan25 was at least one point of contact that protesters used. Today it is carrying massive traffic as the celebrations sweep the nation of 80 million. We noticed nearly 5,000 tweets in about half an hour.
Earlier we blogged about the five-day Internet blackout that the government attempted:
It isn’t clear why Mubarak’s administration told providers they could go back on line. A five-day Internet blackout must have been quite damaging to commerce in the country even though the Egyptian stock exchange was allowed to remain on line.
Does this mean a countrywide “kill switch” is not an option — even in the face of a major revolution — because the Internet is now too vital to normal life?
What did the Egyptian protesters learn about organizing via social media from their peers in Tunisia who organized a similar uprising with similar results?
What did the Egyptian protesters learn that future protesters will use? | <urn:uuid:829ca001-c5e1-4450-9fd0-9b03da5838e6> | CC-MAIN-2022-33 | http://sunbeltblog.eckelberry.com/egypts-facebook-revolution/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.954045 | 263 | 2.09375 | 2 |
Snow thank you.
Let’s admit it, the older we get, the more favorable conditions we prefer for trail riding — and that’s totally okay. Here are 11 ways to tell if you’re a fair weather rider.
1. You check the weather before you saddle up. You won’t ride in wind, rain, snow or any chance of some type of bad weather conditions.
2. You have relocated from the east coast/midwest/any cold place to some place warm where you can ride all year long without worrying about above-mentioned bad weather.
4. You and wind are like oil and water. Anything over 15 mph and you’re staying in. That’s what they made Helmet Cams for: for watching from the comfort of your couch.
5. You’ve invested hundreds of dollars on staying warm. You buy Hot Hands and Toasty Toes by the truck load.
6. Your horses get blanketed if the weather drops below 55 degrees. Who cares if they have a thick natural coat? If you’re cold, they’re cold.
7. You’ll cancel your plans to ride a week in advance because there is a 10% chance of snow flurries predicted in the forecast.
8. You snowbird in Arizona in the winter… and join your 100+ friends who also are snowbirds.
9. You use excuses like “my horse gets spooked in the wind/snow/rain/extreme heat” to get out of riding, even though your horse could care less about those conditions.
10. San Diego seems more and more appealing the older you get. The only thing keeping you from relocation is the cost of horse property on your salary.
11. In the winter you go to the barn once a week, tops. Thankfully you have the barn manager on speed dial to check to see how your horse is doing, hourly.
Go riding. Maybe. Check the weather first. | <urn:uuid:944d91ac-f165-41e2-87cb-ba73c948d9e2> | CC-MAIN-2022-33 | https://www.horsenation.com/2018/01/25/11-signs-you-might-be-a-fair-weather-rider/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.917629 | 418 | 1.6875 | 2 |
Cradle of the Mediterrean civilization, Sicily has always represented a fertile ground for the cultivation of many varieties of trees and shrubs, ranging from olive trees to citrus fruits to wheat. Think for example that in the Roman Era Sicily was considered the Granary of Italy
Along wheat and cereals, which represent the prevalent culture at day in Sicily if we take as parameter the occupied hectars, more profitable cultivations have meanwhile developed, such as citrus, olives, vineyards and fruit trees.
Sicily can now be defined as one of the biggest producer of high quality extra virgin olive oil in the world. The allure and respect for the olive tree derives from the Greek influence on the island. We shall remember, as a matter of fact, that the Greeks adored the olive tree, since it was considered a symbol of peace and fraternity, but also of resistance and purification. The Olympic games’ champions were even awarded with crowns made from the branches of the olive trees of Olympia, consecrated to Zeus. This way, the tiara symbolized peace, glory and sacrality.
The richness of the vast natural heritage of Sicily has created a huge biodiversity. From the sea to the mountains, passing through the hills, every area is distinguished by micro-climatic conditions and different ground composition, which are fundamental characteristics for the growth of an olive tree variety. This biodiversity and uniqueness of the Sicilian territory grants unique flavors and aromas, which result in extra virgin olive oils with extraordinary organoleptic characteristics.
While the olive varieties, “cultivar” in technical terms, identifiable in Sicily are more than 30, the researchers have continued analyzing other genotypes, which might enrich the panorama of olive cultivation in the near future. At the moment, the prevalent cultivar in Sicily are eight: Biancolilla, Cerasuola, Moresca, Nocellara del Belice, Nocellara Etnea, Oglialora Messinese, Santagatese, Tonda Iblea.
Le caratteristiche organolettiche, il gusto e il fruttato variano per intensità a seconda delle varietà, in quanto risultato del singolo microclima e del terreno in cui la cultivar cresce. Tuttavia, alcune sensazioni sono comuni a più cultivar siciliane come la mandorla, il pomodoro verde o maturo e il carciofo.
The organoleptic characteristics, the taste and the fruity can vary in intensity upon the variety, since they are the result of micro-climatic conditions and ground on which the cultivar grows. Nevertheless, some sensations are common to many Sicilian cultivars, such as almonds, green or ripe tomato and artichoke.
Let’s find out the olive varieties which characterize Sicilian oil:
Biancolilla: typical of the Palermo and Agrigento area, it’s characterized by a fruity aroma and a light or medium intensity, which makes it a delicate olive oil, with notes of almonds and sometimes tomato.
Cerasuola: a typical Western Sicily variety, which can be found in little extensions even in the Eastern Sicily. It is characterized by a medium or high intensity fruity, with prevalence of bitter and spicy notes, along with grass, cardoon and tomato.
Moresca: it’s an early ripening cultivar, widespread in the Eastern Sicily, which is harvested at the beginning of September and results in delicate oils, lightly fruity and not very intense, with grass, almonds and green apple notes.
Nocellara del Belice: widespread in the Trapani area, is named after the river flowing in this territory. It is characterized by a fruity, bitter and spicy aroma, with notes of cardoon or artichoke and sometimes tomato.
Nocellara Etnea: clear reference to the Etna Volcano, it is quite typical of the Eastern Sicily, between Enna, Catania, Siracusa and Ragusa. Its fruity is medium/intense with a good spicy and bitter sensation along with grass, artichoke and almond notes.
Ogliarola messinese: widespread in the Messina area, this cultivar can be found also in the Palermo territory. It produces oils with light bitterness and fruity, in which grass notes can be distinguished.
Santagatese: known with other synonims, it grows both in the Western and Eastern Sicily. The oil derived is characterized by a light or medium fruity, with light bitter and almond notes.
Tonda Iblea: Tipica dei Monti Iblei, da cui prende il nome, questa cultivar si ha solo tra le province di Messina, Catania e Siracusa. Produce oli con fruttato di medio-alta intensità con sensazioni di amaro e piccante. Si contraddistingue in particolar modo per le note erbacee e di foglia di pomodoro verde e talvolta anche di carciofo.
Tonda Iblea: typical of the Iblei Mountains, after which takes its name, this cultivar grows only in the territory of Messina, Catania and Siracusa. It produces an oil with medium-high intensity fruity characterized by bitterness and spicy sensations. It is mostly defined by notes of grass, green tomato leaves and sometimes even artichokes. | <urn:uuid:9a9733a8-e605-47f4-af4e-979615430413> | CC-MAIN-2022-33 | https://agricolaoliva.it/en/olio-evo-en/extra-virgin-olive-oil-from-sicily-find-out-the-best-olive-oil-varieties%E2%80%A8/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.896428 | 1,171 | 2.84375 | 3 |
By Richard Price and Bob Pitt
October 4, 1936, remains a landmark in working class history – the day when the East End stopped Mosley’s Blackshirts and dealt British fascism a blow from which it never fully recovered. With the same area once again targeted by fascists, the Battle of Cable Street contains valuable lessons for today.
The British Union of Fascists (BUF) was formed in 1932 by the aristocratic adventurer Sir Oswald Mosley. Mosley’s early career as an MP had traversed the political spectrum: Tory (Harrow, 1918-20); Independent Conservative (Harrow, 1920-23); Independent (Harrow, 1923-24); Labour (Smethwick, 1926-31). In 1931, having failed to win Labour to a radical programme of state “socialism”, Mosley formed the New Party. With its vague platform of “action now!”, state intervention and populist calls for strong leadership in the face of the acute economic crisis, the New Party initially attracted a number of prominent intellectuals. At the general election of October 1931, however, the New Party polled disastrously, winning only 36,777 votes in 24 constituencies, and losing the seats of four MPs including Mosley who had defected to it.
Mosley’s growing interest in authoritarian solutions was fuelled by the debacle, and following a trip to Italy he launched the BUF, modelled on Mussolini’s fascist movement. In a circular to potential recruits, Mosley wrote: “Our object is no less than the winning of power for Fascism, which we believe is the only salvation for our country.”1
The BUF made a definite impact, with its full-time blackshirted Defence Force, its aristocratic and Tory sympathisers, and, for a period, the backing of Lord Rothermere and the Daily Mail. Its meetings – notably the Olympia rally in June 1934 – were ruthlessly stewarded, and it spread the fascist message through provocative demonstrations and a range of publications. The police treated the fascists with the utmost leniency.
But after this initial push, which took its membership to 40,000,2 the BUF faltered. As some of his early backers fell away, alarmed by the violence surrounding BUF activities, Mosley focused his attention on building up a base in working class areas. Anti-semitism, although previously present in BUF propaganda, became its central feature from the autumn of 1934 onwards. By linking the questions of unemployment, housing and racism Mosley was able to win young workers demoralised by the slump, repelled by the retreat of the official labour movement and looking for action. But his strategy also had its limitations. Many of the hardest hit “distressed areas” in the 1930s not only had very little immigration; they were often strongholds of the Communist Party.
The East End of London, however, offered the fascists definite possibilities. Although the 350,000 Jews in Britain were only 0.7 per cent of the total population in 1936, nearly half lived in the East End – 60,000 in Stepney alone. Then, as now, it had some of the worst living conditions in Britain. It had also been a seedbed of anti-semitism and racist propaganda in general. The British Brothers’ League, founded by ex-army officers in 1900, claimed 45,000 members in the East End. Organised on a semi-military footing, it campaigned against “alien” and especially Jewish immigration from eastern Europe, influencing the passing of the Aliens Restriction Act in 1905.3
Mosley’s East London campaign began in earnest in the summer of 1936 with a big rally in Victoria Park in June. Through endless street-corner meetings, fire-bombing and smashing the windows of Jewish shops, racist abuse and physical attacks, the fascists worked overtime to create an atmosphere of siege.
In late September 1936 the BUF announced its intention to mount a show of strength on the afternoon of Sunday October 4, designed to intimidate the organised working class and in particular the local Jewish community. Uniformed fascists were to gather in military formation at Royal Mint Street, where they would be reviewed by their führer, before marching in separate contingents to four meetings in East London.
The Jewish People’s Council responded to this provocation by organising a petition calling for the march to be banned. Having received 100,000 signatures in 48 hours, the petition was presented to the Home Office on Friday October 2 by a deputation consisting of the Labour MP for Whitechapel, the secretary of London Trades Council, a priest and two leaders of the JPC. But the Home Secretary refused to stop it.
News of the demonstration provoked enormous anger: “Crowds gathered wherever a bill poster halted to paste up a notice, but order was preserved by the police”, reported the Daily Herald. “It was expected that every Fascist advertisement in the East End would be defaced or ‘removed’ by this morning.”4 The CP’s Daily Worker reported the hatred expressed by East London workers for Mosley. One was quoted as saying “We must give them such a reception that they will not march down here again”.5
However, rather than preparing to confront Mosley’s thugs, the CP initially called on its members and supporters to attend a Young Communist League rally in solidarity with the Spanish Republic, which was to be held in Trafalgar Square on the same afternoon as the fascist demonstration. On September 30, the Daily Worker only carried a small article on the BUF march, tucked away at the bottom of page 6, reporting that the CP’s London District Committee had issued a call “for workers to go in their thousands to Trafalgar Square, and after the demonstration to march through East London’s streets to show their hatred of Mosley’s support for the Fascist attacks on democracy in Spain”.
By the following day, the Daily Worker’s line had changed only slightly. “To the Square on Sunday at 3.30pm”, a front page article read. On page 5, a further appeal to attend the march to Trafalgar Square and the subsequent return leg was printed.6 In other words, the CP was going to assemble its forces near to where the BUF was rallying, and then march them off in the opposite direction! By the time the CP’s “anti-fascist” march returned to the East End in the early evening, the fascists would have succeeded in carrying out their provocation without serious resistance from the CP.
Although the CP did give its backing to a demonstration by the Ex-Servicemen’s Committee Against Fascism, which was to assemble in Stepney on the Sunday morning, the party’s main emphasis was to rally support for the JPC petition calling on the state to defend workers against fascism. As one study of CP history observes: “It was not that the Party’s leaders were lacking in either courage or anti-fascist feeling, but the Popular Front line predisposed them to respectable protest rather than direct militant action, which could only antagonise those they were so anxious to influence among the Tories, Liberals and ‘Progressives’.”7
In the meantime, a smouldering argument between rival groupings in the CP had broken out into an open dispute. The “leftists” led by Stepney CP secretary, Joe Jacobs, advocated so-called “street work” – directly confronting the fascists. The other tendency around Phil Piratin favoured more cautious “trade union work” in keeping with the Popular Front line.8 Jacobs was appalled at the prospect of the CP marching away from the battle: “The pressure from the people of Stepney who went ahead with their own efforts to oppose Mosley left no doubt in our minds that the CP would be finished in Stepney if this was allowed to go through as planned by our London leaders.”9 On September 29, Jacobs received a note from East London CP organiser Frank Lefitte, which included the following advice: “If Mosley decides to march let him. Don’t attempt disorder.”10
Not until Friday October 2, by which time it had in any case become clear that the Home Office had no intention of stopping the BUF march, did the Daily Worker announce the cancellation of the Trafalgar Square demo and issue the call for mass opposition to the BUF in the East End itself: “Workers’ contingents from various parts of London will march to the rally in Aldgate, Commercial Road, Cable Street, Minories and Leman Street”, the paper reported. “There is no doubt that from 2 o’clock onwards the roads will be crowded with people intent on opposing Fascism.”11 Leaflets advertising the Trafalgar Square event were hastily overprinted “Alteration! Rally to Aldgate 2pm”.
In spite of the evidence to the contrary, the CP has continued to claim the lion’s share of the credit for stopping Mosley.12 In contrast, the role of the Independent Labour Party (ILP) has been written out of many accounts of Cable Street. But it undoubtedly played a prominent part. The East London Advertiser actually referred to “the ILP demonstration against the fascists”. Like the CP, the ILP supported the JPC’s petition. But it too came out in favour of mass mobilisation when it became clear that the march would go ahead. On Friday, October 2, an ILP meeting at Hackney Town Hall issued a call for “an overwhelming demonstration against the Fascist march”.13 The ILP “announced in the Press that it had called to the East End workers to mass in Aldgate in such numbers that the march would be impossible…. For hours at the Head Office duplicated copies of the leaflet were run off, and soon they were being distributed in thousands throughout East London”.14 The Star ran the headline “ILP Call to the Workers” on its front page, and printed the ILP’s statement in full.15
On October 4, the Socialist League’s London Area Committee distributed a pamphlet written by Trotskyist Reg Groves which opposed the Stalinists’ Popular Front line.16 Otherwise, although Trotskyists took part in the events, they do not seem to have made any distinctive intervention.17
Labour leaders, both nationally and locally, acted disgracefully. East London’s Labour councils supported the JPC petition for an outright ban on the march, but George Lansbury, the Labour MP for Poplar and former party leader, could not even bring himself to demand that. He merely called on the Home Secretary to re-route one of the four BUF marches through a less “congested” area. “What I want is to maintain peace and order”, Lansbury stated, “and I advise those people who are opposed to Fascism to keep away from the demonstration.” This was “sound advice”, counselled an editorial in the official labour movement paper, the Daily Herald. “Fascist meetings are in themselves dull…. The only attraction is the prospect of disturbances. Withdraw that attraction and Fascist meetings would die on the organisers’ hands.”18 “If the procession does take place”, the Mayor of Stepney told the local press, “I appeal to all East Londoners most earnestly to stay away.”19
The East End Erupts
The fascists were due to gather in Royal Mint Street at 2.30pm. “Hours beforehand every street between the Mint and Aldgate was thronged with people”, the Daily Worker reported.20 Up to 300,000 anti-fascists had assembled, with 50,000 pressed around Gardner’s Corner alone. Ten thousand police, according to the Daily Herald’s estimate, were brought in from all over London and deployed to protect the fascist march in what was obviously a well-prepared battle-plan:
“Many of the side-streets … were cordoned off by police long before the march was due to start. No one was allowed to go through unless he could satisfy the cordon officer that he had legitimate business there. The inhabitants were scarcely permitted to leave these streets at all…. The police called every modern device into action to help them in their activities.”21
The crowds showed what they thought of the Labour leaders’ pacifist advice: “At 1.30 two lone Blackshirts appeared at Royal Mint Street. They were told to stand against the wall and six policemen were detached to stand in front of them, hiding them from the crowd. Shortly afterwards a covered vanload of Blackshirts appeared. As the first two men dismounted the crowd was on them before the police could intervene, and in another second both were stretched out unconscious. Then the police activities started in earnest. From all quarters foot and mounted police appeared on the scene. Within ten minutes, there were three baton charges in Royal Mint Street, and all the while crowds were being pushed back and more streets cordoned off. Eventually the Minories was closed entirely and the crowd pushed back down Cable Street. By this time Royal Mint Street itself was emptied of workers and was occupied by 500 police and the assembling fascist forces which came up mostly in closed vans.”22
The Daily Herald found its pleas similarly ignored: “Outside Mark Lane station the crowd closed in on six of Mosley’s men, and before the police could do anything three of the Fascists had been knocked down and were bleeding profusely from head-wounds. One of them had been hit on the head with a bottle. Several men and women were hurt in a fierce exchange of blows…. But the police precautions enabled the rest of the Fascists to assemble unmolested. They formed in military formation, a column of 3,000 stretching for half a mile, with over 200 black-bloused women in the centre…. The Blackshirts jeered back at distant booing. ‘The Yids, the Yids, we are going to get rid of the Yids’, they chanted, or, ‘M-O-S-L-E-Y, we want Mosley’, to which the crowd shouted back, ‘So do we, dead or alive’. New detachments arrived in the steel-protected Fascist vans, behind steel-wire meshing.”23 Police attempted to clear the streets close to Royal Mint Street with repeated baton charges. Workers responded with stones, fireworks and marbles hurled under horses’ hooves chanting “They shall not pass!”.
The confrontation between police and anti-fascists was concentrated on Cable Street, through which the fascists were intending to march. Some of those arrested were liberated, and several policemen themselves “arrested”. The brutality of the police only succeeded in spurring on the anti-fascists: “Barricades were built in the street, and packing cases, a lorry and a couple of carts, to say nothing of the contents of a builder’s yard, were called into service to build it. Paving stones were tom up and broken into convenient sizes to serve as ammunition, glasses and bottles were broken and the splintered glass ground into the road to impede the passage of the mounted. The police tried to stop these operations but were powerless to do so.”24
Having retreated, the police later returned with reinforcements, cleared the street with a baton charge, and set about dismantling the barricades. Several hours later, the scene still resembled “the aftermath of a battle in Spain”, according to one eyewitness.25
The demonstrators showed an admirable gift for organisation – some of it planned, some improvised. Local headquarters were established to direct the struggle. Motor cyclists and cyclists were organised to carry messages, and both the CP and ILP established first aid stations to treat those injured.
Mosley finally rolled up in a black sports car around 3.40pm – over an hour late, and ten minutes after the march was due to set off. “Union Jacks on decorated poles rose in the air and a forest of hands above the black-coated ranks went up in salute as Sir Oswald, wearing the new Blackshirt uniform, with a peaked cap, drove down the ranks with two other officers of the movement.”26
Shortly before this, the police had begun preparing to clear a route towards Houndsditch for the BUF march. But by the time Mosley spoke to the Police Commissioner these plans had been abandoned and Mosley was told that the march could not proceed because of the threat of disorder. The intervention of ILP leader Fenner Brockway, who phoned the Home Office, may have had some influence on the Police Commissioner’s U-turn.27 But, as the Herald reporter pointed out, “it was obvious to him, as it was to everyone, that any attempt to force a way for the Fascist column would have meant serious riot and bloodshed”.28
At 4pm the Blackshirts were escorted out of Royal Mint Street by thousands of police and diverted down the Embankment – away from East London. As the fascists skulked off towards the West End, “everyone of Jewish appearance was insulted and in some cases they were spat upon”.29 When they reached Trafalgar Square the fascists tried to hold a meeting there but were prevented from doing so by the police. They were forced to disperse, having been comprehensively humiliated.
Lessons of the Battle
The BUF issued a statement deploring the fact that “Socialists, Communists and Jews openly organised not only to attack the meetings but to close the streets of London by violence to members of the public [i.e. uniformed fascists] proceeding to the legitimate meetings”.30
The Communist Party drew the lesson from Cable Street that it was necessary to intensify the campaign against non-intervention in Spain: “Neutrality must go! Spanish democracy must be saved!”31 It weathered the internal storm, and recruited heavily on the strength of its role in the struggle against Mosley. Party membership doubled between 1935 and 1937. Joe Jacobs was expelled from the CP in 1937 for advocating a more militant line. Phil Piratin went on to become MP for Stepney from 1945-50, although it was on a programme to the right of Labour.
The ILP drew more radical conclusions: “As in Spain, Fascism must be opposed not by appeals for the defence of Capitalist Democracy, but by a call to united working-class action for Workers’ Power and Socialism.”32
The Trotskyist Red Flag, paper of the Marxist League, called upon militant workers to follow up their victory and “swing the entire organised working class movement into action. The effort of the Labour Party leaders to teach the workers reliance on the police must be exposed for what it really is – a policy which will secure the Fascists freedom to conduct their anti-Jewish, anti-working class propaganda, and engage in brutal attacks on workers in East London”.33 It went on to link the fight against fascism to bringing down the National Government and the struggle for workers’ power.
Cable Street took place on the eve of the Labour Party annual conference, which unanimously passed an emergency resolution condemning “the tragic and deplorable events of yesterday in the East End of London”. It condemned the Tory government’s refusal to ban the march, proposed the illegalisation of political uniforms and “militarised politics”, and called on the Tories to organise a government inquiry into Fascism! Moving the resolution, London County Council leader Herbert Morrison placed the blame for the battle in the East End not only on the BUF but on the “threats of counter-demonstrations from the Communists and from the Independent Labour Party”.34 The Mayor of Stepney meanwhile paid tribute to “the splendid behaviour and good humour of the police”!35
The ruling class took its cue from the Labour leadership, and with its support, rushed the Public Order Act through parliament. Although the act banned the wearing of political uniforms, it was primarily used against left-wing demonstrators and anti-fascists.36
What lessons can be drawn for the struggle against racism and fascism today? The most obvious conclusion is that to call on the state to defeat fascism is both futile and counter-productive. Far from defending workers and Jewish people, the state mobilised a huge force of police to defend the fascists. In fact, physical confrontation between anti-fascists and the BUF was very limited. The real battles took place between the anti-fascists and the police.
Cable Street demonstrates the one-sidedness of those who argue that all actions must take place through the official labour movement. If it had been left to the leaders of the labour movement, no mobilisation against the fascists would have taken place.
But it also disproves the facile arguments of those who claim that because the Labour leadership is so hostile to independent working class action its hold over the class as a whole will automatically weaken. There is no evidence that the treacherous response of the Labour Party leaders nationally and locally to the BUF provocation lost the party the allegiance of any but a small minority of the class.
Anti-fascist mobilisations, however militant, do not absolve Marxists from the task of breaking the mass of reformist workers from Labourism. After all, it was in this period that Trotsky argued for a turn to the Labour Party, anticipating a leftward movement in its ranks. A militant united front policy of opposition to all forms of racism and fascism is a vital component of revolutionary politics. But it is not a substitute for an all-round programme to take the class as a whole forward.
1. R. Benewick, The Fascist Movement in Britain, Allen Lane, 1972, p.83
2. R. Skidelsky, Oswald Mosley, Macmillan, 1975, p.331
3. Benewick, pp.25-7; F.G. Clarke, Will-o’-the-Wisp, OUP, 1983, pp.26-7
4. Daily Herald, October 1, 1936
5. Daily Worker, October 1, 1936
7. S. Bornstein and A. Richardson, Two Steps Back, Socialist Platform, 1982, p.47
8. See J. Jacobs, Out of the Ghetto, Janet Simon, 1978, and P. Piratin, Our Flag Stays Red, Lawrence and Wishart, 1978, for contrasting accounts
9. Jacobs, p. 238
10. Ibid., p.238
11. Daily Worker, October 3, 1936
12. For example, Piratin; N. Branson, History of the Communist Party of Great Britain 1927-41, Lawrence and Wishart, 1985; N. Branson and M. Heinemann, Britain in the Nineteen Thirties, Panther, 1973. See also Arnold Wesker’s play Chicken Soup with Barley, and ‘Turning the Tide’, in Fighting Talk No. 1
13. Daily Herald, October 3, 1936
14. New Leader, October 9, 1936
15. F. Brockway, Inside the Left, Allen and Unwin, 1942, p.271
16. S. Bornstein and A. Richardson, Against the Stream, Socialist Platform, 1986, pp.202-3
17. Information from Daisy Groves and Arthur Shute
18. Daily Herald, October 1, 1936
19. East London Advertiser, October 3, 1936
20. Daily Worker, October 5, 1936
23. Daily Herald, October 5, 1936
24. Daily Worker, October 5, 1936
25. East London Advertiser, October 10, 1936
26. Daily Worker, October 5, 1936
27. Brockway, p.272
28. Daily Herald, October 5, 1936
30. Daily Worker, October 5, 1936
32. New Leader, October 9, 1936
33. Red Flag, October 1936
34. Daily Herald, October 6, 1936
35. Daily Herald, October 5, 1936
36. See M. Turnbull, ‘The Public Order Act 1936’, in Labour Review, January 1978
Published in Workers News, March-April 1994 | <urn:uuid:85fff7cc-e9e7-4e61-92c5-2179299ce787> | CC-MAIN-2022-33 | https://bobpitt.org.uk/the-battle-of-cable-street-myths-and-realities | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.971649 | 5,165 | 2.5625 | 3 |
Microsoft Windows Media Player contains a stack-based buffer overflow vulnerability that may allow a remote, unauthenticated attacker to execute arbitrary code on a vulnerable system.
Windows Media Player
Windows Media Player is a multimedia application that comes with Microsoft Windows.
For more information refer to Microsoft Security Bulletin MS06-024
A remote, unauthenticated attacker may be able to execute arbitrary code. If the attacked user is running with administrative privileges, the attacker could take complete control of an affected system.
Apply a patch from Microsoft
For a list of workarounds refer to Microsoft Security Bulletin MS06-024.
This vulnerability was reported in Microsoft Security Bulletin MS06-024. Microsoft credits Greg MacManus of iDEFENSE with providing information related to this vulnerability.
This document was written by Jeff Gennari
|Date First Published:||2006-06-13|
|Date Last Updated:||2006-06-13 21:22 UTC| | <urn:uuid:41361a66-0a73-476b-8946-1c20bbc14fbb> | CC-MAIN-2022-33 | https://www.kb.cert.org/vuls/id/608020 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.782226 | 288 | 1.8125 | 2 |
There are at least 5 ways to take screenshots in Windows 10 without having to install a third party app. Including using built-in screenshot app Snipping Tool. In case none of those ways can fulfill your needs, there are a bunch of third party screenshot tools you can use on Windows 10. One of which is Lightshot.
Lightshot is pretty simple yet powerful screenshot tool for Windows 10. Lightshot is particularly a great tool to work with your team remotely. It allows you to instantly upload the screenshot you took and share the URL to be accessed by your team members. The standout advantage of Lightshot is this app is extremely lightweight, just like its name.
Lightshot is a free screenshot tool. In addition to Windows, it is also available for Mac. This tool works on nearly all Windows versions, including Windows 10. To install Lightshot on Windows 10, you can first download the binary file (EXE file) of this app on its official site. Simply double-click the binary file to install Lightshot on your Windows 10.
Lightshot is a great tool if you are a blogger who often write tutorial articles involving desktop apps. It allows you capture certain actions on a desktop app and annotate it before you use it on your article. For instance, you might want to show the location of certain settings in Google Chrome via image. Lightshot also allows you to highlight certain text in case you want to take a screenshot of a text and share it to someone. Following are the features offered by Lightshot:
How to use Lightshot
Lightshot itself offers only a single mode. While other screenshot tools commonly allow you to capture the active window or entire screen, Lightshot requires you to select the screen area you want to capture yourself. It doesn’t offer neither an option to capture the active window nor option to capture the whole screen.
To start using Lightshot on Windows 10, simply launch the app of Lightshot on your Windows 10. You should see a Lighshot icon on the system tray.
Click the icon and your screen will turn into a bit dark. Lightshot will also turn the cursor into an area selector. To select the area you want to capture, click a start point and drag it according to the area you want to capture. Take a look at the screencast below.
Once you have selected an area, a floating menu will appear to allow you perform further actions like adding an arrow line, adding a straight line, adding texts, highlighting certain area or drawing a rectangle shape. To save the screenshot on your computer, you can click the floppy disk icon beneath the selected area.
How to upload the screenshot
Lightshot allows you to upload every screenshot you took. But first, you need to login before being able to do so. Lightshot allows you to login via either Facebook account or Google account. Uploading your screenshot can be a great option to work collaboratively with your teammates when you are not in the same room with them. You can upload the screenshots you took and allow your teammates to use them.
The screenshots you uploaded will be saved to the Lightshot server and you can manage the uploaded screenshots in the gallery feature offered by Lightshot. To login to Lightshot, right-click the Lightshot icon on the system tray and select Sign In.
A new tab will automatically open in your browser, asking you to login. Simply login with either your Facebook account or your Google account. Once you have logged in, you can upload every screenshot you took by clicking the cloud icon beneath the selected area.
How to capture certain actions
One of the downsides of Lightshot is that it doesn’t offer delay feature. You will need this feature to capture certain actions. For instance, if you want to write a how-to article and want to add some screenshots on your article, it would be great if the screenshots demonstrate certain actions, say choosing an option on a menu.
Although Lightshot doesn’t offer a delay feature, you can make use of a keyboard shortcut to capture certain actions using this tool. Simply perform the action you want to capture and press
Fn+PrintScreen. Next, select the area around the action to capture it.
Lightshot is a great screenshot tool you can you to replace the built-in screenshot tool on Windows 10, Snipping Tool. It is particularly a great screenshot tool to work collaboratively whereby you are allowed to upload the screenshot instantly and share it right away via direct link. In addition to Windows, you can also use this tool on Mac. Lightshot is extremely lightweight and free to use. | <urn:uuid:49706282-9515-4697-b5a7-2c010c22fe9e> | CC-MAIN-2022-33 | https://www.bettertechtips.com/windows/use-lightshot-windows-10/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.924571 | 973 | 1.554688 | 2 |
Discuss about the Four Basic Market Structures.
Dee beer Diamond Company has exercised monopoly through ensuring that the product they are dealing with has no close substitutes. In addition, the same product has a large number of buyers all over the world thus, controlling about 80% of the market share. They are in a position to set prices and influence the market ("AmosWEB is Economics: Encyclonomic WEB*pedia", 2017). Moreover their involvement in every category of industrial diamond mining: open-pit, underground, large-scale alluvial, coastal and deep sea, as well as aggressive advertising, make it hard for new market entrants thus maintaining the monopoly.
In a situation where the Dee Bee Company has to operate in a monopolistic environment, the company will lose the sole role of determining prices in the market. The company will also have to differentiate itself in the market by either branding or packaging in order to sell more. The market share will reduce from 80% to about 5%. The company will also seek alternative methods to lower its production cost in order to maximize profit (Mahoney, 2014).
The airline industry in the market cited by the study has dominant firms such Delta, as well as struggling firms such as the southwest airline. In addition, the companies ‘operating in this market are seen to be offering the same services differentiated class such as first-class, business class and economic class. Delta airline was the first to introduce flat-bed seats on flights from New York to London first class in an effort to attract more clients. The market has barriers to entry following aviation regulation for security and safety. The market has very high initial capital outlay that give first movers a minimum average cost advantage. In the case, southwest airline is frustrated in its efforts to penetrate the La Guardia market.
A careful analysis of the case study shows that the oligopolistic environment thatUnited and Continental Airlines are operating in seem to have a stable pricing, where by the competitive advantage that can help in wooing more clients is only providing better and quality services such as the flat bed seats by Delta ("Eyeing the Four Basic Market Structures - dummies", 2017) . The merger will help a lot in improving the services currently offered by the two airlines separately, as well as reduce the cost of operation. Moreover, they will have a wide customer base as they will pool together all their clients. In situations where the two companies decide to increase its prices, they will lose a large share of the market as they will become uncompetitive compared to other firms ("Market structures: Monopolies | Policonomics", 2017). If the firms reduce the prices of airlines, they attract a huge demand and increase the market share. The only barriers will be that the rest of the firms operating in the same market, as they might not allow the reduction of prices. Therefore the only way to ensure that they attain maximum profit on output is to collude with other airline firms and set a standard price, though collusion is illegal in oligopoly, tactical collusion is hard to detect and it is the only way that United and Continental Airlines can ensure that the oligopolistic market work for their good .
Eyeing the Four Basic Market Structures - dummies. (2017). dummies. Retrieved 19 January 2017, from https://www.dummies.com/business/marketing/eyeing-the-four-basic-market-structures/
Mahoney, D. (2014). Demand, Market Structure, Entry, And Exit In Airline Markets (Phd). University Of Oregon.https://scholarsbank.uoregon.edu/xmlui/bitstream/handle/1794/18338/Mahoney_oregon_0171A_10943.pdf?sequence=1
Market structures: Monopolies | Policonomics. (2017). Policonomics.com. Retrieved 19 January 2017, from https://www.policonomics.com/lp-market-structures-monopoly/
AmosWEB is Economics: Encyclonomic WEB*pedia. (2017). Amosweb.com. Retrieved 19 January 2017, fromhttps://www.amosweb.com/cgibin/awb_nav.pl?s=wpd&c=dsp&k=monopolistic+competition,+characteristics. | <urn:uuid:bfe68fd4-ca18-48b5-b57a-4a6bc07a0f20> | CC-MAIN-2022-33 | https://myassignmenthelp.com/free-samples/four-basic-market-structures | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.949142 | 898 | 2.578125 | 3 |
Human rights approaches to governing fisheries (Editorial)
- Human rights are about more than political and civil rights, they also include a bundle of “economic, social and cultural rights” which include rights to food, water, housing, and decent work, and the rights of children, migrants and women. Each of these rights has a legal framework supporting it, which forms the international architecture of human rights law. The "rights-based approach" to development argues that human rights are integral to development outcomes, as international human rights norms highlight the freedoms and capabilities of each individual, essential components of the human side of development. This special edition brings together contributions on human rights perspectives and approaches as applied to fisheries. The papers are written by academics, activists and international development agency workers. In fact, some of the contributing authors and editors defy these categorizations and all have maintained personal and professional networks across the interfaces between research, management and development, policy and activism.
- Gender
- Journal Article
- Springer Verlag | <urn:uuid:c91caf68-c338-40ba-b3be-4fdb9c74ecd3> | CC-MAIN-2022-33 | https://digitalarchive.worldfishcenter.org/handle/20.500.12348/1091 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.931605 | 258 | 2.640625 | 3 |
Russian Academy of Sciences: Yakutia to host unique research projects
Yakutia with its natural and climatic conditions can serve as a base for unique research projects in various areas ranging from bio-medicine to space exploration, according to President of the Russian Academy of Sciences Alexander Sergeyev.
In an interview with a RIA Novosti correspondent during The Arctic: Territory of Dialogue 5th International Arctic Forum, Sergeyev said that most Arctic regions were one huge area for hosting all kinds of research projects. By way of example, he mentioned Yakutia where annual temperature fluctuations may reach 100 degrees, ranging from abnormally low winter temperatures to scorching hot summer heat waves.
"For example, the republic can accommodate space exploration projects as well as those in the interests of Russian industry. It is very important to study the properties of materials of various structures and buildings, including gas pipelines, during such temperature fluctuations," he explained.
On the theme of permafrost, he noted the need to study the influence of its thinning layer on safety. "Yakutia can accomplish other very interesting tasks, including the creation of a national cryo-bank, as well as matters linked with human health in extreme conditions and energy supplies," Sergeyev said.
"To my mind, Yakutia should focus on the creation of new academic centers. For example, people in the republic are talking about setting up a new center in Oimyakon where the Pole of Cold is located. Its specialists will study the properties of structural materials and human health. This will be a major regional and, maybe, federal project. We will do our best to facilitate it," Sergeyev added.
The Arctic: Territory of Dialogue 5th International Arctic Forum was held in St. Petersburg on April 9 and 10. The State Commission for the Development of the Arctic convened for a meeting on April 9. | <urn:uuid:f004f850-b950-48bc-8fb1-a7562bf743cf> | CC-MAIN-2022-33 | https://arctic.ru/forumarctica/20190409/845524.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.957 | 385 | 1.960938 | 2 |
Bread loaves are one of the most basic ingredients a student can purchase. This is because it can be used to make sandwiches that are varied in filling. On the other hand, rolls are not as versatile as bread loaves but can be more quickly consumed. This is incredibly convenient for a student who is looking for a quick bite. The following options will provide students with the proper London student bread experience check.
Hovis Original 7 Seeds Bread 800G
This pack of bread is considered to be relatively filling at a reasonable price. This will allow you to make sandwiches that fill your stomach without using too many other ingredients thus increasing the amount of sandwiches you can make.
New York Bakery Plain Bagels 5 Pack
This bagel pack will provide you with 5 bagels that can make a hearty breakfast. A single bagel is large enough to fill one’s stomach on its own but a bagel with added ingredients would be even better. | <urn:uuid:31da792c-50cf-4e63-9740-ba7cb9876c2d> | CC-MAIN-2022-33 | https://konsultanpendidikan.com/2021/02/14/london-series-bread-and-rolls/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.926771 | 207 | 1.523438 | 2 |
Established in 1876, the Certified Public Accountant (CPA) certification is one of America’s oldest and most respected accounting certifications. Yet, its heyday may have come and gone, because the CPA candidate cohort size is not what it used to be.
While no one can predict the future, we can investigate reasons for the current state of candidate numbers. With this information, we can speculate if the certification’s glory days are indeed behind us or if the CPA’s influence in accounting can make a resurgence.
In the first article of this series, I will examine the CPA cohort’s reduced size and three factors affecting it.
The Overall Decline in CPA Cohort Numbers
NASBA has been gathering CPA Exam candidate data since 1982 and publishing performance reports since 1985.
From 1983-1993, the number of candidates averaged 140,479. In 1994, when the exam experienced its first major restructure, the population dropped from 140,232 to 130,801.
Then, in 1996, the exam became non-disclosed. Initially, candidate numbers experienced a minor dip, dropping from 126,433 in 1995 to 121,933 in 1996. However, they fell regularly for the next six years, only rising twice until they plummeted in 2004.
In 2003, the candidate population was 109,872. The next year, it was 44,513. The cause of this unprecedented landslide? The launch of the computerized CPA Exam.
Since then, candidate numbers have been modest at best. Over six years, they slowly climbed back to six digits, peaking at 103,609 in 2010. Then, they fell again, though less severely: The population averaged 92,543 until 2016, when it bumped up to 102,323. But after major exam changes in 2017, the total slipped to 95,654.
Factors Affecting the Reduced Popularity of the CPA
Clearly, exam changes bring candidate numbers down. However, even these don’t explain the non-existent recovery to the averages of the 80s and 90s. So, for further insight into this phenomenon, we must consider other developments in the CPA certification industry to see if they account for the loss of candidates.
In the last 20 years, the following events have occurred:
1.The state boards implemented stricter education requirements
In 1983, Florida became the first state to require 150 credit hours of higher education for the CPA license. Then, in 1989, the AICPA recommended other states follow suit. Many did in the late 90s, and by 2015, 54 of the 55 jurisdictions had adopted the 150-hour rule.
The 150-hour rule seems to increase pass rates: For example, Florida’s doubled after implementation. However, the number of first-time candidates sitting in the Sunshine State also fell to almost nothing before creeping back to a fraction of past highs.
The number of Florida candidates has rebounded, but as the 150-hour rule became the standard, the candidate population of many states suffered the same fate. Specifically, studies show that the CPA candidate population has decreased by 15 percent as a result of the rule. The numbers of the late 2000s demonstrate this regulation had a permanent impact.
The switch from the paper-based to the computer-based test improved pass rates while thinning out the candidate population. The demand for more education came at the same cost.
2. The state boards have also enforced more stringent experience requirements.
The CPA experience requirement has changed in the last decade. Thanks to the Uniform Accountancy Act (UAA), most state boards no longer require two years of public accounting experience. Instead, they accept just one year of any work involving accounting or business skills. As a result, in some ways, fulfilling the experience requirement is a bit easier.
In other ways, though, it is now harder. In the last five years, most state boards have specified that an active CPA must verify a candidate’s work experience. While a few jurisdictions allow a “CPA equivalent,” most require a fully certified professional accountant. Some even stipulate the verifier must be a direct supervisor.
For international candidates and those who didn’t work in public accounting, securing a CPA supervisor is a challenge. So, in 2016, NASBA launched its CPA Verification Service, which allows candidates to meet the requirement more easily. However, only 11 jurisdictions currently offer this service, and the cost is steep: $500 for domestic experience verification and $700 for international.
Therefore, the demand for a CPA verifier overshadows the reduced length of the experience requirement and still leaves many individuals out of the candidate cohort.
3. Exam fees have increased
When the CPA Exam was paper-based, the state boards charged candidates $200 to sit for all four sections the first time. Then, depending on how many sections you failed, you paid less for retakes.
However, from 1998-2001, the AICPA was operating at a deficit, so fees rose. In 2001, candidates applying to a state board using NASBA’s CPA Exam Services (CPAES) had to start paying a fixed fee for each section no matter the number of retakes. Initially, the fee varied based on section length. But eventually, the length and cost of each were the same. Consequently, the exam fee increased over the last two decades in the following way:
Now, candidates must pay over four times more to sit for each exam section the first time than they did in 2000 and before. As $200 in 2000 is $292.73 today with inflation, the CPA Exam price spike seems high enough to keep candidates away.
First Impressions and Additional Factors
The appearance of harsher requirements and higher fees corresponds with decreases in the CPA candidate population. And while reverting back to more lenient requirements and lower fees is theoretically possible, it is highly unlikely.
What’s more, some of the other factors affecting the numbers are not adjustable. We will discuss these other factors in this series’s second article and get a better sense of just how long term these lowered CPA candidate numbers are.
Stephanie Ng is the author of How to Pass The CPA Exam (published by Wiley) and publisher of several websites containing helpful information about accounting certification exams. As a licensed CPA (not in public practice), Stephanie recalls her own experience as an accounting... | <urn:uuid:db93248d-ed7a-491d-8882-c239e1812fd8> | CC-MAIN-2022-33 | https://www.accountingweb.com/practice/growth/why-cpa-candidate-numbers-have-decreased-part-1 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.946113 | 1,343 | 1.875 | 2 |
Photo: Steven Zolneczko/Flickr
It would have to be the worst nightmare of a train passenger, not to mention the poor cow.
French media reported on Thursday that a train in northern region of Normandy lost control of the brakes after crashing into a cow on the tracks.
“After hitting a cow, a train lost its capacity to stop and ran adrift,” said the Sud-Rail union.
Rail operator SNCF refused to comment until an investigation had been carried out, but confirmed that an incident occurred at 8am on Tuesday near the station of Ferqueux.
For the next 19 kilometres, the train was a runaway on what was thankfully a track that doesn't see a lot of traffic.
It remains unknown exactly what speed the train was travelling at, but by the time it reached an upwards slope, the driver managed to jump out and wedge the wheels so it wouldn't roll backwards again, reported Le Parisien.
The fate of the cow remains unknown.
The incident marks the second time a TER regional train has made headlines this week.
On Wednesday, a train in western France collided with a truck, injuring 15 people. It remains unknown why the truck was on the tracks, but an investigation has been launched. | <urn:uuid:9a4b1dc0-d1d7-42db-82e9-621dc27a3b31> | CC-MAIN-2022-33 | https://www.thelocal.fr/20151022/runaway-french-train-travels-for-19km-after-hitting-cow/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.972438 | 259 | 1.867188 | 2 |
Want to make flying drones? Your first step is to understand how flying works. And to this end, Stanford students are fiiiilllmmmiiiing biiiiiiirrrrrdddd fliiiiiiiightttttt iiiiiiinnnnn sloooooooooooooooooooow mooooooooooooooooootion.
Really, it’s that slow. “We can spread a single wing beat across 40 frames,” says the professor running this operation. That’s slow. That’s, like, ladies-room-line slow. Bill-getting-through-Congress slow.
And, yup, they’re using their powers of knowledge for evil! Or, well, drones aren’t good or evil in and of themselves. They can be used for both. They can even be used for tacos. But we’re not totally sure what use tiny, fast-flying drones have other than spying or delivering deadly diseases in a coordinated bioattack on America. Or delivering Taco Bell, which is really just as bad. | <urn:uuid:dfed72f8-1837-445b-ac9a-a1af9bfc2c3b> | CC-MAIN-2022-33 | https://grist.org/living/high-speed-video-shows-how-crazy-birds-look-in-very-very-very-slow-motion/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571222.74/warc/CC-MAIN-20220810222056-20220811012056-00672.warc.gz | en | 0.850115 | 235 | 2.59375 | 3 |
Setting big goals has become my M.O.
I learned in 2018 that setting small goals doesn't work because they aren't inspiring. Big, crazy goals make you think bigger, think in ways that small goals just don't inspire.
What if it WAS possible?
What would I do if I knew that I could actually do it?
What am I willing to try doing even though it probably won't work?
What would it take to make it possible?⠀
Who would I need to be to make it happen?
If I had already achieved this, what would I say to someone else going after it too?
Those are excellent questions! Those are the kinds of questions that help us grow, and reach higher than we ever thought you could.
And when we don't reach a big, crazy goal? It doesn't mean that we are failures, it simply means that we are not yet the person for whom that goal would be easy. And that is ok. We are stretching, we are growing, and if we keep trying, we will become the person for whom reaching that goal will be a piece of cake.
A few months ago I asked for guesses on what my 2019 Giveaway Goal would be. I got answers from 150,000 to 300,000.
So those of you who guessed that my 2019 Giveaway Goal would be 300,000, you are right my friend.
Honestly I was going to do 250,000 for the goal, but when Ashely said "Knowing you - you doubled to 300,000!", I had a little a-ha of my own.
Yes! I should double it. So I did.
It's a crazy, impossible goal, or at least I thought it was, but after seeing January's numbers (over 23,000!), it doesn't seem impossible anymore! At least not as impossible as it was!
I don't know if the goal will stay at 300k, I may have to raise it in a few months if January isn't just a huge, abnormal rush. Last January was big in comparison to the following months, so maybe that's the "new year's resolution" reaction. I will wait and see what the next few months have in store, and reevaluate.
I want the goal to be one I won't hit. If that sounds weird, it is. Usually people set "realistic" goals, but not me, I set big, crazy goals that are out of reach on purpose, because small goals keep me playing small. Impossible goals open up my mind to the question "but if it WAS possible, how could I do it?"
So there you have it, the 2019 Giveaway Goal is 300,000 FREE charts, at least for the time being that is what it is.
I can't wait to see what God has in store for Debt Free Charts this year!
January 2019 - Wowzers!!! 23,050 FREE charts given away in January! That's just, well, mind blowing! I had to go back and count it again LOL. That's more than TRIPLE last January!
February 2019 - Even with the after January slip, this month still came in with 14,444 free charts given away, our third highest month EVER!
March 2019 - Another huge month with 21,073 charts given away! Thanks in part to the release of a brand new style of chart - Debt Free Land - makes paying off debt a game!
May 2019 - Another impressive month (well honestly, this entire thing still shocks me, will I ever get used to it?) with 19,456 charts given away, boosted by the release of the Game of Loans chart.
August 2019 - We've blown past the 2018 Goal (which we didn't reach last year) and WOW! I'm just speechless at the August numbers! 30k!
December 2019 - What an amazing year! I learned so much in trying to reach this goal, and the biggest lesson was that what I am doing isn't doing much. These numbers were all very organic. It didn't make much difference if I posted and emailed, or not. I can now say that this is not me. This thing has a life of it's own, and I am just honored and humbled that my little charts are part of whatever this is.
So what's next? What is my goal for 2020? I'll be posting that soon... | <urn:uuid:e92dbd61-b99c-4faa-ab67-8704dec3cb7d> | CC-MAIN-2022-33 | https://debtfreecharts.com/blogs/dfc-blog/free-charts-and-impossible-goals | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571222.74/warc/CC-MAIN-20220810222056-20220811012056-00672.warc.gz | en | 0.982421 | 914 | 1.53125 | 2 |
A problem with your Ocean Pines, Maryland, home’s plumbing could cause severe damage and force you to get costly repairs. Even a tiny leak can cause water damage over time. To find plumbing issues early, watch out for bad smells, discolored water, or pests.
Excess moisture from a leak or another plumbing problem could lead to biological growth. This can cause asthma or allergy symptoms, rashes, eye irritation, fatigue, headaches, or other health issues. It can also create a musty or stale smell. If you see stains or cracks in your house’s caulk near the area where the scent is strongest, you should have a plumbing professional, such as Custom Mechanical, inspect your home. You should also get help from an expert if you notice a sulfur or sewage odor, which can indicate a sewer leak in your home or your yard.
If the water looks cloudy or discolored when it comes from your faucet, you need a plumber. Air in your pipes causes cloudy water, while rusty water is usually brown or yellow. If you have copper pipes, corrosion could make your water look green. Your home’s pipes could be discolored, and your tap water might taste metallic as well.
Pests such as mice, cockroaches, and silverfish are often attracted to water coming from a leaky pipe. A warm house also makes great shelter in cold weather. These pests can get in through damaged or broken sewer lines or through small cracks in the insulation around your doors or windows. Some creatures can crawl up your sink, and rodents can chew through PVC piping.
Custom Mechanical has more than 35 years of plumbing and HVAC experience. We can help you keep your plumbing in excellent condition and make sure that your home stays comfortable. For skilled, friendly service from our professionals, call us anytime at 877-696-0808. We’re a family business and are ready to serve you at any time.
Image provided by Shutterstock | <urn:uuid:da027000-4670-4a66-8cdd-38d3c063e807> | CC-MAIN-2022-33 | https://www.custommechanical.com/blog/3-signs-of-plumbing-problems | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.944346 | 423 | 1.65625 | 2 |
Many have argued that the introduction of the new qualifier format in 2001 have benefitted the so-called stronger countries more so than the weaker counties. In short the qualifier format allowed losing teams in the provincial championships to enter the ‘qualifiers’ for a place in the All-Ireland quarter finals. To look at this is more detail, an index can be calculated based on how similar (or dissimilar) the counties that reach a particular stage are compared to the same stage the previous year. For example, if 5 teams that reach the quarter final stage in 2012, also reach the quarter final stage in 2013, the value of the index is 5/8 = 0.625. So if the value equals 1, the same teams are in the quarter final (or semi-final stage) as compared to the previous year. If the value equals 0, there are entirely new teams.
The index values are calculated from the 1970’s onwards to observe any differences in the long term trend. Three graphs based on the results of the analysis are presented below. The first is based on data of the teams that reached the provincial final (effectively the quarter final stage before the introduction of the qualifier format in 2001) or the quarter final stage post 2001. The second graph adds in the values of the indices using the teams that reached the provincial final from 2001 onwards. Essentially this presents a comparison between what happened and what would have happened without the change in format. The final graph is based on the teams that reached the semi-final stage of the championship.
Figure 2 is interesting as for most years post 2001, the ‘similarity’ of teams reaching the quarter final stage is higher under the new qualifier format than compared to the old provincial format (if that was continued). In the years 2009-2012, the gap is especially wide although it has closed again in 2013. There are only two years, 2007 and 2008, where the old provincial format generates a higher similarity index compared to the new qualifier format.
As Humphreys (2002) states “Competitive balance reflects uncertainty about the outcomes of professional sporting events” pg 133. So a Mayo win in the All Ireland Football final in four weeks’ time will be welcome from the neutrals perspective but it still doesn’t get around the potential problem that the GAA have where the top 8 and top 4 in the competition are getting easier and easier to predict. | <urn:uuid:66f2c605-078e-401d-b23e-df513979d2b7> | CC-MAIN-2022-33 | https://www.sportseconomics.org/sports-economics/more-competitive-balance-in-gaelic-football | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.939124 | 493 | 2.140625 | 2 |
Ed. 17-18 Triple Minor Longways
F Major AABB adlib
A1 1-4: 1st Man turn and run quickly to the corner of the Room, his Partner and the 2nd Couple running after him.
A1 5-8: Then the 1st Woman run to her corner of the Room, the other three following.
A2 1-4: 2nd Man do the same to his corner, the others following.
A2 5-8: Then the 2nd Woman to her original place, the others all following to their places.
B1 1-8: 1st Couple cross over and go the whole Figure with the 2nd Couple, ending in the 2nd Couple’s place.
B2 1-4: 1st Couple lead through the 3rd Couple, and cast back up to the 2nd Couple’s place.
B2 5-8: Then turn your Partner once around.
Repeat down the line. | <urn:uuid:a1656b65-f453-41fd-b139-c8e0e76e4196> | CC-MAIN-2022-33 | https://playforddances.com/dances/gun-fleet/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.950697 | 216 | 2.140625 | 2 |
Extension Master Gardeners love to grow. We grow plants in our gardens, cultivate knowledge through continuing education, but most of all, Master Gardeners love developing friendships and connections within the community.
As part of Virginia Cooperative Extension, we’re always looking to strengthen our networks through collaboration. Extension Master Gardeners do a lot of important work in the community centered around education, horticulture, and working outside. We bring important skills and knowledge into communities regarding the domesticated plants we grow in our gardens, but what about those wild plants and animals that we encounter in the flower beds? | <urn:uuid:f3bfed83-0a44-4727-9c16-92bd8cd9d74b> | CC-MAIN-2022-33 | https://blogs.ext.vt.edu/master-gardener-program/2018/10/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.913962 | 120 | 2.171875 | 2 |
1987, dir. Jörg Buttgereit
With Dakatari Lorenz, Beatrice Manowski, and Harald Lundt
Centering around the bizarre love triangle of a necrophiliac German couple and their newly obtained corpse, NEKRomatik became infamous for its transgressive subject matter. Using necrophilia as a metaphor for the denaturalization and dehumanization of contemporary society, director Jörg Buttgereit sought to expose the underlying psychology of those desperate to control others because of their own feelings of overall powerlessness.
Originally released on VHS, NEKRomatik was only made available due to video rental stores' desire to offer the largest catalogues possible. European directors like Buttgereit took advantage of this, using the VHS market to create a new kind of social commentary that resonated with audiences throughout the globe. NEKRomatik now stands among the most talked-about independent international films.
Museum of Arts + Design (View)
2 Columbus Circle
New York, NY 10019
|Kid Friendly: No|
|Wheelchair Accessible: Yes!| | <urn:uuid:519fd761-612e-4c84-aed0-ab029276903d> | CC-MAIN-2022-33 | https://www.brownpapertickets.com/event/238055 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571222.74/warc/CC-MAIN-20220810222056-20220811012056-00672.warc.gz | en | 0.879735 | 279 | 1.53125 | 2 |
Microsoft Dynamics Lifecycle Services has a new feature you’ll want to check out: Cloud powered support! Cloud powered support helps you manage support incidents.
How it works
Cloud powered support lets you create a virtual machine (VM) in Microsoft Azure that has the same hotfixes installed as your local environment. You can reproduce and record the incident on the virtual machine, and then submit the VM to our support team. Our support team follows up by investigating the incident, testing a fix on the virtual machine, if a fix is found, and sending the VM and the fix back to you for verification.
Note: Virtual machines are only available for Microsoft Dynamics AX 2012 R2 and AX 2012 R3 environments.
The following flowchart illustrates the process of using Cloud powered support.
How to learn more
See the Cloud powered support (Lifecycle Services, LCS) article on TechNet. | <urn:uuid:5667ed86-8195-4024-9361-3fb5c9defa93> | CC-MAIN-2022-33 | https://cloudblogs.microsoft.com/dynamics365/no-audience/2014/06/09/ax-content-cloud-powered-support/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.891572 | 182 | 1.570313 | 2 |
*This story was updated.
Upon taking the position of new director and CEO of the Ethical Journalism Network last April, journalist Hannah Storm argued that it is only possible to build truly ethical journalism if gender is on the agenda and in practice in newsrooms with the aim of advancing equality between women and men.
This observation has been echoed in newsrooms around the world in recent years, as in the U.S. newspaper The New York Times, the Spanish newspaper El País, the British news agency BBC and now in Brazil’s Folha de S. Paulo, which in early May announced the creation of the position of editor of diversity at the newspaper.
But while the initiatives of the NYT, El País and BBC focus on promoting gender balance in their teams and in the content they produce, Folha decided to embrace the challenge of "reflecting the variety of social life in Brazil," according to the newspaper, which had the largest circulation in the country, with 332 thousand copies (print and digital) in March, according to the Instituto Verificador de Circulação (IVC).
This variety includes "diversity of gender, ethnicity, social class, race, color, religious belief, disability, sexual orientation, age and political leanings."
The newspaper’s editor-in-chief, Sérgio Dávila, told the Knight Center that he had detected the need for the newspaper to have a person to deal with the issue for more than a year. Such a need was evident, according to him, when the most recent survey on the newspaper's readership profile, carried out at the end of 2017, found a decrease in the percentage of Folha's women readers (the newspaper does not share specific data about its readers).
Paula Cesarino Costa, who was the newspaper's ombudsman between April 2016 and May 2019, was chosen to occupy the new post. She has worked for Folha since 1987 and was director of the newspaper’s branch in Rio de Janeiro and newsroom secretary.
"During my three years as an ombudsman, that was one of my concerns," Costa told the Knight Center. "In several columns and in the daily internal criticisms that I did for the newsroom, I pointed out a few moments in which I found that there was a lack of diversity, taking into account that this is increasingly fundamental for today and today's journalism."
In addition to paying attention to the subject, Davila said, Costa "has been in house for more than 30 years and knows what Folha is all about, so having a clear picture of the newspaper’s history makes it easier to help change. Taking these factors into account, I think she was the ideal person to be the first occupant of the post."
The editorial area of diversity is "horizontal," Dávila explained, and Costa will be free to get involved and act in all the newspaper's editorial areas.
"She is an editor whose team is the entire newspaper, the 300 journalists who work at Folha. She has influence over all of them," he said. "She participates in the morning meeting, which defines the next day’s print version; in the weekly meetings, that we have to discuss the main issues of the coming week; and in special product meetings. So she has open access to the whole production process of the newspaper."
This open access aims to allow Costa to act on four pillars, according to Dávila: "The first is to take care of the diversity of the newsroom, of those who make the product. The second is to mind the diversity of those we hear from to make the product, meaning, the sources. The third is to take care of the diversity of those who write for the newspaper, such as columnists, article writers, bloggers. And the fourth is to act in the hiring process, to influence the replenishment of the newsroom."
Although Folha does not have an up-to-date census of its reporters, Dávila said that women and men are represented equally among its journalists, "with a slight predominance of women."
But if gender distribution "is not a problem" at the newspaper, in a country where 55.8 percent of the population is black, "the question of race is" with white people disproportionately represented, he said. "[Ethnic-racial] minorities are still minorities in Folha's newsroom and I do not need the census to say it, just walk through the newsroom."
The mapping of Folha's newsroom is one of Costa's first tasks as editor of diversity. "The base of everything has to be, first, the survey of what the paper is today," she said. "From the profile of the team, who are the Folha journalists, where do they come from, what is their formation; how is the division and who are the columnists: how many are black, white, men, women, how many are from São Paulo. The census is essential because otherwise it is very difficult to create a goal."
The diversity in the newsroom is important so that the diverse life experiences of the reporters are reflected in journalistic production, Davila said.
"We, journalists, tend to be – at least those of us in mainstream Brazilian media – members of the middle or upper middle class, who live in the expanded center of São Paulo, in the case of São Paulo journalism. It is a repertoire of experiences and coexistence and personal relationships that lies within a bubble. I want people to pierce this bubble also in terms of economic, housing, professional experience, student background," he said.
The idea is that by popping this bubble, the newspaper can "talk more and listen more to people who live on the periphery of São Paulo, for example," he said. "The majority of the population of São Paulo does not live in the expanded center, but in the fringes, and I think those fringes are not really arriving at the newspaper as a topic.”
Another important analysis will be to understand who are the sources heard from for the newspaper’s reports, since "it is no use changing who does and who writes, if you do not change who is heard in the making of the stories," Davila said.
"I do not say that it is a prejudice of the journalist, but because there is a predominance in itself, and that is historical in society, of always listening to the academic specialist, white, heterosexual," he said. "It's almost by default: when you think of a subject, you think of calling Dr. So-and-so, and that doctor is certainly a man and white. So she's also starting to work on this, which is perhaps one of the most important things.”
Costa said she has received many positive responses since the announcement. "It's something that brought a lot of excitement inside and outside the newspaper. I got a lot of messages from people saying 'yay, that’s great'; people from inside the newspaper who gave me suggestions, as well as interested outsiders. You can see that it is indeed an urgent matter," she said.
The new editor also said she had been looking for content and had heard from a lot of people inside and outside the newspaper on the theme of diversity, to format her work in the new post.
"In several newspapers around the world there are experiences with editorial areas for gender, they will be very useful for us. But the problem is to expand, because in a way it is simpler to make a program of action on gender alone,” she said. “As we want to extend the question also to race, location, religion and others, it is a little more complex, that we will have to learn and devise.”
*This story was updated to correct information on Folha's circulation numbers. | <urn:uuid:45297d24-50cb-4ac3-952a-7eb89b7c3bbf> | CC-MAIN-2022-33 | https://latamjournalismreview.org/articles/with-new-diversity-editor-brazils-folha-plans-to-expand-the-variety-of-voices-and-stories-told-by-the-newspaper/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.979204 | 1,629 | 1.890625 | 2 |
Ocean plastic waste probably comes from ships, report says
Most of the plastic bottles washing up on the rocky shores of Inaccessible Island, aptly named for its sheer cliffs rising from the middle of the South Atlantic, probably come from Chinese merchant ships, a study published Monday said.
The study offers fresh evidence that the vast garbage patches floating in the middle of oceans, which have sparked much consumer hand-wringing in recent years, are less the product of people dumping single-use plastics in waterways or on land, than they are the result of merchant marine vessels tossing their waste overboard by the ton.
The authors of the study published in the Proceedings of the National Academy of Sciences, or PNAS, collected thousands of pieces of waste during visits to the tiny island in 1984, 2009 and again in 2018.
The island is located roughly midway between Argentina and South Africa in the South Atlantic gyre, a vast whirlpool of currents that has created what has come to be known as an oceanic garbage patch.
While initial inspections of the trash washing up on the island showed labels indicating it had come from South America, some 2,000 miles (3,000 kilometers) to the west, by 2018 three-quarters of the garbage appeared to originate from Asia, mostly China.
Many of the plastic bottles had been crushed with their tops screwed on tight, as is customary on board ships to save space, said report author Peter Ryan, director of the FitzPatrick Institute of African Ornithology at the University of Cape Town in South Africa.
Around 90 percent of the bottles found had been produced in the previous two years, ruling out the possibility that they had been carried by ocean currents over the vast distance from Asia, which would normally take three to five years.
Since the number of Asian fishing vessels has remained stable since the 1990s, while the number of Asian—and in particular, Chinese—cargo vessels has vastly increased in the Atlantic, the researchers concluded that the bottles must come from merchant vessels, which toss them overboard rather than dumping them as trash at ports.
"It's inescapable that it's from ships, and it's not coming from land," Ryan told AFP.
"A certain sector of the merchant fleet seems to be doing that, and it seems to be largely an Asian one," he said.
There are two distinct types of marine pollution.
On the one hand, there are the beaches around urban centers: the plastics that are found there come from coastal areas, and include bottles, bags and packaging. But these things sink easily and are less likely to be carried far by currents.
Farther out in the oceans, the garbage patches contain fragments of objects of unclear origin, as well as items used by cargo ships and fishing fleets: not just the bottles emptied by the ships' crews, but also nets, ropes, buoys, crates, barrels and floats.
"It's an underappreciated cause of pollution," said Ryan.
Half of the great Pacific garbage patch is made up of fishing nets, by weight, according to a report published last year in Scientific Reports.
Oceanographer Laurent Lebreton, one of the authors of the latter report, said that the oft-quoted figure of 80 percent of plastic pollution coming from the land does not apply to the high seas.
He recalled having found huge clusters of nets created by fishing vessels in the North Pacific, known as "fish aggregating devices" to attract fish.
"Often they don't retrieve them and they are lost. We have found several tons of them," said Lebreton, of the organization The Ocean Cleanup.
"Everyone talks about saving the oceans by stopping using plastic bags, straws and single use packaging. That's important, but when we head out on the ocean, that's not necessarily what we find," he told AFP.
© 2019 AFP | <urn:uuid:01666135-4875-414f-8842-08b8a84ef2a8> | CC-MAIN-2022-33 | https://phys.org/news/2019-09-ocean-plastic-ships.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.976105 | 799 | 3.4375 | 3 |
Cigars, Whisky, & Winning Leadership Lessons from General Ulysses S. Grant
by Kaltman, Al
Product Type: Bargain Books
List price: $14.00 | Save 45%
Ulysses S. Grant was a perceptive and surprisingly modern manager, who learned from his own and others' successes and failures. He was adept at seizing and exploiting opportunities as they presented themselves. Kaltman uses Grant's military career, beginning with his enrollment at West Point through his early successes in the Civil War to his eventual command of the entire Union Army, to illustrate 250 basic principles of business success, from "Bureaucrats do the dumbest things" to "You can't stop the clock." In an afterword, Kaltman considers how President Grant failed to live up to the principles of teamwork and planning that led General Grant to victory, with a resultant career as chief executive whose legacy has been less than stellar. | <urn:uuid:f1eed142-1293-4c2b-94dd-417bd0ad55b6> | CC-MAIN-2022-33 | https://bookoutlet.com/products/9780735201637B/cigars-whisky-winning-leadership-lessons-from-general-ulysses-s-grant | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.97453 | 204 | 2.046875 | 2 |
Homo erectus wandered around for about a million years before deciding to evolve into something resembling you and me. About half a million years ago, humans took two divergent evolutionary paths: Busy Man, Homo occupatus, and Relaxed Man Homo relaxatis.
Busy Man, h.occupatus
During the Stone Age, Busy Man (h. occupatus ) invented war, the wheel, and the interminable business meeting.
Oog was one of those cave dwellers who just couldn’t hang loose. With manic ferocity, he spent his days smashing bits of rock together. He called this activity invention. He named his latest effort the wheel.
Oog’s invention was a success. The marketing literature said it had “possibilities.” This left many people scratching their heads. Yet early adopters wanted a wheel, or maybe even two. They eagerly anticipated his next release.
With the business proceeds, Mrs. Oog redecorated the cave. But she suffered. Oog’s success only led to more and more activity. Oog himself was rarely home. And when he was at home, he was tense. The only subject of conversation was his wheel.
She wanted them to do some star gazing, or sit around the fur-lined cave in front of the fire. But he said he didn’t have the time.
Oog built a work-cave.
Oog spearheaded stone-age commerce. He sold his wheels to the Flint Group, a local cutlery business. Later, he became famous for inventing the business round table based on his original wheel design.
With the launch of FlintBrand, his future looked bright. That was until his life was cut short in a rolling accident.
As time marched on, Busy Man’s tribe—never content with inactivity—up and left the caves for greener pastures.
And this was a bit of luck for tree dwellers.
Relaxed Man, h.relaxatis
Relaxed Man, h.relaxatis, eventually explored the primeval forest floor, more by accident than design.
Relaxed Man wasn’t one for unnecessary activity. His tribes decided that it was quite nice up there in the trees; especially now the noisy neighbors had left. The leaves were comfy and the food wasn’t bad at all.
The Fall of Man or what some people call The Great Slippage led to the discovery.
When h.relaxis, picked himself up from a long fall to the forest floor, he found abandoned caves in move-in condition. There wasn’t a lot to do, so he wandered about beneath the giant trees and wondering about the meaning of life.
That was until the discovery of the primeval hammock. | <urn:uuid:dadba0bf-3503-4b80-ae5f-a594e2b8ea69> | CC-MAIN-2022-33 | https://www.slowdownnow.org/relaxed-man/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.976597 | 591 | 3.03125 | 3 |
While we humans keep on struggling to see one another, emotionally intelligent AI has advanced rapidly.
The most progressive ones can even differentiate faked feelings from genuine ones.
Also, voice recognition and natural language processing algorithms are showing signs of improvement at discovering our opinion and emotional state from the audio.
The technologies that analyze emotional responses from faces and voice are as of now way beyond the aptitudes of a normal human, and in numerous areas surpass the capacities of even the most skilled people.
Although emotional AI is not widespread, tech goliaths and startups in different segments, including automotive and retail, have put resources into making their technology more human through computer vision and voice recognition.
While organizations need to make further connections with their shoppers by building and deploying emotional AI technologies, responsibility measures should be included.
As we move into a touchless, automated time, the competition to consummate these advancements follows; nonetheless, programming testing should be top of mind to give a frictionless, high-quality digital experience that results in effective results for all included.
Testing the customer experience should be executed for online organizations, as this will find weak areas of an application or gadget, and permit groups to fix any issues with the product.
No More Waiting ☺ Subscribe to our newsletter! | <urn:uuid:782e1d93-a842-4c1c-a761-e810f5a17ade> | CC-MAIN-2022-33 | https://aibots.my/officialBlog/the-growing-importance-of-emotional-ai/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.945137 | 257 | 1.835938 | 2 |
From Bruce Schneier:
Major newspapers do their best to verify the authenticity of leaked documents they receive from sources. They only publish the ones they know are authentic. The newspapers consult experts, and pay attention to forensics. They have tense conversations with governments, trying to get them to verify secret documents they’re not actually allowed to admit even exist. This is only possible because the news outlets have ongoing relationships with the governments, and they care that they get it right. There are lots of instances where neither of these two things are true, and lots of ways to leak documents without any independent verification at all.
No one is talking about this, but everyone needs to be alert to the possibility. Sooner or later, the hackers who steal an organization’s data are going to make changes in them before they release them. If these forgeries aren’t questioned, the situations of those being hacked could be made worse, or erroneous conclusions could be drawn from the documents. When someone says that a document they have been accused of writing is forged, their arguments at least should be heard.
As someone who routinely receives, and consults on, leaked documents I can emphatically say this is a serious issue. And that journalists are generally very cautious these days about publishing based on mysteriously sourced documents. | <urn:uuid:92013da8-0212-485c-ba0b-14ccbabb4079> | CC-MAIN-2022-33 | https://excited-pixels.com/tag/leaks/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.96601 | 264 | 1.96875 | 2 |
A Game of Thrones: The Board Game, A Dance with Dragons
Brighten It Up With This Helpful Landscaping Advice! Nine Dragons Housing Complex designed by YKH_Lab features 9 residential towers set upon a green the Seven Kingdoms hangs in the balance. In the east, Daenerys, last scion of House Targaryen, her dragons grown to terrifying maturity, rules as queen of a city Autumn Renata Piskorska photography Dungeons And Dragons, Fotokonst, Landskapsfotografering, Naturlig Skönhet, Höst. Besök. Sparad från.
You can unsubscribe at any time. Enter email address. Buy A Landscape with Dragons : Christian and Pagan Imagination in Children'S by O'Brien, Michael online on Amazon.ae at best prices. Fast and free shipping free returns cash on delivery available on eligible purchase. EIYQ7U7DAS2N » Doc » A Landscape with Dragons: The Battle for Your Childs Mind Related Books DK Readers Invaders From Outer Space Level 3 Reading Alone DK Readers Plants Bite Back Level 3 Reading Alone Dont Line Their Pockets With Gold Line Your Own A Small How To Book on Living Large DK Readers Day at Greenhill Farm Level 1 Beginning to Read The truth of the matter is, most boys, unless they are mentally disturbed, quickly learn that it is far more heroic, exciting, and rewarding to protect a little sister with that very sword by chasing off dragons and bullies.” – Michael O’Brien, A Landscape with Dragons (p. 36-37) book A Landscape with Dragons, Harry Potter critic Michael OBrien examines contemporary childrens literature and finds it spiritually and morally wanting.
your child's A Landscape With Dragons Quotes by Michael D. O'BrienA Child's Mind A Landscape with Dragons - Ignatius PressMichael O'Brien (Canadian. In his book A Landscape with Dragons, Harry Potter critic Michael O'Brien examines contemporary children's literature and finds it spiritually and morally wanting 17 Feb 2010 Hieromonk Damascene, citing Gregory of Nyssa, argues clearly that imagination is a faculty that is aligned with man's fallen nature, and is not A LANDSCAPE WITH DRAGONS. Author MICHAEL D. O'BRIEN.
Great Waves: Chinese Themes in the Arts of Korea and Japan
268 pages. The Harry Potter series of books and movies are wildly popular.
Clan of Dragons – Appar på Google Play
Book Condition: New. Paperback. 268 pages. The Harry Potter series of books and movies are wildly popular. Many Christians see the books as largely if not entirely harmless. I was looking for other posts concerning dragons, and I found a commentary on Michael D. O’Brien’s “A Landscape with Dragons” under the same name. You can read it to find out what the user thought of said book–it’s not really the issue here, but you should check it out so this is not totally out of context for you. QSSMXZYVVJOK » Doc \ A Landscape with Dragons: The Battle for Your Childs Mind A Landscape with Dragons: The Battle for Your Childs Mind Filesize: 5.59 MB Reviews This is an remarkable pdf which i actually have actually study.
Sparad från. pl.pinterest. A Dance with Dragons. GeorgeR.R. Martin. 249kr / st. Inbunden.
Arbetsmiljöingenjör jobb jönköping
In this study of the pagan invasion of children’s culture, O’Brien, the father of six, describes his own coming to terms with the effect it has had on his family and on most This scroll presents a view of undulating billows and a rocky shoreline where several gnarled trees cling to a bare cliff. To the left of the trees two dragons appear amid the clouds and inky darkness. Tagged A Camping Spree with Mr. Magee, C.S. Lewis, Children's Books, Chris Van Dusen, Hattie & Hudson, If I Built a Car, If I Built a House, Landscape With Dragons, Learning to Ski with Mr. Magee, Mercy Watson, Michael O'Brien, Randy Riley's Really Big Hit, The Circus Ship 2 Comments Click to read more about A Landscape With Dragons: The Battle for Your Child's Mind by Michael O'Brien. LibraryThing is a cataloging and social networking site for booklovers A Landscape with Dragons The Battle for Your Child's Mind Michael D. O'Brien Ignatius Press The film Cape Fear was released in 1961. It tells the story of Sam Bowden, a family man who is being pursued by a sadistic villain, Max Cady. Add some magic to your landscape with the dragon garden sculpture with solar globe.
Are you a dragon of magic? A dragon of time? A dragon of dark and menacing power? Could you be a dragon of healing? Or could you be an ice dragon or
Has all the ingredients for an instant success: plots, counterplots, mystery, valiant knights, and blossoming relationships replete with broken hearts, deception
Maj must traverse a fantastical landscape and overcoming mighty foes, in order to rescue her younger brother from the clutches of an evil
Travel across the treacherous landscape of Earthland and beyond. Players assume the role of Tak, an impulsive and brash Draconian prince
Division of Landscape Architecture invites you to a seminar with Jessica Myers, architectural strategist at LaPlaca Cohen, New York.
Wan Li , Ming . Imagine Dragons - Follow You (Official Music Video). ImagineDragons. ImagineDragons. •.
For children, for their parents? Most of us, I trust, would answer an emphatic YES; story-telling is ever-important. ISBN 0-9698058-0-2. Written in the early nineties by an author who later branched out into the writing of very helpful novels, in this book O’Brien examines something of the slide in children’s literature and fantasy taking place in the latter decades of the twentieth century. A Landscape with Dragons is a controversial, yet thoughtful study of what millions of young people are reading and the possible impact such reading may have on them.
Gymnasium engelska 6
online graph plotter
hur länge överlever magsjukevirus på ytor
green furniture concept
sagor för barn
elinor ostrom books
Dragons Group LinkedIn
2021-mar-03 - Upptäck Ellen Karlssons anslagstavla "Dragons (etc)" som följs av 1694 användare på Pinterest. Visa fler idéer om drake, konst, fantasi konst. Whatever It Takes - Imagine Dragons. kl:12 ska jag och Simon till fotbollsplan så like denna eller skriv #fotbolll. kl:12 ska jag och Simon till fotbollsplan så like music cover Believer - Imagine Dragons · #mostresuacidade #partiupauloafonso #MyCity #PauloAfonso_city.
Smycke 60 årspresent
xanthan gum replacement
- Marknadskommunikatör utbildning göteborg
- Specialpedagog jobb västra götaland
- Studieteknik wikipedia
- Atergivande text exempel
- Kalendarium värmdö skolor
- Malin östling göteborgs universitet
- Momsreg nummer norge
- Den blå avis sverige
Ladda ner till mobilen gratis: Dragons, Fantasy, Sky, Clouds
In this study of the pagan invasion of children's culture, O'Brien, the father of six, describes his own coming to terms with the effect it has had on his family and on most A Landscape with Dragons (9780898706789) by Michael D. O'Brien. Hear about sales, receive special offers & more. | <urn:uuid:1a42aec7-7b84-44a3-9bc8-aea4c1bf00d1> | CC-MAIN-2022-33 | https://jobbqhwa.web.app/23656/24444.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.788172 | 1,792 | 2.171875 | 2 |
As members of the endocrine system, adrenal glands excrete chemicals, called hormones, to regulate important functions by sending messages through the bloodstream. These various hormones control metabolism, physical development, and stress management. A malfunctioning hypothalamus, which controls the endocrine glands, can make adrenal glands secrete too few or too many hormones resulting in serious disorders.
The two adrenal glands are three-pointed and flat, each one located above a kidney near the lower back. The outer layer of adrenal glands is called the adrenal cortex. The cortex is responsible for synthesizing and secreting hormones essential to digestion and sexual maturity. The inner layer, the adrenal medulla, isn't actually necessary to normal life, but evolved to help us manage moments of stress and improve our quality of life.
The adrenal cortex produces steroidal hormones and chemicals that regulate digestion. Androgenic steroids help develop secondary sex characteristics in males while estrogen and progesterone aid in sexual development in females. These hormones work closely with steroids excreted by the testes and ovaries. For metabolism, aldosterone keeps healthy levels of potassium and salt in the bloodstream. Cortisol helps to metabolize carbohydrates, protein, and fats into glucose.
We handle stressful situations, such as public speaking or being chased by a dog, with greater ease due to the adrenal medulla. It is called a "sympathetic" gland because it responds to external stimuli, such as anxiety with the so-called "fight or flight" instinct. Then it releases adrenaline, or epinephrine, which speeds your heartbeat, thereby increasing circulation, and recirculates stored glucose, which provides a sudden burst of energy and strength. Norepinephrine mildly constricts blood vessels, also raising blood pressure, as well triggering perspiration. This allows to fight, with stronger muscles and quicker reflexes, or take flight, with enough energy to run away. We've adapted this instinct to modern situations, like a job interview.
Also known as the suprarenal glands, adrenal glands can be affected by hormonal imbalances. For example, underactive glands don't produce enough chemicals. Addison's Disease results in low blood sugar and weakened immunity. Overactive adrenal glands, called Cushing's Syndrome, causes high blood pressure and can create problems during adolescent development with exaggerated masculine characteristics. Tumors in the adrenal cortex pose a major health risk, but the adrenal medulla can be removed with minimal effects. | <urn:uuid:0bd17c35-32fb-45ab-8f44-965454d12f46> | CC-MAIN-2022-33 | https://www.thehealthboard.com/what-are-the-adrenal-glands.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.920042 | 511 | 3.453125 | 3 |
In financial accounting, a balance sheet is a summary of the financial balances of an individual or organization, whether it be a sole proprietorship, a business partnership, a corporation, private limited company or other organization such as government or not-for-profit entity.
Titagarh Wagons Limited Balance Sheet Statement - Assets
As of 31 Mar 2022, The total current assets of Titagarh Wagons Limited (NSE:TWL) was around ₹15,016,689,000 which consisted of ₹420,561,000 of Cash, ₹5,038,563,000 of Inventory and ₹6,590,758,000 of Net receivables. Current assets represent all the assets of a company that are expected to be conveniently sold, consumed, used, or exhausted through standard business operations within one year.
All amounts in INR
The latest balance sheet of Titagarh Wagons Limited also showed ₹9,541,142,000 of Property Plant Equipment and no Good will. Also there were ₹646,233,000 of Intangible assets and ₹901,645,000 of Other assets. The total assets including current and Intangibles/Deferred Long Term Asset Charges were ₹26,789,079,000.
Titagarh Wagons Limited Balance Sheet Statement - Liabilities
TWL's latest annual results shows the balance sheet has ₹4,387,283,000 of Accounts Payable. Also there were ₹3,649,529,000 of Short/Long term debt, ₹4,955,775,000 of Long term debt, ₹4,602,179,000 of Other Current liabilities and ₹12,665,072,000 of Total Current Liabilities. Current liabilities are a company's short-term financial obligations that are due within one year or within a normal operating cycle.
As per the 31 Mar 2022's annual report of Titagarh Wagons Limited, the total liabilities were ₹18,366,356,000.
TWL Balance Sheet Statement - Stock Holder Equity
Stockholders' equity, also referred to as shareholders' equity, is the remaining amount of assets available to shareholders after all liabilities have been paid. It is calculated either as a firm's total assets less its total liabilities or alternatively as the sum of share capital and retained earnings less treasury shares. Stockholders' equity might include common stock, paid-in capital, retained earnings and treasury stock.
The latest Balance sheet of Titagarh Wagons Limited showed the total stock holder equity was ₹8,421,282,000 which consisted of ₹239,142,000 of Common stocks, no Retained earnings and ₹8,182,140,000 of Other stock holder equity.
TWL Balance Sheet Statement History
Following table shows the history of balance sheet for Titagarh Wagons Limited (TWL).
|31 Mar 2022||31 Mar 2021||31 Mar 2020||31 Mar 2019|
|Total Current Assets||15.02B||14.05B||12.45B||15.85B|
|Property Plant Equipment||9.54B||8.51B||8.25B||9.18B|
|Deferred Long Term Asset Charges||379.24M||378.3M||398.35M||346.98M|
|Short/Long Term Debt||3.65B||9.49M||10.03M||265.12M|
|Other Current Liabilities||4.6B||1.66B||1.45B||2.79B|
|Long Term Debt||4.96B||5.37B||5.53B||5.76B|
|Total Current Liabilities||12.67B||9.04B||7.25B||12.02B|
|Other Stockholder Equity||8.18B||1.03B||158.38M||238.78M|
|Total Stockholder Equity||8.42B||8.41B||7.67B||8.16B|
|Net Tangible Assets||7.78B||7.87B||7.29B||7.74B|
Titagarh Wagons Limited (NSE:TWL) Balance Sheet Statement FAQ
1. How much Cash Titagarh Wagons Limited has on their balance sheet?
As of 31 Mar 2022, Titagarh Wagons Limited (NSE:TWL) has ₹420,561,000 of Cash.
2. What's the long term debt of Titagarh Wagons Limited?
As per the latest Balance sheet of Titagarh Wagons Limited (NSE:TWL), it has ₹4,955,775,000 of Long term debt.
3. How much share holder equity does Titagarh Wagons Limited has?
The Titagarh Wagons Limited (NSE:TWL)'s balance sheet shows that it has ₹8,421,282,000 of Total stock holder equity. | <urn:uuid:bef2547a-4fe8-4976-8e58-c7544341bb1e> | CC-MAIN-2022-33 | https://www.stockmetric.net/nse/twl-balance-sheet-analysis/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.862853 | 1,411 | 2.03125 | 2 |
Abilene Christian University’s “Learning Studio: Year One Report” is now available at Apple’s iBookstore. The report provides an interactive survey of the AT&T Learning Studio, a “learning laboratory” focused on mobility and media creation.
The 35-page report recaps the story of the Learning Studio, from early design discussions through major projects in its first year of operation. Interactive features tell the story of students and faculty who worked with the Learning Studio through video interviews and sample work.
Projects profiled include award-winning student filmmakers, ACU faculty who share how a digital storytelling workshop changed their teaching, mobile media workshops for K-12 faculty, and an ACU art professor who uses a green screen to travel through time for his online art course.
The report also includes a virtual tour of the Learning Studio, providing an inside look at its recording studios and collaboration rooms. It concludes with key numbers from the first year, including student check-out statistics for cameras, room reservations and participation in training workshops.
“Mobile devices continue to transform the way we interact with media,” according to AT&T Learning Studio director Dr. Kyle Dickson. “That’s one reason we produced the report in iBooks Author. Tablets are an emerging platform in education, so we used this project to better understand the potential of publishing to the iPad.”
This book can only be viewed using iBooks 2 on an iPad. iOS 5 is required.
“Learning Studio: Year One Report” is free and available worldwide exclusively through the Apple iBookstore. “Learning Studio: Year One Report LITE” is available in a non-interactive, PDF format.
Created as part of an US$1.8 million gift from AT&T, the Learning Studio opened in February 2011 on the top floor of ACU’s academic library. A state-of-the-art 8,800 square foot facility, it is equipped and designed to support 21st century teaching and learning. Visit www.acu.edu/learningstudio/ for more information.
Abilene Christian University’s mission is to educate students for Christian service and leadership throughout the world. More than 4,500 students, including nearly 800 graduate students, enroll in ACU from 47 states and territories, and 41 nations. Visit www.acu.edu for more info. | <urn:uuid:ac1fd467-0820-4f8d-bfeb-e73ad5b0ffd6> | CC-MAIN-2022-33 | https://www.mactech.com/2012/08/07/ibook-recaps-first-year-of-universitys-ipad-fueled-learning-studio/amp/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.927742 | 504 | 1.75 | 2 |
Is Braga expensive to live in?
Real estate is one of the aspects in the city of Braga that makes it such a great place to live in. Above all, those who live in Braga highlight the greater ease of buying a house and living in the city compared to other countries and other parts of Portugal.
The greater offer of housing, at more accessible average prices , is the main reason why Braga is being chosen by many young couples, but also by investors, to live or start a business.
building @tellimer. #engineering, #machinelearning and #crypto
MORE LIKE THIS
Are you a digital nomad? Consider these countries for 2022
Is there such a thing as a ‘good’ or ‘bad’ recession? | <urn:uuid:3d597379-6bf4-4974-a5a4-a8aaf83846f3> | CC-MAIN-2022-33 | https://deepstash.com/idea/110395/is-braga-expensive-to-live-in | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.930667 | 186 | 1.65625 | 2 |
By Jeff Blakley
It is often noted that history is told by the victors. Those who don’t tell their stories are forgotten but those who do assume out-sized importance in the historical record. Such is the case with Edward Stiling, who, in the published histories of Detroit (now known as Florida City), overshadows many others, like Lafe Ishmael, the Shields brothers, Elbert H. Ring, A. C. Graw and James Powers, who also contributed greatly to the establishment of the town.
Edward’s parents were Edward Chambers Stiling and Sarah Ackland Ellis. Edward C. Stiling, Edward’s father, was born on July 26, 1828 in Broadhembury, Devon, England. In 1851, Edward and his wife, Sarah Ackland Ellis, lived on a 52 acre farm in Broadhembury. By 1858, they had three children: Grace E., born ca. 1854; Georgina, born ca. 1856 and William, born in September of 1858. In August of 1859, the family emigrated to Canada, where they were enumerated in the 1861 census as living in Normanby, Ontario. Edward was born there on October 18, 1860. Edward’s father found work as a butcher there but didn’t stay in Normanby long, moving to Mt. Forest, Ontario, a small town 230 miles northeast of Ann Arbor, Michigan. In December of 1862, the family moved again, this time to Ann Arbor, where Edward’s father was a baker.1 If he owned his own shop, no evidence has surfaced of that. Edward’s father died in obscurity on October 25, 1888 in Detroit and his mother, Sarah, died on May 18, 1900, also in Detroit. Nothing further is known about either of Edward’s parents.
Edward attended the public schools in Ann Arbor until 1876, when he was 16. The family then moved to Detroit. A short biography of Edward, published in 1914 in the Homestead Enterprise, stated that he entered “a prominent business college” in Detroit, where he took “a thorough course in bookkeeping, commercial law and kindred subjects,” graduating after three years in 1879.2 That school was likely the Bryant & Stratton College, which was located at the corner of E. Larned St. and Woodward Avenue in downtown Detroit. In October of 1881, Edward went to Texas and then moved to Sanford, Florida in 1882,3 where he accepted a position as bookkeeper for the firm of Tuxbury & Fernald.4
Sanford, a planned community, was founded by Henry S. Sanford, a wealthy diplomat from Woodbury, Connecticut in 1870, when he purchased over 18,000 acres from Joseph Finegan, who had served as a brigadier general for the Confederacy. The town was incorporated in 1877 with a population of 1005 and by 1880, the South Florida Railroad had connected Sanford with Tampa.6 At about the same time, Charles H. Tuxbury, a wealthy lumber dealer from Saco, Maine and John C. Fernald, a retail grocer in Saco, established the firm of Tuxbury & Fernald, a hardware store, in Sanford.
On June 18, 1885, Edward Stiling, 24, and George H. Fernald, John’s son, 24, were enumerated in the household of C. H. Tuxbury in Sanford.8 Edward was a “bookkeeper” and George was a “merchant,” as was Charles.
Like most business districts of that era in Florida, the buildings in downtown Sanford were constructed of wood. On September 27, 1887, a fire that started in a bakery destroyed much of the downtown area.9 After the fire, there was no further mention of Tuxbury & Fernald in the newspapers so it is likely that the building burned down and the owners did not rebuild.
Alfred G. Prentiss, another retail grocer in Saco and a friend of the Fernald family, spent his winters in Sanford and brought along his family, including his daughter Emily. Edward and Emily fell in love and were married in Saco, Maine on November 15, 1887. They returned to Florida, settling in Cocoa, where Edward had partnered with Alfred A. Taylor to buy out George H. Fernald, who had opened a branch office of Tuxbury & Fernald on Delannoy Avenue. They renamed the business Stiling & Taylor. In 1889, Emily became pregnant and went back to her parents’ home, at 27 Thornton Ave. in Saco, where she gave birth to her only child, Octavia Rosaleen, on November 5, 1889.10
Courtesy of Roy Laughlin, Historian, Cocoa, Florida
On September 2, 1890, much of downtown Cocoa, built out of wood like Sanford, was destroyed in a fire.12 Shortly after the fire, which heavily damaged or destroyed his properties, Edward “purchased the Julius King store lot” and rebuilt his “business house and residence on a larger scale than at first contemplated.”13
Courtesy of The Florida Historical Society
Courtesy of The Florida Historical Society
Edward’s business, which included supplying shipping crates to citrus growers, likely grew slowly, as the Jacksonville, St. Augustine and Indian River Railway, owned by Henry Flagler, did not reach Cocoa until 1893. With regular freight service to the rest of the country, Stiling’s business grew substantially. A little over a year later, though, the Great Freeze of 1894-1895 crippled the citrus industry and the economic impact was severe. Stiling’s business was hit hard. Then, on September 20, 1897, a hurricane struck Cocoa and blew the roof off Stiling’s “new brick warehouse.”14 After suffering three substantial losses in seven years, Stiling left Cocoa and moved to East McKeesport, Pennsylvania. There, he got into the real estate business and, in November of 1898, placed an advertisement in the Pittsburgh Daily Post, offering his house in Cocoa for sale.
In 1900, he was briefly investigated by a Grand Jury and fended off a lawsuit filed by Mrs. Margie Gaertner.16 Stiling was active in East McKeesport until at least the spring of 1901, when the Keystone State Building and Loan Association filed a legal action against him over a mortgage.17 Stiling was listed as a broker and retailer on the Mercantile Appraiser’s List for East McKeesport at this time.18 He was unsuccessful in selling his house in Cocoa and in December of 1902, he leased it to Mr. and Mrs. Steele, who were from Canada, for the winter season.19
Once his legal troubles had been resolved in East McKeesport, Stiling went back to Detroit, where he was listed in the 1903 Detroit City directory as living at 168 Lincoln Ave. He was hired by the Boydell Bros. White Lead and Paint Co. as a traveling salesman. The Boydell firm was one of the largest paint manufacturers in the Midwest at the time, occupying an eight-story building in downtown Detroit. It is not known how many places Edward went on his sales calls but one place he did go to was to Miami, where he registered at the Biscayne hotel on November 21, 1904.20 It was his first visit and he was “so favorably impressed” that he may have made some real estate investments.21
Since Stiling had spent nearly 20 years in Florida and because he had also been a real estate salesman, he certainly paid attention to investment opportunities. The Everglade Land Sales Co., which was a national firm, placed an advertisement in the Detroit Free Press on December 19, 1909 that read:
WANTED – High class salesmen: general agent for every county and local representative for every town; capable of earning $5,000 to $15,000 per year to sell Florida Everglade land now being drained by the state of Florida under U. S. government supervision; world’s largest reclamation project; millions of dollars being invested; 9,200 farms already sold this year; most fertile and productive soil in America; worth over $6 per ton as fertilizer; produces $300 to $450 per acre yearly; price only $30 per acre, sold on terms of $1 down and $1 per acre per month; only tropical section of the U.S. mainland; liberal proposition to right men; write for further particulars; only reliable hustlers need apply. Address EVERGLADE LAND SALES CO., 1219 Majestic Bldg., Chicago.
It is uncertain when the Everglade Land Sales Co. was organized, but Henry G. Ralston, who was born in Chicago in 1884, became associated with the company in July of 1909 and moved to Miami in October. He was a first vice-president and a member of the Board of Directors of the company and later was a principal in the firm of Ralston Brothers, Inc., a prominent Miami real estate development company.22 His father, Robert W. Ralston, platted the Pinehurst Addition to Homestead in November of 1912. That property, the NW 1/4 of the SE 1/4 of 13-57-38, was claimed by four men, one of whom was George B. Romfh, Jr., son of a Miami banker, before being proved up by Leonard S. Mowry in September of 1911.
The Everglade Land Sales Co. advertised in newspapers all over the Eastern United States and their advertisements in Detroit caught the eye of Edward Stiling. Early in 1910, Stiling, two friends from Detroit, John Kay and Dr. T. W. Shields, and Theo Ivens of Sioux City, Iowa, came to Miami to investigate the claims of the company. They left, suitably impressed, and the Miami Metropolis stated that they would be back in the fall to locate.23 Stiling must have connected with the Tatum Bros. Real Estate & Development Co. while he was in Miami because well before the fall, on August 6, Stiling sent a telegram to his friend, Dr. T. W. Shields, telling him that the name of the town the Tatum Bros. were promoting was Detroit. He wrote Shields that he had “another choice section” and he hoped to “sell it all in a month.”24 On August 31, 1910, Stiling purchased six 10-acre tracts and on September 1, he purchased seven more from the Tatums. His total outlay for these purchases was $4,680, equivalent to $130,000 in 2019 dollars.25
On August 31, the Detroit Times printed a note that said that “[a] number of residents of the northwestern part of this city, near Grand River and Hudson aves., have become interested in the fertile reclaimed everglades of Florida and have invested in from 10 to 50 acres each in a tract of land that has just been opened up near Miami and which they propose to make into a town, christening it Detroit.” Edward Stiling, of 168 Lincoln Avenue, was “one of those most deeply interested in the new city but others, “including Dr. T. W. Shields, A. R. Cunningham, John Duncan, T. T. Pomeroy and John A. Kay” were also interested.26
Edward may have escorted the new arrivals to Detroit, Florida – he may be the man standing on the corner of the platform – as the Detroit Free Press reported on June 4, 1911 that Stiling had “returned from a seven months’ sojourn in Florida.”27
Courtesy of the Florida Pioneer Museum
From June 23 until October 23, 1911, he placed an advertisement almost every week in the Detroit Free Press promoting Detroit for the Miami Land & Development Co. How many buyers he was responsible for is unknown but he did not establish a residence in Dade County until at least 1911. He had a real estate office in Detroit, at 692 Trumbull, where he solicited buyers and he traveled back and forth between the two Detroits for several years. In April of 1912, he was listed as a vestryman for the Trinity Episcopal Church in Detroit, Michigan28 and in January of 1914, there was a note in the Miami Herald that he had returned to Detroit, Florida after an absence of six months.29
Stiling went on to play an important role in the establishment of Florida City. Appointed briefly as Detroit’s first postmaster on December 13, 1910, he served in that capacity until June 10, 1911, when Marion L. Williams took over. This short stint as postmaster ended with Stiling’s departure for Detroit, Michigan in early June.30 He was appointed to serve the balance of the term of Florida City’s first mayor, Dr. Benjamin F. Forrest, in late 1916 and then was elected for a full term as Mayor in 1918. He served on the Town Council twice and was elected Mayor again in 1938. Active in civic affairs in both Florida City and Homestead, he was also a leading real estate salesman whose office was on the southwest corner of S.W. 3rd Avenue and Palm Drive. As a representative of the Miami Land & Development Co., he promoted Florida City relentlessly and was richly rewarded as a result. When he died in 1945, the pallbearers included Henry Brooker, Jr. and Clarence J. Parman, a well-known architect in Homestead and a business partner of Stiling’s daughter’s husband, Lee Lehman. Stiling and his wife are buried in the mausoleum at Miami’s Woodlawn Cemetery.
- Personal communication with David Butt, a descendant of William Stiling, Edward’s younger brother.
- Homestead Enterprise, August 6, 1914, p. 15
- Obituary for Edward Stiling, Homestead Leader and Enterprise, June 15, 1945, p. 1
- Homestead Enterprise, August 6, 1914, p. 15
- “Florida Historical Society article on Sanford
- South Florida Railroad
- Orlando Evening Star, April 17, 1884, p. 1
- 1885 Florida census of District 3, Orange County, page 47, lines 30 and 31
- Chase Collection, George A. Smathers Library, University of Florida
- Delayed Certificate of Birth filed on August 14, 1946. The attending physician was Dr. Hampden Hill, who was likely the family physician.
- Florida Star, Titusville, Florida, September 4, 1890.
- Cocoa, Florida: History, by Bob Harvey, 2014, The History Press, Charleston, SC 29403, not paginated
- Note published in the Cocoa Public Spirit and printed in the Polk County News on October 24, 1890 on page 3
- Miami Metropolis, September 24, 1897, p. 5
- Pittsburgh Daily Post, November 27, 1898, p. 12
- Pittsburgh Daily Post, December 14, 1900, p. 7 and October 28, 1900, p. 10
- Pittsburgh Post Gazette, March 29, 1901, p. 7
- The Pittsburgh Press, April 15, 1901, p. 5
- Florida Star, Titusville, FL, December 26, 1902, p. 8
- Miami Metropolis, November 21, 1904, p. 4
- Miami Metropolis, November 25, 1904
- Miami and Dade County: Its Settlement, Progress and Achievement, E. V. Blackman, Victor Rainbolt, Washington, D. C., 1921, pp. 134-135
- Miami Metropolis, May 25, 1910, p. 1
- Telegram in the archive of the Historic Homestead Town Hall Museum.
- Sales receipts in the archive of the Historic Homestead Town Hall Museum. The tracts were lots 3, 4, and 5 in Block 2 of 30-57-39 and lots 1, 2, 3 and 10-16 inclusive of block 2 in 19-57-39. See the plat of the Miami Land & Development Co. in the article The Miami Land & Development Co. for the location of the lots.
- Detroit Times>, August 31, 1910, p. 2
- Detroit Free Press, June 4, 1911, p. 53
- Detroit Times, April 10, 1912, p. 6
- Miami Herald, January 3, 1914
- Detroit Free Press, June 4, 1911, p. 53 | <urn:uuid:82764ade-f019-482d-b833-66d99302836c> | CC-MAIN-2022-33 | https://hsdade.com/edward-stiling/?replytocom=2132 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.976269 | 3,467 | 2.328125 | 2 |
|KEYCTL_CHOWN(3)||Linux Key Management Calls||KEYCTL_CHOWN(3)|
keyctl_chown - change the ownership of a key
#include <keyutils.h> long keyctl_chown(key_serial_t key, uid_t uid, gid_t gid);
keyctl_chown() changes the user and group ownership details of a key.
A setting of -1 on either uid or gid will cause that setting to be ignored.
A process that does not have the SysAdmin capability may not change a key's UID or set the key's GID to a value that does not match the process's GID or one of its group list.
The caller must have setattr permission on a key to be able to change its ownership.
On success keyctl_chown() returns 0 . On error, the value -1 will be returned and errno will have been set to an appropriate error.
This is a library function that can be found in libkeyutils. When linking, -lkeyutils should be specified to the linker.
|4 May 2006||Linux| | <urn:uuid:4429b4c8-8d29-44cd-8f98-fe395aef2f43> | CC-MAIN-2022-33 | https://manpages.debian.org/unstable/libkeyutils-dev/keyctl_chown.3.en.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.778295 | 282 | 2.46875 | 2 |
compute the biconnected components of a graph
graph or network
Important: The networks package has been deprecated. Use the superseding command GraphTheory[BiconnectedComponents] instead.
A connected graph can be decomposed into two connected components possibly connected by bridges. This routine returns two sets in a list of length 2: the first indicating the bridges and the second indicating the biconnected components.
Bridges are specified as edges. The set of bridges may be empty.
The biconnected components are each specified as sets of edges. This set of bicomponents may be empty as for example in the case of a path.
This routine is normally loaded using the command with(networks) but may also be referenced using the full name networks[bicomponents](...).
Download Help Document
What kind of issue would you like to report? (Optional) | <urn:uuid:1207dbf2-ec35-4c7e-aadb-30914aaf08ef> | CC-MAIN-2022-33 | https://fr.maplesoft.com/support/help/maple/view.aspx?path=networks(deprecated)%2Fbicomponents | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.783684 | 393 | 2.828125 | 3 |
This standard was last reviewed and confirmed in 2018. Therefore this version remains current.
ISO/TR 16386:2014 discusses the impact of changes in International Standards for particle counting, contamination control, and filter testing.
Liquid automatic particle counters (APCs) are used in monitoring contamination levels in hydraulic fluids, to establish component and assembly cleanliness level specifications, and in determining filter efficiencies and particle size ratings. As a result of the replacement of ISO 4402 with ISO 11171 (APC calibration), the replacement of ISO 4572 with ISO 16889 (multi-pass filter test), and the publication of ISO 11943 (online particle counter calibration), the quality and reliability of particle count and filter test data have improved, increasing their usefulness to industry. However, the resultant redefinition of particle sizes and the use of a new test dust affect how contamination levels and filter performance are reported and interpreted.
NOTE The first editions of ISO 11171, ISO 16889 and ISO 11943 were published in 1999; all three of these International Standards either have been, or are in the process of being, revised.
Status : PublishedPublication date : 2014-11
Edition : 2Number of pages : 13
Technical Committee:Contamination control
Buy this standard
|PDF + ePub| | <urn:uuid:687d8974-6918-4a8b-aed6-0f6761ef6080> | CC-MAIN-2022-33 | https://www.iso.org/standard/59488.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.864517 | 293 | 1.8125 | 2 |
Navitas Organics Mulberries are an everyday superfood staple! These dried berries are sweet, chewy and nutrient-dense. Snack on them, bake with them, mix them in everywhere!
SWEET, CHEWY PERFECTION
Navitas Organics Mulberries are gently dehydrated at low temperatures for a nutritious, satisfying superberry experience.
- 100% organic mulberries
- Ancient superberry cultivated by civilizations around the world
- Low temperature dried
- Good source of fiber, calcium, iron & potassium
- Contains no added sugar, sulfites or preservatives
- See FAQs
|Includes Added Sugar||0g||0%|
Certified organic mulberries (Morus alba).
How to Use
Deliciously sweet & chewy, Navitas Organics Mulberries are a fantastic addition to breakfast cereals, trail mix and baked goods…if you don't snack your way to the bottom of the bag first.
TRY IT IN
Snacking & Trail Mix
TRY IT IN
Baking & Raw Treats
TRY IT IN
Yogurt & Oatmeal
– Sharif N.
What does a mulberry taste like?
Mulberries are a relative of a fig, and "fig-like" is often how their flavor is described. While some mulberry varieties are red-purple and taste more like a tart blackberry, our mulberries are the white Turkish variety, prized for their maple-like sweetness, lack of astringency and high levels of antioxidants, including resveratrol.
What's the difference between white, red, and black mulberries?
While they share a name and many physical characteristics, the white, red, and black mulberry are worlds apart—literally: the white mulberry is native to East Asia; the red mulberry native to the eastern US; and the black mulberry to the Middle East. All three are from the Morus genus and produce oblong, clustered berries that are high in vitamin C, iron, calcium, fiber and a variety of antioxidants. The white mulberry has a long history of cultivation for both its berries and its leaves, which were used to feed silkworms and livestock.
Why is there a warning label on my mulberries?
Some of our superfoods fall under CA's Prop 65 labeling requirements. This is due to trace amounts of heavy metals that are naturally occurring in the organic soils in which our superfoods grow. Please note that Prop 65 is a right-to-know law, and not a determination of a product's safety. For more information, please see our Help Center articles about Prop 65 here.
Does your packing facility handle allergens?
Do you offer free shipping?
Can I order your products outside of the US?
Have more questions? Visit our Help Center | <urn:uuid:76f6a560-1f1f-4db1-8ccf-483a33c24003> | CC-MAIN-2022-33 | https://navitasorganics.com/products/mulberry-berries | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.895534 | 747 | 1.9375 | 2 |
High Prevalence of Xanthoma and Nephrocalcinosis in Aquarium-housed Atlantic Wolffish (Anarhichas lupus) and Spotted Wolffish (Anarhichas minor)
Centre Québécois sur la Santé des Animaux Sauvages/Canadian Wildlife Health Cooperative, Faculté de Médecine Vétérinaire, Université de Montréal, St. Hyacinthe, QC, Canada; 2
Aquarium du Québec, Québec City, QC, Canada; 3
Biodôme de Montréal, Montréal, QC, Canada
The Atlantic wolffish (AW) and the spotted wolffish (SW), which are long-lived fish found in the North Atlantic and Arctic oceans, are respectively classified as special concern and threatened species, mainly due to bycatch. To better understand health issues associated with the care of these species, which are occasionally kept in public aquariums, reports from all necropsies performed in two zoological institutions between 2009 and 2018 were reviewed (29 AW and 7 SW). These wolffish were fed with a similar fish-based diet, and kept in multi-species exhibits with comparable environmental parameters. The most frequent necropsy findings were the presence of xanthomas (AW: 38%; SW: 71%), nephrocalcinosis (AW: 39%; SW: 71%) and urinary bladder uroliths (AW: 4%; SW: 71%). Xanthomas, which were mostly (81%) located at the base of pectoral fins, were characterized by an extensive granulomatous inflammation centered on accumulations of partly mineralized degenerate fatty material mainly composed of cholesterol crystals. Nephrocalcinosis was characterized by deposition of calcium salts within the kidneys, especially in the collector tubules, and was commonly associated with tubular necrosis. Even if the etiology of these conditions remains unclear, a nutritional origin is suspected. Indeed, the nutritional composition of the cold-water fish-based diet fed to aquarium-housed wolffish is most likely very different from their natural diet which is mainly composed of invertebrates, such as urchins and crustaceans. These differences in nutrients, such as lipid and mineral content, may explain the high prevalences of xanthoma and nephrocalcinosis/uroliths observed in wolffish housed in these institutions.
The authors wish to thank the veterinary residents and veterinarians that performed the necropsies as well as animal health technicians and aquarists that have been involved with the care of these fish.
* Presenting author
+ Student presenter | <urn:uuid:4875f885-b11e-4c3b-98a7-22d536eda122> | CC-MAIN-2022-33 | https://www.vin.com/apputil/content/defaultadv1.aspx?pId=23437&meta=Generic&catId=129393&id=9048600&ind=52&objTypeID=17 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.947782 | 564 | 2.875 | 3 |
See me, feel me, touch me heal me
by Dr. Paul Doherty and Dr. Eric Wegryn (a Mars Scientist)
Music from the Rock Opera Tommy, "See me, feel me, touch me..."
What would happen if you stepped naked onto the surface of Mars. All gas inside you would come out through every orifice in your body. You would remain conscious for 10 to 15 seconds. Your ears would "pop" as they adjusted to Martian pressure, so that you can hear. After 15 seconds your blood would boil.
Hot Dog in a vacuum chamber?
Seeing on Mars, the air is a bit hazy, which obscures our view of the stars, but there is no light pollution. (We've never photographed earth from the surface of Mars.)
During the day the dusty sky scatters salmon-colored light. Everything is illuminated by reddish light, to get the idea what this would be like wear some "Blue-blocker" sunglasses.
Wearing "Blue Blocker" sunglasses gives you a sense of what it might look like on Mars.
Mars appears reddish because the dust contains iron oxides, rust. Probably similar to the minerals known as limonite.
The dust scatters red at high angles and blue at smaller angles. This means that at sunset the sky around the sun is bluish, since the light there is scattered at small angles, and the sky far from the sun is reddish, or salmon, colored.
Early observers of Mars saw a wave of green spread from the polar caps toward the equator every spring. This was an illusion produced by the human eye and brain. On Mars, gray dust was blowing away from the poles into a region of reddish dust. When gray light is viewed in a surrounding field of reddish material it can appear greenish.
We must understand human perception to understand what we "see."
The Moons of Mars are small, about the size of San Francisco, so they are bright against the stars but don't provide much light to the surface.
Hearing on Mars, the thin air does carry sound, just not as well as the thick air of earth.
In fact with the air density 100 times lower on Mars the sound intensity carried to your ear is 100 times less. The ear is a logarithmic detector however so the sound level decreases by 20 dB.
Demo: This is the same decrease in sound produced by covering your ears with your hands.
Demo, put a boombox into a vacuum chamber at the Water Freezer exhibit then listen at Earth and Mars pressures.
Smelling, Mars would smell like CO2
Demo a fish tank with dry ice, waft the CO2 from the dry ice toward your nose to smell Mars.
Or put dry ice into a squirt bottle and squirt CO2 toward your nose and tongue.
Taste Mars, put your tongue into the tank of CO2 or put dry ice into a squirt bottle and squirt some CO2 onto your tongue. Tangy!
Demo cool a sandstone rock to dry ice temperatures and allow people to touch it.
Don't put your tongue onto metal pipes on Mars.
Mars is also very dry, like the air in the Antarctic Dry Valleys or the Atacama Desert on Earth.
Gravity would be 1/3 less on Mars.
But you would have the same mass, The astronauts on the moon adapted very quickly to this combination, but they did stumble and almost fall a few times.
Demo use the swingset and a bathroom scale to show weight on Mars.
UV would be over 100 times as intense on Mars since there is no ozone layer.
I would sunburn in 15 seconds of exposure!
Mount the mars grains onto holders.
Animals with a magnetic sense would not sense Mars since there is no planetary magnetic field.
Return to Mars
Scientific Explorations with Paul Doherty
25 Dec 2003 | <urn:uuid:95f52eef-fe59-442b-9a17-c78342304326> | CC-MAIN-2022-33 | http://www.exo.net/~pauld/Mars/7senses/humanonmars.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.947505 | 851 | 3.234375 | 3 |
“The Shipwreck Diving Capital of Canada”
Ask divers about Tobermory from outside Canada and their answer may be “but the water is cold there.” They’re right, but Lake Huron’s cold, crystal waters have been generous to preserving the shipwrecks there, which allows perfect diving, visibility and definitely the haven of an underwater photographer! Tobermory is regarded as Canada’s scuba diving capital, and is considered to be the best the Great Lakes can give for diving.
The water temperature in summer is about 15 ° C (60 ° F) at the surface. Divers should note the presence of a thermocline between 30 and 40 ft where the temperature drops by 12 ° C (10 ° F). One of the features of the Great Lakes is the presence of a second thermocline at approximately 60-70 ft where there is an additional drop in temperature resulting in a cold dive at this depth. Divers are advised when diving to wear a 7 mm wet suit with a hood, gloves and boots or a dry suit with thermal underwear.
Tobermory is situated at the top of the Bruce Peninsula, a lakeside town surrounded by crystal blue waters, the magnificent Niagara Escarpment and is home to Flowerpot Island along with two national parks. Besides diving, there are many other activities to partake in including cottaging, kayaking, canoeing, hiking the Bruce Trail or taking a cruise to Flower Pot Island. Finish your day with an amazing sunset! The Chi-Cheemaun ferry calls Tobermory home and provides transportation across Lake Huron between Tobermory and South Baymouth on Manitoulin Island. The ferry holds 648 passengers and 143 vehicles, including room for large highway vehicles such as buses and transport trucks.
Many shipwreck treasures in Tobermory are protected by Fathom Five National Marine Park. Fathom Five, Canada’s first national marine park, was established in 1987, and comprises 45 square miles of 20 islands and 22 shipwrecks.
All divers must register at Fathom Five National Park and purchase a dive pass from the Visitor Center or one of Tobermory’s dive shops (Divers Den) before they dive. No registration or snorkeling permit is required (diver’s passes not available this year from Diver’s Den)
Big Tub and Little Tub are popular dive attractions right inside the harbour. Diving in the actual Tobermory harbours is forbidden. Visitors are asked to respect private property rights and the landowners adjacent to them and be advised that tour boats travel the shipwreck area of Big Tub. All divers must remain within 30 metres (100 feet) of a displayed dive flag. The special operational procedures for this location must be observed by divers.
Big Tub Harbour has Sweepstakes – schooner (20 foot dive), City of Grand Rapids- steamer (15 foot dive) and Big Tub Lighthouse Point (75 foot wall dive) for divers to enjoy.
Little Tub Harbour has the “Tugs” (wreckage of four small steam tugs Alice G, Robert K, John & Alex, unidentified) and sits in 40 feet of water. This is a perfect place for divers and snorkelers alike. It is famous for open-water check-outs and for those who wish to watch divers practicing. Site plan maps are available at the Diver Registration Office for this site.
18 more shipwrecks (Arabia, City of Cleveland, Forest City, James C. King, Niagara II, Wetmore and the Newaygo to name a few) await your arrival in Tobermory to dive.
Tobermory has something unique in that, due to all the islands that protect the sites, there’ll always be somewhere to dive. There is a chain of small, uninhabited islands and divers are reminded of being in the open sea.
Tobermory is home to a hyperbaric chamber, motels, bed and breakfasts, an assortment of restaurants and cabins to rent. Reservations are recommended in the peak summer months.
Diver’s Den in Tobermory is a diver’s full service shop. Offering rental gear, dive classes and charter excursions, Mike & Kelly Marcotte (Owners) will make your diving experience a memorable one. Serving Divers since 1967.
Thanks to Carly Brenner Hunter (All things Underwater for Cinema) for her photos and video.
The Scuba News Canada will be featuring some of Tobermory’s shipwrecks in the future. Stay tuned! | <urn:uuid:3e253d8c-83ba-4eba-8ad3-0c456f503147> | CC-MAIN-2022-33 | https://www.thescubanews.com/2020/07/09/diving-in-tobermory/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.92454 | 974 | 1.960938 | 2 |
A work visa permits a person who is not a citizen of the United States to work in Salt Lake City Utah.
There are frequently restrictions on how many Work Visas can be issued for each type of job, and these visas must be renewed regularly.
Applying for a Work Visa in Salt Lake City Utah
Individuals moving to the U.S. for other reasons, such as marriage to an U.S. citizen, may concurrently seek a work visa in Salt Lake City, Utah.
Like every other visa, a work Visa can be your initial step towards citizenship.
Visa Lawyers Can Help You Get to Work in Salt Lake City
Depending on the employer, a foreign worker may be required to provide evidence of a valid passport, evidence of binding ties to a residence outside the U.S., and submit to an interview at the U.S. embassy or consulate in the foreign workers home country to prove they are legally allowed to work in Salt Lake City Utah.
Furthermore, work visa applicants must show the federal government that they are qualified to perform the tasks specific to their field of employment. Conferring with a reputable attorney in Salt Lake City may shorten the time you have to wait for your work visa. Don't wait anymore, contact a legal professional today. | <urn:uuid:066df6bc-7a17-4e04-ba4b-9ff0c21a7918> | CC-MAIN-2022-33 | https://immigrationlawyers.legalmatch.com/UT/Salt-Lake-City/work-visa.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571584.72/warc/CC-MAIN-20220812045352-20220812075352-00672.warc.gz | en | 0.946448 | 260 | 1.5625 | 2 |
The publish-or-perish philosophy continues to characterize academic career development in many universities and research centers around the world . Young researchers and university professors are rewarded based on the number of academic publications they produce annually, as well as on the quality of these publications. Quality standards are often determined by the academic ranking of the conference or journal publishing the work. Special importance is given to "recognized" refereed journals, where peer reviews lead to rejection for 80%90% of all submissions.
Extra pressure is put on university professors in tenure-track appointments to generate a certain number of publications (preferably in refereed journals) . Requirements for the number published and the journal or conference ranking usually depend on the candidate's university and field of research . Some universities grant tenure to candidates with two journal articles; others require more, with at least some in top-ranking journals. Such requirements can be particularly stressful for some candidates.
Pressured to publish to proceed up the ladder, or simply to keep a job, young tenure-track professors may be tempted to cheat their way up through the system. But how can they possibly get away with it? Faking research data is one option, especially when confidentiality prevents disclosure about sources. One famous case of alleged data fabrication involved the British psychologist Cyril Burt. Widely regarded as one of the world's most eminent psychologists, Sir Cyril (18831971) was, within a few years of his death, publicly denounced as having fabricated data to show that intelligence is inherited . His case caused so much controversy that books about his life have variously sought to accuse and exonerate him [5, 7].
Another alternative, apparently pursued by the principal character of the case involving an article I published, is plagiarizing the published work of others. For example, a researcher may submit a nearly identical copy of an article already published in a refereed journal to another journal in a related field. Choosing a journal in a related field, rather than one in the same field, would likely reduce the chance of an overlap of readershipand of being caught. Moreover, using a paper that's already moved successfully through a review process may increase the likelihood it would be accepted for publication again in another journal.
What prevents someone from plagiarizing the work of others, faking data, or both? Not much, as suggested by my experience. The temptation of having to spend just a few hours rather than years of work to fulfill a publication quota can be very strong for some. And holding transgressors accountable for their acts may be more difficult than it would seem. What remains unclear is whether such cases have any chance of gaining the interest of government prosecutors (as regularly happens in especially newsworthy murders, tax evasions by the wealthy, and government corruption). My experience also suggests that few lawyers would be interested in taking plagiarism cases on a contingency basis unless the transgressor's employer is the targetand large amounts of insurance money could possibly be collected.
Two years ago, I found that a paper submitted to a prestigious journal was virtually a copy of an article I had coauthored and published in a well-known research journal several months earlier. I describe here how I learned about the author of this paper, who until recently was a professor of information systems at a prestigious U.S. university. I also describe how I confronted him with the facts and how he reacted. My view of the case's legal aspects is based on my interaction with a number of lawyers. I cover some legal and practical implications for legitimate authors as well as for the academic community.
In early 1997, I received an email message from a colleague telling me about a paper he was reviewing on behalf of the associate editor of a prestigious journal covering knowledge-based systems. My colleague mentioned that the paper "heavily referenced" some of my published work on process-based cognition and improvement, conducted while I was doing research for my Ph.D. dissertation.
I replied with a request for more details about the paper. He responded that, although he would probably recommend the paper for publication, he could give no more information due to the confidentiality of the review process. I was curious; being heavily cited in a paper with a chance of being accepted for publication in a prestigious journal was good news and an indication that my Ph.D. research had indeed been useful to someone. Moreover, chances were good the author of the paper and I could collaborate on related future research projects. I decided to try convincing my colleague to at least let me have a peek at the submitted paper.
A few months later, I met the colleague, who now told me the paper had been rejected due to its poor fit with the journal's editorial mission and readership. He then offered some information from the associate editor, who had attached the reviewers' comments and the formal rejection letter she had sent the author. The review was extremely detailed, impartial, and very professional.
The associate editor said she had asked three reviewers to read and comment on the paper. Two of them (one was my colleague) had strong business orientations; the other had a more technical orientation. The two business-oriented reviewers praised the paper and recommended acceptance; the other strongly recommended rejection because it was not geared toward the journal's target audience, suggesting the paper should instead be submitted to a business journal. The associate editor then reviewed the paper herself, concurring with the technically oriented reviewer. She formally rejected the paper due to the mismatch between the paper's content and the journal's editorial mission.
As soon as my colleague let me see the paper, I noticed the associate editor in her letter to him had not only mentioned the name of the person submitting the paper but included a copy of the paper's first page, which included the title, the name of the person submitting it, and his affiliation. The first page was stamped "Received Mar. 1, 1997, 104135 0."
I immediately noted the wording was quite similar to the wording in some of my papers; even some phrase constructions and grammatical quirks were the same (for example, I usually refer to data in the singular, as in "the research data was obtained from"). Something was strange. The author of the paper (hereafter referred to as Plag) had apparently written it using large chunks of text from the article I had already published in the journal The Learning Organization several months before. I later found out Plag had used a version of the article whose electronic version was available from my Temple University Web page.
I then checked my publications until I found The Learning Organization, vol. 4, no. 2, published by MCB Press, Bradford, England, early in 1997, with my article, "The Nature of Data, Information and Knowledge Exchanges in Business Processes: Implications for Process Improvement and Organizational Learning"; my coauthors were Bob McQueen and Jim Corner, both at the University of Waikato, New Zealand. Comparing this article with Plag's submitted paper, I found about half of the sentences in both to be almost exactly the same.
The temptation of having to spend just a few hours rather than years of work to fulfill a publication quota can be very strong for some.
My article was based on research data collected over several years from three organizations, one in Brazil, the other two in New Zealand. Figure 1 shows the first paragraph of my article's "Research Method" section and that of Plag's "Research Method" section. A few paragraphs earlier in Plag's paper, it said "actual names of companies have been disguised for the sake of confidentiality."
Of the 51 paragraphs in Plag's paper, 38 were nearly sentence-by-sentence, word-for-word copies of paragraphs from my article. The order of the paragraphs in Plag's paper was nearly identical to that in my article. Three paragraphs in Plag's paper were partial copies of paragraphs in my article, from which approximately half the sentences had been copied verbatim.
All but one of the references in Plag's "References" section (the exception was a paper by Plag) were identical to the references in my article, including those to a book and a manual in Portuguese I had written two and four years before, respectively. I wrote the manual for a course on quality management I taught in Brazil; getting a copy from anyone but me would be difficult, and I had never received a request for it from Plag or sent him a copy.
Four of the five figures in Plag's paper were nearly identical to those in my article, including a flowchart with 12 symbols; the symbol shapes (such as square and oval) and their relative locations in Plag's flowchart were identical to those in my article.
The two tables in Plag's paper were nearly identical in shape and content to those in my article, including one showing the processes about which research data had been collected under the caption: "Table 1. General description of the processes studied." Plag's paper also had a table listing the processes studied, under the caption: "Table 1. Distribution of business processes studied." Note that, even though Plag's paper claims that 20 business-process instances are analyzed, his table shows 22 processesthe same number analyzed in my article (see Figure 2).
Good research papers usually include a section in which the authors seek to show they understand the limitations of their research. The section often warns the reader about possible sources of bias in the research, problems that could have arisen from the data collection and analysis methods used, and limitations on the extent to which the research findings can be generalized. In an apparent attempt to maintain such conventions, Plag's paper included the following warning in its section "Limitations of the Research":
"It is important to point out that this research investigated business processes in the U.S. apparel industry and hence research findings may be limited to the apparel industry. Other correlations and relationships may emerge in other industrial (e.g., electronics, pharmaceutical, insurance), national or international organizations. These limitations call for further empirical research in other industries and settings."
I showed Plag's paper and my article to a number of close friends and colleagues; their advice on what I should do ranged from "Forget about it, this guy is going to be caught sooner or later anyway" to "Sue him for theft of intellectual property."
The colleague who had reviewed Plag's paper now read my article, noted the striking similarities between them, and sent an email to the associate editor of the journal to which Plag had submitted his paper, informing her about the potential copyright infringement. He also faxed her a copy of my article for comparison. At my request, he asked her not to take any action until I had carefully analyzed the legal implications of the case and gathered more information about Plag. Most important, I wanted to make sure Plag had submitted the paper himself, as opposed to someone's having submitted it under his name. I reasoned that someone might have done so as a joke or as a deliberate attempt to undermine Plag's reputation.
Plag's paper cited his affiliation with a department of a large U.S. university. I checked the Web page of his department, saw Plag's name listed as a faculty member, and downloaded his personal Web page from there.
He apologized only for is "grave mistake"too vague to be viewed as valid from a legal perspective.
Plag's page had several sections, starting with his contact information and address. Its "Background" section listed three degrees: doctor of philosophy from a prestigious U.S. university, MBA, and B.Sc. in mechanical engineering. There was also the following statement:
"My involvement with information technology at both the operational and executive level in leading Fortune 500 companies has equipped me with an acute awareness of and sensitivity to the importance of information systems in organizations.
"Standing on the threshold of the 21st century and well entrenched in an information age, I feel very privileged to be in the midst of this tumultuous and exciting era of change. As a trained IS professional anchored in a strong academic setting, I perceive for myself a dual role of integrating IS with other areas of knowledge and bridging the 'terrestrial gap' between theory and application of IS."
The "Publications" section listed several papers that had been published or accepted for publication. Among them were eight journal articles, one refereed book chapter, and 24 conference proceedings papers. Also listed were four articles under review and 10 working papers. Among the refereed journal publications, six listed Plag as the sole author. The other two journal papers listed coauthors; their dates ranged from 1995 to "forthcoming" (this was 1997). Of the 24 conferencing proceedings papers, 20 listed Plag as sole author, and the other four listed coauthors; their dates ranged from 1994 to 1997.
These publications suggested that Plag had published on a good number of topics from 1994 to 1997, including reengineering, strategic information systems, software testing, the Internet as a strategic tool, client/server systems adoption, global supply chains, software procurement, system development methods, organizational behavior, global information technology infrastructure, object-oriented systems development, neural network design, heterogeneous and multidimensional databases, and information systems outsourcing.
Plag's page's "Awards and Honors" section listed eight awards or honors, including "Best Dissertation International Award" followed by the name of a prestigious international conference (one I personally regard as the top conference in the information systems field). When checking for confirmation about the award, I indeed found it listed on the conference's official "Awards" Web page, which included all the awards granted since the conference's inception.
I next sought legal advice. I was looking not only for guidelines on how to proceed but the likely legal implications for both Plag and me. Over the next three months, I contacted 12 lawyers by phone and in person.
Initially, I contacted lawyers specializing in patents and intellectual property in general, but these contacts were frustrating, as I had to explain the details of my situation to each of them, only to be told they could not help me. Some expressed surprise; a few pointed out right away that (in the words of one), "There doesn't seem to be much money in [this case]." Some of them recommended caution dealing with Plag, saying, "He seems to have a lot more to lose than you do." I concurred; if Plag really wanted to pursue an academic career, he would do whatever he could to discredit an accusation of academic plagiarism.
Later, one lawyer specializing in intellectual property told me I could always contact Plag directly and request he financially compensate me for the distress caused by his actions. He viewed my case as strong enough for me to win in court easily and believed Plag was probably aware of that outcome. He told me to make it clear to Plag I was seeking an amicable solution and to say I had no intention of suing him if it wasn't necessary. He added that I should cut a deal with Plag; it would scare him so much he would never plagiarize anything again. The lawyer also told me he could not represent me if the case went to court, as he only took cases involving corporate disputes.
Still later, I called the Philadelphia Bar Association's lawyer referral service. The lawyer answering my call said I should contact the bar association of my township (I live in New Jersey near Philadelphia). Because my house was near the border of two townships, I had to contact two bar associations. When I found the right one and called, I was told I should try the Philadelphia Bar Association again, asking specifically for a lawyer licensed to practice in Pennsylvania (where I work) and New Jersey (my state residence). I did so and was given a name. In the meantime, I was referred by a friend to another lawyer who was also a university professor.
In my phone conversations with lawyers from the bar associations, I was strongly advised to seek financial compensation from Plag. In the words of one, "This is your only option in this case," meaning there were not many other avenues through which I could seek justice in the U.S. legal system. However, this lawyer also told me that contacting Plag or someone close to him directly and making allegations about the submitted paper might prompt him to countersue me for harassment and slander. Since Plag was in a different state in the U.S., chances were I would have to hire a different lawyer to defend me in that state if Plag sued me for such offenses.
I met with the lawyer who was also a university professor. Although she agreed something should be done, her advice was filled with caveats, such as I would probably be doing myself a favor if I concentrated on something more productive than going after Plag. She pointed out that Plag would probably deny any wrongdoing and attack my reputation as a form of defense. "Believe me," she said, "this can turn into a bloody battle where there will be no winners."
I also met with an aggressive young lawyer, whose advice was quite different. He felt I had a strong case, given the similarities between the paper and the article, the fact that my article had been published before Plag submitted his paper, and the formal nature of his submission (including Plag's name, affiliation, and signature). He also felt I should not sue Plag directly, as Plag would probably file a lawsuit against me for defamation. The most appropriate tactic, according to this lawyer, was to sue Plag's employer. Not only would this guarantee financial compensation, as the lawyer felt Plag's university probably had some sort of collective professional liability insurance, it would also ensure that the university itself would take disciplinary or legal action against Plag. In a sense, this was probably the most pragmatic advice I had received so far. But I was not sure whether it would be ethical to sue Plag's institution.
After thinking further, I decided to contact Plag directly. I was determined to get a written apology from him as well as financial compensation for the time I had spent on the case.
On July 24, 1997, I called Plag from my office at Temple University. I introduced myself and told him I had a copy of one of his papers. I described some of its details, including its title and the journal it was submitted to. I then asked whether he had submitted it himself; he answered that he had.
I then mentioned the incredible similarity between his paper and my published article. He denied any wrongdoing, telling me the similarity was just coincidence. I told him I didn't think so and wanted him to send me a written apology. I also told him I wanted to be compensated for the time and distress the incident had caused me. He still insisted he had done nothing wrong. Later that day, he sent me an email, including:
"I am extremely sorry for my mistake. I sincerely apologize for this grave mistake. I will not do this again. I promise. As required by you, I will fax you an apology letter to you today. I kindly request you not to take any further action. I am still on student visa and I come from a poor family. I have worked very hard all my life to be in this position. I have a family and kids. If you take any action, my whole life will be ruined. I may have to end my profession. Please, I beg you. I will be eternally grateful to you if you pardon me this last time. I assure you that I will not commit this mistake again.
"Please, at least for my family sake, do not take any further action. Both my family and I will be ever very thankful to you."
In an apology letter he later faxed to me, Plag never mentioned what he was apologizing for. As in his email, he apologized only for his "grave mistake"too vague to be viewed as valid from a legal perspective. Plag could later claim, if the matter for some reason went to a court of law, that he had apologized for something elseunrelated to plagiarism. Although my intent was not to ruin anyone's life or career, I wanted Plag to apologize for using my published article in his paper. I wanted him to send me a signed letter; the letter he faxed me was not signed. I stated these points clearly in an email I sent to him a few days later. On July 28, Plag sent me another email, including:
"I have taken some time from my busy schedule and investigated your accusations regarding my article. I am wrong to have apologized without investigating the matter myself. Now I have ample evidence to prove that my work was not plagiarized from any published/cited source. I have consulted a top attorney who is ready to take up the matter in court if you still plan to defame me on false grounds. In fact, my attorney suggests I file a 'defamation suit' to claim damages for tainting my 'outstanding research record.' It is unfortunate that you have managed to prey on my 'trusting' nature and caused me and my family lot of heartburn, physiological, and psychological problems since last week. I am willing to forget and forgive this if you recognize this error. Some of the senior colleagues in the field have also encouraged me to take a legal course if you still insist on pursuing this case.
I was never contacted by Plag's university directly or given any satisfaction about how it had dealt with his claims against me.
"I would like to rest this matter with this message. I would appreciate your reply; if not, I will assume that you are intent on 'defaming' my career and family and will proceed with my attorney's recommendations on the legal course of action open to me."
This email made me quite angry. In my reply, I said that if he thought he could sue me successfully, he should go ahead and do so. I pointed out that in a defamation suit, he would have to prove that my allegations were falseimpossible for him, given his formal submission of a paper whose earlier publication by other authors was well documented.
His threats were frightening for at least one reason: The U.S. legal system does not require Plag or anyone else to automatically pay the legal expenses of the person sued if a lawsuit is unsuccessful. If a suit's winners so wish, they must sue later to recover their expenses but then might be facing an appeal of the first decision that can be considered a new lawsuit by itself. Unlike those of other countries (such as England), the U.S. legal system does not include the rule usually known as "the loser pays." The only exception is the state of Alaska . This characteristic of the U.S. legal system may encourage someone in Plag's situation to sue first, then appeal as many times as possible to buy time (possibly until tenure is decided). This tactic could also be used to force the other party to abandon the case in the face of mounting legal bills. I consulted a lawyer about legal costs if a lawsuit were filed against me and was told my legal defense could easily cost me $10,000$20,000. I was also told there was a good chance I might also have to defend myself in Plag's home state, thus adding transportation, communication, and other related costs to my defense.
Regarding Plag's threats, yet another lawyer told me it was unlikely that Plag would sue me, saying, "If [Plag] was really planning to sue you, he would have already done so." Although this comment was reassuring, I almost regretted having written my article in the first place. The whole situation had become inconvenient and distressful. Then on July 31, I received a long email from Plag, saying, in part:
"I am writing this to you on the advice of some senior faculty in the field with the hope of resolving this amicably.
"It is very unfortunate that two promising researchers should find themselves in this peculiar situation. Though the ideas represented in our papers are similar, I can truthfully say that I did not come across your 'in press' papers during my literature search. Had I come across them I could NOT have pursued this research. I can sincerely say that the motivation for the study came from unpublished sources on the Internet.
"Some of my mentors who are very senior in the field opine that this may be a coincidence and I have done the right thing in apologizing and that we should be laying this matter to rest as no credit has been taken away from you. I have been told that unintended cases such as this have happened in the past, but have been settled amicably without any talk/threat of legal action. These senior faculty feel that if you indeed take any such action, the credibility of the MIS field would be itself shaken, and they feel they would not be able to forgive us if we end up jeopardizing the future of MIS when we are fighting to stay credible in the eyes of the American Assembly of Collegiate Schools of Business. I agree with their wisdom and advice because I believe that the interests and future of MIS is of overarching importance. I fear to think of the consequences and our futures if we end up jeopardizing all these years of hard work and hope that these visionaries have had for the rest of us. I fervently hope that we don't let them down. We could rise up to the occasion if only we put our heads together and settle this matter.
"Though you may not feel this way, I am still your well-wisher and I would hate to see a dark shadow cast on your future because of one irrational moment. Our academic community is very tightly-knit here in the U.S. and during my stint here I have learned how important the image of the field is in the overall scheme of things and that we shouldn't wash our dirty linen in public and jeopardize that. I have been fortunate to have the blessings of 'powers-that-be' in the field as my mentors. And I can honestly say that they do not like the course that this issue is taking. So in my humble opinion, I think it would be in our best interests to lay this matter to rest and get on with our lives.
"On a personal note, since we share some common research interests, I propose that we could collaborate on future research projects. Currently I am teaming with some very senior faculty in leading U.S. schools in a variety of research and consulting projects. We are forming a consortium to address a variety of issues and I could perhaps recommend you if you are interested in this. This would give you a lot of visibility and opportunity to climb greater professional heights. I cannot reveal the nature of these projects at this juncture, but if we can definitely explore these and other opportunities once this dust settles down."
I never replied, but given the reference to "senior faculty in the field of MIS," I decided to show the evidence I had been collecting to several senior researchers and faculty in departments of information systems at several universities in and outside the U.S. I figured that at some point I would be attending an international conference where these people would likely be gathered, an opportunity that came in August 1997 in Indianapolis, during the Association for Information Systems Americas Conference (AIS97). As for their reactions, all those I spoke with were outraged by what they saw. Many suggested I take the case to a public forum, others that I just wait, as word was spreading quickly and would eventually reach Plag's university.
I also contacted several representatives of academic and research associations in the information systems field. I showed them the evidence of plagiarism, requesting that disciplinary action be taken against Plag. In all cases, I was told no action was possible for one reason or another. The reasons were essentially the same: The associations lacked provision in their budgets for possible defensive lawsuits by Plag against them.
A few weeks after returning from the conference, I was told by a senior academic colleague that he had contacted a faculty member in Plag's department, telling him about the evidence I had shown at AIS97. Later in the week, I was told by another colleague I met at AIS97 that Plag, when faced with the facts by his immediate supervisor, had accused me of plagiarizing his work.
I then asked the editor of The Learning Organization and representatives of MCB Press for help. MCB Press is the rightful owner of my article's copyright. After I faxed them the evidence about Plag's paper, they contacted Plag directly through a formal letter. Under U.S. copyright law, Plag could face severe penalties for what he did, including financial statutory damages. These, according to , could involve the following:
"For a work that is registered, the author may receive statutory damages of up to $100,000 for each willful infringement, without having to actually prove what her [or his] damages were; that is the meaning of statutory damagesthose damages provided by statute regardless of actual damages, which are hard to prove in most cases."
MCB requested a signed letter from Plag apologizing for what he had done. Plag quickly sent MCB such a letter; I received a copy. It was important for me to have a copy as a future deterrent to lawsuits Plag might want to file against meas a practical legal tactic or for revenge.
In September 1997, a colleague told me Plag had resigned from his assistant professor position, a fact later confirmed in an email Plag's immediate supervisor sent to several faculty who had inquired about the case. This email said Plag had resigned due to family and health reasons and his resignation had been accepted by his institution. However, I was never contacted by Plag's university directly or given any satisfaction about how it had dealt with his claims against me.
Meanwhile, another colleague told the university that had granted Plag his Ph.D. about his actions, prompting a full internal inquiry into his doctoral work. To my knowledge, this inquiry was continuing at press time.
Plag's case begs a basic question: Although posting files on a Web page can help disseminate academic results, are such files safe? Many publishers of scholarly journals act as if posting their content is a reasonably safe way to advertise their publications and disseminate scholarly work . On the other hand, another recent case involving freelance writers reveals U.S. copyright law does not provide a way to unequivocally determine rights on material published electronically .
Based on my experience, making paper files available electronically may make it easier for someone to plagiarize them. But the same papers can be scanned and easily turned into text files with standard optical character recognition software or manually copied word for word from a publication's printed version. Moving away from the Web as a distribution medium for academic papers would not solve this problem.
Internet-based distribution of papers may make plagiarism easier, but it also makes it easier to catch a plagiarist, for at least two reasons: Electronic access to files in Web servers can often be traced back to the Web clients from which the files were downloaded, and downloading files from the Web for use in new submissions increases the chance that vital information and patterns in the text structure can be traced back to the original author(s). As in my situation, examples include peculiar grammatical constructions, symbol shapes in figures, and difficult-to-find referencesall available in abundance in Plag's fraudulent paper. Also note that the same general platform Plag used to get my articlethe Internetwas also the means for me and others to react quickly.
Plag could have put up quite a battle and caused me lots of troubleif he had really wanted to and if he could have afforded to. He would not have had to do much more than hire a good lawyer who knew how to work expertly within the bounds of the U.S. legal system. After a while, chances are I would have found myself alone in my battle against him. From my conversations with colleagues, lawyers, and others, I inferred that many people would have tried to hold Plag accountable for what he did, though many would have given up to avoid further legal trouble and expense.
Perhaps the best way to prevent cases like Plag's from being more common than they are is to publicize and discuss them as widely as possible. They can be used to initiate debate on academic plagiarism and its implications for the emerging field of information systems research. This debate should include at least one important subjectestablishment of ethics committees in the various associations of systems researchersto bring some measure of justice to the people involved. Maybe other fields will follow suit; the problem certainly does not belong exclusively to the field of information systems.
©1999 ACM 0002-0782/99/0700 $5.00
Permission to make digital or hard copies of all or part of this work for personal or classroom use is granted without fee provided that copies are not made or distributed for profit or commercial advantage and that copies bear this notice and the full citation on the first page. To copy otherwise, to republish, to post on servers or to redistribute to lists, requires prior specific permission and/or a fee.
The Digital Library is published by the Association for Computing Machinery. Copyright © 1999 ACM, Inc.
No entries found | <urn:uuid:9f961012-9452-4d18-a672-d87635fbf1f3> | CC-MAIN-2022-33 | https://cacm.acm.org/magazines/1999/7/7866-a-case-of-academic-plagiarism/fulltext | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.981964 | 6,858 | 2.140625 | 2 |
Oyster mushroom production is on the increase in the United States. This article details the cultivation of oyster mushrooms from spawn to postharvest handling and marketing.
UPDATED: JUNE 27, 2016
Total mushroom production worldwide has increased more than 18-fold in the last 32 years, from about 350,000 metric tons in 1965 to about 6,160,800 metric tons in 1997 (Table 1). The bulk of this increase has occurred during the last 15 years. A considerable shift has occurred in the composite of genera that constitute the mushroom supply.
|Species||Fresh weight (x 1,000 t)||Increase|
Source: Chang (1999)
During the 1979 production year, the button mushroom, Agaricus bisporus, accounted for over 70 percent of the world’s supply. By 1997, only 32 percent of world production was A. bisporus. The People’s Republic of China is the major producer of edible mushrooms, producing about 3,918,300 tons each year–or about 64 percent of the world’s total. China also produces more than 85 percent of all oyster mushrooms (Pleurotus spp.) grown worldwide (Table 2).
|Country||1,000 m.||1,000 lbs.||%|
|Rest of Asia||88.4||194,887||10.1|
|Rest of Europe||5.8||12,787||0.7|
Source: Chang (1999)
From 2001 to 2002, the United States produced 393,197 metric tons of mushrooms, or about 7 percent of the total world supply. A. bisporus accounted for over 90 percent of total mushroom production value, while Lentinula, Pleurotus, Grifola, Flammulina, Hypsizygus, Hericium, and Morchella were the main specialty genera cultivated. The value of the 2001-2002 specialty mushroom crop in the United States amounted to $37 million, down 12 percent from the 2000-2001 season. The average price per pound for specialty mushrooms received by growers, at $2.77, was down $0.27 from the previous season.
Sales volume of oyster mushrooms, at 4.03 million pounds, was up 11 percent from the 2000-2001 season, with a total of 51 growers producing 4.27 million pounds of the mushrooms in the 2001-2002 season. Total production includes all fresh market and processing sales plus amount harvested but not sold (shrinkage, cullage, dumped, etc.). Average oyster mushroom output per farm in- creased 249 pounds (18.3 percent) per week, from 1,359 pounds in 2001 to 1,608 pounds in 2002 (Table 3). The production of oyster mushrooms (Pleurotus spp.) in the United States has increased at an annual rate of 14 percent during the last 6 years, from 1,941,000 pounds in 1996 to 4,265,000 in 2002. This increase reflects an international trend toward increased production of this crop. Oyster mushrooms accounted for 14.2 percent (875,600 tons) of the total world production (6,161,000 tons) of edible mushrooms in 1997, the most recent year for which statistics were available.
|Year||No. growers||Production (lbs.)|
|Annual (x1000)||Per wk/grower|
Source: USDA (2002)
The increase in United States production is due to increased consumer demand and the relatively high compensation growers receive for the product. According to the USDA, farmers received an average of $2.00 per pound for fresh oyster mushrooms while growers of A. bisporus received an average of $1.07 per pound for fresh product in the 2001-2002 growing season. The higher price received for fresh oyster mushrooms reflects, in part, the less-developed and less-reliable technology available to growers for cultivating these species. Thus, growers need potentially higher incomes to help offset the increased risks associated with producing Pleurotus spp.
Oyster mushrooms are grown from mycelium (threadlike filaments that become interwoven) propagated on a base of steam-sterilized cereal grain (usually rye or millet). This cereal grain/mycelium mixture is called spawn and is used to seed mushroom substrate. Most spawn is made with mycelium from a stored culture, rather than mycelium whose parent was a spore. This is because spores are likely to yield a new strain and performance would be unpredictable. Spawn-making is a rather complex task and not feasible for the common mushroom grower. Spawn of various oyster mushroom species may be purchased from commercial spawn makers who usually provide instructions for its use. Spawn frequently is shipped from the manufacturer to growers in the same aseptic containers used for spawn production. Inoculum for spawn production is frequently produced in polyethylene bags containing a microporous breather strip for gas exchange. Most commercial spawn production companies produce spawn only from inoculum that has met strict quality control standards. These standards include verification of inoculum production performance before it is used to produce spawn and insurance of the spawn’s biological purity and vigor.
Before 1970, cultivars used for commercial spawn production were maintained on various agars or cereal grains with periodic subculturing of growing mycelium to a fresh medium. This method, for the most part, was reliable, although spawn makers and researchers reported cases of culture degeneration periodically. In 1970, researchers successfully preserved and maintained stability of spawn stocks of A. bisporus stored in liquid nitrogen. Several research reports on culture maintenance verified the suitability of cryogenic preservation, fundamentally changing the way spawn makers handled their cultures used for commercial spawn production. In practice, cryogenic preservation is used to ensure use of superior spawn-starter cultures. Many vials (perhaps as many as 200 to 300) containing spawn or mycelium from cultures of promising spawn lines are stored in liquid nitrogen. Following successful testing of the spawn lines at both pilot plant and commercial testing facilities, the spawn maker can easily reproduce the superior lines many times during subsequent years.
Production in Bags
In the United States, the primary ingredients used for Pleurotus spp. production are chopped wheat straw (Triticum aestivum L) or cottonseed hulls (Gossypium hirsutum L) or mixtures of both. For production on wheat straw, the material is milled to a length of about 2 to 6 cm. Production of Pleurotus spp. on cottonseed hulls has some advantages over straw-based production systems in that chopping of the hulls is not required. One of the most common substrates used on modern mushroom farms is a mixture of 75 percent cottonseed hulls, 24 percent wheat straw, and 1 percent ground limestone. This mixture of cottonseed hulls and wheat straw has a higher water holding capacity than cottonseed hulls used alone. At Penn State’s Mushroom Research Center (MRC), a large-capacity, scale-mounted feed mixer (Figure 1) is used to simultaneously grind and mix the material as water is added to increase the moisture content to 67 to 69 percent.
On some commercial mushroom farms, ingredients are fed into revolving mixers, water is added to the desired level, and live steam is injected into the mixer while in operation. At the MRC, moistened, mixed substrate is filled into galvanized metal boxes with perforated floors (Figure 2). The substrate is pasteurized with aerated steam at 65oC for 1 hour by passing the air-steam mixture through the substrate from top to bottom. After pasteurization is complete, filtered air (HEPA filter, 99.9 percent efficiency) is passed through the substrate for cooling (approximately 1.5 hours).
Spawning and spawn rate
Growers have sought, in the past, to optimize the amount of spawn used to inoculate their substrate. Increasing the amount of spawn used (up to 5 percent of the wet weight of the substrate) has resulted in increased yields. Increasing spawn rates from 1.25 percent substrate wet weight to 5 percent may result in yield increases of nearly 50 percent (Figure 3a). Yield increases may be due to several factors. First, the increased level of nutrient available in higher levels of spawn used would provide more energy for mycelial growth and development. Second, more inoculum points, available from increased spawn levels, would provide faster substrate colonization and thus, more rapid completion of the production cycle. Finally, a more rapid spawn run would reduce the time non-colonized substrate is exposed to competitors such as weed molds and bacteria.
For increasing levels of spawn used (up to 5 percent), there is a negative correlation between spawn rate and days to production. As the spawn rate increases, the number of days to production decreases (Figure 3b). By using a spawn rate of 5 percent of the wet substrate weight, it is possible to reduce the time to production by more than 7 days compared to a spawn rate of 1.25 percent. Thus, growers could complete the crop cycle faster, minimizing the exposure of the production substrate to pest infestations, especially sciarid (Lycoriella mali [Fitch]) flies. Research has shown that the sciard fly may complete its life cycle in 25 days at 21°C, while 35 to 38 days are required at 18°C. Timely disposal of spent substrate may help to minimize the buildup of fly populations on a mushroom farm.
Use of delayed-release supplements
At time of spawning, a commercial delayed release supplement consisting of paraffin-coated whole soybean or formaldehyde-denatured soybean and feather meal may be added at rates of 3 to 6 percent of dry substrate weight, to stimulate yield of the mushroom. Yield increases of up to 90 percent have been observed when 6 percent (dry weight) supplement is added to substrate at time of spawning (Figure 4a). Delayed-release nutrient supplements have also been shown to decrease the number of days to harvest (Figure 4b). The addition of 3 percent nutrient at time of spawning may reduce time to production by 2 to 3 days. Thus, growers wishing to hasten the production process may do so by supplementing with only small quantities of supplement. Use of supplements, however, may cause overheating of the substrate if growers are unable to anticipate and control air temperatures to maintain a steady substrate temperature. Additional cooling capacity is required when higher levels of supplement are used.
Filling plastic bags with substrate
The pasteurized, supplemented hull/straw mixture is spawned and filled (25 to 30 pounds) into clear or black perforated polyethylene bags and then incubated at 23° to 25°C (substrate temperature) for 12 to 14 days. Mushrooms then begin to form around the edges of bag perforations and they are harvested from the substrate approximately 3 to 4 weeks after spawning depending on strain, amount of supplement used, and temperature of spawn run (Figure 5).
Figure 5. Yellow oyster mushrooms (Pleurotus cornucopiae) fruiting from pasteurized substrate (75 percent cottonseed hulls, 24 percent chopped wheat straw, and 1 percent ground limestone) contained in black bags suspended from overhead supports (MRC).
Production in Bottles
In Japan, bottle production of oyster mushrooms is most common (Figures 6a-d). Bottle production also is increasing in popularity in the United States. Substrate is filled into bottles contained in trays (usually 16 bottles per tray), sterilized, and inoculated with Pleurotus spp. spawn (Figure 6a-d). Upon completion of spawn run, bottle lids are removed and the surface of the substrate is scratched mechanically (1 to 2 millimeters of substrate surface containing mycelium are removed). Scratching is required to stimulate the mycelium to produce mushroom primordia uniformly on the surface. After the mushrooms are harvested, they are weighed and packaged for shipment to market (Figures 7a-d). | <urn:uuid:1fb1c6a8-dc67-450c-add0-1318fc082a9c> | CC-MAIN-2022-33 | https://mushroomsonlineshop.com/2021/10/12/hello-world/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.905839 | 3,062 | 2.609375 | 3 |
What is Vegan Cheese Alternatives Market?
Vegan cheese alternatives are dairy-free cheese that is made from different types of raw tree nuts & seeds and other plant-based ingredients. Increasing vegan populations and awareness about animal cruelty. Cheese is the most favorite food across the globe. It can be used in various bakery products and food dishes. Cheeses made from nuts and seeds are rich in nutrition, minerals, fibers, proteins, fats, and calories. Vegan cheese is the best dairy-free alternative for various food dishes and is easily available worldwide.
The market study is being classified, by Application (Bakery Products, Food Dishes and Others) and major geographies with country level break-up.
Kite Hill (United States), Urban Platter (India), Bombay Cheese Company (India), Dr-Cow (United States), Miyoko’s Creamery (United States), Daiya Foods Inc. (Canada), GOOD PLANeT Foods (United States), Violife Foods (Greece), Applewood Cheese (United Kingdom), Tyne Chease Ltd (United Kingdom), Bute Island Foods Ltd (United Kingdom), In A Nutshell (Philippines), Kroodi (Singapore) and Feel Foods (Canada) are some of the key players profiled in the study.
The companies are exploring the market by adopting mergers & acquisitions, expansions, investments, new service launches, and collaborations as their preferred strategies. The players are exploring new geographies through expansions and acquisitions to avail a competitive advantage through combined synergies. Research Analyst at AMA predicts that United States and United Kingdom Vendors will contribute to the maximum growth of Global Vegan Cheese Alternatives market throughout the predicted period.
Analyst at AMA have segmented the market study of Global Vegan Cheese Alternatives market by Type, Application and Region.
On the basis of geography, the market of Vegan Cheese Alternatives has been segmented into South America (Brazil, Argentina, Rest of South America), Asia Pacific (China, Japan, India, South Korea, Australia, Rest of Asia-Pacific), Europe (Germany, France, Italy, United Kingdom, Netherlands, Rest of Europe), MEA (Middle East, Africa), North America (United States, Canada, Mexico). Additionally, the rising demand from SMEs and various industry verticals gives enough cushion to market growth.
- Growing Popularity of Vegan and Dairy-free Diet
- Need for Plant-based Cheese Alternatives with Different Flavors and Textures
- Increased Focus on Innovation in Dairy Alternatives
- Availability of a Large Number of Manufacturers and Growing Preference towards the Homemade Vegan Cheese
- Increasing Demand for Plant-based Soft and Cream Cheese Alternatives as Spreads
- Some Vegan Cheese Contains High Fat and Allergies for Nuts or Other Ingredients
Market Leaders and some development strategies
In October 2021, Feel Foods announced the acquisition of Black Sheep Cheese Vegan Cheeze to expand distribution and develop new plant-based products. Black Sheep produces and distributes vegan cheese at multiple locations across British Columbia. With this acquisition, the main aim of Feel Foods is to transform plant-based foods with no compromises on taste or quality while reducing global environmental impact.
Key Target AudienceNew Entrants/Investors, Analysts and Strategic Business Planners, Vegan Cheese Alternatives Manufacturers, Suppliers and Distributors of Vegan Cheese Alternatives, Venture Capitalists and Private Equity Firms, Government Regulatory and Research Organizations and Others | <urn:uuid:b3679918-8999-444d-a3ed-0f5542268a95> | CC-MAIN-2022-33 | https://www.advancemarketanalytics.com/reports/182958-global-vegan-cheese-alternatives-market | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.909509 | 726 | 1.828125 | 2 |
April 13, 2022
Oncology Update 2021 | All Modules
The purpose of the program is to provide clarity on oncology management guidelines as well as an update on new therapies, medications, and technologies involved in care for patients across the lifespan and in all care settings.
For nurses, nurse practitioners, nurse educators, physicians, pharmacists, social workers, health educators, physical therapists, and other healthcare professionals across all settings.
Objectives for Learning Outcomes
Upon completion of this conference, participants will be better able to:
- Describe safe handling practices for administration of chemotherapy, including PPE.
- Identify actionable items nurses can lead in their practices to address inequities.
- Increase understanding of the psychological impact of impaired fertility among patients with a cancer diagnosis and cancer survivors.
- Understand racial health disparities in cancer care.
- Identify and develop knowledge about common survivorship issues such as cancer-related fatigue, sarcopenia and lymphedema.
- Explain how to recognize and report immune-mediated (related) adverse events.
- Safe Handling of Chemotherapy – Kelley Blake
- Nurses as Changing Agents for Health Equity – Weichao Yuwen
- Fertility Preservation for the Oncology Patient: Why, How, and How Quickly? – Anne Judge
- Cancer Care Racial Disparities in the United States – Amanda Lulloff
- Physical Therapy is a Critical Component of the Oncology Team – Andréa Leiserowitz
- Immunotherapy: Demystification for the Masses (Rx) – Kelly Weaver
- Kelley Blake, MSN, RN, AOCNS, NPD-BC
Oncology Clinical Nurse Specialist, UW Medicine/Valley Medical Center
- Andréa Leiserowitz, PT, DPT, CLT
Board Certified Specialist in Oncologic Physical Therapy, Eugene, OR
- Amanda Lulloff, PhD, APRN-CS, PCNS, CPHON
Nurse Educator, Cancer and Blood Disorders Center, Seattle Children’s Hospital
- Weichao Yuwen, PhD, RN
Assistant Professor, School of Nursing and Healthcare Leadership, University of Washington Tacoma; Affiliate Assistant Professor, Department of Child, Family, and Population Health Nursing, UW School of Nursing
- Anne Judge, DNP, WHNP-BC, ARNP
Nurse Practitioner, Seattle Reproductive Medicine
- Kelly Weaver, MSN, RN, ARNP, OCN, ACNS-BC, NP-C
Nurse Practitioner, Oncology/Hematology, MultiCare Regional Cancer Center, Puyallup
UW=University of Washington, Seattle | <urn:uuid:9103d34b-b555-44fb-967c-082030eb59a6> | CC-MAIN-2022-33 | https://learning.nursing.uw.edu/courses/oncology2021ondemand/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.862718 | 584 | 1.726563 | 2 |
Cancer & physical illness
Receiving a diagnosis of cancer or another serious physical illness can be a life-changing moment. Often it is a time of fear and uncertainty. There might be feelings of powerlessness, anger, despair or deep loneliness. Frequently, medical imperatives have to take precedence over all other considerations and this can be anxiety-provoking and alienating. 'Normal' life is interrupted and changes occur in all spheres of existence - practical, physical, emotional, psychological, relational, financial, spiritual. Treatments and medications can have temporary or permanent effects and day-to-day life can feel challenging both during and after treatment.
The impact of a diagnosis and the ongoing management of a physical illness, condition or disability can be profound whether you are a patient, a family member, close friend or carer.
Counselling can be helpful with: | <urn:uuid:d86fbe10-8d00-4026-bb0e-5e2ba1526438> | CC-MAIN-2022-33 | https://www.counsellorinlondon.net/phdi/p1.nsf/supppages/7455?opendocument&part=3 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.882894 | 177 | 2.15625 | 2 |
There is a chance that you will need to understand what you need to know about auto glass replacement or installation. EricTheCarGuy of Kiss Car Glass, walks us through the process of installing a windshield onto his Honda Element 2004. The important stages in installing the windshield is taking off the hood, and then removing everything surrounding the windshield, to expose the windshield perimeter. It is then followed by cutting off the rubber surrounding the windshield with the cold knife and removing the windshield.
When the windshield has been taken off then the old urethane will be scraped away with glass scraper blades to clean any debris or debris from the surface of the frame. To prevent scratches or corrosion the primer must be applied to the blade. Subsequently, using caulking guns, a brand new coat of urethane spray to strengthen the windshield before being glued to the windshield. | <urn:uuid:05b5f284-31c1-43e6-b63d-8293c13177b3> | CC-MAIN-2022-33 | https://downtownrochesterrestaurants.com/tips-for-installing-a-car-windshield-the-correct-way-how-to-fix-a-car/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.899275 | 183 | 2.1875 | 2 |
Why do you want to be a surgical technologist?
Surgical technologists are specialists that are becoming a more cost-effective solution for many hospitals. As nurses are seeing the scope of their duties and the resulting education required for their daily tasks increase, the surgical technologist is becoming a popular way to free them up for the care of patients.
What are the benefits of being a surgical technologist?
6 Benefits of becoming a surgical techYou can enter the field quickly. Job opportunities are on the rise. You’ll have above-average earning potential. Employment opportunities exist in all geographic areas. You won’t get bored. You’ll make a difference every day.
What does it mean to be a surgical technologist?
Definition: Certified Surgical Technologist Surgical technologists prepare the operating room, including the sterile field, setting up surgical equipment, supplies and solutions. During surgery, surgical technologists pass instruments, fluids and supplies to the surgeon and prepare and manage surgical equipment.
What do you need to become a surgical tech?
Surgical technologist programs require candidates to hold a high school diploma or GED at minimum. Some schools might require prerequisite courses ranging from biology to English, and it’s likely that you’ll need to complete a course in CPR as well.
Is it hard to become a surgical tech?
Becoming a surgical tech isn’t nearly as difficult as becoming a doctor, but you can’t exactly waltz straight from high school into the OR, either. Be prepared to get a certificate or degree, pass muster in an internship and earn some credentials. The right skills will help, as well.
Do surgical techs work 12 hour shifts?
Surgeries go on day and night, and depending on where you work you may need to be on-call or working night shifts and weekends. Most surgical techs work full time, which is great for earning a good salary, but it may mean working long shifts, of 12 hours or more, a few days a week.
How many hours does a surgical technologist work?
Surgical Tech shifts vary between 8 and 12 hours. A normal work week for the operating room and most surgical techs, not including “call” or shift rotation, is Monday – Friday. The shifts available and days worked for the surgical tech will vary depending on the type of hospital or facility you decide to work in.
Who makes more LPN or Surgical Tech?
Overall, surgical techs earn a bit more than LPNs, and yet, their salaries differ by job titles and employers.
How much does a certified surgical technologist make an hour?
A mid-career Certified Surgical Technologist (CST) with 5-9 years of experience earns an average total compensation of $28.88 based on 19 salaries. An experienced Certified Surgical Technologist (CST) with 10-19 years of experience earns an average total compensation of $33.88 based on 20 salaries.
How much do surgical techs make starting out?
Industry. The annual median pay for a surgical tech was $45,160 or $21.71 per hour, as reported by the BLS in 2016. This salary exceeds the national median salary of $37,040 per year. You can make the most money working at a large surgery center or specialty clinic.
How much do surgical techs make yearly?
How Much Do Surgical Tech Jobs Pay per Hour?Annual SalaryHourly WageTop Earners$h Percentile$verage$h Percentile$44,000$21
Is Surgical Tech a degree?
According to the US Bureau of Labor Statistics (BLS), with an accredited diploma, certificate, or an associate’s degree, surgical technologists can train for an entry-level medical technology career in 1-2 years.
How much does a surgical tech program cost?
A typical certificate program in surgical technologies costs anywhere from $5,000 to $25,000. How Hard Is Surgical Tech School? Surgical tech school is difficult and requires substantial study and practice. Surgical techs need to have thorough knowledge of surgical procedures, human anatomy, and pharmacology.
Does a surgical tech make more than an RN?
In addition, RNs earn higher salaries on average than surgical techs. According to the BLS, registered nurses on average earned more than $71,000 per year in 2018, compared with $47,000 per year for surgical techs.
Are surgical techs in high demand?
Job Outlook Employment of surgical technologists is projected to grow 7 percent from 20, faster than the average for all occupations. Advances in medical technology have made surgery safer, and more operations are being done to treat a variety of illnesses and injuries. | <urn:uuid:8fb81e03-edb6-40fc-98dd-bcfdb85b30a5> | CC-MAIN-2022-33 | https://yycnewcentrallibrary.com/why-do-you-want-to-be-a-surgical-technologist/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.955222 | 994 | 2.34375 | 2 |
Normally we have thought of vivid color in conjunction with India’s amazing holy days, especially those called Holi. Thanks to India Ink for this story about the street art going up, up north in India’s capital city:
NEW DELHI — While looking out from a balcony in one of Delhi’s many urban villages – former villages that were swallowed up by the ever-expanding capital — more often than not, one is confronted by a boring, gray wall – the bare side of another building.
For street artists, these walls, and these urban villages, offer an ideal combination of expansive canvases for their work and vibrant communities with whom they can share the joy and wonder of their art.
In January, under the auspices of the first organized street art festival in Delhi, known as St.Art, 60 artists from all over the world have convened here for exhibitions, workshops, film screenings, a “graffiti-jam” and, most important, the transformation of dozens of the city’s cement walls into works of art. In Shahpur Jat, an urban village in south Delhi, artists from the festival have painted or plan to paint at least eight walls.
Read the whole story here. | <urn:uuid:402f251a-5011-4375-9d13-98187f94cd6d> | CC-MAIN-2022-33 | https://organikos.net/2014/02/01/a-non-holi-technicolor-moment-in-delhi/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.965741 | 254 | 1.992188 | 2 |
The TOTEM experiment at the LHC has measured proton-proton elastic scattering in dedicated runs at √s = 2.76, 7, 8 and 13 TeV centre-of-mass
LHC energies. The proton-proton total cross-section has been derived for each energy using a luminosity independent method. TOTEM has
excluded a purely exponential differential cross-section for elastic proton-proton scattering with significance greater than 7 σ in the |t| range from
0.027 to 0.2 GeV2 at s√ = 8 TeV. The ρ parameter has been measured at √s = 8 TeV via the Coulomb-nuclear interference, and was found to be
ρ = 0.12 ± 0.03. The measurement has been repeated at 13 TeV and the result ρ = 0.09 ± 0.01 probes the existence of a colourless three-gluon
bound state. The measured 2.76 TeV differential cross-section by TOTEM provides evidence for the colourless 3-gluon bound state, when
compared to the D0 experiment ppbar result at 1.96 TeV (neglecting the small energy difference between TOTEM and D0). | <urn:uuid:7b5bb8e2-a027-4af0-b11c-80d07656d285> | CC-MAIN-2022-33 | https://indico.cern.ch/event/749003/contributions/3374108/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.905327 | 271 | 1.796875 | 2 |
Countries are always trying to develop the latest weaponry that would give them an edge in battle. They spend billions of dollars each year on firearm development and testing. In this video, you will see some of the most futuristic new weaponry. These guns are not available for purchase. If you want to purchase traditional guns for yourself, check out a store that offers gun sales.
Many gunfights take place in hallways of buildings. That is why the Corner Shot was developed.
It allows soldiers to shoot around corners without exposing themselves to gunfire. The front part of the barrel rotates to look around corners. A camera relays images to a screen near the sight on the gun.
Drones have become a force to be reckoned with in the modern battlefield. To combat this, the Kalashinikov REX-1 Anti-Drone Gun was developed. It can jam satellite and other signals from a distance of five kilometers away. The user must simply point and shoot towards the target. No actual rounds are fired, but the disruption causes the drone to hover back to the ground where they can be captured. | <urn:uuid:1ba0bd65-08a7-44e5-9f2a-6f72249db8d5> | CC-MAIN-2022-33 | https://radcenter.org/2022/03/23/incredible-guns-of-the-future/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.954263 | 227 | 2.109375 | 2 |
A Leader in Transforming Public Sector Finance
The Accountant-General’s Department (AGD) is a department under the Ministry of Finance (MOF). We support the Accountant-General in fulfilling his statutory duties under the Constitution, the Financial Procedure Act and other legislative statutes. We partner MOF in making Singapore a better place through finance and closely cooperate with Government agencies to raise the capabilities of financial management in the Public Sector.
Statutory Duties of Accountant-General
The statutory duties of the Accountant-General as specified under the Constitution and various statutes are as follows:
- Inform the President of any proposed transaction that would likely draw on the reserves of the Government (Constitution, Article 148G).
- Responsible for the supervision and administration of the Government accounting system. The duties associated with this role include:
- Prepare annual Government Financial Statements for Minister’s presentation to Parliament and President (Financial Regulations, Regulation 28)
- Administer and make payments of public monies (Financial Procedure Act, Section 2B)
- Set procedures for the purchase, custody and disposal of public property (Financial Procedure Act, Section 2B)
- Report material financial irregularities (Financial Regulations 4)
- Establish accounting standards for Statutory Boards such that the accounts and financial statements of every statutory body is in compliance with the standards (Accounting Standards Act, Section 11).
We seek to fulfil the following strategic outcomes:
We ensure that Government’s resources are used effectively through our financial policies and value-for-money reviews; we benchmark our resource management framework with the leading jurisdictions and strive to learn from the best practices.
We monitor and report Singapore’s reserves position, fulfilling the Accountant-General’s statutory duty to safeguard reserves.
Even as the Government pledges to take better care of Singaporeans through greater social outlays, it is imperative that we continue to promote the fiscal sustainability of Singapore. We seek to engender a culture of prudence within the public sector while meeting the increasing expectations of the public.
We perform financial management reporting and analysis to ensure that Government agencies are held accountable, using efficient data analytics to aid management in its decision-making processes.
As a future-ready organisation, AGD seeks to embrace new knowledge and technology to keep abreast of the latest trends in innovation and achieve transformation. With tighter integration of Government financial systems, the whole financial process is now made more seamless. Government systems have also on-boarded InvoiceNow, the nationwide e-invoicing network, to receive e-invoices from vendors in a touchless manner. | <urn:uuid:2839d174-cc65-4de9-8584-862bd9cc6048> | CC-MAIN-2022-33 | https://www.agd.gov.sg/who-we-are/overview | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.907626 | 545 | 1.726563 | 2 |
Whiting, G. (2009). Gifted Black Males: Understanding And Decreasing Barriers To Achievement And Identity. Roeper Review,31(4), 224-233.
Black males as a group experience disproportionate amounts of school failure. Compared to Black females and White males, for example, Black males have the highest dropout rates, poorest achievement, and lowest test scores. Further, they are sorely under-represented in gifted education and over-represented in special education. Of those Black males who do succeed in school settings, certain characteristics seem to be evident. In this article, I share these characteristics in what I am calling a scholar identity model. First, however, I discuss achievement barriers that many gifted Black males seem to face. The article ends with some recommendations for educators as they work to improve the educational status of Black males identified as gifted.
Access to full article can be found here: | <urn:uuid:c36394f6-70ab-4c25-86cd-ea23826e8ace> | CC-MAIN-2022-33 | https://diversity.utexas.edu/black-male-education-research/2015/01/gifted-black-males-understanding-and-decreasing-barriers-to-achievement-and-identity/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.919999 | 210 | 3.09375 | 3 |
This case study shows how audiologists at Hearing Australia use the PLUM to support decision making about hearing aids, and later, evaluate whether the hearing aid is helping the child.
Tjandamurra, who had just turned three years old, was seen at a Hearing Australia clinic with a history of chronic ear disease. A hearing test seven months earlier had shown a mild conductive hearing loss. He had been referred to an ENT and was on a waiting list for an initial consultation at the local public hospital. He had also been referred to a speech pathologist and was diagnosed with a speech delay, and was receiving regular speech therapy.
On the day of the Hearing Australia clinic, Tjandamurra had a mild to moderate conductive hearing loss, and he had a PLUM score of 18, which indicated his listening skills were not on track.
Two weeks later Tjandamurra was fitted with a bone conduction hearing aid to help him hear while he waited for medical intervention.
We planned to see Tjandamurra a fortnight later to find out how he was going with his hearing aid, however his family could not come into the clinic, so we had a telephone catch up. Mum reported that he really loved the device – they had videos of him crying at night when he had to take it off for bed. They were noticing huge benefits, regarding listening and speech. Tjandamurra went to his speech therapy with the hearing aid on, and she said he was much better, and the clarity of his speech was improving. The PLUM was repeated with mum over the phone. His initial PLUM was 18, however the PLUM two weeks after the hearing aid fitting was 26. Tjandamurra was still not on track but this showed that he had made some improvement with his listening skills.
We were able to reassure Tjandamurra’s parents that he was making progress and that the hearing aid was worthwhile.
Shaira and Caleb
This case study shows how the PLUM and HATS tools can be used to help make decisions about when to fit young children with hearing aids.
My name is Meagan, I am an audiologist and I work for Hearing Australia. In 2019, I was running a telehealth clinic with the Deadly Ears Program, which is a Queensland State Health ear and hearing service that works in remote Aboriginal and Torres StraitIslander communities. Deadly Ears identifies young children with ongoing ear trouble and, if appropriate and after discussing with families, refers to us to work out whether they would benefit from a hearing aid.
Shaira and Caleb were two and a half years old. At this age, children’s hearing can be tricky to assess, and it was not possible to complete a hearing test with either of them. Both children had a middle-ear condition in both ears, and it was unclear how long they had the condition.
Using video conferencing, I met Shaira and her parents. Together with the Deadly Ears audiologist who was in the community with the family, we talked about their child’s hearing. I then did a PLUM and HATS with them. These tools were very suitable for using with telehealth, they were a lovely way to explore with a parent how their child was listening and talking at home.
Shaira had a PLUM score of 35, and a HATS score of 45. This showed that her communication and listening skills were on track for her age. I was able to reassure her parents that Shaira was doing well. I suggested that they should continue to attend the Health Clinic who would help them manage her ear health and monitor her listening and communication skills development, and Deadly Ears would review Shaira in three months’ time.
Next, I met Caleb and his parents. Caleb had a PLUM score of 21 and a HATS score of 15. This showed that his listening and communication skills were not yet on track. I talked with his parents about my concern that Caleb may have been having hearing trouble for some time, which has been affecting his development.
Caleb’s parents decided they would use the device, as it would help Caleb listen and understand better during storytime, and when they talk to him at home.
With the help of the Deadly Ears clinician, we showed the parents a bone conductor hearing aid and tried it on Caleb. He immediately brightened up, and for the first time in the appointment used his voice and started giggling. This is a reliable sign that he had been experiencing trouble hearing, and it helped his parents decide to take the hearing aid home and use it when they were talking with Caleb and for storytime.
The PLUM and HATS measured how each child’s listening and talking skills were developing. The results then guided me towards making the appropriate recommendations for each child to their parents. The PLUM and HATS questions also helped the parents to think about their child’s behavior, which assisted us to decide together what would meet their child’s needs. | <urn:uuid:af3bf0fb-4dd6-4aaa-a3f6-69dce9f9c749> | CC-MAIN-2022-33 | https://plumandhats.nal.gov.au/case-study/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.991999 | 1,059 | 2.140625 | 2 |
DAOFOOD PLUS x30 CAPSULES is an enzyme formula that helps break down histamine in the body by providing diamine oxidase. DAO is a mandatory enzyme that participates in the process of decomposition of histamines that enter the body from various foods and beverages.
DAOfood Plus 30 is a specialized enzyme formula to facilitate the breakdown of histamine in the body. For optimal action and antioxidant protection, protective elements have been added to the formula – quercetin and vitamin C, which will provide the necessary conditions for the action of DAO and strong immune function.
Composition of DAOfood Plus 30 caps.
The updated formula of DAOfood Plus 30 includes three important ingredients to overcome histamine intolerance and improve immune protection. These are:
DAO – Diamine oxidase (DAO) is an enzyme responsible for the breakdown of biogenic amines ingested with food (exogenous histamine). The enzyme is active in the ileum and jejunum of the small intestine. It is also concentrated in the kidneys, thymus and placenta;
Quercetin – Quercetin has antioxidant and anticancer properties. Quercetin is also neuroactive and belongs to the group of bioflavonoids found in various fruits and vegetables;
Vitamin C – an essential vitamin for recovery, immune protection and enzymatic production of certain neurotransmitters.
Histamine intolerance or sensitivity is caused by the accumulation of histamine in the body to a level that exceeds the amount needed for normal functioning. Excess histamine leads to allergy-like symptoms.
Under normal conditions, excess histamine is broken down by specific enzymes, especially diamine oxidase (DAO). The breakdown products of histamine are then excreted by the kidneys in the urine. This will usually ensure that histamine levels do not exceed the person’s ‘tolerance limit’ (the level above which symptoms develop).
However, if the amount of DAO is insufficient to deal with the excess, histamine levels rise and typical symptoms of histamine sensitivity develop.
Diamine oxidase supplements are designed to increase the amount of DAO in the digestive tract and to enhance the breakdown of histamine, the accumulation of which causes the characteristic symptoms of histamine intolerance.
DAOfood Plus 30 is the optimal choice because:
Contains easily digestible form and bioavailable form of diamine oxidase;
Targeted to prevent and control histamine intolerance;
Helps to break down histamine faster and reduce the unpleasant symptoms of its accumulation in the body.
DAOFOOD PLUS x30 CAPSULES Ingredients:
Natural protein extract 7% DAO,
of which Diamine Oxidase (DAO)
Excipients: emulsifier: microcrystalline cellulose, hydroxypropyl cellulose; potato starch, rice starch, medium chain triglycerides; stabilizer: hydroxypropylmethylcellulose, magnesium stearate, oleic acid, sodium alginate; anti-caking agent: stearic acid, magnesium carbonate, dicalcium phosphate; humidifier: glycerin; colorant: caramel; glazing agent: hydroxypropylmethylcellulose, ethylcellulose.
DAOFOOD PLUS x30 CAPSULES Dosage:
Recommended daily dose: one capsule, with a little water, 20 minutes before each meal (three times a day). In case you cannot swallow the capsule whole, open it and swallow the pellets inside without chewing or breaking them.
Daily doses: 10 | <urn:uuid:5f2c2bad-8476-4f2f-9a4f-cf226abbe20a> | CC-MAIN-2022-33 | https://natural-herbs-market.com/product/daofood-plus-x30-capsules/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.862423 | 783 | 1.585938 | 2 |
Hemidactylus turcicus — Mediterranean Gecko
Also known as:
These geckos are native to the Mediterranean region, as you might have guessed, but are one of several gecko species that have successfully colonized large swaths of the world. They are established in localities across the southern U.S. from California to Florida, typically in and around man-made structures. These were two of the dozen or so keeping down the bug level at the campground bathrooms.
I'd seen these a couple of times before at least, in Arizona and California, but never got close enough for a recognizable photo.
I was staying in downtown Scottsdale at my dad and stepmother's place and was taking the dogs for their last-chance-of-the-night outing when I spotted this little gecko in the middle of the sidewalk. Not exactly the natural habitat of this European species, but I'll take any gecko I can get.
- Conant, R., Collins, J. T. 1998. Peterson Field Guide to Reptiles and Amphibians of Eastern and Central North America, Third Edition, expanded
- Crother, B. I. (ed.) 2017. Scientific and Standard English Names of Amphibians and Reptiles of North America North of Mexico, with Comments Regarding Confidence in Our Understanding, Eighth Edition
- Jones, L. L. C., Lovich, R. E. 2009. Lizards of the American Southwest: A Photographic Field Guide
- Stebbins, R. C. 2003. Peterson Field Guide to Western Reptiles and Amphibians, Third Edition | <urn:uuid:0f6982fa-30ec-44c5-a9e6-ac3afdc3cd88> | CC-MAIN-2022-33 | http://www.wildherps.com/species/H.turcicus.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.934764 | 346 | 2.90625 | 3 |
The American Civil Liberties Union and other advocacy groups are suing Education Secretary Betsy DeVos over the department's new federal regulations on how sexual assault and harassment allegations should be handled on school campuses. The lawsuit, filed Thursday, claims the changes will result in fewer institutions "taking much-needed affirmative steps to prevent sexual harassment and assault before it happens."
The lawsuit was filed against DeVos, the U.S. Department of Education and the department's assistant secretary for civil rights, Kenneth L. Marcus. The ACLU wants to block the revised provisions before they go into effect in August, claiming in the suit that they go against the "language and spirit" of Title IX, the 1972 law that bars sex discrimination in education.
"This new federal effort to weaken Title IX makes it more difficult for victims of sexual harassment or sexual assault to continue their educations and needlessly comes amid a global pandemic," the lawsuit claims. "Instead of focusing on how to help these students, the Agency has prioritized gutting protections against sexual harassment and assault that many of them currently rely on."
DeVos new rules, announced earlier this month, will sharply change how schools are required to respond to sexual misconduct allegations. DeVos' rules describe sexual harassment as "Unwelcome conduct determined by a reasonable person to be so severe, pervasive, and objectively offensive that it effectively denies a person equal access to the recipient's education program or activity."
The lawsuit said conduct has to meet the three criteria of "severe, pervasive, and objectively offensive" in order for a school to respond, as opposed to a previous definition that included "or" rather than "and" in the list.
The rules also stipulate that schools are only required to respond if the conduct occurred in an educational program or activity, the lawsuit said, allowing them to "ignore many Title IX reports of sexual assault that occur off campus/school grounds, including in off-campus housing or during study abroad." The suit also noted that the changes relieve colleges and universities from the "the obligation to address sexual harassment" unless reports are made to a limited number of school officials.
The lawsuit also took issue with a rule that allows schools to adopt a "clear and convincing evidence" standard of proof in sexual harassment complaints, which it claims "places a heavier burden on those alleging sexual harassment than on students who allege other forms of harassment."
In 2011, the Obama administration sent out guidelines to Title IX in a letter that offered guidance to school administrators on how to adhere to requirements of the law and urged schools to handle cases of sexual misconduct more promptly.
DeVos has made it a priority to overhaul the Obama-era guidelines and clarify the rights of accused students since she was appointed to the education secretary post.
"Too many students have lost access to their education because their school inadequately responded when a student filed a complaint of sexual harassment or sexual assault," DeVos said on May 6. "This new regulation requires schools to act in meaningful ways to support survivors of sexual misconduct, without sacrificing important safeguards to ensure a fair and transparent process."
In response to the lawsuit, education department press secretary Angela Morabito told CBS News in a statement on Friday that their rule "codifies meaningful protections for survivors into law and requires that schools adjudicate Title IX cases using a transparent, fair, and reliable process."
"The ACLU, which used to defend civil liberties, should be supporting such an approach. Instead, they're helping schools trample on basic due process and gut protections for survivors to serve an ideological agenda where the ends justify the means," Morabito said.
But Ria Tabacco Mar, director of the ACLU's Women's Rights Project, called the new rule a "double standard that is devastating for survivors of sexual harassment and assault, who are overwhelmingly women and girls."
for more features. | <urn:uuid:5d6b2c51-1f36-472f-af81-7a8cf479103f> | CC-MAIN-2022-33 | https://www.cbsnews.com/news/aclu-betsy-devos-sexual-assault-rules-college-campus-title-ix/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571950.76/warc/CC-MAIN-20220813111851-20220813141851-00672.warc.gz | en | 0.962978 | 776 | 1.5625 | 2 |
Complaints to Consumer NZ shows some consumers aren’t pleased with excess and convoluted packaging.
“Customers are getting increasingly frustrated with all the extra packaging. Why do you need plastic-covered vegetables? No-one understands the logic,” says Consumer NZ head of content Caitlin Cherry.
The packaging that irked the most people was the $5 Watties 3-pack mini cans of baked beans.
Despite being value for money at a cheaper price than purchasing three separate cans, the amount of plastic shrink-wrap around the cans has led to some customers boycotting the brand.
The second most complained item were individually wrapped electric toothbrush replacement heads.
Each head usually comes with a double layer of moulded plastic inside a difficult to open outer box.
Some food items were also frustrating for customers to purchase.
Verkerks Salami Protein Snack Pack ($4.89) showed six individually wrapped tear seal packets each with three small pieces of salami inside.
Further down in the meat section at the supermarket, fresh meat on pre-packaged plastic trays were a major source of frustration, says Consumer NZ.
Customers compared buying meat at a local butcher, where you forgo the tray for a simple, thin plastic bag or brown paper wrapping.
Finally, Pure’n Ezy removed corn’s natural packaging (its husks) and individually replaced them with a plastic vacuum seal.
In a global trial, 57 per cent of New Zealand packaging assessed wasn’t recyclable in practice, says Consumer NZ.
Recently, representatives of 175 countries at the UN Environment Assembly voted to draft a legally-binding treaty by 2024 to end plastic pollution. The treaty is expected to address plastic alternatives among other initiatives.
Consumer NZ believes business should consider simpler packaging that is environmentally friendly.
Seen terrible packaging? Send it to email@example.com
Consumer NZ’s tips to reduce buying products with excess packaging:
- Bring your own bag when you go shopping. You can find mesh fresh produce bags that you can weigh on the scale at the supermarket and can store your fruit and vegetables well at home.
- Purchase dry food from the pick and mix section. Here you can purchase as much as you like of one food item, and it goes in one bag.
- Visit your local butcher for meat and eliminate purchasing the plastic tray. | <urn:uuid:53ca829c-f92a-4c7c-bd1e-b5e1869f5f7f> | CC-MAIN-2022-33 | https://www.sunlive.co.nz/news/289009-consumer-nz-reveals-plastic-packaging-complaints.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.932395 | 493 | 1.695313 | 2 |
BAKU, Azerbaijan, March 30
By Tamilla Mammadova – Trend:
The number of COVID-19 cases in Georgia has reached 97, Trend reports citing Georgian media.
The information was recently updated on the special website stopcov.ge created by the Georgian government.
According to the latest data, 18 people recovered, 4,876 patients are under quarantine, and 264 persons under hospital supervision.
On March 21, Georgia declared a state of emergency until April 21 to prevent the spread of coronavirus.
The outbreak in the Chinese city of Wuhan - which is an international transport hub - began at a fish market in late December 2019. Some sources claim the coronavirus outbreak started as early as November 2019.
The World Health Organization (WHO) declared COVID-19 a pandemic on March 11.
Follow the author on Twitter: @Mila61979356 | <urn:uuid:bb6f67e1-19f5-4e0a-bcfe-62bf18816f56> | CC-MAIN-2022-33 | https://en.trend.az/scaucasus/georgia/3214958.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572063.65/warc/CC-MAIN-20220814173832-20220814203832-00672.warc.gz | en | 0.937258 | 189 | 2.015625 | 2 |
Getting shoes is something that can be hard because there are just so many options to consider. What kind of shoes do you like? What are the most popular styles? A lot of shoppers do not ask themselves enough questions before buying a new pair of shoes. If you want to learn more about the world of shoes, keep reading.
Do not wear sneakers without socks. This can damage your foot since it makes it rub the shoes directly. This is also a great way to promote foot fungus growth since there is lots of moisture in your shoes, as a result. Wear cotton socks with some foot powder in order to keep your feet dry.
You don’t want to just wear flip flops all the time, even when it’s nice weather. These shoes provide virtually no support, leaving you susceptible to ankle sprains, injured toes and blisters. Limit how often you wear flip-flops to hot-summer-sun activities.
Avoid shoes that aren’t comfortable. Some sales people will tell you that shoes will feel great after they are broken in. Shoes do not always stretch out with wear. Many times, shoes feel great when you wear them the first time. If a pair feels off, move on even if you really like the style.
Get yourself some athletic shoes that are good. Regardless of what physical activities you participate in, you need to have shoes made for this purpose. They are there to fit your feet in the right way. Not having the proper shoes for your physical activities could actually cause your feet injury.
If you buy shoes online, check out the return policy for when shoes don’t fit. You’ll see that here and there that you’ll get something online that isn’t in stores and you need to be able to return it. See if there’s a money back guarantee so you don’t get stuck with something you can’t even use.
Shoes will not normally break in as you wear them. If they are uncomfortable from the beginning, they will probably stay that way. The shoes may not stretch out in the manner that you had anticipated. They may just cause pain until you stop wearing the altogether.
When buying shoes for children, allow for growth. When measuring from the tip of the biggest toe, allow a thumb width more room to the shoe’s end. This allows room for the child’s foot to grow. A salesman can help, too.
Never buy bargain shoes that are a bit too small or uncomfortable, while thinking they will get better with time. Typically these shoes will never get more comfortable. Having shoes stretched out to accommodate bunions or corns is the only exception.
As previously stated, there’s a lot to learn about shoe shopping. You have a lot of different sales, styles, and locations to choose from that can make shoe shopping a hassle. Fortunately, you just read this article. Use the shoe buying tips to help you make the right decision next time you shop for shoes.… | <urn:uuid:c38802ab-6131-456f-99d5-41568e9d66b4> | CC-MAIN-2022-33 | https://redbottomschristianlouboutinshoes.com/category/clothes/clothes-fashion | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571222.74/warc/CC-MAIN-20220810222056-20220811012056-00672.warc.gz | en | 0.959334 | 624 | 1.9375 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.