text stringlengths 160 608k | id stringlengths 47 47 | dump stringclasses 2 values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1 value | language_score float64 0.65 1 | token_count int64 48 145k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
If you’ve ever needed precision machining services to make parts with complex surface curves or shapes, you might already be familiar with profiling.
In geometric dimensions and tolerancing (GD&T), profiles describe a 3-dimensional tolerance zone—an area with a uniform boundary—around a part’s surface. All surface elements must lie within that boundary to be considered in profile.
Primarily used to dimension complex features, profiles control a feature’s size, orientation, form, and (sometimes) location simultaneously. Profile tolerances are measured with advanced equipment like coordinate measuring machines (CMM) or high-capability vision inspection systems—not standard tools such as calipers and micrometers.
When used correctly, GD&T callouts like profiles help streamline information while ensuring that complex parts function as intended.
The Benefits of Using GD&T Profiles in Precision Machining
If you think profiles sound complicated, you’re right. However, profiling can simplify designs and improve efficiency by reducing the total number of callouts.
For example, we see profiles on designs for consumer goods that need to fit nicely into a human hand—think door handles or pliers. The subtle curves along the surface of metal pliers are complex from a precision machining perspective and typically require many different callouts, including the radii, locations of centers, intersection points, and more.
A better option is to consolidate all of that information into one profile callout.
Not only does this solution reduce time and effort for engineers and manufacturers, but it also helps prevent tolerance buildups and other problems that can arise from incorrect dimensioning. Engineers can clearly convey their design intent in a streamlined manner, leaving less room for translation errors when transitioning from a CAD model to programming.
However, keep in mind that reducing the information provided on a print can eliminate crucial dimensions, potentially compromising a part’s fit, form, and function. Profiles are amorphous—as long as we machine within the acceptable boundary or zone, we’re meeting the profile tolerance, but our design interpretation might not meet your intention.
Two Common Mistakes in GD&T Profiling
Misusing profile callouts cancels out the benefits and introduces risks to precision machining projects. Be sure to avoid these common mistakes:
1. Profiling without a datum
Datums are necessary in profiling—the design must indicate where to start measuring to machine the part correctly. Profiling without a datum is like asking for an incomplete part. The dimensions are essentially left open to interpretation.
In these cases, customers risk getting parts with variable dimensions—or a call from their precision machining partner asking for clarification, which can delay timelines. Additionally, not providing a datum can inadvertently introduce tolerance stack-ups.
2. Profiling features that are too simple
Some designs call for profiles on features that are too simple, which, ironically, adds unnecessary complexity to a project. For example, a feature with a single radius usually does not require profiling.
In precision machining, we use eight basic geometries that are typically sufficient for most designs: plane, circle, point, cylinder, line, torus, sphere, and cone. Profiling is only necessary when highly complex features require dimensioning beyond those eight geometries.
Still not sure if profile callouts are right for your part? Just ask us! Our GD&T experts are happy to collaborate with you during the design phase. And if you’re ready to get started on your next manufacturing project, Reata is here to provide precision machining services for the parts that keep you up at night. Request a quote today. | <urn:uuid:7a262bcb-99ff-4ff1-846a-d60e04acf6cf> | CC-MAIN-2022-33 | https://reataeng.com/blog/could-your-complex-parts-benefit-from-gdt-profile-callouts/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.902847 | 756 | 2.640625 | 3 |
Interest Groups are a community within the CPCU Society, created around shared interests in specific areas of knowledge, learning, technology or other characteristics of membership. An Interest Group serves as a resource to the Society for the purpose of carrying out activities and programs designed to address the needs of members. It creates resources or activities (webinars, conference sessions, etc.) that are tied to those issues while complementing the Society’s overall activities.
Engage With Interest Groups!
Visit our Interest Group websites to get more information: | <urn:uuid:c9608e60-69bf-4631-bff1-3674bd3be02e> | CC-MAIN-2022-33 | https://kentuckyblue.cpcusociety.org/news/interest-groups?qt-social_media_feeds=0 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.936749 | 107 | 2.171875 | 2 |
Full Range Persian Ney
The traditional Persian Ney has five holes in front and one on the back with a range of 2-1/2 octaves. But there is one note missing between the two first octaves. If C3 is considered to be the lowest note, then B3 can be sustained briefly with changing the position and the shape of the tongue and lips and modifying the air pressure on the preceding and succeeding notes. To reproduce B natural we can use the same hole as C and for Bb we can use the hole of A.
This limitation has separated the first six lower notes of the Persian Ney and introduces a special timbre in the lower register. These six notes and sometimes the hint to the half a tone lower or higher are mostly played separately by special breathy sound and particular characteristic effects.
The inconvenient is that we can not produce the stable and precise note of B, Bb/2 and Bb and we can’t play fast ornamentations called (Tahrir) around these notes in the first and second octaves.
Structure of Full Range Persian Ney?
- The full rang Neys have extra holes at the ends in order to easily produce the missing note mentioned above.
- These Neys are each with eight holes on the front These Neys are each with eight holes on the front side and one on the back. In certain parts of the performance, the lower register can be passed smoothly into the upper register and high register evidently can be linked to the lower register. With these Neys we can play 2-1/2 full octaves.Because of the large surface of the skin and its sensibilities to the humidity, synthetics skins are preferred.
- The full range Persian Ney is adjusted using two metallic tubes turned one inside the other, and with the aid of a key made of horn for long Neys.
- Onshort Neys we don’t need a key, and the little finger can cover the corresponding hole. | <urn:uuid:48526221-31a8-4a8c-93d2-ef5d2da6c788> | CC-MAIN-2022-33 | http://omoumi.com/innovations/ney/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.923623 | 405 | 2.703125 | 3 |
CircuitWest: The Search for Audiences Handbook
The Search for Audiences handbook is a tool for helping presenters (venues) build audiences. It details the research techniques CircuitWest and its participating members used for 12 Western Australian presenters in its projects involving focus groups (qualitative) and, in some cases, surveys (quantitative). It provides an overview of the main factors that influenced audience behaviour across the studies, as well as details the research questions posed and research respondents’ feedback. It also provides recommendations regarding strategies for audience development.
In July 2018, the Government of Western Australia funded CircuitWest to deliver grants, training, planning, facilitation and support for research into audience development across 12 regional towns and cities. Development of the project was prompted by feedback from presenters across WA based on a need to grow and better engage audiences, particularly in light of declining audience numbers across the sector.
The project provided one-off support for discrete audience development projects aiming to encourage new approaches to increasing audience numbers through in-depth research, listening to audiences engaged with presenters, collaboration with presenter-partner organisations and information from non-audiences who were not attending performances. The project supported new research projects and innovative thinking with the following aims:
- to create new strategic approaches to audience development;
- to learn how to promote products, works or organisations to new audiences in novel ways;
- to diversify and/or increase earned revenue streams through listening to audience
- to achieve business-objective growth based on insight into audience barriers;
- to deliver feedback for program development; and/or;
- to provide information pertaining to audience development for future marketing activities.
The handbook covers several key areas:
- the art of gathering
- target audience
- community needs
- the mystery | <urn:uuid:dc330122-bdef-4282-9c53-07213d156177> | CC-MAIN-2022-33 | https://www.culturehive.co.uk/resources/circuitwest-the-search-for-audiences-handbook/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.916897 | 398 | 1.773438 | 2 |
Technical Support Centres
Electronics & Instrumentation
Objective/Activities of the centre:
- Identify and procure test and measuring equipment, components and tools necessary for carrying out the servicing of all types of electronic equipment, particularly those used in a materials organization.
- Take an active part in the installation and commissioning of major industrial process control and analytical equipment that includes
- Different types of LASER systems
- CNC and ROBO Systems
- Detonation Spray Coating systems
- EBPVD, SPPS, CVDZnS, HIP, Atomiser, Flame Spray Pyrolysis
- High temperature Furnaces etc.
- Also familiar with interfacing of main systems with subsystems as required by the users.
- Carry out the servicing of equipment already installed in ARCI. Troubleshooting requires an in depth study of the sub systems and electronics involved .One of the major activities of this Group has been troubleshooting of major equipment especially imported ones, where the Documentation has been more often than not incomplete for carrying out servicing. The group has been carrying out servicing of major imported equipments, without undergoing any training at the manufacturer’s works.
- Carry out modifications to available equipment in ARCI to extend their use, as and when the situation demands. Involving in the in house development of systems like Advanced DSC System, Automation of CNT system, Pulsed Electro Deposition, Cold Spray. Providing data logging solutions to most of the R&D projects.
- Study imported equipment and be prepared to replace imported components with indigenously available ones, whenever required to reduce maintenance downtime.
- Render advice to other sections for procurement of accessories and equipment.
- Look after the technical aspects of the Telephone EPABX system and Stabilizers.
- Telephones- Fresh tendering of telephones rate contract and placing of work orders
- Looking after the AMC of Telephone works and complaints, Stabilizers and UPS
- Looking after the AMC for APC, Emerson and DB Power make UPS
- In-house maintenance of UPS below 1kVA.
- Impart training to fresh Graduates in all aspects of electronics, as relevant to the activities of ARCI.
- Render guidance to B Tech graduate students from local Universities for carrying out their experimental project work, without affecting our normal duties.
- Render assistance to parties who have received technologies and equipment, developed at ARCI. | <urn:uuid:b4780469-b724-4bea-b92a-2aef72e9ca07> | CC-MAIN-2022-33 | https://www.arci.res.in/coe-electronics-n-instrumentation | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.37/warc/CC-MAIN-20220809003642-20220809033642-00665.warc.gz | en | 0.907275 | 508 | 1.695313 | 2 |
Proton Pump Inhibitor Use and Magnesium Concentrations in Hemodialysis Patients: A Cross-Sectional Study.
ABSTRACT: Magnesium concentration is a proven predictor of mortality in hemodialysis patients. Recent reports have indicated that proton pump inhibitor (PPI) use affects serum magnesium levels, however few studies have investigated the relationship between PPI use and magnesium levels in hemodialysis patients. This study aimed to clarify the association between PPI use and serum magnesium levels in hemodialysis patients. We designed this cross sectional study and included 1189 hemodialysis patients in stable condition. Associations between PPI and magnesium-related factors, as well as other possible confounders, were evaluated using a multiple regression model. We defined hypomagnesemia as a value < 2.0 mg/dL, and created comparable logistic regression models to assess the association between PPI use and hypomagnesemia. PPI use is associated with a significantly lower mean serum magnesium level than histamine 2 (H2) receptor antagonists or no acid-suppressive medications (mean [SD] PPI: 2.52 [0.45] mg/dL; H2 receptor antagonist: 2.68 [0.41] mg/dL; no acid suppressive medications: 2.68 [0.46] mg/dL; P = 0.001). Hypomagnesemia remained significantly associated with PPI (adjusted OR, OR: 2.05; 95% CI: 1.14-3.69; P = 0.017). PPI use is associated with an increased risk of hypomagnesemia in hemodialysis patients. Future prospective studies are needed to explore magnesium replacement in PPI users on hemodialysis.
Project description:<h4>Backgrounds</h4>Proton pump inhibitors (PPIs) can be associated with vascular calcification in patients undergoing dialysis through hypomagnesemia. However, only few studies have demonstrated the influence of PPIs on vascular calcification in patients on maintenance hemodialysis (HD). This study aimed to investigate whether the use of PPIs accelerates vascular calcification in patients on HD.<h4>Materials and methods</h4>We retrospectively evaluated 200 HD patients who underwent regular blood tests and computed tomography (CT) between 2016 and 2017. The abdominal aortic calcification index (ACI) was measured using abdominal CT. The difference in the ACI values between 2016 and 2017 was evaluated as ?ACI. Patients were divided into PPI and non-PPI groups, and variables, such as patient background, medication, laboratory data, and ?ACI were compared. Factors independently associated with higher ?ACI progression (? third tertile value of ?ACI in this study) were determined using multivariate logistic regression analysis.<h4>Results</h4>The PPI and non-PPI groups had 112 (56%) and 88 (44%) patients, respectively. Median and third tertile value of ?ACIs were 4.2% and 5.8%, respectively. Serum magnesium was significantly lower in the PPI (2.1 mg/dL) than in the non-PPI (2.3 mg/dL) group (P <0.001). Median ?ACI was significantly higher in the PPI (5.0%) than in the non-PPI (3.8%) group (P = 0.009). A total of 77 (39%) patients had a higher ?ACI. Multivariate analysis revealed that PPIs (odds ratio = 2.23; 95% confidence interval = 1.11-4.49), annual mean calcium phosphorus product, ACI in 2016, baseline serum magnesium levels, and HD vintage were independent factors associated with higher ?ACI progression after adjusting for confounders.<h4>Conclusion</h4>PPI use may accelerate vascular calcification in patients on HD. Further studies are necessary to elucidate their influence on vascular calcification.
Project description:Long-term inappropriate proton pump inhibitors use (PPIs) is a matter of concern because of the risks associated with their long-term use in older patients with chronic conditions. The risk of PPI treatment in hemodialysis patients remains unexplored.We assessed the relationship between the use of PPIs and the risk of death in hemodialysis patients throughout a retrospective multicenter propensity score-matched study. Information about demographic, hemodialysis treatment, laboratory data, and concomitant medication was obtained from the EuCliD database (Fresenius Medical Care). We studied 1776 hemodialysis patients on PPI therapy compared to 466 patients not receiving PPIs. The resulting population comprising 2 groups of 410 matched patients was studied.PPI use was associated with hypomagnesemia (Mg <1.8 mg/dl (0.75 mmol/l); odds ratio [OR] = 2.70, 95% confidence interval [CI] = 1.38-5.27, P < 0.01). The exposure to PPIs in the full patient cohort was identified as an independent predictor for all-cause mortality in both univariate (HR = 3.16, 95% CI = 1.69-5.90, P < 0.01) and multivariate (HR = 2.70, 95% CI = 1.38-5.27, P < 0.01) Cox regression models. Moreover PPI use was identified as a predictor of CV mortality (HR = 1.51, 95% CI = 1.05-2.20, P = 0.03) Of the 820 patients matched throughout the propensity score analysis, the hazard ratios for all-cause mortality (HR = 1.412, 95% CI = 1.04-1.93, P = 0.03) and CV mortality (HR = 1.67, 95% CI = 1.03-2.71, P = 0.04) were higher among patients on PPIs versus those not on PPIs.The study data suggest that the PPI treatment should be regularly monitored and prescribed only when indicated.
Project description:BACKGROUND: Some evidence suggests that proton pump inhibitors (PPIs) are an under-appreciated risk factor for hypomagnesemia. Whether hospitalization with hypomagnesemia is associated with use of PPIs is unknown. METHODS AND FINDINGS: We conducted a population-based case-control study of multiple health care databases in Ontario, Canada, from April 2002 to March 2012. Patients who were enrolled as cases were Ontarians aged 66 years or older hospitalized with hypomagnesemia. For each individual enrolled as a case, we identified up to four individuals as controls matched on age, sex, kidney disease, and use of various diuretic classes. Exposure to PPIs was categorized according to the most proximate prescription prior to the index date as current (within 90 days), recent (within 91 to 180 days), or remote (within 181 to 365 days). We used conditional logistic regression to estimate the odds ratio for the association of outpatient PPI use and hospitalization with hypomagnesemia. To test the specificity of our findings we examined use of histamine H2 receptor antagonists, drugs with no causal link to hypomagnesemia. We studied 366 patients hospitalized with hypomagnesemia and 1,464 matched controls. Current PPI use was associated with a 43% increased risk of hypomagnesemia (adjusted odds ratio, 1.43; 95% CI 1.06-1.93). In a stratified analysis, the risk was particularly increased among patients receiving diuretics, (adjusted odds ratio, 1.73; 95% CI 1.11-2.70) and not significant among patients not receiving diuretics (adjusted odds ratio, 1.25; 95% CI 0.81-1.91). We estimate that one excess hospitalization with hypomagnesemia will occur among 76,591 outpatients treated with a PPI for 90 days. Hospitalization with hypomagnesemia was not associated with the use of histamine H2 receptor antagonists (adjusted odds ratio 1.06; 95% CI 0.54-2.06). Limitations of this study include a lack of access to serum magnesium levels, uncertainty regarding diagnostic coding of hypomagnesemia, and generalizability of our findings to younger patients. CONCLUSIONS: PPIs are associated with a small increased risk of hospitalization with hypomagnesemia among patients also receiving diuretics. Physicians should be aware of this association, particularly for patients with hypomagnesemia. Please see later in the article for the Editors' Summary.
Project description:Case series suggest that long-term use of proton pump inhibitors (PPIs) is associated with hypomagnesemia, but the current literature lacks systematically collected data. Our aim was to examine whether hypomagnesemia at the time of hospital admission is associated with out-of-hospital use of PPIs.Nested case-control study matched for age and sex.Data were collected retrospectively from a tertiary acute-care facility. Eligible cases consisted of 402 adults with hypomagnesemia (serum magnesium <1.4 mEq/L) at the time of hospital admission to medical services, age- and sex-matched with 402 control individuals with normal serum magnesium levels (1.4-2.0 mEq/L).Out-of-hospital PPI use was identified in the hospital record. An omeprazole equivalent dose was calculated when possible. Covariates included the Charlson-Deyo comorbidity index, diabetes, diuretic use, estimated glomerular filtration rate, and gastroesophageal reflux.Multivariable conditional logistic regression analyses were used to examine the association of PPI use with hypomagnesemia at the time of hospital admission.PPI use was not associated with hypomagnesemia (adjusted OR, 0.82; 95% CI, 0.61-1.11). Neither PPI type nor omeprazole equivalent daily dose was associated with hypomagnesemia. Sensitivity analyses of PPI use restricted to patients with esophageal disorders (adjusted OR, 1.00; 95% CI, 0.69-1.45), severe hypomagnesemia (magnesium, ?1.0 mEq/L; adjusted OR, 0.78; 95% CI, 0.13-4.61), or estimated glomerular filtration rate ?60 mL/min/1.73 m(2) (adjusted OR, 0.84; 95% CI, 0.53-1.34) were unrevealing.Exposure misclassification; hospitalized patients on medical services may not be representative of a broader ambulatory-based population.In a hospital-based adult population, out-of-hospital PPI use is not associated with hypomagnesemia at the time of hospital admission to medical services. In light of these inconclusive results, prospective cohort studies are needed to address this rare potential medication-related adverse effect.
Project description:<h4>Background</h4>Hypomagnesemia is known to impede hypocalcemia correction. This prospective observational study aimed to evaluate the impact of serum magnesium levels on the development of refractory hypocalcemia, which remains a concerning problem after total thyroidectomy (TT).<h4>Subjects and methods</h4>Consecutive subjects (<i>n</i> = 312; mean age = 38.4 [range: 13-83] years; M:F = 62:250) undergoing TT for benign or malignant thyroid diseases were evaluated for serum corrected-calcium (8.4-10.4 mg/dL), magnesium (1.7-2.4 mg/dL), intact parathormone (iPTH), and 25-hydroxycholecalciferol (25OHD) levels preoperatively, at 48-h and 6-month post-TT.<h4>Results</h4>Postoperatively, 98 subjects (31.4%) exhibited transient hypocalcemia, 96 (30.8%) had hypomagnesemia, and 52 (16.7%) had refractory hypocalcemia. Preoperatively, 38 subjects (12.2%) had asymptomatic hypocalcemia and 77 (24.7%) had hypomagnesemia. In multivariate logistic regression analysis, independent risk factors of transient hypocalcemia were hyperthyroidism (odd's ratio [OR]: 5.6), 48-h iPTH (OR: 3.2), 48-h magnesium (OR: 2.7), preoperative 25OHD (OR: 0.96), and preoperative calcium (OR: 0.5; each <i>P</i> < 0.01). In receiver-operating characteristic analysis, percent calcium decline and 48-h magnesium reliably predicted transient hypocalcemia with a threshold of 10.5% and 1.9 mg/dL, respectively. Area under curve, sensitivity, and specificity were 0.822, 82.7%, and 72.9%; and 0.649 (each <i>P</i> < 0.001), 68.4%, and 63.1%, respectively.<h4>Conclusion</h4>Serum magnesium below 1.9 mg/dL had 2.7 times higher odds of developing transient hypocalcemia post-TT. Hypomagnesemia and percent calcium decline >10.5% within 48-h post-TT are associated with refractory hypocalcemia, which necessitates correction of both the deficiencies for prompt resolution of symptoms.
Project description:Purpose of review:Strategies to mitigate muscle cramps are a top research priority for patients receiving hemodialysis. As hypomagnesemia is a possible risk factor for cramping, we reviewed the literature to better understand the physiology of cramping as well as the epidemiology of hypomagnesemia and muscle cramps. We also sought to review the evidence from interventional studies on the effect of oral and dialysate magnesium-based therapies on muscle cramps. Sources of information:Peer-reviewed articles. Methods:We searched for relevant articles in major bibliographic databases including MEDLINE and EMBASE. The methodological quality of interventional studies was assessed using a modified version of the Downs and Blacks criteria checklist. Key findings:The etiology of muscle cramps in patients receiving hemodialysis is poorly understood and there are no clear evidence-based prevention or treatment strategies. Several factors may play a role including a low concentration of serum magnesium. The prevalence of hypomagnesemia (concentration of <0.7 mmol/L) in patients receiving hemodialysis ranges from 10% to 20%. Causes of hypomagnesemia include a low dietary intake of magnesium, use of medications that inhibit magnesium absorption (eg, proton pump inhibitors), increased magnesium excretion (eg, high-dose loop diuretics), and a low concentration of dialysate magnesium. Dialysate magnesium concentrations of ?0.5 mmol/L may be associated with a decrease in serum magnesium concentration over time. Preliminary evidence from observational and interventional studies suggests a higher dialysate magnesium concentration will raise serum magnesium concentrations and may reduce the frequency and severity of muscle cramps. However, the quality of evidence supporting this benefit is limited, and larger, multicenter clinical trials are needed to further determine if magnesium-based therapy can reduce muscle cramps in patients receiving hemodialysis. In studies conducted to date, increasing the concentration of dialysate magnesium appears to be well-tolerated and is associated with a low risk of symptomatic hypermagnesemia. Limitations:Few interventional studies have examined the effect of magnesium-based therapy on muscle cramps in patients receiving hemodialysis and most were nonrandomized, pre-post study designs.
Project description:Although many case reports have described patients with proton pump inhibitor (PPI)-induced hypomagnesemia, the impact of PPI use on hypomagnesemia has not been fully clarified through comparative studies. We aimed to evaluate the association between the use of PPI and the risk of developing hypomagnesemia by conducting a systematic review with meta-analysis.We conducted a systematic search of MEDLINE, EMBASE, and the Cochrane Library using the primary keywords "proton pump," "dexlansoprazole," "esomeprazole," "ilaprazole," "lansoprazole," "omeprazole," "pantoprazole," "rabeprazole," "hypomagnesemia," "hypomagnesaemia," and "magnesium." Studies were included if they evaluated the association between PPI use and hypomagnesemia and reported relative risks or odds ratios or provided data for their estimation. Pooled odds ratios with 95% confidence intervals were calculated using the random effects model. Statistical heterogeneity was assessed with Cochran's Q test and I2 statistics.Nine studies including 115,455 patients were analyzed. The median Newcastle-Ottawa quality score for the included studies was seven (range, 6-9). Among patients taking PPIs, the median proportion of patients with hypomagnesemia was 27.1% (range, 11.3-55.2%) across all included studies. Among patients not taking PPIs, the median proportion of patients with hypomagnesemia was 18.4% (range, 4.3-52.7%). On meta-analysis, pooled odds ratio for PPI use was found to be 1.775 (95% confidence interval 1.077-2.924). Significant heterogeneity was identified using Cochran's Q test (df?=?7, P<0.001, I2?=?98.0%).PPI use may increase the risk of hypomagnesemia. However, significant heterogeneity among the included studies prevented us from reaching a definitive conclusion.
Project description:In the general population, low serum magnesium levels are associated with poor outcomes and death. While limited data suggest that low baseline magnesium levels may be associated with higher mortality in hemodialysis (HD) patients, the impact of changes in magnesium levels over time is unknown.We examined the association of time-varying serum magnesium levels with all-cause mortality using multivariable time-varying survival models adjusted for clinical characteristics and other time-varying laboratory measures.9,359 maintenance HD patients treated in a large dialysis organization between 2007 and 2011.Time-varying serum magnesium levels across 5 magnesium increments (<1.8, 1.8-<2.0, 2.0-<2.2, 2.2-<2.4, and ?2.4mg/dL).All-cause mortality.2,636 individuals died over 5 years. Time-varying serum magnesium levels < 2.0mg/dL were associated with higher mortality after adjustment for demographics and comorbid conditions, including hypertension, diabetes, and malignancies (reference: magnesium, 2.2-<2.4mg/dL): adjusted HRs for serum magnesium level < 1.8 and 1.8 to <2.0mg/dL were 1.39 (95% CI, 1.23-1.58; P<0.001) and 1.20 (95% CI, 1.06-1.36; P=0.004), respectively. Some associations were attenuated to the null after incremental adjustment for laboratory test results, particularly serum albumin. However, among patients with serum albumin measurements, low albumin level (<3.5g/dL) and magnesium level < 2.0mg/dL were associated with an additional death risk (adjusted HR, 1.17; 95% CI, 1.05-1.31; P=0.004), whereas patients with high serum albumin levels (?3.5g/dL) exhibited low death risk (adjusted HRs of 0.53 and 0.53 [P?0.001] for magnesium < 2.0 and ?2.0mg/dL, respectively; reference: albumin < 3.5g/dL and magnesium ? 2.0mg/dL).Causality cannot be determined, and residual confounding cannot be excluded given the observational study design.Lower serum magnesium levels are associated with higher mortality in HD patients, including those with hypoalbuminemia. Interventional studies are warranted to examine whether correction of hypomagnesemia ameliorates adverse outcomes in this population.
Project description:Prior studies have shown the association of low serum magnesium levels with adverse health outcomes in patients undergoing hemodialysis. There is a paucity of such studies in patients undergoing peritoneal dialysis (PD).Cohort study.10,692 patients treated with PD from January 1, 2007, through December 31, 2011, in facilities operated by a single large dialysis organization in the United States.Baseline serum magnesium levels, examined as 5 categories (<1.8, 1.8-<2.0, 2.0-<2.2 [reference], 2.2-<2.4, and ?2.4mg/dL).Time to first hospitalization and time to death using competing-risks regression models.The distribution of baseline serum magnesium levels in the cohort was <1.8mg/dL, 1,928 (18%); 1.8 to <2.0mg/dL, 2,204 (21%); 2.0 to <2.2mg/dL, 2,765 (26%); 2.2 to <2.4mg/dL, 1,765 (16%); and ?2.4mg/dL, 2,030 (19%). Of 10,692 patients, 6,465 (60%) were hospitalized at least once and 1,392 (13%) died during follow-up (median, 13; IQR, 7-23 months). Baseline serum magnesium level < 1.8mg/dL was associated with higher risk for hospitalization and all-cause mortality after adjustment for demographic and clinical characteristics (adjusted HRs of 1.23 [95% CI, 1.14-1.33] and 1.21 [95% CI, 1.03-1.42], respectively). The higher risk for hospitalization persisted upon adjustment for laboratory variables, whereas that for all-cause mortality was attenuated to a nonsignificant level. The greatest risk for hospitalization was in patients with low serum albumin levels (<3.5g/dL; P for interaction < 0.001).Possibility of residual confounding by unmeasured variables cannot be excluded.Lower serum magnesium levels may be associated with higher risk for hospitalization in incident PD patients, particularly those with hypoalbuminemia. Additional studies are needed to confirm these findings and investigate whether correction of hypomagnesemia reduces these risks.
Project description:Background: Torsades de pointes (TdP) is a life-threatening ventricular tachycardia occurring in long QT-syndrome patients. It usually develops when multiple QT-prolonging factors are concomitantly present, more frequently drugs and electrolyte imbalances. Since proton-pump inhibitors (PPIs)-associated hypomagnesemia is an increasingly recognized adverse event, PPIs were recently included in the list of drugs with conditional risk of TdP, despite only few cases of TdP in PPI users have been reported so far. Objectives: Aim of the present study is to evaluate whether PPI-induced hypomagnesemia actually has a significant clinical impact on the risk of TdP in the general population. Methods: Forty-eight unselected patients who experienced TdP were consecutively enrolled (2008-2017). Shortly after the first TdP episode, in those patients who did not receive magnesium sulfate and/or potassium or calcium replacement therapy, serum electrolytes were measured and their relationship with PPI usage analyzed. Results: Many patients (28/48, 58%) were under current PPI treatment when TdP occurred. Among TdP patients in whom serum electrolyte determinations were obtained before replacement therapy (27/48), those taking PPIs had significantly lower serum magnesium levels than those who did not. Hypomagnesemia occurred in ~40% of patients receiving PPIs (6/14), in all cases after an extended treatment (>2 weeks). In patients taking PPIs the mean QT-prolonging risk factor number was significantly higher than in those who did not, a difference which was mainly driven by lower magnesium levels. Conclusions: In unselected TdP patients, PPI-induced hypomagnesemia was common and significantly contributed to their cumulative arrhythmic risk. By providing clinical support to current recommendations, our data confirm that more awareness is needed when a PPI is prescribed, specifically as regards the risk of life-threatening arrhythmias. | <urn:uuid:73160a26-27d2-4ba3-99e2-78934cabe163> | CC-MAIN-2022-33 | https://www.omicsdi.org/dataset/biostudies/S-EPMC4664382 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00665.warc.gz | en | 0.919236 | 5,273 | 1.710938 | 2 |
KREOD, a portable wooden structure revealed in London last September, has recently been recognized with a Surface Design Award for Temporary Structure. Designed by Pavilion Architecture, KREOD is constructed of Kebony, a sustainable alternative to tropical hardwood and preservative treated wood. The venue sculpture currently forms the centerpiece of Peninsula Square, London's busy public space between the Emirates Air Line and The O2 Arena on Greenwich Peninsula.
Modern Japanese-style house with charred wood siding : Burning the top one-eighth inch of each wood board is a natural way to preserve the timber and (paradoxically) make it fire resistant. Chemical preservatives, paints, and retardants are thus unnecessary. A further plus is the silvery beauty of the charred finish. | <urn:uuid:a188ae2e-a085-4567-bb9e-41acb55505c8> | CC-MAIN-2022-33 | https://in.pinterest.com/jcnorth/town-hall/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.91442 | 168 | 1.609375 | 2 |
Scripture Reading – Numbers 18-20
What difference does it make?
You may be wondering if Old Testament passages that state laws and guidelines for sacrifices have any relevance for New Testament believers. Unfortunately, there are some preachers who foolishly assert the Old Testament scriptures have no application for the Church. They could not be further from the Truth!
Christ “offered one sacrifice for sins for ever” (Hebrews 10:12), His death satisfying the penalty of our sins, we no longer observe the laws and guidelines for sacrifices. However, the Old Testament scriptures give us eternal principles that we find reflected in New Testament doctrine.
For example, unlike the other tribes that would be assigned an inheritance in the Promised Land, the tribe of Levi would have no inheritance of land (18:20-21). The LORD’S will was for His ministers to be wholly dedicated to the LORD. Provision for the priests, Levites, and their families came from the tithes and sacrifices offered to the LORD by the people (Numbers 18:8-19, 23-24).
The laws directing the people to support the high priest, priests, and Levites through their sacrifices is reflected in the New Testament principle that a faithful minister of the Gospel is to honored and rewarded for his labor (1 Timothy 5:17-18).
Numbers 19 gives us ceremonial laws for cleansing should a priest come in contact with a corpse, whether beast or man. Modern science has revealed what ancient Israel may not have known…the ever-present danger of disease and contamination.
The Deaths of Miriam and Aaron (Numbers 20)
Several events are recorded in Numbers 20 that give us pause to consider the ever-present consequence of sin…Death. Miriam, the sister of Moses dies (20:1) and near the close of the chapter Aaron, Moses’ brother dies (20:28).
Returning to a sin that has been their pattern, the people began to chide Moses and Aaron when there was no water (20:2-5). The LORD mercifully commanded Moses to take up his rod, speak before all the people, and water would come forth from the rock (20:7-8).
Frustrated and angry, Moses disobeyed the LORD and spoke harshly to the people. Striking the rock with his rod, water came gushing forth, supplying water for the people and their beasts (20:9-11).
Moses’ actions met the desires and needs of the people; however, the consequence of his sin was tragic for himself and his brother Aaron. We read, Numbers 20:12 – 12 And the LORD spake unto Moses and Aaron, Because ye believed me not, to sanctify me in the eyes of the children of Israel, therefore ye shall not bring this congregation into the land which I have given them.
Our devotional ends with a dramatic ceremony that took place at Mount Hor. Remembering Aaron would not be allowed to enter the Promised Land (20:23-24), Moses was told to strip his brother of his priestly robes and place them on his son and heir, Eleazar (20:25-26).
Moses, Aaron, and his son Eleazar ascended Mount Hor; however, only Moses and Eleazar “came down from the mount (20:28).
Numbers 20:29 – 29 And when all the congregation saw that Aaron was dead, they mourned for Aaron thirty days, even all the house of Israel.
Copyright 2020 – Travis D. Smith | <urn:uuid:b7b11778-96e3-407f-90c6-d16b2ff93b70> | CC-MAIN-2022-33 | https://heartofashepherd.com/2020/03/02/three-men-went-up-but-only-two-came-down-numbers-18-20-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.954475 | 729 | 2.6875 | 3 |
Analysis of GII.4 NoV strains of the novel variant GII.4 Sydney 2012 circulating in Italy in 2012-2013 identified recombinant strains possessing a polymerase gene derived from the former variant New Orleans 2009. These findings may pose a challenge for the diagnostic/characterization of recent GII.4 NoVs.
Noroviruses (NoVs) are a major cause of acute gastroenteritis in both children and adults. NoV can be classified genetically into at least six genogroups, GI to GVI (Green 2007; Martella et al., 2009). Although more than 30 genotypes within genogroup GI, GII and GIV may infect humans (Kroneman et al., 2013), a single genotype, GII.4, has been associated with the vast majority of NoV-related outbreaks and sporadic cases of gastroenteritis worldwide (Bok et al., 2009).
GII.4 NoV strains continuously undergo process of genetic/antigenic diversification and periodically generate novel strains via accumulation of punctate mutations or recombination, with novel GII.4 variants emerging every 2-3 years (Bull et al., 2010; SIebenga et al., 2007). Since 1996, distinct GII.4 variants have been associated with pandemics or major epidemics of NoV gastroenteritis, including US95/96 1996, Farmington Hills 2002, Asia 2003, Hunter 2004, Yerseke 2006a, Den Haag 2006b and New Orleans 2009 (Kroneman et al., 2013). In the late 2012, increased incidence of NoV-related outbreaks and/or illness in various countries has been related to the emergence of a novel GII.4 variant, Sydney 2012. This variant was first identified in March 2012 in Australia (van Beek et al., 2013) and it was found to have originated via recombination by acquiring a GII.Pe polymerase gene (ORF1) from a GII.4 variant Osaka 2007 strain and the ORF2 and ORF3 from a GII.4 Apeldoorn 2008-like strain (Eden et al., 2013).
The Italian Study Group for Enteric Viruses (ISGEV) monitors the epidemiology of enteric viruses in children through hospital-based surveillance. Monitoring and characterization of NoVs is achieved by a multi-target analysis in the diagnostic regions A, B, C and D of NoV genome (Kroneman et al., 2011) and interrogation of the Norovirus Typing Tool database.
During the late 2012 (November-December) and January 2013 ISGEV monitored a 28.9% prevalence (90/311) of NoV infection in children hospitalized or visited for gastroenteritis, vs a prevalence of 25.2% (77/305) in the same period (November-January) of the 2011-2012 winter season. In the 2012-2013 winter season, about 74.3% of the fully typed strains were characterized as GII.4 Sydney 2012, confirming that in Italy as in other European and extra-European countries this new NoV variant had become predominant (Giammanco et al., 2012).
For four samples inconsistencies were observed between region A (pol) and region C (cap)-based characterization, suggesting either mixed infections or a recombinant origin. These strains were found to have a GII.4 New Orleans 2009 pol and a GII.4 Sydney 2012 cap. The sequences of the four recombinant strains are available in GenBank under accession numbers KF378731 (PA13/2013/ITA), KF378732 (PR4200/2012/ITA), KF378733 (PA83/2012/ITA) and KF386146 (PR343/2013/ITA). The recombination event was mapped to the ORF1/ORF2 (pol/cap) junction region. This region is highly prone to recombination in NoVs (Bull et al., 2007), although other recombination hot spots have been identified in the ORF2/ORF3 overlap and in the junction of the shell and protruding capsid domains (Eden et al., 2013). In the four recombinant strains, the GII.Pe pol was replaced by a GII.P4 pol derived from the former pandemic NoV GII.4 variant New Orleans 2009. This variant was still dominant in Italy in the winter season 2011/2012 (41.7% of the detected NoV strains) and its circulation was documented until September 2012. Notably, one recombinant strain was detected as early as January 2012, almost contemporaneously to the emergence of the pandemic GII.4 variant Sydney 2012.
Also, we observed several distinctive punctate mutations in the GII.P4 New Orleans 2009 pol gene between the recombinant strains detected in Northern and Southern Italy, suggesting that independent recombination events occurred.
These findings may be relevant for the diagnostic, as these novel inter-pandemic recombinants can be identified only by multi-target analysis, i.e. by combined analysis of the pol and cap genes. Therefore, the GII.Pe pol, considered a signature of the pandemic NoV variant Sydney 2012, in some strains can be replaced. Continued surveillance for NoV infections and additional data on clinical and epidemiologic features will enable precise assessment of the public health implications of the new variant GII.4 Sydney 2012 and of its recombinant relative strains.
Bok K, Abente EJ, Realpe-Quintero M, Mitra T, Sosnovtsev SV, Kapikian AZ, Green KY. 2009. Evolutionary dynamics of GII.4 noroviruses over a 34-year period. J Virol 83:11890-11901.
Bull RA, Eden JS, Rawlinson WD, White PA. 2010. Rapid evolution of pandemic noroviruses of the GII.4 lineage. PLoS Pathog 6:e1000831.
Bull RA, Tanaka MM, White PA. 2007. Norovirus recombination. J Gen Virol 88:3347-3359.
Eden JS, Tanaka MM, Boni MF, Rawlinson WD, White PA. 2013. Recombination within the pandemic norovirus GII.4 lineage. J Virol 87:6270-6282.
Giammanco GM, De Grazia S, Tummolo F, Bonura F, Calderaro A, Buonavoglia A, Martella V, Medici MC. 2013. Norovirus GII.4/Sydney/2012 in Italy, winter 2012-2013. Emerg Infect Dis 19(8):1348-9.
Green KY. 2007. Caliciviridae, p. 949-979. In Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE (ed.), Fields virology, 5th ed. Lippincott Williams & Wilkins, Philadelphia, PA.
Kroneman A, Vega E, Vennema H, Vinjé J, White PA, Hansman G, Green K, Martella V, Katayama K, Koopmans M. 2013. Proposal for a unified norovirus nomenclature and genotyping. Arch Virol In press.
Kroneman A, Vennema H, Deforche K, v d Avoort H, Penaranda S, Oberste MS, Vinje J, Koopmans M. 2011. An automated genotyping tool for enteroviruses and noroviruses. J Clin Virol 51:121-125.
Martella V, Decaro N, Lorusso E, Radogna A, Moschidou P, Amorisco F, Lucente MS, Desario C, Mari V, Elia G, Banyai K, Carmichael LE, Buonavoglia C. 2009. Genetic heterogeneity and recombination in canine noroviruses. J Virol 83:11391-11396.
Siebenga JJ, Vennema H, Renckens B, de Bruin E, van der Veer B, Siezen RJ, Koopmans M. 2007. Epochal evolution of GGII.4 norovirus capsid proteins from 1995 to 2006. J Virol 81:9932-9941.
van Beek J, Ambert-Balay K, Botteldoorn N, Eden J, Fonager J, Hewitt J, Iritani N, Kroneman A, Vennema H, Vinje J, White P, Koopmans M. 2013. Indications for worldwide increased norovirus activity associated with emergence of a new variant of genotype II.4, late 2012. Euro Surveill 18:8-9. | <urn:uuid:571e1f29-a48f-4b0e-be48-8bca9158d899> | CC-MAIN-2022-33 | https://isgev.net/2013/10/03/recombinant-gii-4-noroviruses-between-the-pandemic-variants-new-orleans-2009-and-sydney-2012-italy-2012-2013/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.837917 | 1,865 | 2.546875 | 3 |
Dry needling. Acupuncture. Is there any difference? You will know that both involve the insertion of very fine needles. Both dry needling and acupuncture use the same or very similar needles, however they vary in the theory, and the technique and location for the insertion of needles.
What is Acupuncture?
Acupuncture is a truly ancient technique, originating in China well over 5000 years ago. It is a cornerstone treatment of Traditional Chinese Medicine. Acupuncture is based on the theory that health is determined by a balanced flow of chi, the vital life energy present in all living organisms.
Chi circulates in the body along twelve major pathways, called meridians. Each meridian is linked to specific internal organs (e.g. heart, lungs, spleen, kidney and liver).The theory is that by inserting needles at specific points along the meridians, the therapist can redirect and reposition the flow of uninterrupted energy for the purpose of relieving tension, stress, pain and improving overall wellbeing. If blockages and imbalances remain this may result in pain and illness.
Physiotherapist’s use a modern adaptation of acupuncture called western acupuncture or segmental dry needling. This adaptation of Chinese acupuncture uses current knowledge of anatomy, physiology, pathology, and the principles of evidence based medicine. Western medical acupuncture therapists tend to pay less attention than classical acupuncturists when choosing one point over another, though they generally choose classical points as the best places to stimulate the nervous system. Needles are generally inserted and left in place for around 20 minutes. Additional needles may be added to increase the potential benefits of treatment.
What is dry needling?
Dry needling is an effective and efficient technique for the treatment of muscular pain and myofascial dysfunction. It is extremely effective for relaxing overactive muscles, which contain trigger points (you may know these area’s as the lumpy painful “knots” in your muscles).
In simple terms, the treatment involves the insertion of a needle into a muscle’s trigger points or ‘knots’ without injecting any substance.
The technique of dry needling differs from that of acupuncture. The therapist will move the needle in a piston motion looking for tight points called trigger points. Hitting a trigger point will often elicit a ‘twitch response’ indicating the trigger point is beginning to release. Once a ‘twitch’ has been produced, the muscle fibres in that area relax causing inflammation to reduce and circulation to improve.
Dry needling is based on Western anatomical and neurophysiological principles. It should not to be confused with the Traditional Chinese Medicine (TCM) technique of acupuncture. Recent research is demonstrating positive physiological effects of dry needling techniques, which may be beneficial as part of the treatment regime recommended by your physiotherapist for your specific pain and injury.
When do we use dry needling?
Our physio’s prescribe dry needling as an adjunct therapy. For clients with conditions in which tight tissues are a contributing factor, dry needling can in some circumstances involve less discomfort than traditional deep soft tissue therapy. Your physiotherapist will tailor a treatment program most suited to you.
Is dry needling painful?
Needle insertion may not be felt, and at most, you may experience a pin-prick. The local twitch response is a sudden slight contraction of the muscle which elicits a quick pain response which varies for each patient. After treatment, you may experience heaviness in the treated limb or even a relaxed state of mind. It is not unusal to experience mild muscle soreness for 24-48 hours after treatment, however we recommend the application of ice is good for any bruising and heat for any pain/aches. Moving and stretching is encouraged (always!).
After a thorough assessment, your physiotherapist will decide if acupuncture, dry needling or a combination of both is necessary. Although not every physiotherapist is qualified to perform dry needling techniques. Our Physiotherapists have undertaken additional training to be accredited to use this technique. | <urn:uuid:77470a3c-ae07-4ee9-927d-721c8c2028c2> | CC-MAIN-2022-33 | https://www.thehealthybodycompany.com.au/dry-needling/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.925589 | 843 | 2.59375 | 3 |
Bill Radke: BP Chief Executive Tony Hayward faces a congressional hearing today. He will tell Congress and the TV cameras what led to the Gulf oil spill, how his company is cleaning it up, and of course how deeply regretful he is about the whole affair. But all these things have already been expressed, many times. So why does today’s public appearance actually matter? Marketplace’s Nancy Marshall Genzer takes a look.
Nancy Marshall Genzer: Earlier in the week, lawmakers at another hearing wanted to know why oil companies mentioned walruses in disaster management plans for the Gulf. They haven’t lived there for 3 million years. Exxon Mobil’s Rex Tillerson dutifully admitted the mistake:
Rex Tillerson: And it’s unfortunate that walruses were included.
Grill baby, grill! Politicians love skewering CEOs — it looks good to the voters back home. But does it actually lead to meaningful business regulations? Allan Lichtman is an expert on politics and elections at American University:
Allan Lichtman: These hearings can build momentum and publicity for real legislation, whatever that may be.
The hearings can also build momentum for the courtroom.
Carl Tobias teaches law at the University of Richmond. He says lawyers will be waiting for BP CEO Tony Hayward to make an incriminating statement today.
Carl Tobias: Well it’s possible that it could be used in some future case that the Justice Department might put together.
A case against BP, or Hayward himself.
In Washington, I’m Nancy Marshall Genzer for Marketplace.
There’s a lot happening in the world. Through it all, Marketplace is here for you.
You rely on Marketplace to break down the world’s events and tell you how it affects you in a fact-based, approachable way. We rely on your financial support to keep making that possible.
Your donation today powers the independent journalism that you rely on. For just $5/month, you can help sustain Marketplace so we can keep reporting on the things that matter to you. | <urn:uuid:da608568-f139-4c54-9c72-2205dbe442e8> | CC-MAIN-2022-33 | https://www.marketplace.org/2010/06/17/what-will-more-face-time-congress-do-hayward/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00665.warc.gz | en | 0.94527 | 433 | 1.734375 | 2 |
Owning a house is a lifetime commitment. It requires more than just paying your mortgage on time; it also means making sure you meet regular home maintenance and repairs to make it a comfortable and safe place for your family.
Most people’s future and finances depend on it, especially for a single-parent household. However, a sole caregiver’s income is found to be significantly lower than those with dual-income families. Furthermore, income disparity is still present to this day among genders and marital statuses. For instance, single dads receive significantly higher incomes than their female counterparts.
Therefore, while homeownership is beneficial for most individuals, committing to this long-term investment can be challenging, especially for single parents. However, it doesn’t always have to go that way. Here are some questions you need to ask yourself before applying for homeownership:
Can you carry out recurring bills?
Homeownership is not for everyone, at least until before one settles their finances. For single parents, this may mean weighing in factors that would benefit them more. This ranges from their children’s needs, cash flow, bills, and current situation.
Therefore, meeting financial obligations such as monthly dues may put a significant toll on your finances. On the other hand, although renting may save you from taxes and regular home repairs or maintenance, having a property can help you build equity. This resource is valuable when investing in other properties or renovating your home, yielding higher monetary benefits in return.
While having a stable income can secure you a home loan, you should not settle there. Take time to understand how your financial weather works and factor in possible changes in your family’s expenses. This includes your rent, food allowance, medical, and daily needs.
Does your environment foster growth?
According to studies, the decision that parents make affect their child’s growth and development. Therefore, one key factor to help you decide is to consider how your current setting affects them as a whole. This is specifically true as your children’s needs change with time.
For example, you may want to move closer to their school for faster and more accessible transportation. If your child has special needs and requires a constant trip to the doctor, consider choosing a neighborhood with good health care facilities and a family-friendly community. You may do this by browsing through sites such as manorlakes.com.au or visiting nearby locations.
Raising your kids in a healthy environment can help them develop a good social circle benefiting them in the long run. But, of course, don’t forget yourself along the way—factor in your growth as a whole. Think about how the new place will benefit your career.
It could be a unique job opportunity, a promotion, or an additional income and learning. This is beneficial, especially if you are planning on settling in that place long-term.
Are you ready to make sacrifices?
Owning a home requires most people to apply for loans or save at least 20% of the initial home price for the down payment. Moreover, they would need to have a good credit score to qualify for a mortgage. To do this, you must provide proof of on-time payment, a history of continuous cash flow, and other crucial documents.
Thus, if you are thinking of applying for one, you must ensure that you can make adjustments to meet these requirements. In most cases, these would entail cutting expenses and incurring additional debts. For sole providers, shouldering all of these can be stressful and taxing.
If you think significant changes in your lifestyle are inevitable, consider discussing them with your family members. Explaining and communicating your goals to your children will assist you in reaching your goals quickly. You can start by reducing your expenses ranging from electric bills, food, and other monthly subscription.
For example, although eating out may be more convenient with your busy lifestyle, consider cooking your meals at home. You can also take advantage of this time to pack lunches for you and your kids instead of a cash allowance.
This will save you a few bucks, at the same time, provide them with healthy and nutritious food. Furthermore, switching to a more sustainable energy source can keep you from skyrocketing electric bills. Have a list of your expenses and savings so it’s easier for you to track your cash flow and know where you can cut back without sacrificing your family’s safety and comfort.
Homeownership is much like starting a family or any other major life decision. Although the challenges are inevitable, it is not impossible. Understand each responsibility that comes with it and weigh each factor towards which is beneficial for you. | <urn:uuid:a096ef93-cba2-4040-a6ec-07cadd072248> | CC-MAIN-2022-33 | https://www.ronpenndorf.com/single-parent-journey-towards-homeownership/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.961377 | 958 | 1.929688 | 2 |
WASHINGTON (AP) — President Barack Obama has imposed sanctions on Russian officials and intelligence services in retaliation for Russia’s interference in the U.S. presidential election by hacking American political sites and email accounts.
The State Department also has kicked out 35 Russian diplomats from its embassy in Washington and consulate in San Francisco, giving them and their families 72 hours to leave the U.S. The diplomats were declared persona non grata for acting in a “manner inconsistent with their diplomatic status.”
Obama said Russians will no longer have access to two Russian government-owned compounds in the United States, in Maryland and in New York.
Russian officials have denied the Obama administration’s accusation that the Russian government was trying to influence the U.S. presidential election.
U.S. intelligence agencies concluded that Russia’s goal was to help Donald Trump win — an assessment Trump has dismissed as ridiculous. | <urn:uuid:5dbd7ac8-a719-4e79-9147-db3075190c17> | CC-MAIN-2022-33 | https://www.fox17online.com/2016/12/29/us-slaps-sanctions-on-russia-expels-35-diplomats | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.976487 | 187 | 1.554688 | 2 |
It’s really hard to get someone in Hollywood to read your film script. Unless, of course, you have a famous name. Just ask Jeremy Lin, not the basketball player but a 16 year-old from Hong Kong, whose script Senior Project is now being made into a feature-length film.
Lin became interested in screenwriting after Fabienne Wen, a Los Angeles-based screenwriter and film investor, visited his high school last year and encouraged students to write their own movie scripts. He did just that and emailed her his completed script—a “Superbad meets Breakfast Club!” sorta thing—a few months ago. According to Lin, “she opened my email immediately because she thought I was the basketball player!”
People never believe that it's actually my name, so like when I try to make a reservation at a restaurant, it takes another ten minutes for me to convince them that it's really my name. I also get tons of friend requests on Facebook from people who think I'm the basketball player.
Even with the name, the film still needs help in getting to that “Hollywood level.” If you donate $1 to his Kickstarter account, you’ll get a “spiritual connection” with him. For $5000, you can be a featured extra. Lin has already raised nearly $150,000 for his project.
[Image via Getty] | <urn:uuid:4cf07b39-ac48-4482-92a4-1f1e5207d54b> | CC-MAIN-2022-33 | https://defamer.gawker.com/jeremy-lin-gets-high-school-screenwriter-a-movie-deal-792058424 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.984244 | 293 | 1.5625 | 2 |
How many centimeters in 5ft. 8in.
5 ft is 152.4 cm 8 in is 20.32 cm
Total: 5 ft 8 in = 172.72 cm
The above is from:
Convert: For those of you who don't have a good conversion program, go to the site below and download Convert. It is FREE and gives you the ability to convert all kinds of things. It is a very handy program.
(Links aren't currently working properly in Answers, so simply copy and paste the above link into your browser's address box, delete the space after "http" and hit Enter.)
5 ft 8 in = 172.72 centimeters
Amblessed, I think you need to recheck your figures.
Welcome to Fun Advice!
Simply a Rose to brighten your day, And maybe lessen the cares in your way; And also, too, to help you to know, That in knowing you, many others grow!
5ft is 150cm 8 inches is 8 cm
68 inches = 438.7088 centimeters | <urn:uuid:7dd1fb26-1db5-4653-8958-c3d424cfd0c4> | CC-MAIN-2022-33 | https://www.funadvice.com/q/height_1815 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.929106 | 246 | 1.796875 | 2 |
AE Aerospace is a machine to print, subcontract precision machining company for the aerospace and marine, civil and defence industries. The company manufactures low to medium volume prototype components, through to original equipment and higher volume manufacture, together with spares and legacy parts.
The business currently employs circa 65 people and is growing, despite the impact of Covid-19, which has hit the sector hard. AE has won some large orders through the pandemic, with further contracts continuing to come through all the time. AE has a wealth of high-end computer numerical control (CNC) machines in place – all with advanced technology integrated. It’s a well-skilled, well-versed, and well-experienced organisation.
Changing the approach
AE Aerospace uses CAD/CAM software to develop offline programs for manufacture on the shop floor. To drive efficiencies, the company is looking to do all the programming within the engineering office and have nothing carried out at the machines themselves. AE’s previous software system was, however, failing to deliver the speed and efficiency it was looking for. The company needed to find an alternative that would enable more upfront engineering to be done before a project hit the shop floor for manufacture, thereby avoiding spending unnecessary time creating programs at the machine.
AE sought out a solution that would allow it to keep the machines running and producing, while the development work is done in the office.
The seeds of a solution were formed at an industry event when contacts from AE Aerospace and Cadspec, the leading Autodesk reseller, first met. AE was looking for a solution capable of delivering expert CNC programming strategies for complex three- to five-axis manufacturing. And Cadspec had expertise in relevant Autodesk software solutions, including Fusion 360 with PowerMill® CAM software.
Scoping out a way forward
Working in conjunction with Autodesk, Cadspec visited the AE Aerospace site and ran a demonstration of Autodesk® Fusion 360 – 3D CAD/CAM for Product Design together with Autodesk PowerMill® CAM software. AE Aerospace could immediately see the benefits not just in terms of the capability itself but also with regards to having all this rich functionality integrated or amalgamated into a single software package. AE decided to order the software solution from Cadspec, seeing the wider picture and long-term confidence in building a collaborative technical working relationship.
PowerMill also comes with access to Fusion 360 from Autodesk. The CAM functionality in Fusion 360 allows AE Aerospace’s engineers to develop machining programs offline for the purpose of continuous improvement. Part of Cadspec’s role is showing AE Aerospace what the CAD software is capable of alongside what they have already bought, and it also offers training on the solutions.
When Covid hit, AE had already loaded the software and started using but they did not initially take up the Cadspec training. While there has been very little onsite training at AE Aerospace over the past 12 months due to the current situation, two of the company’s engineers recently attended Autodesk Fusion 360 training onsite at Cadspec.
Shifting the focus of development and engineering
The biggest benefit that AE Aerospace attains from the Autodesk software comes from its ability to support fast and efficient offline programming to enable the development of jobs in the office rather than on the machines. The software also boasts high-quality simulation accuracy and the ability to run clash detection.
It also allows engineers to model far more complex shapes than would previously have been possible and support five-axis machining. Another major advantage is that Autodesk streamlines the link between design and manufacturing. Changing the design of a fixture or assembly is a lot easier if there is a parametric link between the CAD and the CAM software that allows users to switch quickly from one to the other.
Recently, another benefit AE Aerospace has discovered from using Autodesk Fusion 360 is the ability to develop some 3D-printed fixtures and tooling. AE can now produce the whole set-up for that from within Fusion 360 before it machines any elements.
Brian Hawkes, Project Engineering Manager, AE Aerospace, said:
You can build an assembly. You can take the assembly and hide parts and only show components that you wish to view, and you can create CAM programs for the parts which are visible.
AE Aerospace has also benefitted from the support offered by Cadspec throughout a wide range of projects. They have been highly responsive and delivered in-depth feedback when called upon over recent months in particular.
Brian Hawkes further commented:
We have complete confidence in Cadspec’s support and their expertise as an organisation.
As AE Aerospace evolves its design and engineering capability over time, it plans to make greater use of Fusion 360 with PowerMill for modelling every stage of a project and of a part whether that is a simple fixture design, or moving through to packaging and creating models for that.
The complementary focus the company has on continuous improvement is focused on engineers making more extensive use of Fusion. The company will have two distinct ways of looking at projects moving forward: complex, using five-Axis manufacturing and PowerMill or more routine in terms of what needs to be done to continuously improve parts, and smaller projects, using Fusion 360.
Cadspec is now also engaging with AE Aerospace on 3D printing technology. AE have purchased their first 3D printer and are looking forward to developing the opportunities that this technology offers. | <urn:uuid:2ee08fbe-2bd5-4b23-9d53-df36afb67361> | CC-MAIN-2022-33 | https://www.cadspec.co.uk/case-studies/ae-aerospace/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.947198 | 1,118 | 1.625 | 2 |
“Take heed, and be quiet; fear not, neither be fainthearted for the two tails of these smoking firebrands, for the fierce anger of Rezin with Syria, and of the son of Remaliah.”
Suggested Scripture reading – II Kings 16:1-9
The wicked King of Judah, Ahaz along with the people of Jerusalem, faced a frightening situation. Rezin, the king of Syria and Remaliah, King of Israel, the Northern Kingdom, had joined forces to attack Jerusalem and incorporate it into their kingdoms. The people of God were moved with fear at the prospect of this confederation and attack. Isaiah uses a very vivid word picture to express this fear. “The heart of his people, as the trees of the wood are moved with the wind,” They were afraid. (vs. 2) In the midst of this trial and the fear it caused, God sent this man with a message of peace and hope. Isaiah’s message was, “fear not, neither be fainthearted for the two tails of these smoking firebrands, . . . Thus saith the Lord GOD, It shall not stand, neither shall it come to pass.” (Vss. 4-7) God saw the fear in the hearts of His people and even in their backslidden condition He had compassion on them and sent His man with a message of comfort to them. These two kings and their firebrands of death would not be successful in this attack on the people of God. “Thus saith the Lord GOD, It shall not stand, neither shall it come to pass.” (vs.7)
Child of God, Satan has evil planed against you. He seeks daily to overcome you with temptations and distractions. He seeks to destroy you in Hell. He cannot do this but his attacks cause you anxiety. Even when we are backslidden God sees the fear and uncertainty of our hearts and sends his man, your pastor and the preachers and teachers of His Word. Their message to you is this, fear not; be not afraid of the fire brands of the Devil. We belong to God. Satan can never have us. His attacks “shall not stand; neither shall it come to pass.” (vs.7) God calls to our backslidden heart, just as He did to His people in Israel’s day. Repent, come back to Him. He says to you, “Incline your ear, and come unto me: hear, and your soul shall live; and I will make an everlasting covenant with you, even the sure mercies of David.” (Isaiah 55:3)
Fear not the attack of the Devil for it will not stand.
I Peter 5:6-8
“Humble yourselves therefore under the mighty hand of God, that he may exalt you in due time: Casting all your care upon him; for he careth for you.”
Please leave us a comment if you have any thoughts, ideas, or questions about this post. | <urn:uuid:6bea1bc2-ea03-4eed-bbb7-b0cc46bad6c6> | CC-MAIN-2022-33 | https://lifeabovefear.org/fear-not-the-firebrand/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.963165 | 653 | 2.15625 | 2 |
Ask the Vet Tech: How Much Water Does My Dog Need?
Dogs require adequate hydration to keep their bodies’ systems functioning at their best. So how much water does your dog need? Let’s take a closer look at a few of the key determining factors.
Q: How much water should my dog drink daily for optimal health?
A: Water intake depends on several factors—including your dog’s size, weight, overall health, any meds your animal may be taking, and of course the ambient temperature.
As pet lovers, we all want our dogs to live long, healthy, and enjoyable lives. And like humans, dogs require adequate hydration to keep their bodies’ systems functioning at their best. So how much water does your dog need? Let’s take a closer look at a few of the key determining factors.
Recommended Water Intake for Dogs
On average, a healthy adult dog needs between 0.5 and 1.0 ounces of water per pound of body weight daily. For example, a 40-lb. dog would need between 20 and 40 ounces of water per day. Puppies need about 0.5 cups of water every 2 hours and should be monitored.
Water intake also depends on the ambient temperature. Like us, dogs are warm-blooded animals, but unlike humans, they do not perspire. So they must rely on panting to regulate their body temperature. On hot days, provide your dog with ample and easily accessible water.
Also, check any meds your animal may be taking. Some could make your pet more vulnerable to dehydration. Ask your vet about the meds your animal is on, and whether they pose a dehydration risk or affect your dog’s ability to regulate body temperature.
What Could Excessive Thirst Mean?
Polydipsia (over-drinking of water) and polyuria (excessive urination) can indicate serious and potentially life-threatening kidney disease. Similarly, a dog's inability to expel wastes from its body is equally serious and can quickly put your pet at risk for kidney failure or sepsis.
Other potential causes of excessive thirst include diabetes, Cushing’s disease, and certain forms of cancer. If your dog is persistently thirsty and is over-consuming water, it could be a sign of a serious condition. Contact your vet and schedule a visit.
Learn to Spot the Warning Signs of Dehydration
Whether you and your pet live an active, outdoor lifestyle or are homebodies, learning to spot the signs of dehydration early could help save your pet’s life. Dehydration symptoms include:
• Loose skin (loss of skin elasticity)
• Reduced appetite
• Sticky or tacky gums
• Dry nose
• Sunken eyes
Dehydration can affect your pet’s gastrointestinal system, nutrition, muscle function, and nerve and brain function. If you notice these symptoms in your animal, provide a water source immediately. If your dog is not vomiting and can keep water down, administer an ounce or two of water (or Pedialyte) at 10-minute intervals until your animal stabilizes, then contact your vet.
Keeping Your Pet Cool
The best way to prevent dehydration is to allow your pet easy access to water. If your dog is going to be outdoors in warm weather, provide a shady place for your animal to rest and cool down. Also, you may want to give your pet a periodic gentle rubdown with a damp cloth to mimic the evaporative cooling effect of perspiration.
Remember also, that small-breed dogs are more vulnerable to dehydration than their larger cousins, so if you have a small dog, be sure it has access to water, especially on hot days.
We hope you find this article helpful. If you have questions or believe your dog may be suffering from dehydration. Call your vet.
Cecily Kellogg is a pet lover who definitely has crazy cat lady leanings. Her pets are all shelter rescues, including the dog, who is scared of the cats. She spent eight years working as a Veterinary Technician before becoming a writer. Today she writes all over the web, including here at Figo. | <urn:uuid:85a3e7fa-a991-48cf-bd3d-c53960c0312a> | CC-MAIN-2022-33 | https://figopetinsurance.com/blog/ask-vet-tech-how-much-water-does-my-dog-need | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.936407 | 885 | 2.625 | 3 |
President Emmanuel Macron announced Thursday night that France will impose a curfew from 9 to 6 p.m. on Saturday to be vigilant against the Kovid-19 virus.
The curfew will continue until at least December 1.
Macron presented an order to the cabinet to reinstate the state of emergency, which was declared on March 23 and raised on July 9.
The nine curfew zones are Paris, Lyon, Marseille, Grenoble, Lille, Montpellier, Rune, St. Etienne and Toulouse.
Public transportation and taxis will operate during curfew hours, with people authorized to work at night if necessary. Those who leave the gates after 9pm without cause will be fined $ 135 for the first offense and $ 1,500 for subsequent offenses.
“We are in the second wave,” Macron said. The virus is spreading all over Europe. Germany takes action. The situation in Spain and the Netherlands is worse than it is here. ”
Macron said 90 percent of the 33,037 corona virus deaths in France were over the age of 65. Currently, more than half of the patients in the intensive care unit are under 65 years of age.
Some victims experience long-term cardiovascular, digestive or other effects, Macron said. “We do not fully understand the virus. This is dangerous and serious for everyone. Currently, we see 20,000 new cases per day. Every day, 200 citizens enter the intensive care unit. ”
Macron said his goal is to reduce the number of new cases from 3,000 to 4,000 per day. “We can handle it,” he said.
One-third of beds in the French ICU are now Kovid patients, which creates unbearable stress, Macron said. Last spring, the virus was geographically limited and patients could be transported to unaffected areas, he said.
“Today, the virus is everywhere in France. There are no hidden reserves, ”Macron said. “Our medical staff is exhausted. We have no reserve beds. That is why we must take the most drastic measures. . . We hear people say, ‘Don’t rob me of my freedom.’ We are a country of citizens. If I don’t break, I endanger my father, mother and siblings. ”
Macron said working remotely is comfortable for those with homes in the country but difficult for people in small apartments with children. People should work remotely two or three days a week to ease traffic and stress on public transport.
After 9pm we don’t go to restaurants. We do not go to friends’ houses. We don’t go to parties, ”Macron said. He praised the “very responsible” Frenchmen during the lockdown last spring.
Macron defended himself against allegations that his strategy deceived citizens. “We are all actors in this fight against the virus,” he said. “We need general rules. It’s not babies. All our neighbors do it. ”
There were concerns that travel within France would be limited during the November All Saints holidays. It will not.
“Asking people to stay home and not take vacations is disproportionate,” Macron said, urging citizens to take the same precautions when visiting relatives: masks, social isolation, and gestures of affection. He advised them to ventilate the closed spaces three to 10 times a day and to abide by the “Six Rule”.
Macron expressed sympathy for the French youth. “It will be difficult to reach 20 in 2020,” he said. Youngsters canceled the exam. They are anxious about training and finding their first job. “When you were younger, it was common to party with friends. We ask them to see each other less, for a few weeks or months. ”
Macron said France currently conducts 1.2 to 1.4 million Covid-19 tests per day. He admitted that he had been waiting a long time for tests and results, but said that this was going to change as the new tests would give results within half an hour and there would be home test kits similar to pregnancy.
On October 22, France will release a new version of the failed Stop Covid tracing application.
Musicaholic. Twitter guru. Total bacon fanatic. Zombie ninja. Freelance student. Coffee fan. Gamer. | <urn:uuid:0652b454-4ddb-4508-9a73-c4604b61f39e> | CC-MAIN-2022-33 | https://swordstoday.ie/in-major-cities-france-imposed-a-corona-virus-curfew-from-9-to-6-p-m/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.967672 | 924 | 1.570313 | 2 |
Solutions Framework Templates
Indicator guidance matrix
A guidance matrix on how to use the indicators. It includes: Definition of each indicator; where/how to find data on the indicator (data source); Ideal disaggregate(s) on each indicator; and Proxy indicator(s) where the existing indicator is not possible to measure
Analysis matrix for environmental analysis
This matrix helps the user to make an analysis that is focused on more generalizable contextual factors that are not captured by the criteria and indicators in the ReDSS Solutions Framework.
Analysis matrix for indicator and criteria
A template for recording and analyzing the information gathered based on IASC 8 criteria and 28 indicators in order to explain each indicator rating/ score.
Linkages between criteria
A table displaying potential areas of intersection between the different criteria. This helps the user to understand the broader interrelated factors that influence the indicator rating
Solutions log frame for each of the 8 IASC criteria
These logframes correspond to each of the 8 IASC durable solutions criteria. Each logframe contains the following: An overall goal; Outcomes that contribute to the achievement of that goal; Indicators to measure the outcomes (these are the indicators and alternative indicators from the ReDSS Solutions Framework); Illustrative solutions-oriented activities aligned to the core elements of solutions-oriented programming and contribute to the achievement of the outcomes
Sector specific questions for solutions oriented assessments
A guidance on detailed questions that sector-specific assessments should try to answer, organized according to the 8 IASC durable solutions criteria and relevant to the core elements of solutions-oriented programming
General contextual questions for sector-specific assessments
A guidance on broader environmental factors to consider, including the legal and policy environment, the capacity and willingness of the institutions with responsibility for addressing forced displacement, the profile of the displacement-affected community and the nature of the current response to forced displacement. Useful to understand the extent to which the environment is conducive to the achievement of durable solutions | <urn:uuid:ef0b6c8e-736f-4d01-b99f-9d7bf112b3ed> | CC-MAIN-2022-33 | https://regionaldss.org/index.php/resources/solutions-framework-templates/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz | en | 0.884645 | 399 | 2.25 | 2 |
Can a magazine solve Toronto’s public health problems? Tai Huynh is doing his best to find out.
“I’m interested in making change,” Huynh, the 41-year-old creative director of OpenLab says over the phone in January. “And storytelling is a part of that.”
OpenLab, a design incubator housed in the Toronto General Hospital, exists to fulfill a clear mandate, albeit one which requires immense creative energy and patience: improving Ontario’s healthcare system. A member of the University Health Network, OpenLab consists of three collaborative labs, which work on 15 to 20 projects at once. In the Complex Care Lab, academics, along with clinical and design professionals, research innovative home-care methods, analyze data to predict healthcare system usage, and develop an app to assist clinician’s patient-specific management plans. The Experience Lab studies alternative retirement community models, runs an urban farm, and devises patient-generated solutions to common health-care issues.
But in the ambiguously titled X Lab—where technology, health and multimedia collide—OpenLab runs an online magazine, theLocal.to. Journalism may seem like a strange public health strategy, but when explained by Huynh, who also serves as The Local’s editor, the rationale begins to make sense.
From 2003 to 2011, Huynh was the “director of excellent care for all strategy” for Ontario’s Ministry of Health, writing legislation, designing policy and funding programs which fulfilled a promise of delivering improvements to the province’s healthcare industry. While at the ministry, he had a direct sightline into how change was implemented, so when he arrived at OpenLab in 2011, Huynh understood which systems were working and which needed tinkering.
Many people view healthcare as only consisting of medicine, hospitals, doctors and nurses, but to Huynh, it’s deeper than that. It’s about social determinants like age, gender, income, social services, housing, food availability, transportation, education and virtually everything else.
Since starting in January 2017, The Local has examined various public health issues, including pregnancy through the lens of poverty, addiction through the lens of homelessness, and what happens when a community loses its only grocery store. The frequency of the published content is low, but the stories The Local produces are often unlike those seen in mainstream health reporting in both scope and specificity.
The Local’s team—which consists of Huynh, managing editor Jen Recknagel and Nick Hune-Brown, a prolific freelancer and the site’s features editor—chooses its areas of focus carefully. Rather than report within the confines of a daily news cycle, the staff pores over neighbourhood demographics, community health profiles, and data compiled by the Toronto Central Local Health Integration Network (LHIN), the organization which funds the publication. In Ontario there are 14 LHINs, not-for-profit crown agencies involved in delivering local health services.
“We have a lot of [health] statistics put together by the city, but a lot of these data are just data points,” Huynh says. “They tell you a little bit about what’s going on in the community, but we want to do more than that. We want to go into these neighbourhoods, and from that one data point, uncover deeper, more complex issues.”
The central LHIN covers a region of roughly 1.3 million residents in 72 Toronto neighbourhoods with distinct healthcare concerns. Stephanie Lockert, the central LHIN’s senior policy advisor and director of strategy and planning, says the central LHIN’s mandate is to plan localized healthcare solutions. The Local fit that objective.
“We’ve been looking at a lot of population health data and [are] trying to understand which communities might need different services, more services, and where we can provide different care,” says Lockert.
For example, as Vanessa Milne wrote for The Local in January, Englemount-Lawrence, a northwestern Toronto neighbourhood, has higher birth rates than the rest of the city. And while the city-wide average of families led by single mothers is 18 per cent, in Englemount-Lawrence, that figure jumps to 25 per cent. Of the 72 neighbourhoods in the central LHIN, Englemount-Lawrence has the second-highest rate of prenatal hospitalization.
Milne found that income often had a direct influence on prenatal and neonatal health. She cited a 2012 study which found 10 per cent of new mothers with annual household incomes of less than $20,000 faced multiple health problems, “while only about half a percent of women in households making more than $80,000 did.”
Milne wrote about Sam, a Filipino immigrant who had an ectopic pregnancy in 2015 and stillborn child 36 weeks into her second pregnancy. Sam and her husband make about $24,000 per year, but can’t afford to live in their own apartment. Instead, they live with the elderly man for whom she works as a caregiver. The Local’s motto is that there are no stories without data, and no data without stories. Sam was more than just a data point, and she lived in what Recknagel refers to as a “pocket of inequity,” where her story is much more common than it should be.
“We try to ask what life is like for people who live that data,” says Recknagel, a former documentary producer with a master’s degree in strategic foresight and innovation from the Ontario College of Art and Design, and a degree in new media studies from Ryerson University.
Hune-Brown had been a full-time freelancer for 12 years before joining The Local, but the type of work Huynh and Recknagel hoped to do convinced him to take on the gig.“They had a desire to tell longform stories in a subject area that I think people could really use,” he says.
Hune-Brown has used his connections to wrangle up some of the city’s more established writers, including Katherine Laidlaw and Walrus digital editor Lauren McKeon, as well as up-and-comers, to produce The Local’s stories. Huynh and Recknagel have written several features as well.
Stories like Sam’s are what Huynh and Recknagel envisioned their project would tackle. It’s not that mainstream health reporters don’t care about these issues, but they may not have the time or data access necessary to produce features about them on a consistent basis while responding to daily news. Moreover, their work isn’t paid for by an organization with a mandate to directly improve healthcare.
In 2017, the central LHIN provided OpenLab with $150,000 to fund The Local, and that money covers all production costs as well as freelancer fees and editor payment. Lockert, who worked with Huynh at the Ministry of Health, has a master’s degree in public health, and sees The Local as an opportunity to bring the concerns of community members directly to policy-makers.
“It’s not always possible for them to come meet with us. With The Local, we can go to them,” said Megan Primeau, the central LHIN’s communications manager.
Huynh has a bachelor’s degree in science from the University of Toronto, a master’s of business administration from York University, and a master’s in design from the Ontario College of Art and Design, a resumé which gives him a multidisciplinary perspective on how the world works.
When Huynh was nine years old, his family moved from Ho Chi Minh City, in Vietnam, to Scarborough, where they lived in the Chester Le neighbourhood, a sprawling public housing area. His family didn’t speak English and lived well below the poverty line when they arrived. His mother was a seamstress, and his father was a factory worker.
The neighbourhood was demographically, culturally and ethnically diverse, Huynh remembers, with a lot of newcomers from South Asia and the Middle East. Its residents were good people, he says, but like many public housing complexes, it faced its fair share of issues, including gun violence.
Given his education and career in healthcare, Huynh now sees myriad ways in which the communities we live in affect our well-being. Sometimes, he wishes Chester Le was in one of the 72 neighbourhoods The Local covers so the team could analyze its unique public health scenario, and he hopes the publication might someday expand its reach.
Although funding for the 2018 fiscal year has yet to be approved by the central LHIN, Lockert says the organization is pleased with The Local and is interested in continuing their partnership. In the future, similar projects could start in other integration networks reaching different corners of Toronto.
“To design anything well, you first need to understand the needs of the people who are going to use it,” Huynh says. “To truly understand that, you must start to spend time with those communities.”
And Huynh doesn’t plan on stopping anytime soon. | <urn:uuid:4e9f35c9-4c18-48c2-937a-71da7b424e93> | CC-MAIN-2022-33 | https://rrj.ca/covering-torontos-health-from-a-local-perspective/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.968755 | 1,952 | 1.945313 | 2 |
- Open Access
Supercarriers of antibiotic resistome in a world’s large river
Microbiome volume 10, Article number: 111 (2022)
Antibiotic resistome has been found to strongly interact with the core microbiota in the human gut, yet little is known about how antibiotic resistance genes (ARGs) correlate with certain microbes in large rivers that are regarded as “terrestrial gut.”
By creating the integral pattern for ARGs and antibiotic-resistant microbes in water and sediment along a 4300-km continuum of the Yangtze River, we found that human pathogen bacteria (HPB) share 13.4% and 5.9% of the ARG hosts in water and sediment but contribute 64% and 46% to the total number of planktonic and sedimentary ARGs, respectively. Moreover, the planktonic HPB harbored 79 ARG combinations that are dominated by “natural” supercarriers (e.g., Rheinheimera texasensis and Noviherbaspirillum sp. Root189) in river basins.
We confirmed that terrestrial HPB are the major ARG hosts in the river, rather than conventional supercarriers (e.g., Enterococcus spp. and other fecal indicator bacteria) that prevail in the human gut. The discovery of HPB as natural supercarriers in a world’s large river not only interprets the inconsistency between the spatial dissimilarities in ARGs and their hosts, but also highlights the top priority of controlling terrestrial HPB in the future ARG-related risk management of riverine ecosystems globally.
The dissemination of antibiotic resistance genes (ARGs) and their hosts has been accelerated by extensive overuse of antibiotics around the world . Antibiotic-resistant microorganisms (ARMs) that carried single/multiple ARGs can infect humans by contacting or entering the food chain and possibly trigger public health risks of severe infection and high mortality [2, 3]. In the past decades, great efforts have been made to understand the interactions between ARGs and microorganisms in the human gut [4,5,6]. More recently, explorations have been extended to other anthropogenic systems such as agricultural fertilized soils , wastewater treatment plants (WWTPs) , and even complex natural systems like reservoirs , lakes , and rivers .
In the human gut, ARGs were found mainly conferring resistance to tetracycline, multidrug, and macrolide-lincosamide-streptogramin, mostly hosted by Escherichia coli, Streptococcus salivarius, and Bacteroides vulgatus [4,5,6]. Among the antibiotic-resistant hosts, human pathogenic bacteria (HPB) such as Escherichia, Helicobacter, Neisseria, and Klebsiella were highly noted due to their potential to induce multiple human diseases . However, ARGs would demonstrate resistance to diverse antibiotics in varying systems beyond human/animal guts, potentially being hosted by different kinds of ARMs and HPB. In soil systems, for example, ARGs exhibit resistance to beta-lactams, aminoglycosides, amphenicols, sulfonamides, and tetracyclines , owing to the long-term application of manure fertilizer containing antibiotic residues. Consequently, HPB such as Salmonella, Bacteroidales, Campylobacter, Shigella, and Enterococcus could become supercarriers in different soil systems [13, 14]. WWTPs provide another example by acting as typical anthropogenic hotspots with the enrichment of multiple ARGs resistant to sulfonamide, beta-lactam, and tetracycline, facilitating horizontal gene transfer of ARGs among environmental bacteria and human pathogens and serving as an important pathway to transport antibiotic resistance into aquatic ecosystems [8, 15].
In natural rivers (analogous to a “terrestrial gut”) connecting continents and the oceans, ARGs could be from sewage discharge and soils via surface runoffs or be disseminated to various surrounding environments and human individuals . Previous studies have mostly focused on the occurrence, composition, and distribution of riverine ARGs and their potential hosts in relatively small streams , tributaries , river reaches , and estuarine areas . In a few studies [11, 19], certain riverine ARGs and hosts have been identified, depending on various environmental factors and human activities. Even so, the present understanding of the relationship between ARGs and core microbiota in riverine systems is far from satisfactory.
To address the above knowledge gap, we firstly provide an integral biogeographic pattern for both ARGs and their hosts along the Yangtze River, the third largest river in the world (Fig. S1). Intriguingly, our study reveals that terrestrial HPB were the supercarriers of antibiotic resistome in the Yangtze, which are essentially different from conventional HPB prevalent in the human gut. We confirm that riverine HPB contribute 46~64% to the total ARGs through harboring 79 ARG combinations in spite of their minor presence in ARG hosts (5.9~13.4%). These findings are of the utmost significance in mitigating health risks associated with antibiotic-resistant bacteria in global large river ecosystems.
The Yangtze River, the world’s third longest river, originates in the Qinghai-Tibet Plateau and flows eastwards into the East China Sea. The river has a total length of 6300 km and a drainage basin of 1.8 million km2, experiencing various changes in landform type and hydrological regime . To investigate the integral complete biogeographic patterns of ARGs and their hosts throughout the whole river, paired water and sediment samples were synchronously (i.e., within 1 week) collected at 49 national hydrologic monitoring stations along the mainstream and major tributaries of the Yangtze in March (spring) and October (autumn) 2014, and no extreme weather event occurred before and during the sample collection. A synchronous sampling of water and sediment is laborious and rarely implemented in large river systems. At some sites with heterogeneous sediments, replicates are necessary though fewer parallel water samplings are acceptable under the restricted conditions with the steep terrain and rapid flow [21, 22]. In fact, the mixture of water samples taken over a cross-section at a specific site (according to national hydrologic sampling specification) is more representative in a large river like the Yangtze. As a result, 1~4 samples (considering the significance of replicates) for sediments were undertaken at many monitoring sites particularly where heterogeneous sediments were found. Meanwhile, replicates for water were also conducted at three monitoring sites with the extremely high velocity and turbulent flow of the Yangtze River, and other “single” water samples were collected as a mixture of multiple subsamples across the section at any specific monitoring site. Noting that some samples could not be taken at several monitoring sites due to their steep terrain and rapid flow conditions, a total of 219 samples comprising 87 water and 132 sediment samples were finally obtained for further analysis. Detailed information about these samples was provided in Additional file 2: Table S1.
At each monitoring site, 10 L of water was collected into sterile PET bottles using a plexiglass water sampler at a depth of approximately 0.5 m below the water surface. Then, the water samples were immediately transported to an adjacent laboratory. One part of the water samples from each monitoring site was stored at 0–4 °C for further physicochemical analysis, and the other part for DNA extraction was filtered through 0.22-μm polycarbonate membranes (Millipore, USA) within 24 h. The filtered membranes were kept frozen at − 80 °C until further DNA extraction. Meanwhile, paired sediment samples were collected from the top layer (0–5 cm) of the river bed and placed into 50-ml sterilized polypropylene tubes. Sediments for molecular analysis were placed in dry ice, immediately brought back to the laboratory, and stored at − 80 °C. Another 1 kg of sediments was packaged within polyethylene bags for physicochemical analysis.
Physicochemical analysis was conducted for all water and sediment samples in triplicate . For each water sample, pH, water temperature (WT), pH, dissolved oxygen (DO), suspended solids (SS), total nitrogen (TN), nitrate-nitrogen (NO3−-N), ammonium-nitrogen (NH4+-N), total phosphorus (TP), and dissolved organic carbon (DOC) were measured according to the Environmental Quality Standards for Surface Water (GB3838-2002) recommended by the Ministry of Ecology and Environment of China . As for the sediment samples, pH, TN, NO3−-N, NH4+-N, TP, and total organic carbon (TOC) were also determined as described by our previous studies [21,22,23]. Meanwhile, a total of 26 antibiotics, covering 1 type of aminoglycoside, 1 bacitracin, 3 beta-lactams, 2 chloramphenicols, 3 macrolides, 4 quinolones, 8 sulfonamides, and 4 tetracyclines, were measured in water and sediment. The averaged concentrations of antibiotics were provided in Additional file 2: Table S2. In addition, elevation (E), longitude, and latitude for each sampling site were also recorded by a handheld GPS (Magellan, USA).
DNA extraction and metagenomic sequencing
Environmental DNA was extracted from each sample (using mixed filtered membranes or 0.5 g sediments) multiple times with the FastDNA® SPIN Kit for Soil (MP Biomedicals, USA) following the manufacturer’s instructions. The DNA extracts were mixed together, and the quality and concentrations of DNA were evaluated using the NanoDrop ND-2000 instrument (Thermo Fisher Scientific, USA). The high-quality DNA (DNA amount > 1 μg and concentration > 10 ng μL−1) was used for library construction by utilizing the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, USA) and then submitted for sequencing on an Illumina Hiseq 4000 platform using the paired-end (2 × 150 bp) strategy (Majorbio Company, Shanghai, China). During the DNA extraction and sequencing processes, three negative controls were applied to monitor any potential contamination, and no quantifiable DNA was detected for further molecular analysis.
Raw metagenomic reads of each sample were quality-filtered, trimmed, and screened using Sickle (-q 20 -l 50) (https://github.com/najoshi/sickle) and NGS QC Toolkit (-l 70 -s 20) . Then, high-quality clean reads were assembled into contigs using IDBA-UD with default parameters , and contigs longer than 500 bp were used for predicting open reading frames (ORFs) by MetaGeneMark . Clean reads were annotated by comparison with the SILVA small subunit database (release 132) using BLASTN (-max_target_seqs 1 -e 10-20) . The sequencing depth of each dataset was provided in Additional file 2: Table S3. The BLAST results were used to extract 16S rRNA gene-like sequences assigned to SILVA taxonomies by QIIME .
Identification of ARG-like sequences
All metagenomic clean reads were searched for ARGs against the DeepARG-DB database using DIAMOND with default probability values . Identified ARG-like sequences were automatically categorized into 31 “ARG types” and 2195 “ARG subtypes” for further analysis. To investigate the ARG biogeography in the Yangtze River, the abundance of ARGs (copy of ARG per copy of 16S-rRNA gene) was normalized using the following equation :
where Ni (ARG-like sequence) is the number of ARG-like reads mapped to a specific ARG reference sequence, Lreads is the sequence length (bp) of the Illumina reads, Li (ARG reference sequence) is the sequence length of the corresponding target ARG reference sequence, N16S sequence is the number of the 16S rRNA gene sequence, and L16S sequence is the average sequence length of 16S rRNA genes (1432 bp) in the Greengenes database .
Taxonomy annotation of ARG-carrying contigs
Predicted ORFs of each ARG-carrying contig (ACC) were searched against the DeepARG-DB database using DIAMOND (DeepARG-LS model, --sensitive -e 10-10 -f 6 -k 1). ARG-like ORFs were identified as those ORFs with the best hit in the DeepARG-DB database exceeding 80% identity over 70% of the query coverage . Then, the ARG-like ORFs were compared against the local NCBI non-redundant database using DIAMOND (--sensitive -e 10-10 -f 6 -k 1), and the results were parsed using MEGAN6 . For each ARG-carrying contig, the taxonomic assignment was achieved if more than 50% of the ARG-like ORFs within a contig were classified to the same species, then the ACC would be annotated to that species, and this ARG-carrying microbe was regarded as a potential ARG host . Moreover, the ARG-carrying contigs were then searched against the previously established pathogen database to identify potential human pathogenic bacteria (HPB) at the species level. Meanwhile, the ACCs were also compared against the virulence factor database to identify virulence factor genes (VFGs) , and those ARG hosts carrying any VFGs were also classified as HPB. To assess the distribution of ARG hosts, the abundance of ARG hosts was further determined as follows. First, the coverage for each contig was calculated by mapping clean reads from each sample against the assembled contigs using BBMap (https://sourceforge.net/projects/bbmap/) with the parameters “minid = 0.95” and “ambig = random.” Second, the abundance for each contig was determined as the ratio of coverage for each contig to the coverage for all contigs. Finally, the abundance of ARG hosts was obtained according to the taxonomic annotation of ARG-carrying contigs in each sample.
Horizontal gene transfer (HGT) analysis
To explore the potential HGT of ARGs among microbes, mobile genetic elements (MGEs) were characterized by annotating all ORFs on ARG-carrying contigs (ACCs) against the NCBI non-redundant (NR) protein database. Annotations were categorized as MGEs based on string matches to each of the following keywords: transposase, transposon, conjugative, integrase, integron, recombinase, conjugal, mobilization, recombination, plasmid, and relaxase [37, 38]. Subsequently, the MGE coverage was normalized by the data size of each sample (copies/Gb) to compare the MGE profile among different samples.
Genome binning of each metagenome was performed using MetaWRAP . The completeness and contamination of the MAGs were evaluated using CheckM , and high-quality MAGs (completeness > 50%, contamination < 10%) were kept for downstream analysis. The taxonomy of the recovered metagenome-assembled genomes (MAGs) was determined using a set of 120 universal single-copy proteins based on the Genome Taxonomy Database (GTDB) using GTDB-Tk . The amino acid identity (AAI) between MAGs was determined using CompareM with default options (https://github.com/dparks1134/CompareM), and the redundant MAGs were dereplicated with the 99.5% average nucleotide identity (ANI) . The coverage of each MAG was calculated by BBMAP (https://sourceforge.net/projects/bbmap/) with the default parameters.
Principal coordinates analysis (PCoA) was performed to visualize the dissimilarity of ARGs and hosts in all samples based on Bray-Curtis similarity matrices. Analysis of similarity (ANOSIM) was conducted to test the significance of the differences among a priori sampling groups based on environmental parameters. PCoA and ANOSIM statistics were carried out using the vegan package in R. Linear discriminant analysis effect size (LEfSe) was used in conjunction with the Kruskal-Wallis and Wilcoxon tests to discover high-dimensional biomarkers and explain the taxa differences for different landform types . One-way analysis of variance (one-way ANOVA) was executed to test the significance of group differences using vegan. Sloan et al.’s neutral community model was used to assess the potential importance of neutral processes on the ARG/host/HPB communities. Procrustes analysis was also conducted to assess the correlation between ARGs and their hosts in the Yangtze River by using PCoA results as input. The measure of fit M2 (the sum of squared distances between matched sample pairs) and P-value were computed from 10,000 labeled permutations using vegan.
Distance-decay patterns of the similarity of ARG/host/HPB communities were obtained by considering geographical distances from sample site locations to the river mouth. Mantel tests were used to examine the Spearman’s rank correlation between geographical distance and ARG/host/HPB community similarity using Bray-Curtis distance matrices with 999 permutations in R. The geographical distance of each sampling site was calculated using the ArcGIS V10.3 software. The rate of distance-decay of ARG/host/HPB communities was calculated as the slope of the ordinary least-squares regression line fitted to the relationship between geographic distance and community similarity.
Of the driving factors under consideration [21, 22], physicochemical variables included pH, flow discharge (Q), water temperature (Tw), total nitrogen (TN), dissolved oxygen (DO, for water), nitrate-nitrogen (NO3−-N), ammonium-nitrogen (NH4+-N), total phosphorus (TP), and total organic carbon (TOC). Spatial variables were determined using principal coordinates of neighbor matrices (PCNM) analysis based on geographic coordinates . Anthropogenic variables, comprising population, GDP, aquatic production, meat production, chemical fertilizer consumption, municipal domestic sewage, the number of patients diagnosed and treated, and the number of residential patients, were determined according to the main administrative region covered by each basin, referred to a previous study . Variables with variance inflation factors (VIF) > 5 were removed using vegan. A forward selection step was performed to select variables. A partial least squares-path modeling (PLS-PM) analysis was then conducted to determine the direct and indirect effects of selected variables on ARG/host/HPB communities using the plspm package in R .
Composition profiles of ARGs in the Yangtze River
A broad-spectrum profile of ARGs in the Yangtze River comprised 31 main types and 2195 subtypes, of which the most diverse ARG type was identified as beta-lactam resistance genes containing 1121 subtypes, followed by aminoglycoside, multidrug, macrolide-lincosamide-streptogramin (MLS), glycopeptide, chloramphenicol, tetracycline, and trimethoprim resistance genes (Fig. 1a-b). Moreover, the dominant ARG types included bacitracin resistance genes (relative abundance 22.1%), MLS (17.7%), multidrug (14.2%), and trimethoprim resistance genes (12.7%) (Fig. 1c). Among the ARG subtypes observed in water (89.8% of the total 2195 subtypes) and sediment (85.7%) (Fig. 1d, Fig. S2a-b), the most frequently encountered ARGs were uppP (resistant to bacitracin), drfE (trimethoprim), and macB (MLS) resistance genes (occupancy ≥ 95%) with average abundances of 18.9%, 11.2%, and 9.8%.
The composition of ARG subtypes in different media (water and sediment) and seasons (spring and autumn) was visualized using principal coordinates analysis (PCoA), and four distinct groups were clustered for ARGs (Fig. S2c-d), as confirmed by the ANOSIM test (Fig. S2e-f, ANOSIM R > 0.7, P = 0.001). Furthermore, sedimentary ARGs exhibited higher richness and diversity than planktonic ARGs, and the ARG compositions were more abundant in autumn (1.79 copies/16S rRNA copies in water and 2.02 in sediment) than in spring (0.310 in water and 0.168 in sediment) (Fig. S3a-b). In terms of seasonal sensitivity of ARGs (Fig. S3c-d), 12 dominant ARG types (e.g., multidrug, MLS, and quinolone resistance genes) prevailed in autumn, whereas 5 ARG types (including resistance to bacitracin, trimethoprim, beta-lactam, sulfonamide, and mupirocin) exhibited higher abundance in spring.
Taxonomic profiles of ARG hosts
Detectable ARGs in the Yangtze River were taxonomically annotated to a total of 1853 antibiotic-resistant species belonging to 22 phyla. ARG hosts displayed significantly higher biodiversity in water (1408 species) than in sediment (796 species) (Figs. S4-S5, ANOVA P < 0.001). Most planktonic ARG hosts were affiliated with Proteobacteria (75.8%), Actinobacteria (14.1%), and Bacteroidetes (5.2%) (Fig. 2a), while sedimentary hosts were mostly associated with Proteobacteria (72.2%) and Bacteroidetes (18.8%) (Fig. 2b). At the genus level, Limnohabitans, Acidimicrobium, and Candidatus Methylopumilus contributed about half of the relative abundance in the planktonic hosts (Fig. 2c), whereas Methylotenera and Flavobacterium dominated the sedimentary hosts (Fig. 2d, relative abundance 43.90%). In addition, weak seasonal distinctions were observed in both planktonic (Fig. S4c, ANOSIM R = 0.244, P = 0.001) and sedimentary (Fig. S4d, ANOSIM R = 0.086, P = 0.001) ARG hosts. In planktonic ARG hosts, the seasonal difference was exhibited by 18 genera, namely Rhizobacter, Andreprevotia, Lysobacter, Woeseia, Vibrio, Delftia, Nitrosomonas, Thiobacillus, Knoellia, Azospirillum, Sphingobium, Rheinheimera, Porphyrobacter, Sphingopyxis, and Curvibacter abundant in spring, and Synechococcus, Cyanobium, and Microcystis in autumn (Fig. S5c). In sedimentary ARG hosts, five genera (including Elizabethkingia, Flavobacterium, Rhodoferax, Streptomyces, and unclassified Comamonadaceae) exhibited higher abundance in autumn (Fig. S5d).
Specifically, 65 HPB carrying ARGs were identified in water (56 species) and sediment (24 species) of the Yangtze River (Additional file 2: Table S4). Planktonic HPB were dominated by Limnohabitans sp. 63ED37-2 (38.9%), Acinetobacter bohemicus (14.8%), Rheinheimera texasensis (13.0%), Noviherbaspirillum sp. Root189 (7.0%), Methyloversatilis universalis (5.5%), and Pseudomonas aeruginosa (3.6%), while Methylotenera sp. G11 (22.3%), Flavobacterium fluvii (10.4%), and Methyloversatilis sp. RAC08 (3.3%) were the most abundant sedimentary HPB. Although HPB occupied a small percentage of the entire planktonic (13.4%) and sedimentary (5.9%) hosts, they carried 64.4% and 46.1% of the total number of planktonic and sedimentary ARG subtypes, respectively. At the phylum level (Fig. 3a), HPB were mainly affiliated with Proteobacteria in both planktonic HPB (relative abundance 96.5%) and sedimentary HPB (abundance 98.9%). At the genus level (Fig. 3b), Acinetobacter, Limnohabitans, and Pseudomonas were the most common HPB, with a higher average abundance in spring (80% in water, 88% in sediment) than in autumn (28% in water, 14% in sediment). In addition, other dominant HPB genera such as Comamonas (4%) and Prosthecobacter (7%) prevalent in water_spring, Methyloversatilis (11%) and Rheinheimera (16%) abundant in water_autumn, Morganella (5%) in sediment_spring, and Methyloversatilis (70%) prevalent in sediment_autumn.
Potential horizontal gene transfer of ARGs and ARG hosts
To further evaluate the potential mobility of ARGs, the co-occurrence of specific MGEs and ARGs was investigated. Although many kinds of MGEs were detected to co-localize with ARGs, there were few ACCs (1568) carrying MGEs in the Yangtze River, responsible for 1.23% of all the detected ACCs (127,097). Specifically, the ARGs co-occurring with MGEs, accounting for 0~7.55% of the total ARGs in the river, exhibited a higher abundance in water (average 15.71 coverage/Gb in spring and 17.37 in autumn) than in sediment (2.61 in spring and 1.35 in autumn), demonstrating greater horizontal gene transfer (HGT) potential of ARGs in water (Fig. S6a). Moreover, the most frequently detected MGEs included recombinases, transposases, integrases, and conjugal transfer proteins in both water and sediment (Fig. S6b), and these mobility elements tended to co-exist with multiple ARGs conferring resistance to multidrug, quinolone, and macrolide-lincosamide-streptogramin, thereby promoting the development of multi-antibiotic resistance and the emergence of pathogenic microbes in the river ecosystem. In addition, MGEs were significantly associated with HPB (Additional file 2: Table S5, Spearman’s = 0.48~0.64, P < 0.05), followed by ARG hosts (Spearman’s = 0.25~0.65, P < 0.05) and ARGs (P > 0.05), implying relatively higher environmental and health risks caused by the higher migration and dispersal rates of ARG hosts and HPB along the Yangtze River.
Relationships between ARGs and bacterial communities
Using the Procrustes analysis based on Bray-Curtis distance, we found significant correlations between ARG profiles and microbial compositions in both water (M2 = 0.620, P < 0.01) and sediment (M2 = 0.680, P < 0.01) (Fig. S7). Unlike previous studies based on co-occurrence relationships [11, 19, 48], we have established direct links between ARGs and their hosts at the phylum and genus levels through metagenomic contigs (Figs. S8-S9). In the planktonic networks (Fig. S9a-b), the direct connections consisted of 159 ARG subtypes and 294 genera in spring and 192 ARGs and 574 genera in autumn. In the sedimentary networks (Fig. S9c-d), such connections occurred between 126 ARG subtypes and 239 genera in spring and 142 ARGs and 381 genera in autumn. These findings indicate that the planktonic hosts tended to carry a greater number of ARGs than the sedimentary hosts, especially in autumn. Complex connections in the networks also occurred between multiple ARGs and HPB in water (Fig. S10). In the planktonic networks, the biggest host nodes including Methyloversatilis universalis, Noviherbaspirillum sp. Root189, and Rheinheimera texasensis connected with more than 40 kinds of ARGs in autumn, while Acinetobacter bohemicus and Acinetobacter celticus were identified as the biggest nodes (associated with > 31 ARGs) in spring. Among the planktonic HPB, Comamonas testosteroni and Limnohabitans sp. 63ED37-2 connected with more than 20 kinds of ARGs in both spring and autumn.
We further examined the possibility of multiple ARGs carried by a single HPB. Among the detected 65 HPB, 21 HPB were identified as supercarriers, accounting for 94.4% and 94.5% of the abundance of planktonic and sedimentary HPB, respectively. These 21 supercarriers were found to harbor 79 combinations with multiple ARG subtypes, mainly comprising two kinds of ARGs (56 combinations) (Fig. 3c). Remarkably, planktonic HPB were associated with 97.5% of the total ARG combinations found in the Yangtze, mostly carried by Rheinheimera texasensis, Noviherbaspirillum sp. Root189, Comamonas testosteroni, Methyloversatilis universalis, and Limnohabitans sp. 63ED37-2 (Fig. 3c). Sedimentary HPB including Acinetobacter bohemicus, Pseudomonas reinekei, and Methyloversatilis universalis served as multiple carriers harboring 6 ARG combinations. Hence, planktonic HPB appeared to contribute far more than sedimentary HPB as supercarriers of ARGs in the Yangtze River. These HPB containing ARG combinations were shaped by three ARG resistance mechanisms (Fig. 3d), namely efflux pump, antibiotic inactivation, and target modification. Antibiotic efflux pumps may be divided into five families , namely the major facilitator (MFS) superfamily, the adenosine triphosphate (ATP)-binding cassette (ABC) superfamily, the small multidrug resistance (SMR) family, the resistance-nodulation-cell division (RND) superfamily, and the multidrug and toxic compound extrusion (MATE) family. Surprisingly, each ARG combination encoded at least one antibiotic efflux pump, with 87.3% of the total combinations involved in the resistance-nodulation-division (RND) antibiotic efflux system. In addition, 3.8% and 12.7% of ARG combinations contributed to antibiotic inactivation and target modification mechanisms, respectively.
Furthermore, a metagenomic binning analysis was also conducted. A total of 199 metagenome-assembled genomes (MAGs) carrying ARGs were identified in the Yangtze (Additional file 2: Table S6), and these MAGs were assigned to ten phyla among which Proteobacteria (136 MAGs), Verrucomicrobiota (18 MAGs), Bacteroidota (10 MAGs), Actinobacteriota (10 MAGs), and Nitrospirota (10 MAGs) were the dominant phyla (Fig. 4a). The abundance of ARG-carrying MAGs in water-spring (6.69 coverage/Gb) and water-autumn (5.76 coverage/Gb) was significantly higher than that in sediment-spring (1.79 coverage/Gb) and sediment-autumn (1.24 coverage/Gb). The 199 MAGs mainly carried 13 ARG types, among which multidrug, polymyxin, trimethoprim, sulfonamide, and macrolide-lincosamide-streptogramin were most frequently detected. Moreover, 121 ARG-carrying MAGs could be pathogenic ARG hosts due to the disclosure of diverse VFGs (161 types), and these MAGs belonged to Acinetobacter (0.46 coverage/Gb), Malikia (0.38), Pseudomonas (0.23), Nitrospira (0.13), Methylopumilus (0.12), and Limnohabitans (0.10). Strikingly, a wide range of MGEs was frequently detected in these pathogenic resistant bacteria, implying a high HGT potential of ARGs through pathogenic bacteria that further facilitate the dissemination of ARGs and pose genuine threats to human health.
Notably, some bacteria exhibited both possible multi-antibiotic resistance and pathogenicity characteristics. A total of 61 MAGs harbored at least two ARGs and mainly conferred resistance to multidrug, polymyxin, trimethoprim, sulfonamide, and beta-lactam. These MAGs mainly belonged to Acinetobacter (average abundance of 0.34 coverage/Gb), Pseudomonas (0.23 coverage/Gb), Planktophila (0.16 coverage/Gb), and Malikia (0.15 coverage/Gb) (Fig. 4b). Interestingly, 77% of the MAGs, mostly annotated as Acinetobacter, Pseudomonas, and Malikia, exhibited a pronounced tendency to carry at least one VFG, suggesting that these environmental bacteria with multiple resistance might have considerable pathogenicity in the river (Fig. 4c). Additionally, these pathogenic multi-resistant bacteria tended to display a higher abundance in water (WS 1.89 coverage/Gb, WA 1.39 coverage/Gb) than in sediment (SS 0.62 coverage/Gb, SA 0.38 coverage/Gb).
Biogeographic patterns of ARGs and hosts
No significant distance-decay was found for the similarity of ARG composition in water and sediment along the Yangtze (Fig. 5a-b and Fig. S11a-b), despite the significant decrease in community similarity of ARG hosts with geographical distance (Fig. 5c-d and Fig. S11c-d, < 0.05). Moreover, the similarity of ARG hosts declined faster in water (with decay slopes of − 5.78 × 10−5 in spring and − 6.62 × 10−5 in autumn) than in sediment (with decay slopes of − 5.05 × 10−5 in spring and − 1.12 × 10−5 in autumn), suggesting higher spatial turnover rates of planktonic hosts. Interestingly, both planktonic and sedimentary HPB demonstrated similar mild distance-decay relationships as ARG compositions along the Yangtze (Fig. 5e-f and Fig. S11e-f).
The abundance and distribution of ARGs and their hosts along the mainstream of the Yangtze River were presented, which were further compared with those in the main tributaries such as DTH (Dongtinghu), HBH (Huangbohe), HJ (Hanjiang), JLJ (Jialingjiang), MJ (Minjiang), PYH (Poyanghu), and WJ (Wujiang). The ARGs shared by the mainstream and seven tributaries accounted for 70% and 96% of the total abundance respectively in water and sediment, suggesting similar ARG compositions in most river reaches (Fig. S12, ANOVA P > 0.05). Moreover, the seasonal difference in both planktonic and sedimentary ARGs in the domains was characterized by significantly higher richness and abundance in autumn than in spring. Specifically, the genes conferring resistance to multidrug and MLS were higher in autumn, while the bacitracin resistance genes seemed more abundant in spring (Fig. S13).
The spatiotemporal pattern of ARG hosts was also investigated in terms of the mainstream and seven tributaries. No statistical distinction in abundances of ARG hosts was found among mainstream and tributaries (Fig. S14a, ANOVA P > 0.05), though significant seasonal differences in ARG hosts existed (ANOVA P < 0.05). In particular, planktonic ARG hosts exhibited a significant difference in richness. The mean richness appeared higher in the tributary MJ (81~95) in both spring and autumn, but greater in the mainstream (88) in autumn (Fig. S14b). The planktonic ARG hosts (mainly assigned to Proteobacteria or Actinobacteria) were abundant in tributaries such as WJ, MJ, and HBH in spring (mean abundance 3.10E−3 copies/Gb in WJ, 2.75E−3 in MJ, 1.67E−3 in HBH), while sedimentary ARG hosts (dominated by Proteobacteria) were more abundant in tributaries including HJ (1.50E−3 copies/Gb), DTH (8.31E−4 copies/Gb), and WJ (7.06E−4 copies/Gb) in spring, compared to those in the mainstream (6.21E−4 copies/Gb). In short, ARG hosts exhibited spatiotemporal variations compared with ARGs along the Yangtze River.
Significant differences in the abundance of planktonic HPB were observed in terms of the mainstream and seven tributaries (Fig. S15a, ANOVA P < 0.05). In spring, planktonic HPB in the mainstream were dominated by Limnohabitans and Acinetobacter (mean abundance 1.82E−4 copies/Gb), slightly greater than the tributary HPB, e.g., WJ (1.51E−4 copies/Gb), HBH (1.50E−4 copies/Gb), and MJ (1.27E−4 copies/Gb). In autumn, the highest abundance of HPB occurred at the tributary MJ (4.12E−4 copies/Gb), dominated by Methyloversatilis and Prosthecobacter, which was considerably higher than those observed in the mainstream (2.14E−4 copies/Gb), dominated by Limnohabitans, Methyloversatilis, and Rheinheimera. In general, planktonic HPB exhibited greater richness in autumn than in spring except for those at tributaries HBH and HJ (Fig. S15b). A similar analysis was made on spatiotemporal distributions of sedimentary HPB (both richness and abundance) in the mainstream and tributaries (Fig. S15). Lastly, planktonic supercarriers as the majority (about 94% of the total abundance) of HPB displayed somehow differences among the mainstream and seven tributaries (Fig. S15c, ANOVA P < 0.05) but exhibited significant seasonal differences in tributaries such as WJ and MJ.
Furthermore, landforms may influence the distribution of ARG hosts along the Yangtze River. ANOSIM analysis indicated significant landform difference in planktonic (R = 0.376, P = 0.002) and sedimentary ARG hosts (R = 0.313, P = 0.001) in spring. At the genus level, certain ARG hosts (e.g., Methylotenera and Novosphingobium) were abundant in plain and mountain regions, whereas others (e.g., Rhodoluna and Acidimicrobium) showed a preference for basin or low hill regions (Fig. S16). However, no distinct difference (ANOSIM P > 0.5) occurred in the compositions of planktonic and sedimentary HPB regarding different landforms and none in ARGs except for the river reach with low hill landform (Fig. S17).
Driving forces for antibiotic resistome
To interpret the ARG profiles in the Yangtze River, we fitted the occurrence frequency of ARGs to a neutral model that incorporated the effects of stochastic dispersal and drift processes. As a result, the neutral process fairly described planktonic ARG subtypes (Fig. 6a-b, spring: R2 = 0.773; autumn: R2 = 0.875) and sedimentary ARG subtypes (Fig. S18a-b, spring: R2 = 0.815; autumn: R2 = 0.942), as it for ARG types. Non-neutral partitions of ARGs mainly included those with high occurrence frequency, especially genes conferring resistance to aminoglycoside, beta-lactam, MLS, and multidrug (Fig. S19). Compared with ARGs, the ARG hosts showed a slightly poorer fit to the neutral model in water (Fig. 6c, d, spring: R2 = 0.584; autumn: R2 = 0.601) and sediment (Fig. S18c-d spring: R2 = 0.230; autumn: R2 = 0.109). According to the immigration rate (m) estimated from the neutral model, the random dispersal of microbial hosts was likely to be lower than that of ARGs because of multiple ARGs carried by HPB. However, HPB themselves could hardly be described by the neutral model (Fig. 6c-d and Fig. S18c-d) due to the incomprehensive and uncertain number of HPB as putative functional taxa, leading to difficulties in predicting an immigration rate (m) for HPB.
PLS-PM analysis was conducted to assess the direct and indirect effects of spatial variables, anthropogenic variables, physicochemical variables, antibiotics, MGEs, and ARG hosts/HPB on ARG profiles in the Yangtze River. It was found that physicochemical variables represented with water temperature showed the largest positive total standardized effects on the ARG composition in both water and sediment, while spatial variables significantly correlated with sedimentary ARGs (Fig. 7 and Fig. S20). Besides, antibiotics did not show significant direct effects on ARGs in water and sediment but might affect the sedimentary ARG hosts/HPB and thereby indirectly drive the ARG profiles in the river. MGEs seemed to have an insignificant effect on ARGs in both water and sediment, possibly indicating a low HGT frequency of ARG resistome in the Yangtze. However, both ARG hosts and HPB exerted significant effects (path coefficient 0.193~0.818) on MGEs, suggesting that the mobility of the microbes carrying ARGs further promoted the dispersal of ARGs in the water and sediment of the Yangtze River. In addition, anthropogenic variables mainly represented by municipal domestic sewage and the total population had less influence on ARGs, ARG hosts, and HPB in this large natural river. Notably, HPB exhibited positive associations with planktonic and sedimentary ARGs. Compared with the correlations between the richness of microbial hosts and ARGs in water (Fig. S21, Spearman’s r = 0.30~0.54, P > 0.05), much higher correlations between planktonic HPB and ARGs (Spearman’s r = 0.66~0.69, P < 0.001) further suggested that planktonic HPB were major contributors to antibiotic resistome in the Yangtze River.
Rivers provide an important route for the propagation of ARGs and pathogens between the environment and human beings. Given the limited information available on the public risk posed by riverine antibiotic resistome, we focused on ARGs and their hosts in water and sediment, paying particular attention to the unique contribution of HPB in determining ARGs along the Yangtze River.
Dominant ARGs captured from the river system (regarded as a “terrestrial gut”) are significantly different from those reported in the human gut, anthropogenic systems, and other systems like lakes or reservoirs. For example, tetracycline resistance genes were ubiquitous and predominant in the human gut worldwide ; tetracycline- and aminoglycoside-resistant genes were the most abundant ARG types in sewage treatment plants ; multidrug resistance genes, beta-lactamase, and aminoglycoside were the most diverse and dominant ARGs in Xidong Reservoir and estuarine sediments . However, ARGs conferring resistance to bacitracin, MLS, and multidrug resistance genes were found to be predominant in the Yangtze River. Moreover, the microbiota in the human gut typically resist tetracycline through ribosomal protection mechanisms; sewage bacteria primarily resist tetracycline through MFS antibiotic efflux ; bacteria in reservoir water and estuarine sediments conferred antibiotic resistances mainly through three resistance mechanisms including antibiotic deactivation, followed by efflux pumps and cellular protection. In comparison, riverine microbial resistance is likely driven by RND efflux pumps. Although ARGs in natural rivers could arise from anthropogenic practices that release antibiotics and/or components of human resistant microbiome, it should be stressed that other sources could include naturally produced antibiotics and resistance genes .
ARG hosts may vary in anthropogenic systems and natural rivers. For instance, Firmicutes is the predominant phylum in the human gut and Actinobacteria in polluted farmland , whereas the ARG hosts in the Yangtze are similar to the dominant phylum in pristine Antarctic soil given that the majority (> 97%) are taxonomically assigned to Proteobacteria. As ideal pipelines for the transformation and accumulation of ARGs and antibiotic-resistant microbes, river ecosystems could receive resistant microorganisms in water and sediment from basins with different landforms . Besides oligotrophic ultramicrobacteria, such as Polynucleobacter and Limnohabitans typically observed in freshwater systems , other exogenous bacteria also serve as major ARG hosts in the Yangtze. These include Flavobacterium as a fish pathogen mainly detected in aquaculture systems and Methylotenera and Acidimicrobium often discovered in environments affected by intense agricultural activity or metal contamination . Surprisingly, we found that HPB are the predominant multi-antibiotic resistant “supercarriers” along the Yangtze River. Planktonic HPB occupied a small fraction (13.4%) of all ARG hosts but contributed greatly (64.4%) to total ARGs, suggesting the primary importance of HPB in carrying the ARGs in this large river. Metagenomic binning analysis indicated that many unknown environmental bacteria could be potential pathogenic supercarriers of ARGs. For example, HPB, such as Acinetobacter spp. and Pseudomonas spp., identified to carry at least one VFG, have a remarkable ability to rapidly develop resistance to various antibiotics and persist in the natural environment . Intriguingly, typical HPB in this “terrestrial gut,” including Limnohabitans sp. 63ED37-2, Acinetobacter bohemicus, Rheinheimera texasensis, Noviherbaspirillum sp. Root189, and Methyloversatilis universalis were significantly different from those represented by Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, Enterococcus fecalis, Enterococcus faecium, and Pseudomonas putida, in human/animal guts or sewage systems [33, 61,62,63].
The multi-resistance of HPB can be further explained with RND efflux pumps which facilitate transporting a variety of antibiotics out of a given cell to confer multidrug resistance and play a predominant role in mediating the cross-resistance of HPB (Fig. 3d). Meanwhile, MFS, ABC, SMR, and MATE efflux systems also contributed to the ARG accumulation of HPB because of their resistance to specific antibiotics such as tetracycline, macrolide, aminocoumarin, and fluoroquinolone. Besides, antibiotic resistance of HPB could be caused by a target modification mechanism, mainly driven by the emergence of chrB and dfrE genes with resistance to macrolides and trimethoprim through methylation of 23S ribosomal RNA or the production of alternative proteins [64, 65]. Although antibiotic inactivation is known to be prevalent in environments containing many residual antibiotics due to human activities , only a few HPB-carrying ARGs such as APH(3′)-la may produce specific enzymes that inactivate antibiotics in the Yangtze, indicating a weak contribution of antibiotic inactivation to the multiple resistance of HPB. The co-existence of genes encoding multiple efflux pumps, target modification, and antibiotic inactivation mechanisms promote broad-spectrum resistance in HPB . Dominant HPB such as Rheinheimera texasensis, Methyloversatilis universalis, and Commanonas testosteroni are typical Gram-negative bacteria, which may cause drug-resistant infections which are of significant concern nowadays owing to there being fewer effective antibiotics that target Gram-negative bacteria . Therefore, the widespread distribution of HPB with multiple antibiotic resistance along natural rivers poses a new challenge for the treatment of numerous infections using the existing arsenal of drugs.
The presence of terrestrial HPB is helpful in understanding the spatiotemporal distributions of ARGs and their hosts over the 4300 km continuum of the Yangtze River. Terrestrial HPB indicates the HPB from the terrestrial sources (rather than from the human/animal gut or sewage), mostly from the non-point sources accompanied with water and soil loss in the Yangtze River basin. Seasonal fluctuations in precipitation and temperature would alter runoff and sediment flux and thereby planktonic/sedimentary antibiotic-resistant microorganisms from terrestrial sources in the Yangtze. Higher temperature and increased precipitation in the wet season promote the transmission of ARGs and accelerate the reproduction of ARG hosts , leading to an increased abundance of ARGs. Meanwhile, non-point sources, especially from surrounding agriculture and aquaculture activities, could introduce more diverse ARGs and pathogens into rivers with the help of more frequent surface runoff events in the wet season [69, 70]. Spatially, both ARG hosts and bacterial communities exhibit significant distance-decay patterns in the Yangtze , whereas the distance-decay is not significant for ARGs in the same river. The unexpected inconsistency between ARGs and their hosts may be interpreted by considering the special role of HPB in the Yangtze. Since HPB appear as the minority of the overall microbial community, their impacts on the spatial dispersal of the entire ARG host community are greatly restricted. On the other hand, the weak distance-decay of HPB as the ARG supercarriers would considerably influence the geographical pattern for ARGs. Such insignificant ARG distance-decay relationships were also observed in other ecosystems, such as those in the natural wetlands across the Qinghai-Tibetan Plateau , in agricultural soils across China , and in the phyllosphere across eastern and northern Australia . By contrast with the disconnected waterbodies and soils [10, 74], the highly connected river continuum enables ARGs to spread in the streamflow direction , thereby weakening the dispersal limitation and the distance-decay of ARGs along the Yangtze.
The prevalence of antibiotic-resistant genes and their microbial hosts has become one of the global challenges in river health maintenance. Riverine ARGs could come from the selection process exerted by accumulated antibiotics, or from ARMs released from wastewater or soil runoff. Generally, the majority of input antibiotics are easily degraded and non-persistent with low concentrations in receiving natural rivers, providing a low likelihood of stimulating the prevalence of ARGs . This speculation is consistent with the weak correlations between antibiotics and ARGs (Fig. 7 and Fig. S20). On the other hand, the convergence of resistant microorganisms from multiple terrestrial sources entering rivers may cause persistent ARG pollution. Unlike conventional feces-related bacteria in severely contaminated urban rivers , terrestrial HPB as supercarriers have a direct influence on the distribution and dissemination of ARGs in the Yangtze. Here, non-point source (NPS) systems possibly became the main contamination sources of nutrients, harmful substances, and even pathogenic bacteria to the receiving river, through surface runoff, soil erosion, and farmland drainage [78, 79]. Therefore, priority should be given to the prevention of terrestrial HPB from NPS contamination. Besides the reasonable utilization of low-antibiotic drugs and fertilizers, continuous supervision and land-use optimization would also be helpful in reducing the consumption of antibiotics and the accumulation of terrestrial HPB in river ecosystems .
To prevent the dissemination of potential resistant HPB from NPS systems into surrounding rivers, integrated management is required that incorporates HPB regulation within effective countermeasures for water and soil conservation. Engineering measures such as constructions of sand block retaining buildings and artificial wetland plants are proposed to stabilize channel slopes and reduce the entry of terrestrial HPB into rivers. Alternative strategies such as the introduction of cropland buffers or additional vegetation cover would also be useful to intercept surface runoff . Noting the high capability of certain HPB like Acinetobacter spp. and Pseudomonas spp. to develop antibiotic resistance in the natural environment, mitigation strategies are required to reduce the spread of terrestrial HPB during high river flow and in the wet season. Furthermore, collection facilities (such as sewage ponds) are necessary to centralize the disposal of antibiotics and resistant HPB in runoff. To avoid the transfer of resistant HPB into other environmental compartments and to human individuals, novel treatment technologies (such as ultraviolet irradiation, chlorination, and sonication) should be implemented to sterilize water used for irrigation, farming, and drinking . Given the new challenge of “natural” supercarriers, water authorities must pay special attention to terrestrial HPB when developing future strategies for controlling ARGs in large river basins.
Based on the derived ARGs (31 main types and 2,195 subtypes) and their hosts (22 phyla and 1853 species), we revealed the significant role of HPB in carrying ARGs in water and sediment over a 4300-km continuum along the Yangtze River, the third longest river in the world. Despite their small share (13.4%) in ARG hosts, HPB harbored multiple ARGs accounting for 64% of the total ARGs in water. Multiple resistance of HPB was promoted by resistance-nodulation-cell division (RND) efflux pumps that predominated in 79 ARG combinations. Unlike conventional supercarriers (e.g., Enterococcus spp. and other fecal indicator bacteria) prevalent in the human gut, we found that HPB are characterized by “natural” supercarriers (e.g., Rheinheimera texasensis and Noviherbaspirillum sp. Root189) from the river catchments. From a metagenomic perspective, HPB acting as a key reservoir of ARGs in the complex “terrestrial gut” helped interpret the inconsistency between spatial dissimilarities in ARGs and their hosts and highlighted the importance of HPB-dependent strategies in ARG-related risk management of large rivers globally.
Availability of data and materials
Complete datasets supporting the findings of this article are available in the NCBI Sequence Read Archive (SRA) database (BioProject number: PRJNA559231).
Fischbach MA, Walsh CT. Antibiotics for emerging pathogens. Science. 2009;325:1089–93.
Berendonk TU, Manaia CM, Merlin C, Fatta-Kassinos D, Cytryn E, Walsh F, et al. Tackling antibiotic resistance: the environmental framework. Nat Rev Microbiol. 2015;13:310–7.
Fang H, Han L, Zhang H, Long Z, Cai L, Yu Y. Dissemination of antibiotic resistance genes and human pathogenic bacteria from a pig feedlot to the surrounding stream and agricultural soils. J Hazard Mater. 2018;357:53–62.
Carr VR, Witherden EA, Lee S, Shoaie S, Mullany P, Proctor GB, et al. Abundance and diversity of resistomes differ between healthy human oral cavities and gut. Nat Commun. 2020;11:693.
Hu Y, Yang X, Qin J, Lu N, Cheng G, Wu N, et al. Metagenome-wide analysis of antibiotic resistance genes in a large cohort of human gut microbiota. Nat Commun. 2013;4:2151.
Feng J, Li B, Jiang X, Yang Y, Wells GF, Zhang T, et al. Antibiotic resistome in a large-scale healthy human gut microbiota deciphered by metagenomic and network analyses. Environ Microbiol. 2018;20:355–68.
Han XM, Hu HW, Chen QL, Yang LY, Li HL, Zhu YG, et al. Antibiotic resistance genes and associated bacterial communities in agricultural soils amended with different sources of animal manures. Soil Biol Biochem. 2018;126:91–102.
Liu Z, Klümper U, Liu Y, Yang Y, Wei Q, Lin JG, et al. Metagenomic and metatranscriptomic analyses reveal activity and hosts of antibiotic resistance genes in activated sludge. Environ Int. 2019;129:208–20.
Huerta B, Marti E, Gros M, López P, Pompêo M, Armengol J, et al. Exploring the links between antibiotic occurrence, antibiotic resistance, and bacterial communities in water supply reservoirs. Sci Total Environ. 2013;456–457:161–70.
Liu L, Su JQ, Guo Y, Wilkinson DM, Liu Z, Zhu YG, et al. Large-scale biogeographical patterns of bacterial antibiotic resistome in the waterbodies of China. Environ Int. 2018;117:292–9.
Jia S, Zhang XX, Miao Y, Zhao Y, Ye L, Li B, et al. Fate of antibiotic resistance genes and their associations with bacterial community in livestock breeding wastewater and its receiving river water. Water Res. 2017;124:259–68.
Duan Y, Chen Z, Tan L, Wang X, Xue Y, Wang S, et al. Gut resistomes, microbiota and antibiotic residues in Chinese patients undergoing antibiotic administration and healthy individuals. Sci Total Environ. 2020;705:135674.
Forsberg KJ, Reyes A, Wang B, Selleck EM, Sommer MOA, Dantas G. The shared antibiotic resistome of soil bacteria and human pathogens. Science. 2012;337:1107–11.
Fang H, Wang H, Cai L, Yu Y. Prevalence of antibiotic resistance genes and bacterial pathogens in long-term manured greenhouse soils as revealed by metagenomic survey. Environ Sci Technol. 2015;49:1095–104.
Czekalski N, Gascón Díez E, Bürgmann H. Wastewater as a point source of antibiotic-resistance genes in the sediment of a freshwater lake. ISME J. 2014;8:1381–90.
Marti E, Variatza E, Balcazar JL. The role of aquatic ecosystems as reservoirs of antibiotic resistance. Trends Microbiol. 2014;22:36–41.
Arsand JB, Hoff RB, Jank L, Bussamara R, Dallegrave A, Bento FM, et al. Presence of antibiotic resistance genes and its association with antibiotic occurrence in Dilúvio River in southern Brazil. Sci Total Environ. 2020;738:139781.
Chen H, Chen R, Jing L, Bai X, Teng Y. A metagenomic analysis framework for characterization of antibiotic resistomes in river environment: application to an urban river in Beijing. Environ Pollut. 2019;245:398–407.
Zhu YG, Zhao Y, Li B, Huang CL, Zhang SY, Yu S, et al. Continental-scale pollution of estuaries with antibiotic resistance genes. Nat Microbiol. 2017;2:16270.
Qu S, Wang L, Lin A, Zhu H, Yuan M. What drives the vegetation restoration in Yangtze River basin, China: climate change or anthropogenic factors? Ecol Indic. 2018;90:438–50.
Liu T, Zhang AN, Wang J, Liu S, Jiang X, Dang C, et al. Integrated biogeography of planktonic and sedimentary bacterial communities in the Yangtze River. Microbiome. 2018;6:16.
Wang J, Liu Q, Zhao X, Borthwick AGL, Liu Y, Chen Q, et al. Molecular biogeography of planktonic and benthic diatoms in the Yangtze River. Microbiome. 2019;7:153.
Wang J, Chen Y, Cai P, Gao Q, Zhong H, Sun W, et al. Impacts of municipal wastewater treatment plant discharge on microbial community structure and function of the receiving river in Northwest Tibetan Plateau. J Hazard Mater. 2022;423:127170.
Liu YX, Xu XM, Wang T, Ni JR. Microscopic view of phytoplankton along the Yangtze River. Sci China Technol Sci. 2019;62:1873–84.
Patel RK, Jain M. NGS QC toolkit: a toolkit for quality control of next generation sequencing data. PLoS One. 2012;7:e30619.
Peng Y, Leung HCM, Yiu SM, Chin FYL. IDBA-UD: a de novo assembler for single-cell and metagenomic sequencing data with highly uneven depth. Bioinformatics. 2012;28:1420–8.
Zhu W, Lomsadze A, Borodovsky M. Ab initio gene identification in metagenomic sequences. Nucleic Acids Res. 2010;38:e132.
Chen B, Yuan K, Chen X, Yang Y, Zhang T, Wang Y, et al. Metagenomic analysis revealing antibiotic resistance genes (ARGs) and their genetic compartments in the Tibetan environment. Environ Sci Technol. 2016;50:6670–9.
Yang Y, Jiang X-T, Zhang T. Evaluation of a hybrid approach using UBLAST and BLASTX for metagenomic sequences annotation of specific functional genes. PLoS One. 2014;9:e110947.
Arango-Argoty GA, Garner E, Pruden A, Heath LS, Vikesland P, Zhang L. DeepARG: a deep learning approach for predicting antibiotic resistance genes from metagenomic data. Microbiome. 2018;6:23.
Li B, Yang Y, Ma L, Ju F, Guo F, Tiedje JM, et al. Metagenomic and network analysis reveal wide distribution and co-occurrence of environmental antibiotic resistance genes. ISME J. 2015;9:2490–502.
DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 2006;72:5069–72.
Ma L, Xia Y, Li B, Yang Y, Li LG, Tiedje JM, et al. Metagenomic assembly reveals hosts of antibiotic resistance genes and the shared resistome in pig, chicken, and human feces. Environ Sci Technol. 2016;50:420–7.
Huson DH, Beier S, Flade I, Górska A, El-Hadidi M, Mitra S, et al. MEGAN Community Edition - interactive exploration and analysis of large-scale microbiome sequencing data. PLoS Comput Biol. 2016;12:e1004957.
Li B, Ju F, Cai L, Zhang T. Profile and fate of bacterial pathogens in sewage treatment plants revealed by high-throughput metagenomic approach. Environ Sci Technol. 2015;49:10492–502.
Chen L, Xiong Z, Sun L, Yang J, Jin Q. VFDB 2012 update: toward the genetic diversity and molecular evolution of bacterial virulence factors. Nucleic Acids Res. 2012;40:641–5.
Forsberg KJ, Patel S, Gibson MK, Lauber CL, Knight R, Fierer N, et al. Bacterial phylogeny structures soil resistomes across habitats. Nature. 2014;509:612–6.
Zhao R, Yu K, Zhang J, Zhang G, Huang J, Ma L, et al. Deciphering the mobility and bacterial hosts of antibiotic resistance genes under antibiotic selection pressure by metagenomic assembly and binning approaches. Water Res. 2020;186:116318.
Uritskiy GV, DiRuggiero J, Taylor J. MetaWRAP - a flexible pipeline for genome-resolved metagenomic data analysis. Microbiome. 2018;6:158.
Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25:1043–55.
Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, et al. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018;36:996.
Parks DH, Rinke C, Chuvochina M, Chaumeil PA, Woodcroft BJ, Evans PN, et al. Recovery of nearly 8,000 metagenome-assembled genomes substantially expands the tree of life. Nat Microbiol. 2017;2:1533–42.
Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12:R60.
Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FDFD, Costello EKEK, et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 2010;7:335–6.
Sloan WT, Lunn M, Woodcock S, Head IM, Nee S, Curtis TP. Quantifying the roles of immigration and chance in shaping prokaryote community structure. Environ Microbiol. 2006;8:732–40.
Borcard D, Legendre P. All-scale spatial analysis of ecological data by means of principal coordinates of neighbour matrices. Ecol Model. 2002;153:51–68.
Information M. Using PLS path modeling for assessing hierarchical construct models: guidelines and empirical illustration. MIS Q Manag Inf Syst. 2009;33:177–95.
Qiao L, Liu X, Zhang S, Zhang L, Li X, Hu X, et al. Distribution of the microbial community and antibiotic resistance genes in farmland surrounding gold tailings: a metagenomics approach. Sci Total Environ. 2021;779:146502.
Kumar A, Schweizer HP. Bacterial resistance to antibiotics: active efflux and reduced uptake. Adv Drug Deliv Rev. 2005;57:1486–513.
Yang Y, Li B, Zou S, Fang HHP, Zhang T. Fate of antibiotic resistance genes in sewage treatment plant revealed by metagenomic approach. Water Res. 2014;62:97–106.
Guo Y, Liu M, Liu L, Liu X, Chen H, Yang J. The antibiotic resistome of free-living and particle-attached bacteria under a reservoir cyanobacterial bloom. Environ Int. 2018;117:107–15.
Liu X, Yang S, Wang Y, Zhao HP, Song L. Metagenomic analysis of antibiotic resistance genes (ARGs) during refuse decomposition. Sci Total Environ. 2018;634:1231–7.
Dcosta VM, King CE, Kalan L, Morar M, Sung WWL, Schwarz C, et al. Antibiotic resistance is ancient. Nature. 2011;477:457–61.
Goethem MW, Pierneef R, Bezuidt OKI, Van De Peer Y, Cowan DA, Makhalanyane TP. A reservoir of “historical” antibiotic resistance genes in remote pristine Antarctic soils. Microbiome. 2018;6:40.
Chen Y, Li P, Huang Y, Yu K, Chen H, Cui K, et al. Environmental media exert a bottleneck in driving the dynamics of antibiotic resistance genes in modern aquatic environment. Water Res. 2019;162:127–38.
Meneghine AK, Nielsen S, Varani AM, Thomas T, Alves LMC. Metagenomic analysis of soil and freshwater from zoo agricultural area with organic fertilization. PLoS One. 2017;12:e0190178.
Flemming L, Rawlings D, Chenia H. Phenotypic and molecular characterisation of fish-borne Flavobacterium johnsoniae-like isolates from aquaculture systems in South Africa. Res Microbiol. 2007;158:18–30.
Huang S, Chen C, Jaffé PR. Seasonal distribution of nitrifiers and denitrifiers in urban river sediments affected by agricultural activities. Sci Total Environ. 2018;642:1282–91.
Cleaver AA, Burton NP, Norris PR. A novel Acidimicrobium species in continuous cultures of moderately thermophilic, mineral-sulfide-oxidizing acidophiles. Appl Environ Microbiol. 2007;73:4294–9.
Sofo A, Mininni AN, Fausto C, Scagliola M, Crecchio C, Xiloyannis C, et al. Evaluation of the possible persistence of potential human pathogenic bacteria in olive orchards irrigated with treated urban wastewater. Sci Total Environ. 2019;658:763–7.
Faden M. Diverse antibiotic resistance genes in dairy cow manure. MBio. 2014;5:e01017–3.
Li W, Mao F, Ng C, Jong MC, Goh SG, Charles FR, et al. Population-based variations of a core resistome revealed by urban sewage metagenome surveillance. Environ Int. 2022;163:107185.
Zhang H, Zhang Z, Song J, Cai L, Yu Y, Fang H. Foam shares antibiotic resistomes and bacterial pathogens with activated sludge in wastewater treatment plants. J Hazard Mater. 2021;408:124855.
Spížek J, Řezanka T. Lincosamides: chemical structure, biosynthesis, mechanism of action, resistance, and applications. Biochem Pharmacol. 2017;133:20–8.
Coque TM, Singh KV, Weinstock GM, Murray BE. Characterization of dihydrofolate reductase genes from trimethoprim- susceptible and trimethoprim-resistant strains of Enterococcus faecalis. Antimicrob Agents Chemother. 1999;43:141–7.
Jia S, Wu J, Ye L, Zhao F, Li T, Zhang XX. Metagenomic assembly provides a deep insight into the antibiotic resistome alteration induced by drinking water chlorination and its correlations with bacterial host changes. J Hazard Mater. 2019;379:120841.
Miller SI. Antibiotic resistance and regulation of the Gram-negative bacterial outer membrane barrier by host innate immune molecules. MBio. 2016;7:e01541–16.
Guo X, Liu X, Niu Z, Lu D, Zhao S, Li SX, et al. Seasonal and spatial distribution of antibiotic resistance genes in the sediments along the Yangtze Estuary, China. Environ Pollut. 2018;242:576–84.
Czekalski N, Sigdel R, Birtel J, Matthews B, Bürgmann H. Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes. Environ Int. 2015;81:45–55.
Beattie RE, Walsh M, Cruz MC, McAliley LR, Dodgen L, Zheng W, et al. Agricultural contamination impacts antibiotic resistance gene abundances in river bed sediment temporally. FEMS Microbiol Ecol. 2018;94:fiy131.
Yang Y, Liu G, Ye C, Liu W. Bacterial community and climate change implication affected the diversity and abundance of antibiotic resistance genes in wetlands on the Qinghai-Tibetan Plateau. J Hazard Mater. 2019;361:283–93.
Zhou Y, Niu L, Zhu S, Lu H, Liu W. Occurrence, abundance, and distribution of sulfonamide and tetracycline resistance genes in agricultural soils across China. Sci Total Environ. 2017;599–600:1977–83.
Yan Z-Z, Chen Q-L, Li C-Y, Thi Nguyen B-A, Zhu Y-G, He J-Z, et al. Biotic and abiotic factors distinctly drive contrasting biogeographic patterns between phyllosphere and soil resistomes in natural ecosystems. ISME Commun. 2021;1:13.
Song M, Song D, Jiang L, Zhang D, Sun Y, Chen G, et al. Large-scale biogeographical patterns of antibiotic resistome in the forest soils across China. J Hazard Mater. 2021;403:123990.
Vannote RL, Minshall GW, Cummins KW, Sedell JR, Cushing CE. The river continuum concept. Can J Fish Aquat Sci. 1980;37:130–7.
Hsu JT, Chen CY, Young CW, Chao WL, Li MH, Liu YH, et al. Prevalence of sulfonamide-resistant bacteria, resistance genes and integron-associated horizontal gene transfer in natural water bodies and soils adjacent to a swine feedlot in northern Taiwan. J Hazard Mater. 2014;277:34–43.
Ham YS, Kobori H, Kang JH, Matsuzaki T, Iino M, Nomura H. Distribution of antibiotic resistance in urban watershed in Japan. Environ Pollut. 2012;162:98–103.
Ding X, Liu L. Long-term effects of anthropogenic factors on nonpoint source pollution in the upper reaches of the Yangtze river. Sustain. 2019;11:2246.
Lee S, Suits M, Wituszynski D, Winston R, Martin J, Lee J. Residential urban stormwater runoff: a comprehensive profile of microbiome and antibiotic resistance. Sci Total Environ. 2020;723:138033.
Zheng D, Yin G, Liu M, Chen C, Jiang Y, Hou L, et al. A systematic review of antibiotics and antibiotic resistance genes in estuarine and coastal environments. Sci Total Environ. 2021;777:146009.
Mori J, Smith R. Transmission of waterborne fish and plant pathogens in aquaponics and their control with physical disinfection and filtration: a systematized review. Aquaculture. 2019;504:380–95.
Support from Majorbio Company (Shanghai, China) is gratefully acknowledged.
Financial support was provided by the National Natural Science Foundation of China (Grant No. 51721006 and U2240205) and the China Postdoctoral Science Foundation (Grant No. 2020M680243).
Ethics approval and consent to participate
Consent for publication
The authors declare that they have no competing interests.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
. Map of sampling sites in the Yangtze River covering the actual sinuous channel reach of length 4,300 km (equivalent to 2.05 times the 2,102 km straight line joining the start to end sampling sites). Figure S2. Venn diagrams showing unique and shared numbers of ARG types (a) and subtypes (b) among the water-spring (WS), water-autumn (WA), sediment-spring (SS), and sediment-autumn (SA) samples in the Yangtze River. Principal coordinates analysis (PCoA) diagrams showing the compositional dissimilarity of ARG type (c) and subtypes (d) in the Yangtze River. Analysis of similarity statistics (ANOSIM) displaying the dissimilarities of ARG subtypes in water (e) and sediment (f) between different seasons. Figure S3. Richness (a) and Shannon diversity (b) of ARG subtypes in each sample group of the Yangtze River. ARG types exhibiting significant seasonal differences in water (c) and sediment (d). Figure S4. (a) Principal coordinates analysis (PCoA) showing compositional dissimilarities (Bray-Curtis) of ARG hosts (at the species level) in the four sample groups of the Yangtze River. (b-d) ANOSIM statistics concerning differences in ARG hosts within and between sample groups. Figure S5. Richness (a) and Shannon diversity (b) of ARG hosts in each sample group of the Yangtze River. ARG hosts (at the species level) exhibiting significant seasonal differences in water (c) and sediment (d). Figure S6. (a) Distribution of MGEs co-existing with ARGs across four sampling groups. (b) Distribution of various types of MGEs (co-occurring with ARGs) across four sampling groups. Figure S7. Procrustes analysis depicting correlations between ARG subtypes and ARG hosts in water (a) and sediment (b). Solid and hollow circles represent ARGs and hosts, respectively. Figure S8. Relationships between ARG hosts at the phylum level (inner circle) and ARG types (outer circle) in water-spring (a), water-autumn (b), sediment-spring (c), and sediment-autumn samples (d). Figure S9. Networks displaying ARG hosts carrying multiple ARGs in water-spring (a), water-autumn (b), sediment-spring (c), and sediment-autumn samples (d) of the Yangtze River. The sizes of nodes correspond to the connection degree. Figure S10. Networks displaying HPB carrying multiple ARGs in water-spring (a), water-autumn (b), sediment-spring (c), and sediment-autumn samples (d) of the Yangtze River. The sizes of nodes correspond to the connection degree. Figure S11. Distance-decay relationships of Bray-Curtis similarity of sedimentary ARGs in spring (a) and autumn (b), hosts in spring (c) and autumn (d), and HPB with the geographical distance in spring (e) and autumn (f). Mantel-Spearman correlations (r) and probabilities (significance codes: ***≤ 0.001 **≤ 0.01 *≤ 0.05) are provided. Solid lines indicate the ordinary least squares linear regression across all samples. Slopes of regression lines are also provided. Figure S12. (a) Abundance (copy of ARG per copy of 16S-rRNA gene) and (b) richness of planktonic and sedimentary ARG subtypes in mainstream and seven tributaries (DTH: Dongtinghu, HBH: Huangbohe, HJ: Hanjiang, JLJ: Jialingjiang, MJ: Minjiang, PYH: Poyanghu, and WJ: Wujiang) along the Yangtze River. WS, WA, SS, and SA refer to water-spring, water-autumn, sediment-spring, and sediment-autumn samples, respectively. Figure S13. (a) Abundance (copy of ARG per copy of 16S-rRNA gene) and (b) richness of planktonic and sedimentary ARG types in mainstream and seven tributaries (DTH: Dongtinghu, HBH: Huangbohe, HJ: Hanjiang, JLJ: Jialingjiang, MJ: Minjiang, PYH: Poyanghu, and WJ: Wujiang) along the Yangtze River. WS, WA, SS, and SA refer to water-spring, water-autumn, sediment-spring, and sediment-autumn samples, respectively. Figure S14. (a) Abundance (coverage/Gb) and (b) richness of planktonic and sedimentary ARG hosts in mainstream and seven tributaries (DTH: Dongtinghu, HBH: Huangbohe, HJ: Hanjiang, JLJ: Jialingjiang, MJ: Minjiang, PYH: Poyanghu, and WJ: Wujiang) along the Yangtze River. WS, WA, SS, and SA refer to water-spring, water-autumn, sediment-spring, and sediment-autumn samples, respectively. Figure S15. (a) Abundance (coverage/Gb) and (b) richness of planktonic and sedimentary HPB in mainstream and seven tributaries (DTH: Dongtinghu, HBH: Huangbohe, HJ: Hanjiang, JLJ: Jialingjiang, MJ: Minjiang, PYH: Poyanghu, and WJ: Wujiang) along the Yangtze River. (c) Abundance (coverage/Gb) of planktonic and sedimentary supercarriers in mainstream and seven tributaries. WS, WA, SS, and SA refer to water-spring, water-autumn, sediment-spring, and sediment-autumn samples, respectively. Figure S16. LEfSe cladogram depicting the taxonomic differences of ARG hosts in water (a) and sediment (b) in spring for four landform types. Differentially abundant taxa (biomarkers) are colored according to their most abundant landform habitats. Figure S17. ARG types (water-spring group) exhibiting significant differences among four landform types along the Yangtze River. Figure S18. Occurrence frequency of sedimentary ARG subtypes in spring (a) and autumn (b) as well as hosts in spring (c) and autumn (d) fitted to mean relative abundance using Sloan et al.’s neutral community model. Inserts in (a-b) and (c-d) show the neutral community model fits to ARG type and HPB. Purple and green dots indicate ARGs/hosts that occur more (‘Above’) and less (‘Below’) frequently than given by the neutral model (gray dots, ‘Neutral’). R2 indicates the fit to the neutral community model, and m indicates the immigration rate. Dashed lines represent 95% confidence intervals about the model prediction. Figure S19. Distribution of occurrence frequency (a) and mean relative abundance (b) of ARGs in different sampling groups. ‘Above’ and ‘Below’ indicate ARGs that occur more and less frequently than given by the neutral model (‘Neutral’). Figure S20. The partial least squares path models showing the effects of spatial variables, anthropogenic variables, physicochemical variables, antibiotics, MGEs, and ARG hosts on ARG compositions in water (a) and sediment (b) of the Yangtze River. Solid and dashed lines indicate positive and negative effects, respectively. Numbers adjacent to each arrow denote partial correlation coefficients (significance codes: ***≤ 0.001 **≤ 0.01 *≤ 0.05). R2 values display the proportion of variance explained for each factor. The bar-chart showing the standardized total effect of each factor on the ARG composition in water (c) and sediment (d). Figure S21. Spearman’s correlations (R) between the richness of ARG host and ARGs in water (a) and sediment (b), and between the richness of HPB and the richness of ARGs in water (c) and sediment (d). Ordinary least square linear regressions and 95% confidence intervals are also displayed.
. Detailed information on the 219 samples. Table S2. The averaged concentrations of antibiotics measured from four representative sampling groups of the Yangtze River. Table S3. Statistics of raw reads and clean reads in each metagenomic dataset. Table S4. The list of Human Pathogen Bacteria (HPB) identified in the Yangtze River. Table S5. Spearman’s correlations between ARGs, ARG hosts, and mobile genetic elements (MGEs) in the Yangtze River. WS, WA, SS, and SA refer to water-spring, water-autumn, sediment-spring, and sediment-autumn samples. Table S6. Detailed information of retrieved MAGs carrying ARGs in the Yangtze River.
About this article
Cite this article
Wang, J., Pan, R., Dong, P. et al. Supercarriers of antibiotic resistome in a world’s large river. Microbiome 10, 111 (2022). https://doi.org/10.1186/s40168-022-01294-z
- Antibiotic resistance genes
- Human pathogen bacteria
- Yangtze River | <urn:uuid:41238ddc-d00b-4f92-a581-068d0fc306a3> | CC-MAIN-2022-33 | https://microbiomejournal.biomedcentral.com/articles/10.1186/s40168-022-01294-z | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.883834 | 18,690 | 2.609375 | 3 |
A document can be attested from the Ministry only if it is required to be attested for a particular purpose.
Document to be attested should be submitted to the Ministry of Foreign Affairs with a covering letter (detailing the reason for attestation and along with contact number).
If the submitted document does not meet the criteria for attestation, the application will not be accepted.
Once the application is accepted, the Ministry will notify the date and time of collection.
As a policy, the Ministry does not “Attest” Power of Attorneys (PoA) as the Ministry cannot verify the information provided by the party / parties. However, if the PoA has been registered at a relevant Court with the original stamp and an authorized signature then it can be attested.
In addition, Maldivian students who have returned to Maldives and require another person to retrieve their final results from the educational Institution may submit their PoA for attestation.
The Ministry does not “Attest” documents containing only the lawyer’s stamp and signature. If the document has the original stamp of the concerned Government authority / State Institute with the name, designation and the signature of an authorized official, such a document may be attested.
An English document should contain an English stamp and vise versa.
As a policy, the Ministry does not attest original certificates. However, if a photocopy of the certificate which contains the original stamp, name, designation and signature of an authorized official from the issuing authority or of the Maldives Qualification Authority is submitted, the Ministry can affix the stamp of “True Copy of the Original” on the photocopy.
However, original documents issued from the Government authorities and State Institutes such as “To Whom It May Concern” or “Police Clearance” can be stamped “Attested/Authentic”.
Photocopy of a document other than a certificate can be stamped as a “True Copy of the Original” only if that document contains the original stamp, name, designation and signature of an authorized official from the issuing authority.
Documents submitted by the private companies can be stamped as “True Copy of the Original” only if that document has the stamp from a relevant Government authority or a State Institute.
All attested documents will be returned within 2 working days between 0900hrs to 1200hrs. | <urn:uuid:9db5c2b3-de69-4c8c-97f9-1b62b1cde0f7> | CC-MAIN-2022-33 | https://www.gov.mv/en/services/documents-attestation-service | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.914512 | 506 | 1.546875 | 2 |
|Publisher:||Faber & Faber|
Eccentricity exists particularly in the English, states Dame Edith Sitwell, because of “that peculiar and satisfactory knowledge of infallibility that is the hallmark and the birthright of the British nation.” Originally published in 1933, The English Eccentrics has lost none of its vitality and wit. We find hermits, quacks, mariners, indefatigable travelers, and men of learning. We meet the amphibious Lord Rokeby, whose beard reached his knees and who seldom left his bath; the irascible Captain Thicknesses, who left his right hand, to be cut off after his death, to his son Lord Audley; and Curricle Coats, the Gifted Amateur, whose suit was sewn with diamonds and whose every performance ended in uproar. This is a glorious gallery of the extremes of human nature, portrayed with humor, sympathy, knowledge, and love.—Goodreads.com. [Suggest a different description.]
Author Bio for Sitwell, Edith
Edith Sitwell (1887-1964)
Dame Edith Louisa Sitwell, was a British poet and critic and the eldest of the three literary Sitwells. Sitwell published poetry continuously from 1913, some of it abstract and set to music. Her early work was often experimental, creating melody, using striking conceits, new rhythms, and confusing private allusions. With her dramatic style and exotic costumes, she was sometimes labelled a poseur, but her work was praised for its solid technique and painstaking craftsmanship.
“Still Falls the Rain” about the London Blitz, remains perhaps her best-known poem set to music by Benjamin Britten. Façade is a series of poems in which the poems are recited over an instrumental accompaniment by William Walton.
Sitwell wrote two books about Queen Elizabeth I of England: Fanfare for Elizabeth (1946) and The Queens and the Hive (1962). She always claimed that she wrote prose simply for money and both these books were extremely successful, as were her English Eccentrics (1933) and Victoria of England (1936).
Robert K. Martin summed up Sitwell’s literary career in Dictionary of Literary Biography: “Sitwell’s reputation has suffered from the exceptional success of Façade, which was often treated as if it were the only work she had ever written. Inadequate attention has been paid to her development as a social poet, as a religious poet, and as a visionary. Her career traces the development of English poetry from the immediate post-World War I period of brightness and jazzy rhythms through the political involvements of the 1930s and the return to spiritual values after World War II. Her technique evolved, and, although she always remained a poet committed to the exploration of sound, she came to use sound patterns as an element in the construction of deep philosophic poems that reflect on her time and on man’s condition. . . . She remains one of the most important voices of twentieth-century English poetry.”
Sources: poetryfoundation.org; britannica.com
|Epub||20200613.epub||If you cannot open a .mobi file on your mobile device, please use .epub with an appropriate eReader.|
|Mobi/Kindle||20200613.mobi||Not all Kindles or Kindle apps open all .mobi files.|
Kindle Direct (New, Experimental)
Send this book direct to your kindle via email. We need your Send-to-Kindle Email address, which can be found by looking in your Kindle device’s Settings page. All kindle email addresses will end in @kindle.com. Note you must add our email server’s address, [email protected], to your Amazon account’s Approved E-mail list. This list may be found on your Amazon account: Your Account→ Manage Your Content and Devices→ Preferences→ Personal Document Settings→ Approved Personal Document E-mail List→ Add a new approved e-mail address.
This book is in the public domain in Canada, and is made available to you DRM-free. You may do whatever you like with this book, but mostly we hope you will read it.
Here at FadedPage and our companion site Distributed Proofreaders Canada, we pride ourselves on producing the best ebooks you can find. Please tell us about any errors you have found in this book, or in the information on this page about this book. | <urn:uuid:9d8e1fc2-5e51-4bf1-a259-0a9c5fad3bbf> | CC-MAIN-2022-33 | https://www.fadedpage.com/showbook.php?pid=20200613 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.934004 | 1,076 | 2.40625 | 2 |
Disclosure: I received this complimentary product through the Homeschool Review Crew.
I like to read from a Bible story book or a children’s devotional every morning as we begin our school day. When the opportunity came up to review Everybody, Always for Kids from Tommy Nelson Publishing, and we were offered a print copy, it was a no-brainer. I wanted this book! I’m enjoying it, and the children seem to be, as well. We haven’t quite finished it, since we’re just reading one chapter a day, but I have liked everything I have seen so far.
Each chapter has a story from Bob Goff’s life, and he works a life lesson in naturally. These lessons are designed to help children learn to love other people. The story we read this morning hit me especially. It was about his son learning to fly, and then to fly seaplanes, and how he landed on a small lake. The takeaway was that when we love someone we let them do what they are doing, without giving constant directions and cautions. That’s something I need to learn with my older children!
A lot of the stories just give practical ways to show love to people around us, like making it possible for everyone, no matter what age, to participate in a race, or ordering cake pops for people you disagree with. There is encouragement to be patient and to be forgiving (even when an expensive vehicle ends up at the bottom of a cliff in the ocean because of someone’s mistake). This is really a book for all ages—not just children.
I really like the feel of this book. It has a very nice hard cover, with thick glossy pages. The pictures are full-color and quite nice, and I like the ribbon marker—it means I don’t have to keep putting the bookmark back after the toddler looks through the book! She often picks it up and studies the pretty pictures when I’m finished reading in the morning. The size is just right, too. It’s just right to hold comfortably. I am a bit disappointed in the ribbon, though. It started fraying almost immediately, and I need to melt the edges with a flame again, for the third time.
There is a five-day lesson plan that goes with Everybody, Always for Kids. I downloaded it to have a look, but we didn’t use it. Each plan gives directions for a craft project to go with one of the stories, in which children are challenged to think of ways to show love to other people. There are also questions to discuss to spark a conversation about the topic, and supplemental activities that you can use to add even more to the experience. In looking it over just now, I noticed that one of the lessons has to do with the chapter about a time capsule. After we read that one, one of my sons made a time capsule and hid it under the house somewhere! So, I guess we did one of the activities, though inadvertantly. | <urn:uuid:c94a058a-35da-43cb-b599-567f64b7af8a> | CC-MAIN-2022-33 | https://lotsofhelpers.com/2021/05/book-review-everybody-always-for-kids/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.976042 | 626 | 1.617188 | 2 |
Fred Flom, a Menasha native who spent more than six years as a POW in Vietnam, dies at 80
Fred Flom, a Menasha native and a pilot who spent more than six years as a prisoner of war in Vietnam, has died.
Flom died June 23, according to his obituary. He was 80 years old.
Flom grew up in Menasha as the youngest of four children. His family lived on Park Street, across from Smith Park. He knew from a young age that he wanted to be a pilot.
“I always wanted to fly," Flom told The Post-Crescent in an interview in 2018.
Flom attended Lawrence University — known as Lawrence College at the time — and graduated in 1963. He was commissioned by the U.S. Air Force and became a fighter pilot.
Flom was 25 years old when, on Aug. 8, 1966, his plane was shot down northeast of Hanoi, then the capital of North Vietnam, and he was captured.
“I don’t even remember ejecting myself," Flom recalled. "The airplane just blew up and I was out in a fireball. The next thing I remember, I had already been captured.”
Flom spent his first two years as a prisoner of war almost entirely in isolation. He only saw the guards who brought him rice and a thin soup. He was able to communicate with other prisoners with a series of taps used to spell words.
Flom was coerced and tortured as a prisoner of war, forced to write a statement apologizing for bombing Vietnam and promising he wouldn't do it again.
“Half of that was true, anyway,” he said. “I knew I wasn’t going to bomb them again.”
Flom was released as part of a ceasefire and, on March 24, 1973, stepped off of a plane at the Outagamie County Airport in front of a crowd of about 4,000 people. He gave his 8-year-old daughter, Julie, a hug and greeted his 6-year-old son, Erik, whom he had never met before.
"I don't feel like a hero," Flom told a reporter that day. "It's difficult to consider myself a hero coming out of a prison camp. I'm just happy to be coming home with honor."
Flom didn't stop flying. He served as a member of the Wisconsin Air National Guard and worked as a commercial pilot for American Airlines for more than two decades.
Flom and his wife, Kay, spent their retirement remodeling a cottage in Wisconsin. He wasn't a trained builder, his obituary says, but had built many structures in his mind to pass his time as a prisoner of war.
Flom was never bitter, despite his experience as a prisoner of war.
"He had a zest for life and was always able to see past differences in search of common ground," his obituary says. "He knew that we all need to commit to something bigger than ourselves." | <urn:uuid:3dfb4d5c-15e4-4604-a2dd-ce3990e775bf> | CC-MAIN-2022-33 | https://www.postcrescent.com/story/news/local/2021/07/06/fred-flom-menasha-native-who-spent-more-than-six-years-pow-dies/7874304002/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.994734 | 637 | 1.765625 | 2 |
After too many years of debate, it appears that Liberia 🇱🇷 will join the various rational African countries & recognize dual citizenship.
And so, after decades of prohibition, the Senate and the House of Representatives have now moved to recognize the holistic potential of the Liberian diaspora and the advantage of granting them the opportunity to hold dual citizenship — albeit with some restrictions to protect the rights of those who do not subscribe to dual citizenship.
The restrictions, according to the lawmakers, strike a compromise between supporting the ambitions of Liberians abroad and resolving the worries of those at home, and it would help reduce popular resentment against dual citizenship stemming from socioeconomic inequities in Liberia. As a result of this balancing, would-be dual citizens are barred from holding crucial posts affecting national security, law enforcement, and the economy, as is the case in many African nations with comparable legislation.Liberian Observer
The soon-to-be law in Liberia 🇱🇷 is very similar to Sierra Leone 🇸🇱 in which dual citizens are barred from positions of power while retaining the advantage of being a citizen elsewhere. Thus far, this law only applies to former citizens, as well as children of Liberian citizens abroad.
Hopefully, Liberia 🇱🇷 will consider mimicking what Sierra Leone 🇸🇱 is doing & expand the law to include those who are related to present-day tribes within the country. Yours truly was able to obtain citizenship in Sierra Leone 🇸🇱 based upon a DNA 🧬 test by African Ancestry (results here), & it would be extraordinary if Liberia 🇱🇷 included Diaspora stolen away centuries ago. | <urn:uuid:fe85f4a6-9b07-4d00-a699-3336639f66e3> | CC-MAIN-2022-33 | https://darnell.tv/2022/07/21/liberia-will-finally-recognize-dual-citizenship/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.96148 | 350 | 2.40625 | 2 |
Hi, If you want to use more than one class in one file, specify the class that you want to give the name same as file name (which contains main()) as public specifier.Give other class names with out public specifier.If you provide public specifier with class name the compiler forces you give only one class in one file. In your example remove public specifier to your MyObject class. Then it will run fine.
The compiler doesnt like it because one file can have only one 'public' class. and the file name should correspond to the public class name. A file may contain any number of classes you want, but only one public class.
yes, you can put the class in another file in the same directory(not going into CLASSPATH yet) and compile them.
make sure you compile your MyObject class before compiling the MyProgram class. Because if the MyObject class is not compiled, the compiler will whine about 'not finding MyObject class'.
matter of 5 mins!!! wow! now this is a popular post!!! [ May 10, 2005: Message edited by: Neeraj Dheer ]
Ok, thanks...say I want to have MyObject in a separate file in the same directory. I compile MyObject.java and then "import MyObject.*;" inside MyProgam.java, correct? [ May 10, 2005: Message edited by: Chris Weathers ]
no. you dont need to do that if MyObject is in the same directory.
when you do
what you are saying is that import ALL classes declared in the package MyObject. in your case, MyObject is a class, not a package, so the import statement is not valid.
if your only concern is using MyObject inside MyProgram, then you dont have to do anything as long as MyObject is in the same directory as MyProgram or, as one of the above posts, somewhere in your CLASSPATH | <urn:uuid:771dfc03-1ef2-4591-9fd1-dd4bd471363a> | CC-MAIN-2022-33 | https://www.coderanch.com/t/399605/java/compile-type-code | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.881366 | 409 | 2.578125 | 3 |
Given that agriculture is Scotland’s main land use, farmers and crofters are key actors in making sure we reach climate change targets, restore nature, and produce food sustainably.
The way we support agriculture tends to fund measures that can damage the environment and nature and doesn’t adequately support those working in a nature-friendly way.
That’s why we welcome recent calls on the Scottish Government from the Just Transition Commission (JTC) to reform future farm support systems and help farmers deliver greater climate action.
To put the urgency of action into context, almost a fifth of Scotland’s emissions come from agriculture and reduction trends are not where they need to be. Until this year, the sector’s emissions had remained static for over a decade and last year a report from WWF Scotland showed that policies currently proposed for agriculture get us less than halfway to where we need to be for Scotland to remain on track to reach net zero.
We also know that our changing climate is already impacting Scottish farming. Research from WWF found that extreme weather in 2017 contributed to losses of up to £161 million for Scotland’s farmers.
With the recent record-breaking temperatures, along with water scarcity and drought warnings, it’s clear that the sector is having to play catch-up to the changing climate, rather than taking proactive measures to drive down emissions.
This all shows that Scotland desperately needs a new and more ambitious system to support farming. The Scottish Government has a once-in-a-lifetime opportunity to reframe how it spends the £500 million that it directs every year to farm subsidies. This funding comes with few strings attached, benefits the most agriculturally productive and intensely farmed areas, and in some cases supports damage to the environment and nature.
We’re supporting Scottish Environment Link’s ‘Farm for Scotland’s Future’ campaign which is calling on the Scottish Government to use its forthcoming Agriculture Bill to develop a rural support system that works for climate, nature, and people.
We agree with the JTC’s calls for an ambitious farm-payment scheme and would like to see a proposed Just Transition Plan for Agriculture brought forward before the introduction of legislation.
This would give businesses and communities the guidance they need to invest in their future and receive the support necessary for the transition to regenerative farming systems while the Scottish Government frames how future support will guarantee reduced emissions, restore nature, and ensure that benefits are more fairly shared.
Scotland has the opportunity to lead the way by creating a system that helps achieve our climate ambitions, as well as people and nature. By using a greater share of public money to support nature and climate-friendly farming practices, we can help biodiversity thrive, lock in carbon and assist climate adaptation. This would also build resilience and bring benefits for farm businesses and rural communities.
Unless we take seriously the pressures that land, nature, and climate are facing now, we will exacerbate problems for future generations of land managers by locking-in increasing problems from pollution and the decline of nature. And without urgent action we will fail to deliver a just transition for farming.
Ruth Taylor, agriculture and land-use policy manager, WWF Scotland | <urn:uuid:b2a8f531-cb79-40d5-87f7-fa6c64500176> | CC-MAIN-2022-33 | https://water.news.energy-water.com/climate-change-farming-subsidies-can-currently-fund-damage-to-nature-and-the-environment-that-needs-to-change-ruth-taylor/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.942825 | 655 | 2.625 | 3 |
Dry Stone Walls Study
Amendment C100 and the Melton Dry Stone Wall Study
Amendment C100 to the Melton Planning Scheme has introduced controls into the Melton Planning Scheme to provide guidance on the protection of Dry Stone Walls. The amendment:
- Applied the Heritage Overlay to 125 dry stone walls across the municipality (located within five precincts, and two individual walls)
- Introduced a new local policy into the Melton Planning Scheme in relation to Dry Stone Walls
- Introduced a new incorporated document titled ‘City of Melton Study, Volume 3 – Statements of Significance, February 2016’
Amendment C100 was informed by the Melton Dry Stone Wall Study, which was adopted by Council in 2011.
The Melton Dry Stone Wall Study:
- documented and assessed all the dry stone walls of the City
- created a new methodology for assessing the significance of the walls
- produced a public sculpture and driving trail and
- recommended planning controls for walls that should be protected.
The City Strategy Department have worked through the recommendations of the study, implemented public education and awareness programs, and mapped the walls on Council’s GIS.
Volume 1 - The Report(PDF, 12MB)
Volume 2 - Citations - Combined(PDF, 28MB)
Volume 3 - Statements of Significance - Combined(PDF, 1MB)
For any further information on the Dry Stone Wall Study or Amendment C100, please contact Council’s City Strategy Unit on 9747 7200 | <urn:uuid:b4178df1-b50c-4dc8-a224-8780c9213067> | CC-MAIN-2022-33 | https://www.melton.vic.gov.au/Services/Building-Planning-Transport/Strategic-Planning/Studies-Strategies-Guidelines/Dry-Stone-Walls-Study | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.896752 | 314 | 2.015625 | 2 |
What characteristics should I look for while purchasing a telescope?
- When it comes to purchasing a telescope, the majority of people want to see the planets. The planets of our solar system are a simple and beautiful object for astronomers to see using a telescope. They are easy to locate in the night sky with the naked eye with the naked eye. You should seek for the brightest stars that are red or yellow in hue if you are a newbie and do not know where to look for them.
- 1 What do you see when looking through a telescope?
- 2 What part of a telescope do you look through?
- 3 What happens when light hits a telescope?
- 4 What can you see with a telescope during the day?
- 5 How do planets look through telescopes?
- 6 What does a telescope eyepiece do?
- 7 Why can I not see through my telescope?
- 8 What is the importance of telescope?
- 9 Why can you see yourself in a mirror but not a wall?
- 10 How does a reflecting telescope magnify?
- 11 What reflecting telescope means?
- 12 Can you see through a telescope during the day?
- 13 Can telescopes see through windows?
- 14 Is it safe to look at the moon with a telescope?
What do you see when looking through a telescope?
The form of the mirror or lens of a telescope is responsible for focusing the light. When we look through a telescope, we see the light that came from the sun. A telescope is a piece of equipment that astronomers use to observe distant things. The majority of telescopes, including all big telescopes, operate by collecting and focusing light from the night sky using curved mirrors.
What part of a telescope do you look through?
TELESCOPE EYEPIECES BARLOWS LENSES UNDERSTANDING TELESCOPE It is the function of an eyepiece to take that focused light and show the resulting image for you to enjoy and appreciate.
What happens when light hits a telescope?
In a Newtonian reflecting telescope, light beams from distant objects impact the concave primary mirror at the same angle since they are practically parallel (due to the fact that they are coming from such a long distance away). The rays are then reflected back up through the telescope tube and toward the focal point of the instrument. After then, the light is focused by the eyepiece lens.
What can you see with a telescope during the day?
The top ten celestial objects to observe during the day
- It’s the sun. Obviously, you can see the sun during the day, but ironically, we’re instructed not to look since it might injure our eyes if we do so. Stars during eclipses. Comets during the daytime. The moon, the planet Venus, and Earth-orbiting satellites are all visible in the sky. The planet Jupiter and the planet Mars are also visible in the sky.
How do planets look through telescopes?
Venus and Mercury will exhibit their phases (a crescent shape) when viewed through a modest telescope, and Venus can even show glimpses of cloud features when viewed through the appropriate filter. Through any telescope, Neptune and Uranus will appear as tiny, featureless disks that are blue or greenish in color.
What does a telescope eyepiece do?
What is the operation of eyepieces? In order to operate, an eyepiece must first catch and concentrate the light acquired and focused by your telescope before enlarging the picture that is viewed by your eye. If you want to obtain a truly nice view of a celestial object, you’ll need the eyepiece to do its job well and efficiently.
Why can I not see through my telescope?
If you are unable to see anything clearly through your telescope at night, you should first try using the scope in the daytime. In a reflector, it is the little tube that protrudes from the side of the telescope, almost at the front end of the telescope. Insert your eyepiece into the tube and tighten the setscrew(s) to ensure that it is held firmly in place.
What is the importance of telescope?
In astronomy, the telescope is without a doubt the most essential investigative instrument available. It provides a technique of collecting and studying radiation emitted by celestial objects, even those located in the furthest reaches of the cosmos.
Why can you see yourself in a mirror but not a wall?
The light that reflects off your body in the daylight travels in all directions. So you can see yourself in the mirror as well as other individuals who look at you. In comparison to the way light reflects off your clothes, the light reflected off the mirror will be more ordered. That is referred to as specular reflection, and it is the polar opposite of diffuse reflection.
How does a reflecting telescope magnify?
In order to produce a picture, the telescope must be pointed at the object and light must enter the tube. The light strikes the primary mirror and is reflected back to the observer by the second mirror. Afterwards, it is reflected from the secondary mirror to the eyepiece, where the picture is amplified and sent to the retina.
What reflecting telescope means?
It is also known as a reflector. A reflecting telescope (also known as a reflector) is an optical instrument that employs one or more curved mirrors to reflect light and create a picture. Despite the fact that reflecting telescopes cause various sorts of optical aberrations, their design allows for the use of objectives with extremely large diameters.
Can you see through a telescope during the day?
Anything may be observed safely throughout the day, provided the telescope is not pointed too close to the Sun, which is not recommended. You’ll be alright as long as you remain out of the sunlight. Make sure you don’t accidently swing the tube in the direction of the Sun while doing this.
Can telescopes see through windows?
By looking through the panes, it gives the idea that the telescope will be utilized to see anything. But, for the time being, Hollywood has had enough of creating false notions. The reality of the matter is that staring through your telescope through a window, whether open or closed, is just not a smart idea.
Is it safe to look at the moon with a telescope?
Yes, it is correct. When compared to the intensity of the sun’s light, the light reflected off the moon’s surface has a very low degree of intensity. Consequently, staring at a full moon has no risk of causing damage to your eyesight. If you look through a moderately powered telescope at the full moon, the brightness of the moon will almost likely cause your eyes to become dizzy. | <urn:uuid:4dca0e03-d75f-45a1-8be7-013200abbdba> | CC-MAIN-2022-33 | https://www.amazingtelescopes.com/recommendations/when-looking-through-a-telescope-one-would-experience-best-solution.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.945928 | 1,401 | 3.1875 | 3 |
When U.S. House Judiciary Committee Chairman John Conyers needed an expert to persuade Congress to support his anti-hate crime bill, he knew exactly where to turn. He called Jack McDevitt, associate dean of Northeastern University’s College of Criminal Justice.
Last month, McDevitt testified before the House Judiciary Committee in support of legislation that would greatly expand the reach of federal law to address hate crimes. His depth of knowledge of hate crime statistics and ability to refute criticism with facts helped Conyers’ legislation, also known as H.R. 1592, gain passage by a vote of 237 to 180.
McDevitt was recently contacted by Senator Edward Kennedy’s office to help draft the Senate version of the bill, drawing upon decades of experience at Northeastern, having co-authored two books with sociologist Jack Levin and conducted numerous studies on hate crime, including a government report on improving hate crime analysis, released by the White House in 2000.
The bill would serve a three-fold purpose. First, it would allow federal government to assist local law enforcement with hate crime investigations, via grant funding and manpower. Second, it would remove current limits that allow federal involvement only if crimes occur while victims are engaged in federally-protected activities, such as voting and going to school.
Third – and a source of major controversy – the bill would expand the reach of federal law to prosecute crimes motivated by bias against gender, gender identity, sexual orientation, and disability. This function has sparked heated opposition from political pundits and spiritual leaders who decry the bill as a threat to free speech. Their concern is that pastors who speak against homosexuality in houses of worship would face prosecution under H.R. 1592.
Not so, says McDevitt, who hopes opposing sides will come to an understanding that the bill exists to improve the lives of all hate crimes victims, without threatening Constitutional rights.
“Despite claims by those opposing the bill, its language clearly limits federal prosecution to violent crimes, not verbal articulation of religious beliefs,” explains McDevitt. “We are all entitled to our beliefs. We are not entitled, however, to cruel, physical attacks motivated by bigotry and hatred, which terrorize law-abiding citizens, and divide our communities.”
As he continues to work with Congress on preparing the Senate bill for consideration, McDevitt understands the challenges that lie ahead. The White House has indicated opposition to the legislation, which is expected to go before the Senate sometime this spring. Therefore, the bill’s success will depend largely on support from a wide range of groups concerned with civil rights, including the Anti-Defamation League, which has coordinated efforts to push the bill this far, and citizens across the country, who will contact their legislators to demonstrate support.
“If members of certain groups are afraid to move into or drive through a particular community for fear of attack, America is weaker for it,” states McDevitt, reflecting words from his testimony. “H.R. 1592 is a vital next step in sending the message that Americans will not tolerate hate-motivated violence to be perpetrated on members of our society.”
For more information on McDevitt’s work on this legislation, please feel free to contact John Natale at 617-373-2802 or email@example.com.
About Northeastern: Founded in 1898, Northeastern University is a private research university located in the heart of Boston. Northeastern is a leader in interdisciplinary research, urban engagement, and the integration of classroom learning with real-world experience. The university’s distinctive cooperative education program, where students alternate semesters of full-time study with semesters of paid work in fields relevant to their professional interests and major, is one of the largest and most innovative in the world. The University offers a comprehensive range of undergraduate and graduate programs leading to degrees through the doctorate in six undergraduate colleges, eight graduate schools, and two part-time divisions. For more information, please visit www.northeastern.edu. | <urn:uuid:53a07776-69b0-4652-8de2-e86b4c73a58a> | CC-MAIN-2022-33 | https://news.northeastern.edu/2007/05/17/mcdevitt/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.95946 | 843 | 2.109375 | 2 |
Africa: A Burgeoning Region for Tech Growth
A digital revolution is taking place in Africa. 2021 has been a big year for technology – and specifically fintech – in the innovative continent. Start-ups are building out their solutions, expanding into new markets and raising millions of pounds in capital.
Fintech unicorns have been a long time in the making in Africa. In 2016, Jumia became the continent’s first billion-dollar technology company after it was founded in 2012. Thereafter, the amount of investment obtained by African start-ups quadrupled in 2018. While the pace of growth hasn’t continued to snowball at such a rate, there is a huge acceleration in the market and an increasing maturity of the fintech ecosystem throughout the continent.
Africa has seen a huge increase in mobile payments. Vodafone’s M-Pesa system, a mobile phone-based money transfer and microfinancing service, dominates the African fintech scene with over 50 million subscribers. As Africa’s second-largest mobile network provider after MTN, the company provides payments services. According to Global System for Mobile Communications, by the end of 2020, there were more than 160 million monthly active accounts for mobile payments in Africa, an increase of 18% over the previous year, marking a lucrative opportunity for fintechs in the region.
Despite the setbacks of the global health crisis, Africa’s VC ecosystem is brimming with potential, and there is a wave of optimism around the first four African start-ups to hit a $1 billion valuation. Many African countries have also accelerated their digital transformation and telecom giants are building new networks and streamlining existing facilities to speed up connectivity and improve internet and wireless services. Filling a gap in the market, the number of fintech start-ups active in Africa increased by 89.4% between 2017 and 2021.
“Despite a dip in investments in 2020 due to the COVID-19 pandemic, the continent’s start-up scene reportedly ended the year between $1.3 billion and $1.4 billion in investments.”
OPay, a Nigerian fintech startup, which attracted investment from Beijing Kunlun Technology, reported a steady monthly growth of 10% in mobile payments during the pandemic. The most recent example of start-up success in Africa is OPay’s Series C fundraise of $400m in a round led by Softbank at a valuation of $2bn. Following Nigeria-based Flutterwave’s $170m Series C funding round earlier in 2021, OPay now joins the exclusive cohort of African unicorns which includes Fawry, Interswitch and Jumia. Opay and Wave are just two among many companies behind sub-Saharan Africa’s mobile money push, underpinning an ecosystem that generates $13 billion a month in transaction value, the most of any region worldwide.
Technology for technology sake is not always for global benefit. However, in international trade, with complexity of supply chains technology is facilitating financial inclusion, connectivity of disparate markets, faster client engagement, transparency in dealings and building trust. Underpinned by free trade agreements, across Africa, India and Asia, companies and individuals can now take further advantage of rapid advances in technology.
From legacy 2G and 3G telephone networks to data enabling 5G, use of cost-effective mobile technology to power consumer banking and more efficient processes and supply channels, blockchain and Ai technology are available now, providing solid technological foundations to ensure the continent completes effectively on the world stage. Euro Exim Bank, through adoption of these technologies, with representation in over 100 countries across the globe are positioned to assist trade for SME’s and Corporates, the key contributors of economic growth.
In March, Flutterwave raised its $170m unicorn round. It’s been a busy year for Flutterwave, as it pursues an aggressive expansion strategy geared toward cementing its place as the leading pan-African payments technology company. The Silicon Valley-based start-up announced that it has acquired Disha, a Nigerian platform, that allows digital creators to curate and receive payments from their content and portfolios worldwide. Most recently, Chipper Cash raised $100m. The ‘Big Four’ of Africa – Nigeria, Kenya, South Africa and Egypt – have retained their prominence as key investment destinations, accounting for 80% of all start-up funding. Nigeria and South Africa alone contribute to 56% of these nations’ funding.
Despite a dip in investments in 2020 due to the COVID-19 pandemic, the continent’s start-up scene reportedly ended the year between $1.3 billion and $1.4 billion in investments. Investments have picked up again in 2021. Reports show that in the first half of 2021, African start-ups have managed to raise between $956.2 million and $1.19 billion. Financing for African companies increased significantly from January to March before declining in April. Investments increased from $78 million in April to $208.5 million in May, indicating a resumption of growth.
And this growth is poised to continue. As worldwide lockdowns lift, things are perking up. As vaccination rates rise across Africa and economies stabilize, investments in African start-ups are seeing a rise as well. Africa’s fast-growing but under-banked population has financial services companies eyeing big opportunities on the continent, and with the African Continental Free Trade Area (AfCFTA) now in effect, the eyes of the world are on the continent. AfCFTA is unlocking significant growth opportunities and acting as an impetus for African governments to address their infrastructure needs as well as to overhaul regulations relating to tariffs, bilateral trade, cross-border initiatives and capital flows.
This impressive growth story is taking place continent-wide, and the variety of services being offered by these start-ups is on the rise. Fintech investors are flocking to the continent, putting their faith in the area’s best and brightest minds to tackle the region’s most challenging financial problems more effectively than traditional financial institutions.
See how Euro Exim Bank can support your growth
For more details www.euroeximbank.com | <urn:uuid:8ae4fca3-7f6b-4471-8d6b-1e38500cc543> | CC-MAIN-2022-33 | https://neweuropeaneconomy.com/cover-story/africa-a-burgeoning-region-for-tech-growth/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.944607 | 1,293 | 1.570313 | 2 |
Not since September 1642, when a mob of Parliamentary soldiers opened fire on the sculpture of the Virgin Mary carved into the side of the University Church, has Oxford been in such a fury over statues. The ‘Rhodes must fall’ campaign that started among radical students in 2016 has now spread to the senior common rooms, particularly the SCR of Worcester College which, astonishingly, has taken over from Balliol and Wadham as the headquarters of the workers’ revolution. More than 150 academics have signed a petition calling for their fellow dons to maintain a virtual picket line around Oriel College — that is, to refuse to teach its students or attend its seminars or help with its outreach programmes — as long as the statue of Rhodes remains in its imperial eyrie on the opposite side of the High Street from the sculpture of the Virgin Mary.
I’m not alone in feeling a certain unease about the neo-Puritan call for tearing down statues, let alone punishing Oriel students who have no say over whether the statue stays or goes. It’s not just that Rhodes is a complicated man whose name is plastered all over the university. Or that almost every-body from the dark ages before 1960 is implicated in attitudes that we now find repugnant. ‘Use every man after his desert,’ as Shakespeare put it in Hamlet, ‘and who should ’scape whipping?’ Certainly not Lord Clarendon, Lord Leverhulme or Augustus Pitt Rivers and endless other university benefactors. My basic objection is that it is surely better to erect new statues of our own to celebrate contemporary values rather than to tear down old statues and the memories that they entomb. Tearing down statues may produce a brief paroxysm of righteousness but then leaves nothing but emptiness in its wake. Erecting new statues can instil hope in the next generation.
London’s mayor, Sadiq Khan, has established a commission on diversity in the public realm to tackle this issue. Why don’t Oxford University’s magnificos do likewise? A good person to start with as a candidate for statuary would be Benjamin Jowett — the great 19th-century Master of Balliol and the subject of one of the most Oxonian of Oxonian bits of doggerel (‘Here come I, my name is Jowett / All there is to know I know it / I am the Master of this College / What I don’t know isn’t knowledge’). True, Balliol has a marble bust of the great man hidden away on its premises. But what is needed is an edgy new statue right in the heart of the public realm: ideally, on the pavement outside Balliol that he trod for so many decades.
Jowett has perfect establishment credentials for a public memorial. He transformed Balliol from one college among many into the university’s premier powerhouse of intellectual excellence and public service. He did this by using two revolutionary tools: open competition and high moral seriousness. College places were awarded on the basis of academic merit as revealed by open examinations rather than given away on the basis of family connections. Tutors were expected to devote themselves to their pupils rather than to the bottle. And Balliol men were expected to work hard for their privileges: Jowett’s pupils included a future prime minister, Herbert Asquith; a future archbishop of Canterbury, Cosmo Gordon Lang; and a future viceroy of India, Lord Curzon.
Nor was Jowett just a valet to the offspring of the elite: he was also keen on recruiting bright children from obscure backgrounds, even taking the 11-year-old Frank Fletcher under his wing, paying for his education and acting as his mentor at Balliol. Jowett’s principles eventually spread to the rest of the university, taking an institution that could easily have degenerated into a nest of sinecures and transforming it into a progenitor of Nobel prize winners and social reformers.
Yet there is also another side to Jowett that clinches his case for a new public statue: the preponderance of evidence suggesting that he was Oxford’s first (and at the moment probably only) intersex college head. I was first alerted to this possibility when I was a young Fellow of All Souls in the 1980s by an ancient college fixture called E.B. ‘Henry’ Ford, a distinguished geneticist who had an odd habit (among many odd habits) of talking about figures from the Victorian and Edwardian era as if they were contemporaries. Did I know that the Dean (Inge) had a tail (or coccygeal projection as it is more formally known)? Or that the warden of New College’s spoonerisms were genetically linked to the fact that he was an albino? His favourite subject was Benjamin Jowett on the grounds that ‘everybody knew’ that the celebrated Master of Balliol was a ‘hermaphrodite’, as he called it. He even claimed to know for a fact that Jowett’s relationship with Florence Nightingale had proceeded to a point where the Master of Balliol’s ‘anatomical configuration’ led them to call off plans for marriage.
I had always dismissed this as just another of Ford’s oddities: in an institution that had many eccentrics, Ford towered above them all. But in researching my latest book I repeatedly came across evidence that suggested that he was on to something. The United Nations High Commissioner for Human Rights defines intersex people as individuals who ‘do not fit the typical definitions of male or female bodies’: that is, they are born with atypical variations in their chromosomes, sex hormones or genitals. Estimates of the number of births with ambiguous genitals ranges from just 0.018 per cent to 1.7 per cent, and ambiguity covers a wide range of possibilities. Intersex people have traditionally been hidden from history — classified as one gender or another at birth and expected to go through life as their assigned sex. But they are finally coming into the open, either shifting their gender identity as they grow older to one with which they feel more comfortable or else identifying themselves as ‘middlesex’.
Geoffrey Faber’s standard biography of Jowett is full of striking snippets. Jowett’s father’s family had a long history of high-pitched voices and involuntary celibacy. As a boy, Jowett looked so much like a girl— pretty, gentle and delicate — that his fellow pupils at St Paul’s nicknamed him ‘Miss Jowett’ and protected him from bullying in much the same way that they would protect a sister. His voice never broke and hairs refused to sprout on his chin. As an old man, he looked and spoke like a eunuch. His skin was unusually soft — like the skin of a baby rather than that of an aged scholar. At the height of the age of athleticism he never learned to handle a cricket bat, kick a football or man an oar.
Ford’s intersex hypothesis would help to explain Jowett’s attitudes to sex, which were prudish even by Victorian standards. He was notorious for silencing anybody who dared to mention the subject with a high-pitched admonition not to be so disgusting; he steered well clear of the flirtatious relations that then flourished not only between male undergraduates but also between tutors and their charges. It would also explain the mysterious silence about Florence Nightingale in the otherwise exhaustive Victorian The Life and Letters of Benjamin Jowett by Evelyn Abbott and Lewis Campbell. The two were close friends and enthusiastic correspondents for decades. Several sources suggest that they discussed marriage. Yet Abbott and Campbell don’t mention Miss Nightingale and reprint her letters without attribution, surely evidence that Ford might have been on to something with his hypothesis of a budding physical relationship which, when put to the test, went disastrously wrong.
It is impossible, of course, to produce definitive proof that Jowett was intersex. But at the very least we know that he was what would now be called ‘gender non–conforming’ in an age when gender conformity was imposed far more strictly than it is today: he struggled all his life with both his sexuality and with sex in general; he didn’t fit in with the Victorian ideal of manliness, with its emphasis on bushy beards and thick thighs; and yet he succeeded in bending all the manly types that surrounded him at Oxford to his will.
A statue would not only provide inspiration to Oxford students who are struggling with their own sexuality; it would also help to defuse the culture wars by proving that it’s possible to become a pillar of the establishment even if you belong to the tiniest and most discriminated-against of sexual minorities. Let’s replace the negative and divisive slogan ‘Rhodes must fall’ with a positive and uniting one: ‘Jowett must rise!’
Got something to add? Join the discussion and comment below.
Adrian Wooldridge is political editor of the Economist and author of the Bagehot column. His book The Aristocracy of Talent: How Meritocracy Made the Modern World is published by Allen Lane.
You might disagree with half of it, but you’ll enjoy reading all of it. Try your first 10 weeks for just $10 | <urn:uuid:d21c9a0c-a57e-40b5-bfdf-50fc2ae8a1d7> | CC-MAIN-2022-33 | https://www.spectator.com.au/2021/07/no-title-9/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.973018 | 1,991 | 1.851563 | 2 |
'I spend a lot of my day answering questions from all around the world.'
- Paul Dee
About this video
It’s satisfying to know that the internet can’t answer every question.
Watch as librarian Paul Dee responds to a query from a caller from Switzerland that can’t be answered with the click of a mouse.
Charged with finding an Aboriginal word for ‘harmony’, Paul consults several dictionaries, a 19th-century pamphlet and a number of books from the Library’s storage.
Information seekers from around the world rely on the expertise of Library staff such as Paul, who find the answers to all kinds of questions using the Library’s vast and varied array of reference materials.
Paul Dee is a librarian at the State Library Victoria. | <urn:uuid:50180e7f-7b53-42a7-bf7a-232e91bf5824> | CC-MAIN-2022-33 | https://www.slv.vic.gov.au/view-discuss/paul-dee-answering-research-queries | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.913347 | 172 | 1.523438 | 2 |
Online speech therapy has a robust and growing evidence base
for speech and language disorders, autism and aphasia. There is also wealth of evidence supporting distance intervention using the Lidcombe Program for stuttering.
Online teletherapy has provided continuity of treatment to support fluency and communication targets via a motivating and versatile platform, particularly for families we already see for therapy.
For example, a 5 year old boy from India with moderate stuttering has been receiving fortnightly follow-up consultations. His stutters have reduced with a Severity Rating of 2 to 3 (10 = severe stutter; 1 = no stutter).
A mother of a 12 year old girl was pleasantly delighted with the online voice and diction training provided in preparation for her daughter’s DSA interviews in July 2020.
Online teletherapy caveats may include occasional technological glitches such as audio lag. Nevertheless, in general, we have been impressed by how teletherapy has supported our clients’ progress and positively influenced our delivery of therapy. | <urn:uuid:d6781578-78ea-4018-902f-67d83afdac0b> | CC-MAIN-2022-33 | https://thespeechpractice.com/onlinespeechtherapy/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.949359 | 211 | 1.890625 | 2 |
Chuck Berry, Ali’s butterfly, and the National Hurricane Center
Dorian is powered up and perilously close, but while the forecasting is better than ever — based almost entirely on massive data collection and modeling by NOAA — the meteorologists are still quite uncertain about the hurricane’s path. I’m thinking a lot about folks in the Abacos and in the vast areas that might be struck next, but, sorry, I’m also remembering how I managed to use Chuck Berry and Muhammad Ali in the opening paragraph of a July 2003 SAIL magazine article about visiting the National Hurricane Center in Miami.
So, yes, this entry is partially about a writer’s pride in some sentences that still seem to ring. But maybe you will agree that a couple of deeply ingrained Berry and Ali catchphrases do indeed add gusto to the dangerous dynamics of an immensely powerful weather system that can gyrate like a butterfly “with no particular place to go“:
Hurricane season this year started much earlier than usual (the first named storm, Ana, appeared on April 20, just south of Bermuda), and now, as the heart of the season approaches, almost every saltwater sailor in North America must be mindful of these awesome phenomena. Only sailors north of Los Angeles are immune, while those on both coasts of Central America, in the Caribbean, and in the southeastern U.S. are particularly vulnerable. These storms, spawned from the moist heat of tropical oceans, can generate nearly incomprehensible power—think cement blocks blowing around like gum wrappers. Yet, like jumpy Chuck Berry teens, they “have no particular place to go” and thus are steered—often drunkenly—by all sorts of other phenomena. A hurricane not only punches like Ali, but feints and spins like a butterfly. At some point this season, many of us will feel the anxiety of a seeing a storm head for the bit of coast our boat calls home, and a few will experience the total mental focus of sharing an ocean with one.
The next paragraph of that article (full PDF as printed in SAIL here) begins with “Thankfully, our government addresses the intensity of hurricanes with an equally intense vortex of technology and brain power” and thankfully that’s still true today. My photos are 16 years old, but the nearly impregnable National Hurricane Center building in west Miami is still the intense eye of data distribution and analysis — in almost every form possible to whoever wants it, free — and I’m confident that they still have a plan to evacuate the staff to a standby center in Maryland if Dorian (now Category 5) meanders like a butterfly to Miami.
The NHC’s computer equipment has very likely been updated, and maybe the awesome clipboard rack is history, but I’d wager that some of the meteorologists are still using highlighters and colored pens to help think through data and model printouts (thinking like this). And while Dorian’s future track has been especially hard to predict — though getting better now, as the models evolve toward consensus — I was impressed with what seem like new abilities to forecast the storm’s rapid intensification (learn about kilojoules of oceanic heat content mapping at the ever-excellent Cat 6 blog).
Back in 2003 the NHC had just started extending 3 day hurricane track forecasts to 5 days, but only after extensive backtesting gave them confidence that they were as accurate as their 3 day forecasts had been in 1988. I’m sure they’re still backtesting in a constant search for the favorable factors and models in different situations, and they’re certainly transparent about forecast history. The two screens above are captured from a fascinating animation of every 5 day Dorian forecast since it became Tropical Depression Five on 8/24. It terrifically illustrates all the discussion about weak steering factors and divergent track models, I think, not to mention the “no particular place to go” guitar riff.
I’ll close by noting that the subtitle to my 2003 article — “A visit to NOAA’s National Hurricane Center leaves one sailor pleased to be a taxpayer” — is also still true. In fact, I think that NOAA, the USCG, and many other government agencies have value well beyond any flaky predictions or bureaucratic hassles we may experience, and I worry about their health in this political climate (check out The Fifth Risk). At any rate, thanks again for all you do, National Hurricane Center! | <urn:uuid:d1ece055-79f8-4a57-9f20-fa220da148b8> | CC-MAIN-2022-33 | https://panbo.com/chuck-berry-alis-butterfly-and-the-national-hurricane-center/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.955917 | 941 | 1.859375 | 2 |
The Fed’s critical next move
The world’s most powerful central bank, the Fed, has hiked rates nine times since 2015. After a policy of providing guidance, and sticking to it, the Fed abruptly turned dovish in December. Fed policy is one of the key drivers for markets globally, particularly given the backdrop of quantitative tightening, so this change of tune was a massive deal.
Goldman Sachs has halved the odds of a hike next quarter to 25%, however, Chris Watling from Longview Economics expects a more drastic response. He told us in an interview: “They talked about adjusting the balance sheet if they need to but, frankly, I think they probably need to cut. If I look at global M1 money supply, it's basically at recession levels.” Watch (or read on) to hear more from Chris on this tectonic shift in markets.
I think money got too tight last year. I always think the central banks were endogenous to the whole process and really they're looking at data that tends to be backward looking and really they should be forward looking. Markets are forward looking. The fed and the central banks tend to be backward looking. When you're looking at wage inflation and lead market data, that lags the cycle.
You should be looking at monetary metrics, how tight money is getting and I think with all those hikes into 2018 and the tightening of the balance sheet, you could see if you looked at something like a global M1 money supply measure, that money globally was really very tight and growing at the slowest way it had been growing since the GFC. Markets then reflected that. You had a bout of volatility and the fed thankfully adjusted its path from there on out.
I think the interesting question is where do we go from here? Because they said they were patient, they're on pause and they talked about adjusting the balance sheet if they need to but frankly, I think they probably need to cut.
If I look at global M1, it's basically at recession levels. It makes me quite nervous and I think we're probably not quite through this bout of volatility yet, and indeed I'm wondering whether bubbles have burst because money's been too tight.
Therefore, I think the fed needs to cut and I think another downdraught in markets will push them to do that.
MORE ON Macro
Bulls v Bears: Why Bridgewater, Citi, Morgan Stanley, and Ed Yardeni are divided on recession outlook
1 contributor mentioned | <urn:uuid:bf3502fb-e013-4e2e-9667-97244cd7297f> | CC-MAIN-2022-33 | https://www.livewiremarkets.com/wires/the-fed-s-critical-next-move | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.976831 | 523 | 1.539063 | 2 |
We are grateful for all the traditional Seders that are being held as believers from the nations are being restored to the biblical Jewish roots of our faith. I encourage you to participate in them as the Lord leads. Gather your family and friends together for a meal and “remember this day”—the Passover and the “last supper.” Passover began at sundown yesterday, April 18.
You may choose to use a Haggadah (traditional Jewish way of remembering the evening). Or you may choose simply to read the Passover story from Exodus 12 and the account of the Passover evening meal with Yeshua and His disciples on the night of His betrayal (see Matt. 26:17-30) and to celebrate your own deliverance from slavery through the blood of Yeshua.
Scripture speaks of “bitter herbs and bread made without yeast” (Ex. 12:8) as a part of the meal. The important thing is to remember. And let the Holy Spirit guide your evening.
At some point during the evening, go outside and look for the full moon. Passover comes always on the 14th of the biblical month of Nisan (also called Abib), always a full moon. Israel needed no lighted torches on the night of their deliverance—nor did the Roman soldiers on the night of Jesus’ betrayal.
Remember the night of Israel’s deliverance and remember the night of Jesus’ betrayal when He sat with His close friends for the last time.
“This is my body which is for you,” He said as He took the bread (1 Cor. 11:24).
“This cup is the new covenant in my blood; do this, whenever you drink it, in remembrance of me,” He said as He took the wine (v. 25).
“I will not drink of this fruit of the vine from now on until that day when I drink it anew with you in the Father’s kingdom,” He told His disciples (Matt. 26:29).
At some point in the evening you may also want to read aloud the following selection from one of our Speaking Life e-mails several years ago:
On this day, 3,500 years ago, lambs were slaughtered throughout Goshen in Egypt,
Hyssop brushes stroked Jewish doorposts with lamb’s blood.
The children of Israel met quietly,
Sequestered behind their bloodstained doors,
Waiting to be delivered from 400 years of slavery.
On this night, 3,500 years ago, the Lord went through the land looking for blood on doorposts.
There was a great deliverance, a pass-over.
Firstborn sons were slain in houses where there was no blood.
Wailing and mourning was heard when judgment came in Egypt.
On this night, 3,500 years ago, freedom was proclaimed in Israel.
Firstborn sons of believing Israel were spared through the blood of the lamb.
The lamb’s blood painted on doorposts brought freedom.
The wealth of Egypt became the wealth of Israel.
Shouts of joy were heard as Moses led Israel out of Egypt.
On this night, 3,500 years ago, the exodus from Egypt came suddenly.
For 3,500 years faithful servants of God have remembered this night.
On this day, 2,000 years ago, another Lamb was slain,
Human hearts were stroked with Lamb’s blood and freed from centuries of slavery.
On this day, 2,000 years ago, the Lord began to look for Lamb’s blood on the doorposts of hearts.
There was a great deliverance—a passing over.
On this day, 2,000 years ago, wealth was restored to the sons of Adam,
Another Moses led another Israel out of another Egypt.
On this day, 2,000 years ago, Lamb’s blood on the doorposts of hearts brought freedom.
Today, Lamb’s blood is still found on human hearts.
Deliverance is found behind a blood-stained door.
If the doorpost of your heart is stained with Lamb’s blood, have a glorious Passover.
If not, grab quickly the hyssop and look for the Lamb’s blood.
The exodus will come suddenly!
The Lamb who was slain has risen and will return as King of kings and Lord of lords! | <urn:uuid:1be1de5f-b606-4f47-8dbd-4cd0157ed879> | CC-MAIN-2022-33 | https://charismamag.com/charisma-archive/remembering-passover/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.959667 | 929 | 2.375 | 2 |
President Trump signed the ‘Right to Try’ Act Wednesday afternoon, allowing terminally-ill patients the right to try experimental treatments and investigational drugs before they’re permitted for general use.
The bill, passed by the House of Representatives in March, allows those “near death” or with conditions that will result in “severely premature death” to try new drugs and treatments that could potentially extend their lives but are deemed “high risk.”
President Donald J. Trump signs 'Right to Try' bill, paving the way for people with terminal illnesses to get experimental treatment and medicine https://fxn.ws/2kCWIDM
Posted by Fox News on Wednesday, May 30, 2018
The legislation was championed by Vice President Pence, who called the ‘Right to Try’ Act a great step towards “restoring hope to patients with terminal illnesses and it’s the right thing to do.”
CAUGHT: Hidden Tape Shows What Nancy Really Thinks of Universal Healthcare
FLATLINE: Mitch McConnell Pulls the Plug on GOP Healthcare Bill
Senate Majority Leader Mitch McConnell officially pulled the plug on the GOP’s latest efforts to repeal and replace Obamacare, telling fellow Senators there will not be a vote on the Graham-Cassidy bill and admitting yet another defeat in his final push to make good on a seven-year promise.
According to the New York Times, McConnell made his final decision hours after Sen. Susan Collins of Maine announced her opposition the legislation; joining Sen. John McCain and Rand Paul’s ‘no’ votes and ending the bill’s chances of passing the Senate.
The Graham-Cassidy legislation was GOP lawmakers last and best chance to repeal and replace Obamacare before the September 30th deadline. Any vote after the deadline would then require a 60 vote super-majority; making it nearly impossible to “repeal” Obamacare without any democratic support.
Speaking from the White House, President Trump did not mince words for republican legislators who have -so far- failed to advance the President’s agenda; breaking a seven-year promise to voters that ushered the GOP into power.
“At some point there will be a repeal and replace, but we’ll see whether or not that point is now or will it be shortly thereafter,” said the President. “But we are disappointed in certain so-called Republicans.” | <urn:uuid:b1e415ff-251b-416f-845b-04c2711e6a5b> | CC-MAIN-2022-33 | https://hannity.com/media-room/right-to-try-president-signs-bill-easing-access-to-experimental-drugs/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00665.warc.gz | en | 0.936954 | 507 | 1.585938 | 2 |
Williamson tax committee explores new ways to fund school buildings
The Williamson County Commission Tax Study Committee discussed briefly an alternative funding mechanism that could distribute dollars to capital projects, or new school construction, for example.
After the committee approved Tuesday an 11-cent property tax increase, which will also be considered by the full commission July 8, it briefly discussed the implications of raising the county’s adequate facilities tax.
County Commissioner Tom Tunnicliffe, 7th District, and concerned constituents, have taken a closer look at the structure of the county’s adequate facilities tax, which was devised by a private act in 1987.
Currently, the county does not tax new commercial construction in the county’s six municipalities.
However, some residents and Tunnicliffe are posing the question, “Why not?”
“Why are the residents maxed and the commercial space in the cities charged zero,” Tunnicliffe said.
“I just wanted to get the discussion out there and see if there is any interest in carrying it forward. I am new to the commission, so tell me why it’s a bad idea.”
The county’s adequate facilities tax is structured under the Williamson County Private Act of 1987, Chapter 118, which gives the county authority to tax new residential and nonresidential development. The maximum rate allowed for nonresidential development is $2, while the maximum rate for new residential development is $1 (both per gross square foot).
Under the act, the County Commission has the authority to apply the tax to incorporated and unincorporated areas, and by law, the amount collected must go toward brick-and-mortar costs, not operational ones.
Current collections of adequate facilities tax
The county currently collects 34 cents per gross square foot from new nonresidential development in the unincorporated county, while it collects $1 (the maximum) from new residential developments in the unincorporated county and its six cities, with 70 cents of that amount dedicated to schools.
However, no adequate facilities tax is currently collected from new nonresidential developments, or businesses, in the county’s six municipal areas.
Tax might not be ‘business friendly’
However, some are concerned that if a new tax were applied to commercial construction, it could slow growth or hinder the county’s “business-friendly” environment.
“I was told it would stunt growth and the educational (impact) fee would do the same, but they are still building like crazy,” Tunnicliffe said.
Some argue that cities have its own impact fees and taxes and any additional AFT might burden builders.
For example, the city of Franklin collects fees for parks (green space dedication or fees in lieu of), road impact fees for collector and arterial roads and a portion of its property tax rate is dedicated to schools.
During discussion Tuesday, tax committee chairman Sturgeon asked Kel McDowell, government affairs director for Williamson Inc. who attended the meeting, for an economic perspective.
“Any rhetoric that implies that the business community is not paying its way, we would certainly disagree with, whether it be property tax or otherwise,” McDowell said.
At a budget committee meeting earlier this week, County Mayor Rogers Anderson, highlighted a few points to keep in mind when considering any AFT adjustments.
Anderson explained that the commission revisited adjustments to the AFT six or seven years ago but stayed away from adjusting the business portion of the tax for three reasons as follows:
“One. they are already paying inside the cities. Two, the business tax on real property is already at 40% (for businesses) where residential is 25%, and three, the theory was you wanted to leave the community open to businesses coming in with those jobs and not be unfriendly to them,” Anderson said.
Adequate facilities tax does not help school operational costs
Capital funds don’t help fund the school operational budget, Anderson also pointed out, emphasizing that the 11-cent property tax increase is needed due to the high costs of funding the Williamson County Schools operational budget (which includes teacher raises).
“This tax is for capital, or brick and mortar costs, not operational costs,” Anderson said.
“If you considered raising this tax, the $11 million shortfall in the school budget would still have to be addressed.”
Adequate facilities tax could create more funding options
Although Tunnicliffe does not oppose the 11-cent tax increase proposal, he believes applying the ATF tax would help minimize future increases.
Tunnicliffe also pointed out that funds collected from AFT could be used to construct new county buildings or even used to pay for future capital debt service.
“I’ll bet Dusty [Rhoades] would love a brand new jail,” Tunnicliffe said. “It can pay for brick and mortar for any building in the county. You can pay debt service for any bond after we vote it in.”
No formal resolution proposing an adjustment to the AFT has been presented. | <urn:uuid:3a9d7775-bc2c-4db4-a75b-21e92fe25f03> | CC-MAIN-2022-33 | https://www.tennessean.com/story/news/local/williamson/franklin/2019/07/03/williamson-county-tax-committee-ponders-adequate-tax-businesses/1630628001/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz | en | 0.958238 | 1,069 | 1.609375 | 2 |
Ethicality and Imagination
On Luminous Abodes
Published by: Indiana University Press
Ethicality and Imagination is the astounding conclusion to John Sallis's landmark trilogy launched with Force of Imagination and Logic of Imagination. In this new work, Sallis embarks on an unforgettable voyage spanning the cosmos and delving deep into what makes us human. If the first two works consider the question of being and thinking, respectively, the third and culminating volume takes up the question of action. In a series of highly original and always provocative meditations, Sallis articulates the way humans are rooted in their abodes yet not determined by them.
Ethicality and Imagination develops a new approach to the relation of the imagination to literature, ethics, political thought, and recent discoveries in astrophysics. It represents a brilliant conclusion to one of the most exciting works of thinking in the Continental school in recent decades.
1. Ventriloquies of Origin
2. Luminous Space
3. Solitude and the Stars
7. Cosmic Visions
This extraordinary work completes Sallis's magnum opus, his trilogy on the imagination, inaugurated with Force of Imagination and Logic of Imagination. As it now stands, this trilogy is one of the masterpieces in the Continental idiom in any language, and perhaps the signature work in American English~Jason M. Wirth, Seattle University, and author of Schelling's Practice of the Wild
Sallis has long demonstrated that the inconceivable is never unimaginable, and that this primacy of the imagination – its force and logic – opens original possibilities for understanding and speaking of the world. This new contribution to Sallis' remarkable project draws out the moments of ethicality that appear by virtue of this force of the imagination. In doing this, Sallis shows how the elements of an ethical sense – the intimacies of life shared in time – emerge with their own power and truth. A sweeping work of astonishing insights, this book is written with a wonderful alchemy of eloquence, grace, and precision – it is a pleasure to read.~Dennis J. Schmidt, Western Sydney University | <urn:uuid:30d384a8-496e-46e5-bea1-44521fab2171> | CC-MAIN-2022-33 | https://iupress.org/9780253063991/ethicality-and-imagination/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.912249 | 470 | 1.703125 | 2 |
Traditional sources of electricity generation are mainly hydro and thermal power plants. Nuclear power comes in third place in this list, followed by renewable energy sources. However, according to the optimistic forecasts of the World Nuclear Association, the “Harmony” project, which is aimed at intensive development of the world’s nuclear energy, is expected to increase the share of nuclear power to 25% of the world’s electricity production (today it provides about 11%). Ensuring a low-carbon future will happen thanks to a new generation of reactors with the highest safety level.
The Director General Director of «Uzatom» Agency Jurabek Tursunpulatovich MIRZAMAKHMUDOV speaks on the issues of nuclear energy development in Uzbekistan in an interview to the «EBU».
– Jurabek Tursunpulatovich, by Decree of the President of Uzbekistan Shavkat Mirziyoyev of July 19, 2018 “On Measures for the Development of Nuclear Energy in the Republic of Uzbekistan” the Agency for the Development of Nuclear Energy under the Cabinet of Ministers of the Republic of Uzbekistan “Uzatom” was created. Can you tell us briefly what functions are assigned to your Department.
– The «Uzatom» Agency is the body of state administration in nuclear power development in the country. After forming the Ministry of Energy of the Republic of Uzbekistan in early 2019, the “Uzatom” Agency continues its activities as part of this Ministry. The main tasks and activities of our Agency are:
● preparation of proposals on priority areas of state policy in the field of peaceful use of nuclear energy;
● development and implementation of state programs for the development of nuclear energy in the Republic of Uzbekistan, investment attraction, including foreign investment, for the implementation of projects in the field of nuclear energy;
● conclusion of agreements and contracts for the design, construction and operation of nuclear power facilities;
● preparation and implementation of comprehensive measures for developing nuclear science and nuclear technologies, fundamental research projects, research and development, development and innovation works, and the introduction of advanced technologies;
● ensuring the development and safe operation of research and power nuclear reactors, physical nuclear installations, storage facilities for nuclear materials and radiation sources, and disposal of radioactive waste;
● improving the system of radiation and nuclear safety of the Republic’s facilities;
● ensuring non-proliferation of nuclear materials and technologies, radioactive materials, implementation of measures for physical protection and ensuring nuclear and radiational safety;
● organization of a system of training, retraining and professional development of personnel, including in leading foreign institutions;
● international cooperation and interaction with the International Atomic Energy Agency, the European Atomic Energy Community and other international organizations.
– There are quite a few countries that use nuclear energy, and more than one country has shown interest in cooperation with Uzbekistan. What was the reason for agreeing to the construction of a nuclear power plant with Russia’s “Rosatom?”
– When planning the project, international experience was carefully researched, and the contractor was chosen based of three factors – the project’s technology, cost of work and safety of work.
When choosing a partner for the development of such a high-tech industry, Uzbekistan chose “Rosatom” State Nuclear Corporation, taking into account its long-term experience and world leadership in the field of nuclear energy.
Today, 36 power units are being built using Russian technologies in 12 countries – which is a record in the global nuclear industry for the number of power units being built abroad.
“Rosatom” State Nuclear Corporation is the only company in the world that offers a modern evolutionary project of WWER generation “3+” technology that meets modern international requirements and IAEA recommendations.
– Uzbekistan has confirmed its firm commitment to international obligations in compliance with all the requirements and recommendations of the IAEA to ensure nuclear safety. What are these requirements, and what factors influenced the choice of the territory near the Tuzkan – Aidar-Arnasay lake system as a priority site for the construction of the country’s first nuclear power plant? | <urn:uuid:343f1ec4-5380-4942-a568-1ab95f63d754> | CC-MAIN-2022-33 | https://evu.uz/en/intervyu/atom-for-peace-in-uzbekistan.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.920796 | 868 | 2.375 | 2 |
I attended an informative and provocative session at Limmud Philly. This conference is held in several major cities and is a usually a day or weekend of Jewish learning. The learning includes philosophy, prayer, entertainment and socializing. It is quite an event for those that like to think Jewish!
I attended a session entitled “We Totally Accept You (Almost): Ritual and Leadership Roles in Synagogues.” The participants learned about the Conservative, Reform and Reconstructionist perspectives regarding synagogue membership and prayers. Our presenter was InterfaithFamily’s own Benjamin Maron. Benjamin did a great deal of research regarding different synagogues and their policies regarding interfaith involvement.
I was fascinated by the discussion of prayers and who is allowed to say what from the bimah. Frequently synagogues limit the participation of the parent who is not Jewish. We discussed that the reason that some synagogues don’t want the partner who is not Jewish to participate in the prayers at a Bar and Bat Mitzvah is that the translation of the prayers are things like: “Who has sanctified us through the mitzvot” and “Who has chosen us.” The word “us” refers to the Jewish people, therefore, someone who isn’t Jewish isn’t allowed to participate.
I understand the principle of this – Jews have been through a lot. Our ancestors have been persecuted in our efforts to practice our religion and we have worked hard to educate ourselves. Those that have had a bar or bat mitzvah know that there is a lot of work and education going into this process. We feel the need to hold fast to our religion. Will someone who isn’t practicing Judaism threaten my Judaism by saying a prayer?
The children of many of my friends are becoming bar and bat mitzvah. I am familiar with the frequent scene of the parents and grandparents surrounding their young teenager, beaming with pride. I was thinking about this further. I know many families where the spouse does not practice Judaism but has agreed to raise the kids in Judaism. How do they feel during the blessings? Do they feel included, awkward, proud? Maybe a mixture of feelings and emotions? If there were a blessing from the parent who wasn’t Jewish, what would that look like? Would it be sacrilege to bless your child in their arrival in their Jewish adulthood?
As a Jew, I want anyone standing on the bimah during a simcha to feel joy! I don’t want anyone to feel excluded or simply tolerated. I want them to feel WELCOME! So now, I look at this from another perspective: the parent who is not Jewish, standing in front of the Jewish community, blessing this event is equivalent to saying, “I was not raised Jewish, but I am proud, thrilled, and elated that my child is entering into Jewish adulthood. I fully support this choice and my child.” To me, this has great meaning and this concept strengthens the joy of the day. Here is this parent supporting their child’s Jewish journey – how great is that!?
Do I feel threatened that someone who isn’t practicing Judaism is saying a prayer and including themselves in the Jewish community? Not at all. In fact, I am elated that this parent is allowing and encouraging their child to be Jewish! While I know some of the movements are having trouble “moving” forward toward adapting to interfaith issues within our American society, it is critical that they work to keep those that want to be Jewish.
I will be attending two bar/bat mitzvahs this weekend, and I know that I will be thrilled to witness each child stepping into the role of being a Jewish adult. I love Judaism and am delighted to see someone make the choice to practice Judaism. I think that their parents should be allowed to bless their child’s arrival into Jewish adulthood. And with that I say, Amen, L’chaim and WELCOME! | <urn:uuid:f9c3b584-9b24-4aa5-a248-34b3f6be9d47> | CC-MAIN-2022-33 | https://18doors.org/the-blessing-of-the-parents/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.97213 | 836 | 1.8125 | 2 |
Pitbulls are one of the most popular breeds of dogs in the world. They are known for their muscular build, their loyalty to their owners, and their tendency to shed a lot of hair. While there is no one-size-fits-all answer to the question of how to stop pitbull from shedding, there are a few things that can help. One thing that can help reduce shedding is to make sure your pitbull gets plenty of exercise. A tired dog
How To Stop Pitbull From Shedding
There are a few things you can do to help stop your pitbull from shedding. The most important is to make sure they are getting enough exercise and have a good diet. You can also brush them regularly to help remove any loose hair.
1) A brush – to help remove any loose hair 2) A comb – to help remove any loose hair and also to detangle the fur 3) A de-shedding tool – this can be a slicker brush, a metal comb or even a rubber curry comb 4) Dog shampoo and conditioner – to help keep the coat clean and healthy 5) A good quality dog food – to help keep the coat healthy and shiny
- Comb your dog’s coat weekly with a wide
- Tooth comb to detangle any knots
- Brush your dog regularly with a slicker brush to remove dead hair
- Bathe your dog no more than once a month, using
One of the best ways to help reduce shedding is to brush your pit bull regularly. This will remove any dead hair and help distribute the natural oils evenly, which will minimize shedding. Feeding your dog a high-quality diet can also help, as it will provide the nutrients their coat needs to look its best. Additionally, keeping your pit bull’s living environment clean will help reduce the amount of loose hair around your home.
Frequently Asked Questions
How Do I Get My Pitbull To Stop Shedding So Much?
There are a few things you can do to help reduce your pitbull’s shedding. Start by feeding them a high-quality diet and brushing them regularly. You may also want to consider using a deshedding tool or shampoo specifically designed to reduce shedding.
What Home Remedy Can I Give My Dog For Shedding?
There are a few home remedies you can give your dog for shedding, including supplements like fish oil or biotin, a nutrient found in many foods that helps keep hair healthy. You can also try changing your dog’s diet to one that is higher in protein and lower in carbohydrates to help make their coat shinier and less likely to shed. Home remedies for shedding also include using a grooming glove or slicker brush to remove dead hair, and using a humidifier to help keep your dog’s skin and coat hydrated.
Are Pitbulls Supposed To Shed A Lot?
There is no general consensus on whether pit bulls are supposed to shed a lot or not. Some people say that pit bulls are supposed to shed significantly more than other dog breeds, while others claim that this is not necessarily true. The amount of shedding that a pit bull does can vary depending on the individual dog’s genetics and environment.
There are a few things that you can do in order to help stop your pitbull from shedding. One is to brush them regularly, especially during shedding season. You can also try to feed them a high-quality diet, which will help keep their coat healthy and shiny. Finally, make sure they get plenty of exercise, as this will help them stay healthy and reduce the amount of hair they shed. | <urn:uuid:29235d7b-1a0e-47d0-a25d-f150099651f6> | CC-MAIN-2022-33 | https://ldcgroups.org/how-to-stop-pitbull-from-shedding/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.965952 | 746 | 1.9375 | 2 |
Any instrument worth mastering is useful. The key is to understand a piece as much as you can without going into complete detail, taking notes, and then repeating it.
If learning a single scale, you’ll not be able to play a single part or phrase of it. I’ll explain why, but first, lets take a look at an example of how to play the first note of the Major Scale.
You’ve now learned that if you play the first note of the Major Scale, you’ll know that the following notes are in your range: Bb A
Now, imagine yourself playing a C Major scale that you’re not quite getting (like B, C, D, Eb and F):
You’d know you would play that scale on the A-major scale, since it’s the first note on the A scale.
You’d know you wouldn’t be able to play any of the notes that are in this scale on the F and G basses for example!
Now you’ve learned that, for the first note of an exercise like this, learn the scale with any string(es) available, because it will be easier to recall the notes by sight than if you have to learn them by ear.
Practice that exercise, take notes, repeat it until you’re able to play the entire exercise on the A scale.
If learning a scale is just a matter of memorizing the first note, we need to learn the whole scale. Then, by learning the whole scale, we’d be able to play in different keys as well.
How to learn the whole Major Scale?
You can find the full Major Scale here: https://www.fluteandvoice.com/wp-content/uploads/2015/04/flute-major-scale.pdf
If you’re familiar with the other major scales, you’ll recognize that the major scale is a major octave scale that is built from the notes F and C (which you can pick). So, how do we play the entire scale?
The first thing that you need to understand is that you can’t play the full scale in one hand. If you have two fingers, just play the notes in the opposite hand, and you’ll probably be able to move them around, but you won’t have a solid grasp.
In order for you to know how to play the whole scale, you need to know about your two notes. They are
best way to learn piano at home reddit, how to learn to play the piano faster, learn piano keys videos infantiles, learn piano for beginners register free download, piano notes hindi songs tum hi ho | <urn:uuid:0eda2aea-e68e-4f10-bdd9-5b2bbc97d84c> | CC-MAIN-2022-33 | http://educationbase.myddns.rocks/learn-piano/what-instrument-should-i-choose-to-learn-best-way-to-learn-piano-notation-tier/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz | en | 0.953017 | 572 | 3.15625 | 3 |
A Day in the Life
OF A CADET
Sharing a meal is a longstanding tradition in the fire service that fosters teamwork and a sense of family. The program provides a nutritious "firehouse breakfast," giving youth an opportunity to informally spend time with mentors. This firehouse breakfast, along with the uniform, provide a group identity that often fills the youth's important need to belong.
ROLL CALL &
The Firefighter Youth Academy is designed to reflect the structure of the fire service. Each Saturday morning youth arrive at 0800. Cadets muster for roll call, uniform inspection, and daily activity briefing.The platoon is broken into smaller squads that perform facility clean up and work with volunteers to prepare breakfast.
ACTIVITY SESSION 2
In this session, firefighters teach a variety of public safety topics and share their career with the program's cadets, emphasizing community service. Lessons include learning to save lives with Cardiopulmonary Resuscitation (CPR), earthquake preparedness, and a variety of other skills that will transform participants into assets for their neighborhoods. Youth will be prepared to support Fire Department efforts by providing public safety information and training to low income residents.
ACTIVITY SESSION 1
The first activity session addresses challenges faced by inner city youth. Firefighters and other community professionals volunteer their time to present the curriculum and facilitate the activity session. Firefighters who come from similar backgrounds as the youth share stories about how they overcame obstacles while growing up.
2010 - present
2010 - present | <urn:uuid:17340065-404d-4f72-9c3c-701ab46f5bd6> | CC-MAIN-2022-33 | https://www.firefighteryouthacademy.org/a-cadets-day | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.938897 | 326 | 2.1875 | 2 |
NASA's Earth Observing System Data and Information System (EOSDIS) has announced the addition of Geostationary Operational Environmental Satellites (GOES) GeoColor imagery into Worldview, NASA’s imagery mapping and data visualization application offering the interactive browsing of nearly 1,000 global full-resolution satellite data imagery layers.
NASA’s Land, Atmosphere Near real-time Capability for EOS (LANCE), Global Imagery Browse Services (GIBS), and Worldview development teams have been collaborating with Dr. Steven Miller, Senior Research Scientist and Deputy Director at the Colorado State University’s Cooperative Institute for Research in the Atmosphere (CIRA), and his NOAA colleagues to incorporate GeoColor into Worldview, boosting the amount of near real-time imagery available in the application. Now, the wait is finally over.
GOES GeoColor imagery is a multispectral data product offering true-color imagery during the day and an infrared product at night. The application was developed by scientists at CIRA, NOAA, and the Naval Research Laboratory in Monterey. It is produced pseudo-operationally by Regional and Mesoscale Meteorology Branch of NOAA’s Center for Satellite Applications and Research (STAR).
GeoColor imagery is created with data from the Advanced Baseline Imager (ABI) aboard the joint NASA/NOAA GOES-16 (or GOES-East) and GOES-17 (or GOES-West) satellites, the first two members of the GOES R-Series satellites launched in 2016 and 2018, respectively. The daytime true-color imagery is composed of ABI data from the blue, red, and near-infrared channels, enhanced to maximize the contrast between clear sky, clouds, and various surface types—providing a visually intuitive kind of imagery that is reminiscent of human vision. Since true-color imagery requires a green band that is not native to ABI, this component is synthesized using a lookup table that was built using data from the Advanced Himawari Imager (AHI) aboard the Japan Meteorological Agency’s Himawari-8 satellite. The table provides a relationship between green and nearby spectral bands shared by AHI and ABI. Then, the red, synthetic-green, and blue bands are combined to create the pseudo-true-color RGB product.
At night, the ABI’s window infrared channel is combined with the GOES-16 low cloud and fog product to identify both ice and liquid water clouds. These features are rendered semi-transparent, with opacity factors indexed to cloud thickness, and blended atop a static nighttime city lights background derived from the Day/Night Band of the Visible Infrared Imaging Radiometer Suite (VIIRS) instrument aboard the joint NASA/NOAA Suomi National Polar-orbiting Partnership (Suomi NPP) satellite.
The ABI currently produces images of the Western Hemisphere full disk image (10848 x 10848 pixels, with 1 km visible-band resolution at satellite sub-point) every ten minutes in its Mode 6 operations. It also provides a Continental United States (CONUS) domain image (dimension 3000 x 5000 px) every five minutes, and two mesoscale domains (1000 x 1000 px) every 60 seconds or one mesoscale-domain every 30 seconds. In Worldview, GeoColor imagery will be updated for the full-disk coverage every 10 minutes (ABI Mode-6 operations) and have a latency of approximately 40 minutes.
According to Dr. Miller, GeoColor is the culmination of years of behind-the-scenes scientific research and NASA-NOAA collaboration.
“GeoColor has NASA/NOAA synergy in its development heritage,” said Miller. “We first developed the synthetic green band approximation, used for the daytime true-color imagery of the ABI, based on data from the Moderate Resolution Imaging Spectroradiometer (MODIS) aboard NASA’s Terra and Aqua satellites, and later refined it using the AHI data. The quality of GeoColor is directly traceable to the early work with these NASA sensors.”
GeoColor’s quality, frequency, and interpretability has made it a popular product among scientists, forecasters, and the media.
“Since the colors of features in the daytime are what viewers expect them to be, the product requires little to no training, and also gives useful context to some of the more exotic false color imagery products. This has made it a popular imagery choice for social media,” Miller and his CIRA colleagues write in the GeoColor Quick Guide, available on the NOAA/STAR website.
Among GeoColor’s primary utilities are the distinction of daytime aerosol detection, as the high-quality true-color algorithm facilitates the identification of smoke, blowing dust, smog, and anything that has a unique color property that distinguishes it from meteorological clouds. Its other uses include nighttime cloud detection, because it can differentiate between low liquid water clouds and higher ice clouds at night, and rapid nighttime geo-referencing of weather hazards, as GeoColor’s city lights database allows for georeferencing by helping meteorologists and others determine whether clouds (such as fog) are affecting populated areas. GeoColor’s city lights background is created with essentially the same VIIRS data used to create NASA’s Black Marble data layer, which is already available in Worldview as part of the Earth at Night data category.
Satellites in geostationary orbit are extremely valuable for weather monitoring because they provide a constant view of the same surface area. Many times per hour, GOES-16 and other GOES satellites send information about clouds, water vapor, and wind, and this near-constant stream of information serves as the basis for most weather monitoring and forecasting.
Worldview already offers several data layers from the GOES-East, GOES-West, and Himawari-8 satellites, such as the Red Visible product, which can be used for analyzing daytime clouds, fog and fog-clear air boundaries, overshooting cloud tops, or cumulus clouds; the Clean Infrared Product, which provides cloud top temperature and information about precipitation; and the Air Mass RGB product, which facilitates the differentiation of air mass types (e.g., dry air, moist air, and so on). The addition of GeoColor imagery in Worldview will only make the interface even more valuable, says Miller.
“Currently, much of what Worldview demonstrates is from polar-orbiting satellites, which provide unique spectral capabilities and high spatial resolution, but are also more limited in their temporal refresh rates at the lower latitudes,” said Miller. “Including more geostationary-based information helps to put these high-quality snap-shots into context, and may even reveal new opportunities for data fusion. This will make Worldview that much more relevant to everyday users and enhance applications.”
The inclusion of GeoColor imagery in Worldview also supports the findings of the 2017-2027 Decadal Survey for Earth Science and Applications from Space. Sponsored by NASA, NOAA, and the USGS, the 2017 survey, which helps shape the scientific priorities and guide agency investments into the next decade, called for increasing partnerships between the major Federal agencies serving earth science, including NOAA and NASA.
“Bringing GeoColor to Worldview showcases the potential synergy between NOAA operational assets and NASA’s wealth of research-grade and new-science sensors—revealing complementary information and perhaps paving the way for NASA-enabled technology demonstrations to find a long-term home on NOAA’s Geostationary Operational Environmental Satellites.”
The addition of GeoColor imagery to Worldview is just the beginning. In the future, data and imagery from new NASA sensors destined for geostationary orbit, such as the Tropospheric Emissions: Monitoring Pollution (TEMPO) instrument, the first ever space-based instrument to monitor air pollutants hourly across the North America from a geostationary satellite, and the Geosynchronous Littoral Imaging and Monitoring Radiometer (GLIMR) instrument, which will collect high-resolution observations of coastal ecosystems in such areas as the northern Gulf of Mexico, will be incorporated into Worldview as they come online.
“Data from these new geostationary-based sensors will add new dimensions of environmental information at the surface, throughout the atmospheric column, and importantly, in the very important dimension of time!” said Miller.
For more information:
To learn more about GeoColor imagery, go to the CIRA website.
To learn more about the joint NASA-NOAA GOES satellite program, visit the NOAA National Environmental Satellite Data and Information Service website.
To discover more near real-time data from NASA, see the LANCE website.
To load the GeoColor imagery in Worldview:
Step 1: Load Geostationary Imagery
- Click on “+ Add Layers” button at the bottom of the Layer List in Worldview: worldview.earthdata.nasa.gov
- Select the “Featured” tab and select “Geostationary”; alternatively, type in “GeoColor” in the search box, and select "GeoColor (True Color (Day), Multispectral IR (Night)) GOES-East/ABI" or "GeoColor (True Color (Day), Multispectral IR (Night)) GOES-West/ABI".
Step 2: Set Up Timeline
- Note the change in the timeline! You can now see the Year, Month, Day AND the time in Hours and Minutes Z (Zulu Time which is equivalent to UTC - Coordinated Universal Time) on the left side of the timeline.
- To the right of the “Z” are the < > increment arrows. Click on “1 Day” above these to change the increment. There are several options - Year, Month, Day, Hour, Minute and Custom. Click on Custom and in the Custom Interval Selector box, change the increment to “10” and “Minute”. (This imagery is available in 10 minute increments starting at 00:00)
- Click on “Day” on the right side of the timeline to change the timescale to “Minute” or “Hour”.
Step 3: View Geostationary Imagery and Step Through Time!
- As there is about a 40 minute latency between the satellite acquisition and the time it takes for the data to be processed and available to view, click on the back arrow until imagery appears!
Step 4: Set Up Animation
- To make it even easier to watch an event's progression, set up an animation!
- Click on the Video Camera icon in the timeline.
- Set the second date and time fields to 2021 JUL 21 00:30 Z; set the first date and time fields to 2021 JUL 21 02:20 Z.
- Click on the "Play" button and check out the Dixie Fire in California on 21 July 2021 between 00:30 and 2:20 UTC.
- Click on the "Create an Animated GIF" icon on the right to download an animated GIF of the animation. | <urn:uuid:5646e28e-95f0-46c8-848f-9d97b91bd0f9> | CC-MAIN-2022-33 | https://www.earthdata.nasa.gov/learn/articles/goes-geocolor-worldview | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.890926 | 2,357 | 2.46875 | 2 |
Think you’re ready for the AWS Certified Solutions Architect certification exam? Unveiled during Salesforce’s TrailblazerDX ’22 developer conference, the new capabilities are aimed at enabling more business … This is not necessarily an exhaustive list of all the types of DBAs. There is not a single, simple job out there with the title DBA that fits all IT professionals working with DBA in their title. In 1987, Microsoft partnered with Sybase Solutions for developing DBMS which may compete with other IT giants like IBM and Oracle. Both these companies agreed that Sybase will have all the selling rights and profit earned from the product designed for the Non-Microsoft platform.
If DBA access isn’t possible or necessary, it is also possible to slightly modify the above queries to view the privileges solely for the current user. Retrieving all user privileges within Oracle can range from a simple task using a basic SQL query to an advanced script, depending primarily on how involved the roles and privileges are configured within the server. This tends to be more for the data science jobs, but I’ve seen this start to stretch into the admin roles as well in SMBs as they’re looking for the admin to do more than just admin. One will likely need to work in another role within IT for some time before being trusted enough to handle the sensitive DBA role, meaning that another year to three years is likely. A very lucky few get to become DBAs straight into the job with no experience at all, but this is rare. Using ASM and many disk deep layer software and escaping os from IO make a great jump for performance and management. They are both behind the times and not good options for Big Data or for situations were intelligence needs to be stored with data in a high-performance fashion.
You will work on highly exciting projects in the domains of high technology, ecommerce, marketing, sales, networking, banking, insurance, etc. After completing the projects successfully, your skills will be equal to 6 months of rigorous industry experience. Intellipaat is offering you the most updated, relevant, and high-value real-world projects as part of the training program. This way, you can implement the learning that you have acquired in real-world industry setup. All training comes with multiple projects that thoroughly test your skills, learning, and practical knowledge, making you completely industry-ready. At the end of this SQL DBA training program, there will be a SQL Database Certification quiz that perfectly reflects the type of questions asked in the certification exam and helps you score better. This includes the creation of TestDB database, audit alteration, audit event triggering and more.
A database developer’s job is to develop database applications using programming. The majority of them are experts in SQL as well as other data languages.
- Some examples of these databases are Cassandra, Hadoop and MongoDB.
- A D.B.A. must be well-familiar with structured Query Language and Database Management System.
- Considered all together, becoming an entry-level database administrator means anywhere from two to seven years.
- Oracle SQL Developer can be as simple as running queries against your Oracle Database, or it can be a complete development, management, and modeling solution.
Created clustered and non-clustered indexes on tables for new database to faster retrieval of data for the Reports. Provided software support to home office users, approx 1,500 desktops. As is the case with most jobs, it takes work to become an SQL Database Administrator. Sometimes people change their minds about their career after working in the profession.
Sql Developer And Sql Developer Dba Training Overview
The dba resonsibilities are light here mainly BI reporting databases – no transactional stuff – but I don’t really know what I’m going to ask prospective interviewees when we start that process. I’ve been a sql developer/report writer for many years and have picked up a lot of the dba basics along the way but I definately have holes in my depth of knowledge. The following tables compare general and technical information for a number of available database administrator tools. Please see individual product articles for further information. This article is neither all-inclusive nor necessarily up to date. A related and important skill for a database administrator is SQL tuning, or query optimization. This means creating SQL statements that place the minimum possible load on the database in terms of CPU, memory management and disk access.
Among the duties of DBAs are capacity planning, database design, performance monitoring, troubleshooting, configuration, and installation. They are responsible for security, data recovery, and migration.
Benchmark Factory For Databases
It is more common to find job openings in the area of PHP development as well as C, C++, C#, and Java development skills. Defining SQL Developer As such, a SQL developer is responsible for building databases and writing SQL queries using SQL programming tools. Developers’ most important responsibilities are described by the acronym “CRUD,” which refers to “Create, Read, Update, and Delete” within an RDBMS database environment. So, how long will it take you to become a good DBA—someone who can reasonably be left in charge of at least a mid-sized company’s databases? When considering the most common type of database administrator – a production DBA who looks after a company’s databases – there are a number of variables to consider. Oracle has many tools and facilities for monitoring ,management and tuning..
Database administration is a vital component of the IT environment for any organization that relies on one or more database management systems. Most modern organizations of every size use at least one DBMS, and therefore the need for database administrators is greater today than ever before. Toad has been successfully run by some users via the Windows emulation package on Linux and other platforms, but Quest does not fully support this. SQL, 9%Implemented and maintained security and integrity controls including backup and disaster recovery strategies for document management system and SQL Server databases.
Both Develoment And Production Database Administration Is Needed
This handbook looks at what Oracle Autonomous Database offers to Oracle users and issues that organizations should consider … Document version control can help organizations improve their content management strategies if they choose the right approach, … ; monitor workload and throughput; review SQL performance and optimization; monitor storage space and fragmentation; and view and manage the system and DBMS resource use. And understand the best ways to incorporate database requests into application programs. SQL Developer doubles the features available to the end user with the DBA panel, accessible from the View menu.
As a developer, it’s important to be able to work with others. As a specialist in your area, it’s likely your manager or coworkers will be nontechnical, and you’ll need to be able to communicate effectively with these people. Once they’ve received a degree in Computer Science, college graduates often need assistance in choosing a career path. Our goal is to be objective, simple and your first stop when researching for a new service to help you grow your business. We will help you find alternatives and reviews of the services you already use. Here are some of the tools and services to help your business grow.
Plus, no one wants to sit in a cubicle next to a person cursing at their computer screen. It lets you write queries quickly via the auto-complete feature. You can create dashboards with beautiful charts in a couple of clicks and share them with your team – one of the most valuable features. It also has the feature to let you edit or delete rows in a table, just like sql dba developer a spreadsheet. DbForge by Devart got suites of a database related product to help you with development & administration. DBeaver has all the standard features you can expect from a database tool as a developer, DBA & application analyst. SQL Developer by Oracle is one of the most traditional database tools to offer end-to-end PL/SQL application development.
What Is A Database?
When the script locates a role for the user, it recursively searches for other roles and privileges granted to that role, repeating the process all the way down the chain. The results of the script can be output to the screen or to a file as desired. To resolve this, it is advisable to use an advanced script such as the trusted work of Pete Finnigan and his find_all_privs.sql script. You may also opt for a modified version by David Arthur, find_all_privs2.sql.
- They are the ones who program software, including new programs and features.
- Both database are very stable, secure and usually perform quite well – again depending on what you are looking for.
- Databases are a collection of information that is organized and stored in computers.
- Our goal is to be objective, simple and your first stop when researching for a new service to help you grow your business.
Working with the application development team to ensure that appropriate and efficient SQL is being coded and tested is a big responsibility of the development DBA team. Although production DBAs must constantly monitor and tune SQL , it will be more effective if the SQL is built for performance during the development phase, instead of retrofitted later in production.
Sql Database Administrator Job Description
Programmers need tools to be able to determine what changed as a result of running their programs. The development DBA needs to be able to provide tools to facilitate database testing and data refresh.
Next, one needs to pursue database administrator training and certifications. Becoming a good DBA also requires technical training and database administrator certifications. Most organizations require a four-year college degree in an IT field. Migrating database instances to new hardware and new versions of software from on premise to cloud based databases and vice versa.
These reports can be in the form of pre-formatted reports using the application frontend, or custom-made ad hoc reports by the database administrator. Database Administration consists of everything required to manage a database and make it available as needed. The database administrator is the person who manages, backs up and ensures the availability of the data produced and consumed by today’s organizations via their IT systems.
How Do I Start Sql Developer?
Provide daily productions support for all Windows applications and servers. Provided hardware and software support for clients running a custom Windows-based retail floor-covering management application. Provide technical support for application developers and Unix administrators. Protect selected data that is shown to users in real time without requiring changes to the application.
Along with this, SQL Administrators are also needed to manage, monitor, and secure database servers. So, this combo training course on SQL Developer DBA will provide you with the complete set of skills to help you land high-paying jobs in some of the best companies in the world. Certification programs are available for most of the popular DBMS platforms and many organizations expect DBAs to be certified as a DBA in the database systems they manage.
- Perform software installation, upgrades/patches, troubleshooting, and maintenance on Windows servers.
- Programmers that want to become DBAs usually get a head start on the development role because of their programming experience.
- Many people consider a database administrator (D.B.A.) and a database developer to be the same.
- There are a selection of Application Express reports and you can create your own custom reports.
- After you have proved yourself, you can then be start to be trusted with the organization’s data.
Each job requires different strengths, and it’s wise to evaluate your own personality before moving into one of these roles. PhpMyAdmin- phpMyAdmin is a tool written in PHP intended to handle the administration of MySQL over the Web. Based on our record, SQL Server Management Studioseems to be more popular.
Run And Create Reports
For big high volume applications the back end developer need to be part database developers. For small apps that cannot afford a database developer the application developer has no choice but to do it all. It is a type of computer programmer who develops programs that allow the computers to do specific things. In the world of database management, an administrator manages a database using one of a number of tools. In a world where everyone else works in the same sector, two completely separate jobs occur.
Sql Developer Vs Sql Server Management Studio
Oracle SQL Developer is a free, development environment that simplifies the management of Oracle Database in both traditional and Cloud deployments. DB Visualizer can run on MAC, Windows & Linux and support a large number of databases, including. Data Grip can connect to any RDMS as long as It has a JDBC driver. The following software gives you the flexibility to manage, develop, and easily administer the database. Our job assistance program is aimed at helping you land in your dream job. It offers a potential opportunity for you to explore various competitive openings in the corporate world and find a well-paid job, matching your profile. The final decision on hiring will always be based on your performance in the interview and the requirements of the recruiter.
A database engineer develops databases for various applications. He/she might also either work as a database administrator or supervise the database administrator. His/her duty is to ensure the proper functioning of the database. It is the job of a database engineer to create and manage databases. Developing and building databases based on a specific need is part of this process. An engineer should perform both installation and configuration of the database. It is the job of the database engineer to make sure the databases are secure and functioning correctly.
Many have not only earned a bachelor’s degree in computer science, but also an MIS or an MBA with a concentration on information systems. One of the most confusing parts of being a software developer is the constant changes to coding. Technology is an ever-changing field and as a software developer, it means you must constantly be motivated to do the best you can and pay attention to changes.
Nevertheless, most senior database managers begin their careers as techie DBAs, tinkering with and learning the various aspects of databases and database management. Yet, another type of database administrator is the Performance Database Administrator or Tuning Database Administrator. https://remotemode.net/ This administrator specializes in optimizing and improving the performance of various databases. Simply put, a database’s internal structure consists of data stored within tables. Data access can then be optimized by use of indexes, which read like a book’s table of contents. | <urn:uuid:dc10c0e7-d2dc-4013-911d-d1d4158d7453> | CC-MAIN-2022-33 | https://zoenews.pt/what-does-an-sql-database-administrator-do | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.927339 | 3,013 | 1.648438 | 2 |
Copyright © 2020 Albuquerque Journal
Schools across New Mexico will open the 2020-21 school year with a mix of in-person and online learning.
The Public Education Department is recommending a “hybrid” schedule that alternates the days kids come into the school building, according to Deputy Secretary Gwen Perea Warniment.
That could look like one group of students coming to class Monday and Tuesday for the full school day, while another group would come Thursday and Friday. Wednesday would be remote learning for all students to allow for sanitization before the groups switch off.
“We know that while our educators moved mountains and did amazing things during this period of online and remote learning, it’s not a substitute for our students being able to be physically in community, physically present. So, we want to maximize the amount of in-person learning that our students have access to in a safe way,” Secretary of Education Ryan Stewart said during a virtual news conference Tuesday.
Younger students and students with disabilities will be given priority for in-person learning.
Recovering lost learning
The PED released a 25-page guidance document, which was influenced by a task force, to direct how districts and charter schools educate students in the fall.
In March, Gov. Michelle Lujan Grisham’s administration called for schools to close, ultimately for the remainder of the 2019-20 academic year, to help stop the spread of COVID-19.
Recently, a Legislative Finance Committee report found that school closures due to the COVID-19 pandemic will likely result in months’ to a year’s worth of learning loss for students. PED has raised questions about the report.
In legislative hearings, including during the special session, multiple lawmakers cautioned that if K-12 students are not allowed back into schools this fall, they could fall even further behind academically.
Sen. Bill Soules, D-Las Cruces, who teaches advanced placement psychology at Oñate High School, said the state’s experiment with remote learning after public schools were shuttered in March was unsuccessful.
“It was at very best, better than nothing, and not a whole lot more,” Soules said during a Senate floor debate on a budget solvency bill. “I had highly motivated students and it was not good education.”
In the upcoming year, schools will be tasked with addressing learning loss while adhering to heightened safety requirements to mitigate the spread of the contagious virus.
Specifics on grading and instructional time are unknown right now, but Perea Warniment said the PED will release more information in the future and it will be more rigorous than previous distance learning.
In its reentry guidance, PED writes that “beginning Aug. 3, all schools in the state will be able to start the school year utilizing a hybrid model of instruction.”
“Students will alternate between in-person instruction at the school building and online instruction when at home,” the document says.
APS plan on track
Albuquerque Public Schools has been working on a plan for this scenario. APS Chief Operations Officer Scott Elder, who will take over as acting superintendent July 1, wrote in a statement that the district appreciated the details released by the state.
Stewart said there will be exceptions for medically high-risk students and staff, who should be given virtual or low-contact options to do their work.
Meals will be provided to students on both in-person and distance learning days, according to the plan.
PED deputy secretary Katarina Sandoval said attendance will be reported for in-person days and monitored for remote days.
“If a student wasn’t able to log on for whatever reason, that student wouldn’t necessarily be counted as absent during that particular day, but instead their attendance would be those physical in-person days,” Sandoval said.
The hybrid model will mean extra safety procedures, changing the way school looks and feels for kids.
The number of students in the classroom will be limited to allow for 6 feet of social distancing. PED recommends restrictions on visitors, too.
Students can expect to see signs in classrooms and hallways about how to stop the spread of COVID-19. And they may have to bring water bottles to class as schools are encouraged to turn off water fountains.
Face coverings will largely be required, staff will have to be screened daily and schools must avoid large gatherings, among other requirements.
“It is impossible to avoid all risks of virus transmission in the return to school, but we have the power to greatly minimize the potential for illness if we commit to taking reasonable precautions to contain the virus,” Stewart wrote in the guidance.
As of Tuesday, New Mexico had a total of 10,838 confirmed COVID-19 cases, with 4,874 cases designated as recovered by the New Mexico Department of Health.
“The Department of Health is pulling together their plans for our surveillance testing and rapid-response system. So, they are going to be working with all of our charter schools and districts to make sure that we do have a monitoring and response system in place whenever we see cases get confirmed and need to do the contact tracing and isolation,” Stewart said.
The state says its aim is to “move all schools into a full school schedule as soon as it is safely possible.” But PED added that phasing students back into the classroom has its benefits, such as being able to monitor how a limited back-to-school plan affects the coronavirus spread rate.
The plan also has guidance on remote learning and fully in-person learning, depending on the status of the pandemic in the future.
Journal Capitol Bureau Chief Dan Boyd contributed to this story. | <urn:uuid:18e8c4cd-8a2d-4932-addb-6304ec4073c0> | CC-MAIN-2022-33 | https://www.abqjournal.com/1469099/ped-releases-school-reentry-plan.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.966395 | 1,217 | 1.765625 | 2 |
For discussion board posts, students are responsible for posting one original reflection to the assigned question (reflection post) and two separate follow up responses to posts made by other students (peer responses). A minimum of two peer response posts are required. All posts must engage with course ideas, concepts or theories for the week. Be explicit in bringing them up in your discussion. Make sure to provide any citations of sources used including course lessons and the OER, and provide references for readers to follow along in your post.
*Select an article from an online news media site. Find 2-3 good examples of media bias as discussed in the OER module on Critical Media Literacy. What effect do these have in the media messages that are conveyed to you? | <urn:uuid:b850525e-12ef-49a0-b609-f86c140f2977> | CC-MAIN-2022-33 | https://assignmentswizards.com/discussion-forums-global-citizinship/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.937467 | 151 | 3.203125 | 3 |
Cheboksary is the capital of Chuvash Republic. The town is famous for rich history and beautiful landscapes that open onto the great Volga River.
Art takes an important place in the heart of citizens, so government opened a legal wall for graffiti, and now every artist can show his talent to the town.
Also, citizens are especially related to the Chuvash culture. The artist Ksenia Kokel turned an ordinary building into an interesting art-object, taking as a basis the famous illustration of the Chuvash girl, made by the artist Peter Sizov for the poem “Narspi”. The main idea is to increase the significance and recognition of the Chuvash culture, which has a positive effect on young generations. | <urn:uuid:1246e656-8435-402c-85e4-c123b9c8b0a3> | CC-MAIN-2022-33 | https://interacticity.net/projects/cheboksary/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.955343 | 157 | 2.1875 | 2 |
MANILA, Philippines – The Philippines has asked China to explain the increased presence of Chinese vessels near the disputed Scarborough Shoal in the South China Sea (West Philippine Sea), the defense secretary said Sunday, September 4, expressing “grave concern.”
Philippine Defense Secretary Delfin Lorenzana said a Philippine Air Force plane saw 4 Chinese Coast Guard ships, two barge-like vessels, and two suspected troop ships near the shoal on Saturday, September 3.
“The presence of so many ships, other than Coast Guard in the area is cause for grave concern,” Lorenzana said.
“The DFA (Department of Foreign Affairs) has already called the attention of the Chinese Ambassador and demanded explanation,” he added.
The shoal, which is located just 230 kilometers (650 miles) from the main Philippine island of Luzon, has long been a bone of contention between the two countries.
Lorenzana said that earlier this year, the Chinese tried to bring in dredging barges in an apparent attempt to turn the Scarborough into an artificial island but were dissuaded by the United States.
“If they try to construct anything in Scarborough it will have far reaching adverse effect on the security situation,” he added.
The Chinese Embassy in Manila could not be reached for comment.
Philippine President Rodrigo Duterte has said he intends to ask Beijing – possibly at a regional summit in Laos this week – if they are building up the shoal despite an international court ruling rejecting most of China’s claims in the resource-rich area.
Duterte said Friday, September 2, he had received an “unsettling” intelligence report showing China had sent barges to the contested Scarborough Shoal and had appeared to begin construction in the area for the first time. (READ: Duterte: Hague ruling will be my ‘platform’ for PH-China talks)
A UN-backed tribunal ruled in July that China’s claims to almost all of the strategic sea had no legal basis and its construction of artificial islands in disputed waters was illegal. (READ: CHEAT SHEET: What you need to know about PH-China case)
The United States has warned of “actions” if Beijing extends its military expansion to the Scarborough Shoal.
China has sought to assert its claims in the South China Sea by building a network of artificial islands capable of supporting military operations.
Its massive land reclamation has prompted criticism from the US and claimant countries, with Washington warning it endangers freedom of navigation in international waters. (READ: Duterte to China: You can’t avoid Hague ruling)
Vietnam, Malaysia, Brunei, and Taiwan also have claims to the sea, through which over $5 trillion in annual trade passes.
China took control of Scarborough Shoal in 2012 after a standoff with the Philippine Navy. (READ: Zambales gov to fishermen: Avoid Scarborough Shoal despite ruling)
Duterte, who took office in June, had earlier vowed to mend ties with China after his predecessor Benigno Aquino III angered Beijing by filing the arbitration case in 2013. – Rappler.com | <urn:uuid:8c5f39b8-0c2f-42db-842c-bb44323cd6ee> | CC-MAIN-2022-33 | https://www.rappler.com/nation/145199-philippines-china-explain-ships-scarborough-shoal/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.961561 | 656 | 1.679688 | 2 |
This thesis is a single case study, which utilizes the Better Cotton Initiative (BCI) toidentify favorable organizational structures and practices for multi-stakeholderinitiatives (MSIs) for creating and enabling equality among the involved actors.An inductive research approach is used to analyze BCI’s organizational structure andpractices, who has created sustainability standards for global cotton production,together with the various stakeholder groups of their network. The Actor-NetworkTheory (ANT), the concept of the ‘plot’, and the concept of framing and overflowing,form the theoretical framework of this research. It is applied in order to analyze andidentify how power structures within BCI’s network are identified, how stability iscreated and maintained, and what framing tools and practices are implemented tomanage a large network of diverse actors.In order to answer the research question the set-up phase of BCI is described andanalyzed. Additionally, the same approach is conducted towards BCI’s structure,activities, and organizational dynamics of today. The findings are followed by recentliterature criticizing MSIs for not having an as inclusive network as they claim –based on dominant power structures existing within MSIs and emphasizing theexclusion of especially ‘vulnerable’ actors within the initiative. The criticism willshow that BCI’s structure and various practices contain many characteristics thatcounteract the criticism and how these structures and practices within MSIs arefavorable to lead to equality within its networks. It shows that adaption of thestandards to regional circumstances and the cooperation with local partners are ofgreat value in order to establish a network that is able to respond and consequentlylearn from anticipating and responding to overflows. By doing so it allows the MSI toconsider and incorporate multiple perspectives in their standard setting process andtheir decision making, enabling for a higher degree of equality.
|Educations||MSc in Strategy, Organization and Leadership, (Graduate Programme) Final Thesis|
|Number of pages||87| | <urn:uuid:83b0a15b-a7eb-447e-9d8a-84a7c6335135> | CC-MAIN-2022-33 | https://research.cbs.dk/en/studentProjects/07ac9914-c72c-481b-9a46-8b92e37b80db | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.922543 | 432 | 1.71875 | 2 |
By Wale OLAJIDE.
WITH a more serious and stiff academic effort, I have argued publicly why it is not necessary at all to be born and why being born is always harmful. Besides I have also argued that being born is essentially first a selfish act of two consenting or non-consenting adults even when some cultures even as we speak continue to dress up procreation in metaphysical and religious garb either by claiming that children are gifts from God or gods or that no woman is actually born barren neither can she willingly opt to be one.
I have wondered how loving that God is who after creating human beings and finished serving them out as gifts then turns around without remorse and wipe off same with wars, genocide, hunger and starvation, sickness, tsunamis, mudslides and hurricanes. After all the belief is nothing happens unless God allows it. And when God is not busy doing it himself sometimes he simply watches as suicide bombers give a little helping hand reducing world population.
Being born at all is not only harmful it is essentially a disservice to the one that is born since he or she never asked to be born in the first place neither was he or she consulted or given a chance to at least register some intention or interest. To be born is to be forced into a world that is cruel and at the most wretched, time wasting, pointless and absurd. Who needs it?
The inevitability of death, its unpredictability regarding time or form and the brevity of living itself here on earth bring the absurdity of human enterprise and its tastelessness full circle. And if for some reason longevity is admirable and somehow catches your fancy, I wonder what fun or pleasure is there in living when the individual can no longer remember who he is, where he is, when last he had a meal, when he can no longer feed or clean himself, get up and walk around by himself and had to be put on the veranda to catch some sun as grumbling attendants clean up his room to get rid of the odour of a life slipping away.
There is, of course, the real and present danger of overpopulation, hunger and migration as a result of reckless procreation. The latter has suddenly become bolder and urgently daring, affecting relations among world nations and tipping the balance on what it actually means to be a citizen and if the resources benefits and freedoms available in any one location should be restricted for the use of only those born in that location. International policies on border security have become central to government legitimacy affecting elections and thickening the plot of political partisanship.
While all these are grave issues of human existence and why the plea is that they be urgently tackled if man’s brief stay in the world must have any meaning whatsoever, my concern is about the waste that characterizes human existence itself and why it is neither necessary nor significant to be born.
The two insights are underscored essentially by the socio-cultural existential graph that defines human existence. The cultural emphasis merely defines the significance accorded human life which this author limits strictly to whatever contribution makes the unwarranted survival struggle which is called living somewhat bearable before death. Scholars will, in fact, argue that whatever defines human enterprise when critically appraised is biologically frivolous and therefore pointless and meaningless.
It is grossly misleading, for example, to assert and affirm that life is beautiful while putting a man in the loop and using his endeavours as a gauge. Life simply put is neither beautiful nor ugly, it is simply what it is, life; the enabling element that informs whatever it touches with the pulsating beat of aliveness. What would be correct and justified to qualify with whatever descriptive adjective (beautiful, ugly, fair, wonderful, miserable, sinful) would be is the processes that life informs and makes possible.
Only human life, plant life, animal life as processes can be described and qualified with any adjective. Life itself is neutrally bereft of all and any judgment. In other words, only the living can be appraised and its varied dispositions adjudge as either beautiful or ugly. Life remains untouched. Live with it and by its grace, exit from it as a result of old age or whatever other means suicide inclusive, life is untouched, unmoved, impartial and oblivious of the subject’s plight. Nothing in this participatory existential mode which characterises as living in the world has any intrusive value. All ultimately is insignificant and useless. To be born, to be alive is therefore superfluous.
That cultures since their evolutionary debut have in specific ways confer some meaning and values on the way the people carry on daily is emphatically a determined refutation of their essence as nothing but finite beings and ultimate food for worms. Human life is not only short, it is brief and whatever man has designed to occupy himself with are silly attempts to deny the vicious, deft irreverent blow of death. This self-consciousness makes laughable than the attempt by some religion to paint God as doing man a favour by creating him and giving out babies as gifts. What kind of deity would create such a complex organism only to end up as food for worms? Perhaps a cynical one who uses man’s torments for his own amusement.
Convinced of his own triviality and insignificance you would rather that man will seek early suicide. But no. Such reasoned possibility is ignored and in its place, a yes to faith is chosen with a promise of eternal life. The self-consciousness of human life’s ultimate futility and its vanity nonetheless continues to serve as an indelible backdrop against which man with mindless lunacy erects his heroic games and craze for perpetuity as no one is however deceived but man himself
Here then is the raw deal. Man procreates and so much joy attends. The existential graph is displayed with an upward movement and landmark celebrations of firsts. First tooth, first babble, first step. Up still goes the graph. The first day at school, first certificate, first degree and another and another and yet another. Then marriage, a replication of self by procreation, occupation, acquisition of comfort, promotions, awards and applauds.
Age is on the ride as youthful vitality shifts for aching bones and failing health. Suddenly the subject gets to the summit; careers are attained and fulfilled. No more wars to fight no more land to conquer, no more rivers to cross, suddenly children have become parents, grandchildren now run around in excited noise crashing into furniture. Then you would rather two miles rather than four, because beyond that, you just might fall. Never mind that you used to do six miles some years back. Then comes frequent or yearly visits to the hospital for routine checkups diet regulation, loss of memory, loss of appetite and the desire for sex. Opps! He no longer can recall his name or who exactly is the woman bringing him food. Helping hands are needed to get to the bathroom, take a shower, dress and clean up. Suddenly the bell tolls as he lies in bed. He was eighty-five. Eighty-five on a journey to where?
Some have said that man should carry on and like the Ostrich bury his head in the sand. If he sees nothing then nothing exists either as fear or fate. Has it not been said in fact then that childlike foolishness is indeed the calling of mature men. That definitively is man’s fate living in a world that takes absolutely no notice of him because rightly so, he is just an insignificant speck of dust.
The author, Wale Olajide, is a professor and the head of the Philosophy Department, Ekiti State University Ado-Ekiti. | <urn:uuid:db4069bb-adb8-4cf8-b1d9-a92737ea4b4e> | CC-MAIN-2022-33 | https://www.icirnigeria.org/longevity-and-its-loose-logic/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.966846 | 1,571 | 1.796875 | 2 |
Shop for a film
THANKS FOR ALL THE FISH
Classification: Exempt - Ronin Recommends: G
Runtime: 26 min
Produced In: Australia
Directed By: John Lambert
Produced By: John Lambert, Robin Newell
A FILM ABOUT THE REMARKABLE RELATIONSHIP BETWEEN INDIGENOUS CULTURES,THE DOLPHIN AND THE MARINE ENVIRONMENT.
In Seaworld on Australia's east coast, a curious-looking old dolphin with a white fin no longer performs for the crowds. She now acts as a nanny and mid-wife for the new born dolphins. 'Amity' is the only such animal in captivity in the world. Across a narrow strip of ocean lies 'Minjerribah', Stradbroke Island, and Amity Point from where she was 'collected'. It's here that 'Amity' leads us into a story as old as the Indigenous people that remain there.
The Aboriginal people of Stradbroke Island would call their local dolphins by striking the surface of the water in a coded rhythm. The dolphins recognised the signal and drove the shoals of fish against the shore and into the waiting nets. A portion of the catch was always given back to the dolphins to show thanks and respect.
By journeying through a fishing season, we are drawn into those Indigenous belief systems that made such a relationship with the dolphins possible.
For many descendants, the dolphins are the reincarnation of their 'clever people', maintaining the laws of the saltwater country. Today, in their traditional country, dolphins perform for the tourist dollar, jet-boats race nets around fish, stocks are depleted, marine mammals have been washed up dead, and dolphins have even been the victim of shootings.
Why did the traditional practices break down, and what role can traditional law play in re-establishing an equilibrium between humans and nature? | <urn:uuid:7cbb12d9-1456-410e-9188-aa7f17e90d02> | CC-MAIN-2022-33 | https://www.roninfilms.com.au/video/0/180/686.html?words=what+i+wrote&searchby=details | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.945032 | 428 | 2.1875 | 2 |
The Always-On display is one of the big new features coming with the Apple Watch Series 5. It’s turned on by default and can consume the battery of your Apple Watch. So, in this guide, you will how to turn off or disable Always-On Display on Apple Watch Series 5 and 6 to save battery life.
Meanwhile, The first version to have an Always-On display is the Apple Watch Series 5, a functionality that many users have been calling for. With the Always-On display, there are some great benefits that come. For starters, without having to tap your Apple Watch screen or raise your wrist to enable it, it allows you to check the time discreetly and more.
But the always-on display comes with a big drawback, and the battery life is low. Yeah, it’s going to get you through the day, but every single night you place the watch on the charger at about 20 percent or so. If you turn the Series 5 always-on display off, you can potentially get through two days of use if you are patient enough to use it.
You Might Also Like: How to Take Screenshot on Apple Watch Series
What You Will Learn Here:
Using the Apple Watch AOD
As I said earlier the Always-On display is enabled by default on your Apple Watch Series 5 and 6 and If you would rather not use the Always-On display, you can disable it to save battery life.
Here’s what Apple describes Always-On display:
Always On is turned on by default on Apple Watch Series 5. In this mode, the time is always visible, along with your watch face or the most recent active app.
To preserve battery life, the display dims when your wrist is down, or by a quick gesture of covering the display with your hand. A wrist raise or tap on the screen brings everything back to full brightness and makes the watch screen active so you can interact with your watch.
How to Turn Off the Always-On Display on Apple Watch
Step 1. Click on the Digital Crown on your Apple Watch to go to the home screen.
Step 2. Tap Settings.
Step 3. Tap on Display & Brightness.
Step 4. Now, tap Always On.
Step 5. At last, make sure the toggle switch is off.
Apple also notes you can choose to “Hide Sensitive Complications if you want information such as calendar events, messages, and heart rate to remain hidden when your wrist is down.”
That’s it, your Apple Watch won’t remain on throughout the day, saving you a ton of battery in return. If you want to enable it again, then you can simply move the Always On switch to the on position
Disable Always-On Display in the Watch App on Your iPhone
Meanwhile, you can also disable Always-On Display right from your iPhone as well. Here’s how it’s done:
- Tap the Watch app.
- Scroll down and tap Display & Brightness.
- Tap Always On.
- Tap the Always On toggle button to disable the feature.
This guide was all about how to turn off the Always-On display on Apple Watch Series 5 and 6. By disabling the AOD, you can improve the battery life of your Apple Watch. However, you can either disable it from your iPhone or from Apple Watch itself. Click here to know more about Apple Watch Series 6.
Read More: Most Useful 14 Best Free Apple Watch Apps | <urn:uuid:36b5e4be-8ff0-485e-a530-a8fb73d3a66a> | CC-MAIN-2022-33 | https://shaadlife.com/turn-off-always-on-display-on-apple-watch/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.864683 | 733 | 1.5 | 2 |
To get these headlines delivered to your inbox every week, sign up for our weekly health news roundup.
Experts point to health inequality as Connecticut mask mandates fall along geographic lines
Seamus McAvoy, Hartford Courant, Feb. 28
While Connecticut’s largest cities will continue masking in schools, most suburban and rural communities will drop their requirement. Vaccination rates in urban school districts, which primarily serve children of color, lag behind neighboring towns. Advocates point to this inequity as just one example of the uneven burden that communities of color have faced during this pandemic and call for a deeper examination of the inequities and how to remedy them.
State leaders advocate for more children’s mental health services
Catherine Shen, Connecticut Public Radio, Feb. 27
More than 250 people signed up to speak during the public hearings about expanding children’s behavioral health services and workers support. One of the speakers, Antonia Edwards, described losing a grandchild and the role that racial bias plays in access to culturally appropriate behavioral health care.
Panel urges changes to make US organ transplants more fair
Lauran Neergaard, The Associated Press, Feb. 25
A new report from the National Academies of Sciences, Engineering, and Medicine calls for an overhaul of the U.S. transplant system. With more than 100,000 on the nation’s waiting list for an organ donor, many more people, particularly people of color, never make it on the list. Black Americans are three times more likely to suffer from kidney failure than white people but far less likely to be referred for transplant evaluation.
Why pregnant people were left behind while vaccines moved at ‘warp speed’ to help the masses
Liz Szabo, Kaiser Health News, Feb. 24
Despite being a high-risk population, pregnant people were left out of early COVID vaccine studies. This complicated the messaging about vaccination for pregnant people, which advocates say contributed to widespread vaccine hesitancy. Health officials have since urged pregnant people to become vaccinated, especially Black women who were already at higher risk of maternal and infant mortality before the pandemic.
Opinion: Providers must self-examine to explain Black maternal health disparities
Dr. Lucinda Canty, CT News Junkie, Feb. 25
To combat Black maternal health disparities, health care providers must examine their own behavior that may discriminate against Black women, such as bias in responses when Black women experience pain. In addition, increasing access to doulas can provide support and advocacy to more people during pregnancy and childbirth. | <urn:uuid:3034e593-409d-4137-abeb-6125d58bd948> | CC-MAIN-2022-33 | https://www.cthealth.org/latest-news/health-news-roundup/connecticut-mask-mandates-fall-along-geographic-lines/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.947095 | 528 | 2.171875 | 2 |
|This home page of the
Thorn (DD 988), maintained by the US Navy. Yes, the Thorn/e family has its very own US Navy Ship.
In fact, there have been two! The first, the
Thorn (DD 647), which saw extensive action during WWII in the Pacific.
The newest of "our" fleet was christened on
February 3, 1979.
After years of valiant service it was decommissioned on August 25, 2004.
the underlined link or the pictures to the left will take you to the sites dedicated to the USS Thorn.
They provide a rich history of the original ship as well as for its namesake, LT. Jonathan Thorn and his heroic naval exploits.
LT. Thorn is my 2d cousin, 6 times removed. While he is one of the more famous Thorns in military history (there have been many
others), I'm proud of ALL members of the Thorn/e family and the courage they have demonstrated to protect and defend this Nation we proudly call home.
a 20 year Army retiree, having served 10 years on the Staff and Faculty at the United States Military Academy, West Point, I find it rather ironic that
one of my ancestors served with such distinction and honor in the Navy!
Still....Go Army, Beat Navy! | <urn:uuid:8f4f3016-2083-4ab2-9188-c94e948c9c11> | CC-MAIN-2022-33 | https://thornfamily.net/thorn/thornlineage/thorne_family_special_pages.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz | en | 0.966423 | 297 | 1.507813 | 2 |
(This is the second blog post in a series of similar posts on gender equality in South Korea – Click here for the first post in the series)
Last year, South Korea’s population declined for the first time, with the fertility rate dropping to an all-time low. Although an increase in unemployment and falling incomes driven by the pandemic have contributed to the large drop, these figures have highlighted the ongoing demographic challenges of a contracting population. As a result, the government is under growing pressure to change critical policies to mitigate the fallout of a rapidly aging society and one of the world’s lowest fertility rates. One of the many factors affecting population decline is South Korean women’s growing unwillingness to have children due to the societal challenges it entails. Pressure to adhere to traditional gender roles and an unsupportive workplace culture are disincentivizing women to have children.
Advice for Pregnant Women
In March, the Seoul city government sparked outrage when a bizarre set of municipal guidelines for pregnant women surfaced. The advice published on the website of the Seoul Pregnancy and Childbirth Information Centre contained recommendations (since removed) for expectant mothers in different stages of their pregnancy and was panned for invoking antiquated gender stereotypes. The Centre advised pregnant women to continue doing household duties and consistently look at clothes that they wore before their pregnancy to encourage “healthy weight”. In preparation for going to the hospital to give birth, women were also told to prepare meals and clean clothes for their husbands who are “unaccustomed to cook”. After giving birth, they should also think about their appearance; not to look “disheveled” and therefore they are advised to use a hairband. In the end, the advice was taken down after massive criticism. Its influence, though, is still felt, and it has revived the discussion over why so many South Korean women increasingly are choosing not to have children — a rather concerning trend for a country dealing with a shrinking and aging population.
South Korea’s fertility rate fell to 0.84 last year, making it the lowest in the world. Even before the pandemic, in 2019, the average South Korean woman had just 1.1 children, compared to the global average of around 2.5 children. A major component in South Korea’s population paradox is that the fertility rate does not meet the replacement threshold of 2.1, the point at which the total number of children born per woman in a population exactly balances off the number of deaths. Without migration, there aren’t enough children born in South Korea to keep the population stable ultimately resulting in demographic contraction. According to a UN forecast, if current trends continue, South Korea’s population will be approximately 29 million by 2100, the same as it was in 1966. Such a decline would push up South Korea’s dependency ratio and have detrimental economic and societal consequences.
Gender Roles and the Double Burden
Women’s participation in the workplace has increased as the South Korean government has taken a number of steps to promote better work-life balance, including revamping the parental-leave system and increasing the number of daycare centers. Despite government action, traditional gender norms continue to hamper progress in many areas. For instance, the notion that women should be caregivers and be responsible for the main household duties is still prevalent. As a result, many female workers are hesitant to start a family or marry as they do not want the double burden of dealing with a career and being the main caregiver of the family. These gendered expectations undermine women in the workplace as employers assume that a female worker will eventually take parental leave. Faced with simultaneous societal and professional pressures emanating from traditional gender roles, it may be unsurprising that South Korean women increasingly choose not to have children.
South Korea’s large population drop last year has increased pressure on the government to change relevant policies. The government’s newest five-year plan to combat ‘Low Fertility and Aging Society,’ unveiled in December 2020, contained several policies to improve work-life balance for both men and women. In the next years, it will be interesting to see how effective these initiatives are. However, true transformation will not be achievable without a fundamental change in societal values, particularly gender norms. Falling back on traditional gender expectations when giving counsel to South Korean pregnant women is an example of counter-productive tactics that exacerbate the problem.
The recent population decline has heightened the urgency to eliminate persisting gender stereotypes and demonstrated that aiming for a more gender-equal society in South Korea and moving away from old gender norms is not only a worthwhile goal in and of itself, but is also essential for the population’s future. | <urn:uuid:5ce35eaa-f676-4ba3-8973-cdabcc17a24a> | CC-MAIN-2022-33 | https://isdp.se/concerns-for-the-future-population-decline-and-counter-productive-gender-norms/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.955257 | 971 | 2.96875 | 3 |
TENCEL™ Lyocell is a natural cellulose fibre, which is extracted from wood. The fibrillous structure of this innovative material absorbs excess moisture and transports it outwardly, with a natural kind of blotting paper effect – for dry sleeping comfort and an ideal skin climate. The development of bacteria is inhibited before it can start. TENCEL™ Lyocell fibre is more absorbent than cotton, gentler than silk and cooler than linen.
Picture source: Lenzing AG
In comparison with synthetic fibres, the bacterial growth can be reduced by up to 2000 times, thanks to TENCEL™ Lyocell fibre.*
*Laboratory study “Bacterial growth on textiles”: University Professor Dr. B. Redl, Medical University Innsbruck, 2006
wenaPur® mattress core
wenaCel® sensitive mattress cover
wenaCel® sensitive comfort all-season duvet
wenaCel® sensitive comfort summer duvet
wenaCel® sensitive comfort pillow
wenaCel® sensitive orthopaedic pillow
wenatex® AquaStop mattress protector
Hygiene technology for the cleanest sleeping quality.
For a sense of well-being: the unique Wenatex hollow fibre.
wenaCel® sensitive orthopaedic sleep system. | <urn:uuid:594fa290-96e2-4a2e-b31b-23fc42a19cd9> | CC-MAIN-2022-33 | https://www.wenatex.com/en/products/hygiene-and-sleeping-comfort/tencel/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.79831 | 292 | 1.851563 | 2 |
Across the country, communities are wrestling with how to identify and dismantle the root causes of health inequities, like structural racism, that have persisted for centuries. Data are powerful tools that can be used to measure and address multiple dimensions of community health. However, the data systems that are used to track drivers of community health have been rooted in racist systems and assumptions. We must invest in building data systems that explicitly take on structural racism. These data systems must reflect the assets and needs of communities of color and advance upstream changes in power, access, and opportunity.
Today we launched Modernized Anti-Racist Data Ecosystems (MADE) for Health Justice — a new, multi-year initiative supported through a partnership between the Robert Wood Johnson Foundation and the de Beaumont Foundation. MADE for Health Justice seeks to accelerate the development of health-focused local data ecosystems that center principles of anti-racism, equity, justice, and community power. Through MADE for Health Justice, five non-profit organizations will be awarded up to $1,000,000 over three years to facilitate a multisector team tasked with building local data ecosystems focused on anti-racism, equity, justice, and community power.
From Local Data Systems to Interconnected Ecosystems
Within every community, there are local data systems — collections of organizations, people, processes, and policies within a local geography that are involved in data collection, management, analysis, and use. These systems include data across every sector, including housing, transportation, education, land use, and employment. Like pieces of a puzzle, they contain vital information that, if connected, could provide invaluable insights into the structural drivers of community health.
But when these data are used in isolation — and without critical input from the communities they impact and reflect — at best, they create a distorted view of a community’s health and well-being. At worst, data are used to fuel narratives, policies, and decisions that perpetuate structural racism and the health inequities it creates.
To realize their full potential, local data systems must be restructured to become ecosystems — interconnected generators of information that ultimately dismantle structural racism and improve community health. These ecosystems must connect data across multiple sectors of local government, prioritize the needs and voices of communities oppressed by structural racism, and ultimately drive just and equity-centered decision making.
Phase 1 applications for MADE for Health Justice are now open and will close on August 31, 2022. The initiative is part of a multi-faceted effort to create a more equitable national public health data infrastructure, inspired by the National Commission to Transform Public Health Data Systems established by RWJF. To learn more about this funding opportunity, view virtual sessions that discuss the initiative, and to apply, visit www.madeforhealthjustice.org or email email@example.com. | <urn:uuid:6f70b01b-a3ef-4af3-8849-eafcf099a03e> | CC-MAIN-2022-33 | https://debeaumont.org/news/2022/introducing-made-for-health-justice-a-new-initiative-and-grant-opportunity/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.930555 | 581 | 2.21875 | 2 |
Get radiation therapy tailored to your needs and schedule at UNC Health Johnston. You can stay near home in Clayton or Smithfield for the latest technology thanks to our partnership with UNC Rex Healthcare.
What is Radiation Treatment?
Radiation kills cancer tumors by using high-energy waves you can’t see or feel. At UNC Health Johnston, a linear accelerator sends beams of radiation into your body as you lie on a table. This machine can treat cancer almost anywhere in your body.
Trust your care team to use advanced technology that makes treatment more effective and limits side effects.
Intensity Modulated Radiation Therapy (IMRT)
IMRT adjusts the radiation dose to match the exact shape of your tumor. The radiation beam may rotate around you to get the best angle. This means more radiation can go to your tumor, and less goes to surrounding healthy organs.
Image Guided Radiation Therapy (IGRT)
IGRT uses images taken of your tumor before and sometimes during radiation treatment. Your care team compares these images to older images to see if your tumor has moved. If it has changed position, your radiation team will adjust treatment to target the cancer better.
You may benefit from IGRT especially if your tumor is in the lungs or another area that moves as you breathe.
Certified Radiation Experts
Rest assured you’ll be in the qualified hands of:
- Board-certified radiation oncologists (cancer doctors) from UNC Rex Healthcare
- Certified medical dosimetrist (optimizes your radiation dose)
- Certified radiation therapists (provide the treatment)
- Medical physicist (evaluates and monitors your treatment)
- Oncology Certified Nurses (caregivers with advanced training in cancer)
Your Comfort During Treatment
Ask your care team members for help relaxing during radiation therapy. They can provide warm blankets and recommend comfortable positions for your treatment sessions. After treatment, enjoy refreshments at the coffee bars in our radiation oncology locations.
In some cases, your doctor may recommend brachytherapy (internal radiation). This type of treatment places tiny radioactive pellets in or near a tumor in the prostate, breast, or another organ. If you need this therapy, we’ll help you get care at REX-UNC Radiation Oncology-Raleigh. | <urn:uuid:645c05ff-4e39-4d82-84bf-88b77d07a3a6> | CC-MAIN-2022-33 | https://www.johnstonhealth.org/care-treatment/cancer/radiation-therapy/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.923342 | 479 | 2.15625 | 2 |
By Jennifer McDougall
Addiction is often a complicated problem, especially when the person suffering from addiction is your parent. Addiction affects the entire family and can strain relationships, finances, and much more. If you’re trying to help a parent who struggles with drug or alcohol addiction, it’s important first to take care of yourself as well as possible. Once you’re in a better position to be able to support them through treatment and recovery, there are steps that you can take to both support their recovery while also protecting yourself from co-dependency issues that may arise during their healing process.
Don’t blame yourself.
You may feel guilty for your choices during your relationship with your parent, but don’t be. The fact is that no matter how much you try to help them and how many times they say they will change, they have to be ready and willing to go to treatment and get the help they need. Addiction has four main causes: 1) a chemical imbalance 2) events of the past not reconciled with 3) current conditions they struggle to cope with 4) things believed that are untrue.
If you want to help your parent, it’s best to identify and address one (or all) of the 4 core issues mentioned above.
Check-in on your own mental and physical health; you’ll need it to support your parent.
You might not be aware of this, but your mental health affects your physical well-being. For example: If you are experiencing depression or anxiety, it could be causing gastrointestinal problems like indigestion and bloating. Or if something is bothering you that’s making it hard to sleep at night, which can lead to a headache during the day.
So when it comes to supporting a loved one struggling with drug or alcohol addiction it’s crucial you stay connected with your own health and wellbeing. Take time for yourself and prioritize your wellness needs.
Please educate yourself about addiction and how it works.
If you’re reading this, it’s likely because you’re concerned about a parent or other loved one struggling with addiction. While feeling overwhelmed by the situation is normal and expected, having the knowledge to draw upon will help you better understand what your loved one is going through and make informed decisions regarding assisting them to find treatment.
If a person has an addictive personality type, they may be prone to developing an addiction later in life. An addictive personality means they have low self-esteem and low-stress tolerance—and are often perfectionists as well as impulsive risk-takers that have difficulty controlling their emotions, all of which present challenges for managing substance abuse.
At Passages Addiction Treatment Centers, we do not believe addiction is a disease, but rather a symptom caused by, 1) a chemical imbalance 2) events of the past not reconciled with 3) current conditions they struggle to cope with 4) things believed that are untrue. Our non-12-Step treatment philosophy is an empowering approach to helping individuals worldwide, break free from substance abuse-related issues and become the best version of themselves, without shame and without labels.
Talk to other people who’ve been there.
It is helpful to have someone you can talk to about your situation. Talking with people who have been through similar circumstances can help you gain perspective and comfort and guide how to handle things. Here are some people you should consider talking to:
- Other family members who have shared experiences with your parent
- People who were in the same situation with their parents when they were young
- People who were in the same situation with their children when they were young or currently are in such a position now
- Friends or acquaintances that are facing similar situations
- Recovery support groups where you can be open and honest in a safe place
Grieve the past of how things were before addiction stormed in.
Sometimes it can feel overwhelming of what’s happening to someone you love and care about. Grieving the past is healthy but don’t let it take up too much time. Let yourself pour out all the frustrations and pain you’ve been feeling. Cry if you feel like it. There is no shame in crying, in fact, it’s a good thing. Talk to a therapist to help make sense of everything you’re feeling and experiencing. It’s important you don’t take on all the pressure that comes from watching someone you love suffer from addiction.
Stop enablement as soon as possible.
- Stop enabling your parent immediately. Don’t give them money, don’t make excuses for them, and don’t do their chores or clean their house.
- Don’t cover for your parent’s addiction by caring for their children or pets. This will only extend the problem and could also put you in danger.
- This should be obvious but don’t drink or use drugs with them.
- Don’t encourage them to hang out with people who drink and use drugs.
- Don’t encourage any type of toxic behavior.
- Invite them to do things that don’t involve drinking or getting high.
Recognize a co-dependent relationship and get out of it.
If you suspect that your parent is having problems with drugs or alcohol, there are ways you can help. But first, recognize that even if your parent seems happy and has no apparent problems, they might have other issues going on in their life. For example, if they’re struggling with addiction, they may try to hide it from you because they don’t want to worry or burden you by talking about it.
Perhaps they have ingrained their habits so deep into their lifestyle that they see nothing wrong with it. Maybe they show no signs of wanting to change or be better. The important thing to keep in mind is that it is not your responsibility to save everyone. All you can do is be there for them, especially when they want to open up and talk about what is going on in their life.
Mentioning your concern is good but know that it could cause a dispute as your parent might take offense to you mentioning the obvious. Don’t worry, this is normal and you’re not doing anything wrong by pointing out that you’re concerned and want them to be more mindful about their choices so they can live a long, happy, and healthy life.
Individuals are likely to take advance and overstep boundaries with people closest to them because they are in desperate need of help and don’t know where to turn or what to do. The trouble is when they become co-dependent on you for every little thing in their life. That is something you need to pay close attention to so you don’t get sucked in through manipulation and games of guilt. Stand your ground and protect yourself by having solid boundaries.
Set boundaries with your parent, and don’t be afraid to enforce them.
- Set boundaries that you are comfortable with.
- Enforce them when necessary.
- Your parent may be dealing with withdrawal symptoms when they first get sober, so prepare yourself for this and make sure they understand your boundaries before enforcing them; as difficult as it might be at times, try not to let your frustration get in the way of supporting your parent’s recovery process. Remind them to reach out to their therapist or doctor.
- Live your own life and show up for yourself. Don’t slip on your responsibilities.
- Lead by example. Show them how much more fun and enjoyable life is without drugs and alcohol. Show them how a prosperous life is achievable through sobriety by doing it yourself.
Help them find an effective treatment program.
By now you probably realize, you’re parent should definitely enroll in a treatment program. Here at Passages, we have everything your parent needs to successfully recover from substance abuse and get back on their feet. One of the best aspects of treatment at Passages is our non-12-Step treatment approach along with a vast variety of holistic healing methods that your parent can discover and heal their underlying conditions.
The Passages Difference
- Holistic treatment philosophy
- Non-12 Step
- 60-80 hours of one-on-one holistic treatment
- Highly experienced therapists and physicians
- Cutting-edge treatment modalities
- Strong focus on treating the underlying conditions that cause dependency
- Your treatment program will be designed specifically to your needs
- Top-level detox process – 24/7 nursing with an addictionologist MD
- We do not subscribe to the disease concept of addiction
- We do not use degrading labels like addict or alcoholic to define you
- Five-star amenities including well-appointed suites, a gourmet chef, an ocean-view pool, hot tub, tennis court, and a fully-equipped fitness center
- Rated “The Number One Rehab in the World” by HealthCare Global
- Addiction Ends Here®
It can be hard when a parent struggles with addiction, but you can’t solve their problems for them – all you can do is take care of yourself, set boundaries, and offer support if they want it.
You can be your parent’s biggest advocate by encouraging and empowering them to be the best version of themselves, without drugs and alcohol. Live by example and show them how wonderful sobriety is. Never blame yourself for their problems and do your best not to absorb any kind of guilt by not living up to some sort of expectation they have for you.
- Don’t blame yourself. Your parents are responsible for their actions and decisions.
- Don’t enable it. It’s important to set boundaries and let your parents know that certain behaviors aren’t acceptable. If they keep overstepping your boundaries, don’t hesitate to get professional help from a therapist or counselor specializing in substance abuse issues.
- Don’t ignore the problem. Ignoring it won’t make it go away; ignoring it will only worsen things as time passes (which is bad news for everyone).
- Don’t feel sorry for them or take responsibility for their problems; instead, focus on taking care of yourself so that you are strong enough to handle whatever comes your way.
- Encourage them to get professional, non-12-Step therapy at Passages Addiction Treatment centers and experience holistic healing and lasting sobriety.
Take care of yourself, and remember that no one can save your parent from addiction but themself. They have to want help. All you can do is be supportive, loving, and encouraging. You can’t make them stop using drugs or alcohol, but you can help guide them in the right direction. The most important thing is to stay strong for yourself and your family. Hope is always on the horizon. There are better days ahead if you believe there are. Stay hopeful and stay positive.
Non-12-Step Addiction Rehab at Passages
Passages Malibu is an alternative to traditional rehab that provides a holistic, client-centered approach to addiction treatment. Find lasting healing through our model of care and experiential therapies. You will uncover the root causes of your addiction, and we will provide you with tools for lifelong sobriety and change. We can help you turn your life around and find hope again. Call (888) 397-0112 today for more information. | <urn:uuid:8a0b12c5-9727-4e9e-b041-d6c5ef667eea> | CC-MAIN-2022-33 | https://b.passagesmalibu.com/how-to-help-a-parent-struggling-with-drug-or-alcohol-addiction/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.955888 | 2,375 | 2.078125 | 2 |
“It’s so exciting every time I still feel like a little boy,” he said. “I need my hat and gloves on, and my windproof jacket, but it’s absolutely magnificent. I’d much sooner be here than in a centrally heated house.”
For Gardner, who moved with his wife Janet from suburban England to a remote corner of the Scottish highlands at the age of 50, climbing mountains has become more than just a boyhood dream.
Two years after being diagnosed with Alzheimer’s in 2018, Janet, a former teacher who also suffers from osteoporosis, became so ill she needed 24-hour care. Gardner was devastated and decided he needed a challenge to help him cope.
“When it got too much for me to handle, when she went into hospital and care … I just didn’t know what to do. We’ve been used to each other’s company all 24/7 for 30 years. And then suddenly it’s gone,” he said.
Climber Nick Gardner pauses as he ascends Buachaille Etive Mor in Scotland, Britain, on Sept. 29, 2021. (Russell Cheyne/Reuters)
“Doing this climbing has enabled me to refocus to some extent. I had to find something of this type, otherwise, I’d have had … mental health problems. I know that.”
The task he set himself would challenge many half his age—to climb all 282 of Scotland’s “Munros”, or mountains above 3,000 ft, in 1,200 days. He has completed 177 so far. In honor of Janet, he is raising money for the charities Alzheimer Scotland and the Royal Osteoporosis Society.
Learning about social media as he goes, he records his progress on Facebook and Instagram. Many of the messages on his fundraising webpage, where he has raised more than 30,000 pounds (approximately $40,000) of a 40,000-pound (approximately $54,000) target, are from people he has met on the mountainside.
“I think (it was) the third mountain I climbed where I just happened to be chatting to other climbers and I just happened to mention what I was doing for this challenge. And they couldn’t believe it … They were amazed,” he said.
“Obviously, I thought, I’ve got something here. I really have. And I didn’t realize the potential. And so ever since then, when I see people on the hill, I stop them and have a little conversation with them, tell them what I’m doing.”
By Natalie Thomas | <urn:uuid:d482f41e-eec7-473d-afd6-9bbb42d7e9d7> | CC-MAIN-2022-33 | https://zotanews.com/lifestyle/meet-the-81-year-old-climbing-scottish-mountains-for-his-sick-wife | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.977185 | 577 | 1.5625 | 2 |
Search within the city
Bordered by the Atlantic Ocean on the eastern portion of the state and nestled by rolling hills and the Great Smoky Mountains on the western portion of the state, North Carolina is filled with beautiful scenery and a compelling landscape that makes the state phenomenal for most any lifestyle. But, the pristine beauty the state offers only begins to describe the appeal it has. Thriving industries, low cost-of-living, and a thriving agricultural sector are among the highlights of the state.
The education system in North Carolina is superb, with options like the University of North Carolina Chapel Hill, North Carolina State University, and UNC Wilmington among the top colleges. About 34,000 students attend one of the state’s 17 universities each year.
The state borders South Carolina, Tennessee, Virginia, and Georgia, which draws in more residents. More than 9.9 million people call North Carolina home, making it the 9th most popular U.S. state. Raleigh, the state capital, ranks as one of the 10 fastest-growing cities in the United States. | <urn:uuid:383adb77-7ff0-4b7e-9d41-320c63e04ee4> | CC-MAIN-2022-33 | https://renttoownreviews.com/north-carolina/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz | en | 0.924934 | 221 | 1.65625 | 2 |
07 May The HIPAA Risk Assessment Checklist for Eye Care Professionals
HIPAA compliance and HIPAA risk assessments are challenging tasks for many optometry and ophthalmology practices. There is one compliance task you can’t do once then sweep under the rug—and that’s to perform a HIPAA security risk assessment or risk analysis regularly for your business.
Failing to perform a thorough risk assessment continues to be one of the most common HIPAA violations. If you bury your head in the sand and don’t conduct regular HIPAA risk assessments, not only can it lead to a data breach, the Department of Health and Human Services (HHS) Office for Civil Rights (OCR) could impose hefty fines, anywhere from $100-$50,000 per violation or per violated patient record.
Cybersecurity attacks occur more frequently today. The KPMG 2017 Cyber Healthcare and Life Sciences Survey reports that “47 percent of healthcare providers and health plans said they had instances of security-related HIPAA violations or cybersecurity attacks that compromised data compared with 37 percent in KPMG’s 2015 survey.”
According to the Office of the National Coordinator for Health Information Technology (ONC), many healthcare providers are misinformed that by merely installing a certified EHR, this fulfills promoting interoperability and meaningful use security risk analysis requirements.
That’s not true, says the ONC: “Even with a certified EHR, you must perform a full security risk analysis. Security requirements address all electronic protected health information (ePHI) you maintain, not just what is in your EHR.”
What is the HIPAA Security Rule and Why Must You Comply?
The HIPAA Security Rule defines technical and non-technical safeguards that require health plans, health plan clearinghouses, and any healthcare provider to implement essential security safeguards to protect both printed and electronic Protected Health Information (ePHI).
PHI is any information in the patient’s medical record that identifies the patient. The Security Rule encompasses computer systems and electronic transmissions of patient information that is created, received, maintained, or transmitted by the covered entity (healthcare provider) or business associate (EHR vendor).
HIPAA requires all healthcare providers to conduct ongoing HIPAA security risk assessments to ensure their office is compliant with administrative, physical, and technical safeguards. These safeguards (as described below per HHS) protect the confidentiality, integrity, and availability of PHI.
- Administrative Safeguards: “Manages the selection, development, implementation, and maintenance of security measures to protect ePHI and to manage the conduct of the covered entity’s workforce in relation to the protection of that information.”
- Physical Safeguards: “Physical measures, policies, and procedures to protect electronic information systems and related buildings from natural and environmental hazards, and unauthorized intrusion.”
- Technical Safeguards: “The technology and the policy and procedures for its use that protect ePHI and control access to it.” HHS defines this as the Minimum Necessary Requirement, which means only those people who need access to the patient information to perform a specific job function should have access to ePHI.
Our HIPAA Compliance Guide for Eye Care Professionals reviews several steps you must take to protect the privacy and electronic security of PHI.
The Time for a HIPAA Security Risk Assessment is Now
To jumpstart your HIPAA security risk assessment, First Insight has put together two Risk Assessment Checklists (cloud and traditional server versions). These checklists will help you conduct a security audit as it relates to your optometry and ophthalmology EHR for promoting interoperability and the Merit-Based Incentive Payment System (MIPS).
The questions included in these checklists are from the HealthIT.gov Reassessing Your Security Practices in a Health IT Environment. The checklists are only a reference and starting point to help small- to medium-sized practices assess their health information technology (health IT) by conducting a security audit as it relates to an EHR.
- Download EHR Security Risk Assessment Checklist (Cloud)
- Download EHR Security Risk Assessment Checklist (Traditional Server)
Pro Tip: Download the free ONC and HHS Security Risk Assessment (SRA) Tool and view SRA videos. These tools will help guide small- to medium-sized practices with conducting a security risk assessment. Use the assessment results report to help determine risks associated with your policies, procedures, information systems, and methods to alleviate weaknesses.
Choose an EHR That Keeps Up With HIPAA Compliance
Is your eye care EHR certified for data encryption? And does it include built-in functionality that adheres to HIPAA requirements for user access controls, privacy, and security? If you’re not sure, it’s time to evaluate your EHR system and perform a HIPAA security risk assessment to safeguard your practice from potential security threats.
MaximEyes EHR is ONC 2015 Edition Health IT certified for quality reporting and Promoting Interoperability (PI) Programs. We adhere to IHE (Integrating the Healthcare Enterprise) HL7 standards and functionalities that improve the interoperability of healthcare information systems.
It’s time for you to feel more confident about an EHR and practice management system that keeps up with HIPAA compliance. Request a demo of MaximEyes today.
This blog is meant as an educational resource and does NOT constitute legal HIPAA advice. Covered entities (eye care providers) are responsible for taking the necessary steps needed to protect the confidentiality, integrity, and availability of protected health information (PHI) and complying with the HIPAA security and privacy rules. | <urn:uuid:35366d60-25cd-40e5-82eb-585c62e71cec> | CC-MAIN-2022-33 | https://www.first-insight.com/blog/hipaa-risk-assessment-checklist/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.914627 | 1,181 | 1.609375 | 2 |
Skip to main content
Visit UNICEF Global
Jobs at UNICEF
WHAT WE DO
RESEARCH AND REPORTS
Search area has closed.
Search area has opened.
Created with sketchtool.
18 May 2022
Exploring the Power of Play
UNICEF's ‘Community-Based Family Support Services’ project
04 March 2022
How to raise a healthy eater
6 ways to set your child on the path to a lifetime of positive habits.
04 March 2022
Concerned about your child's weight?
Tips on how to support them with empathy and kindness
09 October 2020
Four things you can do to support your teen’s mental health
Show your teenager love and care, while looking after yourself.
28 September 2020
How to discipline your child the smart and healthy way
Positive discipline for better mental and physical health and a happy childhood.
14 May 2020
Safe School Return Parents Guides
A poster for online or print with guide parents need to know about their children returning to school.
24 April 2020
Balancing Parenting Time and Me Time
Tips for spending quality time with your child during the COVID-19 pandemic
23 April 2020
Must-reads for parents, caregivers and teachers
UNICEF is working with health experts around the clock to provide you with tips and guidance.
21 April 2020
How parents can help their children go back to school
Here are some tips for talking to children, sharing correct information, and supporting school safety efforts.
17 April 2020
Social and Emotional Learning
SEL sub-page publishes weekly activity-based parenting messages and tips to support children's psychosocial needs during the COVID-19 pandemic.
What we do
Campaigns and events
Safe School Return Campaign
Key to Kindness
Every Child ALIVE
Early Moments Matter
Report fraud, abuse, wrongdoing | <urn:uuid:56d216d0-2de9-4d81-be2f-cbdf76efe962> | CC-MAIN-2022-33 | https://www.unicef.cn/en/topics/parenting?items_per_page=10&page=0 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.849769 | 635 | 2.078125 | 2 |
When you first get your nose pierced, your two best options for starter nose rings are labret studs and actual hoops. Hoops, like captive rings, are a good option because they’re unlikely to put pressure on your nostril if it swells during the healing process.
Keeping this in view, what size stud are noses pierced with?
Hereof, can you put a nose ring in a stud piercing?
Yes, you can. But, it is best not to. Depending on what size of ring you use it can cause the shape of the fistula your body creates to be slightly curves due to the jewelry being that shaped.
Is it better to get a nose ring or stud?
You can choose either a stud or a hoop as your initial jewelry, but the hoop will cause the piercing to heal with a slight curve, so it’s recommended that you start with a nose stud. … It’s important to note that your first jewelry will need a longer prong in order to accommodate swelling.
If your earring is made of safe material and is small enough to fit into your nose piercing, then you can always get a piercer to insert it for you. Alternatively, you can insert it on your own but with lots of caution. All you need to do is to ensure that it is well-sanitized to avoid any infections in the long run.
To prep for removal, gently push outward on the end of the piercing inside your nose. It should begin to slide out. Gently twist it as you push it through your nose, following its curve. Depending on your jewelry, it make take two or three full twists to come through.
Like any other piercing, there’s some discomfort and mild pain with a nose piercing. However, when a professional performs a nostril piercing, the pain is minimal.
Nose piercing may damage a nerve and cause numbness or pain.
Nostril screws have a spiral-type curve halfway down the stud and this threads through the piercing then rests against the inside of the nostril to keep the jewelry in place. L bend nose rings stay in the same way, but they have a 45-degree bend instead of a twist/screw.
If your piercing is fully healed and you’re using the correct gauge (thickness) jewellery, it shouldn’t hurt to change from a stud to a hoop. It might feel a bit odd, but it shouldn’t hurt. My piercer changed my stud to a hoop, and it didn’t hurt. If it is healed it does not hurt. | <urn:uuid:3f98774a-39b7-4de9-bc56-5ee87378def2> | CC-MAIN-2022-33 | https://www.bodysjewelryreviews.com/what-is-the-best-jewelry-for-a-nose-piercing-e6f4fa09/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.929218 | 561 | 1.625 | 2 |
Minimal Day Sampler
Block Two: Fringe
It seems like everyone is off to a good start with last month’s Quarter Opals blocks. How did you find it? Any trouble with the appliqué at all? The blocks I’ve seen look fantastic! What’s even better still, is that none of you have sworn directly at me (at least not yet), so I take that as a good sign. Ready for more?
This month’s block is called Fringe, based on the elongated teardrop shape of the metal pieces that dangle from the inspiration pendant. (You can see it in the photo on the January post.)
All of the remaining blocks will use templates in some way. Don’t worry though! They are really simple to use as long as you know a few things ahead of time:
- Appliqué templates DO NOT include a seam allowance. So when you are transferring them to your fabric, you need to leave space around them for the seam allowance.
- Always trace them on the RIGHT side of your fabric. The line you trace is your stitching line and it needs to be visible.
- Don’t use chalk to trace templates on your fabric. Because the piece will be handled quite a bit while you’re stitching, chalk often wears off before you’ve finished and then you have to wing it. (However, if adrenaline-fueled quilting is your thing, by all means go for it! You are the boss of your process.)
Feel better? Excellent. Let’s get started.
Begin by printing out a copy of the template, making sure the scaling on your printer is turned off. The cut-out template should be around 7 ½” long.
Tip: I’ve simply used copier paper for all of the templates for this quilt, which has worked fine. None of them will be used more than a few times and they don’t need to be terribly precise. But if you prefer something stronger, feel free to transfer them to cardstock, template plastic, or whatever you like.
Whether you are making the wall or lap sized quilt, this month’s block is the same for both.
- From background fabric: Cut one 10 ½” square
- From appliqué fabric: You’ll need 3 scraps that are at least 2” x 8”, though you don’t need to trim them down to that size. Just be sure they are at least large enough to allow for the template and seam allowance.
On the RIGHT side of an appliqué fabric, place the narrow end of the template on a cut edge and trace around it, using whatever pen/transfer method you like. Be sure you are leaving enough space around it for a seam allowance that is more than 1/8” but less than ¼” (i.e. a “fat eighth”).
Repeat this process on a second appliqué fabric.
Flip the template over and trace it on the RIGHT side of the third appliqué fabric. The template isn’t symmetrical so this adds a nice bit of variation in the finished block.
Tip: Use a sheet of fine grit sandpaper (from the hardware store) under the fabric while you trace. It holds the fabric smooth and prevents those little skips and drags that the tip of your pen can cause. You’ll get a nice clean line without the struggle.
Cut out the appliqué pieces, adding a “fat eighth” seam allowance.
Lay out the appliqué pieces on your background square as shown:
The top edge of all three appliqués should line up with the top edge of the background square. They should be grouped off-center toward the left side of the block, roughly 1 ½” from the left edge and nearly touching at the widest part of the appliqués. When you are happy with the placement, baste or pin the piece on the left (setting the others aside).
Starting at the top edge of the block, stitch down the left straight edge, around the bottom curve and back up the right side of the appliqué. Do not stitch across the top of the appliqué. That edge will be enclosed in the seam when the blocks are joined later.
Tip: I found it easiest to finger press the seam allowance under on the long straight sides before stitching. It gives a nice, crisp edge that is easy to stitch. Then I used the needle-turn technique to go around the curves at the bottom. These are much tighter curves than we did in the last block, so it is especially important to only turn under enough of the seam allowance to take one stitch at a time. Turning under too much at once or working with a too-wide seam allowance will cause little points and bumps along the edge instead of a smoothly rounded curve.
Add the other two pieces back to your block, according to the above layout, this time basting or pinning the middle piece down. Set aside the third piece and stitch down the middle one.
Finally, add the third appliqué in the same manner as above. Your finished block should look something like this: (you may want to actually iron yours before taking any photos of it though…)
Your new block will go here in the final quilt layout (wall, then lap size):
As always, if you have any questions about anything here or would like more information, email me at email@example.com or come find me on Instagram at @bespokeoutlaw. I will continue to post hints and tips there too.
Next month we’ll add bias strips! | <urn:uuid:ae180248-0f02-4386-b4b9-ce7d44c7d2d3> | CC-MAIN-2022-33 | https://seattlemodernquiltguild.com/2017/03/09/minimal-day-sampler-block-two-fringe/?replytocom=4543 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.916856 | 1,213 | 1.515625 | 2 |
This post considers a number of issues with analytic product evaluation method described in the document ODNI Rating Scale for Evaluating Analytic Tradecraft Standards (Rating Scale), the most authoritative guidance for the evaluation of analytic products in the U.S. intelligence community. It considers the following questions:
- Is the method reliable?
- Is the method valid?
- Are the Analytic Standards adequately delineated?
- Should – and how should – an overall score be calculated?
- Is the method efficient?
- How does the method treat expertise?
But first, a brief description of the Rating Scale, since the document describing it (see references at end of this post) does not appear to be publicly available.
About the Rating Scale
As part of a larger effort to raise the quality of intelligence analysis, the U.S. Office of the Director of National Intelligence (ODNI) has provided Intelligence Community Directive 203: Analytic Standards (ICD 203). This document describes a set of Standards for the production and evaluation of analytic products. There are five primary Standards:
- Independence from political considerations;
- Being based on available sources of intelligence information; and
- Implementing and exhibiting the Analytic Tradecraft Standards.
The Analytic Tradecraft Standards are
- Proper description of sources, data and methodologies;
- Proper expression of uncertainties;
- Proper distinguishing of information from assumptions and judgements;
- Incorporating analysis of alternatives;
- Demonstrating customer relevance and addressing implications;
- Use of clear and logical argumentation;
- Explanation of change to or consistency of judgements with previous reports;
- Making accurate judgements or assessments;
- Incorporating effective visual information where appropriate.
The Rating Scale was developed by the ODNI’s Analytic Integrity and Standards Group (AIS) to provide guidance for evaluators assessing the extent to which a product meets the Analytic Tradecraft Standards. It is, basically, a rubric, though intended for use in the workplace rather than in education. For each of the nine Analytic Standards, the Rating Scale provides:
- A definition of the Standard;
- Brief instructions for applying four rating levels: Poor (0), Fair (1), Good (2), and Excellent (3) – though for Standard 8, the levels are Unclear, Conditioned, and Unconditioned; and
- A page or so of further guidance.
It also provides some general guidance. Two aspects of that guidance are of note here. First, the document describes the process raters should use in evaluating a report. Key components are:
- Raters should provide “narrative comments” elaborating on their ratings for each of the Standards.
- Proper use of the scale is a team activity, with each product being first assessed by two raters, who can discuss and agree on a consensus evaluation; and then a quality check by a third rater.
- Evaluations are entered into a database “used to generate statistical information and reports of various kinds.”
Second, like ICD 203, the Rating Scale says that the Standards should be applied in a manner appropriate to the “length, purpose, classification, and production time-frame of each product” and that such factors should be discussed in the narrative comments.
ICD 203, and the Rating Scale, reflect a great deal of wisdom accumulated over many decades about what matters in intelligence generally, and specifically in written products. The Scale was produced by people who know their domain, and manifestly has high “face validity.”
However, constructing a high quality assessment rubric and an associated assessment process is difficult. It generally requires expertise in evaluation itself, not just domain or “subject matter” expertise. I don’t know whether any evaluation experts were involved in the development of the Rating Scale. If none were involved, you would expect the Rating Scale method to have some serious problems. If evaluation experts were involved, you’d still expect the Scale to have some issues, because no perfect evaluation method exists in any complex domain, and such methods always have limitations and make compromises.
Is the Rating Scale method reliable?
A good evaluation method should be reliable. That is, it should give pretty much the same answer each time it is applied to a product. So for example, when the Rating Scale method is used by two distinct teams of raters, those two teams should get close to the same answer. This is called “inter-rater reliability” (IRR) and there are technical ways to measure it.
There appears to have been little research done on the reliability of the Rating Scale. None had been published prior to 2017, when our group, the SWARM Project, started to investigate the issue. Of course, some such research may have been done by the AIS or elsewhere behind the walls of the IC, and not published or otherwise released.
The research done by our group and reported in the article Better Together suggests that IRR is poor when the Rating Scale is used by a single person. Having products rated by individuals working independently, and then combining their ratings, increases IRR for the combined ratings. Interestingly, the research showed that a reasonable level of IRR is reached when you generate combined ratings from three independent raters. You’ll recall that three is the number of raters specified by the Rating Scale method, though the two approaches work a bit differently. There are a number of limitations in our team’s research, described in the article. Overall, it seems fair to say we (outsiders) don’t know how reliable the Rating Scale method is when deployed on real intelligence products in the I.C., though the SWARM research does suggest cautious optimism.
Is the Rating Scale method valid?
A good evaluation method should also be valid, i.e., it should measure what you want it to measure. As mentioned above, the Rating Scale method certainly has face validity; roughly, it seems to be talking about the right thing. However, when deployed on real products by real human raters in real work situations, does the method actually measure adherence to Analytic Standards, or does it end up reflecting other things?
Assessing validity is not easy. The obvious idea is that you should compare the results of applying the method with some gold standard, i.e. some independent measure of the quality of the products. Trouble is, there is no such gold standard. The Rating Scale method is the only measure we have, and so by default the best measure we have, but it can’t be its own yardstick.
Again, there appears to have been no published research on the validity problem prior to 2017, when SWARM started looking at such issues. Some findings from the study described in Better Together point to possible validity problems. The raters in that study, after they had completed their rating work, participated in a focus group and answered a survey. One theme that emerged was that the Rating Scale method appears to encourage a “box-ticking” approach where a rater – particularly, presumably, one who is tired or bored – checks for superficial signs of adherence rather than “deep quality.” For example, a rater is required to assign a rating level on Standard 3, proper distinguishing of information from assumptions and judgements. To do this well requires understanding what assumptions are being made, and this can be quite intellectually challenging. The rater may be tempted to just check that there is some such distinguishing activity, and perhaps award more points for more such activity, with little regard to how “proper” it really is. In other words, the rater may be rewarding form rather than substance. To the extent that this happens, the Rating Scale method would not really be assessing adherence to Analytic Standards, so much as the appearance of such adherence; and the method would be less than fully valid.
In other respects, our team’s initial investigations are more positive. In another study, reported in the article ODNI as an Analytic Ombudsman, evaluations generated using the Rating Scale method were compared with evaluations produced by members of our own team, who used a different approach to assess quality. Our team members were assumed, for the purposes of the study, to be experts and thus able to provide some sort of yardstick, even if not an ideal gold standard. The Rating Scale evaluations were broadly in line with the SWARM expert evaluations.
However various limitations in this academic research, including the difficulty of extrapolating to real use, and the absence of any other research, mean that we really don’t know how valid the Rating Scale method is in practice.
Are the Analytic Standards adequately delineated?
Ideally the criteria on which products are assessed – in the current case, the Analytic Standards – would be clear, crisp, and distinct. The raters in the Better Together study pointed to a number of concerns about this:
- A number of the Standards encompass multiple different issues. For example, Standard 1 requires proper description of sources, data and methodologies. One can easily imagine a product that is meticulous in describing sources and data, but makes no mention of methodology. This can happen because describing sources and data, and describing methodology, seem quite distinct and separable activities. When they are lumped together in one Standard, it becomes difficult for a rater to assign a single rating overall rating adequately reflecting the level of adherence to each component. Perhaps proper description of methodology should be pulled out into a separate Standard. However that strategy would take us down the path of a proliferation of Standards, a longer and more complex Rating Scale, and a more laborious method.
- A second concern is that the guidance provided in the Rating Scale document is, at least for some Standards, not enough to enable a rater to determine what rating level to assign. The Analytic Standards are broad and abstract, and cover very complex territory. When whole textbooks have been written on clear and logical argumentation, and how to assess it – and when those textbooks don’t always agree with each other – it is effectively impossible to provide, in a few pages, guidance sufficient to unambiguously determine which of four rating levels applies in any given case (for anyone who needs such guidance; see the discussion of expertise below).
- Third, matters are made more complex by overlap between Standards. (In the technical parlance, they don’t have full specificity.) For example, a great deal of intelligence is by nature abductive, or “inference to the best explanation.” Good abductive inference inherently involves assessing the merits of alternatives. It therefore seems that Standard 4 – Incorporating analysis of alternatives – is part and parcel with Standard 6, Using clear and logical argumentation. So interpreting and and applying Standard 6 seems to involve interpreting and applying Standard 4. More broadly, this implies – at least in some situations – these two Standards should be collapsed into one. This concern pulls in the opposite direction to the first point just above, which suggested breaking some Standards apart.
These apparent flaws, as well as being concerns in their own right, reinforce the previous concerns about the general reliability and validity of the Rating Scale method.
Note that this issue of delineation is as much a problem for ICD 203, which specifies the Analytic Standards, as it is for the Rating Scale method.
Should – and how should – an overall score be calculated?
The Rating Scale says that a rater should give a product a rating – Poor (0), Fair (1), Good (2), and Excellent (3) – on each of the Standards, and provide narrative comments. Because a number is provided for each rating level, it would be easy enough to add those numbers up to get a single overall quality score. The overall scores for each of the three raters in the rating process could then be (say) averaged to provide a single aggregate quality score.
The Rating Scale document is silent as to whether these kinds of aggregations should be performed. I don’t know whether the AIS computes overall scores. If no overall scores are generated, then the Rating Scale delivers a multi-dimensional quality profile for a report, not a score. Delivering a profile rather than a single score can be a fine and appropriate thing to do, but managers and others will always be sorely tempted to “boil things down” to single scores. I’d be surprised if there wasn’t some kind of aggregation across Analytic Standards going on. Certainly when the SWARM Project was using the Rating Scale in various research exercises, we calculated single overall scores, and we have been reporting those to research participants and in publications.
If you do calculate overall scores, there are various options. The most obvious is to just add up the ratings. Each of Standards 1-7 and 9 have a maximum score of 3 points, so the overall maximum score would be 24. But this approach has a number of problems:
- Standard 8, which has no rating level numbers in the Rating Scale, is left out of the overall score. Yet Standard 8 goes to the very heart of good intelligence (accurate judgements). Indeed the fact that Standard 8 has no numbers can be taken to imply that overall scores should not be calculated. Of course, there is a workaround – just assign numbers to the three levels in Standard 8.
- Simple addition of scores treats all Analytic Standards as equally important, but this is implausible. To take one example, Standard 9 is about incorporating visual information (charts, etc.). While this can be a very good thing to do, it doesn’t seem right that this should be on par with using clear and logical argumentation, or making accurate assessments. More generally, how likely is it that all the Analytic Standards are of exactly – or even approximately – equal importance?
- An alternative is to do a weighted sum of ratings, with the numerical weights expressing the relative importance of the Standards. But this creates two more problems.
- What should the weights be? How do we determine how much more or less important Standard 7 is than Standard 9?
- The relative importance of the Standards will probably depend on the situation. As noted above, the Rating Scale recognises the Standards should be applied in a manner appropriate to the “length, purpose, classification, and production time-frame of each product”. So we would need to apply different weightings in different contexts. Who decides how to adjust the weightings, and what approach do they use? How can this be done without introducing so much noise that the desired aggregate scores and statistics become meaningless?
- Any simple additive approach effectively treats each of the Standards as optional. That is, a product could achieve a high overall score even if it gets a low rating on a particular Standard. To take this to an extreme, a product could make howling errors of logic and yet be excellent in all other regards, and so receive a high overall score. Surely at least an adequate level of logical reasoning should be a minimum requirement, not just another way to gather some points. As Mark Burgman has argued, this could be handled by making the aggregation rule-based, not additive. For example, the aggregation rule may specify that to be Excellent overall, a product has to be Excellent in logical reasoning, and at least Good in all other respects. This seems compelling, but it raises the problem of what the rules should be. The challenge of determining relative importance of Standards re-enters the picture here. (Note: interestingly, the Rating Scale does use a rule-based approach in its guidance for the rating level to assign for each Standard. It is silent on aggregation across Standards, and so doesn’t use a Rule-based approach for such aggregation.)
- Yet another option is to make aggregation multiplicative. That is, instead of adding the rating numbers for each Standard, multiply them. If a report has terrible logic and gets a Poor (0), then the report gets 0 overall. Again, however, the weighting issue (and/or the need for some kind of rules) remains. Should a report really get 0 overall if it uses no visual techniques and so gets a 0 on Standard 9?
Is the Rating Scale method efficient?
Any evaluation method with humans in the loop involves some amount of intellectual work. Ideally, a method will be efficient, in the sense that it usually takes no more work than is really needed to get the desired result, i.e. to deliver an assessment of appropriate quality. So how efficient is the Rating Scale method?
The Rating Scale method is what I’ll call a positive approach. ICD 203 specifies all the major attributes a product should have by way of conforming to Analytic Standards. The Rating Scale method requires a rater to assess the extent to which all these attributes are present. Further, for many Standards, the Rating Scale specifies sub-attributes which should be checked. For example, for Standard 4, the guidance says “Analyst products should identify and assess plausible alternative hypotheses…In discussing alternatives, products should address factors such as associated assumptions, likelihood, or implications related to U.S. interests.” To assess whether a product has done this properly, a rater would need to think through for herself what the associated assumptions, likelihood(s), or implications are, and then check whether the product has addressed those adequately. It seems that the rater’s task is in some ways as large and difficult as the product writer’s task, if not more so. In short, the Rating Scale is constructed to require positive, comprehensive verification that all important qualities are present. This might require a huge amount of work.
A negative approach looks to find specific problems, and deems a product good to the extent that such problems can’t be found. It might be called a “one minus” approach. In the positive approach, a product starts at zero and accumulates points for each positive attribute identified. In the negative approach, a product starts at the maximum, and loses points for specific problems found.
Depending on what you are looking for in an evaluation, a negative approach might be much more efficient than a positive one. If you want the evaluation to provide feedback to the product author on the extent to which they have exhibited every aspect of the Analytic Standards, then a positive approach would be required. But you might just want an evaluation to help you decide the overall quality of a finished product, or to help you determine whether a product needs further revision. Relative to these kinds of objectives, a negative approach might involve much less work, because it doesn’t force the rater to consider every aspect of the product. A competent rater may be able to quickly identify potential problems in the product, and so determine that a product is substandard overall, or in particular respects, without needing to explicitly consider every attribute.
How does the Rating Scale method treat expertise?
This is closely related to the efficiency issue. A large research literature on human expertise indicates that novices and experts think in fundamentally different ways (H. Simon, Ericsson, Dreyfus, Klein, etc.). When experts have had extensive prior experience with suitable feedback, they acquire the ability to intuitively and holistically assess complex situations and quickly focus attention on relevant aspects. Novices, by contrast, have little immediate sense of what matters in a situation, and need to consciously follow explicit rules or guidelines. Since these rules had to be formulated for them in advance, and must be general and comprehensive enough to accommodate many variations on each type of situation, the rules can become quite lengthy and detailed.
The Rating Scale document currently weighs in at 26 pages, with the nine Analytic Standards getting about 2 pages each. This amounts to quite a bit of guidance, but as discussed above, it may not be enough for novice raters. The guidance for each Standard could in principle be further elaborated in much more detail, providing many more steps for such raters to follow. Taken to the extreme, the Rating Scale might be the size of a large textbook, or many textbooks. Arguably, however, the Rating Scale already provides too much guidance for expert raters. Depending on their objective, expert raters don’t need to pay attention to all the issues raised in the guidance, or to follow all the instructions. They can zero in on the critical issues and quickly determine whether and in what respects a product may be deficient, or that a product is good if such deficiencies can’t be found. (By analogy, inspired by Gary Klein’s well-known work, an experienced firefighting captain can judge a situation to be safe if nothing stands out as indicating that it might be unsafe, while a rookie would have to run through checklist of potential issues.)
The fundamental problem is that the Rating Scale has not been designed to accommodate differing levels of expertise. It ends up compromising on a middle course, providing insufficient guidance for novices and demanding too much needless work, and imposing too much constraint, on true experts. It treats all raters as merely competent, which may be fine for many but presumes too much of novices, and interferes with the intuitive expertise of genuine experts.
Klein, G. A. (1998). Sources of power: how people make decisions. Cambridge, MA: MIT Press.
Marcoci, A., Burgman, M. A., Kruger, A., Silver, E., McBride, M., Singleton, T. G., … Vercammen, A. (2019). Better Together: Reliable Application of the Post-9/11 and Post-Iraq US Intelligence Tradecraft Standards Requires Collective Analysis. Frontiers in Psychology, 9, Article 2634.
Marcoci, A., Vercammen, A., & Burgman, M. A. (2018). ODNI as an analytic ombudsman: Is Intelligence Community Directive 203 up to the task? Intelligence and National Security.
Office of the Director of National Intelligence. (2015). Rating Scale for Evaluating Analytic Tradecraft Standards with Amplified Guidance for Evaluators (last revised on 6 November 2015).
Acknowledgements: this post draws heavily the two SWARM articles cited, and discussions with SWARM colleagues, including Ashley Barnett and Mark Burgman.
Interested in a weekly digest of content from this blog? Sign up to the Analytical Snippets list. This blog, and the list, is intended to keep anyone interested in improving intelligence analysis informed about new developments in this area. | <urn:uuid:329aabd5-704f-4da5-bfc0-bb5af770a15a> | CC-MAIN-2022-33 | https://timvangelder.com/2019/05/19/the-odni-rating-scale-issues-abound/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.943145 | 4,675 | 2.140625 | 2 |
What is the process for turning a story into a “movie” script?
How to Turn Your Book Into a Screenplay
- Read screenwriting books. …
- Invest in industry software. …
- Read books that have been adapted into screenplays. …
- Watch film adaptations. …
- Study movie structure. …
- Outline existing films. …
- Analyze which of your original stories would make a good film.
How do I turn my script into a movie?
How Screenplays Become Movies in 5 Simple to follow Steps
- Write your best screenplay yet.
- Find a screenwriting manager and/or agent to guide you.
- Have a producer or director show interest in your work.
- Pitch your screenplay to the producer or director.
- Negotiate terms.
How much does it cost to turn a book into a screenplay?
If you research rates based on the Writers Guild of America, which represents screenwriters around the world, they recommend a range of costs between $76,341 and $143,319 for a completed feature-length screenplay. That is a staggering number. It’s enough to make you want to turn around and shut the door.
What is it called when you turn a book into a movie?
A film adaptation is the transfer of a work or story, in whole or in part, to a feature film.
What does Netflix pay for scripts?
Breaking these deals down based on a writer’s screen credits shows a $200,000 premium for writers with two or more screen credits as compared to those writers with no screen credits.
Screen Compensation Guide for Streaming Services.
How do I sell my script to Hollywood?
7 Ways to Sell Your Story (Script, Book, Stage Play or Podcast) to “Hollywood”
- Sell/Option to a Producer or Production Company. …
- Get Management Representation. …
- Attend a Film Market. …
- Get into a Development Program. …
- Connect with an Up-and-Coming Director or Producer to Get the Film Made. …
- Create Your Own IP. …
- Use a Pitch Platform.
How do I sell my story to a producer?
Quote from video: And see how this really works selling your movie idea ultimately involves two basic steps number one turn your idea into a production-ready screenplay.
How do I sell my book to a movie?
Be straightforward in your pitch: Briefly summarize the work to be optioned, where it’s published—or not—and your bio. It’s also possible, though less common, to make a sale yourself and later obtain a film agent or lawyer to negotiate the details.
How do I submit my book to Netflix?
“Netflix only accepts submissions through a licensed literary agent or from a producer, attorney, manager, or entertainment executive with whom we have a preexisting relationship. Any idea that is submitted by other means is considered an unsolicited submission
How do I sell my story on Netflix?
Pitching an idea to Netflix
If you have an idea, game, script, screenplay, or production already in development that you’d like to pitch to Netflix, you must work through a licensed agent, producer, attorney, manager, or industry executive, as appropriate, who already has a relationship with Netflix.
Who is the richest screenwriter?
Highest Paid Screenwriters, Number One: David Koepp… David Koepp is undoubtedly one of the planet’s screenwriting kings.
Can you sell story ideas?
Turn a book into a movie script: The differences between …
Is it easier to write a screenplay or a book?
However, novels and screenplays use different structures beyond that for different reasons. Screenplays require more structure than novels because they are primarily a narrative blueprint for cinematic interpretation.
How many pages of a novel is a screenplay?
The average feature screenplay contains about 100-110 pages (roughly 25/30,000 words).
Is it easier to publish a novel or screenplay?
A screenplay is typically easier to write as they are much shorter and more linear than a book. Do I need to know how to write a screenplay before writing one? No, it does not matter whether you know how to write or not; the best way for someone who has never written either is just to start!
Can I write a screenplay for a book?
No. You must have permission from the owner of the copyright in the original movie or book that you’re basing your screenplay on. Particularly in the entertainment industry, there may be monetary hurdles that you have to get around in order to get permission to write a screenplay based on a book or movie.
How do I submit my book to a movie producer?
Buy The Hollywood Creative Directory (HCD), write a nice query letter and synopsis, and start submitting (hundreds of submissions is what’s going to be needed – literally!). You’re going to be submitting to all the same production companies that every other screenwriter is submitting to, which is to say all of them.
Do you need permission to adapt a book into a movie?
Copyright owners have the right to make an adaptation of their work or to allow others to adapt or modify their work. There are no provisions or exceptions in the Copyright Act that cover adapting or modifying material. Permission is required from the copyright owner to make an adaptation. | <urn:uuid:5b00621a-ae4c-4f5f-ae41-4f0605a1f867> | CC-MAIN-2022-33 | https://aguycalledbloke.blog/what-is-the-process-for-turning-a-story-into-a-movie-script/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.946393 | 1,159 | 1.992188 | 2 |
Despite all the beauty in Southern California, there are some very ugly pests. One of the most unsightly pests is the cockroach, and it makes frequent appearances in homes and businesses. Perhaps the worst part about roaches is the fact that they're nearly impossible to eliminate. Learn more about why cockroaches are so hard to kick out and how we can help.
The Cockroaches In Southern California
No matter where in the United States you go, you can be sure you can find a few types of cockroaches in the area. Southern California is no exception, and you're most likely to see these home-invading pests:
- German Cockroaches: These are, by far, the most common types of cockroaches seen in homes and businesses. Because they are small and have rapid breeding cycles, these cockroaches can get in through tiny openings in your building and take over in weeks. You can identify this cockroach by its light brown color and the parallel lines on its back.
- American Cockroaches: Growing over two inches long, American cockroaches are large enough to make anyone feel uncomfortable. They are reddish-brown and have a yellowish figure eight on their head. As if these Southern California pests weren't intimidating enough, they have wings and can fly.
- Brown Banded Cockroaches: As you might expect, these cockroaches have a banded appearance. They share many of the same traits as other local roaches, including spreading diseases and triggering allergies. Whenever you have cockroaches around, you should be worried about your health.
Why Isn't Cockroach Elimination Easy?
You're probably wondering why cockroaches are such dreaded pests. Besides having the ability to spread diseases, cockroaches also are highly invasive. Once they get into a building, they remain in place until you hire a pest control professional.
Do-it-yourself (DIY) methods of cockroach elimination almost always fail. Over time, cockroaches have grown resistant to certain pesticides. The products you find in the store are unlikely to kill cockroaches, and they certainly won't kill all of the unwanted inhabitants in your home. Even if only a few roaches remain, you will be in trouble. They can reproduce and take over your home once again.
One of the biggest challenges of cockroach elimination is finding them. After all, most people don't know they have cockroaches until they have a major infestation in their home. Cockroaches hide out under appliances, in basements, and in other dark and dirty places. How can you eliminate a pest if you don't know where to find it?
Getting Rid Of Roaches For Good
There's also another issue with cockroach elimination. Sure, you can successfully kick out the roaches in your home. But how do you make sure they don't come back? A few crumbs will satisfy cockroaches, and this means they will continue to invade your home.
In eliminating all the roaches from your property, you also need to make sure they don't return. Sealing up your home isn't simple and probably won't keep roaches from returning. Unless you can seal up every gap and crevice, cockroaches can and will find a way inside.
For effective cockroach elimination and prevention, you need professional help. And that means you should call us at Excel Pest Management. Our team is always ready to tackle cockroach infestations, and we don't waste any time. Thanks to our extensive training, we are fully prepared to get rid of all the cockroaches on your property.
For years, we've been serving the Southern California area. Customer service is our priority so that you can count on us. Call us today to learn more about our ongoing cockroach prevention and elimination. | <urn:uuid:9df11f5a-5b72-4157-9257-72b089fe18f5> | CC-MAIN-2022-33 | https://www.excelpestmgt.com/blog/post/are-the-cockroaches-in-southern-california-hard-to-get-rid-of | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.962914 | 790 | 2.328125 | 2 |
Russia launches ISS-bound cargo ship
A Russian rocket carrying an unmanned cargo ship blasted off for the International Space Station early Sunday from the Baikonur cosmodrome in Kazakhstan, the Russian space agency said.
The Soyuz rocket carrying the Progress MS-03 ship was launched on schedule at 00:41 Moscow time (21:41 GMT Saturday) and began a two-day journey to the ISS, the Roscosmos space agency said on its website.
The ship is carrying more than 2.4 tonnes of fuel, air, oxygen, food and equipment for the crew on the international space laboratory.
It is due to dock at 03:22 Moscow time (00:22 GMT) on Tuesday.
A Progress cargo ship launch failed in April 2015. Since then there have been two successful dockings of such ships.
The ISS is currently manned by Kathleen Rubins of NASA, Takuya Onishi of the Japanese space agency, Jeff Williams of NASA and Russian cosmonauts Oleg Skripochka, Alexey Ovchinin and Anatoly Ivanishin. | <urn:uuid:1faaad91-8cb0-4ee0-a8ff-5525f9f1d464> | CC-MAIN-2022-33 | https://www.expatica.com/ru/general/russia-launches-iss-bound-cargo-ship-58931/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.93043 | 224 | 2.03125 | 2 |
BACKGROUND: The objective of this study was to determine the incidence and outcome of perioperative cardiac arrest (CA) in children younger than 18 yr undergoing anesthesia for noncardiac and cardiac procedures at a tertiary care center. METHODS: After institutional review board approval (Mayo Clinic, Rochester, Minnesota), all patients younger than 18 yr who had perioperative CA between November 1, 1988, and June 30, 2005, were identified. Perioperative CA was defined as a need for cardiopulmonary resuscitation or death during anesthesia care. A cardiac procedure was defined as a surgical procedure involving the heart or great vessels requiring an incision. RESULTS: A total of 92,881 anesthetics were administered during the study period, of which 4,242 (5%) were for the repair of congenital heart malformations. The incidence of perioperative CA during noncardiac procedures was 2.9 per 10,000, and the incidence during cardiac procedures was 127 per 10,000. The incidence of perioperative CA attributable to anesthesia was 0.65 per 10,000 anesthetics, representing 7.5% of the 80 perioperative CAs. Both CA incidence and mortality were highest among neonates (0-30 days of life) undergoing cardiac procedures (incidence: 435 per 10,000; mortality: 389 per 10,000). Regardless of procedure type, most patients who experienced perioperative CA (88%) had congenital heart disease. CONCLUSION: The majority of perioperative CAs were caused by factors not attributed to anesthesia, in distinction to some recent reports. The incidence of perioperative CA is many-fold higher in children undergoing cardiac procedures, suggesting that definition of case mix is necessary to accurately interpret epidemiologic studies of perioperative CA in children.
ASJC Scopus subject areas
- Anesthesiology and Pain Medicine | <urn:uuid:947632d5-561f-4a10-addf-31e538f3f4ee> | CC-MAIN-2022-33 | https://mayoclinic.pure.elsevier.com/en/publications/perioperative-cardiac-arrests-in-children-between-1988-and-2005-a | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00665.warc.gz | en | 0.958146 | 390 | 2.234375 | 2 |
EXCLUSIVE PHOTOS BY PAPA JAN: HUNZA AND UGANDA
(from Muslim Harji Collection, to be published week of Monday, February 8, 2016)
Please click on photos for enlargement
Hunza. Photo by Papa Jan (late Abdul Mohamed Ismaily). Copyright.
EXCLUSIVE PHOTOS BY AZHAR CHAUDHRY
(from Sultan Jessa Collection, to be published week of Monday, February 15, 2016)
Nairobi, Kenya. Photo: Azhar Chaudhry. Copyright.
Date posted: Saturday, February 6, 2016.
We invite readers to submit historical photos in their collection for publication on this web site and its sister blog, http://www.simergphotos.com. Please write to the editor, Abdulmalik Merchant, at email@example.com.
A MUST READ PIECE FOR CHRISTIANS AND MUSLIMS ALIKE
“Given a right understanding of the foundations of Islam and Christianity, and the spiritual values which they have proclaimed, it should not prove very difficult to build a bridge of mutual respect and co-operation between the two great religions. Unfortunately, it is a fact that the close similarity between the two remains largely unknown to the West.”
Photo taken at the opening on 15th September 1959 of the 14th session of the United Nations General Assembly. Seated at the head of the delegation of Pakistan is Mr. Manzur Qadir, then Minister for Foreign Affairs. At right is Prince Karim Aga Khan’s father, the late Prince Aly Khan, Permanent Representative to the United Nations. Photo: United Nations Photo Library. Please click for article. | <urn:uuid:5aee1b0d-4564-4e33-ac42-d2040f352582> | CC-MAIN-2022-33 | https://simerg.com/tag/lourenco-marques/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.904974 | 360 | 1.601563 | 2 |
Japan's Prime Minister Yoshihide Suga speaks during the virtual summit of the leaders of Australia, India, Japan and the U.S., a group known as “the Quad", at his official residence in Tokyo, Japan.
Tanzina Vega: As we continue our look at foreign policy under the Biden administration, we turn now to Asia. This week, Japan's Prime Minister Yoshihide Suga is visiting D.C., making him the first foreign head of state to meet with President Biden. Recently, territorial and political disputes between China and Japan have only escalated.
With the US siding with Japan, this week's meeting between President Biden and Prime Minister Suga can be seen as a signal towards a broader approach to the region by the United States. Motoko Rich is the Japan Bureau Chief for The New York Times and we spoke with her on Friday morning before the summit. Let's break down what exactly is China doing that is warranting this response? We'll start by taking a look at the Senkaku islands, what's happening there?
Motoko Rich: These islands, in some ways, it's curious because they're basically a pile of rocks. It's a string of very small uninhabited islands and there's some value to them in terms of the fishing rights around them, but they are more symbolic in a lot of ways than a matter of reality, but they are disputed territory. Japan claims the islands and calls them Senkakus. China also claims them as their own and calls them the Diaoyudao and they have been fighting over them for a long time.
At the moment, the US recognizes Japan's ability to administer these islands such as they are. China sends boats into water territory or waters that are contiguous with territorial waters as a kind of goosing exercise to say we're here and where we're nudging around and Japan doesn't like that. Japan has sought numerous times reassurance with the United States, as its most important ally, that the treaty between the two countries does cover protection on these islands in the event that China should try to invade them.
From time to time, it seems like there's a possibility of an actual conflict arising in that the boats of the Chinese are coming more frequently or staying longer in the territorial waters or contiguous waters. That's been what the escalation has been there. That's in particular relation to Japan, but there's a lot more going on across the region and so the United States is not only interested in talking to Japan about protecting Japan's territorial rights, but also partnering with Japan to create a sense of a bulwark against China's increasing influence and military assertiveness around the region.
Tanzina: What about what's happening in the Taiwan Strait?
Motoko Rich: There, again, the Chinese who regard Taiwan as a rogue territory and Taiwan is a small democratic island and for a long time, as you know the United States has had this approach known as strategic ambiguity, where they don't officially recognize Taiwan as an independent country, but as part of one China, but the mainland Chinese government has been sending war planes to fly near the shores.
Again, buzzing exercise to say we're here and obviously trying to send a somewhat threatening military message and Secretary of State, Blinken, and Secretary of Defense, Austin came to Japan, they put out a statement in which they said, "We recognize the importance of democracy at the Taiwan Strait and that there should not be a military invasion." The question that's going to come up during this summit this week between the two leaders of Japan and the United States is, again, whether they will express some kind of support for Taiwan.
Tanzina: Motoko, what is expected from the summit this week?
Motoko Rich: I think one of the interesting things to watch when we talk about China is that while Japan and the United States have a lot of shared interests in holding back China as its power is rising the region, they also have some differences. The United States under the Biden administration has come out quite strongly criticizing China for its human rights violations in the treatment of the Muslim Uyghurs in the Xinjiang province whereas Japan has not been quite as explicit about that.
There's also a little bit of daylight between the two countries in how they have talked about the coup in Myanmar that Americans have imposed sanctions against the generals. Japan has not imposed any kind of economic sanctions and so there will probably be some kinds of conversations about how they might get a little bit closer in terms of how they comment on human rights violations in the region, but there are many other topics that they have to talk about. One of the big ones is climate change.
The Biden administration has already said that they want to rejoin the Paris Agreement. There'd probably be some discussion with Japan about how both countries might change and improve their targets for 2030. Both countries have talked a lot about their efforts to reduce carbon emissions so there might be discussion about how they might cooperate on technology, renewable energy.
There may be some talk about trade. There's also probably going to be talk about how they can secure supply chains for really important components like semiconductors, which are important from anything, from all kinds of electronics to cars. There's a global shortage of semiconductors at the moment and it's in the interest of both countries to ensure a supply and not be entirely dependent on China for that supply.
They have a lot of issues to talk about, but it's unlikely to be some tension-filled summit. As you pointed out, this is the first foreign leader to visit the Biden White House and so for Japan, it's a diplomatic feather in their cap to be the first, but they're not going to be fighting over anything. This is, in some ways, a courtesy visit to reassure each other that they're still on the same page and that the alliance between the two that has endured since the end of World War II remain strong.
Tanzina: Remind us, is there any repair work to be done here, Motoko, given if you could remind us what President Trump's relationship with Japan was under his administration?
Motoko Rich: That's a really excellent and interesting question because in some ways Japan and the United States grew very close under the Trump administration because of the personal relationship that the former Prime Minister Shinzo Abe worked really hard to develop that. He read the psychology of President Trump and showered him with flattery, invited him for two visits to Japan.
The second one was official state visit in which he was the first foreign leader to meet the new emperor. They cultivated this very close relationship. There was a period early on where they were talking on the phone three or four times a week about North Korea policy and all kinds of things. I think there was a little bit of a concern when Biden won the presidential election, whether or not that personal relationship would disappear.
Of course, Japan now has its own new leader in Yoshihide Suga and so he's going to be looking to develop this personal relationship, but I think there's also a little bit of relief that on the other hand, they're not dealing with a mercurial leader who might change his policy decisions in the moment of a tweet, not really dealing with someone who is threatening to impose tariffs at any moment, or is out there demanding that they pay more for their own defense. It's much more of a measured collaborative approach.
Tanzina: Motoko Rich is the Japan Bureau Chief for The New York Times. Motoko thanks so much for joining us.
New York Public Radio transcripts are created on a rush deadline, often by contractors. This text may not be in its final form and may be updated or revised in the future. Accuracy and availability may vary. The authoritative record of New York Public Radio’s programming is the audio record. | <urn:uuid:c995e3c0-5bec-4546-9707-0dc10e3b29df> | CC-MAIN-2022-33 | https://www.wnycstudios.org/podcasts/takeaway/segments/japanese-prime-ministers-us-visit-could-signal-future-us-asia-relations | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.977698 | 1,616 | 2.1875 | 2 |
History of the Wars of the French Revolution, from the Breaking Out of the War in 1792, to the Restoration of a General Peace in 1815: Comprehending the Civil History of Great Britain and France, During that Period
Longman, Hurst, Rees, Orme, and Brown, 1818
Mit mondanak mások - Írjon ismertetőt
Nem találtunk ismertetőket a szokott helyeken.
Más kiadások - Összes megtekintése
allies amounted appeared arms army arrived assembly attack Austrians battle body Bonaparte BOOK Britain British Captain carried cause Chap charge command commons conduct consequence considerable considered consisting constitution continued convention council course court determined directed effect enemy engaged England English entered established Europe execution fire five force formed four France French hand head honour hundred immediately important interests Ireland Italy king land length liberty Lord loss Louis majesty March means measure ment military ministers month necessary object obliged obtained occasion officers opened Paris parliament party passed peace period persons possession present Prince principal prisoners proceeded proposed received remained rendered republic respect retreat sent ships situation soon success taken thousand tion took town treaty troops victory whole
337. oldal - Will you to the utmost of your power maintain the laws of God, the true profession of the gospel, and the Protestant reformed religion established by the law? And will you preserve unto the bishops and clergy of this realm, and to the churches committed to their charge, all such rights and privileges as by law do or shall appertain unto them, or any of them? King or queen: All this I promise to do.
65. oldal - Council, to order, and it is hereby ordered, That general reprisals be granted against the ships, goods, and subjects of the States-General of the United Provinces...
389. oldal - The noise subsided, and he was asked if he had anything to say why sentence of death should not be passed upon him.
13. oldal - The unrestrained communication of thoughts and opinions being one of the most precious Rights of Man, every citizen may speak, write, and publish freely, provided he is responsible for the abuse of this liberty, in cases determined by the law.
206. oldal - Minotaur, Bellerophon, Defence, and Majestic, sailed on ahead of the admiral. In a few minutes every man stationed at the first six guns in the fore part of the Vanguard's deck was killed or wounded : — these guns were three times cleared. Captain Louis, in the Minotaur, anchored next ahead, and took off the fire of the Aquilon, the fourth in the enemy's line.
225. oldal - The very disgraceful frequency of courts-martial, and the many complaints of irregularities in the conduct of the troops in this kingdom, having too unfortunately proved the Army to be in a state of licentiousness which must render it formidable to every one but the enemy...
65. oldal - ... parties residing in the dominions of the other shall have the privilege of remaining and continuing their trade therein, without any manner of disturbance, so long as they behave peaceably, and commit no offence against the laws...
391. oldal - I am sure," says the noble lord, in his reply, through Mr. Merry, to one of M. Otto's official notes, " I am sure you must be aware that his majesty cannot, and never will, in consequence of any representation or any menace from a foreign power, make any concession which can be in the smallest degree dangerous to the liberty of the press, as secured by the constitution of this country.
280. oldal - ... from the iron yoke of England. " I eagerly embrace this opportunity of testifying to you the desire I have of being informed by you, by the way of Muscat and Mocha, as to your political situation. " I would even wish you could send some intelligent person to Suez or Cairo, possessing your confidence, with whom I may confer. " May the Almighty increase your power, and destroy your enemies. | <urn:uuid:beb51786-50e9-4851-88b8-dbd0b2fd475c> | CC-MAIN-2022-33 | https://books.google.hu/books?id=VspLAAAAMAAJ&dq=editions:LCCN12025307&hl=hu&output=html_text&lr= | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.928069 | 850 | 2.828125 | 3 |
Earth !!!! incoming transmission!!!!
Earth is the third planet from the Sun and the fifth largest.
orbit: 149,600,000 km (1.00 AU) from Sun
diameter: 12,756.3 km
mass: 5.9736e24 kg
Earth is the only planet whose English name does not derive from Greek/Roman mythology.
The name derives from Old English and Germanic. There are, of course, hundreds of other
names for the planet in other languages. In Roman Mythology, the goddess of the Earth was
Tellus - the fertile soil (Greek: Gaia, terra mater - Mother Earth).
It was not until the time of Copernicus (the sixteenth century) that it was understood that the Earth is just another planet.
Earth, of course, can be studied without the aid of spacecraft. Nevertheless it was not until the twentieth century that we had maps of the entire planet. Pictures of the planet taken from space are of considerable importance. They are an enormous help in weather prediction and especially in tracking and predicting hurricanes. And they are extraordinarily beautiful.
The Earth is divided into several layers which have distinct chemical and seismic properties (depths in km):
0- 40 Crust
40- 400 Upper mantle
400- 650 Transition region (asthenosphere)
650-2700 Lower mantle
2700-2890 D'' layer
2890-5150 Outer core
5150-6378 Inner core
The crust varies considerably in thickness, it is thinner under the oceans (5km), thicker under the continents (30km). The inner core and crust are solid; the outer core and mantle layers are plastic or semi-fluid. The various layers are separated by discontinuities which are evident in seismic data; the best known of these is the Mohorovicic discontinuity between the crust and upper mantle.
Most of the mass of the Earth is in the mantle, most of the rest in the core; the part we inhabit is a tiny fraction of the whole (values below x1024 kilograms):
atmosphere = 0.0000051
oceans = 0.0014
crust = 0.026
mantle = 4.043
outer core = 1.835
inner core = 0.09675
The core is probably composed mostly of iron (or nickel/iron) though it is possible that some lighter elements may be present, too. Temperatures at the center of the core may be as high as 7500 K, hotter than the surface of the Sun. The lower mantle is probably mostly silicon, magnesium and oxygen with some iron, calcium and aluminum. The upper mantle is mostly olivene and pyroxene (iron/magnesium silicates), calcium and aluminum. We know most of this only from seismic techniques; samples from the upper mantle arrive at the surface as lava from volcanoes but the majority of the Earth is inaccessible. The crust is primarily quartz (silicon dioxide) and other silicates like feldspar. Taken as a whole, the Earth's chemical composition (by mass) is:
The Earth is the densest major body in the solar system.
The other terrestrial planets probably have similar structures and compositions with some differences: the Moon has at most a small core; Mercury has an extra large core (relative to its diameter); the mantles of Mars and the Moon are much thicker; the Moon and Mercury may not have chemically distinct crusts; Earth may be the only one with distinct inner and outer cores. Note, however, that our knowledge of planetary interiors is mostly theoretical even for the Earth.
Unlike the other terrestrial planets, Earth's crust is divided into several separate solid plates which float around independently on top of the hot mantle below. The theory that describes this is known as plate tectonics. It is characterized by two major processes: spreading and subduction. Spreading occurs when two plates move away from each other and new crust is created by upwelling magma from below. Subduction occurs when two plates collide and the edge of one dives beneath the other and ends up being destroyed in the mantle. There is also transverse motion at some plate boundaries (i.e. the San Andreas Fault in California) and collisions between continental plates (i.e. India/Eurasia). There are (at present) eight major plates:
North American Plate - North America, western North
Atlantic and Greenland
South American Plate - South America and western South Atlantic
Antarctic Plate - Antarctica and the "Southern Ocean"
Eurasian Plate - eastern North Atlantic, Europe and Asia except for India
African Plate - Africa, eastern South Atlantic and western Indian Ocean
Indian-Australian Plate - India, Australia, New Zealand and most of Indian Ocean
Nazca Plate - eastern Pacific Ocean adjacent to South America
Pacific Plate - most of the Pacific Ocean (and the southern coast of California!)
There are also twenty or more small plates such as the Arabian, Cocos, and Philippine
Plates. Earthquakes are much more common at the plate boundaries. Plotting their locations
makes it easy to see the plate boundaries (see above).
The Earth's surface is very young. In the relatively short (by astronomical standards) period of 500,000,000 years or so erosion and tectonic processes destroy and recreate most of the Earth's surface and thereby eliminate almost all traces of earlier geologic surface history (such as impact craters). Thus the very early history of the Earth has mostly been erased. The Earth is 4.5 to 4.6 billion years old, but the oldest known rocks are about 4 billion years old and rocks older than 3 billion years are rare. The oldest fossils of living organisms are less than 3.9 billion years old. There is no record of the critical period when life was first getting started.
71 Percent of the Earth's surface is covered with water. Earth is the only planet on which water can exist in liquid form on the surface (though there may be liquid ethane or methane on Titan's surface and liquid water beneath the surface of Europa). Liquid water is, of course, essential for life as we know it. The heat capacity of the oceans is also very important in keeping the Earth's temperature relatively stable. Liquid water is also reponsible for most of the erosion and weathering of the Earth's continents, a process unique in the solar system today (though it may have occurred on Mars in the past).
The Earth's atmosphere is 77% nitrogen, 21% oxygen, with traces of argon, carbon dioxide and water. There was probably a very much larger amount of carbon dioxide in the Earth's atmosphere when the Earth was first formed, but it has since been almost all incorporated into carbonate rocks and to a lesser extent dissolved into the oceans and consumed by living plants. Plate tectonics and biological processes now maintain a continual flow of carbon dioxide from the atmosphere to these various "sinks" and back again. The tiny amount of carbon dioxide resident in the atmosphere at any time is extremely important to the maintenance of the Earth's surface temperature via the greenhouse effect. The greenhouse effect raises the average surface temperature about 35 degrees C above what it would otherwise be (from a frigid -21 C to a comfortable +14 C); without it the oceans would freeze and life as we know it would be impossible.
The presence of free oxygen is quite remarkable from a chemical point of view. Oxygen is a very reactive gas and under "normal" circumstances would quickly combine with other elements. The oxygen in Earth's atmosphere is produced and maintained by biological processes. Without life there would be no free oxygen.
The interaction of the Earth and the Moon slows the Earth's rotation by about 2 milliseconds per century. Current research indicates that about 900 million years ago there were 481 18-hour days in a year.
Earth has a modest magnetic field produced by electric currents in the core. The interaction of the solar wind, the Earth's magnetic field and the Earth's upper atmosphere causes the auroras (see the Interplanetary Medium). Irregularities in these factors cause the magnetic poles to move relative to the surface; the north magnetic pole is currently located in northern Canada.
The Earth's magnetic field and its interaction with the solar wind also produce the Van Allen radiation belts, a pair of doughnut shaped rings of ionized gas (or plasma) trapped in orbit around the Earth. The outer belt stretches from 19,000 km in altitude to 41,000 km; the inner belt lies between 13,000 km and 7,600 km in altitude.
Earth has only one natural satellite, the Moon. !!!!end of transmission!!!!
|Satellite||Distance (x1000 km)||Radius (km)||Mass (kg)| | <urn:uuid:79198c15-87e5-47fe-8fbb-24ae44374cac> | CC-MAIN-2022-33 | https://geol105.sitehost.iu.edu/images/gaia_chapter_2/earth.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00665.warc.gz | en | 0.933439 | 1,870 | 3.4375 | 3 |
CREATIVITY IN BUSINESS
In 1986, over 30 years ago, Michael Ray and Rochelle Myers wrote a book, Creativity in Business. I picked up the book again last week and found that it is really up to date in light of the COVID-19 pandemic. The following are a few ideas that made sense to me and that, I feel, every small business owner should consider.
- “The highest art form is really business. It is an extremely creative form, and can be more creative than all the things we classically think of as creative. In business, the tools with which you’re working are dynamic: capital and people and markets and ideas. (These tools) all have lives of their own. So to take those things and to work with them and reorganize them in new and different ways turns out to be a very creative process.”
- “In business you don’t have to move physical mountains, but you can accomplish amazing feats by simply believing in your ability to do what is yours to do the job you see in front of you.”
- “Ideas flow easily but too often hit a snag – the negative thoughts we call fear, judgment and the chattering of the mind. What’s worse, you get many ideas every day that never come into your conscious awareness, because your own judgement so quickly and almost automatically knock then down and out.”
I selected these three statements because they convey a message of hope and that if we can overcome our own doubts there is no limit to our potential.
Good ideas as to how we can best grow our business in our current environment can come from within, from our mentors, from books or from a variety of other sources. The key to success is called implementation. That requires overcoming, what I consider to be, the biggest roadblock to success and that is doing the hard work required make something happen.
The belief that we have in ourselves and in our ability should not be jeopardized by the thought and failures of others.
At BizQuack we say that “Success is a choice that is combined with hard work.”
We want to hear and to share your success stories; they are a source of inspiration for others. Please send us your stories.
Comments are closed | <urn:uuid:30418807-3092-49a2-942c-58c441f59466> | CC-MAIN-2022-33 | https://www.bizquack.com/creativity-in-business/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.97269 | 479 | 1.546875 | 2 |
Excessive perspiration, hot flushes
Undue perspiration (hyperhydrosis of varying genesis); excessive perspiration due to overactivity of the sebaceous; hot flushes followed by perspiration, during menopause; hyperhydrosis during acute infectious disease and fever; bromhidrosis, or other conditions which cause perspiration with an offensive odour; nocturnal perspiration with exhaustion (ie. pre-tuberculous cases). The quality of the perspiration may be hot, cold, or sticky.
Mode of action
Acidum nitricum: Offensive odour of perspiration or discharges.
Belladonna: Intense heat or redness; patient exudes hot perspiration, particularly noticeable on the face.
Jaborandi: Contains pilocarpine, which according to the law of similars, is useful in conditions of abnormal or excessive sweat, especially nocturnal sweating of tubercular patients; perspiration after menopausal hot flushes.
Kalium carbonicum: Prostrating perspiration, at night; may be accompanied by back pain localized between the shoulder blades.
Lachesis: Hot flushes, with outbreaks of perspiration.
Salvia officinalis: Effective against general perspiration and night sweats.
Sambucus nigra: Sweating during various acute conditions; marked perspiration during the day or upon waking; weakness with excessive perspiration.
Sanguinaria: Hot flushes of the face in menopause, followed by sweating.
Sepia: Flushes of heat with perspiration during menopause.
Veratrum album: Profuse cold sweat, especially on the forehead; perspiration during menses or with stool. R32 is effective in cases of perspiration, which accompany certain conditions. | <urn:uuid:cd984c1d-4957-45c2-a7a0-da82a681b283> | CC-MAIN-2022-33 | https://boydsalternativehealth.com/shop/r32/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.847107 | 385 | 2.265625 | 2 |
Your characters are probably an inspiration to you, as well as to your readers. So, creating creatures of habit and cool nerdy kids with moral and/or ethical qualities is crucial if you want those individuals connecting to your characters. I want to be clear… Even the worst of your villains needs to relate to his or her audience. Over the next few days let’s discover different characteristics to consider, take the TARDIS out for a spin to the past and the future, and play with what if scenarios. All together they’ll help you create your own Mr. Darcy, Tempe Brennan, Simon Lewis, or Katniss Everdeen.
I have a few fun ideas for exploring a character’s personality and moral compass. Here’s a list of 638 personality traits; positive, neutral, and negative. Once you’ve worked out 6-10 main traits for your character (make sure you select some of each type), you can start working out any ethical strengths and weaknesses they have. The key to any great character is finding out their flaws in addition to their strong points. This process can easily be used as a writing exercise to help at the beginning of a new story idea, or to work through writer’s block.
Here’s a wacky example using a character from Decent, Alexis:
Honest, Passionate, Strong, Sarcastic, Cute, Impulsive, Tactless, Abrupt
Alexis is honest to a fault and some girls may think she’s mean, but she really just lacks a filter and that’s where her best friend Ollie fits in. Ollie is a sounding board, and has a knack for helping Alexis see the big picture. Alexis has always felt compelled to say what she means, because everyone thinks she’s so ‘cute’ that she couldn’t possibly take care of herself. She holds honesty and truth close to her heart, and if someone can’t handle her sarcasm it’s really not her problem. But, cute boys are another story.
Once you have a good idea of who you’re dealing with, you’ll want to take a trip into your character’s past and future. In Part 2, we’ll take a trip down your character’s memory lane, as well as to their ever after, so stay tuned… | <urn:uuid:0aeff941-19be-43df-a653-7d955149296c> | CC-MAIN-2022-33 | https://kallieross.com/creating-characters-with-character-part-1/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.948181 | 503 | 2.203125 | 2 |
I’ll walk the creek with you
Once a day, Diane Seitz walks to Little Butte Creek with her dog Maggie.
It’s not far. Maggie usually leads the way – out a garage door and through a garden gate. Follow the fence to the water.
Seitz started making the routine daily after her husband died.
“It was my therapy,” said Seitz. “Just to come out here and walk.”
They purchased the land along the creek and moved south from Anchorage to the little town of Lake Creek, Oregon. It was the final stop on a grand tour of the West. Gary spent his career in forestry. There were stints in Montana, Wyoming and California.
“I was tired of winter,” said Seitz. “Our goal was to finally get somewhere where we didn’t need a snow shovel.”
And they’d always wanted land along water.
“Having property along a creek like this is a treasure, and you should take care of it,” said Seitz. “But when we bought this place, I called it used and abused. There were no young trees, and it had all been overgrazed.”
Over the years, Gary replanted thousands of trees on their property.
And after he died, The Freshwater Trust (TFT) would come to plant 1,400 more on the land between their home and the creek.
The conversation between Seitz and TFT began in 2013. The creek had been identified by the Bureau of Reclamation as prime habitat for juvenile coho, and had allotted money for restoration.
A side channel off Seitz’s property was critical for the fish during the winter.
“They always seemed to like that little place,” said Seitz. “But it was about to all but dry up before The Freshwater Trust and partners started doing their work.”
Starting in 2015, TFT built nine large wood structures and planted more than 1,000 native trees and shrubs on one acre of Seitz’s property.
“This is a remarkable spot,” said Lance Wyss, restoration project manager with TFT. “When you realize there are more fish because you are present, that’s a powerful example of impact.”
Seitz has watched the plants grow, as she and Maggie wind through them daily.
“All of this just used to be thick, invasive blackberry,” said Seitz. “It’s good to see it gone.”
Her neighbors have noticed the changes as well. It would be hard not to. Dead and dying logs from another nearby neighbor’s property were trucked in to create the large wood structures to improve habitat complexity.
“They knew I was doing something down there, and they probably had questions,” said Seitz. “But honestly, I didn’t really care what they thought. I was going to do what I was going to do.”
Placing large wood in streams can be contentious.
In the 1960s, the Army Corps of Engineers led a national moment to remove “woody debris” and meanders from streams and rivers. They thought it would prevent flooding. In actuality, water was carried through the river system faster, exacerbating the problem. Removing the wood also decreased habitat diversity.
“We’re working to modify historic impacts,” said Wyss. “The accumulation of large wood is a completely natural process. We’re trying to bring these waterways back to a higher functioning state. But understandably, there’s still fear there of flooding and property damage. That’s why we use engineered large wood structures to reduce the risk of logs moving in this the type of land-use system.”
Seitz believes that with seeing comes believing.
The side channel that was once almost gone now has water and juvenile coho in it.
Now entering their second growing season, the native plants that took the place of the invasive blackberry are thriving.
She invites the skeptics to come take a look.
“I’d like to tell them to come down here,” said Seitz. “Come down here, and I’ll walk the creek with you.”
This is a space of insight and commentary on how people, business, data and technology shape and impact the world of water. Subscribe and stay up-to-date.Subscribe | <urn:uuid:6d8d47d7-93a7-49e7-bf25-4ca928daed23> | CC-MAIN-2022-33 | https://shaduf-eu.org/index-121.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.976134 | 965 | 2.171875 | 2 |
There’s a whole world of flavor waiting to be unlocked within an incredibly basic ingredient: sugar. Typically used in its familiar white granulated form, it offers only a single flavor note of sweetness. With a little bit of creativity in the kitchen, sugar can become so much more than that. We’ve fallen head over heels for toasted sugar, and now we’re ready for more sugar creations — bring on flavor-infused sugar!
By adding just an ingredient or two to granulated white sugar, you can make incredible flavored sugar in more varieties than you can imagine.
We’re going to show you how to make vanilla sugar and five other flavor-infused sugars. They make perfect gifts — though you may want to keep them for yourself.
Flavoring sugar: Two basic methods
Let's explore two different ways to add flavor to sugar: the "infusion" method and the "addition" method.
Infusion: Cover whole ingredients with sugar
One method for adding flavor to sugar is burying whole ingredients (like coffee beans or vanilla beans) in a container of sugar. Over time, the oils and small particles from the ingredient impart aroma and flavor into each spoonful of sugar.
With this approach, the source of the flavor isn’t usually consumed along with the sugar. It’s either removed before it's used or simply left in the container to continue infusing the remaining sugar.
Pros: It's easy to identify the flavor of the infused sugar if it still has the ingredient in it — plus it looks elegant, adds some color, and makes a nice gift.
Cons: The flavor can be subtle, and infusion takes time.
Addition: Blend ingredients into sugar
Another way to make flavored sugar is to blend ingredients (sometimes using a food processor) into sugar. With this approach, the flavorful ingredient and sugar are consumed together. This technique works well for delicate ingredients like flower petals, as well as extracts.
Pros: The sugar is fully flavored immediately after blending; it’s ready to use or give as a gift.
Cons: It can be difficult to identify the flavor visually, since the ingredient is usually broken down into small pieces (if present at all). If the flavor is imparted by means of extract, the additional moisture can make the sugar clump slightly.
We’ll offer both infusion and addition versions of all the flavored sugars, so you can choose what works best for you.
Six sweet ideas
Let's introduce the six flavored sugars we're most excited about!
Note that there aren’t weights listed for the infusions and additions below. You can use about 1 cup of sugar without being exact. For those of you who want to use a scale, 1 cup of granulated sugar weighs 198g.
1) Vanilla sugar
Vanilla sugar is the cream of the crop in the flavored sugar world. Vanilla beans are valuable and so is time — two important ingredients in well-made vanilla sugar. The final product is complex, aromatic, and can elevate a basic recipe (or cup of coffee, I might add) to new heights.
- Infusion: 1 cup sugar + 1 vanilla bean; infuse for at least 1 month.
Split the vanilla bean lengthwise for a more robust flavor. This will also add flecks of “vanilla caviar” (seeds inside the pod), which looks stunning.
- Addition: 1 cup sugar + 1/2 vanilla bean; blend in a food processor.
You won’t need as much of the bean since you'll be using the entire thing, pod and all. Start with using half a bean, adding more if you're working with small beans.
2) Citrus sugar
When it comes to citrus sugar, you have options. My personal favorite is orange-flavored sugar because of the nostalgic smell; it reminds me of eating oranges while sitting in the sand (my family's go-to beach snack). You can also play around with lemon, lime, and grapefruit sugar.
- Infusion: 1 cup sugar + about 1 tablespoon zest*; infuse for at least 24 hours.
*Finely grated rind of orange, grapefruit, lemon or lime.
- Addition: 1 cup sugar + 1/8 to 1/4 teaspoon lemon, lime, or orange oil; mix together.
Even if you're relying on citrus oil to impart the majority of flavor in your sugar, add a bit of fresh zest for color.
3) Coffee sugar
- Infusion: 1 cup sugar + 2 tablespoons whole roasted coffee beans; infuse for at least 1 week.
Remove the coffee beans before using the sugar for subtle flavor. Or, after the sugar has infused for about a week, pulse the sugar and beans together in a food processor for strong flavor (which technically combines the infusion and addition techniques).
- Addition: 1 cup sugar + 2 teaspoons espresso powder; stir together.
For best results, use real espresso powder rather than instant coffee powder. You'll get more flavor and zip out of the real stuff.
4) Lavender sugar
- Infusion: 1 cup sugar + 1 tablespoon dried lavender flowers; infuse for at least 1 week.
Sift out the lavender flowers before using for a smooth, pure look. The sugar will have a floral aroma and a hint of lavender taste.
- Addition: 1 cup sugar + 1 to 2 teaspoons dried lavender flowers, pulsed in a food processor.
Use this method if you're looking for light purple flecks and added texture in your baked goods.
5) Rose sugar
- Infusion: 1 cup sugar + 2 tablespoons dried rose petals; infuse as long as you can.
Like with lavender flowers, sift out the rose petals before using for a nuanced flavor. A long infusion period will maximize the smell and taste of the final sugar.
- Addition: 1 cup sugar + 1 tablespoon dried rose petals, blended in a food processor.
If you don't have rose petals, you can try using rose water instead. We've found that some varieties have a borderline soapy taste, especially if too much is used. Be sure to start with a small amount (about 1 scant teaspoon per cup of sugar) if you want to give this approach a try.
Best used: To sweeten whipped cream, tea, or cocktails; anything that you want to seem fancy.
6.) Rosemary sugar
- Infusion: 1 cup sugar + 1 generous tablespoon or a few small sprigs of fresh rosemary.
If you remove the rosemary before using the sugar, it'll add an elusive, herbaceous flavor that no one but you will be able to put their finger on. Everyone will love it!
- Addition: 1 cup sugar + 1 teaspoon dried rosemary; mix together.
If you can't remember when you bought your dried rosemary, it's best to start fresh (or double the amount to compensate for the potentially weak flavor).
We’ve used 1 cup sugar as the base for these formulas because it fits perfectly in an 8-ounce mason jar. (It's the perfect gift for a baker!) If you want to make a larger volume, simply scale up the ratios. There’s nothing holding you back but the size of your jar!
Let the flavorful baking begin
Once you've created a treasure trove of flavored sugars, share them as gifts and save a few for yourself, too. Pull out your favorite recipes and have some fun! Mix and match flavors until you come up with a brilliant combination.
Make a variety of flavored sugars, then use them to transform traditional recipes into new creations.
If you love the idea of making infused sugars, then we're willing to bet you’ll want to make homemade extract, too. Learn how to make vanilla extract at home and round out your handmade gifts. Everyone’s going to hope they’re lucky enough to make it onto your gift list this year.
Let us know what other gifts you’re making (and baking!) in the comments, below.
Thanks to Anne Mientka for taking the photographs for this post. | <urn:uuid:446f20a7-7486-4a94-ae1c-e6901cdc81e5> | CC-MAIN-2022-33 | https://www.kingarthurbaking.com/comment/526936 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.898083 | 1,714 | 1.875 | 2 |
Did you know that the Dutch mice are the smallest of all fancy mice? And although they lack stamina, they’re still a great pet companion.
In addition, Dutch mice are very clean, active, and sociable. However, caring for them is quite a different experience.
In this guide, we’ll discuss everything you need to know about a Dutch mouse, and we’ll provide some caring tips too.
What Is a Dutch Mouse?
The Dutch mouse is a smaller breed of the fancy mouse family with evenly balanced cheek markings and patch coverings on either side of the face. It comes in a variety of colors. These include black, agouti, blue, and cinnamon. The colors distinguish it from wild types, as both mice would be confusing without this difference.
Additionally, Dutch mice are smart. They quickly get accustomed to the smell and sight of their owners. This is important as you don’t want your pet mouse scuttling away when you enter the vicinity.
How Long Do Dutch Mice Live?
The average lifespan of the Dutch mouse is two years. However, it can live up to three years or more when treated with proper care.
Note that as the older Dutch mice grow, they’re more susceptible to health hazards. For instance, most mice grow tumors over the age of one.
What Supplies Do I Get Before Buying a Dutch Mouse?
You don’t need too many supplies before you can welcome your furry friend home. The essentials listed below should get you going.
- Food and water bowl
- Food pellets
- Chewable toys
- Exercise wheel
These supplies should keep your Dutch mouse comfortable for some time. After that, you can decide to go big and get more supplies. However, the mentioned supplies should suffice for the first weeks.
What’s the Best Housing for a Dutch Mouse?
An important thing to note is your Dutch mouse’s housing. Whatever you do, just make sure you get an enclosure that fits the guidelines from RSPCA. What does this mean?
You need to get your mouse an enclosure that’s both comfortable and secure. The preferable habitat for Dutch mice is a cage. The cage has to be big enough for the mouse to play and hide around.
Ventilation in the enclosure is a no-brainer. Your mouse needs room to breathe but not too much space that it can slip through. Additionally, you’ll need to get some bedding for the cage and some solid flooring as well.
Avoid using plastic cages as homes for your Dutch mouse. Plastic cages tend to aid the growth of bacteria, which is poisonous to mice. Although these cages are nice-looking, they can cause more harm than good.
What Do Dutch Mice Eat?
Like most mice, the Dutch mouse isn’t too picky about what it eats. But there are certain essentials you should include in your Dutch mouse’s meal. These ingredients include mouse pellets, fruits, and vegetables. Offer these foods to your mouse in bowls that are not too deep, or else it may fall and get stuck in the bowl.
Also, try to feed your Dutch mouse in the evening as it’s most active at this time. And if your mouse leaves its food untouched for over 12 hours, just discard it. Eating that food later can be poisonous to your pet.
Aside from food, remember to make fresh water available to your mouse.
How Do I Know My Dutch Mouse is Healthy?
Certain signs can tell you whether your mouse is healthy or not. The first is how active it is. If you have a very active and alert mouse, you can rest assured that it’s healthy.
Also, a healthy mouse eats and drinks a lot. This also goes for passing droppings. After all, the more you consume, the more you excrete. Other things to look out for include unlabored breathing, clear eyes, and no loss of hair.
How to Handle a Dutch Mouse
Handling a Dutch mouse is easy if you know what to do. You have to pick up your mouse by lifting the closest part to the tail and cupping your hands around it. That’s all.
However, avoid holding your Dutch mouse too tight, or else you’ll just squeeze it, and that’ll frighten your mouse. Also, make sure your mouse is calm before you let go. This lowers the likelihood of it jumping out of fright. It’s a good way to tame mice too.
How to Tame Your Dutch Mouse
The Dutch mouse enjoys human company. This makes it quite easy to tame. The trick is to hold it gently and over a soft surface. Do this at consistent intervals, maybe over four days.
After that, you’re good to go. Also, it’s worth mentioning that this mouse pet is a curious one, making it easy to pick up your smell, sight, and voice; it gets closer to you this way.
Where Can I Get a Dutch Mouse?
You can purchase your mouse from a variety of pet retailers, particularly major pet stores and even smaller chain ones. In addition, some mouse owners look to animal refuge organizations and breeders.
Now, we know what Dutch mice are and some techniques for taking proper care of them. We’ve also answered some questions that’d help you be a better mouse pet owner.
Remember, the go-to housing for a Dutch mouse is a metallic cage with good bedding. Also, this mouse isn’t a picky eater, so you’re green on the food front.
And you can tame your Dutch mouse if you follow the handling techniques above. You can even teach your mouse a trick or two if you can master the handling technique. | <urn:uuid:01f75f23-aaa5-4cad-affd-b533d1e727ba> | CC-MAIN-2022-33 | https://fancymice.info/dutch-mouse/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.95467 | 1,226 | 2.015625 | 2 |
Pants Up For Purpose Workshop- Facilitator Guide
PANTS UP for PURPOSE
The PANTS UP for PURPOSE is an easy-to-use facilitator manual to aid leaders and coaches to facilitate small group discussions for women ages 18 and up.
In conjunction with the guided journal 99 THINGS to DO with YOUR PANTS UP, this manual is used to facilitate the PANTS UP for PURPOSE program to help women take steps in discovering their purpose.
Through thought provoking questions, group discussions, and activities, participants will learn how to: take steps to identify their purpose, set short- and long-term goals, recognize behaviors that hinder progression, and discover ways to maneuver through obstacles that arise. The Facilitator Guide also includes an optional discussion on practicing abstinence and setting boundaries.
The two-day Program is divided into two workshops:
Session 1 – Getting to Know Yourself
Who Are You?
Start with A Goal
Identifying Your Triggers
Session 2 – Identifying Passions & Overcoming Obstacles
Knowing Your Interests
Identifying Your Passions
Overcoming Obstacles to Achieve Your Goals
Stepping Towards Purpose
Use your knowledge and experience to help other women in your church, ministry, small group, or organization take steps to reach their purpose in life. | <urn:uuid:3918dec0-0ba5-4ec8-b4e0-dd627e20cf4f> | CC-MAIN-2022-33 | https://payhip.com/b/KZQi | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.887263 | 274 | 1.820313 | 2 |
By David Jacobson, Temblor
Over the weekend, there was a M=6.4 earthquake off the coast of Sumatra in Indonesia. Despite the quake’s magnitude, because it struck offshore, 74 km from the city of Bengkulu, and at a depth of 36 km (according to the USGS) it did not cause any major damage. However, shaking did last approximately 10 seconds, and was severe enough to result in power outages, knock objects off shelves, and cause people to flee from their homes. Based on the focal mechanism and depth of this earthquake, it likely occurred on the Sumatra-Andaman plate boundary slightly above the subduction zone.
The Sumatra-Andaman plate boundary is a collision zone between the Indo-Australian and Sunda plates. This subduction zone extends for over 8,000 km and has been responsible for large, damaging, historic earthquakes. For example, in 2004, a M=9.1-9.3 earthquake struck off of Banda Aceh. This earthquake ruptured a ~1,600 km-long portion of this plate boundary, and the shaking and ensuing tsunami killed over 200,000 people. In addition to this great earthquake, there have been several M=7.3+ earthquakes in this region since 2000 (see figure below).
What the above figure from Caltech shows is that the weekend’s earthquake occurred on the edge of the rupture zone of the 2007 M=8.4 earthquake. While just a hypothesis, this could mean that the earthquake over the weekend was a very late aftershock. What is also interesting is that there is a large gap between the two 2007 ruptures and the 2005 M=8.6 rupture zone. If one looks at the two Temblor maps above, you will see that there is not a large amount of seismicity in this region, while to the south, there is. While this could be purely coincidental, it is worth noting as it could be indicative of differences in subduction along the plate boundary.
Based on the Global Earthquake Activity Rate (GEAR) model, the weekend’s earthquake should not be considered surprising. This model, which is availbale in Temblor, uses global strain rates and the last 40 years of earthquakes to determine the likely earthquake magnitude in your lifetime anywhere on earth. From the figure below, one can see that for this part of Indonesia, a M=7.0+ earthquake is likely. This highlights the earthquake potential, and thus the hazard of this region.
The Washington Post
- What’s happening this week in Humboldt County, California: The squeeze - February 6, 2019
- Finding of the unexpected tsunami due to the strike-slip fault at central Sulawesi, Indonesia on 28 September 2018, from the preliminary field survey at Palu - October 15, 2018
- California bill (AB 2681) to create a public inventory of collapse-risk buildings is awaiting Gov. Brown’s signature - September 7, 2018 | <urn:uuid:73069b1e-f6bc-4d42-a32f-05e11dba1ed0> | CC-MAIN-2022-33 | https://temblor.net/earthquake-insights/m6-4-sumatra-earthquake-a-possible-aftershock-of-a-2007-m8-4-quake-4840/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz | en | 0.946969 | 631 | 3.390625 | 3 |
I've read quite a bit on the web about dry lining - but much doesn't apply to our situation, so I've come here for some advice.
We have a rectangular single storey extension on our house with a flat felt roof onto a poured-in-situ concrete ceiling. It has 3 external sides of 9" single thickness brick walls and one side internal of cavity wall. The floor is concrete but does have a dampcourse.
It houses our backdoor as well as two other internal doors to other rooms.
Therefore, in order to make best use of this room, we have floor-tiled the small area by the back door, and have raised the floor level of the majority of the room using 5" x 2" pre-treated joists and 22mm P5 boards. This new floor height marries-up with the existing floor levels of the two other internal doorways that access this room.
We know that the 9" exterior walls suffer from a little rain penetration but we are prepared if necessary to paint some clear rain proofing "render" onto the exterior brickwork (e.g. Wickes Water Seal). The felt roof is brand new and has massively cured the previous damp problem.
We have allowed full airflow under the raised floor by means of 42mm holes through all of the joists and end members - and there is a 25mm gap between the P5 boards and the internal faces of the exterior walls to allow air to rise / fall. There is foil-backed 2-3mm expanded polystyrene sheet between the P5 boards and the top of the joists, with the foil facing uppermost.
We plan to put 25mm deep battens onto the internal faces of the exterior walls and then fit vapour-barrier 1/2" plasterboard onto them. No insulating materials between the wall and the backside of the plasterboard.
We plan to fit 50mm deep battens onto the underside of the concrete ceiling and ditto fit vapour-barrier 1/2" plasterboard onto them. And again, no insulation between the concrete roof and the plasterboard.
We plan that there will be unimpeded air flow from vents at the end of the raised floor by the floor-tiled backdoor area, passing underneath the raised floor, up behind the wall battened plasterboard, and through the ceiling battens...ultimately moving through some vents in the false ceiling.
We also plan to fit a radiator to one of the exterior walls, with the central heating pipework looping through all of the raised floor joists before connecting to the radiator.
So...are we barking mad... :lol: ...or will this idea of having a draught of warm air from pseudo underfloor heating moving up behind the plasterboard walls and over the plasterboard ceiling actually work...?
And are there any pitfalls that we haven't thought of...? e.g. cold bridging, condensate pooling in the ceiling etc...?
[quote="kbrownie"]Why do you want to waste warm air behind plasterboards?[/quote]To stop damp forming behind the plasterboard due to the fact that it's a solid brick wall to the environment.
However, the way that we've planned it, if the air remains warm (albeit cooling all of the time) it will rise, eventually "blowing out" of the ceiling vents - and as it hits the warmer air of the actual room at ceiling level it will drop.
Alternatively, any cold air behind the plasterboard / above the false ceiling will drop and eventually "blow out" of the vents at ground level.
In any event, what we're trying to achieve is air circulation - this, we think, will stop damp becoming an issue.
[quote="kbrownie"]a little bit complex for my liking may be i'm in foreign land. Have a look at a couple of post that I have offered info on see if it will suit your application.
Hammy and doitwell
I looked at a couple of your other posts but didn't glean any further insight to our plasterboarding situation.
However, I get the distinct impression that you and I have the 17th edition in common. I get to play with Industrial Electrics & PLCs & Robots etc during my working day, coming home to play with home-built PCs & Analogue+Digital Recording equipment at night.
Whatever - I'll try asking some of my local builder-buddies for their input in this matter. And if I get a definitive working solution from them, I'll post the results here.
Look forward to hearing from you.
Good spot qualified sparky, mostly domestic and small/medium industrial, not really in to the electronics side.
But my past live I used to do a lot of dry-lining and plastering was family business. So needed to branch ouy a little.
DIY how to tutorial projects and guides - Did you know we have a DIY Projects section? Well, if no, then we certainly do! Within this area of our site have literally hundreds of how-to guides and tutorials that cover a huge range of home improvement tasks. Each page also comes with pictures and a video to make completing those jobs even easier! | <urn:uuid:6fc08a6a-c3eb-4e0b-a265-2c6189f6824d> | CC-MAIN-2022-33 | https://www.diydoctor.org.uk/forums/raised-floor-drylined-walls-ceiling-and-underfloor-t17030.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.933857 | 1,099 | 1.523438 | 2 |
Any cases with a hyperlink to this legislation will automatically be added here. There may be other relevant cases without a hyperlink, so please check the mental health case law page. No results
Article 12 – Right to marry
Men and women of marriageable age have the right to marry and to found a family, according to the national laws governing the exercise of this right. | <urn:uuid:28ec72c1-5a0c-4f5f-b30a-bec57237fcd9> | CC-MAIN-2022-33 | https://www.mentalhealthlaw.co.uk/Article_12 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.898614 | 84 | 1.515625 | 2 |
In the isolated mountains of South Sulawesi, can be found Toraja. Its native animist belief system, Aluk To Dolo (Way of the Ancestors), has provided its people with a unique cultural identity and distinctive rituals.
Since the arrival of Christian missionaries in 1908 and the near total conversion of the population, the survival of this ancient oral tradition is threatened.
Ne Minda, one of the last living spiritual leaders of Aluk To Dolo, lives a humble existence carrying out domestic rituals with his daughter and grandchildren.
Through this family dynamic, Aluk will explore the inter-generational transmission of cultural knowledge and the inevitable transformation of the Torajan identity in the modern world.
Aluk will observe Aluk To Dolo’s sacred connection to Toraja’s natural environment and ancestry, as well as the Torajan people's singular approach to life and death. | <urn:uuid:9520711d-7690-470a-af99-4621f5338dc3> | CC-MAIN-2022-33 | https://www.dogmilkfilms.com/projects/aluk | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.913014 | 186 | 2.765625 | 3 |
Due to a recent rise in cases, the World Health Organization declared the spreading monkeypox outbreak a global public health emergency on Saturday, July 23. Here's what you should know.
With July being Park and Recreation Month and this year’s theme being “We Rise Up for Parks and Recreation,” Clement Lau, a departmental facilities planner with the Los Angeles County Department of Parks and Recreation, shares one way for park and recreation professionals to rise up: telling our stories.
NRPA’s SNAP and WIC Outreach Toolkit provides information for park and recreation professionals on how to provide SNAP/WIC outreach directly to community members, connecting them to enrollment and retention assistance for increased access to affordable and healthy foods.
The August issue of Parks & Recreation magazine is out now, and on today’s bonus episode of Open Space Radio, we’re diving deeper into one of this month’s feature stories, titled, “Homelessness: How Can I Help?”
National Farmers Market Week, taking place August 7-13, is an annual celebration hosted by Farmers Market Coalition that highlights the vital role farmers markets play in the national food system.
On the latest episode of Open Space Radio, we're discussing how Montgomery County, Maryland, is celebrating Latino Conservation Week with Michelle Ramirez, the public outreach specialist for Montgomery Parks.
On the latest episode of Open Space Radio, we map out all the resources you need to have a successful Park and Recreation Month this July. | <urn:uuid:9806134f-5936-46ae-b8a7-82a617c731bb> | CC-MAIN-2022-33 | https://www.nrpa.org/blog/2022/7/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.919533 | 309 | 1.5625 | 2 |
Imagine being invited by a trusted friend to a “life-changing” event. Should you go? Your friend says her life has been transformed by such events and you believe her. The event could be a church service, self-help talk, concert, movie, festival, hike, play, dinner party, book club, union organizing meeting, etc.: whatever you find easiest to allow unfolding such that you are likely to be changed in some fundamental way. Do you go? Why or why not? What sorts of considerations do you reach for in making your choice?
Most prominently in her book Transformative Experience (OUP, 2014), the philosopher L. A. Paul has put problems like these, termed transformative choices, on the map for philosophical and scientific inquiry. Focusing on some exemplary cases, such as that of whether to become a parent, Paul has argued that there may not be satisfactory reasons available for making transformative choices, at least given certain common assumptions, some of which are codified in standard decision theory.
The problem of how to make transformative choices is not simply a philosophical one, but rather a predicament that can arise for anyone in their daily life. Nor is Paul the first philosopher to identify the force of this problem. Prior to Paul’s work, Edna Ullmann-Margalit also discussed the phenomenon of transformative decision-making, and identified some of the philosophical issues it raises (see the essay “Big Decisions”, reprinted in her Normal Rationality, OUP, 2017). While Paul and others have duly acknowledged Ullmann-Margalit’s work, we believe it remains underappreciated for what it can add to current discussions, and wish here to continue amplifying her distinctive contribution. Of particular interest is the detailed framework that Ullmann-Margalit constructs for making sense of transformative choices. As our way into this framework, let’s begin by considering what rational choice generally involves.
“The problem of how to make transformative choices is not simply a philosophical one, but rather a predicament that can arise for anyone in their daily life.”
To be rational in your choices, you need to make the best decisions you can. Best by what measure? This is controversial, of course, but one common answer is that the best choice in a given situation is the one that wins a pro/con contest, i.e., the one that has the strongest upside once all the downsides have been considered. “Standard decision theory” is a formalization of this plausible idea. Assuming certain things about our beliefs and desires or preferences, decision theory gives us quantified expected values for each choice under consideration. The option with the highest expected value is the rational one to choose.
Some of the assumptions that are necessary to achieve this calculus are stronger and more questionable than others. And the problem of transformative choice can be thought of as challenging particular assumptions of this framework. But sometimes people chafe at the very idea that crucial decisions like parenting can be construed merely as an exercise of weighing pros and cons. Ullman-Margalit has a compelling diagnosis of this felt resistance, proceeding from her account of transformative choice.
Planning groceries for the week is a good example of a kind of decision-making that most everyone could agree is adequately covered by standard decision theory. You’ve got some stable preferences, plus expectations about price and availability. Your decisions each week may be subject to such things as your bank account balance, the time you have to shop, whether you’re tired of a certain dish, the unexpected availability of certain items, etc. The question of how to adjust your list each week seems unobjectionably subject to a cost/benefit calculation and is easily modeled by standard decision theory. Ullmann-Margalit categorizes choices like these as “medium” decisions and agrees that it’s possible to approach them rationally in this way.
In contrast with making your list, the activity of actually finding your listed items at the grocery store is full of decisions that Ullmann-Margalit calls “small.” Which box of corn flakes should you pick out of all the identical ones before you? The usual calculus doesn’t apply here, except trivially. Sure, you face a problem of selecting which item to reach for, but it would make no sense at all to deliberate over the possibilities. As opposed to genuinely “choosing,” Ullmann-Margalit says that we simply pick which box to take off the shelf. What the example helpfully provides is a relatively uncontroversial example of a decision problem for which it would be a mistake to employ the standard decision calculus as a tool.
“When we approach ‘medium’ decisions, we evaluate our options and the different considerations for each. But with ‘big’ decisions we are faced with the possibility of altering the very mindset on the basis of which medium decisions are made.”
“Big” decisions are the other area where standard decision theory sometimes seems to break down, but now for much more interesting reasons. For big decisions are the ones that threaten to transform the very basis on which we choose what to do. When we approach “medium” decisions, we evaluate our options and the different considerations for each. But with “big” decisions we are faced with the possibility of altering the very mindset on the basis of which medium decisions are made—and it can be hard to see how such a choice can itself be made rationally, at least by the lights of standard decision theory. To extend our metaphor, suppose you have a friend from a different culture. Their approach to food procurement is very different, with divergent food preferences being just a start. Suppose it was an option to change your preferences, beliefs, habits, etc. to be like theirs. Or suppose that something you did really want to do, such as spending a lot of time with this friend and her family, would likely have the side-effect of changing you in just these ways. Many people will find something inappropriate in the idea of subjecting such decisions to a cost-benefit calculus. Ullmann-Margalit suggests that this is because such a thing is really impossible: in order to perform this analysis you’d need to base it on your current mindset, and yet this mindset is just what the choice is going to change!
In her work, Ullmann-Margalit calls the pool of resources we draw on in decision-making our rationality base. Big decisions, or transformative choices, are those which promise to alter our rationality base in some crucial and irreversible way. Many philosophers talk, as we have above, about our rationality base as composed of beliefs and desires. Standard decision theory employs the language of credences and preferences. Many outside of those contexts would talk about commitments and values. The problem of transformative choice can be put in any of these terms. In the wake of a transformative choice, the choice-maker is left with values, desires, preferences (or whatever else) that either contrast with, or simply don’t make sense from the perspective of, the values, desires, preferences, etc. that she had beforehand, and that she relied on in making the choice. Yet choose we must—or, opt we must, as Ullman-Margalit prefers to put it. (As with small decisions where standard decision theory is deemed inapplicable and so we “pick” rather than “choose”, Ullmann-Margalit says that we “opt” in cases where decisions are big enough to overwhelm our rationality bases.) In transformative decision making we cannot opt rationally, but Ullmann-Margalit holds out hope that we can at least be reasonable in what we opt to do. Whether, or how, one might opt reasonablywhen faced with a transformative choice remains an open question. | <urn:uuid:c9e7c203-8cb5-4e45-8b30-12aace4b5e9e> | CC-MAIN-2022-33 | https://blog.oup.com/2021/05/transformative-choice-and-big-decisions/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.948907 | 1,637 | 2.015625 | 2 |
Are you a peer-to-peer seller? Here’s what you need to know
March 16, 2022
Canada Revenue Agency
What is a peer-to-peer sale?
A peer-to-peer (P2P) transaction involves the selling of goods from one person or party directly to another. You may be taking part in P2P selling if you are connecting with buyers through digital platforms like websites, online marketplaces or mobile applications (such as Etsy, eBay or Amazon).
Income tax implications
As a resident of Canada, you must report your income from all sources on your income tax return. This includes any income you earn inside and outside of Canada, whether through P2P or other transactions. If you paid foreign income tax, you could be eligible for a tax credit.
It is important to maintain proper books and records, including:
- a list of all earnings from peer-to-peer sales
- details about when, how and where your sales were made
- details of the business expenses you incurred for these sales, supported by invoices, receipts, or vouchers
This applies to the sales you make to buyers in Canada and other countries. Keeping records of all your purchases will ensure you can substantiate the expenses you claim on your tax return. To learn what qualifies as an eligible business expense, go to Business expenses.
If there is a reasonable expectation of profit from your online activities, and your total taxable supplies are more than $30,000 over four calendar quarters you will need to register for, collect and pay to the Canada Revenue Agency the goods and services tax / harmonized sales tax (GST/HST) for taxable supplies of goods and services that you made. You can get more details on GST/HST registration requirements at: Find out if you must register for a GST/HST account.
How to correct your tax affairs
If you did not report your income from P2P sales, you may have to pay penalties and interest in addition to the tax on the unreported income. By correcting your tax affairs voluntarily, you may avoid or reduce penalties and interest.
To correct your tax affairs (including corrections to GST/HST returns) and report income that you did not report in previous years, you may:
- Ask for a change to your income tax and benefit return
- Adjust your GST/HST return
- Submit an application through the Voluntary Disclosures Program. If accepted, you will receive prosecution relief, and in some cases penalty relief and partial interest relief that you would have otherwise needed to pay.
You can find more information on this topic at Compliance in the platform economy.
New rules regarding e-commerce services provided by non-residents in Canada came into effect on July 1, 2021. More information is available at GST/HST for digital economy businesses.
Canada Revenue Agency
- 30 -
Report a problem or mistake on this page
- Date modified: | <urn:uuid:4be67d1a-6be0-4e4a-aed5-9c2c3594e8cf> | CC-MAIN-2022-33 | https://www.canada.ca/en/revenue-agency/news/newsroom/tax-tips/tax-tips-2022/are-you-a-peer-to-peer-seller-here-what-you-need-to-know.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.929786 | 655 | 1.835938 | 2 |
BLACKCURRANT CHRISTMAS MINCE
The original Christmas mince pie dates back to medieval times when it did in fact contain meat. Over the centuries the meat has been slowly replaced with more spices, sugars and dried fruit as they became readily available. At one stage the pie was made oval in shape to symbolize the manger and the mince meat contained 3 spices symbolizing the gifts from the Three Kings. To ensure a lucky year the story goes that you should eat 12 pies between Christmas Day and the Twelfth Day !!!
Combined with honey, blackcurrants give a delightful flavor to this Christmas Mince.
Ingredients for Blackcurrant Christmas Mince
- cup frozen blackcurrants
- 2 cups mixed fruit
- 1 cup dates – chopped and tightly packed
- flesh from 1 tangelo – chopped
- ¼ cup honey
- ¼ teaspoon mixed spice
- 3 tablespoons brandy
Preparation of Blackcurrant Christmas Mince
Place blackcurrants into a saucepan. Over a low heat cook until thawed and juices run. Stir in mixed fruit, dates, tangelo flesh, honey and spice. Slowly bring to the boil, simmer gently uncovered for 8-10 minutes or until thick and pulpy. Stir frequently to prevent sticking. Remove from heat. Stir in brandy. Spoon into sterilized jars. Seal. Store in refrigerator.
This Blackcurrant Christmas Mince is wonderful in mince pies:
Or, in a more innovative way, in a coconut creme brulee with Christmas Mince:
Our thanks to Australian-based food writer Anne Morton for this delightful recipe! | <urn:uuid:91f2be2a-1326-4f85-b0e2-8dc2240e9537> | CC-MAIN-2022-33 | https://www.blackcurrant-iba.com/blackcurrant-christmas-mince/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00665.warc.gz | en | 0.908409 | 336 | 2.0625 | 2 |
The topology of gene expression and protein localization is a crucial characteristic of life, where the spatiotemporal dynamic of secretory proteins instruct higher order organization, including the orchestration of developmental and adaptive programs. However tools to non-invasively interrogate the fate of secretory proteins in vivo are scarce. Here we introduce a genetic tagging strategy for in vivo imaging of the secretion and expression dynamics of secretory proteins in living animals. Applying this to a prototypical liver-derived secretory protein, we demonstrate that this approach, combined with optical in-vivo imaging, uncovers extrahepatic prothrombin expression in multiple novel anatomical sites (including testes, placenta, brain, kidney, heart and lymphatic system) and in emerging tumors, resulting in significant amounts of tumor-derived prothrombin in the blood with procoagulant properties. Syngeneic cell lines from this mouse model enable unravelling regulatory mechanisms in high resolution, and in a scalable format ex vivo. Beyond discovering new functions of proteins in a targeted manner, this model allows identifying rheostats in the cross-talk between gene expression and availability of a secretory protein. It is also a valuable resource for uncovering novel (tissue-specific) therapeutic vulnerabilities.
Cells synthesize thousands of proteins with diverse functions, which need to be directed to specific locations in accurate amounts at precise time. Nearly one-third of the human proteome is targeted to secretory environments consisting of the endoplasmic reticulum, lysosome, plasma membrane or the extracellular space, by a well-operating cargo system[3-4]. Almost all cytokines, hormones, receptors, peptidases, channels, extracellular matrix components, transport proteins and coagulation factors are clients of this machinery. Secretory proteins also possess a central role in anatomical and functional compartmentalization, for example by controlling the function, volume and integrity of the vascular compartment[6-8]. Dysfunction of the production and proper delivery of secretory proteins is the cause of a variety of diseases, including neurodegenerative, developmental and cardiovascular disorders, and perturbations of the hemostatic system[9-14].
In most cells, secreted proteins account for 10-20% of the transcriptome. In contrast, about 40% of all transcripts in the liver encode secreted proteins, reflecting the particular functional demands of this metabolic organ. The liver synthesizes and releases into the bloodstream numerous secretory proteins, including albumin, the most abundant serum protein regulating the colloid osmotic pressure and serving as carrier protein, and most coagulation factors. Accordingly, the impairment of hepatic protein production and secretion results in detrimental consequences. This includes bleeding disorders and venous thromboembolism, a global cause of mortality, exemplifying the importance of a well-balanced production of liver-derived secretory proteins. Regulatory mechanisms have evolved to ensure the required functional levels of secretory proteinsand to adapt production to conditions of increased turnover and demand. This likely also involves hitherto largely undefined (auto) regulatory mechanisms reminiscent of hormone feedback circuits. Depending on spatial and temporal availability, secretory proteins can also display entirely distinct functional characteristics[20-22]. Illuminating these processes at the systems level paves the way to unravel underlying regulatory principles and disease-eliciting mechanisms. It can also help identify novel therapeutic opportunities.
Molecular imaging is a rapidly emerging field, providing quantitative, non-invasive visual representations of fundamental biological processes in intact living subjects. In addition to innovative new probes and imaging agents, current applications of non-invasive imaging involve reporter genes to monitor processes including signal transduction, cell tracking, or transgene expression, with exciting advances employing synthetic biology coupled to optoacoustic imaging, and innovative applications in humans. Traditional non-invasive imaging of endogenous gene expression can be complex[28-29]. While indirect imaging relies on reporter gene expression, for example serving as a proxy for the abundance of transcription factors, direct measurements require the manipulation of the endogenous gene without impairing the epigenetic, transcriptional and posttranscriptional regulation[30-32]. Despite the critical medical dimension, tools to non-invasively visualize expression and protein secretion dynamics, and spatiotemporal distribution of secretory proteins at a systems level are surprisingly scarce.
Here we report on a novel multimodal reporter animal designed for conditional non-invasive optical imaging of a prototypical liver-derived secretory protein. This is based on multicolor imaging to dissect the expression and secretion dynamics of prothrombin in its physiological context in a living animal. In a proof-of-concept, including the validation with an inducible hypomorphic animal, we confirm that the reporter mouse model faithfully recapitulates known modifiers of prothrombin expression. We also discover extrahepatic prothrombin expression at various anatomical sites, and in emerging malignant mesenchymal tumors, resulting in significant quantities of functional tumor-derived prothrombin in the plasma, which entertains a procoagulant function. It thereby documents the autonomous expression of a secretory protein that becomes harmful if aberrantly expressed. We further demonstrate that complementary syngeneic primary cell culture lines obtained from this reporter animal enable the deconvolution of regulatory mechanisms in high resolution, and in a scalable high throughput format ex vivo. It thereby represents a valuable resource for uncovering disease-eliciting cues and novel therapeutic vulnerabilities.
Generation of the D-Insight mouse line
The targeting strategy aimed at generating a constitutive Knock-In (KI) of Rluc (Renilla Luciferase)-P2A-Flag-iRFP (near-infrared fluorescent protein)-P2A-DTR (diphtheria toxin receptor)-P2A-Fluc2CP (Firefly Luciferase) at the F2 gene (NCBI transcript NM_010168_2). To that end, the following cassette has been inserted between the last amino acid and the translation termination codon in exon 14 of the F2 gene (from 5’ to 3’, Supplementary Figure S1):
an in frame loxP site (nucleotide sequence: ataacttcgtatagcatacattatacgaagttatgc)
a GGGSGGGGSGGGGSGGGGS-linker peptide (nucleotide sequence: ggcggcggcagcggcggcggcggcagcggcggcggcggcagcggcggcggcggcagc)
theRLuc 8.6 open reading frame (ORF)
the “self-cleaving” peptide P2A (nucleotide sequence: gctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct)
a Flag tag sequence (nucleotide sequence: gactacaaggacgacgatgacaag)
a GGGSGGGS-linker peptide (nucleotide sequence: ggcggcggcagcggcggcggcagc)
a GGGSGGGS-linker peptide (nucleotide sequence: ggcggcggcagcggcggcggcagc)
the “self-cleaving” peptide P2A (nucleotide sequence, see above)
the DTR ORF
an in frame loxP site (nucleotide sequence: ataacttcgtatagcatacattatacgaagttatat)
the “self-cleaving” peptide P2A (nucleotide sequence, see above)
the Fluc2CP ORF.
Prior to cloning of the targeting vector, all inserted sequences have been tested and modified for optical codon usage (in mice). All used linker peptides were tested for potential interference with secondary and tertiary structures of F2, RLuc 8.6, iRFP, DTR and Fluc2CP. The positive selection marker (Puromycin resistance - PuroR) has been flanked by FRT sites and inserted into intron 12. The targeting vector has been generated using BAC clones from the C57BL/6J RPCIB-731 BAC library and has been transfected into the C57BL/6N Tac ES cell line. Homologous recombinant clones have been isolated using positive (PuroR) and negative (Thymidine kinase - Tk) selection. Constitutive KI allele 1 was obtained after Flp-mediated removal of the selection marker. This allele expressed a chimeric transcript encoding F2 protein fused to the loxP-Rluc ORF, the P2A sequence, the Flag tag sequence fused to the iRFP ORF, the P2A sequence, the DTR-loxP fusion protein, the P2A sequence and the Fluc2CP ORF. The expected co-translational „cleavage” at the P2A sequences results in a 1:1:1:1 stochiometric co-expression of the F2-loxP-Rluc, Flag-iRFP and DTR-loxP fusion proteins and the Fluc2CP protein under the control of the endogenous F2 promoter.
Constitutive KI allele 2 was obtained after Cre-mediated removal of the Rluc, the Flag-iRFP and the DTR ORFs. This allele should express a chimeric transcript encoding F2 protein fused to the loxP and the P2A sequences and the Fluc2CP ORF. The expected co-translational cleavage at the P2A sequences should result in co-expression of the F2-loxP fusion protein and the Fluc2CP protein under the control of the endogenous F2 promoter. The remaining recombination site is located in a non-conserved region of the genome.
For conditional imaging heterozygous D-Insight animals were paired with Albumin-CRE (Alb-Cre) animals (B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J) .
Inducible F2-RNAi mouse model
For reversible depletion of F2, an inducible knock-down allele of the F2 gene was generated via targeted transgenesis of a doxycycline-inducible shRNA cassette into the ROSA26 locus (Gt(ROSA)26Sor)69. Briefly, to that end a recombination-mediated cassette exchange vector harboring an inducible H1 promoter (H1tetO)-driven shRNA cassette along with a genetic element for the constitutive expression of the codon-optimized tetracycline repressor protein (iTetR), and a neomycin resistance cassette was transfected into C57BL/6 ES cell line equipped with RMCE docking sites in the ROSA26 locus. Recombinant clones were isolated using neomycin resistance selection and positive clones harbouring six different shRNAs targeting F2 were pretested for knockdown potency in ES cells (by qPCR analysis). The clone with highest knock-down efficiency was used for the generation of the mouse line. All animal experiments were approved by local authorities, and animals’ care was in accordance with institutional guidelines.
Isolation of primary hepatocytes and primary hepatocyte culture
Mice were anesthetized with Ketamine (50 μg/ml, InresaArzneimittel GmbH) and the abdomen was opened. Subsequently the portal vein was cannulated to perfuse the liver with 100 ml of prewarmed (37°C) primary hepatocyte isolation (PHI) buffer I (137 mMNaCl, 52 mMKCl, 10 mM HEPES, pH7.4). Upon successful flushing, 50 ml of PHI-buffer II (58 mMNaCl, 52 mMKCl, 1.6 mM CaCl2, 10mM HEPES, 0.05% collagenase, pH7.6) was used for digestion of the liver. Afterwards, the perfused liver was explanted and stored in PHI-buffer III (137 mMNaCl, 52 mMKCl, 1.6 mM CaCl2, 10 mM HEPES, pH7.6). The liver was then mechanically dissociated under sterile conditions and dissociated through a 40 μM cell strainer (Corning) and centrifuged (90 g, 3 minutes without break). Next the supernatant was discarded and the liver cells resuspended in 15 ml prewarmed PBS followed by a second round of centrifugation (300 g, 3 minutes without break). The cells were resuspended in William’s E medium (Biochrom). Viability was measured by the trypan blue exclusion test. Hepatocytes were then seeded on gelatin-coated culture plates (0.2% gelatin) for 1 hour at 37°C in William’s E medium containing 5 % FBS, 1 μM Dexamethasone in DMSO, 100 units/ml Penicillin, 100 μg/ml Streptomycin, 4 μg/ml Human Recombinant Insulin, 2 mMGlutaMAX, 15 mM HEPES at 37 °C in/5%CO2. The culture medium was changed every 2-3 days. D-Insight positivity of primary hepatocytes was confirmed by luminometric analysis (see below), by FACS based on iRFP fluorescence in a BD FACS Canto (BD Bioscience) and by an AmnisImageStream Mk II flow cytometer (Luminex) and analyzed using the IDEAS software (Luminex).
Generation and assessment of MCA-induced tumors
Methylcholanthrene (MCA) induced sarcomas were generated through 0.1mg MCA suspension (Sigma #213942) in 30μL corn oil (Sigma #C8267) intramuscularly injected into the left gluteal muscle of D-Insight animals (8-12 weeks old).
Generation of tumor cell lines
Tumors were extracted before they reached diameters >2cm. The tumors were washed in PBS and cut into several fragments and transferred into a 6-Well-Plate containing digestion medium (RPMI, 20 % FBS, 100 units/ml Penicillin, 100 μg/ml Streptomycin, 8 mg/ml Collagenase) and incubated for 24 hours at 37 °C in 5%CO2.umor fragments were mechanically dissociated by pipetting up and down, and then filtered through 40 μm cell strainers. The suspension was centrifuged at 1000 x g for 5 minutes and the obtained cell pellet was resuspended in DMEM (Biochrom). Viability was measured by the trypan blue exclusion assay. Fibrosarcoma cells were seeded on culture plates in DMEM containing 20 % FBS, 3.7 g/l NaHCO3 4.5 g/lD-Glucose at 37 °C in 5%CO2. The medium was changed every 48 h.
Generation of primary fibroblast cultures
Mice ears were washed in PBS and cut into several fragments. The fragments were transferred into a 6-well-plate containing digestion medium (RPMI, 20 % FBS, 100 units/ml Penicillin, 100 μg/ml Streptomycin, 8 mg/ml Collagenase) and incubated for 24 hours. Ear fragments were mechanically dissociated by pipetting up and down and filtered through 40 μm cell strainers. The suspension was centrifuged at 1000 x g for 5 minutes and the obtained cell pellet was resuspended in DMEM. Viability was measured by the trypan blue exclusion assay. Fibroblasts were seeded on culture plates in DMEM containing 20% FBS, 3.7 g/l NaHCO3, 4.5 g/l D-Glucose at 37 °C in 5%CO2. The medium was changed every 48 h.
In vivo Imaging
Non-invasive in vivo imaging of D-Insight mice was performed under Ke/Xy narcosis (intraperitoneal (i.p.) injection of ketamine (Ke, 80-120 mg/kg body weight) / xylazine (Xy, 5-10 mg/kg body weight) cocktail) using an IVIS Spectrum In Vivo Imaging System (Perkin Elmer, Rodgau, Germany) with images acquired using the Living Image® software package (Perkin Elmer).
The dorsal or ventral images of mouse bodies, ventral images of mice in operation, ex vivo imaging of the same mice (after euthanasia by overdose application of Ke/Xy narcosis) or postmortem imaging of certain organs were performed 30 min after i.p. injection of 100 μl ready-to-use coelenterazine (RediJetCoelenterazine H Bioluminescent Substrate, PerkinElmer, Rodgau, Germany) or 10 min after i.p. injection of 100 μl ready-to-use luciferin (RediJet D-Luciferin Bioluminescent Substrate, PerkinElmer, Rodgau, Germany) respectively. The pseudo color luminescent images (blue, green, yellow, and red from least to most intense) were overlaid on the grayscale photographic images. Quantification of luminescence was determined by calculating the Average Counts as Total Counts/Number of pixels for a defined region of interest.
100000 cells or 200 mg tissue were lysed in 100-500 μl Passive Lysis Buffer (Promega) for 15 min at room temperature on an orbital shaker. 50 μl of the lysate, plasma or media samples, were assayed in white 96 well plates in triplicate by the addition of 50 μl Bright-Glo™ Firefly luciferase assay system (Promega) or freshly prepared 40 ng/ml Coelenterazine in Renilla-Glo buffer (Promega). Alternatively 20 μl samples were assayed using a Dual-Glo Luciferase Assay System using manufacturers protocol (Promega). Luminescence (RLU) was measured immediately using a GloMax® Discover Microplate Reader (Promega).
Protein Transport Inhibitor Treatment
200000 cells were seed in Hepatocytes-Williams E medium (Gibco, 10043282) containing 10% FCS, 100 units/ml Penicillin and 100 μg/ml Streptomycin and incubated at 37 °C in 5% CO2. After 3 h, 0-0.5 ug/ml Brefeldin A was added to the medium and cells were further incubated for 2 days. Luminometry assays were then performed as described above.
For real time imaging of iRFP signal in DI hepatocytes and fibrosarcoma cells image stream was used. Cells were trypsinized and diluted in FACS buffer (PBS (1x), Bovine serum albumin (BSA, 0.5%), fetal bovine serum (FBS, 0.1%), Sodium azide (NaN3, 0.1%)) to a final concentration of 1 million cells per 500 μL. B6 hepatocytes and fibrosarcoma cells were used as controls. 1 μL of DAPI (1:10000 diluted in PBS) was added to 20 μL cell suspension before loading samples on the ImageStreamXMkII imaging cytometer. Single cell population and live cells were gated by considering the signal generated in DAPI 405 channel. For activation of iRFP signal in fibrosarcoma cells, 3-5 μL of biliverdin hydrochloride (chromophore for iRFP signal activation, final concentration 0.002%, Sigma; 30891) added to cells and incubated for 10 mins at 37 °C before imaging. As liver cells are known to produce sufficient amounts of bilirubin no additional biliverdin was used for iRFP activation in hepatocytes population. Living cells were sorted for iRFP positive signal and were quantified by gating the cells based on signal from 702/86 channel. The INSPIRE software was used to analyze the data and graph prism was used to plot the graphs.
Mice were injected intra-peritoneal with 1.0 to 1.5 mg/kg LPS (Sigma Aldrich). After 3 to 48 h mice were sacrificed by isoflurane inhalation and liver and plasma samples obtained. Samples were assayed by luminometry as described above.
Total RNA recovered from cells using peqGOLDTriFast reagent (Peqlab) and cDNA produced using the RevertAid Reverse Transcriptase kit (ThermoFisher Scientific) as per manufacturer’s instructions. qRT-PCR was performed using the Blue S’Green qPCR Kit (Biozym) with primers for F2 (GGTGAACCTGCCCATTGTAGA, TCCTCGCTTGGTGTCATTCA) and the housekeeper gene GAPDH (AGGTCGGTGTGAACGGATTTG, TGTAGACCATGTAGTTGAGGTCA) as per manufacturer’s instructions. Cycling (95°C for 2 min; 95°C for 30 sec; 60°C for 30 sec; 72°C for 30 sec and followed by a melting curve) was performed in a CFX Real-Time Detection System (Bio-Rad) and relative expression calculated using the CFX Manager Software (Bio-Rad).
F2 RNA in situ hybridization (FISH)
Cryosections were generated from murine organs and tissues. Briefly, mice were sacrificed by isoflurane inhalation and organs were washed in PBS before placing in Tissue-Tek® Cryomolds (25×20×5mm or 15×10×5mm; Sakura). The specimens were immediately covered with Tissue-Tek® O.C.T. compound, put on dry ice until frozen and stored at −80°C until sectioning. Cryosections (12 μm) were produced using a cryostat, mounted onto Superfrost®plus slides (Thermo Fisher Scientific) and fixed overnight at 4°C in 4% formaldehyde (FA).
The Thermo Fisher Scientific ViewRNA ISH Tissue 1-Plex Assay was used to visualize the F2 mRNA expression in cryosections. Briefly, slides were washed twice in PBS and dehydrated in increasing EtOH concentrations (50%, 70%, 100%; 10 min each). After drying, a hydrophobic barrier was drawn around the specimen using the ImmEdge pen (Vector). Slides were boiled (85-95°C) for 30-45s in pretreatment solution and washed twice with PBS, followed by incubation in 0.2M HCL (RT for 10 min). After washing with PBS, slides were incubated (10 min, RT) with Protease solution (diluted 1/100 in prewarmed PBS), followed by rinsing in PBS and 3 minutes incubation in 4% FA. Thereafter, all following hybridization and amplification steps were carried out at 40°C in a humidified chamber.
After washing twice with PBS and once with ddH2O, the hybridization of the probe set was carried out by incubation with the probe set working solution (probe set diluted 1/30 with prewarmed Probe set diluent) for 2.5-3h at 40°C. After hybridization, slides were washed 3x in washing buffer for 2 min at room temperature and under vigorous shaking. The slides were then incubated for 40 min in PreAmp solution diluted 1/100 in Amplifier Diluent, followed by a second washing step as indicated above. The slides were then incubated for 40 min in Amp solution diluted 1/100 in Amplifier Diluent. After a third washing step, the slides were incubated in Label Probe-AP diluted 1/500 in Label Probe Diluent for 40 min, followed by washing 3x in washing buffer for 3 min each with continuous shaking. AP-Enhancer solution was added to the samples and incubated for 5 min at room temperature. The slides were then incubated with freshly prepared detection substrate, consisting of half a tablet of Fast Red Substrate resuspended in 2.5 ml Naphthol buffer, for 30-40 min at 40°C in the humidified chamber. Slides were then washed 2x in PBS and kept in 4% FA for 5 min. After washing in ddH2O, counterstaining in haematoxylin for 10-30 sec and destaining in ddH2O, slides were dried 20 min at room temperature in dark environment, mounted with Fluoromount-G with DAPI (Invitrogen), covered with coverslips and dried again for 15 min. Nail polish was applied to seal the edges and slides were stored at 4°C covered with aluminum foil.
F2 activity, APTT measurements, Clinical Chemistry
F2 activity of tumor-bearing and tumor-free animals was measured with ACL Top instruments and a KC4™ Coagulation Analyser. Analyses of transaminases (GOT/GPT) have been carried out on an Abbott Alinity C analyzer.
The dose of Diphtheria toxin (DTX) was titrated in the range 0-4 ng/g body weight per animal with 2 ng/g being defined as optimal and used for the shown experiment (injected i.p.).
Epigenetic modulator treatment of D-Insight fibrosarcoma cells
100000 D-Insight fibrosarcoma cells were seeded in 6 Well plates in DMEM containing 10% FBS, 3.7 g/l NaHCO3, 4.5 g/l D-Glucose and incubated at 37 °C in 5% CO2 for 24 hours. Media was then changed to include an epigenetic modulator (either 10 nM (+)JQ1, 10 μMAzacitidine, 10 μMDecitabine, 10 μMLomeguatrib, 10 nMPanobinostat, 10 nMQuisinostat, 10 μM RG108 or 10 μMZebularine in DMSO) and incubated for 2 - 7 days and luminometry performed as described above.
All statistical analyses and production of graphs were performed using Prism 9 (GraphPad Software).
Thrombin is the key serine protease involved in blood coagulation and hemostasis. It is synthesized in the liver as an inactive 72-kDa precursor protein (prothrombin) and secreted into the blood circulation. Upon activation, thrombin converts fibrinogen into fibrin, the main component of blood clots, and activates platelets. Besides its role in hemostasis, thrombin is involved in numerous other processes, including embryonic development, angiogenesis, wound healing, inflammation, atherosclerosis and tumor biology[35-36]. This reflects the broad action of thrombin on membrane-bound G-protein coupled Protease Activated Receptors (PARs). However, many of these actions naturally affect cells residing in the extravascular compartment . This questions the prevailing observation of prothrombin synthesis being confined to the liver.
Here we set out to generate a multimodal imaging reporter animal to characterize the spatiotemporal dynamics of this pleiotropic liver-derived protein in vivo. Specifically, our strategy aimed at creating a reporter for (1) identifying and quantifying (non)canonical origins of prothrombin expression, and (2) disentangling gene expression and protein secretion dynamics under control of endogenous regulatory mechanisms. Further it ought to feature a (3) differential labeling of the secretory protein (depending on the origin where it is expressed and secreted), provide a (4) component to explore the downstream function(s) and serve as (5) resource for isogenic primary reporter cell lines for further in-depth studies, including regulatory pathways by high content analyses in a scalable format ex vivo.
To generate this versatile tool, we employed a multicistronic reporter strategy targeting the endogenous prothrombin (F2) gene locus in B6 mice (Figure 1a). We generated a conditional knock-in allele for in-frame insertion of two luminescence reporters, Rluc8.6-535and Fluc2CP (with the latter harboring two protein destabilization domains, hCL1 and hPEST, for improved reporter dynamics), a bright and stable near-infrared Fluorescent Protein (iRFP) for in vivo imagingand a human Diphtheria-Toxin Receptor (DTR) directly upstream of the translation termination codon and the 3’ untranslated region. By using highly efficient viral P2A co-translational ‘self-cleaving’ peptides, the endogenous prothrombin and the inserted reporters are co-expressed as individual proteins in a strict 1:1:1 stoichiometry. While prothrombin is tagged by in-frame fusion to Rluc and secreted into the circulation, the Flag-iRFP, the DTR and the Fluc are cell-resident (and thereby ‘label’ cells that express prothrombin). For the downstream functional exploration of prothrombin and/or the cell(s) expressing this secretory protein, a BRET-compatible Rluc label was chosen (to allow for ligand-receptor interactionand compartment colocalization studiesin addition to the DTR for targeted cell depletion with Diphtheria toxin (DTX). For a Cre-mediated excision, two loxP-sites were inserted upstream of the Rluc and downstream of the DTR. This enables differential labeling of the canonical (liver-derived) and non-canonical (extrahepatic) prothrombin and a conditional DTX-mediated depletion of prothrombin-expressing cells.
Figure 1: D-Insight mouse model for conditional real time in vivo imaging of the spatiotemporal dynamics of prothrombin (F2) gene expression and secretion. a: Schematic representation of the F2 D-Insight model design, carrying various labels to visualize F2 gene expression and secretion dynamics by non-invasive real-time in vivo (3D) imaging (Rluc8.6 = red shifted Renilla luciferase Rluc8.6-535; iRFP = near infrared fluorescent protein; DTR = Diphtheria Toxin Receptor; Fluc2CP = Firefly-Luciferase, P2A = co-translational ‘self-cleaving’ peptide, loxP = sequence for Cre-mediated recombination). b-i, Multiplex F2 expression labelling in vivo. b, Postmortem bioluminescence-imaging (Fluc 10 min after luciferin substrate i.p. injection) of a pregnant B6 animal (after pairing with heterozygous male D-Insight animal) showing 3 D-Insight positive, out of 6 embryos (each embryo is marked with an asterisk). c, D-Insight positive embryo (3 weeks old) showing F2 gene expression along the ventral side of the cranio-caudal axis and e, in the brain (same animal after craniotomy) compared to B6 litter control animals d,f. g-h, Hepatic expression in adult animals imaged dorsally and ventrally. i, spectra of multiplex labeling and imaging of liver with respective emission filters.
Despite the extensive genetic modifications, we obtained viable reporter animals in expected Mendelian ratios (Figuren 1b). The obtained Fluc signals are specific for the transgene, and in the developing embryo project to the ventral part of the cranio-caudal axis (Figure 1c,d) and the brain (Figure 1e,f). This corresponds to earlier reports supposing prothrombin expression at various locations in the developing embryoand a function in the nervous system. In contrast, adult animals show strong signals (Fluc, Rluc and iRFP) that co-localize with the liver (Figure 1g-i), corresponding to the hepatic expression of prothrombin in adults (www.proteinatlas.org).
To validate the functionality of the DTR introduced with our multicistronic transgene, we next administered DTX to the reporter and B6 controls animals. Expectedly, we observe that 24h after DTX injection the Fluc signal declines in the liver (Extended Data Figure 1a,b), reflecting a DTX-mediated disintegration of this organ. This is mirrored by a significant induction of the transaminases (GOT, GPT), reflecting liver tissue damage (Extended Data Figure. 1c). In contrast, B6 animals that do not harbor the human DTR do not show an induction.
Extended Data Figure 1: Functional customization of the D-Insight model through Diphtheria toxin receptor mediated targeting and Cre-mediated reporter excision.a-c Validation of Diphtheria Toxin (DTX) mediated targeting of reporter expressing cells (DI +/-DTX), showing reduction of liver Fluc signal b, and a corresponding release of liver derived transaminases (glutamic oxaloacetic transaminase (GOT), glutamic pyruvate transaminase (GPT)) 24 h after DTX injection in comparison to a wildtype B6 animal c. d-g Validation of Cre-mediated excision of the Rluc-DTR reporter cassette with D-Insight animals after pairing with a liver specific Cre-line (AlbCre). This results in a significant reduction of liver-derived Rluc bioluminescence (e, f, g), confirming functionality of the conditional multiplex reporter labeling strategy (Figure 1a).
For most applications, the DTX-mediated ablation of prothrombin expressing cells (primarily targeting the liver) is incompatible with a functional assessment of minor sites of prothrombin expression. Additionally, we aimed to exploit a differential labeling strategy that allows us to distinguish prothrombin produced in the liver from extrahepatic sites (Figure. 1a). To validate the Cre-mediated conditional labeling, we crossed D-Insight animals with a liver-specific Cre-expressing line (Albumin-Cre) and analyzed the bioluminescence of the offspring. Expectedly, we obtained animals in which the Rluc fused in-frame to the prothrombin can no longer be detected, while Fluc expression remained intact (Extended Data Figure 1d-g). This manipulation also results in the excision of the DTR (Figure 1a), which enables a selective DTX-mediated ablation of prothrombin-expressing extrahepatic cells. The elimination of Rluc and DTR thereby introduces a functional component to further explore downstream features of extrahepatic prothrombin and/or the function of prothrombin-expressing cells in vivo.
Our reporter is designed to discriminate between prothrombin expression and secretion (Figure1a). Accordingly, while Rluc and Fluc can be detected in liver lysates, only the Rluc signal can be found in the plasma (Figure 2a). Comparing plasma thrombin activities of B6 and D-Insight reporter animals revealed almost identical levels (Extended Data Figure 2a), demonstrating that the Rluc tag per se does not impede protein transport nor thrombin function.
Extended Data Figure 2: Performance measures of the D-Insight reporter to track (dynamic changes of) prothrombin gene expression.A, Functionality of Rluc tagged prothrombin compared to untagged prothrombin (B6), confirming (near) complete thrombin activity (clotting time) in D-Insight animals. b, Comparison of tissue lysate luminometry (Fluc, y-axis) with a prothrombin specific qRT-PCR (x-axis), confirming a high sensitivity, accuracy and dynamic range of the D-Insight reporter model. C, Schematic of the doxycycline inducible shRNA mouse model (F2KD) to silence prothrombin. D, Doxycycline-mediated induction of shRNA reduces prothrombin mRNA and protein in the liver, and prolongs the time to clot (i.e. reduces the thrombin activity). E, F Doxycycline-mediated induction of shRNA reduces Fluc signals in double-heterozygous reporter animals (F2KDxD-Insight) in prothrombin high- (liver) and prothrombin low- (spleen, kidney) abundant tissues, corroborating the specificity of the recorded Fluc reporter signals. G, Reporter on/off kinetics (Fluc) in living double-heterozygous reporter animals (F2KDxD-Insight) after addition and termination of doxycycline supplementation. Non-linear regression (One phase decay) indicated by dashed line.
Figure 2: Differential labeling distinguishes expression and secretion dynamics and identifies numerous extrahepatic sources of prothrombin in embryos and adult animals.A, Labelled prothrombin is secreted into the circulation. While Rluc and Fluc can be detected in liver lysates, only Rluc (fused to prothrombin, Figure 1a) is secreted and can thus be detected in the plasma. B, Expression and secretion dynamics in septicemic D-Insight animals (after LPS injection) showing early induction of F2 gene expression (Fluc in liver) with retarded accumulation of Rluc-tagged prothrombin in the blood circulation (Rluc in plasma). Non-linear regressions (Sigmoidal dose-response) are indicated by dashed lines. Established and novel extrahepatic expression of prothrombin (Fluc) in the embryo c-f (c and d, maternal and fetal part of placenta of a pregnant B6 animal after pairing with a heterozygous male D-Insight animal, in e the pseudocolor overlay shows reporter expression only for the placenta and umbilical cord) and in adults g-h (for simplicity, the baseline Fluc bioluminescence of reporter negative B6 controls animals, averaging to 1-2 Fluc counts, is not depicted in h; ns = not significant).
Next, we aimed to validate the reporter with established modifiers of prothrombin expression. Prothrombin is induced during septicaemia by a regulatory mechanism controlling RNA processing. We injected lipopolysaccharides (LPS) into reporter animals and observed a significant upregulation of prothrombin expression (Fluc intensity) in the liver 3 hours after LPS-injection (Fig. 2b) - reminiscent of earlier reported RNA induction. While this induction is rapid, the abundance of prothrombin in plasma (Rluc) increases with retarded kinetics 12 hours after LPS-injection (Figure 2b). This demonstrates that the reporter mouse model recapitulates established prothrombin expression dynamics[19-48]. By differential labeling and quantification of the expression and secretion dynamics, it allows disentangling these processes in vivo.
We next tested the accuracy and sensitivity of the reporter system, and whether new anatomical origins of this prototypic liver-derived protein can be detected. The knockout of prothrombin is embryonically lethal with phenotypes associated with impaired vascular integrity during development [49-50]. Based on this, we expected to retrieve prothrombin expression characteristics that can be associated with these findings. We investigated prothrombin expression in developing embryos, and observed that the fetal part of the placenta (and the umbilical cord) expresses significant amounts (Figure 2c-e). We also identified expression in a variety of other organs in the developing embryo (Figure 2f). We further extended these studies to adult animals. We identified significant amounts of prothrombin expression in the testis (Figure 2g) and at numerous previously unreported extrahepatic locations (Figure 2h), including the lung, pancreas, lymphatic system (spleen), kidney and heart.
To further confirm the accuracy of the reporter system, we compared Fluc signals of various tissues from D-Insight animals and compared this to prothrombin RNA abundance (Extended Data Figure 2b). This revealed that the reporter activity closely mirrors prothrombin gene expression over more than 2 orders of magnitude, documenting a high dynamic range and sensitivity. To control the specificity (above background) and on/off-kinetics of the reporter, we finally generated a doxycycline inducible short hairpin (sh)RNA mouse model targeting the endogenous prothrombin gene (Extended Data Figure. 2c). Upon doxycycline administration, this model (F2KD) reduces endogenous (pro)thrombin RNA, protein and activity down to 10-25% (Extended Data Figure. 2d). We next crossed this model with the reporter mice and determined luminescence with and without doxycycline administration. This analysis confirms the specificity of the Fluc signal in a prothrombin high abundant (liver) as well as in select low abundant tissues (kidney, spleen, Extended Data Figure 2e,f). Further, the Fluc kinetics in the liver upon doxycycline addition and withdrawal corroborates the rapid on/off-kinetics of the reporter (Extended Data Figure 2g), which is suited for real time imaging of dynamic expression alterations and resulting functional effects (Figure 2b). Altogether this demonstrates the functionality of the multiplex imaging strategy to disentangle the expression and secretion dynamics of a prototypic liver-derived secretory protein in vivo. It also uncovers prothrombin expression in a variety of hitherto unknown extrahepatic locations.
Cell-based reporter systems are potent tools to elucidate disease mechanisms and to identify novel therapeutic vulnerabilities. This becomes extremely efficient if such experimental set-ups can be carried out additively on the same genomic background. To test the in-principle applicability, we generated complementary syngeneic cell lines derived from our reporter animal. We used a modified extraction protocol to isolate primary hepatocytes from D-Insight and B6 control animals (Figure 3, Extended Data Figure3a). After initial cultivation, we confirmed purity, iRFP and Fluc positivity of reporter hepatocytes using multispectral imaging flow cytometry (Figure. 3a, Extended Data Figure. 3b), ImageStream fluorescence microscopy (Figure. 3b, Extended Data Figure. 3c), luminometry and live cell imaging, where serial dilutions produced Fluc signals correlating with the number of cells (Figure 3c). Recapitulating the findings obtained in vivo (Figure. 2a), we also detected Fluc and Rluc in hepatocyte cell culture lysates (Figure 3d). Conversely, in the media only Rluc can be detected reflecting the secreted Rluc-tagged prothrombin, while Fluc remains cell-resident (Figure 3d). Further, treating these cells with the protein transport inhibitor brefeldinA leads to a significant reduction of Rluc in the media (Figure 3e), while, expectedly, the Rluc tagged-prothrombin accumulates in the cell. Together this confirms the functionality of this cell-based multimodal reporter imaging approach (Figure 1a) enabling the unraveling of mechanisms governing the expression and secretion dynamics of this liver-derived secretory protein in high resolution and in a scalable format ex vivo. Additionally this multimodal approach provides multiple avenues for identification of novel cellular sources of prothrombin (e.g. flow cytometric analyses for the identification and functional characterization of prothrombin positive cells in the spleen and the lymphatic system (Figure 2h) or hematopoietic (bone marrow) compartment (Extended Data Figure 2b,3d,e).
Extended Data Figure 3: Generation of primary reporter cell cultures for large-scale identification of expression and secretion modifiers.A, Schematic for primary hepatocyte cell isolation. B-c, FACS and ImageStream based confirmation of iRFP positivity of viable hepatocytes obtained from D-Insight reporter and B6 control animals. d, Hematopoietic prothrombin in B6 animals transplanted with D-Insight bone marrow (DI-BMT) as compared to a B6 control, corroborating Fluc positivity in the bone marrow (Extended Data Figure 2b) e, Schematic of the cell identification (and validation) of prothrombin expressing cells based on iRFP in flow cytometric analyses (left) and enrichment analysis (MACS or FACS sorting) followed by luminometry. For functional analyses, cultured cells (right) serve as reporter models for (large scale) identification of expression and secretion modifiers (Figure 3, 5, and Extended Data Figure 5).
Figure 3: Complementary syngeneic primary D-Insight hepatocyte cell culture model for ex vivo exploration of the prothrombin expression and secretion dynamics.a, Flow Cytometric (FACS) analysis and b, ImageStream microscopic flow cytometric analysis of primary hepatocytes isolated from D-Insight reporter and wildtype B6 control animals, documenting iRFP positivity of the reporter cell lines. C, Live cell imaging of primary D-Insight hepatocytes in culture shows a strong correlation between cell number and Fluc signal. D, Luciferase-luminometry confirms a specific Fluc and Rluc signal of primary D-Insight hepatocytes compared to wildtype B6 hepatocytes. It also reveals a specific Rluc signal in the cell culture supernatant (media) of the D-Insight hepatocytes, which reflects the Rluc-tagged and secreted prothrombin (green bars). e, Treatment of D-Insight hepatocytes with inhibitors of the secretory pathway (Brefeldin A) selectively reduces the Rluc signal in the cell culture supernatant (media), confirming the functionality and specificity of the genetic tagging strategy.We next performed a proof-of-concept experiment to explore how the reporter mouse model performs in detecting potentially new locations of extrahepatic prothrombin expression with pathogenic relevance. Up to 20% of all cancer patients develop venous thromboembolism, reflecting a procoagulantdisbalance of the hemostatic system with a significant incidence of fatal outcomes[53-54]. We therefore employed a methylcholanthrene (MCA) tumor induction model to assay whether prothrombin is potentially expressed and secreted by emerging tumors. In MCA challenged reporter animals, we first observed that the emerging tumors express prothrombin (Figure. 4a). We next transplanted these tumors into B6 mice and obtained Fluc signals that increase with time and volume of the transplanted tumor (Figure. 4b, Extended Data Figure 4a,b). This suggests that the initial Fluc signals in the tumor unlikely originate from tumor-associated macrophages or lymphocytes frequently found in tumors. To consolidate D-Insight-reporter and prothrombin expression, we analyzed tumor cell cultures obtained from these animals (Figure 4c-f). Using multispectral imaging flow cytometry and luminometry, we confirm reporter iRFP positivity (Figure 4c, Extended Data Figure 4c) and Fluc expression (Figure 4d). Using fibrosarcomas of the genetic background in which prothrombin expression can be depleted, we directly confirm endogenous prothrombin mRNA expression by F2 RNA-FISH (Figure 4e,f). Surprisingly, probing further murine and human tumors we also find extrahepatic prothrombin expression in several entities (Extended Data Figure 4d-f), suggesting that this finding may be relevant in tumor biology across species and entities.
Extended Data Figure 4: Tumor-derived prothrombin expression in mice and man.A, Increase of prothrombin expression (Fluc positivity) in D-Insight tumors transplanted in B6 animals. Non-linear regression (Exponential growth equation) indicated by dashed line. B, As rapidly growing tumors typically display areas of central necrosis, the relative Fluc signal normalized to tumor volume drops with time. Non-linear regressions (One phase decay) indicated by dashed line. C,ImageStream based confirmation of iRFP positivity of viable primary tumor cells obtained from D-Insight reporter positive fibrosarcomas compared to B6 control fibrosarcomas. d, Prothrombin positivity in murine hepatocellular and colorectal carcinoma (D-Insight animals treated with diethylnitrosamine for 14 months, and D-Insight animals on a Apcmin background after 6 months on Western diet, respectively). E, Prothrombin immunohistochemistry and F2 RNA seq data of human tumors, displaying various extent of positivity within and across tumor entities and individuals (data obtained from protein atlas and the National Cancer Institute’s Genomic Data Commons Data Portal (https://portal.gdc.cancer.gov)).
Figure 4: Identification of new locations of extrahepatic prothrombin expression with procoagulant function.
A, MCA-induced fibrosarcomas in D-Insight mice, showing tumor-associated prothrombin expression (Fluc). B, Tumor-associated prothrombin expression is transplantable and increases with tumor volume. Non-invasive in vivo whole body bioluminescence imaging of Fluc of immunocompetent albino hairless (AH) mice after s.c. transplantation of D-Insight sarcomas at day 10, 20 and 30, respectively (y-axis depicts Fluc, the x-axis displays the tumor volume, n>3 animals per time point). Non-linear regression (Exponential growth equation) indicated by dashed line. c,d, ImageStream and luminometry of fibrosarcomas confirms iRFP positivity and Fluc expression for D-Insight fibrosarcomas. e,f, Tumor-intrinsic F2 expression confirmed by F2-RNA-FISH with and without doxycycline-mediated depletion of F2. G, Tumor-derived prothrombin is secreted into the blood circulation. The D-Insight reporter Fluc signal (x-axis) of sarcoma bearing mice (red) reflects the amount of prothrombin expressed in tumor cells, which positively correlates with the amount of tumor-derived prothrombin secreted into the circulation (y-axis, Rluc in plasma; signals obtained in muscle tissue and plasma, respectively, for B6 mice (blue) serve as non-specific background control). Notably, D-Insight sarcoma bearing B6 mice (red) express and secrete significant amounts of prothrombin, reaching Rluc plasma levels comparable to liver-derived prothrombin of D-Insight control mice (grey shaded corridor). h, Ectopically expressed prothrombin by the tumor is functionally active (assessed by KC4™ Coagulation Analyser; comparing blood plasma clotting time of F2-KD (F2), B6 mice (B6), F2-KD sarcoma bearing B6 mice and B6-sarcoma bearing F2-KD mice with (+) and without (-) administration of a doxycycline (Dox) rich diet for 3 weeks).
We next explored whether our model system provides further insights substantiating the functional dimension of this unexpected finding. We tested if tumor-derived prothrombin is secreted into the blood circulation. We transplanted D-Insight positive fibrosarcomas into B6 mice and determined Fluc and Rluc levels in the tumor and plasma, respectively. Surprisingly, we observed a strong correlation (Fig. 4g). Comparing these signals with Rluc in tumor-free D-Insight control animals reveals a substantial amount of tumor-derived Rluc that can be detected in the plasma, in concentrations comparable to tumor-free reporter animals (Fig. 4g). This suggests that tumor-derived prothrombin is quantitatively significant; it reaches the intravascular compartment to a similar extent as prothrombin constitutively synthesized in the liver.
The biogenesis of prothrombin involves post-translational gamma-carboxylation in the liver, which is required for full functional activity. To determine the potential functionality of tumor-derived prothrombin, we first assessed whether all enzymes involved in the vitamin K cycle are expressed. We confirmed expression for the gamma carboxylase (GGXC), the NAD(P)H quinone hydrogenase 1 (NQOV1), the vitamin K epoxide reductase complex subunit 1 (VKORC1) and the vitamin K epoxide reductase complex subunit 1 like 1 (VKORC1L1) in the tumor at levels similar (or higher) to the liver (not shown). We also applied thrombin activity measurements and analyzed plasma samples obtained from either normal (B6) or prothrombin (F2) hypomorphic animals with and without implanted tumors that express prothrombin (Figure 4f). To that end, we used wildtype B6 and F2 KD fibrosarcomas in which prothrombin expression can be selectively depleted (Figure4e,f). We identified that tumor-derived prothrombin confers a procoagulant function in B6 mice (Fig. 4h, compare bars 1 and 2). Accordingly, we also observed that tumor-derived prothrombin compensates for low thrombin activity in prothrombin hypomorphic animals (Figure. 4h, bar 3 and 4), and that this compensation is lost, when the prothrombin expression in the tumor was silenced by the shRNA (Fig. 4h, bars 5-8). This suggests that tumor-derived prothrombin is functionally active. This may also perturb the well-balanced equilibrium between pro- and anticoagulatory activities in the plasma[58-59]and could thereby contribute to the hypercoagulative state frequently observed in cancer patients, ultimately leading to detrimental consequences including thromboembolic death[53-54].
Understanding tissue-specific gene regulationis key to tissue-tailored therapies in cancer and beyond. Based on our findings, a therapeutic strategy targeting the expression of such a secretory protein in a tissue-selective manner would be desirable. We therefore finally tested the applicability of this approach and conducted a small-scale chemical screening employing a culture of primary hepatocytes, fibrosarcoma tumor cells and fibroblasts (serving as controls) obtained from the D-Insight reporter animal (Figure 3,4). Using in-plate luminometry in a 96-well format in our screening, we surprisingly identified a DNA methyltransferase inhibitor (Decitabine), which shows a long-lasting and highly selective modulation of prothrombin gene expression in a tissue dependent-manner affecting fibrosarcomas, while leaving the expression in the liver and fibroblasts unaltered (Figure 5, heatmap and Extended Data Figure 5). This points to tissue-selective regulatory mechanisms governing the expression of this secretory protein with a multitude of actions in various systems and disease mechanisms, ranging from atherosclerosis to tumor biology[35-36]. It also illustrates the versatility of this model to dissect disease mechanisms and to uncover novel therapeutic vulnerabilities (Figure 5).
Extended Data Figure 5: Tissue specific targeting of prothrombin gene expression.
Small scale proof-of-concept study to illustrate that D-Insight derived primary cell cultures (hepatocytes, fibrosarcomas and fibroblasts) can be used to define tissue-specific therapeutic vulnerabilities.
Figure 5: An integrated genetic reporter system for basic and applied medical research of secretory proteins.
Exemplary representation of a complementary reporter model (screening) approach based on multiplex non-invasive in vivo imaging in combination with the isolation and cultivation of D-Insight-reporter positive target cells (e.g. hepatocytes). Reverse and forward pharmacology approach unified in syngeneic reporter set-up. Here cells endogenously expressing and secreting prothrombin, as well as cells induced in disease models, are identified by non-invasive imaging, isolated and cultured. These can be screened ex-vivo through high-throughput luminometry, and additionally in-vivo, through injection into wild-type mice and non-invasive imaging. Findings made in these systems can finally be validated in-vivo using the original D-Insight model. The heat map in the center exemplifies a tissue selective targeting, obtained from a pilot proof-of-concept study (shown in Extended Data Figure).
The liver is the prime organ producing secretory proteins. While protein targeting is achieved by a well-characterized cargo system3,4, new mechanisms of unconventional protein secretion are being discovered[62-63]. Owing to the importance of secretory proteins in a variety of diseases[9-14], understanding regulatory mechanisms on a systems and cellular level may help elucidating underlying biology and pathophysiological processes, including the identification of novel therapeutic avenues.
Here we introduce a conditional, multiplex imaging reporter mouse model to disentangle the expression and secretion dynamics of a prototypic liver-derived secretory protein in vivo. Our findings illustrate the versatility of this reporter model for detecting and illuminating processes of this secretory protein in the context of development and various disease mechanisms. They also document the autonomous expression of a secretory protein that becomes harmful if aberrantly expressed. Additionally, our pilot screening demonstrates that this reporter tool set is suited to uncover tissue-specific regulatory mechanisms that may allow tailored therapeutic targeting. Given the broad expression of prothrombin in various tissues, the reporter model introduced here will likely find wide application to understand and dissect the role of prothrombin in numerous extravascular pathophysiologies[36-64].
Biologically, our proof-of-concept observations made here reveal a novel mechanism as to how cancer contributes to a hypercoagulant phenotype. Overexpression of prothrombin perturbs the well-balanced equilibrium between pro- and anticoagulatory activities in the plasma. While the hyperexpression observed in tumors is low level, the cumulative secretion appears to quantitatively exceed the procoagulant effects caused by the well-established thrombophilic prothrombin polymorphism F2 20210 G>A [65-66]. Even small tumor lesions can lead to the hypercoagulative state frequently observed in cancer patients, ultimately leading to detrimental consequences including thromboembolic death[53-54]. In view of the evolution of direct oral anticoagulants (DOACs), charting the spatiotemporal dynamics of prothrombin in pathophysiologies may also reveal hitherto unrecognized advantages of selective therapeutic targeting of the hemostatic system[67-69].
Beyond discovering new functions of the hemostatic system with spatiotemporal resolution, this reporter model is multifunctional. It allows exploring fundamental biological principles of gene regulation and protein targeting, and to identify rheostats involved in the cross-talk between gene expression and availability of a secretory protein. Complementary syngeneic primary cell culture models also enable the deconvolution of regulatory mechanisms in high resolution, and in a scalable high throughput format ex vivo. It thereby represents a valuable resource for uncovering disease-eliciting cues and novel therapeutic vulnerabilities, including their validation by non-invasive imaging in vivo, and vice versa (Figure 5). Ultimately this model is an instructive example for a successful multimodal imaging strategy, which can be simply adapted to numerous other secretory proteins.
JN, ST, SK, EK, LKS, LH, LE, DAS performed experiments. JN and ST analyzed and compiled data. HC interpreted data and discussed results. SD conceived and supervised the study, performed experiments and wrote the paper with contributions from all coauthors.
The authors would like to express their gratitude to current and former members of the Danckwardt lab. We are indebted to Enrico Di Cera for sharing his thoughts on the initial concept of the prothrombin-fusion construct, and AncaDragulescu-Andrasi and Andreas Loeing for their supportive information on the modified Rluc proteins. Kathrin Mühlbach for her supportive discussion on the targeting strategy, FriederikeHäuser on protocols of hepatocyte isolation, and Kristian Schütze, Antje Canisius and Kevin Friedemann for technical support.
This work is supported by grants of the DFG (DA 1189/2-1), the GRK 1591, the DFG Priority Program SPP 1935 (Deciphering the mRNP code: RNA bound Determinants of Post-transcriptional Gene Regulation), by the Federal Ministry of Education and Research (BMBF01EO1003), by the HellaBühler Award for Cancer Research, and by the German Society of Clinical and Laboratory Medicine (DGKL).
Citation: Nourse J, Tokalov S, Khokhar S, Khan E, Schott LK, et al. (2021) Non-Invasive Imaging of Gene Expression and Protein Secretion Dynamics in Living Mice: Identification of Ectopic Prothrombin Expression as Driver of Thrombosis in Cancera. J Pharmacol Pharmaceut Pharmacovig 5: 031.
Copyright: © 2021 Jamie Nourse, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. | <urn:uuid:fc281704-9255-4cf5-959d-09ac70215f40> | CC-MAIN-2022-33 | https://www.heraldopenaccess.us/openaccess/non-invasive-imaging-of-gene-expression-and-protein-secretion-dynamics-in-living-mice-identification-of-ectopic-prothrombin-expression-as-driver-of-thrombosis-in-cancera | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz | en | 0.885126 | 13,353 | 1.632813 | 2 |
By BNN Research
LAST January 30, 2020, the Department of Health (DOH) confirmed the first case of 2019 novel coronavirus (2019-nCoV) in the Philippines when a 38-year-old female Chinese patient under investigation (PUI) was found out to be positive after her laboratory results arrived from the Victorian Infectious Disease Reference Laboratory in Melbourne, Australia.
The confirmed case arrived in the Philippines from Wuhan, China via Hong Kong last January 21, 2020. The patient sought consult and was admitted in one of the country’s government hospitals last January 25 after experiencing mild cough.
After recovering from 2019-NCoV, the patient lfet the country and returned back to China. However, the virus scare has since spread like wildfire, until it recorded a high 307 cases, Saturday afternoon.
This list will be regularly updated as the situation progresses.
If, for any reason, the details of a particular patient was mistakenly deduced from the data released by the Department of Health, please call up our attention by sending email at email@example.com. | – BALIKAS News Network | <urn:uuid:e8d53fbf-c7e5-4d57-8004-93c7dee79588> | CC-MAIN-2022-33 | https://balikas.net/list-confirmed-covid-19-cases-in-the-philippines/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.946926 | 236 | 1.757813 | 2 |
If you’re worried about someone then it’s important to encourage them to seek treatment as quickly as possible to ensure the best chance of recovery. But treatment is only one aspect of the recovery journey, and there are ways outside of your loved one’s treatment programme that you can play a vital role in helping them get better, regardless of your relationship to them. This can range from being a listening ear, to going to the supermarket with them and supporting them after mealtimes. Each person is different and will need different things, but this will give you some ideas about what you can do to help. And remember, one of the most important things you can do for your loved one is look after yourself.
Mealtimes can be really difficult for both those suffering with an eating disorder and those supporting them. But there are things that you can do to help things go more smoothly and feel more comfortable for your loved one.
People with eating disorders may become withdrawn, and you may need to go to more effort than usual to make them feel included and stop them from isolating themselves.
Eating disorders can make people behave in ways that seem out of character. While early treatment is always the best option and will give the sufferer the best chance of getting completely better, this can be upsetting and frightening, and they may try to resist it. Emotional or aggressive outbursts and hurtful comments or responses to your attempts to help aren’t uncommon, especially when the person feels challenged – remember this is not them but the eating disorder speaking. There are some things that you can keep in mind to make these times more manageable and avoid escalating the situation.
The eating disorder can cause your loved one to misinterpret what is being said to them, which can leave you unsure of what to say and concerned about upsetting them. Below are some examples of things that you may innocently say, and what the eating disorder may cause your loved one to hear instead. It could be helpful to share these with other people likely to talk to your loved one, to help them to understand more about the eating disorder and avoid upsetting conversations.
Just eat normally.
What may be heard: You’re not trying hard enough, it’s not difficult to eat, it’s your fault, you need to get over this.
Positive alternative: To outsiders it may seem like people with eating disorders just need to eat, or just need to stop purging or binge eating. This is not the case – eating disorders are not a choice but are severe mental illnesses that the person needs supporting through. It is therefore important to acknowledge to the person that you know it’s difficult for them, and you are there to support them.
You look well.
What may be heard: You look fat, you have gained weight, you’re greedy, you’re healthy now so things are easy for you.
Positive alternative: Any comments to do with your loved one looking “healthier” or “better” are often taken to mean they have put on weight. Instead of commenting on their physical appearance, try to ask the person how they are, or compliment something about your loved one that is unrelated to their body such as an item of clothing or an accessory.
I wish I had your control.
What may be heard: You are lucky to have an eating disorder, you are in control of the illness, it’s a good thing to be obsessive with food, weight and shape.
Positive alternative: Often eating disorders are used as a coping mechanism and a way to feel in control. However, when someone is suffering from an eating disorder the illness controls them and fighting against the thoughts and behaviours is extremely difficult. Avoid commenting on the eating disorder as if it is the person’s choice.
You just need to stop eating so much.
What may be heard: You are fat, you are greedy, binge eating isn’t a problem, you are making this up, it is easy to stop binge eating.
Positive alternative: Acknowledge how difficult things are for your loved one, and how distressing the eating disorder must be. Let them know that you are there to support them.
Get well soon.
What is heard: It’s easy to get over this, you aren’t trying hard enough, you are being a burden, hurry up and get better.
Positive alternative: Reassure your loved one that although you recognise how difficult things are for them, you are there for them and will continue to be throughout. Let them know how proud you are of them for challenging the illness.
I wish I had your body.
What is heard: You are lucky to have an eating disorder, you are just doing this to look a certain way, you need to keep doing the disordered behaviours.
Positive alternative: Try to avoid discussing your own weight and shape in front of your loved one as it can be unhelpful for them to hear. Instead focus on topics away from body image, food or exercise.
I can easily finish a packet of biscuits so know exactly how you feel.
What is heard: Everyone eats that way, you don’t have a problem, it is normal to binge eat, you don’t deserve support.
Positive alternative: While many people will overeat on occasion, and this may be triggered by difficult emotions, this is not the same as having binge eating disorder. Binge eating disorder is extremely distressing for the person and involves the person feeling a loss of control while eating a much larger amount of food than most people would eat in similar circumstances. It is good to be understanding, but important to avoid trivialising what the person is going through.
Externalising the eating disorder – viewing it as separate to your loved one – can empower you to help distance them from the illness and challenge the eating disorder behaviours. This challenge to the eating disorder may lead to your loved one acting out of character, but this is often the illness reacting as it feels threatened. By externalising the illness, you can also help your loved one to recognise their thoughts and behaviours as resulting from the eating disorder. To do this, it can be useful to address the eating disorder as distinct from your loved one.
Externalising the eating disorder can also help your loved one to feel less like they are being criticised or are to blame: you both recognise that it is the eating disorder.
Externalising the eating disorder will not be helpful for everyone. Some people may feel that the eating disorder is part of them, rather than separate, and may struggle with questions such as those above or find them patronising. It could also feel dismissive of what is going on for the person. If this is the case, it could be helpful to explore this with your loved one and their treatment team, to find a dialogue that works for everyone.
Supporting someone with an eating disorder can affect your own physical and mental health. It's important to remember that you're not alone, and it's especially important to look after yourself too. At the links below, you can see what services Beat can offer you, and the support that might be available to you as a carer.
Taking care of someone with an eating disorder can be physically and emotionally exhausting. There’s no shame in taking time out or seeking your own support network.
Beat supports anyone affected by an eating disorder. If someone you know is suffering, and you’re supporting them in any capacity, our services are available to you as well. | <urn:uuid:114deb62-9ce7-478b-bc9c-3d3a714733c9> | CC-MAIN-2022-33 | https://www.beateatingdisorders.org.uk/get-information-and-support/support-someone-else/tips-for-supporting-somebody-with-an-eating-disorder/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.976358 | 1,566 | 2.890625 | 3 |
There are approximately 7, 8 Million Tamils living in the Diaspora. Although Tamils are minorities in these countries, and despite many difficulties endured, Tamils have proven to be successful people. Irrespective of poverty, wars or oppression, Tamils have proven to be hardworking, ethical, intelligent people to deal with.
It’s time that Tamils connect with each other, share business ideas, share expertise and do business wherever we can. It is with that in mind that I have developed Tamil Ethos Smart App.
“Tamil Ethos” means anyone who aligns themselves to the Ethics of the Ancient Thirukural.
“S” for Social Media and “mart” for Market Place.
Vazgha Tamizh Vazgha
Founder: Pregy Pillay
Tamil Ethos Chamber of Commerce South Africa | <urn:uuid:f651f0e0-5f40-4fda-962c-30126940bd00> | CC-MAIN-2022-33 | https://play.google.com/store/apps/details?id=za.org.tamilchamber&hl=en | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.932036 | 182 | 1.640625 | 2 |
- 8. Repeat
PREREQUISITE: A final grade of 40% or higher in the same course
GRADE: 11 (University)
AVAILABILITY: Blyth Academy Online
THE ONTARIO CURRICULUM: English
ENG3Ur online emphasizes the development of literacy, communication, and critical and creative thinking skills necessary for success in academic and daily life. Students will analyze challenging literary texts from various periods, countries, and cultures, as well as a range of informational and graphic texts, and create oral, written, and media texts in a variety of forms. An important focus will be on using language with precision and clarity and incorporating stylistic devices appropriately and effectively. ENG3Ur online is intended to prepare students for the compulsory grade 12 university or college preparation course.
Short Stories and Non Fiction
Essential Question: How do literary elements contribute to written works?
In this unit, students will be introduced to the major terms and concepts that will build the foundation for this course. Within the unit, students will be examining a variety of short stories and non-fiction pieces using a variety of mediums and media styles.
Novel Study: The Catcher in the Rye
Essential Question: How do we use context clues to determine or clarify meaning?
In this unit, students will examine J.D. Salinger’s The Catcher in the Rye. Students will focus on theme, character development and point of view. Though the novel was written seventy years ago, the messages and issues are still extremely relevant. Students will explore issues and challenges the protagonist faces, including family relationships, personal faith and the death of loved ones. Students will also learn about formal essay writing and apply this knowledge in a working essay submission.
Elizabethan Drama: Macbeth
Essential Question: What is the definition of a tragic hero?
In this unit, students will examine William Shakespeare’s Macbeth. They will explore the definition of a tragic hero, different types of conflict and the dramatic purpose of a scene. While studying these elements, students will continue to work on literary analysis, oral communication and presentation skills.
Contemporary Novel: A Complicated Kindness
Essential Question: What can the experiences of others teach us about ourselves?
In this unit, students will be working with the winner of the Governor General’s award, A Complicated Kindness written by Miriam Toews. This Canadian novel explores the life of Mennonite teenager Nomi Nickel while she struggles to find her place in life. This is an Independent Study. As students read the novel, they will be expected to compile annotated notes. They will be expected to explore the novel’s plot, themes, conflicts and symbolic elements while they continue to develop their written and oral communication skills through the included assessments.
Please consult our Frequently Asked Questions Page or the Exam section within your course for more details on final exams and the exam fee. More information can also be found in our Student Handbook.
Ready to get started? Register today! | <urn:uuid:ee77404f-1ac5-44cd-8c0a-93d445813557> | CC-MAIN-2022-33 | https://www.blytheducation.com/our-campuses/blyth-academy-online/courses-available/course-details/~board/bao-courses/post/eng3ur-repeat-english-grade-11-university | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.9092 | 649 | 3.90625 | 4 |
Judges doubt the legality of a new law in Montana that punishes parents if their offspring are charged with an alcohol offence. Supreme Court observers believe that courts can’t legally punish parents who have done nothing wrong and are innocent of any crime.
Prosecutors say the law may prompt legal challenge and litigation.
The law resembles an edict passed by the Communist Party in the former Soviet Union during the dictatorship of Joseph Stalin, which similarly held parents responsible for the delinquent acts of their children. That law was abolished long ago. | <urn:uuid:014229c5-8e9c-4dca-8c03-4e9f2d0b2e30> | CC-MAIN-2022-33 | https://www.alcoholproblemsandsolutions.org/InTheNews/UnderageDrinking/1072812260.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.96573 | 106 | 1.835938 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.