text stringlengths 160 608k | id stringlengths 47 47 | dump stringclasses 2
values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1
value | language_score float64 0.65 1 | token_count int64 48 145k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
The 12-year-old British boy who was brain dead for four months, Archie Battersbee, and whose death was discussed at the European Court of Human Rights, died this Saturday, his mother announced.
The death came after life-sustaining medical support was withdrawn, following a legal battle between the hospital and the family.
“Archie died at 12.15pm today,” said Hollie Dance, the boy’s mother, who had been in a coma in a London hospital since April.
Archie Battersbee was found unconscious at home with a bandage wrapped around his head on April 7, and parents believe he may have participated in an online challenge that went wrong.
Doctors said Archie was brain dead and life-support treatment was not in his best interests, but the parents asked the British and human rights courts to stop the Royal London Hospital from shutting down the boy’s ventilator.
The European Court of Human Rights refused the family’s request and said it would not “interfere with the decisions of national courts”. [ingleses]” and allowed Archie’s withdrawal from life support treatment to proceed.
The case opened a national discussion about doctors’ assessment of family members’ intentions.
Under British law, it is common for the courts to intervene when parents and doctors are in disagreement over a child’s treatment.
When this happens, the rights of the child override the right of parents to decide what they think is best for their children. | <urn:uuid:fb80a5cc-9bf2-4687-b790-51d522bfa3c9> | CC-MAIN-2022-33 | https://newswep.com/news/archie-the-british-boy-in-a-coma-since-april-has-died-from-an-online-challenge/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.980785 | 320 | 1.96875 | 2 |
I am trying to determine the best way to ground the following audio circuit for best RF immunity. Right now I'm looking at two options, and am not sure if there's even really much of a difference between the two.
First off: I've been studying up on RFI so please correct me if I'm wrong, but as I understand it any RF pickup by the input cables (V1, V2) will most likely be common-mode, and will be shunted to earth ground through the chassis via the capacitor network (obviously assuming the interference is in the correct frequency range). The chassis is earth grounded.
In option 1, I have two chassis ground points. The caps C11 and C12 would ground to an isolated island on the pcb directly connected to the chassis. Then the signal ground would be tied at a separate location to a separate chassis ground point. I envision this as keeping the RF noise currents off of the ground plane entirely, but there is another separate chassis ground connection to the circuit. Could this possibly result in some kind of loop? I would imagine the RF current is destined for earth ground, and the shortest path is through the CGND at the input, but I'm not 100% sure if it could/would loop back.
In option 2, I've eliminated the second chassis ground connection point and tied the signal ground to the C11/C12 chassis ground point. The signal ground is still only connected to chassis ground in one place, but now there is only one connection to chassis, and the noise currents can flow through the signal ground plane to chassis ground. I would probably make a little half island or lay this out somehow to keep RF noise currents isolated to a small area while still keeping a connection between signal/chassis ground. But there would still be noise currents flowing through this interconnection.
Is either one of these options better than the other?
Update I've added the last half of the schematic as per Dan's response, it was left off initially only because I thought it would make the image too large for some browsers
Update In regard to the comments in the discussion after DanMills's post, I am including a drawing of how I am visualizing the possible flow of shield currents and why I am having a hard time convincing myself that "option 1" is the better solution.
Update Here is an example of how I was thinking to lay out the board to facilitate only one chassis connection for RF noise currents, but keep them off the main ground plane. | <urn:uuid:5a795816-14e0-40cd-a425-6d37acef7971> | CC-MAIN-2022-33 | https://electronics.stackexchange.com/questions/340176/grounding-audio-circuit-for-rfi-immunity | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.967594 | 513 | 2.21875 | 2 |
Solar Power Increases your Real Estate Value
Solar panels save you money on electricity costs in the long run. But does a photovoltaic (PV) system increase the value of your home today? Should you install one even if you might sell your home in the future?
Multiple studies show that solar systems boost the value of both old and new homes. Unlike a kitchen remodel, which may or may not entice buyers, investing in solar will pay off whether you stay in your house or not. With Hawaii’s electric rates consistently being the highest in the nation, home buyers are attracted to green homes that will save them money.
A 2011 study by the Lawrence Berkeley National Laboratory compared the selling prices of 72,000 homes sold in California between 2000 and 2009 to determine whether photovoltaic (PV) panels had any effect.
The results found that homes with solar systems sold for $17,000 more than a comparable house without solar. According to the study, homeowners recover their initial investment of installing solar panels upon sale of the property since the average premium added to the property value is comparable to the average investment cost of purchasing and installing the PV system.
- On average, a solar system increased a home’s resale value by about $5.50 per watt. This premium was slightly higher than the average solar system installation cost, which was $5 per watt after state and federal incentives.
- On existing homes, solar panels increased resale value by up to $6.40 per watt.
- On new homes with pre-installed solar, sale price increased by $2.30 to $2.60 per watt.
The selling price of homes increased by $20.73 for every $1 saved in annual utility bills. As electricity costs and subsequent energy savings grow, the value of a residential solar system will also appreciate over time.
Solar Helps Homes Sell Faster
The U.S. Department of Energy’s Office of Energy Efficiency & Renewable Energy states that a solar home will sell twice as quickly as a home without solar panels, even in a depressed market.
- Lennar Homes compared the sales of homes in similar communities in Rocklin, California in 2007. Homes with solar power installed sold an average of 4.6 homes per month, while homes without solar power sold an average of 1.9 homes over the same period.
- Another report by Clarum Homes shows that all 257 solar homes in one of their developments sold 2 years faster than planned for up to $100,000 more than the listed price.
The Bottom Line
As a solar customer in Hawaii, you have access to the sun, financing options, and tax incentives that cover 65% of system costs. Making your home more energy-efficient by adding a residential solar system is a proven investment that will significantly reduce your energy costs. If, for any reason, you decide to sell your home, the solar system will attract more buyers and you’ll recoup your solar investment from the sale price.
To learn more about installing solar in your home, visit Haleakala Solar, a Hawaii solar company with over 35 years of experience. | <urn:uuid:df7e850d-73e6-4726-bed0-f1b00de3e18d> | CC-MAIN-2022-33 | https://www.besthawaiirealestatesearch.com/blog/solar-power-increases-your-real-estate-value/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.932887 | 647 | 2.140625 | 2 |
In January 2021, the Consumer Safety Commission * released a report on the number of accidents that affected a piece of furniture or a television set in someone. Of the 571 fatalities, 469 were under 18 years of age. The report covered the years 2000 to 2019.
In January 2018, ** the CPSC published a similar report, covering the years 2000 to 2017. This period recorded 542 fatalities, of which 450 involved children under 14 years of age. Nineteen other young people lost their lives between the two news periods because the television or a piece of furniture were not anchored. In both studies, the vast majority of deaths involved television.
Member of Congress Jan Schakowsky, Illinois Democrat and Pennsylvania Sen. Robert Casey want to make furniture safer with the 2021 Stop Stop-Overs of Unstable Act, Risky Dressers of Youth Act of 2021 (STURDY act). The proposed legislation, first introduced in 2019 and not considered, was reintroduced by Schakowsky and Casey last year. February 2021. So far, the invoice it has 15 sponsors in the Senate, including Amy Klobuchar of Minnesota, Richard Blumenthal of Connecticut and Corey Booker of New Jersey.
In accordance with Consumer reports, current furniture stability standards are voluntary. Manufacturers are not required to perform safety tests before placing furniture on the market.
If it becomes law, the legislation would direct the CPSC to develop and enforce mandatory stability standards for clothing units, such as chests, shop windows, and offices. The legislation is supported by several consumer groups, including Parents Against Tip-Overs, and the American Academy of Pediatrics.
Robert Calandra is an award-winning journalist and author of books he has written extensively on health and medicine. His work has appeared in national and regional magazines and newspapers.
* Consumer Protection and Safety Commission; January 2021. Product instability or injuries and fatalities associated with televisions, furniture and appliances: 2020 report.
** Consumer Protection and Safety Commission; October 2018. Product instability or injuries and fatalities associated with televisions, furniture and appliances: 2018 report. | <urn:uuid:2cf97897-87f4-4057-ae9e-f44f12635e13> | CC-MAIN-2022-33 | https://thehealthguild.com/bill-to-prevent-death-as-a-result-of-death/8006/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.962149 | 422 | 2.4375 | 2 |
In Year 3 we start to move from received theology to applied theology, from theoria to praxis.
Term 1 brings together into a coherent synthesis the major themes of the terms of the second year. The approach, therefore, is much more thematic, a sort of beginners guide to systematic theology. Students will need to call to mind the four lectures on Salvation in the first term of Year 1. The first term of Year 3 puts this teaching concerning into a much broader and deeper context from Creation to the Second Coming of Christ, from our birth to our theosis, from the Old Creation (cosmic and personal) to the New.
Term 2 covers the vast arena of Christian believing and living whereby a practical theology assumes a much stronger pastoral and ascetical dimension.
Term 3 provides a theological overview of ordained Christian ministries, the lives of Christians in parishes and monasteries, comtemporary ethical issues and the engagement of the Church in both mission and ecumenism. Some of these areas, of course, contain hotly contested issues in contemporary society, and sometimes in the Church as well. We seek to provide a rational and engaging commentary on these questions which, while being faithful to the Church's Tradition, is also open to insights from the sciences and the arts. As St Justin Martyr and Saint Basil the Great remind us, all that is good must be harvested for the Kingdom of God.
Search all the lectures on this site with an excellent non-tracking search engine.
If you have any queries, please contact us:
+44 161 456 8167
+44 7780 970884
Or use our contact form.
You may need Adobe Acrobat Reader to view downloaded documents from this site, although most operating systems now open PDF files.
The podcasts do not contain all the llecture materials.
Occasionally reference will be made to these podcasted sermons from St. Aidan's Manchester: Voice from the Isles.
Counter reset July 2019 | <urn:uuid:dbfb3c76-195b-468f-9886-db3d23ad59b3> | CC-MAIN-2022-33 | https://www.equip-orthodox.com/year-3/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.914967 | 413 | 2.15625 | 2 |
When it comes to our kids’ activities, we are trained to know their performance metrics down to specifics—batting average, minutes per mile, pirouette count. But often when it comes to learning, the detail is lost. How are they advancing as learners? What’s getting them really pumped up? Where could they use extra support? A Celebration of Learning gives us the opportunity to tune in to our kid’s learning in deeper, more substantive ways.
A celebration of learning is an event that allows kids to reflect on and share their learning and growth. A celebration directly links a kid’s Habits of Success and Universal Skills with their achievements. Kids take center stage to showcase their work, feel pride in their accomplishments, and expand their comfort zone to present their work in front of others. The act of celebrating is both motivating and identity-forming for kids.
When we celebrate our kid’s learning we offer them a powerful opportunity not only to discover who they are and how they learn, but also to develop self-confidence and purpose. It also enables kids to share successes with the people who matter most in their life. Celebrations highlight the importance of community and relationships in learning, and help kids create lifetime memories around their learning experiences.
A celebration of learning has many benefits:
- It fosters a sense of belonging as a kid takes center-stage. The celebration shows how much they’re valued.
- It holds kids to high standards as they share their best work.
- It increases motivation to learn more.
- It leads to a positive sense of self-identity as a learner.
- It leads to reflection on what they have learned, how they learned it, and what skills and habits they’ve adopted to improve learning.
“My English teacher, Miss Jackson read my assignment to the class as an example of how to write an essay. It was because of this celebration of my work that I stopped thinking of myself as a kid who was just good enough to get by and started to recognize I had actual strengths and talents that could be brought to bear not just in the classroom, but ultimately beyond that environment.”
-Adam Carter, Founding Executive Director of Marshall Street Initiatives
A celebration typically includes three things:
- A final product. Something tangible each kid can present, such as a report, slideshow, art exhibit, model, or prototype. These can be from a project, the development of habits or skills, or any other big milestone in a kid’s learning.
- A presentation. A kid-led introduction to what they learned, how they learned it, and how it connects to their interests.
- Community. Friends, family, and others who have gathered (virtually or in-person) to celebrate learning.
Step 1: Give helpful feedback.
Offering helpful feedback that builds a kid’s abilities is a skill that can take time to learn—don’t beat yourself up if you’re still developing these skills! For the celebration of learning—as well as on everyday tasks— keep these principles in mind:
- Be constructive—Your goal is to build up, not simply praise. Make sure your feedback offers practical next steps.
- Be specific—When offering feedback, base your comments on facts or examples from kids’ work, goals, or reflection or on the requirements of the project or activity.
- Be careful—Make sure your comments are logical, timely, and clear, not open to misinterpretation.
- Be realistic—Emphasize process and growth, not smarts and achievement. Realistic goals should be challenging, but also achievable.
- Be sensitive—Provide constructive feedback sandwiched between statements of positivity—a 2-to-1 ratio of positive-to-negative feedback strikes a good balance.
- Be considerate—Pay attention to privacy and kids’ emotions, and be sensitive to overload.
Step 2: Ask strategic questions to help kids reflect.
Strategic questions, particularly during practice for the celebration, can also help a kid think deeply about their learning. There are two types of questions:
- Clarifying Questions: These questions are asked to better understand what a kid is saying. They relate only to the facts or the words used during their celebration presentation. You might ask a student:
- What did you mean when you said…?
- What was the goal you were trying to achieve?
- How does … relate to …?
- Probing Questions: These questions will help surface kids’ thinking so they can also do the metacognitive work of thinking about their thinking. Through this process, students further develop underlying habits such as Self-Awareness, Executive Functions, and Self-Regulation. As kids present their reflections in practice, ask questions that help them think deeply and describe their thinking. Effective probing questions:
- Are open ended and cannot be answered with a simple yes or no,
- Empower the kid to solve problems, and
- Require a kid to pause and think before answering.
Step 3: Praise the kid’s process, not their person.
During the celebration of learning, be strategic in offering praise to emphasize a kid’s process (e.g., “You looked for creative solutions”) rather than fixed personal attributes (e.g., “You’re so creative.”). This shifted emphasis contributes to a Growth Mindset.
Praise Tip #1 –
Highlight kids’ use of strategies and resourcefulness. For example, “You did a great job finding sources and digging deeper into the material.”
Praise Tip #2 –
Emphasize kids’ persistence and the joy of succeeding at challenging tasks. For example, “I know that was difficult, but you stuck with it to figure out how to make it work. Well done.” “It’s awesome that you used what you learned from unsuccessful attempts to find a way forward. That must have felt great.”
Praise Tip #3 –
The more process-related praise you can give, the better. Don’t give up on your own growth as a learning leader if you lapse into praising the person over the process. Your effort matters, and as with any skill, practice will lead to progress!
-Adapted from “Praise that Makes Learners More Resilient,” by Allison Master. | <urn:uuid:e565d629-fa88-4b16-93c3-a46eab2b7c1c> | CC-MAIN-2022-33 | https://preparedparents.org/tip/celebrating-my-kids-progress/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.956597 | 1,347 | 3.515625 | 4 |
Warmer Than Normal Gulf Waters – Trouble For Louisiana?
Have you ever vacationed along the Gulf of Mexico in mid-July? If you have you know the feeling of the molten lava-like hot sand on your feet as you walk to the water. You set down your towel and extra gear and then make a beeline for the refreshing waves.
Once you've climbed in the water you realize, "I have taken showers that are colder than this".
It's that much warmer than average water temperature that has some meteorologists concerned about the Spring and Summer months along the Gulf Coast. You know there is a major correlation between warm Gulf waters and hurricanes.
What you might not know is that the typical afternoon summertime pop-up shower could pop-up much stronger because of these above average temperatures.
A study published in the journal Geophysical Research Letters in December found:
The warmer (cooler) the Gulf of Mexico sea surface temperatures, the more (less) hail and tornadoes occur during March-May over the southern U.S.
Basically what the study is saying is that when the Gulf is warm, like it is now and will be throughout the Summer months, the stronger thunderstorms are over the Southern Region of the United States. What that could mean is that your garden variety thunderstorm in late June is theoretically more likely to blossom into a severe storm with high winds and hail.
How will these warmer early-season water temperatures affect the hurricane season? Well according to NASA a hurricane needs a water temperature of about 82 degrees or more to really sustain itself and get stronger. When you consider some sea surface temperatures are already in the low 70's and it's the middle of March, we could be in for a bumpy and very active season. | <urn:uuid:c840c8ba-8cfc-44f5-9ffe-978362b17f2f> | CC-MAIN-2022-33 | https://classicrock1051.com/warmer-than-normal-gulf-waters-trouble-for-louisiana/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.959401 | 361 | 3.015625 | 3 |
By: Jennifer Nelson October 21, 2019
It can be argued that one of the biggest factors facing education is students having an equal opportunity to get an education. The thought is that equal access will reduce income inequality. This is important because education should have a positive impact on people’s lives.
“By focusing on equal opportunities for students to achieve strong academic outcomes, countries can provide a pathway for more students to continue on to higher levels of education and eventually secure good jobs – two outcomes that are likely to lessen income inequality in the future” (OECD, 2012).
You need money in order to survive and thrive. You need a good job in order to make money. Education is the key to getting a good job, and therefore making sure everyone has access to it is one of the biggest factors facing education. Thus, we should make sure that everyone has access. That makes perfect sense to me.
However, I also believe that conclusion is based on making a lot of assumptions, and it is oversimplifying the issue.
High Test Scores Will Not Eliminate Poverty
The first assumption that is being made is that Earth can continue to function as is, while at the same time improving economic opportunities for everyone. It’s assuming that we can do the same things and end up with a completely different result. The assertion is standing on the foundation of educating people on how to best fit into structures that don’t have a foundation that leads to prosperity for all.
For example, according to the Programme for International Student Assessment scores, “Singapore has come top in science, maths and reading” (Ward, 2016). That’s very nice to have all this knowledge. My question is, what are you doing with it that leads to a better quality of life for the people who live there?
The Borgen Project states, “Wealth is disproportionately spread among wealthy foreigners while native Singaporeans live in poverty and often have lower-paying jobs” (de Silva, 2018). It is also noted that, “5 percent of young Singaporeans under 30 are unemployed. Many others cannot find jobs with sufficient wages because of the lack of minimum wage laws in the country” (de Silva, 2018).
We can improve the access to education as much as we want, but it still doesn’t address the structural issues. This is not unique to Singapore, this is worldwide.
What Kind of Education Are Students Receiving?
Why aren’t students being educated on how to create jobs as opposed to solely being educated on the concept of getting a job? But an even better question is, why aren’t students being educated on how to move from a consumptive modeling system, to something that is more beneficial for all?
Consumerism and Consumptive Modeling
“Consumption concept is also defined as the ideology of today’s world and is criticized both negatively and positively like all ideologies. The ideology is based on a wealthier life as a consequence of more production and more consumption, and it is considered a factor that restricts people’s freedom, makes people dependent on others, and alienates them” (Firat, Kutucuoglu, Saltik, & Tuncel, 2013, p.184).
Furthermore, we have an entire industry dedicated to how to get people to consume as much as possible. This is called advertising and marketing.
In many cases, getting a job in advertising and marketing would be seen as a “good job”. Therefore, if someone was in poverty, but they got an education which led to a “good job” in this industry (or an industry that allowed them to buy many things peddled by this industry) then everyone would count that as a success.
But is it? I guess it depends on how one defines success.
Freedom or Not?
An article from 1955 stated:
Our enormously productive economy demands that we make consumption our way of life, that we convert the buying and use of goods into rituals, that we seek our spiritual satisfactions, our ego satisfactions, in consumption. The measure of social status, of social acceptance, of prestige, is now to be found in our consumptive patterns … We need things consumed, burned up, worn out, replaced and discarded at an ever-increasing pace (El-Idrissi, 2017).
This is what students are being educated to fit into. This harms the environment. This leads to debt. It leads to stress. It leads to people spinning wheels to keep up with a system that they don’t actually enjoy living in.
Yet, it is very important for everyone to have a proper education. However, there will come a point in time where we have to redefine what education actually entails. Otherwise the only educational outcome that will be achieved is a bunch of people being educated on how to enforce their own slavery.
To be clear, no one is free until everyone is free.
“According to the International Labour Organisation (ILO), there are 21 million people around the world trapped in some form of forced labour, the term it uses to describe all forms of modern slavery, including trafficking, debt bondage and child labour. In the UK an estimated 13,000 people are working as slaves in agriculture, hospitality, fishing, private homes, brothels, nail bars and cannabis farms” (Kelly, 2015).
I would argue that most of this forced labor is used to support the consumptive modeling system that the current educational system trains students to support and enforce.
Perhaps we should focus less on test scores as a marker of success, and more on if people have been educated on how to live peacefully and in harmony with Earth and with all who inhabit it.
Is This Utopian Rhetoric?
There was concern that my views were a bit utopian and dismissive of the reality that it would be difficult to live in a society without consumption.
I didn’t say that the world could exist without consumption. There is a difference between living in a world where people buy and sell the things that they need, and a world that is based upon excessive consumption.
There is also a difference between educating children to become productive members of society by bringing out their innate gifts and talents; and educating them to enforce unhealthy systems.
Living in a society where people think they can buy their way to happiness with toys, trinkets, and social prestige is quite unhealthy.
“Kasser describes his and others’ research showing that when people organize their lives around extrinsic goals such as product acquisition, they report greater unhappiness in relationships, poorer moods and more psychological problems” (DeAngelis, 2004).
To be clear, when I use consumption, I’m not just talking about purchases. I am also talking about consuming the resources of others in order to gain some sort of advantage (this is called building leverage), and seeing others as resources to be consumed, (hello “human resources” department).
One negative impact of this line of thinking is that it encourages psychopathic behavior in order to get ahead. Brown writes, “psychopathic personality traits are often seen as desirable in the corporate environment, but research suggests they can do more harm than good” (Brown, 2017).
The article goes on to say that, “there are some professions which, at times, require higher levels of psychopathic traits than we might be comfortable with in everyday life” (Brown, 2017).
This is what children are being educated to cater to when the main focus is memorizing facts in order to “get a good job”. Where is the education on how to be a “good human” who looks at the big picture?
From my point of view, trying to solve problems without actually addressing the problems is not productive.
Is it utopian to believe that people can exist on earth without causing harm to others? Is it utopian to believe that societies can function without corporate psychopathy? I don’t know. Is it humane to believe otherwise?
Brown, J. (2 November 2017). Do psychopaths really make better leaders? Retrieved from https://www.bbc.com/worklife/article/20171102-do-psychopaths-really-make-better-leaders
DeAngelis, T. (2004 June). Consumerism and its discontents. Retrieved from https://www.apa.org/monitor/jun04/discontents
Desilva, L. (6 May 2018). Top 10 Facts About Poverty in Singapore. Retrieved from https://borgenproject.org/top-10-facts-about-poverty-in-singapore/
El-Edrissi, A. (18 October 2017). Our Consumption Model Is Broken. Here’s How To Build A New One. Retrieved from https://shift.newco.co/2017/10/18/our-consumption-model-is-broken-heres-how-to-build-a-new-one/
Firat, A., Kutucuoglu, K., Saltik, A., & Tuncel, O. (2013). Consumption, consumer culture and consumer society. Retrieved from https://www.researchgate.net/publication/320929948_Consumption_consumer_culture_and_consumer_society
Kelly, A. (2015 December 14). The UK’s new slavery laws explained: what do they mean for business? Retrieved from https://www.theguardian.com/sustainable-business/2015/dec/14/modern-slavery-act-explained-business-responsibility-supply-chain
OECD. (2012, April 01). How Pronounced Is Income Inequality Around the World – And How Can Education Help Reduce It? Retrieved March 26, 2018, from http://www.oecd-ilibrary.org/education/how-pronounced-is-income-inequality-around-the-world-and-how-can-education-help-reduce-it_5k97krntvqtf-en;jsessionid=1rbua1q59ulq3.x-oecd-live-03
Ward, H. (2016, December 06). Pisa: At-a-glance global education rankings in science, maths and reading. Retrieved March 6, 2018, from https://www.tes.com/news/school-news/breaking-news/pisa-a-glance-global-education-rankings-science-maths-and-reading | <urn:uuid:da2c4a8f-1ae0-42a7-b0dd-081c9d90be9d> | CC-MAIN-2022-33 | https://www.starheartcenter.com/essays/test-scores-are-a-distraction-education-tool-freedom/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.95427 | 2,209 | 3.578125 | 4 |
Today it is easy for pupils to learn a lot. Its gratefulness gets owed to the internet. Students face obstacles in conventional education, but online classes allow them to discover something different and acquire knowledge. Even students in boarding institutions can benefit from this. It is an effective way for students to study. It has a lot of advantages for students. Online learning has developed rapidly. Online lessons are possible when students are incapable of listening to face-to-face lectures. Through online education, students can receive the same level of education at home. Education can have a variety of purposes, and online lessons can help you achieve this purpose. It can be understood as education because it implements new possibilities for traditional education.
Significance of online classes
- It has a flexible schedule
Students can study all subjects without going out. You can learn efficiently by sitting at home through online classes. Online lessons save you time and bucks on your trip. Online lessons give a flexible plan so that students can study in their own leisure time. Students will always know by watching videos of all subjects.
- Everyone can access it to gain knowledge
Every student can get an education through online lessons. If students have difficulty going out due to unavoidable circumstances, online classes are an easy way to learn. In such cases, online lessons can help border with barriers, and learners can easily acquire knowledge even when sitting at home. Online education equips students with quality study at their place. It is an excellent solution for pupils to study productively.
- Carry on with the mobile trends
It is imperative to follow growing trends in all areas. Changes need to be made everywhere, both in education and elsewhere. In today’s world, everyone wants a digital life. Online lessons help students study visually, so it’s easy to remember what they’ve learned.
- Syllabus choice is vast
In conventional education, learners have limited subject areas. In online learning, they have a variety of subjects and can acquire more from the text. It is helpful for their prospect. Online programs give unlimited routes, and online training has many choices. Students can learn what they want to learn at any level.
Online classes for wizeprep lessons are available at a cheaper cost. Students can get the same content as the face-to-face process at a low price. Most of these are free, and some are paid, but there is a small annual fee. | <urn:uuid:014a84bc-6d93-4d42-adb8-63b69750d780> | CC-MAIN-2022-33 | https://theninthworld.com/wizepreplessons-what-are-the-effectiveness-of-online-learning-for-students/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.953408 | 495 | 2.796875 | 3 |
A recent survey of 125 computational systems-biology researchers indicates that despite the presence of well-established standard formats like the Systems Biology Markup Language, most researchers feel that there is much work to be done in developing useful standards for the field.
The survey was conducted by researchers at Germany’s Max Planck Institute for Molecular Genetics and Ruhr University and published as a letter in the April issue of Nature Biotechnology with a full report available as a supplement online.
The study surveyed 125 researchers — 75 percent of whom where modelers, 4 percent were experimentalists, and 21 percent who consider themselves to be both.
It found that SBML is “widely recognized as a standard format for systems biology models.” Around 60 percent of respondents use SBML, compared to only around 4 percent who use CellML, and around 15 percent who said they use “other exchange formats.” Around 15 percent of respondents, however, noted that SBML is “missing functionality,” and 10 percent responded that “the learning curve of SBML is too steep.”
Respondents also appeared to be familiar with the MIRIAM (Minimum Information Requested in the Annotation of Models) standard, an offshoot of SBML that governs annotation of models that are submitted as part of a publication. Around 35 percent of respondents indicated that they were “aware” of MIRIAM, though there was no information in the survey results regarding usage of the format.
In addition, the survey found a strong demand for new standardization efforts in areas where formats are lacking, such as the graphical representation of biochemical networks.
Overall, 80 percent of the survey participants agreed with the statement that “standards are necessary” for systems biology research, largely in order to simplify the exchange of models across research groups and because it is still difficult to reproduce simulation results from published computational models.
The call for standardization was far from unanimous, however. The 20 percent of respondents who were not in favor of standards cited two main reasons, according to the report: “biology is considered to be too complex to be standardized,” and “obeying standards can be too time-consuming and restrictive.”
Edda Klipp, head of the computational systems biology group at the Max-Planck
Institute for Molecular Genetics and lead author on the survey paper, said that the project started within her own research group as an exercise in determining what standards were available and which tools were in use. Klipp designed a questionnaire that was first distributed among members of the European Yeast Systems Biology Network, and then more broadly throughout the systems biology research community via listservs.
One of the goals of the YSBN is to develop standards, Klipp said, “but we realized that before we start to standardize something, we should know what other people are doing.”
Another goal of the survey, she said, was to get a better idea of specific modeling tools that researchers are using. “If I have three colleagues working with Petri nets, then I could have the impression that Petri nets is the most common approach, but now from the survey we see what people are really doing, and most people are doing very classic deterministic modeling using [ordinary differential equations], and that was something that I could not predict,” she said.
Most researchers said they are studying either metabolism or signaling networks. ODEs are mostly used for modeling metabolism, cell signaling, and cell cycle research; stoichiometric models are used primarily for metabolism; partial differential equations are commonly used for structural analysis; and those studying genetic networks tend to use graphical models or discrete modeling methods such as Bayesian, Boolean, and Petri networks.
The survey also addressed systems biology software tools. In the general-purpose category, Mathworks’ Matlab package was the clear leader: Nearly half of the survey participants said they use Matlab “regularly” in their work. In terms of specialized computational systems biology packages, libSBML, CellDesigner, BioModels, XPPAUT, and Gepasi saw the most usage.
“For many respondents, the price and free availability of a tool is of utmost importance, followed by the requirement that it should be flexible and applicable to many different problem types,” Klipp and colleagues write. “The widespread use of Matlab indicates that flexibility is seemingly more important than free availability,” they add, although they note that “many respondents regard Matlab as free software, probably because many universities have campus licenses.”
An important — if not altogether surprising — finding of the survey is that while SBML is “a very important standard for exchanging models, it has its limitations,” Klipp said.
“SBML was clearly perceived as an upcoming standard,” the report states, though it also outlines several drawbacks, namely, the fact that SBML “is becoming more and more complex and therefore difficult to be implemented completely,” and the fact that interoperability between programs that are said to be SBML-compatible “is not satisfying and must be improved.”
This is not the first critique of SBML. A Nature Biotech paper published last year by Rui Alves of Spain’s University of Lleida and colleagues compared 12 kinetic modeling packages and found SBML compatibility to be “problematic in many packages.”
Michael Hucka, a senior research fellow at the California Institute of Technology and a lead SBML developer, told BioInform via e-mail this week that the SBML developers are “keenly aware” of the shortcomings mentioned in the survey report and noted that he and his colleagues are “working hard on this front to address specific areas.”
First, he said, the SBML Level 2 Version 3 specification will be released next month, which is expected to simplify “certain areas that were too complex” in the Version 2 specification. “We feel this will help software developers produce more compatible tools more easily,” he said.
At the same time, the SBML team will also release version 3.0 of libSBML, a software library that developers can use to implement support for SBML in their software “without having to start from a low-level XML parser,” Hucka said.
“The ranking of the simulators almost perfectly follows the quality and completeness of SBML support, which demonstrates the importance of standard formats.”
Also in the works is an SBML Test Suite “that will provide an objective way for software developers and users to assess how well a software system is interpreting SBML models,” Hucka said, noting that the suite should help improve the interoperability of SBML-based tools.
Hucka said that some of the report’s findings were less expected. “I think I'm most surprised by the prominence … of the notion of standardizing graphical network diagrams,” he said. He added that while he is involved in the Systems Biology Graphical Notation project, which aims to develop such a standard format, he didn’t realize that the lack of a standard in this area was on the radar of the broader systems biology community.
“I thought it was still early days,” he said. “Except for a relatively small number of those who are directly participating in this, I actually didn't think people in general really paid much attention to the issue. Apparently, enough other people desire this that it made an impact on the survey results.”
Hucka said that another “interesting result” is the fact that no single approach dominates modeling signaling networks. “Maybe it's because the modeling of signaling systems is so difficult that people are exploring all kinds of different approaches, and are unable to stick to a single paradigm such as ODE-based models,” he said.
“It suggests that we in the SBML community need to keep this result in mind,” he said. “All too often, people end up thinking that SBML models will be based on either a continuous ODE framework or a discrete stochastic simulation framework, but these results show a broader distribution. We need to make sure to make it easy.”
Nicolas Le Novère, a researcher at the European Bioinformatics Institute who is involved with SBML, MIRIAM, and the BioModels database, said that he was “pleased” by the results of the survey, which indicated that SBML has had a positive impact on the field.
Novère noted that the top three tools cited — libSBML, CellDesigner, and BioModels — were developed with SBML grants. In addition, he said, “the ranking of the simulators almost perfectly follows the quality and completeness of SBML support, which demonstrates the importance of standard formats.”
Indeed, one of the report’s recommendations is that modelers make their models available in a format that enables exchange and testing by others. “Considering the frequent use of SBML, this would be preferably SBML format,” the authors write.
Klipp stressed, however, that it is important for the field to remain flexible and not settle into a single standard too quickly. “In one sense I would completely agree that one cannot standardize everything,” she said. “You always need new ideas and you need the development of new concepts, and one should never restrict this in any way by demanding some kind of standard.”
Many models “don’t fit into SBML,” she said. “If you have a different type of model that has a completely different formalism, then of course you cannot apply SBML. But then they must make clear in the publication what the formalism is, how it has been calculated, how I can get the results that they show, and so on.”
The point of the survey and report was not to endorse any particular standard, Klipp noted, “but if we want to exchange models and if we want to use what other people have done, then there must be some kind of format,” she said. “These formats are always developing, but we can try to find the best solution for the time being.” | <urn:uuid:03dfbda4-de58-4aee-87a7-bfbb0def4c4a> | CC-MAIN-2022-33 | https://www.genomeweb.com/informatics/survey-says-sbml-widely-recognized-theres-room-improve-sys-bio-standards | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.964153 | 2,175 | 2.046875 | 2 |
There arе а lot оf health tips оn the Internet. Consume right, physical exercise frequently, avoid vices, avoid stress, but sоme doеs not deal wіth therapeutic or maintaining a wholesome way оf life іn a all-natural way.
You knоw aѕ I knоw thаt whеn depressed, chances are we wіll finish up consuming fatty meals aѕ well aѕ forgetting about working out оr оur objective for a "healthy teeth cleaned regularly". What happens, wе put fat аnd thе lbs back again on. We gеt more frustrated. And оn іt goes.
Besides, children arе alѕo prone to various diseases. It could bе due оf numerous factors likе poor hygienic routines, coming in contact with dangerous microorganisms, bad health and fitness, drinking chilled drinks, etc. Therefore, іt іs essential for you tо knоw all about thе safety health actions that уou will require tо consider care of while оn yоur vacation.
So don't wait around for the appraisal letter tо arrive аnd thеn back again calculate - both tо justify оr gеt indignant. Ask yourself. What iѕ yоur worth? And give а deep believed, instead of a superficial 1. Look intо thе mirror аnd get to the base of the honest reality.
You сould discover a Expert Biking Mentor оn either the web оr at уоur nearby fitness middle. Some Expert Biking Coaches саn bе discovered at the metropolis parks, where bike riders meet. Their notices ought to bе uр with the extra biking events.
Proper nutrition wіll assist make sure you are obtaining all оf the essential vitamins and minerals уour body needs tо assist уou get intо form. Eating the correct meals wіll give yоur physique thе essential power to get the mоst out of yоur exercises and assist you shed weight, as nicely.
Many tree businesses will alѕo offer unexpected emergency tree elimination services. If уour tree hаѕ been struck by lightning, for instance, it might be in danger of slipping аnd creating severe harm tо уour house аnd property. To steer clear of that, numerous reliable tree removal companies will arrive оut tо уоur home and assess the scenario at аny time of working day or evening.
Keep theѕe typical mistakes in thoughts whеn yоu begin tо search houses. Steer clear of creating hasty choices. Using your time to evaluate every thing first tends to make thе difference between an unwise purchase and a wise expense. | <urn:uuid:3e9db451-f974-4052-b8eb-1e9989e64e62> | CC-MAIN-2022-33 | https://nvqtyson79491336.hatenablog.com/entry/2017/11/05/081844 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.812542 | 670 | 1.890625 | 2 |
Rapunzel's Children: The making of democracy in Germany
by Tim Mellage
Publisher: Smashwords 2014
Number of pages: 87
Tim Mellage's and Sarah Ledbetter's interpretation of the fairy tale Rapunzel is such a work of true originality. It provides a fascinating method to understanding the social developments of Germany over the past five hundred years -- starting with the Reformation of 1517, through the dark years of two World Wars, to the modern democratic state that we know today -- based on the premonitions and symbols contained within the fairy tale.
Home page url
Download or read it online for free here:
by Edmund Curtis - University Paperbacks
The traditions of the Irish people are the oldest of any race in Europe north and west of the Alps, and they themselves are the longest settled on their own soil. The book covers Ireland history from the origins to circa 1922.
by Monica Helen Green (ed.) - Arc Medieval Press
This ground-breaking book brings together scholars to address the question of how recent work in genetics, zoology, and epidemiology can enable a rethinking of the Black Death's global reach and its larger historical significance.
by Mark Damen - Utah State University
The purpose of this course is to survey the development of various Western civilizations from antiquity through the late Middle Ages. Our goal is to advance your skills in articulating issues centering around historical events and figures.
by Antony C. Sutton - G S G & Associates
This book describes the role of the Wall Street financial elite in the 1933 seizure of power by Adolf Hitler in Germany. Contemporary academic histories, with perhaps the sole exception of Carroll Quigley's Tragedy And Hope, ignore this evidence. | <urn:uuid:64494f4a-02a9-4946-8082-b08e2e4f005e> | CC-MAIN-2022-33 | http://www.e-booksdirectory.com/details.php?ebook=9997 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.878693 | 406 | 2.484375 | 2 |
C++ stdlib man pages
stdman is a tool that parses archived HTML files from cppreference and generates groff-formatted manual pages for Unix-based systems. The goal is to provide excellent formatting for easy readability. stdman has been tested on Linux and OS X.
There's no need to compile stdman if you just want to install the man pages. Instead, just run:
./configure make install # as a user with appropriate permissions to install
If you need to pass options to configure, you can do so. See
./configure --help for more updated information.
If you're getting 'no manual entry for std::foo' or you're seeing the libstdc++ man pages (characterized by a huge list of typedefs when you run
man std::string), see the following. By default, stdman will install to
/usr/local; on some systems, the manpath does not look there first. To fix this, you have two options:
- Install to
./configure --prefix=/usr # will replace existing libstdc++ pages make install
- Manage your
If your output is not colorized
You either need to set your pager up to colorize man pages, or you need to install a pager to do this for you.
less will not do this by default, but it's easy enough to add.
most will do this by default, but it doesn't ship with vim-like navigation.
To configure less:
# Colors default=$(tput sgr0) red=$(tput setaf 1) green=$(tput setaf 2) purple=$(tput setaf 5) orange=$(tput setaf 9) # Less colors for man pages export PAGER=less # Begin blinking export LESS_TERMCAP_mb=$red # Begin bold export LESS_TERMCAP_md=$orange # End mode export LESS_TERMCAP_me=$default # End standout-mode export LESS_TERMCAP_se=$default # Begin standout-mode - info box export LESS_TERMCAP_so=$purple # End underline export LESS_TERMCAP_ue=$default # Begin underline export LESS_TERMCAP_us=$green
To install most:
pacman -S most
apt-get install most
export MANPAGER=most # in ~/.bashrc or similar
Should you want to build the source to make modifications and/or generate your own man pages, simply:
make generate # will build stdman and generate man pages
make generate expects sources will be in the
./reference/en/cpp directory by default. See
./configure --help to modify this.
- C++11 (recommended GCC 4.9 or clang 3.4 or greater)
- elinks (recommended 0.12pre6 or greater)
- gzip (recommended 1.3.12 or greater)
NOTE: Generation not tested on Windows/cygwin. | <urn:uuid:c3163cf5-5a4f-4a21-a436-d5aae0113170> | CC-MAIN-2022-33 | https://bestofcpp.com/repo/jeaye-stdman-cpp-tutorials | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.695647 | 724 | 2.28125 | 2 |
Get a free Business Credit Application template, Consumer Credit Application template, Notice of Credit Limit form and Business Credit Letter of Reference for your small business below.
The Business Credit Application template can be used when another business such as a distributor or vendor wishes to establish credit terms or a line of credit with your company. This template helps you gather important information in order to evaluate whether the borrower is reliable and will pay back their debts to you.
The Consumer Credit Application template can be used to address when an individual consumer or customer wishes to establish credit terms with your company. This template will allow you to do a prepare a loan application and ask the right questions so you can minimize the risk of a customer not paying back what they owe.
The Notice of Credit Limit template is a letter/form to consumer to address the need for a credit limit and explains in detail the amount and why their credit was limited.
The Business Credit Letter of Reference (also called letter of good credit or letter of good standing) is a letter that outlines your payment history with a business that you have purchased from in the past. Potential creditors use this letter to learn more about your payment history and determine the risk of providing credit to your company.
Why are Business Credit Templates Necessary?
Small business owners need a guide for the credit process in order to stay on track. Small business owners or entrepreneurs often need help when they are seeking outside financing for the first time. Each credit facility may have different account or income standards, and documents to complete.
The key to establishing a business credit profile and score is to search and find companies that will establish credit for your small business without using a credit check and then report the payment experience to the business credit bureaus. They will be able to help you establish your business credit profile by reporting the information to proper agencies.
If you would like your personal credit separated from your business credit profile and score , here are some general steps you need to take:
- Form a corporation or LLC to operate your small business. With these types of businesses you can establish a business credit profile that is separate from your personal debts. You might be able to apply for credit under your business name and obtain credit without a personal credit check, chances are that you will only have to ask. A social security number and an authorized signature may be required by a credit facility before being issued a credit card.
- Be in full compliance with the business credit market requirements.
- Be fully prepared to address the need to provide a professional business plan and your business transactions or financial statements.
- Find those companies or a lender willing to grant credit to your business without having a check done of your personal credit.
- Always manage your debt and account and keep statements in order so you do not fall into any trouble making payments and you do not negatively affect your credit score.
- Always make monthly payments on time to credit grantors in order to keep your business credit profile active.
How to Fill out a Business Credit Application Form
The key to properly filling out a business credit application form template is to pay attention to details and be truthful. The bank / lender / vendor needs to know specific personal and financial information to make a proper credit analysis before granting credit.
The basics of the name of the business, address and phone number will be requested and legal business entity in addition to the personal information of the owners/members/partners such as names and contact information. The business’s FEIN (Federal Employment Identification Number), information about what the business does (or in the case of personal credit, where the customer works) and names and contact information for references.
It’s common for people to try and hide any credit issues but they are often discovered. It’s the best policy to be upfront and explain the circumstances as they may still give you a chance if you don’t try to hide the facts.
Click on the link to download the business credit application templates: | <urn:uuid:db3e8d57-039b-473a-ad79-1daeddbb2ec1> | CC-MAIN-2022-33 | https://www.smallbusinessfreeforms.com/business_credit_application.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.937882 | 809 | 1.539063 | 2 |
Recommend this product to friends and acquaintances via email. To do so, simply complete all the fields marked * and click "Send".
Despite its origins being nearly 2500 years old, Socratic Questioning (SQ) in therapy generally and specifically in CBT remains somewhat a mystery to many practitioners. SQ is based on the practice of disciplined and thoughtful dialogue that, on the first sight, appears simple, but in fact – is intensely rigorous. Despite lots of references to SQ as a cornerstone of cognitive therapy (C.Padesky, 1993), there is very little, almost nothing, written about it and how to conduct it. This DVD set is an attempt to give practitioners clear explanation of SQ process and guidance about its use.
Julia Budnik interviews Fiona Kennedy and Paul Grantham, both experienced clinicians, tutors, and Accredited CBT Therapists, about SQ, from its origins to a detailed discussion about its practical implications. The interview is followed by a demonstration of SQ in three live sessions with different clients conducted by Dr Kennedy.
Regular price - £120 | <urn:uuid:f0031ec9-8a1a-42ca-9478-28a7ec51e076> | CC-MAIN-2022-33 | https://estore.eclipse.net.uk/epages/colt5155.sf/en_GB/?ObjectPath=/Shops/colt5155/Products/12215&ViewAction=ViewRecommendation | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.958575 | 237 | 1.84375 | 2 |
rectal prolapse under laparoscopy
Rectal prolapse is more common than you might think and affects two very distinct populations. It is either an insufficiency of means of fixation of the rectum and it then affects rather the young man, or it is a defect of fixation and support of the rectum by dehiscence of the pelvic floor and the sphincter apparatus to which cases it is more often elderly women.
Objective of the intervention
The operation consists of reattaching the rectum to the pelvic cavity using a strip. This procedure does not require a stomach tube. On the other hand, the bladder probe facilitates the exposure of the pelvis and the dissection in the rectovaginal septum.
Before the operation, it is important to promote regular transit by prescribing laxatives. In general, a prescription for duphalac for one sachet three times a day is sufficient. The patient is hospitalized the day before the operation. There is no hair removal to do on the abdomen or perineum. A normacol enema is done at 6 p.m. to promote rectal emptying. This enema is repeated the morning of the operation at 6 a.m.
Drinks are authorized the evening of the operation and a laxative is systematically prescribed postoperatively immediate. The infusion is useful only during the first hours in the most fragile patients.
From the day after the operation an early rise is recommended and the solid food is resumed by favoring a diet rich in fiber. For this, dietary support is desirable. The infusion and the bladder catheter are removed. Discharge can be considered around the 4th or 5th postoperative day. For young patients, in activity, the work stoppage is one month.
The patient leaves the service with transit facilitators (Duphalac), standard analgesics (Doliprane), dietary recommendations (fiber-rich diet) and an appointment with his surgeon. A functional rectal assessment will be scheduled (especially for young patients) at 3 months with a gastroenterologist.
Risks and complications
Severe constipation this is the most common complication, especially in cases of extensive rectal dissection. It corresponds to a malfunction of the rectum which is no longer able to evacuate stools correctly. This complication is to be feared especially in the event of slow transit before the intervention.
Infections it is to be feared in elderly patients who have already undergone vaginal surgery. The presence of a foreign body (strip) makes treatment more difficult, which will include antibiotics.
Erosion of the rectal wall this complication can occur some time after the operation. It results in rectal pain and emissions of mucus. On examination by rectoscopy, the distal end of the strip may be apparent. The treatment most often consists of completely or partially removing the strip.
Disorders of faecal and/or urinary continence although most of the time faecal continence is improved, these Disorders may appear postoperatively, especially when continence is almost normal initially. They can be corrected secondarily through perineal rehabilitation.
Genito-urinary disorders these problems occur in young patients most often men with a narrow pelvis. The problem comes from the dissection of the promontory or there is a lesion of the hypogastric plexus. | <urn:uuid:6c4f3c4c-0d6b-4cb2-b894-fed42f79de11> | CC-MAIN-2022-33 | https://eng.tunisie-esthetic.com/prolapsus-rectal.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.92855 | 714 | 1.515625 | 2 |
FRIDAY, Oct. 16, 2020 — The U.S. Food and Drug Administration is requiring labeling changes to nonsteroidal anti-inflammatory drugs (NSAIDs) that warn of the risks of taking these drugs at 20 weeks of pregnancy or later, the agency announced Thursday.
The new labeling is required to explain that if women take NSAIDs at 20 weeks or later in their pregnancy, the drugs can cause rare, serious kidney problems in the unborn baby that can lead to low amniotic fluid levels and potentially pregnancy-related complications. The recommendations apply to NSAIDs such as ibuprofen, naproxen, diclofenac, and celecoxib, but the FDA notes they do not apply to low-dose aspirin (81 mg), which may be a necessary treatment for some pregnant women.
Prescribing information for prescription NSAIDs must be updated to indicate that NSAID use be limited at 20 to 30 weeks of pregnancy. The FDA recommends that health care professionals “limit prescribing NSAIDs between 20 to 30 weeks of pregnancy and avoid prescribing them after 30 weeks of pregnancy. If NSAID treatment is determined necessary, limit use to the lowest effective dose and shortest duration possible.” Similar updates will be made to the Drug Facts labels for over-the-counter NSAIDs. The agency also suggested health care professionals consider ultrasound monitoring of amniotic fluid if NSAID treatment extends beyond two days.
The FDA based its decision on its own review of the medical literature and cases reported to the agency about low amniotic fluid levels or kidney problems in unborn babies related to NSAID use by pregnant women. The agency noted that oligohydramnios may be detected as soon as two days after a woman starts taking NSAIDs and the condition usually goes away if the pregnant woman stops taking the NSAID.
Source: Read Full Article | <urn:uuid:e395b98f-ccd4-48df-a864-690cc1eb4155> | CC-MAIN-2022-33 | https://toppersonalhealth.com/health-news/fda-requiring-labeling-changes-to-nsaids-warning-of-risks-in-pregnancy/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.921639 | 381 | 2.125 | 2 |
OVERLAND PARK, KS, July 29, 2021 (GLOBE NEWSWIRE) — The findings of DARE-19, a double-blind, placebo-controlled Phase III trial examining Dapagliflozin in patients with cardiometabolic risk factors hospitalized with COVID-19, have been published in The Lancet Diabetes & Endocrinology. The study was a collaboration of George Clinical, a global scientifically-backed clinical research organization and Saint Luke’s Mid America Heart Institute and was funded by AstraZeneca.
Prior to the study, it was established that patients hospitalized with COVID-19 with cardiometabolic risk factors had an elevated risk of organ failure and death. DARE-19 was the first large, randomized controlled study of hosptialized patients with COVID-19 to evaluate the safety and efficacy of SGLT2 inhibitors. Detailed results from the primary analysis of the DARE-19 Phase III trial assessing the potential of Farxiga (dapagliflozin), a sodium-glucose cotransporter 2 (SGLT2) inhibitor, to treat patients hospitalized with COVID-19 who are at risk of developing serious complications, showed that the trial did not achieve statistical significance for the two primary endpoints. However, there were numerically fewer events of death or new or worsened organ dysfunction in the Farxiga group compared with placebo.
The primary endpoint of prevention was defined as new or worsened respiratory, cardiovascular or kidney organ dysfunction during hospitalization or death from any cause during the 30-day treatment period. Numerically fewer events were observed in the Farxiga group across all components of this composite endpoint. Cardiac, renal and metabolic comorbidities have been associated with poor outcomes and death in patients hospitalized with COVID-19 The second primary endpoint of recovery, which assessed change in clinical status (improvement or deterioration) compared to baseline, showed no overall difference between the treatment groups.
“The ability to rapidly start and execute this study during the midst of a major global pandemic is a credit to the entire cross-functional project team,” stated George Clinical Chief Business Officer, Sean Hart. “In a month we broke down barriers to go from concept to our first patient in the trial, and the team displayed extraordinary commitment needed to successfully manage this research during this pandemic personally and professionally.”
Mikhail N. Kosiborod, MD, a cardiologist at Saint Luke’s Mid America Heart Institute, Vice President of Research at Saint Luke’s Health System, and a member of George Clinical’s Scientific Leadership was the principal investigator of DARE-19. The study was an international Phase III trial in 1,250 patients evaluating the efficacy and safety of Farxiga in addition to background local standard of care therapy in adults who are hospitalized with COVID-19 at the time of trial enrollment. Patients enrolled in DARE-19 also had a medical history of hypertension, type-2 diabetes (T2D), atherosclerotic cardiovascular disease, heart failure (HF) or chronic kidney disease (CKD) Stages 3-4 and received Farxiga or placebo for 30 days. The trial was conducted in collaboration with Saint Luke’s Mid America Heart Institute, the global sponsor, and George Clinical, a global contract research organization.
“DARE-19 is one of the few randomization controlled, double blind clinical trials for COVID-19 that has been completed during the pandemic. This accomplishment is due to the tireless work and commitment of our Investigators, site staff and the study team members across the sponsor, George Clinical, and our partners. Their dedication to the project during a time of significant personal stress is the key reason these results are available for the scientific community,” said Emily Akin, Project Director for George Clinical.
About George Clinical
George Clinical is a leading global clinical research organization founded in Asia-Pacific driven by scientific expertise and operational excellence. With more than 20 years of experience and more than 300 people managing 38 geographical locations throughout the USA, Asia-Pacific region and Europe, George Clinical provides the full range of clinical trial services to biopharmaceutical, medical device, and diagnostic customers, for all trial phases, registration and post-marketing trials.
For more information of George Clinical, contact:
Donna McDonnell George Clinical 901-229-5345 email@example.com | <urn:uuid:cbcbba47-9faf-4f57-94c9-ec02ae811b20> | CC-MAIN-2022-33 | https://cambodiachronicle.com/dare-19-phase-iii-collaboration-between-astrazeneca-saint-lukes-mid-america-heart-institute-and-george-clinical-shows-treatments-well-established-safety-profile-was-consistent-in-pa/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.934321 | 982 | 1.648438 | 2 |
Mitophagy, the selective degradation of mitochondria by autophagy, is a central process that is essential for the maintenance of cell homeostasis. It is implicated in the clearance of superfluous or damaged mitochondria and requires specific proteins and regulators to perform. In yeast, Atg32, an outer mitochondrial membrane protein, interacts with the ubiquitin-like Atg8 protein, promoting the recruitment of mitochondria to the phagophore and their sequestration within autophagosomes. Atg8 is anchored to the phagophore and autophagosome membranes thanks to a phosphatidylethanolamine tail. In Saccharomyces cerevisiae, several phosphatidylethanolamine synthesis pathways have been characterized, but their contribution to autophagy and mitophagy are unknown. Through different approaches, we show that Psd1, the mitochondrial phosphatidylserine decarboxylase, is involved in mitophagy induction only after nitrogen starvation, whereas Psd2, which is located in vacuole, Golgi and endosome membranes, is required preferentially for mitophagy induction in the stationary phase of growth but also to a lesser extent for nitrogen starvation-induced mitophagy. Our results suggest that the mitophagy defect observed in Δpsd1 yeast cells after nitrogen starvation may be due to a failure of Atg8 recruitment to mitochondria.
Autophagy is a cellular degradation process that is highly conserved among eukaryotic species by which cytosolic components such as organelles or proteins are degraded within specific compartments: the vacuole in yeast and plants, and lysosomes in mammalian cells. Autophagy can be split into three categories: microautophagy, chaperone-mediated autophagy (CMA) and macroautophagy (Jacob et al., 2017). Microautophagy occurs when vacuole membrane invagination sequesters organelles or proteins directly. CMA has been only characterized in mammalian cells and involves the recognition and translocation of protein substrates within the lysosomes (Tasset and Cuervo, 2016). Macroautophagy or bulk autophagy, commonly just called autophagy, requires transitory structures to be made (Feng et al., 2014). When this process is triggered, the phagophore, a membrane structure, appears from the phagophore-assembly site (PAS), located next to the vacuole in yeast. The phagophore elongates, closes, and forms an autophagosome, a vesicle containing sequestered cytosolic components. The autophagosome fuses with the vacuole membrane, releasing the cargo into the vacuolar lumen, where hydrolases degrade it. Degradation products are then exported to be reused by the cell. Many studies in yeast and mammalian cells have shown that different cellular compartments, such as mitochondria (Hailey et al., 2010), the Golgi (Van der Vaart et al., 2010), endoplasmic reticulum (ER) (Axe et al., 2008) and the plasma membrane (Ravikumar et al., 2010) may supply autophagosome membranes.
Defects in autophagy mechanisms or regulation have been linked to neurodegenerative diseases and cancers (Choi et al., 2013). The molecular mechanisms involved in autophagy have been widely studied, and this process has been increasingly understood both in yeast and mammalian cells. Autophagy requires more than 40 autophagy-related genes (denoted ‘Atg’) proteins. About 18 Atg proteins are part of the core autophagy machinery necessary to all types of autophagy, selective and non-selective, and the rest are implicated in selective types of autophagy processes (Wen and Klionsky, 2016). Bulk autophagy (hereafter referred to as autophagy) is considered a non-selective event; cytosolic components are sequestered within autophagosomes randomly. However, so far, many selective autophagic processes have been characterized. Peroxisomes, ribosomes, nucleus and mitochondria can be recruited to the PAS specifically and further degraded by autophagy (Suzuki, 2013). Autophagic degradation of mitochondria is called mitophagy and, in yeast, involves specific proteins. Atg32, an outer mitochondrial membrane protein, is the protein that marks mitochondria for degradation (Kanki et al., 2009a; Okamoto et al., 2009). Atg32 can interact with Atg8 (Okamoto et al., 2009), a protein whose phosphatidylethanolamine (PE) tail anchors it to the phagophore and autophagosome membranes (Ichimura et al., 2000). This interaction between Atg32 and Atg8 is responsible for the recruitment of mitochondria to the phagophore and for their further degradation within the vacuole. Depending on induction conditions, in addition to the interaction between Atg32 and Atg8, some other proteins are involved in mitophagy, including Atg11 (Kanki and Klionsky, 2008), Uth1 (Kissová et al., 2004), Aup1 (Tal et al., 2007), Atg33 (Kanki et al., 2009b), Whi2 (Mendl et al., 2011), Hog1, and Slt2 (Mao et al., 2011). PE has a central role in all autophagy processes because of its dual role in Atg8 lipidation and phagophore membrane elongation (Ichimura et al., 2000). PE is a major component of cell membranes, together with phosphatidylinositol (PI), phosphatidylserine (PS) and phosphatidylcholine (PC), in yeast (Klug and Daum, 2014). When non-selective and selective autophagy are triggered, the Atg8 ubiquitin-like conjugation system, involving Atg4, Atg7, and Atg3 proteins, lipidates Atg8 with PE (Schlumpberger et al., 1997; Mizushima et al., 1998; Ichimura et al., 2000; Kirisako et al., 2000). In Saccharomyces cerevisiae, several PE synthesis pathways have been characterized to date (Fig. 1A). Mitochondria (Mito) and endoplasmic reticulum (ER) are the main compartments of PE production in yeast cells (Daum and Vance, 1997). Ept1, an ER-located enzyme, can perform de novo PE synthesis by converting cytidine-diphosphoethanolamine (CDP-Etn) into PE. CDP-Etn can be produced via both the Kennedy pathway from extracellular ethanolamine (Zelinski and Choy, 1982), and an enzymatic cascade involving Dpl1, which like Ept1, is also located in the ER. Two phosphatidylserine decarboxylases, Psd1 and Psd2, located in the inner mitochondrial membrane, and in the vacuole, Golgi and endosome (V/G/E) membranes, respectively, can also synthesize PE from phosphatidylserine (Trotter et al., 1993; Trotter and Woelker, 1995). Recently, the Nunnari laboratory have shown that Psd1 exhibits dual mitochondrial and ER localization, depending on the metabolic status of cells (Friedman et al., 2018). Reacylation of lyso-PE by Ale1 and Tgl3, in the ER and lipid droplets (LDs), respectively, constitutes the final pathway of PE synthesis (Calzada et al., 2016).
The central role of Atg8-PE in all nonselective and selective autophagy is now well established. However, the origin of PE required for autophagy and mitophagy induction is still unknown. In this work, we used mutants affected in single PE synthesis pathways to investigate the contribution of the different cellular PE pools on autophagy and mitophagy induction. Our results showed that, in yeast, mitochondrial phosphatidylserine decarboxylase 1 (Psd1) is involved in mitophagy only when nitrogen starvation induces the process.
Autophagy is not affected in deletion yeast strains defective in one PE synthesis pathway
Among all Atg proteins, Atg8 is particularly useful in the study of autophagy. This protein is located in the PAS and autophagosomal membranes, and is involved in autophagy process from the beginning to the end. To assess the role of each PE-producing enzyme in autophagy, we submitted BY4742 (wild-type, WT) and Δpsd1, Δpsd2, Δale1, Δept1, Δtgl3 and Δdpl1 S. cerevisiae strains expressing GFP–Atg8 and grown on a strict respiratory carbon source to nitrogen starvation or harvested them after 1 day of stationary phase growth. These conditions induce both autophagy and mitophagy in yeast (Bhatia-Kiššová and Camougrand, 2010). Under basal conditions, GFP–Atg8 is only located in the PAS, whereas under autophagy-inducing conditions, GFP–Atg8 is transported into the vacuolar lumen, where hydrolases degrade the Atg8 moiety more rapidly than GFP moiety. Next, we quantified autophagy induction from western immunoblot analyses by calculating the ratio of the amount of residual GFP to that of total GFP (GFP+GFP–Atg8). We observed no significant differences, even in the kinetics of autophagy implementation, between WT and all strains in which one PE synthesis pathway was impaired, both in the stationary phase of growth and after 6 h of nitrogen starvation, meaning that autophagy required no central PE enzyme in the conditions we used (Fig. S1A–K). Our results show that existing PE synthesis pathways can compensate for absent pathways.
Mitophagy requires different enzymes of PE synthesis depending on conditions of induction
We studied mitophagy induction in WT and Δpsd1, Δpsd2, Δale1, Δept1, Δtgl3 and Δdpl1 strains expressing Idp1–GFP. Under basal conditions, this fusion protein is only located in mitochondrial matrix. Under mitophagy-inducing conditions, mitochondria are sequestered within autophagosomes and degraded within the vacuole; consequently, residual GFP is detectable in this compartment. As for the autophagy experiments, mitophagy was induced either by 6 h of nitrogen starvation or after 1 day of stationary phase growth on a respiratory carbon source (Fig. 1B). We performed a quantification of western immunoblots (Fig. 1C,D) by measuring ratio of the amount of residual GFP to that of total GFP (GFP+Idp1-GFP). While mitophagy was not affected in Δale1, Δept1, Δtgl3 or Δdpl1 strains in the stationary phase of growth, we noticed a faint decrease in mitophagy in Δale1 and Δept1 strains during nitrogen starvation (Fig. 1B,D). Interestingly, we observed that Δpsd1 and Δpsd2 mutant strains, both deleted for a phosphatidylserine decarboxylase, exhibited different phenotypes. After 1 day in stationary phase growth, in comparison with WT, mitophagy induction was delayed in Δpsd2 strain only, whereas after 6 h of nitrogen starvation, mitophagy was impaired in Δpsd2 (45% of WT) and, to a greater extent in Δpsd1 (15% of WT) strain (Fig. 1B–D). To quantify mitophagy, we performed measurements of mitoPho8Δ60 alkaline phosphatase (ALP) activity as described previously (Kanki et al., 2009b). Pho8 is a vacuolar alkaline phosphatase synthesized as an immature form in the cytosol and imported and matured within the vacuole. The truncated Pho8Δ60 version of this protein cannot be imported into the vacuolar lumen; by addressing this truncated protein to mitochondria, thanks to a COXIV mitochondrial-targeting sequence, mitophagy is the only way for this protein to be delivered to and matured in the vacuole. Thus, this assay is a very convenient tool for quantitative measurement of mitophagy. All strains displayed a basal level of mitoPho8Δ60-dependent alkaline phosphatase activity because of the presence of Pho13, another alkaline phosphatase (Fig. 2A,B). Nitrogen starvation treatment induced an increase in ALP activity in WT because of mitophagy induction (Fig. 2A). This activity was 40% lower in the Δpsd1 strain and 25% lower in the Δpsd2 strain than in WT. In the stationary phase of growth, the ALP activity increased in WT and in the Δpsd1 strain and was lower in the Δpsd2 strain (Fig. 2B). Cells lacking Atg32 protein (Δatg32) cannot perform mitophagy in this condition, so we used them as a negative control. These results confirmed the findings from western immunodetection analyses, and suggest that during the beginning of nitrogen starvation, the presence of Psd1 is crucial for the induction of mitophagy and could provide PE to autophagy machinery to initiate mitochondrial degradation. The scenario is completely different in the stationary phase of growth, in which the activity of Psd2 is strictly necessary. We note that, in WT cells, nitrogen starvation does not change mitochondrial lipid composition compared to that seen during the exponential phase of growth (Fig. S2A–C). Finally, we performed immunoelectron microscopy on WT and Δpsd1 strains. We prevented degradation of autophagic bodies (ABs) by addition of PMSF, as described previously (Kiššová et al., 2007) and compared the number of vesicles (ABs) in the vacuole and the number of cells with mitochondria within the vacuole. As expected, the number of cells with vacuole-containing mitochondria was much lower in the Δpsd1 strain than in WT (Fig. 2C).
We next focused on mitochondrial Psd1, and, using different approaches, we confirmed that mitophagy impairment in Δpsd1 strain is due to an absence of Psd1. The mitophagy defect was rescued in the Δpsd1 strain expressing pPSD1 after 6 h of nitrogen starvation, as shown by the appearance of free GFP in this strain on western blots to a similar level as observed in WT (Fig. 3A,B). Accordingly, the mitoPho8Δ60 alkaline phosphatase (ALP) activity defect was also rescued in Δpsd1 strains expressing pPSD1 (Fig. 2A). Psd2, which is located in membranes of the Golgi, vacuole and endosomes, is the other phosphatidylserine decarboxylase characterized in eukaryotes (Trotter and Woelker, 1995; Zinser et al., 1991; Riekhof et al., 2014; Gulshan et al., 2010). Overexpression of Psd2, in the Δpsd1 strain, in which it localizes in the cytosol, rescued the observed defect in induction of mitophagy after nitrogen starvation (Fig. S3A). Surprisingly, no beneficial effect of overexpression of Psd2 was observed if protein was targeted to mitochondria. Because the Atg32 protein plays a crucial role during mitophagy by acting as a mitochondrial receptor for the autophagy machinery, we also checked whether the mitophagy defect in the Δpsd1 strain was cause by an alteration in Atg32 expression. We tagged the C-terminus of Atg32 with a V5 tag and analyzed Atg32–V5 expression in both parental and Δpsd1 strains during the exponential phase of growth and after 3 h of nitrogen starvation. We did not see any difference in Atg32 expression in these conditions in WT or Δpsd1 strains. This result suggests that the mitophagy defect in the Δpsd1 strain does not depend on the Atg32 protein expression (Fig. S3B,C).
Atg8 protein localizes to mitochondria under nitrogen starvation
Considering the importance of PE synthesized by mitochondrial Psd1 in mitophagy triggered by nitrogen starvation, we hypothesized that mitochondria could provide this phospholipid for Atg8 conjugation. To investigate this hypothesis, we isolated mitochondria from WT, Δpsd1 and Δpsd2 strains expressing GFP–Atg8 after 3 h of nitrogen starvation. We loaded purified mitochondria on sucrose gradients and, after centrifugation, collected and analyzed fractions by western immunodetection analyses. We were able to visualize GFP–Atg8 in fractions in which porin, a mitochondrial protein, was the most abundant, in all strains (Fig. 4A–C), which suggested recruitment of GFP–Atg8 to mitochondria. The GFP–Atg8:porin ratio was similar between WT and Δpsd2 strains. However, this ratio decreased by 50% in Δpsd1 compared with WT (Fig. 4D). In cell fractionation experiments, we detected ∼40% of GFP–Atg8 in mitochondrial fractions in WT cells and only ∼20% in the Δpsd1 strain (Fig. S4A,B). When we isolated mitochondria from WT cells that were grown in the presence of glucose and submitted to nitrogen starvation, a condition in which mitophagy is not induced, we found no localization of GFP–Atg8 in mitochondrial fractions (Fig. S4C,D). Our results suggest that the mitophagy defect observed in the Δpsd1 strain under nitrogen starvation conditions may be the result of failure to recruit Atg8 to the mitochondrial surface.
To further examine the nature of the association of Atg8 with mitochondria, we next treated mitochondria, purified from WT that had been exposed to 3 h of nitrogen starvation, with sodium carbonate and Triton X-100 (TX-100). GFP–Atg8 was detected in pellet fraction upon sodium carbonate treatment, and it was visualized in the supernatant when mitochondria were treated with TX-100 (Fig. S4E). This result suggests that GFP–Atg8 is a peripheral protein not only associated with mitochondrial membranes but also likely anchored to them owing to its PE moiety.
To confirm the localization of Atg8 to mitochondria upon nitrogen starvation, we also carried out an immunoelectron microscopy analysis with antibodies directed against the Atg8 protein. After 3 h of nitrogen starvation, we observed a significant number of WT cells with clusters of gold particles on the mitochondrial surface, autophagosomes and ABs. In the Δpsd1 strain, Atg8 clusters on mitochondria were less frequent (20%) and much smaller than in WT cells (50%) (Fig. 5A–D). We also checked the localization of two proteins of the Atg8-conjugation machinery, Atg3 and Atg4, to mitochondria in nitrogen starvation. We performed cell fractionation on WT cells expressing Atg3–GFP and Atg4–GFP submitted to 3 h of nitrogen starvation, and we observed a very weak GFP signal in the mitochondrial fractions (fractions where porin is abundant) (Fig. S5A,B). In order to determine Atg3 and Atg4 localization more precisely, we prepared crude mitochondrial extracts from these two strains and loaded them on sucrose gradients. We detected Atg3–GFP and Atg4–GFP proteins in porin-enriched fractions (Fig. 6A,B). Moreover, we observed clusters of Atg4–GFP on mitochondria by immunoelectron microscopy (Fig. 6C). At the same time, we found Atg4 dispersed in cytosol, as expected based on its function in the process of Atg8 cleavage to a form required for autophagosome formation. In the stationary phase of growth, Atg4–GFP is not found in mitochondrial fractions (Fig. S5C). Our data suggest that Atg8 and Atg8-conjugation machinery could be recruited to mitochondria specifically in response to nitrogen starvation-induced mitophagy; thus, Atg8 can be conjugated to mitochondria directly.
We next wondered whether we could visualize Atg8 recruitment to mitochondria by fluorescence microscopy. We examined a WT strain expressing Ilv3–RFP (a mitochondrial matrix protein fused to RFP) and GFP–Atg8 submitted to nitrogen starvation. We were able to observe a few colocalization events between GFP–Atg8 and mitochondria, but they were very fast and transient (∼4 min) (Fig. 7A). Every acquisition was taken at a 2 min interval, enough for GFP–Atg8 to colocalize with and then not be retained on mitochondria. We had demonstrated previously that two waves of mitophagy occur in nitrogen starvation (Kiššová et al., 2007). In the first hours of nitrogen starvation, mitochondria are targeted selectively for degradation by autophagy machinery; later, mitochondria are degraded by general autophagy. We next wondered whether colocalization events between GFP–Atg8 and mitochondria would occur in close proximity to the vacuole, meaning that mitochondria located near to the vacuole would be degraded first by mitophagy. We carried out fluorescence microscopy in WT cells expressing Ilv3–RFP and GFP–Atg8 and with FM4-64-stained vacuoles. After 3 h of nitrogen starvation, colocalization between GFP–Atg8 and mitochondria occurred next to the vacuole (Fig. 7B), suggesting degradation of mitochondria in close proximity to this cell compartment.
Autophagy and mitophagy are two central processes required for cell homeostasis and survival. One step required for all general and selective autophagy processes is Atg8 (LC3 proteins are the mammalian Atg8 homologs) conjugation with PE, which is mediated by the Atg8-conjugation system (Ichimura et al., 2000; Kirisako et al., 2000). After PC, PE is the most abundant phospholipid in eukaryotic cells, and can be synthesized via different pathways in yeast (Fig. 1A). Among them, in standard culture condition, when cells are grown in a medium containing glucose as carbon source, the mitochondrial phosphatidylserine decarboxylase Psd1 synthesizes the majority of PE via decarboxylation of PS (Birner et al., 2001). Previous studies have shown that Psd1 is responsible for 85% of phosphatidylserine decarboxylase activity (Trotter et al., 1993). Moreover, PE content, measured in mitochondria isolated from cells grown in lactate as a carbon source, was 87% lower in the Δpsd1 mutant than in WT (Storey et al., 2001). It was also shown that PE positively regulates autophagy and longevity (Rockenfeller et al., 2015). We used yeast strains with one impaired PE synthesis pathway (Δpsd1, Δpsd2, Δept1, Δale1, Δtgl3 and Δdlp1) to assess the contribution of each pathway in autophagy induction. Our results showed no differences in autophagy induction, both in the stationary phase of growth and under nitrogen starvation, between WT and all mutants with a single impaired PE synthesis pathway, suggesting no central enzyme supplies PE to the autophagy machinery (Fig. S1). Our data also suggest that, in yeast cells, PE synthesis pathways can compensate for each other to supply PE to autophagy machinery in both conditions. These results suggest that the PE necessary for autophagy can come from different cellular compartments, and are in agreement with previous studies showing membranes required for autophagy can have different origins. Moreover, depletion of both pathways involving Psd1 and Psd2 has an impact on autophagy (Nebauer et al., 2007). Recently, the Nunnari laboratory reinvestigated Psd1 location and found that this protein is localized not only in mitochondria but also in ER, depending on the metabolic status of cells (Friedman et al., 2018). However, in their study, the authors did not discuss the possibility that the ER location of Psd1 could be related to mitochondrial-associated membranes (MAMs) derived from the ER. Bürgermeister et al. also observed that a certain portion of PE synthesized by Psd2 can be imported into mitochondria with a moderate efficiency (Bürgermeister et al., 2004). In addition, some data have suggested that autophagy competes for a common PE pool with major cellular PE-consuming pathways, such as glycosylphosphatidylinositol anchoring (Wilson-Zbinden et al., 2015). Considering lipid trafficking and the major role of autophagy, our results are therefore not so surprising.
Considering mitophagy, Δpsd1 or Δpsd2 mutants exhibited an impairment of this process depending on conditions of induction. When we submitted cells to nitrogen starvation, mitophagy induction was impaired in the Δpsd2 strain and by an even greater extent in the Δpsd1 strain, whereas in the stationary phase of growth, mitophagy induction was impaired in the Δpsd2 strain only (Fig. 1B–D). The mitochondrial localization of Psd2 (Bürgermeister et al., 2004) may help to explain the observation that mitophagy is also affected in the Δpsd2 mutant during nitrogen starvation, but to a lesser extent than in the Δpsd1 mutant. Unfortunately, we could not include the double-mutant Δpsd1psd2 in our study because it does not grow in the medium we used containing lactate as respiratory carbon source, as previously shown by Daum laboratory (Horvath et al., 2011). Our data highlight the importance of phosphatidylserine decarboxylase activity in mitophagy induction in both conditions, but most importantly the requirement for Psd1 specifically in nitrogen starvation-induced mitophagy. Expression of Psd1 or overexpression of Psd2 were enough to rescue the impairment in mitophagy in the Δpsd1 strain. Some proteins are known to be required only for mitophagy induced by stationary phase growth, such as Aup1 or Atg33 (Tal et al., 2007; Kanki et al., 2009b). Psd2 can now be added to this list. To our knowledge, Psd1 is the first protein shown to be strictly involved in nitrogen starvation-induced mitophagy. Our results also mean that mitochondria could supply PE for Atg8 lipidation or phagophore membrane elongation in order to promote their own degradation under nitrogen starvation. Immunoprecipitation experiments during mitophagy induction have previously demonstrated the recruitment of Atg8 to mitochondria; this allowed Atg8 interaction with Atg32, but whether Atg8 is already PE-lipidated when it is recruited to mitochondria is unknown (Kondo-Okamoto et al., 2012). Our observation showing that, in the Δpsd1 strain, Atg8 fails to localize in mitochondria under nitrogen starvation, suggests that Psd1 could supply PE for Atg8 lipidation.
Our hypothesis concerning mitochondria as a source of PE and/or membranes is consistent with the observations of Hailey et al. in mammalian cells (Hailey et al., 2010). In their work, they showed that in starved NRK58B cells, the early autophagosomal marker Atg5 transiently localizes to puncta on mitochondria in the same way as do LC3 proteins (the Atg8 homologs), which identified mitochondria as membrane sources of starvation-induced autophagosomes. They showed that this autophagosome–mitochondria overlap during starvation is not due to mitophagy, and proposed that these contacts mediate the lipid transfer between both organelles. They also observed that autophagosome induction during starvation is inhibited severely when ER–mitochondria connections are impaired in cells. Moreover, these ER–mitochondria connections have also been shown to be important for mitophagy (Böckler and Westermann, 2014). In yeast, the ERMES complex, a protein complex that links the ER with mitochondria and may have a role in promoting exchange of Ca2+ and phospholipids between the two organelles, is a major player contributing to mitophagy but not to autophagy. In ERMES mutants, colocalization between Atg8 and Atg32 is not affected; nevertheless, mitophagy is impaired (Böckler and Westermann, 2014). Consequently, this complex is hypothesized to facilitate exchange of lipids between ER and mitochondria and perhaps between ER and phagophores.
In our study, we highlighted a specific role of Psd1 in nitrogen starvation-induced mitophagy. We understand that the purpose of mitophagy induced during nitrogen starvation and the stationary phase of cell growth is most probably different (Fig. 8). When cells are grown under respiratory conditions that allow full differentiation of mitochondria and then are submitted to nitrogen starvation, they initiate degradation of some unnecessary mitochondria to provide nutrients required for their survival. On the other hand, the goal of mitophagy induced during the stationary phase of growth is to eliminate damaged mitochondria. This can be attested to by the increase in oxidized mitochondrial proteins in the Δatg32 strain, which is impaired in mitophagy (N.C., unpublished results). Moreover, we hypothesize that under nitrogen starvation, cells degrade mitochondria that are in close proximity to the vacuole preferentially, whereas in the stationary phase of growth, damaged mitochondria anywhere in the cell might be targeted for degradation (Fig. 8). We previously performed electron microscopy kinetics studies on the WT strain grown in respiratory conditions and submitted to nitrogen starvation. We observed two distinct waves of mitophagy. The first one took place in the first hours of nitrogen starvation, and we visualized contacts between the vacuole and mitochondria, followed by the appearance of vesicles containing mitochondria with only residual cytosol almost exclusively. The second wave appeared later, where vesicles containing mitochondria and significant amounts of cytosol were observed (Kiššová et al., 2007). The first event suggested a direct targeting of mitochondria for degradation, or ‘micromitophagy’, with a direct recruitment of autophagy machinery to mitochondria; the second wave suggested non-specific mitophagy. In the present study, we first confirmed GFP–Atg8 recruitment to mitochondria after 3 h of nitrogen starvation in WT cells by western immunodetection analyses (Fig. 4A) and immunoelectron microscopy (Fig. 5A). In Δpsd1 cells, we observed a decrease of GFP–Atg8 localization to mitochondria in the same condition compared with WT, suggesting that Δpsd1 mitophagy defect may be due to the failure to recruit Atg8 to mitochondria (Figs 4B and 5B). To test this hypothesis, we prepared purified mitochondrial extracts from our WT and Δpsd1 cells, and tried to separate both Atg8 and Atg8-PE forms by western blot. Despite all our attempts, we did not manage to separate both Atg8 forms, but we confirmed the recruitment of two proteins of Atg8-conjugation machinery, Atg3 and Atg4, to mitochondria (Fig. 6A–C), suggesting that Atg8 is processed on mitochondria directly in response to nitrogen starvation. Then, to have a direct sequestration of mitochondria by the vacuole or micromitophagy, proximity between the PAS, the vacuole, and mitochondria seems necessary (Fig. 8). The findings that, during the first hours of nitrogen starvation, contacts between mitochondria and vacuoles occur and that some core autophagic proteins are recruited to mitochondria, as confirmed by fluorescence observations, support for this hypothesis (Fig. 7). At this point, we can hypothesize that Atg8 might be recruited and maintained on mitochondrial surface to be lipidated directly under nitrogen starvation, after which autophagy machinery might be recruited. In the absence of Psd1, Atg8 might fail to be retained to mitochondria and autophagy machinery might not be recruited to these organelles, leading to the mitophagy defect.
In yeast, Atg8 is encoded by one single gene and it is the only protein shown to be anchored to phagophore and autophagosome membranes. In mammalian cells, seven Atg8 homologs from different transcripts and genes have been characterized and are subdivided into two groups, LC3s (also known as MAP1LC3s) and GABARAPs (Schaaf et al., 2016). Because of strong sequence similarities, these proteins are believed to perform similar functions in autophagy; nevertheless, substantial evidence shows that the LC3/GABARAP family proteins are unique in function and important in autophagy-independent mechanisms (Schaaf et al., 2016). We can wonder whether each LC3 or GABARAP protein is lipidated with PE produced by different PE synthesis pathways in mammals depending on the mitophagy induction conditions. Our data in yeast highlight the role of phosphatidylserine decarboxylase (PSD) activity in mitophagy induction during the stationary phase of growth and in nitrogen starvation (Fig. 8). Therefore, it is possible that PSDs could have a central role in PE supplying for mitophagy in mammals. Our results are also in line with data showing that PE for Atg8 lipidation and membranes necessary for phagophore expansion are provided in different places in the cells depending on the purpose of autophagy or mitophagy.
MATERIALS AND METHODS
Yeast strains, plasmids and growth conditions
All yeast strains used in this study are listed in Table S1. BY4742 was used as wild-type (WT) strain. All strains were obtained from Euroscarf bank. Plasmids and gene deletion protocols are described below. Yeast cells were grown aerobically at 28°C in minimal medium (0.175% yeast nitrogen base without amino acids and ammonium sulfate, 0.5% ammonium sulfate, 0.1% potassium phosphate, 0.2% Drop-Mix, 0.01% of auxotrophic amino acids and nucleotide, pH 5.5), supplemented with 2% lactate as a carbon source. Cell growth was followed by measuring the optical density at 600 nm (OD600nm). For starvation experiments, cells were harvested (5000 g for 5 min) at the early exponential phase of growth, washed three times with water and incubated in nitrogen starvation medium (0.175% yeast nitrogen base without amino acids and ammonium sulfate, and 2% lactate, pH 5.5). Autophagy was studied in cells expressing GFP–Atg8 after 6 h of nitrogen starvation or after 1 day of stationary phase growth (Noda et al., 1995). pRS416-GFP-ATG8 was a gift from Dr Dan Klionsky (University of Michigan, Ann Arbor, MI). Mitophagy was studied in cells expressing Idp–GFP protein submitted to nitrogen starvation for 3 or 6 h or 1 day of stationary phase growth. The plasmid pIDP1-GFP was a gift from Dr Hagay Abeliovich (Hebrew University of Jerusalem, Jerusalem, Israel). BY4742 strains expressing Atg3–GFP or Atg4–GFP were a gift from Dr Isabelle Sagot (IBGC, Bordeaux, France). For PHO8 disruption, the PHO8 gene was deleted in the BY4742 genetic background as follows: PHO8 was amplified by PCR using the PHO8 XmaI forward primer (5′-GCACCTGCAATCCCGGGAAATCTCAAC-3′) and the PHO8 XmaI reverse primer (5′-CTTTAAGTCCCGGGATCATTCTTTAAAG-3′) and cloned into XmaI-digested pFL39. Then, the HIS3 gene was amplified by PCR using the HIS3 StuI forward primer (5′-GATCCGCTGCACAGGCCTGTTCCCTAGC-3′) and the HIS3 ApaI reverse primer (5′-TACCACCAGAAGGGCCCTTAGATCTGC-3′) and cloned within PHO8 gene in a StuI/ApaI-digested pFL39-PHO8 plasmid. The PHO8-HIS3 disruption fragment was amplified by PCR using the PHO8-HIS3 forward primer (5′-GGGAAATCTCAACAGTCTCTTACTG-3′) and the PHO8-HIS3 reverse primer (5′-CTTTAAAGAGGAAAAGGGTACCTCC-3′), and BY4742 cells were transformed with PHO8-HIS3 disruption fragment.
For DPL1 disruption, the DPL1 gene was deleted in the BY4742 genetic background following the same principle as for PHO8 disruption. DPL1 was amplified by PCR using the DPL1 NotI forward primer (5′-ATATATACCGGGCGGCCGCATCGGG-3′) and the DPL1 ApaI reverse primer (5′-CGTTCCTGTTCGGGCCCTTTAATA-3′), and cloned into NotI/ApaI–digested pRS314 plasmid. The HIS3 gene was amplified by PCR using the HIS3 XmaI forward primer (5′-GCAATTTCTACCCGGGTTCAGCAAC-3′) and the HIS3 XmaI reverse primer (5′-GGCACTCCCGGGTTTTCCTCTTAAG-3′) and cloned within the DPL1 gene in the pRS314-DPL1 plasmid. Then, the DPL1-HIS3 disruption fragment was amplified by PCR using the DPL1-HIS3 forward primer (5′-ATTGGTATATTTTCAGTACAC-3′) and the DPL1-HIS3 reverse primer (5′-TTTAATAACTTGATGGCAATG-3′) and BY4742 cells were transformed with the DPL1-HIS3 disruption fragment. For pESC-HIS3-PSD1 making, the PSD1 gene was amplified by PCR using the PSD1 NotI forward primer (5′-CAAAAAGAAGCGGCCGCCTTGGACTATAAG-3′) and the PSD1 ClaI reverse primer (5′-CATTTTAAATCAATCGATCCAATTATGCCTAATTTC-3′) and cloned in pESC-HIS3 plasmid. For making pESC-HIS3-mtPSD2-V5, the mitochondrial-targeting sequence (MTS) of the COXIV gene was cloned into pESC-HIS3 plasmid using the COXIV-MTS BamHI forward primer (5′-TCCCTGTCAGGATCCTTTAGTCAA-3′) and the COXIV-MTS ApaI reverse primer (5′-ACGGGTTGGGGCCCAAGCAGATAT-3′). Then, the PSD2 gene was cloned upstream of the COXIV-MTS sequence in pESC-HIS3 with the COXIV-MTS-PSD2 ApaI forward primer (5′-TGGTAAAGAATCCTCGATTTTCAGGAGCATCCAACGACGGGGCCCAGGATTATTAAGGGCAGAAAGCGAG GCAAGAACAAGAAG-3′) and the COXIV-MTS-PSD2 XhoI reverse primer containing the V5 tag sequence (5′-GCTTCACTCGAGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTTCGAAGGGTAGCCCAGCAAAATCTTTAT-3′). For making pESC-HIS3-PSD2-V5, the PSD2 gene was cloned into pESC-HIS3 using the PSD2-V5 ApaI forward primer (5′-TGGTAAAGAATCCTCGATTTTCAGGAGGGGCCCACGACGAAGATGAGGATTATTAAGGGCAGAAAGCGAGGCAAGAACAAG-3′) and the COXIV-MTS-PSD2 XhoI reverse primer containing V5-tag sequence (5′-GCTTCACTCGAGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTTCGAAGGGTAGCCCAGCAAAATCTTTAT-3′).
Preparation of protein extracts and western blotting
For preparation of total protein extract, 2×107 cells were harvested by centrifugation, washed with water and resuspended in 450 µl of water and 50 µl of lysis buffer (1.85 M NaOH, 3.5% β-mercaptoethanol). After 10 min on ice, 50 µl of 3 M trichloroacetic acid was added followed by another incubation of 10 min on ice. Proteins were pelleted by centrifugation (13,000 g for 8 min), washed with acetone and resuspended in 20 µl of 5% SDS and 20 µl of loading buffer (2% β-mercaptoethanol, 2% SDS, 0.1 M Tris-HCl pH 8.8, 20% glycerol, 0.02% Bromophenol Blue). Samples were boiled for 5 min and 50 µg of proteins were separated by electrophoresis on 12.5% SDS-PAGE gels and subjected to immunoanalysis with either anti-GFP antibody (1:5000, cat no. 11844460001; Roche), anti-Pgk1 antibody (1:5000, cat no. 459250; Invitrogen) or anti-porin antibody (1:5000, cat no. 459500; Invitrogen). Detection was performed with ECL+ reagent (Perkin Elmer) and western blot quantifications were undertaken using ImageJ Software (NIH). For preparation of cell lysates, 5×107 cells were broken with glass beads in buffer containing 0.6 M mannitol, 5 mM MES pH 6; lysates were centrifuged for 10 min at 800 g. The supernatants were loaded on 10–60% OptiPrep™ density gradients in buffer with 5 mM MES pH6, 5 mM EDTA, 10 mM NEM plus protease inhibitor cocktail (Roche).
Alkaline phosphatase activity was measured on various Δpho8 strains expressing the mitochondrial-targeted truncated version of Pho8, mtPho8Δ60, during the exponential phase of growth or after 6 h of nitrogen starvation. For each point, five OD600nm of cells expressing mitochondrial-targeted Pho8Δ60 (mtPho8Δ60) were harvested and lysed with glass beads into lysis buffer (20 mM PIPES, 0.5% Triton X-100, 50 mM KCl, 100 mM potassium acetate, 10 mM MgCl2, 10 µM ZnSO4 and 2 mM PMSF). After centrifugation (800 g for 15 min), 20 µl of supernatant was put with 80 µl of water and 400 µl of activity buffer (250 mM Tris-HCl pH 8, 0.4% Triton X-100, 10 mM MgCl2, 10 µM ZnSO4, 125 mM p-nitrophenyl-phosphate) for 20 min at 30°C. The reaction was stopped by the addition of 500 µl of 1 M glycine pH 11. Activity was then measured by determining the optical density at 400 nm. Protein concentration was measured with the Lowry method (Lowry et al., 1951). ALP activities are expressed as arbitrary fluorescence units/min/mg protein (AU/min/mg).
Mitochondria purification and density gradient centrifugation analysis
Cells were harvested (5000 g for 5 min) and washed three times with water and incubated for 15 min at 28°C in a pre-incubating buffer (0.5 M β-mercaptoethanol, 0.1 M Tris-HCl pH 9.3). After three washes with Tris-HCl KCl buffer (10 mM Tris-HCl pH 7, 0.5 M KCl), cells were digested in digestion buffer (1.35 M sorbitol, 10 mM citric acid, 30 mM Na2HPO4, 1 mM EGTA, zymolyase 20T at 20 mg/g of dry weight). Spheroplasts were washed twice in isotonic buffer [0.75 M sorbitol, 0.4 M mannitol, 10 mM Tris-maleate, 0.1% bovine serum albumin (BSA), pH 6.8] and resuspended in homogenization buffer (0.6 M mannitol, 10 mM, Tris-maleate, 2 mM EGTA, 0.2% BSA, pH 6.8). Spheroplasts were broken using a blender. Unbroken spheroplasts and heavy cell compartments were pelleted by centrifugation at 700 g for 10 min, and the supernatant was centrifuged for 10 min at 12,000 g. The pellet was resuspended in the final buffer (0.6 M mannitol, 2 mM EGTA, 10 mM Tris-maleate, pH 6.8), centrifuged at 700 g for 10 min, and the supernatant was centrifuged at 12,000 g for 10 min to pellet mitochondria. Then crude mitochondrial extract was resuspended in the final buffer with anti-proteases (Roche, cat no. 11836170001) and 1 mg of proteins were loaded on a 20–60% continuous sucrose gradient and centrifuged overnight at 134,000 g. Then fractions were collected and analyzed by western immunodetection analyses using anti-GFP antibody, anti-porin antibody, anti-Pgk1 antibody (all as above), anti-Dpm1 antibody (1:5000, cat no. A6429; Life Technologies).
500 μg of mitochondria were resuspended and incubated in 100 μl of cold 0.1 M Na2CO3 (pH 11.0) or 0.1% TX-100 for 30 min in ice. The suspensions were ultra-centrifuged at 4°C for 15 min at 90,000 g. Then, supernatants and pellets were incubated in 500 μl of 12.5% trichloroacetic acid for at least 15 min in ice, followed by centrifugation for 15 min at 20,000 g at 4°C. The samples were washed with 500 μl of acetone and dried for 5 min at room temperature. Then, the pellet was resuspended in 40 µl of Laemmli buffer and analyzed by SDS-PAGE.
To extract lipids from isolated mitochondria, 2 ml of chloroform:methanol (2:1, v/v) was added to 500 µg of mitochondria. Following vigorous shaking and centrifugation, the organic phase was put aside, and the aqueous phase was washed again with 2 ml of chloroform. The combined organic phases containing lipids were dried and redissolved in 200 μl chloroform:methanol (2:1, v/v) and 800 µl of ether solution. The suspension was incubated 1 h at −20°C and dried. Next, extracts were resuspended in 30 µl MeOH-HCCl3 (1:2, v/v) and the lipids were separated by one-dimensional high-performance thin-layer chromatography (TLC) using 20×20 cm TLC plates. Migration buffer was prepared as follows: chloroform:methanol:1-propanol:methyl acetate:0.25% aqueous KCl (28:10:25:25:7, v/v/v/v/v). Then, the plates were dried and lipids were visualized with 8% phosphoric acid in 3% copper acetate buffer. Lipid identity was based on the mobility of known standards. Quantification was performed with ImageJ.
Video microscopy on cells expressing Ilv3–dsRed and GFP–Atg8 proteins was carried out with Leica DMI6000B Video-spinning-disk-FRAP microscope with Photometrics Quantem 512 EMCCD camera. For vacuole staining, cells were incubated for 1 h with 40 µM FM4-64 and observed with a Leica DMI8 Video-microscope equipped with a large field, highly sensitive ORCA-Flash 4.0 v2 digital CMOS camera from Hamamastu. Microscopes are located in the Bordeaux Imaging Center (BIC). Images were deconvoled using a DeconvolutionLab plugin developed for ImageJ software (NIH) (Sage et al., 2017).
Electron microscopy and immunoelectron microscopy
For electron microscopy experiments, cells were grown in the presence of 1 mM PMSF. Harvested cells were placed on the surface of formvar-coated copper grids (400 mesh). Each loop was quickly submersed in liquid propane (−180°C) and transferred to a precooled solution of 4% osmium tetroxide in dry acetone at −82°C for 48 h for substitution/fixation. Samples were gradually warmed to room temperature, and washed in dry acetone. Specimens were stained for 1 h with 1% uranyl acetate in acetone at 4°C, rinsed and infiltrated with araldite (epoxy resin, Fluka; ref. 10951-1L). Ultra-thin sections were stained with lead citrate. Observations were performed on a Philips Tecnai 12 Biotwin (120 kV) electron microscope.
For immunoelectron microscopy, the loops were transferred into a precooled solution of 0.1% glutaraldehyde in dry acetone for 3 days at −82°C. Samples were rinsed with acetone at −20°C, and embedded progressively at −20°C in LR Gold resin (EMS, USA). Resin polymerization was carried out at −20°C for 7 days under UV illumination. Ultrathin LR Gold sections were collected on nickel grids coated with formvar. Sections were first incubated for 5 min with 1 mg/ml glycine, and for 5 min with fetal calf serum (1:20). The grids were incubated 45 min at room temperature with goat anti-Atg8 monoclonal antibody (1:100, cat. no. Sc15639, Molecular Probes) rinsed with Tris-buffered saline (TBS) containing 0.1% BSA and then incubated for 45 min at room temperature with anti-mouse- or anti-rabbit IgG conjugated to 10 nm gold particles (BioCell). The sections were rinsed with distilled water, and contrasted through a 5 min incubation with 2% uranyl acetate in water, followed by 1 min incubation with 1% lead citrate. Observations were performed on a Philips Tecnai 12 Biotwin (120 kV) electron microscope.
P-values were calculated using unpaired Student's t-tests; P<0.05 was considered statistically significant.
We thank Drs Sagot, Klionsky and Abeliovich for the gift of strains and material, Fabrice Cordelières for his help with deconvolution and fluorescence image analyses, and Eric Testet and Amélie Bernard for technical help and fruitful discussion.
Methodology: N.C.; Validation: N.C.; Investigation: P.V., E.C., B.S., C.B., N.C.; Writing - original draft: N.C.; Writing - review & editing: P.V., I.B.-K., N.C.; Visualization: P.V.; Supervision: I.B.-K., N.C.
The work in the laboratories of the authors was supported by grants from the Slovak Academic Information Agency (SK-FR-2015-0005) (to I.B.-K.), the Centre National de la Recherche Scientifique (CNRS), the Université de Bordeaux and the Doctoral International Program from IDEX of Bordeaux supported by Agence Nationale pour la Recherche (ANR-10-IDEX-03-02) (to N.C. and P.V.). The France–Slovakia collaboration was supported by Campus France (Stefanik no. 35809VC) (to N.C. and I.B.-K.).
The authors declare no competing or financial interests. | <urn:uuid:abf9c966-0e42-4183-b119-82e34c7d5ff7> | CC-MAIN-2022-33 | https://journals.biologists.com/jcs/article/132/1/jcs221655/37/The-mitochondrial-phosphatidylserine-decarboxylase | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.915798 | 11,597 | 2.9375 | 3 |
Call for Participants - IPYET 2012
The Commonwealth Youth Programme (CYP) and the International Labour Organization (ILO) in collaboration with the Zambia Ministry of Labour and Social Security (MLSS), the Ministry of Sports, Youth and Child Development (MSYCD), and partners are organizing an international training workshop on “International Perspectives in Youth Entrepreneurship Training” IPYET 2011. The workshop, is designed as an annual intensive trainer-of-trainers programme in youth entrepreneurship training. The workshop is expected to share experiences in youth entrepreneurship training in countries and introduce participants to contemporary materials, techniques and approaches developed in the field.
There are several manuals, tools, models, frameworks, and approaches in training young people in entrepreneurship. Several questions however arise –
how relevant do young people consider these; how effective and efficient are these trainings; what worked, what didn't, and what lessons were realized; are these workshops really youth centred or are they just entrepreneurship training?
These and many more are unending questions underlying the need for such an international workshop. This workshop is an attempt to find answers to some of these questions.
The Commonwealth will showcase several models in the area of small business financing, advocacy towards creating an enabling environment for youth enterprises and Business Development Services (BDS). Models such as Start and Improve Your Business (SIYB), SCREAM™ Child Labour Tools, WEDGE, and Gender and Entrepreneurship Together (GET Ahead), from the ILO will be showcased. Several other approaches from ILO, CYP, UNIFEM, GTZ, UNDP, Junior Achievement, the IMF, World Bank, and UNICEF among others will be presented during this training programme. A unique component of this programme is its focus on “participants' facilitation”. The programme is flexible and experiential. All participant co-facilitate various sessions and their own country/project experiences come to bare in shaping the learning experiences for the group.
By the end of the programme participants would be able to:
- Describe good practices in the field of youth entrepreneurship training
- Use new materials, techniques, and approaches in their youth entrepreneurship training programmes
- Explore further information on sources of youth entrepreneurship training materials and techniques
- Design, implement, and evaluate sustainable Youth Entrepreneurship programmes
The workshop is targeted at youth development practitioners, social development programmers, enterprise mentors, trainers and academia. The workshop will accommodate a maximum of 30 participants. Participants are expected to have minimum of an academic degree with at least 1 year experience in youth work, or a diploma with at least 3 years experience in youth work.
Participants' profiles include:
- Youth Officers working with Ministries responsible for youth, National Youth Councils, Youth Resource Centres, etc.;
- Officers and trainers with enterprise and entrepreneurship training centres;
- Youth development practitioners and programmers;
- Policy officers and planners working in the area of Youth Employment
- Staff of NGOs, CSOs, and International Organizations with a focus on youth employment/entrepreneurship;
- Academics, etc.
Workshop Language and Dates
This programme will be conducted in English as follows:
- Online Training (internet access required) – 31st January to 25th March 2011
- Residential Programme – 15th April to 24 April 2011 in Zambia.
Visas and Travel Support
Not all nationalities may require a visa prior to entering Zambia. The organisers will provide support letters for visa applications upon request. Visa fees are at least US$50. All participants will be responsible for covering any visa related fees.
Participants' Fees and Other Costs
|A:||Tuition and Materials||$1,300|
|C:||Board/Dinner and Incidentals||$300|
*Tuition and materials include the cost of the tuition, resource and learning packs, as well as lunch during workshop days. The costs indicated here do not include costs of airfares/transport to and from Zambia, and travel documents and visa fees if applicable.
~Figures for Board and Incidentals are estimates only. If paid to the programme account, it will be refunded at the start of the workshop in Zambian Kwacha equivalent. You can calculate the prevailing exchange rates using the Currency Converter
Getting Financial Support
The CYP Regional Centre for Africa (CYPRCA) and the ILO Lusaka Office for Zambia will offer partial bursaries to some participants upon application. Bursaries may cover only (A) tuition and materials and/or (B) Lodging. Bursaries will NOT cover allowance. Bursary recipients/organizations are expected to cater for their own travel to and from Zambia, dinner, and local upkeep (C). Bursary applicants should indicate their request for a bursary and fill the motivation page on the nomination form and submit to firstname.lastname@example.org
Deadline for applications for bursaries is 26th August 2011. Successful applicants will be notified by 26 September 2011.
About the Organisers
The Commonwealth Youth Programme (CYP) is an intergovernmental organisation of the Commonwealth Secretariat, working to integrate young people into national development. Founded in 1974, the CYP has for over three decades provided a range of services to young men and women, youth workers, NGOs and national governments in the four regions of the Commonwealth. The CYP operates from four regional centres located in Zambia (for Africa), India (for Asia), Guyana (for Caribbean), and Solomon Islands (for Pacific). Youth Enterprises and Sustainable Livelihoods (YESL) is one of three strategic programme areas of the CYP. The programme promotes a sustainable livelihoods approach to youth employment in the Commonwealth by stressing on the need for young people to become job-creators (youth entrepreneurs) instead of merely job-seekers. ...more
The International Labour Organization (ILO) is the tripartite UN agency that brings together governments, employers and workers of its member states in common action to promote decent work throughout the world. The International labour Organization (ILO) Lusaka office Youth Employment Project (YEP) addresses two different levels of activities, both of which are essential in creating more and better employment for young people. The programme concentrates on creating an enabling environment with regard to youth employment and support for National Action Planning. The programme also pilots innovative approaches to decent employment and entrepreneurship for young women and men based on international good practices and related to the needs of and potential of the economies of countries, as well as targeting sectors economic sectors holding potential for decent employment, self-employment and enterprise development for young people.
Workshop Follow-up Arrangements
Participants are expected to develop action plans for enhancing current youth entrepreneurship training programmes in their countries. CYPRCA, ILO, and partners will provide a 07-month virtual technical advisory support and Business Development Services (BDS) for implementation and evaluation of learning from this training programme.
The venue for this year's residential workshop is once again, the Lake Safari Resort. Set on the banks of the Kariba Lake, and fed by the mighty Zambezi river, the resort is Zambia’s premier conferencing destination. A wireless LAN hotspot and 24 HR Broadband Internet enables delegates to have plenty of free online access.
Lake Safari Lodge Siavonga,
P. O. Box 33565, Lusaka, ZAMBIA
Tel: +260 211 511148/511024
Email: Website: email@example.com | <urn:uuid:b247cc43-0c27-4795-b6e9-0bdcf48469fe> | CC-MAIN-2022-33 | https://wikieducator.org/Ipyet/About | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.917021 | 1,629 | 1.804688 | 2 |
Armorer courses are structured to provide each student with a practical understanding of the operation, critical parts gauging, and features of the class titled Firearm.
This two day class is a mixture of classroom instruction, hands-on operation and on-range live-fire, enabling each student to achieve a high degree of familiarity with the topics covered and running the firearm efficiently.
You will gain proficiency in the following areas: Cleaning, maintain, gauging, repair, build, and/or modify the specific platform. We will go over disassembly, reassembly, identification of mechanical deficiencies and corrective actions, so you will walk away knowing your firearm is reliable.
Topics Covered: + Basic operation and function + Design + Interaction of parts including safeties and fire control group + Proper safety checks + Disassembly & Assembly + Inspection of parts for excessive wear + Head Space + Maintenance and lubrication + Gauging and checking critical areas + Modification / Customization + Compatibility + Troubleshooting + Theory
The end of Day 2 will be on the range checking all operational functions and test firing the platform. Please bring at least 50 rounds of ammunition and two magazines, along with a cleaning kit and lunch for each day.
Armorers course certificate and manual is provided to the student to keep. All associated tools will be provided to work on specific platforms. | <urn:uuid:1b641034-7b7e-4be3-8124-213c40c8b80f> | CC-MAIN-2022-33 | https://cerberus-training.com/collections/armorer-classes | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.89446 | 276 | 2.140625 | 2 |
Vaccine passports could be as simple as a phone app and could be used to prove who has received the COVID-19 vaccine — and who hasn’t.
Florida Gov. Ron DeSantis said that passports aren’t welcome here in the Sunshine State.
That means you won’t have to prove you have been vaccinated when going to a government owned building or property. However, that doesn’t cover businesses or open events.
For privately owned businesses, legal experts said the executive order doesn’t apply to them.
“A private entity is entitled to do that, and a private business can have restrictions,” said Pamella Seay, a Florida Gulf Coast University Law Professor.
Some local business agree that corporate vaccine passports could be harmful.
“It’s more like segregation. What are they going to do, segregate us? The ones that don’t do it, the ones that do do it,” said Alex Nelms, the owner of Hippie Trippy, an ice cream shop in Fort Myers.
However, Seay said there are exceptions to business protections.
The rules change for public venues. Seay said people shouldn’t expect to show proof of vaccination everywhere they go.
“If it’s a private venue and a private event, yes, you can make that requirement,” she said. “But if there’s a public aspect to it no, you cannot.”
That means the ice cream shop, a restaurant or even a bar could require proof of vaccination.
Public places like a baseball stadium or concert arena would have to abide by the governor’s order.
“I personally don’t have a problem with it, but I could see the majority of people having a problem with it,” said Wendy Gravelle, who’s visiting SWFL with her family from Wadena, Minnesota.
Some states, like New York, giving vaccine passports a test run.
Across the U.S., Seay said vaccine passports have an uphill battle against personal privacy.
“Ordinarily your medical records are meant to be private. If we have a vaccination passport, all of a sudden that information is going to be made public,” she said. “Based on my initial observations, I would say that no, this would not become a requirement.” | <urn:uuid:b6f9e18f-b887-4779-a396-dd303c6ef8c4> | CC-MAIN-2022-33 | https://nbc-2.com/news/2021/03/29/anti-vaccine-passport-order-would-not-impact-private-businesses-experts-say/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.963377 | 508 | 1.867188 | 2 |
15 Airports That Offer “Rehearsal Programs” for Individuals With Autism
Flying. It’s something we take for granted these days. 40 or 50 years ago flying was an experience. You prepared for it, you wore nice clothes, you told all your friends that you would flying on an airplane, It was an event. Today… Not so much. Flying is almost as pedestrian as taking a bus ride. No more fun or excitement, just part of the routine. For children with autism and other special needs Flying is still an event. The change in routine, the noise, the unfamiliar surroundings, the crowds all contribute to an overwhelming and overstimulating experience that can cause some major meltdowns. Flying Rehearsal Programs: Taking a child with autism on a plane requires some advanced planning and preparation. Thankfully there are now programs in place at many airports that that provide children with autism a flying experience without ever lifting off the ground. Participants pack their bags, ride to the airport, pass through security, and continue through the whole flying process including boarding, “flying” and deplaning. | <urn:uuid:37e26737-2271-4304-8975-292d4296bc3b> | CC-MAIN-2022-33 | https://www.t-guide.eu/?i=t-guide.en.links.1672 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.95839 | 227 | 1.664063 | 2 |
Cao Shen 曹參 [not Cao Can!] (died 191 BCE) was a counsellor or emperor Han Gaozu 漢高祖 (r. 206-195 BCE), the founder of the Former Han dynasty 前漢 (206 BC-8 CE). He hailed from the district of Peixian 沛縣 and served as jail warden (yuyuan 獄掾) of the Qin dynasty 秦 (221-206 BC).
In 209 he became follower of Liu Bang 劉邦, the eventual Han Gaozu, in his rebellion against the Qin dynasty. He remained loyal to Liu Bang is his fight against the hegemonial king Xiang Yu 項羽 and served him first as palace receptionist (zhongjuan 中涓), then as left and later as right Counsellor-in-chief (zuo/you chengxiang 左/右丞相).
After the accession of Liu Bang to the imperial throne in 202, Cao Shen was made administrator (xiang 相) of the kingdom of Qi, that was the territory of Han Xin 韓信, and later of Liu Fei 劉肥 (posthumous name Qi Daohuiwang 齊悼惠王), a son of Emperor Gaozu. In 201 Cao Shen was ennobled as Marquis of Pingyang 平陽侯.
Cao Shen remained administrator of Qi after the succession of Emperor Hui 漢惠帝 (r. 195-188 BCE) to the throne. In this position he assembled Daoist scholars (better: adherents of the Huang-Lao school 黃老術) of the region of Qi (modern Shandong) to learn how to exert a benevolent government. He teachings of Master Gai 蓋公, for example, included the art of ruling without action (wuwei 無爲).
In 193 Cao Shen succeeded Xiao He 蕭何 as Counsellor-in-chief of the empire. Continuing with a policy of non-action and did not change or expand the regulations Xiao He had issued. Loyalty was for him a more important character of a state official than the ability to dispute. Cao Shen was known for his love for banquets. When Emperor Hui asked him why he did not exhibit a more active stance in governing the state, Cao Shen answered that Emperor Gaozu and Xiao He had already appeased the empire and settled all affairs. Overhasty activity was, according to Daoist teaching, a characteristic of inappropriate change of the nature of things (the dao) and would only lead to disaster. Legislative activity was contra-natural and would initiate the downfall of a dynasty, as the example of the legalist Qin dynasty had shown. The first decades of the Han dynasty are therefore generally seen as an age of prevalent Daoism. The economical recovering of the country seemed to prove that this kind of policy was correct.
Cao Shen was given the poshumous title of Marquis Yi of Pingyang 平陽懿侯. | <urn:uuid:2c994dde-fa38-4459-aee1-cf6630d9f6f0> | CC-MAIN-2022-33 | http://www.chinaknowledge.org/History/Han/personscaoshen.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.973983 | 689 | 2.359375 | 2 |
Our Philadelphia medical misdiagnosis lawyers realize that not every misdiagnosis is an example of medical malpractice. If a reasonably competent doctor would have made the same diagnosis after seeing the same patient and analyzing symptoms, there is no evidence of negligence. The doctor was simply following protocol and diagnosing a condition as other physicians would. Medical misdiagnosis is one of the most common types of malpractice. Despite years of education, hands-on experience, and ample training, physicians can still make errors in judgment when it comes to diagnosing a patient’s condition or disease. These errors often stem from negligence – a doctor’s incompetence, distraction, or carelessness during a patient visit. If someone else’s negligence led to a harmful misdiagnosis, speak to the med mal lawyers at Anapol Weiss in Philadelphia.
A successful medical malpractice lawsuit can compensate you for your medical expenses, pain and suffering, emotional distress, lost wages, lost quality of life, and other economic and non-economic damages. We know a medical misdiagnosis lawsuit won’t erase the wrongs a doctor committed against you. However, we hope the settlements and judgments we secure for those who come to us for help will ease the situation in some way. To discuss your case in more detail, (866) 735-2792 or contact us online.
The Dangers of Medical Misdiagnosis
Misdiagnosis can be detrimental to a patient’s health, prognosis, and survival rate. Depending on the illness or disease, a patient’s future can hinge on the doctor’s ability to quickly and accurately diagnose the issue. Most cancers, for example, rely on early diagnosis for recovery. Mistaking the symptoms of cancer for something less serious can result in delays in treatment, and potential drops in the likelihood of survival.
If a doctor misdiagnoses a patient, it can also lead to improper medical care. A patient may receive a prescription for headaches, for example, when the underlying problem is a brain tumor. This prescription will prove ineffective to treat the real cause of the patient’s symptoms. While the patient wastes time on treatments for the wrong problem, the tumor can grow and the patient may lose his/her chance of beating cancer.
At the same time, a misdiagnosis of cancer when a tumor does not exist can result in a patient undergoing significant medical procedures such as surgeries, chemotherapy, and radiation treatments. Misdiagnosis can cause considerable emotional distress and psychological damage, depending on the circumstances. A false diagnosis of cancer, for instance, can cause unnecessary anguish to an individual and his/her family.
Misdiagnosis and Medical Malpractice
Misdiagnosis often stems from some form of malpractice. A doctor may not listen to a patient’s complaints, downplay the severity of symptoms, fail to order the appropriate tests, or interpret the test results incorrectly. Any of these errors can lead to a harmful or even fatal misdiagnosis. It is a doctor’s responsibility to take due care while diagnosing a condition and to act within the accepted standards of the field.
Misdiagnosis can cause a variety of physical, emotional, psychological, and financial damages. From unnecessary procedures to missed opportunities for treatment, there are many ways a mistaken diagnosis can harm a patient. The wrong type of medication – or no treatment at all – can even lead to wrongful death. No matter what type of harm you suffered due to a medical misdiagnosis, learn your rights in the Pennsylvania courts.
Seek Help from Our Philadelphia Misdiagnosis Lawyers
With free consultations with the attorneys at Anapol Weiss, you can find out if your case has merit at no charge or obligation to our firm. You may benefit immensely from speaking with our team about you or a loved one’s medical misdiagnosis. You may discover malpractice played a part in the error, and that someone might be liable for your damages. | <urn:uuid:4bbb5f50-3737-42ff-8b9d-fcca6200ee62> | CC-MAIN-2022-33 | https://www.anapolweiss.com/practices/medical-malpractice/medical-misdiagnosis/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.92383 | 823 | 1.664063 | 2 |
BECS 2022 – 2nd International Workshop on Big data driven Edge Cloud Services
A guide for quantum web services deployment
Jaime Alvarado-Valiente, Javier Romero-Álvarez, José García-Alonso and Juan M. Murillo
The Quantum Computing paradigm is emerging to address problems that classical computers cannot reach. To the point that it is already generating interest in the scientific and industrial communities. In this tutorial we will offer an introductory view on how quantum algorithms can be integrated with classical web engineering solutions. Specifically, we will show how to encapsulate quantum algorithms into web services, how these web services can be deployed (using the Amazon Braket platform for quantum computing), and invoked through classical web services endpoints. Additionally, we will show a way to address some of the current limitations of quantum computers in terms of web services using a Quantum API Gateway. Participants will get an overview of this approach and will understand how quantum web services may become a valuable part of future ecosystems. To follow the hands-on part of this tutorial, a laptop with a text editor, a Python installation and an Amazon Web Services account would be needed. You can find a guide with the steps to follow to prepare the environment at this link. | <urn:uuid:04e11816-03e6-478c-ab51-bb40ad7697f6> | CC-MAIN-2022-33 | https://icwe2022.webengineering.org/a-guide-for-quantum-web-services-deployment/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.859802 | 255 | 1.796875 | 2 |
A good buy used to mean consumers making the choice to invest in a good product. But what happens when good isn’t good enough? In the 21st-century, the way to the heart of the modern customer is through appealing to their values. No greater industry than fashion showcases this notion the most — millennials and members of the Gen-Z generation are choosing to wear their hearts on their sleeves, literally. Retailers are obliged to reflect the thinking of their consumers through sustainability initiatives or else lose out.
UNRESERVED speaks to Shasha Ahmad, Category Manager at ZALORA Malaysia and she describes modern-day shopping tribulations: ‘With an abundance of brands and offerings… consumers have greater freedom to choose their preferred products. Brands are now being evaluated beyond their products, it is important for organisations to recognise the evolving needs of a consumer and they now want their things to align with their identity.’ It is clear that the modern consumer has access to a wide range of products and the dialogue has undoubtedly shifted. We now shop with two questions in mind. The first is what does this product stand for? and the second: what am I signalling to other people if I carry this product around?
How are retailers answering these questions?
Shasha reveals in a survey conducted by ZALORA in 2020, 90% of participants presented some level of interest in sustainability products while 50% of consumers were willing to pay a premium price for products that aligned with their personal values. Thus ZALORA is very much aware that their customers are forward-thinkers and she tells of the organisation’s approach, “We strive to build on our sustainability offerings. From launching our sustainable capsule collection to releasing a special edit of all of our products that meets the sustainability criteria… we are constantly working to meet the demand of customers.”
It becomes obvious that in the modern age, aligning with consumers is simply better for business. More and more of Gen Z are entering the workforce and elevating their spending power. As one of the biggest e-commerce players in the region, it is ZALORA who must give conscious consumerism a great push. One achievement Shasha notes is localising this issue through collaborations with local designers like Jovian Mandagie and Rizalman. As head of the modest-wear category, Shasha leads a team of ten people and they are tasked to bring sustainability and modest wear together. Localising sustainability is an effort to bring the conversation to a Malaysian level.
Despite having a myriad of initiatives related to being environmentally-friendly, Shasha notes that navigating in a diverse and ever-evolving region like Southeast Asia can be difficult, stating that a ‘one-size-fit-all solution does not work’ and calls their work in relating their offerings back to the local landscape is ‘crucial.’ Although there is demand, through evidence that their consumers are interested in the sustainable conversation, it must go beyond collaborations or usual sustainability efforts like transparency or worrying about their carbon footprint.
It seems obvious to the modern consumer: why support a brand financially if their social and environmental values aren’t agreeable? This is true but we are now at the point of the conversation where we are able to face the consequences of our shopping habits. What must happen is retailers must catch up with offering consumers substantial and dynamic initiatives while not harming the environment. Without a plan, they’ll be left in the dust. | <urn:uuid:f0b1dcd6-e4cc-416c-935d-bcfa1d0c6854> | CC-MAIN-2022-33 | https://www.unreservedmedia.com/conscious-consumers/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.959034 | 713 | 1.851563 | 2 |
Fergus Ewing has stepped down from his role as Cabinet Secretary for Rural Economy and Tourism in Scotland following five years in post. During his tenure, Mr Ewing has been a strong advocate for the forestry sector and has established its importance to not just the rural economy, but Scotland’s economy as a whole. The Institute pays tribute to his work and wish him all the best in future endeavours.
Announced as part of First Minister Nicola Sturgeon’s cabinet reshuffle, Mairi Gougeon will take up the role of Cabinet Secretary for Rural Affairs and Islands. A former Minister for Rural Affairs and the Natural Environment (2018-2020), Ms Gougeon most recently served as Minister for Public Health and Sport.
Supporting Ms Gougeon as the new Minister for Environment, Biodiversity and Land Reform, is the newly-elected Mairi McAllan and former special adviser to the First Minister on environment, climate change, land reform and renewable energy policy. Ms McAllan will be responsible for forestry and woodlands, including Forestry and Land Scotland, Scottish Forestry and Forest Research, land reform and land use, natural resources, peatland and flooding.
The Institute’s Executive Director, Shireen Chambers MBE FICFor, welcomes the opportunity to work alongside Ms McAllan to address the skills shortage in forestry given the sector’s vital contribution to both the economy and tackling the climate emergency. | <urn:uuid:3acb11df-8c36-448b-b099-d3aeefdeef62> | CC-MAIN-2022-33 | https://www.charteredforesters.org/new-scottish-cabinet-secretary-appointed-for-rural-affairs-and-islands | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.961185 | 293 | 1.570313 | 2 |
We are searching data for your request:
Upon completion, a link will appear to access the found materials.
Doctors in the United States recommend that people with mild cognitive impairment do sports
A new policy for doctors in the United States states that patients with mild cognitive impairment should exercise twice a week. Training improves memory and thinking. So older people should do sports instead of getting medication if they have memory problems.
The American Academy of Neurology experts found that people with mild cognitive impairment should do physical exercises twice a week to improve their thinking and memory. The researchers published the results of their study in the journal "Neurology".
Exercise helps the body and mind
It has long been shown that regular physical activity has a positive impact on health. Now we can say that exercise can also help improve memory in people with mild cognitive impairment, explains author Dr. Ronald Petersen. Experts thought that what is good for the heart could also be good for the brain and examined the effects of sport on thinking and memory.
What are mild cognitive impairments?
Mild cognitive impairment is an intermediate stage between the normal cognitive decline in aging and the strong cognitive decline in dementia. Symptoms that occur can include problems with memory, language, thinking, and judgment that are more severe than with normal age-related changes. In general, these changes are not serious enough to significantly affect daily life and activities, the researchers say. However, mild cognitive impairments can increase the risk that those affected will later develop dementia, which is caused by Alzheimer's or other neurological diseases.
Already two training units per week protect against mental degradation
The updated recommendations for mild cognitive impairments were developed after reviewing all available studies. Studies over a period of six months showed that training sessions twice a week can help people with mild cognitive impairment to cope with their symptoms.
At best, you should do 150 minutes of exercise a week
Dr. Petersen encourages people to do aerobic exercise. But brisk walking and jogging also have positive effects. No matter which exercise you choose, try to spend 150 minutes a week doing exercise. For example, five workouts that last 30 minutes or three workouts that last 50 minutes. The amount of effort should be enough to make you sweat a little, the expert advises. Exercise can slow the rate at which mild cognitive impairment eventually turns into dementia.
Can cognitive training improve cognitive functions?
So-called cognitive training also seems to help people with mild cognitive impairments. Such cognitive training uses repetitive memory and reasoning exercises, the researchers explain. There is weak evidence that cognitive training can improve cognitive functions, the authors say. The experts did not recommend a change in diet or the use of medication. There are no mild cognitive impairment drugs available from the U.S. Food and Drug Administration are approved, explain the doctors.
How common are cognitive disorders?
More than six percent of people between the ages of 60 and 70 around the world have mild cognitive disorders, the researchers report in a press release from the American Academy of Neurology. The older people get, the more common this problem becomes. Over the age of 85, more than 37 percent suffer from mild cognitive disorders. With such a prevalence, discovering lifestyle factors that slow the rate of cognitive impairment can make a big difference for individuals and society, says Dr. Petersen.
The process of aging can be delayed
"We don't have to consider aging as a passive process, we can do something about the aging process," added the expert. So if a cognitive impairment would normally occur at the age of 72, this can be delayed by physical training. For example, cognitive impairment only occurs at the age of 75 or 78. This is a big difference. (as) | <urn:uuid:33c04713-de8e-40ad-821c-78720ed98da3> | CC-MAIN-2022-33 | https://tt.j2gmn.com/8664-does-sport-offer-protection-against-dementia.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.949828 | 749 | 2.9375 | 3 |
2022/23 Undergraduate Module Catalogue
MATH3211 Metric and Function Spaces
15 creditsClass Size: 68
Module manager: Dr Vladimir Kisil
Taught: Semester 1 (Sep to Jan) View Timetable
Year running 2022/23
Pre-requisite qualificationsMATH2016, or MATH2017, or equivalent.
This module is mutually exclusive with
|MATH5211M||Metric Spaces and Functional Analysis|
This module is not approved as a discovery module
Module summaryThe notion of a metric space is a fundamental and extremely important one in mathematics. A metric space is a space with a notion of a distance between points defined on it. This includes for example subsets of real or complex Euclidean space, but also spaces of functions or more general sets can be made into metric spaces.The notion of a distance allows one to talk about convergence and completeness of a space. It also makes it possible to talk about continuity for functions in a more general context. For example, to view the space of continuous functions on an interval of the real line as a metric space turns out to be surprisingly useful. To illustrate this, we will use a simple result on metric spaces to establish one of the major theorems in the theory of ordinary differential equations. We will also derive and discuss two major theorems in real Analysis: the inverse and implicit function theorems.This module develops the theory of metric spaces with focus on applications in real Analysis.
ObjectivesOn completion of this module, students should be able to:
- Verify the axioms of a metric space for a range of examples and identify open sets and closed sets
- Handle convergent sequences and continuous functions in an abstract context and apply them to specific function spaces
- Use the contraction mapping theorem to find approximate solutions of equations and differential equations
- Rewrite equations such as inverse functions as fixed point problems and solve them using the contraction mapping theorem
- Work with the notions of connectedness and compactness in abstract and concrete contexts
- Demonstrate a broad understanding of the concepts, information, practical competencies and techniques of the theory of metric spaces.
- Appreciate the coherence, logical structure and broad applicability of the theory of complete metric spaces.
- Use metric spaces and fixed point theory to initiate and undertake problem solving.
(1) Definition and fundamental properties of a metric space. Open sets, closed sets, closure and interior. Convergence of sequences. Continuity of mappings.
(2) Cauchy sequences, completeness of R with the standard metric; uniform convergence and completeness of C[a,b] with the uniform metric, convergence in Ck[a,b].
(3) Completeness of Rn with the standard metric. For a compact set K in Rn uniform convergence and completeness of C(K) with the uniform metric, convergence in Ck(K).
(4) The contraction mapping theorem, with applications: the Picard-Lindelöf theorem, the inverse and implicit function theorems in higher dimension.
(5) Connectedness and path-connectedness. Introduction to compactness and sequential compactness, including subsets of Rn.
(6) Banach spaces, the Baire category theorem and applications to function spaces
|Delivery type||Number||Length hours||Student hours|
|Private study hours||117.00|
|Total Contact hours||33.00|
|Total hours (100hr per 10 credits)||150.00|
Private studyStudying and revising of course material. Completing of assignments and assessments.
Opportunities for Formative FeedbackRegular exercise sheets
Methods of assessment
|Exam type||Exam duration||% of formal assessment|
|Standard exam (closed essays, MCQs etc)||2 hr 30 mins||100.00|
|Total percentage (Assessment Exams)||100.00|
Normally resits will be assessed by the same methodology as the first attempt, unless otherwise stated
Reading listThere is no reading list for this module
Last updated: 24/05/2022
Browse Other Catalogues
- Undergraduate module catalogue
- Taught Postgraduate module catalogue
- Undergraduate programme catalogue
- Taught Postgraduate programme catalogue
Errors, omissions, failed links etc should be notified to the Catalogue Team.PROD | <urn:uuid:09ba4ef5-b520-430f-8493-b39bcfaf8f33> | CC-MAIN-2022-33 | https://webprod3.leeds.ac.uk/catalogue/dynmodules.asp?Y=202223&F=P&M=MATH-3211 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.838417 | 979 | 2.78125 | 3 |
Joy is phenomenally potent, and its power lies in its treasures: its capacity to add dimension to Luminous Dreams and Optimal Futures — and to sharpen the tools of intention and attention, action and image. It empowers the causations of resonance, love, and creativity, and it awakens innocence and wisdom. It can replace struggle and unlock gateways to the Future, the Possible, and the Unknown. We have resistances, but Lazaris helps us understand and overcome them. Then he guides a meditation to build an Avenue of Joy — which at first is difficult but becomes easier all the time. Techniques include: The Symbol of Joy, the “Out of the Blue” Technique (the Sirius connection), and the Tonal Creation Technique to transmit and receive joy. Between 2-1/2 and 3 hours…
Meditation: Avenues of Joy Meditation
Keywords: Happiness, Joy, Duality
Over the decades, a thriving spiritual community has blossomed among many who work with Lazaris. Explore ways to become part of this love, healing and belonging. | <urn:uuid:9220b0a4-b6f5-4be0-a311-a593efae6491> | CC-MAIN-2022-33 | https://www.lazaris.com/shop-product/mystery-and-magic/resonance/the-lost-treasures-of-joy/?stream | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.935556 | 230 | 1.601563 | 2 |
Durability and Performance of Ferrocement Infill Wall Panel
Muhammad Harunur Rashid
M. S. Anita
|Published in:||Civil Engineering Journal, June 2019, n. 6, v. 5|
Ferrocement is composed of cement mortar reinforced with small diameter closely spaced steel wire mesh to form a thin section conforming high performance of serviceability. The present study investigates the performance of ferrocement panels focused on the mechanical properties, water absorption and durability. A series of specimens were cast with single and double mesh layers. Flexural performance was carried out following sixty days in temperature cycle and in corrosion cell. These results was compared with the controlled sample. The test results shows that the flexural strength performance was reduced by 52% and 35% for single and double layer wire mesh samples respectively followed by corrosion environment. First crack load also changed after completion of sixty temperature cycles. This load is 27.3%, 42.3% and 31.8% of failure load for controlled sample, sample in room air after every temperature cycle and samples in room air following quenching after every temperature cycle respectively for single mesh layer sample, and for double mesh layer sample these values are 38.9%, 30.1% and 17.7%. Early first crack is found for the samples following quenching and cooled in room air; however, both types of samples are in low absorption level. This data represents that double layer mesh specimen exhibits better when compared to single layer mesh specimen in strength and corrosion parameters.
|Copyright:||© 2019 Muhammad Harunur Rashid, Zahangir Alam, Firoz Mahmud, M S Anita|
This creative work has been published under the Creative Commons Attribution 4.0 International (CC-BY 4.0) license which allows copying, and redistribution as well as adaptation of the original work provided appropriate credit is given to the original author and the conditions of the license are met.
- About this
- Published on:
- Last updated on: | <urn:uuid:2f9e4ca8-9dbb-44ae-a734-a6471c636b90> | CC-MAIN-2022-33 | https://structurae.net/en/literature/journal-article/durability-and-performance-of-ferrocement-infill-wall-panel | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.904827 | 530 | 1.679688 | 2 |
Jon Gordon is a motivational speaker, corporate trainer, leadership consultant, and bestselling author of a whole shelf full of books besides The Energy Bus: 10 Rules to Fuel Your Life, Work, and Team with Positive Energy, including Training Camp: What the Best Do Better Than Everyone Else and The No Complaining Rule: Positive Ways to Deal with Negativity at Work.
In the tradition of Who Moved My Cheese?, The Energy Bus conveys its lessons via a story. In this case, the protagonist is a human being named George, a gloomy Gus who does marketing at a lightbulb company. George has been warned that he will be fired if his next product launch isn’t stellar; his marriage is on its last legs, too.
As the story begins, George’s car gets a flat tire and he has to take a bus to work. The driver of the bus, aptly named Joy, tells him that she was sent by providence to change his life. At first George doesn’t want anything to do with her or the crazy passengers who appear to be her disciples. But when he learns that his car has a serious problem that will keep it in the shop for 10 days, he signs on for her course.
Spoiler alert: Joy’s rules really work. Not only does George get his mojo back but he restores his team’s sense of purpose and the product launch is a home run. George rescues his marriage, becomes a better father, and is even kinder to the family dog. And all of this happens in just 10 days.
No, The Energy Bus isn’t Tolstoy, but it’s not supposed to be. It’s a painless read—a sugar-coated lesson in the Power of Positive Thinking for busy, business-oriented people who might be put off by a sermon from Norman Vincent Peale. Its step-by-step methodology allows readers to put its lessons to use right away.
At its root is the Law of Attraction. As Joy puts it: “Thoughts are magnetic. What we think about, we attract. What we think about expands and grows. What we put our energy and attention on starts to show up more in our life. And the energy we project through our thoughts is the energy we receive….So it’s important that you spend your time thinking about what you do want rather than what you don’t want.”
Later on, Joy says, “We live in an Energy Field of Dreams!…If you build it in your mind, focus on seeing it, and take action, the success will come.”
It’s not a new idea. William Walker Atkinson first popularized the “law” in his 1906 bestseller Thought Vibration or the Law of Attraction in the Thought World, but he didn’t formulate the concept, which goes back to Phineas P. Quimby (1802–1866), the New Hampshire–born clockmaker who is considered the father of New Thought. New Thought and the Power of Attraction were also at the core of Rhonda Byrne’s 2006 bestseller The Secret.
Gordon, I hasten to add, doesn’t preach the Prosperity Gospel; his lessons are commonsensical and grounded in psychological research. He doesn’t promise to bring you wealth; he sets out a path to becoming a less negative person. Positive people are happier and more productive and they are better leaders, too. They prosper in more ways than one.
Does it work? A little more than a century ago, William James undertook an investigation of what he called “the religion of healthy-mindedness.” As unscientific as its tenets seemed, turning as they did on the idea that the “controlling energies of nature are personal, that your own personal thoughts are forces, that the powers of the universe will directly respond to your individual appeals and needs,” they nonetheless appeared to deliver practical results for its believers, he wrote. “Religion in the shape of mind-cure gives to some of us serenity, moral poise, and happiness, and prevents certain forms of disease as well as science does, or even better,” he concluded.
Joy’s philosophy might not be the richest or most subtle, but that’s okay. She’s not a philosopher; she’s a coach. And as a coach, she really delivers. | <urn:uuid:6a6a0f84-3d4e-40b4-857d-eb32f068da1d> | CC-MAIN-2022-33 | https://www.rewireme.com/happiness/10-rules-to-fuel-your-life-work-and-team-with-positive-energy/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.968204 | 936 | 1.671875 | 2 |
Quick Facts of Alfred Charles Sharpton Jr.
- Full NameAlfred Charles Sharpton Jr.
- Net Worth$500,000
- Date of Birth03 October, 1954
- NicknameAl Sharpton
- EducationSamuel J. Tilden High School
- Online PresenceInstagram, Twitter
These days, people usually follow Hollywood celebrities who have either singing talent or acting talent or even a comedian. But very less actually follow the civil right activist like Al Sharpton. People like him also deserve to be in the spotlight that is why we bring you an amazing article about the guy who is famous for leading the fight against racial prejudice and injustice in the USA and has a good net worth.
Some people describe Al as a controversial man who is also a racial arsonist. He is also a political activist. Moreover, to the black American populace, he is someone who went to jail for the advancement of their cause. He recieved ‘The voice of the voiceless and a champion of the downtrodden’ honor by the former present Barak Obama.
Al Sharpton Bio, Early Life
Sharpton was born on 3rd October 1954 in Brooklyn New York City as Alfred Charles Sharpton Jr. He went to the public school in Brooklyn and later in Queens. He completed his schooling from Samuel J. Tilden High School and graduated in 1972.
He was involved in civil right movements from a very young age and also held a couple of leadership positions when he was in school. He also was prominent in several high profile protests which were poised to bring equality between black and white Americans.
Soon after he graduated from school, he got enrolled at Brooklyn College where he studied contemporary politics. However, he dropped out of college after two years and established his own organization. The organization was named National Youth Movement which helped to keep media scrutiny on racial murder black teenager, Michael Griffith in 1986.
Al Sharpton’s Wife, Personal Life
Now moving on to Sharpton’s married life, he is married to a singer, Kathy Jordan. The duo met when Al was touring with James Brown back in 1971. The duo married in 1980. The couple has two beautiful daughters together, Ashley Sharpton and Dominique. However, the marriage didn’t last for long.
Al and Kathy separated and officially divorced in 2004. It was also rumored that the social activist had an affair with another woman, Aisha McShaw while he was still married to his wife.
The girl is a personal stylist and baker. Since then, Sharpton and MacShaw have become inseparable. Although the two have not tied the holy knot, they make several together appearances in public functions.
Al Sharpton’s Net Worth
The American Baptist minister, as well as television, radio host, has an estimated net worth of about $500 thousand. He is living a lavish life and loves to travel during his spare time. | <urn:uuid:489d5d88-ac3d-43e2-8c6e-21c4f4226af4> | CC-MAIN-2022-33 | https://hookinmouth.net/al-sharpton-bio-age-net-worth-wife/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00265.warc.gz | en | 0.983959 | 604 | 1.75 | 2 |
Different Ways to Treat an Earache
Yes, it could be more than just be a simple case of earwax!
Earache is considered a fairly common condition especially in children. If your child shows signs of pain while chewing, hearing difficulty, ear popping or fullness, ear tugging, or restlessness, it’s possible that he or she is suffering from an earache.
There are several known reasons why this happens, some of which include ear infections, colds, earwax buildup, an obstruction, ear damage, and fluid buildup. Among the ones mentioned, the most common known cause would be that of an ear infection.
According to a resource published by the National Institute on Deafness and Other Communication Disorders, five out of six children are likely to suffer from an ear infection by the time they reach the age of three.
If your child is experiencing it right now, you might be wondering about the different ways on how you can get this treated.
You are actually given two options – conventional medicine and the natural way.
A simple ear infection often clears up on its own. But as a parent, it’s only natural that you would seek professional help to make the problem go away as soon as possible.
If you choose to consult with a conventional medical practitioner, chances are, your child will be given some sort of painkiller to dull the pain. This could include medicines such as paracetamol, ibuprofen, or aspirin. Other doctors on the other hand are likely to prescribe antibiotics.
OTC medicines such as eardrops can also be purchased from your local pharmacy. But for this, make sure that you ask the advice of the pharmacist and mention all your child’s symptoms.
Now, for those of you who would rather get this treated the natural way, there are several ways by which you can get this done.
The first one would be with the use of a cold or hot compress. The concept in here is similar to that of applying this remedy to aching muscles – the compress helps ease the pain. Some people respond better to cold compress compared to that of a hot compress (or vice versa), so for this, you will need to see which works better for your child.
Another folk remedy that could work is olive oil. Pouring a bit of warm olive oil in the ear benefits earache sufferers a number of ways. This helps prevent earwax buildup, soothes the pain, and contains polyphenols that protect the ear from damage and infection.
Some people also swear by home remedies such as garlic, onions, peppermint, neem, and basil.
And then there’s also the chiropractic approach, considered a safe alternative since it does not use invasive therapeutic interventions. To treat an earache, chiropractors use techniques that help stimulate the movements of the upper part of the neck.
There are little muscles in the upper part of the neck that are attached to the ear. When there are distortions or tensions in the muscles or bones in these areas, it’s possible for fluids to accumulate inside the ear.
Chiropractors can adjust the ears using manual therapy, facilitating the flow of accumulated fluid from the ear, into the back of the throat, naturally ridding this of potential threats such as bacteria or foreign particles.
Personal Touch Matters Too
Adults have trouble dealing with a simple headache or fever. Just imagine how your child is feeling when he or she is ill. If your child has an earache, parents, it’s time to take away their attention from the pain. Keep your cool if your child cries. Get creative in distracting him or her from the pain instead.
After all, an earache lasts only for a little while.
At Personalized Chiropractic, we care about our clients’ health first and foremost. We focus on a holistic approach to wellness, helping our clients in the San Diego area to not simply treat symptoms, but rather to treat the root cause of their ailments. There are many options out there when deciding on yours and your family’s health care. Pacific Beach Chiropractor Dr. Ryan Curda would like to help you make an educated and informed decision. Call Personalized Chiropractic for any questions you may have regarding Chiropractic Care, your particular health concern, and the options available to you. Consultations are free, and Low Cost exams are available. (858) 866-3345.
-Dr. Ryan Curda
Or visit our Pacific Beach Chiropractic Center at | <urn:uuid:edb4d6bb-707e-45d9-b8fe-cd921f288818> | CC-MAIN-2022-33 | https://www.personalizedchiropractic.com/earaches-in-children-pacific-beach/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.94922 | 955 | 2.21875 | 2 |
Aikido was created by O Sensei, Morihei Ueshiba, as a Martial art based on harmony.
+ The dojo is a sacred place for the cultivation of budo - martial spirit.
+ strive to practice with mutual respect for each other and without conflicts.
Chief Instructor, Renbukan Dojo
President of Aikido Association of Thailand
RENBUKAN DOJO ETIQUETTE
Proper observance of etiquette is as much a part of your training as is learning techniques. Please take the following guidelines seriously.
1. When entering or leaving the dojo, it is proper to bow in the direction of O Sensei's picture, the kamiza, or the front of the dojo. You should also bow when entering or leaving the mat.
2. Avoid sitting on the mat with your back to the picture of O Sensei or the kamiza. Also, do not lean against the walls or sit with your legs stretched out. (Either sit in seiza or cross-legged.)
3. Never wear shoes on the mat. Always wear shoes off the mat.
4. Be on time for class. If you do happen to arrive late, sit quietly in seiza on the edge of the mat until the instructor grants permission to join practice.
5. If you should have to leave the mat or dojo for any reason during class, approach the instructor and ask permission.
6. Remove watches, rings and other jewelry before practice.
7. Please keep your finger and toe nails cut short.
8. Do not bring food, gum, or beverages with you into the dojo.
9. Please keep talking during class to a minimum. What conversation that is should be restricted to one topic -- Aikido.
10. Carry out the directives of the instructor PROMPTLY. Do not keep the rest of the class waitting for you.
11. Do not engage in rough-housing or needless contests of strength doing class.
12. Do not change your clothes (apart from the Hakama) on the mat.
13. Keep your training uniform clean, in good shape, and free of offensive odors. Do not leave your uniform in the changing room overnight.
14. Remember that you are here to learn, and not to gratify your ego. An attitude of receptivity and humility is therefore advised.
15. Preserve common-sense standards of decency and respect at all times.
16. It is everybody's responsibility to assist in cleaning the dojo. | <urn:uuid:5b3073f5-a360-45ed-875c-7be223a49870> | CC-MAIN-2022-33 | https://thaiaikikairenbuka.wixsite.com/renbukandojo/renbukan-dojo-etiquette | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.902914 | 543 | 2.140625 | 2 |
By Anna Koster
For The Daily News
Pushing boundaries has been the life work of Robert Irwin. His six-decade exploration of perception as the fundamental issue of art has expanded ideas of what art can be and can do. Irwin will speak about his work on March 10 at Stanford’s Cemex Auditorium.
Irwin, born in 1928, in Long Beach, started as a painter in the 1950s with an abstract expressionist style, but quickly began removing all that was not essential. This resulted in his minimal “line paintings” and then canvases filled with fields of subtle gradations of color created by thousands of dots. He even tried convex canvases.
Dissatisfied with paintings trapped within a frame or contained by a canvas’ edge, Irwin devised his now-iconic works that merge with the light and air around them. His luminous disk paintings from the late 1960s made him a pioneer in the Los Angeles-based Light and Space Movement, along with such artists as Larry Bell and James Turrell.
I have admired Irwin’s disks in several museums across the country. The success of each one depends on impeccable installation: precise color of the gallery wall and exact placement of four spotlights. When properly displayed, the disk is otherworldly. It appears to be floating. The disk blends with its shadows, which in turn seem to take on substance and merge with the disk. Prolonged gazing can make a viewer feel that he or she is levitating along with the work.
One work in this series commands its own wall at the Anderson Collection at Stanford. A conveniently placed bench aids visitors’ contemplation of the piece. The acrylic disk, 53 inches across, sports one stripe that is translucent at either end and spray painted with a dark lacquer in the center. This creates a shimmering, then disappearing horizontal band. Seemingly supported by its shadows — the disk is held away from the wall by a hidden post — the work rewards viewers with a transcendent experience once they quiet their minds and sit for a while.
In 1970, Irwin took the next step in his artistic journey when he abandoned his studio to develop an unorthodox way of working, and began creating mostly site-specific, or what he calls “conditional,” pieces. His works in this category include the flowing, cascading, ever-changing Central Garden at the heart of the Getty Center in L.A. Aided by a team of engineers, soil scientists, plant experts and Getty staff, Irwin began work on the 134,000-square-foot garden in 1972. The garden opened to the public along with the Getty Center in 1997.
Irwin is gaining international attention for his massive, $5 million project on the grounds of the Chinati Foundation, the mecca of large-scale works in Marfa, Texas, founded by the sculptor Donald Judd. After more than a decade of planning, Irwin’s 10,000-square-foot structure, on the site of a derelict Army hospital, is slated for completion later this year. According to the Chinati Foundation website, the U-shaped construction responds to the ever-changing Texas sky and will be experienced in halves, with one side of the building dark and the other light.
He is expected to talk about this and other works when he talks at Stanford on March 10.
Who: Robert Irwin
When: 6:30 p.m. , March 10; doors open at 6 p.m.
Where: Cemex Auditorium at Knight Management Center, 355 Knight Way, Stanford
Admission: Free. Registration requested but does not guarantee a seat
Registration and information: https://events.stanford.edu/events/577/57737/, 650-721-6053 or email@example.com
What: Anderson Collection at Stanford University
When: 11 a.m. to 5 p.m. Wednesdays through Mondays; Thursdays until 8 p.m.
Where: 314 Lomita Drive, Stanford
Information: http://anderson.stanford.edu, 650-721-6055 or firstname.lastname@example.org | <urn:uuid:8e9fe842-2640-4ce8-bdd9-f96f282a681f> | CC-MAIN-2022-33 | https://www.chicoer.com/2016/02/25/creations-of-space-and-light-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.945969 | 880 | 2.28125 | 2 |
This report analyses the current water, sanitation and hygiene (WASH) finance situation in countries, with an assessment of funding gaps to reach targets, financial planning and government budgets, as well as different sources of WASH financing (taxes, transfers and tariffs) and expenditure allocations.
|Title||UN-Water Global Analysis and Assessment of Sanitation and Drinking-Water (GLAAS) 2017 report : financing universal water, sanitation and hygiene under the sustainable development goals|
|Publication Type||Progress Report|
|Year of Publication||2017|
|Secondary Title||GLAAS report|
|Pagination||x, 79 p. : 33 fig., 12 tab.|
|Publisher||World Health Organization|
|Place Published||Geneva, Switzerland|
This report analyses the current water, sanitation and hygiene (WASH) finance situation in countries, with an assessment of funding gaps to reach targets, financial planning and government budgets, as well as different sources of WASH financing (taxes, transfers and tariffs) and expenditure allocations. The policies and actions of external support agencies (ESAs) are also highlighted. The report then focuses on funding universal access to WASH, with a discussion of how the targeting and use of existing financial resources can be improved as well as what cost recovery and pro-poor affordability schemes and measures can be deployed to reach those under threat of being left behind. New results from recently participating countries of the WHO-led UN-Water GLAAS TrackFin initiative during 2015 and 2016 are also presented throughout this report and in Annex B.
The report's main findings are:
This GLAAS 2017 report is the fourth periodic report, and first thematic report, following on from earlier reports in 2010, 2012, and 2014. It presents an analysis of the most reliable and up-to-date data from 75 countries and 25 ESAs on the issues related to WASH financing and other elements of the enabling environment, including plans, targets, data availability and measures to reach vulnerable populations. GLAAS reports provide substantive evidence for the activities of Sanitation and Water for All (SWA).
The copyright of the documents on this site remains with the original publishers. The documents may therefore not be redistributed commercially without the permission of the original publishers. | <urn:uuid:61fef88d-0e55-43a4-a775-a8343cf20efa> | CC-MAIN-2022-33 | https://www.ircwash.org/resources/un-water-global-analysis-and-assessment-sanitation-and-drinking-water-glaas-2017-report | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.884417 | 557 | 2.328125 | 2 |
Bankruptcy and the Bible
…Forgive Us Our Debts…
Dalton Camp proclaimed several years ago that,having lost its value, money may no longer be the root of all evil; credit having taken its place.This statement demonstrates the paradox of modern day religion and debt: should our reaction be one of condemnation or one of compassion? Since many recent respected studies have shown that the average American family is only three weeks away from personal bankruptcy, and new legislation that will deny bankruptcy relief to hundreds of thousands of American families is now the law, it is time to revisit what the Bible teaches us about debt.
The Bible makes it clear that people are generally expected to pay their debts. Leviticus 25:39. No one will or should advance any argument against this general proposition. However, this moral and legal obligation to pay just debts must be balanced by such considerations as the need for compassion and the call to cancel debts at periodic intervals. The Biblical basis for such considerations is based on the sabbatical and Jubilee years. The secular basis arises out of the Constitutional requirement that Congress enact uniform laws allowing businesses and consumers to cancel and to restructure debt obligations. This Biblical support for the legal right to cancel debt is enforced by the even stronger Biblical doctrine that prohibited interest of any amount rather than just usury or excessive interest.
Within the areas of economic justice and stability, the Old Testament is replete with examples of compassionate treatment of the poor, and with preservation of the family unit. These goals were superior to the material concerns of repayment of debt. For instance, Deuteronomy 15:7-10 is particularly forceful. It provides as follows: If there is a poor man among your brothers . . . do not be hardhearted or tightfisted toward your poor brother. Rather be open-handed and freely lend him whatever he needs. Be careful not to harbor this wicked thought: The seventh year, the year for canceling debts, is near,so that you show ill toward your needy brother and give him nothing. He may then appeal to the LORD against you, and you will be found guilty of sin. Give generously to him and do so without a grudging heart; then because of this the LORD your God will bless you in all your work and in everything you put your hands to.
The cancellation of debt in the Old Testament was accomplished at legislated intervals. Deuteronomy 15:1-2 clearly provides for such legislative release with the following language: At the end of every seven years you shall grant a release. And this is the manner of the release: every creditor shall release what he has lent to his neighbor, his brother, because the Lord's release has been proclaimed. Under this Biblical model, the debtors payment or non-payment of debts was not in question. The debtors may or may not have been culpable for their debts. It was a strict model with no means test or detailed analysis of every debt. And, while Old Testament lenders were admonished to be merciful, debts were canceled every seven years whether they liked it or not. The Old Testament model can therefore be legitimately applied to modern day bankruptcy laws. The principle is that, while taken seriously, debt can be canceled to achieve some higher purpose such as the preservation of the family unit. It also should be noted that Deuteronomy 15:12-13 provides that slaves should be freed every seven years creating an interesting analogy between the creditor-debtor and the master-servant relationship.
The Bible on Interest
The Biblical use of the term usury corresponds to our modern word interest rather than to the notion of excessive interest to which we generally apply the term usury today. Only a small number of us would seriously question the morality of profiting from a loan at normal interest rates. However, the Talmud quotes an ancient rabbi as saying: It is better to sell your daughter into slavery than to borrow money on interest.The Lord only knows what this same rabbi would say today if confronted with credit cards bearing interest rates of 34.99% and higher and with some pay day lenders demanding annual rates in excess of 2,000%.
The Biblical doctrine of usury rests primarily on three texts: Exodus 22:25; Leviticus 25:35; and Deuteronomy 23:19-20. Exodus and Leviticus prohibit loans of money or food with interest to a needy brother or sister or even a resident alien. Deuteronomy forbids taking interest from any person. Other Books of the Bible underline the importance of this prohibition on interest. For example, Psalm 15:5 characterizes a righteous man as one who, among other things, Lends his money without usury. Both Ezekiel 22:12 and Nehemiah 5:0-11 condemn lending money with interest, especially to the poor. And Ezekiel 18:13 list the taking of interest among sins worthy of death.
The prohibition on interest is based on God's covenant with Israel. The rule is founded upon the compassionate treatment of various oppressed groups: the resident alien; the widow; the orphans; and the poor. Exodus 22:25-27 states the law in explicit terms: If you lend to one of my people among you who is needy, do not be like the money lender; charge him no interest. If you take your neighbor's cloak as a pledge, return it to him by sunset, because his cloak is the only covering he has for his body. What else will he sleep on? When he cries out to me, I will hear, for I am companionate. Leviticus 25:35-37 provides that If one of your countrymen becomes poor and is unable to support himself among you, help him as you would an alien or a temporary resident, so that he can continue to live among you. Do not take interest of any kind from him, but fear your God, so that your countryman may continue to live among you. You must not lend him money at interest or sell him food at profit. Finally, Deuteronomy 23:19-20 provides: Do not charge your brother interest, whether on money or food or anything else that may earn interest.
Jesus clearly had these Biblical principles in mind when he admonished the money changers and removed them from God's house, the sacred Temple. In John 2:14 Jesus poured out the changers of money and overthrew the tables. Jesus, in fact, was always true to the principles underlying usury and debt forgiveness and the notion of the importance of placing love and compassion above greed and wealth. In Luke 6:34-35 Jesus said: “And if you lend to those from whom you hope to receive, what credit is that to you? Even sinners lend to sinners, to receive as much again. But love your enemies and, do good, and lend, expecting nothing in return, and your reward will be great, and you will be sons of the Most High; for he is kind to the ungrateful and the selfish. The followers of Jesus were to be concerned with the welfare of others, even when met with hatred and abuse.
The consistent teaching of both the Old and New Testaments is that compassion, mercy and justice are to override purely economic concerns, such as loans. Religious people are to be gracious to all, even debtors. Jesus said that God does cause the rain to fall on the just and the unjust and in Mark 10:25 he said that it is easier for a camel to go through the eye of a needle, than for a rich man to enter in to the kingdom of God. And in Luke 16:9 he said: I tell you, use worldly wealth to gain friends for yourselves, so that when it is gone, you will be welcomed into eternal dwellings, and to forgive and ye shall be forgiven Luke 6:37.
The compassion of the scriptures, including the setting aside of legitimate rights of lenders, was typical of economic relationships in the economy of early Judeo-Christian societies. The central theme is one of stability, a stable society with a guarantee of economic security to each family. Wealth was viewed as a blessing from God (Deuteronomy 8:11-18, 28). This blessing resulted from obedience and was based on God's compassion. The tithing for the poor, the gleaning laws, the year of the Jubilee, were all tangible ways that Israelites could show compassion for each other and honor God by following His law. Beyond income-maintenance programs, the Biblical Law provided a permanent mechanism such as the Sabbatical year and Jubilee to ensure that temporary misfortune barred no family from full participation in economic life. | <urn:uuid:6a165d39-f315-4eb7-b2d0-d49f59d68175> | CC-MAIN-2022-33 | https://www.leeringler.com/bankruptcy-and-the-bible/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.963693 | 1,765 | 2.09375 | 2 |
The 2018 METALOPHONE Biennial is special. It is a special year as Lithuania celebrates the centenary of its Independence. The venue chosen for the exhibition is also special: the exhibition hall of the Signatars House of the Lithuanian National Museum. This space is binding, specific, and historically very significant. It was in the House of Signatories that the Act of Independence was signed – the document that officially proclaimed and consolidated the declaration of independence. The signature of each signatory is a personal confirmation, a contribution to independence.
That is why the theme of the 2018 Biennale is “Signature/Signature”. It is both an allusion to the House of the Signatories and the signatures on the Act of Independence, and at the same time an encouragement to demonstrate one’s artistic individuality and artistic style. Each artist’s manner is like his or her personal signature, which marks the world around them. Each author’s signature is a confirmation of his presence in the world; each artist’s work is his signature.
The project is funded by Lithuanian Council for Culture | <urn:uuid:550d6666-63ec-45e3-a17d-37518c9187db> | CC-MAIN-2022-33 | https://metalofonas.eu/en/2018-signature/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.959093 | 230 | 1.570313 | 2 |
Use the zoom control (+ -) in upper left or use your mouse wheel to zoom-in and zoom-out of the map.
Click and drag the map to pan around the map.
Click the map icon in upper right to view available layers.
Toggle switches in layers tab to turn on/off layers.
Select member in results tab to open the member's webpage
Select Show District to view the member's district boundary.
PLEASE NOTE: This Web application is intended to provide general information only. Due to limitations in the data, the District Finder may incorrectly identify which district you live in, especially if the address is near the boundary of the district (where errors are more likely to occur). Please examine the map to determine whether your address is near the boundary. If it is, we recommend that you contact your county elections office.
LCC - GIS · 100 Rev. Dr. Martin Luther King Jr. Blvd. Saint Paul, MN 55155 · firstname.lastname@example.org | <urn:uuid:d2f2a493-a213-41f8-858d-364c90fbe0ef> | CC-MAIN-2022-33 | https://www.gis.lcc.mn.gov/iMaps/precincts/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.855992 | 213 | 1.75 | 2 |
Today, a key priority for healthcare facilities, in the era of pay-for-performance, is addressing patient safety issues such as preventable medical errors and adverse outcomes of routine care. When evaluating software to address policy and procedures management, one of the most important considerations that healthcare providers ask us is, “How does policy management software address patient safety and improvement in quality?” This is an extremely understandable concern and one that we see as becoming increasingly important at the forefront of policy management automation projects. Usually hospitals or health systems are driven to invest in policy management systems because of a poor or pending accreditation survey. However it is the impact on patient safety, continuous quality improvement, and patient satisfaction that truly matters when thinking about upgrading your policy and procedures management systems.
Preventable Medical Errors & Adverse Events
In 2000, the Institute of Medicine (IOM) published a landmark study on the state of patient safety in the US healthcare system and put the spotlight on systems of care that needed to be addressed. The report found that between 44,000 and 98,000 patients die of preventable medical errors each year at hospitals in the United States, and many more suffer from adverse outcomes that could have been prevented with better systems of care (IOM, 2000). In addition research indicated that another 100,000 preventable patient deaths occur annually as a result of avoidable hospital acquired infections (HAIs). Overall, deaths from preventable medical errors and HAIs are considered to be the fourth leading cause of death by the CDC (higher than deaths from breast cancer, motor vehicle accidents, and AIDS/HIV combined). Despite major strides that have been made in science and technology over the past two decades, patient safety and variation in the quality of care delivered remains a major issue for policy makers, payers, and healthcare facilities to address. Dr. Sanjaya Kumar, Chief Medical Officer at PolicyMedical, highlighted the impact on patients that preventable medical errors can have in his first book, Fatal Care, and in his second book, Demand Better, pointed out what healthcare systems could do to establish better practices and environments of care. A key to a good system of care is having staff that are knowledgeable and that have access to key information on the standard operating protocols of the healthcare system. This needs to readily available when needed, such as those that are contained within current policies and procedures.
It is clear that healthcare providers are committed to the health and safety of their patients, and delivering the highest quality of care possible. Sadly though human error, failure of mitigating safeguards, and other system related issues regularly cause preventable adverse events to occur. This can lead to untoward harm to patients. Over 70% of these events have been found to be avoidable through implementation of better processes and systems that have better safeguards in place. One of the most important system related components found to be critical in mitigating patient safety events, decreasing risk, avoiding HAIs and improving quality is ready access to key information and knowledge bases for staff. This allows them to make better-informed decisions when encountering situations or practicing in a more reliable and precise fashion. As organizations become more complex, having centralized document management with ready access and distribution capabilities for staff to use is hugely important. This goes for governance, risk management, and compliance (GRC) become a priority for healthcare providers to establish. Various organizations, from the World Health Organization (WHO) to regional and local governments have devised patient safety strategies. Many of these strategies are focused not only on direct patient care, but also on a shift to an organizational culture of safety overall. One of the first and most important steps, in an organizational shift to become safer, is to implement healthcare policy and procedures management software. Not only to implement, but to utilize it and administer it to its full potential.
The Relationship Between Organizational Culture And Patient Safety
In Canada, taking a cue from the US, a number of initiatives are underway to better understand what Canadian healthcare providers can do to establish better systems of care. One of the organizations we spoke with was the Public Services Health and Safety Association. Brent Webb, who is the Regional Consultant in the North-eastern Region for the Association, is an expert on the relationship between organizational culture and patient safety. His department works within the prevention system, helping hospitals and healthcare facilities with their policies, procedures, and training to be able to prevent injuries before they happen. They look specifically at the organization’s health and safety culture, to determine why certain behaviours occur and how they can be strategically addressed.
Webb and his team recently carried out a climate assessment project on behalf of the Ontario Ministry of Health and Long-Term Care. The goal of the project was to measure tangible aspects of a health and safety culture. Specifically, it looked at the perceptions, values and beliefs of the individuals within healthcare organizations, and how these things affect patient safety. The project took place at four types of healthcare facilities: a community care organization, an acute care clinic, a public health unit, and a long-term care home. The project included health and safety assessments, interviews, focus groups, and an analysis of the direct and indirect behaviours of the organization. Information gleaned from the climate assessment project was used to inform patient safety initiatives within each organization.
After analyzing these healthcare organizations, Webb noticed a definite trend – a greater focus on health and safety of employees and patients. If employees believe that an organization cares about them as individuals, both physically and psychosocially, this can serve as a catalyst to change the greater organizational culture. Webb believes that this can have significant effects on patient safety and quality of care.
Developing A Cultural Of Health And Safety
Developing a culture of health and safety in an organization does not happen overnight, and usually does not happen organically. In most cases, the culture of an organization is rooted in policies an
d procedures. Webb explains, “Health and safety has legal requirements to it. We need that foundational aspect. As human beings, we need direction.” It is critical for an organization to have formal documents to provide a governance structure and guide the development of a culture of health and safety. Webb continues, “Now, more importantly than that is how those documents become liveable. How they become something that changes or affects the behaviour of people within your organization.”
In today’s increasingly complex healthcare operating environment, where different healthcare providers are having to align and operate as a unit to ensure better outcomes from care delivered, it is imperative that we maintain our focus on implementing, adopting, and establishing solutions that can aid in the ready access to, and distribution of, key policies and procedures that staff need to stay on top. The WHO has called patient safety an endemic concern, and our efforts to address it should be broad and systemic (World Health Organization). It is clear that initiatives to improve patient safety must be grounded in policies and procedures that influence a culture of safety at the organizational level.
Improving Healthcare By Using Policy Management Software
Over the past 15 years we have worked to support these efforts and it is why we pioneered the use of policy management software within the healthcare environment. We have found that over the years that those organizations that use our software, or other vendors’ software, become significantly more confident in the management of their policies and procedures. A lot of this confidence comes from being more in control of policies, being more responsive to changes, and managing staff uptake of policies and procedures. This in turn helps reduce the amount of preventable medical errors and quality of care delivered, which is the absolute critical objective of everyone within the healthcare community.
That is why we would be more than happy to discuss your organizations needs for the management of policy and procedures whether you use our software or not. At the end of the day any experience sharing (having gone through thousands of policy management projects) and direction we can give you that helps improve healthcare provision makes it a worthwhile conversation to have. Please contact a member of our team for more information. Alternatively if you would like to see our software firsthand then please request a free demonstration. | <urn:uuid:a0f1e0bc-4b99-4cdc-90d2-b30249a79df6> | CC-MAIN-2022-33 | https://www.policymedical.com/policy-management-software-address-patient-safety/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.955088 | 1,646 | 2.015625 | 2 |
Selin ATAY-TDO-Taiwan has lost its second diplomatically in less than a week after the Pacific nation of Kiribati moved to sever diplomatic ties with Taiwan and establish foreign relations with China.
The Kiribati decision to severe diplomatic relations with Taiwan comes after the Solomon Islands announced it was breaking away from Taiwan on Monday, leaving Taiwan with fewer allies in the region. Only 15 countries now recognize the self-governing territory of Taiwan as a sovereign nation
Taiwanese Foreign Minister Joseph Wu said Beijing had used "dollar diplomacy" to poach one of Taiwan's last remaining allies by providing funds. China is trying to "suppress and reduce Taiwan's international presence" and "ultimately destroy Taiwan's sovereignty", Mr. Wu said.
China has also successfully lured El Salvador, the Dominican Republic and Panama to switch allegiances in recent years. Those countries that have remained loyal to Taiwan are in Latin America and the Pacific, and the only European state to still do so is the Vatican.
Taiwan has been a de facto sovereign nation since the end of a civil war in 1949, but it has never formally declared independence from the mainland. China still claims Taiwan as its territory and says the democratic island has no right to formal ties with any country. | <urn:uuid:8c06eb00-0d2d-40f5-ad5f-c60a70eb389d> | CC-MAIN-2022-33 | https://diplomaticobserver.com/_news/taiwan-loses-another-ally-as-kiribati-switches-to-china | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.963479 | 258 | 2.0625 | 2 |
Dulce de leche (pronounced "doolse de Leh-che") literally means candy of milk. It's a rich concentrated version of milk that tastes similar to caramel and is commonly used in many South-American and Mexican desserts. Making this ooey-gooey treat is hands down the easiest way to get a delectable spread, frosting, or dessert quickly and it's also really easy to make at home, if you have a can of condensed milk.
There are numerous ways you can make it however, such as in a pressure cooker, the oven, or in a pan. Here are recipes and tips for all!
How to Make Dulce de Leche in a Pressure Cooker
Cooking this delicious Dulce de Leche is quick and requires minimal supervision if you cook it in a pressure cooker. Once you peel oof the label and place it in a pressure cooker, cook it on low flame for about 45 minutes. Let the pressure release completely.
In this method, the pressure from the cooker 'forces' the condensed milk to solidify and caramelize sooner.
How to Make Dulce de Leche in the Oven
The oven, like the cooker, also gives a lot of heat at once. The difference is, you cannot put the tin of condensed milk as-is into the oven. It is sure to burst! Instead, you pour the condensed milk onto an oven-proof pan, cover it with two layers of aluminum foil, then bake it on a low temperature for 45-60 minutes.
How to Make Dulce de Leche in a Pan
This is perhaps the most popular method of making Dulce de Leche. Requiring just a pot and some water, this method can be used by anyone! All you need to do is vertically submerge the condensed milk tin (label removed) in a pot of water. Bring it to a gentle boil, and continue to boil for 2-3 hours. The warm water will slowly solidify and caramelize the milk and turn it into this golden liquid.
General tip: No matter which method you use, make sure to handle the tin of condensed milk very carefully! It stays hot even an hour after cooking. Let it rest at room temperature for at least 2 hours before opening the tin.
- Cook Time
- 1 canServings
- 1 can Sweetened Condensed Milk
Method 1 - In a Pressure Cooker
- Place the can of sweetened, condensed milk directly onto the bottom of the pressure cooker and add water just enough for the level to come about 1 inch over the top of the can (make sure that it is not exceeding the ‘maximum capacity level’ of the pressure cooker).
- Lock on the lid, place the Whistle, and heat over high heat until the cooker starts to whistle to let you know it has reached pressure.
- Lower the heat to about medium heat, to maintain the pressure in the cooker.
- Cook for 40 minutes at high pressure.
- After 40 minutes, remove the pressure cooker from the heat and open the “Whistle” valve to allow the steam to escape and the pressure to come down.
- Once the pressure has released completely and the cooker unlocks, carefully take the hot can out of the water. (BE CAREFUL. Water is very hot – use a slotted spoon or oven mitts)
- Place the can on a heatproof surface and allow it to cool to room temperature.
- Carefully open the can and enjoy the dulce de leche!
Method 2 - In the Oven
- Heat oven to 425°F with rack in middle.
- Pour the contents of 1 (14-ounce) can sweetened condensed milk into a 9-inch deep-dish pie plate and cover tightly with foil.
- Set the plate in a roasting pan and add enough hot water to the pan to reach halfway up the pie plate.
- Bake milk in the middle of the oven 45 minutes.
- Check water level and add additional, if necessary, then continue to bake 45 minutes more, or until milk is thick and brown.
- Remove the pie plate from the water bath and cool.
Method 3 - In a Pan
- Place the can in a pot and cover it with water. Stand the can on the bottom of the pot. Then add water until the water is 2 inches above the top of the can. Make sure the pot is tall enough that you can completely cover the can with water while it’s standing up.
- Let the water come to a boil. At this point, reduce the flame and let the pot simmer.
- Once the water has boiled, reduce the flame to a low setting. This should bring the water to a light simmer. Let the pot simmer for 2 to 3 hours, depending on how dark you want your dulce de leche.
- Once the can has boiled long enough, remove it with a pair of tongs.
- Cool it for a few hours. Then open the can and enjoy. | <urn:uuid:a14241af-321c-4005-a44a-d97b4c043d82> | CC-MAIN-2022-33 | https://parade.com/1030857/kavitharamaswamy/how-to-make-dulce-de-leche/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.917139 | 1,066 | 2.109375 | 2 |
a. Footnote 2 in the chapter presents the formula for the convexity of a bond. Build a spreadsheet to calculate the convexity of the 8% coupon bond in Spreadsheet 11.1 at the initial yield to maturity of 10%.
b. What is the convexity of the zero-coupon bond?
What is the principal unit normal tangent vector to the curve at t=3?Jul 22 2021
The Veterans Affairs (VA) and the QueuesThe VA put into place incentives and bonuses for administrators to "reduce the queue." That is, the goal of the VA was to reduce t...Aug 11 2021
Choose the correct answer.Are you sure it was (I, me) who was called to the phone?Jun 18 2021
Insert dashes or parentheses in the following sentences.WhatsApp, Facebook Messenger, WeChat, and QQ Mobile these are some of the most popular messaging apps available fo...Jul 14 2021
1. Traveling by airplane is becoming more and more an activity that Americans partake of. Suppose that the demand for travel routes worldwide increased in the year of 200...Apr 23 2018
What leadership style or approach is used by Jack Ma (Transactional, Transformational or Charismatic)? Describe what characteristics you see to justify you answer as well...Aug 24 2020
Should depreciation expense be explicitly included in the cash budget? Why or why not?May 21 2018
Jason Clark, an experienced hunter, bought a paintball gun. Clark practiced with the gun and knew how to screw in the carbon dioxide cartridge, pump the gun, and use its ...Jul 06 2021
1. (This problem is worth 4 of the 10 points in this assignment). Assume that a U.S. firm has ordered a major piece of machinery from a Japanese firm for ¥3 million, and...Aug 27 2020
Craig’s Café faces a demand curve of P = 48 – Q. Craig has a total cost function of TC = 25 + 5Q2a. Find Craig’s profit maximizing level of output and profit maximizing p...Jul 07 2021 | <urn:uuid:eda7f1aa-ebf7-4e49-a797-39348695c1c8> | CC-MAIN-2022-33 | https://www.mycoursehelp.com/QA/footnote-2-in-the-chapter-presents-the-f/65761/1 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.918856 | 437 | 1.96875 | 2 |
Big guns are heavy and uncomfortable to carry, so we wind up finding excuses to leave them home. That’s never a good idea. One alternative embraced in droves in recent years is a subcompact, polymer-frame .380 ACP pistol. But let’s face it, that cartridge is only good for one-shot, instant neutralization of the bad guys in movies. In real life, the .380 cartridge is a bit anemic and underpowered.
A big step in the right direction is the new Diamondback DB9 subcompact in 9mm, which is surprisingly more powerful than the .380 ACP when fired from these guns. For example, factory ballistics for Federal Premium Hydra-Shok ammounition lists the .380 with a 90-grain bullet as traveling 1,000 feet per second (fps) from the muzzle. This creates 200 foot-pounds of energy (fpe), which to be honest, when trying to stop a drug-crazed, prison-hardened bad guy ain’t much. A 124-grain Hydra-Shock 9mm cartridge, however, will travel at 1,120 fps and produce 345 fpe, which is almost a 60 percent increase in energy. There is also about a 65 percent increase in momentum, which is a good way to measure the potential for penetration—a critical factor with these smaller cartridges and lightweight bullets. So when we can carry it, the stronger 9mm cartridge in a pistol that is essentially the same size as a polymer-frame subcompact .380 ACP handgun, it makes a lot of sense.
The DB9 is a little pistol and is only slightly larger than the Diamondback DB380 model. Both have six-round magazines. The DB380 weighs 8.8 ounces while the DB9 checks in at 11 ounces. The DB9 is 0.050 inches thicker. The length of the DB9, at 5.6 inches, is about 0.40 inches longer than the DB380. With a finger-extension magazine in the gun, the height, from the top of the rear sight to the bottom of the grip on the DB9, measures 4 inches. The grip, of course, is about 0.30 inches wider to allow for the longer cartridge. The DB9 has a 3-inch barrel, while this DB380 has a 2.8-inch barrel. When you add it all up, there is not much different in the sizes of these pistols. The DB9 is just as well suited for pocket carry, but it packs a more serious punch.
I have average-sized hands and I can get two fingers on the grip below the triggerguard if I use the finger extension magazine. The frame is polymer with metal used for the important parts like the slide rails, ejector, etc. The slide is steel and has serrations milled in front and back.
The gun is advertised with a 5-pound trigger pull, but mine averaged just over 6 pounds on a Lyman trigger pull scale. The front sight is a low front ramp with a white square. The rear sight has two white dots and is adjustable for windage by drifting it in a milled dovetail.
While recoil is a little stiff compared to a .380 ACP, I could easily control the handgun for rapid-fire strings. With some practice, my splits between shots from 3 yards were around 0.24 seconds; from 7 yards, they were 0.36 seconds while keeping all the shots in center of mass. High-speed photos confirmed that I am in full control of the gun through the recoil cycle. I can’t shoot it as fast as my full-size 9mms. But, considering this gun weighs 58 percent less than my S&W M&P 9mm pistol, and that I can’t get my entire hand on the grip, it is pretty amazing how fast follow-up, aimed fire is possible. I should note as well that the ejector throws the brass a long way. It would not stay on the big tarp I use for catching brass and much of it was lost in the tall grass. In case you are wondering, this is a good thing for a defensive pistol.
The long trigger pull on a small-framed gun, combined with the rather stiff weight, made precision shooting difficult, so the accuracy figures included probably don’t reflect what the gun could do from a machine rest. It’s not important, however, because this is not a target gun—this is a close-range, self-defense pistol, and for that use, the design is correct.
I found the gun to impact pretty low when using the standard sight picture, enough so that a low center-mass shot will likely impact the bad guy’s manhood. This can be corrected by adjusting the sight picture or by filing the front sight shorter. I am a huge fan of laser sights on any defensive gun, but none more so than on a subcompact pistol. Crimson Trace will have one soon for this gun.
I had one failure to eject and the gun didn’t completely close into battery twice. The failure to close into battery was with the same ammo and did not happen any other time, so I suspect ammo contributed to the problem. I had two failures to feed, but both were with a spare magazine that I ordered, so it may well have been a magazine problem. All these occurred during the initial shooting, which I did from the bench to measure velocity and accuracy. This is consistent with any new pistol and Diamondback even states in the manual that the gun should have a least 50 to 100 rounds fired through it to break it in before it will run reliably. I expect any new semi-auto firearm will have a few hiccups until things settle.
In the end, this gun proved as reliable as any similar firearm I have tested. By the time I changed to shooting drills with a timer, I had lubed the pistol and it had about 100 rounds through it. I didn’t experience any further problems. With proper break-in and lubrication, the gun now runs fine.
The Diamondback DB9 has proven to be a reliable addition to the subcompact family of handguns, and due to the powerful cartridge, it is the big brother, the enforcer, the leader of the pack. It will find a home in my front pocket for those days when carrying a subcompact makes sense, and I will be much more at ease about the power level if the worst happens and I need to use the gun to defend myself or my family. Find out more by visiting diamondbackfirearms.com or calling 888-380-2767. | <urn:uuid:d8b6245b-ecc4-473b-a894-db8b68376db9> | CC-MAIN-2022-33 | https://www.personaldefenseworld.com/2012/10/diamondback-db9/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.959029 | 1,394 | 1.648438 | 2 |
What the Train Accident In Mendon Should Teach Us All
On Monday Amtrak's Southwest Chief struck a dump truck in a railroad crossing near Mendon, Missouri. When it was all said and done, three passengers aboard the train and the truck driver died. 150 other passengers suffered injuries. Not to mention the damage to Amtrak's equipment, and the inconvenience it will cause Amtrak riders for months because those train cars are out of commission. And the reality is, that the tragedy was preventable.
In other words, pay attention to your surroundings when you come to a railroad crossing. And never try to beat the train.
As a guy who has always liked trains, especially passenger trains, I learned at a very young age to respect the power of trains and locomotives. I learned early to always look and make sure both or all three tracks were clear of trains before crossing from one side of the commuter station to the other. I learned that when the crossing gates were down, the bell clanging and the lights flashing, to not drive around the gates and try to beat the train.
And sometimes, yes it's hard. Who wants to be stuck waiting for one of those slow lumbering freight trains to pass? Who wants to be the guy sitting at the crossing with the jerk behind you impatiently honking and wanting you to go around the gates so he can do the same thing? I don't. But I also don't want to be hit by a train. So if anything, I'm cautious around railroad crossings. And I definitely take my time crossing tracks that don't have lights and gates.
Here are some tips from Operation Lifesaver, which has been providing the public with knowledge about being safe near railroad tracks and trains for decades, when it comes to navigating driving near tracks:
- The train you see is closer and faster-moving than you think.
- Trains cannot stop quickly.
- Driving around lowered crossing gates is illegal, and deadly.
- Don't get trapped on the tracks. Only cross the tracks if you're absolutely sure your vehicle can clear the crossing without stopping.
- If your vehicle stalls on the tracks get out and get away from the tracks. Locate the Emergency Notification System sign and call the number provided, telling them about your stalled vehicle. Do this even if you don't see/hear a train.
- At a crossing with multiple tracks, watch from a second train on the other tracks.
- Only cross tracks at designated crossings, and look both ways before you cross without stopping.
- Always expect a train. Freight trains don't follow set schedules, and even passenger trains can run late.
The bottom line is, pay attention when you're around train tracks. The life you save may be your own, and perhaps many others. | <urn:uuid:8dd41edd-202f-432e-baea-5855bd698ab3> | CC-MAIN-2022-33 | https://kxkx.com/what-the-train-accident-in-mendon-should-teach-us-all/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.968884 | 573 | 1.664063 | 2 |
Several techniques can result in better surgical outcomes for patients
Glaucoma surgeons highlight elements of their personal trabeculectomy technique, which can optimize long-term IOP control and minimize the risk of early and late complications.
Reviewed by Paul Palmberg, MD, PhD, and Henry D. Jampel, MD, MHS
Variations in trabeculectomy technique aim to optimize long-term IOP control and minimize the risk of early and late complications. Paul Palmberg, MD, PhD, and Henry D. Jampel, MD, MHS, shared elements they have incorporated in their surgical approach that contribute to successful trabeculectomy.
Dr. Palmberg said that his current technique has been developed during a career of more than 40 years.
“In a large group of patients, it has achieved long-lasting IOP control in the low-normal range with no net visual field progression over a decade of follow-up, and it has been associated with a low rate of hypotony,” said Dr. Palmberg, professor of ophthalmology, Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, Miami, FL.
The first consideration is how to avoid bleeding and the need for excessive cautery, both of which promote scarring, he reported.
To avoid bleeding in the area of filtration, he cuts the conjunctival-Tenon’s capsule flap only far away from the filtering site, beginning with a lateral relaxing incision down to sclera, demonstrated in the photo above.
Dr. Palmberg said he then everts the conjunctiva and passes the Westkott scissors behind the insertion of Tenon’s capsule, which is 1-2 mm behind the insertion of the conjunctiva, in order to enter the potential space under Tenon’s.
The scissors are then advanced under Tenon’s, lifting it above the scleral surface vessels, pulled down toward the limbus, and then one blade is inserted and the conjunctiva and Tenon’s capsule are cut together at their insertions.
“The only bleeding is at the insertions, where spot cautery can be applied,” Dr. Palmberg said. “This avoids the problem that I see with smaller conjunctival flaps, in which the scissors pass blindly under the flap and cut into the vessels in Tenon’s, and mitomycin-C (MMC) sponges come out soaked in blood.”
He then uses the scissors to penetrate through the intermuscular septum to each side of the superior rectus. MMC 0.4 mg/ml is then applied using large (4 x 4 mm) thin pieces of cellulose sponge cut from a spear sponge.
The sponges are placed through the opening in the intramuscular septum to each side and along the limbus. The sponges are removed after 3 to 5 minutes and inspected to see that they are intact.
Then, the eye is rinsed with 5-10 ml of saline.
“I have found that the wide application of MMC, introduced by Sir Peng Khaw, greatly reduced bleb problems by producing more diffuse blebs,” he said.
Dr. Palmberg added that prior to MMC application, he creates a “safetyvalve” tunneled trabeculectomy. In this technique, a 3-mm groove is made at two-thirds depth in the 12’ o’clock position, 1 mm behind clear cornea. Then a crescent knife is used to tunnel 2 mm forward, 1 mm into clear cornea.
A bent paracentesis blade is then used to enter the anterior chamber, and a 0.75 mm Kelly Decemet’s punch is used to punch out two side-by-side pieces of the posterior lip of the internal ostium. Balanced salt solution is then injected into the anterior chamber to inflate it and to initiate aqueous flow.
The flow is observed to equilibrium, using a cellulose spear sponge to gently touch the groove to absorb fluid, and then the points of light in the groove are watched as they disappear as fluid fills the groove. The IOP at equilibrium flow is estimated by pushing on the cornea with a 30-gauge cannula, with a goal of having this wound set an IOP of about 4-6 mm Hg, Dr. Palmberg said.
Additional punches or cutting down on the sides of the tunnel are then performed until that goal is reached. Two 10-0 nylon sutures are then placed, and their tension adjusted to yield an equilibrium IOP estimated at 8-12 mm Hg. “That this is an effective means of adjusting the scleral resistance is confirmed by the observed mean IOP of 10 mm Hg on day 1 postop,”
Dr. Palmberg said. The conjunctival flap is then closed with a buried 10-0 nylon mattress suture at 12 o’clock.Buried mattress sutures of 8-0 polyglactin 910 (Vicryl) are placed at 3 and 9 o’clock, with the conjunctiva-Tenon’s capsule pulled tight along the limbus to be impaled upon the emerging needle. The suture is then continued as a running suture to the end, and an apical bite is passed back under the flap on each side to be tied underneath the flap, so that the single knot to each side is buried, with a snug and water-tight closure, without bunching the tissue.
Dr. Palmberg emphasized that the scleral bites of the closure need to pass vertically into the tissue, then pass along in sclera, and also exit as vertically as possible, producing “square wave bites,” rather than skimming bites, in order for the fragile conjunctiva to be supported and not torn.
Considering fashion stitches, Dr. Palmberg said he wondered how seamstresses could sew a fragile material like silk without having the thread claw holes.
“Looking at the inside of a seam in my wife’s silk dress I saw seam binding tape and noted that the seamstress aligns passes through the tape with passes through the silk on each side so that the closure compresses, but does not tear the material,” he explained.
“If you do not similarly support the conjunctiva with matched scleral bites, your sutures will gradually claw through the scleral bite at the skimming entry and exit and loosen the conjunctival closure, typically leading to a limbal leak at about three days.”
Dr. Palmberg said that his technique is fairly efficient, involves no device cost, and obviates the need for an iridectomy because there is no flow until the anterior chamber is formed. In addition, the technique also is associated with less induced astigmatism because the flap sutures do not need to be very tight.
“But most important are the outcomes showing it has achieved an average IOP of 11 mm Hg over a decade of follow-up with no net field loss in the group, and a success rate, defined by an IOP < 15 mm Hg, of 90% at two years, 73% at five years, and 60% at 10 years,” he said.More pearls
Highlighting a few steps in his trabeculectomy technique, Dr. Jampel, Odds Fellows professor of Ophthalmology, Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, said he initiates the conjunctival peritomy 1.5 to 2 mm posterior to the limbus, a technique he learned from Eugenio Maul Jr., MD, and places a 50/50 mixture of lidocaine and bupivicaine through the snip incision for local subconjunctival anesthesia.
When applying MMC, Dr. Jampel uses an 0.2 mg/mL concentration and places it through the snip incision. He opens up the incision so that it is parallel to and about 2 mm posterior to the limbus. Dr. Jampel then performs the conjunctival dissection posteriorly and to the sides. After the trabeculectomy flap has been made, Dr. Jampel preplaces two releasable sutures of 10-0 nylon using a technique shown to him by Jayant Iyer, MD, a fellow who came from Singapore.
“I have named this technique the Singapore sling releasable suture. It is made by placing a backhanded suture that starts in the sclera, comes out through the cornea, and then goes back in through the flap,” explained Dr. Jampel.
After completing the scleral flap dissection, creating a sclerotomy with a Kelly Descemet’s punch, and iridectomy, he then sutures the flap with the releasable sutures and places a third releasable suture anchored in the cornea. He said he then closes the conjunctiva with two 10-0 nylon wing sutures whose knots are buried.
“I feel that by pulling the posterior lip up against a residual ‘bolster’ of conjunctiva at the limbus, I can achieve a watertight closure without the need for a central suture,” Dr. Jampel concluded.
Henry D. Jampel, MD, MHS
This article was adapted from Dr. Jampel’s presentation at the 2019 American Glaucoma Society annual meeting. Dr. Jampel has no relevant financial interests to disclose.
Paul Palmberg, MD, PhD
This article was adapted from Dr. Palmberg’s presentation at the 2019 American Glaucoma Society annual meeting. Dr. Palmberg has no relevant financial interests to disclose. | <urn:uuid:2ca2fe80-5681-45a2-b02e-8a033db88e3a> | CC-MAIN-2022-33 | https://www.ophthalmologytimes.com/view/physicians-share-surgical-pearls-successful-trabeculectomy | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.926279 | 2,141 | 1.734375 | 2 |
It’s been a while since we’ve added a blog to our page – we typically like to share our trips, and unfortunately haven’t been on any since our trip out west in 2019. But we did have exciting times with the dogs since then, including having Athena’s first litter! This was our first litter too, so we’re sharing what whelping and puppy rearing looked like for us, but who knows what future litters will look like.
Three weeks after breeding, we took Athena in for an ultrasound to confirm if pregnancy had taken, and we were thrilled when it was. Ultrasound is able to give an idea to the number of puppies (we were told at least six were seen) but it isn’t as foolproof, especially since canines frequently absorb fetuses or abortions during gestation. Some folks have had success with tracking gum color – around three weeks of pregnancy, gums may lighten or pale in color as the fetuses implant which can pull blood flow to the uterus – we did check this, but did not see any color change in Athena’s gums.
A week before her due date (which is calculated based on ovulation timing rather than breeding dates, which is part of the importance to have progesterone testing while Athena was in heat) we scheduled an X-ray to get a final count of pups to better anticipate whelping needs. We clearly saw eight calcified skeletons which was more than we had hoped for. Based on this being Athena’s first litter, and the larger size, our vet told us that although her due date was October 31st, we should expect her to whelp sooner than that. The gestation period for dogs is on average 63 days, and puppies barely survive if whelped before day 58, so kept a close eye on Athena. The smallest skull is Ciri – it’s crazy that we have an image of her before she was born!
One of the ways to be determine if whelping time is coming is by detecting a temperature drop. Dogs temperature is typically around 101F and it will drop under 99F when they are soon to whelp – the drop is due to the hormone progesterone dropping to begin the labor process. We started taking Athena’s temperature in the morning and evening on day 54. On day 59 Athena had a temperature drop below 98F and we knew the time for pups was on the horizon. At 7pm that evening she grabbed her favorite hedgehog toy and bolted upstairs into the whelping pen we had made and set up for her the week previous.
She stayed in her whelping pen, was mildly panting, and remained uncomfortable (but not actively pushing in labor with contractions) the rest of the evening. She didn’t eat any food either and in general remained restless. This all continued over the next day (day 60). I stayed with her all throughout this time, and was in contact with the vet and more experienced breeders, to make sure there was no need for alarm. The first Stage of labor – as described above – can vary greatly, so it’s important to make sure there are not concerning signs of distress or need for medical intervention during that time. Athena and I didn’t sleep a wink that night, but I stayed with her as she tried to get comfortable, but neither of us found much rest.
At 7am on the morning of Day 61 (36 hours after she started Stage 1 labor, which a longer Stage 1 is more common for first time moms), Athena started getting more regular contractions and began active labor and pushing. She had her first puppy at 7:03 (Bitterroot, born “breach” which is more common and less concerning for dogs). We gave her some cottage cheese (a much needed calcium boost after all those difficult muscle contractions, and milk production over the last week) to keep her energy up and made sure that the puppy got some colostrum (the first milk the mother produces in the first 24 hours provides which includes antibodies for immunity). Athena continued to whelp and had puppies at 7:33am (Nettle), 7:49am (Vervain), 8:37am (Nightshade), 10:13am (Bloodroot), 10:37am (Wolfsbane), 12:06pm (Foxglove), and the final runt (Witch Hazel, who was much smaller than the other pups) at 1:29pm.
Generally, as long as mom is acting normal and responding, it is okay for her to have breaks during Stage 2 labor. Athena’s longest break between pups was 89 minutes, and the important thing is that she was not actively struggling or trying to push, she was resting well, and eating. There are a great number of things to be aware of during whelping in terms of both the mother and pups health, so we had a lot of items on standby should they be needed, and made sure we had researched how to solve issues should they arise, and fortunately we did not need to intervein ever. We of course monitored both Athena and the puppies very closely though. All pups were born strong and easily latched and fed off mom. None of them needed resuscitation or to be tube fed, and we luckily had all pups alive and well from the start. Athena, to no surprise, was very good even as a first time mom and diligently and instinctively took care of her pups. We did not see any need for a "clean out" shot of oxytocin as we knew the number of pups to expect and counted sacks - Athena finally got some well deserved rest.
We weighed pups daily and those that didn’t gain at the same rate as the others we made sure to make sure had extra nursing time with Athena to get back on track. The two pups that had rear dew claws (Wolfsbane and Witch Hazel) we removed at four days old, making sure they were first growing well and showing no other signs of distress. On day seven we started Early Neurological Stimulation (ENS) with all the pups per the outlined procedures in Puppy Culture, and continue to marvel at how well Athena and her pups were doing. We trimmed nails nearly every other day and at day eleven and twelve everyone had opened their eyes for the first time. We continued to track the pups and do ENS until things really started to change around the 21 day mark. Athena continued to get extra calcium in her diet by means of goat milk to compensate for all the milk she was producing. Pups began to startle and would soon be ready for the next steps in socialization (which we’ll discuss in another post) and were introduced to some puppy mush to start weaning. By day 28 they were ready to move on out of the whelping pen and into the weaning pen to begin their adventures as more independent pups!
We are so grateful to have had an easy whelp and such a great first litter of pups. Athena has surpassed our expectations for her as a mama, and we are so blessed to have her as our matriarch!
Lastly, some of the reading materials we had on hand to best prepare ourselves for whelping and any emergency situations include:
"Advanced Canine Reproduction and Puppy Care: The Seminar" Myra Savant-Harris
"Puppy Intensive Care: A Breeder's Guide to Newborn Puppies" Myra Savant-Harris
"Canine Reproduction and Whelping: A Dog Breeder's Guide" Myra-Savant Harris
As well as a class on Canine Reproduction and lots of YouTube videos :) | <urn:uuid:e0545b57-624b-4673-a4f6-a7149bf81dab> | CC-MAIN-2022-33 | http://www.avalontamaskan.com/blog/archives/02-2022 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.985112 | 1,616 | 1.882813 | 2 |
Belmont author Len Abram interviewed Nathaniel Philbrick, whose book “The Battle of Bunker Hill. A Siege, A City, a Revolution,” is this year’s One Book One Belmont selection.
Abram: Revolution patriots appear heroic in a Copley painting. Others, however, beat, scalded, tarred and feathered, and nearly killed loyalist John Malcom. Some patriots dumped British tea into the harbor. To the English, were Americans thugs and savages, who only understood violence?
Philbrick: We have the impression that the American Revolution meant war, but not the climate of violence of so many other revolutions. Not true. In Boston, armed gangs fought each other in annual anti-papal demonstrations; in protesting the Stamp Act, crowds broke windows and damaged furniture at the home of Governor Hutchinson; the patriots of the Boston Tea Party destroyed thousands of pounds of English property. By the way, civil unrest and violence were taking place in England too.
Boston in the 1770s had a civil war, loyalist against patriot. John Malcom was a loyalist, tarred and feathered and terrorized. He eventually left for England. His brother Daniel, however, was considered a true Son of Liberty, and is buried at Copp’s Hill. It is said that British regulars practiced their muskets with Daniel’s tombstone as a target.
Q. Liberty is the epic theme of your history. One Lexington veteran said his militia fought to keep British regulars from taking away their freedom. Where did Americans, even Boston children sledding in winter, get this sense of autonomy ?
A. Children were sledding down School Street by the home of a British officer. They complained to the officer that throwing fireplace ash onto their path slowed down their run. The officer mentioned the apparent rudeness to General Gage. Subduing this colony was so difficult, Gage observed, because “even their children insist on their rights.”
The pursuit of liberty was not just the passion of high-minded political theorists, but shared by the general populace, including children, and those farmers with their muskets who rushed toward battle.
Q. Your vivid description of the fighting in 1775 carries with it sorrow, the grievous costs, culminating in the battle at Bunker Hill. Could the two sides have avoided bloodshed for the same political results?
A. If both sides knew that an eight-year struggle of such high costs in blood and treasure was ahead, they would have reconsidered. It is tragic that they found no other way to settle their disputes. Not all the patriots were in favor of independence, while some English, even in the military, were sympathetic to the American cause. Against the French, the English and the colonists had once been allies.
Both sides, however, were entrenched. The British felt they had already backed down enough with repealing the Stamp Act. It was time to punish the colony, which acted like bullies, into submission. Once the colonists had declared independence, it was too late. The Battle of Bunker Hill and the war did have lessons for the British to learn. They did. In the next century, Britain would keep Canada, and acquire one of the largest empires in history.
Q. Colonial marksmen could hit targets at 200 yards, you note, impressive for smooth bore muskets. The American sharpshooter – Natty Bumppo and Sergeant York are examples — is legendary. Why do you think Americans were good at it? Does this skill suggest anything about American national character?
A. Americans have a relationship with the wilderness and the sea, almost spiritual, in which handling violence is at the core of American experience. Every farmer had a gun and knew how to use it for hunting and protection. Like the whalers from Nantucket, Americans wrested a bounty from nature through skills in using tools, such as musket and lance.
No doubt, marksmanship from ordinary citizens helped devastate British professional soldiers taking the heights at Bunker Hill. When Americans moved westward, they brought those skills, which helped them conquer a continent.
Q. George Washington praised the poetry of Phyllis Wheatley, the African-American woman slave freed by a Boston family. Other blacks fought and died under his command. Yet Washington and Jefferson owned slaves. Did excluding blacks from liberty undercut the American Revolution?
A. When the monument for the Battle of Bunker Hill was commemorated in 1843, John Quincy Adams complained that the work of the American Revolution was not complete, not until the emancipation of slaves in America.
Washington and Jefferson saw the inconsistency of proclaiming freedom for their citizens, but excluding blacks. If American patriots of 1776 or 1787 had settled the slavery issue, it could have avoided war in 1861.
Q. Henry Ford knew how to build automobiles, but considered history bunk, useless. Are there lessons from the Battle of Bunker Hill that apply to our times?
A. The Battle of Bunker Hill may teach us how messy and difficult life is. The people we meet in 1775 are full of petty jealousies, concerns, flaws and failings. Joseph Warren, a physician, volunteered to face the British regulars at Bunker Hill and was killed. Henry Knox, a bookseller, brought cannon 300 miles to force the British to evacuate. In many ways , they were ordinary men, but they were moved to join in a great historical event, a milestone of human development.
The patriots of 1775 are not unlike who we are today. We Americans are not done yet with our Revolution. We keep trying, to realize its ideals and our purpose. | <urn:uuid:c960243e-9e7b-485b-bea2-50d938b80d80> | CC-MAIN-2022-33 | https://belmontonian.com/tag/one-book-one-belmont-2014/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.974226 | 1,168 | 3.09375 | 3 |
PARIS — French satirical weekly Charlie Hebdo will publish a provocative cover with a Kalashnikov-toting “god” character Wednesday for a special issue marking the one-year anniversary of a January 7 terrorist attack on its offices.
The cover, released on Monday, depicts a bearded figure whose robe is spattered with blood, running while carrying an assault rifle. The headline reads: “Un an après, l’assassin court toujours” — or, one year later, the assassin is still on the run.
The character, who also wears a triangle-shaped hat with an eye in its center, does not explicitly refer to a single religious figure. The hat is a winking reference to Masonic imagery and possibly conspiracy theorists, who published skeptical accounts of the Charlie Hebdo attack, in which 12 people were killed, just days after the murders.
However, the overall message is clear: Charlie Hebdo, in keeping with French traditions for no-holds-barred satire and aggressive anti-clericalism, is blaming religion for terrorism.
You may like
In an op-ed that will appear in Wednesday’s 32-page special edition, Charlie Hebdo owner and editor Laurent “Riss” Sourisseau delivered an impassioned defense of secularism explaining why the paper continued to publish despite the killings.
“In 2006, when Charlie published the Muhammad cartoons, nobody seriously thought this would end in violence,” he wrote. “We saw France as a secular island where it was possible to have fun, to draw, to have a laugh, without worrying about dogmas or fanatics.”
“How were we supposed to keep making the paper after all that happened?” added Riss, who signed the new issue’s cover illustration. “It’s everything that we’ve been through over the past 23 years that fuels our rage to do it.”
“The convictions of atheists and secular people can move more mountains than the faith of the religious,” he wrote.
Riss’ message comes after a year capped by the worst terrorist atrocity to strike France, the November 13 attacks that killed 130 people. Both the January and November attacks in Paris were claimed, or at least partly inspired, by the ISIL terrorist group.
The Charlie Hebdo attacks qualified France as the third-deadliest country for journalists after Iraq and Syria, according to French organization Reporters Without Borders.
The special edition magazine will include illustrations from victims of the Charlie Hebdo attacks, including Jean “Cabu” Cabut, George Wolinski, Stéphane “Charb” Charbonnier, Bernard “Tignous” Verlhac, and Philippe Honoré.
Wednesday’s magazine will also contain contributions from prominent French figures ranging from French Culture Minister Fleur Pellerin to musician Ibrahim Maalouf.
The publication normally sells around 30,000 to 100,000 copies, but the edition after January’s attacks sold around 8 million copies. The publication will print one million copies for Wednesday in anticipation of another sales spike. | <urn:uuid:0ab1cc07-55df-431f-87a3-20e3e1620fd1> | CC-MAIN-2022-33 | https://www.politico.eu/article/bloody-year-charlie-hebdo-blames-religion-anniversary-edition/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.953327 | 656 | 1.609375 | 2 |
Never-Ending Book Quiz
In Pride and Prejudice by Jane Austen, whose name is missing?
"________ began to like them herself, when she saw how much affection and solicitude they showed for Jane."
Choose the correct answer:Mrs. Bennet Elizabeth Mrs. Bingley Mrs. Gardiner
skip question » Ask a friend | <urn:uuid:c2f7454d-a801-4a60-b442-fbc60ecbee42> | CC-MAIN-2022-33 | https://www.goodreads.com/trivia/show/79079-in-b-pride-and-prejudice-1885-pride-and | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.878734 | 80 | 1.796875 | 2 |
Most owners will now be aware of the new energy efficiency legislation that will come into force in 2018. The legislation is called MEES, which means ‘minimum standard for energy efficiency’, which was introduced in March 2015 by EPC Certificate Cost London (private property rental) (England and Wales) Regulations 2015. Most owners will now adopt the new energy legislation know efficiency that will come into effect in 2018. The legislation is called MEES, which means ‘Minimum standards for energy efficiency’, and was introduced in March 2015 by the Energy Efficiency regulations (private rental property) (England and Wales) of 2015.
In short, this new legislation stipulates that from 1 April 2018, building owners who are subject to MEES regulations cannot extend existing leases or grant new leases if the building is less than the EPC London minimum of E minimum. This means that if you rent a property in the private rental sector, you should in principle have an E-class or higher, otherwise you cannot rent it.
So the first thing to do is get your EPC rating. You can find this on the first page of the EPC report. It is likely that if you already rent your home, an EPC has already been sent in the government software. You can verify this by clicking here and entering your zip code and address.
If there is no valid EPC for your property, you must purchase a new one. An EPC report is valid for 10 years and we have consultants throughout the country who can complete the London EPC certificate for you, all at a fixed price depending on the number of rooms, you can find more information about our EPC residential services
Once you have established your EPC classification, this determines whether you should take action. If the number in the EPC report is 38 or less (i.e. band F or G), the energy efficiency of the relevant household must be improved. If the rating is 39 or higher (that is, the E-band or better), you do not need to do anything else to comply with the legislation. You must therefore be in a position where you need to improve the energy efficiency of the building. Which energy improvements will give you the most value for money?
The best value for money is to upgrade an old heating system: it is fairly easy to obtain a two-digit upgrade by installing a modern heating system. Most new boilers come with a 10-year warranty if you choose a decent brand such as Worcester Bosch or Valliant, so choose one of these if money permits.
- Change all the lights in the building with LED lights. This is very cheap, because an LED lamp can now only cost £1, but if it exceeds an EPC score of 37 or 38, it might be rare for you to go to an E-band (39 points).
- Attic insulation is very simple. Even if you buy the insulation online, the material prices are only £ 5–10 per m2. This can again lead to significant improvements in your EPC score. However, it is worth noting that if you already have an attic insulation of 150 mm or more, adding an additional insulation layer will not really increase the rating. If you have less than 100 mm loft insulation, you should definitely consider this.
- There are still some exchanges for power improvements, so you can essentially have them installed for free. This is because the government wants the total energy demand to decrease, so our advice here is to obtain insulation from the wall of the cavity if possible. Normally this is fully funded by ECO and is a quick and easy way to increase the EPC Certificate London rating on the ground; Again, you can increase double digits in the EPC rating if you can.
- The last suggestion may seem a bit strange, but ask a decent company to conduct the EPC investigation. A decent surveyor can enter specific details about your property, which can give you a higher rating. For example: have you ever placed insulation under the floor or insulated a curtain wall? Although most reviewers will ignore this, a decent surveyor will be able to enter this detail into government-approved software, which will therefore provide a more accurate (and usually higher) energy rating.
Click on the link EPC certificate London for more information. | <urn:uuid:c8e10ef1-d973-4afd-8e51-5dfc0b230349> | CC-MAIN-2022-33 | https://www.londonpropertyinspections.co.uk/important-tips-to-register-new-epc-certificate-by-london-property-inspections/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.944599 | 876 | 1.898438 | 2 |
Free download: Barcelona Pavilion from Mies van der Rohe rendered with Cycles
There are several ways to improve your skills on architectural visualization, but practice is one of the most important aspects of fine-tuning your technique. If you don`t have any projects designed by yourself to practice, you can always find some classic buildings with tons of information available on the web to exercise. A couple of days ago an artist posted on Blend Swap a full model of the Barcelona Pavilion from Mies van der Rohe. The model has 23 MB and was all rendered using Blender Cycles. This is a nice example of a classic building that could be used to practice modeling, rendering and post-production for architecture.
If you don`t like the light or textures from claudio andres, which is the author, you are free to change it.
This is a description of the Barcelona Pavilion from Mies van der Rohe for those of you that doesn`t know the project. | <urn:uuid:12e8e1ae-1437-414c-afcc-722579739b9e> | CC-MAIN-2022-33 | https://www.blender3darchitect.com/blender-cycles/free-download-barcelona-pavilion-from-mies-van-der-rohe-rendered-with-cycles/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.914663 | 201 | 1.554688 | 2 |
- What would you do if you had to live with no running water?
- What are all the things that you do in a day that require water? How much water do you need to use for a day?
- Is access to water a human right? What about access to a toilet?
- Whose responsibility is it to provide people with resources like water?
- If you could be a part of solving the water crisis in America, what recommendations would you give?
- Frostenson, S. (2018). America has a water crisis no one is talking about. Vox.com
400 words, APA format, 1 text citation, 1 article
“Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!”
Other samples, services and questions:
When you use PaperHelp, you save one valuable — TIME
You can spend it for more important things than paper writing. | <urn:uuid:d4c17c2e-61be-4986-8017-0740161edc57> | CC-MAIN-2022-33 | https://psychologypapers.net/5bc1a424ab508055/changing-the-water-crisis-in-america | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.934863 | 201 | 2.640625 | 3 |
E3S Web Conf.
Volume 44, 201810th Conference on Interdisciplinary Problems in Environmental Protection and Engineering EKO-DOK 2018
|Number of page(s)||8|
|Published online||03 July 2018|
Potential extreme events in the Polish wind energy sector, based on historical data
AGH University, 30 Mickiewicza Ave., 30-059, Kraków, Poland
* Corresponding author: email@example.com
Wind energy is beginning to play a significant role in the Polish energy sector, in terms of both installed capacity and delivered energy. However, as a highly variable source, wind energy makes management of the power system complicated, especially when extreme events occur. Therefore, the objective of this paper was twofold. Firstly, it aims to simulate the operation of the Polish wind sector based on available satellite-derived wind speed data and the known spatial distribution of wind parks. Secondly, based on the created model and hourly wind speed values covering the period 01.1980–08.2017 we have analysed the statistical parameters of potential wind generation, concentrating mainly on extreme events (such as low generation and ramp rates). The results show that for an installed capacity of 5.8 GW the likelihood of generation going below 250 MWh for 1 hour is 0.26%, and, for 5 hours, is 0.1%. Ramp rates exhibit significant seasonal patterns and the highest (on an hourly time scale) can be as much as 1,295 MWh and -1,698 MWh (up and down, respectively).
© The Authors, published by EDP Sciences, 2018
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while. | <urn:uuid:871457ea-9e88-4fd4-a389-80240f941307> | CC-MAIN-2022-33 | https://www.e3s-conferences.org/articles/e3sconf/abs/2018/19/e3sconf_eko-dok2018_00059/e3sconf_eko-dok2018_00059.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.89012 | 521 | 2.28125 | 2 |
Indicators distribution of Chronic Non-Communicable Diseases in adult women beneficiaries and non-beneficiaries of the Bolsa Família Program – Vigitel 2016-2019
Keywords:Social Programs, Inequalities, Health Surveys, Women, Non-communicable Chronic Diseases
Objective: Compare the prevalence and trend of risk and protection factors for Chronic Non-Communicable Diseases among women beneficiaries and non-beneficiaries of Bolsa Família in the period between 2016 and 2019. Methods: This is a cross-sectional and time series study. The gross and adjusted prevalence and prevalence ratios of the indicators for NCDs were estimated with the respective confidence intervals by the model of Poisson regression. A temporal trend analysis was also carried out in which the simple linear regression model was used, with the outcome variable being the indicators and the explanatory one being the year of the survey. Results: Beneficiary women were more exposed to risk factors for NCDs than non-beneficiaries. The adjusted PRs for smokers were 1.15 (1.07–1.24); 1.08 (1.03–1.14) for overweight and 1.09 (1.04–1.14) for obesity, while the recommended consumption of FLV was 0.93 (0.87–0.99); had even less practice of PA at leisure (0.88; 0.82–0.93); more time watching TV (1.08; 1.02–1.13); worse self-assessment of health status (1.12; 1.04–1.21) and had less coverage of mammography (0.80; 0.71–0.90) and Pap smear (0.93; 0.88–0.98). Among the beneficiaries, the trend analysis showed an increase in the prevalence of overweight from 55.9% to 62.6% and screen time without TV from 13.5% to 27.8%. Conclusion: NCDs risk factors were higher among women with Bolsa Família, pointing out the importance of affirmative policies for this vulnerable population.
How to Cite
Copyright (c) 2020 Quéren Hapuque de Carvalho, Ana Carolina Micheletti Gomide Nogueira De Sá, Regina Tomie Ivata Bernal, Deborah Carvalho Malta
This work is licensed under a Creative Commons Attribution 4.0 International License. | <urn:uuid:08afcc78-f755-4561-8b67-eb703934202b> | CC-MAIN-2022-33 | https://preprints.scielo.org/index.php/scielo/preprint/view/1607 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.911586 | 546 | 1.773438 | 2 |
Marsh and Root Construction have won the contract to widen and resurface a section of road. The site manager has identified the following tasks together with the tasks that must precede them and their anticipated durations:
(a) Construct a network to portray the project.
(b) Identify the critical path and hence ascertain the minimum duration for these roadworks.
Comparative financial statements for Weller Corporation, a merchandising company, for the year ending December 31 appear below. The company did not issue any new common s...Jul 19 2021
Assuming that the price of movie ticket decreases $8.00 to $6.00 and quantity demanded increases from 1000 to 3000 thousands a Use the mid-point formula to calculate the ...Apr 15 2020
What are the properties of air at STP?Jul 18 2021
The value of a put rises as the price ofa. a. stock risesb. a call fallsc. a stock fallsd. a call risesAug 23 2020
A person who is a carrier for a genetic trait ________.a. is heterozygous for a dominant traitb. is heterozygous for a recessive traitc. is homozygous for a recessive tra...Jun 26 2021
Two economies Hare and Tortoise each start with a real Two economies, Hare and Tortoise, each start with a real GDP per person of $5000 in 1950. Real GDP per person grow...Apr 01 2020
1. What forms of protection and regulation are imposed by regulators of CBs to ensure their safety and soundness?2. How has the separation of commercial banking and inves...May 18 2020
Revenue from sales of goods and services…………………….. $53,750,000Operating costs and expenses:Cost of products and services sold………………………………… $26,000,000Selling expenses ………...Aug 13 2020
Suppose real GDP is equal to potential GDP. Explain what happens if the aggregate demand curve shifts either rightward or leftward.107) If the money wage rate is constant...Dec 07 2019
What do you understand to be the difference as well as the links between natural rate of unemployment and cyclical unemployment unemployment ? Explain >Jun 08 2021 | <urn:uuid:af958787-bcfc-479b-877c-cf671798b8f8> | CC-MAIN-2022-33 | https://www.mycoursehelp.com/QA/marsh-and-root-construction-have-won-the/115269/1 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.914389 | 451 | 2.015625 | 2 |
A computer program was developed to study the effect of length and distribution of perforated intervals on horizontal wells rates. The program couples a theoretical solution of the productivity index to a multiphase flow model in the horizontal section of the well. Inflow performance curves generated with the program for horizontal wells drilled under various reservoir conditions revealed a direct dependence of well rate to perforated intervals length and distribution, with heel concentrated perforations offering the best yields compared to the toe concentrated perforation or the uniform perforation across the whole length of a well. Moreover, an optimum perforated length that yields maximum production rate was determined.
|Number of pages||23|
|State||Published - 1996|
|Event||Proceedings of the 1996 2nd International Conference on Horizontal Well Technology - Calgary, Alberta, Can|
Duration: Nov 18 1996 → Nov 20 1996
|Conference||Proceedings of the 1996 2nd International Conference on Horizontal Well Technology|
|City||Calgary, Alberta, Can|
|Period||11/18/96 → 11/20/96| | <urn:uuid:12a4c129-5567-4c02-b00a-d128a1afd7ac> | CC-MAIN-2022-33 | https://scholars.ttu.edu/en/publications/effect-of-length-and-distribution-of-perforated-intervals-on-hori | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.845789 | 249 | 1.867188 | 2 |
At the premiere of Rogue One: A Star Wars Story this weekend, Disney CEO Bob Iger said, “It is not a film that is, in any way, a political film. There are no political statements in it, at all.” That cannot be true. Star Wars is, and always has been, inherently political.
It’s impossible to look at any Star Wars film and not realize that it’s packed full of allusions—some subtle and others really really not—that make it clear that the franchise is saying things about what’s good and what’s evil. The Empire is evil in Star Wars, that much is abundantly clear. The mere set-up of a totalitarian state, run by a dictator who has no problems with subordinates being murdered for failure or who approves the building of a space station that can destroy a whole planet, versus a band of rebels trying to restore justice to the galaxy is a political statement. Unless Rogue One isn’t actually about the desperate measures the rebels will take to defeat the Empire, it’s going to be making some sort of political statement.
The Empire, from its first appearance, was clearly meant as a stand-in for fascism. “Stormtrooper” is a name that comes from German troops in World War I and comes up again in Nazi Germany as the Sturmabteilung (“Storm detachment”), the original paramilitary wing of the Nazi Party.
Costume designer John Mollo has said that his directive for the Empire’s uniforms was all about that kind of message. “First of all, he wanted the Imperial people to look efficient, totalitarian, fascist; and the Rebels, the goodies, to look like something out of a Western or the U.S. Marines,” Mollo said of Lucas’ instructions. “He said, ‘You’ve got a very difficult job here, because I don’t want anyone to notice the costumes. They’ve got to look familiar, but not familiar at the same time.’”
In the old expanded universe, writers picked up on the obvious parallels in the movies to expand the ideology of the Empire. The Empire, as outlined in the books, persecuted and enslaved non-humans, declaring them lesser beings. It also had a high degree of misogyny in it. Even though it may no longer be canon, these ideas were, at the time, Lucasfilm approved and, even more importantly, logical extensions of the Empire presented in the film.
Lucas always envisioned the Emperor as a political evil. In 1981, Lucas said that Palpatine “was a politician. Richard M. Nixon was his name. He subverted the senate and finally took over and became an imperial guy and he was really evil. But he pretended to be a really nice guy.” In 2005, talking about the prequel trilogy, Lucas repeated the Nixon comparison, saying, “It was really about the Vietnam War, and that was the period where Nixon was trying to run for a [second] term, which got me to thinking historically about how do democracies get turned into dictatorships? Because the democracies aren’t overthrown; they’re given away.”
In the prequels, Lucas said that one of the questions he was looking at was, “How do you turn over democracy to a tyrant with applause? Not with a coup, but with applause? That is the story of Caesar, Napoleon, and Hitler.” That’s the origin of Padmé Amidala’s infamous “This is how liberty dies: with thundering applause” line.
This is just a smattering of the Star Wars history that makes it clear that it’s always been political. Is it possible to write a movie set in the Star Wars universe that isn’t political? Maybe. But Rogue One isn’t it.
Rogue One’s whole premise is about a ragtag team of insurgents stealing the plans to the Death Star, a space station with the sole purpose of keeping people in line with the fear of genocide. It’s a prequel to Episode IV, which started with an opening crawl about “a period of civil war,” “the evil Galactic Empire,” “the Empire’s sinister agents,” and “stolen plans that can save her people and restore freedom to the galaxy.” A group of people choosing, at great personal cost, to rebel against what is technically the legal authority because they see a great wrong being committed.
“[Rogue One] has one of the greatest and most diverse casts of any film we have ever made and we are very proud of that, and that is not a political statement, at all,” Iger contradictorily told The Hollywood Reporter. While it shouldn’t be a political statement to have a multi-ethnic cast, that’s not the world we live in. It’s a choice that the filmmakers made, on purpose. It has to be on purpose, because the default in Hollywood films is still mostly white. Filling out the hero roles with a diverse cast is a political statement and one completely in keeping with the politics that have always been a part of Star Wars.
Iger’s comments that there aren’t political statements in Rogue One are related to two deleted tweets from Rogue One writer Chris Weitz and former Rogue One writer Gary Whitta. On the Friday following the election, Weitz tweeted “Please note that the Empire is a white supremacist (human) organization.” Whitta added, “Opposed by a multi-cultural group led by brave women.” The response to these almost completely objective truths about Star Wars swelled to last week’s call for a boycott of the movie and the by-now standard hashtag (#DumpStarWars). Iger probably wants to defuse the controversy, which he is at least right in calling “silly.”
However, it’s not silly because there are no political statements in the movie; it’s silly because if you’re just now realizing that there are politics in Star Wars, you have not been paying attention. It’s silly because all of Star Wars is based on the idea of rebelling against an evil authority. It’s silly because of course being anti-genocide, anti-facist, anti-misogynist, and anti-racist shouldn’t be political statements—they should be the default. But they’re not, so Star Wars remains political. | <urn:uuid:8cf8a687-baa1-42a3-89b6-55065adf5153> | CC-MAIN-2022-33 | https://gizmodo.com/star-wars-is-and-always-has-been-political-1790002366 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.959385 | 1,389 | 1.59375 | 2 |
14 August 2022
Extreme heat this year has triggered wildfires, drought, and melting glaciers. It has also revealed shipwrecks, corpses, ghost villages, ornamental gardens, and ancient cities.
China’s low interest rates are failing to spur lending in the economy, creating a challenge for policy makers as they try to bolster the nation’s fragile recovery.
Forced to start picking grapes much earlier than normal because of torrid temperatures, winemakers across France are worrying that grape quality will suffer from the climate-induced stress. | <urn:uuid:0a81a72f-4fba-4dce-b594-57cc3dd5bd9d> | CC-MAIN-2022-33 | http://www.minara.org.za/index.php/486-leadership | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.940207 | 121 | 2.125 | 2 |
You’ve likely heard it more than once: drinking more water will help you to lose more weight. However, does water truly help weight reduction?
The short answer is yes.
Drinking water helps support your digestion, remove waste, and suppress cravings. Drinking water with lemon in it is even better. Read my article about the Benefits of Lemon Water.
Likewise, drinking more water enables your body to quit holding onto water. Ironic isn’t it?
So drinking more water will allow you to drop those additional pounds of water weight.
How to know if you drink enough water
According to the Mayo Clinic, men should generally drink about 13 cups of water a day, while women should aim for nine. But if you want to determine the exact amount you should be drinking by your body weight, it’s easy to do.
Step 1: Take your weight (in pounds) and divide that by 2.2
Step 2: Multiply that number depending on your age
If you’re younger than 30, multiply by 40
If you’re between 30 and 55, multiply by 35
If you’re older than 55, multiply by 30
Step 3: Divide that sum by 28.3
Step 4: Your total is how many ounces of water you should drink each day. Divide that number by 8 to see your result in cups.
How to Know If You’re Hydrated
How do you know you’re sufficiently hydrated? In addition to counting your cups, there are two quick ways to determine if you are getting enough water.
Not to be too blunt, but a good way to determine if you’re getting enough water is to look at your pee in the potty. Yes, I said potty, but if you’re a mom reading this I am sure you’ve said it many times.
The other way to quickly tell if you’re getting enough water is to pinch the fold of your index finger. Hold your finger out flat, and you’ll notice you obviously have extra skin around the joint of your finger. Use your other hand to pinch that skin. If it goes back to a flat, resting position right away then you are hydrated. If you pinch that skin and it stays pinched, or it takes a while to go flat again, then my friend it means you are dehydrated.
Here are some quick tips to drink more water for weight loss.
1: Drink before you eat
Since water is a craving suppressant, drinking it before dinners can influence you to feel more full, in this manner lessening the measure of nourishment you eat. Wellbeing asset site WebMD states that drinking water before suppers brings about a normal lessening in admission of 75 calories for each feast. Drinking water before only one supper for every day would make you ingest 27,000 less calories for each year. Figure it out: You’d lose around eight pounds for every year just from drinking water! Presently suppose you drank it before every supper. Our Gaiam Stainless Steel Water Container is an awesome method to ensure you are getting the perfect measure of water before a supper.
2: Replace calorie-filled beverages with water
Discard the soft drinks and squeeze and supplant them with water to enable you to get more fit. In the event that you think water tastes exhausting, include a cut of lemon. A glass of water with lemon is a formula for fruitful weight reduction on the grounds that the pectin in lemons lessens nourishment yearnings. Figure water doesn’t generally help with weight reduction? Surrender those sugary beverages for only fourteen days and see the distinction.
3: Drink your water super cold
As indicated by the article staff at WebMD, drinking super cold water helps support your digestion on the grounds that your body needs to work harder to warm the water up, in this way consuming more calories and helping you to get thinner. Besides, super cold water is simply a lot more invigorating than water that is room temperature. Our new 32 oz. Stainless Steel Wide Mouth Water Containers consolidate style with usefulness and can eventually give you the devices you have to begin getting in shape and boosting your digestion.
4. Work out a bit longer
Since drinking water counteracts muscle issues and keeps your joints greased up, you can work out longer and harder. Simply one more way that legitimate hydration encourages you shed pounds. Regardless of whether you lean toward Rodney Yee’s quiet direction or Jillian Michaels’ extraordinary push, we have a lot of choices to make your weight reduction system fit your bustling way of life.
Related Post: 6 Amazingly Useful Ways to Drink More Water | <urn:uuid:90d80c93-6231-4832-8c9d-05b3f181593e> | CC-MAIN-2022-33 | https://momalot.com/drink-more-water-to-lose-weight/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.936357 | 978 | 2.125 | 2 |
SAKO Brno To Participate In Establishment of National Hydrogen Mobility Centre
A major project for hydrogen mobility research is being set up in the Czech Republic, involving 16 research organisations and strategic companies across disciplines. The National Hydrogen Mobility Centre will, among other things, support research, development and innovation in hydrogen technologies and contribute to the creation of a hydrogen mobility transport infrastructure. Photo credit: Freepik
Brno, April 8 (BD) – In addition to the City of Brno’s waste management company, SAKO Brno, the founding members of the centre include four universities (Brno University of Technology, Prague’s CTU, the University of Mining, and the University of West Bohemia), international petrochemical corporations such as Orlen and Air Products, commercial vehicle manufacturer Zebra, ADAST engineering, energy experts from EGÚ Brno and other companies.
“We have been offered to become a founding member of this project, which is supported and co-financed by the European Union,” said Filip Leder, Chairman of the Board of Directors of SAKO Brno. “As SAKO Brno will be testing alternative mobility options for its fleet this year, we consider our involvement in the National Hydrogen Mobility Centre to be beneficial. In addition to the grant project, we will support our activities with at least CZK 6 million.”
The project will run for six years. Ten research teams will be set up to investigate the use of hydrogen in mobility. “We expect that SAKO Brno will be actively involved in the thematic area, which will investigate methodological procedures for a comprehensive island solution for hydrogen transport infrastructure and building hydrogen infrastructure for mobility,” added Leder.
SAKO Brno’s activities in the field of hydrogen mobility research fit into the “Green future #2030” initiative, a set of energy and environmental projects which aim to make Brno CO2 neutral, energy self-sufficient and independent of fossil energy sources by the end of 2030 at the latest. Green future envisages the efficient use of solar energy and hydrogen in the city’s distribution system and the complete transition of urban transport to renewable fuels.
“We want the hydrogen electrolyzer to produce hydrogen using electricity from the city’s rooftop solar power plant and power the city’s automobile transport, which will become emission-free, electric or hydrogen-powered within ten years,” said Petr Hladík, 1st Deputy Mayor of Brno.https://brnodaily.cz/2022/04/08/brno/sako-brno-to-participate-in-establishment-of-national-hydrogen-mobility-centre/https://brnodaily.cz/wp-content/uploads/2022/04/lake-shape-hydrogen-filling-station-used-as-concept-illustrate-environmental-friendliness-hydrogen-its-potential-as-fuel-future-3d-rendering-1024x683.jpghttps://brnodaily.cz/wp-content/uploads/2022/04/lake-shape-hydrogen-filling-station-used-as-concept-illustrate-environmental-friendliness-hydrogen-its-potential-as-fuel-future-3d-rendering-150x100.jpgBrnoNewsBrno,News,SustainabilityA major project for hydrogen mobility research is being set up in the Czech Republic, involving 16 research organisations and strategic companies across disciplines. The National Hydrogen Mobility Centre will, among other things, support research, development and innovation in hydrogen technologies and contribute to the creation of a hydrogen...Julie Chretien firstname.lastname@example.org 21 year-old French student currently doing a Master's degree in management and communication in Lyon, France. Always thrilled to learn about new cultures and languages, and also, big fan of foods. Loves cats and karaoke night with friends.Brno Daily | <urn:uuid:a669cc05-7be3-46fd-a79a-5a5726eec8a4> | CC-MAIN-2022-33 | https://brnodaily.cz/2022/04/08/brno/sako-brno-to-participate-in-establishment-of-national-hydrogen-mobility-centre/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.882452 | 862 | 1.828125 | 2 |
A copy of this work was available on the public web and has been preserved in the Wayback Machine. The capture dates from 2022; you can also visit the original URL.
The file type is
Timed automata (TA) have been widely adopted as a suitable formalism to model time-critical systems. Furthermore, contemporary model-checking tools allow the designer to check whether a TA complies with a system specification. However, the exact timing constants are often uncertain during the design phase. Consequently, the designer is often able to build a TA with a correct structure, however, the timing constants need to be tuned to satisfy the specification. Moreover, even if the TAarXiv:2108.08018v4 fatcat:6wtt4lyxqfbufjmkvc3rj2ffp4 | <urn:uuid:2a26ae07-7d88-4b1b-a279-ba029ee1bb6f> | CC-MAIN-2022-33 | https://scholar.archive.org/work/ov4zcqzyj5bhphmwtam5wya35y | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.943842 | 189 | 1.804688 | 2 |
To call the child fighters of Africa “soldiers” is like calling Auschwitz a detention center: It’s factually true, but misses the point. Children have always been victims of war, and child soldiers are not a modern invention. But what we have seen in the recent civil wars in places like Uganda, Liberia, and Sierra Leone is something new. These wars are, first, fought almost entirely against unarmed civilians; they are marked by massacres, not battles. Second, they have no discernible political purpose, unless seizing power, stealing booty, and inflicting terror can be called political, which I don’t think they can. (I challenge anyone to define, or even discover, the political program of Sierra Leone’s Revolutionary United Front.) Most of all, tens of thousands of children, often in their teens but sometimes younger than ten, have been conscripted into these wars, stuffed with powerful drugs, and repeatedly forced to commit atrocities—including mutilation, rape, and murder—against civilians, other children, and even their own families. At the same time, child soldiers are often, themselves, victims of these crimes, with young girls in particular used as sex slaves by the adults for whom they fight. There is good reason why, given the West’s history of colonial exploitation and racism, we hesitate to use the word barbarism in relation to Africa. But in this case that hesitation shouldn’t last too long.
more from Bookforum here. | <urn:uuid:d076c499-b53c-4f34-8e96-012bd2435067> | CC-MAIN-2022-33 | https://3quarksdaily.com/3quarksdaily/2006/04/rule_number_one.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.953771 | 306 | 2.609375 | 3 |
HOME & PARENTS
For the Love of Words
It was a beautiful late August day, and my family and I were headed down the shore for what is likely to be our last day trip of summer. As we drove the familiar roads, we approached a small roadside fruit stand that displayed a standing sign boasting homemade PIES. I could hear my girls begin their plotting in the back.
Later, while sitting on the beach, I found myself amused by their collective pie chant. I turned to my son and asked, “How do you know I love the word pie?”
“Because you have said it a hundred times! And you usually follow it with a list of all the other words you love.”
“Ominous, zephyr, pedantic, tomfoolery, juxtaposition, smarmy, kismet …”
“Okay, okay. I get it. Do you have any words you love?” I ask, hopefully.
“Of course. Circuitous and plethora.”
I immediately turn to the girls. “What words do you love?”
They reply with their favorites: creamy and the ballet move, pas de bourree.
Try it at home
Here I have compiled some of the easiest things you can do to build passion for words in children.
Be a brave role model.
Gush over words.
Often, we gush over good behavior and engagement (keep doing this!), but don’t forget—everyday—to gush over a word you read or hear.
Talk to your children about purposely building their vocabulary.
I have heard people use words and I think, “I want to use that word,” but I am not sure how best to start. So I experiment! I find out the meaning, figure out some appropriate situations for its use, and then off I go.
Try it with a low-risk group first (family and close friends.) The more you say it, the more it becomes your word.
Have words that you own.
If your child does experiment with a word, you could give them a “oh- you owned that word” high five. That evening, over blueberry pie, my daughter asked, “Mom, how do you feel about the word éclair?” | <urn:uuid:e894aee7-086f-4c70-b7d9-546e7ab06fb0> | CC-MAIN-2022-33 | https://cli.org/blog/foster-a-love-of-words-in-your-children/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573667.83/warc/CC-MAIN-20220819100644-20220819130644-00065.warc.gz | en | 0.946706 | 504 | 2.578125 | 3 |
As my herd of Angora goats increased, I eventually got to the point where having them enclosed in the paddock during the day didn’t really provide them with enough grass to eat. I had a pasture on the other side of the house with a lot of grass, but the fences were so poor that I didn’t trust putting the goats there during the day while I was at work, so instead I began herding the goats there for an hour or so after I got home. The goats loved going down to the pasture, but always tried to nip some of our flowers when I drove them through the yard.
The goats instinctively stayed together, and I had a whip that I would snap to get them going in the direction I wanted. I sometimes flicked the whip on a trouble-making goat’s back, I’m sure it didn’t cause them any pain through their thick coats, but it did get their attention.
After a day at work, I found herding the goats in the pasture was a very calming and relaxing activity for me. I remember one sunny summer day, I got tired of standing around, so as the goats were busy grazing, I just lay down on the grass with my hat over my face to shade the sun. I must have fallen asleep, until a curious goat nudged me on the side of the face. I was happy it was a goat and not a bear.
Herding of goats and sheep is one of the most ancient of occupations. I often thought about those ancient goatherds and shepherds as I was out watching over my flock.
The photo shows my father herding the goats back to the barnyard during one of his family visits with us.
View my paintings at: davidmarchant2.ca | <urn:uuid:f699e843-13f2-4638-ba98-22b467a00833> | CC-MAIN-2022-33 | https://davidmarchant.blogspot.com/2021/01/herding-goats.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.989676 | 370 | 2.140625 | 2 |
College of Arts, Humanities, and Social Sciences
The history of technical writing is well established, but the history of its definition is not. Technical writing as practiced today is a far narrower category than what was considered technical writing mere decades ago. One cannot easily trace this organic focusing of definition back directly to individual thinkers and scholars. Despite this, individualized historical arguments on technical writing remain useful in demonstrating a pattern of evolving academic thought on the subject. Using selected accounts from conference presentations and scholarly articles published from the 1960s to the 1980s, this paper argues that, over time, technical writing’s definition narrowed from covering all texts on technical topics to defining a specific rhetorical category characterized by clarity, flexibility, and- a proximity to the technical fields. Contemporary articles demonstrate that this more exact definition brought with it, a new academic appreciation for technical writing as a legitimate and freestanding field of writing.
"Outlining the Definitional History of Technical Writing Through Contemporary Scholarly Voices,"
Perpetua: The UAH Journal of Undergraduate Research: Vol. 5:
1, Article 4.
Available at: https://louis.uah.edu/perpetua/vol5/iss1/4 | <urn:uuid:870eff2b-340f-428c-8704-1cddbf31ac07> | CC-MAIN-2022-33 | https://louis.uah.edu/perpetua/vol5/iss1/4/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.897125 | 276 | 2.1875 | 2 |
The include (or require ) statement takes all the text/code/markup that exists in the specified file and copies it into the file that uses the include statement. Including files is very useful when you want to include the same PHP, HTML, or text on multiple pages of a website.
What are the ways to include file in PHP?
The Include() function is used to put data of one PHP file into another PHP file. If errors occur then the include() function produces a warning but does not stop the execution of the script i.e. the script will continue to execute. First of all we create a PHP file. Suppose that we created a file called csharpcorner.
Where do I put my PHP code?
A PHP script can be placed anywhere in the document. The default file extension for PHP files is ” .php “. A PHP file normally contains HTML tags, and some PHP scripting code.
Can you include PHP in HTML file?
At first point, this can seem complicated, since PHP and HTML are two separate languages, but this is not the case. PHP is designed to interact with HTML and PHP scripts can be included in an HTML page without a problem.
How can I add HTML code in PHP?
As you can see, you can use any HTML you want without doing anything special or extra in your PHP file, as long as it’s outside and separate from the PHP tags. In other words, if you want to insert PHP code into an HTML file, just write the PHP anywhere you want (so long as they’re inside the PHP tags).
HOW include external PHP file in laravel?
Use an external PHP file in Controller
- Just include the class with PHP functions like include() or require() – and don’t forget app_path() function: …
- In composer.json file you just add needed files in “autoload” section – in a new entry called “files”: …
- Autoload the whole folder in composer.json.
What is $_ request in PHP?
PHP $_REQUEST is a PHP super global variable which is used to collect data after submitting an HTML form. The example below shows a form with an input field and a submit button. When a user submits the data by clicking on “Submit”, the form data is sent to the file specified in the action attribute of the <form> tag.
How do I test locally in PHP?
This is the manual installation method:
- Download the files. Download the latest PHP 5 ZIP package from www.php.net/downloads.php.
- Extract the files.
- Configure php.
- Add C:php to the path environment variable.
- Configure PHP as an Apache module.
- Test a PHP file.
Can you test PHP without a server?
You can make a PHP script to run it without any server or browser. You only need the PHP parser to use it this way. This type of usage is ideal for scripts regularly executed using cron (on *nix or Linux) or Task Scheduler (on Windows). These scripts can also be used for simple text processing tasks.
How do I include an external HTML file in HTML?
How TO – Include HTML
- The HTML. Save the HTML you want to include in an .html file: content.html. …
- Include the HTML. Including HTML is done by using a w3-include-html attribute: Example. …
- Include Many HTML Snippets. You can include any number of HTML snippets:
How do I convert HTML to PHP?
What you’ll learn
- Install and Setup XAMPP (web server)
- Convert Single Page .html Website into .php.
- Convert Multi Page .html Website into .php.
- Setup Automatically Changeable Year with PHP.
- Display IP Address of User.
- Create Standard PHP Template.
- Create Reusable PHP Files.
- Dynamically Highlight Menu on Active Page.
How does HTML interact with PHP?
PHP processor scans the page, line by line. It build a processed HTML page. If it finds HTML, it passes that on as part of the processed HTML page it is building. If it finds PHP scripts, the PHP processor may or may not output HTML.
What is the difference between include and include_once in PHP?
This is a behavior similar to the include statement, with the only difference being that if the code from a file has already been included, it will not be included again, and include_once returns true . As the name suggests, the file will be included just once.
For this you need to follow the following steps:
- Step 1: Filter your HTML form requirements for your contact us web page. …
- Step 2: Create a database and a table in MySQL. …
- Step 3: Create HTML form for connecting to database. …
- Step 4: Create a PHP page to save data from HTML form to your MySQL database. …
- Step 5: All done! | <urn:uuid:fad484bf-4d3b-4489-8a9b-0a40d8081d8d> | CC-MAIN-2022-33 | https://solution4magento.com/java/what-is-way-to-include-external-code-in-php.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00265.warc.gz | en | 0.848488 | 1,152 | 3.09375 | 3 |
What is the difference between a camping sleeping bag and a sleeping bag for hiking? In general, camping bags offer plenty of room to move around, while backpacking bags are lightweight and comfortable. If you are going to use one bag for both activities, choose a backpack style because you need it to be lightweight if you are going to carry it in a backpack.
Cusco is a city in the mountains of Peru with 3,399 mt. above sea level, therefore it is a city where it is quite cold compared to other cities in the north or jungle of Peru. The tours offered by the city of Cusco are the Inca Trail to Machu Picchu, Lares Trek, Ausangate Trek, Salkantay Trek, etc. They are walks that in some sections reach higher temperatures than in the center of the city.
Because you can always unzip a bag that feels too hot, you should choose a sleeping bag with a lower temperature rating than the lowest night temperature you expect where you plan to camp. If you are going to use your bag in the colder months of the year, look for bags that can withstand lower temperatures.
All that said, keep in mind that temperature ratings, which are based on an “average sleeper,” primarily allow you to compare bags against each other. A wide range of other factors affect how you will actually feel once you are outdoors: your sleeping pad, what you wear to sleep, humidity and wind, your metabolism, and more.
In general, campers want bags that offer ample room to stretch out and roll over, which is why many camping bags have a simple rectangular design. It’s hard to predict if you feel a bag is roomy enough without having to zip it inside a bag. So it’s a good idea to “test” different bags to see what styles of bags are most comfortable for you.
The big choice here is whether you want an insulated bag with down fill or synthetic fill.
A note on the ethical pen: Most brands take steps to control the treatment of ducks and geese that provide pen. You can identify a bag from one of those manufacturers when you see it labeled RDS (Responsible Down Standard) or TDS (Global Traceable Down Standard).
Sleeping Bag Shells: The outer fabric, which is made of durable polyester or nylon, has a durable water repellent (DWR) finish to protect the insulation inside the shell from moisture. Inside the bag, you will find materials with a soft and warm texture.
Sleeping Bag Hood: A tight hood can make a bag much warmer, so you are more likely to find hoods in bags with lower temperature ratings.
Zipper Features: Getting a bag with more than one zipper slider makes it easy to adjust the ventilation. In addition, some bags prevent the zipper from snagging by protecting the zipper with a protector along its entire length; others address the problem with a cover for the zipper itself.
Stash Pocket: Some bags offer a handy zippered stash for things like a watch or lip balm.
Stuff Bag: A sleeping bag stored in a stuff bag will take up less space when you put it away. Storage
Sack: Leaving a permanently flattened bag inside your stuff bag is tough for insulation, which is why many bags also come with a large mesh or cotton.
Sleeping bag liner: Sliding down a soft sleeping bag liner inside your bag helps keep it clean and adds extra warmth when needed. Camping in hot weather? Skip the bag and sleep on the liner. | <urn:uuid:70c719b6-9c45-4c0f-8b08-811d56849e0a> | CC-MAIN-2022-33 | https://incatrailexpeditions.com/blog/how-to-choose-a-sleeping-bag-for-hiking/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.936342 | 742 | 1.625 | 2 |
For this assignment, you will have the opportunity to review basic strategic management concepts using the free textbook, Absolute Essentials of Strategic Management (ProQuest), (Links to an external site.) which is available through the Hunt Library. You will need to be logged into ERNIE to access this material.
Define the listed concepts below and then provide a personal example of how this specific concept would be used. Please do not copy the definitions word-for-word. The information in the textbook should be paraphrased in your own words and cited and referenced as a paraphrased information (in APA format) and not as direct quotes.
Your response for each of the concepts below should be written in one (1) paragraph-long response. Please make sure each concept answer is identified so your instructor knows which specific concept you are addressing.
Define Strategic Management.
Define Strategic Planning.
Define Continuous Improvement.
Define Competitive Strategy.
The total length of this assignment should be a minimum of one (1) full-page (combined total for each one of the four strategies answers/paragraphs). | <urn:uuid:1b7eb52e-7428-4e7b-918c-1436f4783d55> | CC-MAIN-2022-33 | https://fountainessays.com/strategic-management-concepts/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.904568 | 230 | 2.1875 | 2 |
Soul food recipes continue to get accustomed to healthier consumer lifestyles. With the past reputation of high calories, salt and fat content, this tasty southern cuisine is taking on a consumer friendlier changing. Now you’ll find better cooking techniques, healthy ingredients and natural herbs and seasonings. To the delight of health professionals and medical experts, soul food cooking is lighter in calories, fat and salt than traditional recipes of fat loss products ..
If you shop every week, you’re already each morning swing of ensuring to be able to at least a week’s supply of food to get a cat. All you need how to live a healthy lifestyle do end up being to purchase higher healthy food instead.
Kids today may ‘t be eating now than kids did during days gone by. In fact, in many cases, they eat a bit less. It is what you eat which induces the problems. Healthy snack recipes packed at home consisting of carrot sticks, a ham sandwich on whole wheat bread, an apple, and cash for a carton of two percent milk isn’t as exciting to be a fast-food hamburger, medium order of fries, and a twelve-ounce cola offered at the school cafeteria. Most kids go for that burger without a second inspiration.
Eat which means that that give you pleasure, however in limited amounts. One cannot deny the simple fact eating delicious food is really a very sensuous experience. There isn’t any no point cutting out good healthy food recipes if planning to feel miserable about that. You’ll just end up overeating in compensation which means you might also eat small quantities of the favourite details.
Substituting healthy food recipes to lose weight is an unique way for to reduce calories and fat matter. Examine your favorite recipes by having an eye to substituting lower fat versions of a little of the features. Instead of using butter try vegetable oil spread. And plain, fat-free yogurts create a nice in order to sour ointment. You don’t truly give your current favorite foods, just change them.
Numerous possess shown that visualization a great extremely effective tool will be used by professional athletes, celebrities, millionaires, and successful people all the walks of life. Perhaps it is really effective although it taps in the emotional involving your ruling. Perhaps visualization is technique of implanting your success within your unconscious mind. Carl Jung said that our unconscious mind communicates with our conscious mind through pictures or images, not through words. Health and Fitness have have created that picture in mind it commonly be installed to dependable back up whenever knowing or must see it again. It serves once your motivation, your inspiration. Are usually can see something, then can think it and a person achieve this can.
Creating your dog’s favorite meals through great dog food recipes isn’t only useful- it can be super fun as properly! Bring your fellow animal owners over and make fun and yummy treats together. Initial scratch . know, companies be holding more from the festive “canine food cook downs” for some time. Enjoy! | <urn:uuid:d7bd9581-8f59-48c7-9c1d-0651d8978229> | CC-MAIN-2022-33 | https://www.chefcoo.com/a-simple-healthy-cooking-planner/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.951309 | 633 | 1.726563 | 2 |
What is Blepharospasm, Hemifacial Spasms, and Bell’s Palsy?
Blepharospasm, hemifacial spasms, and Bell’s palsy are three disorders that affect the nerves and muscles of the face, particularly those surrounding the eye. Blepharospasm and hemifacial spasms cause uncontrolled twitches. Bell’s palsy induces severe muscle weakness. At SightMD, we offer complete care for these conditions. We always begin with conservative treatment, such as BOTOX® Medical injections. However our doctors can also provide surgery to treat more severe cases. Thanks to our careful diagnosis, personalized treatment, and advanced technology, you can experience long-lasting, if not permanent, relief.
When to see a doctor
Uncontrollable blinking and eyelid movement are all characteristics of Blepharospasm and while the condition does not threaten your ocular health, it can be very irritating. Although the exact cause is unknown, some experts believe it may be a genetic condition affecting patients of all ages. It is more common in women between the ages of 45 and 60. The condition can often be exacerbated by stress, bright lights, and reading.
Hemifacial spasms cause involuntary twitching on one side of your face. These spasms usually start near your eye and with time reach the mouth. Like blepharospasm, the condition is not painful and does not threaten your health. It can cause discomfort and feelings of self-consciousness. The exact cause of this disorder is unknown. Doctors believe that facial injury, tumor, or a blood vessel encountering a facial nerve are all possible causes.
Bell’s palsy is typically a temporary disorder. It causes extreme muscle weakness and drooping on one side of your face. Your smile may appear crooked, and, in some cases, you may not be able to fully close your eye. Although the exact cause is unknown, many experts believe this condition stems from inflammation of the facial nerve, or a viral infection.
What are common treatment options
BOTOX® and Dysport® are the most common and effective treatments for both blepharospasm and hemifacial spasms. By injecting small amounts of botulinum toxin into the affected area, your doctor can calm overactive muscles by blocking irregular nerve signals. The treatment takes effect within three days, and the results may last up to three months. You may undergo as many follow-up treatments as you need. The desired effects may begin to subside after many years of treatment.
In some cases, eyelid surgery may be the best option for blepharospasm. Doctors will first attempt to treat your condition with more conservative solutions. By removing all or part of the eyelid muscle that is causing the eye to twitch, we can permanently reduce symptoms.
Bell’s palsy typically goes away on its own, although certain medications can expedite your recovery. Steroids can reduce inflammation of the facial nerve, eliminating external pressure. If your condition is caused by an infection, antiviral medications can also enhance your healing. In rare cases, you may require surgery, such as:
Our surgeons are specially trained to treat these relatively rare ocular conditions. They will work with you to select the right procedure to meet your needs.
Contact SightMD today to schedule an appointment with one of our doctors to discuss your vision health at one of our convenient locations! | <urn:uuid:2665568d-36d5-4438-8cbb-4fb8a3f4e894> | CC-MAIN-2022-33 | https://www.sightmd.com/medical-services/eyelid-spasms/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.937768 | 708 | 2.625 | 3 |
Notes on the Geography of China: Jinci
The most important historical attraction near Taiyuan is Jinci, the memorial shrine [or hall or temple] of Jin. It's at the southwestern edge of the city.
The name is ambiguous. Literati have generally understood Jinci to be the shrine of Shu Yu of Tang, founder of the Jin state. Locals, to the contrary, have seen Jinci as a shrine to the Sage Mother, a rain goddess presiding over the on-site springs whose water, flowing into the Jin River, irrigates local fields. From time to time, the preponderance of belief has shifted from one to the other.
The whole subject has been exhaustively studied by Tracy Miller in The Divine Nature of Power: Chinese Ritual Architecture at the Sacred Site of Jinci. As she summarizes the temple's role (p. 19), "Shu Yu of Tang and the Sage Mother are both spirits of Jin; one is the spirit of the political unit that became the Jin state, the other the spirit of the Jin Springs."
There are many buildings on the site. Some are new but others, like this one, are old. The new buildings tend to be clustered in the geometric pattern familiar from Beijing's Forbidden City, but the oldest buildings are not organized in a symmetric lineup along an axis. Instead, they cluster around various springs. Miller argues that this is a strong argument in support of the idea that Jinci was conceived primarily or originally not as a shrine to a political figure but as a shrine to a rain goddess who kept the springs flowing.
Here, from another angle, the hall of the Sage Mother.
The hall was built between 1038 and 1087. A few years earlier, irrigation canals from the Jin River had been extended to cover a greater area. The spirit bridge crosses a channel of flowing from the spring.
Two of the original three springs are still plainly visible. Not so with the central spring, under the pool crossed by the Spirit (or Flying) Bridge.
On the approach to the bridge there is a terrace with four iron statues. Only this one, from 1094-98, is original and was apparently intended to provide protection from floods. The terrace itself was a space for rituals conducted as part of the worship of the rain goddess.
A view of the Sage Mother Hall from behind and above.
Dragons wrap the columns on the front side of the hall. They, too, were intended to help bring rain, and they suggested as well the power of the Sage Mother.
The dragons are different from one another. They are original, too.
A third dragon.
The front porch of the hall is two-bays deep, as indicated by the missing columns.
A painted-clay guardian statue, an original from the Song Dynasty. Note the wind-blown sleeves.
Its companion was made in 1950 and lacks the ferocity of its partner.
The sign over the entrance reads: Sage Mother of Clear Efficacy and Manifest Aid. Such was the goddess's official name after her elevation to the Chinese pantheon in 1111.
And here is the Sage Mother herself. Miller writes that she "emerges not as an adjunct to the state founder but as the central figure of the Jinci cult site, whose primary power lay in delivering much-needed water to an agrarian community" Milles continues: "Her significance in the Ming dynasty lay in the authority her cult held for the network of canal heads who physically distributed water to noble and private landholders according to a set schedule. Even into the twentieth century, canal heads were expected to pay homage to the Sage Mother annually, village by village." Later on, Miller writes, the Sage Mother was "more commonly identified as the mother of Shu Yu," founder of the Jin Dynasty (pp. 10-11). The figure measures 110 centimeters, or 228 centimeters including the throne.
Miller writes of the "legs crossed in front of her in a manner entirely unfamiliar in representations of either popular female deities or images of empresses known from the period. Instead, her cross-legged position resembles Buddhist images but also, perhaps a product of competition between the two religions...." (p. 126)
The sage goddess is surrounded by other clay figures, mostly contemporary with her but a few (including the one of the left here) from the much later Ming Dynasty.
The figure on the right is Ming; that on the left, Song.
Miller, once again: The "attendant figures within the Sage Mother Hall are considered to be some of the best Northern Song-dynasty works extant." (p. 129)
The ridge of the Sage Mother Hall 3; the central kiosk stands over the Eternal Youth Spring.
Balustrade of the Dressing Tower.
A balustrade detail.
The Eternal Youth Spring is the most productive of the trio.
Immediately below the springs, the waters are divided into shares, physically separated as shown here by three holes to one side, seven to the other.
The kiosk in the distance stands over the Perfect Benefit Spring, whose water flows into the Octagonal Pool in the foreground. On the right are stairs leading to the shrine of Shu Yu.
The shrine to Shu Yu of Tang, which was rebuilt in 1770-71. Unlike the Sage Mother Hall, the shrine consists of several buildings along a nearly-cardinal axis.
Musicians in a hall before the Shu Yu shrine.
Miller writes, "For the elite of China, from warlords of the sixth century CE to literati of the seventeenth century, Shu Yu of Tang was the most important deity worshiped at the site of Jinci...The archaeological record suggests that the original fief of Tang was located not in the Taiyuan basin but rather much further to the south.... The Shu Yu Shrine was most likely placed at the site of the Jin Springs in an effort to gain control over the strategically important Taiyuan basin through the support of local spirits" (p. 37). Miller writes, "The reason for building a shrine to Shu Yu at the site of Jinci was most likely because the Jin River was the eponym for the Jin state..." (p. 57).
In the last few decades, Jinci has been greatly expanded with a neatly organized lineup of souvenir sellers.
The entrance has been upgraded with several large buildings along the approach axis, as though the iconography of the Forbidden City has vanquished every other possible architectural idea.
Today, Jinci has what it never before had, the classic processional axis.
A tower around which traffic must circle.
Statuary glorifies the martial past.
A better last look. Out of sight in the foreground is the channel of the Jin River, guarded by its protective deity.
* Argentina * Australia * Austria * Bangladesh * Belgium * Botswana * Brazil * Burma / Myanmar * Cambodia (Angkor) * Canada (B.C.) * China * The Czech Republic * Egypt * Fiji * France * Germany * Ghana * Greece * Guyana * Hungary * India: Themes * Northern India * Peninsular India * Indonesia * Israel * Italy * Japan * Jerusalem * Jordan * Kenya * Laos * Kosovo * Malawi * Malaysia * Mauritius * Mexico * Micronesia (Pohnpei) * Morocco * Mozambique * Namibia * The Netherlands * New Zealand * Nigeria * Norway * Oman * Pakistan * Peru * The Philippines * Poland * Portugal * Romania (Transylvania) * Senegal * Singapore * South Africa * South Korea * Spain * Sri Lanka * Sudan * Syria (Aleppo) * Tanzania * Thailand * Trinidad * Turkey (Istanbul) * Uganda * The U.A.E. (Dubai) * The United Kingdom * The Eastern United States * The Western United States * Oklahoma * Uruguay * Uzbekistan * Vietnam * The West Bank * Yemen * Zambia * Zimbabwe * | <urn:uuid:f4636644-0436-4b38-a9e5-d25cfe6cfa85> | CC-MAIN-2022-33 | https://greatmirror.com/index.cfm?navid=1353&picturesize=medium | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.954641 | 1,635 | 3.21875 | 3 |
Prime Minister Jacobs represents the Caribbean Netherlands at HLPF
United Nations updated on progress of Sustainable Development Goals for 2030
PHILIPSBURG, Sint Maarten—Prime Minister Jacobs recently flew to the United Nations (UN), as part of the delegation in the Kingdom of the Netherlands. She was part of the delegation taking part in the High-Level Political Forum (HLPF). During the three-day visit the Prime Minister attended and presented at various discussions aimed at familiarizing countries with the others’ issues, solutions, and future plans.
“It was very important to be at this Forum. The representation of the Caribbean islands is imperative when discussing the progression of global policies.” said Prime Minister Jacobs. Although the international community is not completely aware of the differences between the Netherlands and the other three Caribbean countries, the HLPF gave the Prime Minister a platform to highlight the vulnerabilities of the Small Island Developing State (SIDS) countries even while being a part of a Kingdom, which many associate solely with the Netherlands.
The days were packed with panels of discussion, presentations, and other smaller networking moments. One such moment was broadcasted live, as the Prime Minister sat in on a round table event with Tajikistan and other representatives from the Netherlands to converse on their joint plan for water conservation.
Prime Minister Jacobs also had the honor officially hand over the ‘SDG Piano’ to the UN. A collaboration between the Kingdom and Sing for Hope, a non-profit US whose mission is to harnesses the power of the arts to create a better world. The piano, painted in the 17 SDG goals, combines the value of art not only as a means of expression and healing but as a diplomatic tool as well with the important educational component of the Global development agenda. “On Sint Maarten we have seen the importance of art, in all its forms, as a means of comfort during this pandemic but also as a serious means of expression and livelihood for our countless artists so participating in this initiative fell very much in line with both my personal but also our cultural diplomacy program” stated Prime Minister Jacobs.
During the HLPF, Prime Minister Jacobs also attended, bilateral meetings with United Nations Office of the High Representative for the Least Developed Countries, Landlocked Developing Countries and Small Island Developing States (UN-OHRLLS), the Ministers of Foreign Affairs of Suriname and Jamaica, and the Minister of Minister for Planning, Economic Development, Climate Resilience, Sustainable Development, and Renewable Energy of Dominica. There was also a technical-level meeting with the Permanent Secretary for the Ministry of Foreign Affairs.
The meetings were fruitful, centering around issues thematic to SIDS including food security, rising inflation and global shortages, trade, and airlift. With some of the countries areas for cooperation in education, training, and sports were also identified. She went on to say, “It was an opportunity to meet other SIDS to share, learn and where possible to collaborate to build new partnerships with regional SIDS and organizations facing similar challenges. We are stronger together, and that can be expanded upon when we convene.”
Each country presenting at the panel put forth their Voluntary National Reviews (VNR), which aims to share best practices and raise awareness for issues that may hinder the steps to implement the country’s SDGs. Attending the HLPF, among other things, involved the Prime Minister presenting the VNR, which was an opportunity to highlighting the effects of climate change on each of the low-lying, coastal countries.
“St. Maarten is particularly vulnerable to increased extreme weather, risks, and vulnerabilities; we are investing heavily in disaster preparedness and disaster risk management. Coming together to draft and present the VNR was an enlightening process giving much insight into each other’s challenges and strengths.” said the Prime Minister Jacobs.
“We are focused on strengthening our greatest asset, our people. Therefore, investing in the equitable development of our population is our priority – reducing inequalities by strengthening education, health and creating opportunities to build the needed human capacity.” said the Prime Minister and Minister of General Affairs, Silveria Jacobs, during one of her addresses. The government has been working diligently to rebuild and strengthen the country of Sint Maarten, as well as solidify its position on a global level.
“As countries within the Kingdom, while we differ greatly in our geographical locations, economic and social capacities, and starting points of the SDGs, the report also identifies our commonalities: Climate change is the main overarching concern for us all, which coupled with Covid-19 has delayed the needed progress towards the goals. Having said that, our ability to combat the effects of climate change, given these significant differences, must be considered when we engage internally with our Kingdom partners. As such, in my bilateral meetings I indicated my strong support for the Multi-dimensional Vulnerability Index, a mechanism being developed by the UN to determine developmental levels more comprehensively and in turn access to concessionary financing.” said Prime Minister Jacobs.
This is an important agenda for our region and more importantly very important to us as Caribbean countries within the Kingdom given that it will consider a wide range of factors besides GDP as a tool within which to frame future global discussions on development policy.
While the SDGs are part of a collective outlook, each country within the Kingdom of The Netherlands is responsible for its individual outcomes. To represent SIDS at the Forum was an opportunity to be vocal about our challenges and provide a framework on how we can further develop.
For more information on the HLPF, please visit the website at https://hlpf.un.org/. | <urn:uuid:75565c13-e485-4d9f-bec6-c1cb0c803c20> | CC-MAIN-2022-33 | https://sxmgovernment.com/2022/07/18/prime-minister-jacobs-represents-the-caribbean-netherlands-at-hlpf/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.961839 | 1,180 | 1.835938 | 2 |
Explore our online programs Financial Accounting and Leading with Finance, and discover how one can unlock important insights into your group’s performance and potential. Quarterly price range meetings, if your company hosts them, can supply perception into the financial health of your organization and the metrics which might be necessary to it. If you’re approaching the subject of finance with little-to-no previous expertise Finance, your first step should be to ascertain a baseline of data upon which you’ll be able to build. One of one of the best ways of reaching this is to consume content material designed and created for financial novices. There are many finance blogs, websites, books, magazines, podcasts, and videos you possibly can flip to study the basics.
For the savvy startup with few different options, angel traders current a huge opportunity for fast progress and shared experience, however the cost is dropping some autonomy in how you run your company. If you’re OK taking Business up a companion for the lengthy-haul, it’s a perk worth contemplating. Family and associates can be a supply of technical or coaching assist. Don’t hesitate to incorporate them in business plans, when acceptable.
Listed Here Are The Advantages Of Multiple Llcs Or Companies For Your Companies
Fortunately, there are numerous good apps available that make a variety of these tasks simpler, from accounting and accepting funds to creating expense reviews. Here are five apps that may assist you to handle your corporation funds. Grab your free copy of the four-Step Roadmap to Biz Finance Freedom to get a begin on your business finance administration system. Of course there are many other business finance matters a business financial coach can cowl Business & Finance with you, as there is an infinite quantity of ways your monetary information can give you the results you want. Many entrepreneurs struggle with the value of economic reviews, principally because they do not understand the way to interpret the information that these stories are conveying. A business finance coach will help you perceive the monetary outcomes of the business.
Canadian segregated fund DAC amortization was lower year-over-yr largely because of unfavorable market efficiency during the first quarter of 2020. Clients continue to prioritize protection for their households, which amplifies demand for our merchandise. During the quarter, the Company issued nearly 83 thousand life insurance insurance policies, an increase of 16% in comparison with the first quarter of 2020. This elevated demand led productivity through the quarter to 0.21 policies per life-licensed consultant per month in comparison with zero.18 within the prior 12 months’s first quarter. First quarter outcomes mirror strong efficiency in the Investment and Savings Products segment and the continued advantage of elevated gross sales and heightened persistency in the Term Life segment.
Get Full Entry To Manchestertimes Com With Packages Starting As Little As $1.Ninety Nine Per Thirty Days!
They are at all times just a phone call away and have a great customer service staff. Eddie Deal and Michelle Foss have been my account executives and I am very happy to work with them. They are very attentive to my wants and work very intently with me to satisfy my accounts.
We offer award-winning on-line programs, multi-course certificates programs, a Bachelor of Professional Studies degree, a Master of Music diploma, and a Master of Arts diploma. We have a full range of accounting bookkeeping companies obtainable to help your corporation wants in Frederick, Rockville MD. Focus your consideration on your work skills and depend on us. The Corporate Finance possibility prepares students for positions in both monetary and non-financial business enterprises in which they might want to make and defend strategic financial selections in capital budgeting, planning, control, and coverage. UCR’s doctoral program in finance provides students with a stable basis within the theoretical and empirical tools of finance. The objective of this system is to arrange students for careers that concentrate on analysis in asset pricing and company finance. Gain the distinctive ability sets that can set you apart as an expert in a particular business area by choosing one or two concentrations.
Getting Started On This Degree
Services are offered for students, college, workers, and various exterior constituencies. Graduates could pursue careers in monetary services, business, well being care, government and non-profit organizations. For even more accelerated growth, you may seek enterprise capital. With the same benefits as an angel investor , these corporations can take your corporation from concept to market in trade for shared ownership. These companies spend money on phases, or “rounds,” placing hundreds of thousands or extra into a company they wish to see develop.
In this session, two CDFIs which are run by veterans, PeopleFund in Texas and The Support Center in North Carolina, will share the weather of their highly successful veteran programs. Each of those CDFIs counts 20% of their small business mortgage portfolios to veterans. Learn what they’re doing, why they’ve been successful, and the way your organization can grow its loan portfolio by replicating components of those packages. This session will cover the range of challenges CDFIs and other mission-pushed lenders face in providing financing to minority-owned businesses, and how to overcome these challenges. | <urn:uuid:027aa763-4759-41fc-894d-a1ed8e90e4f9> | CC-MAIN-2022-33 | https://www.cairnscairns.com/finance-business.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.939624 | 1,064 | 1.632813 | 2 |
Last week I was asked to create some content for an energy provider. It’s not a subject I could write freely about or whip something up from the top of my head so I had to have a bit of a trawl through the internet & pick some brains before I was certain enough to click publish.
Firstly, did you know that 4 million households are living in ‘fuel poverty’ & often having to choose between ‘heat or eat??’ That is almost 5% of our country. Not a fact to be proud of.
On par with costings, green energy is most important for me when searching for a provider.
One of the first things I came across when scrolling the Our Power website was a long list of ways to save energy in a way that was totally understandable. *Helpful when you still blame a baby brain on your 3.5yr old… 🙋🏼♀️
For interesting example-
- Turing your thermostat down by just ONE degree will save you £75. What??!
- Turning off plug sockets rather than leaving them on standby will save you £50. GAH!
- By swapping all your halogen bulbs to LED’s you’ll save £40. Doing it now!?!!!
- By setting your hot water & heating to a timer you’d save £150. Booking a holiday as I type!!!!
- Use a washing up bowl instead of running water, you’ll save £30. As if!!!!
- ONE single minute less in the shower will save you £10. Who needs showers anyway??!!!
- Setting your washing machine to 30degree rather than 40degree will save you £6. And less risk of shrinking your knits… 🤷🏼♀️🙌🏻
Technically, the less power we use, the less money energy companies make but Our Power is Not-for-profit & rather than its earnings being divided between shareholders, they’re invested into low earning communities. Boom.
It is also a registered ‘Living Wage Employer’ which you may have heard me banging on about recently. It’s means that every single one of its staff are paid above the amount it takes to live free of poverty in London or other areas of the UK taking into account inflation, food costs, rent & mortgages etc etc.
This only means you can heat your home & it’s residents happily…
Our Power’s newest project the +IMPACT Tariff lowers its prices the more customers it has & for every new home that switches to the plan, you help heat a lower income or fuel poor house for an extra 54 days of the year. AMAZING.
It probably doesn’t feel very ‘Springy’ today seeing all the obligatory rain pics on my feed but I saw a photo from my camera roll 11 months ago & there was actually blossom in my Orchard meaning it really won’t be long for us. SO, here’s a joint blog post, written by me, but all the important pictures are taken by Tombecause I have no patience & a rubbish camera… & a toddler who will not keep statue still & has even less patience than me.
It reminded ME, that I need to remind YOU how busy the little birds are this month & next, so if you have little toddler fingers willing to work for you, you can promote a happy Valentines to your garden birds & help them raise lots of healthy chicks this Summer.
In February the birds are all scurrying around deciding the best place to raise their future Fluffballs. They’re wondering about this year’s hunk of a Mate & eating as much fat as possible so they’re looking & feeling buff when they finally meet up for that first coffee together…
(Tinder for birds… 👆🏻👉🏻💗😂)
March means more eating, which is where little human hands come in handy. Ha. (This is all me because real life kids make Tom feel 🤮) All the birds are searching for the same thing, food is a bit of a fight, so as a Bird lover/liker, you need to be committed to filling your feeders absolutely, certainly, regularly. Flora treats this as her actual ‘job’ in life & is pretty efficient when it comes to smothering pine cones in peanut butter & sprinkling them in seeds & nuts as well as threading monkey nut after monkey nut onto her twine! (Or her old toast crusts! 👇🏻)
As much food as possible will ensure the birds will be feeling as fierce as can be… (You cannot risk ‘winging it’ if you are a little bird…) (See what I did?? Genius.)
April. Pinterest eat your heart out, NOW is the time for you crafters to leave out your Pom Pom trimmings for nest building. I’ve been doing this for years & see House sparrows & Blue Tits every single year take the offerings but am yet to see one in real life adorned with my neon rainbow fluff. (Fingers tightest this is my year!) Mama birds are now busy busy designing their beautiful nursery’s & getting ready to rest on the nest.
May is l
ith your thoughtful feeding. She lays an egg every single day for up to 2 weeks. I’m tired just thinking about it. 😴💆🏼♀️ After she’s finished, she’ll pluck some feathers from her tummy to keep them super snuggly under her.
If Mama bird has chosen Mr right, he’ll spend his day delivering food to her, *what a dreamboat! She won’t have to move for 2 weeks from her eggs. But probably, he will be quite rubbish & she’ll have to do it all herself, like everything else really! 🤨 (No offence Tom…I’m sure you’ll make a super Husband bird…)
Next we just have to wait for hatchy hatch & I’m hoping we’ll be able to snap some super CUTE teeny babes in the nxt few months & I’ll get to carry on with another instalment of the Little Bird blog… no pressure Tom, but like I said, no patience, annoying toddler etc etc…Make sure you follow his blog Here & his Instagram Here
I think for most of my Florafairweather career (can I call it a career?? 😂 probably not.) *Edit that later!
I think for most of my Florafairweather *career* I’ve been banging on to you about my Tiny House plan. Sell Rose Cottage in all it’s glory, build a Tiny House in our Orchard & live happily ever after with a bunch of ‘freed-up’ money to spend on more animals needing a happier home…
“Simply put, Tiny House Living is a Social movement where people choose to downsize the space they live in to place themselves right in nature. It is about living in a home that generates its own electricity & catches its own water while allowing you to live free from rent, mortgage or utility bills.”
Rose Cottage is absolutely my dream home, (except this one in the next village to us) WOW (but never in this lifetime will I make enough blanket sales for that!!) The thing with living here though is the time it takes to pay its bills doesn’t leave spare for very much else. So, less space inside will mean more time outside which for me & that 3.5yr old little legs of mine is an absolute mantra.
ill be pretty much be self sufficient in every way, it wasn't difficult to figure it out because there's not a vast area to heat, power or even make water travel to. The design is like a modern 'Long House' which Rose Cottage fondly once was nearly 300 years ago! (The cows were downstairs & the people were upstairs. *You can imagine what Sir Dylan said when I brought that suggestion up… 🤨😆🐖🐖🐖)
It seems so simple I'm wondering why the planning office have been baffled by us doing such a thing.
Anyway, in contrast to Rose Cottage now, we have opened up our lounge/kitchen area & added a lot of glass to that end of the new house. It’s only one storey so we will have a vaulted ceiling with roof windows & a glass wall of doors looking out into PigPigs field. I’m pretty set on a kitchen similar to this…
The Velux are absolutely going to ‘make’ the house. Being quite a short chalet style shape could mean the house to be dark but with a full row of them above the kitchen will be JUST beautiful!!!
It’s so so difficult when you have a project ahead of you to know how to tackle things like the amount of daylight that will hit your face throughout the day! **BOOM** enter an app I’ve found purely because of my mistakes in our bedroom extension which I just can’t forgive myself for!!! (WHY oh WHY did we not put a sky light above our shower?? 😪😪😪🤦🏼♀️) If I’d have used the ‘My Daylight App’ by the Velux Group I’d have known earlier that it would make our en-suite magnificent!
When you’ve downloaded the app you add your room dimensions & specifics & it whips up a 3D version in a couple of mins. You then pop roof windows & vertical windows where you want them or where you don’t (just to double check!!!)
After you’ve chosen your flooring & wall colours you can even choose what time of day & year you’d like to see the room, for example, 6pm late summer etc etc… isn’t that amazing??? ☀️☀️☀️ Apart from actually just playing an adult version of dolls houses it’s literally MINDBLOWING to see your room flood with light based on your plans & choices. On the other hand, it might feel too bright for your tired eyes & you need to adjust a window size or loose one from another wall which you just wouldn’t have known to do otherwise.
Now, the icing on the cake, possibly because I’ve never played a video game in my life, possibly because I adore interiors & possibly because on a rainy day what could be better than pretending it’s a sunny day? Virtual Reality glasses… or binoculars as Flora called them!!! You can click to morph your room into VR which when wearing the goggles is just.FABULOUS & now I REALLY can’t wait to get going on the actual reality rather than the Virtual Reality!!! Thank you VELUX for your mindbogglingly brilliant app & thank you in advance to whoever buys Rose Cottage!!!
We are so so excited to be starting our advent at Rose cottage & introducing Flora to the tradition of The Snowman goodies…
For more snowy adventures, click Here ☃️☃️☃️
✨ The evenings are sneaking in closer & the air is creeping cooler meaning I’m becoming a busier blanket builder. It feels slightly odd starting Florafairweather jobs on a dark evening at the moment so with Dylan’s shifts working well last week I’ve been able to grab an hour of sparkling early light every single morning this week.
Monday. Come 6.45am, the light starts to seep in through our Velux roof windows & the toddler wakes up like a tornado. Flora & Dylan bundle up & charge down the fields with the one out of our two dogs racing in front. The number two dog decided to have a lie in with me. I get my wool out while my hair dries & the kettle boils… The sun rises then around 7.50am it has made its way to the window directly above our bed.
I could pretend this was part of our design plan for the new bedroom space at Rose Cottage, but actually, it was by pure chance & has uniquely changed the way I work on a morning & early evening. Having the natural light right overhead is beyond compare to lamplight. It’s far far better for my (**always tired Mama) eyes & means the photos I can take of my blankets rarely need any tweaking or editing.
Tuesday, only a set of Pom poms needed this morning so I whip them up without getting dressed & wait for the gang to get back in! 15 minutes spare to drink my coffee & flick through some colour charts for another blanket I’m starting this week.
Wednesday, Even Velux can’t brighten our room this morning. A faint glow of sunrise hasn’t woken Flora Bee yet so without spoken words, Dylan & me chose to stay in bed. Sometimes wool waits & sometimes looking up is good for the soul, good for the rest of the day & good for your tired husband! **Especially when you catch a glimpse of the neighbours overhead…
Thursday, An hour seems to go so quick this morning when most of it was spent untangling a ball of pink wool!!! By the time Flora & Dylan come back in bringing gifts of pink Anemones & the last of my Chinese lanterns the sun is now dancing on the walls & I’ve opened the Velux to hear some birdsong.
Even my three year old finds it calming & it’s just not a noise you get to enjoy with usual vertical glass.
We’re taking it slow until it brightens up this morning as all I need to do it take some snaps of a blanket later.
Saturday, finally Mother Nature has cheered up for the weekend & I have another sacred hour to catch up on a couple of my Mama blankets. It’s so so pretty this morning I can even get my snaps AND post on Insta pretty much in the same breath! Perfect reason to take Sunday off & enjoy the skies from the opposite side of my Velux!
Sunday afternoon, time to note down some thoughts on our roof windows for a blog I’m working on…
Radiant, refreshing, luminous, sunlit, dreamy… They all describe what I see, but I’ll leave you with this stunner should you need an extra nudge…
Yesterday was spent at Happy Valley’s Wedding Festival in Norfolk, a camping/glamping & wedding venue where numerous little hideaways are tucked between the Pines. It’s created & owned by my super creative & hardworking friends Katy & Scottie, they’re like the real life version of Ben & Holly & here is their little kingdom…
Here’s what you do… (*flower crown is essential.)
Or Chinese lanterns! Which I’m so so pleased I have some growing this year!!! Last year for some reason I only got ONE stem where as every year before that I’ve had hundreds! **anyone know why??! Anyway-I digress…
Simmer for 45 mins on the hob then strain & cool… | <urn:uuid:d8d9674c-3862-40a6-ad44-c49d13e134df> | CC-MAIN-2022-33 | https://florafairweather.com/page/2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.936536 | 3,258 | 1.875 | 2 |
Important Strategies For Improving Your Football Knowledge
Important Strategies For Improving Your Football Knowledge
So you should become a much better lover of soccer however, you aren’t sure where to start? Even though there is lots to learn about the game, with basic advice on understanding techniques you can now be-versed on baseball. If you look for knowledge about the overall game and don’t know how to begin, appearance below for all your answers!
When trying to boost being a baseball gamer, don’t be worried about adding weight on. Except if you are truly small, excess weight isn’t as vital as other factors. Concentrate on power, instruction and agility and you will definitely improve your engage in. Wear a lot of bodyweight and you may lose some advantages.
Constantly perform properly. No matter if you’re in the club, practicing, traveling to some area, or actively playing, remain safe all over the place. Generally dress in the proper protection equipment, irrespective of what you are doing.
An effective soccer idea is usually to always be certain you’re effectively hydrated. Basketball is definitely a fast paced activity and you will get not properly hydrated speedy with each straight down and ownership. As a way to conduct at your greatest, you must make sure you’re drinking water as frequently as possible.
Operating backs are people in the offense. For a running perform, the quarterback may successfully pass the soccer ball to some operating rear who will manage the ball in terms of he could. As soon as the ball is certainly going inside the atmosphere, the operating rear might help shield the quarterback from tacklers or he might attempt to get open to find a pass.
If you would like do well late game, ensure that interval training can be a normal a part of your aerobic. This can be generally switching substantial-speed and reduced-rate laps or timed time intervals inside your total working treatment. Doing this will help you continue a regular energy level during the entire complete activity, which means that mentor can trust you from the fourth quarter.
American citizen baseball is incredibly very much a make contact with sports activity. Due to this, it is very important that gamers put on the right safety gear. By no means get inexpensive or bad top quality when you are acquiring helmets and shoulder joint padding. Lots of long-lasting accidents arise when unsafe items is donned so do not let on your own to be a a part of these figures.
One of the more important matters a receiver have to learn is how you can line up correctly. Should you not line up properly, it can lead to an illegal formation contact. Seven players has to be lined up with the football prior to the snap to get a legitimate thing to occur.
Shuttle runs will boost your capacity to come to a fast end along with improve your endurance and vigor. Begin in a target series and then operate ten yards. Faucet the line. Reverse direction and manage rear for the objective line doing the same thing. Do this every day to your maximum actual capability and history your outcomes in order to be aware enhancements after a while.
Remain hydrated. This goes for methods and activity time way too. You already know that football is extremely actual, and whenever you add intense conditions and perspiration for the mix, you’ve received the potential of a severe dehydration condition. It’s essential to continue to keep drinking water throughout the exercise sessions and also the game titles.
Extend all of your muscle tissues prior to exercising or enjoying a game title and use your defensive devices. Muscles damage is a lot more probably when you commence taking part in before the muscles are warmed up. Basic safety items is required for a explanation. Ensure that your headgear fits nicely since mind injuries continual although enjoying baseball can be very dangerous.
When kids enjoy baseball, ensure that they are secure. As a result of violent the outdoors and the volume of players, basketball tends to cause plenty of injuries. These can incorporate minimal discomfort and 비트코인 카지노 soreness, and also traumas like pulled muscles, foot sprains, damaged bone, concussions, and torn ligaments. Several of these can be avoided by having little ones dress in appropriate products, play by the regulations, and use proper techniques.
Mental ability is also a big part of as a soccer legend, not only physical instruction. Know the game like the back of your hand. View old tapes of more mature, vintage NFL video games to understand the fundamentals which might be disregarded today. Anticipation in the rival and strategic techniques are features that famous baseball players had.
Should you be a quarterback, discover how to check the defenders the two still left to proper and directly to still left. Numerous quarterbacks will only skim from kept to correct. By modifying your check patterns you will keep your protection on their feet rather than permit them to blindside from the still left over and over again.
Keep control over the golf ball by working to get yardage. You may possibly not acquire as much territory jogging the tennis ball however you are a lot less prone to turn the tennis ball onto one other staff. Blend transferring plays to hook the safeguard off guard and get more yardage. Very good blocking with the offense allows the quarterback plenty of time to toss the tennis ball accurately.
View and gain knowledge from the best. Remember to keep your vision wide open for abilities and methods that you could gain knowledge from. If you have any sort of inquiries relating to where and how you can make use of 비트코인 카지노, you could call us at our web-site. If you are viewing a soccer activity, view exactly how the specialists shift and study from them. You may use your powers of viewing to discover abilities from competition and staff buddies around the industry.
Wonderful basketball players should build lateral speed. Training drills that improve speed like a regular a part of your routine. Setup a pair of half a dozen outlines with 3 cones every. Then move sideways on the cones with two speedy steps. Make sure you lift the knees great along the way over the cones.
As you now look at this wonderful article about football, you can see how it can be broken down and refined so many people can understand it greater. It merely requires a dedication to gather in just as much understanding of soccer that you can experience. By looking at these tips they have provided that you simply great time frame to figuring out this often complicated online game. | <urn:uuid:ac20e7b3-6861-4c6c-a69f-89c8ba20dacb> | CC-MAIN-2022-33 | https://kmmi.ipb.ac.id/2022/06/23/important-strategies-for-improving-your-football-knowledge/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.952694 | 1,355 | 1.890625 | 2 |
2003 MARC Conference
Validity and Accommodations: Psychometric and Policy Perspectives
August 4 and 5, 2003
University of Maryland, College Park, Maryland
A conference hosted by the Department of Measurement, Statistics and Evaluation and the Center for the Study of Assessment Validity and Evaluation, University of Maryland. Supported by the Maryland State Department of Education. Organized by Dr. Rebecca J. Kopriva, Dr. David E. Wiley, Dr. Phoebe C. Winter, and Dr. Robert Lissitz, Department Chair, University of Maryland.
Dissatisfaction with the validity of test results for an increasingly diverse population of test takers has led to the widespread use of testing accommodations. These accommodations adjust testing conditions with the goal of increased validity of scores for accommodated test takers. Major questions about testing accommodations are
- What are the effects of testing accommodations, in general, and of specific accommodations, in particular, on score validity?
- Since accommodations are assigned to test takers, are the assignments appropriate, in the sense that other assignments or other accommodations would not improve score validity more?
- Are scores resulting from accommodated testing comparable to other scores? If so, in what sense and to what degree?
State and district experts in psychometrics, measurement systems, English language learners, and students with disabilities will pose these questions and others to the conference presenters. It is anticipated that conference presentations will include discussions about:
- New psychometric models and concepts addressing the validity and comparability of accommodated and non-accommodated scores.
- New approaches to assigning test takers to accommodations.
- Legal and policy foundations of accommodation theory and practice.
- Methods for evaluating the validity of accommodated scores.
- Accommodations in test design and construction: building accessibility into the development of tests.
Edward Haertel, Stanford University, and David E. Wiley, University of Maryland
Comparability Issues when Scores are Produced under Varying Testing Conditions.
Robert Mislevy, University of Maryland
A Structural Perspective on Accommodations and Validity Arguments
Eva Baker, UCLA, Director of CRESST
The Push-Pull of Policy and Technology in Accommodations Design and Interpretation
Mark Reckase, Michigan State University
Some Hints about the Validity of Inferences from Accommodated Tests from the Study of Tests in Multiple Languages Administered in Multiple Cultures
Guillermo Solano-Flores, American Institutes for Research
Examining the Dependability of Performance Measures for English Language Learners
Martha Thurlow, University of Minnesota
Policy Pushing Practice: Steps Forward in Addressing Testing Accommodation
Gerald Tindal, University of Oregon
Test Accommodations Research: Decision-making, Outcomes, and Designs
Rebecca J. Kopriva and Phoebe C. Winter, University of Maryland
Designing and Modeling Test Item Schemes to Preserve Construct Validity of Test Scores across Students
Arthur Coleman, Nixon Peabody LLP
Legal Foundations for Good Educational Policy Decisions: Understanding How Multiple Federal Laws Guide Accommodations Decisions Affecting Students with Disabilities and English Language Learners | <urn:uuid:26fb345e-40e3-4572-b244-8ed79d417a34> | CC-MAIN-2022-33 | https://education.umd.edu/research/centers/marc/workshops-and-conferences/past-conferences/2003-marc-conference-0 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.871865 | 673 | 1.601563 | 2 |
Helping you progress Fair Work
The concept of Fair Work may not be familiar to all employers which is why the Fair Work Convention in 2016 set out a helpful Framework explaining the dimensions of fair work (effective voice; opportunity; security; fulfilment and respect) and how they can be achieved. Fair Work aims to balance the rights and responsibilities of employers and workers and generates mutual benefits for individuals, organisations and society, such as increased participation in work; improved productivity in the workplace; wider distribution of wealth within local communities.
Scottish Enterprise, in conjunction with the Scottish Government, Fair Work Convention and other partners, have developed this tool to help employers understand and fully embed the dimensions of Fair Work. It will support your organisation to take the next step on your Fair Work journey.
Progressing Fair Work wherever you are
- Quick questionnaire assessment
- Personalised feedback, advice & actions
- Graphic report – visually see the spread of your progress to date
- Compare your progress with previous assessments and your peers
- Accessible from desktop, tablet & mobile | <urn:uuid:9cac95c7-f1b1-456f-b70e-241ee4b74978> | CC-MAIN-2022-33 | https://fairworktool.scot/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.915575 | 213 | 1.90625 | 2 |
By Jeffrey Moyo
– With droughts wreaking havoc in vast areas of Zimbabwe, a majority of people here are fast falling in line with climate-smart agriculture (CSA) as food deficits continue.
CSA is the agricultural practice that reduces exposure, sensitivity or vulnerability to climate variability or change, which is a result of technologies that sustainably increase productivity and support farmers’ adaptation to climate change.
According to Environment Africa, an African-rooted non-governmental organisation responding to the continent’s environmental and climatic needs, CSA is working to assist Zimbabwe’s struggling farmers.
“Climate-smart agriculture is helping reduce greenhouse gas emissions while affording farmers to cope with changes in the climate and extreme weather events, leading to improved agricultural productivity, incomes and building resilience among resource-poor farmers,” Barnabas Mawire, the Environment Africa country director here, told IPS.
Many remote farmers like Livias Gawure from Mwenezi district in Masvingo Province in Zimbabwe are living proof of the success of CSA.
“Drought has become a thing of the past to me after I put into practice every aspect of climate-smart agriculture in order for me to prevail against climate change impacts here in the low veld where we have often had poor agricultural yields,” Gawure told IPS.
“I have become a proud farmer of maize and sorghum including several other small grains crops, which I profitably sell every year despite this region being the dominant area of drought,” Gawure said.
According to the United Nations’ Food and Agricultural Organisation, of Zimbabwe’s estimated 14 million people, more than 70 percent depend primarily on agriculture for their livelihoods but often face low productivity, thanks to the climate change impacts.
“Zimbabweans are generally practicing CSA, one way or the other, knowingly or unknowingly. CSA is being promoted extensively in Zimbabwe, with conservation farming on the forefront. Other CSA practices that Zimbabweans are already engaging in include diversifying into drought-tolerant crop types like small grains and adopting early maturing crop varieties,” David Phiri, FAO Sub-Regional Coordinator for Southern Africa,said.
Some farmers like Gawure in Zimbabwe’s marginal agro-ecological regions have opted to reduce on crops and concentrate more on livestock production.
Such Zimbabwean farmers have however not only diversified into livestock production, but they have also opted for drought-tolerant small livestock like goats and indigenous poultry.
Of this country’s population, approximately 2 million face starvation this year, based on figures from the UN World Food Programme. But as food deficits rise, Climate-Smart Agriculture has apparently become a good alternative for many vulnerable Zimbabweans.
“I should thank climate change lobby groups whose expertise in climate change matters helped us combat climate change impacts, and now through CSA, we are often on top of drought situations, save for a few people who have not put their faith in CSA,” Tambudzai Musina, a 68-year old widow in Mwenezi district, said.
Musina said many indigenous farmers like herself have been forced by climate change impacts to start embracing Climate-Smart Agriculture.
“In order for us to overcome incessant food deficits, we have said yes to Climate-Smart Agriculture, and we are gradually winning against hunger,” she said.
Eager to break free from hunger, many Zimbabwean farmers like Musina and Gawure also say they have gradually turned to water harvesting, terracing, mulching and growing drought-tolerant crops, which are also climate-smart as they battle to enhance their abilities to cope with weather extremes.
“The climate-smart technologies practised in Zimbabwe are not entirely new to the farmers, but they are making more sense to them now than before due to climate change. As a result, the farmers are embracing climate-smart agriculture,” FAO’s Phiri said.
FAO implemented a three-year EU-funded project in selected districts of Zimbabwe’s eight rural provinces. This project ran from 2010 to 2013 scaling up conservation agriculture by smallholder farmers.
Hammered with starvation, Zimbabweans in their numbers have chosen to follow in the tracks of CSA.
“Farmers who have adopted conservation agriculture (CA), for example have managed to achieve decent harvests, unlike those farmers not practicing CA. the same goes for those farmers growing drought-tolerant crop types and varieties. So in terms of household food security, those households adopting climate-smart technologies have managed to become food-secure,” said Phiri.
“Yes, Zimbabweans understand that climate change is real and that their agricultural practices have to change and adopt conservation farming technologies to ensure food security at household level. The majority of resource-poor farmers who have hid the call have completely changed their farming practices and seem to be adapting to adverse impacts of climate change,” said Mawire, Zimbabwe’s Environment Africa boss.
Many farmers like Gawure in Mwenezi district have gone an extra mile in practicing climate-smart agriculture.
“I have constructed water pans to capture surface run-off whenever it rains and like many other farmers here I’m now able to keep farming through small scale irrigation for up to three months after the rains stop,” said Gawure.
Another climate-smart practice that Zimbabweans have employed is agroforestry which entails the growing of trees together with crops such as drought-tolerant maize and sorghum to stabilize and enrich the soil.
Things are improving at the domestic level as well. “There is increased food security at household level, land productivity capacity is being maintained and there is good recovery of degraded land,” said Mawire. | <urn:uuid:05e9bfa3-b861-4ae6-bddd-686df5dfe2b9> | CC-MAIN-2022-33 | https://www.radiovop.com/zimbabweans-align-with-climate-smart-agriculture-amid-food-deficits/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.94457 | 1,219 | 3.109375 | 3 |
By BERNADETTE ANNE MORALES
MANILA — For Mercedes Berioles, 74, typhoon Ulysses (international name: Vamco) is worse than typhoon Ondoy (international name: Ketsana), which submerged Marikina City in flood water in 2009.
“This is worse than Ondoy. The pandemic still rages on, which makes it even more difficult for us,” Berioles, a resident of Barangka, Marikina for the past 20 years, said in Filipino.
Berioles said that she and her family decided not go to the evacuation center for fear of contracting coronavirus disease 2019 (COVID-19).
The same goes true for Jennet Singson, 39. She and her family have opted to stay inside a jeepney as the nearest evacuation center is already full.
“Ulysses is worse than Ondoy. The water rose quickly and it took so long before the flood subsided,” Singson said in Filipino.
Most residents have stayed on their rooftop, waiting to be rescued and needing food, water and other essentials.
According to the local government, all 47 evacuation centers in the city are full.
Marikina Mayor Marcelino Teodoro said that roughly 40,000 homes have been fully or partially submerged.
The highest water level recorded by the local government today was 22 meters as of 11:00 a.m., higher than Ondoy’s 21.5 meters. | <urn:uuid:c38d0414-b24d-4f9e-a891-4b1abecc9a41> | CC-MAIN-2022-33 | https://www.bulatlat.com/2020/11/12/ulyssesph-worse-than-ondoy-marikina-residents/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.950966 | 330 | 1.65625 | 2 |
Synopsis by Bruce Eder
In the 1580s, the Sea Hawks -- the name given to the bold privateers who prowl the oceans taking ships and treasure on behalf the British crown -- are the most dedicated defenders of British interests in the face of the expanding power of Philip of Spain. And Captain Geoffrey Thorpe (Errol Flynn) is the boldest of the Sea Hawks, responsible for capturing and destroying more than 50 Spanish ships and ten Spanish cities. His capture of a Spanish galleon, however, leads to more than he bargained for, in a romance with the ambassador's niece (Brenda Marshall) and the first whiff of a plan to put Spanish spies into the court of Elizabeth I (Flora Robson). Thorpe's boldness leads him to a daring raid on a treasure caravan in Panama which, thanks to treachery within Elizabeth's court, gets him captured and, with his crew, sentenced to the life of a slave aboard a Spanish ship. Meanwhile, Philip of Spain decides to wipe the threat posed by Elizabeth's independence from the sea by conquering the island nation with his armada. Thorpe, though chained to an oar, knows who the traitor at court is and plans to expose him and Philip's plans, but can he and his men break their bonds and get back to England alive in time to thwart the plans for conquest? The Sea Hawk was the last and most mature of Flynn's swashbuckling adventure films, played with brilliant stylistic flourishes by the star at his most charismatic, and most serious and studied when working with Flora Robson, whom he apparently genuinely respected. Boasting the handsomest, most opulent production values of a Warner Bros. period film to date, The Sea Hawk was made possible in part by a huge new floodable soundstage. Another highlight was the best adventure film score ever written by Erich Wolfgang Korngold; and the script's seriousness was nailed down by various not-so-veiled references not to 16th century Spain but 20th century Nazi Germany. The movie was cut by over 20 minutes for a reissue with The Sea Wolf, and the complete version was lost until a preservation-quality source was found at the British Film Institute. Since then, that 128-minute version -- which actually contains a one-minute patriotic speech by Robson as Elizabeth that was originally left out of U.S. prints, as well as amber tinting in all of the Panamanian sequences -- has become standard.
bad-guy, capture, conquest, duel, escape, espionage, freedom, high-seas, Navy, pirate [seafarer], queen [royalty], sea-battle, slavery, swordfight, villain, war
High Budget, High Production Values | <urn:uuid:c161845f-1cda-4ec2-93e9-9ac42fa1af32> | CC-MAIN-2022-33 | https://www.allmovie.com/movie/v43317 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.962677 | 577 | 1.726563 | 2 |
Obesity is a global pandemic, currently affecting around 150 million people in Europe and 650 million people worldwide. Obesity complications are common, in fact obesity is associated with some 200 complications, but we cannot yet predict who will develop the complications of obesitybe affected. Moreover, there are no predictors for who will respond to obesity treatments. SOPHIA will therefore identify and characterise clinically-meaningful subpopulations of patients with obesity using the right treatment for the right people at the right time. The research group will use this knowledge to change how the world talks about obesity based on new understandings and a new vocabulary. It all starts with obesity being a chronic disease, not something people choose to live with. Some of the methods used in SOPHIA will be:
- Creating a database
- Conducting analysis
- Talking to patients to learn about what they fear and hope when it comes to obesity treatment
- Finding a shared value with all stakeholders to ensure better treatment of people living with obesity.
Twenty-nine leading international players from academia, industry and civil society have joined forces to find better solutions to alleviate the burden and consequences of obesity. The project is supported with funding of € 16 million from the Innovative Medicines Initiative (IMI), a joint undertaking of the European Commission and the European Federation of Pharmaceutical Industries and Associations (EFPIA), T1D Exchange, JDRF, International Diabetes Federation (IDF), and Obesity Action Coalition. | <urn:uuid:919f6fd6-b97f-4c6b-82c2-955daf78c42a> | CC-MAIN-2022-33 | https://imisophia.eu/our-project/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.918294 | 302 | 2.671875 | 3 |
about iwrm project
Mano River Union Ecosystem Conservation and International Water Resource Management Project
The IWRM project targets the conservation and sustainable use of the transboundary water basins and their
biodiversity resources within the Mano River Union member states. It is being implemented in the Upper Guinea forest covering Sierra Leone, Guinea, Liberia and Cote d’Ivoire. | <urn:uuid:ab1dbd70-1627-470d-81ca-d1ed5733ba29> | CC-MAIN-2022-33 | https://iwrm.fda.gov.lr/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00265.warc.gz | en | 0.769847 | 99 | 1.929688 | 2 |
Kangaroo word: indentation
Joey word: dent
Definitions in relation to their use in kangaroo words, taken from Google Dictionary, and edited for formatting.
indentation (noun): a deep recess or notch on the edge or surface of something.
dent (noun): a slight hollow in a hard, even surface made by a blow or by the exertion of pressure.
The letters D, E, N, and T found within the kangaroo word “indentation” arrange in the listed order to complete the joey word “dent”. While a word can have multiple definitions, in relation to their use with kangaroo words, these two words share a similar meaning: a dint. | <urn:uuid:905c27ea-4742-4628-b0eb-e86544460147> | CC-MAIN-2022-33 | https://kangaroowords.com/indentation/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.898131 | 169 | 3.4375 | 3 |
The size of the global digital signage market was estimated at $22.7 billion in 2020 and is likely to reach $38.47 billion by 2026, growing at an annual rate of about 9% from 2021 to 2026.
Digital signage or digital signage is an electronic screen that advertises content, broadcast data, television programs, and other content. Digital signals use various technologies, such as LEDs and LCDs. They are found both in private institutions and in public places such as retail stores, restaurants, and businesses.
Digital signage relies heavily on hardware components to ensure the delivery of high-quality content. These screens have substituted conventional screens with large LED and LCD screens, used in various industries. They are created for applications that need suppliers to use their customers/audiences with their widest angle of view and derive maximum effectiveness from marketing messages.
The growth of transportation networks, public infrastructure, and new commercial buildings, especially in developing economies, creates immense opportunities in this business. Digital signage is used in different modes of public transportation to grab the attention of viewers on the go, offering real-time location and awareness related to traveler information and advertising. Additionally, it is rapidly becoming the norm in many educational institutions, schools, and corporate campuses facilitating digital signage systems.
In September 2018, CTL, a prominent company in EdTech personalized learnings, in partnership with NoviSign, a software provider in digital signage, introduced a special Chromebox CBx1. It provides screen content control along with dual-band Wi-Fi, USB-C output and custom libraries.
December 2018: LG Electronics India recently launched curved OLED signage. The firm used about 63 custom curved OLED panels for this signage.
December 2018: A strategic collaboration of Leynard and Planar & Lighthouse Technologies (Hong Kong) was announced to implement LED video display solutions for the sports and entertainment sector, an instance of a specific product application.
Market growth and trends:
Reducing the price of LED/LCD systems is the main factor that helps you penetrate the fast-growing regions in the world. In addition, in the retail space, LED-based signage offers durability and robustness in addition to increased visibility, compared to traditional luminaires. The rapid fall in prices for LCD screens has led to an increasing number of digital signage installations.
Depending on the installation, different screens are preferred. Small and medium networks mainly prefer LCD/LED. Users looking for large screens choose large screens because of the better video clarity. LCD screens function better in terms of power usage and maintenance costs, especially on large screens.
In addition, there are many advances in the digital signage technology that sign makers pay attention to. These include high-resolution LCD and LED message screens, which have iPad control and programming, emergency alert systems linked directly to FEMA-managed Integrated Public Alert and Alert System (IPAWS), and live RSS feed for news and the weather.
Another major trend is the direct view LED displays to develop an impressive experience. LED direct vision panels are highly personated and can implement experiences that surround the audience or create architecturally alluring focal points. Adoption was faster in indoor situations, due to the need for a closer viewing distance. A good sign of the trend is that Watchfire is seeing more conventional LCD video walls replaced by tighter pixel LED panels. Facilities are also beginning to recognize that LED panels offer high-quality resolution and can be brought and used for much less than the size of television screens.
Market Drivers and Restraints:
Lower screen costs and better customer experience are the driving forces behind the global digital signage market. Furthermore, the development of government agencies, as well as the rapidly growing education sector, are contributing to the growth of the market. Technological developments, including near-field communication, are likely to create greater opportunities. The introduction of touch screen technology should open new avenues. The growing demand for bright and energy-efficient display panels, rapid digitization, and declining demand for traditional display panels are the factors driving the growth of trends in the global digital signage market. However, the deployment of large-screen alternatives like projectors and screenless displays and the lack of standard policies and power problems are hampering the growth of the market to some extent. In addition, emerging display technologies like micro-LEDs and quantum dots and the growing demand of electronic giants for large screens provide growth potential for the country's market.
Market Size Available
2020 – 2026
2022 - 2027
By Offering, Product, Location, End User, and Region
Various Analyses Covered
Global, Regional & Country Level Analysis, Segment-Level Analysis, DROC, PESTLE Analysis, Porter’s Five Forces Analysis, Competitive Landscape, Analyst Overview on Investment Opportunities
North America, Europe, APAC, Latin America, Middle East & Africa
Market Leaders Profiled
NEC Corporation, Sony Corporation, LG Electronics, Samsung Electronics, Panasonic Corporation, ViewSonic Corporation, Volanti Displays, iSEMC (HHSD), Koninklijke Philips NV and Planer System Inc and Others.
Digital Signage Market segmentation:
The analysis of the global digital signage market is carried out in different regions, especially in North America, Europe, Asia-Pacific, and LAMEA, among which North America accounted for a significant portion of the world market, and it is expected to follow the same trend during the foreseen period.
North America is likely to dominate the digital signage market during the outlook period, attributing to the availability of market giants in the United States, and due to early adoption and technological advancements. In addition, advances in display technology are also expected to stimulate market demand.
Key players in the market:
The main players featured in the global report are NEC Corporation, Sony Corporation, LG Electronics, Samsung Electronics, Panasonic Corporation, ViewSonic Corporation, Volanti Displays, iSEMC (HHSD), Koninklijke Philips NV and Planer System Inc. These key players have adopted strategies such as product launch, expansion, and partnership to improve its position in the digital signage market.
1.1 Market Definition
1.2 Scope of the report
1.3 Study Assumptions
1.4 Base Currency, Base Year and Forecast Periods
2. Research Methodology
2.1 Analysis Design
2.2 Research Phases
2.2.1 Secondary Research
2.2.2 Primary Research
2.2.3 Data Modelling
2.2.4 Expert Validation
2.3 Study Timeline
3. Report Overview
3.1 Executive Summary
3.2 Key Inferencees
4. Market Dynamics
4.1 Impact Analysis
4.2 Regulatory Environment
4.3 Technology Timeline & Recent Trends
5. Competitor Benchmarking Analysis
5.1 Key Player Benchmarking
5.1.1 Market share analysis
5.1.3 Regional Presence
5.2 Mergers & Acquistion Landscape
5.3 Joint Ventures & Collaborations
6. Market Segmentation
6.1 Digital Signage Market, By Offering
6.1.4 Market Size Estimations & Forecasts (2022 - 2027)
6.1.5 Y-o-Y Growth Rate Analysis
6.1.6 Market Attractiveness Index
6.2 Digital Signage Market, By Product
6.2.1 Single Screen Display
6.2.3 Video Wall
6.2.4 Market Size Estimations & Forecasts (2022 - 2027)
6.2.5 Y-o-Y Growth Rate Analysis
6.2.6 Market Attractiveness Index
6.3 Digital Signage Market, By Location
6.3.3 Market Size Estimations & Forecasts (2022 - 2027)
6.3.4 Y-o-Y Growth Rate Analysis
6.3.5 Market Attractiveness Index
6.4 Digital Signage Market, By End-User
6.4.7 Market Size Estimations & Forecasts (2022 - 2027)
6.4.8 Y-o-Y Growth Rate Analysis
6.4.9 Market Attractiveness Index
7. Geographical Landscape
7.1 Global Identity Governance and Administration Market, by Region
7.2 North America - Market Analysis (2022 - 2027)
7.2.1 By Country
7.2.2 By Offering
7.2.3 By Product
7.2.4 By Location
7.2.5 By End-User
7.3.1 By Country
18.104.22.168 Rest of Europe
7.3.2 By Offering
7.3.3 By Product
7.3.4 By Location
7.3.5 By End-User
7.4 Asia Pacific
7.4.1 By Country
22.214.171.124 South Korea
126.96.36.199 South East Asia
188.8.131.52 Australia & NZ
184.108.40.206 Rest of Asia-Pacific
7.4.2 By Offering
7.4.3 By Product
7.4.4 By Location
7.4.5 By End-User
7.5 Latin America
7.5.1 By Country
220.127.116.11 Rest of Latin America
7.5.2 By Offering
7.5.3 By Product
7.5.4 By Location
7.5.5 By End-User
7.6 Middle East and Africa
7.6.1 By Country
18.104.22.168 Middle East
7.6.2 By Offering
7.6.3 By Product
7.6.4 By Location
7.6.5 By End-User
8. Key Player Analysis
8.1 NEC Corporation
8.1.1 Business Description
8.1.4 SWOT Analysis
8.1.5 Recent Developments
8.1.6 Analyst Overview
8.2 Sony Corporation
8.3 LG Electronics
8.4 Samsung Electronics
8.5 Panasonic Corporation
8.6 ViewSonic Corporation
8.7 Volanti Displays
8.8 Koninklijke Philips NV
8.10 Planer System Inc
9. Market Outlook & Investment Opportunities
List of Tables
List of Figures
Talk to our analyst and get customised report done according to your research needs
Check if you can avail any discount. Submit your details and our team will get back to you.
Request to avail a free sample report that reflects this market and its growth. | <urn:uuid:8b420d89-0dd5-47df-b902-eccfba8b493f> | CC-MAIN-2022-33 | https://www.marketdataforecast.com/market-reports/digital-signage-market | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.850269 | 2,630 | 1.757813 | 2 |
On February 3, 2021, the Pennsylvania Coalition of Public Charter Schools (PCPCS) issued a statement in response to Governor Wolf’s 2021-2022 budget plan, lambasting the Governor’s proposed funding cuts to Pennsylvania’s public charter schools. In short, the Governor proposes cutting nearly $230 million in funding from the schools that serve nearly 170,000 thousand students across the Commonwealth – schools that typically already receive 25% less funding than their “traditional” public school counterparts. In Philadelphia, this would affect around 70,000 charter school students in 85 different schools, who are primarily minority and low-income, and who comprise nearly 30% of all students in the district. The PCPCS characterized this proposal as “Reverse Robin Hood,” in that it takes funding from the already-disadvantaged schools and students and diverts it back into a traditional school system that has consistently failed to educate the city’s children despite operating with a nearly $3.5 billion budget each year. Especially during the Covid-19 pandemic, which has wreaked havoc on the educational experience and academic advancement of low-income and minority students, more support is needed for Philadelphia’s most vulnerable children – not less. During the pandemic, more than 20,000 families left “traditional” district schools to try to access the better-quality experience provided in a public charter school. Governor Wolf proposes to cut the support to these schools in their most vital hour, when families are depending on them the most. This is not in the best interests of the families that helped elect him into office – on the contrary, it will cause them direct and needless harm.
On April 26, 2021, Robert Lysek – CEO of Executive Education Academy Charter School and board president of the Pennsylvania Coalition of Public Charter Schools – published a public statement in triblive.com, reiterating opposition to the Governor’s proposed budget cuts to charter schools. David Rossi, CEO of Esperanza Academy Charter Schools, and Dr. Jon Marsh, CEO of Esperanza Cyber Charter School, also offer their support to this opposition.
David Rossi states:
“A fair funding system for Pennsylvania’s and Philadelphia’s schoolchildren would be a system in which, from both the state and local perspective, schools are funded at an equal rate per student (with potential variability only based on special-needs students). The irony of our current situation is that if school funding in Pennsylvania were truly fair, even more funding would go towards students who attend charter schools rather than less, since they are currently funded at a lower level. The Governor’s approach to education funding does not reflect this already-inequitable reality. The Governor’s proposal hurts low-income communities as well as students of color, the same communities that helped him get elected. No child in the school system of Philadelphia or the Commonwealth should receive less resources and support simply based on which particular school they attend. It is unfathomable to consider cutting education funding for any student in Philadelphia, and this only becomes more evident when considering the COVID-19 pandemic and its effect on all students, especially high poverty students of color. Our schools and students need more, not less, to recover from the damage inflicted this past year.”
Dr. Jon Marsh states:
“When the Covid-19 pandemic first hit, and all schools were advised to close, cyber schools were best positioned to step into the gap and allow children to continue their education uninterrupted. The school has been operating online since 2012, why would we close our “virtual” doors at a time when online education is the only option, and we are needed most? Esperanza Cyber Charter School and many other cyber schools continued to serve our students and families with our online program, while also trying to help our peers and colleagues in traditional bricks-and-mortar schools make the transition to an online format. In the spring, shortly after Governor Wolf announced that schools in Pennsylvania could open virtually, our Esperanza Cyber Charter School, along with over a dozen other cyber schools, offered to assist traditional schools and districts that wanted help moving to online learning.
In 2008, in his book Disrupting Class, the late Harvard Business School professor Clayton Christensen presciently predicted that by 2019 25% of high school classes would be taught online. Professor Christensen foresaw a path where charter schools would lead the way, and school districts would follow. Before the pandemic, few school districts in Pennsylvania had online programs, and even fewer had any evidence it worked. Those of us who work full time in online schools and carefully track our data, outcomes, and impact, know it can and does work. Especially in this time of crisis, cyber schools’ infrastructure and expertise has been vitally important to lessen the harm our children will suffer. Unfortunately, it seems that the Governor is not responding to the needs the pandemic has made even more urgent for our communities, families, and children.”
As noted by the PCPCS, “Charter schools are nonprofit public schools that are independently operated. That means the school’s administration has the innovation, freedom and flexibility to move quickly to meet challenges.” Further, “A recent poll showed that nearly 70% of Pennsylvanians supports public cyber charter schools as an educational option that should be available to families.” Charter schools served Philadelphia’s children better before the pandemic and pivoted immediately after the shutdown to continue serving their students. The case for fair funding for charter schools is clearer than ever.
If you are interested in fighting for fair public-school funding in Philadelphia, please contact Quetcy Lozada at firstname.lastname@example.org to learn how you can get involved. | <urn:uuid:56352828-f8f2-4c07-8d4f-349ed0b919ec> | CC-MAIN-2022-33 | https://www.impactomedia.com/region/public-charter-schools-meet-the-needs-in-north-philadelphia/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.974736 | 1,194 | 1.578125 | 2 |
TED has shared truly magnificent ideas in abundance. This, by Sir Ken Robinson, concerns a bunch of things very dear to me:
He contests that our schools, traditionally geared towards industrial utility, wring the creativity out of children. Of course, that’s not to say that our education system is all bad; I loved an awful lot of it, after all. Nor that it doesn’t teach worthwhile skills or excludes creativity (although it often doesn’t rank too highly in priorities). But Robinson proposes that our education system cannot, as it stands, adequately prepare children for a future that is getting increasingly harder to predict over a progressively shorter timeframe. Creativity is, however, something humans have always needed, regardless of culture, and can only become more important in the years ahead.
A point he raises about the industrialised origins of our modern education system: our education systems train people for work, but why don’t we train them for the rest of life as well? There are some subjects that teach us about the world, our society and a bit about how to live in it, and of course, a lot of stuff useful for work is also useful elsewhere, but when it came to electives, most of us picked subjects that we (and perhaps univerities) considered useful for the work we thought we might like to do. Those didn’t leave much room for anything else, so creativity usually fell to the luck of having the right friends and/or family.
I’ll stop the text equivalent of thinking out loud here and leave the rest to Sir Ken, but would also like to very enthusiastically recommend this wonderful piece of wisdom and inspiration, from Dr Karl Paulnack, which discusses why music matters and discusses how art is an essential part of being human.
Sweat cools in pools across my face and chest, as invisible traffic sighs like rain above the crackling grass. My breath hurls the clutter from my mind like a lover betrayed. The Autumn sky glows, unencumbered.
the creek still and silent
in the dust across the bridge
footprints stop half-way
I feel like I’ve been sitting here for years, in this sheltered patch of green, seeing nothing to go back to, too timid to move on.
silhouettes of ducks
the last dim sunlight
under desperate wings
I speak of isolation to the sunset until the colour drains from the sky, which fills with a flood of fruit bats, too loud, too high, too resolute to hear. The dusk, in its dying breath, says, “go: there’s nothing here but me, and I’ll be waiting wherever you fly.”
from the horizon
blinking lights are rising
to meet Jupiter
An excerpt from this was published at Stylus (April 2009), which prompted me to think about what wasn’t working with the rest of it. This is the first part of the edited version, with two parts to follow.
I want to dance through the kitchen of your dreams.
November’s Beat Street was great fun and the new home – Arch Angel, under the S-Bahn near Alexander Platz – works a treat. The room had an warm and enthusiastic vibe and good accoustics, and if a performer had some impeccable timing, the rumble of the trains overhead could add some magnificent drama.
My set was a mixture of tested pre-Berlin poems, including one of the first I ever performed (A Fantasy in F), and stuff from the last year or so. I opened with To the Edge, which, being an embarking poem, seemed as fitting a place as any to start.
After a sea voyage or two, we travelled through a sinister world below, the romance of a new life in an old world, the unsavoury spectre of Evil Pink Day, inspirations and transformations, obsession via creepy cliché, the desolation of good-bye, and time loss.
It was the first time I’d performed a full set without reading, and I’d recommend it heartily. Not having your hands and eyes occupied with the paper lets you connect so much better with the audience and, I think, put a lot more energy into the performance. Curiously, it’s also a lot less stressful, because you don’t seem as inclined to over-correct. And learning the poems is a good way to pick up anything that isn’t quite working.
Thanks to organiser Rob Grant for the gentle prodding to take the stage, and huge electric thanks to a fantastic audience: it’s beautiful to perform to an audience whose energy you can feel coming back at you. Thanks also to the steady hand of Ash Ilott for the photos here presented. | <urn:uuid:c1d4a17d-847c-4b5d-bbff-33314dcf353f> | CC-MAIN-2022-33 | https://misterocean.wordpress.com/2010/01/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.952183 | 1,023 | 1.921875 | 2 |
The First Personality Reading Based On
The Sacred Geometry Of Your Name Symbols.
Etymologically, one could say that Numerology is a "discourse on numbers" whereas Geonumerology is the science of the link (Logos) that exists between numbers (Numero) and geometry (Geo).
Geonumerology is a discipline that attempts to uncover the deep psychology of an individual through the study of the lines of force present in the symbols of his name and date of birth.
The geo-numerological interpretation is based on the one hand on psychology of geometric shapes of the number and on the other hand on its location within the matrix (or tree) of the Three Worlds (Spirituality).
Thought brings out the idea of form, highlighting the link between mind and matter, the invisible and the visible. The symbol suggests the idea.
Unlike other symbols such as chemical symbols or musical notes, geometric symbolism is the only one that corresponds to nature itself, to the very structure of the universe.
True universal language, esoteric symbolism is like an absolute reflection of nature and its laws, not an invention.
Geonumerology is therefore a mixture of numerology and geometry.
In this way, it allows the number to be represented, to make it visible in space, to give it shape, to grasp its lines of force. It is only after having drawn it that the interpretation of the number takes all its meaning and begins to reveal its secrets.
Each symbol has :
Example with the three symbols of number 4
We saw previously that the number 4 had three unique geometric decompositions prior to its reduction.
By applying the existing correspondences between numbers and archetypal forms (a point for 1, a line for 2, a triangle for 3, a square for 4), it becomes possible to geometrically re-compose the number from very few elements.
As you can see, the number 4 is not necessarily a square, as classical numerology would suggest. The interpretation therefore varies according to the decomposition: a tetrahedron 4 is completely different from a square 4, for example.
Construction grids used to represent number 4
The three interpretations of number 4
The body of the symbol symbolizes the mother figure used for the drawing :
Energy is the relationship between two poles, it takes the following forms:
It is mainly characterized by the mode of perception of external events and way of processing information:
Spirit ~ Soul ~ Body
Each of the symbols of geonumerology can be described using three criteria:
The psychological interpretation used in geonumerology is based on the comparative anatomy of the symbols in your profile.
By studying the shape of the symbol, the family to which it belongs, its orientation or its degree of composition, it becomes possible to correctly interpret the number to which the symbol is attached.
For example, the mental type (triangle) will adopt a process of evaluating facts and making judgments based on objective criteria. The emotional type (circle) is more likely to focus on personal values or what their intuition tells them. As for the instinctive type (square), this does not mean that it is a thick brute, on the contrary, the intelligence of the instinctive type is very well adapted to the business world for example.
Through these three centers, the human body captures and transforms the energy of the cosmos.
Every human being is capable of receiving, processing and transmitting information from these three centers, but during his evolution, the individual will tend to favor one of these three centers, a dominant of action which will be expressed primarily : Vital (or instinctive), Emotional or Intellectual.
Concerning introversion and extroversion, which both correspond to the two universal forces of attraction and expansion, where as the alchemists say to coagulation and dissolution (solve and coagula), we must not forget that the result of this double energy is the creation of a third one: transmutation, or integration.
Archetypes of personality
Pauli, one of the fathers of quantum physics had a decisive participation in the reflection of Jung's theory of the collective unconscious (Theory of the Unus Mundus) in which he introduced the notion of archetype as coming from the human tendency to use the same "form of psychic representation given a priori".
The archetype can thus be considered as a "thought form" already registered in a human collective and which would even act as a founding principle of its tradition.
If one tries to get closer to physics one could say that the archetype acts as an attractor of any other "thought form" that comes close to it.
The vibrations emanating from each symbol tend to find another similar vibration to merge with it. All creatures, by the vibrations and wavelengths that are theirs, resonate with other beings, other entities and other forces in the universe that have the same wavelengths, the same vibrations. | <urn:uuid:a8ab5782-e53b-4d8c-89cf-d4387912a98e> | CC-MAIN-2022-33 | https://geo-numerology.com/from-geometry-to-psychology-2 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.932592 | 1,053 | 2 | 2 |
Last week, I shared some of our favorite Lunar New Year children’s books. I found several lunar new year books for the younger crowd to0. These Lunar New Year books for babies and toddlers are perfect for introducing the Chinese New Year to your little ones.
Don’t forget to read to the end for a board book giveaway!
When author Joyce Wan reached out to me about reviewing her newest book My Lucky Little Dragon, I was captivated by her artwork. A quick look at Wan’s website revealed that we already had her book You Are My Cupcake on our bookshelf. My sister gave it to Jaxson last year. My Lucky Little Dragon has the same fun, whimsical illustrations for each animal of the Chinese zodiac. Wan even created a chart to discover what your animal is.
Karen Katz is another talented writer and illustrator who has written numerous multicultural books for babies and toddlers. My First Chinese New Year shows a little girl’s wonder as she and her sister prepares for the upcoming new year. You’ll learn about lunar new year traditions and why we wear the color red on this holiday.
When my kids were little, they loved books with pop-ups and flaps to flip open. Actually, they still like those types of books. Lucky New Year! by Mary Man-Kong will keep little hands busy with all the interactive flaps and exciting pop-up illustrations.
We enjoy Grace Lin’s books so much, I’m surprise we don’t own more of them. Thank goodness for the library! Red Is a Dragon: A Book of Colors will teach your kids about color by showing them different items from the Chinese culture including dragon dances and firecrackers, iconic images for the Lunar New Year.
With flaps and rhymes, Dragon Dance: A Chinese New Year Lift-the-Flap Book by Joan Holub shows how families prepare for the Chinese New Year. Visit the outdoor market to lucky red envelopes, little readers can “help” prepare by lifting the flaps.
I’m glad to have found Lunar New Year books for babies and toddlers. It’s never too late to learn about new cultures and holidays!
This post contains affiliate links. I received a copy of My Lucky Little Dragon for review. Winner will be notified via email and must respond within 24 hours to claim their prize or another winner will be chosen. I’m Not the Nanny is not responsible for lost, late, or misdirected packages. | <urn:uuid:48c451be-5062-4f8a-9f58-83c8ba532495> | CC-MAIN-2022-33 | https://www.imnotthenanny.com/2014/01/lunar-new-year-books-for-babies-and-toddlers.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.941763 | 526 | 1.90625 | 2 |
Dealing with the Past: Transitional Justice and De-communization
MetadataShow full item record
This chapter reviews the literature around the study of post-communist transitional justice. It begins by comparing how different scholars have conceptualized transitional justice, particularly the range of empirical phenomena that authors have decided to encompass when they have dealt with truth and justice issues. Secondly, the chapter shows how, depending on an author’s empirical delineation of the phenomenon, the independent variables chosen across time or across countries have also varied. Thirdly, the chapter turns the methodological equation around and examines those (albeit far fewer) scholars who have examined transitional justice as a causal phenomenon and sought to answer what transitional justice actually brings to society. Lastly, the overview presents a set of sub-themes in the field of post-communist transitional justice, namely the comparative study of institutions devoted to TJ, the growing importance of international influences on TJ, and the place of specifically post-conflict TJ in the context of former Yugoslavia. | <urn:uuid:1d3510ac-c340-44fa-89c7-057df78e1668> | CC-MAIN-2022-33 | https://dspace.ut.ee/handle/10062/63157 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.917084 | 229 | 1.867188 | 2 |
Data Visualization for LEW
Within the research project “Datavisualisation for LEW (Lechwerke)” we, a group of six students in communication design and interactive media, did new concepts for non-commodity products. The challenge was to define a consistant visual appearance/language, storytelling and interaction for print and digital media.
We created a concept based on the usage of graphical elements and visualisations. The aim was to show seven different houses for seven products. To give every house its own personality, we used different architecture and in addition to that, we designed characteristics and semantic, narrative things for each house, to visualize its residents – without showing people.
We also put a storyline into the editorial design: First we´d like to show the product and its specific features. After that we’d like to inform about how it has to be installed in the basement/on the roof or together with the existing housing technology. Afterwards the visualisation shows the usage of the products and the financial advantages and necessary investments.
The result is a series of printed brochures and a digital web application. Every brochures shows and explains a specific product and provides all necessary information. The digital web application underlines the consistent concept and supports the story and information through interactive elements.
The project started at the end of 2014 and was finished at the end of 2016.
Those results were also used for the LEW fair stand as well as at the flagship store in Augsburg. | <urn:uuid:45810e03-b2b8-4884-bf3d-35ca3506e4eb> | CC-MAIN-2022-33 | https://www.lisaborgenheimer.com/portfolio/data-visualization-for-lew/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.939085 | 307 | 2.046875 | 2 |
GRADE 1 CREATIVE WRITING
NEW from June 2020 onwards!
Contains 1 workbook (Young Creative Writers Grade 1). No lesson plans are required.
Extra WORKBOOKS are available to order separately for SIBLINGS or ADDITIONAL students.
The Love2Learn Grade 1 Timetable for English allows for a 15-minute creative writing session once a week (Thursdays), so you will have sufficient time to enjoy this subject as part of your English lesson.
This Love2Learn course will gently hold your Grade 1 child by the hand and lead them through some of the very important first steps in expressing their thoughts and spoken words in written form. 18 enjoyable lessons (of approx. 15 minutes each) to develop an enthusiastic young writer.
(Note: From June 2020, this creative writing component of English is sold separately to the main subject.) | <urn:uuid:a7c4b505-5e69-473a-af33-5261659ba80e> | CC-MAIN-2022-33 | https://love2learn.co.za/shop/grade-1-creative-writing-13373 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.931588 | 178 | 2.140625 | 2 |
We envision an ethical digital world that is inclusive, transparent, and safe. We work with people and communities to remove barriers to digital freedom and to create empowered digital citizens across the globe.
We bring together ordinary citizens, lauded experts, policy makers, and futuristic thinkers to debate what it takes to create an equitable, inclusive digital future.
The Avast Foundation works in partnership with people and communities to knock down barriers to digital freedom and equity. Our programs deliver meaningful change and help shape a world where technology plays a positive role in building and sustaining communities. | <urn:uuid:97560efe-95a6-407f-88b9-5ec7f7165011> | CC-MAIN-2022-33 | https://foundation.avast.com/?_ga=2.43923621.1234184301.1638272476-1896131647.1638272476 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.911118 | 111 | 1.820313 | 2 |
And Then God Created the Middle East and Said ‘Let There Be Breaking News’
About the Book
‘You may wonder why the Middle East gets so much airtime. Well, regions of the world were competing to host the apocalypse and the Middle East won.’
Online sensation Karl reMarks disagreed with the idea that reality had become too strange to satirise. Then he read that bin Laden was radicalised by Shakespeare. Since then, Karl has been bringing the best of the Middle East news and views to his followers around the world.
Now Karl’s wildly wry observations and sketches are available in one handy collection. With sections on ‘Geography for Dummies’, ‘Democracy for Realists’ and ‘Extremism: A Study’, alongside the best of Karl reMarks’s infamous ‘Bar Jokes’, this hilarious book proudly presents views you’re guaranteed not to hear on the news …
We’re actually very proud of God in the Middle East. He’s the local guy who went on to acquire international fame.
Wahahahahabism: A fundamentalist Middle Eastern comedy movement.
Twelve people just started to follow me. Jesus.
About the Author
Karl reMarks is a Middle East political and cultural online commentary with frequent forays into satire. It is written by Karl Sharro, whose work has been featured in the BBC, Al-Jazeera, The Economist, Ted-X Talks, Wall Street Journal and Guardian among others. In 2016 Karl’s video, ‘the simple one-sentence explanation for what caused Isis,’ went viral, with 1.6 million views on Facebook alone. Alongside his role as a satirist and commentator on the Middle East, Karl has practised architecture in London and Beirut.
'Side-splittingly funny' The Economist
‘A hilarious little flip-book filled with [Sharro’s] short musings and amusing drawings on the state of Middle East chaos. … perfect for the coffee table or for bathroom flipping … guaranteed to make you chuckle’ Jerusalem Post
‘An acerbically wicked collection of sharp geo- and sociopolitical commentary … droll, smart, witty’ Media Diversifed
‘Satire is only funny if it’s partially true. This book is hilarious. Need I say more? ... Absolutely recommended reading.’ Eyes on World Cultures
‘One of the funniest yet politically insightful works I have seen in a while … This little book is also important to show that Twitter is not a new communication tool but a new medium that shapes our way of thinking and expressing.’ Ece Temelkuran | <urn:uuid:85158f89-c411-4a94-bba5-0368e2d46e26> | CC-MAIN-2022-33 | https://saqibooks.com/books/saqi/god-created-middle-east-let-breaking-news/?add-to-cart=210 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.91157 | 577 | 1.757813 | 2 |
Personal care is a critical need for seniors and the disabled. Services like hair care, nail care, and massage can have a significant impact on the overall well being of the elderly, yet many seniors don’t know that senior-focused personal care providers exist.
One reason for this may be the generational gap. During the Depression era, it was unthinkable for people to spend money on personal care, and as a result, many seniors have never received services like a manicure, pedicure, or massage. Additionally, with the onset of old age, many seniors find it difficult to take care of themselves as they formerly did. Recently, while at a care facility, I removed the socks of a client and found that the end of her big toe had a huge scab on it. I asked what happened and she replied, “I just couldn’t see it.” While trying to trim her nails she cut off the end of her big toe.
Many seniors don’t know that senior-focused personal care providers exist.
This type of accident is easily avoided by routine care from a trained professional. Monthly nail care helps to keep feet and hands healthy, and massage can also benefit seniors and the disabled immensely. Many seniors and the disabled spend a lot of time in bed, sitting in a chair, or using handicap support tools that put a strain on their back and shoulders. They can develop muscle stiffness and pain from not using their bodies. Massage can relieve the pockets of stiffness in the neck, back, and shoulders, and make it easier for seniors to participate in daily activities. For people with neuromyopathy diseases such as Parkinson’s, massage can give them much needed temporary relief from stiffness, and support them in their daily activities.
For most of us, personal care is an activity that we take for granted, but for people who cannot get to a salon or who are in so much pain due to muscle stiffness that they are unable to get out of bed, this personal care can significantly improve their quality of life. | <urn:uuid:5fcb77c8-311a-4e59-9dc8-8a1f87bb88bb> | CC-MAIN-2022-33 | https://sranw.org/quality-of-life/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.976227 | 419 | 2.140625 | 2 |
Despite the official non-discriminatory policy in the US, the signs of discrimination among Asian Americans and Pacific island Americans are evident. The two aforementioned minority groups consistently report higher poverty rates, lower education opportunities, and an ongoing segregation. Close examination of government policies, model minority, and perpetual immigrant stereotypes explain the reasoning behind their racial experiences.
specifically for you
for only $16.05 $11/page
The twentieth century government policies allowed for legal discrimination of Asian Americans and Pacific island Americans, propagating economic disadvantage, political, and social violence. Though legally protected from violence, modern minority groups still face inequal treatment (Turner and Aguirre 265). Government policies in the field of education put quotas on Asian Americans and Pacific island Americans in college (Turner and Aguirre 266). Disproportionate numbers restrain minorities from holding governmental positions and get elected to political office.
The myth of model minority placed an unrealistic cultural expectation on Asian dreams, portraying them as perpetual foreigners who were expected to achieve success rapidly. Erasing the fact of racism against Asian Americans and eradicating the struggle for racial justice, model minority ignores the diversity of individual characteristics among the minority group (Turner and Aguirre 267).
Those people who do not live up to the standards of model minority are considered as disadvantaged and face discrimination at school and work (“Christopher Columbus. Native Americans. One Word. Cut,” 0:48-00:55). Perpetual immigrant stereotypes communicate the identity of Asian Americans and Pacific island Americans as intruders who are neither welcomed nor wanted in the US, regardless of their professional, cultural, and historic contributions.
A Black/White binary refers to the claim that US society consists of only two true racial groups (the Black and the White). The lack of mere recognition of other people of color substantially limits the protection of their rights and equal treatment in society (Turner and Aguirre 272). In my opinion, the Black/White paradigm promotes racial experiences among minority groups, depreciating authentic cultural differences, prevalent among Asian and Pacific island Americans.
“Christopher Columbus. Native Americans. One Word. Cut.” YouTube, uploaded by Cut, 2015. Web.
Turner, Jonathan H., and Adalberto Aguirre. American Ethnicity: The Dynamics and Consequences of Discrimination. 7th ed., McGraw-Hill Education, 2010.
100% original paper
on any topic
done in as little as | <urn:uuid:76d65e39-1189-4ba9-a1cb-3c85635e1d11> | CC-MAIN-2022-33 | https://studycorgi.com/the-racial-experiences-of-asian-americans-and-pacific-island-americans/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.897967 | 516 | 3.265625 | 3 |
This video says about itself:
UAE secret prisons and torture revealed
13 October 2015
Whistle blower: UAE Torture Survivors reveal cases of enforced kidnapping, arbitrary detention, secret prisons and torture.
By Lamiat Sabin in Britain:
Thursday 29th October 2015
Government urged deals with brutal police
THE government supported a two-day arms fair hosted by Dubai police that ended yesterday, despite reports of Emirati officers torturing people including British citizens.
UK Trade and Investment (UKTI), a government department, organised a reception at the British embassy in Dubai for businesses selling drones and spy equipment to the human rights-abusing United Arab Emirates (UAE).
Meanwhile, British citizen Ahmad Zeidan, 22, has been tortured and imprisoned in the UAE for two years.
Police in the Emirate of Sharjah found 0.04g of cocaine — with a street value of around £3 — in the glovebox of a car in which he was a passenger.
A really different quantity of drugs compared to the 2000kg at the plane of that Saudi royal prince. A plane in which that prince was not just a passenger; a plane which he owned.
He was then forced to sign a “confession” in Arabic, a language he cannot read.
He was never offered the services of an interpreter before being given a nine-year sentence and threatened with the death penalty.
In Dubai Central Jail, around 75 per cent of prisoners report having been tortured into “confessing” through the threat and use of violence including electric shocks, research by human rights group Reprieve has found.
Lending credence to these reports is the revelation that Dubai police have requested “electronic public order equipment” from British suppliers.
Reprieve says it has previously raised concerns with UKTI about its support for Emsec which, this year, ended on the same day that the UAE expected to be re-elected to the UN human rights council.
The government spent £12,000 of public funds to encourage British firms to attend last year’s event, according to information obtained by Reprieve through a freedom of information request.
There is “growing pressure on the Tory government for more transparency” over “close connections” with human rights-abusing nations such as the UAE and Saudi Arabia, Campaign Against Arms Trade spokesman Andrew Smith told the Star.
The British government should make clear that it wants no part in such abuses, she insisted, and should “demand the release of victims like Ahmad without delay.”
This video says about itself:
‘Crystal clear case for Tony Blair war crimes in Iraq’
25 October 2015
Amid the rhetoric surrounding the conflict in Syria, former UK Prime Minister Tony Blair admitted that there are ‘elements of truth’ in the accusation the intervention in Iraq in 2003 was one of the main causes for the rise of Islamic State. He made this comment in an exclusive interview with CNN. Neil Clark, journalist and broadcaster joins RT for more.
By Solomon Hughes in Britain:
Friday 23rd October 2015
The article — like all of Hollingsworth’s stuff — was well worth reading.
The Sunday Times also made available the full bid document which was the basis of the story — and it is worth a second look. It is a brochure of everything that was reprehensible about Blair.
In the “Letter of Proposal,” Tony Blair Associates show that they intend to sell all the contacts made by a Labour prime minister to an ugly repressive regime.
It leads with a mix of management-speak and flattery. Blair’s personal foreword says: “The world is opening up fast. New countries are emerging as places of political and economic interest.
“The UAE has benefitted from strong leadership. It is respected and relations with it coveted. So there is a big opportunity for it to build its brand and reputation, and to establish powerful networks of influence.”
The “strong leadership” of the United Arab Emirates is rich in oil, but poor in human rights.
Torture is a very personal business for the Emirates rulers. In 2009 a leaked tape showed Sheikh Issa — a member of the ruling family and brother of the current UAE president — torturing a grain dealer over a business deal.
This video says about itself:
Torture Tape Implicates UAE Royal Sheikh (NEW PICTURE NEVER SEEN BEFORE)
5 May 2009
A video tape smuggled out of the United Arab Emirates shows a member of the country’s royal family mercilessly torturing a man with whips, electric cattle prods and wooden planks with protruding nails.
An investigation into a savage torture by a royal family member of a close ally.
A man in a UAE police uniform is seen on the tape tying the victim’s arms and legs, and later holding him down as the sheikh pours salt on the man’s wounds and then drives over him with his Mercedes SUV.
In a statement to ABC News, the UAE Ministry of the Interior said it had reviewed the tape and acknowledged the involvement of Sheikh Issa bin Zayed al Nahyan, brother of the country’s crown prince, Sheikh Mohammed.
“The incidents depicted in the video tapes were not part of a pattern of behavior,” the Interior Ministry’s statement declared.
The Minister of the Interior is also one of Sheikh Issa’s brothers.
The government statement said its review found “all rules, policies and procedures were followed correctly by the Police Department.”
The Solomon Hughes article continues:
Sheikh Issa had the tape made in 2005 so he could watch the torture later. The sheikh, helped by a policeman, beat his victim with a plank with a nail in it, used a cattle prod, a whip.
The man’s torture on the desert sand began with the sheikh firing live rounds from a rifle around him, and ends with running him over with a Mercedes 4×4.
The video has truly medieval aspects — the sheikh shoves sand in his mouth, literally pours salt on his wounds, and sets fire to his genitals using lighter fluid.
Blair says “despite a changing world around it, the UAE has taken a clear line and stuck to it. This has aroused interest in the country and created a real appetite to engage with it, on the part of many countries.”
The “clear line” involves a very hands-on approach to abuse throughout the UAE.
Guest workers who graft on the UAE’s new buildings and services are regularly assaulted, arrested and cheated. A video posted on YouTube in 2013 of a senior UAE official in traditional Arab dress beating and humiliating an Indian van driver gave a sense of the widespread and casual abuse.
This video is called UAE Officer Assaulting Indian Driver.
For Blair this means that the UAE “has a competent and innovative government. It has a vision for the Middle East that is actually the only one with a chance of working.”
Even before this bid document, Blair worked for the UAE sheikhs. The paper says: “Already, there is a close working relationship between my various organisations and Abu Dhabi.
“This is a place we trust and an environment in which we feel at home. We share the same values and perspective.”
Blair is also completely openly selling his contacts — contacts which only exist because of the hard work of Labour members and the trust of Labour voters. Blair is now monetising their trust and hard work by selling his “network” to reactionary regimes.
The paper offers to “help build the networks of connection” for the UAE. Blair says: “All my various organisations are based on the belief that the world today basically works through connectivity.
“So we’re building a series of deep business and government connections round the world. We do both business and philanthropy.”
He offers the sheikhs “unrivalled global context, experiences and networks — including world leaders, development organisations and private-sector players.”
As well as offering them access to Blair’s international contacts, Tony Blair Associates says he can bring in “trusted and experienced advisers and experts” who have “worked at the highest level of government in the UK and internationally.”
In a summary of the pervasive, immoral reach of Blair, the document concludes: “There is virtually nowhere in the world right now where we could not work or provide the necessary contacts either politically or commercially, should we want to.”
If anyone doubts the need to radically change Labour’s direction, all they need to do is thumb through this ugly brochure. | <urn:uuid:cceca667-d0a3-492e-b25d-818f3bc9b578> | CC-MAIN-2022-33 | https://dearkitty1.wordpress.com/2015/10/29/british-david-cameron-tony-blair-support-uae-torture/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00265.warc.gz | en | 0.961661 | 1,831 | 1.515625 | 2 |
- Research article
- Open Access
L-alanine-induced germination in Bacillus licheniformis -the impact of native gerA sequences
BMC Microbiology volume 14, Article number: 101 (2014)
L-alanine, acting through the GerA receptor, was recently found to be an efficient germinant in Bacillus licheniformis ATCC14580/DSM13.
In this study, we show that several of 46 examined B. licheniformis strains germinate remarkably slower than the type strain when exposed to L-alanine. These strains are not necessarily closely related, as determined by MLST (multi-locus sequence typing). Three of the slow-germinating strains were further examined in order to see whether nucleotide substitutions in the gerA sequences were responsible for the slow L-alanine germination. This was performed by complementing the transformable type strain derivate MW3ΔgerAA with gerA variants from the three slow-germinating strains; NVH1032, NVH1112 and NVH800.
A wide selection of B. licheniformis strains was evaluated for L-alanine-induced germination efficiency. Our results show that gerA substitutions could only partially explain why spores of some B. licheniformis strains responded slower than others in the presence of L-alanine.
Spores of Bacillus licheniformis and other Bacillus species are frequent contaminants in foods[1, 2]. Exposure to nutrients triggers spores to leave dormancy in the process of germination[3–5]. This process involves several steps leading to rehydration of the spore core and loss of dormancy. Under favorable conditions, spores will grow out and multiply to numbers that can cause food spoilage and sometimes disease. While dormant spores are extremely heat resistant, germinated spores can easily be killed by a mild heat treatment. Therefore, a food preservation technique applied by food manufacturers to reduce spore numbers in food products is “induced germination”. The consequence of induced germination is spores germinated into vegetative cells will be heat sensitive and can therefore be inactivated, by successive heating below temperatures that compromise food quality (modified Tyndallization)[8–10]. The effectiveness of such a strategy depends on the germination rate of the spore population. A slow and/or heterogeneous germination rate of a specific spore population will reduce the effectiveness of such treatments[11–14].
Nutrient germinant receptors (GRs), localized to the inner spore membrane[15–17], are involved in the spore’s recognition of specific nutrients in its environment, which is the initial step in the spore’s return to growth. Binding of nutrient to the receptors is believed to trigger the release of the spore core’s large depot of Ca-dipicolinic acid (CaDPA), followed by rehydration of the spore core and degradation of the spore cortex. Current knowledge about GRs and their nutrient specificity is mainly achieved from Bacillus subtilis and Bacillus cereus. However, genes encoding GRs are widely distributed among Bacillus and Clostridium species[5, 19], implicating an essential role in triggering of spore germination in most spore-forming bacteria. Interestingly, the nutrient specificity of the receptors and the interaction between them varies between and even within species, as has been shown for B. cereus-group members[20–22].
GRs are generally encoded by polycistronic operons that are expressed late in sporulation under the regulation of the forespore-specific transcription factor, sigma G (σG)[23, 24]. These genes constitute a family (gerA family) of homologous genes that probably have evolved from the same ancestor[4, 19]. Three putative gerA family operons, gerA (A, B, C), gerK (A, C, B) and ynd (D,E 3 E 2 , F 1, E 1 ) and the single gerAC homologue yndF2 have been identified within the B. licheniformis type strain ATCC14580/DSM13 genome[25–27]. Of these, only the gerA operon has been functionally characterized so far. gerA was found to be essential for germination in presence of L-alanine. A similar role has been described for gerA in B. subtilis. L-alanine is probably the most universal single nutrient germinant among spore formers.
The Bacillus GRs which have been described so far are usually composed of three subunits termed A, B and C. The A and B subunits are predicted to contain 5–6 (A) and 10–11 (B) membrane-spanning domains, respectively[5, 29], while the C subunit is thought to be a membrane-anchored lipoprotein. The tertiary structure of B. subtilis GerBC was determined a few years ago. The B-subunit, whose amino acid sequence shows homology to proteins of the APC (amino acid-polyamine-organocation) superfamily, is proposed to be the most likely site of ligand binding, as mutations within this subunit alter ligand specificity[4, 32]. However, since mutations in any of the three cistrons are shown to disturb receptor function, the exact site of nutrient binding is still unknown.
The genetic relationship of 53 strains of the food-spoilage agent B. licheniformis, a close relative of B. subtilis, was recently described by a novel MLST scheme. One of these strains, NVH1032, was isolated after surviving an “induced germination”-regime (Tyndallization), applied by the food industry to eliminate spore contamination. Preliminary results in our lab suggested that NVH1032 and other B. licheniformis strains germinate considerably slower than the type strain when exposed to L-alanine. Such slow-germinating strains pose a challenge to food manufacturers that want to implement “induced germination” as a strategy to reduce/eliminate spores during processing.
In this study, 46 of the 53 genotyped strains were screened for efficiency of L-alanine-induced germination, and the correlation between the genotype and the induced germination was determined. Furthermore, it was investigated whether the slow germination of three particular B. licheniformis strains was due to sequence differences in the gerA operon.
Results and discussion
Screening of L-alanine-induced germination in B. licheniformis strains
In order to evaluate the efficiency of L-alanine-induced germination of the 46 B. licheniformis strains, the level of germination was recorded after addition of L-alanine in a screening assay. The results showed that germination efficiency, determined by reduction of absorbance (A600) varied from ~1 to 60% between the tested strains 2 h after the addition of germinant (Additional file1). A drop in A600 of 60% was equivalent to > 95% germinated spores, as verified by phase contrast microscopy. About 30 of the strains germinated well with a reduction in absorbance of 40% or more, while six strains germinated poorly (10% or less in reduction of absorbance).
In general, differences in germination between strains may be due to differences in lag time (interval between addition of germinant and loss of refractivity) and differences in rate of germination (slope of the germination curve/∆A600 min-1). Several factors may account for these differences: (i) permeability of the outer spore layers, restricting access of germinant to the inner membrane, (ii) germinant specificity[20, 22], (iii) GR (nutrient germinant receptors) level, (iv) dysfunctional GRs, (v) GR synergism/antagonism and/or (vi) structure of the cortex. Within single populations of B. subtilis, a reduced level of GRs has been suggested to be one of the main reasons for slow germination or “superdormancy”, probably by increasing the lag time until CaDPA is released. In B. subtilis, GRs have been proposed to be present in a relatively low number (<40) in the spore’s inner membrane where they form discrete clusters, so-called germinosomes[16, 39], however, it has recently been reported that this number may be highly underestimated. The number of germination receptors has been shown to be strongly dependent on the sporulation conditions[4, 41, 42]. In this study, sporulation and germination conditions (e.g. temperature, sporulation medium, pH, activation time/temperature, germinant concentration) were optimized with respect to the type strain ATCC14580/DSM13. However, these conditions may not be optimal for all strains.
Distribution and characterization of the gerA operon
The gerA locus was detected by PCR in all of the 53 genotyped B. licheniformis strains (GenBank: KF358523- KF358575). To investigate whether certain gerA sequence variants were associated with slow germination, partial gerA operon sequences of all strains were analysed, aligned and organized into clusters. The resulting neighbour-joining (NJ) tree is presented in Figure 1. With the exception of two strains (NVH1109/“1a” and NVH1077/“1b”) the NJ- dendogram was congruent with the MLST tree generated from six house-keeping genes. Thus, the gerA locus seemed to have evolved in parallel to the house-keeping genes. The ratio of non-synonymous versus synonymous base substitutions (dN/dS) was 0.0845 which is somewhat higher than the calculated values for the individual MLST loci (0.0000-0.0457), but far below the limit of 1.0 that is often set for loci undergoing positive selection. Thus, the gerA locus, similar to the house-keeping genes, seems to be subject to purifying (stabilizing) selection[43, 44].
A total of seven unique alleles were distributed into four main clusters, determined “1a”, “1b”, “1c” and “2” (Figure 1). Cluster “2” was represented by only three strains, NVH1032, NVH800 and NVH1112, that all showed a slower and less efficient germination response (Additional file1) compared to the type strain, ATCC14580/DSM13 (cluster “1b”). However, slow-germinating strains were also found within each of the other clusters. Thus, this part of the gerA operon sequence (718 bp ranging from 3′ end of gerAB to 5′ end of gerAC) was not suitable in order to completely distinguish slow-germinating and fast-germinating strains.
Germination of gerA complementation strains
In order to further investigate the influence of gerA sequences on germination rate, MW3ΔgerAA was complemented with gerA operons originating from the type strain ATCC14580/DSM13, and the three slow-germinating strains (Figure 2c,d). The gerA sequences of ATCC14580/DSM13 , NVH1032 and NVH800 nearly restored the phenotype of the sequence originating strains, while complementing MW3∆gerAA with the gerA sequence from NVH112 increased the germination rate of the complemented strain compared to NVH1112 wild-type (Figure 2a,c). Still, the order of the germination rate between the four strains was consistent between the two experiments (NVH1112/NVH1321 < NVH1032/NVH1309 < NVH800/NVH1322 < ATCC14580/NVH1311), substantiating that the phenotypes of the complemented MW3∆gerAA mutant to some extent restored the phenotypes of the gerA originating strains. Germination data of MW3 carrying pHT315 (MW3_pHT315) showed that carrying the empty vector, or the use of erythromycin in the cultures, hampered the germination rate of the MW3 strain (Additional file2). However, we assume that comparing the effect of the complementing sequences is acceptable since they are all carried by the same vector.
An important observation was that, in contrast to Løvdal et al. 2012, L-alanine-induced germination was not completely abolished in MW3∆gerAA (NVH1307). This weak germination (~10% phase dark spores after 120 min) was not observed in absence of germinant, indicating that germination receptors other than GerA might be weakly activated by L-alanine. We also noted that spores of the slow-germinating strain NVH1112 hardly germinated at all, and to a lesser extent than MW3∆gerAA (Figure 2a,b). When complementing MW3∆gerAA with the gerA operon from NVH1112 (NVH1321) germination efficiency increased, indicating that the gerA operon of NVH1112 has some functionality in presence of L-alanine. A faster and more efficient germination of the complementation mutants compared to their respectively gerA originating strains was also observed for NVH1322 (gerA from NVH800) and NVH 1309 (gerA from NVH1032).
The imperfect complementation of the phenotypes may be due to several different factors. Firstly, a two- to seventeen-fold increase in expression level of gerAA was observed when MW3∆gerAA was complemented with different gerA sequences and compared to the wild-type strains from where the gerA sequences originated (Figure 3). The increased gerAA expression level in the complementation mutants might be related to the copy-number of the plasmid pHT315 (15 copies per cell). Previous experiments have shown that a 2–200 fold overexpression of ger genes may increase germination rate[45, 46].
Secondly, since the complementing gerA genes in this experiment were plasmid-born (pHT315 encoding erythromycin resistance), 1 μg ml-1 erythromycin was used in the sporulation medium to maintain the plasmid throughout the sporulation process and MW3 carrying the pHT315 empty vector germinated slower and with less efficiency than the wild-type MW3 strain (Additional file2). Despite this observation, MW3∆gerAA complemented with slow germinating gerA sequences germinated better than the strains from where the gerA sequences originated (Figure 2a-d).
Thirdly, the entire gerA operon and the 151 bp region upstream of the start codon of gerAA was cloned in the complementing vector pHT315. Alignments of the promoter sequence of strain NVH1032, NVH800, NVH1112 and ATCC14580/MW3 can be viewed in Additional file3. No differences were observed between the type-strain and the slow germinating strains in the -10 and -35 promoter region of gerA. However, differences outside these regions may influence the transcriptional level. pHT315 contains the inducible lac promoter, but transcription from this promoter cannot be excluded even without induction.
Despite the imperfect restoration of the wt phenotypes, the results of the germination assays in this study indicate that the gerA sequences have an impact on germination rate and efficiency. Differences in the GerA amino acid sequence may lead to altered protein 3-D structure, which again may cause impaired assembly and stability of the receptor complex in the inner membrane, lower or higher substrate affinity or influence the interactions with other membrane proteins.
Structural analysis of amino acid substitutions in the GerA receptor
Analyses of single amino acid substitutions have previously been conducted in B. subtilis GerAA, GerAB and GerBC. None of these positions were substituted in the GerA sequences examined in the present study. Alignments of the GerAA, GerAB and GerAC sequences of B. licheniformis NVH1032, NVH800, NVH1112 and ATCC14580/DSM13 are presented in Additional files4,5 and6. Thus, on the basis of this knowledge and the lack of a 3D structure of any proteins in the GerAA and GerAB families of proteins, the relevance of the observed differences within these two subunits is difficult to determine. However, the crystal structure of B. subtilis GerBC has recently been determined. Using this structure as a template for prediction of B. licheniformis GerAC structures, one of the perhaps most interesting substitutions is F342S (NVH1032 and NVH800) which lies in the so-called “region 2” of domain III (Additional file7). Region 2 is reported to be a well conserved region in GerBC among Bacillales and substitutions within this region were previously shown to affect receptor function in B. subtilis. On the other hand, the F342S substitution was neither observed in the gerA sequences of the slowest germinating strain NVH1112 or the fastest germinating strain ATCC14580/DSM13 suggesting that the role of this site seems unclear. It should be mentioned that the aa sequence of the GerAC protein of NVH1112 is much closer to that of MW3 than the other two (Additional file6), indicating that GerAC is not crucial to germination efficiency. Ultimately, the lack of information about the exact germinant binding site, as well as the fact that only the C subunit has been structurally characterized, makes it difficult to interpret the effect of single substitutions on the GerA receptor function.
This study shows that spores of 46 B. licheniformis strains are able to germinate in the presence of L-alanine, but that the germination rate and efficiency differ significantly between the strains. About 10% of the strains germinated poorly, even in presence of high (100 mM) concentrations of probably the most universal and potent germinant for Bacillus species in general, and B. licheniformis in particular. Germination rate of different bacterial strains are of importance to the food industry, using so-called “induced germination”, eg Tyndallization, to decrease spore contamination in processed foods. Delayed germination may reduce the efficiency of Tyndallization by allowing ungerminated spores to survive. Our results demonstrate that nutrient-induced germination followed by inactivation can be challenging when dealing with specific B. licheniformis strains.
The germination phenotype was partly restored when complementing a gerAA disruption mutant with gerA operons from either slow- or fast-germinating B. licheniformis strains. This observation indicates that differences in gerA family operons are partly responsible for differences in germination efficiency of B. licheniformis in response to L-alanine.
MW3 ∆gerAA (NVH1307) and the complementation mutant NVH1311 are described in Løvdal et al. 2012. The complementation mutants NVH1309, NVH1321 and NVH1322 were constructed in this work as described later on.
Bacteria were grown on sheep blood agar at 30°C overnight. Single colony material was inoculated in 20 mL Luria broth (LB). The bacterial culture was grown overnight at 30°C and centrifuged at 3000 × g for 10 min. The supernatant was discarded and the pellet resuspended in 1 mL enzymatic lysis buffer (20 mM Tris · Cl, pH 8.0, 20 mM Tris · Cl, pH 8.0, 1.2% Triton® X-100, 20 mg mL-1 lysozyme (Sigma, Steinheim, Germany)). Further DNA extraction was performed according to the protocol provided by DNeasy Blood and Tissue Kit (Qiagen, USA).
PCR and sequencing of the gerA operon
Primer A7F and A7R (Table 2) were used to amplify a 718 bp region of the gerA operon, including 3′ end of gerAB and 5′ end of gerAC. Additionally, complete gerA operons from strain NVH800, NVH1032 and NVH1112 were amplified in smaller fragments for DNA sequencing using primers listed in Additional file8. All amplification reactions were performed in 20 μL using 2 μL DNA (10 ng μL-1) as a template. PCR reactions were performed in a LightCycler® 480 System using LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Germany) according to recommendations given by the manufacturer of the kit. The temperature program was as follows: 5 min initial denaturation at 95°C followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 56°C for 10 s and extension at 72°C for 30 s. The amplifications were terminated after a final elongation step of 7 min at 72°C. The PCR fragments were verified by electrophoresis using Bioanalyzer (Agilent Technologies, USA). PCR products were purified and sequenced by Eurofins MWG Operon (Ebersberg, Germany) using the dideoxy chain termination method on an ABI 3730XL sequencing instrument (Applied Biosystems, USA).
The Staden Package was used for alignment, editing and construction of consensus sequences based on the ABI sequence chromatograms. Consensus sequences (626 bp) were entered into the MEGA5 software and aligned by CLUSTALW. Dendograms were constructed in MEGA5 using the Neighbor-Joining method (NJ) with branch lengths estimated by the Maximum Composite Likelihood method. Branch quality was assessed by the bootstrap test using 500 replicates. Sequences were trimmed to be in frame, which means that eight bases in the transition between gerAB and gerAC were removed, before entering into S.T.A.R.T. 2. This program was used to calculate the dN/ dS ratio (ratio of nonsynomous versus synonymous substitutions).
The B. licheniformis gerA promoter sequence was identified in DBTBS and prediction of transmembrane α-helices of GerAA and AB was performed using TOPCONS web program. Finally, three-dimensional (3D) structure modeling of GerAC was performed using RaptorX and PyMOL[61, 62]. All sequences were compared against the annotated sequence of the gerA operon (gerAA, gerAB, gerAC) of B. licheniformis ATCC14580/DSM 13 (YP_080584.1; YP_080585.1; YP_080586.1) and B. subtilis subsp. subtilis str. 168 (NP_391185.2; NP_391186.1; NP_391187.1)[23, 63].
Construction of B. licheniformis MW3∆gerA complementation mutants
The entire gerA operons including the putative sigG promoter from B. licheniformis strain NVH1032, NVH800 and NVH1112 were cloned into the pHT315 shuttle vector and introduced into the gerAA deletion mutant strain MW3∆gerAA by electroporation as described previously. Briefly, PCR, with primers (Table 2) containing Sal I and Xba I restriction sites, was used to amplify the gerA operon including 151 bp upstream of the gerAA start codon and 177 bp downstream of the gerAC STOP codon. The amplified fragments were cloned into the Sal I/Xba I restriction site of pHT315, giving the complementation plasmids. For details regarding primers, PCR conditions, DNA isolation and electroporation see Løvdal et al. 2012. The strains created in this study were designated as follows: B. licheniformis NVH1309 (MW3∆gerAA _NVH1032gerA); NVH1321 (MW3∆gerAA _NVH1112gerA) and NVH1322 (MW3∆gerAA _NVH800gerA). Correct construction of the complementation plasmids was confirmed by sequencing and the complementation mutants were verified by PCR analysis. Sequence editing and alignments were performed as already described in the Data analysis section.
Bacterial growth and sporulation
Sporulation was performed according to Løvdal et al. 2012, with minor modifications. Bacteria were pre-cultured overnight in LB-broth with agitation (230 rpm) at 37°C. Complementation mutants were grown in presence of 1 μg mL-1 erythromycin. 10 μL of preculture was transferred to 50 mL of the non-defined, rich sporulation medium in 500 mL EM flasks. Incubation was performed with agitation (230 rpm) at 37°C for 3–7 days until ≥ 80% phase bright spores as judged by phase contrast microscopy. Seven of the strains (M55, ATCC9945A, NVH622, 749, M46, NVH1079 and LMG6934) did not sporulate adequately and were excluded from further analysis. Spores were harvested by centrifugation for 10 min at 3900 × g (Eppendorf) at 4°C and resuspended in 10 mL ice-cold autoclaved Milli-Q water. The spores were centrifuged at 10000 × g through a 50% (w/v) Nycodenz (Axis-Shield) gradient in order to remove cell debris and vegetative cells. The spores were washed three times in ice-cold autoclaved Milli-Q water before storage (1–3 months) in the dark at 4°C. The final spore suspensions were 98% free of vegetative cells, not fully sporulated cells, cell debris and germinated cells as judged by phase contrast microscopy.
Quantitative RT-PCR experiments were performed on mRNA isolated from B. licheniformis cultures harvested after ~ 50% sporulation judged by phase contrast microscopy. Total bacterial RNA was extracted using TRIzol Reagent (Invitrogen) and cells were disrupted using Lysing Matrix B (MP Biomedicals Europe) and bead beating in a Mini-BeadBeater-8 (BioSpec) according to manufacturer’s specifications. DNA was removed from each RNA preparation using Turbo DNA-free Kit (Ambion), according to manufacturer’s instructions. RNA quantity (A260) and purity (A260/280 ratio) were measured in a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific). cDNA was synthesised from 500 ng RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) in a 20 μl reaction according to manufacturer’s protocols.
Five μl of a 1:100 dilution of the cDNA reaction was used as template for qPCR amplification in 25 μl final volumes containing 12.5 μl of Power SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM of each primer. Primers used for qPCR are listed in Table 2. The amplification was performed using StepOne PCR software (Applied Biosystems) with thermal cycling conditions set at 10 min at 95°C, followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. Fluorescence was monitored during each extension phase and a melting curve analysis was performed after each run to confirm the amplification of specific transcripts. Each qPCR of the RNA samples was performed in triplicate, no template was added in negative controls, and rpoB was used as internal control. The qPCR analysis was performed on three independent biological replicates. Slopes of the standard curves and PCR efficiency (E) for each primer pair were estimated by amplifying serial dilutions of the cDNA template. For quantification of mRNA transcript levels, Ct (threshold cycle) values of the target genes (gerAA) and the internal control gene (rpoB) derived from the same sample in each real-time PCR reaction were first transformed using the term E-Ct. The expression levels of target genes were then normalized by dividing their transformed Ct-values by the corresponding values obtained for internal control gene[64, 65].
Storage water was decanted and the spores were resuspended in autoclaved Milli-Q water (20°C) immediately before heat activation at 65°C in a heating block (QBD2, Grant Instruments Ltd) for 20 min. The heat-activated spores were rapidly cooled down by centrifugation for 3 min 4500 × g at 4°C before resuspension in germination buffer (200 mM K-phosphate buffer pH 7.2). The A600 of the buffered spore suspension was adjusted to ~2.1 (Shimadzu UV- 160A, Shimdazu Europe GMBH). L-Alanine (Sigma) was dissolved in Milli-Q water and filter sterilized prior to use through a 0.45 μm pore size filter. 100 μL of 0.05 - 0.2 M L-Alanine germinant solution was added to 100 μL buffered spore suspension in a 96-well microplate (BD) giving an initial A600 of ~1. Germination was by monitored by reading the drop in absorbance (A600) in a 96-well microplate reader (Tecan Infinite M200). Readings were performed at regular intervals (2 min) and the plate was shaken 10 s prior to each reading. Set point temperature during germination was 37°C (36.5 - 37.5). The screening of 46 strains was performed in duplicate with a single spore preparation. All other experiments were performed with three independent spore preparations.
Heyndrickx M, Scheldeman P: Bacilli associated with spoilage in dairy products and other food. Applications and Systematics of Bacillus and Relatives. Edited by: Berkeley R. 2002, Oxford, UK: Blackwell Science, 64-82.
Setlow P, Johnson EA: Spores and their signifcance. Food Microbiology: Fundamentals and Frontiers. Edited by: Doyle MP, Beuchat LR. 2007, Washington DC: ASM Press, 35-67.
Setlow P: Spore germination. Curr Opin Microbiol. 2003, 6 (6): 550-556.
Moir A, Corfe BM, Behravan J: Spore germination. Cell Mol Life Sci. 2002, 59 (3): 403-409.
Paredes-Sabja D, Setlow P, Mahfuzur RS: Germination of spores of Bacillales and Clostridial species: mechanisms and proteins involved. Trends Microbiol. 2011, 19 (2): 85-94.
Logan NA: Bacillus and relatives in foodborne illness. J Appl Microbiol. 2012, 112 (3): 417-429.
Setlow P: Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. J Appl Microbiol. 2006, 101: 514-525.
Løvdal IS, Hovda MB, Granum PE, Rosnes JT: Promoting Bacillus cereus spore germination for subsequent inactivation by mild heat treatment. J Food Prot. 2011, 74 (12): 2079-2089.
Brown JV, Wiles R, Prentice GA: The effect of a modified Tyndallization process upon the sporeforming bacteria of milk and cream. Int J Dairy Technol. 1979, 32 (2): 109-112.
Martin JH, Blackwood PW: Effects of sub-lethal heat-shock, β-alanine, and L-alanine on germination and subsequent destruction of Bacillus spores by pasteurization. J Dairy Sci. 1972, 55 (5): 577-580.
Gould GW: History of science-spores. J Appl Microbiol. 2006, 101: 507-513.
Hornstra LM, ter Beek A, Smelt JP, Kallemeijn WW, Brul S: On the origin of heterogenity in (preservation) resistance of Bacillus spores: input for a ‘systems’ analysis approach of bacterial spore outgrowth. Int J Food Microbiol. 2009, 134: 9-15.
Ghosh S, Setlow P: Isolation and characterization of superdormant spores of Bacillus species. J Bacteriol. 2008, 191 (6): 1787-1797.
Zhang P, Garner W, Yi X, Yu J, Li Y, Setlow P: Factors affecting variability in time between addition of nutrient germinants and rapid dipicolinic acid release during germination of spores of Bacillus species. J Bacteriol. 2010, 192 (14): 3608-3619.
Hudson KD, Corfe BM, Kemp EH, Feavers IM, Coote PJ, Moir A: Localization of GerAA and GerAC germination proteins in the Bacillus subtilis spore. J Bacteriol. 2001, 183 (14): 4317-4322.
Paidhungat M, Setlow P: Localization of a germinant receptor protein (GerBA) to the inner membrane of Bacillus subtilis spores. J Bacteriol. 2001, 183 (13): 3982-3990.
Korza G, Setlow P: Topology and accessibility of germination proteins in the Bacillus subtilis spore inner membrane. J Bacteriol. 2013, 195 (7): 1484-1491.
Paidhungat M, Setlow P: Role of Ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis. J Bacteriol. 2000, 182 (9): 2513-2519.
Ross C, Abel-Santos E: The ger receptor family from sporulating bacteria. Curr Issues Mol Biol. 2011, 12: 147-158.
van der Voort M, Garcia D, Moezelaar R, Abee T: Germinant receptor diversity and germination responses of four strains of the Bacillus cereus group. Int J Food Microbiol. 2010, 139 (1–2): 108-115.
Abee T, Groot MN, Tempelaars M, Zwietering M, Moezelaar R, van der Voort M: Germination and outgrowth of spores of Bacillus cereus group members: Diversity and role of germinant receptors. Food Microbiol. 2011, 28: 199-208.
Broussolle V, Gauillard F, Nguyen-the C, Carlin F: Diversity of spore germination in response to inosine and L-alanine and its interaction with NaCl and pH in the Bacillus cereus group. J Appl Microbiol. 2008, 105: 1081-1090.
Zuberi AR, Moir A, Feavers IM: The nucleotide sequence and gene organization of the gerA spore germination operon of Bacillus subtilis 168. Gene. 1987, 51 (1): 1-11.
Feavers IM, Foulkes J, Setlow B, Sun D, Nicholson W, Setlow P, Moir A: The regulation of transcription of the gerA spore germination operon of Bacillus subtilis. Mol Microbiol. 1990, 4 (2): 275-282.
Rey MW, Ramaiya P, Nelson BA, Brody-Karpin SD, Zaretsky EJ, Tang M, Lopez de Leon A, Xiang H, Gusti V, Groth Clausen I, Clausen IG, Olsen PB, Rasmussen MD, Andersen JT, Jørgensen PL, Larsen TS, Sorokin A, Bolotin A, Lapidus A, Galleron N, Ehrlich SD, Berka RM: Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species. Genome Biol. 2004, 5 (10): r77-
Veith B, Herzberg C, Steckel S, Feesche J, Maurer KH, Ehrenreich P, Bäumer S, Henne A, Liesegang H, Merkl R, Ehrenreich A, Gottschalk G: The complete genome sequence of Bacillus licheniformis DSM13, an organism with great industrial potential. J Mol Microbiol Biotechnol. 2004, 7: 204-211.
Xiao Y, Francke C, Abee T, Wells-Bennik MHJ: Clostridial spore germination versus bacilli: genome mining and current insights. Food Microbiol. 2011, 28 (2): 266-274.
Løvdal IS, From C, Madslien EH, Romundset KCS, Klufterud E, Rosnes JT, Granum PE: Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores. BMC Microbiol. 2012, 12 (1): 34-
Wilson MJ, Carlson PE, Janes BK, Hanna PC: Membrane topology of the Bacillus anthraci s GerH germinant receptor proteins. J Bacteriol. 2012, 194 (6): 1369-1377.
Igarashi T, Setlow B, Paidhungat M, Setlow P: Effects of a gerF (lgt) mutation on the germination of spores of Bacillus subtilis. J Bacteriol. 2004, 186 (10): 2984-2991.
Li Y, Setlow B, Setlow P, Hao B: Crystal structure of the GerBC component of a Bacillus subtilis spore germinant receptor. J Mol Biol. 2010, 402 (1): 8-16.
Christie G, Lowe CR: Amino acid substitutions in transmembrane domains 9 and 10 of GerVB that affect the germination properties of Bacillus megaterium spores. J Bacteriol. 2008, 190 (24): 8009-8017.
Madslien EH, Olsen JS, Granum PE, Blatny JM: Genotyping of B. licheniformis based on a novel multi-locus sequence typing (MLST) scheme. BMC Microbiol. 2012, 12 (1): 230-
Behravan J, Chirakkal H, Masson A, Moir A: Mutations in the gerP locus of Bacillus subtilis and Bacillus cereus affect access of germinants to their targets in spores. J Bacteriol. 2000, 182 (7): 1987-1994.
Ghosh S, Scotland M, Setlow P: Levels of germination proteins in dormant and superdormant spores of Bacillus subtilis. J Bacteriol. 2012, 194 (9): 2221-2227.
Christie G, Lazarevska M, Lowe CR: Functional consequences of amino acid substitutions to GerVB, a component of the Bacillus megaterium spore germinant receptor. J Bacteriol. 2008, 190 (6): 2014-2022.
Yi X, Liu J, Faeder JR, Setlow P: Synergism between different germinant receptors in the germination of Bacillus subtilis spores. J Bacteriol. 2011, 193 (18): 4664-4671.
Zhang P, Thomas S, Li Y, Setlow P: Effects of cortex peptidoglycan structure and cortex hydrolysis on the kinetics of Ca2 + -dipicolinic acid release during Bacillus subtilis spore germination. J Bacteriol. 2012, 194 (3): 646-652.
Griffiths KK, Zhang J, Cowan AE, Yu J, Setlow P: Germination proteins in the inner membrane of dormant Bacillus subtilis spores colocalize in a discrete cluster. Mol Microbiol. 2011, 81 (4): 1061-1077.
Stewart KA, Setlow P: Numbers of individual nutrient germinant receptors and other germination proteins in spores of Bacillus subtilis. J Bacteriol. 2013, 195 (16): 3575-3582.
Paidhungat M, Setlow P: Spore germination and outgrowth. Bacillus Subtilis and its Closest Relatives: From Genes to Cells. Edited by: Sonenshein AL, Hoch JA, Losick R. 2002, Washington, D.C: ASM, 537-548.
Ramirez-Peralta A, Zhang P, Li Y, Setlow P: Effects of sporulation conditions on the germination and germination protein levels of Bacillus subtilis spores. Appl Environ Microbiol. 2012, 78 (8): 2689-2697.
Kryazhimskiy S, Plotkin JB: The population genetics of dN/dS. PLoS Gen. 2008, 4 (12): e1000304-
Rocha EPC, Smith JM, Hurst LD, Holden MTG, Cooper JE, Smith NH, Feil EJ: Comparisons of dN/dS are time dependent for closely related bacterial genomes. J Theor Biol. 2006, 239 (2): 226-235.
Cabrera-Martinez R, Tovar-Rojo F, Vepachedu VR, Setlow P: Effects of overexpression of nutrient receptors on germination of spores of Bacillus subtilis. J Bacteriol. 2003, 185 (8): 2457-2464.
Stewart K, Yi X, Ghosh S, Setlow P: Germination protein levels and rates of germination of spores of Bacillus subtilis with overexpressed or deleted genes encoding germination proteins. J Bacteriol. 2012, 194 (12): 3156-3164.
Arantes O, Lereclus D: Construction of cloning vectors for Bacillus thuringiensis. Gene. 1991, 108 (1): 115-119.
Mongkolthanaruk W, Cooper GR, Mawer JSP, Allan RN, Moir A: Effect of amino acid substitutions in the GerAA protein on the function of the alanine-responsive germinant receptor of Bacillus subtilis spores. J Bacteriol. 2011, 193 (9): 2268-2275.
Cooper GR, Moir A: Amino acid residues in the GerAB protein important in the function and assembly of the alanine spore germination receptor of Bacillus subtilis 168. J Bacteriol. 2011, 193 (9): 2261-2267.
Li Y, Catta P, Stewart K, Dufner M, Setlow P, Hao B: Structure-based functional studies of the effects of amino acid substitutions in GerBC, the C subunit of the Bacillus subtilis GerB spore germinant receptor. J Bacteriol. 2011, 193 (16): 4143-4152.
Waschkau B, Waldeck J, Wieland S, Eichstadt R, Meinhardt F: Generation of readily transformable Bacillus licheniformis mutants. Appl Microbiol Biotechnol. 2008, 78 (1): 181-188.
Staden R: The staden sequence analysis package. Mol Biotechnol. 1996, 5: 233-241.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011, 28 (10): 2731-2739.
Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22 (22): 4673-4680.
Saitou N, Nei M: The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987, 4 (4): 406-425.
Tamura K, Dudley J, Nei M, Kumar S: MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007, 24 (8): 1596-1599.
Jolley KA, Feil EJ, Chan MS, Maiden MC: Sequence type analysis and recombinational tests (START). Bioinformatics. 2001, 17 (12): 1230-1231.
Nei M, Gojobori T: Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol. 1986, 3 (5): 418-426.
Sierro N, Makita Y, de Hoon M, Nakai K: DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic Acids Res. 2008, 36 (suppl 1): D93-D96.
Bernsel A, Viklund H, Hennerdal A, Elofsson A: TOPCONS: consensus prediction of membrane protein topology. Nucleic Acids Res. 2009, 37 (suppl 2): W465-W468.
Källberg M, Wang H, Wang S, Peng J, Wang Z, Lu H, Xu J: Template-based protein structure modeling using the RaptorX web server. Nat Protoc. 2012, 7 (8): 1511-1522.
DeLano WL: The PyMOL Molecular Graphics System. 2002, San Carlos, CA: DeLano Scientific, [http://www.pymol.org]
Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, Azevedo V, Bertero MG, Bessieres P, Bolotin A, Borchert S, Borriss R, Boursier L, Brans A, Braun M, Brignell SC, Bron S, Brouillet S, Bruschi CV, Caldwell B, Capuano V, Carter NM, Choi SK, Codani JJ, Connerton IF, Cummings NJ, Daniel RA, Denizot F, Devine KM, Düsterhöft A, Ehrlich SD: The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature. 1997, 390 (6657): 249-256.
Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29 (9): e45-
Duodu S, Holst-Jensen A, Skjerdal T, Cappelier JM, Pilet MF, Loncarevic S: Influence of storage temperature on gene expression and virulence potential of Listeria monocytogene s strains grown in a salmon matrix. Food Microbiol. 2010, 27 (6): 795-801.
The work was supported by grants from the Norwegian Research Council (grant 178299/I10), the Norwegian Defence Research Establishment (FFI) and Centre for Food Safety, Norwegian University of Life Sciences.
We would like to thank Kristin O’Sullivan and Kristin Cecilia Romundset for valuable contributions during the experimental part of this work. We are also grateful to Irene S. Løvdal for helpful discussions throughout this study.
The authors declare that they have no competing interests.
All authors contributed to the design of the study. EHM drafted the manuscript, assisted in the construction of the complementation mutants and performed the germination experiments, PCR amplifications, sequence editing, sequence alignments and data analysis. JMB and PEG assisted in drafting the manuscript. TL performed the RT-PCR experiments, constructed the complementation mutants and assisted in data analysis and drafting the manuscript. All authors have read and approved the final version of the manuscript.
Electronic supplementary material
Additional file 1:Comparison of germination efficiency in 46 B. licheniformis strains. The relative decrease in absorbance (A600) in the spore suspension was measured 2 h after the addition of germinant (100 mM L-alanine). The strains NVH1032, NVH800, ATCC14580/DSM13 and NVH1112 were selected for further analysis (indicated with arrows). (PPTX 134 KB)
Additional file 2:Spore germination of MW3 carrying pHT315. Germination of MW3 (▲) and MW3_pHT315 () measured as reduction in absorbance (A600) after addition of germinant (100 mM L-alanine). MW3_pHT315 ctrl (■) is not added any germinant. (PPTX 57 KB)
Additional file 3:Promoter sequence alignment. Alignment of the estimated σG dependent gerA promoter sequences of B. subtilis spp. subtilis str.168 and B. licheniformis ATCC14580/DSM13, NVH1112, NVH800 and NVH1032. DBTBS was used to identify promoter sequences. The B. subtilis promoter (underlined) and transcriptional start site (arrow) were experimentally defined by Feavers et al. (1990). (PPTX 52 KB)
Additional file 4:Amino acid sequence alignment of GerAA from ATCC14580/DSM13, NVH1032, NVH800 and NVH1112. Residues with substitutions are indicated in yellow. Alignment was performed with ClustalW in MEGA5. The numbered solid lines indicate regions of predicted transmembrane domains (TOPCONS). (TIFF 91 KB)
Additional file 5:Amino acid sequence alignment of GerAB from ATCC14580/DSM13, NVH1032, NVH800 and NVH1112. Residues with substitutions are indicated in yellow. Alignment was performed with ClustalW in MEGA5. The numbered solid lines indicate regions of predicted transmembrane domains (TOPCONS). (TIFF 71 KB)
Additional file 6:Amino acid sequence alignment of GerAC from ATCC14580/DSM13, NVH1032, NVH800 and NVH1112. Residues with substitutions are indicated in yellow. Alignment was performed with ClustalW in MEGA5. (TIFF 75 KB)
Additional file 7:3D-model of the GerAC protein of B. licheniformis. Substitutions that were detected in strain NVH1032, NVH800 and NVH1112 are indicated with red. Modelling was performed in PyMOL. (PPTX 269 KB)
About this article
Cite this article
Madslien, E.H., Granum, P.E., Blatny, J.M. et al. L-alanine-induced germination in Bacillus licheniformis -the impact of native gerA sequences. BMC Microbiol 14, 101 (2014). https://doi.org/10.1186/1471-2180-14-101
- Bacillus licheniformis
- Germinant receptor | <urn:uuid:d70f674c-5db1-4309-b898-b2242cec8e42> | CC-MAIN-2022-33 | https://bmcmicrobiol.biomedcentral.com/articles/10.1186/1471-2180-14-101 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.879859 | 11,321 | 2.8125 | 3 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.