text
stringlengths 160
608k
| id
stringlengths 47
47
| dump
stringclasses 2
values | url
stringlengths 13
2.97k
| file_path
stringlengths 125
140
| language
stringclasses 1
value | language_score
float64 0.65
1
| token_count
int64 48
145k
| score
float64 1.5
5
| int_score
int64 2
5
|
|---|---|---|---|---|---|---|---|---|---|
Some time ago we had already reported that you can change or show the “ shutdown button on the Windows login screen ” by changing the registry . Today we would like to show you how this can also be done using a group policy . By default, the Windows login screen including the shutdown button looks like this.
Remove shutdown button via GPO
To remove the ” shutdown function ” from the Windows login screen , you must first open the Windows Group Policy Editor (gpedit.msc). The easiest way to do this is to use the Windows keyboard shortcut
After starting the Group Policy Editor you have to switch to the following GPO path.
Computer Configuration / Windows Settings / Security Settings / Security Options
Here, as can be seen in the following picture, there is the decisive group guideline
Shutdown: Allow the system to shutdown without logging in.
This group policy must be deactivated so that the ” shutdown icon ” also disappears from the Windows login mask . After deactivation, the Windows login looks like this.
Microsoft also provides the user with the following additional information about this GPO.
Shutdown: Allow the system to shutdown without logging in
This security setting determines whether a computer can be shut down without first logging on to Windows.
When this policy is enabled , the shutdown command is available on the Windows logon screen.
If this policy is disabled , the shutdown option will not appear on the Windows logon screen. In this case, users must be able to successfully log on to the computer and they must have the “System shutdown” user right to shut down a system.
Default setting on workstations: Enabled
Default setting on servers: Disabled
A lot of other interesting information and setting options when shutting down Windows systems can also be found in these articles:
– Delete Windows swap file by security policy on shutdown
– Delete Pagefile.sys (Windows swap file) on shutdown of Windows
– Shut down and restart
Windows with PowerShell commands – Shut down Windows 10 faster – Registry change
– Execute scripts when
Windows starts / shuts down or logs on and off – Restart the PC with Windows 10 during an RDP session ( shutdown )
Time- controlled shutdown of Windows 10 – Measure Windows boot time and Windows shutdown time exactly
|
<urn:uuid:4f83ea29-ff0f-4a23-85f6-eca0fd7c6e3c>
|
CC-MAIN-2022-33
|
https://howpchub.com/remove-shutdown-icon-from-the-windows-login-screen-via-gpo/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.860645
| 472
| 1.851563
| 2
|
Explores how the entry of migrant workers into Israel raises questions beyond just those of the labor market.
In this account of a social experiment gone awry, Israel Drori exposes a little-known and recent phenomenon: the importation of foreign workers from Third World economies to Israel. Focusing on Romanian, Thai, and Filipina migrants brought to Israel for specified periods of employment, Drori examines the effect of migrants on Israeli society, particularly the issue of national identity. What began as a political corrective—avoiding the danger of hiring Palestinians to do work that Jewish Israelis would not—has developed into a social and economic problem the state does not know how to handle. In addition to examining the work experiences and social lives of these workers, Drori also situates the Israeli case within a global context, where many affluent nations have significant populations of marginalized, undocumented workers.
Israel Drori is Professor at the School of Business Administration, College of Management, Israel, and also teaches at the Department of Public Policy at Tel Aviv University. He is the author of The Seam Line: Arab Workers and Jewish Managers in the Israeli Textile Industry and coauthor (with Izhak Schnell and Michael Sofer) of Arab Industrialization in Israel: Ethnic Entrepreneurship in the Periphery.
"Drori explores critical issues. Especially because many of these workers are illegal, from as far away as China, Thailand, and the Philippines, the state offers them no protection, and they are often exploited. " — Jewish Book World
|
<urn:uuid:1f82a2cc-5f85-492a-8244-4ab4b133137a>
|
CC-MAIN-2022-33
|
https://sunypress.edu/Books/F/Foreign-Workers-in-Israel
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571719.48/warc/CC-MAIN-20220812140019-20220812170019-00264.warc.gz
|
en
| 0.935643
| 315
| 2.515625
| 3
|
Race & Justice News is a monthly electronic newsletter produced by The Sentencing Project. To receive the newsletter in your inbox, sign up here.
Criminal Justice Reforms for Sanctuary Cities
Political leaders should end harmful criminal justice practices that criminalize poverty and send undocumented residents into the deportation pipeline, according to a new report by Harvard Law School’s Fair Punishment Project, the Immigration Defense Project, and the Immigrant Legal Resource Center. “Any contact with the criminal justice system that a non-citizen has, however small, creates a serious risk that ICE [Immigration and Customs Enforcement] will intervene,” the report states. However, even progressive cities claiming sanctuary status engage in ineffective criminal justice policies and practices, including “broken windows” policing, cash bail requirements, and harsh drug laws, which all increase the likelihood of ICE intervention. The report provides eight recommendations, including ending broken windows policing, considering immigration consequences in discretionary decisions, and ending all collusion with ICE.
Brooklyn Prosecutors to Protect Immigrants from Deportation Over Petty Crimes
While the Trump administration threatens to cut funding to police departments in cities that are not cooperating with ICE, the Brooklyn district attorney’s office has stepped up to protect the borough’s foreign-born residents. Under acting district attorney Eric Gonzalez, the office announced a new policy directing prosecutors to seek out guilty pleas without invoking federal laws that could lead to detention or deportation, reports The New York Times. The office will also hire immigration lawyers to train prosecutors on immigration law and advise them on individual cases, and notify defense lawyers about the potential immigration consequences of their clients’ cases. As Gonzalez explained, “We will not stop prosecuting crimes, but we are determined to see that case outcomes are proportionate to the offense as well as fair and just for everyone.”
Ban the Box Reforms and Statistical Discrimination
Some recent studies have found that Ban the Box reforms, which generally require employers to delay inquiring about criminal backgrounds, may disadvantage job applicants of color who do not have criminal histories. This is because in the absence of information about an applicant, employers may engage in statistical discrimination, assuming that black applicants—particularly young black men—have criminal histories because African Americans are overrepresented in the justice system. Most researchers advise caution in interpreting these study results.
Mike Vuolo, Sarah Lageson, and Christopher Uggen’s recent Twin-Cities-based experimental audit compared employer callback rates for young African American male entry-level jobseekers who answered “no” to a criminal history question with those who were not asked this question. They found that African American applicants experienced a lower callback rate from employers who did not ask about criminal histories than if they could answer “no” to those who asked, although this finding was not statistically significant. They also found that the black/white disparity in callback rates was greatest when employers did not ask about records compared to when they did. The study was conducted before Minnesota’s Ban the Box legislation was adopted, and published in Criminology & Public Policy.
Similarly, Amanda Agan and Sonja Starr’s study of New Jersey and New York City, described in a working paper, found that “the gap in employer callbacks between Black and White applicants grows significantly after Ban the Box.” Jennifer Doleac and Benjamin Hansen’s working paper reports that Ban-the-Box policies decreased the employment probability of young, low-skilled black and Hispanic men, while increasing employment among older, low-skilled black men and highly-educated black women.
Cautioning that their statistically insignificant results have not yet been replicated in other settings, Vuolo and colleagues note that while policymakers must strike the right balance between leveling the playing field for those with records and not harming those without, they should also recognize the “large proportion of African Americans who do possess criminal records.” Agan cautions that while these studies identify a barrier to eventual employment, “neither study could analyze eventual employment outcomes, only initial callbacks.”
Reflecting on these findings and on Noah Zatz’s commentary, Naomi Sugie asks, “Instead of wavering on Ban the Box policies because of resulting racial discrimination by some employers, shouldn’t we advocate strategies that address both of these forms of discrimination”? The National Employment Law Project echoes these critiques. Doleac, in contrast, suggests repealing Ban the Box reforms and replacing them with employability certificates that only give employers more information about the candidate’s job readiness.
Wisconsin Documentary on Urban Agriculture and Re-Entry
A new short film explores how improving food systems can address the cycle of incarceration for individuals of color in Madison, Wisconsin, reports The Badger Herald. The film, “Break the Cycle: The Power of Food to Interrupt the Revolving Prison Door,” explains that black men make up 6% of Wisconsin’s population, yet comprise 52% of its state prison population. The film show how two South-Madison programs, Neighborhood Food Solutions and Nehemiah Center for Urban Leadership, equip formerly incarcerated individuals to engage in organic urban agriculture, helping them to reintegrate into their community while improving healthy food access. The film was produced by students from University of Wisconsin’s Nelson Institute for Environmental Studies as part of Building Food Justice Capacity in South Madison—a four-year community-university partnership.
State Police Dismiss Racial Disparities in Vermont Traffic Stops
Although a five-year analysis revealed clear racial disparities in Vermont State Police traffic stops, officials say they have found no instances of implicit or explicit racial bias after conversations with troopers, reports Vermont Public Radio. After conversations with the “outlier” state troopers, Captain Ingrid Jonas, Director of the Vermont State Police’s Fair and Impartial Policing Committee, concluded that troopers had reasonable explanations for the racial disparities in their stops.
Since the original Northeastern University study, an analysis by University of Vermont economist Stephanie Seguino and Nancy Brooks of Cornell University found that after stops, black and Hispanic drivers had a higher likelihood of being ticketed, searched, or arrested compared to their white counterparts. However, searched white drivers were more likely to have contraband than their black or Hispanic counterparts. The American Civil Liberties Union of Vermont and lawyer Robert Appel, a member of the Fair and Impartial Policing Committee, suggest bringing in outside consultants to identify bias among the State Police.
Incarcerated People in England Perceive Justice System as Unfair and Racially Biased
Based on focus groups with incarcerated people in an English prison, Catch22 reports that “both black and white prisoners, as a whole, consider the criminal justice system to show widespread racial bias.” Over the past year, researchers asked incarcerated people about their perceptions of fairness—particularly racial discrimination—spanning the breadth of the criminal justice system, from policing to legal representation, sentencing, prisons, and community-based sanctions.
Study participants’ two greatest concerns were the lack of diversity among criminal justice practitioners and the lack of transparency in decision making. They believed that lack of diversity could lead to more racial stereotyping and discrimination against black and minority ethnic people. The researchers noted that opaque-decision making processes increased the likelihood of bias as well as its perception. The report was produced as part of MP David Lammy’s review into the justice system.
|
<urn:uuid:fe0b8c09-d905-4013-88e7-ce0ebbe75510>
|
CC-MAIN-2022-33
|
https://www.sentencingproject.org/news/race-justice-news-can-ban-box-policies-result-racial-discrimination/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.946438
| 1,528
| 2.15625
| 2
|
The death of Justice Ruth Bader Ginsburg will set off a massive political battle over her replacement, and just a few hours later on Friday night, the cable networks were already getting in place to cover it.
On MSNBC’s “Rachel Maddow Show,” the tone was somber, as the show broadcast live images of a vigil outside the Supreme Court building. Maddow interviewed NPR’s Nina Totenberg, who related that Ginsburg’s dying wish was that the next president would pick her replacement.
“There’s going to be a monumental fight over this,” Totenberg said. “I’m not optimistic that what she wanted, her fervent wish, will in fact take place, but you never know. You really never know.”
Shortly after Ginsburg’s death was announced, Senate Majority Leader Mitch McConnell issued a statement saying that President Trump’s nominee would get a vote on the floor. Democrats, meanwhile, are seeking to invoke the “McConnell Rule” — recalling the leader’s refusal to consider President Obama’s appointment of Merrick Garland in the 2016 election year.
On Fox News, legal commentator Jay Sekulow — who worked as Trump’s outside counsel during the impeachment — predicted that there would be a decent interval of a couple of days to mourn Ginsburg before the political fight begins.
“The battle will be pitched on Monday, I don’t think there’s any doubt about it,” Sekulow said on “Hannity,” as he sketched out the Republican argument for allowing Trump to replace Ginsburg. “The president nominates with the advice of the United States Senate. That’s how it works. The Constitution doesn’t change when you’re five months before, two weeks or after an election.”
The vacancy on the court will raise the stakes — if possible — in the presidential election, just six weeks before the vote. The confirmation hearings can also be expected to exceed even the high drama of the battle over Justice Brett Kavanaugh.
That fight riveted the nation, though Kavanaugh was replacing another conservative, Justice Anthony Kennedy. In this case, Trump’s nominee would replace the court’s leading liberal. As with Kavanaugh, all eyes will be on a handful of Republican senators, including Sen. Susan Collins, who is up for re-election in November, and will face tremendous political pressure to back up McConnell and Trump.
On CNN’s “Anderson Cooper 360,” commentator David Gergen predicted that the fight would help Joe Biden.
“I think this plays into Biden’s hands,” he said. “The unfairness is so — it shrieks of hypocrisy.”
Biden issued a statement Friday night, saying “The voters should pick a President, and that President should select a successor to Justice Ginsburg. This was the position that the Republican Senate took in 2016, when there were nearly nine months before the election. That is the position the United States Senate must take now, when the election is less than two months away. We are talking about the Constitution and the Supreme Court. That institution should not be subject to politics.”
|
<urn:uuid:4ced1fbf-d016-43ac-a35a-97a008d348e8>
|
CC-MAIN-2022-33
|
https://variety.com/2020/politics/news/ruth-bader-ginsburg-cable-news-1234775439/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.954331
| 686
| 1.65625
| 2
|
Restaurant chain Chipotle Mexican Grill has deployed autonomous kitchen platform, Chippy, to assist in making tortilla chips.
The technology from Miso Robotics harnesses AI to replicate Chipotle’s chip recipe, cook the chips and season them with salt and lime. The collaboration said it is imperative that the technique remained the same so customers receives quality tortilla chips every time.
“Everyone loves finding a chip with a little more salt or an extra hint of lime,” said Nevielle Panthaky, vice president of culinary, Chipotle. “To ensure we didn’t lose the humanity behind our culinary experience, we trained Chippy extensively to ensure the output mirrored our current product, delivering some subtle variations in flavour that our guests expect.”
Chippy is currently being tested at the Chipotle Cultivate Centre, Chipotle’s innovation hub in Irvine, California and will be integrated into a Chipotle restaurant in Southern California later this year. The company said it is leveraging its stage-gate process to listen, test and learn from crew and guest feedback before deciding on a national implementation strategy.
“When Chipotle challenged us to see if our technology could meet the brand’s high standards for culinary quality, we couldn’t wait to flex our engineering and design muscles,” said Mike Bell, CEO, Miso Robotics. “This partnership will allow us to move into new territory to help improve back-of-house functions and assist team members with their day-to-day responsibilities.”
|
<urn:uuid:72e9b1af-c7fd-4326-8a37-7c5b28d39695>
|
CC-MAIN-2022-33
|
https://www.roboticsandinnovation.co.uk/news/fb/chipotle-trials-chippy-ai-powered-kitchen-system.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.928819
| 321
| 1.8125
| 2
|
Looking for help with stink bugs? Quality Pest Exterminator is here to help. Stink bugs belong to the order of Hemiptera. Uncertain of what a stink bug is? They have mouths that can penetrate and suck and straight receiving wires. The easiest way to identify them is by their distinct shape. Their shape appears like that of a guard. The bulk of stink bug species eat plants and can be green or brownish in color.
For example, the marmorated stink bug, with a distinct brown coloring and shield-like body shape, varying from 12 to 17 millimeters in total length. This particular kind will have lighter colored bands on the antennae and darker bands on their front wings.
A female stink bug may convey 20 to 30 youthful in every generation cycle. It only takes 4 to 5 days for the young to hatch and the nymphs will demand food immediately. By autumn they will have become adults after enduring many molts.
Indianapolis Stink Bugs
The majority of stink bugs choose to eat vegetables and fruits consisting of green peppers, peaches, apples, soybeans, corn, tomatoes and blackberries. If you have a garden you’ll probably discover damage to your plants if it endures a stink bug invasion. This particular time is when their special mouth-parts are important; they cut the outside of the food so that they can eat. It will continue to feed until complete and then just wander away, oftentimes causing the still-growing fruit or veggie to be left with a mark.
Believe an Infestation Has Manifested?
It is not very hard to determine if stink bugs are a problem on your property since when Fall comes along they will be all around you. The exterior side of your house is toasty from the sunshine and may very likely have many of these little annoying bugs on it. If you see stink bugs in your yard there are likely others close-by that you’ve yet to observe.
Indianapolis Stink Bug Management
Utilizing prudent systems before you even notice an issue is clearly exhorted. But we realize it’s also not always the perfect choice for everyone. Securing your property from stink bugs is similar to protecting your house from just about every other small, less extreme insect. Here are some tips to manage the bugs coming inside your property, stink bugs and others.
- Check windows and doors for cracks; seal with caulk.
- Fix any door and window screens that has damage or rips.
- Install weather stripping and fix any present harmed stripping.
- The crawl space and attic vents should also be inspected in order to avoid pest entry.
|
<urn:uuid:c62331c9-b5da-4a5e-a90c-5da8c701fa8a>
|
CC-MAIN-2022-33
|
https://indypest.net/stink-bugs/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.934912
| 547
| 2.4375
| 2
|
A certificate of birth is an important document that gives essential information regarding a person’s birth. This document is vital because it provides the child’s statistics, tax, military, and census information. It also acts as a proof for an individual’s age, identity, and citizenship status. With it, you can acquire a social security number, driver’s license, or apply for other benefits.
You need to be familiar with the following tips for applying and replacing a U.S. birth certificate:
1. Types of birth certificates The U.S. birth certificate is categorized into two; long-form and short-form birth certificates. A long-form certificate is a copy of the real document on file with the exact place where you were born. A short-form certificate is a notarized document proving the existence of a long-form guarantee on file. The following tips will help you to distinguish a long-form from a short form certificate. A long-form lists the exact hospital where you were born while a short form does not, a long-form certificate has a file number, and the date of filing of the certificate unlike a short form, long-form lists the parents’ names and birthdays while a short form does not.
2. Who can apply? In the U.S., each state has its protocols for requesting and applying for copies of a birth certificate. You can either apply for a birth certificate online via the state’s website or manually. However, to apply for a birth certificate online, you need to be a citizen, either one of your parents or guardian is a U.S citizen. Also, in case you are the legal parent or guardian with full-court proof of child custody or were born in one of the country’s states.
3. Birth certificate with parental information
A birth certificate with parental information is of considerable significance to acquiring and replacement of birth certificates. The document is recommended for newborns where parental information is needed and can be used for the same identification purpose as a certificate of birth with subject information, child health insurance, and immigration or citizenship applications.
4. Certified copy of birth registration To apply for a copy of your birth certificate, you need to get a certified copy of your certificate from the appropriate government agency. If you are a citizen by birth, you will go to the Centers for Disease Control and Preventions to provide you with the name and address of each vital record office. U.S. non-citizens are advised to login to the U.S. Department of state’s website for the names of issuing authority in each state. A certified birth certificate should have your full names, date of birth, place of birth, parents’ name, the issuing agency, and official seal, registration date, and issuing date.
5. Cost and delivery The cost of applying and delivery for birth certificates in the U.S.A varies from state to state. For instance, in 2018, the states-issued certificates of birth ranged between $ 7.00 in North Dakota to $ 34.00 in Michigan. In case you are a U.S. citizen, visit the vital records office for the cost and delivery while the non-citizens visit the issuing authority in each country.
6. How to order online
The United States offers an alternative to apply for a birth certificate online. There are two options here:
Vital records online are the first option. You will be able to order your certificate in ten minutes. The certificate will be delivered to your door.
Call vital records. With this option, you should be able to link with a person to guide you appropriately.
|
<urn:uuid:55075070-68f8-4e91-b56c-c53e911cabde>
|
CC-MAIN-2022-33
|
https://www.profiletrend.net/lifestyle/how-to-get-or-replace-a-birth-certificate/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.926321
| 753
| 2.25
| 2
|
The empiricist approach to discerning reality is making sense of evidence that has been gleaned from the senses. Some philosophers – such as Kant – challenged this approach. They stated such things as that senses are imprecise, and that (in Kant) they only see the appearance of things – the “phenomenal” - but fail to see the things in themselves – the “noumenal.”
I want to make sense of the whole thing.
Now the senses are actually not imprecise. Incomplete yes, but imprecise no. We do not see the radio waves or the infrared radiation; we see the visible light. However the information that I get from seeing the visible light is not an erroneous one. If I see you, I am fairly certain that I am actually seeing you – both the phenomenal you and the noumenal you. I can from this make an educated guess that you are not Adolf Hitler.
Sorting out these issues requires being more careful. The word "imprecise" has a meaning when it comes to observations and measurements, which you ignore. A measurement of 1.337 inches is more precise than a measurement of 1.3 inches. Our senses are imprecise in the straightforward sense that they offer limited, not unlimited, precision. You can't look at something and see the exact, precise color or length of it.
You are trying to communicate about subtle differences between terms like "imprecise" and "incomplete", but you don't define them and you aren't using them correctly according to their standard English meanings.
After that you start equivocating with "not erroneous", "fairly certain" and "educated guess". These are standard equivocations used by almost everyone including Objectivists. But they're still a big problem.
When you say "not erroneous" do you mean it cannot be mistaken? That is, it's infallible? The standard equivocation is to be unclear on this meaning -- to say things like "X is not mistaken" like it's a fact. But then to admit, if pressed, that X could be mistaken.
This equivocation is much worse in this context because of a second ambiguity. It's possible to say that sensory data cannot be mistaken, it merely is, and the concept of error doesn't apply. If the sense data is misleading because of a defect in your eye, that's a different thing than a mistake. One can reasonably say mistakes are only made by intelligences, and that one's interpretation of sense data can be mistaken but the concept of being mistaken or not doesn't even apply to the data itself. (If one was taking that position, then one shouldn't say uses phrases like "not erroneous" to refer to error-doesn't-apply-here. But people do it anyway.)
"fairly certain" can mean things like
- you don't want to be held accountable if your claim is wrong, so you hedged.
- you don't know how certain you are, so you used a phrase that could mean pretty much any amount between 100% and 0%.
- you want wiggle room to treat what you say as meaning "certain" sometimes and meaning "uncertain" at other times.
and if that weren't bad enough, the word "certain" alone is used as an equivocation. does it mean fallible knowledge? an "educated guess" as you put it? or does it mean you found the truth and it's proven beyond being doubted? people equivocate between those two meanings. and they pretend to mean something in the middle, which they can't actually define.
now let's consider "educated guess". does this mean simply "i have a guess and i think it's good?" or does it mean something more than that? is "educated" a claim to some kind of meaningful, objective status for the guess separate from your own positive opinion? it's unclear and the phrasing allows you to shift positions mid discussion.
and it fails to specify how educated the guess is. all guesses are educated more than zero and less than infinitely. so what's the idea here? it means it's educated an amount people in our culture think is good. which is really vague and unargued/unexplained.
there are lots of ways a guess can be educated. the important things are:
1) if any of the ways the guess is educated are relevant to the discussion, they can be stated. (none were stated here.)
2) is the claim to educated status meant to grant authority to one's position?
3) there is a myth that ideas have a continuum of epistemological status. Peikoff labels points on this continuum as "arbitrary", "possible", "probable", "certain". these are terrible terms which are chosen for maximizing equivocation. "probable" mixes things up with math. "certain" suggests infallibility. and the word "possible" has a meaning (that the laws of physics and logic don't contradict something) which is true of many claims in all the categories. the phrase "educated guess" may be a claim for higher status on this continuum. this continuum is one of the fundamental mistakes in epistemology and has led to endless equivocating. what difference does status on this continuum actually make? fundamentally everything comes down to critical refutation of ideas – or not. and the continuum sometimes refers to using critical arguments (for which no continuum is needed -- one always can and should act on ideas with no criticism of them), but sometimes the continuum hides the lack of any arguments.
so the fundamental equivocation is: do you have an argument that something is false? yes or no? but people don't want to face that. people want to ignore criticism and claim it's outweighed by some positive factor. they also want to ignore that they have no criticism of something, but reject it anyway by saying something else has more merit which outweighs it. (but if it's actually missing some important merit, why not just criticize that inadequacy?)
and meanwhile people are very interested in arguments that something is true. but that approach can't work because there's no way to prove something true, we always have improvable, fallible knowledge not some sort of final perfection. so what does trying to argue your idea is true mean, exactly, if you aren't arguing it's perfect? you're arguing it's the best we've got right now, it's good enough to act on, stuff like that. but how do you do that? to say it's the best idea we've got so far, you refute the rival ideas. and to say it's good enough to act on, you consider if there's any criticism of acting on it.
|
<urn:uuid:9f359c27-211c-471c-a010-765245827e50>
|
CC-MAIN-2022-33
|
https://www.curi.us/2000-dont-equivocate
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.970421
| 1,401
| 2.59375
| 3
|
Prithu is a Hindu Boy name. The name is originated from ‘unknown’ origin. The baby name Prithu means “God Gift”.
Origin of the name is: “unknown”
Prithu is a Boy name.
The pronunciation of the name is: “Not available”
Prithu Name Meaning:
The name Prithu means God gift; Broad; Spacious. It is a masculine baby name.
It is a Hindu baby name.
Variations or similar name:
bharath , paarth , parth , partha , parthey , partho , parthu , prath , prathu , preethu , prithu , prithu
Famous people with this name:
|
<urn:uuid:ab8827d3-9939-4448-a079-7cd963ad2d32>
|
CC-MAIN-2022-33
|
https://wowbabyname.com/prithu-name-meaning-and-origin/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571987.60/warc/CC-MAIN-20220813202507-20220813232507-00264.warc.gz
|
en
| 0.761549
| 199
| 2.125
| 2
|
Fifteen inmates at the Miami Correctional Institute are suing for being kept in what lawyers say are deplorable conditions.
The lawsuit, filed in Indiana’s Northern Federal District, seeks unspecified damages from the Indiana Department of Corrections.
The ACLU says the plaintiffs were housed in cells within the prison’s “restrictive units.”
“I assume because of COVID, they were not getting the five days a week recreation they were supposed to get,” said the ACLU Legal Director For Indiana Ken Faulk.
According to the lawsuit, the cells the inmates were in had broken lights and windows. Prison officials only covered the broken windows with steel plates and did not fix the lights.
“They literally were walking into live wires in their cells because they could not see. They were running into their toilet and beds because they could not see,” said Faulk.
Some inmates spent up to 60 days in the dark cells beginning in the summer of 2019, only leaving to shower every other day.
Warden William Hyatte and Deputy Warden George Payne asked a judge to give them until Oct. 5 to respond to the allegations.
|
<urn:uuid:e8a1f663-928d-48b0-ab31-1579a43ed49a>
|
CC-MAIN-2022-33
|
https://www.wfyi.org/news/articles/inmates-sue-northern-indiana-prison
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.985689
| 239
| 1.515625
| 2
|
By the way, feel free to ask me more about this stuff, if you're curious. I'm always happy to share knowledge.
@InvaderXan I would love to know more! What processes are you looking at? How is the work progressing? How do you see the technology being applied? Got any papers you're able to share? How long have you been at it?
This would probably be super awesome for space stations, actual plants are tricky in microgravity and the carbon scrubbers they have now need new filters shipping up every so often...
* The basic process involves charge separation and flow of electrons, a lot like in photosynthesis. Plants use this to split water. I'm hoping to use it to directly split carbon dioxide, if that's even possible.
* It's progressing steadily, but slower than I'd like. There are a lot of people working on carbon sequestration. Finding something that works well is easier said than done. Being a theorist, I hope to help narrow things down.
* The ultimate goal is to apply it on a large scale. Pulling CO2 from the air gives a source of hydrocarbons which doesn't use fossil sources. This could either be used as carbon-neutral fuel (short term) or be used for permanent removal of CO2 from the atmosphere (longer term).
* Here's a summary from a 2017 conference, which should be open source: https://pubs.rsc.org/en/content/articlelanding/2017/fd/c7fd00133a#!divAbstract
* Not long. A few months. I hope I can get more funding for next year...
And space stations... I don't see why this kind of thing can't work together with plants. NASA have been studying how to grow things in orbit for decades, after all. The only difficulty is growing enough of them, so an artificial system could help out where required.
@InvaderXan Improved RuBisCo? I don't know if that is the same thing but was thinking of it randomly yesterday
@InvaderXan Really cool. I tried to switch careers into plant bio a while back but life had other plans. I had dreams of working with heirloom crops to breed varieties specifically suited for the needs of organic agriculture.
Life often has other plans, sadly. Pity too, that sounds like an interesting thing to work on!
Sunbeam City is a anticapitalist, antifascist solarpunk instance that is run collectively.
|
<urn:uuid:e62ada7d-e3e1-4413-998a-4aa4da37f581>
|
CC-MAIN-2022-33
|
https://sunbeam.city/@InvaderXan/101704479252836731
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570871.10/warc/CC-MAIN-20220808183040-20220808213040-00264.warc.gz
|
en
| 0.955431
| 539
| 2.578125
| 3
|
Daily Current Affairs for Government Exams:
Today Current Affairs: 3rd November 2020 for UPSC IAS exams, State PSC exams, SSC CGL, State SSC, RRB, Railways, Banking Exam & IBPS, etc
Table of Contents
- Mission Sagar – II:
- Contempt of Court:
- Rajasthan passes Bills to stall Centre’s farm laws.:
- Aero India:
- Ammonia levels in the river:
- Other important current affairs
1.Mission Sagar – II:
As part of ‘Mission Sagar-II’, the Government of India is providing assistance to Friendly Foreign Countries to overcome natural calamities and the Covid-19 pandemic.
- Towards the same INS Airavat is delivering food aid for the people of Sudan.
- Mission Sagar-II, follows the first ‘Mission Sagar’ undertaken in 2020.
- As part of Mission Sagar-II, Indian Naval Ship Airavat will deliver food aid to Sudan, South Sudan, Djibouti and Eritrea.
- Mauritius, Madagascar, Comoros, and Seychelles along with La Réunion are part of the Indian Ocean Commission. India has recently become an observer to the Commission.
- The assistance is in line with India’s role as the first responder in the Indian Ocean region.
- The deployment is also in consonance with the Prime Minister’s vision of Security and Growth for All in the Region (SAGAR)
- Earlier, India had sent Indian Naval Ship (INS) Kesari, carrying food items and medical assistance teams, to countries in the southern Indian Ocean to deal with the Covid-19 pandemic as part of a “Mission Sagar” initiative.
The strategic importance of these island nations is highlighted by their location along key Sea Lines of Communication (SLOCs).
- These islands are vital and can facilitate a navy’s continuous presence along key international shipping routes, allowing a navy to patrol and secure SLOCs during peace times and an option to interdict and cut off an adversary’s communications during times of conflict.
2.Contempt of Court:
Attorney General declines to consent to initiate a contempt case against Andhra CM Jagan Reddy.
- Last month, CM Jagan Reddy had written to the CJI S.A. Bobde, alleging the Andhra Pradesh HC was being used to ‘destabilize and topple my democratically elected government’.
- Following this, a lawyer had written a letter to AG seeking his consent to initiate contempt proceedings against Reddy and his advisor.
Contempt Of court:
- While the basic idea of contempt law is to punish those who do not respect the orders of the courts, in the Indian context, contempt is also used to punish speech that lowers the dignity of the court and interferes with the administration of justice.
- Contempt of court can be of two kinds:
- Civil, that is the willful disobedience of a court order or judgment or willful breach of an undertaking given to a court.
- Criminal, that is written or spoken words or any act that scandalizes the court or lowers its authority or prejudices or interferes with the due course of a judicial proceeding or interferes/obstructs the administration of justice.
- Articles 129 and 215 of the Constitution of India empowers the Supreme Court and High Court respectively to punish people for their respective contempt.
- Section 10 of The Contempt of Courts Act of 1971 defines the power of the High Court to punish contempts of its subordinate courts.
- The Constitution also includes contempt of court as a reasonable restriction to the freedom of speech and expression under Article 19, along with elements like public order and defamation.
3.Rajasthan passes Bills to stall Centre’s farm laws.:
The three Bills, pertaining to the State amendments to the Central statutes, were:
- The Farmers Produce Trade and Commerce (Promotion and Facilitation) (Rajasthan Amendment) Bill, 2020.
- The Farmers (Empowerment and Protection) Agreement on Price Assurance and Farm Services (Rajasthan Amendment) Bill, 2020.
- The Essential Commodities (Special Provisions and Rajasthan Amendment) Bill, 2020.
The three agriculture laws are a clear infringement on the states’ right to legislate.
- The main subjects of the three acts are agriculture and market that are essentially state subjects as per the Seventh Schedule of the Constitution.
- However, the Central government finagled its way into the legislation by misconstruing its authority on food items, a subject in the Concurrent List, as authority over the subject agriculture.
- However, food items and agricultural products are distinct categories as many agricultural products in their raw forms are not food items and vice versa.
According to the Constitution:
- Agriculture is in the state list under the Constitution.
- But, Entry 33 of the Concurrent List provides Centre and the states powers to control production, supply and distribution of products of any industry, including agriculture.
- Usually, when a state wants to amend a Central law made under one of the items in the concurrent list, it needs the clearance of the Centre.
- When a state law contradicts a Central law on the same subject, the law passed by Parliament prevails.
- This is an arrangement envisaged as most Parliament laws apply to the whole of India and state amending the Central laws indiscriminately could lead to inconsistencies in different regions on the application of the same law.
- In matters of trade and commerce, this could especially pose serious problems.
- Article 131 of the Constitution provides exclusive jurisdiction to the Supreme Court to adjudicate matters between the states and the Centre.
- Article 254 (2) of the Constitution empowers state governments to pass legislation which negate the Central acts in the matters enumerated under the Concurrent List.
- State legislation passed under Article 254 (2) requires the assent of the President of India.
The Supreme Court has refused a plea made by the lawyer of fugitive businessman Vijay Mallya to discharge him from the case and gave the Union government six weeks to file a status report on the progress made in extraditing him from the United Kingdom.
- India has been pressing the UK to extradite Mallya after he lost his appeals in the British Supreme Court in May against his extradition to India to face money laundering and fraud charges.
- However, the UK government had indicated that Mallya is unlikely to be extradited to India anytime soon, saying there is a legal issue that needed to be resolved before his extradition can be arranged.
- As defined by Hon’ble Supreme Court of India, ‘Extradition is the delivery on the part of one State to another of those whom it is desired to deal with for crimes of which they have been accused or convicted and are justifiable in the Courts of the other State’.
- An Extradition request for an accused can be initiated in the case of under-investigation, under-trial and convicted criminals.
- In cases under investigation, abundant precautions have to be exercised by the law enforcement agency to ensure that it is in possession of prima facie evidence to sustain the allegation before the Courts of Law in the Foreign State.
- The Extradition Act 1962 provides India’s legislative basis for extradition.
- It consolidated the law relating to the extradition of a criminal fugitive from India to foreign states.
- The Indian Extradition Act, 1962 was substantially modified in 1993 by Act 66 of 1993.
The Consular, Passport & Visa (CPV) Division, Ministry of External Affairs, Government of India is the Central/Nodal Authority that administers the Extradition Act and it processes incoming and outgoing Extradition Requests.
The online media registration for the 13th edition of Aero India has been started, which will be held at Air Force Station, Bengaluru (Karnataka) in February 2021.
- Aero India is a biennial international military and civil airshow.
- It is a premier event that draws international and Indian military and civil aircraft makers, their support industries, military brass, and government dignitaries, and business visitors.
- It provides a unique opportunity for the exchange of information, ideas, and new developments in the aviation industry, in addition to giving a fillip to the domestic aviation industry furthering the cause of Make in India.
- The Yelahanka air base, about 30 km from the city centre of Bengaluru, has been hosting the air show in February since it was started in 1996.
- In 2019, it was organized by Hindustan Aeronautics Ltd. (HAL) and in 2021, it will be organized by the Defence Exhibition Organisation, Ministry of Defence.
- DEO is an autonomous organization of the Indian Government established in 1981, to promote the export potential of the Indian defence industry.
- It is responsible for organizing international exhibitions such as DefExpo and Indian participation at overseas exhibitions.
6.Ammonia levels in the river:
Ammonia levels in the river, flowing into Delhi from Haryana, had reached nearly 3 parts per million (ppm) on Thursday, almost six times above the acceptable limit of 0.5ppm.
- The acceptable maximum limit of ammonia in drinking water, as per the Bureau of Indian Standards, is 0.5 ppm.
- Ammonia is a colourless gas and is used as an industrial chemical in the production of fertilisers, plastics, synthetic fibres, dyes and other products.
- It consists of hydrogen and nitrogen. In its aqueous form, it is called ammonium hydroxide.
- This inorganic compound has a pungent smell.
- Occurrence: Ammonia occurs naturally in the environment from the breakdown of organic waste matter.
- It is lighter than air.
- Contamination: It may find its way to ground and surface water sources through industrial effluents or through contamination by sewage.
- If the concentration of ammonia in water is above 1 ppm it is toxic to fishes.
- In humans, long term ingestion of water having ammonia levels of 1 ppm or above may cause damage to internal organs.
Other important current affairs:
1.According to the data released by the National Payments Corporation of India (NPCI), the total number of transactions conducted on the Bharat Interface for Money-Unified Payments Interface (BHIM-UPI), known more simply as the UPI, crossed the 2 billion transactions count in a month in October 2020.
- UPI is currently the biggest among the NPCI operated systems including the National Automated Clearing House (NACH), Immediate Payment Service (IMPS), Aadhaar enabled Payment System (AePS), Bharat Bill Payment System (BBPS), RuPay, etc.
- Digital transactions were already on the rise but the lockdown imposed during the pandemic provided a thrust and the value of UPI transactions crossed the 200 crore mark.
- The Reserve Bank of India (RBI) had advised resorting to the digital payment due to the threat of coronavirus spreading through the physical exchange of currency.
- This resulted in businesses accepting mostly prepaid orders and in turn rise in digital transactions.
- Further, after being able to conveniently pay utility bills and even receive cash back at times, people might now be preferring to transact digitally. So, their habit may have played an important role in this thrust.
- India’s digital payments industry is likely to grow from Rs. 2,153 trillion at 27% Compounded Annual Growth Rate (CAGR) to Rs. 7,092 trillion by 2025.
- The growth is likely to come on the back of strong use cases of merchant payments, government policies including Jan Dhan Yojana, personal data protection bill along with the growth of MSMEs, growth of millennials, and high smartphone penetration.
2.As per the IHS Markit India Purchasing Managers’ Index (PMI), India’s manufacturing output showed the strongest growth in 13 years in October 2020 amid robust sales growth.
- The Nomura India Business Resumption Index (NIBRI) has also shown improvement.
- The rise in PMI: The headline seasonally adjusted IHS Markit India Manufacturing Purchasing Managers’ Index (PMI) rose from 56.8 in September to 58.9 in October, and pointed to the strongest improvement in the health of the sector in more than a decade (13 years).
- This is a third straight monthly improvement in PMI. In April, the index had slipped into contraction mode (27.4), after remaining in growth territory for 32 consecutive months.
- In PMI parlance, a print above 50 means expansion, while a score below that denotes contraction.
- NIBRI improved to 82.4 in October, a rise of 2.1 points from 80.3 in September and 73.6 in August.
- It is the Japanese brokerage’s weekly tracker of the pace of normalization of economic activity.
3.A three-judge committee of the Madras High Court has questioned the constitutional validity of setting up special courts to exclusively try MPs and MLAs for various crimes.
- Courts should be “offence-centric” and not “offender-centric.”
- Special courts can only be constituted by a statute and not by the executive or judicial fiats.
- Timing of the report: The HC committee report comes in the face of a 2017 Supreme Court order authorizing the Centre to set up 12 special courts to exclusively try criminal politicians across the country.
- It also comes at a time when a three-judge Bench of the apex court is looking at ways to expedite these trials pending for years, in some cases, for decades.
4.Department of Administrative Reforms and Public Grievances (DARPG) has come up with new initiatives for good and vigilant governance on the last day of the Vigilance Awareness Week 2020.
- “Ideas Box on Good Governance Practices in a Pandemic” has been launched and operationalized both on the DARPG as well as on the MyGov platform.
- It will crowdsource ideas related to good governance.
- Social media tweets on the “Best Practices in e-governance” have been launched.
- Round table discussion on “Satark Bharat, Samriddh Bharat” (Vigilant India, Prosperous India) was held.
- It focused on key issues of preventive vigilance in the pursuit of “Naitik Bharat” (Ethical India) which includes ethics training in public services, a social audit of ethical practices, development of measurable metrics for corruption, and disproportionately high impact of corruption on governance.
Vigilance Awareness Week:
- The Central Vigilance Commission (CVC) observes the Week every year during the week in which the birthday of Sardar Vallabhbhai Patel (31st October) falls.
- Objective: It affirms India’s commitment to the promotion of integrity and probity in public life through citizen participation and reiterates Government’s resolve to continue the crusade against corruption.
- The theme for 2020: In 2020, it was observed from 27th October to 2nd November with the theme of “Satark Bharat, Samriddh Bharat”.
|
<urn:uuid:5bceed96-98fd-4969-a2ed-2ea6d3877c5a>
|
CC-MAIN-2022-33
|
https://crackittoday.com/daily-current-affairs/daily-current-affairs-for-upsc-ias-3rd-november-2020/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.935732
| 3,290
| 2.15625
| 2
|
Challenges are a natural part of life. We face challenges in our personal lives, in relationships, in owning a business or any other aspect tied to a career. There isn’t a single person who is exempt from facing trials and difficulties. It’s impossible to avoid going through challenges, but it is possible to overcome and improve your situation.
Jeffery R. Holland gave a talk called, “However long and hard the road,” where he points out, “Excellence does not come easily or quickly.” It is through persistence, faith, and grit that we will be able to walk the long and hard road. Not only walk the road but be able to come out of it successful. It isn’t easy to keep going when burdens seem overwhelming and impossible to overcome. But it is easy in the short term to give up but this causes more trials and difficulties in the long run.
He continues to encourage those who are going through difficult times to look ahead and have hope. Without hope life is difficult, life seems overwhelming and impossible. We cannot expect a bright future when we don’t have hope for one. It is through faith and persistence that we can overcome difficulties in our lives.
In this video The 5 Whys he explains how to face challenges and ultimately how to solve said challenges.
The video is specifically about getting to the core of issues in business. It’s asking why again and again until you find the root of the issue. Because if you don’t go past the surface of issues or challenges you won’t actually be able to solve the problem and come up with a solution to permanently fix it.
This theory has helped me tremendously in life and it will continue to be a powerful tool to be able to analyze a situation and understand what the real cause of tension is. This requires a deep analysis of problems. This can be uncomfortable for a lot of people especially when it comes to introspection. A lot of people don’t like taking that long hard look in the mirror to figure out why things are the way they are in their personal life, relationships, or at work.
I’ve seen many people struggle with challenges because they’re not willing to keep asking “Why?” Surface-level answers are not the root cause of challenges. To find the root cause of an issue it requires genuine curiosity and a willingness to accept what the problem is. It requires a thorough investigation and a continuance of asking “Why?”
Then once you discover the answer you have to be willing to take action. Some people don’t take action because it requires change and change can be very difficult or painful at times. But it’s essential to progress and growth. Change is essential to being able to overcome our challenges.
|
<urn:uuid:5fc7dc83-4fbb-4cda-be26-4ab1dd198505>
|
CC-MAIN-2022-33
|
https://letthewildflowersgrow.com/overcoming-challenges/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.957347
| 583
| 1.835938
| 2
|
Since there has not been a ruling in this case, the supporters of the censorship laws had to try and find a way to get the internet censored to children. Whether it is withheld information from the news, or . on the grounds that these are morally or otherwise objectionable in light of the standards applied by the censor. By removing items that could create a panic from public view, government and law enforcement officials can provide better protection, reduce the spread of rumors, and encourage individuals to review the information they see before coming to a conclusion. According to GreenGarage there are nine primary pros and cons of censorship. Free standard shipping with $35 orders. It is a surprising fact that in a country with a rich liberal tradition like the United States, there have been over 250 attempts by school districts at book banning in 31 states. Censorship can reduce the impact of hate speech in society. The idea that all speech is equal is arguably false. The Young Adult Library Services Association named the book one of its best books for young adults in 2004. . Also known as "censorware," the development of this software began in the early 1990s. They will be bold in the use of explicit words. The control in the media is, as any other government action, full of pros and cons about the reasons and results it gives. Music can highly influence young children and adults alike and regulating it can provide balance. Hate speech isn't created equal. The censorship of books deals with removing them from school or local libraries because they contain things like vulgar language, sexual references, drug use, or extremely violent details. Censorship and oppression are tools to which make it appear as if the space is safe. Many people believe that censorship is against our constitution. They argue it is a matter of public and national safety and should be implemented in as many countries as possible. Cons: Lack of censorship. This is just in the last 4 years. The notion that all speech is equal is contested. . . it also strives in making materials available to all library patrons (60-120) Media censorship opponents feel that censorship is a great hindrance as the society . The practice of censoring the internet elicits a mixture of reactions from different entities. Expect More. What are the pros and cons of Internet censorship? Pros And Cons Of Censorship In Schools Censorship is "the removal, suppression, or restricted circulation of literary, artistic or educational materials . The 5 Cons of Music Censorship. is equally difficult to delimit.
Censorship is the suppression of speech, public communication, or other information. As shocking as this information is, "over 85% of bans go unreported either due to poor media attention or lack of opposition. The American Library Association (ALA) created Ideas & Resources to help librarians, schools, and other organizations promote Banned Books Week. There are various pros and cons of censorship in media. There, Governor William Bradford learned of . Read the lesson plan Censorship in the Classroom: Understanding Controversial Issues. It channelizes the thought process as to what to focus on. We exile Tom Cruise but we LEAVE the posts there (i.e. Used as tool to extract obscenity and other dangers, political censorship unjustly manipulates society's . Sensitive and confidential military information will be kept out of the hands of terrorists if there is a limitation on the access of information, specifically on the internet. Of course, the Internet should be free for all. Propaganda is any communication that advances biased and prejudiced arguments and distorts opposing points of view. The countries that do have censorship do not give out the full information that is needed for the people of the country, their citizens stay ignorant to the truth of what is going on in society. It gives parents peace of mind. Click to see full answer Keeping this in consideration, what are the advantages of censorship? From keeping kids away from bad influences to the government not telling citizens where troops are located, censorship will continue affecting generations to come. when the Greek state attempted to censor his philosophical teachings (The Long History of Censorship). Censorship is a negative influence on schools and education in general. Censorship can reduce the impact of hate speech. Potentially Reduce Hate Speech In The Society. Understanding Censorship: Censorship is not easy to define. Internet censorship and surveillance have become normalized, and a huge market for cybersecurity products and services has provided authorities with means to undertake extensive information controls. Censorship in the United States is nothing new. However, the past decade has shown a noticeable spike in books being banned from public school curriculums. The ALA also sells Banned Books Week merchandise to help celebrate the freedom to read. LIBRARY TRENDS, Vol. List of the Pros of Censorship 1. On the other hand, Most democratic countries such as The United States, The United Kingdom, and Japan may argue that censorship suppresses its peoples, takes away from . We also have to address the lack of censorship, or even any form of responsibility for the information, online. Pay Less. The information there should not be censored or limited. 2. There are pros and cons to these methods: Pros: They limit the spread of misinformation, disinformation, and dangerous speech - pushing platforms to be more transparent about their policies and algorithms. Many pros and cons are to censorship but three main . There are terms that individuals employ in an attempt to silence the right of everyone to speak. In a decision important to all communications media, the Supreme Court on Jan. 23 sustained the authority of a Chicago police board to pass on the content of motion picture films before granting city licenses for their public showing. American Civil Liberties Union (ACLU) webpage on Internet Censorship. A press release briefly and accurately summarizes the facts surrounding the censorship, includes a quote about the censorship from your staff spokesperson and perhaps from an expert on censorship or journalism (such as someone from the Student Press Law Center or your state . 1. Censorship can work to improve a person's knowledge. Read reviews and buy Pros and Cons: Social Media Censorship - (21st Century Skills Library: Two Sides of an Argument: Speech and Debate) by Jonah Lyon (Paperback) at Target. Music can help teach adolescents about things that they cannot talk to their parents about, and the censorship of music would just make this common process more difficult to go through. Sometimes, the citizen from a specific nation is not ready to understand fully the material . The number one benefit of censorship is to protect minors and children. Last September, Womens Health Minister Maree Todd told abortion activists that Scotland-wide . By removing items that could create a panic from public view, government and law enforcement officials can provide better protection, reduce the spread of rumors, and encourage individuals to review the information they see before coming to a . Censorship can be conducted by governments, private institutions and other controlling bodies. 1 & 2, In short, what started as an infrastructure for academics has become something entirely different within which students and researchers are now .
It promotes manipulation for personal gain. Libraries provide Internet access and are consequently drawn, willingly or not, into censorship controversies. censorship, the pros and cons of censorship itself will not be discussed: rather it will . Communities, school boards, religious offices, local libraries, the US Post Office, the Customs Service, and other instruments of authority in the United States have practiced censorship over articles, songs, films, television productions, plays and especially books since the earliest days of the Plymouth Colony in what is now Massachusetts. The Pros And Cons Of Government Censorship.
In almost every case, banned music or the creation of "edited" music has been ignored and people have gotten to the uncensored versions nonetheless. The Pros And Cons Of Censorship On Piratesofgrill Com Censorship in schools may be limiting your child. It prevents the airing of too much violence which can pollute the minds of individuals. We escalate it up and delete the off topic posts in that thread. " OR " The control of the information and ideas circulated within a society. 3. Music that has lyrics that are completely up to interpretation have been censored by the music industry and radio stations, even though the lyrics are actually acceptable, concretely speaking. Censorship is an unjustifiable thing for people to live through. It occurs in many different aspects of life. Proponents of banning books say that the act of censorship isn't a process that is supposed to ban all speech. R. Kathleen Molz, School . Many libraries have opted to use Internet filtering or blocking software while others have adamantly refused to do so. Proponents of music censorship see it fit to ban songs with expletive lyrics like gangsta rap because of what most of this type of . Due to the prevalence of hate speech, it took more than a century for minorities and women to achieve a semblance of equal . Among many issues presently, people argue that censorship threatens our first amendment, the freedom to speak and publicize freely.
As a product of the digital . It's a type of propaganda. . Pros and Cons of Internet Censorship . Government officials, organizations and even private individuals have always had the ability to challenge books on school reading lists, as well as the books in public libraries and bookstores. Fake user Tom Cruise comes in and hijacks the thread turning it into a "bash WinCustomize" thread. no censorship yet). Where freedom of expressions is stressed enough, the pro media censorship agreement may be implied as a sacrilege. Censorship involves the suppression of communication that may be valuable or harmful to the censor, the individual or group censored, or the intended recipient of the communication. the board jumped straight to censorship. Asserting the equal and equitable rights of citizens to information regardless of age, race, gender, religion, disability, cultural identity, language, socio-economic status, lifestyle choice, political allegiance or social viewpoint; 2. Students, and even teachers, are blocked from a lot of websites that supposedly have 'bad' content attached to them. 2. Censorship gives governments, local authorities, schools, and parents the leeway to limit what the children under their jurisdictions access and consume. Internet censorship is a big part of schools online searching. The one arena that gets a lot of scrutiny are the public schools and libraries. Pros and Cons of Censorship Censorship is prevalent in the modern society. Both democratic and non-democratic countries use it. In school libraries, the idea of censorship has always been considered. The 1982 censorship case Board of Education vs. Pico clearly highlights that "school officials may not remove books from school libraries for the purpose of restricting access to the political ideas or social perspectives discussed in the books, when that action is motivated simply by the officials' disapproval of the ideas involved." Keeping valued information, or keeping the outside world from the public is called censorship. Internet censorship is the control or suppression of the publishing of, or access to information on the Internet. [ 4] Internet Censorship: Pros and Cons. Adventures of Huckleberry Finn is the 4th most banned book in schools according to Banned in the U.S.A. by Herbert N. Foerstal. It encourages ignorance. Among many issues presently, people argue that censorship threatens our first amendment, the freedom to speak and publicize freely. In 1998 three new attacks arose to challenge its inclusion in education. Those who choose to declare a censorship on books are appeasing the idea that we should not put ourselves in the position to read a book that may be seen as inappropriate. 2. Censorship, they think, may well cause more harm to women than it removes. These are feelings felt with music censorship. A. Censorship in Schools Pros and Cons - May 07, 2022 By limiting resources and flexibility censorship hampers a teachers ability to explore all possible avenues to motivate and reach students. Ignorance is a tool that can be used to control people and keep them unaware about what is really going on in their community. Still, the song became the singer's biggest hit and was even added to the National Recording Registry by the Library of Congress in 2002"(Banned Music). Click to see full answer People also ask, what are the advantages of censorship? Pros of Censorship 1. Used as tool to extract obscenity and other dangers, political censorship unjustly manipulates society's . Prominent examples of censorship in recent times are the following: 1. the Australian government banned use of YouTube in the entire public schooling system, 2. the Canadian Teachers' Federation has also created additional classroom resources to control cyber-bullying. In 1982, the landmark case of Board of Education, Island Trees School District v. Pico found that school officials could not remove library material because they disagreed with the ideas behind it. Censorship is the act of filtering what an audience of something hears and sees. Propaganda is any communication that advances biased and prejudiced arguments and distorts opposing points of view. Censorship is not easy to define. 1. The meaning of censorship is to ban a book, it's not necessarily up to the library, but more so to the community and the school board. The Free-Lance Star reported: The big guys use it to hide secrets and operate more privately behind the people, the soul of a democracy. Censorship varies on the levels of helpful to harmful. Pros of Internet Censorship-Advantages of Internet Censorship: 1. Library Service, Columbia University, New York, NY . When it is introduced into the school education system, it comes with some flaws and drawbacks not intended by the original effect by which safety is a colossal concern. . Someone asked a question about Litestep. Let us go through a number of internet censorship pros and cons. Such as, it violates amendment rights, takes away students freedoms, and When using censorship it violates student's amendment rights. 2. Nicola Sturgeon has announced that she intends to trial censorship zones around abortion clinics in Scotland. "Literary works containing explicit sex, oral sex, explicit & violent descriptions of rape, masturbation, vulgar and obscene language" were on the approved reading list for grades 7-12, according to Speak up for Standards, a group seeking age-appropriate reading materials for students in Dallas, Texas. No sites or pages should be banned or controlled by any government or other powers. 1. Nicholas G. Evans, Michael J. Selgelid, in International Encyclopedia of the Social & Behavioral Sciences (Second Edition), 2015 Abstract. Conjured up by one of its oldest meanings is the work of the ancient Roman magistrates assigned to take the census of the citizens and to supervise their moral . The Library Bill of Rights adopted by the ALA in 1948 stresses the need to resist "all abridgment of the free access to ideas and full freedom of expression." The Bill has its basis in the first and fourteenth amendments 2 of 10 These are the same reasons a book can and will be banned from a library. Censorship can work to improve a person's knowledge. It's a type of propaganda. . Pros And Cons Of Censorship. There are words that people use as an effort to shut down the right to speak of others. Censorship is a huge thing within today's society, Censorship in libraries is when a school board, a parent, or just anyone challenges a book that is explicit with sexual language, homosexuality, and or religion. With the explosion of communication technology, it has become all-pervasive. The Pros of Censorship. Understanding Censorship. Internet censorship pros and cons. Censorship: What does it mean ? censorship . Here's a look at its pros and cons. Researchers and scholars have been censored throughout history by religious . Proponents are pushing for censorship because it limits the exposure of people . According to Webster's Dictionary, to "censor" means "to examine in order to suppress or delete anything considered objectionable." Its central characteristic is the suppression of an idea or image because it offends or disturbs someone, or because they disagree with it. The right to speak and the right to publish under the First Amendment has been interpreted widely to protect individuals and society from government attempts to suppress ideas and information, and to forbid government censorship of books, magazines . Despite the different forms and amount of censorship, everyone is affected by it.
When groups of people stay ignorant of what is going on in the world there is no room . Its central characteristic is the suppression of an idea or image because it offends or disturbs someone, or because they disagree with it. Book banning, a form of censorship, occurs when private individuals, government officials, or organizations remove books from libraries, school reading lists, or bookstore shelves because they object to their content, ideas, or themes.Those advocating a ban complain typically that the book in question contains graphic violence, expresses disrespect for parents and family, is sexually explicit .
He told the BBC that people who say they are being coerced into abortions and are not being given the pros and cons need to be listened to. If the censorship is enforced, the focus on the important issues in our life gets the right channel. ". This principle is supported by seven specific responsibilities for libraries to uphold: 1. Censoring information about corruption and injustices means people will continue to be victims and of abuse and exploitation. 1. Movie Tribulations in the Courts. A patina is a layer or coating that appears on metals or other surfaces as a result of age or exposure to elements like chemical or weather. Censorship is the forbidding, blocking, limiting, or obstructing access to information for whatever reason. . Governments, ISPs, corporate employers, school libraries, coffee shops, and even parents would like to purchase and use this kind of commercial content filtering software for better web usage management and control, including but not limited to streaming and e-mail services. Pros. Tom Cruise creates new account, jumps on and continues. It can help make teaching easier. It is a highly divisive issue. Prof I Kristol article presents arguments in favor of some form of censorship over pornography and obscenity to avoid serious deterioration of quality of life in Amer democracy; illus 39, Nos. Cons: Algorithms used to identify wrongful acts or information are relatively new and a work in process. Protects Children and Minors.
It costs money for monitoring the internet. 3. Music is a very influential medium and can do so in a positive and negative way. College students will not be distracted and office goers will be sincere in there work. Download. And when the Library of Congress* created its exhibit "Books that Shaped America," thirty out . The words that some people use to create feelings of personal superiority are damaging. . Censorship is the control of information and ideas in a society. Google has over 2.1 trillion results; with this huge volume of results, it would require a costly process to filter all of the information published online. Censorship is a strategy to promote a set of values while excluding opposing views. According to Webster's Dictionary, to "censor" means "to examine in order to suppress or delete anything considered objectionable.". Censorship A. its citizens. College English, Period 8 Censorship is the prohibition of any content that is considered to be threatening or unacceptable by society (Burress 23). Gatekeeping and censorship can . First Amendment Resources | Statements & Core Documents | Publications & Guidelines "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances." First Amendment of the U.S . Libraries and Intellectual Freedom The American Library Association (ALA) has fought efforts at library censorship. . It only goes to say that the mind is at times dirtier compared to the lyrics itself. The first amendment guarantees freedoms of religion, expression, assembly, and the right to petition. On one hand, it is important to put a limit on the kind of information, images, videos and others that can get to the population. Protecting the vulnerable Censorship & Judy Blume " Interview: Judy Blume | Books | guardian.co.uk ." Latest news, comment and reviews from the Guardian |. This may . Regarding the disadvantages of internet censorship, one of the most notable cons of censorship is the cost. This is an effective method for mothers to protect their children from being exposed to things they do not fully understand, however it can be harmful once it is put into the hands of the government, because it crosses some moral and ethical lines. 708 Words3 Pages Censorship in some libraries is a big issue amongst people across the world. It may be carried out by governments or by private organizations at the behest of government, regulators, or on their own initiative. Censorship is a strategy to promote a set of values while excluding opposing views. Censorship of music is the practice of restricting free access to musical works. Censorships definition is the suppression or prohibition of any part of a book, film, news, etc that are thought to be considered as a politically unacceptable, or cause a threat to society. Explore the idea of censorship.
The official definition of censorship, according to the online Oxford Dictionary, is "the suppression or prohibition of any parts of books, films, news, etc." Instances of censorship can be seen all the way back to the Greek philosopher, Socrates, in 399 B.C. List of Pros of Music Censorship. How does internet censorship affect business? So in the year 2000, Congress passed the Children's Internet Protection Act, which is aimed at the computers in the schools and libraries that the children would have access to. By thus sanctioning prior censorship, the Court seemed to be reversing a . Choose from Same Day Delivery, Drive Up or Order Pickup. Due to its origins in enslavement and racism, it is often the topic of disgruntled phone calls from parents. A good first step is to draft a press release about the censorship. of . Censorship in schools seems to come from a desire to ensure that our children grow up making the choices and following the beliefs that we desire for them by removing any other options. Censorship in school libraries is a terrible idea. Censorship and oppression are tools to which make it appear as if the space is safe. They recommend more speech-education, protest, picketing, satire and public debate-rather than censorship or other forms of legal regulation, as less dangerous and more effective tools for raising public consciousness and effecting the desired attitudinal and cultural . I also think that thinking about internet censorship in a school library is especially important because that is where most . And the truth of the matter is that there could be two sides to the coin. . Parents often worry about what's taught to their children in school. " The suppression of speech, public communication, or other information, on the basis that such material is considered objectionable, harmful, sensitive, or inconvenient. The big guys use it to hide secrets and operate more privately behind the people, the soul of a democracy. Covert censorship in libraries: a discussion paper adopt the stance that censorship in libraries is undesirable, and explore the less overt, sometimes even unconscious forms of censorship which can occur in libraries. If a school has a censorship policy, parents have the assurance that their kids are exposed to positive values and principles and are learning to be good citizens of the country. Boyd tells us that censorship is seen as a patina when books that are important for deepening concepts, seeing from different perspectives, and understanding universal qualities are banned. There are several things wrong with censorship. Pros: Censorship regulation, especially on the internet, can keep people, particularly children, from exposure to pornographic materials and racial discrimination. This may be done on the basis that such material is considered objectionable, harmful, sensitive, or "inconvenient". There are many pros and cons of real world censorship just as there is with many things meant to .
|
<urn:uuid:79c28c49-6e2e-408e-bee7-fd6ef0ad227d>
|
CC-MAIN-2022-33
|
https://mail.institut-cuisine-libre.fr/efficiency/tight-binding/10993637a7bd531128a58a5a-censorship-in-libraries-pros-and-cons
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.950558
| 4,935
| 2.671875
| 3
|
Mustard is one of those things that after you know how to make it you wonder why you ever wasted your money buying it from the store. It’s that easy. When you make your own you’re also avoiding all of the additives that come along with the packaged stuff.
I’m sharing a basic recipe here that you can take in all sorts of directions. Blend it completely smooth, add your favorite herbs and spices (like cinnamon, cumin, coriander, ginger, turmeric or lavender), play with the ratio of yellow to brown (or even black) mustard seeds for a milder or more intense heat – go wild.
More than just a condiment
Mustard isn’t just for sandwiches either (boring!). Try it on crackers, in dips, sauces and dressings. It pairs well with beans, meats, eggs, greens, olives, pickles or anywhere else you want a little tangy heat. The sky is the limit!
This recipe makes a great gift and also freezes well. It will keep for several weeks in the fridge (if it lasts that long) and the flavors enhance over time. Make a double batch for gift giving or freeze some for later.
Mustard belongs to the cruciferous family and like it’s relatives, mustard is high in cancer protective glucosinolates that are released when the seeds are crushed or soaked. It is a fiery byproduct of the glucosinolates, allyl isothiocynates (also found in wasabi and horseradish), that give mustard seeds their distinctive bite and medicinal properties. Researchers have found mustard to protect against colon, lung, prostate, bladder and ovarian cancers, heart disease and prediabetes. It also improves digestion and helps metabolize fats. Oh yeah, it’s also delicious!
There are three types of mustard seeds available – yellow (the mildest and largest), brown (more pungent and slightly smaller) and black (the smallest and hottest). I like a ratio of 1:4 brown to yellow mustard seeds, but I’ll go with 1:1 if I want a spicier result.
This post is part of a series of recipes I’m sharing over the next few weeks for the holiday gift-giving season. They’re tasty any time of year, BUT they also make great gifts. If you missed the first one, check out my Herbal Masala Chai recipe!
|
<urn:uuid:5c329bac-0f47-4a3e-9745-0eaa57375dac>
|
CC-MAIN-2022-33
|
http://sheenascott.com/homemade-mustard/?replytocom=156
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.932656
| 518
| 1.664063
| 2
|
Delaware legislators propose bill to require feminine hygiene products in schools
DOVER, Del. – A bill to help remove cost barriers and stigma around menstruation is being proposed by Delaware legislators. On Thursday, House Majority Leader Valerie Longhurst and Senator Elizabeth Lockman announced their proposal. The bill would require all Delaware public and charter schools to provide menstrual hygiene products in their bathrooms for grades 6 through 12. Both Longhurst and Lockman say they’re aware that many women struggle monthly to purchase basic menstrual hygiene products. Which is why they want to see this bill passed and take the stress off of students.
“As a parent and also a public policymaker and as a parent with daughters, I think it’s important for all of us and for me especially to be cognizant of the fact that we need to make sure that our students have what they need in our schools. The more kids are healthy and know what they need to take care of themselves the better. If that can happen within the school and the school building and in the health centers that’s what should happen,” said Senator Ernie Lopez (R-SD6).
Representative Longhurst says she expects to have this legislation drafted in the coming months and filed before the General Assembly returns to session in January.
|
<urn:uuid:fa0a7eee-d52c-4d0a-8e92-0bf9477376fc>
|
CC-MAIN-2022-33
|
https://www.wmdt.com/2019/10/delaware-legislators-propose-bill-to-require-feminine-hygiene-products-in-schools/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.964171
| 265
| 1.960938
| 2
|
We begin our days with a warm greeting at the door and progress to Morning Stations. Each day, children are paired with a partner and assigned a drawer that may contain a game, a fine motor activity, a puzzle, or an art project. Students work in their drawers until the beginning of Morning Meeting when we gather on the carpet to greet each other and get ready for the day ahead.
After our meeting, it is Work Station time where the class rotates through learning stations which include Teacher Time, Math, Art, Word Work, Blocks, Art, iPads, Writing, Playdough, and Games. By the end of the week, each child has visited each station.
Now it’s time to grab our snacks and head outside to the playground for recess where children jump rope, play tag, swing on the swings, play basketball, or enter the creative worlds of imaginative fun!
When everyone is worn out, we head back inside for Storytime and Writing. During writing, we use letter sounds and concepts of print to make books, create illustrations, and write about stories from our lives. After all our hard work, the children have lunch and get a chance to socialize with their friends. As they finish eating, they tidy up and get their spots and get ready for Rest and Read. This is a time that children can snuggle with a blanket and recharge their batteries while looking at books and reading with teachers who are circulating the room.
After we rise and shine, it is time for a Specialist class which maybe Art, Music, Creative Movement, or Physical Education. Back they come and we will explore the world of numbers, shapes, and counting during Math Workshop. Our day ends with Free Choice time and/or extra time outside to play. The students have earned it and play is also a kindergartener’s work!
Subjects such as Social Studies and Science are integrated throughout our learning and follow our goals of being curious, taking care of the Earth, and making it a more fair place for everyone.
|
<urn:uuid:db86b523-6e54-4ab4-abcc-fac5f748116b>
|
CC-MAIN-2022-33
|
https://fdnsc.net/admission/day-in-kindergarten/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.956013
| 416
| 3.46875
| 3
|
As Prime Minister Orbán and his Polish counterpart said they were waiting for a compromise on the debate over the rule of law conditionality of EU payments, commentators on both sides of the political divide ponder the implications.
Hungarian press roundup by budapost.eu
In Népszava, Róbert Friss writes that the Hungarian-Polish threat to veto the budget of the European Union as well as its coronavirus recovery scheme may seriously backfire. Germany has been mild on Hungary, he suggests, taking into account the interests of German investors here. The left-wing columnist now quotes a statement by the body representing the interests of German companies with subsidiaries in East Europe, which has urged Poland and Hungary not to veto the EU budget. They explained that investors need predictability and stability to plan their activities and deem “suspended games” unacceptable. If German companies turn against the Hungarian government, he warns, the leaders of Germany will follow suite.
In Magyar Hírlap, Imre Boros, who served as Cabinet Minister in charge of the initial EU financial transfers to Hungary from 1998 to 2002 believes that the rule of law complaints against Hungary are unfounded. During the accession process, he explains, Hungary systematically harmonised its institutional and legislative system with Union requirements. What it joined, Boros continues, was a community, rather than an empire. Since then, new and new directives have followed, and he deems some of them harmful. Now Hungary believes no more power should be given to the leadership of the Union at the expense of the member states. Hungary, he writes, wants to prevent the EU from becoming an empire and that is why it is being accused of non-compliance with rule of law principles. That false rule- of-law claim, he concludes, is a challenge to the principle of democracy.
Featured photo by Zoltán Fischer/PM’s Press Office
|
<urn:uuid:463409ba-202b-4935-8537-088ce6af5e39>
|
CC-MAIN-2022-33
|
https://hungarytoday.hu/press-rule-of-law-compromise-eu-funds/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.971092
| 391
| 1.5
| 2
|
Scandinavian authorities suspended or discouraged the use of Moderna’s COVID-19 vaccine in young people on Wednesday due to an increased risk of heart inflammation, an infrequent side effect of the shot.
Halted For Young People
The country is seeing signs of an increased risk of side effects, such as heart muscle inflammation. Sweden has suspended the use of Moderna for recipients under the age of 30, Denmark has stated that those under the age of 18 will not be offered the Swiss-made vaccine, and Norway has urged those under the age of 30 to receive the Pfizer vaccine instead.
The countries will be able to continue their vaccination campaigns because they have sufficient supplies of both Pfizer and Moderna vaccines. According to Dr. Hanna Nohynek, chief physician at the Finnish Institute for Health and Welfare, authorities in neighboring Finland are expected to announce their decision Thursday.
All three countries based their decision on an unpublished study with Sweden’s Public Health Agency saying that it signals “an increased risk of side effects such as inflammation of the heart muscle or the pericardium” — the double-walled sac containing the heart and the roots of the main vessels. It added: “The risk of being affected is very small.”
Sweden’s chief epidemiologist, Anders Tegnell, stated that they “follow the situation closely and act quickly to ensure that vaccinations against COVID-19 are always as safe as possible while also providing effective protection” against the disease.
The preliminary findings of the Nordic study have been forwarded to the European Medicines Agency’s adverse reaction committee for review.
Denmark’s Statens Serum Institut carried out the research. This government agency tracks the spread of the coronavirus in the country, Sweden’s Medical Products Agency, Norway’s National Institute of Public Health, and Finland’s Institute for Health and Welfare. According to Bolette Soeborg of the Danish government’s health agency, the final results should be available in about a month.
Adults have already received hundreds of millions of Moderna doses. In a study of over 3,700 children aged 12 to 17, the vaccine elicited the same signs of immune protection. There were no COVID-19 diagnoses in the vaccinated group, compared to four cases in the dummy shot group.
Young vaccine recipients’ most common side effects were the same as in adults: sore arms, headache, and fatigue.
According to Swedish health officials, the heart symptoms “usually go away on their own,” but a doctor must evaluate them. The conditions are most common in young men and are associated with viral infections such as COVID-19. In 2019, about 300 people under the age of 30 were hospitalized with myocarditis.
According to the Danish Health Authority on Wednesday, people under the age of 18 will not be offered the Moderna vaccine in Denmark as a precaution.
The Norwegian Institute of Public Health urged young people under 30 in non-EU member Norway to choose the Pfizer vaccine “due to an increased risk of a rare side effect” with Moderna.
According to the Swedish agency, the Pfizer vaccine is recommended for these age groups instead. Its decision to halt the Moderna vaccine is effective until December 1.
Read Related Article: Alaskan Doctors Make Life-Or-Death Decisions With COVID-19 Patients
|
<urn:uuid:b9ba40ba-2520-40ba-ab7d-a5691468c185>
|
CC-MAIN-2022-33
|
https://republicmonews.com/2021/10/07/sweden-halts-the-use-of-moderna-vaccine-for-young-people-due-to-increased-risk-of-heart-inflammation/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.957447
| 715
| 2.484375
| 2
|
This course is part of the (Res)MA History Programme. Students from within the specialization the course belongs to have right of way. It is not accessible for BA students.
One thing about time that we know for sure is that we never seem to have enough of it. For an indication of the level of current anxieties about our lack of time, one need look no further than the proliferation of books, articles and other media that tell us that we can manage and expand our time by using a variety of handy tricks and techniques ranging from to-do lists to meditation. But have we always been so pressed for time?
For millennia, the simple question “what is time” has puzzled philosophers and physicists. Anthropologists have studied how conceptions of time vary across cultures. Historians, for their part, have shown how ideas about time have changed throughout history. According to some scholars, dramatic political and social changes of the last two centuries, together with new technologies, new scientific insights and the dynamism of trade, have changed the way we “experience” time. Time is speeding up. Or so it seems.
The publication of François Hartog’s recent influential book, Regimes of Historicity, and the translation into English of older works by Reinhart Koselleck has led to a growing interest among historians in the changing cultural attitudes to time. In this course, we will examine some recent scholarship on the cultural history of time and temporality focusing in particular on the 19th and 20th centuries. We will discuss changing conceptions of time expressed in art, politics, culture and in ideas about modernity and postmodernity. We will reflect on the link between technologies, time consciousness and conceptions of national identity. We will think about how scientific insights sparked cultural imaginations. And we will review classic works on the relationship between time discipline and capitalism.
There will be a written entry test for this course in the third week of term. This test will be based on the readings from the first two weeks of classes.
The main book for this course is Hartog, F., & Brown, S. Regimes of historicity : presentism and experiences of time. New York: Columbia University Press, 2015.
The book is available in the University Library.
General learning objectives
The student has acquired:
The ability to independently identify and select literature, using traditional and modern techniques;
The ability to independently identify and select sources, using traditional and modern techniques;
The ability to analyse and evaluate a corpus of sources with a view to addressing a particular historical problem;
The ability to analyse and evaluate literature with a view to addressing a particular historical problem;
The ability to independently formulate a clear and well-argued research question, taking into account the theory and method of the field and to reduce this question to accessible and manageable sub-questions;
The ability to independently set up and carry out an original research project that can make a contribution to existing scholarly debates;
The ability to give a clear and well-founded oral and written report on research results in correct English, when required, or Dutch, meeting the criteria of the discipline;
The ability to participate in current debates in the specialisation;
The ability to provide constructive feedback to and formulate criticism of the work of others and the ability to evaluate the value of such criticism and feedback on one’s own work and incorporate it;
(ResMA only:) The ability to participate in a discussion of the theoretical foundations of the discipline.
Learning objectives, pertaining to the specialisation
The student has acquired:
Thorough knowledge and comprehension of one of the specialisations or subtrack as well as of the historiography of the specialisation, focusing particularly on the following;
-in the specialisation Politics, Culture and National Identities, 1789 to the Present: political practices, symbols and perceptions, nationalism, and national identities in a cultural and societal context from 1800;
Thorough knowledge and comprehension of the theoretical, conceptual and methodological aspects of the specialisation Politics, Culture and National Identities, 1789 to the Present: international comparison and transfer; the analysis of the specific perspectives of secondary studies; a cultural-historical approach of politics and a political-historical approach of culture.
Learning objectives, pertaining to this Research Seminar
Is familiar with interdisciplinary literature in the humanities on the topic of time and temporality.
Has gained expertise in a particular case of cultural attitudes and/or practices regarding time and is able to formulate a scholarly argument about said case which is supported by primary source evidence.
Is able to reflect critically on the importance of conceptions of time throughout history.
(ResMA only – Has a nuanced understanding of theoretical debates pertaining to the politics of time and the difference between time and temporality. Has acquired the ability to use a more complex corpus of sources in comparison to regular MA students; and/or the ability to set up and carry out original research which raises new questions, pioneers new approaches and/or and points to new directions for future research).
The timetables are available through MyTimetable.
Mode of instruction
- Seminar (compulsory attendance)
This means that students must attend every session of the course. Students who are unable to attend must notify the lecturer beforehand. The teacher will determine if and how the missed session can be compensated by an additional assignment. If specific restrictions apply to a particular course, the lecturer will notify the students at the beginning of the semester. If a student does not comply with the aforementioned requirements, the student will be excluded from the seminar.
Written paper (6500-7500 words, based on research in primary sources, excluding title page, table of contents, footnotes and bibliography)
measured learning objectives: 1-9, 11-15 (ResMA also: 10, 16)
measured learning objectives: 13
measured learning objectives: 3-9, 11-15 (ResMA also: 10, 16)
Written paper: 60%
Oral presentation: 15%
Entry test: 15%
The final grade for the course is established by determining the weighted average with the additional requirement that the written paper must always be sufficient.
Assignments and written papers should be handed in within the deadline as provided in the relevant course outline on Brightspace.
Should the overall mark be unsatisfactory, the paper is to be revised after consultation with the instructor.
Inspection and feedback
How and when a review of the written paper will take place will be disclosed together with the publication of the results at the latest. If a student requests a review within 30 days after publication of the results, a review of the written paper will have to be organised.
- Hartog, F., & Brown, S. Regimes of historicity : presentism and experiences of time. New York: Columbia University Press, 2015.
Enrolment through MyStudyMap is mandatory.
Registration Studeren à la carte and Contractonderwijs
For course related questions, contact the lecturer listed in the right information bar.
For questions about enrolment, admission, etc, contact the Education Administration Office: Huizinga.
|
<urn:uuid:f2391e72-12da-4cca-8237-a8713e46be9f>
|
CC-MAIN-2022-33
|
https://studiegids.universiteitleiden.nl/en/courses/115088/a-cultural-history-of-time
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.920583
| 1,542
| 3.4375
| 3
|
How do you deal with gender stereotypes?
6 Everyday Ways to Bust Gender Stereotypes
- Let toys be toys—for girls and boys! Make sure your children get a wide variety of toys to play with.
- Plan meaningful meet-ups. Expose your children—boys and girls!
- Watch, then talk.
- Think before you speak.
- Remember that chores have no gender.
- Embrace Adventure.
How do you overcome stereotypes in the workplace?
Get to know others who appear different from you. Stop yourself before making snap judgments about others. Consider what you have in common with other people—it may be more than you think! Develop empathy for others.
What are the stereotypes to avoid?
Perhaps the hardest stereotypes to avoid are behavior stereotypes, especially those centered on beliefs. Intolerant Christian parents, licentious atheists, rugged individualists, ever-meditating Buddhists, and radical communists are very prevalent behavioral stereotypes.
What are the effects of gender stereotyping to you?
What are the negative impacts of gender stereotypes? Gender stereotypes shape self-perception, attitudes to relationships and influence participation in the world of work. In a school environment, they can affect a young person’s classroom experience, academic performance, subject choice and well-being.
How do you stop stereotyping?
- Empirically Validated Strategies to Reduce Stereotype Threat.
- Remove Cues That Trigger Worries About Stereotypes.
- Convey That Diversity is Valued.
- Create a Critical Mass.
- Create Fair Tests, Present Them as Fair and as Serving a Learning Purpose.
- Value Students’ Individuality.
- Improve Cross-Group Interactions.
What are cultural stereotypes?
Cultural/national stereotypes are both descriptive and prescriptive in nature: they are perceivers’ shared beliefs about the characteristics of the target group and at the same time they also function as social expectations.
How are stereotypes formed?
Stereotypes are not mysterious or arbitrary,” Alice Eagly said, but “grounded in the observations of everyday life.” People form stereotypes based on inferences about groups’ social roles—like high school dropouts in the fast-food industry. Picture a high-school dropout.
Does gender have an impact on job opportunities?
Men’s and women’s jobs differ greatly, across sectors, industries, occupations, types of jobs and types of firms. Social norms around the role of women also influence these trade-offs. Women are more likely to supply fewer hours of market work than men, putting them at risk of being channelled into lower-quality jobs.
How does gender affect your life?
There’s a lot of diversity in how individuals and groups understand, experience, and express gender. Because gender influences our behaviors and relationships, it can also affect health. Influences on Health — “Sex and gender play a role in how health and disease affect individuals.
What to do when someone is stereotyping you?
Try to stay calm when you experience stigma or people are stereotyping you. Yelling or getting upset will not change their mind, because they will be more focused on your anger than your words. Staying calm gives you the opportunity to share your perspective and redefine the stereotype.
Why are there so many stereotypes in movies?
Game makers and movie studios keep making products with unfair portrayals because people pay for them. Remember that you can vote with your dollars. Challenge assumptions. Depending on your kids’ age, you can talk about common stereotypes and debunk your kids’ perceptions.
How to get rid of stereotypes about race?
You need a variety of perspectives. Look for several books written by people of different backgrounds and genders. So many good books have been written from various faith perspectives, too. Learning about race and racism is good. But it’s not enough by itself.
How to overcome stereotypes During reintegration into society?
TIPS FOR OVERCOMING STEREOTYPES DURING REINTEGRATION. Stay Calm. Reintegration can be difficult, and dealing with stereotypes during this time can add more stress. Try to stay calm when you experience stigma or people are stereotyping you.
|
<urn:uuid:e4935561-6550-410a-af14-d7e665db7abc>
|
CC-MAIN-2022-33
|
https://opiatalk.com/how-do-you-deal-with-gender-stereotypes/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.929065
| 887
| 3.453125
| 3
|
Your Security and Privacy
UPLOADING & DOWNLOADING YOUR SENSITIVE INFORMATION
When you exchange your private documents via your Secure Tax Folder, we want you to know it’s handled by Citrix ShareFile. They’re the global experts in data security and storage.
We’re brilliant at U.S. tax, but they’re the experts in data security… so we’ll leave it to them.
Encryption is a method for transforming data during either transfer or storage so that it requires permission to access. The data is transformed using an algorithm that generates a decryption key that must be used in order to open the data.
Secure uploads and downloads
Files are uploaded and downloaded between the end user and the storage tier directly over a Secure Socket Layer (SSL) or Transport Layer Security (TLS) encrypted segment using high grade encryption. ShareFile supports TLS 1.0, 1.1 and 1.2. These are the same encryption protocols and algorithms used by e-commerce services and online banking.
Secure user access
Each user on an account is given a unique username and password to login. Passwords are hashed so that not even ShareFile employees can access this information. If a user enters an incorrect password five times in a row, the system will lock that user account for five minutes before they can login again.
Servers and storage
ShareFile accounts are stored on servers maintained by Amazon Web Services in multiple locations across the globe. An account’s data is generally stored at the server location that is geographically nearest to the administrator.
Network and connections used by ShareFile
ShareFile separates application traffic from file uploads and downloads. ShareFile client applications require access to the ShareFile.com SaaS application as well as access to the storage location for their account. The SaaS application is hosted by Citrix and accessed using a customer-specific URL such as company.sharefile.com or company.sharefile.eu. User account settings, business logic and file metadata are handled by the SaaS application—no files are stored within the SaaS application tier.
When logging into the Citrix ShareFile web application, you provide your email address and password at your account landing page. After a period of time your session will timeout and you will be prompted to login again. ShareFile Enterprise customers can opt to integrate with Active Directory and redirect this login process.
Working with your data. When our EAs, CPAs and their support teams are working with your confidential information all the work that is conducted is done within the industry leading security software.
We use CCH by:
Secure log in
Administrators can control rights and define user access to features and files. User logon, audit trails and secure storage help protect practice and client information.
Military grade encryption
For complete peace of mind CCH uses the highest available, military grade 256-bit Advanced Encryption Standard. On top of this we apply the same security protocols as internet banks to give the visible reassurance of an https website address and familiar closed padlock icon.
Documents that have been checked out can be viewed but not changed, preventing potentially conflicting edits.
E-filing to the IRS
Once your tax return is ready to be filed your complete tax return is transported securely between CCH and the IRS.
The connection between CCH and the IRS is completely encrypted from beginning to end.
We’re PCI compliant, so your payments and data are safe.
|
<urn:uuid:43dff623-64fc-438f-8242-f4b9f4d8eebc>
|
CC-MAIN-2022-33
|
https://www.expattaxonline.com/security/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.904551
| 741
| 1.65625
| 2
|
Meaningful Moments in Play Therapy
This training will provide practitioners with an introduction to Child-Centered Play Therapy. Through didactic discussion and case study examples, participants will understand the rationale for therapeutic play, practice engaging with symbolism and metaphor in play, and be able to grasp the relational components and skills of child-centered play therapy and its healing properties.
Presenter: Rosie Newman, LMHC, RPT-S
Session Date: Friday, December 16, 2022 @ 10am – 1:30pm PST (Convert Time Zone)
3 APT-Approved CE Hours*
*These CE hours are applicable for the Registered Play Therapist (RPT) credential as APT Specialized Live Webinar hours (new as of July 1, 2022) and other mental health credentials in WA. For other states, please consult your state-specific CE requirements. You must be present for all sessions and pass post-tests in order to receive continuing education credits.
Availability: In stock
Children naturally engage in play to help organize and make sense of their world. A trained play therapist looks beyond
the content of the play behaviors to understand the meaning behind the child’s play through symbolism and metaphor. For
those not trained in play therapy, it can be difficult to understand this language and to see play, not as random and
meaningless, but rather intentional and meaningful. Even for the trained play therapist, it can be difficult to ‘trust the
process’ in the face of therapeutic challenges and believe in the child’s innate ability to heal through play.
This presentation will invite the participant along the therapeutic journey with one child, over the course of three years of
treatment. The case example will show the ways in which the child uses symbolism and metaphor to make sense of her
internal world and slowly feel free to be herself. Each meaningful moment with this child, will be threaded together to
make a cohesive story that will illuminate key aspects of Child Centered Play Therapy theory, the Neurosequential Model
of Therapeutics, symbolic expression and the value of the therapeutic relationship as the foundation for growth and
change in the play therapy encounter.
Participants will be able to:
1. Describe a framework for understanding directive versus non-directive play therapy and identify when therapist
intervention may be clinically indicated
2. Apply Axline’s 8 Basic principles of play therapy into practice
3. Observe the course of treatment for a child receiving long term play therapy, and through example, will learn to
recognize the value of symbolism and metaphor in children’s play
4. Apply the format and principles used in the example treatment plan provided for creating Child Centered Play Therapy
treatment plans in practice
|
<urn:uuid:fa932f95-138c-4fe8-8a7f-c9b4ddddd683>
|
CC-MAIN-2022-33
|
https://seattleplaytherapy.com/training/meaningful-moments-in-play-therapy/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.896561
| 582
| 2.375
| 2
|
Adaptogens are a collection of mushrooms and herbs that support the body and mind against daily stressors. They help to give you a good night’s sleep which will aid in the body’s biological repair process. Adaptogenic mushrooms and herbs help create a healthy calm body by regulating a person’s cortisol levels or reducing a body’s anxiety levels. The five best adaptogens to use are Ashwagandha (a root extract that lessens stress and improves sleep), American Ginseng (which helps to regulate stress and cortisol levels), Schisandra (herb that helps with anxiety), Holy Basil (herb that is thought to reduce anxiety), and Reishi (a mushroom that is thought to increase sleep quality).
- Ashwagandha is the most well known root to use for sleep function
- American Ginseng is another good alternative to use if you have sleep issues.
- Holy Basil which is also known as Tulsi is highly recommended.
“In this article, we will discuss how adaptogens may be helpful in promoting sleep while reducing levels of stress.”
|
<urn:uuid:438037f9-6948-4879-8ef8-378fd3728f5e>
|
CC-MAIN-2022-33
|
https://healthsurgeon.com/summary/the-5-best-adaptogens-for-sleep/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.941266
| 232
| 1.898438
| 2
|
Fiber and cable networks are dominating the global broadband market, accounting for 77% of fixed subscriptions, new figures from Point Topic have revealed.
According to Point Topic’s latest Global Broadband Statistics report, which take into account subscriptions up to the end of 2017, more than 50% of people in more than 40 countries, including Singapore (97%), China (89%), United States (87%), and the UK (55%), are connected via full-fiber, fiber-fed copper or cable.
“We are finding that customers across most global regions increasingly prefer faster broadband services delivered over fiber and cable platforms, as opposed to ADSL,” said Point Topic Research Director Dr Jolanta Stanke in a statement posted by the Broadband Forum. “This trend will continue as more bandwidth-hungry young consumers become paying decision makers, even though superfast 4G LTE and 5G mobile broadband services will compete for their wallets.”
Fiber-fed subscriptions – including FTTH, FTTB, FTTC, VDSL, VDSL2 and G.fast – accounted for 57% of broadband subscriptions, with more than 530 million connections. Stanke said VDSL and G.fast were together largely responsible for the growth that fiber has seen, with more than 30 operators across all continents deploying or trialing G.fast.
“G.fast gives operators a more cost-effective variant of fiber that will be used by operators who want to upgrade their existing networks quicker and more easily,” she added. “This could enable them to serve more customers in less densely populated areas, where direct fibre investment is less economically feasible.”
In total, cable – including HFC – accounted for 20% of all fixed broadband connections. According to the report, the latest standard of this technology is currently deployed across several markets, being especially popular in North America, and can deliver gigabit download speeds.
Broadband Forum CEO Robin Mersh said the figures reflect the fact that new technologies that let operators deploy fiber deep into the network without having to enter buildings themselves are quickly moving from trials to mass deployment.
“If operators want to deliver competitive broadband services, maximizing their investments through the use of technologies like G.fast is vital,” said Mersh. “Expanding the footprint of their existing fiber networks in this way is cost-effective and delivers the gigabit speeds consumers crave.”
|
<urn:uuid:52f4931a-228a-4d3e-b58e-4a8c7747ceb6>
|
CC-MAIN-2022-33
|
https://disruptive.asia/fiber-rules-adsl-fades/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.950147
| 502
| 1.726563
| 2
|
Most social media marketers do not know what inbound marketing means. This lack of knowledge has affected the growth of their brands and their overall patronage from customers. In this article, we discuss the nature of inbound marketing and the types and examples of inbound marketing.
Inbound marketing is a customer-focused form of marketing; the marketer attempts to make their outreach materials attractive and convincing enough. Inbound marketing targets people who are interested in the information, goods, or services you have to offer. Inbound Marketing is helpful because it helps you gain much better leads and improves your brand image.
However, inbound marketing requires patience. Most people consider this fact to be the only downside. It could take at least six months for an inbound campaign to really start to produce results. You would need plenty of time to build up all the content in order to get people to notice your brand.
An established inbound strategy will make a good lead generation that will continue to provide more and better leads for years to come. In essence, an inbound marketing approach is a customer-friendly approach that presents marketing materials to those who truly had an existing interest.
Components of Inbound marketing
There are five key components that make up an inbound marketing campaign. They are not only interconnected but also mutually reinforcing.
1. Search Engine Optimization (SEO)2. Content Marketing
3. Social media marketing
4. Email Marketing
5. Link building
Specific Types and Examples Of Inbound Marketing Content
Inbound marketing requires a number of approaches, and each of these approaches will have an effect on all the other approaches. These approaches must be of high quality for an inbound marketing campaign to be successful.
At the end of the day, however, content is key. Posting good content regularly will spur brand growth and success. Content types vary, and this means that you have to be careful with whichever you choose.
Blogging: Blogs are super helpful to new inbound marketers because through blogging, they get to start building their own content. Blogs score well on search engines, too. Blog posts are easily shared, and they can even be repurposed for posts on social media. Be sure to focus your blog on the information. You could do a little self-promotion but be sure to have your customers’ interests at heart.
Videos: Online videos are now incredibly popular; most marketing agencies even consider them more important than television. Posting video content online provides an unlimited opportunity for your brand to gain exposure. Video production is even easier nowadays with the availability of inexpensive video-making tools. You can publish videos which are funny, cute, and informative since they tend to perform best with viewers. Do not be too serious. Try to make informative videos which are capable of entertaining and addressing commonly-searched interests.
Infographics: Infographics are relatively cheap to make and can easily be shared online. A good infographic is also one of the best ways to be noticed. Infographics can be useful to those targeted customers, and they will be inspired to share.
Webinars: Webinars are advanced online seminars hosted by a brand in order to show off its expertise or industry influence. Webinars combine live video with a chatroom for Q&A, allowing participants to interact in real-time with those hosting the webinar.Featured Image Source: Fabrik Brands
Got a suggestion? Contact us: firstname.lastname@example.org
You might also like:
- Brands We Love: Tersus Limited
- How Kwik Logistics Company Ventured Unto E-commerce
- Five Ways To Leverage Technology To Attract New Customers To Your Business
- Fintech: Five Ways To Make Your Fintech Business Stand Out
|
<urn:uuid:62744565-9bc3-4ab7-b0d0-d188dd8a330a>
|
CC-MAIN-2022-33
|
https://articles.connectnigeria.com/all-you-need-to-know-about-inbound-marketing-strategy/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.940363
| 780
| 1.945313
| 2
|
Studies in the Book of Acts
Peter and John go to Samaria (8:14)
The overwhelming success of the mission to Samaria soon reaches the ears of the apostles in Jerusalem. Peter and John are sent to Samaria as emissaries of the Jerusalem church (8:14). There are several reasons why the apostles go to Samaria. For one, it is a mission of goodwill — to show that the church is one body. By sending the apostles to Samaria, the Jewish Christians in Jerusalem are demonstrating their brotherly bond with the Samaritan disciples. The Jerusalem church also needs to satisfy itself of the genuineness of the Samaritan conversions. Once they do so, there will be no question of the mother church accepting these new converts.
By going to Samaria, Peter and John are also confirming the validity of the Hellenistic Christians’ ministry of evangelization. During the early years of the church, the apostles seem to exercise a general supervision over the progress of the gospel in general (11:22). But we should also note the collegial method of decision-making at Jerusalem. It is the church that sends the apostles to Samaria (8:14).
Samaritans receive the Spirit (8:15-17)
When the Samaritans are baptized in Jesus’ name (8:12, 16), there is no visible evidence that they receive the Holy Spirit. Only after the apostles pray for the Samaritan disciples and lay hands on them, does God give visible evidence of the Spirit (8:17).
Why this delay? Luke does not hint at any deficiency in the Samaritan believers’ faith. Philip does not perceive any, and neither do the apostles. Nor do the apostles need to enlighten the Samaritans any further about the faith. (On the other hand, it must be pointed out that Simon’s sin is not evident right away, either — it becomes known when he tries to buy the power to give the Holy Spirit.)
An important point may be behind the delay in the evidence of the Holy Spirit for the Samaritan believers. Luke may be implying that the Samaritans need to be brought into the church as a whole, not just into its Hellenistic branch. This does not mean that converts can receive the Holy Spirit only through the apostles. Ananias, with no known ministerial function (and certainly not an apostle), is the human instrument through which the Holy Spirit is given to Paul (9:17). Luke may be trying to show that God wants a link established between Jerusalem and the new venture in Samaria. So God seems to delay the Spirit until the Jerusalem apostles validate the Samaritans’ conversion so they might become fully incorporated into the community of believers.
If the Spirit came on the Samaritans immediately upon their baptism, perhaps they would remain under suspicion by the mother church in Jerusalem. But when two apostles of high standing in the church validate the Samaritans’ conversion, and show that God fully accepts this despised ethnic group, they will also be fully accepted by believers in Jerusalem. Since the apostles are the instruments through whom the Holy Spirit comes, something of a Samaritan “Pentecost” occurs (8:15-17), giving further proof that God is working among the Samaritans. The conclusion is inescapable: God loves Samaritans in the same way that he does Jews.
How do people know that the Samaritans receive the Spirit? Luke’s story assumes it can be known, but he doesn’t say how. Some speculate that the original Pentecost charismatic gifts occur again, such as speaking in other languages. For example, Simon “sees” something when the Spirit is given, and we might wonder what visible manifestation Simon reacts to (8:18). But Luke gives no indication that charismatic gifts are manifested every time converts receive the Spirit. Luke makes no mention of any such gifts in this account. Perhaps the Samaritan converts outwardly exhibit a sense of spiritual joy, which is a gift of the Holy Spirit (Galatians 5:22). Luke and Paul both indicate in their writings that in some cases the evidence of joy can signal the presence of the Spirit (13:52; 16:34; 1 Thessalonians 1:6).
In this case, the Holy Spirit is given only after the laying on of hands. However, we should not assume that this is a requirement in all cases. For example, Luke does not say that the believers converted on Pentecost had hands laid on them (by the apostles or anyone else) before receiving the Spirit (2:38-42). The laying on of hands is also not mentioned in Luke’s account of the household of Cornelius receiving the Spirit (10:44-48). The point is that believing in Christ and being baptized is the fundamental path to “receiving” the Spirit, not laying on of hands. F.F. Bruce writes, “In general, it seems to be assumed throughout the New Testament that those who believe and are baptized have also the Spirit of God.” [F.F. Bruce, The Book of Acts, The New International Commentary on the New Testament (Rev. ed., Grand Rapids, MI: Eerdmans, 1988), page 169.]
The laying on of hands, however, is an important outward symbol of acceptance. The person doing the action represents the community, which extends its acceptance of the people who are putting their faith in Christ. The ceremony is also a symbol of the transfer of God’s power, through the church, to an individual. The laying on of hands is used in various situations in the early church, and so it is today. The apostles pray and lay hands on the Seven, ordaining them to a particular task (6:6). Paul lays his hands on the father of Publius and heals him (28:8). And it is done here so the Samaritans will receive the Spirit.
The elapsed time between the Samaritan’s baptism and receiving of the Spirit has given rise to two widely held beliefs in the Christian world. One is the doctrine of “confirmation” and the other is “the baptism of the Spirit” as a second work of grace after conversion. In some Christian circles a person is baptized, perhaps during infancy, and later in life is “confirmed” in the church by a profession of faith. In a few other denominations, a person may be regarded as converted but later be “confirmed” by exhibiting a special outward manifestation of charismatic gifts.
Nothing of either idea is suggested in Acts 8. The delay in God’s granting the Holy Spirit is simply due to a special situation, as discussed above. It is important that the Samaritan believers be accepted as full converts in the church community, and this requires the involvement of the apostles. Also, the Samaritans are baptized as adults, and they receive the Spirit within days or weeks. Luke does not mention any accompanying charismatic gifts, such as glossolalia, as occurring here. Thus, no doctrinal innovations are intimated in Luke 8, and none should be drawn out of the account.
|
<urn:uuid:99d96382-1b87-4982-be10-cd876568b852>
|
CC-MAIN-2022-33
|
https://learn.gcs.edu/mod/book/tool/print/index.php?id=4475&chapterid=77
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.950595
| 1,486
| 2.625
| 3
|
This knowledge could be used to help MS patients by stimulating the formation of new myelin sheaths after a relapse (doi: 10.1038/s41467-018-03336-3).
The human brain is likened to a high-performance computer in which it’s essential for the numerous individual processors to be connected to each other as efficiently as possible using high-speed cables. Each of the between 90 and 100 billion nerve cells represent the processors, and the nerve fibres or axons covered by myelin sheaths represent the fibre optic cables. The speed at which information is transmitted is highly dependent on the quality of the myelin sheaths, which are formed by special brain cells called oligodendrocytes. Damage to myelin sheaths or to the cells from which they are produced leads to serious disorders such as MS. Such disorders finally lead to the nerve cells being destroyed.
Complex mechanisms regulate myelin formation
The working group led by Prof. Dr. Michael Wegner, Chair of Biochemistry and Pathobiochemistry at FAU, is researching how oligodendrocytes regulate the formation of their myelin sheaths. Neurological disorders such as MS can only be understood with this knowledge. The working group has already identified protein molecules such as ‘Sox10’ that regulate the formation and preservation of myelin sheaths.
The aim of the new project was to understand how the identified proteins with the regulating function in the oligodendrocytes interact when myelin is formed. The researchers discovered that other molecules called Nfat proteins are required for this interaction between the known molecules to be successful. These are mainly known for their function in the immune system. The presence of Nfat proteins in the oligodendrocytes ensures that all other required protein molecules can exist together in these cells without displacing each other.
Findings could help MS patients in the future
In their work, which has recently been published in the journal Nature Communications, Prof. Dr. Wegner’s working group led by Dr. Matthias Weider and Prof. Dr. Tanja Kuhlmann’s team from Universitätsklinikum Münster demonstrated the precise biochemical mechanisms involved. Inhibition of Nfat proteins adversely affects the capability of oligondendrocytes in rats, mice and also humans to form myelin. There are in fact fewer of these proteins in oligondendrocytes in parts of the brain affected by MS. However, it is still unclear whether this is one of the causes of the damage. ‘The interrelationships are very complex’, emphasises Michael Wegner.
This research project is very closely linked to research being carried out by scientists at the Faculty of Sciences and the Faculty of Medicine in an FAU research training group funded by the German Research Foundation called ‘Neurodevelopment and vulnerability of the central nervous system’. The findings are not only relevant to basic research, but also to medicine. Targeted stimulation of Nfat proteins could perhaps be used in the future to promote the formation of new myelin sheaths in MS patients, for example after a relapse.
More substances need to be developed
However, such stimulating substances are not yet available. Up to now, only substances that inhibit the activity of Nfat proteins have been developed, such as Cyclosporin A and Tacrolimus. They are used in medicine mainly to keep the immune system under control and thus prevent organ rejection in transplant patients, for example. An interesting fact is that these patients often suffer from neurological disorders that are caused by myelin sheath loss. The new research suggest that these serious side effects are a direct result of the medication to inhibit Nfat proteins. It is thus extremely important that this medication is improved.
The findings demonstrate the significance of Nfat proteins for myelin formation and open up a new approach for the treatment of neurological disorders that currently have no cure.
Prof. Dr. Michael Wegner
Phone: +49 9131 8524620
|
<urn:uuid:bf2904c8-5752-4413-a445-807b48f53fcf>
|
CC-MAIN-2022-33
|
https://medizin-aspekte.de/our-vulnerable-nervous-system-what-affects-its-protective-sheaths-100669/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.949962
| 849
| 3.140625
| 3
|
Evaporation: A new vapour pressure estimation method for organic molecules including non-additivity and intramolecular interactions
Earth and related Environmental sciences
MetadataShow full item record
We present EVAPORATION (Estimation of VApour Pressure of ORganics, Accounting for Temperature, Intramolecular, and Non-additivity effects), a method to predict (subcooled) liquid pure compound vapour pressure p0 of organic molecules that requires only molecular structure as input. The method is applicable to zero-, mono- and polyfunctional molecules. A simple formula to describe log10p0(T) is employed, that takes into account both a wide temperature dependence and the non-additivity of functional groups. In order to match the recent data on functionalised diacids an empirical modification to the method was introduced. Contributions due to carbon skeleton, functional groups, and intramolecular interaction between groups are included. Molecules typically originating from oxidation of biogenic molecules are within the scope of this method: aldehydes, ketones, alcohols, ethers, esters, nitrates, acids, peroxides, hydroperoxides, peroxy acyl nitrates and peracids. Therefore the method is especially suited to describe compounds forming secondary organic aerosol (SOA).
CitationCompernolle, S.; Ceulemans, K.; Muller, J.-F. (2011). Evaporation: A new vapour pressure estimation method for organic molecules including non-additivity and intramolecular interactions. , Atmospheric Chemistry and Physics, Vol. 11, Issue 18, 9431-9450, DOI: 10.5194/acp-11-9431-2011.
|
<urn:uuid:9b341377-ade5-4e4b-8fed-877450691119>
|
CC-MAIN-2022-33
|
https://orfeo.belnet.be/handle/internal/3063
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.785538
| 460
| 1.960938
| 2
|
By Thomas Greenshields
In this blog I look at my recently published book, Those Bloody Kilts, and look ahead to my forthcoming book on The British Infantry NCO in the Great War.
Those Bloody Kilts examines the experience of the Highland soldier during the Great War of 1914-1918. The experience of the Highland soldier had been somewhat romanticized and glamourized in popular accounts, the conventional picture being the semi-mythologised bayonet-toting hero from a martial race. In this book I have endeavoured to move away from the myth and explore the reality of his experience, working entirely from the evidence provided by the soldiers themselves.
The book is the culmination of research over a period of about ten years. The principal sources were the letters and eye-witness accounts of the Highland soldiers themselves, drawn from the Imperial War Museum, the Liddle Collection and the Regimental Museums, notably the Black Watch, at Perth, the Gordons at Aberdeen, the Argylls at Stirling, and the Highlanders Museum at Fort George, embracing the Seaforths and Camerons. The first two collections have been well exploited although not for this purpose, and there is of course new material constantly being received by the IWM. The revelation was the amount of material available in the regimental museums, extremely rich, but much less exploited.
The casual reader will find many first-hand examples of the life of the Highland soldier; the practicality of the kilt, the use of the pipes, comradeship, support from home, and behaviour in battle, with many fascinating or touching extracts from soldiers’ letters and diaries. I hope that he will be touched, amused, inspired, saddened, and occasionally shocked by the experiences described. The serious researcher will find a challenging analysis of the Highland soldier’s experience, the extent to which he was different, the dynamics of interactions within a battalion, the significance of identity, and the way morale actually worked.
All, I think, may be surprised at the normalcy of the Highland soldier, and the variations and contradictions in his behaviour. Thus, the pipes came increasingly to be used, not to pipe troops into battle, but to build morale behind the lines; alongside some informality, there co-existed the iron rod of discipline; alongside compassion and understanding between officers and men, there were some abject failures; amongst touching examples of comradeship are found disturbing examples of selfishness; amongst moving examples of compassion towards the enemy are found disturbing examples of brutality; and among inspiring examples of courage are found disturbing accounts of shattered nerves. It is therefore a ‘warts and all’ picture I present. But while I have been happy to debunk myths, I have, I believe, maintained respect for both the soldiers and regiments concerned.
This is my first book, and I am honoured to have been named Second Runner Up in the Best First Book category for 2019, by the Society for Army Historical Research. I am grateful that this has given me a platform for my second book, also to be published by Helion, on The British Infantry NCO in the Great War, with publication around 2025. Although much has been written about the life of the officers during the Great War, much less has been written about the N.C.O.’s. The book will examine the social background of the N.C.O.’s, and their roles and effectiveness in battle, in training and behind the lines. It will consider the role of the N.C.O.’s in maintaining discipline, maintaining morale and providing support both upwards and downwards. It will consider the relationship between N.C.O.’s and their officers and men, and between themselves at the same and different levels. As for Those Bloody Kilts, the research will be based on the recorded experiences of the soldiers themselves. The potential source material is vast, and this will be a labour of love.
As regards myself, I am a retired Civil Servant, living in Chessington, Surrey. I have a degree in geography from the University of Oxford and a PhD in the same from Durham, on the settlement of Armenian refugees in Syria and Lebanon after the First World War, and in the distant past had a couple of chapters published in geography texts based on this research. After completing my doctorate, I spent the bulk of my career involved in mapping and geographic support to the Armed Forces within the Military Survey organisation, while in my last eight years, I worked in MOD HQ. In addition, from 1980 I spent eight years in the Territorial Army (Royal Engineers), and retired as a captain in 1988. I took early retirement from MOD at the end of March 2008, in order, inter alia, to pursue my research interests.
|
<urn:uuid:ede6b6a0-77e1-4dd5-9a85-422979698919>
|
CC-MAIN-2022-33
|
https://helionbooks.wordpress.com/2021/09/03/those-bloody-kilts/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.963494
| 984
| 2.171875
| 2
|
Being Poor in America
Being Poor in America examines the causes and factors that contribute to poverty. It discusses the experiences of being poor in urban and rural environments, and sheds light on homelessness and the role of education and health care in poverty. Features include a glossary, references, websites, source notes, and an index. Aligned to Common Core Standards and correlated to state standards. Essential Library is an imprint of Abdo Publishing, a division of ABDO.
|Interest Level||Grade 6 - Grade 12|
|Reading Level||Grade 8|
|BISACS||JNF025250, JNF010000, JNF052040|
|Subject||History, Social Studies|
|Number of Pages||112|
|Title Format||Reinforced Library Bound Hardcovers, Anywhere eBooks|
|Graphics||Full-color photographs, Historical photographs|
|Dimensions||6.25 x 9.25|
|Accelerated Reader® Quiz||NOT AR|
|Features||Glossary of key words, Index, Infographics, Informative sidebars, Reviewed, Sources for further research, and Table of contents|
|Online Resources||FREE! Booklinks Nonfiction Network|
Class in America – Booklist
The clearly written discussions place narratives and data within a broader context that makes them more meaningful. Presenting useful overviews of topics related to class differences, these books will leave readers with ideas to ponder.
|
<urn:uuid:b9b55fa1-ed68-44e3-adaa-3ed1f0217d73>
|
CC-MAIN-2022-33
|
https://abdobooks.com/shop/show/11362
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.808418
| 389
| 3.40625
| 3
|
For an overview, please click on one of the images above and scroll through the gallery. For images that you can enlarge to examine in greater detail, please scroll down to the end of this page.
An exceptional mahogany round topped regulator. The case of the very finest quality with well chosen mahogany veneers and with all its doors still fitting superbly to this day. The case has the usual opening main door fully glazed with intricate carving below the dial. It has a panelled base and sits on a single plinth with square pads to the front. The mouldings between the main trunk and the panelled base are very fine.
The case has a massive cast iron bracket fixed to the back board to support both the pendulum and the movement. The movement is one of the finest we have seen on a Victorian regulator. It has massive plates with adjustable end stops throughout the train. The escape wheel and anchor running in jewels. The escapement has jewelled pallets and the plates are separated by six very substantial and beautifully turned pillars. Even the dial feet are very substantial and secured by a central arbor and three blued steel screws which fix them to the movement. The whole movement is enclosed within brass dust covers held onto the plates with beautifully turned knurled hand screws.
The dial of typical regulator form is signed for the maker J R Losada, 105 Regent Street, London and numbered 5916.
The clock has a typical pendulum suspended with a regulator style suspension spring, with a mercury filled glass jar and running against a beat plaque in the base of the trunk.
Length: 6′ 1½” (187 cm.)
Jose Rodriguez de Losada was an exceptional and well known maker of chronometers and clocks. He was born in Spain and at one stage was attached to the court of Madrid. He emigrated to England where he worked initially for James Moore French. He made movements for Kullberg and James Poole and continued to make chronometers and clocks for the Spanish government and the Royal Observatory at Cadiz, and had a number of high honours conferred on him by Queen Isabella II.
|
<urn:uuid:f68e114e-7e2d-4415-9801-405b82eceab7>
|
CC-MAIN-2022-33
|
https://www.qualityantiqueclocks.com/portfolio-items/31919-j-r-losada-regent-street-london-no-5916/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.969855
| 439
| 2.09375
| 2
|
School of Public Health
The surge of methamphetamine use has been a complicating factor compounding the steeply increasing number of drug overdose deaths in the U.S. Infection from blood-borne viruses including hepatitis B virus (HBV), hepatitis C virus (HCV) and HIV, related to methamphetamine use continue to grow. This study aims to examine the risk factors associated with HBV, HCV and HIV among people who used methamphetamine.
People who ever used methamphetamine were identified from five National Health and Nutrition Examination Survey (NHANES) cohorts, 2007 to 2016. The outcome was either positive or negative for blood-borne viruses as identified from laboratory tests. Weighted statistics for the combined ten years of data were calculated by multiplying the weighted variable for laboratory measurements by 0.2. We examined the association of sexual activities (sexual partners, sexual identity), drug use behaviors (poly-drug use, injection drug use, frequency of drug use, age started using methamphetamine), demographics, and socio-economic status with blood-borne viruses using bivariate and multivariable logistic regression models.
There were 1132 participants representing approximately 11,996,319 persons who ever used methamphetamine in the U.S. Blood-borne viruses’ positive rate was 13.0 per 100,000. Multivariable logistic regression analyses showed significant associations of blood-borne infections with age 40–49 years (vs. age 20–29 years, adjusted odds ratio 4.77, 95% CI 1.11–20.55), age 50–59 years (vs. age 20–29 years, 10.25, 2.40–43.82), living within poverty index 1–1.9 (vs. poverty index > = 2, 2.55; 1.19–5.49), living below the poverty threshold (vs. poverty index > = 2, 2.55; 1.11–5.86), having lower than high school education (vs. equal or higher than high school education, 3.13; 1.51–6.46), sexual identity as other than heterosexual (vs. heterosexual, 5.60; 1.72–18.28), using methamphetamine and heroin and cocaine (vs. using methamphetamine alone, 4.24; 1.06–16.92), injection drug use (vs. no injection drug use, 3.15; 1.61–6.16), and started using methamphetamine at age above 25 (vs. started using methamphetamine at age between 10 and 17, 2.09; 1.01–4.35).
Among people who use methamphetamine, those who use polysubstance, or who inject substances, are in urgent need for vaccination and interventions to avoid further harm from blood borne infections.
Digital Commons Citation
Cai, Yilin; Wen, Sijin; and Bhandari, Ruchi, "Risk factors associated with infection of blood-borne virus among people who used methamphetamine" (2020). Faculty & Staff Scholarship. 2941.
Cai, Y., Dai, Z., Wen, S. et al. Risk factors associated with infection of blood-borne virus among people who used methamphetamine. BMC Infect Dis 20, 742 (2020). https://doi.org/10.1186/s12879-020-05464-y
|
<urn:uuid:94c08442-78e8-4a0f-96b7-31602aa83804>
|
CC-MAIN-2022-33
|
https://researchrepository.wvu.edu/faculty_publications/2941/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.887481
| 743
| 2.78125
| 3
|
Constipation : One of the most important gastrointestinal motility disorders is a disorder that causes delay in the movement of the contents of the gastrointestinal tract.
And may be present in various parts of the digestive system, including esophagus (mega isophagus),
stomach (gastroparesis and delayed gastric emptying), small intestine or colon (mega isophagus).
One of the most common motor disorders of the digestive tract is constipation.
Constipation can be performed by treating the large intestine longer than its normal time (less than three times a week),
Or inadequate fecal excretion.
In the normal state of the remainder
The food consumed on the next morning breakfast comes to the large intestine.
Disposal is typically 12 to 72 hours or more after consuming food.
The type of food
The type of food intake is somewhat effective in terms of the length of time it takes.
For example, fiber-rich foods resist digestive enzymes throughout the digestive tract and absorb a bulk of water,
which is the stimulant of excretion.
Constipation is not a disease
But it can be a sign of different causes. This condition can be a hereditary or endocrine disorder, or nervous system diseases,
Colon diseases, or the effects of drugs and toxins.
Reducing the movement of the colon,
Reducing the frequency of bowel movements,
Decreasing the volume of stool
And increasing its stiffness will definitely cause constipation.
Constipation also occurs due to stool depletion that persists for a long time in the colon.
What is maladaptive syndrome?
The malabsorption syndrome occurs when there is no barrier to the process of absorbing important nutrients (including proteins, fats and vitamins) and fluids from the intestines.
Malabsorption can be caused by conditions such as
And intestinal trauma.
What are the causes of maladaptation syndrome?
and a lot of fluids are absorbed in the small intestine
The malabsorption syndrome occurs when
something prevents the absorption of nutrients and important fluids from the intestines.
This problem can be caused by
Damage to the intestinal wall,
An internal disease,
Or lack of sufficient digestive enzymes.
|
<urn:uuid:eeb94d5a-6ca5-49ff-8b0b-60f88f15ed6c>
|
CC-MAIN-2022-33
|
https://en.parsiteb.com/constipation-do-you-know-that-constipation-prevents-the-proper-absorption-of-medicine-and-food-part-1/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.877504
| 497
| 3.390625
| 3
|
In case you’re an RC enthusiast, you probably know by now that sustaining your RC vehicle and keeping it clean is essential. You merely cannot keep away from getting dirt, mud or water in your RC automotive, irrespective of how hard you try. And I’m not just talking about your off-road RC buggy or monster truck, I mean every type of RC automotive, even the on-road ones, which pick up grit and dust from the asphalt.
Not cleaning your RC automobile can cause lengthy-term damage. So accept the truth that spending some time cleaning your little toy car is solely inevitable. The very best thing you are able to do is to get organized and develop a cleaning routine. This will make the whole cleaning process quite a bit faster, in time.
Within the following pages, you’ll discover the reply to each query about keeping your RC automobile clean. You will discover ways to make your own RC cleaner, take good care of your RC body, clean and keep your chassis, tires and different components. Final, but not least, this book will show you a few ideas and methods on how to protect your automotive from massive quantities of dirt.
Make your own cleaning answer
You will find many types of cleaning products on your RC car. Some are excellent, while others are actually the identical as regular automotive or domestic cleaning solutions. In the end, all of it will depend on how much you’re keen to spend. If you happen to do not mind paying for a particular cleaning resolution, then it’s best to undoubtedly go with the better ones.
Then again, if you would like a less expensive resolution, you can use the following RC cleaning spray “recipe”:
A splash of WD40
Denatured Alcohol – 2 elements
Common bleach free cleaner
Mix all of these in an empty spray bottle and shake it gently.
The right way to use it
Before you begin cleaning your RC automobile, remove all of your batteries. Spray the cleaning solution all over your RC automotive chassis, however be sure that it doesn’t attain your digital devices. Depart the cleaner on for a few minutes, then grab a cleaning rag and wipe away all of the dust accrued in your RC car. Soon sufficient, it’ll appear like a brand new automobile!
Instruments it is advisable to clean your RC automobile
You don’t want any particular instruments to properly clean your RC automotive, but you might discover it useful to place together a small cleaning kit. Listed here are a few “instruments” that may always come in useful:
Q-ideas or cotton buds – these assist you reach corners and tight places
A toothbrush – helps remove bigger chunks of dirt or mud. You may as well use this to wash your wheels and equipmentbox
A few rags – used for wiping your automobile chassis
Paper towels – to dry off your RC body shell
Work space protection
Once you’ve got dedicated yourself to RC cars as a interest, it is best to know that cleaning and sustaining your vehicle come with the package. Quickly enough, you’ll develop a cleaning routine and everything can be so much easier.
Protecting your working space is without doubt one of the necessary steps in the whole cleaning process. Irrespective of where you determine to clean your RC car, the world has to be neat and organized. You will find that, this means, you’ll save yourself a whole lot of time and hassle.
RC dust bags have been designed for this precise purpose. They’re water, nitro and oil proof and they’re made from an excellent type of fabric. They help your work area keep clean, dry and tidy. Additionally, they give you loads of room, so you’ll be able to move round your RC car. Meanwhile, the grime and mud you removed out of your RC automotive will stay off out of your table, carpet and clothes.
Cleaning and polishing your RC body
Every time you take your RC automotive out for a ride, the RC body gets more or less filth on it. It may be mud, filth or just dust. It doesn’t really matter. Even the slightest traces of dust have to be cleaned; otherwise the dust and dirt particles will accumulate and find yourself damaging your RC car.
Nevertheless, cleaning your RC body is not really a big deal. You can merely rinse it with some cold water, to clean off many of the dirt. After you’ve got removed the bigger chunks of dust, wash the body in hot water, using a daily cleaning solution. This will remove grease, fuel and the remaining dirt. Rinse it off and let it dry.
Every once in a while you will wish to polish your RC body, to make it look clean and shiny again. You are able to do this by utilizing an everyday glass cleaning agent and a piece of soft fabric. For painted ABS body shells, use particular automotive polish, designed for acrylic paints.
Cleaning your RC chassis
This is probably the part that takes up most of your time, however it’s also essentially the most important. Keep in mind that it’s possible to properly clean your chassis without stripping it down, however ensure you remove all the dirt. Otherwise, it will possibly build up and find yourself damaging your RC car.
Here is more information in regards to evo drone autel visit the web page.
|
<urn:uuid:58bd91b2-fcff-4bdf-b9bf-8ff94ed67fa3>
|
CC-MAIN-2022-33
|
https://brightpropertyagents.com/2020/01/the-right-way-to-keep-your-rc-car/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.923693
| 1,132
| 1.875
| 2
|
From predicting consumer behaviours to pre-empting driving conditions, artificial intelligence will help unlock new insights for both businesses and individuals. As a recruitment services provider, CPL is pioneering the use of machine learning to help match the right candidates to the right job opportunities.
We previously heard from Aidan Keenan: A Trailblazing Data Ninja Building AI Apps, but today I caught up with Kevin Sweeney, IT Director at Dublin-based CPL, about how it plans to make the most of AI.
In the last 12 months, we’ve seen an explosion of new AI products aimed at the recruitment industry, primarily focused on matching candidates and predicting success rates. There have been lots of conversations around the idea that AI will replace consultants but I really don’t see that happening. Finding the right candidate is only the first part of the recruitment journey – building relationships with clients and candidates is also key and that will always need a human touch.
We want to make short-listing candidates easier for our 350 consultants. We receive around 40,000 CVs every month, and that’s an awful lot of information for them to go through. To help our consultants be more productive, we’ve built an AI-enabled app, based on Einstein and Heroku, which uses machine learning to predict the probability of a candidate’s success.
Within 12 hours of receiving a CV, we can process it via the app and provide consultants with a list of the most highly rated candidates. It helps us react faster and boosts our competitive advantage – recruitment is all about speed.
For machine learning to work, you need a wealth of data to analyse. Our app draws on eight years’ worth of candidate and CV data, such as education and career history, which has been captured in a standardised format in Salesforce. We’ve developed and trained a model, using machine learning and our historical data, where we can now input in a candidate’s information and output their probability of success.
You’ve got to have good base data to get accurate results. It’s got to be clean, consistent, and comprehensive. It also helps to have a strong mathematical skillset within your organisation that understands the data, so you can verify outputs and confirm that your model is working correctly.
I think we’ll see massive developments in the use of AI in the next year or two, particularly when it comes to transactional placements, such as recruiting 50 people to steward a concert, that aren’t so much about the candidate’s skillset. There are loads of exciting opportunities in other sectors too – I’m a bit of a sports fanatic, so I’m really interested in how AI might be used in the future to predict a team’s performance.
And in the meantime, read this e-book on AI for CRM to find out how you can get started.
|
<urn:uuid:6f11b3c3-1d5d-4a89-9f13-684d1d2540b5>
|
CC-MAIN-2022-33
|
https://www.salesforce.com/uk/blog/2018/02/see-how-irish-recruitment-consultants-are-blazing-trails-with-ai.html?bc=WA
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.941792
| 604
| 1.5
| 2
|
A couple of decades ago, we all closed out a project by reviewing all the paper documents associated with it, throwing out the extraneous stuff, packing the rest in a file box or cabinet (sometimes along with a current copy of building codes and ordinances), and dropping it off in dead storage.
Things are much more complex now. The life of a project is now no longer in a single medium like paper. We have faxes, phone calls, e-mail, CAD documents, word processing, spreadsheets and databases. What can we expect when we attempt to resurrect all this information years from now when we need to make changes to a structure or reconstruct information to support a legal position?
Later in the life of a project, it's sometimes difficult to figure out the rational for early decisions made just months ago.
Last month, we reviewed the difficulties of maintaining project knowledge generated by CAD and Office Productivity applications. This month, we consider the difficulties of integrating all the information flowing in from the other common sources: fax, phone and email.
Faxes, Phone Calls and E-mail
How do you document the information that flows outside of your project directory? To maintain a record of extemporaneous information, I like to write a short telephone memo (or meeting minutes) after each important phone call - just like most of us do for formal meeting minutes. After all, a telephone call is just a meeting. That written record can then be saved in the project directory for the record, and even e-mailed to others to maintain clear communications.
E-mail: E-mail is a difficult thing to keep track of. Most people treat their mailboxes as a private stash of personal notes rather than as a source of company knowledge. Most E-mail servers allow the creation of shared folders. Shared folders should be created for each project and shared between all project team members. Each team member should occasionally take a moment to drag any project-specific e-mail into that shared folder. This allows the whole team to share project knowledge, and makes knowledge transfer to new team members easier.
Unfortunately, most E-mail servers are not designed as knowledge repositories but rather as small, temporary data bins. Administrators usually create a maximum e-mail folder file size for users forcing them to constantly remove information from their mailboxes in order to conserve disk space and speed up the e-mail software. Make sure that maximum is generous enough to maintain all important project data for the life of the project. At the conclusion of each project, it is possible with many e-mail clients (such as Microsoft Outlook) to drag the contents of the e-mail project folder to a project subdirectory. You can then keep all the project information together in a searchable folder - even if you ultimately archive the project to tape or CD.
Many E-mail clients allow the creation of 'rules', which redirect a message based upon it's contents. For example, incoming messages from a certain e-mail address can be moved or copied to a shared folder, or those with a project name in the subject line can be forwarded to the project manager. Open standards for automation of e-mail clients allow much greater customization of rules and better integration with Knowledge Management tools, but so far those tools are too imprecise to depend on. It remains a mostly manual drag and drop operation to organize important e-mail
Faxes: Important incoming faxes are another aspect of project information that must be archived. There are two good solutions for this. The first is to use a fax modem and computer for all incoming faxes. Support staff can review the cover page of each incoming fax on-screen, and forward it to the intended recipient via e-mail. As a result it becomes e-mail information stored in a public project folder and is managed with the other e-mail for the project. In this case, you should also have a shared fax-modem on the network for outgoing faxes generated electronically.
Another approach is to have individual fax numbers for each Project Managerfor automatic forwarding to their e-mail address. In-house systems like this have been prohibitively expensive, but there are now several services which provide this service with no in-house hardware at all! Pricing is about $6 to $11 per month for each fax number.
In both these cases, you will need to retain a traditional fax machine for sending outgoing faxes from hand sketches and catalog cuts.
Many attorneys have read of people being burned by their own e-mail archives (proving the claims of others) and consider keeping email as bad an idea as recording the Nixon tapes. They recommend you permanently dispose of all e-mail over 90 days old to protect you from poorly considered correspondence.
I feel that all project-specific information should be generated and reviewed by the same people responsible for the written correspondence - and that they put the same attention and care into electronic correspondence as they put into the paper kind. If your office has generated correspondance that is embarrassing or opens you to liability, the time to stop it is before it is sent. Your electronic project documents are at least as important as your written correspondence and your firm should take responsibility for it. Personal email messages are a seperate issue and are outside the scope of this article.
How do you consolidate these disparate project information sources in your firm? E-mail me to share your story.
Michael Hogan - at Ideate,
is an Architect. He developed the first national AEC Information Exchange. He
currently provides business extranet solutions and provides consulting services
to the AEC industry in Chicago. He welcomes comments by e-mail at email@example.com
|
<urn:uuid:1398e36b-93f2-45ef-b419-16b6bdafc6f1>
|
CC-MAIN-2022-33
|
https://www.webconnectionhosting.com/Articles/November-2001.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.939236
| 1,166
| 1.554688
| 2
|
Posted on July 20, 2018 by Tony McMahon
A visit to the Templar castle in Mogadouro in north east Portugal
Category: Templar History
Tags: afonso, castle, catholic, Cavaleiros, Dom Afonso, Douro, fortress, gualdim, knights, medieval, miranda, Mirandense, Mogadouro, mystery, pais, porto, portugal, Templar, templario, today, tower, Tras os Montes
Come and join the growing army of Knights Templar!
Sign me up!
Follow the Templar on Facebook
Powered by WordPress.com.
You must be logged in to post a comment.
|
<urn:uuid:d574a267-4caa-4aab-94b3-8b17a0b60f1c>
|
CC-MAIN-2022-33
|
https://thetemplarknight.com/tag/dom-afonso/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.791333
| 148
| 1.867188
| 2
|
A collaborative piece by Maureen Halsema, Kristina Tarsan of Southern Appalachia Highlands Conservancy, and Joseph Gatins of Georgia Forest Watch
The crunch beneath your boots, a calming sense of solitude, a familiar landscape transformed. The world of winter hiking is unlike any other trail season—new vistas open up, new challenges present, even new trails too difficult to traverse in other seasons are suddenly open for exploration.
Renowned for its exceptional biological diversity and outstanding beauty, Roan Mountain is one of the most magnificent places to explore.
Located on the North Carolina and Tennessee state line, Roan Mountain is a wonderful place to visit and hike any time of the year. Cross country skiing and snow-shoeing are a unique way to explore the trails during the winter as Roan gets more snow than almost any other location in the area. It is one of the highest ranges in the Southern Appalachians, with peaks topping out at over 6,200 feet.
Seventeen miles of the Appalachian Trail cross Roan Mountain, which traverse endangered, high-elevation ecosystems including spruce-fir forests and open grassy balds (the longest stretch in the world). The treeless mountaintops of the balds offer spectacular views and an alpine-like hiking experience.
In addition to the A.T., the Overmountain National Historic Victory Trail, which traces the famous route of mountain patriots during the Revolutionary War, crosses Roan Mountain.
Protected through the partnering efforts of the Southern Appalachian Highlands Conservancy (SAHC), the Appalachian Trail Conservancy and the U.S. Forest Service, conserving Roan Mountain was the initial effort of SAHC and remains today the organization’s flagship project.
Roan Mountain is located where NC 261 and TN 143 join on the NC/TN state line. Parking is located at Carvers Gap. To view more details about recreation on Roan Mountain visit the Cherokee National Forest website.
This trek to an isolated section of national forest lands in the Cattahoochee National Forest, Rabon County, Ga., serves as introduction to the rich bio-diversity of Southern Appalachia.
A three-mile loop hike to two bold waterfalls, Holcomb Creek and Ammons Branch Falls—rated moderately strenuous for the novice, easy for the experienced hiker—has a total elevation gain of approximately 400 feet.
The trail bisects two crystal-clear trout streams and runs alongside stands of tall pines, hemlocks, rock faces and patches of native plants and ferns, including galax, pipsisewa, yellow root and saxifrage.
Dense stands of rhododendron, mountain laurel and doghobble are replacing the hemlocks falling prey to the current Hemlock Woolly Adelgid infestation and the white pines devastated by the Southern Pine Beetle.
The bonus for doing this hike in the dead of winter—assuming the mercury is at the right frigid temperature—is that both waterfalls and the rock faces will turn to ice, making for a spectacular and unusual display of nature.
Start your hike at the trailhead, located at the intersection of Hale Ridge Road (FS 7) and Overflow Creek Road (FS 86). Approach from Warwoman Road to the South, from North Carolina Route 246 to the North. You will descend on marked Forest Service trail (FS No. 52) to Holcomb Creek Falls will lead to a footbridge across a creek. Follow trail to Y intersection (right leads to Ammons Branch Falls overlook, left leads back a steady uphill to Hale Ridge Road.) Look for bonus cascade on left. Return to vehicles at trailhead (left along Hale Ridge Road.)
A few safety tips before embarking to this remote, but beautiful area: do not count on cell phone coverage, the last gas stations are in Clayton or Dillard, Ga., or Scaly, N.C., and hiking boots are recommended.
By Stephen Otis
If you want a winter challenge, hike the Appalachian Trail through the Great Smokies, a 69-mile ridge walk along one of the most scenic sections on the entire A.T. Hiking trails in the midst of winter offers a certain beauty and solitude, unique from every other season.
Ryan Baxter, manager of Blue Ridge Mountain Sports in Knoxville, Tenn, recently hiked the Great Smokey ridgeline. “We only saw game tracks in the snow. We were breaking fresh trail the whole time,” Baxter said.
A rare treat, especially in Great Smoky Mountains National Park, the most visited park in the United States. Preparation is key when taking on the added challenges of snow, ice, and subfreezing weather.
“We focused on extraction, with multiple exit strategies to deal with things like weather on the mountain, injuries,supply shortages, or road closures,” Baxter said. An essential element of preparation is having the right supplies, such as food, crampons, and fuel.
“A good plan…and DOWN, lots of down; booties, bags and jackets,” Baxter added, “crucial to morale.” And with this morale in place, “you are surrounded by limitless potential.” For information about strategies and planning, visit: nps.gov/grsm
|
<urn:uuid:86e05709-dcd7-4062-800d-2ddd52062c38>
|
CC-MAIN-2022-33
|
https://appvoices.org/2010/04/03/hiking-the-highlands-3/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.92305
| 1,110
| 2.15625
| 2
|
Makes good sense
Surprisingly, air conditioning in the UK workplace is not that common. According to government figures, in the offices sector only about 20% of the total floor area is air conditioned and in total it is estimated that just 40% of all commercial buildings have air conditioning, so a good many of us can find ourselves working in far from stable and at times, uncomfortable environmental conditions in the workplace.
Numerous surveys, over the years have revealed that there is a direct correlation between productivity (up or down) and temperature in the workplace, similarly accidents and absenteeism can increase alarmingly where working conditions, move just 3°C outside the perceived "comfort zone", this is generally assessed to be 22°C or 71.6°F. Lost productivity, accidents and absenteeism obviously cost businesses £millions each year, yet a little more investment in our working environment, in terms of climate control and indoor air quality could make a significant difference.
According to Guildford based, Space Airconditioning plc, one reason that the commercial take up of air conditioning in the UK is relatively low is because the benefits of the available technology are woefully misunderstood. "Generally speaking, when people attempt to define air conditioning, they only associate it with cooling", comments Mike Nankivell, Business Development Manager for Space Air; "employers are likely to take the view that given our 'normal' short periods of above average temperature days, an investment in cooling equipment for the workplace would have an unacceptable payback period. The fact is that the majority of air conditioning systems today employ heat pump technology which means that one system can efficiently replace conventional heating systems in the colder months of the year as well as resolve overheating problems in the summer. This can be a very sound commercial investment, particularly as heat pumps can also attract valuable tax breaks for businesses".
"Installing heat pump based air conditioning in the workplace makes very good sense all round" claims Nankivell; "maintenance costs are low and operating efficiency levels are excellent, with most heat pumps being capable of out-performing conventional gas and other fossil fuel boilers by a factor of 4. Additionally, heat pumps are classified as renewable micro-generation technology, so acknowledged as good for the global environment. A well-designed, good quality heat pump air conditioning system can be set to maintain the optimum workplace temperature of 22°C all year round." As a distributor of Daikin products, the world's leading manufacturer, Space Air has been supplying air conditioning systems for almost 30 years and is happy to offer advice on various available options and put prospective clients in touch with a dependable and approved local installer". If you would like more information on the year round benefits that air conditioning can offer, contact Space Air on 01483 504883.
|
<urn:uuid:04132191-6623-4701-b1ff-4743250b7e59>
|
CC-MAIN-2022-33
|
https://www.spaceairltd.co.uk/press-releases/makes-good-sense/26
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.948357
| 569
| 2.234375
| 2
|
This information is followed by a comprehensive list of Frequently Asked Questions to help guide you through any confusion you may have regarding insurance and how to go about getting the right coverage. If after reading this information you still have questions, please feel free to connect with us on the CONNECT page of our website.
If you have ever been sick or injured, you know how important it is to have health coverage. But if you are confused about what kind is best for you, you're not alone.
What types of health coverage are available? If your employer offers you a choice of health plans, what should you know before making a decision? In addition to coverage for medical expenses, do you need some other kind of insurance? What if you are too ill to work? Or, if you are over 65,will Medicare pay for all your medical expenses?
These are questions that today's consumers are asking; and these questions aren't necessarily easy to answer.
Making Sense of Health Insurance
The term health insurance refers to a wide variety of insurance policies. These range from policies that cover the costs of doctors and hospitals to those that meet a specific need, such as paying for long-term care. Even disability insurance which replaces lost income if you can't work because of illness or accident is considered health insurance, even though it's not specifically for medical expenses.
But when people talk about health insurance, they usually mean the kind of insurance offered by employers to employees, the kind that covers medical bills, surgery, and hospital expenses. You may have heard this kind of health insurance referred to as comprehensive or major medical policies, alluding to the broad protection they offer. But the fact is, neither of these terms is particularly helpful to the consumer.
Today, when people talk about broad health care coverage, instead of using the term "major medical," they are more likely to refer to fee-for-service or managed care. These terms apply to different kinds of coverage or health plans. Moreover, you'll also hear about specific kinds of managed care plans: health maintenance organizations or HMOs, preferred provider organizations or PPOs, and point-of-service or POS plans.
While fee-for-service and managed care plans differ in important ways, in some ways they are similar. Both cover an array of medical, surgical, and hospital expenses. Most offer some coverage for prescription drugs, and some include coverage for dentists and other providers. But there are many important differences that will make one or the other form of coverage the right one for you.
The section below is designed to acquaint you with the basics of fee-for-service and managed care plans. But remember: The detailed differences between one plan and another can only be understood by careful reading of the materials provided by insurers, your employee benefits specialist, or your agent or broker.
This type of coverage generally assumes that the medical provider (usually a doctor or hospital) will be paid a fee for each service rendered to the patient you or a family member covered under your policy. With fee-for-service insurance, you go to the doctor of your choice and you or your doctor or hospital submits a claim to your insurance company for reimbursement. You will only receive reimbursement for "covered" medical expenses, the ones listed in your benefits summary.
When a service is covered under your policy, you can expect to be reimbursed for some, but generally not all, of the cost. How much you will receive depends on the provisions of the policy on coinsurance and deductibles. Here's how it works:
• The portion of the covered medical expenses you pay is called "coinsurance." Although there are variations, fee-for-service policies often reimburse doctor bills at 80 percent of the "reasonable and customary charge." (This is the prevailing cost of a medical service in a given geographic area.) You pay the other 20 percent your coinsurance. However, if a medical provider charges more than the reasonable and customary fee, you will have to pay the difference. For example, if the reasonable and customary fee for a medical service is $100, the insurer will pay $80. If your doctor charged $100, you will pay $20. But if the doctor charged $105, you will pay $25. Note that many fee-for-service plans pay hospital expenses in full; some reimburse at the 80/20 level as described above.
• Deductibles are the amount of the covered expenses you must pay each year before the insurer starts to reimburse you. These might range from$100 to $300 per year per individual, or $500 or more per family. Generally, the higher the deductible, the lower the premiums, which are the monthly, quarterly, or annual payments for the insurance.
• Policies typically have an out-of-pocket maximum. This means that once your expenses reach a certain amount in a given calendar year, the reasonable and customary fee for covered benefits will be paid in full by the insurer. (If your doctor bills you more than the reasonable and customary charge, you may still have to pay a portion of the bill.) Note that Medicare limits how much a physician may charge you above the usual amount.
• There also may be lifetime limits on benefits paid under the policy. Most experts recommend that you look for a policy whose lifetime limit is at least $1 million. Anything less may prove to be inadequate.
The three major types of managed care plans are health maintenance organizations (HMOs), preferred provider organizations (PPOs), and point-of-service (POS) plans.
Managed care plans generally provide comprehensive health services to their members, and offer financial incentives for patients to use the providers who belong to the plan. In managed care plans, instead of paying separately for each service that you receive, your coverage is paid in advance. This is called prepaid care.
For example, you may decide to join a local HMO where you pay a monthly or quarterly premium. That premium is the same whether you use the plan's services or not. The plan may charge a copayment for certain services for example, $10 for an office visit, or $5 for every prescription. So, if you join this HMO, you may find that you have few out-of-pocket expenses for medical care as long as you use doctors or hospitals that participate in or are part of the HMO. Your share may be only the small copayments; generally, you will not have deductibles or coinsurance.
One of the interesting things about HMOs is that they deliver care directly to patients. Patients sometimes go to a medical facility to see the nurses and doctors or to a specific doctor's office. Another common model is a network of individual practitioners. In these individual practice associations (IPAs), you will get your care in a physician's office.
If you belong to an HMO, typically you must receive your medical care through the plan. Generally, you will select a primary care physician who coordinates your care. Primary care physicians may be family practice doctors, internists, pediatricians, or other types of doctors. The primary care physician is responsible for referring you to specialists when needed. While most of these specialists will be "participating providers" in the HMO, there are circumstances in which patients enrolled in an HMO may be referred to providers outside the HMO network and still receive coverage.
PPOs and POS plans are categorized as managed care plans. (Indeed, many people call POS plans "an HMO with a point-of-service option.") From the consumer's point of view, these plans combine features of fee-for-service and HMOs. They offer more flexibility than HMOs, but premiums are likely to be somewhat higher.
With a PPO or a POS plan, unlike most HMOs, you will get some reimbursement if you receive a covered service from a provider who is not in the plan. Of course, choosing a provider outside the plan's network will cost you more than choosing a provider in the network. These plans will act like fee-for-service plans and charge you coinsurance when you go outside the network.
What is the difference between a PPO and a POS plan? A POS plan has primary care physicians who coordinate patient care; and in most cases, PPO plans do not. But there are exceptions!
HMOs and PPOs have contracts with doctors, hospitals, and other providers. They have negotiated certain fees with these providers and, as long as you get your care from these providers, they should not ask you for additional payment. (Of course, if your plan requires a copayment at the time you receive care, you will have to pay that).
Always look carefully at the description of the plans you are considering for the conditions of payment. Check with your employer, your benefits manager, or your state department of insurance to find out about laws that may regulate who is responsible for payment.
Your employer may have set up a financial arrangement that helps cover employees' health care expenses. Sometimes employers do this and have the "health plan" administered by an insurance company; but sometimes there is no outside administrator. With self-insured health plans, certain federal laws may apply. Thus, if you have problems with a plan that isn't state regulated, it's probably a good idea to talk to an attorney who specializes in health law.
HMOs, PPOs, and fee-for-service plans often share certain features, including pre authorization, utilization review, and discharge planning.
For example, you may be asked to get authorization from your plan or insurer before admission to a hospital for certain types of surgery. Utilization review is the process by which a plan determines whether a specific medical or surgical service is appropriate and/or medically necessary. Discharge planning is an approach that facilitates the transfer of a patient to amore cost-effective facility if the patient no longer needs to stay in the hospital. For example, if, following surgery, you no longer need hospitalization but cannot be cared for at home, you may be transferred to a skilled nursing facility.
Almost all fee-for-service plans apply managed care techniques to contain costs and guarantee appropriate care; and an increasing number of managed care plans contain fee-for-service elements. While the distinctions among plans are growing increasingly blurred, the number of options available to consumers increases every day.
Many people worry about coverage for preexisting conditions, especially when they change jobs. The Health Insurance Portability and Accountability Act (HIPAA) helps assure continued health insurance coverage for employees and their dependents. Starting July 1, 1997, insurers could impose only one 12-month waiting period for any preexisting condition treated or diagnosed in the previous six months. Your prior health insurance coverage will be credited toward the preexisting condition exclusion period as long as you have maintained continuous coverage without a break of more than 62 days. Pregnancy is not considered a preexisting condition, and newborns and adopted children who are covered within 30 days are not subject to the 12-month waiting period.
If you have had group health coverage for two years, and you switch jobs and go to another plan, that new health plan cannot impose another preexisting condition exclusion period. If, for example, you have had prior coverage of only eight months, you may be subject to a four-month, preexisting condition exclusion period when you switch jobs. If you’ve never been covered by an employer's group plan, and you get a job that offers such coverage, you may be subject to a 12-month, preexisting condition waiting period.
Federal law also makes it easier for you to get individual insurance under certain situations, including if you have left a job where you had group health insurance, or had another plan for more than 18 months without a break of more than 62 days.
If you have not been covered under a group plan and have found it difficult to get insurance on your own, check with your state insurance department to see if your state has a risk pool. Similar to risk pools for automobile insurance, these can provide health insurance for people who cannot get it elsewhere.
What Is Not Covered?
While HMO benefits are generally more comprehensive than those of traditional fee-for-service plans, no health plan will cover every medical expense.
Very few plans cover eyeglasses and hearing aids because these are considered budgetable expenses. Very few cover elective cosmetic surgery, except to correct damage caused by a covered accidental injury. Some fee-for-service plans do not cover checkups. Procedures that are considered experimental may not be covered either. And some plans cover complications arising from pregnancy, but do not cover normal pregnancy or childbirth.
Health insurance policies frequently exclude coverage for preexisting conditions, but, as explained, federal law now limits exclusions based on such conditions.
You should also remember that insurers will not pay duplicate benefits. You and your spouse may each be covered under a health insurance plan at work but, under what is called a "coordination of benefits" provision, the total you can receive under both plans for a covered medical expense cannot exceed 100 percent of the allowable cost. Also note that if neither of your plans covers 100 percent of your expenses, you will only be covered for the percentage of coverage (for example, 80 percent) that your primary plan covers. This provision benefits everyone in the long run because it helps to keep costs down.
What Happens to My Insurance if I Lose My Job?
If you have had health coverage as an employee benefit and you leave your job, voluntarily or otherwise, one of your first concerns will be maintaining protection against the costs of health care. You can do this in one of several ways:
• First, you should know that under a federal law (the Consolidated Omnibus Budget Reconciliation Act of 1985, commonly known as COBRA), group health plans sponsored by employers with 20 or more employees are required to offer continued coverage for you and your dependents for 18 months after you leave your job. (Under the same law, following an employee's death or divorce, the worker's family has the right to continue coverage for up to three years.) If you wish to continue your group coverage under this option, you must notify your employer within 60 days. You must also pay the entire premium, up to 102 percent of the cost of the coverage.
• If COBRA does not apply in your case perhaps because you work for an employer with fewer than 20 employees you may be able to convert your group policy to individual coverage. The advantage of that option is that you may not have to pass a medical exam, although an exclusion based on a preexisting condition may apply, depending on your medical history and your insurance history.
• If COBRA doesn't apply and converting your group coverage is not for you, then, if you are healthy, not yet eligible for Medicare, and expect to take another job, you might consider an interim or short-term policy. These policies provide medical insurance for people with a short-term need, such as those temporarily between jobs or those making the transition between college and a job. These policies, typically written for two to six months and renewable once, cover hospitalization, intensive care, and surgical and doctors' care provided in the hospital, as well as expenses for related services performed outside the hospital, such as X-rays or laboratory tests.
• Another possibility is obtaining coverage through an association. Many trade and professional associations offer their members health coverage often HMOs as well as basic hospital-surgical policies and disability and long-term care insurance. If you are self-employed, you may find association membership an attractive route.
Question: How do I purchase a policy?
First, an application is sent for your signature. At the same time a medical examiner contacts you to set a convenient time at your home or office to take blood and urine. On larger amounts or older ages, a resting EKG or blood pressure check may be required. It is important to give blood after a 12 hour fast so it is better to do the exam in the morning. Once the insurance company receives the exam results, the application, and any additional doctors records that the insurance company obtains at their expense, we receive an offer. Every expense in this process is paid for by the insurance company!
Question: How long does this process take?
If no doctors records are ordered, 3 to 4 weeks (Less if there is an urgency). If doctors records have to be obtained, 4-7 weeks since we are dependent on the promptness of the doctor.
Question: If I apply and don't get the rate I applied for, what happens?
The company many times will make another offer. If our office thinks we can get a better offer from another company, we will ship your file over there.
Question: Are these stable companies?
Every company our agency uses has a strong financial rating as determined by the various rating agencies such as A. M. Best, Standard and Poor's and Moody's Bond Ratings.
Question: Are these stable companies?
Every company our agency uses has a strong financial rating as determined by the various rating agencies such as A. M. Best, Standard and Poor's and Moody's Bond Ratings.
Question: What is "Preferred Plus", "Preferred", and "Standard"?
Insurance companies are learning more and more about identifying their risks. Since cancer and cardiovascular disease are the two leading causes of death where the risk can be lessened by the individual, companies zero in on these risks. Those that qualify for the super preferred would be less at risk, then the preferred, then the standard. These companies look at height and weight, blood pressure, cholesterol(good and bad), family history(relatives dying before 60 of CV disease or cancer), personal history of cancer and CV disease, and smoking history. A more specific guide is as follows:
Question: What if I don't fit into any of these categories?
If an individual has one or more of these risk factors, they may still qualify for preferred or standard. If even standard is out of the question, there are some highly rated companies that will still take the risk. Insurance companies fear the unknown. If they can identify what those risk factors are, there is a greater chance they will offer a policy. For example, someone just finds out he has a blood pressure problem and his doctor is trying different medications to bring it under control. Until the blood pressure is under control, this remains an unknown to the insurance company. Once under control it could be a preferred with some companies, standard to others.
Question: Do most companies treat pilots the same way?
No. If a pilot has enough hours to lower the risk to the insurance company, it is possible to get preferred. Two of our companies with the lowest rates will consider preferred.
Question: Do insurance companies treat all tobacco users the same?
Cigarette smokers that smoke less than a pack a day have a chance to get a non smoker rate with one company. Other companies treat pipe smokers, chewers, and cigar smokers as non smokers. Still another company gives almost all tobacco users a non smoker rate for the first 3-4 years! This same company gives a preferred rate if you use tobacco less than three to four times a year. They look at the amount of nicotine in your system.
Question: What if an instant quote is not right for me because of my special medical history?
Using the same diligence we use to find the lowest preferred rates for our customers, we will prepare a custom quote. Of course we need to know the medical condition, its duration, treatment and prognosis.
Question: Can I apply at my age?
Our agency works with individuals 18 to 85! A few companies provide policies to age 85 for term, second to die or Disclaimer insurance. Occasionally Disclaimer is available past 85.
Question: How are companies and rates selected by our agency?
A. M. Best is the industry's most recognized insurance rating organization. A.M. Best uses a letter grade to rate companies overall strength and solvency. Our agency uses only insurance companies that have at least an "A" rating with A. M. Best The top three ratings with A. M. Best are:
• A++ Superior
• A+ Superior
• A Excellent
The companies rated lower than this, generally speaking, don't have rates that are as competitive.
• Each company is slightly different, and most allow 5lbs leeway.
• No tobacco usage last 2 years.
• Cholesterol 180-220 (A couple of our companies will go as high as 230 to 250)
• Blood Pressure 140/90 (untreated)
• Family history (No deaths before age 60, siblings or parents) (sometimes one allowed) of cancer or cardiovascular disease
• Aviation - No super preferred
• Avocation (hazardous) - No super preferred
• Driving - No more than 3 moving violations in last 2 years.
• Travel- No extensive travel to underdeveloped or politically unstable countries.
If one or more of these variables are out of the guidelines, it can move you from super preferred to preferred. Even if moved to preferred these are still very competitive rates and only 5% to 10% higher. Again, the preferred rates vary between companies so it is important to try to find which company will consider you preferred. That's where we can help! The requirements vary between companies but here are some general preferred guidelines:
• Height and weight is the same as super preferred but with more leeway sometimes up to 20-25 pounds.
• Cholesterol 250 to 280
• Blood pressure 150/90 (treated or untreated)
• Family history cannot have both parents or one parent and one sibling die before age 60 of cancer or cardiovascular disease.
• Aviation - Sometimes depending on situation
• Avocation - Sometimes depending on how hazardous
• Driving - Same as super preferred
• Travel - Similar to super preferred but not as strict
These are general guidelines and will vary more from company to company than the requirements for super preferred. If after seeing your quote, you would like to discuss this with our office by e-mail, phone or fax, our office will be glad to advise. Other factors that may or may not exclude someone from preferred are:
• Current or history of alcohol/drug abuse
• Rheumatoid arthritis
• Asthma (current treatment)
• Personal history of cancer or cardiovascular disease
• Crohn's disease
• Current treatment for depression
• Diabetes (oral diabetics can get standard rates, others can get a slightly higher premium)
• Kidney/liver disease
• Mental illness
|
<urn:uuid:8b34bead-4a5c-4b16-8729-3e87a6496e24>
|
CC-MAIN-2022-33
|
https://avertainsurance.com/averta-resources
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.954901
| 4,715
| 2.3125
| 2
|
More than 1000 Victorians have been thanked for their support in managing foxes and wild dogs in Victoria during 2021.
In 2021 alone, 65,915 fox scalps and 309 wild dog body parts were received from 1136 participants.
Agriculture Victoria Biosecurity manager Jason Wishart is grateful for all residents who have participated in the 2021 Victorian Fox and Wild Dog Bounty.
“The bounty is a Victorian Government incentive program designed to encourage community participation in fox and wild dog management, and that’s exactly what we’ve seen this year.
“These numbers were achieved with reduced mobility and temporary suspensions of collections due to Covid-19 restrictions. So, although this is lower than other years, it is still a tremendous effort.
“It is important to manage wild dogs and foxes because they prey on livestock and native wildlife and can carry diseases.”
Since the bounty program started in 2011, more than 940,000 fox scalps and 4200 wild dog body parts have been collected.
Victorian Fox and Wild Dog Bounty collections are closed for the summer period and will recommence in March 2022.
“Participants submit entire fox scalps for a $10 reward and entire wild dog body parts for a $120 reward during scheduled collection times.
“Hunters and landowners can still collect then freeze or airdry fox scalps and wild dog body parts that can be submitted when the 2022 program recommences.
“I urge hunters to familiarise themselves with terms and conditions of the Victorian Fox and Wild Dog Bounty to ensure the pieces they submit are acceptable.”
Foxes and wild dogs require ongoing management from all private and public land managers and effective management requires an integrated approach using a range of techniques including baiting, trapping, exclusion fencing and shooting.
“Hunting is important for managing foxes and wild dogs, but effective management requires the use of a range of control techniques.”
A new digitised bounty application process will be launched in March 2022, which will improve administrative efficiency of the Victorian Fox and Wild Dog Bounty and streamline payment.
For further information on the Victorian Fox and Wild Dog Bounty visit agriculture.vic.gov.au/bounty
|
<urn:uuid:b46b349c-8e89-4b17-adce-4b15584f7b62>
|
CC-MAIN-2022-33
|
https://mountainviews.mailcommunity.com.au/news/2021-11-27/fox-and-wild-dog-bounty-wraps-up-for-year/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.927589
| 460
| 1.898438
| 2
|
Just leave the fields blank that you don't want to search
Dr Huda Salman
|Biography||Dr Huda Salman is a Chartered Architectural Technologist and lecturer in Architectural Technology at the Scott Sutherland School. She holds qualifications in Digital transformation of processes and design thinking (PhD), Computer Aided Design (MSc) and Architecture (BSc in Architecture) Having this research background in digital design platforms and communication and their impact on processes and efficiency, she has expertise in the application of 3D data to support decision making, planning strategies, public participation and sustainability agenda. This expertise is supported by her research work, on Computer Aided Design, on analysing and managing digitalisation processes in construction and on 2D/3D data transformation (CAD/ BIM based).
Dr Salman has undertaken high profile research activities, including membership of editorial boards, contributing to national and international forums and expert practitioner groups, as well as presentation of her original work. She recently had the privilege to work with the European Commission as an expert reviewer.
Dr Salman PhD work has been published in Design Studies journal; a leading Interdisciplinary peer-reviewed Journal of Design Research. The article was on “The impact of computer aided architectural design programs on conceptual design in an educational context. Design Studies, 35 (4) pp.412-439.
Dr Salman has extensive teaching, and supervisory management experience, involving her participation, leadership and two successful completion of one PhD research project and successful supervisions of more than 20 MSc dissertations, while she is currently supervising four PhD student.
Dr Salman is experienced Research Coordinator with a demonstrated history of working in the higher education industry. She is a skilled professional in further education delivering excellence in Architectural Technology, Computer-Aided Design (CAD), BIM, Visual Thinking, Design Thinking, and Research Methodology (Design process-oriented protocol/ think aloud & Linkography).
|Research Interests||Design thinking, Collaboration, Conceptual Phase, Architectural design, Design activity, Computer aided architectural design, Protocol analysis, Research Methodology, Innovative technologies|
|Teaching and Learning||I teach both architectural technology and built environment modules. I also supervise undergraduate and postgraduate dissertations on a range of topics. I am also the Research Degree Coordinator, and run sessions for PhD students on a wide range of academic issues relevant to studying at doctoral level in architecture, computer aided design and the built environment.|
|Scopus Author ID||56147221100|
|
<urn:uuid:d535ca8d-f841-4494-b54d-812690d06f42>
|
CC-MAIN-2022-33
|
https://rgu-repository.worktribe.com/person/154554/huda-salman
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.925156
| 549
| 1.710938
| 2
|
- Bridge of the Gods is steeped in Native history and legend.
- Spans the Columbia Gorge 45 miles east of Portland on Cascade Locks Highway.
- Sits at the spot where a natural stone bridge once stood.
- Open all year, 24 hours for vehicle traffic and lovely views.
More than 1,000 years ago, a huge landslide blocked the Columbia River at a spot near where the township of Cascade Locks exists today. Over time, water eroded through the stone to form a magnificent natural rock bridge spanning the Gorge. Eventually the natural bridge fell—as native legend would have it, due to eruptions from neighboring Cascade volcanoes—forming the wild Cascade Rapids. These rapids were submerged upon construction of Bonneville Dam.
The natural Bridge of the Gods was replaced by a man-made structure on the same site, originally completed in 1926. This cantilevered bridge has been renovated several times and was raised and extended in 1940 to accommodate Bonneville Dam backwaters. Today, this 1858-foot toll bridge is open to vehicle traffic and provides an excellent viewpoint to experience gorgeous Columbia River Gorge scenery.
Location & Information
Bridge of the Gods is located about 45 miles east of Portland, Oregon. Take I-84 to Exit 44 (the Cascade Locks Highway) and follow signs to Bridge of the Gods.
The bridge tollhouse is open year-round 24 hours a day. For tolls and information, call Port of Cascade Locks at (541) 374-8619.
Bridge of the Gods was named by NW Native American tribes. Tribal legend says the bridge was built by the Great Spirit Manito, and destroyed by Manito’s sons Wy’east (Mt. Hood) and Klickitat (Mt. Adams) in a volcanic battle over the affections of Squaw Mountain.
|
<urn:uuid:3bc99496-014e-4d7a-a1d0-9a6f39a88dbf>
|
CC-MAIN-2022-33
|
https://www.allmounthood.com/nature/bridge_of_the_gods.php
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.944929
| 386
| 2.171875
| 2
|
INSPIRING THE ENGINEERS OF THE FUTURE
With NASA’s recent success extracting minerals from asteroids and landing a rover on Mars, space is once again the final frontier. However, these technologies don't design and make themselves. A skilled aerospace engineering team first solves problems in the lab, then launches the rockets into space. I founded SkyTalks to get insight into aerospace careers through interviews with top professionals. This project will inspire future aerospace engineers to carry humanity into unknown destinations.
By interviewing successful aerospace professionals, SkyTalks provides high-level industry insight for current students and future aerospace engineers. These early career professionals can make more informed decisions by talking to current engineers. After the initial talks, these working STEM professionals can also become role models to aspiring aerospace engineers.
A BIT ABOUT ME
Balamir is a high school Senior who is launching a future career in aerospace engineering. Since he was a freshman, he has known he wants to combine the study of innovative space technology with applied engineering. He decided that aerospace engineering was the path to change humankind. To connect with other students interested in aerospace engineering, he plans to close the information gap between working aerospace professionals and students with SkyTalks.
THE INFORMATION THAT WE PROVIDE
Straightforward answers to the most asked questions about the aerospace engineering field.
WHAT AEROSPACE ENGINEERING IS
Learn the purpose of this job and what value it provides to society.
QUALITIES OF AN AEROSPACE ENGINEER
Explore the knowledge and the character of an aerospace engineer.
LIFE OF AN AEROSPACE ENGINEER
Find out what the daily life of an aerospace engineer looks like.
|
<urn:uuid:36072f77-71a7-4a69-9c01-70db0eb4d799>
|
CC-MAIN-2022-33
|
https://www.sky-talks.com/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.931238
| 354
| 2
| 2
|
The tech bubble in Silicon Valley may be losing air, but at least one billion-dollar start-up is still flying high. Slack, the workplace communication platform, is said to be raising anywhere from $150 million to $300 million in a new round of funding that would value the company at up to $4 billion, according to Bloomberg, well above its current $2.8 billion valuation. Slack has already raised $340 million in venture capital, including a $160 million Series E round the company raised in April 2015. Its investor list reads like a Who’s Who in Silicon Valley: Chamath Palihapitiya’s Social Capital, Google Ventures, Kleiner Perkins, SV Angel, and Accel have all been lead investors for Slack’s funding rounds. The company didn’t comment on the funding news, telling Bloomberg, “there has always been a great deal of investor interest in the company, and we expect that to continue.”
Slack C.E.O. Stewart Butterfield is a Silicon Valley double-success story. Before founding his multi-billion-dollar communication tool, Butterfield founded Flickr, which sold to Yahoo in early 2005 for $35 million. Butterfield joined and then left Yahoo, and along with some of his old co-workers from Flickr, he set out to build a multi-player gaming start-up. They founded a start-up called Tiny Speck, which built a game called Glitch, which ended up being a total failure. But there was one good thing to come from the wreckage of Tiny Speck and Glitch: a tool the team called Slack, which has upended how companies everywhere communicate.
Right now, Silicon Valley doesn’t seem to be the most hospitable place for start-ups. In the last three months of 2015, only 12 new “unicorns,” billion-dollar private tech companies, got their new, lofty valuations, according to CB Insights. Venture-capital funding has slowed down. Deal-making activity fell to its lowest level in three years. There seems to be a freeze on tech I.P.O.s, and some billion-dollar start-ups are even laying off employees. But in spite of all of this, Slack has been lauded for its massive growth. Last month, Butterfield said 20 percent of Slack’s 2.3 million daily monthly active users started using the app for the first time in the past two months. In an otherwise unstable time in Silicon Valley, a new round of funding for Slack would indicate investors still have confidence in at least one high-growth start-up.
|
<urn:uuid:2b5cb777-df6d-460d-8a37-dabf04770fc5>
|
CC-MAIN-2022-33
|
https://www.vanityfair.com/news/2016/03/slack-could-be-worth-4-billion-dollars
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.963641
| 544
| 1.5625
| 2
|
I recently had the pleasure of talking with Wendy Axelrod, who is an executive coach, mentor coach and author of a handful of books around mentoring. She shared her thoughts on what mentoring is, how it’s different from coaching, whether it’s appropriate for someone to mentor someone who is older or more experienced than them and what an organization may want to consider if they’re thinking of starting a mentoring program.
Brian Washburn: Welcome, everyone, to another episode of Train Like You Listen, which is a podcast about all things learning and development in bite-sized chunks. I’m Brian Washburn, I’m your host. And I’m also the Co-founder of an organization called Endurance Learning. Today, I am joined by Executive Coach, Mentor Coach, and Author, Wendy Axelrod, and we’re gonna be talking about mentoring.
But before we get to that, I do wanna let you know today’s podcast is brought to you by Soapbox, which is an online tool that you can use for about 5 or 10 minutes, and you can take care of about 50 or 60% of the work when it comes to developing a live, instructor-led training. So basically, you go to www.soapboxify.com, you set up an account, you tell your computer how long your presentation is, how many people are going to attend, whether it’s in-person or virtual, what your learning objectives are, and then boom! Soapbox instantly generates a training plan for you with clusters of training activities that are designed to help you accomplish all of your learning outcomes. And if you don’t wanna just listen to me babble on about it, you can go to www.soapboxify.com and try it out for two weeks for free. All right. We are here with Wendy Axelrod, and Wendy, thank you so much for joining us.
Wendy Axelrod: It is my sheer joy for joining, Brian. Thank you so much.
Brian Washburn: Just so much good energy coming from you. So what we like to do, I shared that you’re an Executive Coach, Mentor Coach, you’re an Author, but we like to have people introduce themselves in exactly six words. So how would you introduce yourself to our audience in six words?
Wendy Axelrod: Make every day a development day.
Brian Washburn: I love that. And I think that’s a great way to jump into this idea of mentoring. You know, you’ve literally written the book or books on mentoring. How did you get involved in mentoring in the first place?
Getting Involved in Mentoring
Wendy Axelrod: You know, necessity is the mother of invention. I was president of a professional association in the greater Philly area, and I took a look at what was going on and what our pipeline for future leaders were and there was none. We were very homogeneous. So I said this is the time to start mentoring and bringing folks into the fold. And we came at it from a pretty, oh serious, mindset as talent management, talent development, and strategic HR leaders. So we used a lot of rigor to what we put together as that program, and that was 21 years ago. It’s still going on!
Brian Washburn: Well, I love that. I love that for several reasons. One is it was just kind of something that developed out of necessity. And, two, is it must have been developed well because it is still going on. And we were just having this conversation before we hit record, but I’d love to hear your thoughts. I think a lot of people use the word “mentoring” and the word “coaching,” and sometimes even “supervising” interchangeably. Can you give us a definition of mentoring and share your thoughts on how it’s different from other support roles like coaching and supervising?
What is Mentoring? And How is it Different from Coaching and Supervising?
Wendy Axelrod: Yes. As a matter of fact, Brian, I’ve had all three positions, and I’m currently a coach and a mentor, so happy to do this. And the distinction between them, I think, is maybe even more important than the definition of mentoring per se.
But mentoring is using a well-formulated relationship as the basis for moving forward for a person’s growth and development. And in that relationship, you are both volunteers, and it is good to have an intentional pathway that you are on, including goals and a regular structure for how you meet. And we see that there are much better results when there is an actual, even if it’s just the two of you, a program. If it’s company-run, of course, there is one, there is that structure. So, that’s a light touch on the first part. How does it get distinguished from coaching and from supervising or leading? First of all, mentoring, as I mentioned, it’s a voluntary relationship.
Brian Washburn: Mhm.
Wendy Axelrod: It won’t work well if you’re pushed into it and some companies do that. It should be a volunteer relationship, which means you are at it because the relationship is growing, and you feel wonderful about coming into your regular meetings. And there’s a trust that is in place and it’s not performance outcome-oriented.
With coaching, the type of coaching I would talk about is like executive or leader coaching, it’s a paid role and there are results that are expected. That’s pressure on both people. I mean, it works. And also with executive coaching, there’s very advanced skills that need to be in place and lots of certifications.
And then, the manager, God bless the manager. They have to figure out how to move people along. And, you know, there’s a lot of tools that they don’t have that are really important for them to engage, retain, grow all of those kinds of things. But, they probably, in some ways, have the most challenging of all the jobs because they wanna develop that relationship, and yet they have that performance element that must be accomplished.
Brian Washburn: Okay. So, as I’m listening to this and as others are listening to this, and when we think of the idea of professional development, the first thing that a lot of us think about is training, right? Or maybe the idea of mentoring also comes to mind, but it’s rarely the first thing. How can mentoring– and I’m really curious about your answer for this with your range of experience from supervising people to writing books on mentoring, right? How can mentoring play a key role in somebody’s professional development?
How can mentoring play a key role in somebody’s professional development?
Wendy Axelrod: I think it’s the ultimate. (CHUCKLES) So mentoring is really about the mentee’s development. Some people think mentoring is mostly about the relationship. Yes, the relationship needs to be in place, but mentoring is a lot about how we can grow that individual. And it’s done outside the bounds of the job. That’s the beauty of it is we’re not restricted to, you know, the work activities, the work goals, things along that line.
So the mentor can step outside those bounds and really use questions that broaden a person’s self-awareness. They take the time to create a safe space, safe– what I call safe conversational space- where there’s lots of trust. And they actually grow the person by increasing self-awareness, letting them share their doubts, their insecurities, exploring those, trying experiments where, you know, a mentee can try something that they’d never think of, or they would never be offered to do at work. But the mentor helps set that up for them. And the mentor is in the wings, supporting them and talking it through, and pushing them out on the ledge.
But they always have their back so that the growth can be what I call from the inside out. The growth can be insight-driven and self-awareness driven and also have broader, you know, increased perspective about what they can be, what they can do. And they end up trying out, with the help of the mentor, new ways of behaving, new ways of thinking, you know? Managers mostly want to see you do it this certain way–
Brian Washburn: Mhm.
Wendy Axelrod: –this step, this step, this step, and that’s understandable. But within the mentoring relationship, they can try new things, they can experiment, and that’s where growth comes from.
One of the things that I talked about with a mentor just this morning was the idea that being in a role for years on end and racking up those years of experience, and, you name the job, doesn’t grow you necessarily. If you’re not trying new things, getting honest input where you feel open to the input, and looking at new avenues of getting work accomplished, you might not be growing – years of experience at the same thing really doesn’t mean a whole lot.
Brian Washburn: That’s a really interesting thought that made me think of a question here. When it comes to the mentor/mentee relationship, is it implied that the mentor always has more experience than the mentee?
Should the Mentor Always Have More Experience Than The Mentee?
Wendy Axelrod: The experience that I hope the mentor has is learning what it takes to significantly grow another.
Brian Washburn: Mhm.
Wendy Axelrod: They do not need more experience in the job. And in many companies, they actually don’t pair people who are in the same role. So, if the mentee is in a role, even for 10 or 12 years, maybe they’re somewhat seasoned in that role, but the mentor knows how to facilitate the growth. Then you have a relationship going forward. I want to say, for the most part, it seems that the mentors are more seasoned in their career and more seasoned in their life experiences. That doesn’t necessarily have to be that way.
Brian Washburn: Yeah. And so maybe an even more direct way to ask that is: is it appropriate for somebody who’s younger or newer to a company to be mentoring somebody who’s older or more experienced within the company?
Wendy Axelrod: You know, I can think of an example of a young professional woman that has now come into a new role, and she is an expert in her role. She is at least 20 years younger than her primary client, and we could almost say she’s mentoring him.
Brian Washburn: Mhm.
Wendy Axelrod: But she has a specific set of skills that are finely honed.
Brian Washburn: Yep.
Wendy Axelrod: And she is helping him with his strategic perspective. He has tended to see things more tactical and, you know, doing things in a certain way, and she’s opening him up to more strategic perspective. And in that way, even though you could say it’s her job, but she is sort of mentoring him.
Brian Washburn: Yep. That makes perfect sense. And that’s where I was going with that question. So it’s not out of the question that a mentor is younger or less experienced, with the asterisk that anybody who’s in a mentor role needs to have some good experience and to know how to help somebody navigate maybe a specific area, in order for–
Wendy Axelrod: Navigate a specific area, but also understand what it takes to increase another person’s self-awareness.
Brian Washburn: Mhm. Yep.
Wendy Axelrod: Create trust and openness so that the conversations can flow, so people can open up and begin to see their blind spots. Offer ways to put them in the shoes of others. You know, get them up on the balcony, let them see things differently. If they can do that, that’s cool.
Brian Washburn: Yeah.
Wendy Axelrod: I would say, for the most part, the mentors tend to be a bit more seasoned.
Brian Washburn: Yep. I really appreciate that piece of the conversation. Now we’re starting to run out of time here, but before we do, I do wanna ask, for those people who are listening and thinking, “Huh, maybe we should bring some mentoring into our organization.” What are some of the first steps they should be taking into account?
First Steps for Bringing Mentoring Into You Organization
Wendy Axelrod: Well, first of all, what’s the purpose for this program?
Brian Washburn: Mhm.
Wendy Axelrod: Companies, or anyone, can have multiple purposes, believe it or not. It is not just about career growth, although it could be. It could be filling the leader pipeline. It could be a DEI kind of, you know, orientation. So know that. Know what your structure is gonna look like, this needs to be intentional. Think about who your mentees and mentors would be. How are you going to identify them? And who in the company is placing value on this? If this is just somebody’s idea, say out of HR, if there’s no big sponsorship behind it, it may not succeed. It’s always good to tie it to business objectives and identify what that value is and have sponsorship for it.
Getting to Know Wendy Axelrod
Brian Washburn: Before we leave, I do have a few quick questions to ask so that our audience gets to know you just a little bit better. Are you willing to stick around for a few speed-round questions?
Wendy Axelrod: Of course.
Brian Washburn: Perfect. All right. So our first question is: do you prefer to read books or to write books? I know that you’ve written several books, and so do you prefer to read or to write?
Wendy Axelrod: Read, of course, because I already know what I’m thinking about. I want to find out what others think about.
Brian Washburn: That’s hilarious. You already know how your book is going to end. That’s awesome. What is your favorite place in the U.S. to travel to for work or for fun?
Wendy Axelrod: I have two in mind. One is San Diego and the other is Seattle.
Brian Washburn: Oh, are you just saying that because you’re talking to somebody who is in Seattle right now?
Wendy Axelrod: No, I knew you were going to ask that question and that’s actually what I have on my paper. Would you like to see it?
Brian Washburn: No, I will trust you. What is the best piece of advice you’ve ever received?
Wendy Axelrod: When you leave a conversation, think beyond what the person may have learned or heard from you. Think about how they feel about that conversation.
Brian Washburn: Mmm. That is such a good– I had a supervisor who once said, “Yeah, Brian, you’re right, but are you effective with how you’re approaching that?” And I think that the way that somebody feels can really overshadow anything else that you may have talked with somebody about. I love that. Before we leave, any shameless plugs for us?
Wendy Axelrod: I’m sorry. No shameless plugs. Simply that people should feel free to reach out with questions, with suggestions, or if they wanna discuss their interests. That’s it. I’m at WendyAxelrodphd.com.
Brian Washburn: Perfect. And do you like to connect with people on LinkedIn or what are there other ways for–
Wendy Axelrod: Oh, yeah, please! Please, people should connect with me on LinkedIn. That’s perfect. Or drop me an email.
Brian Washburn: Okay. Awesome. Thank you so much, Wendy. And thank you everybody for listening to this particular session or this particular podcast on mentoring. If you think that other people would find this to be interesting, please do pass a link to this podcast along. If you wanna make sure that you are notified anytime a new podcast is hot off the press, go ahead and subscribe to us on Apple or Spotify, or wherever you’re getting your podcast. Even better, if you went in and gave us a like or a review, that’s how other people would find out about us. Until next time, happy training everyone.
This week’s podcast is sponsored by Soapbox. Sign up today for a free demo below.
|
<urn:uuid:a7969bb6-73a5-43b0-899b-2489904212d5>
|
CC-MAIN-2022-33
|
https://trainlikeachampion.blog/mentoring/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.965366
| 3,703
| 1.59375
| 2
|
Twin Falls Sheriff Office Shares Disturbing Video Of Why Not To Text And Drive
April is Distracted Driving Awareness month and the Twin Falls Sheriff's Office shared a video compilation of how the results of distracted driving can be life-threatening. The video is from all over the country and involves lots of different types of drivers.
DISCLAIMER: Some people may find this video disturbing. Watch at your own risk
This video is absolutely insane. I can't believe how quickly things can go from, an open road ahead of you, to, bam! It only takes a split second to go from fine to not fine when it comes to the open road. This is especially true for highways due to increased speeds.
Some of these people you can actually see the cell phone in their hands or right in front of their face. Some of them were able to recover and not cause a serious accident. I was surprised to see how many of them were semi-truck drivers.
I know everyone has driven down Blue Lakes or Poleline and seen people texting, talking on the phone using their hands, or much worse. Distracted driving does not just include using your cell phone. It also includes things like doing your makeup, eating a burger, or even worse, clip their toe nails.
Please, make sure that you drive responsibly. Things can happen in a split second. I also am curious what the craziest thing you have ever seen someone do while driving. I saw someone curl their hair driving 90 down the highway. Scary stuff. No distracted driving!
|
<urn:uuid:8b6573ba-f5d4-4be1-a8a7-9ebd4c7841d1>
|
CC-MAIN-2022-33
|
https://kezj.com/twin-falls-sheriff-office-shares-disturbing-video-of-why-not-to-text-and-drive/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.975432
| 318
| 1.96875
| 2
|
Feedback on Retin-A Side Effects and Usage, page 94
If you’ve used Retin-A, please help others by sharing your experience with side effects. What would you tell your best friend about this product? Please remember that we do not give medical advice. That is for your local health care provider, who is familiar with your medical history.
Crohn’s and Celiac diseases
I have used Retin-A in the Obagi system for many years. I have Crohn’s and Celiac diseases. I am now hearing vitamin a can be a contributer to these diseases. Am I ok with the topical Retin A? Thanks
AskDocWeb: According to Researchers at the University of Chicago’s Digestive Disease Research Core Center, the Retinoic acid in Retin-A could cause an increased inflammatory response and worsen tissue damage in people who have high levels of an inflammatory protein called interleukin-15 (IL-15). Interleukins are a group of cytokines that play an important role in your immune system. They modulate inflammation and immunity by regulating growth, mobility and differentiation of lymphoid and other cells. Recent studies suggest that suppression of this protein may be a potential treatment for celiac disease.
If you have autoimmune disease
I used retin A and it helped my skin but made me very ill. I have celiac disease and it made it flare up. Retin A is a form of vitamin A an inflammatory chemical. It took months for my doctor and I to figure this out. I lost weight and hair. I will never use it again. Be careful if you have an autoimmune disease.
Wondering about wrinkles and hyperpigmentation
Dear AskDocWeb Team, I have been using Tazorac 0.5% for about a month now. My skin is still peeling under my lips, there were no other areas in my face that were peeling. I found in the last couple of days that my acne gets worse after it was a lot better about two weeks after I started using the product. The small wrikles arround my eyes seem to get deeper now and there is no sign that my hyperpigmentation gets better. I live in Australia where the sun is very strong but I use 50+ protection every day. I was wondering if the described issues will go away and my hyperpigmentation will get better over time or if the product is not working for me. Thanks for your help,
AskDocWeb: Tazorac and Retin-A are both vitamin A-based drugs called retinoids. The reaction you get depends upon many factors, including skin type and concentration strength. Any changes in hyperpigmentation usually take place slowly over a period of months. Note that skin discoloration has been reported with Tazorac topical gel in 1% to 10% of acne patients. In order to determine how well it is or isn’t working you would need to consult with a dermatologist for an evaluation.
Have you found Retin A to cause any heart palpitations? I used this product 10 years ago and developed severe palpitations. When I discontinued the product palpitations went away but it took awhile. Is there cause and affect here?
AskDocWeb: Although it is possible to have heart palpitations while using Retin-A we have not seen any cause-effect relationship.
Dark skin around mouth
I’ve been using retin a micro for about 7 weeks now for just sun damage, and around my mouth and face is dark is that normal I need help on what to do
AskDocWeb: For advice your unique skin and condition consult with a a Dermatologist.
I accidently used retin A instead of premarin, will this case a lasting problem and what can I do to reverse the reactions of the retin A? I am embarrassed to go to the doctor and explain this stupid mistake.
AskDocWeb: Usually when we hear about a stupid mistake someone is referring to applying it to their lips, eyelids or forgetting to use sunscreen. The good news is that it is not a lasting problem. Much like a chemical burn it is likely to take several days to heal but it will.
Waxing really burns!
I use ratin A for years on my face and always wax my lip. This time when I wax it it turn really red and burns like a sunburn. I put on Alovera and ice but still it’s very bad. What should I do to make it go away faster?? Please help.
AskDocWeb: We know that copious irrigation with plain water is the main treatment for chemical burns but for a medical solution, consult with your doctor to evaluate your condition. Some waxing kits come with a lotion to put over the affected areas to get rid of redness. Please note that waxing kits usually warn against the use of waxing by those using Retin-A and other retinoids.
Will tretinoin .025% help the vertical lines above my lip?
AskDocWeb: Sorry Mona, you would need to consult with a dermatologist to evaluate a specific condition.
Over 21 years of Retin-A
At 11 year old my skin started to break-out with ance. As i got older my ance became worse. I had tried everything and the only thing that worked for me is the retina gel. I have been using retina gel for over 21 years. My skin is beautiful. I use the retina gel three times a week. If I stop for more then 2 weeks my ance comes back. My doctors said that I have some rare fungi skin problem which I passed down to my 13 year old son. He’s using proactiv at the moment, but as soon as he reaches 18 I will introduce him to retina. I started using retina at 24. I’m now 47 and is still using retina.
I have been using tretinoin cream for about 2 years now. Started with .025 and now using 0.05. I see only a small diffrence with wrinkles, but my sundamage has disapated some. I continue to use sunscreen everyday. I need to use a face firming lotion/cream, because the tretinoin is not helping with firming. Are there any suggestions? I continue to use tretinoin, because it is the only product that should help with fine wrinkles. Thanks and I love this site!
AskDocWeb: We’ll let readers make suggestions for firming products. Has anyone found something that they would suggest?
I want to agree with the person who says retin a caused neurotoxity they coulnt sleep at night and felt sick how ever I had the same problem on thing is I had cold spells to and wake up with numbness and after I stop using all symptoms go away. Doctors never believe side affects they think we make things up.
Hi, I am using Tretinoin cream .25% each night for the last two months. I have had four nosebleeds in that time, and I’m wondering if there can be a relationship between them. I have never had nosebleeds in my life. Now I know how to stop them quickly, but that first one was horrifying. Your opinion is greatly appreciated!
AskDocWeb: We’ve seen reports of up to 30% of patients using Tretinoin experience unexplained bleeding (i.e. nosebleeds or bruising). Please note that any unexplained bleeding, including black, tarry stools, blood in the urine, nosebleeds, etc. should be report to your doctor.
Report – 92 – 93 – Page 94 – 95 – 96 – 97 – Last Page 102
If you find this page useful share it with others. If you have used Retin-A, use the form below to add your review of Retin-A, feedback or suggestions that may help others. Please note that all addresses are held confidential.
|
<urn:uuid:e6804823-2043-461f-9f98-c643663779e1>
|
CC-MAIN-2022-33
|
https://www.askdocweb.com/retin-a94/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571719.48/warc/CC-MAIN-20220812140019-20220812170019-00264.warc.gz
|
en
| 0.948015
| 1,840
| 1.546875
| 2
|
Hey North East, upskill and develop with The Skills Network today!
Details: Written by Eleanor Lodge
Hey North East, looking to upskill in your region today? With 48 fully accredited training courses available for free through government funding, upskilling with The Skills Network could help you take the next step in your career today.
With skills in nursing and mental health coming in on the list of the top ten most highly requested hard skills in this area, our courses for care workers and more in mental health could help:
- Level 2 Certificate in the Principles of the Mental Health Care Worker
- Level 2 Certificate in Awareness of Mental Health Problems
- Level 2 Certificate in Self-harm and Suicide Awareness and Prevention
- Level 2 Certificate in Understanding Children and Young People's Mental Health
And with skills in warehousing coming in at number three on the list of hard skills most demanded in the North East, our Level 2 Certificate in the Principles of Warehousing could provide you will skills to succeed!
Top hard skills in demand in the North East:
- Mental Health
- Key Performance Indicators (KPIs)
- Agile Methodology
- Business Development
- Risk Analysis
Top soft skills in demand in the North East:
- Customer Service
- Detail Oriented
With communications, management and customer service being revealed as the top soft skill in demand in the North East today, our expertly developed, fully accredited and totally free training courses in Level 2 Principles of Customer Service, Level 2 Lean Organisation Management Techniques or our Level 2 Principles of Team Leading can help as you upskill in the fields that your region are requesting now!
Top posted occupations in the North East:
- Care workers and home carers
- Sales accounts and business development managers
- Elementary storage occupations
- Other administrative occupations n.e.c.
- Programmers and software development professionals
- Primary and nursery education teaching professionals
- Van drivers
- Metal working production and maintenance fitters
- Business sales executives
With 48 fully funded free training courses available, upskilling with The Skills Network just makes sense!
Looking for FREE training for your staff? Click here
Looking for FREE training for yourself? Click here
|
<urn:uuid:2b2315dd-b86f-4f5f-bc8e-2af9323e755b>
|
CC-MAIN-2022-33
|
https://theskillsnetwork.com/insights-resources/blog/hey-north-east-upskill-and-develop-with-the-skills-network-today
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.907304
| 504
| 1.523438
| 2
|
What Is Woodworking?
Woodworking indicates a great deal of points, but right here’s moderately uninteresting meaning I generated that most enthusiasts will possibly agree with
Woodworking is a productive craft that entails cutting, shaping, and signing up with wood to produce ornamental and/or helpful picket fence design woodworking plans points.
There is nothing physically requiring about woodworking as well as you can develop at your very own rate. The standard ideas are simple to learn, yet it’s a hobby that will constantly continue to be fresh as well as tough as your abilities develop. If you enjoy problem-solving, you will certainly like woodworking. I have actually gone to this for over 40 years as well as encounter brand-new challenges with every task I construct.
It belongs to the process. It’s additionally awarding to generate actually amazing things for your residence using your hands as well as brain. As a whole, woodworking is an extremely singular experience: if you are a bit withdrawn and also love taking on jobs from start to finish, you will certainly like woodworking.
That Are Woodworkers?
There made use of to be 2 stereotypes of woodworkers. The cranky shop instructor who instructed an actually monotonous course to kids that didn’t wish to exist, and the retired grandfather who puttered about in his garage with a great deal of time to develop an occasional birdhouse.
Luckily, those stereotypes are no longer true. There is more diversity in woodworking currently than ever before, thanks to on-line areas as well as the cost of devices and also products.
In the past 10 years there has been a massive surge in two teams of individuals making woodworking a pastime. First, females. It wasn’t that long ago when a female woodworker was unusual. Today, females woodworkers are typical. There is nothing concerning woodworking that anyone can not do.
The second massive demographic spike has been amongst millennials, individuals in their 20s and also 30s. I speak with people all the time that work in silicon valley or simply have some sort of office job as well as really feel the requirement to make points with their hands.
What’s The Difference In Between A “Maker” And Also A “WoodWorker”?
A manufacturer is a relatively brand-new term that has actually appeared in the past years or so. It’s a comprehensive term for individuals who such as to dabble in various crafts. This can indicate a little woodworking, metalworking, epoxying, concreting, computer programming, electronic devices, 3D printing, cooking, sewing, knitting, jewelry making, sculpting, porcelains, robotics, also playing with Legos. So essentially, we are all makers.
A woodworker is a manufacturer who is primarily interested in learning and fine-tuning the craft of producing points out of timber. Sometimes we bring other products right into our jobs, however the focus gets on the wood. It’s an affordable, classic material that’s simple to develop with.
Ted’s 16,000 Woodworking Plans
I have actually had my eye on Ted’s 16,000 woodworking prepare for a long time.
It seemed also great to be true. Even though I’m not a passionate woodworker, I figured if I made one or a few of the tasks from the package it would certainly be money well spent.
My interest got the most effective of me. I bit the bullet and bought it. They supply a refund so I figured if it was totally pointless I can request for my cash back.
Is is too excellent to be true?
Not truly. It’s pretty good. It’s not perfect, but it’s great.
Some of the strategies are so bad yet are included just to increase the sales pitch of “16,000” strategies.
And after that a few of the plans are fantastic. Some are okay. I’m not shocked it’s not ideal. It’s a huge collection as well as combination of different plans for all sort of products.
Below’s the way of thinking you should have if you purchase Ted’s Woodworking. Accept the fact you will not like every plan. As a matter of fact, approve you will possibly refrain 90% or more of them for any kind of variety of reasons such as the plans are bad and/or they aren’t projects you wish to develop.
BUT, minority strategies that you simulate and that are good quality, if you build them, will certainly be make the cost of this electronic collection of woodworking strategies worth it.
Who should purchase Ted’s Woodworking?
This is for individuals that such as DIY jobs. Most of the plans are labeled “newbie”, “intermediate” or “sophisticated” which is handy.
Even if you have actually never constructed anything or done any type of woodworking, this is a respectable collection of strategies to start with since there are newbie tasks consisted of.
You can develop all sort of stuff for your house. See the checklist of plan groups below.
At the end of the day, if you do the weird DIY task or meddle woodworking, this is a good set of plans to have in your supply.
Regarding the Item
I have not counted to see if there are 16,000 strategies, yet I validate there are a lot of them.
Luckily they are well organized so you can locate exactly what you’re trying to find.
Ted’s Woodworking is delivered as a PDF download. It’s in fact a series of PDF downloads (see plan groups above).
Nevertheless, you can additionally purchase the DVD edition yet it costs an added $19.95 (I really did not pay $19.95 for the DVD variation).
Some fantastic woodworking strategies: Obviously if a plan is something you wish to develop and also the plan is outlined sufficient so that you can complete the task it’s great.
Nevertheless, some of the projects are old and the strategies are poor quality … so poor you’ll most likely simply ignore them.
On the and also side, there are many excellent jobs worth building. For instance, the loft bed strategy over is superb (one of numerous).
Well Organized: I was soothed after getting Ted’s Woodworking that I really did not have to look with thousands of PDF pages. Rather, Ted at least place some effort right into arranging the strategies in numerous groups. This made finding some decent plans extremely simple.
As a matter of fact, the participants’ location is truly easy to use and well organized.
Good value for money: 1 or 2 completed jobs from this product makes it worth the money. I believe I’ll get my cash’s well worth in the long run and I’ve yet to look into each and every single plan consisted of. I’ve found sufficient quality tasks that I’m satisfied with the item worth provided it’s rather low cost.
Expense: It’s not extremely costly. Since it’s a digital download, you don’t need to spend for a costly book, which is fantastic.
Motivation: One advantage of there being many plans is merely by combing with the plans I developed new project ideas I had not considered previously.
Some terrible plans: Sadly a few of the strategies are horrible which implies you need to invest a long time filtering through the poor plans. I would certainly choose a product with less plans with each one be high quality.
Woodworking Videos: These are a joke. The good news is it’s simply a benefit so I didn’t care. I believe these deteriorate the item. The videos are primarily from YouTube. Ted merely brushed through YouTube searching for woodworking videos as well as put them in the participants’ location. I had a look at a few of the video clips as well as they weren’t worth viewing.
Overall, I’m completely satisfied. I discovered numerous tasks worth doing and also the plans were adequately outlined that I ‘d be able to build them.
It’s a fantastic stock to have on hand despite the fact that I have no immediate need. If ever I want to construct something, I have a good collection of strategies to have a look at.
|
<urn:uuid:de3e9d1a-2eb9-4ba0-b0f1-fbf8fa8cf6cc>
|
CC-MAIN-2022-33
|
https://www.engagement-group.com/picket-fence-design-woodworking-plans/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.964272
| 1,782
| 2.703125
| 3
|
What is Adaptive Authentication?
Adaptive Authentication: Why Should You Care?
Before going into what adaptive authentication is I want to answer why you should care first. In today’s IT world, relying on a simple username and password authentication is not enough to protect critical business data and systems against the growing number of sophisticated cyber attacks. Just do a quick search online to get an idea of how expensive a hack can be and how sophisticated attacks have become. That ever-growing number of compromised enterprises is clearly asking for systems that do not allow access to business applications and data with a simple username and password login. For a long time now, there have been mechanisms that IT can use to protect against such “simple” break-ins. Multi-Factor Authentication (MFA) is the name of the game. MFA gives you the ability to protect access to your enterprise information.
With MFA, users must provide at least two “factors” when they access applications, networks, and resources. Also, most commonly, one of the two factors is a one-time password (OTP) that cannot be used a second time. MFA implementations use a combination of the following factors:
Something you know, such as a username, password, PIN, or the answer to a security question.
Something you have, such as a smartphone, one-time pass token, or smart card.
Something you are, biometrics like your fingerprint, retina scans, or voice recognition.
However, at the same time, we all remember (or are still subject to) having used an RSA Secure ID, Symantec VIP, or similar token. For this, you have to type in that code, which is displayed only for 30 seconds, and if you do not type in the code displayed fast enough your authentication will fail -- which causes you to have to start all over again. Also, you do not have the token with you when you need it most -- you forgot it in the car, at home, at grandma’s house over Thanksgiving, or, or, or… We all have been there. That begs the question… Does it have to be that difficult? Isn’t there a better way to do this? That’s where adaptive authentication with a sophisticated MFA solution comes in.
What is Adaptive Authentication?
Adaptive authentication is a type of multi-factor authentication that can be configured and deployed in a way that the identity service provider (IDP) system will select the right multiple authentication factors depending on a user’s risk profile and behavior. Well, it’s also to adapt the type of authentication to the situation.
There are three ways that adaptive authentication could be configured depending on the IDP’s capabilities:
- One can set static policies defining risk levels for different factors, such as user role, resource importance, location, time of day, or day of the week.
- The system can learn the typical activities of users based on their tendencies over time. This learned form of adaptive authentication is similar to behavioral correlation.
- A combination of both static and dynamic policies.
And a sophisticated adaptive authentication IDP system should provide more than just the use of OTP tokens like RSA Secure ID, Symantec VIP, or similar (so you are not subject to the previously mentioned annoyance with display tokens). It should support MFA through:
- Email verification
- SMS / text verification
- A phone call to predefined numbers
- Mobile push notification to trusted mobile device
- Smart Cards
- Derived Credentials
- OTP tokens
Regardless of how you would define your corporate risk levels, adaptive authentication should adapt to that risk level and present the appropriate level of authentication for the given level of risk. Unlike standard, one-size-fits-all authentication elevation, it avoids making low-risk activities inappropriately burdensome or high-risk activities too easy to hack.
Adaptive authentication should look at the following…
- Device Profile: What system is the request coming from? Is this a system I have seen before, is this a corporate-issued device?
- Location Awareness: Where is this request coming from, is this a “risky” IP address range, is this coming from a “risky” country? How did the user get from San Francisco to some other country in one hour? This isn’t the usual location from which this user is logging on.
- User Behavior: Why is the user accessing those servers/applications/data? He has never done that before.
Adaptive authentication is the recognition that authentication elevation is part of a continuous process of managing access to applications and resources. Meaning, instead of applying risk evaluation and elevation only during the authentication process once, they are continuously evaluated as part of the process while accessing information to determine whether to allow any request for a resource, transaction, or interaction or to elevate the authentication and challenge for additional authentication factors at any point in time if suspicious behavior is detected. If suspicious behavior is detected, it should prompt the user then and there to provide an additional factor of authentication.
Identity Automation with adaptive authentication policies is part of a broader multi-factor authentication approach for all your applications and resources. This strategy is the most secure way of managing identities and access to your corporate applications, network, and resources because with adaptive authentication you make low-risk activities easy and high-risk activities protected by OTP MFA. Resulting in a “happier” user force all the while protecting your enterprise.
|
<urn:uuid:db7ae539-68ad-4236-815f-50ee0cba905c>
|
CC-MAIN-2022-33
|
https://delinea.com/blog/what-is-adaptive-authentication
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.922156
| 1,153
| 2.671875
| 3
|
Faults -- Identify What's Wrong with Fine Wines and Spirits
Our much-anticipated "box of bad smells" that adds an entirely new dimension to drinks analysis and assessment. Thirty aromatic essences used by professionals to identify problems with the manufacturing process, and by high-level aficionados who want to fully understand the drink in front of them.
Use conventionally with the included aroma-neutral paper strips included in the kit, or add small amounts to "spike" tasting samples to discerns tasters' sensitivity to chemical faults.
The Faults home study kit contains:
- 30 aromatic essences
- A manual that walks you through the use of the kit
- Aroma strips, which allow each aroma to evolve over time just as aromas evolve and open in the glass
- A scoresheet that reinforces what you've learned from session to session
|
<urn:uuid:aecac354-5e80-48c0-a2ca-ea255c5b1764>
|
CC-MAIN-2022-33
|
https://uptosniff.com/products/faults
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.923359
| 178
| 1.976563
| 2
|
Endophytes – characteristics and possibilities of application in forest management
MetadataShow full item record
Endophytes are organisms that live within the plant tissue without usually causing any symptoms. In plants of natural ecosystems, endophytic fungi are in fact ubiquitous. This review summarizes research carried out on their biology emphasizing their functionality in terms of the host range, the colonization extent, the way of transmission between hosts and their influence on host fitness. The main focus will be on two classes of fungal endophytes, class 2 and 4 (Dark Septate Fungi), due to their potential for practical application in forestry. Raising awareness of the potential of endophytes to enhance the host’s resistance to pathogens, insects and anthropogenic disturbances is a key factor in developing applications for forest management.
- Artykuły / Articles
|
<urn:uuid:93638ef6-97d6-42ec-a073-0ae2311e3c21>
|
CC-MAIN-2022-33
|
https://depot.ceon.pl/handle/123456789/11405
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.889383
| 202
| 3.515625
| 4
|
In 2015, we discovered how to make sports fuels easier to tolerate by encapsulating high concentrations of carbohydrates in hydrogels. The sports fuels, based on only natural ingredients, became popular and one year later some of the world's best runners started using our products. The technology is patent pending.
NOT JUST ANOTHER SPORTS DRINK
Athletes have always struggled to fuel their bodies.
By the 1960s, scientists realized that drinking carbohydrate solutions during exercise increased performance. With a mixture of sugar, salts and lemonade, the first sports drink was born.
But carbohydrate drinks can cause problems. Our stomachs don't cope well with high concentrations of sugar – often resulting in slower gastric emptying and GI distress.
At Maurten, we’re launching a new range of sports fuels. We’ve harnessed hydrogel technology to develop carbohydrate-rich and natural sports drinks and energy gels that our bodies can tolerate.
BASED ON ONLY NATURAL INGREDIENTS
The hydrogel technology enables us to redefine the field of sports fuel. First out are the sports drinks Drink Mix 160 and Drink Mix 320;
Twice the energy – the Drink Mix 320 contains nearly 14 per cent – or 80 grams – of carbohydrates when mixed. That's about twice as much carbs as was previously thought possible for the body to tolerate.
No added flavor – we're not impressed by artificial flavors. You can tell what you're getting from the taste of our drink mixes.
Clean – no added colorants or preservatives. Our sports drinks contain only natural ingredients. Nothing more and nothing less than what’s needed.
HOW IT WORKS?
Drinks - Mix the Drink Mix with water, and you’ll have a liquid sports drink containing high concentrations of carbohydrates. The drink instantly converts to hydrogel in the acidity of the stomach, encapsulating the carbohydrates. The hydrogel then enables a smooth transportation of the sports drink through the stomach to the intestine where the water, salt and carbohydrates are absorbed.
GEL 100 - The GEL 100 is a hydrogel – a biopolymer matrix that holds carbohydrates. It relies on the same concept as our drinks where the hydrogel technology enables a smoother transportation of carbohydrates through the stomach to the intestine where the carbohydrates are absorbed. In the case with our drinks, the hydrogel is formed in the acidity of the stomach – but the GEL 100 is a hydrogel formed in production, by combining sodium alginate and calcium carbonate under exact conditions.
MEET THE HYDROGEL
Hydrogels are widely used in the food industry, often as thickeners and structurants. A hydrogel is a biopolymer- and water-based structure with very small pores. As a three-dimensional network with the ability to hold water, it looks and behaves a bit like a kitchen sponge.
At Maurten, we’ve found a way to build hydrogels with natural food ingredients. And we’ve filled the structure with the most efficient source of energy around – carbohydrates.
The hydrogels in our sports drinks are built from the combination of two natural ingredients:
·Alginate – extracted from the cell walls of brown algae.
·Pectin – found in apples, lemons, carrots and tomatoes, to name a few.
These two dietary fibers have been used for decades within the food industry. Combined under precisely the right circumstances, alginate and pectin form a pH-sensitive hydrogel.
WE RELY ON SCIENCE AND ELITE ATHLETES
In 2015, we found a way to make sports fuels easier to tolerate, by encapsulating carbohydrates in hydrogels.
The method was so successful, that one year later, some of the world's best marathoners were fueling their training sessions and competitions with our technology. It’s science that has taken us this far. Now we're working together with several international research initiatives and universities. A number of studies are evaluating our technology and products. And soon, we hope that the first peer-reviewed paper will be published in support of our technology.
The number of great athletes using our technology is constantly growing. For the latest updates on which athletes are using our products, visit the Result page and follow us on Instagram and Twitter.
You may also like
|
<urn:uuid:9535e1f0-a6e0-4225-93a2-9a25d1c13e41>
|
CC-MAIN-2022-33
|
https://trishopsa.com/products/maurten160sportdrinkbox18servings
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.923408
| 934
| 2.390625
| 2
|
Established in: 2010
Registration Law: Society Registration Act 1860
Themes & Interventions: Education, Health
What We Do: Awareness Rising, Advocacy
Head Office at Swabi
Jangira Road, Mall Lara, District Swabi
Brain Development Organization (BDO) is a non-profit, non-political and non-government organization working for the welfare and uplift of the standard of the poor and backward people of the Khyber Pukhtun khwa (KPK) province of Pakistan established in 2007. Looking to the misery of the people a group of highly motivated people came together to with the great zeal and enthusiasm to develop the life standard of these under privileged society of the country and form BDO registered with Social Welfare Department of government of KPK under Registration and Control Act 1961 under Registration number 3315. The organization has valid account number 3046-4 in National Bank of Pakistan, Maneri Branch, Swabi.
To acquire a society where all the people have an equal and easy access to all available opportunities, resources and fundamental rights without any discrimination and especially committed to a just, vibrant, progressive and democratic society where women are fully empowered, gender equality, human security and opportunities are ensured for all, peace prevails and resources are shared on a sustainable and equitable basis.
To facilitate the under developed, marginalized and destitute communities for their Socio-economic uplift by formulating policies and institutional changes through human resources development, advocacy and awareness rising campaign in the society and especially
· To mobilize and stimulate moralized community about the importance of education and get them involve in all the activities of their children education.
· To create awareness among neglected segments of society especially women and Children about their basic rights i.e. education, access to resource and facilities.
· To develop and strengthen basic organization on local level and bring them into a network to motivate them to undertake developmental activities for the welfare of the people
· To motivate women sect to participate in economical activities by providing them skill development training to enable them to provide a gender balance.
· To protect and prevent the target society from the abuse of social evils.
· To provide basic health facilities to the target community by educating and providing them the health training.
· To maintain a balance of economic equality in the target community by providing such training to enable them to earn their livelihood.
· To help the needy and affected people of the province in any natural or artificial calamity.
· To develop a sensitive society against the social evils like human trafficking, inheritance, swara, air firing etc.
· To preserve the natural resources at their original shape by providing training and developmental programs.
Subscribe to our weekly newsletter below and never miss the latest Updates.
|
<urn:uuid:22ec43f1-4832-4f6d-bb90-63520ef734d6>
|
CC-MAIN-2022-33
|
https://pakngos.com.pk/listing/brain-development-organization/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.913294
| 584
| 1.8125
| 2
|
Starting a Clothing Line is a lucrative business opportunity, but there are many steps that you must take before you can begin selling your products. There are several important steps that you must take before launching your clothing line, such as developing solid designs and marketing strategies. Below are some helpful tips to help you get started. Read on to learn how to design and market your clothing line for a successful business. There are some common mistakes that clothing line owners make, as well as some useful advice that you can follow.
First, choose a name for your clothing line. Choose a name that is unique, but representative of your clothing line’s style. Next, design a logo for the brand. Your logo will be the first thing customers will see when they buy your clothing. You want it to be memorable and not a generic logo. Don’t change your logo too often, as customers will recognize it with ease. Once you’ve chosen a name, it is time to start designing.
Develop your business plan. The business plan for a clothing line should clearly define the goals of the company and the management strategy. It should be realistic, and include the target markets that you will target. It should also define the cost of the clothing line and its distribution. Once these details are established, you’ll be ready to start selling your clothing line. It’s important to remember to have a business plan before launching your clothing line. The plan can be as short as two pages, but you should be sure to include all of the important elements of the strategy.
|
<urn:uuid:1e8900c3-96a2-4aa5-aea3-f0241a7befd1>
|
CC-MAIN-2022-33
|
https://chanandkrys.com/about/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.964714
| 319
| 1.632813
| 2
|
By Nathalie Basto-Aguirre, Paula Cerutti and Sebastián Nieto-Parra, OECD Development Centre
This blog is part of a series on tackling COVID-19 in developing countries. Visit the OECD dedicated page to access the OECD’s data, analysis and recommendations on the health, economic, financial and societal impacts of COVID-19 worldwide.
COVID-19, like most crises, is exacerbating inequalities in the region. To contain the pandemic, most Latin American countries have closed their schools, affecting the learning of 154 million students. However, not all students are affected equally. While distance education can contribute to alleviate the immediate impacts of school closures, it requires a number of conditions to deliver meaningful results. Students from poorer socio-economic backgrounds tend to suffer the most and risk bearing lasting consequences in terms of learning outcomes and, ultimately, opportunities. In particular, three interconnected dimensions stand out. Continue reading “Is COVID-19 widening educational gaps in Latin America? Three lessons for urgent policy action”
|
<urn:uuid:7b3f51dd-5957-4a83-9eb3-0a68e3299c6e>
|
CC-MAIN-2022-33
|
https://oecd-development-matters.org/tag/digital-learning/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.905404
| 216
| 3.03125
| 3
|
|Institutional Source||Beutler Lab|
|Gene Name||ATPase, Ca++ transporting, plasma membrane 1|
|Synonyms||PMCA1, 2810442I22Rik, E130111D10Rik|
|Is this an essential gene?||Essential (E-score: 1.000)|
|Stock #||R0899 (G1)|
|Chromosomal Location||98914406-99026143 bp(+) (GRCm38)|
|Type of Mutation||critical splice donor site (1 bp from exon)|
|DNA Base Change (assembly)||G to A at 99017031 bp (GRCm38)|
|Amino Acid Change|
|Gene Model||predicted gene model for transcript(s): [ENSMUST00000020107] [ENSMUST00000220104]|
|Coding Region Coverage||
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
|Allele List at MGI|
|Other mutations in this stock||
|Other mutations in Atp2b1||
(F):5'- AACGTGTGCTTCCCACAAAGCC -3'
(R):5'- CAATAAGCAAGCGCCATCTTGGAC -3'
(F):5'- TAGCTGCATGACATACATAGCG -3'
(R):5'- ATCTTGGACAAGCCGCC -3'
|
<urn:uuid:86be5b15-7bbc-4588-a8f8-fda8f78dc26c>
|
CC-MAIN-2022-33
|
https://mutagenetix.utsouthwestern.edu/incidental/incidental_rec.cfm?mid=83801
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.685327
| 864
| 1.726563
| 2
|
The execution of the function blocks contained in a structure block can be controlled by the bit input of the Enable-SB block. When the input signal P is 1 the target system functions of the contained blocks are called. At 0 the block functions are skipped.
The Enable-SB block is placed at the lower right corner if it is dropped over the symbol of a structure block during inserting. The block is connected to the structure block until it is erased, i.e. operations like moving and copying are automatically executed with both blocks.
At disabled structure blocks the last calculated values are provided at the outputs.
By enabling and disabling structure blocks the runtime of programs can be reduced considerably. For example, with sequence controls it is useful to enable or to disable program parts over the bit outputs of the step blocks.
|
<urn:uuid:81e04f97-2ec1-41c7-abc7-e14e53197cc9>
|
CC-MAIN-2022-33
|
https://micon-l.de/FB_EN_Enable-SB.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.89642
| 198
| 2.5
| 2
|
Normal planets orbit in the same direction as their star – in a plane a few degrees from the star’s equatorial plane. But it turns out that many planets tend to behave wildly, with steeply inclined orbits, orbits that extend far or insanely close to their parent stars. Some even dare to orbit backwards. Mercury, with a rotation of 7⁰, is the strangest planet in our solar system. It’s a wild, wild galaxy full of exoplanets. Exoplanets are planets orbiting stars outside our solar system – they can be beautiful Earth-like environments or worlds called ‘hell planets’ because of their rough surfaces. You’ll find everything from diamond planets to frozen planets. Planets are so close to their stars that their matter explodes every second, and the planets are so far from the Sun that we still don’t know how they exist. Some planets wander in the darkness of our Universe, while others have such long ages that a year in their world is the equivalent of 900 000 years in ours. So far, we have over 4000 confirmed exoplanets, 2 724 potential exoplanet candidates, and 2 783 planetary systems (stars with confirmed planets). Let’s check it all out, and don’t forget to read the
HD 106906 B: The Planet Furthest From Its Star
Another planet that breaks with everything we know about Astronomy. Neptune is the planet furthest from the Sun in our Solar System. It is an incredible 4,500 million kilometres, which has already taken 165 years to go around the Sun and that in the light of our star, it takes 4 hours to reach it. But it is that HD 106906 b is 97,000 million kilometres from its star. Given this incredible distance, astronomers believed it would be the planet with the lowest temperatures known. But no. To their amazement, the temperature of this planet is 1,500 ° C, much hotter than Mercury, the planet closest to the Sun (58 million kilometres) and where temperatures do not reach 500 ° C. Nothing in HD 106906 b makes sense. Not that it is attracted by gravity at that distance, much less that it is so hot.
Kepler 78b: When The Year Lasts 8 Hours
Kepler 78b, located 172 light-years away, is another of the hells in the Universe. It is so close to its star that it not only reaches temperatures of more than 2,800 ° C, but it only takes 8 hours to complete one revolution around its star. That is, your year does not last 365 days like on Earth, but just like a working day.
HD 80606 B: The Extreme Planet
HD 80606-B, located 190 light-years away, is a black and red gas giant that looks like something out of a horror story. It is so dense that even the light of its star has it challenging to penetrate inside. But not only is it peculiar visually, but it also follows one of the strangest orbits known.
It unusually approaches its star and then wanders far away. This causes temperatures to vary from 3,000 ° C to -20 ° C. It is the planet with the most extreme temperature variations.
GJ 1214 B: The Giant Pressure Cooker
GJ 1214 b is an ocean planet, but that does not make us think that it is a possible home. It is not at all. It is so hostile that it can be considered a liquid hell. Its atmosphere is so dense and expansive that this world is like a giant pressure cooker. Everything that enters this planet is instantly shredded.
NGTS-1b: A Disproportionate Planet
NGTS-1b is known as the “impossible monster”. And it is that, again, this planet should not exist because it defies all the laws of planet formation. It is similar in size to Jupiter but extremely close to its star: 4.5 million kilometres. To understand how incredible this is, keep in mind that Mercury, the closest planet to the Sun, is 58 million kilometres from it. The strangest thing is that this planet is disproportionate to its star, which is very small (half of our Sun). But this is not only surprising. Technically, a star of this size could not have such a giant planet around it, much less so close. Again, the reality is stranger than fiction.
|
<urn:uuid:8a9e601f-91ce-4e6c-bcd2-21a085a3d1e9>
|
CC-MAIN-2022-33
|
https://www.thescienceblog.net/64-2/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.946527
| 916
| 3.6875
| 4
|
I’ve recently been experimenting with preparing homemade nut milks. I absolutely LOVE the flavour and texture, and the fact that there are no weird ingredients added. The one thing that is important to be aware of, however, is that homemade nut milks are not a good source of calcium like their calcium-fortified counterparts (i.e. store-bought varieties). It is important to be sure to get enough calcium from other dietary sources!
Homemade nut milks are super easy to prepare- especially coconut, because there is no soaking required (as there is with others, like almond milk). I prepared my homemade coconut milk as follows:
Homemade Coconut Milk
2 cups unsweetened shredded coconut
4 cups water
Pinch of salt
Add coconut milk, water and a pinch of salt to a high-powered blender. Blend on high for 3-4 minutes, then strain through a nut milk bag. You can save the coconut pulp for use in other recipes!
Use your homemade coconut milk in lattes, smoothies, oatmeal or cereal! Or just drink it plain! It is that good.
1 cup frozen strawberries
1/2 cup frozen avocado
1/2 cup plain kefir
3/4 cup homemade coconut milk (as above)
1 tbsp. ground flaxseed
1 tbsp. unsweetened cocoa powder
Add all ingredients to a blender and blend until smooth.
|
<urn:uuid:363c155a-e24b-4b0a-8652-0c6403a3a052>
|
CC-MAIN-2022-33
|
http://eatwellwithsar.com/2018/06/chocolate-strawberry-coconut-smoothie-homemade-coconut-milk/?share=google-plus-1
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.908578
| 320
| 1.835938
| 2
|
Meaning of the name: who brings profit. Related names are: Aquila
, and Lord. The translations of Onesiphorus in 71 languages of the Bible are illustrated in the
below, from Onesíforo in Spanish
to ᐅᓂᓯᐳᕋᓯᐅᓪᓗ in Inuktitut!
The Lord give mercy unto the house of Onesiphorus; for he oft refreshed me, and was not ashamed of my chain: (2TI 1:16)
Salute Prisca and Aquila, and the household of Onesiphorus. (2TI 4:19)
|
<urn:uuid:ee0359aa-0070-46f6-9f9f-0f232e82bbee>
|
CC-MAIN-2022-33
|
https://mondonomo.com/biblical_name/onesiphorus
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.867201
| 151
| 1.648438
| 2
|
AFROTC cadets get ready for a flight on a C-17 Globemaster III aircraft at Wright-Patterson AFB, Ohio, March 19, 2018. USAF photo by A1C Adam R. Shanks.
MacDill AFB, Fla, this week brought in about 1,300 students from eight schools in the Tampa area to show the Air Force mission in a new effort aimed at increasing the quality of schooling around bases and giving more insight into the military to help bolster recruitment.
During the March 21 “STEAM” day—for Science, Technology, Engineering, Art, and Mathematics—students went on board a KC-135, and saw other displays of military technology. Two days earlier, the base hosted more than 20 Reserve Officer Training Corps cadets from Miami University in Ohio for a “flying classroom” on board a C-17.
“We want to partner with schools to help share our experiences and let students know that if they work hard, there is a place for them on our team,” Air Mobility Command boss Gen. Carlton Everhart said in a release. “Partnering with schools to develop everything from classrooms in the sky, to getting our airmen into school classrooms, will build interest and enthusiasm in our Air Force.”
The revamped outreach by AMC is based on feedback from airmen across the command that education is lacking in areas around military bases. The shortfalls in the quality of education impact the quality of life for military families, AMC spokesman Col. Chris Karns said. By holding these events regularly, the command is showing it is interest in addressing issues in education
“Rather than relying on accepting the status quo, this is a way to be a better partner to the schools, a way to hopefully bring about positive change, and to start dialogue on an issue that is of importance to military families,” Karns said.
Additionally, there is a disconnect between the public in non-military schools about military life, so outreach can educate the public on what airmen actually do, Karns said.
The command wants to have “flying classrooms” or other educational events at every wing this year, and make it easier for local students to immediately apply for internships on bases. The command will track this outreach, and is looking to provide regular reports to Air Force Secretary Heather Wilson and Chief of Staff Gen. David Goldfein on its progress.
The quality of education around military bases as become a priority for military leadership as a whole, with Wilson, along with Army Secretary Mark Esper and Navy Secretary Richard Spencer, writing a letter in February to the nation’s governors urging them to improve education offerings around bases. Military officials will consider the quality of local schools in basing decisions as a way to help improve the quality of life for military families, the secretaries wrote.
|
<urn:uuid:a8f1ad68-5bee-4f82-97db-10558a4fbcd6>
|
CC-MAIN-2022-33
|
https://www.airforcemag.com/macdill-hosts-large-open-house-for-students-as-part-of-new-amc-effort-to-improve-education/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.962575
| 587
| 1.921875
| 2
|
How Important is IT Project Management for Olympic Games Success? RIO 2016 A Case Study
Information technology has an important role in many businesses and in Olympic Games is not different, but when we think about its project management immediately a question comes up. How much important is it project management for Olympic Games success? Information technology department in general has the second biggest budget in the Olympic Games organizing committees (OGOC). Due to the improvements and sports and consequently their dependency from technology, we can say that is almost impossible to realize games without a huge technology set of products and services. Considering as well, that technology is one of the infrastructure areas that provides services to the others functional areas, manage professionally a portfolio of projects became mandatory, not only for technology but also to the entire committee in order to achieve the games organization goals. Olympic games is a megaproject which needs to be planned and managed based on recognized best project management practices. Scope, time, cost, and quality are the minimal aspects that must be managed for functional areas in an integrated manner. Manage it projects it is not an easy thing, especially because it projects are the ones with the highest rate of failure, which means that usually these project do not achieve their goals and realize the benefits planned.
|
<urn:uuid:6f09a752-c76b-4cfd-ab0b-a77d0cb86060>
|
CC-MAIN-2022-33
|
https://pmsymposium.umd.edu/pm2016/session/how-much-important-is-it-project-management-for-olympic-games-success-rio2016-a-case-study/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.967856
| 259
| 1.765625
| 2
|
Quarto orders over $150 get Free Freight
Clear, step-by-step instructions for drawing a variety of dragons, from baby dragons (hatchlings) and sea serpents to dragons of Western and Eastern origin
Fire-breathing beasts have soared in popularity in recent years. With Dragons, the newest addition to our best-selling How to Draw and Paint series, budding artists will find clear, step-by-step instructions for drawing these fanciful creatures. Featuring extraordinary information on the origin and history of dragons from around the world, as well as a wide variety of drawing and shading techniques, this book covers everything readers need to know to render their own versions of these impressive beasts. Dragons differentiates itself from similar books on the market because it features fantasy dragons as well as mythological dragons from around the world.
|
<urn:uuid:8d917a25-8fbb-4668-9db4-8d478e00d461>
|
CC-MAIN-2022-33
|
https://wholesalecraftbookseasy.com/products/drawing-dragons
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.936172
| 174
| 2.421875
| 2
|
Five years of progress: A decade of ambition ahead
We are embarking on a critical decade for climate action.
There are just 10 years left to halve global emissions and the spotlight is on governments to increase their climate commitments in advance of COP26 in Glasgow. Businesses have a critical role to play in driving government ambition and reducing emissions to avoid irreversible and catastrophic climate change.
Five years since the launch of the Science Based Targets initiative (SBTi) and the 2015 Paris Agreement, there has been a surge in corporate climate ambition, with SBTi companies leading the way.
Momentum is growing more quickly than ever
Over 1,000 companies spanning 60 countries and nearly 50 sectors – including one-fifth of the Global Fortune 500 – are working with the SBTi to reduce their emissions at the pace and scale necessary to prevent the worst effects of climate change.
These companies represent nearly 20% of global market capitalization (over $20.5 trillion USD). In spite of COVID-19, 370 organizations joined the SBTi between November 2019 and October 2020, at an average rate of 31 companies a month – more than double the average rate from 2015 to 2019.
From ambition to cutting emissions at scale
Companies with science-based targets have delivered emissions reductions at scale.
The 338 companies we analyzed have collectively reduced their annual emissions by 25% between 2015 and 2019 – a difference of 302 million tonnes of C02e, the same as the annual emissions from 78 coal-fired power plants.
1.5°C is the new north star
More companies than ever are setting targets aligned with limiting global warming to 1.5°C above pre-industrial levels.
As of October 2020, 41% of companies with approved science-based targets were 1.5°C-aligned, with many setting even bolder goals. Hundreds of companies are committing to net-zero emissions by 2050 and to setting science-based targets across their whole value chain through our Business Ambition for 1.5°C campaign.
Approaching a critical mass
Companies with science-based targets are beginning to represent a global movement.
In 16 OECD countries, at least 20% of high-emitting companies are setting science-based targets. According to the 'diffusions of innovations' theory, this threshold – a critical mass – could trigger a domino effect (a rapid adoption of science-based targets) in those markets.
In 2020, the 20% threshold was reached in six new sectors, including the high-emitting and hard to abate cement and concrete sector.
A system-wide change
Science-based targets are catalyzing system-wide change, including large-scale investment in mitigation activities and a greening of global supply chains.
The planned emissions reductions of companies with approved science-based targets will channel up to US$25.9 billion of new investment into mitigation activities over the next decade. Setting value chain targets (scope 3 targets) is now standard practice; 94% of companies with science-based targets include scope 3 emissions.
With the rapid growth of companies joining the SBTi, the potential future impact of science-based targets is huge:
2021: A year of opportunity for business leaders to seize
Five years on from the signing of the Paris Agreement and amidst the urgent challenges of COVID-19, 2021 will be a key year for accelerating climate action.
Companies setting science-based targets are making real and measurable differences to fighting climate change, but there is still much to be done.
By working towards ambitious targets and annually disclosing their progress, businesses from all sectors and regions can play their vital role, and give a clear signal to governments that they are ready for ambitious, bold policy.
Join the world’s biggest companies by cutting your GHG emissions
In 2017, we became the first company globally to set new, science-based targets in line with the 1.5 degree trajectory recommended in the Paris Climate Accord. Jason Tarry Tesco UK and ROI CEO
|
<urn:uuid:4e847cf4-8ace-4445-9110-7e117c52e394>
|
CC-MAIN-2022-33
|
https://sciencebasedtargets.org/sbti-progress-report-2020
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.94627
| 826
| 2.09375
| 2
|
One aspect of the 2016 American election that has gone largely unnoticed has been the way this election has deepened an already existing rift within American Judaism, and Judaism in general.
The election of Donald Trump and the appointment of Breitbart News head Steve Bannon as Trump’s Chief Strategist prompted the Bnai Brith Anti-Defamation League to condemn Steve Bannon as anti-semitic and a conduit for white nationalist Alt Right viewpoints. Two days later, Steve Bannon attended the dinner of the Zionist Organization of America (ZOA). Other major Jewish organizations such as American Jewish Committee and Jewish Federations declined to support the ADL while Jewish luminaries such as Alan Dershowitz defended Bannon and the ADL was finally compelled to partially walk back its comments.
The sight of a major American Jewish organization denouncing a single person – in this case, Bannon – and an organization – i.e., Breitbart – with a bureau in Jerusalem and a following among a segment of Jews in both the United States and abroad laid bare the schism. The sources of the schism go back to the 18th Century, but the current split became apparent in 1967 and 1968 as a result of Israel’s victory in the 6 Day War along with the 1968 New York Teachers strike. It has resulted in a situation in which Orthodox Jews and Liberal Jews are finding themselves having less and less in common.
From the time of the Christian Byzantine Empire Jews were treated as a despised, downtrodden but segregated and autonomous underclass in both Christendom and Islam. Jews were not equal before the law (treated as dhimmi, or “protected”, under Sharia). But in Christendom nobles, clergy and commoners made up differing estates and were not equal before the law either. Judaism had a number of messianic movements during this period (led by false messiahs) including Shabbatai Tzvi in the 17th century and Jacob Frank in the 18th century.
Unlike previous messianic cults, the Frankist movement occurred during the 18th Century and reached it’s culmination toward the end of the 18th Century. The Frankists (and the Shabbataeans) were antinomian, preaching a rebellion against Jewish Law in order to bring the coming of the Messiah. And unlike previous “false messiahs”, Frank lived to see actual insurrection and the achievement of equality before the law as a result of the French Revolution, which two of his nephews participated in. When Frankism collapsed following the death of its leader his daughter Eva, many of the rank and file,, according to historian Gershom Scholem joined the nascent Reform Movement in Judaism.
Thus the liberal tradition in Judaism was born.
Equality before the law for Jews was something many Christians were uncomfortable with in the 19th century. Many Christians had a cultural phobia about Jews. And antisemitism might properly be called” Judeophobia” since the heart of it seems to be a fear of Jews. Jews, however, prospered under the new regimes only to find the gates start to close to them after the 1850sy even in Western Europe. And in the Russian Empire, such Judeophobia often resulted in murderous riots (pogroms) against Jews.
It was in Russia that Jews first began to see the possibility of a Jewish nation centred in what is now the land of Israel through the work of Leo Pinsker. A steady stream of Jews had started to settle in Eretz Yisroel from the early 19th Century. These were mainly Talmudic scholars sustained by donations from abroad, who had joined Sephardic communities and who had come earlier to Palestine. Many were Jews whose ancestors never left the land.
By the early 1900s this movement had fused with Marxist socialism, which was also sweeping Russian jewry and the first kibbutzim, which constituted an on-the-ground attempt to realize the communist and the Zionist national dream at the same time. But most Russian Jews, who were alienated and prompted to leave Russia, were more interested in migrating to the United States and Canada, where there was relatively little Judeophobia until the turn of the 20th century (except in New York City where most Jewish immigrants lived) and where they were offered a chance to start businesses.
Even in the United States anti-semitism became a factor by the 1900s with universities and other institutions increasingly barring Jews. Relegated to the working class, Jews became increasingly interested in progressive social reform, particularly in the area of labour organizing during this period. At the same time, an already transplanted German Reform Judaism looked increasingly attractive to the marginalized Jews who made the trip to the US. Jews more integrated in their communities tended to remain in Europe.
Thus, during the first half of the 20th Century, the settlement of Palestine was not particularly relevant to American Jews, who would help Palestine financially but rarely send their sons and daughters to pioneer in the land of their ancestors. Even the independence of the State of Israel, something few Jews believed could happen until the 1949 cease-fire, did not change this calculus. The Jewish communal priorities after World War II became a combination of using their GI benefits to good purpose to finally attend universities, which were expanding, and a mutual alliance with African-Americans to break down the remaining barriers of prejudice.
During the interwar period a non-socialist version of Zionism grew in Poland, as Timothy Snyder in his book Bloodlands points out, with the sponsorship of the Pilsudski regime. This was Jewish Revisonist Zionism, led by Joseph Trumpledor and Ze’ev Jabotinski, and it advocated complete independence for Israel on both sides of the Jordan River by any means necessary. The Pilsudski regime, seeing Zionism as an extension of its program of Prometheanism (i.e., independence for all the subject peoples of Russia) sponsored Revisionist Zionism to the point of permitting its youth movement Betar to train militarily on Polish soil before migrating to British Palestine.
With the end of World War II and the formation of Israel Zionism temporarily receded in importance for American Jewry. Israel had a lot of legitimacy, though perhaps too socialist for American tastes But American Jews were most concerned with supporting civil rights – theirs along with those of African-Americans. The American Jewish loyalty to the Democratic Party was cemented during these years, especially after 1964 when the Democrats basically repudiated segregation, at least in public facilities.
A turning point and a parting of the ways were reached in 1967. Israel’s victory in the Six Day War was a complete shock. Suddenly Jews were not embattled and in danger of being thrown into the sea, as Egyptian President Anwar Sadat had threatened in the run-up to the conflict. On the contrary, they were actually ruling Jerusalem, the West Bank, Gaza and Sinai.
It was a jolt for the Arabs, the USSR and the US. And this was at a time when African-Americans were shifting from the ideals of the Civil Rights movement to Black Power. Martin Luther King was pushing toward economic justice and a unified front for the working class. But King was assassinated in 1968, ushering in the ascendancy of Black Nationalism.
Black Muslims began to garner a great deal of respect in the African Community. After Elijah Muhammad’s son Wallace (now Warith Dean) Muhammad) made the haj to Mecca, links with Wahabi Sunni Islam were forged, even if the son did not take on all the customs of Wahabism.
The pivotal event in the breach between Jews and African-Americans turned out to be a strike by New York City teachers over the involuntary transfer of ten of the members by the Ocean-Hill Brownsville Community School Board. During this strike Alfred Shanker, President of the United Federation of Teachers, attributed the firing of the ten teachers to anti-semitism. Anti-semitic statements were made by some students, and the events of this strike were instrumental in motivating Meir Kahane to form the Jewish Defense League.
Militant, and later labelled a terrorist group, the Jewish Defense League played a major role in popularizing Revisionist, right-wing Zionism in the 1970s. During the 1970s and 80s, the JDL was soon joined by Aish Hatorah and other Orthodox Jewish organizations, particularly after 1974 when the Israeli political party Likud under Menachem Begin ended 26 years of labor-left dominance of the nation’s politics. The rise of Gush Emunim in Israel lent an Orthodox accent to Jewish settlement of the West Bank.
Gradually, in the United States, the Baalei Teshuva movement competed head to head with cults from the Hare Krishnas to Jews for Jesus to Unification Church for the allegiance of disaffected young Jews. Whether they were Aish Hatorah, Chabad-Lubavitch or other groups, this movement increasingly developed a politically conservative, Revisionist Zionist outlook that revitalized Jewish Orthodoxy. It also found itself increasingly at odds with the Liberal Jewish, Conservative, and Reform and Reconstructionist mainstream. This all happened at a time in which the American secular left became increasingly anti-Zionist.
Over the course of the 20th century, the support for the conservatives deepened. Jews, whose backing for the Democrats was in the 80 percent range in the mid-1900s dropped to the 70s during the early 2000s. Much of the reason for this shift was demographic. Orthodox Jews have large families, and those families tend to stay Orthodox, while liberal Jews have smaller families and their intermarriage rates are at half or more, depending on the community.
Despite outreach and conversion efforts, over the course of generations, intermarried Jews tend to lose their Jewish identity. So over time, the proportion of Orthodox Jews increases. And both in Israel and the US, Orthodox Jews are increasingly right-wing Zionist.
Martin Katchen is an independent scholar, teacher, and researcher living in California. He specializes in Middle Eastern affairs, particularly the state of Israel. He holds a PhD from the University of Sydney (Australia).
|
<urn:uuid:4a47007c-1f1f-40de-b34e-cde08ea39f17>
|
CC-MAIN-2022-33
|
https://politicaltheology.com/the-deepening-rift-in-american-jewry-and-the-turn-toward-revisionist-zionism-martin-katchen/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.972345
| 2,089
| 2.328125
| 2
|
Health calls for 3 issues, willpower on your objectives, a willingness to switch your lifestyles, and a plan. And not using a plan, it’s too simple to give up your new way of life when issues get arduous. The next data will will let you in developing your course of action at the highway to being bodily are compatible.
It’s not foolish in any respect to emphasise the significance of a favorable temper to health. While you determine in a just right temper, you are going to workout more difficult, get advantages extra, and be capable of cross additional. When you’re feeling certain whilst you workout, you center of attention at the just right effects as a substitute of the damaging stumbling blocks in your highway to health.
For wholesome health staying hydrated is vitally necessary. Some great benefits of getting quite a lot of water don’t finish on the gymnasium door, regardless that. But even so powering an exerciser thru a tricky exercise, a abundant water consumption improves general well being and aids in digestion all the way through the day. Overall hydration is any other a part of a plan for general health.
A just right tip that will help you get are compatible is to you should definitely’re getting a minimum of 8 hours of sleep each and every evening. Our our bodies free up hormones as we sleep and in case you reduce your sleep quick, you’re now not getting the total get advantages. 8 hours of sleep or extra, will have to be sufficient.
An excellent health tip you will have to apply is to ensure your weight exercises keep underneath an hour. When weight coaching for greater than an hour, your frame makes extra of the tension hormone cortisol. This decreases the extent of testosterone to your frame and has a damaging impact in your muscular tissues.
Steer clear of coaching with weight belts in spite of the entire hype about how they get you effects sooner. They are able to in reality weaken your belly and decrease again muscular tissues through the years. For those who should put on one in your regimen, handiest accomplish that for optimum lifting workouts corresponding to squats and overhead presses.
In case you have hassle with the phrase workout and steer clear of all of it prices, perhaps you will have to name it one thing else. It will simply be a mental barrier that assists in keeping you from attaining your complete attainable. So name it “mowing the garden”� or “taking a breather”�, however no matter you make a decision to name it, it’s positive to paintings.
An excellent health tip is to start out the usage of chains to your exercises. The usage of chains is an effective way so as to add additional resistance and problem your self. You put up the bar with plates as you usually would, and you then upload chains on every aspect for the additional resistance.
Range your day-to-day power coaching regimen to let muscular tissues leisure. Power coaching places rigidity on muscular tissues and will motive painful muscle tears and different accidents. Through rotating your power coaching workouts and that specialize in other workforce of muscular tissues on a daily basis, you are going to steer clear of harm on your muscular tissues whilst attaining complete frame effects.
So, what do you need from your health plan? Whether or not it’s weight reduction, firming or simply bettering the state of your well being – you’ll be triumphant to your objectives. Take the tips above and use what works for you. It’s your frame, take just right care of your self!
|
<urn:uuid:f76bd1e0-a318-4cad-b468-08e1ef0efb3c>
|
CC-MAIN-2022-33
|
https://elwebdesants.com/nice-recommendation-for-a-a-success-exercise-regimen.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.934109
| 738
| 1.851563
| 2
|
Motorized Scooter Car The Complete Guide to Know!
You're looking for a fresh method of getting around town? Look into the motorized scooter! These tiny cars are ideal for anyone who wants an easy and efficient way to get around. In this blog post we will cover everything you need to be aware of about motorized scooters! We'll cover topics like pricing and features and also how to select the most suitable option for you. If you are seeking out more information then keep reading!
Motorized Scooter Car
Cars that run on motor is referred to as a motorized car. the cars that operate on diesel or petrol are referred to as engine cars. Motorized scooters cost more than non-motorized vehicles. This is the first factor to consider. They range from a few hundred bucks to several thousand dollars depending on the model, make and the characteristics.
There are also smaller cars as well as the motorized car. They are simple to drive. They are very easy to park and don't require you to fret about traffic.
It is also important to understand that motorized scooter cars come in many models and makes. If you're planning to buy one, you need to do your research to find the ideal model.
Electric scooters are another option that are very popular. They are environment-friendly and they do not emit any noise.
Kids and Adults Motorized Scooter Cars:
Motorized scooter cars are no anymore just for kids. Adults can also use these vehicles. If you are an adult and want to purchase a motorized scooter car then you should definitely take the plunge. There are many advantages to using these cars.
The first advantage is that they're extremely economical. You don't have to spend a lot of money on petrol or diesel. You just need to recharge the battery, and then you can drive the vehicle for a long period of time.
The second benefit is that they don't produce any emissions. These vehicles are eco-friendly, and they don't emit polluting gases into the air.
The other benefit is that they're easy to maintain. There is no need to take your car to a garage for maintenance. It can be done at the comfort of your home.
Are Scooter Cars famously popular?
Scooter cars are well-known. Many people use scooters to commute on a daily basis. Many politicians and famous people utilize them.
Are Scooter Cars a Disadvantage?
There are some negatives to using scooters. They are uncomfortable and not extremely practical. They're not comfy enough to be able to sit for long durations of time. They're also slow. They are limited in their speed. However, these disadvantages are offset by the advantages.
There are many scooters on the market. However, the most popular scooters are the Nissan Scoot, Scoot Coupe, and numerous others. Find out more by clicking here.
Many people are able to make use of scooters throughout their day-to-day lives. These cars are extremely convenient and could save you both time and money. Before you decide to buy one, be aware of the pros and disadvantages.
Scooter cars are an excellent way to get around. Since they're inexpensive and simple to operate, many people are finding them to be an excellent alternative to public transportation , or even driving their own vehicle. A scooter car may be the right choice for you, whether you're looking to save on gas costs or just want to make it easier for you to move around.
|
<urn:uuid:7bee751d-40e0-4373-bab2-f022d160430b>
|
CC-MAIN-2022-33
|
https://limoservicesdailynews.com/2022/04/12/motorized-scooter-car-the-complete-guide-to-know
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.973405
| 732
| 1.625
| 2
|
Although some people will be more than happy with their dog being their best friend, it is essential to have humans in your life to socialize and have fun with.
That being said, it can prove difficult to make new friends. Whether you are looking for new friends at work, whilst traveling, or around your area, here are some tips that can help you form new friendships.
Use online communities
Although it is best to form new friendships in person, or at least have in-person interactions eventually, it can be easier to use online communities to form new friendships. Being online, it doesn’t matter if your new friend lives on the other side of the world or down the road. You can interact with them at any time and keep in touch when you want to catch up, organize a meeting, and more.
You can build an online community at Geneva where you can get organized and stay connected with others while forming new friendships. You can share stories, ask how each other is, and more.
Don’t be afraid to compliment someone
Sometimes, new friendships can be formed from a simple compliment. You might be sitting next to someone on the train and notice that they have a similar style and are wearing a pair of shoes that you like. If so, then don’t be afraid to compliment their shoes. From there, the two of you might start a conversation, exchange numbers, and stories, and form a new friendship.
There will never be anything bad that comes from complimenting someone. It will make their day and may lead to a new lifelong friendship.
Be your true self
When you are looking for a new friend or forming a friendship, it is always important to be your true and authentic self. Doing so will allow the person to see the real you. You might have noticed that over the years you have formed a different version of yourself to please others. If so, then you should work to put a stop to this as any friend will love you for who you are and respect your qualities.
Being your true self will make you and your new friend feel the most comfortable. You will be able to relax around them and have the most fun.
Make the same amount of effort
Speaking of people-pleasing, it is always a good idea to recognize how much effort the other person is giving you. Although you might want to continue reaching out to them and make new plans because they are always busy, you will only leave yourself disappointed. Hence, always ensure to make the same amount of effort that they give you. This will result in a fair and respectful friendship.
Likewise, never go quiet on a friend for no reason. When you think about them, let them know. It will show them that you want to spend time with them and think of them as an essential and happy part of your life.
Speak to people with similar interests
Although you might think that it is difficult to know what strangers are interested in, it can soon become obvious if you attend the same things. For instance, you might be a keen runner. Joining a running club will soon have you surrounded by like-minded people with a similar interest in running.
Having this in common, you can soon spark a conversation and form a friendship from there. Who knows, you might even discover that they have other things in common with you. Soon enough, you will have so much to talk about that you will never run out of conversation.
Try not to take things personally
To form a new friendship, will always help to not take things personally. Should your new friend be a busy person, then they might be difficult to organize a coffee date with. It doesn’t mean that you have done anything wrong. It simply means that they have to make time to fit around their schedule. The time that you eventually get to spend with them might be the best coffee date with a friend you have ever had.
Hence, if a friend is quiet or isn’t free most days, then make sure not to take it personally as it will likely not be something you have done. It is just that you lead different lifestyles. When the time is right for you both, you will be able to spend time together and grow your friendship.
|
<urn:uuid:82247efc-6e47-4757-9a9d-d5a8469fe90e>
|
CC-MAIN-2022-33
|
https://theguycornernyc.com/2022/07/04/how-to-form-new-friendships/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.970513
| 871
| 1.960938
| 2
|
Citizens often send messages to the President of the European Parliament (or to the institution’s public portal) expressing their views on current issues and/or requesting action from the Parliament. The Citizens’ Enquiries Unit (AskEP) within the European Parliamentary Research Service (EPRS) looks into these issues and replies to the messages, which may sometimes be identical as part of wider public campaigns.
The President of the European Parliament has recently received a large number of messages calling on the Parliament to revoke its resolution on the fundamental rights of people of African descent in Europe adopted on 26 March 2019. Citizens first began to write to the President on this subject in December 2019. In its resolution, the Parliament called on EU member states and the EU institutions ‘to recognise that people of African descent are subjected to racism, discrimination and xenophobia in particular, and to the unequal enjoyment of human and fundamental rights in general, amounting to structural racism, and that they are entitled to protection from these inequities both as individuals and as a group’.
Please find below the main points of the reply sent to citizens who took the time to write to the President of the European Parliament on this matter (in English and German).
Main points made in the reply in English
The European Parliament adopted the resolution on fundamental rights of people of African descent in Europe on 26 March 2019. You can find the video recording of the corresponding debate here.
The resolution was adopted by 535 votes to 80 with 44 abstentions (p. 11 of the annex ‘Results of votes‘). You will find the result of the roll-call vote under item 31 of the relevant annex, B8-0212/2019 – Resolution, pp. 68-69.
Main points made in the reply in German
Das Europäische Parlament hat die Entschließung zu den Grundrechten von Menschen afrikanischer Abstammung in Europa am 26. März 2019 angenommen. Die Videoaufnahme der diesbezüglichen Debatte können Sie hier finden.
Die Entschließung wurde mit 535 Stimmen dafür, 80 Stimmen dagegen und 44 Enthaltungen angenommen (S. 12 der Anlage „Ergebnisse der Abstimmungen“). Die Ergebnisse der namentlichen Abstimmung finden Sie in dem entsprechenden Protokoll, unter Punkt 31. B8-0212/2019 – Entschließung, S. 68-69.
|
<urn:uuid:6b8d7ffe-8ca8-406d-9ed1-d49cb866f91e>
|
CC-MAIN-2022-33
|
https://epthinktank.eu/2020/03/30/reply-to-the-campaign-against-the-ep-resolution-on-fundamental-rights-of-people-of-african-descent-in-europe/?replytocom=275964
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.751109
| 558
| 1.992188
| 2
|
Was the course of life on the planet altered 12,900 years ago by a giant comet exploding over Canada? New evidence found by UC Assistant Professor of Anthropology Ken Tankersley and colleagues suggests the answer is affirmative.Read more
COLUMBIA — Fans of the Saluda River now have a new place to learn about the area’s Native American history.Read more
EVANSTON, Ill. — Northwestern University researchers ditched many of their high-tech tools and turned to large stones, fire and someRead more
Ancient port site was used periodically between 800 B.C. and 1521 A.D. Explorers sit atop the ancient Maya pyramid atRead more
A team of archaeologists, led by Walter Alva, have discovered the wooden tomb of another member of the Mochica culture’s elite – older than the “Señor de Sipan” (Lord of Sipan).
These findings belong to the Moche civilization, which ruled the northern coast of Peru from the time of Christ to 800 AD, centuries prior to the Incas.Read more
Anthropologists working on the slopes of the Andes in northern Peru have discovered the earliest-known evidence of peanut, cotton and squash farming dating back 5,000 to 9,000 years. Their findings provide long-sought-after evidence that some of the early development of agriculture in the New World took place at farming settlements in the Andes.Read more
A headless skeleton found in a Peruvian tomb is adding new wrinkles to the debate over human sacrifice in the ancient Andes. The decapitated body was found in the Nasca region, named for the ancient civilization that thrived in southern Peru from A.D. 1 to 750.Read more
Prehistoric Polynesians beat Europeans to the Americas, according to a new analysis of chicken bones.
The work provides the first firm evidence that ancient Polynesians voyaged as far as South America, and also strongly suggests that they were responsible for the introduction of chickens to the continent – a question that has been hotly debated for more than 30 years.Read more
People living in the earliest known settlement in the Americas harvested seaweed and other marine plants from a coastline more than 50 miles (80 kilometers) away, new research shows. Scientists discovered several species of seaweed and marine algae dating back more than 14,000 years at the Monte Verde archaeological site in south-central Chile.Read more
Images of disembodied heads are widespread in the art of Nasca, a culture based on the southern coast of Peru from AD 1 to AD 750. But despite this evidence and large numbers of trophy heads in the region’s archaeological record, only eight headless bodies have been recovered with evidence of decapitation, explains Christina A. Conlee (Texas State University). Conlee’s analysis of a newly excavated headless body from the site of La Tiza provides important new data on decapitation and its relationship to ancient ideas of death and regeneration.Read more
Archeologists have uncovered the 1,300-year-old skeleton of a ruler or priest of the ancient Tiwanaku civilization together with precious jewels inside a much-looted pyramid in western Bolivia.Read more
Research at a 4,200-year-old temple in Peru yields clues to an ancient people who may have clocked the heavensRead more
|
<urn:uuid:153ad715-3ffd-4382-b464-14934ec92c55>
|
CC-MAIN-2022-33
|
https://lostworlds.org/category/news/page/8/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.945269
| 692
| 2.984375
| 3
|
Sonic Sea is a 60-minute documentary about the impact of industrial and military ocean noise on whales and other marine life. It tells the story of a former US Navy officer who solved a tragic mystery and changed forever the way we understand our impact on the ocean. The film is narrated by Rachel McAdams and features Sting, in addition to the renowned ocean experts Dr. Sylvia Earle, Dr. Paul Spong, Dr. Christopher Clark and Jean-Michel Cousteau. Sonic Sea was produced by the Natural Resources Defense Council (NRDC) and Imaginary Forces in association with the International Fund for Animal Welfare (IFAW) and Diamond Docs.
Free Event – Suggested $5 Donation
|7:40pm:||Pre-film live music by The Whale Guitar Project featuring Jen Long, Krista Baroni & Steve Delmonico|
|8:40pm:||Film, followed by conversation with: Dr. Francine Kershaw: Marine Mammals Science Fellow, NRDC, Steven Honigman: Former General Counsel, U.S. Navy (featured in the film), William J. Parker: Former Commodore U.S. Navy (featured in the film), Moderated by: Dennis Nixon:Professor and Director, Rhode Island Sea Grant|
|Run time:||56 minutes|
|
<urn:uuid:a03b78b8-0b07-46ae-9826-0fca07c45933>
|
CC-MAIN-2022-33
|
https://newportfilm.com/films/sonic-sea/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.882064
| 277
| 1.96875
| 2
|
MIT develops new brain tracking sensor targeting calcium activity in neuronsFebruary 28, 2019
Researchers from Massachusetts Institute of Technology have developed a magnetic resonance image(MRI) based sensor that can detect calcium activity within neurons, allowing them to closely track brain activity.
The researchers tested their sensor in rats by injecting it into the striatum, a region deep within the brain that is involved in planning movement and learning new behaviors. They then stimulated electrical activity in neurons of the striatum, and were able to measure the calcium response in those cells.
“This paper describes the first MRI-based detection of intracellular calcium signaling, which is directly analogous to powerful optical approaches used widely in neuroscience but now enables such measurements to be performed in vivo in deep tissue,” says Alan Jasanoff, an MIT professor of biological engineering, brain and cognitive sciences, and nuclear science and engineering, and an associate member of MIT’s McGovern Institute for Brain Research.
Calcuim is a critical signaling molecule for most cells and is especially important in neurons for their communication. They achieve this by sending electrical signals, which trigger an influx of calcium ions into active cells. Tracking the signaling process inside neurons would help link neural activity with specific behaviours in animals.
Since MRI is a powerful non-invasive imaging technique, detecting calcium activity using it will enable a deeper penetration into the brain unlike the traditional functional MRI (tfMRI) which measures the blood flow in the brain.
MRI works by detecting magnetic interactions between an injected contrast agent and water molecules inside cells. Though scientists had tried creating calcium based sensors to measure the extracellular calcium concentrations, creating a contrast agent was a major obstacle.
Here the researchers developed the contrast agent with building blocks that can pass through the cell membrane. The contrast agent contains a manganese part that interacts weakly with magnetic fields. This metal is bound to an organic compound that can penetrate cell membranes. This complex contains a calcium-binding arm called a chelator.
Once inside the cell, if calcium levels are low, the calcium chelator binds weakly to the manganese atom, shielding the manganese from MRI detection. When calcium flows into the cell, the chelator binds to the calcium and releases the manganese, which makes the contrast agent appear brighter in an MRI image.
“When neurons, or other brain cells called glia, become stimulated, they often experience more than tenfold increases in calcium concentration. Our sensor can detect those changes,” Jasanoff says.
With further modification this technique could be developed in future to perform diagnostic imaging of the brain or other organs whose functions rely on calcium.
|
<urn:uuid:dae43f85-b80a-4d43-ac6f-1cba270c2780>
|
CC-MAIN-2022-33
|
https://futuremedicineindia.com/f-m/news/3472/mit-develops-new-brain-tracking-sensor-targeting-calcium-activity-in-neurons
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.924892
| 540
| 2.828125
| 3
|
Summary: Researchers have identified a new type of vertigo. The study reveals people with this new form of vertigo are more likely to have severe motion sickness than those with other types of the condition.
Neurologists have identified a new type of vertigo with no known cause, according to a study published in the May 23, 2018, online issue of Neurology.
With vertigo, people have episodes of dizziness that can last from minutes to days. Vertigo can be caused by serious conditions, such as tumors, or conditions that are fairly benign, such the inner ear disorder Meniere’s disease. But for some people, no cause can be found.
In this new study, neurologists have identified a new type of vertigo where treatment may be effective.
“These conditions can be difficult to diagnose and quite debilitating for people, so it’s exciting to be able to discover this new diagnosis of a condition that may respond to treatment,” said study author Ji-Soo Kim, MD, PhD, of Seoul National University in Seongnam, South Korea.
To diagnose this new condition, the person sits in a dark room and the examiner moves the patient’s head forward and then the head is shaken horizontally for about 15 seconds. Then the patient opens his or her eyes and a video recording is taken of eye movements. The neurologists discovered that after the test people with this new condition had eye movements called nystagmus that lasted longer than for other people. The new condition is called recurrent spontaneous vertigo with head-shaking nystagmus.
Among 338 people with vertigo with no known cause, 35 had this new condition and were included in the study. The participants had attacks of vertigo ranging from two or three times a week to once a year. They also experienced nausea or vomiting, headaches and intolerance of head motions during the attacks.
The participants were compared to 35 people with other conditions that can cause vertigo, such Meniere’s disease, vestibular migraine and vestibular neuritis. The test measured the time constant, or the time that represents the speed with which the reflexive eye movements can respond to change. For those with the new condition, the time constant during the primary phase of the nystagmus was 12 seconds, while it was six seconds for those with Meniere’s disease and five seconds for those with vestibular neuritis and vestibular migraine.
The neurologists also found that people with the new type of vertigo were more likely to have severe motion sickness than those with other types of vertigo.
A total of 20 of the 35 people with the new type of vertigo who had frequent attacks and severe symptoms were given preventive medication. About one-third of those had partial or complete recovery with the new medication. During the long-term follow-up of an average of 12 years after the first symptoms for 31 participants, five reported no more attacks, 14 said their symptoms had improved and only one said symptoms had gotten worse.
Kim said that people with this condition may have a hyperactive mechanism in their vestibular system that helps the brain respond to movement of the body and in the environment.
“It’s possible that the vertigo occurs when this unstable mechanism is disrupted by factors either within the person’s body or in their environment,” Kim said.
About this neuroscience research article
Funding: The study was supported by the National Research Foundation of Korea.
Source:AAN Publisher: Organized by NeuroscienceNews.com. Image Source: NeuroscienceNews.com image is in the public domain. Original Research:Abstract for “Recurrent spontaneous vertigo with interictal headshaking nystagmus” by Sun-Uk Lee, Jeong-Yoon Choi, Hyo-Jung Kim and Ji-Soo Kim in Neurology. Published May 23 2018. doi:10.1212/WNL.0000000000005689
[cbtabs][cbtab title=”MLA”]AAN “New Type of Vertigo Identified.” NeuroscienceNews. NeuroscienceNews, 25 May 2018. <https://neurosciencenews.com/new-vertigo-9138/>.[/cbtab][cbtab title=”APA”]AAN (2018, May 25). New Type of Vertigo Identified. NeuroscienceNews. Retrieved May 25, 2018 from https://neurosciencenews.com/new-vertigo-9138/[/cbtab][cbtab title=”Chicago”]AAN “New Type of Vertigo Identified.” https://neurosciencenews.com/new-vertigo-9138/ (accessed May 25, 2018).[/cbtab][/cbtabs]
Recurrent spontaneous vertigo with interictal headshaking nystagmus
Objective To define a disorder characterized by recurrent spontaneous vertigo (RSV) of unknown etiology and interictal headshaking nystagmus (HSN).
Methods We characterized HSN in 35 patients with RSV-HSN compared to that recorded in randomly selected patients with compensated vestibular neuritis (VN), vestibular migraine (VM), and Ménière disease (MD).
Results The estimated time constant (TC) of the primary phase of HSN was 12 seconds (95% confidence interval [CI] 12–13) in patients with RSV-HSN, which was larger than those in patients with VN (5 seconds, 95% CI 4–5), VM (5 seconds, 95% CI 5–6), or MD (6 seconds, 95% CI 5–6). TCs of the horizontal vestibulo-ocular reflex were also larger during the rotatory chair test in patients with RSV-HSN. Among the 35 patients with RSV-HSN, 7 showed vigorous long-lasting HSN with a peak slow-phase velocity >50.0°/s. In 5 patients (5 of 7, 71%) with vigorous HSN, HSN could have been induced even with headshaking for only 2 to 5 seconds. Long-term prognosis was favorable, with a resolution or improvement of the symptoms in more than half of the patients during the median follow-up of 12 (range 2–58) years from symptom onset. None developed VM, MD, or cerebellar dysfunction during the follow-up.
Conclusion The clinical features and characteristics of HSN in our patients indicate a hyperactive and asymmetric velocity-storage mechanism that gives rise to intermittent attacks of spontaneous vertigo probably when marginal compensation of underlying pathology is disrupted by endogenous or exogenous factors.
|
<urn:uuid:66fe186f-0367-4e2c-a616-dd284cf1cf6b>
|
CC-MAIN-2022-33
|
https://neurosciencenews.com/new-vertigo-9138/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.94629
| 1,412
| 3.265625
| 3
|
History is made as a Renaissance-era landmark in Venice is now open to the public for the first time. Visitors to Venice will now be able to enter the Procuratie Vecchie after it opened to the public for the first time in its history on April 13 following an extensive five-year renovation project.
The building stretches the entire length of the north side of the Piazza San Marco or St Mark’s Square and is arguably one of the most famous and most photographed buildings in Venice.
Italian insurance company Geraldi and the NGO, Human Safety Net, occupy the second and parts of the third floor of the building but now visitors will be able to access the top floor where a permanent exhibition space has been installed after David Chipperfield Architects in Milan was called in to breathe new life into the iconic building.
Designers installed new spaces and opened up passageways and rooms that could be enjoyed by the public too.
|
<urn:uuid:6e4da834-8294-43d0-b35a-cc883acf3a95>
|
CC-MAIN-2022-33
|
https://sheskull.com/one-of-venices-most-iconic-landmarks-opens-to-visitors-for-the-first-time-in-500-years/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.962863
| 191
| 1.976563
| 2
|
If you’re looking for experienced, knowledgeable hydroseeding service that will leave you with a lush, green area, Instant Green Hydroseeding ensures a successful and efficient seeding job for locations throughout the Okanagan and western Canada.
You could be mowing your freshly seeded lawn in less than a month! With hydroseeding, grass grows evenly, not patchy, and is suitable for a wide range of projects. It helps to prevent erosion as well as noxious weeds from growing. We use different grass seed mixtures for various applications.
What is Hydroseeding?
Hydroseeding is a spray of seed and mulch used for many purposes, including soil erosion and a quicker, more uniform germination of grass or ground cover. Any seed can be applied by this method, including native grasses and wildflowers, erosion control mixtures and lawns. The hydroseed slurry consists of the chosen seeds, fertilizer, lime, bio-stimulants, and other agents to assist the spraying and boost that establishes quick healthy growth. Hydroseeding can be used to stimulate old damaged lawns or establish new ones.
Hydroseeding is useful for both residential and commercial applications:
- Habitat Restoration
- Erosion Control
- Embankments and Slopes
- Pastures Land Reclamation
- Construction Sites Sports Fields
Instant Green Hydroseeding
Monday to Friday: 7:30 a.m. – 3:30 p.m.
Saturday and Sunday: Closed
#113-437 Martin Street (PO BOX 158) Penticton BC, V2A 5L1
|
<urn:uuid:219e4ceb-d1cb-4336-a7e7-373221b6a781>
|
CC-MAIN-2022-33
|
https://www.instantgreen-hydroseeding.ca/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.903018
| 338
| 1.632813
| 2
|
Cairns are traditionally markers to define distance or warn foolhardy sailors of the rocks beneath the ocean’s waves. This one – near the neolithic Tomb of the Eagles in Orkney – is quite possible modern. Its anonymous maker has sought a balance between order and the chaos of broken shards of stone, much like the work of the artists Andy Goldworthy and Richard Long. For me photographically, chaos is all around; order is how I try to make it sing.
Location: Isbister, South Ronaldsay, Orkney, Scotland
Cairns are human-made piles (or stacks) of stones. The word cairn comes from the Scottish Gaelic: càrn (plural càirn). Cairns have been and are used for a broad variety of purposes, from prehistoric times to the present.
In modern times, cairns are often erected as landmarks, a use they have had since ancient times. However, since prehistory, they have also been built and used as burial monuments; for defense and hunting; for ceremonial purposes, sometimes relating to astronomy; to locate buried items, such as caches of food or objects; and to mark trails, among other purposes.
Cairns are used as trail markers in many parts of the world, in uplands, on moorland, on mountaintops, near waterways and on sea cliffs, as well as in barren deserts and tundra. They vary in size from small stone markers to entire artificial hills, and in complexity from loose conical rock piles to delicately balanced sculptures and elaborate feats of megalithic engineering. Cairns may be painted or otherwise decorated, whether for increased visibility or for religious reasons. An ancient example is the inuksuk(plural inuksuit), used by the Inuit, Inupiat, Kalaallit, Yupik, and other peoples of the Arctic region of North America. These structures are found from Alaska to Greenland. This region, above the Arctic Circle, is dominated by the tundra biome and has areas with few natural landmarks.
|
<urn:uuid:9dbf15cf-5780-4d3b-80aa-66225c25014f>
|
CC-MAIN-2022-33
|
https://www.anniewrightphotography.com/orkney/cairns/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.956218
| 440
| 3.234375
| 3
|
Treating Elbow Injuries in Hyannis and Sandwich, MA
The elbow is a complex joint involved in pulling, pushing, and forearm rotation. Just as in other joints of the body, there are many processes that can cause elbow pain.
Elbow pain can be caused by injury to the bones that make up the elbow, the muscles that surround the elbow, or the tendons that attach muscle to bone.
Our Elbow Specialists
Jesse Affonso, MD, Timothy Kinkead, MD, Brian Najarian, MD
Common Causes of Elbow Pain
Fortunately, most elbow pain is not serious and is the result of overuse or repetitive motions. Just as in all other joints, occasionally arthritis may affect the elbow. However, this is much less common than joints of the lower extremity. Common causes of pain include nerve compression (cubital tunnel or radial tunnel), direct trauma (fractures or dislocation), inflammation of surrounding bursa (olecranon bursitis), and inflammation of tendons on the inside (“golfer’s elbow”) or outside (“tennis elbow”) of the elbow, and arthritis (osteoarthritis or rheumatoid arthritis).
Of course, the proper treatment for elbow pain will depend on the cause. Many times treatment consists of a combination of rest, ice and/or heat, anti-inflammatories, physical therapy, stretching, corticosteroid injections, and in some cases, surgery. While most patients have heard of arthroscopy or replacements of hips and knees, many of those treatments are also available for the elbow (although much less frequently required).
|
<urn:uuid:463416cd-0658-4893-9f2a-c35c7623085a>
|
CC-MAIN-2022-33
|
https://www.capecodortho.com/orthopaedics/elbow/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.924933
| 347
| 2.328125
| 2
|
During our trip to Seoul, South Korea, our itinerary included a local Korean restaurant for lunch. Bibimbap was on the menu. We were excited to taste the Korean food to be served on a very low table, maybe a foot in height. First to be served was the portable butane stove. Next was the ingredients for the Bibimbap. Then the waitress left and stood a few feet from us and waited for our additional orders. We looked at each other and whispered , “What are we going to do with that?” The waitress sensed that we were tourists in the city and observed us for a minute. Ha, ha,ha ! Nothing has been done with the bacon-thinned pork and the veggies. So, I called her to please help us do the cooking. She started with a smile and did the explanation in Korean which we never understood a single word she uttered. Only her body language helped us to understand her show. When all was finished and devoured the delicious food, our tour guide who left us earlier to eat her own meal in another room showed up. “Did you enjoy your Korean meal? … “Of course, we love it”
There is a reason this dish is one of the most popular dishes served in Korean restaurants all over the world…it’s amazing!
Learn how to cook this delicious Korean dish. Seasoned veggies, Korean beef (bulgogi), egg, Korean sauce, all on top of perfectly steamed rice. It’s so easy. Make all the toppings first, then the rice…and serve with the homemade sauce. So good.
This can give you the following Vitamins and Minerals for the body. Calories: 274kcal | Carbohydrates: 19g | Protein: 15g | Fat: 14g | Saturated Fat: 3g | Cholesterol: 164mg | Sodium: 1738mg | Potassium: 1014mg | Fiber: 5g | Sugar: 7g | Vitamin A: 8327IU | Vitamin C: 42mg | Calcium: 180mg | Iron: 5mg
All the vegetables, mushrooms, and steak can be prepared up to 1 day ahead of time. You need to re-heat each component in the wok, or skillet, before serving. Gochujang can be found in the Asian section of most well-stocked supermarkets, or at Asian food markets, or online. Long-grain rice, or Jasmine rice are good substitutes for the traditional short-grain rice. Just follow the cooking time according to package directions.
▢1 lb prepared bulgoli or cooked, seasoned ribeye, sirloin, or skirt, thinly sliced
▢Stir-fry oil or vegetable oil…for stir-frying all the ingredients as you go.
▢4 garlic cloves minced
▢2 cups bean sprouts
▢4 tbsp soy sauce divided
▢2 tbsp sesame oil divided
▢1 cup julienne carrot or shredded
▢1 zucchini seeded, cut into 1-inch sticks
▢12 oz spinach fresh
▢8 oz shiitake mushrooms sliced
▢2 tbsp sesame seeds toasted
▢2 cups short-grain white rice
▢2 cups water
▢2 tsp rice vinegar
▢1 tsp salt
THE KOREAN SAUCE
▢2 tbsp gochujang
▢1 tbsp sesame oil
▢1 tsp sugar
▢1 tbsp water
▢1 tsp apple cider vinegar
▢1 tsp garlic minced
MAKE THE TOPPINGS
Prepare the bulgogi, or stir-fry beef with salt, pepper, and 1 tbsp each soy sauce and sesame oil. Set aside.
Cook the bean sprouts in boiling water for 5 minutes. Drain, Place in a separate bowl and add 1 teaspoon garlic, 1 tablespoon each of soy sauce and sesame oil. Mix. Set aside.
Stir-fry the carrots in a little oil for about 4 minutes. Set aside. Lightly salt.
Stir-fry the zucchini in a little oil for about 4 minutes. Set aside. Lightly salt.
Stir-fry the spinach with a teaspoon of water until wilted and water has evaporated, about 4 minutes. Place in a separate bowl. Add 1 teaspoon garlic, 1 tablespoon each soy sauce and sesame oil. Mix. Set aside.
Stir-fry the mushrooms with 1 tablespoon of soy sauce, until reduced and lightly browned, about 6 – 8 minutes.
Cook 4 eggs, sunnyside up, add salt and pepper, set aside.
PREPARE THE RICE
Bring rice, water, vinegar, and salt to boil in a medium saucepan over high heat.
Cover, reduce heat to low and cook until liquid has been absorbed, 7 – 9 minutes.
Remove rice from heat and let sit, covered, until tender, about 15 minutes.
(Cook time will be longer, approx. 25 minutes, if using long grain rice).
|
<urn:uuid:df2bb953-42bf-4e71-8082-76ce0bf3ddd8>
|
CC-MAIN-2022-33
|
https://trianglewritesphil.wordpress.com/2020/11/12/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.889342
| 1,082
| 1.695313
| 2
|
The Washington University community lost a beloved member when James E. “Jim” McLeod died in 2011. McLeod was vice chancellor for students and dean of the College of Arts & Sciences, however, he might best be remembered as a dispenser of wisdom.
Every year, McLeod delivered a talk called “Habits of Achievement” to incoming Ervin Scholars in his role as director of the Ervin Scholars Program. This speech, fondly remembered by alumni of the Ervin program, had never been printed or even written down. Until now.
In preparation for the 25th anniversary of the Ervin Scholars Program in September 2012, several Ervin alumni decided they would like to have the “Habits of Achievement” published. And so began the process that resulted in Habits of Achievement: Lessons for a Life Well-Lived, a book that weaves Ervin alumni recollections of McLeod with his speech. It also includes a short biography of McLeod’s life.
“The book was an 18-month labor of love,” said Ervin alumna Trina (Williams) Shanks, Class of ’92, MSW ’00, PhD ’03.
Shanks used a recording of McLeod’s talk and notes taken by current Ervin Scholars and Ervin alumni to write the “Habits of Achievement” section of the book, which includes quotes from alumni about how much the “Habits” meant to them. These quotes were gathered from the Ervin Facebook page, the Ervin website and from condolences sent after McLeod died. The biography section was written by the book’s editor, Mary Ellen Benson, former assistant vice chancellor for public affairs.
After the Chancellor’s Office agreed to fund the project, the book was readied for the printer, which included getting permissions for all the quotes and perfecting the layout.
“This later effort to perfect final details was less taxing for me but took lots of work by the editor, Mary Ellen Benson, and the designer, Marcy Mamroth,” said Shanks, associate professor of social work at the University of Michigan.
“The ‘Habits of Achievement’ project meant a lot to me because I have seen how Dean McLeod touched so many lives over the years, and I wanted to generate something that would attempt to commemorate all that he has done for individuals through his various roles at Washington University,” Shanks said.
“I have received supportive emails and Facebook messages from dozens of alumni, as well as others affiliated with Washington University who have seen the book,” she said.
Habits of Achievement was unveiled by Chancellor Mark S. Wrighton during a special luncheon May 1 at the Whittemore House. He also mentioned the book in his remarks to graduates at Commencement.
A limited number of copies are available in the Campus Bookstore on the Danforth Campus for a $10 donation to the McLeod Scholars Program. For more information, contact Mary McGinley at email@example.com or (314) 935-5580.
|
<urn:uuid:e1f5d8ad-5493-4a93-b8dd-7072dfd3fcd6>
|
CC-MAIN-2022-33
|
https://source.wustl.edu/2013/07/habits-of-achievement-book-is-tribute-to-mcleod-and-hiswords-of-wisdom/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.977916
| 666
| 1.632813
| 2
|
DApps browsers are also referred to as web3 browsers that help users to bond decentralized applications. This browser is very important for making transactions with cryptocurrency as the available regular browsers will not help with this. The decentralized applications are not compatible with regular browsers and hence, DApps are very important.
There are a lot of people who often question how do I get DApps on my trust browser? So, if you are also someone who is thinking the same then read our article carefully and learn how you can enable trust wallet on your iPhone and Android devices.
Enable Trust wallet on your iPhone
After a new update in June 2020, you can no longer use a trust wallet on your iOS device. So, follow these steps to know how to enable a trust wallet on iPhone.
You can add a version of the DApp browser to your trust wallet using the WalletConnect feature. WalletConnect is a protocol that is attuned with a lot of applications and allows the users to Scan QRs and pay money.
- Launch the Safari browser on your iPhone and then search for the PancakeSwap website or click at this link https://pancakeswap.finance/.
- On the screen, you will see a ‘Connect’ button. You need to click on it.
- Then you will see a list. Look for ‘WalletConnect’ and then select it.
- If you are still on the Mobile tab then, select ‘Trust’ wallet from the given list of wallets.
- You will get a notification on your Trust Wallet about the PancakeSwap. Accept the connection to finalize your changes.
- Now, your Trust Wallet is successfully connected and you can use this Wallet to make payments.
There is an alternative method that you can use to get the same results. For this, you need to use UniSwap.
- Click on the link https://app.uniswao.org/ or open the UniSwap website on your apple browser.
- You will see a ‘Connect Wallet’ option on the screen. Tap on it.
- Then you will be directed to a list where you need to select WalletConnect.
- Now, choose Trust from all the apps present on the list.
- Then, you need to follow the given instructions on the screen and you will activate your Trust Wallet.
This is how you can complete the process of trust browser enable on iPhone.
Enable trust Wallet on your Android Device
Now, if you are thinking about how to enable trust browser on android then, you will be happy to know that the process is much simpler in comparison to the above process. So, follow these steps and enable your wallet.
- You need to Open the Trust Wallet on your phone and then click on the ‘Settings’ option.
- Then, you will see a list where you need to hit on the ‘Preferences’ option and then select ‘DApp Browser’.
- You will be directed to a separate page where you will see the ‘Enable’ button.
- Click on the button and enable it.
- Now, you can open your DApp browser Dashboard which is on the bottom of the Trust Wallet app’s home screen.
You can now easily use a DApp browser on your mobile phone be it an iPhone or an Android device. Hope you will benefit from the guide given by us. For more information you may also visit the official website of Onlinegeeks, here you will find different types of troubleshooting blogs and articles.
Also recommended – https://www.joinarticles.com/top-instagram-usernames-ideas/
|
<urn:uuid:8ebc467f-eff9-45e0-bc2b-02b772d6ae88>
|
CC-MAIN-2022-33
|
https://www.joinarticles.com/how-do-i-enable-dapps-on-my-trust-wallet/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571719.48/warc/CC-MAIN-20220812140019-20220812170019-00264.warc.gz
|
en
| 0.880522
| 771
| 1.6875
| 2
|
by Ethan Tong & Jorge Gomez • 5 min read
53% of Democratic voters support abolishing the U.S. Supreme Court and replacing it with “a new “democratically elected” court, according to a recent Heartland/Rasmussen Poll.
The poll also asked about “a constitutional amendment that would give the United Nations the authority to reverse U.S. Supreme Court decisions.” More than 1/3 Democrats—39%—support this proposition.
The Supreme Court’s recent precedent-setting decisions––Dobbs v. Jackson (abortion), NYSRPA v. Bruen (gun rights), and First Liberty’s cases, Kennedy v. Bremerton School District (prayer) and Carson v. Makin (religious freedom)––have garnered much attention in recent weeks.
In the aftermath of these decisions, radicals have claimed the Supreme Court is “illegitimate.” Some politicians and activists did not like how the Court has ruled and immediately renewed calls for court “reform.” Some are demanding court-packing, a blatant attempt by one party to grab more power and tilt the Court in its favor. Others are calling for a complete restructuring or to get rid of the Court altogether.
But most Americans do not appear to be persuaded by these radical claims. 53% of all likely voters oppose abolishing the Supreme Court.
What’s more, a majority of Americans—54%—say they oppose court packing, according to a recent NPR/PBS NewsHour/Marist poll. The poll asked nearly 1,000 Americans about the Dobbs v. Jackson decision, which properly returned the power to regulate abortion to the states. A majority said they disagreed with the ruling. Nonetheless, a majority still oppose packing the Supreme Court.
A Harvard-Harris poll also found 63% consider the nation’s highest court legitimate. 59% also said it’s wrong for the party in power to call the Supreme Court illegitimate.
Earlier this year, First Liberty commissioned our own Mason-Dixon poll, asking 1,100 Americans their views on court packing. The findings were similar: 64% opposed restructuring the Supreme Court and 65% opposed court packing.
Threatening to expand the Supreme Court is an extreme response. One political party disagreeing with recent decisions should not lead to a complete restructuring of the Court. We can disapprove of and criticize judicial rulings. We have a constitutionally protected right to peacefully protest outside the Supreme Court.
But disagreement and destruction are two different things. The judiciary is one of our most revered and important institutions, one that often protects our rights and freedoms. Court packing would bulldoze this pillar of our constitutional republic.
Additionally, the findings help expose court packing for what it really is: a politically motivated scheme to advance the agenda of the party in power. Whenever rulings don’t go its way, the far Left’s “solution” is to radically tilt the Court in its favor. The rush to add seats to the Court and stack it with liberal justices is not about “reform” or “restoring balance.” It’s all about changing the rules, getting around decisions they don’t like, and grabbing more power.
The poll numbers make it clear: We The People oppose radical court packing. Americans are waking up and learning the dangers of this plot. They are not fooled. Most recognize it would destroy our judicial system and erode our core freedoms, including religious liberty.
Even so, some insist on staging a Supreme Court Coup.
People with tremendous power in Washington, D.C.—Sen. Ed Markey, Sen. Elizabeth Warren, Rep. Mondaire Jones, Rep. Rashida Tlaib, Rep. Jerry Nadler and others—appear emboldened to turn the judiciary into a rubber-stamp of their radical agenda. In recent weeks, their voices have grown even louder.
We must stand strong against those who advocate for court expansion. Court packing is not a benign, diplomatic suggestion––it would only take America one step closer to tyranny. Court packing is the stuff of dictators, not democracies.
Nearly 500,000 Americans have already made their voices heard by joining First Liberty’s national coalition of patriots who are saying “NO!” to court packing. With your help, we’ve already made a tremendous impact in stopping this radical scheme.
If we’re to save the Supreme Court and the independence of our judiciary, we need to keep educating millions more Americans and exposing the lies of those who want to fill the Court with partisan judges.
|
<urn:uuid:8307fa4d-bede-4164-85a0-add127f5accb>
|
CC-MAIN-2022-33
|
https://firstliberty.org/news/democrats-support-abolishing-scotus/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.939494
| 962
| 2.28125
| 2
|
Mixed reality applications and devices have brought a new shine to gaming and entertainment and will continue to push the envelop as the technology becomes more capable. Mixed reality has also proven to be beneficial in workplace environments. For example, NASA is using data gloves and augmented reality to train their astronauts in a virtually recreated International Space Station. In a slightly more grounded environment, the HoloLens is being used to assist technicians in elevator repairs.
Traversal via elevator is such a regular part of our lifestyles, its importance is rarely recognized…until they’re not working as they should be. ThyssenKrupp AG, one of the largest suppliers for elevators, recognizes how essential they are as well as how the simplest malfunctions can deter the lives of millions. Announced on their blog, Microsoft is partnering with Thyssenkrupp to equip 24,000 of their technicians with HoloLens.
With this tool at their disposal, these technicians get a major boost in efficiency. In a video attached to the announcement embedded above, a rep explains that their technicians will be able to tackle an issue in 20 minutes or so for something that would usually take two hours without HoloLens. You also witness how a technician can get a look at what’s wrong with an elevator before starting, with a seemingly sci-fi future interface displayed on the wall next to it.
Once they get down to the work itself, off-site assistants can view what the technician sees and even direct the tech’s attention toward something by drawing on a Microsoft Surface screen. Skype integration, which is what allows them to contact support, allows them to comply with safety regulations and remain hands-free while receiving said support. The One World Trade Center is taking advantage of this new partnership along with one set in motion in 2015 called MAX, a predictive maintenance system. The combination of these two tools makes the One World Trade Center a symbol for new advancements in this arena.
|
<urn:uuid:65e1812c-9ae2-412c-9948-5a3d0e69ff59>
|
CC-MAIN-2022-33
|
https://uploadvr.com/microsoft-hololens-elevator-technicians/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.946546
| 416
| 2.1875
| 2
|
DragonFly BSD is a fork of FreeBSD, begun June 2003. Motive: the methods and techniques adopted for threading and symetric multiprocessing (SMP) in FreeBSD 5 would perform poorly and be hard to maintain.
Concise, with links, forum comments. [OSNews.com]
Matthew Dillon personal page: brief introduction, links to projects; software: DIABLO backbone news transit system, DICE Amiga C compile, XMAKE.
Interview of core developers (Matthew Dillon, Joerg Sonnenberger, Jeffrey Hsu, Hiten Pandya) on their goals. [ONLamp.com]
A source-code search engine, based on an improved version of OpenGrok, allows one to grok — profoundly understand — the source code of DragonFly BSD.
Lists: summary, links, features, news.
Fork of FreeBSD 4.11, focus: scalability, robustness, and debuggability in several broad system traits, especially threading and symetric multiprocessing, SMP.
News Weblog with large archives, links to BSD and DragonFly related sites.
Lead developer talks on MP3 file, with forum comments. [bsdtalk]
Lead developer comments on his goals, with links, forum comments. [OSNews.com]
Fan control with sysctl hw.sensors and lm(4) on OpenBSD and DragonFly BSD.
Encyclopedia article about the Unix-like operating system, including history and future directions.
Thanks to DMOZ, which built a great web directory for nearly two decades and freely shared it with the web. About us
|
<urn:uuid:286b953a-e1cb-4b20-9946-a2db98e769a6>
|
CC-MAIN-2022-33
|
http://odp.org/Computers/Software/Operating_Systems/Unix/BSD/DragonFly
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.777027
| 542
| 1.679688
| 2
|
How Seniors Can Elevate Their Mood
You know the old saying, “We are what we eat.”
We all know that doesn’t literally mean we could turn into jelly donuts after we eat them. It does mean our middles can look like a donut and jiggle like jelly if we overindulge too often. And that doesn’t make anyone feel physically and mentally healthy, especially older adults.
So if seniors eat lots of carrot and celery sticks, they’ll stay skinny and chipper? Well, sort of. But physical and mental health are tied together for sure.
Certain foods can improve seniors’ overall mood; a positive mood equates to a lower risk of depression and anxiety. Happier, healthier older adults are more inclined to have more energy to do things like exercise. And when they feel better, they’re incentivized to keep eating better.
Here are some activities and tips for seniors to boost their mood, along with ways nutrition can help seniors boost their mood and energy.
Activities to boost seniors’ mood
- Exercising regularly. We have to lead with the most obvious first, but it’s true. Regular, low-impact exercise like walking, biking, yoga and tai chi is great for older adults’ health, especially when done with friends. If seniors can get in 20-30 minutes of exercise every day, mind and body both benefit.
- Maintaining social connections. People who have strong social ties have lower rates of stress, depression and anxiety, and studies have shown friends can also help seniors live longer.
- Playing games. Board games, online games, card games — it doesn’t matter. Games of all kinds activate key parts of the brain, the hippocampus and the prefrontal cortex, which stimulates memory and helps ward off the effects of dementia. Game-playing can also boost seniors’ immune systems, improve hand-eye coordination and dexterity, and reduce stress. Who knew a competitive game of Scrabble or a crossword puzzle could do all that?
- Learning something new. Learn how to play a musical instrument, or learn how to speak a foreign language (Icelandic, anyone?). Acquiring new skills sharpens seniors’ brains and improves memory.
- Adopting a pet. Pets can improve an older adult’s mood by offering vital social interaction and enhancing overall quality of life. Dogs in particular can be a great pet if an aging adult wants to get more exercise: After all, dogs love walking. Pets also help older adults find a new purpose, because all pets need regular care.
- Getting outside. Nature can be an incredible mood-booster. There’s even a word for it: forest bathing. It’s proven to reduce stress hormone production, lower heart rate and blood pressure, boost the immune system, and improve feelings of happiness.
Ways nutrition helps seniors boost mood and energy
Let’s revisit that jelly donut analogy. Who would feel great eating the same unhealthy item day after day? For one answer, see the movie Super Size Me, in which Morgan Spurlock ate nothing but fast food for every meal for one month.
For older adults who want to boost their mood through foods, the key is to eat a balanced diet that integrates a variety of these types of foods.
- Dark chocolate: One study found that eating a little dark chocolate can reduce cortisol levels and other stress hormones. Researchers think it could be because of antioxidants found in dark chocolate.
- Leafy greens: The mineral magnesium helps reduce anxiety. Dark leafy greens like spinach and Swiss chard are loaded with it; so are almonds and avocados. So make a salad and get lots of magnesium in every bite.
- Berries: Berries of all kinds pack a wide range of antioxidants and phenolic compounds, which play a key role in combating an imbalance of harmful compounds in your body. They’re particularly high in anthocyanins, a pigment that gives certain berries their bluish-purple color. One study associated a diet rich in anthocyanins with a 39% lower risk of depression symptoms.
- Nuts and seeds: Nuts and seeds provide tryptophan, an amino acid responsible for producing mood-boosting serotonin.
- Fatty fish: Though it’s an essential fat needed to survive, the body doesn’t produce Omega-3 fatty acids on its own. It only comes from eating fatty fish like salmon and albacore tuna. People who aren’t fans of fish can get omega-3 fatty acids from walnuts and canola oil.
Staying active and eating nutritious foods at every meal can be tough for some aging adults. It’s much easier when they’re constantly surrounded by health and wellness opportunities — like at an Independent Living community such as Eagle Senior Living.
|
<urn:uuid:4438f861-85c9-4501-ad14-2b0eba2142c7>
|
CC-MAIN-2022-33
|
https://www.eagleseniorliving.org/blog/ways-seniors-can-boost-mood/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.924473
| 1,021
| 2.578125
| 3
|
About The Center
Thrombosis and Hemostasis are global problems with high prevalence among both men and women of all ages. Studies on the Saudi population have demonstrated high prevalence of venous and arterial thromboembolic as well as bleeding disorders with high rate of morbidity and mortality. According to the directives of the Ministry of Higher Education (MOHE) through its national strategies for scientific research in Saudi Arabia. The centre of Excellence in Thrombosis and Hemostasis (CETH) has been established in college of Medicine, King Saudi University.
The CETH will be one of the leading research centers in the area of Thrombosis and Hemostasis diagnosis, prevention, and treatment in Saudi Arabia and the Middle East. This will be through conducting studies in several thrombosis and hemostasis research programs including: nanotechnology, biotechnology, stem cells, genotyping, clinical trials, pharmacogenomics, and other innovative research activities. Such studies will contribute to evaluate the problem of thrombosis and hemostasis in Saudi Arabia and achieve the objective in improving the quality of life in patients with thromboembolic disorders. It will also contribute to the transfer of technology and enhance partnership and interaction among governmental and private sector agencies in all related activities.
|
<urn:uuid:4141e64c-cc1e-4afd-8e85-4586b920e0c7>
|
CC-MAIN-2022-33
|
https://ceth-ksu.com/about-the-center/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.920171
| 264
| 2.265625
| 2
|
This content contains affiliate links. When you purchase through these links, we may earn an associated commission.
“When I was younger and thinking about whether I wanted children, I always came back to this formula: if no one had told me anything about the world, I would have invented boyfriends. I would have invented sex, friendship, art. I would not have invented parenting. “- Sheila Heti, Motherhood
Regret has often been armed to push women into the institution of motherhood, regardless of their preferences. The cultural assumption that motherhood is synonymous with unadulterated joy precludes the possibility of how many women may even be reluctant to do so. I Sheila Heti’s Motherhoodher protagonist takes on the role of interrogator and asks the question of whether a child is a curse disguised as a blessing. Women are rarely allowed to exercise their free will over their own reproductive health and are mostly forced into socioculturally accepted models of femininity.
With reference to Heti’s aforementioned quote, it is only logical to conclude that the commitment to motherhood and care does not correspond to ‘female nature’, but the parochial definition of femininity in our society. While changing the way our society has been connected overnight is a nightmare, contemporary fiction has started the much-needed conversation about the multidimensional nature of motherhood. Thanks to contemporary fiction writers, the naturally self-sacrificing, patient, and martyr-like figure of a mother is debunked. Instead of swinging between the two extremes-madonna-esque pure and asexual or the pop culture stereotype of a hypersexual “MILF” (mother I want to F * ck), contemporary fiction humanizes mothers by shining light on how motherhood has become a exhaustive public enterprise where there is little or no chance of autonomous decision-making.
Mother and / or monster?
Rachel Yoders Nightbitch is a Kafkaesque meditation on the monster of motherhood. The protagonist, an artist who became a stay-at-home mom, has become a shell of her former self after having to raise a baby without the help of her husband. Motherhood and irreversible physical motherhood, her husband’s perennial absence, and co-mothers who seem to fall into the rhythm of motherhood naturally take a heavy toll on her, and she does not find satisfaction in this very unfulfilling exercise. Despite her extreme love for her child, she mourns again and again the loss of self that is often a side effect of motherhood. Her rage turns her into “Nightbitch,” and she finds refuge and liberation in this transformation.
The idyllic reality of motherhood glamorized by popular culture and her actual lived experiences are never united. Yoder depicts the complex and changing nature of motherhood as something that cannot be understood or articulated with respect to the universal psychological rules. Her canine emotions help her reconnect with the artist who lies latent in her. She makes art out of the grotesque and the surreal and thus succumbs to and acknowledges the basic impulses of humanity and in return represents the invincible experience that is motherhood. If you are new to horror and have enjoyed it Nightbitch, you should definitely check out Come On In, The Horror’s Fine: Horror Books For Beginners and A Love Letter To The only good Indians By Stephen Graham Jones.
Motherhood and chaos
Ariana Harwicz Die, my love is another example of the subgenre of motherhood horror. The protagonist’s irritability, impatience, fear and confusion define what it’s like to be a mother. She swears by her child and prefers to be outside and kick in the air so as not to have to deal with her family. She is a “nutshell” and “a person who cannot be repaired.” This raises the question of why ‘insanity’ is the standard mark women get when they refuse to succumb to cultural expectations. She revel in lustful and subtle acts of violence and not maternal instincts. Her husband’s lack of libido makes her wonder if the secrecy should come at the expense of satisfaction, sexual or otherwise. Her infidelity and madness turn into rebellion against social pressure by having to allow themselves to be consumed by the needs of the child.
Harwicz has skillfully dived into the senseless brutality that motherhood unleashes on a woman. The dichotomy of the conflict-filled self comes to life in her dilemma of whether to give in or get rid of her inner demons. Will she embrace chaos or become a mother in the conventional sense? Harwicz urges readers to consider why these are the only options for women.
Motherhood, and so are mothers, is a bunch of conflicting traits – a mixture of terror, love, hate, fear, rage and countless other unrecognizable emotions. While happiness can certainly be a part of this equation, it is not the only deciding factor. Modern fiction lets mothers embrace and celebrate the motley team of emotions and personalities that make them up. Women can now feel a kinship with their fictitious colleagues and a sense of community as the struggle is not theirs alone.
Modern fiction about the ebbs and flow of motherhood shows how the personal becomes political. A unique, disinfected image of motherhood has been normalized for far too long, making women more lonely when they feel differently about motherhood. Modern fiction outlines motherhood as it is, a psychic battlefield in all its glory.
|
<urn:uuid:4ce66eaf-5588-4311-8c4f-7268842f0b87>
|
CC-MAIN-2022-33
|
https://mcutimes.com/blog/2021/10/17/how-does-modern-fiction-humanize-mothers-by-depicting-the-universally-unrecognized-dangers-of-motherhood/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00264.warc.gz
|
en
| 0.95885
| 1,146
| 1.601563
| 2
|
Manage episode 305243703 series 2922428
Why should writing be taught as a workshop? Listen in on our conversation with River Brown, a retired teacher turned illustrator, writer and teacher consultant. She recalls the evolution of her writing instruction and the subsequent changes she witnessed in her student writers. To teach writing as a workshop, River explains the shift she had to make as a teacher. She gives advice on how to get started, what to look for, and where to get help.
San Jose Area Writing Project - https://www.sjawp.org/professional-learning-community-2021
About Lynda Barry - https://onwisconsin.uwalumni.com/features/creative-license/
The Lost War by Anaïs Vaugelade
Ish by Peter Reynolds
|
<urn:uuid:6a67bd07-bc6e-435f-b4c3-c9b1628b0750>
|
CC-MAIN-2022-33
|
https://th.player.fm/series/the-graphic-campus-podcast/ep-11-teaching-writing-as-an-art-conversation-with-river-brown
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.933767
| 183
| 1.695313
| 2
|
You are not permitted to download, save or email this image. Visit image gallery to purchase the image.
The 85.5m-long suspension bridge in the middle of the trail was officially named the Hugo Bridge on Saturday.
The bridge is named after Irish philanthropist and businessman the late Hugh Green, known in Ireland as Hugo.
His eldest daughter Maryanne Green, founded the Hugo Charitable Trust, also known as Hugo, in May 2017, to continue Mr Green’s philanthropic legacy and to give back to the people of New Zealand.
Ms Green worked closely with her father for 25 years and developed a deep understanding of his philanthropic priorities and wishes.
The Central Otago Queenstown Trail Network Trust was delighted when Hugo decided to support the trail by paying for a bridge.
As a cycle trail enthusiast Ms Green said having watched the progress of the trail and the construction of the suspension bridge, the trust "couldn’t think of a better way to contribute to this project".
Signs were created and installed in record time on Friday by local company Shotover Engineering.
Trustees were in town for a board meeting, so the timing was right to get them on site to cut the green ribbon and pay tribute to Hugh.
On Saturday that happened, when trustees were flown to the site in two helicopters.
Hugo chairman Mark Owens said the trust’s namesake would be impressed.
"Being in civil engineering, Hugh would have admired the engineering feat but wouldn’t have thought much of grazing in the area — no decent grass for livestock."
The bridge, constructed by Abseil Access in 2020, is located near the 23km mark on the soon-to-be-opened 41km-long trail, which runs from the Cromwell heritage precinct to the Clyde heritage precinct and connects to the Otago Central Rail Trail.
|
<urn:uuid:ae602cc5-14a6-4571-a1b0-72197dafff28>
|
CC-MAIN-2022-33
|
https://www.odt.co.nz/regions/central-otago/new-trail-bridge-named-irish-sponsor
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.973318
| 383
| 1.804688
| 2
|
The task is to adapt a widely available thermostatic valve for use in the solar water pasteurizer. The thermostatic valve that will be used comes from the coolant system in automobiles. The thermostat in automobiles utilizes a wax core which expands with increased heat, pushing a piston and ultimately opens the valve.
Project requirements[edit | edit source]
To alter an existing thermostatic valve for use in a water pasteurization system using simple labour and cheap materials. The device must be readily accessible and easily modifiable.
Design[edit | edit source]
Currently the most feasible solution is a modified radiator valve, however alteration may be difficult. We have come to the conclusion that altering the thermostatic valve will require too much money and precision. Due to the circumstances of alteration it would be unfeasible for local labor to produce such precise results. Therefore, we have decided that the valves posted below would suit the task without modification required. In order to achieve the desired results the valves must be attained, cleaned and tested before being implemented into the water pasteurization system. In our project we will outline how to remove, test, and clean a thermostatic valve from a car.
There are now three possible thermostatic valves.
- Murray Plus 13476
- Murray Plus 13108
- Murray Plus 13069
Testing[edit | edit source]
To test the thermostatic valves we will use a traveling heating element', 2" ABS piping, a digital thermometer, and a waterproof adhesive.
- The ABS piping will be cut into three pieces and attached to the sensitive end of the thermostatic valves.
- Fasten the thermostatic valve to the ABS pipe using putty for sealant and duct tape for support (this was done so that the valve could be easily removed and used in the Solar Pasteurization System). The cylinder side must be places inside the ABS pipe.
- Using a hot plate and a beaker heat up 200mL of water to 67˚C.
- Clamp the thermostatic valve device vertically above another beaker.
- Pour the water into the ABS pipe, if water begins to drip start the stopwatch and record flow rate using the 600mL beaker below. Record time until there is enough water for an accurate reading.
- Pour water from 600mL beaker into a 50mL graduated cylinder. Measure volume and divide by time to produce flow rate.
- Repeat with water at the rated temperature specific to each valve.
The heating element was decided upon to provide better control of the water temperature. It provides the ability to instantaneously remove or add the heat source.
How to remove a car thermostat[edit | edit source]
- Make sure the car system is completely cool.
- Locate the radiator cap and use a rag to cover and open the cap. To open the cap push down and turn. (The rag is used to prevent any splash back from the radiator).
- Place a tub underneath the radiator and locate the draincock which should be on the bottom left or right of the radiator. Unscrew the draincock and allow the coolant to drain for fifteen too twenty minutes.
- On the top of the radiator locate the upper radiator hose. Follow this hose to the thermostat housing.
- Loosen the hose around the thermostat housing and remove. Be aware of excess coolant spilling out.
- Use a wrench to unscrew the thermostat housing. Remove the housing and the thermostat should be exposed.
- Now that the thermostat is exposed remove it. If stuck, jiggle the thermostat out or use a pair of pliers to pull it (be careful not to damage it).
- Now that the thermostat is remove the coolant residue must be removed. In order to do this, use warm water and a rag to clean thoroughly.
- To determine quality of thermostatic valve a visual inspection should be conducted. Look for:
- Bends or Cracks
- Chemical Buildup
- Valve stuck open
- If the valve exhibits any of the above systems it should not be used because the seal may be compromised. If the valve passes visual inspection it should move on to more thorough testing as specified above.
Costs[edit | edit source]
$9.00 each however that is retail price so if bought straight from the factory it would cost less.
Conclusions[edit | edit source]
What has been accomplished:
- Research of thermostatic valve operation
- Determine automobile coolant thermostat to be most viable option through comparison
- Pricing of the parts
|
<urn:uuid:014e7a4a-2cfc-4b36-89c4-a937bb6e89aa>
|
CC-MAIN-2022-33
|
https://www.appropedia.org/Adapted_thermostatic_valve_for_water_pasteurization
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.881025
| 970
| 2.890625
| 3
|
South China Sea: Relations with US 'intensified' says expert
The new ship dwarfs coastguard vessels from other nations based in the highly disputed waters where China’s military presence continues to increase. The ship will enter service with the Ministry of Transport’s South China Sea Rescue Bureau.
On Monday, a subsidiary of state-owned China State Shipbuilding Corporation announced they had completed work on the ship and had successfully installed stabilising components for the search and rescue (SAR) vessel.
According to a press release on the China Merchant Industrial Holdings’ website, a contract to construct the ship was signed between the South China Sea Rescue Bureau and a subsidiary of the China Merchants Group back in November.
The signing ceremony was reportedly overseen by the South China Sea Rescue Bureau’s Party Secretary, Zhuang Zeping.
Technical plans and designs for the ship are expected to be completed this month.
China unveils new record-breaking ship set for the South China Sea region
Known as the 14,000 Kilowatt Large Cruiser Rescue Ship, it is reportedly set to be roughly 450-feet-long, 88 feet wide and 36 feet deep, according to Radio Free Asia.
If these measurements are accurate, the ship would be the largest and most powerful operated by China’s search and rescue service.
It is also reported to be the most advanced SAR vessel in China’s fleet with the ability to haul shipwrecks out of the sea with a 133-ton crane.
The China Rescue Service (CRS) solely focuses on maritime rescue or salvaging after accidents at sea involving other ships and civilians.
The South China Sea Rescue Bureau has set up regional bases on disputed rocks and islands in the region, including Fiery Cross Reef.
According to state media, there have been four rescue missions since the establishment of the rescue base on Fiery Cross Reef.
Most recently, the CRS rescued a fishing boat that became ground in the Paracel Islands.
This rescue took place after Vietnam resisted China’s decision to kick its fisherman out of the sea earlier this month.
China warns of military conflict risk as US steps up warplane flights [INSIGHT]
South China Sea hammer blow: China secures huge victory in region [REVEAL]
US would LOSE Pacific war with China - shock Pentagon report [OPINION]
China hit out at Vietnam's fishing protest in the South China Sea days after Beijing issued a ban on trawlers in part of the disputed waters.
The Chinese Foreign Ministry said its neighbour had no right to comment on the annual summer prohibition on fishing, insisting China had every right to issue such a ban.
The two countries have for years been embroiled in a bitter dispute over the stretch of water.
The area is known to the Vietnamese as the East Sea.
The stretch which is home to more than 200 specks of land is potentially rich in energy.
Le Thi Thu Hang, a spokeswoman for Vietnam’s Foreign Ministry, said: “Vietnam demands that China not further complicate the situation in the South China Sea.”
The annual ban sees more than 50,000 fishing boats forced to suspend their operations.
The South China Sea region is a disputed territory where it faces rival ownership claims from China, Vietnam, Brunei, Malaysia, the Philippines and Taiwan.
Diplomatic relations between the nations, which have laid claim to the islands, are already extremely strained.
The recent construction of bunkers on some of the atolls points to China preparing to “protection against air or missile strikes”, raising the prospect of a potential conflict, sparking World War 3 fears.
The islands and surrounding reefs have been the subject of a bitter and long-running territorial dispute, with China, Malaysia, Taiwan, Vietnam and the Philippines all laying claim to parts of the archipelago.
|
<urn:uuid:02e1cf8d-fd16-4a64-84e1-522b5c7d8aa8>
|
CC-MAIN-2022-33
|
https://www.express.co.uk/news/world/1288058/South-China-Sea-china-military-war-world-war-3-ww3-news
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.946895
| 806
| 2.203125
| 2
|
- Dietary Supplements
- Health Conditions
- Healthy Nutrition
- Cardiovascular Health
- Skin Care
- Natural Remedies
Famous Billionaire gives his invaluable advice on energy stocks and the BP oil spill
T. Boone Pickens has achieved a lot in his 82 years. He was a corporate raider, a billionaire investor, and, most importantly, a wind natural gas proselytizer. But through it all he has stayed an oil and gas man. Pickens warned about the dangers of investing in alternative energy stock, especially during the difficult times in the industry.
In a recent interview, Pickens talked about energy stocks and the BP oil spill. His answer to the question of why the BP oil spill hasn’t forced oil prices up was simple. Although a lot of oil has been lost in the blowout, it was never in the system to begin with. This means that the general supply is not under threat. However, he does admit there does remain the possibility of a slight price increase. Supply is capped daily at 85 million barrels, and if there is to be any kind of global recovery, price will be the only way to control demand.
Pickens denied that the BP oil spill will recreate excitement in alternative energy stocks and spur investment in this sector, citing that oil and alternative energy do different things. Solar power and wind power are there purely for the generation of electricity, so they cannot replace oil, since 70% of oil produced goes into transportation fuel. There are some good projects in alternative energy, but these projects are not going to stop us being dependant on foreign oil. For this reason, Pickens thinks that natural gas will replace oil. It’s cheaper, cleaner, it’s abundant, and we have it right here in the country. So, he believes that the transportation fuel mix will come to include natural gas, and it will also be used for electricity generation. It won’t happen quickly, but it will happen eventually.
Many people believe that the consumption of natural gas will increase, but it is difficult for investors to make predictions, because pricing is so unstable. Pickens advises potential investors in natural gas to… check the weather! He says that weather conditions affect natural gas consumption tremendously. For example, a hurricane on the African coast would probably shut production down, which would lead to a sudden price increase. Weather conditions that are very hot or cold can also increase demand.
The price of natural gas also has a strong effect on the plausibility of alternative energy projects, and, in turn, investments in alternative energy stocks. For example, very low natural gas prices will make it difficult to implement wind power projects, since the pricing of wind power is right at the margin. Thus, the margin largely depends on natural gas prices.
All this makes it sound like natural gas might be one of the riskiest investments there is, but Pickens says
that natural gas is not something you invest in on a daily basis, because it’s simply too volatile. However, if you think of it as a long-term holding, then your profits could be very respectable. This may be at least 2 years or more.
The information supplied in this article is not to be considered as medical advice and is for educational purposes only.
34 Responses to “Famous Billionaire gives his invaluable advice on energy stocks and the BP oil spill”
|
<urn:uuid:85baed63-ee80-4ead-922f-bd7b63148476>
|
CC-MAIN-2022-33
|
https://www.nutralegacy.com/blog/general-healthcare/famous-billionaire-gives-his-invaluable-advice-on-energy-stocks-and-the-bp-oil-spill/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.961229
| 712
| 1.742188
| 2
|
If you are working somewhere that isn’t your usual office you may be less inclined to think about workplace injuries, but if you are working from home you need to continue to look after your health and mitigate the risk of injury just as you would if you were at a regular workplace.
Read on to find out what some of the most common working from home injuries are.
Some people are unlucky enough to understand how painful migraines can be. In particularly bad cases migraines can be debilitating and may cause nausea, dizziness, impaired vision and a lack of concentration in addition to the pain.
Migraines can be caused by many factors including stress and hormones, but in a work situation, they can be triggered by a workstation that has been set up poorly and is under bad lighting or causing the worker to sit awkwardly or in a way that causes tension.
If you are experiencing migraines that you believe are a direct result of your home workstation set up you should ask your employer to arrange an in-home assessment.
Injuries impacting a worker’s mental health should not be overlooked, particularly after a trying few years. Stressful or toxic working environments can lead to depression and anxiety but working from home can add elements of isolation and burnout due to a lack of social interaction and a lack of distinction between an employee’s work and personal life.
To mitigate this, workers should try to work in an area separate to where they sleep or relax and should log off completely at a nominated time of day. Taking scheduled lunch breaks can also break up the monotony, as can leaving the home to grab a coffee or some fresh air, even if only for 15 minutes.
Planned catch-ups with colleagues can be a great way to stay in touch and feel less lonely. If possible, arrange for a standing video call each week with your team or a friend from work to talk about something other than your jobs or what you are currently working on.
Repetitive Strain Injuries
Repetitive Strain Injuries (RSI) are often sustained in the workplace and can be particularly pertinent to working from home situations if the employee’s workspace is not set up correctly. It can take time for the symptoms of RSI to emerge, but the effects can be long, painful and deeply impact a person’s ability to work effectively.
If you are working from home it is crucial that your home set-up is compliant with WHS regulations and it may be necessary to have an in-home assessment to ensure your workspace will not lead to an injury of the hands, neck, back or shoulders.
Broken bones, cuts and contusions
Home working environments may seem cosier and more familiar than an office or other workplace, and it can be easy to assume you won’t be injured in your own environment, but with fewer people watching out for hazards and no dedicated WHS officer on duty the risk of trips and falls is higher than you may realise.
When working from home you must ensure your own workspace is hazard free. This extends beyond temporary physical obstacles that can be easily moved (such as delivery boxes) and include faults that you may be used to like loose floorboards, uneven steps or rugs that have curled back at the edges.
Extra equipment in the home means more cords, so you should be sure to tuck any chargers or extension cords away from the walkway around your workspace so you do not trip over them.
Am I entitled to compensation if I am injured whilst working from home?
If you are injured because of your work or otherwise during the course of your employment you may be entitled to compensation, even if you are working from home. This includes injuries sustained while taking a break or cooking your lunch, so long as you were not engaged in a particularly risky activity at the time of the injury.
If you have been injured because of, or during the course of, your employment while working from home and you need advice on claiming compensation our personal injury lawyers can assist.
|
<urn:uuid:b1ef1ee7-b07f-4894-9399-aef0ce54a325>
|
CC-MAIN-2022-33
|
https://www.cairnscompensationlawyers.com.au/blog/working-from-home-injuries/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.965321
| 839
| 2.109375
| 2
|
***1985 was a transitional period for the Washington DC music scene.?! Founding members of the hardcore movement pulled away from its original trajectory in search of a new musical direction.?! Rites of Spring, Embrace, and Gray Matter are all well-known and well-documented examples of this time and shift that came to be known as Revolution Summer.?! But theirs were not the only voices.?! In the early months of 1985, 17-year-old guitarist LAWRENCE MCDONALD set out to form a new band.?! His ex-bandmates from his previous hardcore band CAPITAL PUNISHMENT Punishment were doing the same—Mike Fellows with Rites of Spring and Colin Sears with Dag Nasty.?! Lawrence found vocalist ALEC MACKAYE (FAITH), drummer PETE WILBORNE (THE 400), and bassist BLEU KOPPERI and BELLS OF was born.?! Inspired by the budding movement of the time, the band moved quickly.?!
|
<urn:uuid:14387637-3175-428b-8123-7356e89b12d5>
|
CC-MAIN-2022-33
|
https://midheaven.com/artist/bells-of/all/list
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.949872
| 208
| 1.5625
| 2
|
By 2024, the Normandie motorway (A13-A14) will be the first motorway in France to completely replace barrier tolls with a free-flow system. Find all the information you need to travel well here.
What is the Free Flow Highway?
Already present in many countries (Norway, Chile, United States...), the Free Flow Motorway replaces toll barriers with vehicle detection gates. No need to stop at the toll booth to pay: it's a new way to travel!
How does free flow work?
How does the Free Flow Highway work?
Do you have a toll tag?
This is detected by the portal and you are automatically debited at the end of the month, it's that simple!
You don't have a toll tag?
The gantry reads the number plate of the vehicle and you can pay:
- Automatically: by associating the number plate with a bank card for 48 hours or for the year.
- In the days following the journey: simply log on to the website or contact an advisor by telephone and state the number plate. For customers who need it, it will be possible to pay on and off our motorway network. The advantage is that it will be possible to pay in one go. For example, for a return trip between Paris and Caen over a weekend, customers will be able to pay in one go on Monday morning, as opposed to 10 stops at the toll gates at present.
What are the advantages of a free-flow motorway for me?
- more fluid: no need to stop to adjust your passage. A real time saver in periods of heavy traffic, especially during long weekends or major holiday departures,
- more responsible: less fuel consumed in journeys, less CO2 emissions into the atmosphere,
- simpler: a single payment rather than at each toll station,
- more security: less stress about finding the right lane when approaching the tollbooth and choosing your payment method.
And when is it due?
The free flow already exists in France, and is gradually expanding:
- In March 2019, the Sanef group opened the Boulay-Moselle free-flow toll on the A4. More than 4.5 million transactions have already been recorded.
- In 2023 in the Allier region, the APRR group will transform 88km of the RN79 into a free-flow toll motorway.
- In 2024, the 210km of the Paris-Normandie motorway will be free-flowing, find below the main dates of the project.
|
<urn:uuid:47824d7a-266d-42dc-bfd3-d2b73f17b078>
|
CC-MAIN-2022-33
|
https://www.sanef.com/en/node/626933
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00264.warc.gz
|
en
| 0.925574
| 536
| 1.546875
| 2
|
‘Baruch Shekivanti!’ (which loosely translates as ‘Thank you G-d for directing me [to the same conclusion as someone far greater than me in Torah knowledge and Torah understanding]’) is a phrase that people exclaim when they discover that an insight or interpretation which they have independently reached matches that of someone of a far higher stature in Torah learning. And today, when preparing this Daf Yomi thought, I exclaimed the words ‘Baruch Shekivanti!’.
In today’s daf (Eruvin 73a) a Beraita is quoted which presents a case where, situated within the same courtyard, is the home of a Master as well as separate homes for each of his servants. The question posed by the Beraita is whether each of the servants – who are sustained by their Master but who live in separate houses – must establish their own Eruv (i.e. do we say that they live independently), or whether they can rely on the Eruv of their Master (i.e. do we say that they are dependents)?
While Rabbi Yehuda Ben Beteira rules that since each servant has their own place of residence they must each establish their own Eruv, Rabbi Yehuda Ben Bava rules that the servants are still considered to be part of their Masters’ household, and consequently, they may rely on his Eruv.
Living a century later, Rav wondered what justification could be offered for Rabbi Yehuda Ben Bava’s ruling, and he answers by quoting from Daniel 2:49 which informs us that ‘Daniel [who was a servant to King Nebuchadnezzar] was in the gate of the king’. As Rashi explains, though Daniel was not always physically within the king’s palace, ‘wherever he was, he was considered to be in the gate of the king’.
Pondering this idea, I realized that since each of us are charged to be ‘עובדי ה (servants of G-d – who is the ultimate King of the Universe), then no matter where we are, we should consider ourselves to be within the gate of The King and conscious of G-d’s presence, and soon after, while exploring the rich insights of some of the commentaries on today’s daf, I exclaimed ‘Baruch Shekivanti!’ because I found that an exquisite expression of this same idea was previously stated by Rabbi Eliyahu Schick (1809-1876) in his ‘Ein Eliyahu’ commentary (while being even more delighted by the fact that he references the upcoming parsha of Noach!). As he explains:
‘Within this teaching [of Rav explaining the ruling of Rabbi Yehuda Ben Bava] is a profound mussar lesson to us all. We see how Daniel was perpetually aware of the awesomeness of the king’s presence to the extent that even when he was not in his presence, he felt that he was standing before him. Given this, how can we not be awed by the presence of G-d? Surely in an even greater way, we should be able to perpetually maintain an awareness of being in G-d’s presence whose glory fills the earth! This is what is meant by the requirement [expressed by King David in Tehillim 16:8 and] cited in the first chapter of the Shulchan Aruch of ‘I have set the Lord before me, always’ which [we are told] is a great principle in the Torah. Similarly, as the Gaon explains on the verse ‘Noach walked with G-d’ (Bereishit 6:9), this means that Noach did not disassociate his mind from G-d, and wherever he went he thought in his heart that he was standing in the presence of G-d. This is what we should fulfil in this same way.’
Given our many loyalties to many other people on earth, we often forget that our ultimate task is to be an ‘עבד ה (a servant of G-d). At the same time, even those who wish to be ‘עובדי ה are often unsure how to achieve this goal. What Rabbi Schick so powerfully explains to us is that becoming an ‘עבד ה begins with us fostering an awareness of always being in the presence of G-d. Yet by doing so, we too have the chance of achieving the goal of walking with G-d wherever we go.
|
<urn:uuid:23736375-773b-4c97-98db-801121ec63f6>
|
CC-MAIN-2022-33
|
https://rabbijohnnysolomon.com/eruvin-73/
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.975549
| 987
| 1.960938
| 2
|
One of the questions in a Needs Analysis questionnaire that I use with general purpose intermediate learners asks them What do and don't you enjoy doing in the classroom? In reply to this question, one learner replied I don't like reading long texts, and when we discussed this in the group, nearly all the members of the class were in agreement.
Yet current coursebooks are full of long texts. Pull any coursebook off your shelf and flick through it. Nine out of ten of them will contain at least one long reading text per unit, and listening texts of a similar length.
Back in the seventies, at the beginning of the methodological change from Audiolingualism to the Communicative Approach, one of the things teachers most often said to learners in then classroom when introducing a listening or speaking text was Don't worry about the bits you don't understand. concentrate on what you do understand, you don't have to understand everything.
Thee was a very good reason for this. The new approach was a reaction to the old Audiolingual principle that receptive and productive competence should proceed in tandem - learners should not be exposed to language above their productive level in order to avoid confusion and therefore error. However, the Communicative Approach argued that
a) receptive competence could be developed to a higher level than productive, and learners did not need to be "protected" from language they didn't understand.
b) learners needed to be able to cope with texts above their level of competence, as it was these that they would often meet outside the classroom. They therefore needed to be taught coping strategies to deal with them. These coping strategies included subskills like inferring the meaning of unknown words from co-text - but also recognising that not all words were crucial for an overall understanding of the text. Hence the insistence It's not necessary to understand everything and also the introduction of authentic texts into teaching materials.
This use of materials above the general level of the learners, and the shift apparent in coursebooks to a text-based approach to teaching, was given further impetus by various other movements that have occurred in EFL over the past forty years :
a) Acquisitional approaches, which suggested that language would gradually be subconsciously acquired by simple exposure - particularly Krashen's Input Hypothesis. If learners were in an English speaking environment, this would automatically happen outside the classroom. However elsewhere, listening or reading texts used in the classroom would often be the learners' main source of exposure to the language..
b) The Lexical Approach, which emphasised the enormous number of lexical items, collocations etc in English that the learner needed to be able to deal with. Long texts are the best way to bring these into the classroom and increase learners’ exposure to them. Powell (1996), describing the Business English textbook Business Matters explains:
“The articles and many of the exercises in Business Matters have been specially written to contain a large part of the target language of the course. They are not simplified but lexically enhanced with a disproportionately high number of word partnerships and/or fixed expressions (and little of the redundant or colloquial language found in many authentic texts). And this makes them eminently exploitable in the classroom as the main source of input as well as fuel for discussion. Your learners would have to read an enormous number of newspaper and magazine articles to be sure of covering anything like the same range of content language.”
The text-based approach is now the dominant approach to EFL teaching and has been apparent in all coursebooks published in the later years of the Communicative Approach. Just as an example, Moor et al (2014) Cutting Edge Intermediate, (Pearson 3rd edition) has fourteen units. Unit Two has ten pages with a longish reading or listening text on seven out of the ten - and one page has both reading and listening.
The standard approach for dealing with these texts is the pre-. while and post reading framework :
- Pre-reading : Activation of schemata; reactivation of or pre.teaching of key lexis.
- While reading : a) reading for gist b) reading for detailed information
- Post reading : language focus / spin off activities
Many teachers take it for granted that this is how texts should be used, but the approach has a number of disadvantages:
- Time – to really deal with the texts thoroughly would take far longer than is available on the average course.
- The course books don’t encourage teachers to deal with the texts thoroughly. The activities for the first long text in the Cutting Edge unit mentioned above are : a) an extended warm-up discussion, part of which involves discussing 5 shorter texts (activities 1 and 2); b) a gist reading activity (activity 3); c) a reading for detailed information activity (activity 4); d) a spin off discussion (activity 5). Thus comprehension of the information is dealt with, but there is no opportunity for learners to really get to grips with the language of the text.
Clandfield (see here) has suggested that there are three uses for texts :
- TALO: Text as a linguistic object
- TAVI: Text as a vehicle for information
- TASP: Text as a springboard for production
This suggests that our Cutting Edge example has used the first text for TAVI and TASP, but has ignored TALO. Or has it? Both the main text and the five short texts contain language that will later be focused in the unit. It could therefore be seen as acting as a preview. However, at this point in the course the learners don’t fully understand that language (if they did it wouldn’t need to be taught later) and it therefore might be confusing or distracting. Additionally, there will inevitably be other language points in the text that the learners aren’t sure of but never get a chance to focus on. This I would suggest is why our learner at the beginning of the article "hates reading long texts". Too much language that she only half understands is being thrown at her all at the same time, and she has no chance to sort it out. She wants what Thornbury has termed "zero uncertainty" - in other words a full understanding of everything in the text. If you've never read Thornbury's article, click on the link and do it now. It's short - but i think one of the most important criticisms of current methodology that has been published in recent years.
So - what would be an alternative approach?
Firstly, we would need to use shorter and fewer texts that can be dealt with thoroughly and that the learners can cope with better – ie which will have less unknown language to distract them, or which are short enough that all the unknown language can be fully explained.
Secondly, we can use a framework that allows for TAVI and TASP but emphasises TALO. The framework we saw before can easily be adapted for this :
- Pre-reading : Activation of content or situational schemata (TAVI); reactivation of or input of key language,which the teacher doesn't want to have to focus on later (so eg not including words which s/he wants learners to infer at a later stage), whether lexis or structure (TALO). This will usually involve a PW/GW discussion (TASP), which needs its own framework : set-up, enactment, follow up – content and language.
- While reading : a) reading for gist b) reading for detailed information. These stages, I would argue should focus on developing specific subskills and coping strategies - eg inference of unknown words from co-text; inference of non-explicitly stated meaning; inference of speaker/writer attitude through connotation; dictionary skills; decoding features of connected speech etc. As you can see, this means that we are not just asking random questions to check understanding of content (TAVI), but also continuing work in the TALO area started in the pre-reading stage. It also means that we are not throwing the idea of teaching learners to cope out of the window, but actively teaching them the subskills they need to do so.
- Post reading : a) language focus (TALO). But not just a bit of guided discovery and practice of language items selected by the teacher or coursebook writer. Go through the text before the lesson to identify anything that might cause learners problems and be ready to explain and/or practise it. Yes, by all means prepare activities to focus on items that would be particularly useful to the learners, but don't stop there. Most important of all, finish the TALO section by asking the learners Does anybody have any other questions about the language in the text? And finally b) spin off activities (TASP)
- And in the next or later lessons : come back to the text. Gap out the words that you looked at and see if the learners can remember them; use it as a running dictation or dictogloss; jumble the sentences and see if the learners can put them back in order; gap the verbs, provide the infinitives in brackets, and see if the learners can remember them - there are many different activities you can use to recycle the texts. (see also the article on the value of task repetition).
Unfortunately, the texts in current coursebooks are, as we've seen, of a length that would make all of this impossible - hence the need for shorter texts. we could of course ignore coursebooks all together and choose short texts based on our learners' interests - or even better, let the learners choose them . If you do this I suggest giving the learners a length limit (number of words for reading texts, number of minutes for listening) and getting them to email you their suggestions. You can then check they really are suitable, develop activities around them and generally prepare yourself to use them in the classroom.
That, however, is not possible in many teaching situations where a coursebook is "imposed" and the teachers must use it.
But until publishers come round to the idea, how can you adapt your coursebook based lessons to incorporate a more thorough focus? Some ideas :
- Reorganise the coursebook - teach the TL before you get to the text so that the text acts as consolidation rather than confusing the learners while they're working on TAVI activities
- Don’t worry about ‘missing texts out’ . Use as many of the texts as time allows for TAVI and TASP but ignore any texts that have more unknown language than you think you can deal with thoroughly in the time available. In some teaching situations, however, even that may not be allowed - the coursebook is not only "imposed" but teachers are expected to deal with a double page spread every lesson (crazy as it allows no scope for dealing with the learners' needs. The course just turns into a matter of "ploughing through" the material.) So...
- Deal with each text but don't use the whole of it in class - just one or two short paragraphs which you can deal with thoroughly. Then give the learners the option of working on the rest of the text for homework, using guided activities which you provide. Leave time in the next lesson for follow up and, as always, a final "any other questions?" stage to deal with any doubts they still have
|
<urn:uuid:42f1509e-f333-4e87-a9c6-03c7eb0ac1ea>
|
CC-MAIN-2022-33
|
https://eltnotebook.blogspot.com/2020/06/you-dont-need-to-understand-everything.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00264.warc.gz
|
en
| 0.959955
| 2,353
| 2.8125
| 3
|
The sentence quoted accidentally misuses the word ‘cognate’ because in attempting to appear profound it has become overweight and off-balance. Notice the sentence also contains the meaningless nonsense of “real-time dynamics”, and in the rest of the paper the word ‘cognate’ is (fortunately) nowhere to be found.
What does the author mean? His review is on proteomics, and he wishes to emphasize the importance of post-translation modification of proteins. He needs to refer to the unmodified form of proteins, and so he associates them with the information in their genes, which is limited to the unmodified amino acids. The word ‘cognate’ in plain English has the meaning of ‘related’ or ‘corresponding’, so the author would appear to be using it to imply the relationship between particular genes and the individual proteins that they encode. What he may have meant to say is:
“Whereas genes encode the basic biological functions of their
This would have been linguistically correct, although the word ‘cognate’, in my opinion is unnecessary as it adds nothing to the sentence.
You can find a biological definition of cognate on GenScript:
A term borrowed from linguistics, signifying a correspondence;
e.g. a receptor and its cognate ligand, a tRNA and its cognate amino
These two examples are of the most common uses of ‘cognate’ in molecular biology — that for tRNA can be found on the Wikipedia page for aminoacyl tRNA synthetase. A quick search brought up few examples of ‘cognate proteins’ or ‘cognate genes’, and in these cases I found the word was used to refer to similar genes or proteins in different organisms or strains.
|
<urn:uuid:cc7dc34a-35eb-4557-b9b2-326f2a7dd5d6>
|
CC-MAIN-2022-33
|
https://biology.stackexchange.com/questions/55620/meaning-of-cognate-genes-encode-the-basic-biological-functions-of-proteins/55626#55626
|
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00264.warc.gz
|
en
| 0.944897
| 400
| 2.625
| 3
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.