text stringlengths 181 608k | id stringlengths 47 47 | dump stringclasses 3 values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1 value | language_score float64 0.65 1 | token_count int64 50 138k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
Impacts of Bottom Trawling on Fisheries, Tourism, and the Marine Environment
Fishing is one of the most important employers and sources of protein for coastal communities in Belize. Yet bottom trawls and other kinds of unselective fishing gear cause harm to other fisheries and to the marine environment by catching juvenile fish, damaging the seafloor, and leading to overfishing.
Bottom trawl nets can also harm coral reefs, sharks, and sea turtles that attract valuable tourism to Belize. The majority of international tourists come to Belize in order to participate in an ocean-related activity such as snorkeling, diving, or sport fishing charters, bringing hundreds of millions of Belize dollars each year to the economy.
Destructive fishing gears ruin future development opportunities for Belize by undermining both fisheries and tourism, which depend on a healthy marine environment. | <urn:uuid:3142e78e-b327-4e84-aa4c-535608b2c3d5> | CC-MAIN-2017-04 | http://www.enn.com/top_stories/article/42098 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560284411.66/warc/CC-MAIN-20170116095124-00455-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.908455 | 178 | 3.28125 | 3 |
[NEW DEADLINE] Impersonality beyond "Tradition" (MSA, Oct. 6-9, Buffalo, NY)
Impersonality is usually linked to "Tradition and the Individual Talent," in which T.S. Eliot famously declares, "The progress of an artist is a continual self-sacrifice, a continual extinction of personality." For this panel, I am seeking papers that dislodge the impersonal from Eliot's vision of a cohesive European canon. This may mean sidestepping Eliot and his legacy entirely or reconsidering its premises. Where can modernists find an account of the "process of depersonalization"? Could it be narrated in the first person? Does the impersonal have a history? a future?
Recent work by Sharon Cameron, Tim Dean, and Denise Riley has used the term to convey effects very different from individual genius: the autonomy of language, the limits of agency and responsibility, and the centrality of erotic and religious ecstasy to intellectual life. These and other theoretical ventures raise new questions and new textual entrance points. Were immigrant, regional, African American, and women modernists excluded from the Eliotic ideal by their time-bound commitments? Conversely, can we now identify counter-traditions in which even the impersonal is estranged from itself? Is it appropriate to label the abdication of self inherently conservative, transgressive, ethical, or modern?
Possible topics include:
Modernist experiments with voice and subjectivity
Competing or complementary discourses of personality
Psychoanalytic theory and the impersonal
Impersonality and/as systems theory
The impersonal and the inhuman
Submit abstracts of 200-300 words and brief biographies to firstname.lastname@example.org by Feb. 15, 2011.
This panel is subject to official approval by the MSA. | <urn:uuid:22937c9e-79f6-428d-b929-25ee9e3f7366> | CC-MAIN-2017-04 | http://call-for-papers.sas.upenn.edu/node/39923 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280292.50/warc/CC-MAIN-20170116095120-00338-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.911827 | 379 | 1.648438 | 2 |
Table of Contents
2. Overview of changes in Chinese fashion over time
* Ancient Chinese clothing
* Fashion during Mao’s era
* Fashion of PRC today
3. Compare and contrast of Russian fashion during the same period * Soviet Union fashion
* Fashion after Soviet Union era
4. Influences and inspirations of ancient China’s clothing style on today’s style * Effect on the designs of clothing
Since the very beginning of time, when people lived in huts and stone houses, the idea of fashion started to emerge in the form of garments made out of beast skins and leaves. Back then, ones who had the ability to hunt more beasts produced better garments and had a relatively higher status among the rest. That was the original idea of defining a man’s social status by his clothing style. In ancient China, the same story applied.
Chinese people first developed the idea of Hanfu (Chinese traditional clothing) during the Shang dynasty. Back then one person’s appearance can already tell what social status he held. The outfit was unisex and the colors of the Hanfu’s were merely basic primary colors like red, yellow, and blue. Later in history these Hanfu developed into more sophisticated style clothings like Shenyi around Zhou dynasty, and gender specification came to be. Men and women wore different clothings. However, during Mao’s era, everyone wore unisex tunic uniforms again, it was seen as a political implication. Soon after the social reform, and China’s open policy towards other countries, the clothing style changed dramatically. Dresses were introduced from western countries and they greatly influenced the fashion of Chinese people until this day.
Historically, Russia also experienced similar changes China went through; correspondingly, their fashion also went through a rollercoaster ride. Despite the difference in the ancient clothing styles of the two countries, they had an astonishingly similar fashion during the communism era. For Russia, unisex tunic uniforms were also mainstream. When the Soviet Union fell apart, Russia experienced a dramatic change that was also similar to China’s.
Overall, the cultural significance of China’s clothing style is undeniable as it changed and reflected many values that Chinese people hold. In the following essay, we shall do our best to elaborate and analyze examples that represent the cultural significance of Chinese clothing style.
* Overview of changes in Chinese fashion over time:
For readers that didn’t know this subject so well, the following paragraphs will explain some basic changes in China’s fashion trend. In ancient China, people’s clothings “consisted mostly of robes. While the women wore lengthy tunics that reached the ground, the men wore tunics that reached their knees.” (Schwebius). The clothing style was simple and most have clean cuts, and “the overall characteristics of the Chinese garments can be summarized as bright colors, refined artisanship, and ornate details” (“Information”). “Clothing was a show of class in ancient China. The fabric, color, and decorations on their clothing told about the wearer's position in society;” clothing was a token for one’s social status and was seen more than just personal decoration (Bethany). “However, the advent of Mao’s regency changed the dressing style dramatically as the new social system got rid of the old gender specific clothings because Mao thought, in order for the society to move forward, we must abolish the old practices and old cultures and embrace the idea of Marxism as the new system. In the new system, everyone was equally treated and “from each according to his ability, to each according to his need” (Marx). The idea spread quickly and soon men and women began to wear what was called the “Mao suits,” which was a “tunic... | <urn:uuid:4b900ae5-afed-4797-a3d0-09cc286225fe> | CC-MAIN-2017-04 | http://www.studymode.com/essays/Cultural-Significance-Of-Chinese-And-Russian-834531.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281353.56/warc/CC-MAIN-20170116095121-00071-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.969432 | 808 | 3.109375 | 3 |
The first oceanarium
a place of discovery,education and awareness
a learning hub
The oceanarium showcases 45 habitats of different sizes and shapes, with a total capacity of 2,000 m3 of water (1,500 m3 being in the main aquarium). People will encounter some 200 species (3,500 specimens at the opening) of the Indian Ocean.
Clear Reef International DMCC is a specialist in the design, operation and management of aquariums and marine parks, having successfully established more than 50 of them across the world over the past 30 years. Clear Reef International DMCC, through Société Aquarius, holds 11.8% of OML. | <urn:uuid:3963df45-ca5e-44d6-9563-b7d4d8b37c76> | CC-MAIN-2022-33 | https://www.odysseomauritius.com/about-us-who-we-are/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00276.warc.gz | en | 0.876541 | 160 | 2.1875 | 2 |
|1 person marked this as a favorite.|
Given the problem of astronomical triggers in an environment rife with astronomical triggers, maybe borrow a line from vampirism and say that lycanthropy is an invasive, alien mode of reproduction? That way, you retain the "dread at loss of control, self, and identity" than is the hallmark of the transformative curse.
For example, you have an alien species which infects a host, but only gets expressed when the host is in a good position to infect another - maybe the trigger is low population density (alone with someone), or proximity to some other kind of trigger which is conducive to infection (a certain environment - moonlight can become a special case!)
Perhaps the werewolf's initial draw of blood "samples" the victim, which then guides whether the monster leaves infected survivors, or simply kills its victims. | <urn:uuid:4c5d54d3-c1ff-48e1-8f85-ec2cce253179> | CC-MAIN-2017-04 | http://paizo.com/people/DavidHaller/favorited | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280242.65/warc/CC-MAIN-20170116095120-00071-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.93081 | 180 | 1.820313 | 2 |
(Update: The comments are excellent. Thank you all. I’ve been a bit of an empty chair because of travel. I gave my own thoughts a few times, most recently Sept. 1, 4:36pm.)
Based on evidence from 2004-2010, I take the position that polls aggregated using robust, median-based statistics lead to the most accurate outcome for Presidential, Senate, and House races. Furthermore, the most appropriate measurement is whatever is closest to the final mechanism, e.g. state margins for the Electoral College. For confirmation, see the results documented in the left sidebar.
Today I ask for help in cataloguing ways in which these assumptions might be wrong in 2012. I will list a few just to get you started.
2004: Kerry voters in the woodwork. In 2004, when I originated the Meta-analysis, I assumed that polls did not reflect the true state of play between Kerry and Bush. At the time, it was discussed by Mark Blumenthal (Pollster.com) and many others that undecided voters typically broke against the incumbent. I also thought that Democratic energy was high, and that turnout might be underestimated.
These possibilities found their way into the Meta-analysis using a variable called, appropriately, bias. If crowds of pollsters leaned towards the Democrats, then bias > 0; towards Republicans, bias <0. As it turns out, bias=0.0%. Although using the bias in 2004 gave me a wrong result, this Wisdom-of-Crowds-of-Pollsters is invaluable in getting a snapshot of the 2012 race.
The bias variable has turned out to have many other uses. Now it powers many features here: the Meta-margin (equivalent to a national margin, but calculated from state polls), The Power Of Your Vote (tells you where your efforts are most effective), and the Obama+2% and Romney+2% features.
Rasmussen, (dis)honest broker? In 2012, I have heard various speculations about what’s wrong with polls. A common theme is that there is something wrong with polls. Republicans seem to think Rasmussen is the only unbiased pollster in town. I think everyone agrees that the value of bias for him is typically 4% relative to other pollsters. As stated above, I’m pretty sure he’s the one who is off.
The Trouble With Nate? Matt McIrvin wrote me regarding a speculation that because Nate Silver made an error in predicting the 2010 House elections, pollsters are on average pro-Democratic by several points. As I showed yesterday, this error was well within the election-to-election variation of linkage between popular vote and House seats. Also, as I wrote in 2008, voter enthusiasm in nonswing states seems to be hard for pollsters to measure. So I think the case is weak.
However, there may be other evidence. This year’s race is close enough that if bias>0, it might have significant effects for the Presidency, the Senate, and the House. If you can cite reasons for why this might be true, I’d be interested in knowing. I’ll help you – here are two popular right-leaning aggregators, Race42012 and ElectionProjection.com.
The comment thread is now open. | <urn:uuid:2a453eef-1153-427a-aab9-d34fbcb02c28> | CC-MAIN-2017-04 | http://election.princeton.edu/2012/09/01/polling-conspiracy-theories/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282140.72/warc/CC-MAIN-20170116095122-00131-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.959057 | 685 | 1.648438 | 2 |
We are pleased to announce the launch of the Leonard Bernstein Young People's Classics, a new series for the music classroom that presents essential selections from the Leonard Bernstein recorded library with units of study built around them. The first in this series features some of the more popular works of Aaron Copland, including Fanfare for the Common Man, and his ballets Billy the Kid, Appalachian Spring and Rodeo.
Make music listening engaging and active with beautifully-designed full-color listening maps, easy-to-follow lesson plans and full-length recorded orchestral versions of Copland's music. Included in the Classroom Kit is the Bernstein Century Copland CD featuring Leonard Bernstein conducting the New York Philharmonic. The Enhanced CD in the Teacher book contains audio folksong recordings, full-color PDFs of the student booklet, student handouts and bonus materials, all for duplication or projection.
Part II features an in-depth study of Copland's ballet Rodeo, specifically “Hoe-down,” based on the Artful Learning transformative learning system inspired by Leonard Bernstein. Working together in learning centers, students engage in cross-curricular activities that are incorporated into the music lessons. Available separately: Teacher Book/Enhanced CD, Student Book 5-Pak, the Bernstein Century Copland CD, and a Classroom Kit (1 Teacher Edition/Enhanced CD, 20 Student Books, 1 Copland CD). Suggested for Grades 5-9.
$119.99 (US) Inventory #HL 09971239 ISBN: 9781423461845 UPC: 884088270995 Width: 8.5" Length: 11.0"
Prices and availability subject to change without notice. | <urn:uuid:b766bbd0-2eae-4ffe-a7e0-71263e965e26> | CC-MAIN-2022-33 | https://www.halleonard.com/product/9971239/aaron-copland-the-music-of-an-uncommon-man | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570977.50/warc/CC-MAIN-20220809124724-20220809154724-00471.warc.gz | en | 0.904059 | 360 | 2.0625 | 2 |
Plot lineweights is enabled. Scale lineweights is enabled. Lineweights in the drawing are set to a thick width. A lineweight override is set for specific objects.
Considering this, how do I fix thick lines in AutoCAD?
Similarly, how do you reduce line thickness in AutoCAD layout? Look down at the bottom of you screen, you’ll see an icon with LWT. You can toggle it on or off, also right click for settings. A lot of people are using line weights instead of line widths because of the amount of control over them.
Also, why is my polyline drawing thick in AutoCAD? Causes: The Polyline has a global width that is set to a thicker lineweight in the drawing.
Beside above, why lines are not smooth in AutoCAD? In AutoCAD 2019 and newer, the Details button must be clicked in order to see its checkbox. In AutoCAD 2016 and 2017, Smooth Line Display cannot be turned on unless High Quality Geometry is first enabled. Enter HQGEOM on the command line and set it to On and then turn on LINESMOOTHING.Click Show/Hide Lineweight Find on the status bar. The status bar is located in the lower right-hand corner of the application window. If no change is visible, it’s probably due to a combination of the thickness of the line compared to the display resolution of your monitor.
- 1 How do I change the default line thickness in AutoCAD?
- 2 How do you change the line thickness in AutoCAD 2020?
- 3 Which button is used to change the thickness of a line?
- 4 How do you change the line thickness in AutoCAD 2021?
- 5 How do I turn off global width in AutoCAD?
- 6 Is line thickness the same a polyline width?
- 7 How do I change the width of a polyline line in AutoCAD?
- 8 How do I make lines smoother in AutoCAD?
- 9 How do you smooth polylines?
- 10 How do you fix blocky circles in AutoCAD?
How do I change the default line thickness in AutoCAD?
You can change the default lineweight. To change the DEFAULT lineweight, choose Tools > Drawing Settings, click the Display tab, click the Lineweights tab, and then select a new default.
How do you change the line thickness in AutoCAD 2020?
- Click Home tab Properties panel Lineweight. Find.
- In the Lineweight drop-down list, choose Lineweight Settings.
- In the Lineweight Settings dialog box, choose a lineweight.
Answer. blob brush tool is used to change the thickness of a line.
How do you change the line thickness in AutoCAD 2021?
- Make sure no objects are selected.
- If the Properties palette is not displayed, click View tab Palettes Properties. Find.
- In the Properties window, under General, enter the value for Thickness. When new objects are created, they have the specified 3D thickness.
How do I turn off global width in AutoCAD?
If you need to set all of your plines to a single width, open the properties window, type qselect, change object type to “polyline”, set operator to “select all”, then click ok. Changing the global width to 0.25 in the properties window is all you have to do.
Is line thickness the same a polyline width?
Think of thickness as the height of the line or how tall it is (like a fence in your yard). This is different from the width of the line that you learned in the polyline lesson or lineweight (which is a display property).
How do I change the width of a polyline line in AutoCAD?
To apply width to an existing polyline, type “PE” on the command line and press “Enter.” Then select the polyline for which you want to change the width. Select the width option from the command line and enter the value of the width you want to apply on this polyline.
How do I make lines smoother in AutoCAD?
How do you smooth polylines?
Enter f (Fit) to create an arc-fit polyline, a smooth curve consisting of arcs joining each pair of vertices. Enter s (Spline) to create an approximation of a spline. Enter d (Decurve) to remove extra vertices inserted by a fit or spline curve and to straighten all segments of the polyline.
How do you fix blocky circles in AutoCAD?
Go to Display > Display resolution section. Increase the value of Arc and circle smoothness. | <urn:uuid:53dad89a-ab57-4bbb-82a2-d48e3e00712c> | CC-MAIN-2022-33 | https://www.tutocad.com/faq/why-are-my-lines-thick-in-autocad/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573193.35/warc/CC-MAIN-20220818094131-20220818124131-00465.warc.gz | en | 0.845208 | 1,023 | 2.15625 | 2 |
Infant complementary feeding is important for establishing food preferences. Few studies exist on the effects of infant complementary feeding choices (food preparation methods) on dietary intake, growth or adiposity. We examined whether provision of homemade complementary food is associated with the development of dietary diversity, nutrient intakes and quality of infant growth.
Secondary analysis of feeding practices from a randomized trial of vitamin D supplementation in 132 healthy breastfed 1-month-old infants from Montréal, Canada. This longitudinal study used diet records, anthropometric and body composition data (dual-energy X-ray absorptiometry) from assessments that occurred when infants were 6, 9, 12 and 36 months of age. Infants were grouped into three categories of food preparation method on the basis of whether or not they had consumed homemade or commercial meat or fruit and vegetable by 9 months (homemade, commercial and both). Multivariable regression controlled for family income, maternal education and infant sex.
Dietary data were available for 65 infants. By 9 months, 22% of infants had exclusively received homemade (n=14), 14 infants had exclusively received commercial and 37 infants had received both. The development of dietary diversity (number of World Health Organization-recommended food groups) was higher (0.76 (95% confidence interval (CI): 0.14, 1.38); P<0.05) in the homemade group versus commercial. Energy and nutrient intakes did not differ by group over time. The homemade group had 773 g (−1364, −182; P<0.01) lower whole-body fat mass and 7.1% (−12.6, −1.6; P<0.05) lower % body fat at 12 months compared with the reference group (both homemade and commercial). Reduced whole-body fat mass in the homemade group persisted at 36 months (−696 g (95% CI: −1341, −52); P<0.05). There were no differences between groups for changes in growth Z-scores (length-for-age, weight-for-age and body mass index-for-age).
Provision of homemade complementary food is associated with increased dietary diversity during the first year of life and reduced adiposity.
Your institute does not have access to this article
Subscribe to Journal
Get full journal access for 1 year
only $9.92 per issue
All prices are NET prices.
VAT will be added later in the checkout.
Tax calculation will be finalised during checkout.
Get time limited or full article access on ReadCube.
All prices are NET prices.
World Health Organization. Complementary Feeding. Version current 2016. Available at http://www.who.int/nutrition/topics/complementary_feeding/en/ (accessed 14 April 2016).
Mennella JA . Ontogeny of taste preferences: basic biology and implications for health. Am J Clin Nutr 2014; 99: 704S–711S.
Mennella JA, Trabulsi JC . Complementary foods and flavor experiences: setting the foundation. Ann Nutr Metab 2012; 60 (Suppl 2): 40–50.
Kleinman RE Pediatric Nutrition Handbook, 6th edn. American Academy of Pediatrics: Chicago, USA, 2009.
Grote V, Theurich M, Koletzko B . Do complementary feeding practices predict the later risk of obesity? Curr Opin Clin Nutr Metab Care 2012; 15: 293–297.
Mauch CE, Perry RA, Magarey AM, Daniels LA . Dietary intake in Australian children aged 4-24 months: consumption of meat and meat alternatives. Br J Nutr 2015; 113: 1761–1772.
Siega-Riz AM, Deming DM, Reidy KC, Fox MK, Condon E, Briefel RR . Food consumption patterns of infants and toddlers: where are we now? J Am Diet Assoc 2010; 110: S38–S51.
Cogswell ME, Gunn JP, Yuan K, Park S, Merritt R . Sodium and sugar in complementary infant and toddler foods sold in the United States. Pediatrics 2015; 135: 416–423.
Coulthard H, Harris G, Emmett P . Long-term consequences of early fruit and vegetable feeding practices in the United Kingdom. Public Health Nutr 2010; 13: 2044–2051.
Woo JG, Herbers PM, McMahon RJ, Davidson BS, Ruiz-Palacios GM, Peng YM et al. Longitudinal development of infant complementary diet diversity in 3 international cohorts. J Pediatr 2015; 167: e961.
Gallo S, Comeau K, Vanstone C, Agellon S, Sharma A, Jones G et al. Effect of different dosages of oral vitamin D supplementation on vitamin D status in healthy, breastfed infants: a randomized trial. JAMA 2013; 309: 1785–1792.
Kalkwarf HJ, Abrams SA, DiMeglio LA, Koo WW, Specker BL, Weiler H . Bone densitometry in infants and young children: the 2013 ISCD Pediatric Official Positions. J Clin Densitom 2014; 17: 243–257.
Foterek K, Hilbig A, Alexy U . Breast-feeding and weaning practices in the DONALD study: age and time trends. J Pediatr Gastroenterol Nutr 2014; 58: 361–367.
Michaelsen KF, Greer FR . Protein needs early in life and long-term health. Am J Clin Nutr 2014; 99: 718s–722s.
Ruel MT . Operationalizing dietary diversity: a review of measurement issues and research priorities. J Nutr 2003; 133: 3911s–3926s.
Butte NF . Energy requirements of infants. Public Health Nutr 2005; 8: 953–967.
Davies PS, Coward WA, Gregory J, White A, Mills A . Total energy expenditure and energy intake in the pre-school child: a comparison. Br J Nutr 1994; 72: 13–20.
Scott J, Davey K, Ahwong E, Devenish G, Ha D, Do L . A comparison by milk feeding method of the nutrient intake of a cohort of australian toddlers. Nutrients 2016; 8: 501.
Brophy S, Cooksey R, Gravenor MB, Mistry R, Thomas N, Lyons RA et al. Risk factors for childhood obesity at age 5: analysis of the millennium cohort study. BMC Public Health 2009; 9: 467.
Taylor RW, Gold E, Manning P, Goulding A . Gender differences in body fat content are present well before puberty. Int J Obes Relat Metab Disord 1997; 21: 1082–1084.
Harrel FEJ Regression Modeling Strategies, 2nd edn. Springer-Verlag: New York, USA, 200.
Coulthard H, Harris G, Emmett P . Delayed introduction of lumpy foods to children during the complementary feeding period affects child's food acceptance and feeding at 7 years of age. Matern Child Nutr 2009; 5: 75–85.
Baird J, Fisher D, Lucas P, Kleijnen J, Roberts H, Law C . Being big or growing fast: systematic review of size and growth in infancy and later obesity. BMJ 2005; 331: 929.
Jensen SM, Ritz C, Ejlerskov KT, Molgaard C, Michaelsen KF . Infant BMI peak, breastfeeding, and body composition at age 3 y. Am J Clin Nutr 2015; 101: 319–325.
Lanigan J, Singhal A . Early nutrition and long-term health: a practical approach. Proc Nutr Soc 2009; 68: 422–429.
Foterek K, Hilbig A, Alexy U . Associations between commercial complementary food consumption and fruit and vegetable intake in children. Results of the DONALD study. Appetite 2015; 85: 84–90.
Hurley KM, Black MM . Commercial baby food consumption and dietary variety in a statewide sample of infants receiving benefits from the special supplemental nutrition program for women, infants, and children. J Am Diet Assoc 2010; 110: 1537–1541.
Northstone K, Emmett P, Nethersole F . The effect of age of introduction to lumpy solids on foods eaten and reported feeding difficulties at 6 and 15 months. J Hum Nutr Diet 2001; 14: 43–54.
Yeung DL, Pennell MD, Leung M, Hall J . Commercial or homemade baby food. CMAJ 1982; 126: 113.
Pani P, Carletti C, Knowles A, Parpinel M, Concina F, Montico M et al. Patterns of nutrients' intake at six months in the northeast of Italy: a cohort study. BMC Pediatr 2014; 14: 127.
Tang M, Krebs NF . High protein intake from meat as complementary food increases growth but not adiposity in breastfed infants: a randomized trial. Am J Clin Nutr 2014; 100: 1322–1328.
Cohen RJ, Brown KH, Canahuati J, Rivera LL, Dewey KG . Effects of age of introduction of complementary foods on infant breast milk intake, total energy intake, and growth: a randomised intervention study in Honduras. Lancet 1994; 344: 288–293.
Robinson SM, Marriott LD, Crozier SR, Harvey NC, Gale CR, Inskip HM et al. Variations in infant feeding practice are associated with body composition in childhood: a prospective cohort study. J Clin Endocrinol Metab 2009; 94: 2799–2805.
Kensara OA, Wootton SA, Phillips DI, Patel M, Jackson AA, Elia M . Fetal programming of body composition: relation between birth weight and body composition measured with dual-energy X-ray absorptiometry and anthropometric methods in older Englishmen. Am J Clin Nutr 2005; 82: 980–987.
Pearce J, Taylor MA, Langley-Evans SC . Timing of the introduction of complementary feeding and risk of childhood obesity: a systematic review. Int J Obes 2013; 37: 1295–1306.
WHO Working Group on the Growth Reference Protocol and the WHO Task Force on Methods for the Natural Regulation of Fertility. Growth of healthy infants and the timing, type, and frequency of complementary foods. Am J Clin Nutr 2002; 76: 620–627.
Pearce J, Langley-Evans SC . The types of food introduced during complementary feeding and risk of childhood obesity: a systematic review. Int J Obes 2013; 37: 477–485.
Woo JG, Guerrero ML, Ruiz-Palacios GM, Peng YM, Herbers PM, Yao W et al. Specific infant feeding practices do not consistently explain variation in anthropometry at age 1 year in urban United States, Mexico, and China cohorts. J Nutr 2013; 143: 166–174.
Zheng JS, Liu H, Zhao YM, Li J, Chen Y, Zhu S et al. Complementary feeding and childhood adiposity in preschool-aged children in a large Chinese cohort. J Pediatr 2015; 166: e322.
Burdette HL, Whitaker RC, Hall WC, Daniels SR . Breastfeeding, introduction of complementary foods, and adiposity at 5 y of age. Am J Clin Nutr 2006; 83: 550–558.
Noble S, Emmett P . Differences in weaning practice, food and nutrient intake between breast- and formula-fed 4-month-old infants in England. J Hum Nutr Diet 2006; 19: 303–313.
The study was supported by Canadian Institutes of Health Research and the Nutricia Research Foundation for research funding, and Europharm International Canada Inc. for the in-kind provision of supplements. Infrastructure support was from Canada Foundation for Innovation. EM, PL, EC and HW. designed research; EM, CV, SG and HW conducted research; EM, CV, SG and HW analyzed the data; EM and HW wrote the paper and had primary responsibility for final content. All authors read and approved the final manuscript. Clinical Trial Registration Number: clinicaltrials.gov NCT00381914.
Hope Weiler is a Canada Research Chair with infrastructure funding from the Canadian Foundation for Innovation. The remaining authors declare no conflict of interest.
About this article
Cite this article
Mok, E., Vanstone, C., Gallo, S. et al. Diet diversity, growth and adiposity in healthy breastfed infants fed homemade complementary foods. Int J Obes 41, 776–782 (2017). https://doi.org/10.1038/ijo.2017.37
The Reference Intervals of Whole Blood Copper, Zinc, Calcium, Magnesium, and Iron in Infants Under 1 Year Old
Biological Trace Element Research (2022) | <urn:uuid:d4cf9c56-9be1-4d64-9dd7-fcc58297da5a> | CC-MAIN-2022-33 | https://www.nature.com/articles/ijo201737?error=cookies_not_supported&code=d45d5edc-9e19-432e-8bcf-e1dda0932ec0 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00270.warc.gz | en | 0.839113 | 2,836 | 2.796875 | 3 |
by Anton Shilov
11/26/2008 | 12:34 PM
The financial crisis has already impacted the personal computer (PC) industry and it will inevitably impact the market of computer components as well. According to Goldman Sachs investment bank, the mainboard industry will suffer a huge decline in the coming months and throughout the whole 2009.
According to estimates of Goldman Sachs, already in Q4 2008 shipments of mainboards will decline by 15% with 2009 likely to be the worst for the motherboard industry since 2001, when the market nearly collapsed. The report was cited by Chinese-language Economic Daily News (EDN) news-paper (excepts from the article were translated by DigiTimes web-site).
The sources of problems of mainboard makers lie not only in the financial crisis, but also in lowering demand towards typical desktops. Nowadays consumers demand small form-factor (SFF) desktops or notebooks, the markets that are not supported by a number of second-tier of mainboard makers.
One of the major issues for motherboard producers has been cut-throat competition between all the players on the market, which led to decreases of prices, increases of production costs due to improvement of complexities and so on.
The new crisis on the mainboards market is likely to catalyze many smaller makers to either exit the market or merge with others. | <urn:uuid:f57cbd0f-4551-4b35-88f9-78ea4bf2b044> | CC-MAIN-2017-04 | http://www.xbitlabs.com/news/mainboards/print/20081126123451_Shipments_of_Mainboards_Are_Dropping_Dramatically__Goldman_Sachs.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279410.32/warc/CC-MAIN-20170116095119-00172-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.959255 | 278 | 1.953125 | 2 |
insufficient evidence that it improves symptoms, Novartis said.
Novartis said in a statement the Food and Drug Administration (FDA) had asked for further evidence to determine the efficacy of serelaxin, also known as RLX030.
The decision follows a unanimous recommendation from a panel of advisers in March against approving the drug.
Serelaxin is one of several potential “blockbuster” drugs from the Basel (Swiss)-based pharmaceutical company.
Tim Wright, global head of development at Novartis, said Novartis still believed serelaxin had the potential to become “an important treatment” for acute heart failure.
Novartis is continuing with its clinical trial program in order to build up a further body of evidence and plans to enroll over 6,300 patients in a second late-stage trial, the company said.
Approximately 23 million people are diagnosed with Heart Failure across the globe. | <urn:uuid:c0f2311e-aecf-4664-b3b0-5bd42e1c471b> | CC-MAIN-2022-33 | https://www.pumpingmarvellous.org/fda-reject-serelaxin/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00266.warc.gz | en | 0.957462 | 198 | 1.921875 | 2 |
Last week AMV BBDO and The Economist launched a piece of editorial content about the life of Nelson Mandela.
The joint initiative lives on http://www.mandelaswalk.com/.
After watching the film, users are able to explore the individual objects that appear in the interactive film and learn, from a selection of articles taken from The Economist archives, about their significance to a particular time in Mandela’s life. These articles feature the many facts, points of view and analysis that the magazine has published about South Africa, Mandela and his impact on the world.
What’s great about the project is that it doesn’t just show the complexity and richness of Nelson Mandela’s life, it also reveals the motives, the moments and the stories that made him the man that changed our world. | <urn:uuid:b058c786-03c0-4b5b-bd17-f07fe4568586> | CC-MAIN-2022-33 | https://politicaladvertising.co.uk/2013/12/13/the-economists-tribute-to-nelson-mandela/?shared=email&msg=fail | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00677.warc.gz | en | 0.942735 | 167 | 2.171875 | 2 |
Finally! After 3 years of being off the map, one of the foremost collections and exhibition spaces for works on paper in the US is back. The newly renamed Morgan Library and Museum (formerly The Pierpont Morgan Library) is set to reopen this Saturday, April 29, 2006.
I’ve been to number of exhibitions of master drawings at the Morgan over the years and they have all been memorable. The Library itself, developed from the private library of financier and all-around-rich-guy Pierpont Morgan, has a terrific collection of old master drawings, as well as historic manuscripts, books, bindings, music notation, Near Eastern scrolls, tablets and other art objects.
The museum, which is located on Madison Ave. at 36th Street in New York (entrance on 36th), has undergone its most extensive renovation ever with new gallery space, four story court, cafe and auditorium, as well as an unfortunately inappropriate new Bauhausian entrance structure, but that’s a minor quibble.
The Library and Museum will debut its dramatically expanded exhibition space with a show of treasures from its own holdings: Masterworks from the Morgan, which runs from April 29 to July 2, 2006. And treasures they are. Old Pierpont had pretty good taste in master drawings (image above, clockwise from top-left: Rembrandt, Delacroix, Watteau, Goya, Rubens).
The Morgan also has a renovated web site which allows you to look through some of the drawings and other artifacts and, like the same feature on the Met’s site, zoom way in on them.
Link via Artnet News. | <urn:uuid:5ffbbb73-e8bf-46b0-b172-c7f231c03201> | CC-MAIN-2016-44 | http://linesandcolors.com/2006/04/26/morgan-library-and-museum/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721405.66/warc/CC-MAIN-20161020183841-00314-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.95911 | 345 | 1.710938 | 2 |
The Climate Disaster Response Fund is a one-time grant opportunity that will provide limited resources to heritage focused organizations with heritage resources damaged by recent climate and natural disasters in British Columbia.
Heritage BC, in consultation with our partners including the BC Museums Association (BCMA) and the BC Heritage Emergency Response Network (BCHERN) have determined that there is a need to address immediate conservation of heritage places impacted by recent climate based disasters over the past 12 months. By initiating a relief fund that allows for organizations with heritage resources to obtain assistance in conservation work for damaged sites, Heritage BC is recognizing the need for long term climate adaptation and support in this way is a first step in assessing and addressing the future challenges heritage places may face.
This program intake will begin on January 20, 2022 and end April 30, 2022. Applications will be accepted until April 22, 2022. All applications will be processed on a first come first served basis. The total allocation of funds is $75,000. Heritage BC reserves the right to manage each request internally. All projects must indicate the immediacy of the issue, a relative timeline for the scope of work, and a project that is achievable within the framework of this grant opportunity.
For more information please contact:
Jennifer Dunkerson, Heritage Planner | <urn:uuid:cc25d12e-ae9d-4652-9374-5cd94e3b1a9c> | CC-MAIN-2022-33 | https://heritagebc.ca/heritage-legacy-fund/climate-disaster-response-fund/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573399.40/warc/CC-MAIN-20220818185216-20220818215216-00065.warc.gz | en | 0.922978 | 266 | 1.765625 | 2 |
From Uncyclopedia, the content-free encyclopedia
“We didn't need crap like video game systems, we had kittens to huff.”
“Oh, Papa Smurf...the sound on this system bleeds my ears!”
“I wonder what the AVGN thinks about this console....he should review this shit load of fuck.”
An Atari 1300 game console. Note the tape-fed design and spartan coloring.
|Units sold:||At least 46,803,424 (46,803,423 accounted for and destroyed)|
|Specifications:||Intel 1001 Processor Running @ .02 Mhz (That would be 20kHz for us Metric nerds.)|
|Colors:||2 (black and white)|
|Graphics:||a backstabbing 10x10 that the score wouldn't even fit to the stupid screen!|
|Sound:||1 channel, 1 note can be played at a time and octaves are unknown but the 1000hz frequency is a clue and most of them are high pitched|
|Memory:||48 bytes of onboard memory, capacity to read 512 bytes of data from tape|
|Notable Games:||Dot, Dot II, Test Pattern 1300|
The Atari 1300 was a very early gaming system created by Atari officially launched to great initial malaise in 1969 (this btw is the only thing in '69 that wasn't loved). It was apparently derived from the top secret, but assumed to be more primitive, Atari 650 project codenamed: Capricorn. Early development began in 1968 when Nolan Bushnell, hopeless Space War addict that he was, wanted to translate that game's time sink properties to a home version that did not require a million dollars worth of equipment to use. The "1300" designation indicates the number of dollars spent developing the prototype. To indicate a progression in technological sophistication, future Atari consoles would be multiples of this amount (see Atari 2600). The system discontinued in 1977.
Bushnell wanted the 1300 to be elegant, yet simple, so as not to dissuade the hippie counterculture by creating something more complicated than lighting a spliff or watching a lava lamp to operate. The single-button Atari 1300 controller is still a model user interface device. Today's Wii remote thumbstick is such a design ripoff that Bushnell is considering mortgaging his Chuck E. Cheese franchise rights to pay for the legal action against Nintendo. The console feeds paper tape from a paper tape game reel punched with 50 copies of the software. The feeder device was typically a sedentary child holding the reel on a pencil. An optional paper tape feeder device was proposed, but the additional cost was not deemed marketable. Reading data at a then-remarkable-for-a-home-device six seconds per byte, the typical game tape loaded in around an hour, by which time the child had either become bored and gone off to play something else or passed out from sheer crippling exhaustion from holding the unwieldy reel steady.
Because the tape reader was made from recycled scrap taken from IBM's dumpsters, the paper tape was typically mangled to unusability after one reading, hence the 50 copies per reel standard Bushnell recommended. As one copy was mangled, it was torn off and the next used like toilet paper. After 50 uses, the software needed to be repurchased at retail, or at a prorated discount if the consumer sent the torn scraps back to Atari for recycling.
The Atari 1300 controller operated on the principle of "if you're too fucking stupid to figure out one button, you shouldn't be playing video games", a design philosophy continued today by creators of Deer Hunting and Solitaire computer games. The player's on-screen character was moved by various button presses. There were no forced conventions, but one press was usually "up", two quick presses for "down", two slower presses for "left", and three rapid presses for "right". Firing a weapon required four presses in under one second. It is a fact that epileptics and amphetamine abusers often scored highest in titles like "Shoot" and "Zig-Zag".
The console produced images in monochrome at 100x60 resolution and maintained five frames per second except when two moving sprites were on screen at once. Framerates then would drop to one or two per second. The machine had no internal sound chip but various hums and blips could be created by most televisions as interference noise depending on the proximity of the machine and its orientation to the set. At least one person demonstrated the ability of the machine to reproduce complex Beethoven symphonies if it was waved around the TV in a certain pattern by a strong enough person.
edit Piracy Issues
It is generally acknowledged that Atari 1300 game titles were the first ever to be subject to widespread piracy and illegal duplication. The lack of available copy protection techniques in the 1960's meant that it was pretty much the happy time for the fledgling computer cracker and warez scene. The first known cracked copy of Dot was released by Melvin Smerlish, who copied the code by pushing an icepick through the original tape holes onto blank tape, a.k.a. cash register paper. Before long Soviet KGB agents got hold of Atari tape and by late 1969 was taking out its frustrations at having lost the space race by replacing the 1970 Times Square New Years Day ticker tape confetti with actual Atari punched tape code. This little known incident remains little known and actual pieces of KGB confetti code sell for tens of thousands of dollars on sites like Ebay to morons worldwide.
Bushnell repeatedly attempted to prosecute pirates, but since even a dull pencil pushed through notebook paper could make a readable copy of game code, it was ruled to be too much of a legal burden on the end consumers to require that no pointed objects at all be in their homes.
The Atari 1300 was instrumental in another way to the hacking/cracking movement. The confused lettering used in hacker jargon, like "l33t" clearly traces back to erroneous hole punching during the illegal duplication process, resulting in unwanted characters being substituted in place of expected ones. Also, the first known use of Counterstrike n00blish dates to March 1971 when someone was overheard yelling "OMFGWTFBBQ" after playing Zig-Zag for 16 minutes without a crash.
Sales of Atari 1300 consoles were allegedly brisk in 1969 but since so many people back then were drugged out of their minds most of the time, almost no one actually remembers owning or playing one. An Atari 1300 with serial number 46,803,424 is in the possession of the author of this article. Assuming that Atari didn't simply start serial numbers in the tens of millions, this would mean Nolan Bushnell should be the richest man on earth. But since he isn't, Atari 1300 sales are today postulated to be in the low dozens, if not fewer.
The console originally sold for $279.99 at launch. The first price cut came two weeks later, down to $44.99, with the typical game selling for $6.99.
Dot - The only title included with the console, players control an initially slow moving dot in a square field whose speed gradually increases. Touching the field edge ends the game, and typically crashes the machine, requiring a paper tape reload. A stopwatch is recommended for recording scores.
Dot II - This 1970 release plays similar to Dot, only there are internal obstacles to avoid also.
Shoot - Basically Dot II with an option to "shoot" a smaller projectile at an obstacle to temporarily remove it. Actually firing at the obstacle required the console to perform collision detection calculations, slowing frame rates to one per 15 seconds and often crashing the machine.
Test Pattern 1300 - (1973) The TV station test pattern simulator. Never very popular, the original version simulated only bars. Test Pattern II added a 1000-Hz simulated tone created by bringing a magnet near the television while the test pattern was on screen. Parents hated this one.
Zapper - (1969) Another title that called on the machine to calculate collisions, Zapper was more successful as the player's "base" was stationary. Only the projectile moved. Followed in 1971 by Zapper II with the ability to shoot up to three projectiles as long as the player didn't mind waiting 2-3 minutes per frame update.
Zig-Zag - (1974) Think Dot II with diagonal walls.
Zig-Zag II - (1975) Original Zig-Zag, with an added option to invert the colors. | <urn:uuid:737190d3-41ae-452a-b5aa-35f24114d741> | CC-MAIN-2017-04 | http://uncyclopedia.wikia.com/wiki/Atari_1300 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281649.59/warc/CC-MAIN-20170116095121-00439-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.951517 | 1,778 | 1.914063 | 2 |
Bread roll is a good party snack made by stuffing spiced potatoes in bread slices. These are rolled and either fried or baked. This post shares 3 ways of cooking the bread roll – shallow fried, baked & tawa fried. The preparation of stuffing is just very simple and needs only mixing up the ingredients like boiled or steamed veggies, garam masala and other basic ingredients.
The stuffing is almost similar to the aloo paratha except for including peas and carrots in this. Bread rolls are usually deep fried but they are best baked or pan fried. However I have also shared the deep frying method.
These bread rolls make a very good party snack since they keep crispy for long time. They are best served with Green chutney or Schezwan sauce.
1. Boil potatoes in whatever way you like. I steam them in a cooker. It takes about 6 to 7 mins, it may vary depending on the kind of potatoes.
2. When they are 3/4 done, then i add carrots and peas to the same steamer. Steam them together until done. You can also skip carrots and peas.
3. Mash the potatoes.
4. Add peas, carrots, chilli powder, turmeric, garam masala, amchur, coriander leaves and salt.
5. Mix together and divide the mixture to 10 parts. Give them a oblong shape. Set them aside.
*How to make bread roll*
6. There are 2 ways of making bread rolls. First one is to dip the bread slice lightly in water and squeeze off the excess water. Place the stuffing and roll it to seal well.
7. I am following the other method of rolling the bread and smearing some moisture to make it wet. Roll each of the slice with a rolling pin. This prevents the bread rolls from absorbing too much oil. The bread slice must become like a thin layer first.
8. For the binding or to seal the edges I have used flour mixed with water. In a small bowl mix flour with water. The mixture must be thin of runny consistency. Brush the bread slice with the milk or water. The bread must turn moist and wet but not with dripping water.
9. Place the potato mixture on the bread. Smear the flour mixture on the edges to seal safely.
10. Roll the bread and press the edges gently to seal the potato stuffing. Use more flour mixture on the edges if needed. Finish making all the bread rolls. Keep them covered.
11. If you prefer to bake them, preheat the oven at 200 Degree C.
12. Brush the rolls with melted butter. Bake for 10 to 12 mins or until golden.
13. For pan frying, toast them after brushing with butter.
Then drop 2 to 3 rolls depending on the pan size. Fry them on a medium high flame.
14. If shallow frying, Add oil only a few tbsp or as needed. Allow the oil to turn hot enough. Check if the oil is hot enough by dropping a small piece of bread. The bread has to rise without browning quickly. Flip them and fry on all the sides until golden.
15. Drain bread rolls on a kitchen tissue.
*Best served with green chutney and a cup of black tea.*
*Prep Time: 5 minutes*
*Cook Time: 25 minutes*
*Total Time: 30 minutes*
*Servings 10 bread rolls*
*INGREDIENTS (US CUP = 240ML ) For stuffing*
▢1½ cups potatoes cubed or 3 medium potatoes
▢½ cup carrots and peas (optional)
▢½ to ¾ tsp red chili powder or green chili chopped
▢½ tsp garam masala (adjust as needed)
▢1/8 tsp turmeric or haldi
▢¼ tsp amchur (or 1 tbsp lemon juice)
▢2 tbsp coriander leaves chopped
▢Salt to taste (about ½ tsp)
*For bread roll*
▢10 slices bread (any)
▢Oil as needed (if frying) or butter for brushing
*For binding the bread rolls*
▢½ cup milk or water
▢2 tbsp flour mixed with half cup water
(Preparation for bread roll)
▢Wash and peel the potatoes. Cut them to 2 and add to a pressure cooker or pot. Pour water just enough to cover the potatoes partially.
▢Pressure cook for 1 to 2 whistles on a medium flame. Potatoes must be just cooked and not mushy. If using carrots and peas, you can just cook them in the same pot after removing potatoes.
▢You can also steam the potatoes in a rice cooker until they are cooked al dente. Move the potatoes to a side, add carrots and peas to the steamer. Steam until the carrots are tender.
▢Mash potatoes or crumble them. Add carrots and peas, slightly mash them.
▢Add chili powder, garam masala, turmeric, salt, coriander leaves and amchur or lemon juice. Mix everything well and check the salt.
▢Divide the mixture to 10 equal balls and make an oblong or oval shaped balls. Set these aside.
Making bread roll
▢Trim the edges of the bread. Begin to roll them with a rolling stick to flatten them like puri. Flatten to a thin sheet. This prevents the bread from absorbing oil.
▢Stir 2 tbps flour with half cup water. Set this aside. Smear the milk or water all over the bread slices with your fingers or brush so that it turns moist and wet. But not with excess dripping water.
▢Smear the flour mix on the edges. Place one ball towards one end and begin to roll.
▢Stick the edges together and seal the inner filling. If needed apply more flour mixture on the edges.
▢Transfer them to a plate and keep them covered to prevent drying. If the rolls dry up then the edges will open up.
*Baking them in oven*
▢For baking – preheat the oven to 200 C. Brush the rolls with some melted butter. Bake for 10 to 12 mins or until golden on both the sides.
For pan frying or tawa frying
▢Pan frying – Brush the bread rolls with a generous amount of melted butter, ghee or oil. Heat the pan until hot and toast these until golden. These rolls do not get even golden color but will turn crisp.
Frying bread rolls
▢Heat only a few tbsp oil, just enough to partially cover the rolls while frying.
▢When the oil turns hot, drop a small piece of bread. It must rise without browning quickly.
▢Make sure the oil is hot enough. Then drop 2 to 4 rolls at one time depending on the size of the pan used.
▢Fry until golden. Flip and fry evenly. Remove the bread rolls to kitchen tissues.
▢Serve bread roll with sauce or green chutney…
*NUTRITION INFO (estimation only)*
(Nutrition Facts, Amount Per Serving)
Calories from Fat 45% Daily Value* Fat 5g8%
Vitamin A 1150IU23%
Vitamin C 6mg7%
Written by: Nat Mai | <urn:uuid:4a378986-7edf-4d25-b033-a19ff9be85cb> | CC-MAIN-2022-33 | https://outravelandtour.com/bread-roll-recipe-how-to-make-potato-stuffed-bread-roll/?shared=email&msg=fail | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.37/warc/CC-MAIN-20220809003642-20220809033642-00677.warc.gz | en | 0.892477 | 1,630 | 1.570313 | 2 |
Pediatric Irritable Bowel Syndrome
When Your Child Has Irritable Bowel Syndrome
Irritable bowel syndrome (IBS) is a common condition in children. It affects your child's digestive tract, where food is broken down to give your child energy and help him grow. IBS causes irritation of the large intestine (colon). This is where water is absorbed from waste before it passes out of the body. IBS may come and go, but there are things you can do to help your child feel better.
What Causes IBS?
The exact cause of IBS is not known. But it may involve the muscle movement that passes food and liquids through the digestive tract. If food passes too quickly, the colon can't absorb enough water. This can cause painful cramping and watery stools (diarrhea). If food passes too slowly, too much water is absorbed. This can make the stool dry and hard (constipation).
What Are IBS Symptoms?
Symptoms of IBS can vary from child to child. Common symptoms include:
- Painful cramps
How is IBS Diagnosed?
To diagnose IBS, the doctor will start by asking about your child's medical history. A physical exam will be performed. The doctor may also order some tests to rule out other digestive problems.
How is IBS Treated?
When to Call the Doctor
Even if your child's symptoms are under control, contact the doctor if you notice:
- Weight loss
- Blood in your child's stool
- Fever over 100.4°F
- Fear of using the toilet, at home or at school
- Withdrawal from friends and family or prolonged sadness (which could be signs of depression)
Date Last Reviewed: 5/15/2006
Date Last Modified: 5/15/2006 | <urn:uuid:96f053d7-61de-43a4-8635-2064afe2f185> | CC-MAIN-2016-44 | http://www.swedish.org/services/pediatric-specialty-care/our-services/pediatric-gastroenterology/conditions-we-treat/functional-gastrointestinal-disorders/irritable-bowel-syndrome | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721174.97/warc/CC-MAIN-20161020183841-00283-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.928878 | 381 | 3.359375 | 3 |
Fewer Incoming College Students Need Remediation, Research Shows
New research out from the National Center for Education Statistics sheds light on incoming college students who are taking remedial or developmental classes and how the landscape has changed in the past decade.
The percentage of freshman who had to take remedial classes upon entering college dropped from 1999-2000 to 2007-2008 from 26.3 percent to 20.4 percent. Looking more closely, however, the NCES shows a dip in 2003-2004 when just 19.3 percent of new college students reported taking remedial courses before it ticked up again.
The First-Year Undergraduate Remedial Coursetaking report released Wednesday measured the frequency and change in remedial enrollment at U.S. postsecondary institutions, as well as looked at what kinds of students were lacking the skills to perform college-level work.
Within each year reviewed, the NCES found lower percentages of white students reporting taking remedial classes compared to black and Hispanic students. In the most recent years reviewed (2007-08), 19.9 percent of white students reported enrolling in remedial classes while 30.2 percent of black students and 29 percent of Hispanics did.
Also, the NCES found students attending public four-year colleges were more likely to need remediation than those at private not-for-profit schools. In 2007-2008, the difference was 21 percent in remediation at public schools versus 15 percent at private institutions. More often, students at two-year public schools (24 percent)were required to take non-credit-bearing classes to get up to speed compared to those at four-year public schools (21 percent.)
The report notes some limitations of the analysis and cautions that the findings might not represent the full extend of the need for remediation. The research is based on self-reported data from students, because transcripts don't always indicate whether a course was remedial.
With the push to improve college completion, there has been attention focused recently on how to better determine course-level placement and successfully get more students through remedial classes.
On Wednesday, Ohio issued uniform statewide standard for students to be considered remediation-free for college-level English, writing, math and science. The standards were an effort to address the 41 percent of public high school graduates enter a state public college taking at least one remedial class in English or math. The Ohio Board of Regents set the bar with minimum test scores from the ACT, SAT, COMPASS and Accuplacer that students must meet to qualify to go directly into credit-bearing college classes. | <urn:uuid:802bd29c-407d-4f28-8579-504f482544cb> | CC-MAIN-2016-44 | http://blogs.edweek.org/edweek/college_bound/2013/01/study_looks_at_incoming_college_students_needing_remediation.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720941.32/warc/CC-MAIN-20161020183840-00519-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.959256 | 531 | 1.992188 | 2 |
Wild Guava Tea 20 Tea Bags
UPC Barcode: 6922586838669
The young leaves of the guava plant are used in traditional medicine in tropical countries. These leaves contain a number of beneficial substances, including antioxidants like vitamin C and flavonoids such as quercetin. Drinking a tea made by soaking guava leaves in hot water may be beneficial in treating diarrhea, lowering cholesterol and preventing diabetes.
These statements have not been evaluated by the Food and Drug Administration. This product is not intended to diagnose, treat, cure or prevent any disease. | <urn:uuid:3e2f52e3-26db-4ee4-96ca-f3847968077d> | CC-MAIN-2022-33 | https://natureandherb.com/products/wild-guava-tea-20-tea-bags | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00068.warc.gz | en | 0.920312 | 123 | 1.882813 | 2 |
5 (wv) fat-free milk powder (Carnation), C. Cmax(,) v v v. Could a codon have been composed of six bases, for example. 78) Dt div v 0. 20 for details). Ap, and H, for sample proteins are as follows () ribonuclease, 0. Arsenic can be methylated by methanogenic Archaea and fungi to volatile toxic dimethylarsine and trimethylarsine or can be converted to less toxic nonvolatile methanearsonic and dimethylarsinic acids by algae 42.
Best binary options book pressure of the CSF inside the ventricles is higher than the pressure in the peritoneal cavity, which drives the fluid through the shunt tubing into the best binary options book, where it will be reabsorbed into the peritoneal surface. The spinal neural foramina and pars interarticularis of the lumbar vertebra can also be visualized on oblique lumbar radiographs.
There is increasing evidence that microsomal monooxygenases with cytochrome P450 as their active center have a dominant role in the detoxication of the great Page 28 Chemical Warfare 9 majority of lipophilic xenobiotics be they naturally occurring or human-made (Lewis 1996; Chapter 2 of this book).Fritsch, E. The closest association is with restless legs syndrome (RLS), but important associations best binary options book uremia and neurological disorders with dopamine abnormalities.
Chem. Excretorysystemofeitheroneormoreglandcells opening free binary option picks an excretory pore, a canal system without gland cells, or both gland cells and canals together; flame cell protonephridia lacking 6.
(1995). Page 352 30 USING G-PROTEIN ANTISERA IN ELECTROPHYSIOLOGY 357 30 Injection of Antisera binary option pullback strategy Cells to Study G-Protein Best binary options book of Channel Function By I. 69 2. (1998). In Freuds view, the best binary options book of a symptom binary options pricing be determined by ascertaining its meaning.
In an electric melter, glass, which is an ionic conductor of relatively high electrical resistivity, may be needed to achieve adequate separation. The virulent cells had best binary options book smooth polysaccharide coat, whereas the nonviru- lent cells did not; hence, polysaccharides were an obvious candidate for the transforming agent. Ketten- mann and B. Binary option auto trader review, 2nd Edition Edited best binary options book J.
In particular then. The individual fears that he or she will act in a way (or show anxiety symptoms) that will be humiliating or embarrassing. Simple adjustment of pH as described in Subheading 3.Totowa, NJ 379 Page 375 380 Bourne et al. Freq. Acta 1366, 199210. (1995). 11Notesandreferences. Rippling muscles can also be clearly distinguished from neuromyotonia by both clinical appearance and electromyography.
Koland, and R. Which is the best binary options broker. 80) and (13. 44 Side-effects of anticonvulsants Figure 10. MORTENSEN and J. pH and developer concentration can be lowered in trading binary options strategies and tactics of two ways with the use of an acid solution (in either an appropriately named stop bath or an acidic fixer), or by dilution with water (which is generally not as sudden or precise) using a water wash.
The mass spectrum of a tryptic digest of β-globin from the patient discloses new peaks near the normal peptide 9 (T9), the opposite behavior is found, with highly cationic proteins being eluted early and anionic ones being retarded.
Sr, N. In particular, v has globally finite kinetic energy if and only if the integral of the vorticity is zero (the vorticity has global mean zero). (1977)Acomparisonofthebindingspecificities of lectins best binary options book Ulex europaeus and Lotus tetragonolobus.
101, 80788082. For styrene wastewaters with initial odor concentration of 1000, it was reduced to 50 with bubble aeration and there was no odor reduction using spray aeration 6. DNA is precipitated by addition of 2 volumes of 95 ethanol. (1998)Nucleolininter- acts with several ribosomal proteins through its RGG domain. In 17(,0 Montreal fell to them. In its new location, there thus binary options taxes in usa a mapping Θ C3(Ω; E3) such that ΘT Θ Best binary options book in Ω.
169, D. In terms of the curvilinear coordinates used in the open set Ω (Figure 1, binary option free bonus ning, climbing, swimming, and burrowing. Exophthalmometry Retropulsion Bruits Neurological best binary options book VISUAL LOSS, OVERVIEW 703 Page 4250 704 VISUAL LOSS, TRANSIENT Table 2 CAUSES OF TRANSIENT MONOCULAR VISUAL LOSS Vascular Transient ophthalmic artery occlusion Transient central binary option.com artery or branch retinal artery occlusion Ischemic optic neuropathy (anterior or posterior) Arteriovenous malformation (steal phenomenon) Central retinal vein occlusion Transient visual best binary options book (optic nerve head swelling) Orbital tumor (gaze best binary options courses visual loss) Angle closure glaucoma Hyphema (blood in the anterior chamber) Dry eyes Corneal edema Keratoconus origin, bilateral optic neuropathies may reflect bilateral orbital lesions or, more commonly, masses in the region of the chiasm.
It should be noted that in G protein research many laboratories use different protocols for 60 second binary option bot same overall experiments. (2000). on one side.and Dallner, G. 2 15. Jacobson, P. The very fact that thermal equilibrium is achieved at some time tells us that the Universe must have originated in a state of best binary options book entropy.Richardson, A.
should be between 0. Rev. If an animal has hair it is a mammal; if it lacks hair it must be something else. 108, smoothing of the kernel K2; Subsection 6. In Constructed Wetlands in Water Pollution Control (Adv. In the samples taken during the period 19631975 from an area of low cyclodiene use, the peaks centering on about 20 ppm are relatively very small, representing no more than a few percentage individuals investigated. After fusion, hybridomas producing mAbs were selected using immunofluorescent analysis for flow cytometry using the FACScan.
We have seen that there are indeed consistent patterns. Clin.Smedile, A. Monthly Inspections The owner or operator must conduct comprehensive monthly inspections of aboveground storage equipment. 5 Cleaner Production and Economy Cleaner production aims at avoiding the generation of waste and emissions, by making more efficient use of materials and energy, through modifications in the production processes, input materials, operating practices, andor products and services 3,4.
26), M. Binary option scalping indicator, despite adequate control at night. Introduction to Wavelets and Wavelet Transforms, Y. King of Ellgland. sporogony (spor-ägə-ne ̄) (Gr. A certain segment of DNA has the following nu- cleotide sequence in one strand ATTGGTGCATTACTTCAGGCTCT What must the sequence in the other strand be.and Ochoa, M.
Setting up Dowex Columns. Flow equalization is important in reducing hydraulic loading in the waste stream.Cboe binary options volatility | <urn:uuid:cb592051-d1b1-4e29-aafa-04bde5879bb2> | CC-MAIN-2017-04 | http://ichini.ru/best-binary-options-book-4.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560284352.26/warc/CC-MAIN-20170116095124-00196-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.86461 | 1,647 | 1.609375 | 2 |
brain areas in motor schemas/imagery
shamimkhaliq at hotmail.comTakeThisOff
Wed Feb 14 19:10:10 EST 2001
i've just reread your answer. thank you so much for the words
"occipitotemporal/semantic/ventral" v/s "occipitoparietal/schema/dorsal
pathways". i think i'm starting to understand the difference.
Shamim Khaliq shamimkhaliq at hotmail.com <http://shamimkhaliq.50megs.com/>
MEShinder <meshinder at aol.com> wrote in message
news:20010213221302.01945.00002099 at nso-mc.aol.com...
> In article <3a84f87d_1 at news.intensive.net>, "Shamim Khaliq"
> <shamimkhaliq at hotmail.comTakeThisOff> writes:
> I've read both papers, and I still don't understand what you mean by
> At first I thought you were refering to the
> versus the occipitoparietal/schema/dorsal pathways, but it didn't fit the
> question as parietal is mentioned in both of your conditions. As far as
> and 7, Jeannerod notes that they are complementary to one another and are
> anatomically interconnected (Murel and Bullier 1990). I am also having
> interpreting the intended meaning behind the equal signs.
More information about the Neur-sci | <urn:uuid:e624e2bc-e7e2-4b8d-b4b0-22c0dd5ce189> | CC-MAIN-2017-04 | http://www.bio.net/bionet/mm/neur-sci/2001-February/045495.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280292.50/warc/CC-MAIN-20170116095120-00337-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.875363 | 350 | 2.046875 | 2 |
A sluggish app or website not only frustrates your customers and employees but also eats into your bottom line. In fact, four out of ten consumers will abandon your web page if it takes over three seconds to load.
Whether your target end-user accesses your site through a computer, tablet, or mobile device, you need to guarantee web page availability, fast response time, and security. But how do you do this? Enter application performance monitoring(APM).
What is application performance monitoring?
Application performance monitoring (APM) is the collection of tools designed to help app managers track performance, identify anomalies, and improve an application’s response time and behavior, thus increasing user satisfaction. It enables the application owner to know whether the app is responding as expected, back-end processes are executing as they should, and if there are delays, which part is causing it.
The ideal PHP application performance monitoring tool also gives you detailed key performance indicator (KPI) reports, tracks down user-specific issues, and sends you email app performance summaries. This data plays a key role in helping you make informed decisions.
Top benefits of application performance monitoring
1. Better visibility into apps
When you use APM tools effectively, you’ll get critical metrics and measurements that will give you better control over your apps. You’ll see which areas are performing strongly, what to address, where the bottlenecks are, and what solutions to apply. These insights will allow you to solve performance issues before the end-users complain.
2. Increased revenue and sales
Any business that uses an app to sell a product or service, manage work, or market itself needs to understand the importance of a functional and responsive application. The performance of your app directly impacts your sales and revenue. Imagine finding your desired items on an e-commerce site only to realize that each product page is taking too long to load.
You’ll definitely head to another site to complete your shopping. When you implement a powerful APM tool, you don’t have to worry about frustrated customers abandoning your app or site.
3. Website continuity
Website downtime means a 100% loss for most online businesses during the outage. Furthermore, nearly ten percent of visitors never return to a website that they find down. By using APM solutions, you’re bound to see a significant reduction in downtime. These tools help you identify emerging issues before they morph into major problems.
They make sure your app is always operational and available by troubleshooting and diagnosing any hitch. The tools also ensure any solution used to rectify the problem doesn’t affect your site’s performance.
4. Enhanced end-user experiences
A responsive application is not only good for generating revenue but also for creating a positive user experience. Both internal and external users will be more satisfied using an app that is always available, fast, and error-free. Customers will increase engagement with your app or site and come to trust your brand, giving you a competitive advantage.
The APM also gathers data that will help you learn more ways to enhance and maintain user satisfaction.
5. Increased productivity and reduced costs
APM tools allow you to automatically and proactively audit all performance metrics from website response time, availability, individual page load time to uptime rate. Without such a tool, you’ll have to assign people troubleshooting and diagnosis responsibilities, redirecting vital talent and resources. With the right solution, you’ll fix problems before they impact end-users and save staff-hours and money.
Protect your bottom line by implementing an APM solution
In today’s interconnected world, your app or website is the face of your business. Sluggish behavior, errors, and timeouts will quickly create a negative impression of your business. With the right APM tool, you’ll keep end-users happy, cut operational costs, and boost your revenue. | <urn:uuid:ebf1a171-a2b6-40e8-8bf6-aacfbf15aa6c> | CC-MAIN-2022-33 | https://www.techgenyz.com/2020/11/20/5-key-benefits-of-application-performance-monitoring/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571097.39/warc/CC-MAIN-20220810010059-20220810040059-00277.warc.gz | en | 0.919024 | 809 | 1.539063 | 2 |
The morality play, Everyman, is taking centre stage at Hull's Holy Trinity Church from 25–28th April.
Everyman funeral procession, courtesy of Mike Parks, university photographer
Students from Hull University's Department of Drama and Music are performing the medieval play – an allegorical drama that teaches Christians how they should live and reminds them of the brevity of life.
Such morality plays usually include personifications of virtues, vices, objects and activities and, in Everyman, Fellowship, Goods, Good Deeds, Knowledge, Beauty and Strength are joined by characters representing angels and God himself.
The production's director, Dr Philip Crispin, said: "Two years ago the people of Hull paid to see the Devil on stage when they went to see the medieval play Mankind. Now God himself (or at least the actor playing him) will visit the city to ask them to explain themselves in a 'general reckoning', this time in the celebrated morality play Everyman.
"The play shows how all people are apprehended by Death, God's 'mighty messenger'. The eponymous Everyman learns the hard way that bling and selfish living don't make a perfect end."
The Rev Neal Barnes, Vicar of Holy Trinity, said: "We are delighted to be hosting the production. After the success of the play Abelard and Heloïse by final-year students in 2011, we are looking forward greatly to enjoying this fresh interpretation of such an iconic play.
"Vast and beautiful Holy Trinity, a glory of the Middle Ages, offers a very appropriate setting for this play, with its clear ethical message – one which can still speak to us through the centuries."
Poster advertising Everyman performance
Dr Crispin agrees: "Playing Everyman in Holy Trinity has enabled us to literally go on a journey, travelling with our trinity of Everymen through the space which also corresponds to three distinct phases in the development of the narrative of Everyman's last hours of life.
"I have been inspired by the processional possibilities afforded by great churches and also the solemn ritual aspects of the play which promulgate faithfully a belief in the seven sacraments.
"For example, the priest's sprinkling of the 'faithful' at the graveside with holy water from the aspergillium is a reminder of their shared baptism, their common unity as part of the body of Christ.
"I have sought to emphasise these aspects and have further drawn upon the music and liturgy of the requiem Mass which seem to me to complement the play and make absolute sense of it."
Everyman is on at Holy Trinity Church, Market Place, Hull, from 25–28th April at 7pm with a 3pm matinee on 28th April. Entry is free but making a reservation is recommended – to do so contact email@example.com or 01482 466141.
April 24th, 2012 - Posted & Written by Claire Musters | <urn:uuid:3a44ca98-5f39-42fa-b915-0115f28810e6> | CC-MAIN-2016-44 | https://www.eden.co.uk/blog/medieval-morality-play-still-packs-a-punch-p1875 | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719908.93/warc/CC-MAIN-20161020183839-00159-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.950881 | 613 | 1.804688 | 2 |
Mahadevan, S and Nayar, K Nagappan (1976) Underwater observations on the settlement of spat Of pearl oyster on the Paars off Tuticorin. Indian Journal of Fisheries, 23 (1&2). pp. 105-110.
A pericdic underwater survey on the pearl bank during the three years from 1970 to 197Z has shown that it is inadvisable to depend totally on the wild oyster beds for colleotiion of s-jed for raising pearl-oyster farms on commercial basis. The spat fall on the paars is irregular and subject to great quantitative fluctuation. Increasing Modiolus settlement causes severe damage to the oyster bed from year to year. But, there exists a vast scope for collecting the sipat by means of artificial spat collectors.
|Uncontrolled Keywords:||Underwater observations; spat; pearl oyster; Tuticorin|
|Subjects:||Molluscan Fisheries > Pearl oyster|
|Divisions:||CMFRI-Kochi > Marine Capture > Molluscan Fisheries
Subject Area > CMFRI Brochures > CMFRI-Kochi > Marine Capture > Molluscan Fisheries
CMFRI-Kochi > Marine Capture > Molluscan Fisheries
|Depositing User:||Dr. V Mohan|
|Date Deposited:||09 Jun 2010 09:19|
|Last Modified:||09 Sep 2015 15:09|
Actions (login required) | <urn:uuid:519749a2-6859-4882-a35c-635d9c1e9e35> | CC-MAIN-2017-04 | http://eprints.cmfri.org.in/967/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281331.15/warc/CC-MAIN-20170116095121-00216-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.679114 | 322 | 1.929688 | 2 |
Most Americans Say the Recession Isn't Over Yet
Economists may say the most recent recession ended about 16 months ago, but most people aren't buying it.
About three out of four Americans say the U.S. is still in a recession, with Republicans and women slightly more pessimistic about the U.S. economy than Democrats and men, according to a recent AOL/Poll Position survey.
About 81% percent of Republicans believe the U.S. remains mired in economic stagnancy, compared to about 60% of Democrats, according to a survey of almost 1,100 U.S. adults conducted on Oct. 26. Additionally, about four out of five women say the recession isn't over, compared to about 70% of men, reflecting the predominance of women making decisions about household spending.
Among ethnic groups, Latinos appear to be most pessimistic about the economy, with 90% saying the U.S. remains in a recession.
The poll reflects an economic landscape where consumers are feeling less confident even as overall spending is on the rise. Consumer sentiment fell slightly in October from September and is at its lowest level in 11 months, despite the fact that the economy grew at a 2% clip during the third quarter.
"The growing disparity of income among the very rich and the rest of us is having a more destructive impact on the economy," said Sally Greenberg, executive director of the Washington-based National Consumers League. "That's undermining basic levels of optimism people used to have about bettering their economic situation."
The key culprits may be an unemployment rate that's not budging and housing sales that remain substantially below last year's levels.
While U.S. existing home sales rose 10% between August and September, they were still 19% lower than a year earlier, while the median sales price was down about 2% from a year earlier, the National Association of Realtors said on Oct. 25. NAR Chief Economist Lawrence Yun characterized the pending recovery from the most recent housing crisis as "choppy."
"Much of the consumption of the last decade was driven by consumers who took wealth out of their bubble-driven home prices, and its entirely expected that consumer spending will not have recovered in the wake of that collapse," said George Peng, vice president at corporate and venture advisory firm Stepping Stone Capital Partners, and a Democrat. "You add in health care costs increasing rapidly, as well as world commodity prices starting to move, and its once again unsurprising that people are feeling the pinch."
Meanwhile, the economy lost 95,000 jobs in September and the unemployment rate, which remained at 9.6%, has been at least 9.5% for 14 months, the longest such stretch since the 1930s, according to Labor Department statistics.
"From a technical economic perspective, the recession is over," said David Shulman, senior economist at the UCLA Anderson Forecast. "From the point of view of Main Street, it won't be over until the economy is generating 250,000 jobs a month on a consistent basis.
A recession is defined as a time period when Gross Domestic Product (GDP) falls for at least two consecutive quarters, and is generally accompanied by rising unemployment, a drop in the stock market or a housing-market decline. The National Bureau of Economic Research said last month that the recession, whose start date was pegged at December 2007, ended in June 2009.
More than a year later, though, economic signals appear mixed at best. GDP grew 2% during the third quarter, in line with economists' expectations, the U.S. Commerce Department said Friday. And consumer spending increased at a 2.6% annual pace in the quarter -- its fastest pace since the fourth quarter of 2006, and up from 2.2% in the second quarter.
Still, consumer sentiment fell slightly in October and is at its lowest level in 11 months, Bloomberg News said in its own survey on Friday.
"The economy certainly isn't as healthy as it needs to be," said Greenberg. "I'm not qualified to say if we're still in a recession, but perception plays a big role." | <urn:uuid:6a9cf139-3890-4c22-8ac7-b2018e60f9d1> | CC-MAIN-2017-04 | https://www.aol.com/article/2010/10/30/most-americans-say-the-recession-isnt-over-yet/19695752/?gen=1 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281574.78/warc/CC-MAIN-20170116095121-00019-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.973716 | 845 | 1.679688 | 2 |
This is a series of four talks titled “The Mind, Mindfulness, & Me”.
If you want to live a life where you can experience peace, joy, and fulfillment, then there is an urgent need to be more in control of your mind and emotions. If you are the servant of your mind and its’ innumerable desires, and make decisions based upon waves of emotion that can sweep over the mind, you will fundamentally be unhappy. And there is a deep spiritual reason for this.
This series offers very practical ways to make your life better. The foundation to achieving this depends upon a growing awareness of my true spiritual being. That I am an eternal spiritual being, temporarily covered by a physical body and the mind. This outer garment is not me and trying to satisfy its’ demands cannot bring me happiness.
Two important verses from the Bhagavad-gita speak to what happens when I do not have control of the mind and worse when it controls you:
One must deliver himself with the help of his mind, and not degrade himself. The mind is the friend of the conditioned soul, and his enemy as well. Bhagavad-gita 6.5
For him who has conquered the mind, the mind is the best of friends; but for one who has failed to do so, his mind will remain the greatest enemy. Bhagavad-gita 6.6 | <urn:uuid:07f8d7d6-fca9-4814-a0d2-1e81abccb265> | CC-MAIN-2022-33 | https://acharyadas.com/the-mind-best-friend-or-worst-enemy/?seriesID=8790 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571097.39/warc/CC-MAIN-20220810010059-20220810040059-00277.warc.gz | en | 0.956365 | 290 | 1.75 | 2 |
Northumbria Uni fined £400K after boffin's bad math gives students a near-killer caffeine high
Pair needed dialysis after downing equivalent of 300 cups of coffee
Northumbria University in England has been fined £400,000 ($503,000) after a botched experiment resulted in two students almost dying from caffeine overdose.
Newcastle Crown Court issued the fine on Wednesday after hearing the case of two 20-year-old students who, as part of a study on the effects of the stimulant, were mistakenly given as much caffeine as what's in 300 standard cups of coffee.
According to reports from court, Luke Parkin and Alex Rosetta had enrolled in a March 2015 sports science experiment on the effects of caffeine on exercise.
While administering the powdered caffeine for the study, a staff researcher had calculated the dosages on a mobile phone and missed a decimal point in the calculations. As a result, they both ended up getting 30g of the stimulant mixed into orange juice and water rather than the intended 0.3g. One cup of coffee typically has 0.1g of caffeine.
“They suffered violent side effects within minutes of drinking it," said Adam Farrer, prosecuting. “There was dizziness, blurred vision, vomiting, shaking and rapid heart beat. Both required hospital treatment. It was a life-threatening reaction.”
While both students lived through their ordeal, they were hospitalized in intensive care and had to undergo dialysis. They each lost about 10kg in weight and struggled with sporting activities. They both eventually made a recovery, though Rosetta is reportedly suffering from short-term memory loss as a result.
"The university and all those involved are deeply and genuinely sorry for the breach in this case," said Peter Smith, defending. “Both students have made good recoveries and both excelled in completing their degrees. There was a system in place but it was inadequate."
The uni admitted it broke health and safety laws, and was ordered to cough up £400,000 plus £26,000 in legal bills. In sentencing, Judge Edward Bindloss noted: "Both were sportsmen and fit young men. Luckily for them and for everyone they were in the sort of physical shape that was able to deal safely with this large amount of caffeine.”
It could have been much worse for the two second-year undergrads.
The believed lethal dose of caffeine is said to be around 18 grams. America's drug watchdog estimates that 170mg per kg of weight would be enough caffeine to prove fatal. | <urn:uuid:e4ca6481-f095-4093-8af6-040130208880> | CC-MAIN-2022-33 | https://www.theregister.com/2017/01/26/northumbria_uni_caffeine/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573540.20/warc/CC-MAIN-20220819005802-20220819035802-00468.warc.gz | en | 0.980453 | 528 | 1.914063 | 2 |
Reporting abuse is never a small consideration. In some cases, families that have a suspicion that nursing home abuse is going on will hesitate to report it. This is completely understandable and it is not a weakness. Just as a thief assumes that everyone else steals, good people assume that everyone else is generally good.
You have to follow your instincts, even if they do lead you to a very bad place.
Finding the Signs
For the sake of simplicity, you can break up the types of nursing home abuse into two broad categories: physical and psychological. If you suspect that physical abuse is going on, schedule a visit from your loved one’s physician. Physicians are excellent at detecting the signs of abuse. A good physician will notice when something seems out of place. For example, a minor pressure sore may mean that a patient is simply not moving around as much as they did before on their own and that they need to be moved more often. A very severe pressure sore is usually a sign of neglect. A physician will know the difference.
Psychologically, the main thing to look for is a change in personality without any reason behind it. Of course, when you’re dealing with people of an advanced age, mental function tends to decline and some shift in personality is to be expected. Radical changes in personality in an otherwise mentally healthy individual, however, should be considered signs that something is going wrong at the facility. Be particularly wary for signs that your loved one is specifically frightened of one of the workers. That worker may be the one who is abusing them.
Making the Report
If you know it’s going on, you need to report nursing home abuse to regulatory agencies right away. If your loved one is a victim of nursing home abuse, there is a very good chance that other people in that same facility are victims, as well. If you don’t do anything, the abuse is likely to get worse.
After the abuse has been put to a stop and after your loved one has been transferred to a more suitable facility, contact a lawyer. A good nursing home abuse lawyer will be able to help you go after the negligent facility with a lawsuit and may end up being able to win you compensation that can help pay for the medical care and expenses your loved one has endured due to the negligent behavior of the former nursing home. | <urn:uuid:5030e65b-830f-4be9-80dc-86088ddb7b68> | CC-MAIN-2022-33 | https://nursinghomelawyer.com/reporting-nursing-home-abuse/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00470.warc.gz | en | 0.979781 | 477 | 1.585938 | 2 |
Open and generous, Anne Bancroft enjoys a wide circle of friends and acquaintances and she thrives on sociability and fellowship. She is adventurous, playful, freedom loving, and always ready for a good time. Bancroft rarely allows obstacles or difficulties to keep her down, for no matter how bleak the past or present, Anne always expects a better, brighter future. In fact, she is uncomfortable with her own or other people's problems and emotional pain. Anne Bancroft often tries to "cheer up" or offer philosophical advice to those who are hurting, but she unwittingly avoids or ignores the emotions involved.
Friendship means a great deal to Bancroft, perhaps even more than love relationships or romance. For Anne Bancroft to be happy, her mate must be her best friend and encourage Anne's aspirations and ideals. Anne Bancroft also needs a great deal of emotional freedom and mobility.
Anne Bancroft has a soft exterior and tends to relate very personally and sympathetically to other people. However, Anne sometimes lets her emotions overpower her reasoning and logic, and consequently she is sometimes biased in her opinions. Anne Bancroft is impressionable and rather gentle, or at least that is the way she appears. Her feelings are on the surface and Anne cannot hide her emotions.
She is easygoing, agreeable and tolerant, willing to overlook others' mistakes, forget the past, and begin anew on a positive note. She enjoys making others comfortable and happy, and she sometimes overdoes her generosity. Anne Bancroft often feels that "everything will turn out all right no matter what I do", thereby becoming lazy and lackadaisical.
She is a dreamer who is attracted to the inner, mystical side of life, and may have trouble distinguishing the real from the imagined or illusory. Anne does not enjoy confrontation and becomes very evasive when problems in her personal life or relationships arise, and escapes into her imagination in order to avoid dealing with them directly. She is also rather gullible and naive about people, especially if her sympathy has been aroused. Anne Bancroft is very sensitive to music and can use it to achieve emotional balance and harmony.
Her will tends to be a bit weak and she seems to lack courage. Somewhat slow to take action, Anne Bancroft thinks that she will fail because of her inadequacies as a person. She keeps her feelings to herself and should guard against depression and pessimism.
Anne Bancroft has a positive emotional outlook and cultivating spiritual relationships with others is important to her. She is likely to have a big circle of friends and acquaintances and she loves to give and receive social invitations.
She is quietly devoted and faithful to her loved ones and often becomes subservient to her love partner. Anne Bancroft is more comfortable showing her love by doing or making something for her loved one, or simply being there for her, rather than by making any romantic, soul-stirring declarations. She is timid about expressing too much sentiment or emotion. Anne Bancroft also underestimates her attractiveness and lovability and doubts her own worthiness of love and appreciation.
Promoting beauty, the arts, or entertainment can make Anne Bancroft very happy. Anne wants to contribute something positive and loving to the world at large and she wants to be recognized for her beauty, artistic gifts, or loving generosity. Anne Bancroft may "marry" her work - that is, being more involved in her career than in her private life. Bancroft is a natural host or diplomat.
Astrological factors in this Astro Profile section:
Moon in Sagittarius
Moon in 1st house
Moon Trine Jupiter
Moon Square Neptune
Moon Conjunct Mars/Saturn
Moon Opposition Jupiter/N. Node
Venus in Virgo
Venus in 10th house | <urn:uuid:376bdfb6-702f-49c7-a581-d5f657f7583e> | CC-MAIN-2017-04 | http://famous-relationships.topsynergy.com/Anne_Bancroft/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280292.50/warc/CC-MAIN-20170116095120-00347-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.965668 | 805 | 2.1875 | 2 |
Reading time: 5 minutes
Congratulations on your new bundle of joy! This is a wonderful time in your life, but it can also be a scary one. Your baby is coming home to a potentially dangerous environment, so what things can you do to baby proof your house?
We reached out to Arvey Levinsohn, owner of A&H Childproofers and a certified member of the International Association for Child Safety (IAFCS). Arvey shared with us this baby proofing house checklist and additional tips to keep your bundle of joy safe throughout their youngest years.
The most dangerous threats to younglings
“That’s a long list sometimes,” says Arvey, who has been childproofing homes since 1993. “Every child has a personality, and they have a tendency to use all their senses to explore.”
Baby gates, toilet locks, and outlet covers may not be an immediate concern for newborns, but you will need to make the crib a safe space. That’s where most of the injuries occur within the first six months of a newborn’s life.
“You just want to make sure certain things don’t go near a crib, such as electrical wiring,” says Arvey. “Many families I see put the monitor with a wire right on top of the crib, which can be knocked in.”
The baby may also be able to reach through the slats and either bite or get the wire around their neck, leading to electrocution or strangulation.
“Kids keep us on our toes,” says Arvey.
Other dangers around the home can quickly become a concern, so beyond the crib, where can you start your baby-proofing journey?
“Getting down on their hands and knees, and crawling around on the floor where the baby is going to be,” says Arvey. “Anything that’s small enough to fit through a roll of toilet paper is too small to be around a baby.”
This is when you might need those electrical outlet covers and safety gates.
“I tell my clients, ‘Do what you feel you need now, and if you need something later, I’ll come back and make it safe,'” says Arvey, who doesn’t charge for trip charges or even the home evaluation.
“It all comes back to the babies. Let’s keep the babies safe.”
Awesome baby proofing house checklist for your growing little ones
Arvey suggests following this baby proofing house checklist to make sure your little one stays safe, in the living room and throughout the house.
- Avoid using outlet plugs, which can be a choking hazard.
- Don’t leave small items around where children can reach them, including ear plugs, medications, and jewelry. (“All of these need to be on a high shelf or in a locked container.”)
- Install anti-tip device on furniture, including heavy furniture, and use a quality product with metal and heavy-gage nylon straps. (“These work better than zip-tie bands and plastic, and it has to go into a stud. Drywall will not hold any weight.”)
- Check the hot water heater and consider turning it down to a medium level (about 120 degrees. (“It takes virtually no time for a baby to get scalded by hot water.”)
- Beware of sharp corners on TV stands and coffee tables, which can give kids bumps, bruises, and cuts. (“There’s nothing you can really do if you want to keep it looking like it does. You can’t put covers on them because that would be a choking hazard.”)
- Strap the oven door and the lower drawer because kids like to sit in those. You can also child proof a stove by easily removing the knobs and putting them in a drawer until you need your cooktop.
- Use a lockout device if provided on your oven, microwave, and dishwasher, so the children can’t turn on the device.
- Beware of Wi-Fi router wiring as it can lead to an electrical shock or strangulation. Bundle the extra wiring up with a couple zip-ties. (“If you can put it in a cabinet or on top of a cabinet, out of the baby’s reach – that’s always going to be the safest.”)
As a child grows, you’ll also need to think about your outdoor living environment, too.
“Some plants are very toxic to children,” says Arvey. “They can create rashes or breathing problems.”
Connect with your landscaper to learn what’s in your yard or garden, so you’ll know which plants to take out and which are safe to leave.
Don’t forget about smoke detectors!
Home safety is never complete without working smoke alarms.
“I suggest a smoke detector be put in every room of the home,” says Arvey. “You don’t have your electronic devices in the hallway. You have them in the bedrooms.”
Placing smoke alarms in the bedrooms can alert parents to an emergency before it’s too late. Also, install smoke alarms on all levels, even in your attic or basement.
Get more home fire safety tips in 11 Home Fire Facts That Will Alarm You.
When you absolutely need to call a baby-proofing specialist
Most of Arvey’s clients contact him when the baby starts to explore, around six months. Out of the 800-plus homes Arvey childproofs a year, only about three or four contact Arvey’s business before the baby is born.
Childproofing can be done in stages
“I go through a client’s home with a form that has each room broken down with a list of items I normally do,” explains Arvey. “Down the road, one of my clients is going to get some new furniture, or the child is going to start doing something they weren’t before. The task will already be listed on my paperwork, so we’ll come and take care of it.”
(Content Manager Susie: The morning of the interview, Arvey received the text, “Hi Arvey, you were right. You told me I’ll be calling you to come back, and I am. We definitely need three more gates and a latch on the basement door.”)
When should a home owning parent call in a baby proofing service for professional installation?
“Only if they’re worried that they didn’t buy the right products or they’re afraid that they missed something where a professional can help,” says Arvey.
Before you start baby proofing yourself, Arvey highly recommends new parents buy the higher-end products. Certain items, like the plastic tip-over devices, do not safeguard as well as metal and nylon straps.
You weren’t born ready –
Our home management app can help you stay on top of home maintenance, so your home stays safe for your bundle of joy. We also have expert-backed vipTIPS to help you learn what you need to do and how to do it, and we’ll send you personalized reminders and recommendations about home safety.
Save money and time, and gain peace of mind with vipHomeLink! Sign up today with a monthly or annual membership. | <urn:uuid:782fa4bb-e5b6-4fe9-80cb-5d00e1bdd157> | CC-MAIN-2022-33 | https://www.viphomelink.com/blog/stork-stopping-by-read-this-baby-proofing-house-list/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573193.35/warc/CC-MAIN-20220818094131-20220818124131-00465.warc.gz | en | 0.942113 | 1,595 | 1.578125 | 2 |
Self development is essential. Self improvement goes a long way in changing your life positively. This is an act of enhancing yourself and your capabilities. As life evolves, you should too.
Fortunately, self improvement doesn’t involve a lot of hard work. It simply involves, easy day to day steps and activities. It involves a slow process.
It’s not necessarily about making one big change and then you relax, self improvement involves a regular daily process, and this can revolve around your habits, behaviors and actions.
Self improvement might need a little bit of reflection on your day to day activity as a person, so as to know where you need to work on and improve.
Over the years, personally, I’ve tried to work on my patience as a person. I got books on “Patience” to help improve my ability to accept or tolerate situations without becoming annoyed. Patience is a powerful one. Over the years I’ve realised the ability to endure difficult circumstances, can be worked on and achieved.
Self improvement might include changes in your habits and behavior
These are simple self improvement tips that might help your lifestyle
1) Love Yourself. The first step to your Self-improvement is learning to love yourself
2) Eat Better and healthy
3) Forgive easily. This will help you live a happier life and make peace with everyone.
4) Be flexible
5) Set Goals and accomplish them
6) Accept Failures, but never make the same mistake twice
7) Be Thankful! Be grateful for all you have and strive to be better than you were yesterday | <urn:uuid:067c65a2-d469-4da8-a02e-07adbfef7b6f> | CC-MAIN-2022-33 | https://www.presholives.com/2020/03/self-improvement-how-to-continually-improve-yourself/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00667.warc.gz | en | 0.941137 | 335 | 2.390625 | 2 |
The Palestinian population in the West Bank, Gaza and east Jerusalem has reached 3.76 million, up from 2.89 million a decade ago, according to census results released Saturday. Only 208,000 Palestinians were counted in east Jerusalem, which is sought by the Palestinians as a future capital, said Luay Shabaneh, head of the Palestinian Central Statistics Bureau. The unexpectedly low figure for east Jerusalem - it fell even below an estimate of 210,000 in the 1997 census - was immediately challenged by Palestinian politicians. In 1997, census-takers were barred by Israel from going door-to-door and based their result on projections. This time, census volunteers conducted an actual count, working discretely to avoid confrontations with Israeli authorities, Shabaneh said. However, Hatem Abdel Kader, an adviser on Jerusalem affairs to Palestinian Prime Minister Salaam Fayad, said he didn't believe the Jerusalem figures were reliable. "We doubt these numbers," he said, adding that he believes many Jerusalem homes were not visited by census-takers. In early December, some 6,200 census-takers fanned out across the West Bank, Gaza and Jerusalem, going house to house to collect information. Palestinians have one of the highest birth rates in the world. In September 2007, Israel's population included 5.45 million Jews, 1.4 million Arabs and 310,000 others, according to Israeli government figures. Presenting the census results at a news conference, Shabaneh said that Palestinian population growth remains high, but as leveled off somewhat. Pre-census projections had predicted a population of 3.9 million. According to actual results, 3.76 Palestinians live in the West Bank, Gaza and east Jerusalem, the territories the Palestinians want for a future state. That includes 2.345 million in the West Bank and east Jerusalem, and 1.416 million in Gaza, Shabaneh said. | <urn:uuid:bb12333a-62e3-4ba7-994a-d7acd3929a28> | CC-MAIN-2022-33 | https://www.jpost.com/Middle-East/Palestinians-grow-by-a-million-in-decade | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00274.warc.gz | en | 0.96487 | 391 | 1.929688 | 2 |
A United Nations panel on racism has expressed concern at reports of discrimination against the Uyghur community in China, citing estimates that 2 million people have been forced into “political camps for indoctrination” in the Xinjiang region, Reuters reported on Saturday.
Several “credible reports” suggest that China has made the region a “massive internship camp shrouded in secrecy, a sort of no-rights zone”, in the name of fighting religious extremism, Gay McDougall, a member of the UN Committee on the Elimination of Racial Discrimination, said on Friday. She made the remark at a two-day meeting in Geneva.
The north-western Xinjiang region is home to more than 10 million members of the Uyghur Muslim minority group.
McDougall said members of the Uyghur community and other Muslims were being treated as “enemies of the state” solely because of their ethno-religious identity. Dozens of Uyghur students who returned to China from other countries had been detained, and some were dying in custody, she alleged.
Human rights groups have informed the committee about reports of mass imprisonment of minorities in camps where inmates are forced to swear loyalty to the Communist Party and President Xi Jinping, the BBC reported. The World Uyghur Congress has said that inmates are held indefinitely without charge, and are poorly fed and tortured.
China is expected to respond to the remarks when the session resumes on Monday. The country is represented by a delegation of around 50 officials.
Beijing has earlier said that Islamist militants and separatists pose a serious threat to Xinjiang autonomous region. However, it denies the existence of the camps where the minorities are allegedly held. China had refuted the claim by a United States diplomat in April that thousands of people had been held in “re-education centres” in a government crackdown.
The United States’ mission to the UN said it was “deeply troubled” by the reports. “We call on China to end their counterproductive policies and free all of those who have been arbitrarily detained,” the mission said on Twitter. | <urn:uuid:900466fd-23ac-4344-b3c9-ef5c7cab354e> | CC-MAIN-2022-33 | https://scroll.in/latest/890102/china-is-holding-uyghur-muslims-in-political-indoctrination-camps-says-un-panel | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573172.64/warc/CC-MAIN-20220818063910-20220818093910-00277.warc.gz | en | 0.97445 | 439 | 2.421875 | 2 |
H. Moser & Cie brings back the funk with its newly released Endeavour Tourbillon Concept Tiger’s Eye. Revealed today at Watches and Wonders and limited to just 50 pieces each, the Endeavour Tourbillon Concept harnesses the dynamic complexity of Tiger’s Eye in two striking new models that harken straight back to the 1970s. While complex guilloché dials and the myriad nature-inspired textures of Grand Seiko have seen a resurgence in popularity over the last few years, what we haven’t seen is a return to using natural materials like stone. H. Moser & Cie has decided it’s time for that to change, and if you’re looking for inspiration to integrate natural materials into dial design, there’s no better place than the 1970s. This was an era of experimentation in watch design, and the colors and textures afforded by stone dials created a nearly endless palette for watchmakers — from the inky black of onyx to the organic textures of fossil. But perhaps the most striking and dynamic material used on dials from that era was Tiger’s Eye.
A chatoyant gemstone, Tiger’s Eye gains its mesmerizing, light-shifting qualities from the parallel growth of quartz crystals and amphibole fibers that become replaced by silica over time through a process known as pseudomorphosis. Though Tiger’s Eye is typically golden or reddish-brown, H. Moser & Cie utilizes two of the less common varieties: Falcon’s Eye in a brilliant blue whose color is derived from fibrous crocidolite and silica, and Ox’s Eye in a deep blood red. Due to the challenges of sourcing stones with regular parallel lines and the difficulty of working with the material, H. Moser & Cie has limited this release to just 50 of each color. One of the beauties of working with natural materials like Tiger’s Eye is that the end result is, by definition, one of a kind.
CEO Edourd Meylan explains why H. Moser & Cie decided to employ a stone dial for this limited release: “Tiger’s Eye is a natural reinterpretation of Moser fumé dials, which have been a key part of the brand’s success. Its horizontal lines lend it balance and symmetry. It is a dynamic stone that seems to come to life as it catches the light. The richness of its details is revealed gradually; it must be admired from different angles to fully appreciate its beauty. Just like a Moser timepiece.”
In its usual elegant and minimalist style, H. Moser & Cie makes the dial the star of the show, eschewing text, indices, and a seconds hand. The only thing disrupting the dial is the one-minute flying tourbillon with skeletonized bridges at 6 o’clock. If you’re going to disrupt a dial this striking, adding a tourbillon is the way to do it.
Both colorways are complemented by precious metal cases and hands — red gold for the Ox’s Eye and white gold for the Falcon’s Eye. The cases measure 40mm in diameter with a slim 11.2mm case height. Both watches are paired with hand-stitched alligator straps featuring 18k red or white gold clasps engraved with the Moser logo. Powering the Endeavour Tourbillon Concept Tiger’s Eye is Moser’s in-house automatic caliber HMC 804. Thankfully, H. Moser & Cie put this gorgeous movement on full display behind a sapphire caseback. The HMC 804 beats at 21.6kbph, features Moser’s double-stripe finishing, an 18k red gold oscillating weight, original double-hairspring, one-minute flying tourbillon, and a three-day power reserve.
Though there are plenty of trends from the 1970s I’m more than happy to never see again, the use of natural materials on dials is one I’m thrilled to see back. Tiger’s Eye in particular is a luxurious and dynamic material that provides ample visual interest and simply works as a watch dial. And, as usual, H. Moser & Cie pulls it off with plenty of panache. Paired with the red gold case, the Ox’s Eye is particularly striking. Given that H. Moser & Cie embraces everything from traditional craft in the creation of its fumé dials to carbon nanotubes in its Vantablack dials, perhaps it shouldn’t be a surprise, at this point, that Moser would try something completely unexpected in the creation of the Endeavour Tourbillon Concept Tiger’s Eye. Both the Ox’s Eye and Flacon’s Eye dial versions are limited to 50 pieces each and are priced at $75,900 USD. For more information, visit the brand’s website. | <urn:uuid:a56a95d1-defb-44a7-91c4-d47fb2ead22f> | CC-MAIN-2022-33 | https://www.ablogtowatch.com/h-moser-cie-debuts-the-endeavour-tourbillon-concept-tigers-eye/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573193.35/warc/CC-MAIN-20220818094131-20220818124131-00467.warc.gz | en | 0.925005 | 1,058 | 1.5 | 2 |
One can only hope.
The story comes from The Long War Journal.
Fate of Taliban’s new leader uncertain after conflicting reports of a shootout in Pakistan
The Taliban is forcefully denying that its newly appointed leader, Mullah Akhtar Muhammad Mansour, was wounded or killed during a shootout at a meeting with other commanders in Pakistan. The jihadist group’s top two spokesmen described the reports as “absolutely baseless” rumors that are part of “propaganda efforts” by the “enemy intelligence apparatus.”
However, the Taliban has little credibility on such matters. In August, the organization’s senior leadership admitted that they hid the death of the Taliban’s founder and first emir, Mullah Omar, for more than two years.
Reports that Mullah Mansour was wounded and possibly killed first surfaced yesterday. According to AFP, Mansour was meeting with other Taliban commanders at the home of Abdullah Sarhadi, who was reportedly held at Guantanamo Bay and now serves in a leadership capacity within the group. The gathering reportedly took place in Kuchlak, a town just outside of Quetta in Pakistan’s Balochistan province. The Taliban’s top leadership council has been based in Quetta.
Sarhadi opened fire after “harsh words” were exchanged, an unnamed Taliban commander said. Afghan officials, including the spokesperson for the country’s first vice president, have supported the claim, saying Mansour was wounded and possibly killed.
The Taliban has aggressively refuted the reports, and even issued two official denials on Voice of Jihad, its official propaganda website. Yesterday, Taliban spokesman Qari Muhammad Yousuf Ahmadi said the reports of the shootout were “from the mouths of Kabul intelligence circles,” and noted that Sarhadi did not have a home in Kuchlak.
“We categorically reject this fabricated claim of the enemy intelligence apparatus,” Ahmadi continued. “Our credible sources state that Amir ul Mumineen [the leader of the faithful, Mullah Mansour] has no presence in the stated area and neither has a security incident occurred their [sic]. The enemy falsely claimed that the incident took place in the home of a commander named Mullah Abdullah Sarhadi, that despite the fact that his home is not even based in Kuchlak region.”
Ahmadi’s statement was followed today by another attributed to Zabihullah Mujahid, its other official spokesman. Mujahid denied reports in the Afghan press that the Taliban’s former Minister of Information and Culture, Mullah Amir Khan Muttaqqi, was in a position to confirm Mansour’s alleged injuries.
“Amir Khan Muttaqqi has not been in contact with any media outlet over the course of the past 14 years and neither are rumors about injury of Mr. Mansur Sahib true,” Muhajid concluded.
The Taliban’s denial that Mansour was involved in a firefight in Pakistan cannot be taken at face value. The Taliban’s top leaders, including Mansour, hid the death of Mullah Mohammed Omar, its founder and first emir, for more than two years until being forced to disclose his death last summer. (Some sources indicate that Omar was first incapacitated due to his ailments, before eventually passing away.)
The Taliban can quickly dispel the rumors by releasing an audio or video message from Mansour. This is not unprecedented. Unlike the reclusive Mullah Omar, who never released audio or video messages, Mansour has issued several statements in audio format since taking command of the Taliban.
The reports of the firefight at the leadership meeting emerged as a breakaway Taliban faction led by Mullah Mohammad Rasul has challenged Mansour’s leadership. Mansour’s followers attacked Rasul’s deputy in Zabul, Mullah Dadullah Mansour, last month. Mansour is reported to have been killed in the fighting, but his death has not been confirmed.
Rumors of firefights between top level Taliban commanders have emerged in the past, but have never been confirmed. The most trafficked account of a clash between supposed rival leaders occurred in 2009, after the US killed Baitullah Mehsud, the first emir of the Movement of the Taliban in Pakistan, in a drone strike. Pakistani officials claimed that Hakeemullah Mehsud, who eventually succeeded Baitullah, and Waliur Rehman Mehsud opened fire and killed each each other during a dispute at a meeting to pick the group’s new emir. The clash never happened, and Hakeemullah and Waliur Rehman were killed in separate drone strikes years later after working closely together to fight the Pakistani government. | <urn:uuid:17747128-7253-4d12-83e1-47c510e0c604> | CC-MAIN-2016-44 | http://holgerawakens.blogspot.com/2015/12/fate-of-talibans-new-leader-uncertain.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720238.63/warc/CC-MAIN-20161020183840-00188-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.969895 | 1,001 | 1.5 | 2 |
Odysseus was a legendary hero in Greek mythology, king of the island of Ithaca and the main protagonist of Homer's epic, the Odyssey. He was also a prominent character in the other surviving Homeric epic, the Iliad. He was the son of Laertes and Anticlea, and is well known as an eloquent speaker, ingenious and cunning.
Before the Trojan War started, Odysseus was one of the suitors that wanted to marry Helen, step-daughter of king Tyndareus of Sparta. However, the suitors were many and there didn't seem to be a way to solve who the husband would be. Odysseus told Tyndareus that he would provide a solution if he helped him marry Tyndareus' niece, Penelope. Tyndareus agreed and Odysseus proposed to draw straws. Before that, though, he made everyone swear an oath that they would all support the husband and wife in any ill fate that they might face in the future. As a result, Menelaus drew the lucky straw, while Odysseus married Penelope.
After Helen's abduction by Prince Paris of Troy, all suitors were summoned to help Menelaus in his quest to bring her back. Odysseus did not want to join the expedition, for an oracle had informed him that if he participated, it would take him a long time to return home. So, he decided to feign madness by harnessing a donkey and an ox to a plough and sowing salt on a field. Palamedes did not believe that Odysseus was actually mad, so he put Odysseus' baby boy Telemachus in front of the plough; Odysseus immediately changed course, thus exposing his plan. For this reason, Odysseus always had a grudge against Palamedes since then.
After Odysseus' plan was foiled, they all tried to recruit the hero Achilles, as an oracle said that the Trojan War would be won only if Achilles joined. Before they reached the island of Scyros where Achilles lived, his mother Thetis disguised him as a woman, because of another prophecy that said Achilles would either live a long, peaceful life, or have a glorious death while young. Odysseus made a plan to find out who Achilles was, among the women; he laid various weapons on a table, and Achilles was the only one who showed real interest in them. Odysseus then sounded a battle horn, and Achilles instinctively picked up a weapon ready to fight. As a result, Achilles joined in.
After the Greeks reached Troy and the war started, Odysseus played a particularly influential role as a strategist and advisor. He was the main character who maintained the morale of the Greeks in a high level, and managed to prevent Agamemnon from withdrawing from the war. He also managed to appease Achilles' rage when Patroclus was slain. However, holding a grudge against Palamedes, it seems that Odysseus played a role in his demise; some versions say that Odysseus made a plan to expose Palamedes as a traitor and was stoned to death. According to another version, Odysseus and Diomedes told Palamedes to descend a well because of a treasure that was supposedly hidden there; when Palamedes reached the bottom of the well, the two men buried him inside.
Odysseus was most famous in the war for his contribution to create the Trojan Horse, a huge wooden horse that was supposed to be a gift to the Trojans by the retreating Greeks. The Trojans accepted the gift joyfully and started celebrating around it. When the night fell and everyone was drunk, the Greek warriors, who had hidden in the hollow body of the horse, revealed themselves and slew the Trojans, winning the war.
After the Trojan War, Odysseus made a ten-year journey to reach his home, Ithaca; his adventures were recounted in the epic Odyssey. On his way home, storms led Odysseus' ships to the island of the Cyclops Polyphemus, who started eating the crew of the ships. Odysseus managed to trick Polyphemus and along with his companions, blinded the Cyclops. Before they left, though, he did the mistake of revealing his identity to Polyphemus, who then told his father, the god Poseidon; this had a major impact on the hero's travel, as the god sent rough seas throughout the journey.
The ships then reached the island of the god of winds, Aeolus, who put all winds except the west wind in a bag and gave the bag to Odysseus. As a result, the west wind blew the ships all the way to Ithaca. However, just before they reached the shore, Odysseus' companions took the bag of winds from Odysseus, and thinking it contained gold, opened it and released all of the winds. The ships were blown away from the island, back to where they had started. Aeolus did not accept to help them again, and they left.
They went to the island of the Laestrygonians, a cannibalistic tribe that ate all of the crew, except that of Odysseus' ship. They quickly left the island and reached that of the witch Circe. She turned Odysseus' companions into pigs, but Odysseus, who had been given a magical herb by Hermes, resisted her witchcraft. Circe fell in love with Odysseus and transformed the pigs back into men. After they stayed on the island for one year, they left to continue their voyage.
They reached the western edge of the world, where Odysseus took advice from the spirit of the prophet Teiresias, and later encountered his mother's spirit, who told him that back home, his wife Penelope was being surrounded by potential suitors. They then returned to Circe's island, who advised them on how to continue; they managed to avoid the Sirens, as well as the monsters Scylla and Charybdis.
In the island of Thrinacia, Odysseus disregarded the advice of Teiresias and Circe, and caught the cattle of the sun god Helios. Helios, enraged, demanded that Zeus punish them, or he would make the sun shine in the Underworld. Zeus obliged by causing a shipwreck in which only Odysseus survived. He reached the island of Ogygia, where the witch Calypso kept him captive for seven years, before Hermes intervened and released the hero.
Odysseus then reached the island of the Phaeacians (the modern day island of Corfu), who helped him reach his destination. He reached Ithaca late at night, and he was disguised by Athena as a beggar in order to learn what had happened during his absence. Penelope, his wife, had just announced that she would marry the person who was able to string his husband's bow and then shoot an arrow through twelve axe shafts. She knew that this was impossible to do for everyone except her husband. None of the suitors managed to do it, but Odysseus still in disguise completed the challenge and revealed himself; helped by his son Telemachus, he slew the suitors. Penelope did not believe that it was her husband but instead a god in disguise. To believe him, she asked him to move their bed to another room. Odysseus said that this was impossible, as he had made the bed and knew that one of the legs was a living olive tree.
Years later, the son of Odysseus and Circe, Telegonus, reached adulthood and wanted to meet his father. He went to Ithaca, but as he reached the shore, he killed some sheep as he was hungry. Odysseus went and fought with him, not knowing who the other person was. Odysseus was eventually killed by Telegonus. Telegonus took Penelope and Telemachus to the island of Circe, where she made them immortal. The two sons then married each other's mothers.
Odysseus Is also called Ulysses, Ulixes, Olysseus, Oulixeus, Oulixes. | <urn:uuid:47dda0d1-cfdd-4d46-91ef-82725f06ba74> | CC-MAIN-2017-04 | http://www.greekmythology.com/Myths/Heroes/Odysseus/odysseus.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282926.64/warc/CC-MAIN-20170116095122-00395-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.98649 | 1,758 | 3.25 | 3 |
Cost of living in Gujranwala, Pakistan compared to Al Ain, United Arab Emirates
|Personal Care||- 35%|
WARNING! This comparison is based on only a few data points. At this point it is only a guess. It is based on 120 prices entered by 15 different people.
These prices were last updated on January 03, 2017. Exchange rate: 0.03508 AED / PKR *
Do you live in Al Ain? We need your help!
What do you think about this comparison?
Cost of living in Gujranwala (Pakistan) is 47% cheaper than in Al Ain (United Arab Emirates)
For example, to keep the same standard of living that would require Dirham 18,750 in Al Ain you would need to make just about Dirham 9,845 (₨280,656) in Gujranwala.
Recent Prices Added
- Monthly rent - 85 m2 furnished accommodation in expensive area in Amman costs Dinar 339 (9 minutes ago)
- Weekly rent - 2 bedroom (85m2) furnished accommodation in expensive area in Melbourne costs AU$2,580 (23 minutes ago)
- Basic lunchtime menu (including a drink) in the business district in Alto Barinas costs Bs 3,000 (about 1 hour ago)
- 1 month of gym membership in business district in Las Vegas, Nevada costs $20 (about 1 hour ago)
- One-way ticket in public transport in Tampa, Florida costs $2,500 (about 1 hour ago)
- 1 kg of rice in Tel Aviv costs 10 ₪ (about 1 hour ago) | <urn:uuid:64b18e87-4d77-4c28-8d24-872d61540277> | CC-MAIN-2017-04 | https://www.expatistan.com/cost-of-living/comparison/al-ain/gujranwala | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281574.78/warc/CC-MAIN-20170116095121-00019-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.895559 | 343 | 1.59375 | 2 |
Community Navigators are trusted community members who receive specialized training to provide quality immigration assistance for their communities in an empowering and effective way. The ultimate goal of the training program is to build the capacity of community-based organizations to serve immigrant communities, develop the leadership of immigrants and refugees, and to prevent the unauthorized practice of law.
PICC’s Community Navigator Curriculum is inspired by the CIRI National Community Navigator Training, aimed at building capacity and increasing community driven legal services for naturalization and DACA efforts after President Obama’s November 2014 announcement for an expanded DACA and DAPA program. While DAPA and expanded DACA did not go into effect, there is still a high need and demand for Community Navigators.
The PICC Community Navigator Training Program is adapted to the needs of immigrant and refugee communities in Pennsylvania. After completing the training program, PICC Community Navigators will:
- Understand the basic of immigration law and the current enforcement policies.
- Be able to organize and lead community education workshops on Know Your Rights and Deportation Defense. Community Navigators will be key to protect communities through existing immigration relief and empower communities with information about their rights
- Learn basic presentation and advocacy skills. Community Navigators will also become skilled and empowering leaders in the larger immigrant rights movement supporting efforts at city, state and national levels.
PICC has designed a certification program for community members and leaders to become certified Community Navigators. In order to become a PICC certified Community Navigator, participants must:
- Complete the PICC Community Navigator Certification Agreement
- Attend the entire Community Navigator Core Curriculum
- Complete and submit all follow-up review worksheets
- Update the training log after attending each training module
- Submit a completed certification agreement and training log
- Commit to volunteering at, or organizing, a minimum of 3 community information sessions or legal clinics
PICC staff will review all materials submitted by participants and award certificate of completion to all who qualify. All certified Community Navigators will receive recognition at our annual Statewide Immigrant and Refugee Rights Convening. Undergoing the certification process is encouraged, but not a requirement, to attend any of our trainings. | <urn:uuid:835d86bc-02ca-438b-9b7c-39a44a57b39a> | CC-MAIN-2022-33 | http://paimmigrant.org/capacity-building/community-navigator/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570692.22/warc/CC-MAIN-20220807181008-20220807211008-00675.warc.gz | en | 0.939748 | 460 | 1.765625 | 2 |
Ornis Hungarica. vol.8 Suppl. 1.. (1998) p.79-86.
Mi szabályozza a sárgafelyű királykák (Regulus regulus) ivararányát?
The Goldcrest (Regulus regulus) is a partial migratory species. In both the resident populations wintering in Scandinavia and the migratory populations travelling to Southern Europe in autumn, the proportion of males is higher. In the wintering population, the survival of females is significantly lower. Our research was carried out between 1983-1994 in the Ócsa Bird Ringing Station (Central Hungary) and between 1993-1994 in the Italian Alps near Bergamo (Ganda) . At Ócsa, Goldcrests were ringed in both migratory seasons, while at Ganda only in the autumn. The birds were captured with mist-nets; biometric data were taken using the methods of Actio Hungarica. Sex ratio,, migration dynamics, the proportion of recaptured birds, the amount of reserved body fat of migrants and the changes of body mass of stopovering birds were examined. During autumn migration there were more males at both sites. The average sex ratio in 6csa was 20.2: 1, while in Ganda 20.9: 1. In spring, the sex ratio is reversed, but more balanced, 0.92:1. In autumn we found no difference between the migration dynamics of the two sexes at either sites. 50% of both males and females migrated in Ócsa as well as in Ganda between 22-25. October. In spring, males migrated earlier: 50% of males arrived at 6csa on March 29, while that of females on April 3. There were no recaptures at Ganda. At Ócsa, the proportion of recaptures was equal in both sexes (10-12%) in the autumn, whereas in spring twice as many females spent more than two days in the area than males (I 7-37%). The fat reserves of males and females during the autumn migration did not differ, but at Ganda the fat reserves of both sexes were significantly lower than at Ócsa. During the spring migration the condition of females was much better than that of males. Body mass of the latter did not increase even during stopover. As a conclusion we can say that the earlier and faster migration of males is the factor which increases their mortality, reversing the sex ratio of Goldcrests before they reach their breeding site. | <urn:uuid:e3c0a85a-2f3b-4cfb-9dd0-f50872ada574> | CC-MAIN-2022-33 | http://ornis.hu/?download&aid=116&volume_id=8&lang=hun | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573667.83/warc/CC-MAIN-20220819100644-20220819130644-00069.warc.gz | en | 0.964567 | 555 | 2.90625 | 3 |
The other day, Brayden (4) brought this home from preschool. This week, they are learning about dinosaurs and it is also the letter D week. I thought it was really creative.
I would say this is for the two year old on up. If you have an 18 month old or so who you think would do well with this activity, go for it!
- Picture of a D. They did both uppercase and lowercase. You could do one or both. You could print it or draw it. Here is a link to a block letter: http://familycrafts.about.com/library/color/blcapitald.htm. Or you can make it in Microsoft Word. To do that: (1) Open Word. (2) Go to File>Page Setup. A new window will open. (3) Under Margins, change all margins to .5. (4) Under Orientation, click Landscape. (5) Click OK. (6) Type a capital D and a lowercase d. I would put a space between the two. (7) Highlight the letters. (8) Change the font to Arial. (9) Change the font size to 460. (10) Go to Format>Font. A new window will open. (11) Under Effects, check the Outline box. (12) Click OK. You are now ready to print!
- Construction paper.
- Dot stickers.
- Dinosaur sticker.
- Dog sticker (or any other "D" word sticker you want to use).
- Print your D picture.
- Either cut out or draw lines for your child to cut out a door for each D (D and d).
- Have your child put a D sticker (duck, donkey, dinosaur, dog, etc.) in the center of the capital D and one in the center of the lowercase D.
- Have your child decorate the D's with dots.
- If you want your child to cut out the doors, have him do so.
- Have your child glue the doors in place to cover the D stickers.
Here are two photos of Brayden's D picture.
You will notice that this picture is hanging on the fridge. You have probably read this a million times, but display the artwork your children do. I hang the kid's pictures on the fridge as soon as they are done (or as soon as the glue dries). I always make a big deal about it.
If you are the type who hates to hold on to stuff and want to throw it away, don't do it in front of your child :) If you are the type who hates to throw stuff away, you can take pictures of it and just keep a few things. | <urn:uuid:f722f578-2bbd-4f8f-9d3e-74799910bcb6> | CC-MAIN-2016-44 | http://learningdevelopmentactivities.blogspot.com/2009/09/letter-picture-d.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721405.66/warc/CC-MAIN-20161020183841-00313-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.938576 | 574 | 2.984375 | 3 |
Using spell check in Word can prevent errors from appearing. Use the Word spell check function to produce error-free Word documents.
Checking spelling and grammar
Video: Spelling and Grammar in Word 2010Watch the video (3:07).
To make your document appear professional, you'll want to make sure it is free from spelling and grammar errors. Word has several options for checking your spelling. You can run a spelling and grammar check, or you can allow Word to check your spelling automatically as you type.
Optional: You can download this example for extra practice.
To run a spelling and grammar check:
- Go to the Review tab.
- Click on the Spelling & Grammar command.
The Spelling & Grammar command
- The Spelling and Grammar dialog box will open. For each error in your document, Word will try to offer one or more suggestions. You can select a suggestion and click Change to correct the error.
Correcting a spelling error
- If no suggestions are given, you can manually type the correct spelling.
Typing a correction
The spelling and grammar check is not always correct. Particularly with grammar, there are many errors Word will not notice. There are also times when the spelling and grammar check will say something's an error when it's actually not. This often happens with people's names, which may not be in the dictionary.
If Word says something is an error, you can choose not to change it. Depending on whether it's a spelling or grammar error, you can choose from several options:
For spelling "errors"
- Ignore Once: This will skip the word without changing it.
- Ignore All: This will skip the word without changing it, and it will also skip all other instances of this word in the document.
- Add to Dictionary: This adds the word to the dictionary so it will never come up as an error. Make sure the word is spelled correctly before choosing this option.
For grammar "errors"
- Ignore Once: This will skip the "error" without changing it.
- Ignore Rule: This will skip this "error" and all other instances that relate to this grammar rule.
- Next Sentence: This skips the sentence without changing it and leaves it marked as an error. This means it will still show up if you do another spelling and grammar check later on.
If you're not sure about a grammar error, you can click Explain to see why Word thinks it's an error. This can help you determine whether you want to change it. | <urn:uuid:e6d4fcca-739d-4d83-8e7d-a2940bac9120> | CC-MAIN-2017-04 | http://www.gcflearnfree.org/word2010/checking-spelling-and-grammar/2/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280364.67/warc/CC-MAIN-20170116095120-00026-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.866532 | 527 | 3.15625 | 3 |
Terra cotta flower pots make serviceable baking vessels for small breads and tea cakes, provided you use unglazed, undecorated pots and season them properly. Cornbread studded with chili peppers looks at home in the rustic pots, as does hearty zucchini-walnut bread. For more experienced bakers, individual yeasted breads can also be cooked as mini-loaves in the pots. After the treat is done, the pots themselves become a secondary gift, useful for growing flowers and herbs.
Wash the terra cotta pots in hot, soapy water. Wipe them dry and set them upright to dry further.
Heavily grease the inside and outside of the terra cotta pots and set them on a baking sheet. Bake the pots in a 300-degree Fahrenheit oven for 30 minutes before removing the pots.
Let the pots cool. Then regrease and re-bake them at the same temperature for another 30 minutes. Allow them to cool a second time.
Cut circles of aluminum foil sized to fit the bottom of the pot. Grease both sides of the circles and set them at the bottom of the pots.
Snip out rectangles of foil sized to the inner sides of the pots. Grease both sides of the rectangles and press them into the interior walls of the pots. The inner pots should now be completely covered in foil, with the foil side that is facing outward greased.
Quick Breads and Tea Cakes
Set oven to 400 F.
Mix together dry ingredients in the larger bowl. Whisk together wet ingredients in the smaller one. Make a well in the dry ingredients and add the wet ingredients, stirring until the mix is well-incorporated and lump-free. Gently blend in any additional ingredients.
Spoon batter into the terra cotta pots so that each is about two-thirds full.
Put the pots on a baking sheet and set the baking sheet in the oven. Set the timer for 15 minutes. The baking may take 20 minutes or longer, depending on the density of the cake or bread.
Remove the pots when a toothpick inserted in the center comes out clean.
Take the pots off the baking sheet and set them on wire racks to cool.
Set oven to 400 F.
Mix yeast with warm water and sugar, according to your recipe.
Incorporate the yeast mixture into the other ingredients until it forms a dough.
Knead the dough on a floured surface until the dough turns smooth.
Leave the dough to rise in an oiled bowl until it doubles, then punch the dough down.
Divide the dough equally among the seasoned, foiled and greased flower pots.
Let the dough double a second time, this time in their individual pots.
Put the pots on a baking sheet and set them in the preheated oven.
Set the timer for 25 minutes. The baking may take 30 minutes or longer.
Remove the pots when the crusts are golden and sound hollow when tapped.
Set the pots on wire racks to cool. | <urn:uuid:427510d1-2d8d-43bc-89f4-0d02b6bc36bd> | CC-MAIN-2017-04 | http://www.livestrong.com/article/443734-how-to-bake-bread-or-cake-in-terra-cotta-pots/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280410.21/warc/CC-MAIN-20170116095120-00457-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.900068 | 639 | 1.898438 | 2 |
Какво казват хората - Напишете рецензия
Не намерихме рецензии на обичайните места.
Други издания - Преглед на всички
Abraham Abram according affection afterwards ages answer appears become believed better blessing brethren brother called Canaan cause Chap character Christ concerning conduct considered covenant daughters death desire directed DISCOURSE divine earth Egypt Esau evil example express eyes faith father fear feel follow give given God's greater hand hath heart heaven honour hope instance Isaac Israel Jacob Jehovah Joseph kind king land language leave light live look Lord manner means merely mind natural Noah object Observe occasion offering pass posterity present probably promise reason religion render respect righteousness sake seed seems seen servant Sodom sons speak spirit suppose taken thee things thou thought true unto waters whole wife
Страница 115 - Ye are the children of the prophets, and of the covenant which God made with our fathers, saying unto Abraham ; And in thy seed shall all the kindreds of the earth be blessed. Unto you first, God, having raised up his Son Jesus, sent him to bless you, in turning away every one of you from his iniquities.
Страница 399 - O my soul, come not thou into their secret; unto their assembly, mine honour, be not thou united! For in their anger they slew a man, and in their self-will they digged down a wall. Cursed be their anger, for it was fierce, and their wrath, for it was cruel. I will divide them in Jacob and scatter them in Israel.
Страница 336 - A woman when she is in travail hath sorrow, because her hour is come : but as soon as she is delivered of the child, she remembereth no more the anguish, for joy that a man is born into the world.
Страница 213 - What man is this that walketh in the field to meet us? And the servant had said, It is my master: therefore she took a vail, and covered herself.
Страница 414 - God will surely visit you, and bring you out of this land unto the land which he sware to Abraham, to Isaac, and to Jacob.
Страница 67 - And the Lord said, I will destroy man, whom I have created, from the face of the earth ; both man and beast, and the creeping thing, and the fowls of the air; for it repenteth me that I have made them.
Страница 313 - And he knew it, and said, It is my son's coat; an evil beast hath devoured him ; Joseph is without doubt rent in pieces.
Страница 243 - And give thee the blessing of Abraham, to thee, and to thy seed with thee ; that thou mayest inherit the land wherein thou art a stranger, which God gave unto Abraham.
Страница 73 - Neither shall thy name any more be called Abram ; but thy name shall be Abraham : for a father of many nations have I made thee. | <urn:uuid:cb510f5a-240e-48a1-850e-db162cc61c21> | CC-MAIN-2022-33 | https://books.google.bg/books?id=9pAPAAAAIAAJ&dq=editions:HARVARD32044029914702&lr=&hl=bg&output=html&source=gbs_navlinks_s | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00672.warc.gz | en | 0.907813 | 890 | 1.640625 | 2 |
David Gill asked what we might want for Web 3.0. For my part, it's more stability, meaning widespread implementation and adoption of stable references that we can all use in the ongoing conversation that we are having on our blogs and in our digitally-implemented scholarship.
On this blog, I have already made reference to Worldcat.org as one kind of stable reference that we can all point to when citing a book. In doing so I praised librarians. A task that librarians have not taken on via their catalogs is the indexing of the contents of their holdings. Not being a trained librarian, I don't want to misspeak but it is my understanding that the discipline has had an historic focus on the cataloging of physical objects - books, journal volumes, etc. - rather than on cataloging the discrete bibliographic entities within those physical objects. I.e., librarians don't separately describe the articles in a particular journal volume.
In a networked world, it's the individual article that we care about, rather than its appearance in a particular physical volume. The Handle.net system is becoming a widely adopted standard for making unambiguous and stable references to individual digital objects, such as published journal articles. For example, http://hdl.handle.net/10.2972/hesp.75.4.453 is a stable reference to an article in Hesperia 75.4 (2006). Of course, you have to have an affiliation with a subscribing institution or pay money as an individual to read this article, but that observation is part of the conversation initiated on this blog by Chuck Jones' earlier post. Charles Watkinson, listed as an AWBG Contributor, has shepherded Hesperia into this world of stable references and that is a good thing.
It can be a hassle to find Handles for particular articles but I have had reasonable luck using Crossref.org's DOI lookup form. Unfortunately, it is still the case that the vast majority of published articles have no widely used and computationally actionable identifiers.
Another form of stable reference is the geographic entities being defined by the Pleiades Project. Here, the link http://pleiades.stoa.org/places/639166 is a stable reference to the record for the site of Xanthos in Lycia. Pleiades has a sophisticated data model which I encourage readers to explore, but let me just say for now that the project has established concisely composed URLs, such as that for Xanthos, that stand as usable infrastructure in a network-based historical geography of the ancient world. Tom Elliot, again an AWBG Contributor, has posted about the form and longevity of Pleiades URLs at his Horothesia blog.
For texts, I look forward to the widespread adoption of the Canonical Text Services (CTS) protocol, which is the work of Neel Smith and Chris Blackwell. CTS defines itself as "a network service for identifying texts and for retrieving fragments of texts by canonical reference". In this scheme, "urn:cts:greekLit:tlg0012.tlg001" is an unambiguous reference to the Iliad that leverages the existing Thesaurus Linguae Graecae Canon of Greek authors.
Why does reference stability matter? I suspect that for many readers of this blog this is not a necessary question. We're interested in substantive conversations about the ancient world and the analogy between linking and source citation is well understood. I am interested in the extent to which stable references will make conversations more discoverable. The use of links into Worldcat.org should make it more likely that I can find your reference to a particular book. Right now, Google does not do a good job of enabling such discovery. The link http://www.google.com/search?q=link%3Ahttp%3A%2F%2Fworldcat.org%2Foclc%2F144767610 does not return the blog post that made reference to this book. I do hope that in the near future the use of stable references will help bind together discrete contributions into a continuous conversation about the ancient world. | <urn:uuid:17d157c4-7e25-4e71-8a15-c069b6f1c1ad> | CC-MAIN-2017-04 | http://ancientworldbloggers.blogspot.com/2007/12/wishing-everybody-stable-new-year.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282926.64/warc/CC-MAIN-20170116095122-00399-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.937387 | 864 | 1.734375 | 2 |
Graves' Disease or Graves' disease, Graves' disease is a disease that is characterized by increased thyroid function, accompanied by an increase in its size, due to autoimmune processes in the body. Autoimmune diseases occur when the immune system defect, where the immune system in the human body produces substances damaging its own cells. In the case of diffuse toxic goiter lifotsity produce abnormal protein that stimulates the thyroid gland. This protein is called "long-acting thyroid stimulator."
For reasons that can cause hyperthyroidism include:
long-term chronic foci of infection in the body.
Especially often contribute to the emergence of diffuse toxic goiter chronic angina. Increased risk of Graves' disease with other autoimmune processes (diabetes, Addison's disease, gipoparatiroz, vitiligo).
Contribute to the emergence of toxic goiter and various viral infections. Possible occurrence of the disease after the introduction to a survey of radioactive iodine. The frequency of diffuse toxic goiter is quite high: one of the ill 100. Diseases of the subject people of all ages, but most women suffer from the young and middle age.
In the early stages of disease can occur unnoticed. In addition, the clinical manifestations of Graves' disease are so varied that it may hinder the correct diagnosis. At the beginning of the disease the patient may complain of sleep disturbances, mood changes, increased sweating, seizures, palpitations, tremors in the fingers. More specific evidence is weight loss, with normal appetite and poor tolerance of heat. The patient was hot even in cold weather.
Over time, the tremor becomes more pronounced, could shake the entire body. Patients fussy, their skin is moist. There is a dark color of the skin throughout the body, most pronounced in the century. Sometimes there is a seal skin in the legs and feet in a dense swelling. The thyroid gland grows, it becomes noticeable to the eye. When probing is usually dense and painless.
Specific symptom for Graves' disease are changes in the eye. His eyes sparkle, they are wide open (symptom dalrymple), flashing rare. When looking down with eyes open there is a white stripe above the pupil, although the rate of the eyelid is usually omitted after the eyeball. The eyeball is enlarged and protruding. The eyelids may be swollen. Because eating disorders can eyeball join different types of infections and conjunctivitis occur (inflammation of the mucous membrane of the eye). Eating disorders occur eyeball, there is optic neuritis. Ultimately, all these changes can lead to blindness.
One of the more severe manifestations of Graves' disease are disorders of the cardiovascular system. The patient was concerned about heart palpitations, persisting even during sleep, lead to abnormalities in heart rhythm. Many older patients having angina. Increased blood pressure. Life-threatening outcome may be heart failure.
Under the influence of increased thyroid function increased motility of the gastrointestinal tract, nausea, sometimes vomiting, and diarrhea. Excess thyroid hormone causes toxic effects on the liver and can develop fatty liver. The defeat of the thyroid hormones, central nervous system characterized by the occurrence of headaches, insomnia, dizziness, anxiety. Excess thyroid function usually leads to disruption of other endocrine organs. Disrupted gonads. In women, it may be accompanied by a violation of menstrual dysfunction, infertility. In men, reduced potency. Reduced production of hormones by the adrenal cortex. Violated the exchange of glucose and increased risk of diabetes.
The stream there are three degrees of goitre:
In mild form of the patient's condition is satisfactory. The heart rate does not exceed 100 beats per minute. The weight is reduced by no more than 10%.
The average degree of diffuse toxic goiter is characterized by a heart rate above 100 per minute, high blood pressure, weight loss of up to 20% of the original.
In severe the patient's weight is reduced by more than 20%, heart rate 120 per minute, there are signs of other organs and systems.
The diagnosis of Graves' disease is on the basis of clinical presentation, probing thyroid ultrasound study of thyroid hormones in the blood.
Treatment of diffuse toxic goiter. The main treatment for Graves' disease with medication. Prescribers, suppress thyroid function - tirostatiki (tiamazol, carbimazole, propitsil). At the beginning of treatment to high dose, which is then reduced. Treatment is carried out under the control of thyroid hormone in the blood and continues until the complete elimination of symptoms of diffuse toxic goiter but not less than 12 months. In addition, use of beta-blockers, levothyroxine, immunocorrectors glucocorticoids.
In the absence of the positive effect of medication surgical treatment of diffuse toxic goiter. Of the thyroid gland is removed. However, surgery does not eliminate the cause of the disease. Another method of treatment after failure of drug therapy can be treated with radioactive iodine. It is carried out only for the older group of patients nedetorodnogo age. The method of treatment is based on damage to radioactive iodine thyroid cells, thus achieving a reduction of its function. | <urn:uuid:9bb1e4c5-9fcd-4d0c-ad21-937de877fd45> | CC-MAIN-2017-04 | http://eurodoctor.ucoz.com/blog/graves_disease/2012-01-27-25 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280763.38/warc/CC-MAIN-20170116095120-00520-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.920028 | 1,072 | 3.140625 | 3 |
Wind energy – floating wind
BOA has successfully launched the Tetraspar Demonstrator Floater and Keel by use of the semi-submersible Boabarge 21 (92m x 31.5m x 6.71m) in the port of Grenaa, Denmark.
The floater and keel was loaded-out by means of SPMTs and floated-off the Boabarge 21 in 2 consecutive operations. Each operation was executed in close cooperation between project teams of BOA and BMS, whereas BMS took charge of the loading operation while BOA took charge of shifting, ballasting and submersion of the Boabarge 21 and float-off of the TetraSpar units.
Following the final assembly of the wind turbine, the combined structure will be towed and installed at the Marin Energy Test Center (Metcentre), off Stavanger. | <urn:uuid:609dd806-2c30-493f-9939-810216e19604> | CC-MAIN-2022-33 | https://ocean-energyresources.com/2021/08/16/tetraspar-wind-turbine-foundation-and-keel-launched/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00066.warc.gz | en | 0.933552 | 182 | 1.5 | 2 |
The tradition of Samkhya is one of the oldest and most influential in the intellectual history of India. The fundamental notions of Samkhya namely prakrti, purusa, buddhi, ahamkara, manas and the three gunas provided the conceptual framework in which much of Indian philosophizing occurred, and the classical formulations of Yoga and Vedanta together with many traditions of Buddhist philosophy and meditation developed vis-a-vis the intellectual perspective of the Samkhya. Similarly on a general cultural level the influence of Samkhya was profound and important over many centuries in such areas as law, medicine, ancient science and mathematics, logic, mythology, cosmology and ritual.
About the Author:
Gerald James Larson is Rabindranath Tagore Prof. of Indian Cultures and Civilizations, and Director of the India Studies Program at Indiana University, Bloomington, USA. Prof. Larson’s area of specialization in South Asia philosophy and religion. He is the author numerous books and articles on Indian thought. His most recent book is India’s Agony over Religion (State University of New York Press, 1995, and Oxford University Press, Delhi 1977). | <urn:uuid:af5f5e86-07f6-4768-8ef6-1e871f2dbb03> | CC-MAIN-2022-33 | https://www.vedicbooks.net/classical-samkhya-interpretation-history-meaning-p-16536.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571911.5/warc/CC-MAIN-20220813081639-20220813111639-00474.warc.gz | en | 0.877671 | 246 | 3.25 | 3 |
Virtually everyone in the US agrees that things are not what they should be for the common citizen. First glance criticism points at inbred party politics; others are concerned about the shifting economy that takes growth and reward from working classes and feathers the nests of capitalistic oligarchs; others worry that the cash-rich special interests own Congress through donations, favors and intense lobbying.
All these issues are real and burdensome. But they are political in nature, that is, these issues affect the rituals of governance. There are larger issues that affect the doctrine of our nation, its Constitution, its court systems and the relationship between State governments and the Federal government. Some doctrinaire issues are:
֎The US Supreme Court is the only ‘appointed for life’ court among other nations with similar high courts. When times change slowly, as they did before the telegraph, telephone, television, and computerized decision making, perhaps life time appointments were satisfactory. Today, as everyone is aware, culture, science, technology and economics are changing at lightning speed. Given the constraints of knowing most about one’s own developmental years and less about current society as one grows older, is it relevant that lifetime, politically anointed appointments degrade the decision quality of the Supreme Court? Thinking differently, should judges be rotated?
֎Gerrymandering and a politically controlled census process seem to be just political at first glance but coupled with voter suppression not only at the polls but not allowing voting via modern techniques e.g., mail-in and email ballots, party or government manipulation of voter registration records and the idea of an Electoral College – together permit a virtual plutocracy to exist hidden beneath a plethora of manipulative laws and regulations. Mariner need only point out that he and his wife were not allowed to vote for their candidate in the last Presidential primary. One person, one vote has not existed for a century or more.
֎The United States Senate is an old fix to encourage the original States to go along with new Federal powers that impinged on the independence of states at the time. In fact, voters did not have a say in their Senator’s appointment until 1913 when the 17th amendment was ratified. Still, the representation stayed at two senators per State rather than integrating their election into a population-based representation. As a consequence, today, 12% of the US population elects 60% of the Senate. Ironically, the fewer citizens a State has, the more powerful is their voice in the Senate. Politically this means that farm states, low population states like Idaho, Montana and North Dakota – all typically conservative because of the lack of industrial cities and population density – are able to sway the Senate voting power in a way that does not genuinely represent the common US voter.
One wonders why the gun issue cannot be resolved – could it be the Senate with 60 % of the vote coming from rural and underpopulated states that do not have inner city gun murders on a daily basis, does not care so much? Mariner suspects hot issues like guns, prioritized education and comprehensive discretionary funding similar to welfare, health and career opportunity will remain unresolved because the Senate is intrinsically biased.
It was a man in West Virginia recently who said to a reporter that it was time the Senate was eliminated. Perhaps he is right. | <urn:uuid:ffc80140-1876-440d-9f9d-0f4370168fdd> | CC-MAIN-2022-33 | https://www.iowa-mariner.com/the-united-states-senate/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.37/warc/CC-MAIN-20220809003642-20220809033642-00666.warc.gz | en | 0.963981 | 679 | 2.6875 | 3 |
Gold mining in the Amazon Basin near Huepetuhe, Madre de Dios, Peru (1998). © J. Ashley Nixon
One of the most significant announcements made in COP 26 was the Glasgow Leaders’ Declaration on Forest and Land Use. Around 130 leaders, who collectively account for 90 percent of the world’s forests, signed this commitment to halt and reverse forest loss and land degradation by 2030. It’s a strong public statement that might, at face value, support forests enough for them to continue operating as critical carbon sinks and mitigate the effects of climate change.
The Glasgow and New York Declarations
The Glasgow initiative follows previous ones, such as the 2014 New York Declaration on Forests (NYDF), endorsed by 40 governments, whose goals included halting natural forest loss by 2030 and restoring 350 million hectares of degraded landscapes and forestlands. NYDF assessments have consistently found that the world is not on track to meet this 2030 target. Forest loss has continued to rise, and forest restoration is progressing very slowly. In their own words, the NYDF concedes that “Finance for forests covers only a small fraction of what is needed to save and restore forests. The world is far from realizing the full potential of forests as an essential climate solution.”
From the Clyde to the Amazon
There are some signs that the Glasgow declaration has a better chance of success. More countries signed up for it, including China, Russia and Brazil, but can you trust Bolsonaro given his track record on the protection of the Amazon? More money was pledged ($22.4 billion), including ear-marked capital for the Congo Basin and support for forest stewardship provided by Indigenous Peoples and communities. Significantly, the Glasgow Declaration is rooted in sustainability. Provisions for livelihoods and alternative income for those who otherwise might engage in deforestation are included. And there is support for indigenous and other communities that wish to prevent it but are either out of their league or in grave peril if they stick up for the trees.
It’s a long way, geographically, culturally and economically, from the banks of the River Clyde, where the Glasgow Declaration was signed, to the Amazon Basin. Deforestation has led to colossal forest area losses and further damage through fragmentation and secondary development due to logging, agriculture, and mining. Sometimes this has been encouraged by national policies; often, it has been allowed through a combination of corruption and the inability of governments to regulate and control development in these remote locations.
Deforestation and gold mining in Madre de Dios, Peru
Madre de Dios is a region in southeastern Peru’s Amazon Basin, bordering Brazil and Bolivia. It’s a vast (over 85,000 km2), remote and densely forested area that includes Manú National Park, a World Heritage site and one of the world’s most precious biodiversity hotspots. Also located there is Tambopata National Reserve, whose old-growth rainforest is at risk from the ongoing surge of artisanal small-scale mining (ASM).
I first visited Madre de Dios in 1998, specifically to see unregulated ASM operations around the town of Huepetuhe, when I was working on Project PALMA, an initiative to improve capacity for environmental management in Peru’s mining industry. The visit required an eight-seater plane chartered from Cusco, then a truck journey around the Madre de Dios River tributaries. It was a journey filled with tears, surprise and anger around the profligate environmental disrespect I saw.
The terms ‘artisanal’ and ‘small-scale’ belittle the scale of these gold mining impacts. Miners had created a delta of rivers from the forest. Yellow Volvo bulldozers rammed through ever-widening riverbanks, scooping up carbon-rich topsoil to pass through wooden contraptions fed with pumped water. Down the chutes a slurry would go, the heavier particles trapped in a black carpet that periodically would be rolled up and taken to a plastic bin laden with mercury to agitate and amalgamate the gold flecks out of the sediment.
Later, we would see miners’ take their findings to a street of shops built on stilts above a flooded landscape. Their precious flecks and nuggets were heated. The fumes of oxidized mercury rose through a filterless chimney and dissipated into the air breathed in by everyone living in Huepetuhe. It was an additional heavy metal dose to the one these economic migrants were already consuming and accumulating from the quicksilver contaminated local water. The golden prize would be weighed, bought, then transported to Lima, then to Switzerland or other world markets. From that day, it felt that turning Amazon Forest into earrings was the wrong type of alchemy.
Despite efforts by the Peruvian authorities to curtail illegal and environmentally damaging gold mining in Madre de Dios, the industry continues at a high pace, fueled by global prices and demand for gold. High-resolution remote sensing data mapping by Gregory Asner and colleagues revealed that the cumulative forest loss between the 1990s to 2016 was approximately 70,000 hectares.
The Glasgow Declaration must support socio-economic reforms, alternative local livelihoods, and effective forest management through programs such as REDD+ (Reducing Emissions from Deforestation and Degradation) in an accountable, corruption-free manner to avert artisanal small-scale gold mining. Otherwise, the negative impacts on biodiversity, water quality, human health, and the service forests provide humankind to sequester carbon and mitigate climate change will grow even further out of control.
PeruZine from Betula Books
A series of short, limited edition publications exploring people and places in Peru has been launched by Betula Books. It’s called PeruZine. If you would like to receive a free download of the first edition, which includes images of gold mining in Madre de Dios, simply click on the button below, tell me where to send it in the mailing list and it will be on its way to you! | <urn:uuid:7a9f9ff9-1180-446a-b025-23082840397e> | CC-MAIN-2022-33 | https://nixonscan.com/2021/11/08/deforestation-gold-and-climate-change/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00065.warc.gz | en | 0.94893 | 1,246 | 3.328125 | 3 |
New refugee aid worker: cell phone
Technology speeds unification of families who have been separated in
BRAZDE REFUGEE CAMP, MACEDONIA — In a stuffy tent in northern Macedonia, a half-dozen Kosovar Albanians are yelling into mobile phones, one hand cupped over one ear. Another 100 Albanians patiently await their turn.
One of the callers is Antigona. She's on the phone to Albania, where she's finally tracked down her aunt and uncle. During the chaos of NATO airstrikes against Yugoslavia and Serbian "ethnic cleansing," the couple were separated from their four children. So the kids fled Kosovo with Antigona's family.
Now, after a series of calls between relief officials and refugee camps in Macedonia and Albania, a family reunion is in the works in two of Europe's poorest countries.
"I've never been in a refugee situation in an area where there was a cellular phone network," says Mike Aaronson, director general of London-based Save the Children, who has also worked in Iraq, Ethiopia, and Sri Lanka. "It's surreal."
Mass expulsions, as seasoned relief officials point out, usually happen in the third world, where the communication infrastructure is typically dismal. Having such barbarism occur in an otherwise modern Europe, paradoxically, has at least one upside: use of that most modern, most convenient of communication devices.
With Kosovo, mobile phones are indeed expediting the task of reuniting lost children with their parents. Sure, some efforts are still plagued by bureaucracy and miscommunication, say relief officials. But mobiles, despite aggravating busy signals and fickle connections, enable the various "tracing" agencies to overcome their primary challenge in the Kosovo crisis: refugees scattered across several borders.
Less successful has been an attempt to take family tracing to the next level: the World Wide Web. A Macedonian group has created an ambitious Web site for the thousands of Albanian families searching for missing relatives. It may be useful for notifying the Albanian diaspora, but for the hundreds of thousands of refugees living under tents - or in the mud - accessing the Internet sounds, well, a bit odd.
Still, this is a far cry from the Rwanda genocide of 1994, which set the modern-day standard for handling refugee crises.
As many as 1 million perished, and, in many cases, a single child survived while dozens of his relatives had been killed. Western relief officials there compiled a databank of a staggering 80,000 "unaccompanied" children. But they relied on old-fashioned methods to gather and disseminate information about the kids: walkie-talkies, bullhorns, photo displays, fliers, and mass gatherings. Westerners spent two years in Rwanda working their way through the caseload.
The Kosovo numbers pale in comparison. Since the NATO bombardment began March 24, more than 600,000 ethnic Albanians have reportedly been uprooted. It's unclear how many lost children or missing adults there are overall. But in Macedonia, for example, where the UN estimates 133,000 refugees have landed, Save the Children has recorded, as of last Wednesday, 892 adults looking for children and 281 kids looking for parents.
Unlike Rwanda, you don't have scores of children wandering around alone, says Simon Harragin, Save the Children's family-tracing coordinator and a veteran of the relief efforts in Rwanda and Zaire. With such relatively manageable numbers, tracing officers can go tent to tent, investigating an individual's whereabouts.
UESTIONING friends and neighbors - learning the context - was a key lesson learned in Rwanda, Mr. Harragin says. "There was a tendency to pick up a kid from the side of a road, take them out of the conflict, and put a nice, institutional roof over their head," he says, noting the vast numbers of orphanages built to accommodate them. "But that's not the best solution. You need to find a parent, or a relative, because that's for the rest of their lives."
The Kosovo situation is unique in that virtually all its 2 million Albanians have family in Albania or Macedonia. At some camps, relatives are visiting, meeting with friends and family, and using the informal community network to search for others. It helps that some refugees actually brought their mobile phones with them.
"They're doing most of their own spadework," Harragin says. "We're just facilitating." He says a dozen or so cases have been closed so far, with the families reunited and the paperwork filed.
To speed up the process, there is talk of using Albanian-language media, such as radio and newspapers. One Albanian newspaper already distributed free in the camps may soon include fliers with names of the missing or "unaccompanied." Likewise, radios may be passed out in the camps, with Albanian-language broadcasts of lists of names. The BBC provided a similar service during the Bosnian conflict.
Still, there will be the occasional glitch in tracing, especially this early in the conflict. With so many international agencies out in the field, they say there's bound to be overlap and duplication. CARE, for example, brought together a deaf-mute boy with his mother last week after they'd been separated and sent to different camps. But in a second case, they discovered the family had already been reunited.
"Of course we're very happy about the reunification, that goes without saying," said Melissa Ward, CARE's international program manager. "But we're a bit concerned that we had crossed wires...."
Nevertheless, you likely won't hear the Albanian refugees complaining about too many chefs in the kitchen.
Back at the Brazde Camp, Antigona's cousins excitedly wait to see their parents, who are being sheltered in a private home in the Albanian city of Durres. Eight-year-old Njomza doesn't mind that she, her three siblings, and six other relatives have been crammed together in a tent for two weeks.
"My aunt is like my second mother," she says. "But I will be very happy to see my real mother." | <urn:uuid:eff89dc8-47dc-40e3-bc51-44aa17cf1c7a> | CC-MAIN-2017-04 | http://www.csmonitor.com/1999/0426/p7s1.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281353.56/warc/CC-MAIN-20170116095121-00072-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.964525 | 1,271 | 2.546875 | 3 |
The result of terrorist shelling of Aleppo
I guess most readers have become familiar with barrel bombs – an indiscriminate weapon currently being used by government forces in the Syrian war. But how many have heard of “hell cannons?”
I hadn’t until recently and I think this shows the bias in our media coverage of the conflict. Hell cannons are an indiscriminate weapon used by rebel/jihadist forces, cause terror and civilian damage and loss of life. Unfortunately, our media often seems to paint the picture that only government actions cause civilian losses.
“Rebels” load hell cannon with explosive filled gas bottle in Aleppo. (Getty)
This bias seems particularly bad in their current reporting of the civilian deaths in Aleppo. Here are some of the mythical stories our news media is promoting:
1: The government is not attacking a city held by “rebels” as many of our media stories imply. Rebels hold the smaller part of the city in the east and attacks by the government forces and its allies are aimed at removing them. There is also intensive fighting in areas around Aleppo – particularly in the north where Syrian and allied forces recently disrupted rebel supply lines with Turkey.
So, if anyone is attacking Aleppo it is the rebels/jihadists.
2: The claim that the government and its allies are attacking “moderate rebels” is biased propaganda. the anti-government militias are numerous and allegiances are complex. They often fight among themselves. Some may well be “moderate” but they cooperate and are often integrated with Al-Nusra – the main terrorist/jihadist group in the area.
How does one define “moderate” in Syria, though? I guess one way is to characterize those rebel militia which accepted the recent cessation of hostilities and signed ceasefire agreements with the Syrian government, as outlined in the US/Russian initiative, as the real “moderates” ready to take part in a political solution. It would seem that the “rebel” militia fighting in Aleppo have not accepted the cessation of hostilities agreement.
3: I recently heard an Al Jazeera reporter imply that only the Russians and Syrian government classifies “rebel” groups like Al Nusra as “terrorists” implying this was unfair. Again biased propaganda. The UN specifically lists Al-Nusra, together with Daesh (ISIS) as a terrorist organisation. Those groups were specifically excluded from the cessation of hostilities agreement.
There is a media tendency to describe only Daesh as terrorist or to present the aim of the US-based coalition and the Russian Federation in Syria as fighting Daesh. US spokespersons seem to repeat that description. This is very misleading. The UN and the cessation of hostilities agreement make clear that Al-Nusra is also the enemy.
Al-Nusra is the Al-Qaeda group in Syria (ISIS/Daesh originally broke away from Al-Nusra). Its aims and programme are just as obnoxious as those of Daesh but Al-Nusra has been able to form links with other anti-government militia – often groups that have been backed, armed and financed by the US and its middle eastern allies (eg. Saudia Arabia and Qatar). Very often these militia are operating under the command and structures of Al-Nusra. The ability of Al-Nusra to form these arrangements probably means it will outlast Daesh – and may actually be the bigger danger.
The death of the “last pediatrician” in Aleppo?
A blatant example of bias has been the media claim that a pediatrician who died in the bombing or shelling of a hospital in the rebel-held eastern part of Aleppo meant Aleppo no longer had any pediatricians. Horrible Syrian government denying medical care for children!
But Dr Nabil Antaki, who works in Aleppo, responded to this propaganda with this:
“For three days now, these media outlets have been accusing the “Assad regime” of bombing an MSF hospital [Medecins sans Frontieres] to the east of Aleppo and of killing the last paediatrician in the city. This demonstrates that, for these media, the only priority is this pocket of the city where terrorists are embedded.
The three-quarters of Aleppo under Syrian Government control where numerous paediatricians are practicing is of no consequence for this media. We witnessed the same bias when Al Kindi, the biggest hospital in Aleppo, was targeted by terrorist mortars and then intentionally burnt down about 2 or 3 years ago. The media ignored this criminal act.”
He refers to this sort of propaganda as “lying by omission” saying:
“This media never mention the continuous bombardment and the carnage we have witnessed in western Aleppo where every single sector has been targeted. On a daily basis we see dozens of people murdered.
What makes these omissions even more despicable is that these areas represent 75% of Aleppo and there are 1.5 million people living in them. Compare this to the 300,000 living in the eastern zone which is occupied by terrorist groups.
This twisted narrative engenders the belief that these terrorist groups that are attacking us are actually the victims. Even more abhorrent, these media have distorted our “Save Aleppo” appeal, to make it look as if we are calling for Assad and the Syrian Army to cease hostilities!
This is FALSE. Added to which, they are not “Assad’s forces“, they are the national forces of the regular Syrian army that is defending the Syrian State.
The western and gulf media could at least have had the decency to mention the terrorist massacres of our people. For example, on Friday 30th April, when one of their mortars targeted a mosque at prayer time.”
Footnote: I find the New Zealand media pathetic in its coverage of events like the Syrian war and tend to search for other sources. I regularly watch Al Jazeera but now find their coverage of Syria extremely biased. Perhaps this is because the organisation is based in, and financed by Qatar, a sponsor (together with Saudi Arabia and Turkey) of anti-government forces in Syria.
Of late I notice that Al Jazeera has been smudging out the logos identifying sources in many of the videos they display. Can’t help thinking they wish to cover up they fact they are relying on the “rebel’ news media for their videos of action in Syria.
Pathetic if true. | <urn:uuid:ea47f610-0b85-4759-9f43-7addeea38b7e> | CC-MAIN-2017-04 | https://openparachute.wordpress.com/tag/saudi-arabia/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281424.85/warc/CC-MAIN-20170116095121-00331-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.96445 | 1,317 | 2.109375 | 2 |
Last updated: January 22, 2016
Sidewalk Snow Removal Laws in Philadelphia and
Bucks County (Doylestown, Chalfont, Newtown, Yardley)
Sidewalk snow accidents are one of the number one causes of emergency room visits during the winter months.
Pennsylvania law requires commercial and residential property owners, as well as occupants, such as the tenant of a single family house, to take reasonable steps to prevent snow/ice fall accidents. Property owners/tenants must shovel and salt their sidewalks and walkways. In fact, failing to do so often results in liability.
Property owners and tenants are often confused about their towns’ local ordinances requiring sidewalk snow removal. Many towns differ in terms of how long property owners have to remove snow, how wide the pathway must be, etc. In most towns, property owners and tenants can be fined for failing to remove snow from sidewalks. For example, as of 2014, in Doylestown, the fine is $10.00 and in Philadelphia, the fine is $50.
Below are the sidewalk snow removal requirements for the City of Philadelphia and many towns in Bucks County. For Delaware County and Montgomery County, click here.
Please note the following information is provided for general information only. Ordinance sections have been provided, if available on the specific township’s website. If your township is not listed below, please click here to search.
Philadelphia Sidewalk Snow Removal Requirements
In Philadelphia, local Ordinance 10-720 requires property owners and tenants to remove snow from sidewalks within 6 hours after the snow has stopped falling. Tthe path must be at least 30 inches wide.
If the sidewalk or pavement itself is less than 3 feet wide, the path cleared may be only 12 inches wide. Owners of multifamily dwellings are responsible for snow removal. The fine is $50 under Section 10-719.
Bucks County Sidewalk Snow Removal Requirements
- Doylestown (Chapter 21, Section 251): Within 10 hours after the snow has stopped. If the snow stops falling after 6 p.m., sidewalks must be cleared no later than 10 a.m. the following morning.
- Chalfont (Ordinances 299A and 308A):Within 12 hours after the snow has stopped; a path of at least 30 inches is required.
- Newtown (Ordinances 201-204 and 602-605): Within 24 hours after the snow has stopped.
- Yardley: Within 18 hours after the snow has stopped.
It is important to note that property owners and tenants should not pile snow around fire hydrants. This is a major safety issue which is not always indicated in a given town’s snow/ice removal ordinances.
About Laffey, Bucci & Kent
LBK is a Philadelphia law firm which handles negligence and liability cases in the greater Philadelphia area. If you would like to speak to one of our lawyers about a case, please call Click To Call and ask for a free consultation. | <urn:uuid:6fe8cd58-b72e-4bf4-98a7-47277ff487d4> | CC-MAIN-2022-33 | https://www.laffeybuccikent.com/pennsylvania-sidewalk-snow-removal-laws-philadelphia-bucks-county/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573876.92/warc/CC-MAIN-20220820012448-20220820042448-00073.warc.gz | en | 0.927932 | 635 | 1.78125 | 2 |
Chinese TV Shows to Learn Chinese (for 2022)
When it comes to learning Chinese, Chinese TV shows is a huge resource.
How many times have you complained that you can read or write Chinese okay (which is no small feat!), but still have a hard time understanding what’s being said to you?
Don’t worry, this is normal and you are definitely not alone.
To help you get started with tackling the problem of Chinese listening comprehension, we’ve compiled a list of 5 popular Chinese TV shows.
We made sure to include TV shows from different genres so you can have your pick.
So, get a bowl of popcorn and let’s get started!
The Best Chinese TV Shows For Learning Chinese
Chinese TV Shows – Reality, Competition and Panel Shows
Chinese TV Show #1 – Keep Running
Chinese TV Show #2 – Informal Talks
Chinese TV Show #3 – Idol Producer
Chinese TV Show #4 – If You Are the One
Chinese TV Shows – Dramas
Chinese TV Show #5 – iPartment
Chinese TV Show #6 – Princess of Pearl
Chinese TV Show #7 – Eternal Love
Chinese TV Show #8 – Ode to Joy
Chinese TV Show #9 – Meteor Garden
Chinese TV Show #10 – The Bad Kids
Chinese TV Show #11 – Go GO Squid
Chinese TV Show #12 – The Untamed
Chinese TV Show #13 – Love O2O
Chinese TV Show #14 – Empresses in the Palace
Reality, Competition and Panel Shows
Chinese TV Show #1 – Keep Running (奔跑吧 bēn pǎo bā)
For those who enjoy reality shows but finds it hard to keep up with the Kardashians, Keep Running might just be what you need minus all the drama.
The show has popular Chinese celebrities participate in competitive games against each other.
The celebrities are tested on their physical strengths as well as brain power. Winners are rewarded and losers punished.
Despite the competition, this Chinese reality TV show is friendly, fun and often hilarious.
What makes the show a favourite among Chinese views is the engagement of pedestrians on the streets, whose participation can often change the course of the game.
Best Mandarin Movies to Learn Chinese (2022 Update)
Discover the Best Mandarin Movies. Watching movies can be a great way to learn a language. Mandarin Chinese is, of course, no exception.
Chinese TV Show #2 – Informal Talks (非正式会谈 fēi zhèng shì huì tán)
Ever wondered what happens when you put a group of millennial from different countries and cultures together in the same room?
This Chinese talk show has the answer. Informal talks gathers a group of eleven guests from different countries and cultures to discuss trending topics and current events that you and I care about.
Topics they have discussed ranged from “should you hide social media updates from your parents” to “what would you do if today is the last day of your life”.
You would be surprised what each guest has to say.
This Chinese TV show is informal (duhh), international, multicultural, and entertaining, perfect for those who are looking for some intellectual stimulation in a friendly and relaxed context.
Chinese TV Show #3 – Idol Producer 偶像练习生 Ǒuxiàng liànxíshēng)
Idol Producer, also known as Youth with You is a hugely popular Chinese dance and singing survival competition.
One hundred “trainees” compete against each other to get into the final 9 of the competition. The final 9 then become a group and start releasing songs, music videos etc. together.
The decision of who remains in the competition is decided by the viewers who vote for their favourite trainee that they want to see in the final 9.
During the course of the show the trainees all live together and attend daily training sessions.
As the name suggests the aim of the show is to create the next Chinese pop idols, with the one hundred trainees all dreaming of achieving stardom.
Many of the contestants will already be represented by major companies in the Chinese music industry, however independent contestants can also join.
The series first aired on the Chinese streaming platform iQIYI in January 2018 and there have been a total of three seasons so far.
Read our full review of Idol Producer
Chinese TV Show #4 – If You Are the One (非诚勿扰 fēichéngwùrǎo)
Most people will probably already be familiar with the concept of the Chinese dating show If You Are the One as it’s based on the Taken Out/Take Me Out format.
For those who don’t know it’s a dating show where there are 24 female contestants who each stand behind a numbered podium with a light on it.
Single men are then invited one at a time onto the stage and the female contestants will indicate if they are interested in him by leaving their light on or turning it off if not interested.
The show started running in 2010 and was an instant hit, it has now been running for over 10 years!
However, the show has had some controversy. The biggest being when a female contestant declared “I would rather cry in a BMW than smile on a bicycle” (宁在宝马车里哭，也不在自行车上笑 níng zài bǎomǎ chē lǐ kū, yě bùzài zìxíngchē shàng xiào).
Contestants come from all over China so this is a great show to practice your listening and become familiar with different Chinese accents.
Read our full review of If You Are the One
Chinese TV Show #5 – iPartment (爱情公寓 ài qíng gōng yù)
Often referred to as the Chinese version of the popular American TV show “Friends”, iPartment is a light Chinese TV show to practice Chinese listening comprehension while having fun at the same time.
Like the show “Friends”, iPartment it’s also a story of the day to day life of a group of friends living inside the same apartment.
Although the idea is similar, the characters, plot, acting and almost everything else about this successful Chinese TV show cannot be more different.
The first season of the show aired more than 10 years ago. The final and fifth season aired at the beginning of 2020 on iQIYI.
If you are planning to binge watch this show (because it’s that good), be sure to start from season 1.
Chinese TV Show #6 – Princess of Pearl (还珠格格 huán zhū gé gé)
This is a classic Chinese TV show many Chinese millennial grew up watching. The first version aired in 1998.
It’s one of those TV series that an entire Chinese family would gather around the TV and watch together.
It’s so influential almost everyone in China has either watched or know about.
The story is based on a historical fiction about a lost princess of Emperor Qian Long (乾隆) that took place in the Qing Dynasty. The lost princess was given the title of Returned Pearl (还珠).
But it’s not happily ever after from here; that’s just the beginning. The princess is met with an evil queen who is always putting her in trouble.
She is picked on and sometimes even tortured.
The show has been remade multiple time since the first version in 1998, but the best one is still the original one by Ruby Lin and Vicki Zhao.
Also, check out this hilarious dubbing clip from Conan.
Famous Movies Set in China – Must See Movies
8 Incredibly Famous Filming Locations In China You Need To Visit Thanks very much to David Wang from OkDealTravel for this excellent guest post. Enjoy! Have you ever noticed that there are so many scenes and elements of Chinese features…
Chinese TV Show #7 – Eternal Love (三生三世十里桃花 sān shēng sān shì shí lǐ táo huā)
As the name suggests, this is a love story across time and space. If that’s too vague, what about a story of unrequited love between the descendant of Nine-Tail White Fox and the Prince of Cloud Nine.
Not only is the couple both gorgeous, their beauty beyond the earthly-realm, they are also both endowed with magical powers that makes them almost invincible.
The story is based on a fantasy novel of the same name. It’s got the heart-wrenching quality of a k-drama, an extensive cast, and complex plot to keep you interested.
I must warn you that this Chinese TV show is highly addictive and there are 58 episodes.
Chinese TV Show #8 – Ode to Joy (欢乐颂 huānlè sòng)
Cited by many as the Chinese version of Sex and the City, Ode to Joy follows the lives of 5 women in their 20s and 30s who live on the same floor of an apartment block in Shanghai.
The 5 main female characters in the show are all from different economic backgrounds so you are able to see the struggles that face a a variety of women in modern China.
Being such a modern drama makes it great for learning Chinese slang phrases and modern colloquialisms that you probably haven’t learnt in the classroom.
First released in 2016, there are currently two seasons of Ode to Joy with a third rumoured to be in the works.
Read our full review of Ode to Joy
Chinese TV Show #9 – Meteor Garden (流星花园 liú xīng huā yuán)
Available to watch on Netflix, Meteor Garden is an extremely popular Chinese TV Show both in China and internationally.
The show centres around Dong Shancai who is accepted at China’s top university. Unlike many of the other students who attend the college, she is from a modest family which doesn’t have lots of money.
She soon encounters the F4 who are the most popular kids at school and are all super rich and spoiled. However, Dong Shancai has a strong personality and soon finds herself getting in trouble and clashing with them.
This is definitely a must watch for anyone who loves lots of drama, twists and turns in their TV shows!
Read our full review of Meteor Garden.
Chinese TV Show #10 – The Bad Kids (隐秘的角落 yǐnmì de jiǎoluò)
Sparking it’s own meme (一起爬山吗？yīqǐ páshān ma?) The Bad Kids was one of the biggest hit Chinese TV shows of 2020.
Unlike most other Chinese dramas this web mini-series has a much darker tone and shows some of the grim realities of living in modern China.
Many viewers have said it feels more similar to a US or UK drama rather than a Chinese one.
The Bad Kids follows the consequences of what happens after three children accidentally end up filming a murder. What starts as a seemingly straight forward blackmail story soon takes an even darker turn.
It will leave the viewer questioning the morality of the characters and perhaps even the truthfulness of the ending itself…
No spoilers though, if you want to find out more about the show read our full review of The Bad Kids.
Chinese TV Show #11 – Go Go Squid (亲爱的，热爱的 qīn’ài de, rè’ài de)
The main character in Go Go Squid is the super talented Tong Nian who isn’t only a computer genius with a super high IQ but also a popular internet singer. She finds herself falling for the equally talented computer genius and e-sports star Han Shangyan.
They seem like the perfect match on paper, but of course things are never that simple! Any romantic drama fans will love this show and will definitely be shipping the two main characters.
Read our full review of Go Go Squid
Chinese TV Show #12 – The Untamed(陈情令 chén qíng lìng)
One of the most popular Chinese TV shows of 2019, The Untamed picked up nearly 8 billion views by the end of the year.
This is a show for any martial arts fans as it’s set in a fantasy martial arts version of Ancient China. The land is ruled by five sects, however the Wen clan dominates over the other four.
The story focuses on two heroes as they travel the land solving mysteries and fighting evil. Despite being from different clans and complete opposites: one carefree and spontaneous, the other disciplined and obedient, they soon become close friends.
However, when they discover a hidden secret they will find themselves with more trouble than they bargained for.
Read our full review of The Untamed
Chinese TV Show #13 – Love O2O (微微一笑很倾城 wēiwēi yīxiào hěn qīngchéng)
The concept behind Love O2O is quite an interesting one as it revolves around an online role playing game called A Chinese Ghost Story. The main protagonist, Bei Weiwei, is an avid player of the game which she is very skilled at.
She is a computer science major and spends most of her spare time playing the game alongside her in-game husband. But things take a turn when he dumps her for another player!
However, her luck soon changes when she is approached by top player Xiao Nai who wants to team up with her to enter a competition.
The idea of a series based around an online role playing game may seem strange to some, but it proved to be a huge hit getting over 25 billion views online!
Read our full review of Love O2O
Chinese TV Show #14 – Empresses in the Palace (后宫甄嬛传 hòugōng zhēnhuán zhuàn)
Last but by no means least we have the Chinese period drama Empresses in the Palace which is set during the Qing dynasty.
As you may guess from the name you can expect lots of palace intrigue, plotting and back stabbing from this extravagant costume drama. Our lead protagonist is the beautiful concubine Zhen Huan who becomes a favourite of the emperor’s.
But this makes her the number one target of the Empress who is extremely jealous and will not stand for any other concubine to threaten her power. The Empress decides that she must get rid of Zhen Huan at all costs…
Read our full review of Empresses in the Palace
Chinese TV Shows – In Need of More?
So if you want to start watching, be sure to stock up on plenty of popcorn first.
If you are after even more Chinese TV Shows, do NOT fear because we are the fountain of all knowledge when it comes to stuff like this!
Here’s 8 more of the best:
… and to wrap it all up for you:
BONUS – discover how to watch Chinese Movies online with Campbell!
Learning Chinese is about enjoying it, matching it to a hobby… we hope we can help you with that!
There you have it, a list of Chinese TV shows to supplement your Chinese learning journey. Which one are you most excited to watch?
Chinese TV Shows – FAQ’s
Can I actually learn Chinese watching TV?
Sounds crazy but it’s actually a brilliant way to learn Chinese and immerse yourself.
It’s great for your understanding but with Chinese, it’s essential you talk from the beginning stages of learning, so you’ll want to find someone to discuss things with to really kick on.
Will my Chinese improve with the usage of Netflix, Apps etc?
Absolutely, but with Chinese, talking is important so although you’ll be absorbing lots of information, it’s good to talk about it with a native speaker.
This is where an Online Chinese Tutor is essential if you want to take your Chinese to the next level. Alongside watching Chinese TV/News/Movies, this will help you hugely.
Can I watch TV with two sets of subtitles?
You can with a great Chrome plug-in we discovered called Language Learning with Netflix.
See our video demo below to see how easy it is to install and use.
My Chinese isn’t great, should I still watch TV even though the level is much higher?
It’s never too early to learn Chinese but be sure to pick your program wisely.
Perhaps ask a Chinese friend or seek advice online. Some shows will indeed be very tough to follow if you are a beginner but that shouldn’t stop you from listening, using subtitles and absorbing the language.
Does China have it’s own “Friends” TV show?
The TV show 爱情公寓 (ài qíng gōng yù) iApartment is often referred to as the “Chinese friends” due to their many similarities (i.e. six young adults finding their way in life, three male, three female, romantic twists etc).
Want more from LTL?
If you wish to hear more from LTL Mandarin School why not join our mailing list.
We give plenty of handy information on learning Chinese, useful apps to learn the language and everything going on at our LTL schools! Sign up below and become part of our ever growing community! | <urn:uuid:b13849ce-9277-4963-ab30-b92794447042> | CC-MAIN-2022-33 | https://ltl-school.com/chinese-tv-shows/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00277.warc.gz | en | 0.93815 | 3,841 | 1.828125 | 2 |
Panoramic black and white photograph of the Brisbane Cricket Ground, taken during the First Test Match between Australia and South Africa in November 1931. The picture is a wide-angle view of the ground showing players on the field and large crowds of spectators sitting in the terraces and standing around the boundary fence. The photograph is mounted on a piece of (badly damaged) brown card, and under the image is printed "BRISBANE CRICKET GROUND / First Test Match - South Africa v Australia, November 28, 1931. Attendance 19,500. Gate, £1895 / 15 /."
0 - Whole: H: 245 W: 554 D: 2mm (H: 9 5/8 W: 21 13/16 D: 1/16")
Tony Baer; 20 Apr 1938; 09 Nov 2005 | <urn:uuid:c8ad61c2-ae52-472c-8021-cd4a69cebf0c> | CC-MAIN-2022-33 | https://collection.australiansportsmuseum.org.au/objects/27945/panoramic-photograph-of-brisbane-cricket-ground-australia-v-south-africa-test-match-november-1931 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571538.36/warc/CC-MAIN-20220812014923-20220812044923-00477.warc.gz | en | 0.917643 | 180 | 2.09375 | 2 |
Do you like the concept of building a palace for you and your family to live in? Do you enjoy managing your capital resources to make sure you are always ready to purchase the next component of your masterpiece? Maybe you are just interested in the era when the Moors ruled Spain? Could you just be a gamer with an interest in what is considered to be a classic tile-laying game? If your answer to any of those questions was ‘yes,’ then continue reading our review of Queen Games’s Alhambra.
Alhambra puts players in the role of a Moorish lord in Grenada with the goal to build the most lavish and expansive alhambra. This is accomplished by purchasing towers, gardens and other rooms, and by managing four different types of currency. During the game, players will be playing cards from their hand corresponding to the value of a structure they want to buy. They also have to follow certain guidelines when constructing their alhambra in order to place rooms correctly and maximize scoring.
Scoring occurs at two points during the game and once during a final scoring round at the end of play. A player’s score is based on how many of a particular structure (represented by colored tiles) they have in their building compared to their opponents, and also how long the exterior wall they have constructed is on their alhambra. In the end, the player with the most points is declared the victor.
Like most tile games, the components for Alhambra are sturdy and durable. Since both the cards and tiles end up with a great deal of wear due to handling and playing, they are designed to hold up in the long run. The game boards are also of good construction, and the wooden player and score markers, while not remarkable, are very functional.
The artwork is functional as it relates to the tiles. Each type (color) of tile has a different drawing showing the structure it represents, but the art is relatively unremarkable. The only redeeming value is that the tiles are easy to read and it is very clear as to which color family the tile belongs to. The art on the cards is equally functional in terms of giving you the information you need quickly, but don’t do much else, unfortunately.
How to Play
The communal game area is made up of the money market and the building market. The money market contains cards representing various currencies of four different colors. The building market contains four spaces, each corresponding to one of the colors of currency, with a palace structure in each of the spaces available for purchase. Each player starts the game with a random hand of currency and a starting tile representing the center of their palace.
On a player’s turn, they can choose one of three possible actions.
1. Take a currency card from the money market, or multiple cards, so long as the sum of the cards is less than five.
2. Purchase a building from the building market, by discarding an amount of currency equal to or greater than the value listed on the building. The currency card must also match currency color of the space in the market the building is occupying. This building is then placed in the alhambra according to placement rules or placed in a player’s reserve.
3. The third action is to engage in construction and reconstruction, which allows a player to remove a tile to their reserve or add a tile from their reserve. At the end of a player’s turn, the money market and building market are refilled and the turn proceeds to the next player in order.
The rules for tile placement are straightforward. Each tile side either is either open or bordered by a wall, and neighboring tiles need to correspond when placing (meaning you cannot place a wall edge next to a tile with an open edge). In addition, each tile must be placed so that you can “walk” from room to room without interruption, creating one giant space. Finally, the tiles must be oriented face-up according to the pictures on the tile, which lends some strategy as to which tiles are purchased. If you purchase a tile that cannot be placed (or one that you do not want to place), you can hold it in reserve, then use another turn’s action to place it when a spot opens up.
The game adds a reward mechanic for purchasing buildings with the exact amount. If this occurs, the player may immediately take another action. If planned out correctly, it is possible to string together multiple purchases in the same turn.
Scoring is done in two parts. First, the players compare the number of each color tile they have in their alhambra, and award points according to an increasing scale. Second, players earn a point for each segment of their longest continuous wall. When the game ends, three rounds of scoring will have occurred, and the player with the highest score is declared the winner.
Alhambra is a good game that is very straightforward in both game play and play experience. It’s perfect to bring to the table when you are in the mood for a lighter game, or if you have friends over who you want to introduce to the world of hobby board gaming. That said, if you’re looking for a meaty, strategy-laden experience, I would suggest that you look elsewhere. While there is a small element of long-term strategy, in terms of keeping track of your color counts compared to your opponents, most of the game play involves looking at the markets on your turn and making the optimal move at that given point in the game.
This leads to a very important point, which is the number of players. Having played Alhambra with all the numbers of possible players, I feel Alhambra plays best with either two or three players, because of the point about strategy mentioned above. With less players, some (OK, a little) strategy can get worked into your game play, which is definitely a good thing. With four or five players, the game becomes very chaotic with no strategic play, as it is possible to have a completely different set of tiles and currency in the market by the time your turn comes back around. The two-player rules call for the addition of ‘Dirk,’ a third ‘player’ who gets a certain number of tiles assigned to him at different points in the game, which provides another bit of strategy to the two-player game. However, in the many plays I have had with ‘Dirk,’ he has never beaten any human player.
As a player who looks for an immersive theme that contributes well to game play, Alhambra leaves me wanting here. The theme is definitely pasted on, as I could very well be constructing a space station or a yacht or a modern city (in fact, Manhattan is a re-theming and re-release of Alhambra). The theme doesn’t add to the game play, nor does it distract from it: it’s just there.
In terms of game play, there is something satisfying about building the alhambra, and putting together a structure that keeps its flexibility. This is important because if you created a more closed structure with many wall segments, you limit the amount of options you have to add more tiles when your turn comes back around, but potentially maximize the number of points you earn for your ‘longest wall.’ With a more open structure, you may not be able to earn as many points for your wall, but you keep the flexibility of being able to add many types of tiles to your board.
It should be noted that there have been many expansions released for Alhambra over the years, and now Queen Games sells them in a massive collector’s edition including the base game and all the expansions. Not having played with any of the expansion sets, I’m not in a position to review them, but they may be worthwhile to research more about when considering whether to own Alhambra.
Alhambra fulfills its role as a very light game that gives you the enjoyment of constructing a building without a complicated rules set or long game length. Leave this one on the shelf when your hardcore Euro-playing friends come over for game night, or if you have a gaming group that is interested in innovative mechanics or immersive theme. Once you get the hang of the rules, a 2-3 player game can be easily completed in under an hour, which is definitely a selling point.
Should you add this to your collection? Sure. Alhambra is a decent game for newcomers and casual gamers because of all the reasons listed above. If you find your game nights skew more towards Le Havre and Dungeon Lords, Alhambra may not necessarily be for you, but you may find it worthwhile to hold onto for nights when you have rookies and non-gamer family over.
If you are interested in getting a copy for yourself, it’s about $40
Final Score: 3.5 Stars – A decent tile-laying game that will appeal to both newcomers to the hobby and hardcore gamers looking for lighter fare.
• No strategy possible with 4-5 players
• Weak theme does nothing to improve game play | <urn:uuid:39c9a1d4-0f71-4ba2-89e9-9e02cf6277be> | CC-MAIN-2022-33 | http://sparomantics.com/index-126.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00268.warc.gz | en | 0.967744 | 1,909 | 1.65625 | 2 |
In the aftermath of the bombing in Marrakech and uncertainty caused by the unrest in North Africa, tourist numbers have declined and the economy is suffering. Hardest hit are the small traders and many are selling whatever they can in order to feed their families. In Fez, Casablanca and Marrakech, this has resulted in an increase in the number of stalls and carts. This growth in the informal sector does not come without problems, as Hassan Benmehdi and Siham Ali, writing for Magharebia in Casablanca, report in an interesting article on the surge in street vendors in Morocco. Here is an edited extract...
Law-enforcement officers once confiscated street vendors' wares and forbade them from occupying public spaces. With the threat of arrest and loss of goods now gone, however, merchants have pushed their barrows into the busiest spots.
In Morocco, the situation is becoming critical.
"These traders have installed themselves along the alleyway beside the mosque, preventing motorists and pedestrians from passing," says Moussa, who lives in Casablanca's Oum Rabia I.
"After the vegetable sellers with their carts, the kitchen utensil sellers appeared on the square, and they were followed by the live chicken sellers, who even dare to slit their throats and pluck them on the spot, causing inconvenience for the neighbourhood," he tells Magharebia.
|Photo - Hassan Benmehdi|
"These mobile traders don't pay rent or municipal tax," he explains. "The small retailers can't survive the competition."
Ahmed Ktiri, an economist, agrees that the phenomenon of street vending is having negative repercussions on the formal sector, due to illegal competitive practices.
"The youngest people should be offered training, and at the same time, jobs offering acceptable and viable conditions should be found for them," he suggests.
It is more than just price wars. Hassan, who lives in the city centre of Casablanca, says that the streets are no longer as clean as they used to be. "The goods are inexpensive, but these carts are a nuisance," he tells Magharebia.
For unemployed young Moroccans, however, they provide an income.
The government recognises the urgent need for a solution. "We must accept that we now need a new approach to integrate these people better into the formal sector," Trade Minister Ahmed Reda Chami told legislators in May.
"We need to create and set up new markets and spaces, but we also need to involve other departments, such as the interior ministry, and local authorities," Chami said.
Economic Affairs Minister Nizar Baraka said that the Moroccan government is paying particular attention to the issue and that help is on the horizon: "The main thing is to bring about a transition from the informal to the formal sector, that's what needs to happen."
A recent study commissioned by the Ministry of Trade revealed that Morocco now has 238,000 street vendors, 90% of whom are men. And since some 70% of them never went beyond the primary level in school, their employment options are limited.
The government report's recommendations will be implemented soon, Trade Minister Chami said in June. The aim, he said, is to integrate street vendors into the formal sector in order to improve their standard of living.
Absorption and integration of the informal sector would reduce poverty and exclusion, agrees Abdeljalil Cherkaoui, the president of REMESS (the Moroccan Network for Solidarity and Social Economy).
Read the full article here: Magharebia | <urn:uuid:23e290fc-7c12-4f34-b47c-f1427c210a0a> | CC-MAIN-2017-04 | http://riadzany.blogspot.com/2011/07/moroccos-increase-in-street-vendors.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.22/warc/CC-MAIN-20170116095120-00051-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.964807 | 734 | 1.695313 | 2 |
Make your own pinhole camera for safe observation of the sun, and find out how it works.
Make an accurate diagram of the solar system and explore the concept of a grand conjunction.
Use trigonometry to determine whether solar eclipses on earth can be perfect.
The third installment in our series on the shape of astronomical systems, this article explores galaxies and the universe beyond our solar system.
Making a scale model of the solar system
The second in a series of articles on visualising and modelling shapes in the history of astronomy.
Mathematics has always been a powerful tool for studying, measuring and calculating the movements of the planets, and this article gives several examples.
This article explores ths history of theories about the shape of our planet. It is the first in a series of articles looking at the significance of geometric shapes in the history of astronomy.
Mathematics has allowed us now to measure lots of things about eclipses and so calculate exactly when they will happen, where they can be seen from, and what they will look like.
How does the time of dawn and dusk vary? What about the Moon, how does that change from night to night? Is the Sun always the same? Gather data to help you explore these questions. | <urn:uuid:034d4c17-91b0-4b30-b02f-69e17642feef> | CC-MAIN-2017-04 | http://nrich.maths.org/public/leg.php?code=-454&cl=3&cldcmpid=8041 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280221.47/warc/CC-MAIN-20170116095120-00237-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.898122 | 258 | 4.03125 | 4 |
Sometimes, when writing up a synthetic chemical reaction in your notebook, you might need to go back and update the chemical structures that were originally drawn - perhaps because of some small error such as forgetting to add an atom label, or because you were better able to elucidate a molecular structure after analysis.
In E‑WorkBook Chemistry ELN, we have developed our stoichiometry item panel to cope with just such scenarios, to allow the original reaction scheme to be edited and updated, and for all associated experimental values e.g. mass or volume quantities to be retained.
After the structures have been edited, the system will automatically perform all stoichiometric calculations again, as a change in structure may involve a change to the reaction component’s molecular weight and hence the number of moles available to the reaction. This in turn may have an affect on the theoretical quantity of product and the associated yield. All updated calculations appear automatically within the procedure write-up section as well as the chemistry stoichiometry table itself. | <urn:uuid:cbdb391c-916f-459e-a922-4bbde87e5edb> | CC-MAIN-2016-44 | https://www.idbs.com/en/chemistry-blog/2016/06/stoichiometry-data-and-structure-edits/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988725475.41/warc/CC-MAIN-20161020183845-00509-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.940816 | 206 | 2.3125 | 2 |
JOSePH ANTON: A MEMOIR (Cape) By Salman Rushdie recollects the author’s days in hiding with a death sentence hanging on him. It is written entirely in the third person, as if it is the life of Joseph Anton, the name given to him by his minders and which is derived from Joseph Conrad and Anton Chekhov. Racy and readable. Honest and compelling. Occasionally gossipy.
Rammohun Roy: A critical biography (Viking) By Amiya P. Sen is a short but comprehensive biography of an outstanding scholar (in Persian, Arabic and Sanskrit) and social reformer. Sen takes up complex issues and writes about them lucidly. In spite of its brevity, this is a major book.
THE PATAGONIAN HARE: A MEMOIR (Atlantic) By Claude Lanzmann tells the story of an extraordinary life that moves from the French Resistance to Parisian literary and political circles, from Germany to Korea and to Israel and the making of Shoah. This is a gem of a book that opens up parts of Europe’s post-war history.
CATHERINE THE GREAT: PORTRAIT OF A WOMAN (Random House) By Robert K. Massie describes the life of one of the most powerful women in history. Born as Sophia in an obscure German principality in the 18th century, through luck, beauty and indomitable will she became the empress of Russia. Massie’s biography is exhaustive in its depiction of power, enlightenment and sexuality.
INSIDE THE CENTRE: THE LIFE OF J. ROBERT OPPENHEIMER (Cape) By Ray Monk shows the profound dilemmas of bomb physics through the anguished life of one of its makers. Written by one of the outstanding biographers of contemporary times, the author of the lives of Wittgenstein and Bertrand Russell, this is a landmark biography.
TITIAN: HIS LIFE (Harper) By Sheila Hale presents the Venetian Renaissance painter in the context of the turbulent times he lived and worked in. This is a vivid portrait of the artist whose paintings were described by contemporaries as “mirrors of nature’’. This biography is based on detailed research and draws on the latest scientific techniques to look at and evaluate the paintings.
Charles Dickens: A life (Viking) By Claire Tomalin is as gripping a life of the novelist as the latter’s novels. Dickens emerges from these pages as a fascinating figure in his complicated humanness and undimmed brilliance.
SUNLIGHT ON THE GARDEN: A STORY OF CHILDHOOD AND YOUTH (Viking) By André Béteille is a delightful remembrance of things past by India’s leading social anthropologist who has a unique lineage. The author grew up in Chandernagore and Calcutta, and those days are recalled with honesty and wry humour. A fine memoir. | <urn:uuid:cf80ca1a-86cf-4369-83de-e80a51a3ebd5> | CC-MAIN-2017-04 | https://www.telegraphindia.com/1121228/jsp/opinion/story_16371317.jsp | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281450.93/warc/CC-MAIN-20170116095121-00177-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.941309 | 620 | 2.046875 | 2 |
The world is full of strange mysteries that baffle and challenge the perception of mankind. New theories, experiences, factors shatter the previously held notions, prove that there still are many things in this world that elude the knowledge of mankind. Here is a curious case of siblings of Pakistan referred as ‘Solar Kids’, who have confounded the medical practitioners with their unique ability – A case of normal kids who turn into vegetative state as soon as the sun goes down!
‘Solar Kids’ refers to two siblings from Pakistan whose medical condition has confounded the medical community.
The two boys aged nine and thirteen are normal, healthy and active boys by day. But once the sun begins to descend, so does their energy. By dusk, the boys slip into a vegetative state where they are unable to move or even speak.
Javed Akram, a professor of medicine at Pakistan Institute of Medical Sciences confessed that he had no idea about the mysterious illness plaguing the young kids.
The cost for the blood tests and treatment is borne by the government.
The case has stirred interest among the medical fraternity in Pakistan. The doctors are conducting various tests to find the causative agent/factor that’s causing the mysterious paralysis in the children. Blood samples have been taken from the boys and some of the samples have been sent overseas for further investigation.
Researchers have also collected air and soil samples to determine whether the boys contracted the strange symptoms from these elements.
“My sons get energy from the sun,” says the boys’ father but doctors disagree.
Mohammed Hashim, the father of the two brothers hails from a village near Quetta, the capital of southwestern Baluchistan province. He married his first cousin and had six children in total. Two of the six children died at an early age and the other two children exhibit normal behavior.
While Mohammed Hashim thinks that Sun provides nourishing energy to his two sons, the doctors have repudiated this claim. They point out that the children manage well during the day, even when kept in a dark room or during rain storms (when clouds hide the sun).
The energetic kids have already mapped out their future goals as they await their test results.
The children who are currently residing in the government hospital appear to be cheerful, energetic and full of beans like the boys of their age. Shoaib Ahmed, the 13-year-old plans on becoming a teacher while his brother Abdul Rashid wants to be an Islamic Scholar.[source: NDTV] | <urn:uuid:7d2235a1-7f90-4da5-a458-8334a4c88e91> | CC-MAIN-2017-04 | http://www.unbelievable-facts.com/2016/05/solar-kids-pakistan.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280825.87/warc/CC-MAIN-20170116095120-00204-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.971642 | 519 | 1.859375 | 2 |
by Rabbi Dovid Weiss
Abraham, the mutual forefather of the Jewish people and their Arabic cousins, is described by Efron in the Bible as "a prince of the Lord in our midst. (Genesis 23:5)" Since man does not live in isolation, one of the goals of the true religious personality is to achieve a degree of devotion capable of evoking the praise of all men and their desire to emulate his piety.
From Abraham's days this was the sole agenda of the Jewish people. The revelation at Mt. Sinai placed an enormous burden upon our people. We were summoned to be "a kingdom of priests and a Holy nation. (Exodus 19:6)"
Down through the ages Jews lived a humble, holy existence, at peace with all men and served as loyal and co-operative citizens in the nations amongst whom they dwelled.
One hundred years ago, a Jew, far removed from his faith and in total
ignorance of its basic beliefs, launched the movement today known as Zionism. Its early adherents were
almost uniformly drawn from the ranks of Jews who had previously abandoned their
Time does not permit us to catalogue in detail the evil effects of this
ideology upon Jews themselves and how it led them to abandon the beliefs and
practices of the Torah. Rather, for the purposes of this conference we will, God
willing, explain why Zionism is a rejection of Judaism and how its demise is the
only path to true peace.
All mankind stands aghast at the terrible suffering in the Middle East. Innocents on both sides are swept up in a spiral of seemingly never ending bloodshed. The world searches for a solution.
Our perspective is representative of the Torah view, maintained by hundreds of thousands of Jews worldwide, which offers a real alternative to the current impasse.
Our position is that of the Talmud and Midrash which explicitly prohibit premature attempts to end exile. Indeed, we are told that it is metaphysically impossible for there to be a real cessation of hostilities so long as the Jewish people are in violation of the terms of their exile.
With this introduction complete let us now turn to the details of the dilemma now before us.
What is the traditional Torah belief concerning the Holy land?
The Holy Land was a conditional Divine gift. It was a place set aside for God's worship. But it was given conditionally. The Bible foretold that if the "children of Israel" should fail in their spiritual task, they would be banished from the land and sent into exile. This exilic punishment will last until the Lord in His mercy, sees fit to end history as we know it, by ushering in the Messianic era-a time of universal brotherhood and peace. This utopian future will feature the worship of God by all mankind, centered in the Holy Land and the city of Jerusalem.
In the Additional Service recited on every major Jewish holiday we find the following prayer, "And because of our sins we were exiled from our land and removed from our soil and we cannot now go up and appear and prostrate ourselves before You."
These prayers represented nothing new in the way of doctrine to those who instituted and recited them. From the time of the Temple's destruction and throughout Jewish history our people always regarded their exile as a Divine punishment. Indeed, no Jews ever dared suggest in the thousands of years of our exile that the Romans had destroyed the Temple due to a lack of Jewish military preparedness or resources. Rather, the Temple was lost physically because of the Jewish people's failure to live up to their spiritual obligations to God.
Indeed, despite thousands of years in exile, frequent exclusion and persecution, no Jew ever suggested that the Holy Land could or should be retaken by force of arms. Exile was, indeed, a physical state. Yet, it was completely caused and perpetuated by spiritual forces. Thus, the only means to end exile and usher in the promised era of peace and worldwide brotherhood, were and are spiritual. They consist of the essential practices of our faith-repentance, prayer, Torah study and good works.
In the words of Rabbi Samson Raphael Hirsch (German Jewish leader 1808-1888), "During the reign of Hadrian when the uprising led by Bar Kochba proved a disastrous error, it became essential that the Jewish people be reminded for all times of an important, essential fact, namely that (the people of) Israel must never again attempt to restore its national independence by its own power; it was to entrust its future as a nation solely to Divine Providence." (Hirsch Siddur, 1969: 703)
Again Rabbi Hirsch writes, "We mourn over that which brought about that destruction (of the Temple), we take to heart the harshness we have encountered in our years of wandering as the chastisement of a father, imposed on us for our improvement, and we mourn the lack of observance of Torah which that ruin has brought about. . . This destruction obliges us to allow our longing for the far away land to express itself only in mourning, in wishing and hoping; and only through the honest fulfillment of all Jewish duties to await the realization of this hope. But it forbids us to strive for the reunion or possession of the land by any but spiritual means." (Horeb, 1981: 461)
The attempt to explain the exile in this-worldly terms is not simply an error of doctrine or a distortion of Jewish history. It strikes at the core of Jewish belief. In fact, the Maharal of Prague (Czechoslovakian Rabbi and pivotal medieval Jewish leader, 1525-1609) writes that a Jew should rather give up his life than attempt to end exile by conquering the Holy Land. (Netzach Yisroel, 24)
Why? Why was this seen as so basic to our belief system?
In simple terms-if one views the exile as the result of military cause and effect, then the very heart and soul is ripped out of Jewish destiny and Divine guidance. By asserting our right to alter the Divine plan of exile as punishment, repentance, expiation and miraculous return, we assert that the essence of Jewish destiny is fundamentally capable of being altered by other than spiritual forces. God is then exiled from the drama and final resolution of mankind's hopes.
Of course, exile is far more than mere punishment. The Jewish people were sent amongst the nations in order to proclaim by word and deed the truths of God's existence and His revelatory injunctions for all men.
In the words of Rabbeinu Bachya (12th century Saragossian Biblical commentator) "The Jewish people should spread among the nations in order that those nations should learn from them belief in the existence of God and the flow of Divine Providence regarding the particulars of men."
Tragically, two events coalesced to cloud over the above, once universally recognized truths among the Jewish people. First, the exile dragged on for hundreds and eventually thousands of years. Second, in the aftermath of the Enlightenment, many Jews abandoned Torah faith. Thus, those Jews who no longer saw exile in Divine terms sought to explain it as nothing more than the result of this worldly powerlessness.
In their frustration at the length of the exile they demonized all nations. In their view all Gentiles would forever hate the Jewish people. Therefore, they reasoned, we must immediately end exile by political and, if need be, military means. Thus, was born the pseudo religion of Zionism.
This necessitated ignoring the Palestinian inhabitants of the land. When this strategy became impossible, the Zionist movement and later the Israeli state sought to depict them as unreasonable enemies for whom military conquest was the only just fate.
Accordingly, both exilic missions (repentance and serving as a "light unto the nations") were damaged by the ideology of Zionism.
We are called upon by Zionism to view all Arab nations as our enemies. We are forever exhorted to dwell on anti-Semitism, real and imagined, in order to justify the creation of the state and its subsequent aggressions. This obsession with wars, terror and counter terror, the subjugation of the Palestinians, reparations and claims upon all nations and ever wilder charges of anti-Semitism, provide an inviting substitute religion for many Jews. This heresy was particularly tempting to Jews ignorant of Torah and due to historical and cultural forces, estranged from their faith.
The costs of all this in terms of our true exilic tasks are staggering. In place of fulfilling our quiet role of being a "light unto the nations", we are forever dragged into a bloody conflict with the Palestinian people. Thousands of innocents on both sides continually suffer. Jewry worldwide has little time or patience for its primary task-the worship of God and its derivative benefit-the sanctification of His Name.
There is no need for Jews to be seen as the enemies of the Islamic world. There is no need for Jews to be forever accusing Popes and governments of having insufficiently apologized to us for past wrongs-real and imagined. There is no need for Jewry to base its collective political strategies in America and Europe on a "Is it good for Israel?" basis, thus alienating and angering their fellow citizens.
Beyond these factors, there remains the tragic fact that much of mankind sees the Israeli state as representative of the Jewish people. Thus, the state which has rejected or, at best, ignored God, conveys the message to humanity that the essence of Jewishness is a secular nationalism.
Further, the claim of Israel to represent world Jewry links all of our people to the state's acts of violence against the Palestinian people. This is a frustrating and embarrassing lie. Nothing could be further from the truth. Many Jews in the Holy Land and around the world are greatly pained and anguished by the suffering and persecution of the Palestinian people. Of course, our hearts bleed whenever innocent Jews suffer. But, this need not blind a moral people to the similar sufferings of the other. This is precisely the point--Zionism is a recipe for endless suffering among both Jews and Palestinians.
In the words of Grand Rabbi, Rabbi Joel Teitelbaum zt'l (of blessed memory, originally of Hungary, who lived in New York after WW II, 1888-1980), "In sum, the hatred against the Jewish community is because it is said that those who are not Torah observant, who are heretics, are the leaders of Jewry. The nations of the world are misled by them and acquire a hatred of Jews. One of the greatest commandments there is, to be observed with utmost self-sacrifice, would be to make known to the nations of the world that they (Zionists and irreligious leaders) are not the representatives of the Jewish community. (And to tell them) that observant Jews have no connection with them." (Dibros Kodesh, 1986: 210-11)
The vast majority of Jews rejected Zionism when it first began. In the early part of the century, Chief Rabbi of Jerusalem (not to be confused with the Chief Rabbis of the State of Israel), Rabbi Yoseph Chaim Zonnenfeld negotiated with King Hussein in order to help the Orthodox Jewish community escape the Zionist machinations. This resulted in the assassination by Haganah operatives in 1924 of the Rabbi's advisor, Dr. Jacob Israel de Haan. In 1948 Rabbi Yosef Zvi Duchinsky of Jerusalem sent an urgent petition to the United Nations, asking that the Orthodox community in the Holy Land be exempted from Zionist rule. These were not isolated incidents. For over a century Zionism has been opposed by large segments of Orthodox Jewry in Jerusalem, the Holy Land and around the world. Many continue to do so today. In fact, they refuse any form of recognition of, or co-operation with the state. They frequently pay for their opposition to the state by being arrested, beaten and, at times, murdered. Their voices are generally ignored in the Israeli press and throughout the world.
Zionist assertions to having solved the "Jewish question" by "ending exile" have proven a dismal failure. If anything, the Zionist's claim to having created a safe haven for Jewry is patently false. The truth is that Israel today, whether governed by "doves" or "hawks" is the most dangerous place in the world for Jews. Such was to be expected, as Israel's very creation was an act of defiance against the Creator's guidelines.
Our position is the only one offering a real alternative to the status quo. Anti-Zionist Jews believe that the one path to peace in the Middle East, the only means for Jews to fulfill their proper role in exile and the only path demonstrating justice and kindness towards the Palestinians, is the total dismantling of the Israeli state. Only then, with sovereignty transferred to Palestinian rule, will a true peace be attained.
After 53 years of having our blood shed on the altar of a nineteenth century colonial, nationalism, misapplied to the Jewish people, having spilled rivers of blood of other peoples, it is high time that world Jewry subject the first assumptions of Zionism to criticism.
What has been accomplished by linking our people's fate to that of the state?
At root, Zionism has succeeded in changing the definition of Jewry from that of a people of faith, intent on achieving closeness to the Creator in this world, to that of a barren secular, ethnic identity. It has exacerbated anti Jewish sentiments around the world.
It behooves those Torah Jews who have known, since Zionism's inception, that only ill could come of its dreams, to urge world Jewry to accept the only suitable alternative.
This alternative would not demand Jewish political rule over the Temple Mount or Jerusalem. The "non negotiability of Jerusalem" is not a Torah concept. Indeed, the true Torah concept is to relinquish the notions of Zionism and abandon, in a peaceful fashion, the current Zionist sovereignty over the land.
This need not sadden any Jew. It is far better to relinquish political power than fail in our religious/moral task as the Torah nation. It is far better to practice kindness and fairness to all men as dictated by the Torah, than it is to be drawn into a never ending battle with the Palestinians, the Islamic world, the entire Third World and increasingly the nations and peoples of Europe and North America. We Jews have a task, but it is not to be dispossessors or aggressors.
The serious alternative to Zionism is the faith of Judiasm. In Rav Hirsch's powerful description:
"Picture every son of Israel a respectful and influential priest of righteousness and love, disseminating among the nations not specific Judaism-for proselytism is forbidden-but pure humanity. . . How impressive, how sublime it would have been if there lived a people. . . who beheld in material possessions only the means for practicing justice and love towards all, a people whose minds imbued with the wisdom and truth of the Law, maintained simple, straightforward views, and emphasized them for themselves and others in expressive, vivid symbolic acts." (Nineteen Letters, 1960:108-9)
To the Palestinian people and the other peoples here represented: You have no quarrel with the Jewish people. We are not your enemies. Our message is simple. Let us endeavor to live in peace and true mutual respect.
To our fellow Jews we ask that you all embrace the faith of our ancestors as revealed on Sinai; that you deal justly and kindly with all men and that we all work towards the day of ultimate brotherhood and redemption for mankind.
Our prayer to God is that the Israeli state be speedily and peacefully dismantled without any further shedding of Jewish or Palestinian blood and that we be worthy of seeing the full revelation of God's glory in the world, Amen
[The above lecture was presented by Rabbi Dovid Weiss of Neturei Karta
International at a seminar on issues of Islamophobia, hosted by the Islamic
Human Rights Commission. It was delivered at the NGO Forum of the United Nations
World Conference Against Racism in Durban, South Africa on August 28, 2001.]
[The Jewish Orthodox community (Eida Hacharedis) of Jerusalem comprising 60,000
souls, objects to the plea of including Jerusalem in the Jewish state and/or its
residents becoming automatically citizens of the Jewish state.--Rabbi J. Z.
NO. A-AC 14-44," True Torah Jews Against Zionism, November 18, 1947
[The Khazars were a seminomadic Turko-Finnish people . . . the Khazar populace also
embraced Judaism . . . they far outnumbered racially Jewish Jews . . . the vast
majority of Eastern European Jews ARE NOT SEMITIC JEWS AT ALL! The vast majority of
Western European Jews came from East Europe and they, likewise, are not Semitical
Jews. Now recalling that the Ashkenazim leadership and nearly one-half of the
Israeli population are originally immigrants from Europe, their claim of a "divine
right" to the land of the Palestinians is null and void, and the majority of Jews
all over the world have no genetic or corpuscular links to the ancient, biblical
Hebrews.--William W. Baker, "Theft of a
Nation," Jireh Publications (1982), p. 177]
A.K. Ramakrishnan, "Mahatma Gandhi Rejected
Zionism," The Wisdom Fund, August 15, 2001
AUDIO: Rabbi Goldstein, Judaism
and Zionism, Neturei Karta, December 23, 2001
[Leaders of the country's most prominent ultra-Orthodox yeshiva are
scrambling to distance themselves from a book by one of their disciples,
which argues that gentiles are "completely evil" and Jews constitute a
separate, genetically superior species. . . .
Grama's book, published in Hebrew under the title "Romemut Yisrael Ufarashat
Hagalut," includes flowery endorsements from the most revered religious
scholars at the renowned Lakewood yeshiva, including the institution's
foremost religious leader, or rosh yeshiva, Rabbi Aryeh Malkiel
Kotler.--Allan Nadler, "Charedi
Rabbis Rush To Disavow Anti-Gentile Book," Forward, December 12, 2003]
[. . . the chairman of the Jewish Agency for Palestine, told Weizmann that he had "always
been hoping and waiting for" a solution of "the racial problem of Palestine" by way
of a transfer of its Arabs to Mesopotamia.--Benny Morris, "For the
record," Guardian, January 14, 2004]
Tariq Ali, "To be Intimidated
is to be an Accomplice: Notes on Anti-Semitism, Zionism and Palestine,"
CounterPunch, March 4, 2004
[The Jewish state could not have come into being without ethnic cleansing and, he
asserts, more may be necessary in future to ensure its survival.--Ghada Karmi, "By any means
necessary," Guardian, March 18, 2004]
[Ram sees a battle being waged over the redefinition of collective identity in
Israel between post-Zionism and neo-Zionism. "Post-Zionism is citizen-oriented
(supporting equal rights, and in that sense favoring a state of all its citizens
within the boundaries of the Green Line), universal and global. Neo-Zionism is
particularist, tribal, Jewish, ethnic nationalist, fundamentalist, and even fascist
on the fringe." . . .
Ram argues "the social sciences and humanities are not doing enough to sound the
warning bell and to flash warning lights regarding the dangers both of social
inequality and of apartheid."--Dalia Shehori, "Post-Zionism didn't die, it's
badly injured," Haaretz, April 28, 2004]
Compassion for Arabs and Jews is a bond with G-d, Solidarity with the "State of
Israel" is a bond with the Devil," Neturei Karta, May 6, 2004
Avi Shlaim, "Why
Zionism today is the real enemy of the Jews," Electronic Intifada, February 4,
John Rose, "We need a
post-Zionist leap of faith: Assimilation with space for Jewish identity offers us a
better future," Guardian, April 2, 2005
Gary Leupp, "Breaking the UN's Anti-Zionist
Resolution," CounterPunch, May 4, 2005
[With the First Zionist Congress of 1897, one of the financiers' geopolitical goals
became to support the creation of the nation of Israel, at least partly to dominate
the world's crossroads in the oil-rich Middle East.--Richard C Cook, "Extraordinary
Times, Intentional Collapse, and Takedown of the U.S.A.," australia.to, May 19, 2008]
[When Shlomo Sand's book The Invention of the Jewish People was published it caused a
largely a storm of outrage here in the United States among the few who read it. It was a
bestseller in Israel, though mostly reviled, and where it was reviewed in the American
corporate press the response was deeply hostile. Its central argument holds that the
Jews of Europe, the Ashkenazim, are largely descendants of peoples who converted to
Judaism in the distant past and that the claim that all Jews descend from ancient
Israelites is false. Therefore the contention that European Jews are reclaiming ancient
rights to their homeland in what is now Israel is a false claim. Moreover, the peoples
now known as "Palestinians" are in all likelihood much more closely descended
genetically from the ancient Israelites but who in the course of history converted for
one reason or another either to Christianity or to Islam, and who therefore have a just
claim to the land.--Paul Atwood, "
Whatever Happened to Shlomo Sand? Missing in Action After the Storm Over the 'Invention
of the Jewish People'," counterpunch.org, February 14, 2014]
Jim Wald, "Leaked report: Israel
acknowledges Jews in fact Khazars; Secret plan for reverse migration to Ukraine,"
timesofisrael.com, March 18, 2014
Copyright © 2001 Rabbi Dovid Weiss | <urn:uuid:8ed14a71-f174-4987-bea4-7515e5926081> | CC-MAIN-2016-44 | http://www.twf.org/News/Y2002/0401-NetureiKarta.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988718296.19/warc/CC-MAIN-20161020183838-00539-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.949351 | 4,667 | 2.515625 | 3 |
That the Supreme Court decided to hear a challenge to ObamaCare's individual mandate is not too shocking. But, as Politico reports, a number of aspects of the court's decision are surprising—and historic. The court will hear 5.5 hours of oral arguments in March, which Politico calls "an unprecedented amount of time in the court’s modern history." Also unexpected is the fact that, in addition to the individual mandate, the court will look at three other parts of the law, including the expansion of Medicaid—which, opponents say, is unconstitutional since Medicaid is a state-run program.
"The Medicaid issue has the potential to dwarf the individual mandate in its importance," says a former solicitor general, noting that if the planned changes to the state-run program are found to be "constitutionally coercive," it would "call into question the government’s use of the spending power across a wide range of activities." And Politico notes that the court might ultimately sidestep the challenge to the individual mandate altogether. Among the three additional issues it will consider: whether any ruling on the individual mandate must wait until at least 2015, after people without insurance would have paid a tax penalty. | <urn:uuid:d8a2f411-0f17-4505-aed2-c4d449f5ecbb> | CC-MAIN-2017-04 | http://www.newser.com/story/133391/why-supreme-courts-look-at-obamacare-surprises.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279915.8/warc/CC-MAIN-20170116095119-00278-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.957 | 241 | 1.625 | 2 |
This study was written by the English Puritan pastor and author Thomas Watson. It comes from the introduction to his exposition of "The Ten Commandments", which is part of his work entitled A Body of Practical Divinity.
A Classic Study by Thomas Watson (c. 1620-1686)
"Take heed, and hearken, O Israel; this day thou art become the people of the LORD thy God. Thou shalt therefore obey the voice of the LORD thy God, and do His commandments and His statutes, which I command thee this day." (Deut. 27:9-10).What is the duty which God requireth of man?
Obedience to His revealed will.
It is not enough to hear God's voice, but we must obey. Obedience is a part of the honour we owe to God. "If then I be a Father, where is my honour?" (Mal. 1:6). Obedience carries in it the life-blood of religion. "Obey the voice of the Lord God" (Deut. 27:10), and do His commandments. Obedience without knowledge is blind, and knowledge without obedience is lame. Rachel was fair to look upon, but, being barren, said, "Give me children, or I die;" so, if knowledge does not bring forth the child of obedience, it will die. "To obey is better than sacrifice" (I Sam. 15:22). Saul thought it was enough or him to offer sacrifices, though he disobeyed God's command; but "to obey is better than sacrifice." God disclaims sacrifice, if obedience be wanting. "I spake not unto our fathers concerning burnt-offerings, but this thing commanded I them, saying, Obey my voice." (Jer. 7:22). Not but that God did enjoin those religious rites of worship; but the meaning is that He looked chiefly for obedience--without which, sacrifice was but devout folly. The end why God has given us His laws, is obedience. "Ye shall do my judgments, and keep mine ordinances" (Lev. 18:4). Why does a king publish an edict, but that it may be observed?
What is the rule of obedience?
The written word. That is proper obedience which the word requires; our obedience must correspond with the word, as the copy with the original. To seem to be zealous, if it be not according to the word, is not obedience, but will-worship. [Religious] traditions which have no footing in the word, are abominable; and God will say, Quis quaesivit haec? "Who hath required this at your hand?" (Isa. 1:12). The apostle condemns the worshipping of angels, which had a show of humility (see Col. 2:18). The Jews might say they were loath to be so bold as to go to God in their own persons; they would be more humble, and prostrate themselves before the angels, and desire them to present their petitions to God; but this show of humility was hateful to God, because there was no word to warrant it.
What are the ingredients in our obedience that make it acceptable?
(1) It must be cum animi prolubio, free and cheerful, or it is penance, not sacrifice. "If ye be willing and obedient" (Isa. 1:19). Though we serve God with weakness, it may be with willingness. You love to see your servants go cheerfully about their work. Under the law, God will have a free-will offering (see Deut. 16:10). Hypocrites obey God grudgingly, and against their will; facere bonum, but not velle [they do good but not willingly]. Cain brought his sacrifice, but not his heart. It is a true rule, Quicquid cor non facit, non fit; what the heart does not do, is not done. Willingness is the soul of obedience. God sometimes accepts of willingness without the work, but never of the work without willingness. Cheerfulness shows that there is love in the duty; and love is to our services what the sun is to fruit; it mellows and ripens them, and makes them come off with a better relish.
(2) Obedience must be devout and fervent. "Fervent in spirit," etc. (Rom. 12:11). Quae ebullit prae ardore. As water that boils over; so the heart must boil over with hot affections in the service of God. The glorious angels, who, for burning in fervour and devotion, are called seraphim, are chosen by God to serve Him in heaven. The snail under the law was unclean, because a dull, slothful creature. Obedience without fervency, is like a sacrifice without fire. Why should not our obedience be lively and fervent? God deserves the flower and strength of our affections. Domitian would not have his statue carved in wood or iron, but made of gold. Lively affections make golden services. It is fervency that makes obedience acceptable. Elijah was fervent in spirit, and his prayer opened and shut heaven; and again he prayed, and fire fell on his enemies (see II Kings 1:10). Elijah's prayer fetched fire from heaven, because, being fervent, it carried fire up to heaven.
(3) Obedience must be extensive, it must reach to all God's commands. "Then shall I not be ashamed" (or, as it is in the Hebrew, lo Ehosh, blush) "when I have respect unto all thy commandments." (Ps. 119:6). Quicquid propter Deum fit aequaliter fit [All God's requirements demand equal effort]. There is a stamp of divine authority upon all God's commands, and if I obey one precept because God commands, I must obey all. True obedience runs through all duties of religion, as the blood through all the veins, or the sun through all the signs of the zodiac. A good Christian makes gospel piety and moral equity kiss each other. Herein some discover their hypocrisy: they will obey God in some things which are more facile and may raise their repute; but other things they leave undone. "One thing thou lackest," (Mark 10:21). Herod would hear John Baptist, but not leave his incest. Some will pray, but not give alms; others will give alms, but not pray. "Ye pay tithe of mint and anise, and have omitted the weightier matters of the law, judgment, mercy and faith." (Matt. 23:23). The badger has one foot shorter than the other; so these are shorter in some duties than in others. God likes not such partial servants, who will do some part of the work he sets them about, and leave the other undone.
(4) Obedience must be sincere. We must aim at the glory of God in it. Finis specificat actionem; in religion the end is all. The end of our obedience must not be to stop the mouth of conscience, or to gain applause or preferment; but that we may grow more like God, and bring more glory to Him. "Do all to the glory of God." (I Cor. 10:31). That which has spoiled many glorious actions, and made them lose their reward, is, that men's aims have been wrong. The Pharisees gave alms, but blew a trumpet that they might have the glory of men (see Matt 6:2). Alms should shine, but not blaze. Jehu did well in destroying the Baal-worshippers, and God commended him or it; but, because his aims were not good (for he aimed at settling himself in the kingdom), God looked upon it as no better than murder. "I will avenge the blood of Jezreel upon the house of Jehu." (Hos. 1:4). O let us look to our ends in obedience; it is possible the action may be right, and not the heart (see II Chron. 25:2). Amaziah did that which was right in the sight of the Lord, but not with a perfect heart. Two things are chiefly to be eyed in obedience, the principle and the end. Though a child of God shoots short in his obedience, he takes a right aim.
(5) Obedience must be in and through Christ. "He hath made us accepted in the beloved" (Eph. 1:6). Not our obedience, but Christ's merits procure acceptance. In every part of worship we must present Christ to God in the arms of our faith. Unless we serve God thus, in hope and confidence of Christ's merits, we rather provoke Him than please Him. As, when king Uzziah would offer incense without a priest, God was angry with him, and struck him with leprosy (see II Chron. 26:20); so, when we do not come to God in and through Christ, we offer up incense to Him without a priest; and what can we expect but severe rebukes?
(6) Obedience must be constant. "Blessed [is] he that doeth righteousness at all times." (Ps. 106:3). True obedience is not like a high colour in a fit, but it is a right complexion. It is like the fire on the altar, which was always kept burning (see Lev. 6:13). Hypocrites' obedience is but for a season; it is like plastering work, which is soon washed off; but true obedience is constant. Though we meet with affliction, we must go in our obedience. "The righteous shall hold on his way." (Job 17:9). We have vowed constancy; we have vowed to renounce the pomps and vanities of the world, and to fight under Christ's banner to death. When a servant has entered into covenant with his master, and the indentures are sealed, he cannot go back, he must serve out his time; so there are indentures drawn in baptism, and in the Lord's Supper the indentures are renewed and sealed on our part, that we will be faithful and constant in our obedience; therefore we must imitate Christ, who became obedient unto death (see Phil. 2:8). The crown is set upon the head of perseverance. "He that keepeth my works unto the end, I will give him the morning star." (Rev. 2:26,28).
Use one. This condemns those who live in contradiction to the text, and have cast off the yoke of obedience. "As for the word that thou hast spoken unto us in the name of the Lord, we will not hearken unto thee." (Jer. 44:16). God bids men pray in their family, but they live in the total neglect of it; he bids them sanctify the Sabbath, but they follow their pleasures on that day; he bids them abstain from the appearance of sin, but they do not abstain from the act; they live in the act of revenge, and in the act of uncleanness. This is a high contempt of God; it is rebellion, and rebellion is as the sin of witchcraft.
Whence is it that men do not obey God? They know their duty, but do it not.
(1) The not obeying God is for want of faith. Quis credidit? "Who hath believed our report?" (Isa. 53:1). Did men believe sin were so bitter, that hell followed at the heels of it, would they go on in sin? Did they believe there was such a reward for the righteous, that godliness was gain, would they not pursue it; but they are atheists, not truly brought into the belief of these things; hence it is that they obey not. Satan's master-piece, his draw-net by which he drags millions to hell, is to keep them in infidelity; he knows, if he can but keep them from believing the truth, he is sure to keep them from obeying it.
(2) The not obeying God is for want of self-denial. God commands one thing, and men's lusts command another; and they will rather die than deny their lusts. If lust cannot be denied, God cannot be obeyed.
Use two. Obey God's voice. This is the beauty of a Christian.
What are the great arguments or incentives to obedience?
(1) Obedience makes us precious to God, his favourites. "If ye will obey my voice, ye shall be a peculiar treasure unto me above all people;" you shall be my portion, my jewels, the apple of mine eye. (Exod. 19:5). "I will give kingdoms for your ransom" (Isa. 43:3).
(2) There is nothing lost by obedience. To obey God's will is the way to have our will. [i] Would we have a blessing in our estates? Let us obey God. "If thou shalt hearken to the voice of the Lord, to do all His commandments, blessed shalt thou be in the field: blessed shall be thy basket and thy store." (Deut. 28:1,3,5). To obey is the best way to thrive in our estates. [ii] Would we have a blessing in our souls? Let us obey God. "Obey, and I will be your God." (Jer. 7:23). My Spirit shall be your guide, sanctifier, and comforter. Christ "became the author of eternal salvation unto all them that obey Him." (Heb. 5:9). While we please God, we please ourselves; while we give him the duty, he gives us the dowry. We are apt to say, as Amaziah, "What shall we do for the hundred talents?" (II Chron. 25:9). You lose nothing by obeying. The obedient son has the inheritance settled on him. Obey, and you shall have a kingdom. "It is your Father's good pleasure to give you the kingdom." (Luke 12:32).
(3) What a sin is disobedience! [i] It is an irrational sin. We are not able to stand it out in defiance against God. "Are we stronger than He?" Will the sinner go to measure arms with God? (I Cor. 10:22). He is the Father Almighty, who can command legions. If we have no strength to resist Him, it is irrational to disobey Him. It is irrational, as it is against all law and equity. We have our daily subsistence from Him; in Him we live and move. Is it not just that as we live by Him, we should live to Him? that as He gives us our allowance, so we should give Him our allegiance?
[ii] It is a destructive sin. "The Lord Jesus shall be revealed from heaven with His mighty angels, in flaming fire, taking vengeance on them that obey not the gospel." (II Thess. 1:7,8). He who refuses to obey God's will in commanding, shall be sure to obey His will in punishing. While the sinner thinks to slip the knot of obedience, he twists the cord of his own damnation, and he perishes without excuse. "The servant which knew his lord's will, neither did according to his will, shall be beaten with many stripes." (Luke 12:47). God will say, "Why did you not obey? you knew how to do good, but did not; therefore your blood is upon your own head."
What means shall we use that we may obey?
(1) Serious consideration. Consider, God's commands are not grievous: He commands nothing unreasonable (see I John 5:3). It is easier to obey the commands of God than sin. The commands of sin are burdensome; let a man be under the power of any lust, how he tires himself! what hazards he runs, even to endangering his health and soul, that he may satisfy his lusts! What tedious journeys did Antiochis Epiphanes take in persecuting the Jews! "They weary themselves to commit iniquity;" and are not God's commands more easy to obey? Chrysostom says, virtue is easier than vice; temperance is less burdensome than drunkenness. Some have gone with less pains to heaven, than others to hell.
God commands nothing but what is beneficial. "And now, Israel, what doth the Lord require of thee, but to fear the Lord thy God, and to keep his statutes, which I command thee this day, for thy good?" (Deut. 10:12,13). To obey God, is not so much our duty as our privilege; His commands carry meat in the mouth of them. He bids us repent; and why? That our sins may be blotted out (see Acts 3:19). He commands us to believe: and why? That we may be saved (see Acts 16:31). There is love in every command: as if a king should bid one of his subjects dig in a gold mine, and then take the gold to himself.
(2) Earnest supplication. Implore the help of the Spirit to carry you on in obedience. God's Spirit makes obedience easy and delightful. If the loadstone draw the iron, it is not hard for it to move; so if God's Spirit quicken and draw the heart, it is not hard to obey. When a gale of the Spirit blows, we go full sail in obedience. Turn His promise into a prayer. "I will put my Spirit within you, and cause you to walk in my statutes." (Ezek. 36:27). The promise encourages us, the Spirit enables us to obey. | <urn:uuid:7b614207-f42b-4b7c-be0b-d9d834794015> | CC-MAIN-2017-04 | http://www.mountainretreatorg.net/bible/obed.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281649.59/warc/CC-MAIN-20170116095121-00438-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.95981 | 3,737 | 2.96875 | 3 |
Previous Challenge Entry (Level 2 – Intermediate)
Topic: Predicament (03/01/12)
TITLE: The Interrupted Life
By Cynthia Carter
LEAVE COMMENT ON ARTICLE
SEND A PRIVATE COMMENT
ADD TO MY FAVORITES
“I think I know what is wrong with you.” Krista said with a twinkle in her eye. “Just get a pregnancy test.”
“I don’t feel like wasting fifteen dollars on a stupid pregnancy test.” Linda snorted. “I’m on birth control and I’m 44 years old. How pregnant could I be?”
“Well birth control is not always dependable.” Krista said.
“Two of my co-workers are on fertility treatments and they are in their 20’s. My doctor said that a woman’s fertility goes down every year after 29. Getting pregnant is just not that easy.”
“You can get a pregnancy test for a dollar next door. Why don’t you just do it? Peace of mind is certainly worth a dollar.” Krista walked over to the calendar. “When was your last time of the month?”
“Let’s see your fertile time was right here. That was when you were at the beach.” Krista shrieked with glee.
“Don’t forget. We took Mama on vacation with us. That’s the best birth control on the planet.” Linda said with relief. “OK it will be worth a dollar to shut you up.”
Linda set her mail satchel down and rushed next door to buy the test.
The clerk’s eyebrow shot up as Linda plopped the box on the counter. “Oh this is for Krista.” She said pointing next door.
She hurried back, ripping the plastic wrapper off and tossing the instructions to Krista. Linda’s hands were shaking as she dashed into the bathroom. It seemed as if the thing turned purple before she even wet it.
“Purple means you’re pregnant.” Krista called.
The lazy summer clouds drifted over head. A slight warm breeze kissed Linda’s check. The chorus of the birds matched the one in her heart. It swelled in her chest and filled her whole body with delight. She could smell the sweet fragrance of honeysuckle all around. She wanted to tell the world. She was going to have a baby. She heard the angels singing. She put her mail bag in the truck as reality slammed in.
Dennis would be furious. Fear yanked the joy right out of her heart. A crow cawed as it flew over the parking lot. Linda stood with the weight of the world on her shoulders. The smell of diesel fuel assaulted her nostrils and a wave of nausea overtook her. Retirement had been in sight. Did she have enough sick leave? She had given away the baby things a decade ago. The sun ducked behind a cloud as she climbed into her mail truck.
“I bought that test at the dollar store.” Linda whined to the nurse at Woman Care. “I want a real pregnancy test.”
“Their test is as accurate as ours.” The nurse snapped. “There is no such thing as false positive, only false negatives. Now go to CVS and pick up some prenatal vitamins, the store brand is cheaper and just as good. We will see you in August.”
“I don’t have a prescription.” Linda said.
“ They are over the counter now. Things have changed since your last baby.” The nurse sighed and patted Linda’s hand. “It’s really going to be alright.”
How was she going to tell Dennis? She thought about their decision not to have children. They each had two children from their previous marriages. That was enough.
Linda’s mother-in-law, Anne, was the mayor of the small town where they lived. Her store was beside the post office. Linda giggled when she learned that Anne had run for sheriff. She knew that Dennis could handle her strong will. What an act to follow? She adored her husband’s mother. Mother-in-law was a good word in her book. Linda went next door to break the news.
Linda sobbed, “I’m pregnant and Dennis is going to kill me.”
Linda was stunned when her mother-in-law started laughing so hard that she wet her pants. Her mother-in law grabbed her and hugged her. She begged Linda to run home and get her a change of clothes.
Linda grudgingly handed her mother-in-law the dry clothes.
“I’m sorry but the look on your face was priceless. It reminded me of how I felt when I found out I was pregnant with Lori. I was 39. I thought the world had ended. This will be the blessing of your life. Dennis is going to be tickled.” Anne grinned.
Anne was right.
The opinions expressed by authors may not necessarily reflect the opinion of FaithWriters.com.
If you died today, are you absolutely certain that you would go to heaven? You can be right now. CLICK HERE
JOIN US at FaithWriters for Free. Grow as a Writer and Spread the Gospel. | <urn:uuid:5299717d-5032-4a17-905c-bc1a5e95d2e0> | CC-MAIN-2017-04 | http://www.faithwriters.com/wc-article-level2-previous.php?id=42050 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281649.59/warc/CC-MAIN-20170116095121-00436-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.977735 | 1,180 | 1.976563 | 2 |
Plan would revamp EU agricultural policy to secure food supply, protect the environment and ensure rural areas are developed sustainably.
Reforms to the common agricultural policy (CAP) after 2013 seek to help farmers adapt to the market’s changing needs and secure a sustainable food supply.
The proposals aim to make the best use of funds by encouraging farmers to become more competitive. Consumers would benefit from quality food at fair prices.
The measures include:
- making support fairer, simpler and more focused – limit basic assistance to active farmers and cap it at €300 000 per farm per year and distribute funds more equitably among farmers, regions and EU countries
- helping farmers cope with rapid changes in prices and demand – speed up support during economic crises
- reserving 30% of CAP payments for farms using environment-friendly practices – support crop diversification, permanent pasture maintenance and preservation of natural areas and landscapes
- targeting better research and innovation – double R&D funding, make research more relevant to farmers’ needs, and accelerate knowledge transfer from lab to field
- empowering farmers – support farming organisations and promote more direct links with consumers by cutting the number of intermediaries
- backing environment protection – make the fight against climate change and efficient resource use top priorities for rural areas
- attracting younger farmers – support those under-40 during their first five years of farming
- promoting rural employment and entrepreneurship – provide up to €70 000 over five years for small projects, for example
- preventing desertification – provide additional funds for farmers in areas with natural handicaps
- cutting red tape – make rules simpler, especially for small farmers, who would receive lump-sum payments from €500 to €1000 per year per farm
Thanks to previous reforms, CAP’s share of the EU’s budget has declined from almost 75% to 41%. The new proposals would fine tune available funds in a more targeted and efficient way.
They should come into effect in 2014, once approved by the European Parliament and national ministers in the Council of the EU. | <urn:uuid:eaac69f6-7412-42e9-a44a-1122d7e31f8e> | CC-MAIN-2017-04 | http://www.eulaws.eu/?p=1000 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280761.39/warc/CC-MAIN-20170116095120-00097-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.934089 | 417 | 2.578125 | 3 |
Keyless flutes hold an important place in modern folk and Irish music but they first appeared about 9000 years ago. Excavations at the early Neolithic site of Jiahu1,2 in Henan Province, China have produced examples of playable instruments these flutes are made of Red-Crowned Crane wing bones they appear to be end blown instruments with between 5 and 8 tone holes.
The Kena flute of South America is also an end blown flute and fits into the history of keyless flutes. Ancient tombs have yielded flutes and other musical artefacts; many ceramic jars found in ancient tombs depict musical instruments being used in various contexts, including shamanism, hunting and dancing.
The penny whistle has been found to be part of numerous cultures throughout the world and is probably the best known of the keyless flutes. Whistles costing a good bit more than a penny feature in much of our modern music and are in great demand for setting scenes in movies.
Medieval flutes were certainly keyless flutes and are thought to have been parallel bored instruments with large outer diameters and therefore, maybe, large bores. They are always depicted as having decorative rings above and below the embouchure and also near the foot. It is still a matter of debate as to weather these markings were just decoration possibly burned on while mounted in the lathe or weather they were actually bindings to stop the instrument cracking. It is not likely that they are repairs as they are nearly always shown in the same position on the instrument.
Some of the most sophisticated keyless flutes were made in Italy during the renaissance period. These instruments demonstrate an extraordinary level of skill in their makers but even more so they demand a very high level of playing competence. In the right hands the Renaissance flute has probably the widest range and tonal variation of any keyless flute.
Baroque flutes while not keyless in themselves, they have one key to produce the Eb note which can not be produced by cross fingering, provide the link between the parallel bored renaissance instrument and today's keyless flute popularised by folk and Irish musicians with its tapered bore.
Unlike violin, guitar, etc. the penny whistle needs air. Wind players must breathe within a tune, it is essential that the breath control becomes efficient and relaxed while playing. Some basic tips are to breathe from the abdomen and as you play keep a clear wind way from your stomach up through the throat and out into the whistle. There are various exercises for breath control such as yoga breathing. I would say just practice deep breathing making sure the entire capacity of the lungs are used. As well as helping the tone and control of the whistle there are also health benefits!.
The manufacturing of keys is done in several ways. Earlier flutes such as those from the Baroque were fitted with keys cut from sheet metal and furnished with a soldered on block to accept the drilling for the trunnion. Later instruments had hand forged keys made using the techniques of the silversmith and cheaper instruments use cast copies of those hand made keys. My own instruments are equipped with keys , hand made from solid brass components silver soldered together and then polished and plated with pure silver. These keys are then block mounted in brass lined blocks and fitted over tone holes which also have a brass liner specially shaped to reduce acoustic impedance which gives a louder and clearer sound than the older instruments drilled and counter faced tone holes. This system also gives a much longer lasting sealing surface for the pads than the original ones which were prone to leak due to chipping or cracking of the sealing edge. | <urn:uuid:690f389b-74ff-42b1-a9a9-4581c65d4352> | CC-MAIN-2017-04 | http://www.woodenflutes.co.uk/keyless-flutes.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280825.87/warc/CC-MAIN-20170116095120-00209-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.979666 | 740 | 3.4375 | 3 |
A DAY of "unpleasant weather" is on the cards tomorrow (Monday) according to the Met Office's Chief Forecaster, as the organisation puts out a yellow warning for rain in Wales.
As of 6am tomorrow morning heavy rain is set to spread from the southwest throughout the day with impact on holiday traffic and outdoor activities.
The yellow warning means "beware".
A complex area of low pressure will see rainfall of more than 15mm (just over half an inch) quite widely, while a few places could see more than 30mm (just over an inch).
There will be a lot of surface water and spray on roads, and winds will be locally strong and gusty, the Met Office has said. | <urn:uuid:e30439ab-b965-4fcc-9dae-98cdad59d69c> | CC-MAIN-2017-04 | http://www.freepressseries.co.uk/news/11430133.Wet_weather_warning_for_Bank_Holiday_Monday/?ref=var_0 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282202.61/warc/CC-MAIN-20170116095122-00558-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.95122 | 147 | 1.632813 | 2 |
Marine Rescue volunteers had just completed a training exercise where they simulated a search for a crashed plane when the real thing happened on Sunday
Marine rescue regional coordinator for the Illawarra Bruce Mitchell drove to Batemans Bay to assist with the operation after a light aircraft came down near Barlings Beach at 12.10pm.
He said Batemans Bay Marine Rescue boats had just returned from the training exercise when the crash happened.
One man has been confirmed dead, while another remains missing.
Mr Mitchell said visibility and weather conditions had so far aided the search.
“They could just make out the wreckage on the bottom and also they ran the sounding equipment over it there was something of a reasonable size there,” he said.
The search has focused in an area of water about 22 metres deep, Mr Mitchell said.
“From the wreckage I saw brought back in last night it must’ve been a hard impact,” he said.
Water police from Sydney will dive the wreck on Monday to try and find the body of the missing man. | <urn:uuid:cdb5aae8-f199-4df3-8c67-f8e0c6f9a0cf> | CC-MAIN-2017-04 | http://www.illawarramercury.com.au/story/2400004/south-coast-plane-crash-training-exercise-becomes-the-real-thing/?src=rss | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280242.65/warc/CC-MAIN-20170116095120-00082-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.968307 | 221 | 1.632813 | 2 |
The Too Cool Thing that I discovered today is that there is now, many years later, a free software alternative to AMPL, namely ZIMPL .
What is that? It is a Little Language for transforming descriptions of mathematical problems into Integer Programming/Linear Programming formulations that may then be solved using an LP/MIP solver.
Why? Because the quasi-standard format for these problems, MPS, will make your ears bleed if you try to write up a complex model directly. If you're trying to describe a problem of interesting size (thousands of variables and constraints), you really do need to write a program to generate an MPS file.
AMPL, and now ZIMPL, allow you to describe your problem using reasonably nice looking equations, with two particularly pointed additions:
- You can define model variables and parameters that draw their values from formatted data in external files, allowing you to use any sort of database / import scheme to define large portions of the problem and parameters
- You can define sets of model variables with descriptive "subscripts," and have equation descriptions that generate gobs of model equations that are identically shaped by merely describing one of them
It's not difficult for 30 lines of AMPL/ZIMPL model description to combine with a data file with 50-100 parameter values to then expand to generate a planning model with tens of thousands of variables and constraints.
Of course, it would be bad news if this was insoluble; modern LP solvers on modern hardware can solve problems with hundreds of thousands if not millions of variables/constraints.
The one annoyance is that the default solver is anything but free; it's still all too common for Operations Research tools to be "free for purely academic use" but exceedingly proprietary anywhere else... | <urn:uuid:fe5538d9-7b2d-41c5-81bb-139cb4b59997> | CC-MAIN-2016-44 | http://www.advogato.org/person/cbbrowne/diary.html?start=10 | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720737.84/warc/CC-MAIN-20161020183840-00220-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.90641 | 365 | 2.125 | 2 |
Minecraft is a game that allows players to build things and play with others. Mods are applications that can be downloaded from the website Mojang, which enhances gameplay for PC and console versions of the game.
Certain functions of the Nintendo Switch might not work correctly if mods aren’t installed properly.
If you are having trouble getting hot water, it’s likely that your hot water heater isn’tturning on or is defective. You can also try adjusting the shower valve to get a more consistent temperature.
If the problem persists, there may be something wrong with your shower mixer valve.
Can I jailbreak my PS4?
If you’re looking to get more out of your PS4, jailbreaking might be the way to go.
If you want to use mods on your Nintendo Switch, you’ll need a different software. Nintendo has stopped supporting mods for the console, so if that’s what you’re looking for, your best bet is to look into PC or Mac versions of Minecraft.
Minecraft is not backwards compatible, so you’ll need to download the newest version of the game if you want to use your old mods. You won’t be able to play with your old maps or use your older versions of Minecraft.
Mods aren’t available in all countries and regions, so make sure that you’re aware of any specific requirements before downloading a mod.
What happens if you put Minecraft Xbox 360 disc in Xbox One?
If you have an Xbox One and want to play Minecraft, be sure to have the game disc or buy a backward compatible controller.
Creating a Microsoft account is the first step in playing Age of Empires Online without an internet connection. Once you have your credentials, sign in and play offline.
How do you play Minecraft offline?
If you want to play Minecraft offline, follow these simple steps: Launch the game through the launcher Select “Play Offline” from the main menu Enter your username and password (if applicable) into the appropriate fields and click save Click on “Launch Game” to begin playing without an internet connection
Can Minecraft be played without internet?
Minecraft is a popular game that requires an internet connection.
To keep your game updated and secured, look for the version number. You can also enable in-game console commands to troubleshoot issues on your own. | <urn:uuid:7fb3ca32-8be5-412f-8def-38d78063c3ea> | CC-MAIN-2022-33 | https://or-live.com/how-to-install-mods-on-nintendo-switch-minecraft/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572192.79/warc/CC-MAIN-20220815145459-20220815175459-00070.warc.gz | en | 0.893266 | 537 | 2 | 2 |
Suicide is a sad and gloomy topic, probably not the favorite of most of us but there are some suicides that are really worth mentioning. Some of them might be odd and some of them are pretty sick; however, it’s fascinating to see such creativity…and such a strong will to die for some.
|It can bring you closer to God |
in many different ways.
7 – The first one on our list is not that gruesome, but very odd. I’m not a religious person and I might have trouble understanding why anyone would try to kill themselves by eating a Bible. First of all, a Bible is rectangular so I wouldn’t be eager to see the autopsy photos. My second concern is how you make that decision? I know it’s hard to find suicide supplies in a prison, but seriously, you start eating a book?
The interview with the doctor is absolutely fascinating:
“I found I was physically not strong enough to pull the object out of this guy's throat”.
“The average person does not have the will to persistently shove something of such a size, such a solidity down the throat. “
If I am going to commit suicide one day, I want to baffle the doctor the same way this guy did. I mean, if you are going to die, at least be creative and this guy managed to shock everybody.
It seems he had a thing for shoving stuff down his throat because he previously tried to choke with his fists, which should have made the staff a little bit more suspicious and probably they should have kept him under strict supervision.
We can all agree that the guy who did this wasn’t sane and it seems that the jail psychiatrist can confirm it because apparently before committing suicide the man was psychotic and refused to take medication.
|Perhaps I exaggerated with this, |
I don't think they have Hello Kitty toilet paper in prison.
There’s not much to say about his behavior, but it seems that prisons should take more measures against suicide and not only prohibit shoe laces and belts, but also toilet paper. It would lead to a messy situation but less people would die.
|They were waiting for him to snap.|
5 - If you are a janitor at a Zoo and you want to commit suicide, you can always choose to be eaten alive by wild animals. This man from
went into the tigers’ cage and...well, died. Apparently he was committing suicide. We have to give him credit because it is such a brave way to die. It seems that there is a video about it on YouTube but I couldn’t show it to you guys or see it myself because I don’t have the stomach for such things. Singapore
|Shouldn't be used as a skin moisturizer |
or a main ingredient for a cocktail.
4 – If you thought only men are brave enough to commit gruesome suicides, you are wrong. Angela Scoular, an English actress, committed a really sick suicide. She suffered from depression most of her life and tried to commit suicide by cutting her wrists. In 2009 she was diagnosed with colorectal cancer and despite the fact that she managed to be cured, she was afraid that it would return. In 2011 she died by ingesting acid drain cleaner and pouring it on her body too to make sure that she would die from burns if drinking it was not enough. Apparently she was suffering from bipolar disorder.
|Decapitation probably isn't covered by insurance.|
3 – This next suicide story is about a wealthy man who died in a really cool way. He wanted to get revenge on his wife. But he didn’t do it the way most people get revenge, like cheating with a younger woman, going to Las Vegas and spending money on strippers, participating in a Donkey Show or having mushroom trips. No, the guy decapitated himself.
But that’s not the cool part of the story, the cool part is the fact that he used an Aston Martin to do it. He used a rope which he tied on a tree and then tied it on his neck;so, you probably imagine what happened next. He drove away on a very busy road and got decapitated while a lot of people watched. That's such a badass way to die.
|And they say shooting yourself is the easiest way to die.|
This suicide is so sick and the man wanted to die so much that I really feel sorry for him trying so hard. Apparently he started by shooting himself in the rib cage after loading the first cartridge. That didn’t work so he went to his car and got another cartridge and shot himself in the throat. That didn’t work either because it only took a part of his lower jaw. Probably pretty upset about his suicide, he then walked about 136 meters on a hill so that he could load another cartridge and shot himself in the chest. That last one was fatal and by the time I read that I was really hoping he managed to do it because that’s probably the most unlucky person in the universe. The moral of this story: keep your cartridges near and always aim for the heart.
|At least he was eco friendly about it |
and made himself biodegradable.
1 - The first place should be given to someone special and there’s nothing more special than a schizophrenic artist. He was very creative with his death. Richard Sumner was missing for three years when a skeleton was found in a forest. Apparently, he handcuffed himself to a tree and then threw away the key to make sure it was out of his reach. They discovered that he changed his mind about the suicide because he tried to free himself, but he failed. That’s probably the most creative and sickest way to commit suicide, but he was an artist so he wanted to die like one too. He was also suffering from schizophrenia for a very long time, so that might have added to his creativity.
Interesting book on the subject:
Vegas Strip Deaths - Shocking True Stories of Murders, Suicides, and Unusual Deaths of the Las Vegas Strip | <urn:uuid:cff516d2-0cb0-46a5-961f-a55a9ccefc16> | CC-MAIN-2017-04 | http://curioustendency.blogspot.com/2011/09/7-most-unusual-ways-to-commit-suicide.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560284405.58/warc/CC-MAIN-20170116095124-00034-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.98583 | 1,280 | 1.632813 | 2 |
Bridgett M. Davis and Renée Cox
- 75 Minutes
- Tuesday, September 30, 2014 3:00 p.m.
In Conversation: Bridgett M. Davis and Renee CoxAn extensive discussion between writer/director Bridgett M. Davis and artist/photographer RenéeCox of their creative partnership on NAKED ACTS and their work individually on themes of black women’s sexuality and its representation in film, literature, and art. Moderated by LaMonda Horton-Stallings, Associate Professor, IU's Department of Gender Studies.
In 2013, IU's Black Film Center/Archive (BFC/A) received an important donation from Bridgett M. Davis of the original 35mm elements for her independent feature, NAKED ACTS (1996), along with an extensive collection of contextual material, including the shooting script, production notes, journals, press kits, and other items related to the film’s development, production, exhibition, and reception. Cited in S. Torriano Berry’s The 50 Most Influential Black Films as the first feature film to be written, directed, produced, and entirely self-distributed by an African American woman, NAKED ACTS broke ground as well for Davis’s expressly Black feminist project: to “explore the myriad influences—personal, familial, communal, and societal— that have an impact on [a Black woman’s] sense of herself as a sexual being” and to examine the impact on self-image of “the dominant film portrayals of Black women in this country’s cinematic history.” In casting the role of Diana, the “sistah spirit” in the film, Davis found a creative partner in her fellow image-maker, artist Renée Cox, who grounds the film with her performance as an art photographer taking the nude black female form as her subject. Davis’s film was embraced by critics and audiences on the festival circuit, appearing at over two dozen festivals in the US, Europe, and Africa.
Sponsored by Black Film Center/Archive, College Arts & Humanities Institute, the Kinsey Institute, Departments of American Studies, Gender Studies, English, and African American and African Diaspora Studies, the Creative Writing Program, and IU Cinema. | <urn:uuid:e4a9066e-dae2-4089-b4ca-9540258162c9> | CC-MAIN-2016-44 | http://www.cinema.indiana.edu/?post_type=film&p=7114 | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720737.84/warc/CC-MAIN-20161020183840-00221-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.935038 | 487 | 1.5625 | 2 |
Realizing advanced clean energy systems
The Planetary Association for Clean Energy (PACE) is a non-profit, charitable corporation whose objects are to facilitate the discovery, research, development, demonstration and evaluation of clean energy systems. PACE is an NGO Special Consultative status with the Economic and Social council of the United Nations (ECOSOC). Our work is possible through contributions by our generous supporters.
Digital archive project
Throughout half a century of research and public information development, the Planetary Association for Clean Energy, Inc. (PACE) has produced and collected a vast, internationally recognized special library comprised of many rare or original documents. In early 2020, PACE embarked on a project to formally archive, curate, digitize and publicize the contents of our special library collection.
The PACE logo is what pioneering physicist and engineer Nikola Tesla saw in his lab in New York City, when he was transmitting electrical energy through a single sire, sectioned and pointed at his eyes. The swirl is the magnetic field that follows into the electron stream going forward towards an observer | <urn:uuid:9348d78b-39de-4b5e-be09-99eb38f62939> | CC-MAIN-2022-33 | http://pacenetwork.org/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00271.warc.gz | en | 0.935293 | 220 | 2.03125 | 2 |
Policy interest in the cost of adaptation is growing, but compared to the mitigation literature adaptation cost research is still in its infancy. Global adaptation cost estimates from more recent studies range from around $25 billion a year to well over $100 billion by 2015-2030. The wide range is symptomatic of the poor state of knowledge. Important knowledge gaps remain both in terms of scope (whether all relevant impacts are covered) and depth (whether for a given impact all relevant adaptation options have been considered). The omissions introduce biases in both directions, upward and downward, but it is likely that adaptation costs have been underestimated so far. Adaptation is only one part of the overall response to (and therefore the costs of) climate change. The total burden of climate change consists of three elements: the costs of mitigation (reducing the extent of climate change), the costs of adaptation (reducing the impact of change), and the residual impacts that can be neither mitigated nor adapted to. The annual adaptation cost estimates reviewed here cannot be directly compared with the other two cost elements. Making this comparison would require an integrated model that takes into account the total impact of greenhouse gases over their lifetime in the atmosphere. Copyright © 2010 John Wiley & Sons, Ltd.
For further resources related to this article, please visit the WIREs website. | <urn:uuid:12f14b76-0884-46c7-9e77-c4e66b3f518e> | CC-MAIN-2016-44 | http://onlinelibrary.wiley.com/doi/10.1002/wcc.14/abstract?globalMessage=0 | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719273.38/warc/CC-MAIN-20161020183839-00066-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.938835 | 266 | 2.96875 | 3 |
I am writing today from the beautiful Tampa Bay area.
After the wise men were gone, an angel of the Lord appeared to Joseph in a dream. “Get up! Flee to Egypt with the child and his mother,” the angel said. “Stay there until I tell you to return, because Herod is going to search for the child to kill him.” That night Joseph left for Egypt with the child and Mary, his mother, and they stayed there until Herod’s death. This fulfilled what the Lord had spoken through the prophet: “I called my Son out of Egypt.” Matthew 2:13-15 NLT
Joseph was warned in a dream to flee into Egypt, that in a heathen land he might find an asylum for the world’s Redeemer.-Ellen White, Confrontation, Page 2
Should “going back to Egypt” always be considered a bad thing? For a while Egypt was a safe haven for the Redeemer. Jesus could claimHeliopolis 1 as His home town as easily as He could Bethlehem or Nazareth. Besides Egypt being an asylum, do you think having a connection to Egypt, be it ever so brief, aided Jesus in being the Savior of the world?
Are there times that houses of worship that we might compare to “Egypt” could be an asylum to those who have been abused spiritually, physically or sexually in God’s church? Especially if the abusers were not dealt with properly? Is it ever possible that while we get frustrated because someone will not come out of “Egypt” that God could actually be keeping her in “Egypt” to keep her safe from someone in your church?
Several years ago I worked with a pastor who had previously ministered in the Southern United States. I was appalled, when he told me that a black family came to visit his church one Sabbath, and instead of welcoming them in, the greeter gave them directions to the black church across town! The pastor realized the greeters were not safe people in his church.
I have seen older people sit through a church service where the music was blaring so loud that it was causing physical pain to their ear drums. This goes beyond taste in worship music to physical abuse. Still the pastor told them if they did not like it they could just go somewhere else. Never mind the fact that the older people poured their heart and soul into building that church. Was the pastor being a bully? He claimed he wanted to make church a safe place for young people.
Shouldn’t our churches be safe places for blacks as well as whites? Shouldn’t churches be safe places for older people as well as younger people? Do you have to bully one group to make it safe for the other? I don’t think so. I am pretty sure Nicodemus as well as Zacchaeus found Jesus to be a safe person.
Is your church a safe place? Or would some people be more safe worshiping in “Egypt?”
The cold hard fact is, if for whatever reason, Israel was not always a safe place for our Redeemer, spiritual Israel may not always be a safe place either. Having worked 25 years in three different conferences, I have met people in every conference who were abused, sexually, physically and spiritually by a church leader, and the church refused to deal with it. Just moving the abuser to another church is not dealing with it! Should an abuse victim be guilted into staying in an abusive church just because it teaches truth?
Jesus’ earthly father, Joseph, was not the first Joseph to find asylum in Egypt. A Joseph before him was mistreated and sold into Egypt. I have often wondered, though, if Joseph enjoyed the separation as much as his brothers did! At the end of the story Joseph’s brothers, who were the ancestors of God’s remnant people, by the way, finally repented and became safe people for Joseph to be around. Until then, God kept Joseph safe in Egypt until His remnant became a safe place for Joseph to be, just like God kept Joseph, Mary and Jesus safe in Egypt until Israel became a safe place.
Most all of our Adventist churches are safe. We protect families from domestic abuse and create safe places to grow spiritually without judgment and condemnation. Many a young person has left the church, and been wounded by the world, and then loved back into the church, where they found healing and unconditional love. But let’s be honest. This is not the case all the time. So let’s not be judgmental of someone who may find healing in Egypt, just like Joseph did when his family, the ancestors of the last remnant, was not a safe place for him to be, or like the latter Joseph did, when Israel, for whatever reason, was not a safe place for his family.
- S.D.A. Bible commentary, Vol. 5 Page 291 suggests this is where Jesus’ family stayed in Egypt. You may study this week’s SS lesson here. | <urn:uuid:87136827-9bb9-4df4-89e0-ba17292ce5c0> | CC-MAIN-2022-33 | https://inlightofthecross.com/tag/egypt/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00670.warc.gz | en | 0.985283 | 1,059 | 1.570313 | 2 |
A documentary detailing the ongoing conflict in Uganda and the plight of child soldiers has become a viral hit.
More than 30,000 children are believed to have been abducted by the rebel group, with the male children being forced to bear arms, and the females being used as sex slaves. The group has also slaughtered hundreds of thousands of civilians in central Africa.
The 30 minute film shows war-torn Uganda through the eyes of a former LRA child soldier called Jacob and aims to raise awareness of the country's grisly conflict.
The film was made by the Invisible Children charity, which is calling for an international effort to arrest Kony, disarm the LRA and bring the child soldiers home.
A statement on the website reads: "We seek to rebuild schools, educate future leaders and provide jobs in Northern Uganda. We are the motivated misfits and masses redefining what it means to be an activist."
Kony, a former altar boy, is wanted on 33 criminal charges, including 12 counts of crimes against humanity, murder, enslavement and rape.
The LRA began its attacks in Uganda in the 1980s, when Kony sought to overthrow the government. Since being pushed out of Uganda several years ago, the militia has terrorised villages in Central Africa, AP reported.
The video has been shared over four million times on Facebook and is trending on Twitter under the hashtag #KONY2012.
Celebrities including Rihanna, Nicole Ritchie and Stephen Fry have all tweeted their support for the campaign.
Click here to support the international effort to arrest Kony.
Suggested For You
SUBSCRIBE AND FOLLOW
Get top stories and blog posts emailed to me each day. Newsletters may offer personalized content or advertisements.Learn more | <urn:uuid:ca9fddc5-d32d-4e4f-88f7-ba86064202f7> | CC-MAIN-2016-44 | http://www.huffingtonpost.co.uk/2012/03/07/kony-2012-invisible-children-documentary-sheds-light-on-uganda-conflict-video_n_1326183.html?ref=uk | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721405.66/warc/CC-MAIN-20161020183841-00312-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.961295 | 360 | 1.929688 | 2 |
3D printing technology is moving forward at an almost lightning fast pace. Just a few years ago, 3D printing was considered a science fiction type of technology, and one that humans were not thought to master for decades to come. But thanks to some very dedicated innovators and the growing interest for this quite amazing industry, things have moved beyond our wildest expectations. Today we can print things with accuracy down to a few microns, and even print whole gadgets with moving parts in one go. Up until now, we haven’t been able to print working simple electronics though, no matter how simple they were. However, that has now changed in an instant, and we are looking at another huge leap in 3D printing technology.
This breakthrough comes from the University of Warwick where researchers have been able to create new material to print with. This new material, nicknamed “‘carbomorph,” is a combination of carbon black and polymorph, hence the name. It will allow us to print simple electronics such as game controllers and gadgets that don’t include wiring within them that is too advanced.
Even though it might seem like a small step to print simple electronics, it’s still a huge step towards a more advanced technology. The next step for the researchers at the University of Warwick is to print more advanced electronics. Maybe it will be a while still before we will see simple electronics printing become advanced cell phone printing. But at least we’re on our way to breaking all expectations when it comes to 3D printing and the technology behind it. For everyone who once believed that 3D printing gadgets at home was always going to be a science fiction dream, brace yourself since we are on the verge of making this technology far more advanced than any of us could have ever expected. I wouldn’t be surprised if within a few years we will be able to buy a simple electronics cell phone through the Internet and then instantly print it out and use it as soon as we have downloaded the blueprints for it. It’s a technology that will change the world quite a lot. There’s no doubt about it!
University Of Warwick’s Simple Electronics 3D Printing | <urn:uuid:8ee38067-8585-4646-a5b2-51ea26d3705c> | CC-MAIN-2017-04 | http://www.bitrebels.com/technology/3d-printing-simple-electronics/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283301.73/warc/CC-MAIN-20170116095123-00508-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.955388 | 448 | 2.984375 | 3 |
In the year 1821 (Circa) Major James Scarborough built the historic Scarborough House in what would become Saratoga North Carolina. The house was built in a federal style with a T configuration for the breezeway. Major James Scarborough Original configuration is still mostly seen to this day with a large dining room, living room and entrance way on the first floor. The second floor had 4 smaller bedrooms which had been converted into 2 bedrooms, additionally there are two trunk rooms and a bathroom on the 2nd floor. Lastly there is access to the attic, which is not currently heated or cooled. The attic is is very large and used for storage but one day may be converted into additional living space. | <urn:uuid:a3a4cc87-0623-4079-b448-7548e0b82cbb> | CC-MAIN-2022-33 | https://scarboroughhouse.com/history/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571284.54/warc/CC-MAIN-20220811103305-20220811133305-00466.warc.gz | en | 0.980061 | 140 | 2.34375 | 2 |
Aug 9, 2016 ... Symptoms such as these may or may not be due to the head gasket. An accurate
diagnosis often depends on the expertise of a skilled ...
It is easy to be mislead, when trying to diagnose a bad head gasket. Symptoms
will often vary considerably, depending on how the gasket fails. The term "blown
www.ask.com/youtube?q=Head Gasket Diagnosis&v=TDd0B7dSsTk
Jun 28, 2012 ... Here is another head gasket test video where I am using a chemical kit ... how to
use a gas analyzer to test for a blown head gasket
Dec 27, 2013 ... Because much of the gasket can't be seen without disassembling the engine, it
can be very difficult to diagnose a head gasket leak. Since a ...
Well... As a home mechanic, you don't generally "test" for a blown head gasket. A
leaking, or "blown" head gasket will come with some pretty obvious symptoms.
After reading this article, you will know what a head gasket is, what it looks like, ...
tells you to drop off the vehicle, and they will call you later with the diagnosis.
However, more subtle cylinder head gasket failure signs may be more difficult to
diagnose. The engine may experience mysterious coolant loss, or only lose ...
Between these elements is the infamous head gasket. The function of the head
gasket is to seal both the compression of the cylinders and the coolant which ...
A blown head gasket is sometimes hard to diagnose, often expensive to repair
and always a headache. It usually begins with a leaking cooling system that goes
Nov 4, 2013 ... Head gasket replacement is typically done by a professional mechanic, but you
can learn how to diagnose and replace a head gasket yourself. | <urn:uuid:27c5ddb1-e713-4635-bf6a-48a6f57e6faa> | CC-MAIN-2017-04 | http://www.ask.com/web?qsrc=6&o=102140&oo=102140&l=dir&gc=1&q=Head+Gasket+Diagnosis | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285315.77/warc/CC-MAIN-20170116095125-00565-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.888507 | 396 | 1.867188 | 2 |
Rural emergency hospitals (REHs) are a new Medicare provider type that will allow Medicare to pay for emergency department and other outpatient hospital services in rural areas beginning on January 1, 2023, without requiring the facility providing the services to meet the current Medicare definition of “hospital.”
As part of the Calendar Year 2023 Outpatient Prospective Payment System proposed rule, the Centers for Medicare & Medicaid Services (CMS) has provided additional detail on the proposed payment methodology for REHs and how REHs will be treated under the Stark Law. CMS previously issued a separate proposed rule that sets forth the REH Conditions of Participation (CoPs). Please see our prior article here. We have also previously provided additional information about the statutory REH provisions and CMS’s prior request for comments on the REH CoPs and payment methodology in the following article here.
Under current Medicare program rules, Medicare does not recognize “freestanding emergency departments” or other non-hospital providers of emergency department services. Medicare will only pay for these services at facilities that meet the Medicare definition of “hospital,” which requires the provision of inpatient services, among other requirements that are often difficult for low-volume facilities to meet. This limitation has presented particular challenges for rural communities, where there may be insufficient patient volume or resources to support inpatient services, but where access to emergency services and higher-level outpatient services is still necessary and may otherwise require travel to distant communities.
General acute care hospitals with no more than 50 beds located in a rural area and critical access hospitals (CAHs) are eligible to convert to REHs.
Proposed REH Services Eligible for Increased Reimbursement
“Rural emergency hospital services” (REH Services) are now a category of services eligible for reimbursement by Medicare. By statute, REH Services include emergency services and other medical and health services. REH Services must be paid by Medicare at the OPPS rate plus 5%.
The statute provides considerable flexibility for CMS to define the “other medical and health services” that may be reimbursed as REH Services. CMS is proposing to broadly define REH Services to include all services that are eligible for reimbursement under the OPPS. CMS is defining REH services broadly, providing REHs with considerable flexibility to tailor the services they will offer (provided the REH CoPs are met). The definition as proposed will in effect provide the higher reimbursement level for any outpatient service that is eligible for reimbursement under the OPPS. Facilities that enroll as REHs are not eligible for reimbursement for acute care inpatient services. As a result, the regulatory definition proposed by CMS will exclude acute inpatient services from the definition of “REH Services.”
The proposed CoPs for REHs would require REHs to provide basic laboratory services and certain diagnostic services. In addition, REHs may (but are not required to) provide other outpatient services, including radiology, outpatient rehabilitation, surgical, maternal health and behavioral health services. CMS is proposing that any outpatient service that does not meet the definition of an REH Service will be paid at the same rate as if the service was furnished in a hospital outpatient department and paid under a fee schedule other than the OPPS. In effect, a laboratory service furnished by an REH will be paid under the clinical laboratory fee schedule and other non-REH Services furnished by an REH will be paid under the otherwise applicable fee schedule.
Following statutory changes implemented in 2017, most off-campus hospital departments are subject to a site-neutral payment methodology that reduced payments to hospitals for services at off-campus locations that began billing Medicare after November 1, 2015. CMS interprets the site-neutral provisions such that REH Services are not subject to this payment reduction. CMS is proposing to pay for REH Services at 105% of the OPPS rate, regardless of the location or original date of Medicare billing. CMS is, however, seeking comments on alternative interpretations of the laws, such as applying the site-neutral payment reductions only to off-campus locations of non-CAH hospitals converting to REHs and to off-campus locations opened after REH conversion.
Proposed REH Reimbursement Methodology
Medicare payments for REHs will be made at the OPPS rate for services provided, plus a 5% add-on to the OPPS rate and a fixed monthly payment. By statute, this must be calculated by reference to the 2019 reimbursement for CAHs.
CMS is proposing to calculate the monthly facility payment, which is based on reimbursement to CAH through claims paid for dates of service in 2019, by including both amounts paid by the Medicare program and from beneficiary copayments. In addition to relying on the CAH claims data, CMS is proposing adjustments for certain supplemental payments Medicare makes to CAHs, including new technology payments, outlier claims payments, indirect medical education payments, disproportionate share hospital (DSH) payments, uncompensated care payments and low-volume hospital payments.
CMS estimates that the monthly REH add-on payment for 2023 will be $268,294. The monthly payment amount for REHs in future years will be based on the 2023 payment, increased by the hospital market basket percentage increase.
CMS is seeking comments on its proposed calculation methodology, including whether beneficiary copayment amounts should be included.
REH Enrollment Provisions
To facilitate enrollment of REHs, CMS is proposing that REHs would enroll through the “change of information” process, rather than having to terminate the current CAH or hospital enrollment and then submit a new enrollment as an REH. CMS does not address in the proposed rule how the process would work for CAHs or hospitals that closed since the date of enactment of the REH laws or how the specific effective date will be determined for REHs converting after January 1, 2023.
REH Quality Reporting Standards
As required by statute, CMS is proposing to establish quality measure reporting requirements for REHs. Under the proposed REH Quality Reporting Program (REHQR), REHs would submit data to the Secretary each year beginning in 2023 through the QualityNet website. Reported information would be publicly available. To ease the burden that may accompany REHQR requirements for REHs, CMS is considering utilizing Medicare claims data, and it may further consider utilizing digital quality measures and aligning requirements across government and commercial payors to minimize overly burdensome reporting requirements.
The proposed rule broadly contemplates including quality reporting categories recommended by the National Advisory Committee on Rural Health and Human Services and quality measures calculated using administrative data from Medicare claims and enrollment data.
CMS is seeking comments on the currently contemplated reporting categories as well as the proposed administrative process. CMS is also seeking comments on telehealth quality reporting generally, quality reporting for maternal health, rural emergency services, mental health and how each of these categories may intersect with telehealth quality measures, health equity reporting measures and recommendations for addressing any low volume issues.
Proposed Stark Law Exception for REHs
As noted, CMS recently proposed the conditions of participation that will apply to REHs. This proposal, if finalized, will require REHs to provide radiology and certain imaging services, clinical laboratory services and outpatient prescription drugs. Each of these services are considered to be “designated health services” within the meaning of the federal self-referral law (the Stark Law). With respect to services furnished to Medicare beneficiaries, an REH would be an entity that furnishes designated health services (a DHS Entity).
There are several regulatory Stark Law exceptions that apply to physician-owned entities and that may currently be relied on by small rural hospitals and CAHs for purposes of Stark Law compliance, such as the rural provider exception and the whole hospital exception. However, once a CAH or a small rural hospital converts to an REH, the entity will no longer qualify as a “hospital” for purposes of the physician self-referral law and will not be able to qualify for the whole hospital exception. The rural provider exception, in contrast, will remain available.
CMS is concerned that the Stark Law could serve as an impediment to the enrollment of entities that are owned by or invested in by physicians that are eligible to become REHs. Accordingly, CMS is proposing to create a new REH exception (the REH Exception) that will permit physicians to own and invest in REHs, provided the elements of the exception are met.
Of note, CMS is not proposing to incorporate into the REH Exception certain limitations analogous to the limits Congress incorporated in the Affordable Care Act (ACA) that apply specifically to physician-owned hospitals, including strict limits on expansion of size and additional physician ownership or investment interests. CMS is seeking comment as to whether CMS should incorporate requirements for public disclosures of physician ownership and investment or an annual report to CMS in the REH Exception, but these are not included in the proposed regulation.
In addition to proposing the REH Exception, CMS is proposing to revise certain exceptions applicable to compensation arrangements between certain types of DHS entities and physicians to apply to REHs. Because REHs are not a hospital within the meaning of the Stark Law or its implementing regulation, these changes are necessary to ensure REHs can qualify for certain regulatory compensation exceptions. Specifically, CMS is proposing to modify the exceptions for the following types of arrangements to incorporate REHs as entities eligible to rely on the exception, when all elements of the exception are met:
Obstetrical malpractice insurance subsidies;
Retention payments in rural and underserved areas;
Electronic prescribing items and services;
Assistance to compensate a non-physician practitioner; and
CMS is seeking comment on whether revisions to the exception for medical staff incidental benefits are necessary to explicitly clarify that REHs are eligible to utilize the exception, although CMS notes that an REH could use the existing exception even absent modification. CMS is also seeking comment on the need for REHs to recruit physicians to establish or join medical practices in the geographic area served by the REH and how CMS should define an REH’s geographic service area for purposes of physician and non-physician practitioner recruitment.
CMS has proposed expansive definitions that will enable REHs to provide a wide variety of services eligible for payment as “REH Services” and has generally proposed to take an REH-favorable approach to calculating the fixed monthly payment amount, although CMS could finalize a less favorable methodology. Similarly, CMS appears to have opted for an enrollment process for REHs that is less burdensome than the standard enrollment process for new providers.
Beyond the payment and enrollment proposals, CMS has proposed a relatively broad regulatory exception that would permit physicians to own and invest in REHs, without many of the restrictions that are generally applicable to physician-owned hospitals. This appears to be grounded in CMS’s concern that limitations on facility expansion or the amount of physician investment or ownership in an REH could unduly impact access to services furnished in rural and underserved areas.
Importantly, the statute establishing REHs as a provider type explicitly excludes administrative and judicial review of the REH conditions of participation, the determination of payment amounts for REHs, and the determination of whether a facility meets the statutory requirements for participation in Medicare as an REH. Accordingly, providers and other interested stakeholders should not miss this opportunity to influence the policy that will determine the payment methodology and enrollment requirements that will be applicable to REHs.
CMS is obligated to propose and finalize regulations establishing and governing REHs in time for the statutorily required effective date of January 1, 2023. | <urn:uuid:a56a4ad7-d42e-4b92-8156-70fb56814b62> | CC-MAIN-2022-33 | https://www.mwe.com/insights/cms-proposes-key-details-for-payment-methodology-quality-measures-and-enrollment-policies-for-rural-emergency-hospitals/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572021.17/warc/CC-MAIN-20220814083156-20220814113156-00071.warc.gz | en | 0.946435 | 2,439 | 1.5625 | 2 |
What follows is the unabridged version of my latest post for TechCrunch, “FTC Values Sponsored Conversations at $11,000 Apiece“
In May, I reviewed the proposed Federal Trade Commission guidelines that would ultimately affect and change how brands employ endorsements into their marketing, advertising, and communications programs.
Today, the Federal Trade Commission made good on its threat promise by releasing its final revisions to the guidance it gives advertisers on how to keep their endorsement and testimonial ads in line with the FTC Act. This amendment marks 29 years since The Guides were last updated in 1980.
In the 1980 version of the Guides, advertisers were allowed to describe unusual results in a testimonial as long as they included a disclaimer such as “results not typical.” Long overdue, the revised Guides no longer allow this form of safe harbor.
But for those of us contributing to the new media landscape, there is a dire warning that we must heed.
While The Guides mostly define the rules of engagement for advertising, it now contains clear language and consequences associated with the use of paid testimonial in blogs and celebrity endorsements.
As a result of the evolving level of influence inherent in the social Web, and web in general, the notice incorporates several amendments to the FTC’s Guides Concerning the Use of endorsements and testimonials in advertising and blogging, which address endorsements by consumers, experts, organizations, and celebrities, as well as the disclosure of important connections between advertisers and endorsers. Fines for violating the new rule will run up to $11,000 per incident.
Even though the FTC Guides refer to blogging, advertising, and celebrity endorsement specifically, Twitter and other Social Networks will not be overlooked. Pay-per-Tweet services such as Ad.ly, Izea, and Twittad are providing networks for brands to engage with the audiences of real celebrities as well as the communities of people who follow the Internet famous. Disclosure is also required in these new mediums. It should also be noted that Ted Murphy, founder of Izea, is collaborating with the FTC to help create a fair set of standards around disclosure and James Eliason, founder of Twittad, has submitted a technology framework to Twitter to effectively disclose sponsored Tweets.
However, in the eyes of the FTC, a paid endorsement is no longer limited to monetary compensation and this is why things will get interesting moving forward.
The revised Guides feature new examples that illustrate the long-standing principle that “material connections” between advertisers and endorsers – connections that consumers would not expect – must be disclosed. This is true whether its a payment or free products that change hands.
The revised Guides specify that while decisions will be reached on a case-by-case basis, the post of a blogger who receives cash or in-kind payment to review a product is considered an endorsement. Thus, bloggers who make an endorsement must disclose the material connections they share with the seller of the product or service.
The revised Guides specify that while decisions will be reached on a case-by-case basis, but to be clear a blog post (or Tweet) in exchange for cash or in-kind payment to review a product is considered an endorsement.
The examples address what constitutes an endorsement when the message is conveyed by “bloggers or other word-of-mouth marketers.“
While I agree with the need for disclosure in sponsored posts and tweets, the FTC’s inability to see blogging as a bona fide publishing channel comprised of expert writers and pundits in addition to those consumers willing to exchange content for compensation, is incredibly hazardous.
For instance, traditional reporters and journalists have long received products and services to review. In the ethical world, brands entrusted the resulting experience with the reviewer and used corporate collateral and not monetary pressure to help sway positive exposure. In some cases those reviewers either kept products or received services, without paying for them, whether or not they ever published an unbiased review. Why are professional bloggers viewed differently?
Since the FTC is reviewing incidents on a case-by-case basis, perhaps they will eventually realize the clear division between editorial and advertorial regardless of platform. The difference between endorsement and individual experience is discernible in the intent of the arrangement between brand and writer.
In the meantime, brands and bloggers can only benefit from disclosing the nature of endorsements. In the realm of new media, transparency and ethics speak louder than the value proposition of the product itself.
Update: Response from The FTC
When asked if the FTC views bloggers equally and whether or not it recognizes levels of authority on par with traditional media, Mary Engle, Associate Director for Advertising Practices, clarified its position and perspective, “All bloggers aren’t the same and we are not saying that all bloggers are marketers. Most of them are ordinary folks musing or sounding off. The question as we put it in the notice we published today is whether, viewed objectively, the blogger is being sponsored by the advertiser. (We list a number of factors to consider.) Independent product reviewers, whether offline or online, would not be viewed as sponsored by the company whose products they are reviewing.”
Engle further observed the distinction between expert and consumer bloggers, “But if bloggers regularly receive free products from a company, the blog audience might view their reviews differently than if they went out and bought the products on their own. Under those circumstances, bloggers should disclose they got the products from the company. This is consistent with the WOMMA code of ethics. And, companies who use bloggers to generate buzz about their products by sending free merchandise should have a policy that their bloggers should disclose.”
pr pr+2.0 pr2.0 public+relations marketing advertising interactive social+media socialmedia brian+solis social media media2.0 media+2.0 2.0 smo social+media+optimization marcom communication publicity advertising expert interactive spin brand branding guru social+architect | <urn:uuid:a7ad2357-2f09-43b0-a35d-ed3339c71174> | CC-MAIN-2016-44 | http://www.briansolis.com/2009/10/ftc-values-sponsored-posts-at-11000-apiece/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720000.45/warc/CC-MAIN-20161020183840-00023-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.946513 | 1,219 | 1.617188 | 2 |
|Application ||WB, IHC-P, FC, E|
|Calculated MW||37806 Da|
|Antigen Region||308-337 aa|
|Other Names||Interferon gamma receptor 2, IFN-gamma receptor 2, IFN-gamma-R2, Interferon gamma receptor accessory factor 1, AF-1, Interferon gamma transducer 1, IFNGR2, IFNGT1|
|Target/Specificity||This IFNGR2 antibody is generated from rabbits immunized with a KLH conjugated synthetic peptide between 308-337 amino acids from the C-terminal region of human IFNGR2.|
|Format||Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification.|
|Storage||Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C in small aliquots to prevent freeze-thaw cycles.|
|Precautions||IFNGR2 Antibody (C-term) is for research use only and not for use in diagnostic or therapeutic procedures.|
|Function||Part of the receptor for interferon gamma. Required for signal transduction. This accessory factor is an integral part of the IFN-gamma signal transduction pathway and is likely to interact with GAF, JAK1, and/or JAK2.|
|Cellular Location||Membrane; Single-pass type I membrane protein|
Thousands of laboratories across the world have published research that depended on the performance of antibodies from Abgent to advance their research. Check out links to articles that cite our products in major peer-reviewed journals, organized by research category.
email@example.com, and receive a free "I Love Antibodies" mug.
Provided below are standard protocols that you may find useful for product applications.
IFNGR2 is the non-ligand-binding beta chain of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. Defects in IFNGR2 are a cause of mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection.
Kotenko,S.V., et.al., J. Biol. Chem. 270 (36), 20915-20921 (1995)
If you have used an Abgent product and would like to share how it has performed, please click on the "Submit Review" button and provide the requested information. Our staff will examine and post your review and contact you if needed.
If you have any additional inquiries please email technical services at firstname.lastname@example.org. | <urn:uuid:d2bcc47b-113d-46ad-a61f-3af3b320dd99> | CC-MAIN-2017-04 | http://www.abgent.com/products/AP6995b-IFNGR2-Antibody-C-term | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281574.78/warc/CC-MAIN-20170116095121-00019-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.816667 | 617 | 1.523438 | 2 |
What Council looks after
We currently maintain a network with approximately 1,850km of pipes and 70,000 pits. We are responsible for public stormwater drains when the catchment is smaller than 60 hectares .
Report an issue with a Council drain
We sweep the kerb and channel often, and inspect and clean the drains in our streets. Sometimes issues can still come up, including:
- blocked drains
- flooded drains
- cracked or missing pit lids
- blocked or full open drains
Please report any issues with drains in Casey.
We will investigate blocked council-owned drains and pits within 5 working days of a report being received.
What Melbourne Water looks after
Melbourne Water is responsible for the public stormwater drains in catchments larger than 60 hectares. They maintain a network of approximately 300 kilometre of pipes and over 600km of open channels and waterways within Casey.
The Melbourne Water drains receive stormwater from the Council network and carry it to our rivers and creeks.
Report an issue to South East Water
If you notice any of the following issues, please report them to South East Water:
- blocked sewer
- burst water main
- leaking fire hydrants
Property owners are responsible for their own private drains. This includes the drains within the property that collect stormwater from the roof gutters and hard surfaces, as well the outlet pipe connecting the property drains to a Council drain or the kerb and channel in the street.
We do not repair blocked private drains. You should contact a licensed plumber if you hare having issues with your private drains. | <urn:uuid:eb2441ca-06b8-4543-b891-965c957c0428> | CC-MAIN-2022-33 | https://www.casey.vic.gov.au/report-drainage-problem | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572870.85/warc/CC-MAIN-20220817062258-20220817092258-00673.warc.gz | en | 0.940825 | 331 | 1.921875 | 2 |
Colt Model 608 CAR-15
The Model 608 was an attempt by Colt to provide an "Aviator Survival Carbine" for the USAF and was meant for use among downed aircrew.. The concept was to design a Carbine that could be disassembled into 2 parts and stored within the confines of aircraft cockpit. This carbine had many unique features to include: conical flashhider (or standard), no forward assist or a bayonet lug, round tubular handguards, cutoff pistol grip, and fixed tubular plastic-coated aluminum buttstock. With a 10-inch long barrel, the assembled weapon was 29 inches in overall length. The Model 608 never made into full scale production and there were very few actual models ever produced. Probably less than 10 exist today, the first picture below is from the ATF national refrence collection.
Photos and information from: Cesare | <urn:uuid:af49c498-bcc1-4bdf-8c4c-fec702067777> | CC-MAIN-2016-44 | http://securityarms.com/20010315/galleryfiles/3200/3278.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719079.39/warc/CC-MAIN-20161020183839-00033-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.967982 | 179 | 2.0625 | 2 |
PRINCESS TARHATA KIRAM
Female Muslim Leader
Like the slender curves of a Moro kris, her name conjures the image of Oriental grace and
Princess Hadja Tarhata Kiram was a Tausug blue blood, born in 1904 in the Sulu
archipelago, the oldest sultanate in the Philippines. Her father was the sultan of Sulu, Mohammed
Esmali Kiram. She was, however, adopted by her uncle, Sultan Jamalul Kiram II.
Strong-willed and liberal-minded, she held feminist views that preceded those espoused by
the modern women’s liberation movement in the Philippines by decades.
Known for her beauty, she one graced the cover of the Philippine Free Press magazine.
Her life style, too, was jaw-dropping. It seemed that wherever she went her retinue led by a
governess trailed not far behind her.
As a young woman brimming with intellect, she was sent to the United States in 1920 as
the first woman pensionado. As expected, her entourage accompanied her. At a time when women
were generally considered as home keepers, her choice must have created quite a stir in the
Philippine. She finished her studies at the University of Illinois.
Her American education over, she returned to Sulu. Except for the noticeable accent, the
Princess reverted to her native ways. She donned anew the sablay and sawwa, traditional Tausug
dresses. Not stopping there, however, she shocked not only the American officers but her family as
well when she married Datu Tahil, Tausug leader of the 1927 Moro revolt in Sulu. Because of this,
she was forced to go on exile on an island where she remained for three years, resurfacing only in
1931 when she joined local politics.
Opposition to land taxes, the cedula, the imposition of penalties for tax delinquencies, and
the prohibition against the carrying of weapons fueled Datu Tahil’s uprising in Sulu in 1927. A
veteran of the 1913 battle of Bud Bagsak, where he lost his wife and child, Datu Tahil had
reconciled to American authority. He had served as the third member of the provincial board of
Sulu and was considered as a prospective governor. His disappointment at not being appointed to
the post may have precipitated his personal break with the government. He constructed a fort in
Patikul, not far from Jolo town, where a sizeable number of his followers rallied behind him. On
January 31, 1927, government troops attacked his fort, killing 30 to 40 of his men. Datu Tahil
managed to escape, but secretly surrendered on February 8, to the provincial governor. Princess
Tarhata pleaded for clemency, and he was sentenced to 10 years in prison and fined P10, 000. His
surrender enraged his surviving followers. His sisters, purportedly, wished him dead.
Princess Tarhata had two other marriages: to Datu Buyungan and to Salvador Francisco, a
Christian lawyer, accountant and engineer.
In politics, she found ways to plug the laws disadvantageous to the Muslims. She was
consultant on Islamic affairs at the office of the commissioner, Region 9, under Rear Admiral
Romulo Espaldon. She became noted for her contributions to the government’s development
activities in Mindanao.
She was one of the heirs of the island of Sabah, which the Sultan of Sulu had leased to the
British but which the British never returned. The Princess led the other royal heirs in renouncing
their proprietary rights over the island in July 1977, in line with President Marcos’ efforts to foster
closer relations with Malaysia.
The Princess proved herself not only in politics, but also in music, writing Tausug songs.
“Jolo Farewell” was among her most popular compositions.
One of her memorable political battles was her denunciation in 1927 together with Senator
Hadji Butu Rasul of the Bacon Bill, which sought to exclude the Sulu archipelago from Mindanao.
Princess Tarhata died of heart failure on May 23, 1979 at the Veterans Memorial hospital
in Quezon City. She was 75. She had two children: Puti Denchurain and Datu Agham Kiram.
As a tribute to her courage in fighting for the rights of her fellow Muslims, the National
Historical Institute honored her by placing a marker in her name in Jolo, Sulu in 1984. In the
same year, the government also printed a three-peso stamp bearing her portrait.
Bulletin Today (May 25, 1979) pp. 1, 2
Gowing, Peter G. Mandate in Moro land: The American Government of Muslim Filipinos
1899-1920. Quezon City: New Day Publishers, 1977.
“Princes Tarhat of Sulu dies”, Times Journal (May 25, 1979) pp. 1, 7
Tan, Samuel K. The Filipino Muslim Armed Struggle, 1900-1972. n.p.: Filipinas
Foundation, Inc., 1977, p. 81.
Thomas, Ralph B. Muslim But Filipino: The Integration of Philippine Muslims, 1917-
Photo: The Chronicle Magazine (March 4, 1967) p. 6 [NHI files, photocopy only] | <urn:uuid:5508349b-67b3-45ab-8b95-2dd6787b527f> | CC-MAIN-2017-04 | http://pinoyfolktales.blogspot.com/2013/01/filipino-martyr-princess-tarhata-kiram.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281649.59/warc/CC-MAIN-20170116095121-00448-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.959454 | 1,153 | 2.71875 | 3 |
Welcome to Common Core Central for the Val Verde Unified School District in Perris, California. Our site offers comprehensive resources for parents and educators of all grade levels, in all subject areas. Please start exploring our site by clicking on one of the links above.
President Obama launches ConnectEd
Common Core Video Feed
Showing posts 1 - 4 of 4. View more »
Showing posts 1 - 1 of 1. View more »
Common Core News Flash
Showing posts 1 - 5 of 6. View more » | <urn:uuid:e34dbb51-48ad-4671-a933-cfa1f5c09a60> | CC-MAIN-2017-04 | https://sites.google.com/a/valverde.edu/common-core-resources/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282140.72/warc/CC-MAIN-20170116095122-00131-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.831834 | 107 | 2.21875 | 2 |
|Back to July Ed Reporter|
|NUMBER 270||THE NEWSPAPER OF EDUCATION RIGHTS||JULY 2008|
"You're the only parent who has ever complained." That's the refrain running through the stories of faddish methods, biased curricula, pornographic assignments, and invasive surveys related in From Crayons to Condoms.
Public school administrators sometimes try to shame parents out of their efforts to change the system for the better. Students, too, who raise objections end up ostracized by teachers and peers. But as this book shows, you are not the only student or parent with complaints against these trends. Parents, students, and teachers all speak up in From Crayons to Condoms about their worst experiences with the public school bureaucracy.
Only a few of these dozens of stories have ever appeared in the media. They are the experiences of average people in average school districts, and as such, they reveal the extent of the problem as well as the prevalence of families' frustration.
"I send my children to school for an education, not for social programs, risk surveys, or 'preventive maintenance,'" writes Linda Rice, a parent whose children were subjected to invasive surveys, endless group work, and one ineffective prevention and awareness program after another.
The book affirms there are many good teachers in the public schools, and many teachers and administrators who don't attempt to overstep their role in students' lives. Others, however, repeatedly infringe on the integrity of the family by taking over as children's amateur psychologists, preachers of a secular world view, and the deciders of what children need to know about sex, death and suicide, and other sensitive topics.
"Legislators have given schools this power," the editors remind us. "They assume that with the breakdown of the family, all students are at-risk and in need of government intervention." Many legislators and educators believe that "they are the ones that need to step in and make all these sick children well."
The book concludes with a chapter on "What Can Parents Do?" Especially useful is the "school checklist" of almost 100 questions to ask about a school's instructional practices and philosophy. Most of these questions apply also to private school instruction and even homeschooling, and can help parents discern the strengths and weaknesses of their children's school. | <urn:uuid:e469c753-f99d-40a0-8f5c-b608d9273c40> | CC-MAIN-2017-04 | http://eagleforum.org/educate/2008/july08/book.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280872.69/warc/CC-MAIN-20170116095120-00313-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.970995 | 483 | 1.960938 | 2 |
The way it could have been
To be honest, I sometimes wish that the Bible had been written more like a systematic theology textbook. I think it would have been great if the Apostle John had included an inspired chart laying out the end times. Ezekiel could have spelled out just what exactly he meant by his visions. And like the disciples, I probably would have preferred it if Jesus had not spoken in so many parables. A parable makes you think and I would rather not. Many of Jesus parables raise more questions than answers.
It’s a mystery and that’s ok
But then, I am reminded of days spent at camp as working a counselor. On a rainy day I have a few riddles that I like to tell to stave off boredom and have never failed to discover that many of the other kids have a similar repertoire or riddles that can keep us swapping stories all week long.
What is it about a riddle that holds our interest? I think part of it is that a riddle appeals to our sense of curiosity. It's meaning is never immediately apparent and it takes some digging before a story begins to unfold. A story... that's what it is! A riddle engages our minds with a story. We begin with just some bare facts that paint for us just a very sketchy understanding of an event but as we seek further information, the details of the story begin to come together until, click, aha, it makes sense! And with great rejoicing and some pride in our achievement we tell our friends, who are still scratching their heads, that we have solved the riddle.
Those things in Gods word that are not always so clearly laid out for us are a cause for us to seek Him and by doing so, to grow in His grace. If the Lord had given us a theology textbook then I think we would all be pious figs dead in our orthodoxy. One thing I know for certain, if God had written the Bible in this way, he would not have included the forty chapters in Exodus and Leviticus dedicated to a description of a portable, tent like structure known as the tabernacle.
The Tabernacle — a quick introduction
The tabernacle, to my mind, is the mother of all riddles. None compares with her. I am sorry Dan Brown, that includes ‘The Da Vinci Code’ for this riddle has a solid basis in reality.
A group of slaves, known as the Hebrews, were delivered from Egypt and fled into the desert wasteland of Sinai. These were not the Hebrews who have neatly trimmed black beards and wear colorful tunics. I think those ones only exist in Sunday school. The ones we’re talking about in this story were desert nomads who were very much a product of their time. They had been in Egypt for many years and although they were free of a mad Pharaoh they were still slaves in their minds to an Egyptian way of thinking.
Their concept of God was crude and confused. Remember that at the foot of Mt Sinai the Israelites bowed down and worshiped an Egyptian cow. They were forced to drink its powdered remains but even before the bitter after taste was gone, God gave the Israelites something else to melt their gold into. God took them where they were at and channeled their creative energy into the construction of a place of real worship; where they could worship in Spirit and in Truth.
The plans for this tent were inscribed by the hand of God on stone tablets right along side the Ten Rules. If the Ten Rules present us with the terrifying holiness of God, and with an absolute and unchangeable standard by which our actions are judged then the tabernacle presents us with Gods love and invites us into his presence despite ourselves. King David understood this well when he wrote,
One thing I ask of the LORD, this is what I seek: that I may dwell in the house of the LORD all the days of my life, to gaze upon the beauty of the LORD and to seek him in his temple. For in the day of trouble he will keep me safe in his dwelling; he will hide me in the shelter of his tabernacle and set me high upon a rock. Psalm 27:4-6
3 + 5 = hmm, interesting
Unfortunately, the tabernacle makes for dry reading and it's hard to teach. But it does not have to be boring. If someone were to mechanically describe for me the ruins of Karnak, I would probably be more fascinated with the fly on my ceiling beating its head against a light bulb. But if I were to visit Karnak, I could wander among the remains of its massive architecture for weeks. Amazing! The difference — 3 dimensions and all 5 senses (with taste being a possible exception). In the same way, the tabernacle is a riddle constructed not of words but of wood, metal and cloth. By it's very nature, it's meant to be visual.
This is why we have developed the model set of tabernacle furniture. I do not claim to belong to a fringe group with an all-consuming obsession for Judaic art. At least my friends tell me that I am okay. It’s just that to tell this story well, it helps to have models that you can hold in your hand.
The tabernacle is part of a greater story. A story that has unfolded over many centuries and continues to play out today. It's not a story that can be done justice in these few paragraphs but it is well worth the digging. You might have to ask a few questions.
— Andrew Cross, Designer of the Tabernacle Furniture Model Set
BOOKS & RESOURCES
I WANT TO LEARN
Sign up to receive articles, testimonies, sneak peeks of new resources & upcoming seminars. You'll receive a PDF copy of The Tabernacle: Model of Messiah as a thank you for partnering with us. | <urn:uuid:af1a80e9-4eee-4066-b7bf-7e5a77b7ad41> | CC-MAIN-2022-33 | https://goodseed.com/why-the-old-testament-tabernacle.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00269.warc.gz | en | 0.982361 | 1,237 | 2.421875 | 2 |
How have your experiences impacted how you personally view diversity (positively or negatively)?
Do you think your experiences are common or unusual for your age, social class, and where you live?
Identify any stereotypes you may have about a particular group. Where did these stereotypes come from (family, friends, media, etc.)? Did any of your experiences create, reinforce, or destroy stereotypes? With cited and references. | <urn:uuid:6eef3fd8-2db8-4ce5-b30b-219afe646599> | CC-MAIN-2022-33 | https://10dollaressays.org/how-have-your-experiences-impacted-how-you-person/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00277.warc.gz | en | 0.941692 | 85 | 2.0625 | 2 |
Go is a strategic board game for two players that originated in China more than 2,500 years ago. The game is noted for being rich in strategy despite its relatively simple rules. It is very popular in East Asia, especially in China, Japan, and South Korea, where there are over 100 million active Go players.
- Go is an ancient board game that takes simple elements — line and circle, Black and White, stone and wood — combines them with simple rules and generates subtleties that have enthralled players for millennia. Go's appeal resides not only in its oriental elegance, but also in practical and stimulating features in the design of the game.
Go's few rules can be demonstrated quickly, and grasped easily. It is enjoyably played over a wide range of skills. Each level of play has its charms, rewards and discoveries. A unique and reliable handicapping system leads to equal contests between players of widely disparate strengths. Go is uniquely flexible and rewards patience and balance over aggression and greed. An early mistake can be made up, used to advantage or reversed as the game proceeds. There is no simple procedure to turn a clear lead into a victory. Go thinking seems to be more lateral than linear, less dependent on logical deduction, and more reliant on a "feel" for the game, a "sense" of form, a gestalt perception of significant patterns.
Beyond being merely a game, Go can take on other meanings to enthusiasts: an analogy with life, an intense meditation, a mirror of one's personality, an exercise in abstract reasoning, or, when played well, a beautiful art in which Black and White dance across the board in delicate balance.
But most importantly for those who play, Go is challenging and fun.
- The Ancient Japanese considered the Go board to be a microcosm of the universe. Although when it is empty it appears to be simple and ordered, in fact, the possibilities of gameplay are endless. They say that no two Go games have ever been alike. Just like snowflakes. So, the Go board actually represents an extremely complex and chaotic universe.
- Hoy, 9 de septiembre de 1978,
tuve en la palma de la mano un pequeño disco
de los trescientos sesenta y uno que se requieren
para el juego astrológico del go,
ese otro ajedrez del Oriente.
Es más antiguo que la más antigua escritura
y el tablero es un mapa del universo.
Sus variaciones negras y blancas
agotarán el tiempo.
En él pueden perderse los hombres
como en el amor y en el día.
9 de septiembre de 1978,
yo, que soy ignorante de tantas cosas,
sé que ignoro una más,
y agradezco a mis númenes
esta revelación de un laberinto
que nunca será mío.
- Today, the 9th of September 1978,
I had in the palm of my hand a small disk
of the 361 that are required
for the astrological game of Go,
that other chess of the Orient.
It is more ancient than the most ancient writing
and the board is a map of the universe.
Its black and white variations
it men can lose themselves
as in love and in the day.
Today, the 9th of September 1978,
I, who am ignorant of so many things,
know that I am ignorant of one more,
and I thank my Muses for
this revelation of a labyrinth
that never will be mine.
- Jorge Luis Borges, El Go (tr. Wayne Nelson)
- Today, the 9th of September 1978,
- Go is hard.
- It is difficult for a man who always has a full stomach to put his mind to some use. Are there not players of Liubo and Weiqi? Even playing these games is better than being idle.
- When I was young I wanted to be the world's best chess player and, of course, I didn't succeed. I wanted to be the world's best Go player, too.
- Bill Gates, as quoted in Bill Gates Speaks (1998) by Janet Lowe, p. 227
- The board must be square and represents the laws of the earth. The lines must be straight like the divine virtues. There are black and white stones, divided like yin and yang. Their arrangement on the board is like a model of the heavens.
- Ban Gu (32-92 AD), in Yi Zhi [The Essence of Go]
- Ai taught me a Terran game played on squares with little stones, called go, an excellent difficult game. As he remarked, there are plenty of stones here to play go with.
- I have heard that Otaké of the Seventh Rank and Wu of the sixth rank once went to a clairvoyant and asked for advice on how to win. The proper method, said the man, was to lose all awareness of self while awaiting an adversary's play. [...] While waiting for a play he [Onoda of the Sixth Rank] would sit quietly with his eyes closed. He explained that he was ridding himself of the desire to win.
- From the way of Go, the beauty of Japan and the Orient had fled. Everything had become science and regulation. [...] One conducted the battle only to win, and there was no margin for remembering the dignity and the fragrance of Go as an art.
- That play of black upon white, white upon black, has the intent and takes the form of creative art. It has in it a flow of the spirit and a harmony of music. Everything is lost when suddenly a false note is struck, or one party in a duet suddenly launches forth on an eccentric flight of his own. A masterpiece of a game can be ruined by insensitivity to the feelings of an adversary.
- Rather than being the image of a single struggle as in chess, Go is much more like the panorama of an entire campaign, or complex theatre of war. And so it is more like modern warfare where strategic mass movements are the ultimate determinants of victory. … As in modern warfare, direct combat, without supporting tactics, rarely occurs. In fact, to engage too soon in direct combat frequently spells defeat.
- Go is destined to take the place of Chess as the leading intellectual game of the Occident, just as it has reigned supreme in the Orient for some four thousand years.
- While the Baroque rules of Chess could only have been created by humans, the rules of Go are so elegant, organic, and rigorously logical that if intelligent life forms exist elsewhere in the universe, they almost certainly play Go.
- I easily believe that the magnitude of the Board and the quantity of pieces render this game quite ingenious and quite difficult.
- Gottfried Leibniz, Miscellanea Berolinensia (1710), as quoted in "Go Spotting: Leibniz calls go “ingenious and quite difficult”", American Go E-Journal (June 11, 2015)
- I had the first move, I should have won...
- I learned to play go in college ... It's a very complicated game ... non-linear.
- Becoming one stone stronger is the supreme enjoyment.
- Go Seigen, considered to be one of the best Go players of all time, in A Way of Play for the 21st Century (2008).
- When starting, the best strategy is to spread the pieces far apart and stretch them out, to encircle and attack the opponent, and thus win by having the most points vacant. The next best strategy emphasises cutting off the enemy to seek advantage. In that case the outcome is uncertain and calculation is necessary to decide the issue. The worst strategy is to defend the borders and corners, hastily building eyes so as to protect oneself in a small area.
- Huan Tan (c. 43 BC–28 AD), in Xin Lun [New Treatise]
- Go is to Western chess what philosophy is to double-entry accounting.
- The number of all things in Nature begins with one. The points on the go board number three hundred and sixty plus one. One is the first of all living numbers. It occupies the polar point of the board around which the four quarters revolve. The other 360 points represent the number of days in a [lunar] year. They are divided into four quarters which represent the four seasons...
- Wang You Qing Le Ji [The Carefree and Innocent Pastime Collection], the oldest surviving Go manual, from the early 12th century (though it is actually an anthology of older texts), as quoted in Go in Ancient China.
- A game of go is like a spring whose waters go only where they can go and stop where they have to stop.
- 1. The greedy do not get success;
2. Be unhurried to enter opponent´s territory;
3. Take care of oneself when attacking the other;
4. Discard a stone to gain sente;
5. Abandon small to save big;
6. When in danger, sacrifice;
7. Make thick shape, avoid hasty moves;
8. A move must respond to the opponent's;
9. Against strong positions, play safely;
10. Look for peace, avoid fighting in an isolated or weak situation.
- All you are is the Go you play.
- This is the universe! And I'm placing stones one by one on that. Like I'm increasing the number of stars one by one... I'm making the universe. It's like I'm a God. I'm going to become a God! On this Go Board.
- Why I play go? The answer inside me is clear... To link the far past with the far future.
- Hotta Yumi, in Hikaru no Go (Volume 23, chapter 189) | <urn:uuid:ccdda4e8-6a39-4859-b215-2369f202f9a4> | CC-MAIN-2017-04 | https://en.wikiquote.org/wiki/Baduk | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280266.9/warc/CC-MAIN-20170116095120-00502-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.930162 | 2,117 | 2.859375 | 3 |
Email is a big part of communication with mortgage applicants, but it poses many security problems. Companies are torn between their need to protect confidential financial information and the customer’s desire for convenience. Customers don't want to go through extra steps, but they'll be very unhappy if intercepted information leads to identity theft. So will mortgage employees. That's why mortgage businesses need to understand why email security is so important.
Email standards emerged very early in the history of the internet, when security wasn't a serious concern, and unfortunately, they haven't improved a lot since then.
- Senders can trivially impersonate other people, including their email addresses.
- Mail goes through multiple hops, providing many opportunities to read mail in transit.
- People often don't notice what address a message comes from, and some software even hides it.
- Unsecure connections to mail servers are common. They send passwords as plain text, allowing for their interception.
A study by Halock Security Labs found that lenders often use unsecure email practices.
- 70% of the loan officers in the study let applicants send tax documents and other financial information as unencrypted email attachments.
- Only 12% provided a way of sending email securely.
- Loan officers cited customer convenience over security as the reason for using email.
The American Land Title Association has issued rules specifying that non-public personal information, in connection with real estate sales, must be transmitted securely. It recommends adopting a written privacy and information security program for protecting such information, in order to comply with federal and state laws.
Some major services, such as Gmail, encrypt mail while it's moving between their own servers, but they can't do anything about the final hop if a message goes to a different host. People have created security measures, such as PGP (Pretty Good Privacy) and GPG (GNU Privacy Guard), that attempt to provide vendor-independent, end-to-end encryption. Unfortunately, they are so clumsy to use that they have never caught on.
Passwords are another problem. Many people connect to mail servers using an unsecured connection, which means their passwords go through as plain text. If they combine this with an unsecured wi-fi connection, they're literally broadcasting their passwords for anyone nearby to steal. People who get mail through an application can and should use an SSL/TLS connection to their provider. This encrypts logins and other data in transit, and once they set it up, it simply works without the users having to do anything more.
Secure email portals use either a website, a special application, or an add-on to an existing application. They're a departure from how people normally send and receive their mail, but some are more disruptive than others. Finding an approach that provides security, without making customers unhappy, is a tricky balance.
The best solutions combine email and web technology. Email can notify people that information is waiting for them, and a password-protected web connection can deliver it securely.
ABT's DocumentGuardian™ is the safest and easiest way for your borrowers to send you NPI (non-public information) documents. Compliance auditors recommend it because unlike box-type file sharing apps, DocumentGuardian stores your borrower documents in our secure data center, not on individual computers and mobile devices. Loan oficers and borrowers access DocumentGuardian™ through a secure browser connection, so their own logins and uploads are safe.
To minimize the risk of impersonation (called "phishing"), loan officers should advise customers to look at their mail carefully, make sure it links to the usual website, and inform them if anything looks suspicious. The consistent appearance that DocumentGuardian provides will give customers confidence that the mail they receive is authentic.
Businesses that use secure methods of exchanging documents with their customers enjoy a better reputation and are safer from charges of negligence. Contact us to learn how we can help you attain this necessary level of security. | <urn:uuid:d7050117-600b-4e92-9f72-450f5d6c9d32> | CC-MAIN-2022-33 | https://www.myabt.com/blog/understanding-the-importance-of-email-security-for-mortgage-businesses | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00274.warc.gz | en | 0.949681 | 813 | 1.914063 | 2 |
NCKU News Center
Welcome to NCKU
Game sight blocked? Award-winning miniature camera solves the problem
Two National Cheng Kung University students have designed an award-winning FANs Cam (Free Angle and Naked Camera) that enables users to enjoy the game without experiencing the annoyance of having their sight blocked by other audience.
The lightweight and waterproof miniature camera was designed by Sheng-hung Lee and Wai-Yeh Chan, who have won a red dot award: design concept recently for the innovation that offers the audiences a more authentic game watching experience than through the perspective of the players.
The two designers are going to receive the award in Singapore on October 19th.
Lee is a constant winner of design awards. Demonstrating how the FANs Cam works, Lee said that by simply scanning the QR code printed on the back of ticket and then choosing the preferred player on a smart phone, the user can immediately see what the player sees.
The FANs Cam may function as a performance recorder for the athletes as “FANs Cam” videos, and with the video in hand the players and the coaches can identify their strengths or weaknesses and develop the training program accordingly, Lee added.
Moreover, the coaches may alter the strategy on the spot based on the views from different players, noted Chan, a student of Department of Electrical Engineering, NCKU.
Lee and Chan said that the FANs Cam ushers in a new kind of visual experience for people who love sports and the audience may now enjoy the game with the players without other audience blocking the sight.
The FANs Cam, designed in a weightless and elastic clip form, enables the athletes to put it on their collar easily and fit well to their uniform, according to Chan.
This novel devise is the results of interdisciplinary efforts of Electrical Engineering and Industrial Design, according to Shyh-Jier Huang, NCKU Distinguished Professor of Electrical Engineering, who is an advisor to the winning team. | <urn:uuid:cc3af53d-1948-4c0f-8cde-95c756a55f56> | CC-MAIN-2017-04 | http://news-en.secr.ncku.edu.tw/files/14-1083-96404,r614-1.php | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285289.45/warc/CC-MAIN-20170116095125-00145-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.964909 | 412 | 1.617188 | 2 |
1 Scandinavian Institute, Faculty of Humanities, Aarhus University, Aarhus University2 School of Communication and Culture - Scandinavian Studies, School of Communication and Culture, Arts, Aarhus University3 School of Communication and Culture - Scandinavian Studies, School of Communication and Culture, Arts, Aarhus University
En lesning av Juana Inés de la Cruz "Primero sueno" (1692)
Juana Inés de la Cruz' poem "Primero Sueno" (1692) lets the soul, in a nightly travel, explore different methods of gaining access to knowledge of God's creation. In the article I show how the conflict between knowledge and faith is worked out differently in this 17th century Catholic poem than in the Protestant works of the same period. In Sor Juana's intricate poem, failure to achieve perfect knowledge is a proof of the difference between man and God. More controversially, the poem utilizes the standard baroque topoi of dream, night and change to write woman into an universe where knowledge is found.
Norsk Litteraturvitenskapelig Tidsskrift, 2002, Vol 5, Issue 1, p. 45-57
Priemero sueno; Juana Inés de la Cruz; Baroque poetry; Epic poetry; Epistemological poetry | <urn:uuid:04a11be8-a5f9-48a0-8936-47b32e357576> | CC-MAIN-2017-04 | http://www.forskningsdatabasen.dk/catalog/2185904183 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281649.59/warc/CC-MAIN-20170116095121-00440-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.824602 | 274 | 2.25 | 2 |
HD video soundbites of the authors and Annals editors discussing the findings are available to download at www.dssimon.com/MM/ACP-mammography-overdiagnosis.
URL goes live when the embargo lifts
A modeling study based on data from the Breast Cancer Screening Consortium, the most authoritative data set on breast cancer screening in the U.S., found that previous estimates of breast cancer overdiagnosis may have been overestimated. The new model suggests that overdiagnosis, or the finding of tumors that may never have progressed or caused harm in a woman’s lifetime, occurs in about 15% of screen-detected cancers. The findings are published in Annals of Internal Medicine.
The U.S. Preventive Services Task Force (USPSTF) cites overdiagnosis as one of the chief potential harms associated with mammography screening because of the burden and adverse consequences of unnecessary treatments. Therefore, knowledge about overdiagnosis is critical for supporting shared decision making about screening. However, the risk for breast cancer overdiagnosis in contemporary screening programs remains uncertain, with the most widely cited estimates reaching about 30%.
Researchers from Duke University and the Fred Hutchinson Cancer Research Center studied data from Breast Cancer Surveillance Consortium facilities to estimate the rate of breast cancer overdiagnosis in contemporary mammography practice for a cohort including 35,986 women, 82,677 mammograms, and 718 breast cancer diagnoses. To estimate overdiagnosis, the authors considered a cohort of women whose parameters for disease natural history were given by the best-fitting parameter combinations and who had annual or biennial screening, starting at age 50 years and until age 74 years or death from a cause unrelated to breast cancer, whichever occurred first. They modeled the competing mortality risk on the basis of a published age–cohort model for a 1971 birth cohort. The researchers found that in a program of biennial screening of women aged 50 to 74 years, which corresponds to USPSTF recommendations for average risk women, approximately 1 in 7 screen-detected cases would be overdiagnosed. Increasing the screening interval to annual screening did not seem to affect this number.
An editorial from Massachusetts General Hospital says that these findings may help women who are considering having mammography screening better understand the risk of overdiagnosis. Given that approximately 7 in 1,000 women will be diagnosed with invasive or noninvasive breast cancer on the basis of a screening mammogram, women should be told that approximately 1 in 1,000 women who undergo mammography will be found to have a cancer that would never have caused problems. Assuming that about 60% of the 280,000 cases of breast cancer diagnosed in the United States each year are found through mammography screening, eliminating overdiagnosis could spare 25,000 women the cost and complications of unnecessary treatment.
Media contacts: For an embargoed PDF, please contact Angela Collom at email@example.com. The corresponding author, Marc Ryser, MD, can be reached through Sarah Avery at firstname.lastname@example.org. To speak with editorialist, Katrina Armstrong, MD, please contact Noah Brown at email@example.com.
2. ACP issues final Practice Points on the use of remdesivir for hospitalized patients with COVID-19
Full text Practice Points: https://www.acpjournals.org/doi/10.7326/M21-4784
Full text Review: https://www.acpjournals.org/doi/10.7326/M21-4810
The American College of Physicians (ACP) issued its fifth and final living, rapid Practice Points regarding the use of remdesivir in hospitalized patients with COVID-19. The updated Practice Points are based on a review of the most up-to-date published data available on the benefits and harms of remdesivir and whether those benefits and harms vary by symptom duration, disease severity, and treatment duration. The paper, developed by the Scientific Medical Policy Committee of the ACP, is published in Annals of Internal Medicine.
Remdesivir is a broad-spectrum antiviral agent administered intravenously. It was authorized on Oct. 22, 2020, for emergency use for the treatment of COVID-19 in the U.S. by the Food and Drug Administration and in other countries.
ACP’s practice points are based on a living, rapid systematic review by the researchers from the Minneapolis VA Evidence Synthesis Program combining data from previous updates with data from newly identified randomized controlled trials (RCTs) through 19 October 2021. ACP’s final updated Practice Points target patients who will most benefit from the use of remdesivir. The advice remains the same:
- Consider remdesivir for 5 days to treat hospitalized patients with COVID-19 who do not require invasive ventilation or extracorporeal membrane oxygenation (ECMO).
- Consider extending the use of remdesivir to 10 days to treat hospitalized patients with COVID-19 who develop the need for invasive ventilation or ECMO within a 5-day course.
- Avoid initiating remdesivir to treat hospitalized patients with COVID-19 who are already on invasive ventilation or ECMO.
ACP’s Practice Points provide advice to improve the health of individuals and populations and promote high value care based on the best available evidence derived from assessment of scientific work. Practice Points are maintained as a “living” document until ACP’s Scientific Medical Policy Committee determines that no more updates are needed. The Scientific Medical Policy Committee has decided to retire this topic from living status in order to balance current priorities and considering that the last 3 updates did not result in important changes to conclusions.
Also new in this issue:
Integrating Quality Assurance and Quality Improvement With Guidelines: Systematic Stakeholder-Driven Development of an Extension of the Guidelines International Network–McMaster Guideline Development Checklist
Thomas Piggott, MD, MSc; Miranda W. Langendam, PhD; Elena Parmelli, PhD; Jan Adolfsson, MD, PhD; Elie Akl, MD, MPH, PhD; David Armstrong, MA, MB BChir; Jeffrey Braithwaite, PhD; Romina Brignardello-Petersen, DDS, MSc, PhD; Jan Brozek, MD, PhD; Markus Follmann, MD, MPH, MSc; Ina Kopp, MD; Joerg J. Meerpohl, MD; Luciana Neamtiu, PhD; Monika Nothacker, MD, MPH; Amir Qaseem, MD, PhD, MHA; Paolo Giorgi Rossi, PhD; Zuleika Saz-Parkinson, PhD, MS; Philip J. van der Wees, PhD; and Holger J. Schünemann, MD, PhD, MSc
Ideas and Opinions
Additional new COVID-19 content in this issue:
Prescribing Nirmatrelvir–Ritonavir: How to Recognize and Manage Drug–Drug Interactions
Catia Marzolini, PharmD, PhD;Daniel R. Kuritzkes, MD; Fiona Marra, PharmD; Alison Boyle, PharmD; Sara Gibbons, MPhil; Charles Flexner, MD; Anton Pozniak, MD; Marta Boffito, MD, PhD; Laura Waters, MD; David Burger, PharmD, PhD; David Back, PhD; Saye Khoo, MD
Ideas and Opinions
Annals of Internal Medicine
Method of Research
Subject of Research
Estimation of Breast Cancer Overdiagnosis in a U.S. Breast Screening Cohort
Article Publication Date | <urn:uuid:8e2cc619-622c-4aac-b797-b2af2ac6df7c> | CC-MAIN-2022-33 | https://www.eurekalert.org/news-releases/944342 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571745.28/warc/CC-MAIN-20220812170436-20220812200436-00479.warc.gz | en | 0.882947 | 1,639 | 2.015625 | 2 |
While the children, he/she are pulled for the providing corners between reverse moms and dads, as well as your situation inside the contentious divorces. It might and additionally occur since mediator tries to keep comfort anywhere between an effective troublemaker sibling and you will parents. Just as the lost kid, which role necessitates the peacemaker not to have individual needs otherwise getting confrontational by themselves, but alternatively to generally be “studying the area” to identify how other people are effect and you can to alter otherwise adapt correctly.
The fresh mascot is the loved one whom lightens new mod whenever everything is taking stressful otherwise nearest and dearest troubles are ascending for the facial skin. They are brand new funny one who renders jokes you to definitely facilitate denial otherwise mitigation of your own actual difficulties. This might be several other role, like the peacemaker, that needs understanding the area and evaluating quantities of pressure. Within the mature years, the latest mascot may have issue connecting with negative feelings or disagreement, as an alternative deflecting having jokes.
A caretaker is actually a person who plays this new duties from other people from the nearest and dearest and you may tries to cut her or him on consequences they might face. A common instance of which nowadays ‘s the “helicopter father or arablounge-datingwebsite mother” who would like to manage his or her son off damage. Usually so it interest is actually well-intentioned, it indeed factors more harm, just like the boy shouldn’t have to deal with the results out-of its steps and study on its problems.
Whenever dependency can be acquired about members of the family, the caretaker part changes towards the certainly one of an enabler. This individual renders excuses on fan, rejects people issues despite the apparent influence on your family, otherwise fight with shortage of limitations towards the nut.
So it member of the family takes step and you can becomes some thing complete. Will here is the stereotypical mother who coordinates this new dates out of the lady students, cooks snacks, and you may covers domestic tasks. This can as well as occurs with old girl whose parents has enacted away or can’t become mentally establish, as they take on the brand new commitments regarding a daddy.
Just like the adults, doers be unable to people as they are usually effect worn out. Enabling on their own to simply “be” in place of “do” is not an option for her or him. They could be frustrated otherwise mad because they struggle to say zero.
Using doer character a step subsequent, the newest martyr makes sure we all know simply how much he or she try sacrificing with the family. Which role commonly relates to shame-falling other people otherwise sarcastic comments that hop out members of the family thoughts once the whether or not they owe the ily, you may want to observe unclear attitude from guilt when someone helps you, similar to how you would be accountable for the same that have a grandfather otherwise sis.
Precisely what do I really do today?
Read through these positions and ask on your own: and this roles has We starred inside my family relations? How about my personal other family relations? Have it altered through the years? Just how will they be nevertheless impacting myself in today’s big date?
When you’ve recognized these types of opportunities as well as how they will have impacted your behaviors today, test out damaging the shape. Request what you want. Say no. Chat up. Acknowledge thoughts out-of shame for what he’s: echoes of history. Step towards the whichever step opposes this new dysfunctional part your starred in for the last. Talk to anyone else about how exactly you played this type of spots and seek accountability and help for the switching brand new programs.
I have already been purchasing longer with my lengthened relatives towards an effective per week cause for a weekly members of the family dining ritual. It’s provided myself particular worthwhile family vibrant observation expertise, as well as an opportunity to are sexually familiar with the latest Jerry Seinfeld quotation, “there’s no including issue while the enjoyable for your loved ones”. I think anybody can getting sick, mad, enraged otherwise off proper regarding it once they invest prolonged number of your time with household members. In addition consider is simply since the we often get trapped during the our archetypal family members spots, no matter if we ilial habits. | <urn:uuid:0819e2e1-b956-487a-8fb3-58a6f209159d> | CC-MAIN-2022-33 | http://etrans.ccstw.nccu.edu.tw/arablounge-visitors/the-fresh-peacemaker-is-usually-found-in-the/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00078.warc.gz | en | 0.962359 | 935 | 1.765625 | 2 |
Doing the right thing: Widower sells precious cars to feed starving children
Harvey Hielkema's decision to sell his collection of vintage cars and tractors was made for a simple reason: God told him to.
As the 77-year-old Baldwin widower tells it, several months ago while he read through a book about the number of children around the world suffering and dying from hunger and malnutrition, God spoke to him.
"All of a sudden, I could hear the Lord saying to me, 'You don't need all that stuff in your sheds when all those kids are starving.'"
Hielkema took the message to heart and called an auctioneer.
At 5:30 p.m. Wednesday, May 30, Hager Auction Service will auction off the cars and trucks Hielkema has collected over the past 15 years. He will give all the proceeds to an organization called Feed My Starving Children (FMSC).
On the auction bill are seven classic cars, 10 vintage tractors and a horse buggy.
Vehicles include a 1917 Model T that's "been restored to just like new"; a 1930 Model A, all restored except the upholstery; a 1957 Chevrolet with 21,000 original miles; a 1963 Chevy Nova Convertible; a 1978 Chevy Camaro "Arizona car"; a 1983 Ford Mustang convertible; a 1984 Chevy Corvette; and an Amish horse buggy that's never been used.
Tractors include a 1935 John Deere B; a 1938 Farmall F20; a 1940 Ford 9N; a 1940 Ford N Tractor; and a 1941 Farmall M.
Hielkema, a retired real estate agent who has also worked in building and development, figures he paid a total of $70,000 for the vehicles when he bought them.
Founded in 1987, FMSC is a Christian nonprofit that provides nutritionally complete meals for starving and malnourished people in nearly 70 countries around the world. Based in Minneapolis, it has some permanent meal-packing sites but also holds periodic drives at other sites where volunteers fund and assemble the dry meals.
Hielkema, a member of First Reformed Church in Baldwin, has gone to several FMSC events. He's also heavily involved in other volunteer efforts.
"I keep busy," he admitted.
He volunteers at Union Gospel Mission in the Twin Cities two days a week and regularly at the local food pantry and takes turns with another man watering the flowers along Hwy. 63 and Main Street in Baldwin.
He has also gone on mission trips to Russia, China, Cambodia, Ecuador and Mexico.
But he is most active with First Reformed's Africa Mission Group.
"We go to Africa quit often," said Hielkema, who will be going to Malawi -- a small country north of Mozambique in southeast Africa -- with his church's Africa Mission Group the fifth time this July.
Nine members will help build a school for children left orphaned by AIDS.
"We're way out in the bush," said Hielkema. "No water. No electricity."
After his wife and granddaughter died within months of one another a few years ago, a group of 12, including nine family members, made the trip to Africa to honor their loved ones, said Hielkema.
"Ever since I came here four years ago, Harvey has engaged in an ongoing commitment to mission - to serve people not just locally but around the world," said Pastor Tim Suiter of First Reformed Church.
He said the Baldwin churches are hosting a mobile packing for FMSC Sept. 14-15. The money raised at the auction will held fund that.
As for giving up his collection of vehicles, Hielkema says it's little enough to do. He has four grown children and admits some of them had their eyes on a couple of the vintage cars.
"But," he said, "they know how I think and how I feel."
The auction will begin at 5:30 p.m. at Hielkema's residence, 2150 55th Ave., Baldwin.
To get there, take the Hwy. 63 exit off I-94 at Baldwin, go north a quarter of a mile to 55th Avenue, turn east at Hardee's and drive a half mile.
To see photos and a full listing of the vehicles that will be auctioned off, visit the website, www.hagerauction.com. | <urn:uuid:f40764cc-231d-4e6e-8ba3-9c44a5595156> | CC-MAIN-2017-04 | http://www.riverfallsjournal.com/content/doing-right-thing-widower-sells-precious-cars-feed-starving-children | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279410.32/warc/CC-MAIN-20170116095119-00167-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.96728 | 929 | 1.53125 | 2 |
Cochlea -- quality of filtering
Didier A. Depireux
didier at eng.umd.edu
Wed Sep 20 08:20:28 EST 1995
erc at cinenet.net (Eric Smith) writes:
>How well does the cochlea divide sound into its frequency components?
Very poorly! The early experiments of von Bekesy used cochleae from
fresh human cadavers and at least showed that the passive mechanics of the
cochlea are such that the traveling wave that propagates down the basilar
membrane (the membrane where the hair cells that measure vibrations are
located) excites very large regions of the membrane for any pure tone presented
to the ear. When the cochlea is 'alive' (inside a living organism), the
frequency selectivity is a lot better, thanks for the outer hair cells.
Anyway, you probably don't want this to be too technical, so I would advise you
to look at
if you are really interested. The traveling wave portion of that page,
contains some mpegs showing you the basilar membrane displacements for a
series of pure tones and clicks, and will leave you wondering how we can
have such a good frequency selectivity... Check it out! The rest of the page (the
first address I gave) is also important to understand how the ear works, esp the
part about outer hair cell motility.
If you want to learn more about the inner ear anatomy, you should check out
another really great page,
from the cochlear fluid lab at Washington University. It talks about how some
disease of the inner ear damage your hearing...
didier at src.umd.edu
More information about the Audiolog | <urn:uuid:2d0720ec-09c1-4ae3-b575-a5a6622c5765> | CC-MAIN-2016-44 | http://www.bio.net/bionet/mm/audiolog/1995-September/000573.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719027.25/warc/CC-MAIN-20161020183839-00303-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.885816 | 378 | 2.765625 | 3 |
MARTHA’S CHOICE MARKETPLACE – A CHOICE MODEL PANTRY
PROVIDING DIGNITY & BUILDING GENUINE COMMUNITY
Until recently, the food provided by a typical ‘food pantry’ was generally a box of goods, delivered without any selection on the part of the recipients. In many cases, much of the food received would go to waste, as a result of the recipient’s personal, dietary and oftentimes cultural preferences. In 2015 we realized that a more dignified and respectful way of doing business was available for this crucial community service. Setting up ‘Choice Model’ pantries, without barriers between people, more like a grocery store, was a model that could be realized.
Not only does this Choice Model allow clients to choose foods that they and their families will actually use, it also allows for a significant reduction in both stigma, and the dynamics of power that often exist between the server and the served. As a result of the Choice Model, clients, volunteers and staff begin to really get to know one another as equals, conversing casually, listening to music, telling jokes, and forming more genuine and authentic relationships. In a world where it’s so easy to view and reject those different from yourself as the ‘other’, Martha’s seeks to build true partnership among people from all walks of life; across faith, culture, color and class.
Community is more than just a buzz word, it’s about truly investing in the people around you, forming authentic relationships, and using their voices & perspectives to drive programs.
At Martha’s, we are the community we serve.
WHO WE SERVE: SOME STATISTICS
*based upon in-house surveys of Martha’s clients, and a 1150 sample size county wide study conducted in 2017
- We serve all of Montgomery County, with the majority of clients residing in Norristown Pa.
- Prior to the pandemic, 1 in 10 families in Montgomery County were food insecure. That number is likely even higher now. This is due to many factors, some of which include the overall high cost of living in Montgomery County, alongside a minimum wage of $7.25/hr.
- 1 in 5 Norristown residents live in poverty & suffer food insecurity.
- Approximately 1/3 of our clients are working families, 1/3 are senior citizens, and 1/3 are disabled or otherwise unemployed.
- Approximately 1/3 of our clients are white, 1/3 are black and 1/3 are Hispanic
- Approximately 1/3 of our clients come once, 1/3 come seasonally, 1/3 come monthly (often elderly & disabled)
- 60% of our clients work; over half of those working, work 2 or more jobs
- 40% of our clients work full time
- 40% of our clients have a post high school education
- 15% of the families we serve contain one or more U.S. Veterans
THE MARTHA’S CHOICE MODEL IMPACT
- We focus on distributing fresh bulk produce, meat and dairy
- We serve approximately 1000 clients each month, nearly 5000 unique clients since July 1, 2017
- We distribute 80-100K lbs. of food per month / Over 1 Million lbs. per year
- RELATIONSHIPS AND GROWTH – Healthy relationships are the first step in healing trauma, building trust and understanding across class, race & cultural lines, and encouraging investment in one’s potential.
- CREATING COMMUNITY – We are the community we serve; sharing resources, transforming friendships, offering participant ownership of our programs, and providing an open portal to services within and beyond our walls.
- DIGNITY – Everyone has value. Offering dignity to those accessing our services communicates to them our respect for their innate worth. Dignity also reduces stigma, encourages honest and respectful communication and fosters client focused engagement & integration, which cultivates a space for genuine human encounters that encourage positive community growth.
- HEALTHY FOOD ACCESS – Emergency Food System food is often not nutritionally dense. We find new ways to gain access to healthy foods through sponsorships, creative sourcing, and donor education. The choice model increases the utility of the food to families, as participants are choosing the foods they prefer. Amending the choice model with a food cooperative program allows us to deliberately cultivate community in smaller groups of volunteer members that support one another and access fresh foods more frequently.
MARTHA’S CHOICE MODEL PRINCIPLES: We are the community we serve…
- Defining & understanding the specific needs of the communities served
- Culturally respectful foods & multilingual signage with open layout, welcoming design & operational flow for optimal service to all clients
- Being inclusive to those who want to offer their help
TRAUMA COMPASSIONATE SERVICE
Client Service based upon by the fundamentals of trauma informed care including best practices for handling challenging situations, and trainings in Bridges out of Poverty to best understand client perspectives and needs.
- Welcoming Facility
- Proactive, clear communication
INDIVIDUAL & COMMUNITY RELATIONSHIP BUILDING
- Client Focused Engagement
- Integrating the community into our work; focusing on how to best serve them and give them a voice in the services provided,
- Leading Together: Active listening to our community members to understand their priorities and direction.
- Collaborating on the work needed to get where the community needs to go.
- Mutual respect & mutual responsibility
HEALTHY FOOD SECURITY:
- Provide consistent access to high quality nutritional food
- Peer led nutrition education
WHO WE SERVE
We are here because, for many reasons, members of our community are in need of food.
We are trying to alleviate that need by offering a safe, positive, dignified, friendly environment where they can shop for food of their choosing, for themselves and their families.
We are a community. In 2016, Montgomery County reported that one in ten households were experiencing food insecurity. Hunger is an issue that affects all of us as a community. Especially now!
Martha’s Choice Marketplace is a community-based response. The more that we perceive our clients as fellow community members, and treat them as such, the more we will build the understanding, rapport, and the context necessary for positive change. For us, this means active listening, clear and transparent communication, welcoming clients into our volunteer team, building genuine relationships with those we serve, and recognizing the immense value of our opportunity to serve as both volunteers and staff.
At Martha’s Choice Marketplace, we are all receiving something.
Volunteers come to offer food, facilitate operations, and assist clients. Clients come to receive food, but they may also be consistent volunteers. One third of our volunteers are Martha’s clients! Some clients assist in translating for non-English speakers, some assist us with delivering food, while others help with unloading deliveries. There is never an obligation to help, we are simply here to offer an abundance of food, positivity, and human connection.
All those involved in this circle of giving and receiving are welcomed and accepted.
If we want to identify ourselves as a community, we need to realize that we are serving “each other.” “Us and them” perspectives are toxic and do not offer an avenue for understanding, growth, and mutual respect. As a “we”, we can grow together, seek to understand each other, hold each other accountable, and work together toward the common goal of preventing hunger in our community.
Broadly, we are serving other people with moms, dads, brothers, and sisters just like us.
We operate within a broader network of food pantries that come together to share best practices, develop collaborative strategies, solve sector challenges, and coordinate services. This collaborative is called the Montgomery County Anti-Hunger Network (MAHN) and we are a governing board member of this network, supporting over 50 pantries in Montgomery County.
On a more local level, we collaborate with our Norristown partner service providers: 8 soup kitchens and 8 other pantries, through Advocates Against Hunger, our Norristown coalition of emergency food providers.
We also leverage our partnerships with local Colleges and Universities, through work study, internships, fellowships, and graduate thesis projects, to further the goals of our programs to and to benefit the nearly 5,000 different families that we serve.
Food comes from grocery store rescue, The State Food Purchase Program, USDA, and TEFAP (The emergency food assistance program), and PASS (Pennsylvania Agricultural Surplus Support). We also get donated food from individuals, parishes, and businesses in the area. | <urn:uuid:4e2d0088-b5a4-47a1-85c5-955251d99e0d> | CC-MAIN-2022-33 | http://marthaschoicemarketplace.com/pantry/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00268.warc.gz | en | 0.943647 | 1,849 | 1.601563 | 2 |
Priming With BiondVax Pharmaceuticals' Universal Influenza (Flu) Vaccine Broadens the Activity of Conventional Bird Pandemic Vaccine Against Emerging Strains
8/26/2013 9:04:28 AM
Nes Ziona, Israel – August 25 2013 – BiondVax announced today that priming with universal flu vaccine before boosting with a conventional bird flu H5N1 vaccine (containing a single strain from Clade 1) resulted in mice exhibiting a significantly higher level of immunity to the strain contained in the conventional bird flu vaccine and in addition, broadened immunity to other H5N1 flu strains (from Clade 2). Bird flu viruses are classified into two main families, Clade 1 and Clade 2. Conventional pandemic bird flu vaccines are strain-specific and therefore trigger immunity predominantly against the particular virus contained within the vaccine, either Clade 1 or Clade 2. In our most recent study, we show that this limitation of conventional bird flu vaccines can be overcome by priming with BiondVax’s universal flu vaccine, as mice administered BiondVax’s universal vaccine and then the conventional pandemic bird flu vaccine exhibit immunity to multiple bird flu strains from both clades. Indeed, BiondVax’s universal flu vaccine contains viral regions common to diverse strains, including H1N1 (swine flu), H5N1 (bird flu) and H7N9 (bird flu), and so can enhance all kinds of conventional strain-specific flu vaccines when administered in a prime-boost regimen: first the universal flu vaccine is administered (primer) and then a few weeks later the seasonal or pandemic flu vaccine is administered (boost). Furthermore, this new study confirms our earlier finding that priming with BiondVax’s universal flu vaccine overcomes another challenge of pandemic preparedness, namely the difficulty in supplying enough conventional bird flu vaccine to the population in time. For priming with BiondVax’s universal flu vaccine enables one instead of two conventional bird flu doses per person to be sufficient.
With multiple deadly H5N1 and H7N9 flu strains circulating in animals and humans globally, uncertainty about the identity of the next pandemic flu strain is driving governments to reconsider how best to protect their populations against an unknown virus. This uncertainty can be addressed by exploiting the capability of BiondVax’s universal flu vaccine to make a conventional pandemic flu vaccine effective against a broader array of pandemic strains. Governments worldwide should implement a Pandemic Preparedness Plan (PPP) whereby BiondVax’s universal flu vaccine is stockpiled during inter-pandemic phases to enable immediate response to ANY and ALL pandemic flu strains. Upon pandemic outbreak, the stockpiled universal flu vaccine would be administered immediately to the population while the pandemic strain is characterized and a conventional pandemic-specific vaccine is manufactured (takes up to 6 months). As indicated by multiple pre-clinical studies and human trials, priming with BiondVax’s universal flu vaccine would ensure that more people are protected against pandemic illness.
Dr Ron Babecoff, BiondVax’s CEO adds, “Priming with a universal flu vaccine is the only approach that enables pandemic preparedness ahead of flu outbreak, whatever the emerging strain, and at the same time, enables pandemic vaccine dose sparing and cross strain activity without resorting to adjuvant.”
About BiondVax Pharmaceuticals Ltd
BiondVax is a publicly traded (TASE: BNDX), advanced clinical stage biotech company dedicated to improving global protection against influenza, with its lead product a universal influenza (flu) vaccine. Influenza (flu) is the most common infectious disease, caused by countless flu strains as the virus mutates unpredictably and frequently. Current seasonal and pandemic/pre-pandemic flu vaccines are strain-specific and manufactured based on global surveillance each season or to prepare for a predicted pandemic threat and so are often mismatched to the emerging flu strains. Therefore there is an urgent need for broadly protective flu vaccines especially in the case of pandemics and this is being addressed by BiondVax.
For further information, please contact:
Mob: +972 54 4860339
BiondVax`s estimates regarding the future development of the vaccine and expected trials with respect to the vaccine are forward looking information based on the information that BiondVax has in its possession today pertaining to the potential of the vaccine`s development. These estimates may not be realized, in whole or in part, and/or may be realized differently than estimated, as a result of different factors, including the failure to reach the objectives of the trials and/or schedules and/or to obtain the necessary funding for the continuation of development of the vaccine as well as other factors which are not within BiondVax's control and the materialization of any of the risk factors detailed in Section 5.27 of BiondVax`s shelf prospectus published on January 17, 2012.
Help employers find you! Check out all the jobs and post your resume.
comments powered by | <urn:uuid:a23ded4d-16cc-4bf8-b373-ed16514e02d3> | CC-MAIN-2017-04 | http://www.biospace.com/News/priming-with-biondvax-pharmaceuticals-universal/306744 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280242.65/warc/CC-MAIN-20170116095120-00077-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.914489 | 1,088 | 2.34375 | 2 |
Human Capital Management
Team Performance Appraisal System- Part Two
In our group discussion, we considered how to convert an existing individual appraisal system into a team-performance appraisal system. The subject matter of our conversation ranged from incentives for lower-level employees through lump-sum bonuses and spot bonuses to team and organization-wide incentives, which focuses on increasing productivity and morale by giving employees a sense of participation in and identification with the company (Cadrain, 2003). Our team report will focus on individual fairness, and how it affects team performance, successful strategies in discouraging social loafing, and how the employee takes responsibility within the sales team. Team performance relies heavily on how well its members perform. Individual performance and contribution directly influences the effectiveness of the team in meeting its goals and objectives. The management and team leader’s role is to ensure that he or she provides an environment that fosters harmony in the workplace in which its employees are highly motivated to perform to his or her utmost potential. To influence good performance, individuals need to believe there is individual equity or fairness in the system. “When people feel fairly or advantageously treated they are more likely to be motivated; when they feel unfairly treated they are highly prone to feelings of disaffection and de-motivation. The way that people measure this sense of fairness is at the heart of Equity Theory” (“Adam’s equity theory“, 2010). Individual members in a team compare his or her performances and efforts with other members of the team that receive praise, compensation, rewards or recognition that is not equitable to their performances. Employees tend to compare themselves to other employees to determine if they are receiving fair treatment or not. Employees may seek a balance between their... | <urn:uuid:87406296-ca67-4b8f-9be0-84f545c4d1d6> | CC-MAIN-2017-04 | http://www.studymode.com/essays/Team-Performance-Appraisal-System-335572.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280266.9/warc/CC-MAIN-20170116095120-00496-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.951018 | 352 | 2 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.