id stringlengths 9 9 | question stringclasses 284 values | options listlengths 0 15 | answer stringlengths 1 1.49k | images listlengths 1 18 | question_type stringclasses 3 values | field stringclasses 5 values | lang stringclasses 2 values |
|---|---|---|---|---|---|---|---|
L001/0000 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as GVSREEIQR. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 2, 'y ions': 5} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0000_9ff35077bf55359afc2e36137e209cd7.png"
] | exact_match | life | en |
L001/0001 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as YGPHT+15.995MAGDDPTK. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 1, 'y ions': 3} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0001_a945475091057356845d8040a22e9ad2.png"
] | exact_match | life | en |
L001/0002 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as SVIGRPEDQR. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 2, 'y ions': 5} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0002_7a2d127f2274857e219ccd98758f4ef3.png"
] | exact_match | life | en |
L001/0003 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as QVEASVANNEADKAK. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 1, 'y ions': 7} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0003_753ad7c4b1b00f6626a36cf1c146b156.png"
] | exact_match | life | en |
L001/0004 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as ASNAEDVEYGR. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 0, 'y ions': 6} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0004_aa7a4601cd51eae69b7e20a3410c4c53.png"
] | exact_match | life | en |
L001/0005 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as NHSDSNGTEQVSQDTHSNEYNQTEQK. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 8, 'y ions': 9} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0005_162ccd5a993b7c4e7108aee8c2cd5444.png"
] | exact_match | life | en |
L001/0006 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as TGEVSDPVK. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 3, 'y ions': 8} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0006_1d7d61768e48523911198e43d3c84f62.png"
] | exact_match | life | en |
L001/0007 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as NMS+0.984NGDVMK. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 1, 'y ions': 4} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0007_1fccf577aef712862776c3deeb4ace4a.png"
] | exact_match | life | en |
L001/0008 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as MDQSATISAK. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 2, 'y ions': 10} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0008_8b9122679541e0394d504630b9251be5.png"
] | exact_match | life | en |
L001/0009 | You are an expert in mass spectrometry and peptide sequencing. The peptide sequence is given as ISGEVPEEK. Given the MS/MS spectrum shown in <image>, please count and fill in the number of b ions and y ions in the following format:
{
"b ions": ,
"y ions":
} | [] | {'b ions': 2, 'y ions': 5} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L001_0009_f29cb38ce56131c821c756dcec9981bc.png"
] | exact_match | life | en |
L016/0000 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | tRNA | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0000_d4a64643b5fed21c13496ab92149f714.png"
] | exact_match | life | en |
L016/0001 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | tRNA | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0001_606f7b5ee8cb08e1767895c3177cc7a8.png"
] | exact_match | life | en |
L016/0002 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | Ribozyme | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0002_a83c83c6c0627af62fd33688d9f03420.png"
] | exact_match | life | en |
L016/0003 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | Ribozyme | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0003_ad791439e6779ef6d7fa46bff75c8970.png"
] | exact_match | life | en |
L016/0004 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | Ribozyme | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0004_6ec02a6a5dd682dbd0b873ff151dafa7.png"
] | exact_match | life | en |
L016/0005 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | Riboswitch | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0005_272c2bf95ede70b2eb2adb1563b4d28e.png"
] | exact_match | life | en |
L016/0006 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | Riboswitch | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0006_052bb079a9b42379821d9949df1f8bf1.png"
] | exact_match | life | en |
L016/0007 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | rRNA | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0007_231b28b41baa5e9bc903ff4aa970d411.png"
] | exact_match | life | en |
L016/0008 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | rRNA | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0008_22fb6fb29972790873c4a7d1f938e969.png"
] | exact_match | life | en |
L016/0009 | Examine the given RNA secondary structure diagram <image>. What type of RNA is represented by the structure? | [] | rRNA | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L016_0009_68c251881ddca6ed17e056434fc0176f.png"
] | exact_match | life | en |
L017/0000 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'CCGUGCUAGGUGGGGAGGUAGCGGUUCCCUGUACUCGAAAUCCGCUUUAUGCGAGACUUAAUUCCUUUGUUGAGGGCGUAUUUUUGUGAAGUCUGCCCGAAGCACGUAGUGUUUGAAGAUUUCGGUCCUAUGCAAUAUGAACCCAUGAACCAUGUCAGGUCCUGACGGAAGCAGCAUUAAGUGGAUCCUCAUAUGUGCCGUAGGGUAGCCGAGAUUUAGCUGUCGACUUCGGUAACGUUUAUGAUAUGCGUUCGAUACAAAGGUGCAUGG'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0000_15d8f36b89985345816c0bf7d36a8388.png"
] | exact_match | life | en |
L017/0001 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'AAAGAAAUCCCUUUACAACGGAUCGUGAGGCACGUACCUGCCUCUGAAAGGAUGACAAAUC'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0001_89baaac01af9d8c4389acf2169248d40.png"
] | exact_match | life | en |
L017/0002 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'GGGCCCAUAGCUCAGUGGUAGAGUGCCUCCUUUGCAAGGAGGAUGCCCUGGGUUCGAAUCCCAGUGGGUCCA'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0002_56fc288f8225d77d0217b3f84b9c462f.png"
] | exact_match | life | en |
L017/0003 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'AUAAUCAACGAGAGUGUCAACCUGCCGCGAAGGUCUAUGAGUGGUCUGUUGCUCAUCUUUGUGUAGC'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0003_b9547c86fbe3d60252e1446c69b9d660.png"
] | exact_match | life | en |
L017/0004 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'CGACUAGAAGGGCUGCACAAGUGGCUCGUUAGGGUUUAACCCUGUCUGGUUG'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0004_01b9e4953211c3e7facb816c0afa8ab3.png"
] | exact_match | life | en |
L017/0005 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'GUUACCACUGAGCGGUGGCUGUCGUGAGGUACUGGGGAGUACUGCUGACCGGCGGGUACCGAGUCUGGGCUACAGCCAAGGGAAUGGGCCUGGACGUUUCAGUGAAGGAG'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0005_241241ce9e95f40d4b3b7477853b4084.png"
] | exact_match | life | en |
L017/0006 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'GUUUCCAUCCCCGUGAGGGGUAAGAGAUUAAAAAC'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0006_a3594b6a3929d1c63c6212bc7e505652.png"
] | exact_match | life | en |
L017/0007 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'GCCUCCACCACCUCCCCUGCAAACGUCCAGUGACGCAGAGGUAAUGGACGUUGGCUCUGGUGGUGAUGGACA'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0007_3e92fa7eab6552d4cffa86b998a5f81c.png"
] | exact_match | life | en |
L017/0008 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'CGGCCAGCGAAAACACAGGCGCCGUGCUUGCAACGAUCACUUCGCCUGCACCUGUGCUGCCCCAGA'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0008_e96ada560a7e05d77982b00c0a88db37.png"
] | exact_match | life | en |
L017/0009 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'GGUUUAAUCCCUUGUAGGGAUUCUUAUUUAUGGAAC'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0009_1c399437ee99d3e974df00d331c2496d.png"
] | exact_match | life | en |
L017/0010 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'AAAGAAAUCCCUUUACAACGGAUCGUGAGGCACGUACCUGCCUCUGAAAGGAUGACAAAUC'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0010_89baaac01af9d8c4389acf2169248d40.png"
] | exact_match | life | en |
L017/0011 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'GAGCAAUGACGUCAAAAUAAAAAUGGCGUAAGUUGCCUUGAAGGUUGGCAACAACAAAUAGCGAUUCUCCGUGCCUAUCAAGUUUUCUAAUCUUGAUUGUUGGCCUCGAACAAGUCGCUACAUU'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0011_c5cce1bef536d3fb6dae5273d27aedee.png"
] | exact_match | life | en |
L017/0012 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'AAACAAAGGUAUCGACACUAGUCAGCGAGGGUUCGCCCACUAGUGCGAUUUUU'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0012_2a7c1c2367fd819a71a12bf7f4fc4f70.png"
] | exact_match | life | en |
L017/0013 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'UUCGAUAAAGCCGAACCCAUCGAAAGAUGGGGACGGGAAACCACAAGUUUCAGAUAGUUUCGUUGAUUCAAGCUCCUAGUUUUUUUGGCGCUUCCUUAAGAUCUUGAUUCUCUACUAAACAGUAUUGAGCUGCAGCGC'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0013_430312ea55bb35c7cf58f5c3c51b3ed8.png"
] | exact_match | life | en |
L017/0014 | You are a professional biologist, and you are skilled at reading RNA sequences. From the RNA secondary structure <image>, give the exact RNA sequence. Answer in capital letters only, from 5' to 3'. If there exists any T base in the picture, replace them into U base.Please output as a JSON dict with given exact keys (no units):
{'Exact Sequence': Sequence}. Please strictly follow the format. | [] | {'Exact Sequence': 'GUGAAAUUGAUCACAAACAAACAUUACCCCUUUGUUUGACCGUGAAAAAUUUCUCCCAUCCCCUUUGUUGUCGUUAAGACAUAUGAAACCGCGCUUAUCCCGGCGCGGUUUCUUU'} | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L017_0014_8c8da09d5507b687c5a29475a295e6f2.png"
] | exact_match | life | en |
L003/0000 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | GVSREEIQR | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0000_9ff35077bf55359afc2e36137e209cd7.png"
] | exact_match | life | en |
L003/0001 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | YGPHT+15.995MAGDDPTK | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0001_a945475091057356845d8040a22e9ad2.png"
] | exact_match | life | en |
L003/0002 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | SVIGRPEDQR | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0002_7a2d127f2274857e219ccd98758f4ef3.png"
] | exact_match | life | en |
L003/0003 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | QVEASVANNEADKAK | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0003_753ad7c4b1b00f6626a36cf1c146b156.png"
] | exact_match | life | en |
L003/0004 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | ASNAEDVEYGR | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0004_aa7a4601cd51eae69b7e20a3410c4c53.png"
] | exact_match | life | en |
L003/0005 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | NHSDSNGTEQVSQDTHSNEYNQTEQK | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0005_162ccd5a993b7c4e7108aee8c2cd5444.png"
] | exact_match | life | en |
L003/0006 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | TGEVSDPVK | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0006_1d7d61768e48523911198e43d3c84f62.png"
] | exact_match | life | en |
L003/0007 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | NMS+0.984NGDVMK | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0007_1fccf577aef712862776c3deeb4ace4a.png"
] | exact_match | life | en |
L003/0008 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | MDQSATISAK | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0003_753ad7c4b1b00f6626a36cf1c146b156.png"
] | exact_match | life | en |
L003/0009 | You are an expert in mass spectrometry and peptide sequencing. Given an MS/MS spectrum, your task is to predict the amino acid sequence of the peptide that generated the spectrum using your expert knowledge of peptide fragmentation patterns and *de novo* sequencing principles. The masses of amino acids and modifications are as follows:
G: 57.021464, A: 71.037114, S: 87.032028, P: 97.052764, V: 99.068414, T: 101.047670, C+57.021: 160.030649, L: 113.084064, I: 113.084064, N: 114.042927, D: 115.026943, Q: 128.058578, K: 128.094963, E: 129.042593, M: 131.040485, H: 137.058912, F: 147.068414, R: 156.101111, Y: 163.063329, W: 186.079313, M+15.995: 147.035400, N+0.984: 115.026943, Q+0.984: 129.042594, +42.011: 42.010565, +43.006: 43.005814, -17.027: -17.026549, +43.006-17.027: 25.980265. Given the MS/MS spectrum shown in <image>, determine the most likely peptide sequence. Please write your answer as a single peptide sequence. | [] | ISGEVPEEK | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L003_0009_f29cb38ce56131c821c756dcec9981bc.png"
] | exact_match | life | en |
L010/0000 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | A | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0000_36cc460084784c4d33633626296aba64.png"
] | exact_match | life | en |
L010/0001 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | I | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0001_ea63daa71ac60dbda11b388d0f829676.png"
] | exact_match | life | en |
L010/0002 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | A | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0002_e3475ae3472de5584f343b1657a7b157.png"
] | exact_match | life | en |
L010/0003 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | F | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0003_ad635cce982c8d251b840b5af220d256.png"
] | exact_match | life | en |
L010/0004 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | A | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0004_09de6dd140d462ab5f2de068a7f74112.png"
] | exact_match | life | en |
L010/0005 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | D | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0005_5e57d2fbfcdf424fefc2f129982df092.png"
] | exact_match | life | en |
L010/0006 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | D | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0006_1de6d9d3ab0be5b3b6620f9fe707b421.png"
] | exact_match | life | en |
L010/0007 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | A | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0007_8cb6c9e8ee4d9713e144f68523a79928.png"
] | exact_match | life | en |
L010/0008 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | A | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0008_6ee42cd57b2a75d7ce52e31cf3062f85.png"
] | exact_match | life | en |
L010/0009 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | A | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0009_348940deb429e87fa79ba931e5c31b24.png"
] | exact_match | life | en |
L010/0010 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | D | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0010_145336c471bb33a20444ab39e93de133.png"
] | exact_match | life | en |
L010/0011 | Based on the structures <image>, choose the most suitable description of the protein structure | [
"(A) Enzymes",
"(B) Storage Proteins",
"(C) Structural Proteins",
"(D) Transport Proteins",
"(E) Signaling Proteins",
"(F) Regulatory Proteins",
"(G) Motor Proteins",
"(H) Receptor Proteins",
"(I) Defensive Proteins"
] | H | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L010_0011_6972c92122d25cf10a374e95b807c49d.png"
] | exact_match | life | en |
L008/0000 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer number of protein chains with integers | [] | 2 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0000_36cc460084784c4d33633626296aba64.png"
] | exact_match | life | en |
L008/0001 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 2 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0001_ea63daa71ac60dbda11b388d0f829676.png"
] | exact_match | life | en |
L008/0002 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 2 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0002_e3475ae3472de5584f343b1657a7b157.png"
] | exact_match | life | en |
L008/0003 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0003_ad635cce982c8d251b840b5af220d256.png"
] | exact_match | life | en |
L008/0004 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0004_09de6dd140d462ab5f2de068a7f74112.png"
] | exact_match | life | en |
L008/0005 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0005_5e57d2fbfcdf424fefc2f129982df092.png"
] | exact_match | life | en |
L008/0006 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0006_1de6d9d3ab0be5b3b6620f9fe707b421.png"
] | exact_match | life | en |
L008/0007 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0007_8cb6c9e8ee4d9713e144f68523a79928.png"
] | exact_match | life | en |
L008/0008 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 2 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0008_6ee42cd57b2a75d7ce52e31cf3062f85.png"
] | exact_match | life | en |
L008/0009 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0009_348940deb429e87fa79ba931e5c31b24.png"
] | exact_match | life | en |
L008/0010 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 4 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0010_145336c471bb33a20444ab39e93de133.png"
] | exact_match | life | en |
L008/0011 | From the molecular structure PDB image <image>, (remove hydrogen atoms), please answer the number of protein chains with integers | [] | 5 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/L008_0011_6972c92122d25cf10a374e95b807c49d.png"
] | exact_match | life | en |
M004/0000 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | Ag: +1, O: -2 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-353-multiview-front_f718c3140211269e113d33f37f827db3.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-353-multiview-side_8210404efbf84e26505d9e476c8b408a.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M004/0001 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | Al: +3, N: -3 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-661-multiview-front_28fc3f8c5c0b30e87939ee13b4484915.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-661-multiview-side_935cd3b1578abcd26ca1c8d1a126ba6f.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M004/0002 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | Sn: +4, O: -2 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-856-multiview-front_73955bf9e436ad3f7292f83a6f26375e.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-856-multiview-side_74bb93c0efbb357a82bc3ea043d7c5cb.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M004/0003 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | Ba: +2, Te: -2 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-1000-multiview-front_5adf3d45f5298eec6c0f39f82be243eb.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-1000-multiview-side_1260443f36271e795ca1f58d6aeeddfd.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M004/0004 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | B: +3, P: -3 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-1479-multiview-front_1c51449f887753abcba55abcb5a64133.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-1479-multiview-side_d2a5a7f01fcfb1990f2decf0c04b4ff3.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M004/0005 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | Ag: +2, F: -1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-2284-multiview-front_a986ea21bae7dc4125f99775922fc234.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-2284-multiview-side_9135f4cdc4a86084c42b70350def4882.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M004/0006 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | Al: 0, Ir: 0 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-2294-multiview-front_99cdcfededb7615807f1ee8d8ca40c03.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-2294-multiview-side_4a1dbb910b9a8adfbff9c7a7c4a40f5f.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M004/0007 | Given different lattice‑diagram views of the material, identify the oxidation state of each element and reply only with those states formatted exactly as 'Element: Oxidation state', separated by commas (e.g., Ag: +1, O: -2), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the oxidation state of each element | [] | B: +3, As: -3 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-10044-multiview-front_e020a357936b1127131ca9dcaa313544.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M004_mp-10044-multiview-side_860b4f45b1feeef58cddd7a4fefb7e5d.png",
"/fs-computility/ai4sData/earth-shared/SFE/sf... | exact_match | material | en |
M006/0000 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) Ag (O fraction = 0)",
"(B) Ag₂O (O fraction ≈ 0.33)",
"(C) AgO (O fraction ≈ 0.50)",
"(D) Ag₃O₄ (O fraction ≈ 0.57)",
"(E) O (O fraction = 1.00)"
] | ['C'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-353-phase-diagram_aa6c0428669a440766a20bf090d35810.png"
] | mcq | material | en |
M006/0001 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) Al (N fraction = 0)",
"(B) Al₃N₂ (N fraction = 0.4)",
"(C) AlN (N fraction = 0.5)",
"(D) Al₃N₄ (N fraction ≈ 0.57)",
"(E) N (N fraction = 1)"
] | ['C'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-661-phase-diagram_7bbe82b5d9b7b7f3b918762c8ddb4760.png"
] | mcq | material | en |
M006/0002 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) Sn (O fraction = 0)",
"(B) SnO (O fraction = 0.5)",
"(C) SnO₂ (O fraction ≈ 0.67)",
"(D) O (O fraction = 1)"
] | ['C'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-856-phase-diagram_91067cc178b91080b53b4d994e7b4077.png"
] | mcq | material | en |
M006/0003 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) Ba (Te fraction = 0)",
"(B) BaTe (Te fraction = 0.5)",
"(C) BaTe₂ (Te fraction ≈ 0.67)",
"(D) BaTe₃ (Te fraction = 0.75)",
"(E) Te (Te fraction = 1.00)"
] | ['B'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-1000-phase-diagram_c24755dacbec7519f7eba8b0e44dedfa.png"
] | mcq | material | en |
M006/0004 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) B (P fraction = 0.00)",
"(B) B₆P (P fraction ≈ 0.14)",
"(C) B₃P (P fraction = 0.25)",
"(D) BP (P fraction = 0.50)",
"(E) P (P fraction = 1.00)"
] | ['D'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-1479-phase-diagram_8ac22aeff5bae8831841e17432712e82.png"
] | mcq | material | en |
M006/0005 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) Ag (F fraction = 0.00)",
"(B) Ag₂F (F fraction ≈ 0.33)",
"(C) AgF (F fraction = 0.50)",
"(D) AgF₂ (F fraction ≈ 0.67)",
"(E) F (F fraction = 1.00)"
] | ['D'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-2284-phase-diagram_d369a942d51545fbfd1ce7e5fe0230dd.png"
] | mcq | material | en |
M006/0006 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) Al (Ir fraction = 0.00)",
"(B) Al₉Ir₂ (Ir fraction ≈ 0.18)",
"(C) Al₃Ir (Ir fraction = 0.25)",
"(D) AlIr (Ir fraction = 0.50)",
"(E) Ir (Ir fraction = 1.00)"
] | ['D'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-2294-phase-diagram_b3c4da4f1342d7ff6ab3bae7c5cb0df2.png"
] | mcq | material | en |
M006/0007 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given phase diagram <image>, at what composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) B (As fraction = 0.00)",
"(B) B₆As (As fraction ≈ 0.14)",
"(C) BAs (As fraction = 0.50)",
"(D) BAs₂ (As fraction ≈ 0.67)",
"(E) As (As fraction = 1.00)"
] | ['B'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-10044-phase-diagram_8cf7bf0700dd4fad07987fc85cfef0c0.png"
] | mcq | material | en |
M006/0008 | Given a phase diagram with multiple‑choice answer options, select the single letter corresponding to the composition ratio at which the material exhibits its most thermodynamically stable phase and reply only with that letter (e.g., C), without any additional text, explanation, or commentary.
Based on the given convex-hull phase diagram <image>, at which composition ratio does the material exhibit its most thermodynamically stable phase | [
"(A) S₃FY₂",
"(B) SF₂Y",
"(C) SY",
"(D) S₂F",
"(E) FY"
] | ['B'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M006_mp-10086-phase-diagram_e62bf5e6b224a775c6b563ffe02c03c5.png"
] | mcq | material | en |
M001/0000 | Please strictly follow the format—no additional text or explanation may be provided.
You should only reply with the letter(s) of the correct option(s) (e.g., A, C) corresponding to the descriptions that match the diagram.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, thoroughly analyze these views to identify correct descriptions from the options given below. | [
"(A) The chemical formula of the lattice is Ag₂O.",
"(B) The O²⁻ anions form a body-centered cubic sublattice.",
"(C) Each O²⁻ is octahedrally coordinated by six Ag⁺ cations.",
"(D) Each Ag⁺ is linearly coordinated by two O²⁻ with a 180° bond angle.",
"(E) Each O²⁻ is tetrahedrally coordinated by four Ag⁺."... | ['A', 'B', 'D', 'E', 'F'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M001_mp-353-multiview-front_f718c3140211269e113d33f37f827db3.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M001_mp-353-multiview-side_8210404efbf84e26505d9e476c8b408a.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | mcq | material | en |
M001/0001 | Please strictly follow the format—no additional text or explanation may be provided.
You should only reply with the letter(s) of the correct option(s) (e.g., A, C) corresponding to the descriptions that match the diagram.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, thoroughly analyze these views to identify correct descriptions from the options given below. | [
"(A) The chemical formula of the lattice is AlN.",
"(B) The N³⁻ anions form a hexagonal close-packed sublattice.",
"(C) Each N³⁻ is tetrahedrally coordinated by four Al³⁺ cations.",
"(D) Each Al³⁺ is octahedrally coordinated by six N³⁻ anions.",
"(E) Al³⁺ cations occupy exactly half of the tetrahedral voids... | ['A', 'B', 'C', 'E', 'F', 'G'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M001_mp-661-multiview-front_28fc3f8c5c0b30e87939ee13b4484915.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M001_mp-661-multiview-side_935cd3b1578abcd26ca1c8d1a126ba6f.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | mcq | material | en |
M001/0002 | Please strictly follow the format—no additional text or explanation may be provided.
You should only reply with the letter(s) of the correct option(s) (e.g., A, C) corresponding to the descriptions that match the diagram.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, thoroughly analyze these views to identify correct descriptions from the options given below. | [
"(A) The chemical formula of the lattice is SnO₂.",
"(B) The O²⁻ anions form a face-centered cubic sublattice.",
"(C) Each Sn⁴⁺ is octahedrally coordinated by six O²⁻ anions.",
"(D) Each O²⁻ is three-coordinated by three Sn⁴⁺ cations.",
"(E) Sn⁴⁺ cations occupy exactly half of the octahedral voids in the O²... | ['A', 'C', 'D', 'E', 'F'] | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M001_mp-856-multiview-front_73955bf9e436ad3f7292f83a6f26375e.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M001_mp-856-multiview-side_74bb93c0efbb357a82bc3ea043d7c5cb.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | mcq | material | en |
M002/0000 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | Pn3̅m1 | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-353-multiview-front_f718c3140211269e113d33f37f827db3.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-353-multiview-side_8210404efbf84e26505d9e476c8b408a.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M002/0001 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | P6₃mc | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-661-multiview-front_28fc3f8c5c0b30e87939ee13b4484915.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-661-multiview-side_935cd3b1578abcd26ca1c8d1a126ba6f.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M002/0002 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | P4₂/mnm | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-856-multiview-front_73955bf9e436ad3f7292f83a6f26375e.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-856-multiview-side_74bb93c0efbb357a82bc3ea043d7c5cb.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M002/0003 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | Fm3̅m | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-1000-multiview-front_5adf3d45f5298eec6c0f39f82be243eb.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-1000-multiview-side_1260443f36271e795ca1f58d6aeeddfd.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M002/0004 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | F4̅3m | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-1479-multiview-front_1c51449f887753abcba55abcb5a64133.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-1479-multiview-side_d2a5a7f01fcfb1990f2decf0c04b4ff3.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M002/0005 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | Pbca | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-2284-multiview-front_a986ea21bae7dc4125f99775922fc234.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-2284-multiview-side_9135f4cdc4a86084c42b70350def4882.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M002/0006 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | P6₃/mmc | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-2294-multiview-front_99cdcfededb7615807f1ee8d8ca40c03.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-2294-multiview-side_4a1dbb910b9a8adfbff9c7a7c4a40f5f.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_... | exact_match | material | en |
M002/0007 | Given different views of the material, determine the space‑group symbol that best matches the symmetry and lattice features shown, and reply only with that symbol (e.g., Pn3̅m1), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the most likely space group of the material. | [] | F4̅3m | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-10044-multiview-front_e020a357936b1127131ca9dcaa313544.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M002_mp-10044-multiview-side_860b4f45b1feeef58cddd7a4fefb7e5d.png",
"/fs-computility/ai4sData/earth-shared/SFE/sf... | exact_match | material | en |
M003/0000 | Given different lattice‑diagram views of the material, infer the molecular formula based solely on the lattice composition and reply only with that formula (e.g., Ag₂O), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the molecular formula of the material | [] | Ag₂O | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M003_mp-353-multiview-front_f718c3140211269e113d33f37f827db3.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M003_mp-353-multiview-side_8210404efbf84e26505d9e476c8b408a.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M003/0001 | Given different lattice‑diagram views of the material, infer the molecular formula based solely on the lattice composition and reply only with that formula (e.g., Ag₂O), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the molecular formula of the material | [] | AlN | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M003_mp-661-multiview-front_28fc3f8c5c0b30e87939ee13b4484915.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M003_mp-661-multiview-side_935cd3b1578abcd26ca1c8d1a126ba6f.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
M003/0002 | Given different lattice‑diagram views of the material, infer the molecular formula based solely on the lattice composition and reply only with that formula (e.g., Ag₂O), without any additional text, explanation, or commentary.
Based on the different views of a material: front view <image>, side view <image> and top view <image>, determine the molecular formula of the material | [] | SnO₂ | [
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M003_mp-856-multiview-front_73955bf9e436ad3f7292f83a6f26375e.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_dataset/v0/images/M003_mp-856-multiview-side_74bb93c0efbb357a82bc3ea043d7c5cb.png",
"/fs-computility/ai4sData/earth-shared/SFE/sfe_da... | exact_match | material | en |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.