max_stars_repo_path
stringlengths
4
286
max_stars_repo_name
stringlengths
5
119
max_stars_count
int64
0
191k
id
stringlengths
1
7
content
stringlengths
6
1.03M
content_cleaned
stringlengths
6
1.03M
language
stringclasses
111 values
language_score
float64
0.03
1
comments
stringlengths
0
556k
edu_score
float64
0.32
5.03
edu_int_score
int64
0
5
IRIS_data_download/IRIS_download_support/obspy/io/nied/tests/test_knet_reading.py
earthinversion/Fnet_IRIS_data_automated_download
2
6617351
<filename>IRIS_data_download/IRIS_download_support/obspy/io/nied/tests/test_knet_reading.py # -*- coding: utf-8 -*- from __future__ import (absolute_import, division, print_function, unicode_literals) from future.builtins import * # NOQA @UnusedWildImport import os import io import unittest import numpy as np from obspy import read from obspy.io.nied.knet import _is_knet_ascii class KnetReadingTestCase(unittest.TestCase): """ Test reading of K-NET and KiK-net ASCII format files from a file. """ def setUp(self): # Directory where the test files are located self.path = os.path.dirname(__file__) def test_read_knet_ascii(self): testfile = os.path.join(self.path, 'data', 'test.knet') tr = read(testfile)[0] tr.data *= tr.stats.calib tr.data -= tr.data.mean() max = np.abs(tr.data).max() * 100 # Maximum acc converted to gal np.testing.assert_array_almost_equal(max, tr.stats.knet.accmax, decimal=3) duration = int(tr.stats.endtime - tr.stats.starttime + 0.5) self.assertEqual(duration, int(tr.stats.knet.duration)) def test_read_knet_ascii_from_open_files(self): """ Test reading of K-NET and KiK-net ASCII format files from an open file. """ testfile = os.path.join(self.path, 'data', 'test.knet') with open(testfile, "rb") as fh: tr = read(fh)[0] tr.data *= tr.stats.calib tr.data -= tr.data.mean() max = np.abs(tr.data).max() * 100 # Maximum acc converted to gal np.testing.assert_array_almost_equal(max, tr.stats.knet.accmax, decimal=3) duration = int(tr.stats.endtime - tr.stats.starttime + 0.5) self.assertEqual(duration, int(tr.stats.knet.duration)) def test_read_knet_ascii_from_bytes_io(self): """ Tests that reading of K-NET and KiK-net ASCII format files from a BytesIO object works. """ testfile = os.path.join(self.path, 'data', 'test.knet') with open(testfile, "rb") as fh: buf = io.BytesIO(fh.read()) with buf: tr = read(buf)[0] tr.data *= tr.stats.calib tr.data -= tr.data.mean() max = np.abs(tr.data).max() * 100 # Maximum acc converted to gal np.testing.assert_array_almost_equal(max, tr.stats.knet.accmax, decimal=3) duration = int(tr.stats.endtime - tr.stats.starttime + 0.5) self.assertEqual(duration, int(tr.stats.knet.duration)) def test_station_name_hack(self): """ Station names in K-NET and KiK-net are 6 characters long which does not conform with the SEED standard. Test hack to write the last 2 characters of the station name into the location field. """ testfile = os.path.join(self.path, 'data', 'test.knet') tr = read(testfile, convert_stnm=True)[0] self.assertEqual(tr.stats.location, '13') def test_is_knet_ascii(self): """ This tests the _is_knet_ascii method by just validating that each file in the data directory is a K-NET ascii file and each file in the working directory is not. The filenames are hard coded so the test will not fail with future changes in the structure of the package. """ # K-NET file names. knet_filenames = ['test.knet'] # Non K-NET file names. non_knet_filenames = ['test_knet_reading.py', '__init__.py'] # Loop over K-NET files for _i in knet_filenames: filename = os.path.join(self.path, 'data', _i) is_knet = _is_knet_ascii(filename) self.assertTrue(is_knet) # Loop over non K-NET files for _i in non_knet_filenames: filename = os.path.join(self.path, _i) is_knet = _is_knet_ascii(filename) self.assertFalse(is_knet) def suite(): return unittest.makeSuite(KnetReadingTestCase, 'test') if __name__ == '__main__': unittest.main(defaultTest='suite')
<filename>IRIS_data_download/IRIS_download_support/obspy/io/nied/tests/test_knet_reading.py # -*- coding: utf-8 -*- from __future__ import (absolute_import, division, print_function, unicode_literals) from future.builtins import * # NOQA @UnusedWildImport import os import io import unittest import numpy as np from obspy import read from obspy.io.nied.knet import _is_knet_ascii class KnetReadingTestCase(unittest.TestCase): """ Test reading of K-NET and KiK-net ASCII format files from a file. """ def setUp(self): # Directory where the test files are located self.path = os.path.dirname(__file__) def test_read_knet_ascii(self): testfile = os.path.join(self.path, 'data', 'test.knet') tr = read(testfile)[0] tr.data *= tr.stats.calib tr.data -= tr.data.mean() max = np.abs(tr.data).max() * 100 # Maximum acc converted to gal np.testing.assert_array_almost_equal(max, tr.stats.knet.accmax, decimal=3) duration = int(tr.stats.endtime - tr.stats.starttime + 0.5) self.assertEqual(duration, int(tr.stats.knet.duration)) def test_read_knet_ascii_from_open_files(self): """ Test reading of K-NET and KiK-net ASCII format files from an open file. """ testfile = os.path.join(self.path, 'data', 'test.knet') with open(testfile, "rb") as fh: tr = read(fh)[0] tr.data *= tr.stats.calib tr.data -= tr.data.mean() max = np.abs(tr.data).max() * 100 # Maximum acc converted to gal np.testing.assert_array_almost_equal(max, tr.stats.knet.accmax, decimal=3) duration = int(tr.stats.endtime - tr.stats.starttime + 0.5) self.assertEqual(duration, int(tr.stats.knet.duration)) def test_read_knet_ascii_from_bytes_io(self): """ Tests that reading of K-NET and KiK-net ASCII format files from a BytesIO object works. """ testfile = os.path.join(self.path, 'data', 'test.knet') with open(testfile, "rb") as fh: buf = io.BytesIO(fh.read()) with buf: tr = read(buf)[0] tr.data *= tr.stats.calib tr.data -= tr.data.mean() max = np.abs(tr.data).max() * 100 # Maximum acc converted to gal np.testing.assert_array_almost_equal(max, tr.stats.knet.accmax, decimal=3) duration = int(tr.stats.endtime - tr.stats.starttime + 0.5) self.assertEqual(duration, int(tr.stats.knet.duration)) def test_station_name_hack(self): """ Station names in K-NET and KiK-net are 6 characters long which does not conform with the SEED standard. Test hack to write the last 2 characters of the station name into the location field. """ testfile = os.path.join(self.path, 'data', 'test.knet') tr = read(testfile, convert_stnm=True)[0] self.assertEqual(tr.stats.location, '13') def test_is_knet_ascii(self): """ This tests the _is_knet_ascii method by just validating that each file in the data directory is a K-NET ascii file and each file in the working directory is not. The filenames are hard coded so the test will not fail with future changes in the structure of the package. """ # K-NET file names. knet_filenames = ['test.knet'] # Non K-NET file names. non_knet_filenames = ['test_knet_reading.py', '__init__.py'] # Loop over K-NET files for _i in knet_filenames: filename = os.path.join(self.path, 'data', _i) is_knet = _is_knet_ascii(filename) self.assertTrue(is_knet) # Loop over non K-NET files for _i in non_knet_filenames: filename = os.path.join(self.path, _i) is_knet = _is_knet_ascii(filename) self.assertFalse(is_knet) def suite(): return unittest.makeSuite(KnetReadingTestCase, 'test') if __name__ == '__main__': unittest.main(defaultTest='suite')
en
0.871993
# -*- coding: utf-8 -*- # NOQA @UnusedWildImport Test reading of K-NET and KiK-net ASCII format files from a file. # Directory where the test files are located # Maximum acc converted to gal Test reading of K-NET and KiK-net ASCII format files from an open file. # Maximum acc converted to gal Tests that reading of K-NET and KiK-net ASCII format files from a BytesIO object works. # Maximum acc converted to gal Station names in K-NET and KiK-net are 6 characters long which does not conform with the SEED standard. Test hack to write the last 2 characters of the station name into the location field. This tests the _is_knet_ascii method by just validating that each file in the data directory is a K-NET ascii file and each file in the working directory is not. The filenames are hard coded so the test will not fail with future changes in the structure of the package. # K-NET file names. # Non K-NET file names. # Loop over K-NET files # Loop over non K-NET files
2.439183
2
tests/test_dataloader.py
chengweilin114/test
2
6617352
import pandas as pd # from ..codes.dataloader import dataloader from dataloader import dataloader def test_dataloader(): actual_load_fname = 'ieso_ga_master_dataset_allWeather_updated2020.csv' forecasts_fname = 'ga_forecasts_top_2.csv' actual_load, forecasts = dataloader(actual_load_fname, forecasts_fname) assert isinstance(actual_load, pd.DataFrame)
import pandas as pd # from ..codes.dataloader import dataloader from dataloader import dataloader def test_dataloader(): actual_load_fname = 'ieso_ga_master_dataset_allWeather_updated2020.csv' forecasts_fname = 'ga_forecasts_top_2.csv' actual_load, forecasts = dataloader(actual_load_fname, forecasts_fname) assert isinstance(actual_load, pd.DataFrame)
en
0.178345
# from ..codes.dataloader import dataloader
2.349058
2
api/migrations/0003_auto_20181018_1551.py
unrealkaii/tweeto-django-api
0
6617353
# Generated by Django 2.1.2 on 2018-10-18 14:51 from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ('api', '0002_auto_20181018_1527'), ] operations = [ migrations.CreateModel( name='Reply', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('body', models.TextField(max_length=140)), ('date_created', models.DateTimeField(auto_now_add=True)), ('author', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)), ('tweet', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='replies', to=settings.AUTH_USER_MODEL)), ], options={ 'ordering': ('date_created',), }, ), migrations.RemoveField( model_name='tweet', name='tweet_type', ), ]
# Generated by Django 2.1.2 on 2018-10-18 14:51 from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ('api', '0002_auto_20181018_1527'), ] operations = [ migrations.CreateModel( name='Reply', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('body', models.TextField(max_length=140)), ('date_created', models.DateTimeField(auto_now_add=True)), ('author', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)), ('tweet', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, related_name='replies', to=settings.AUTH_USER_MODEL)), ], options={ 'ordering': ('date_created',), }, ), migrations.RemoveField( model_name='tweet', name='tweet_type', ), ]
en
0.792752
# Generated by Django 2.1.2 on 2018-10-18 14:51
1.836158
2
List_FBSnaps.py
PureStorage-OpenConnect/PythonSampleScripts
12
6617354
import requests from requests.packages.urllib3.exceptions import InsecureRequestWarning requests.packages.urllib3.disable_warnings(InsecureRequestWarning) from base64 import b64encode import os import sys import json import getpass from optparse import OptionParser from datetime import datetime, timedelta import time from time import gmtime, strftime, strptime from operator import itemgetter, attrgetter # Global Variables VERSION = '1.0.0' HEADER = 'Pure Storage List FlashBlade Snapshots (' + VERSION + ')' BANNER = ('=' * 132) DEBUG_LEVEL = 0 VERBOSE_FLAG = False XTOKEN = '' def create_session(flashBlade, api_token): global XTOKEN # Set-up HTTP header userAgent = 'Jakarta Commons-HttpClient/3.1' hdrs= {'Content-Type' : 'application/json', 'User-agent' : userAgent, 'api-token' : api_token} data = { } params = json.dumps(data) path = '/api/login' url = 'https://%s%s'%(flashBlade,path) # Perform action print('Attempting to create session') response = requests.post(url, params, headers=hdrs, verify=False) if DEBUG_LEVEL == 2: print('URL', url) print('respose', response) print('Status', response.status_code) print('Text', response.text) print('Data', response.json) print('HTTP Header:', response.headers) print('x-auth-token:', response.headers['x-auth-token']) print('') if (response): print(BANNER) XTOKEN = response.headers['x-auth-token'] else: print(BANNER) sys.exit('Exiting: Unable to establish session') jsonString = response.text jsonData = json.loads(jsonString) if VERBOSE_FLAG: print(BANNER) print(json.dumps(jsonData, sort_keys=False, indent=4)) name = (jsonData['username']) welcome = 'Welcome ' + name print(welcome) def post_url(flashBlade,path,params): # Set-up HTTP header userAgent = 'Jakarta Commons-HttpClient/3.1' hdrs= {'Content-Type' : 'application/json', 'User-agent' : userAgent, 'x-auth-token' : XTOKEN} url = 'https://%s%s'%(flashBlade,path) # Perform action response = requests.post(url, params, headers=hdrs, verify=False) if DEBUG_LEVEL != 0: print('URL',url) print('Response Status:', response.status_code) print('Text', response.text) print('Data', response.json) print('HTTP Header:', response.headers) print('') jsonString = response.text jsonData = json.loads(jsonString) return(jsonData) def get_url(flashBlade,path,params): # Set-up HTTP header userAgent = 'Jakarta Commons-HttpClient/3.1' hdrs= {'Content-Type' : 'application/json', 'User-agent' : userAgent, 'x-auth-token' : XTOKEN} url = 'https://%s%s'%(flashBlade,path) payload = params # Perform action response = requests.get(url, headers=hdrs, verify=False) if DEBUG_LEVEL != 0: print('URL', url) print('Response Status:', response.status_code) print('Text', response.text) print('Data', response.json) print('HTTP Header:', response.headers) jsonString = response.text jsonData = json.loads(jsonString) return(jsonData) def list_fssnaps(flashBlade,fsname,limit): data = '' params = json.dumps(data) if fsname == '': path = '/api/1.8/file-system-snapshots?sort=name&limit=%s'%(limit) else: path = '/api/1.8/file-system-snapshots?sort=created&names_or_sources=%s'%(fsname) # Perform action jsonData = get_url(flashBlade,path,params) r = str(jsonData) if VERBOSE_FLAG: print(BANNER) print(json.dumps(jsonData, sort_keys=False, indent=4)) # Count of returned rows res = len(jsonData['items']) if res == 0: print('No File System Snapshots found') else: print('number of snaps:', res) x = 0 print(BANNER) print('{0:40} {1:60} {2:20}'.format('File System', 'File System Snapshots', 'Created')) print(BANNER) while (x<res): # source = (jsonData['items'][x]['source']) name = (jsonData['items'][x]['name']) cdate = (jsonData['items'][x]['created']) c1 = str(cdate) epoch = int(c1[0:10]) created = time.strftime("%a, %d %b %Y %H:%M:%S %Z", time.localtime(epoch)) print('{0:40} {1:60} {2:20}'.format(source, name, created)) x = x + 1 def parsecl(): usage = 'usage: %prog [options]' version = '%prog ' + VERSION description = "This program returns Snapshots for given File System. Please contact <EMAIL> for any assistance." parser = OptionParser(usage=usage, version=version, description=description) parser.add_option('-d', '--debug', type = 'int', dest = 'DEBUG_LEVEL', default = 0, help = 'Debug level, used for HTTP debugging') parser.add_option('-l', '--limit', type = 'int', dest = 'limit', default = 999, help = 'Limit number of responses [default: %default]') parser.add_option('-p', '--password', action = 'store', type = 'string', dest = 'password', help = '<PASSWORD>') parser.add_option('-f', '--fsname', action = 'store', type = 'string', dest = 'fsname', default = '', help = 'File System name') parser.add_option('-s', '--server', action = 'store', type = 'string', dest = 'flashBlade', help = 'Pure FlashArray') parser.add_option('-t', '--token', action = 'store', type = 'string', dest = 'api_token', help = 'Pure Api Token') parser.add_option('-v', '--verbose', action = 'store_true', dest = 'VERBOSE_FLAG', default = False, help = 'Verbose [default: %default]') (options, args) = parser.parse_args() ''' print("Options:", options) print("Args:", args) ''' return(options) def main(): # Setup variables global DEBUG_LEVEL global VERBOSE_FLAG exit_code = 0 # Check for command line parameters options = parsecl() flashBlade = options.flashBlade limit = options.limit fsname = options.fsname api_token = options.api_token DEBUG_LEVEL = options.DEBUG_LEVEL VERBOSE_FLAG = options.VERBOSE_FLAG if DEBUG_LEVEL != 0: print('Flash Blade:', flashBlade) print('File System:', fsname) print('Limit:', limit) print('Api Token:', api_token) print('Debug Level:', DEBUG_LEVEL) print('Verbose Flag:', VERBOSE_FLAG) if flashBlade == None: sys.exit('Exiting: You must provide FlashBlade details') if api_token == None: sys.exit('Exiting: You must provide an API Token') print(BANNER) print(HEADER + ' - ' + flashBlade) print(strftime('%d/%m/%Y %H:%M:%S %Z', gmtime())) print(BANNER) # Create session create_session(flashBlade, api_token) list_fssnaps(flashBlade,fsname,limit) print(BANNER) print(strftime('%d/%m/%Y %H:%M:%S %Z', gmtime())) print(BANNER) sys.exit(exit_code) main()
import requests from requests.packages.urllib3.exceptions import InsecureRequestWarning requests.packages.urllib3.disable_warnings(InsecureRequestWarning) from base64 import b64encode import os import sys import json import getpass from optparse import OptionParser from datetime import datetime, timedelta import time from time import gmtime, strftime, strptime from operator import itemgetter, attrgetter # Global Variables VERSION = '1.0.0' HEADER = 'Pure Storage List FlashBlade Snapshots (' + VERSION + ')' BANNER = ('=' * 132) DEBUG_LEVEL = 0 VERBOSE_FLAG = False XTOKEN = '' def create_session(flashBlade, api_token): global XTOKEN # Set-up HTTP header userAgent = 'Jakarta Commons-HttpClient/3.1' hdrs= {'Content-Type' : 'application/json', 'User-agent' : userAgent, 'api-token' : api_token} data = { } params = json.dumps(data) path = '/api/login' url = 'https://%s%s'%(flashBlade,path) # Perform action print('Attempting to create session') response = requests.post(url, params, headers=hdrs, verify=False) if DEBUG_LEVEL == 2: print('URL', url) print('respose', response) print('Status', response.status_code) print('Text', response.text) print('Data', response.json) print('HTTP Header:', response.headers) print('x-auth-token:', response.headers['x-auth-token']) print('') if (response): print(BANNER) XTOKEN = response.headers['x-auth-token'] else: print(BANNER) sys.exit('Exiting: Unable to establish session') jsonString = response.text jsonData = json.loads(jsonString) if VERBOSE_FLAG: print(BANNER) print(json.dumps(jsonData, sort_keys=False, indent=4)) name = (jsonData['username']) welcome = 'Welcome ' + name print(welcome) def post_url(flashBlade,path,params): # Set-up HTTP header userAgent = 'Jakarta Commons-HttpClient/3.1' hdrs= {'Content-Type' : 'application/json', 'User-agent' : userAgent, 'x-auth-token' : XTOKEN} url = 'https://%s%s'%(flashBlade,path) # Perform action response = requests.post(url, params, headers=hdrs, verify=False) if DEBUG_LEVEL != 0: print('URL',url) print('Response Status:', response.status_code) print('Text', response.text) print('Data', response.json) print('HTTP Header:', response.headers) print('') jsonString = response.text jsonData = json.loads(jsonString) return(jsonData) def get_url(flashBlade,path,params): # Set-up HTTP header userAgent = 'Jakarta Commons-HttpClient/3.1' hdrs= {'Content-Type' : 'application/json', 'User-agent' : userAgent, 'x-auth-token' : XTOKEN} url = 'https://%s%s'%(flashBlade,path) payload = params # Perform action response = requests.get(url, headers=hdrs, verify=False) if DEBUG_LEVEL != 0: print('URL', url) print('Response Status:', response.status_code) print('Text', response.text) print('Data', response.json) print('HTTP Header:', response.headers) jsonString = response.text jsonData = json.loads(jsonString) return(jsonData) def list_fssnaps(flashBlade,fsname,limit): data = '' params = json.dumps(data) if fsname == '': path = '/api/1.8/file-system-snapshots?sort=name&limit=%s'%(limit) else: path = '/api/1.8/file-system-snapshots?sort=created&names_or_sources=%s'%(fsname) # Perform action jsonData = get_url(flashBlade,path,params) r = str(jsonData) if VERBOSE_FLAG: print(BANNER) print(json.dumps(jsonData, sort_keys=False, indent=4)) # Count of returned rows res = len(jsonData['items']) if res == 0: print('No File System Snapshots found') else: print('number of snaps:', res) x = 0 print(BANNER) print('{0:40} {1:60} {2:20}'.format('File System', 'File System Snapshots', 'Created')) print(BANNER) while (x<res): # source = (jsonData['items'][x]['source']) name = (jsonData['items'][x]['name']) cdate = (jsonData['items'][x]['created']) c1 = str(cdate) epoch = int(c1[0:10]) created = time.strftime("%a, %d %b %Y %H:%M:%S %Z", time.localtime(epoch)) print('{0:40} {1:60} {2:20}'.format(source, name, created)) x = x + 1 def parsecl(): usage = 'usage: %prog [options]' version = '%prog ' + VERSION description = "This program returns Snapshots for given File System. Please contact <EMAIL> for any assistance." parser = OptionParser(usage=usage, version=version, description=description) parser.add_option('-d', '--debug', type = 'int', dest = 'DEBUG_LEVEL', default = 0, help = 'Debug level, used for HTTP debugging') parser.add_option('-l', '--limit', type = 'int', dest = 'limit', default = 999, help = 'Limit number of responses [default: %default]') parser.add_option('-p', '--password', action = 'store', type = 'string', dest = 'password', help = '<PASSWORD>') parser.add_option('-f', '--fsname', action = 'store', type = 'string', dest = 'fsname', default = '', help = 'File System name') parser.add_option('-s', '--server', action = 'store', type = 'string', dest = 'flashBlade', help = 'Pure FlashArray') parser.add_option('-t', '--token', action = 'store', type = 'string', dest = 'api_token', help = 'Pure Api Token') parser.add_option('-v', '--verbose', action = 'store_true', dest = 'VERBOSE_FLAG', default = False, help = 'Verbose [default: %default]') (options, args) = parser.parse_args() ''' print("Options:", options) print("Args:", args) ''' return(options) def main(): # Setup variables global DEBUG_LEVEL global VERBOSE_FLAG exit_code = 0 # Check for command line parameters options = parsecl() flashBlade = options.flashBlade limit = options.limit fsname = options.fsname api_token = options.api_token DEBUG_LEVEL = options.DEBUG_LEVEL VERBOSE_FLAG = options.VERBOSE_FLAG if DEBUG_LEVEL != 0: print('Flash Blade:', flashBlade) print('File System:', fsname) print('Limit:', limit) print('Api Token:', api_token) print('Debug Level:', DEBUG_LEVEL) print('Verbose Flag:', VERBOSE_FLAG) if flashBlade == None: sys.exit('Exiting: You must provide FlashBlade details') if api_token == None: sys.exit('Exiting: You must provide an API Token') print(BANNER) print(HEADER + ' - ' + flashBlade) print(strftime('%d/%m/%Y %H:%M:%S %Z', gmtime())) print(BANNER) # Create session create_session(flashBlade, api_token) list_fssnaps(flashBlade,fsname,limit) print(BANNER) print(strftime('%d/%m/%Y %H:%M:%S %Z', gmtime())) print(BANNER) sys.exit(exit_code) main()
en
0.520473
# Global Variables # Set-up HTTP header # Perform action # Set-up HTTP header # Perform action # Set-up HTTP header # Perform action # Perform action # Count of returned rows # print("Options:", options) print("Args:", args) # Setup variables # Check for command line parameters # Create session
2.447586
2
tests/registering_tests.py
varajala/flask-auth-server
1
6617355
<gh_stars>1-10 import microtest from auth_server.extensions import orm from auth_server.models import User import auth_server.security as security @microtest.setup def setup(app): global ctx ctx = app.app_context() ctx.push() @microtest.reset def reset(): User.query.delete() @microtest.cleanup def cleanup(): reset_database() ctx.pop() @microtest.test def test_typechecking(): #invalid_type assert microtest.raises( security.register_user, {'email': 10, 'password': '1', 'password_confirm': '2'}, TypeError ) #missing_arg assert microtest.raises( security.register_user, {'email': '1', 'password': '2'}, TypeError ) @microtest.test def test_valid_registering(): error = security.register_user(email='<EMAIL>', password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is None user = User.query.filter_by(email='<EMAIL>').first() assert user is not None assert not user.is_verified @microtest.test def test_registering_invalid_email(): error = security.register_user(email='asd', password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is not None assert len(User.query.all()) == 0 @microtest.test def test_registering_email_in_user(): USED_EMAIL = '<EMAIL>' user = User(email = USED_EMAIL, password_hash = '') orm.session.add(user) error = security.register_user(email=USED_EMAIL, password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is not None @microtest.test def test_registering_invalid_password(): error = security.register_user(email='<EMAIL>', password=' <PASSWORD>', password_confirm=' <PASSWORD>') assert error is not None assert len(User.query.all()) == 0 @microtest.test def test_registering_invalid_password_confirm(): error = security.register_user(email='<EMAIL>', password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is not None assert len(User.query.all()) == 0
import microtest from auth_server.extensions import orm from auth_server.models import User import auth_server.security as security @microtest.setup def setup(app): global ctx ctx = app.app_context() ctx.push() @microtest.reset def reset(): User.query.delete() @microtest.cleanup def cleanup(): reset_database() ctx.pop() @microtest.test def test_typechecking(): #invalid_type assert microtest.raises( security.register_user, {'email': 10, 'password': '1', 'password_confirm': '2'}, TypeError ) #missing_arg assert microtest.raises( security.register_user, {'email': '1', 'password': '2'}, TypeError ) @microtest.test def test_valid_registering(): error = security.register_user(email='<EMAIL>', password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is None user = User.query.filter_by(email='<EMAIL>').first() assert user is not None assert not user.is_verified @microtest.test def test_registering_invalid_email(): error = security.register_user(email='asd', password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is not None assert len(User.query.all()) == 0 @microtest.test def test_registering_email_in_user(): USED_EMAIL = '<EMAIL>' user = User(email = USED_EMAIL, password_hash = '') orm.session.add(user) error = security.register_user(email=USED_EMAIL, password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is not None @microtest.test def test_registering_invalid_password(): error = security.register_user(email='<EMAIL>', password=' <PASSWORD>', password_confirm=' <PASSWORD>') assert error is not None assert len(User.query.all()) == 0 @microtest.test def test_registering_invalid_password_confirm(): error = security.register_user(email='<EMAIL>', password='<PASSWORD>', password_confirm='<PASSWORD>') assert error is not None assert len(User.query.all()) == 0
zh
0.08791
#invalid_type #missing_arg
2.521115
3
k_maxpooling.py
evu/VDCNN
0
6617356
<reponame>evu/VDCNN<filename>k_maxpooling.py """Keras layer to extract k highest activations from a sequence.""" import tensorflow as tf class KMaxPooling(tf.keras.layers.Layer): """K-max pooling layer that extracts the k-highest activations from a sequence (2nd dimension).""" def __init__(self, k=1, sort=True, **kwargs): super().__init__(**kwargs) self.input_spec = tf.keras.layers.InputSpec(ndim=3) self.k = k self.sort = sort def get_config(self): super().get_config() def compute_output_shape(self, input_shape): return input_shape[0], self.k, input_shape[2] def call(self, inputs): # swap last two dimensions since top_k will be applied along the last dimension shifted_inputs = tf.transpose(inputs, [0, 2, 1]) # extract top_k, returns two tensors [values, indices] top_k = tf.math.top_k(shifted_inputs, k=self.k, sorted=self.sort)[0] # return flattened output return tf.transpose(top_k, [0, 2, 1])
"""Keras layer to extract k highest activations from a sequence.""" import tensorflow as tf class KMaxPooling(tf.keras.layers.Layer): """K-max pooling layer that extracts the k-highest activations from a sequence (2nd dimension).""" def __init__(self, k=1, sort=True, **kwargs): super().__init__(**kwargs) self.input_spec = tf.keras.layers.InputSpec(ndim=3) self.k = k self.sort = sort def get_config(self): super().get_config() def compute_output_shape(self, input_shape): return input_shape[0], self.k, input_shape[2] def call(self, inputs): # swap last two dimensions since top_k will be applied along the last dimension shifted_inputs = tf.transpose(inputs, [0, 2, 1]) # extract top_k, returns two tensors [values, indices] top_k = tf.math.top_k(shifted_inputs, k=self.k, sorted=self.sort)[0] # return flattened output return tf.transpose(top_k, [0, 2, 1])
en
0.824535
Keras layer to extract k highest activations from a sequence. K-max pooling layer that extracts the k-highest activations from a sequence (2nd dimension). # swap last two dimensions since top_k will be applied along the last dimension # extract top_k, returns two tensors [values, indices] # return flattened output
3.549996
4
iscc_generator/migrations/0004_rights_field.py
iscc/iscc-service-generator
2
6617357
# Generated by Django 4.0.4 on 2022-04-29 16:44 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ("iscc_generator", "0003_nft_fields"), ] operations = [ migrations.AddField( model_name="iscccode", name="rights", field=models.CharField( blank=True, default=None, help_text="Copyright notice", max_length=1024, null=True, verbose_name="rights", ), ), ]
# Generated by Django 4.0.4 on 2022-04-29 16:44 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ("iscc_generator", "0003_nft_fields"), ] operations = [ migrations.AddField( model_name="iscccode", name="rights", field=models.CharField( blank=True, default=None, help_text="Copyright notice", max_length=1024, null=True, verbose_name="rights", ), ), ]
en
0.878096
# Generated by Django 4.0.4 on 2022-04-29 16:44
1.649689
2
vas/shared/InstallationImages.py
spring-operator/vas-python-api
0
6617358
<reponame>spring-operator/vas-python-api<filename>vas/shared/InstallationImages.py<gh_stars>0 # vFabric Administration Server API # Copyright (c) 2012 VMware, Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from vas.shared.Deletable import Deletable from vas.shared.MutableCollection import MutableCollection from vas.shared.Resource import Resource class InstallationImages(MutableCollection): """A collection of installation images :ivar `vas.shared.Security.Security` security: The resource's security """ def __init__(self, client, location, installation_image_class): super(InstallationImages, self).__init__(client, location, 'installation-images', installation_image_class) def create(self, path, version): """Creates an installation image by uploading a file to the server and assigning it a version :param str path: The path of the file to upload :param str version: The installation image's version :rtype: :class:`vas.shared.InstallationImages.InstallationImage` :return: The new installation image """ return self._create_multipart(path, {'version': version}) class InstallationImage(Resource, Deletable): """A product binary, typically are .zip or .tar.gz file, that has been uploaded to the server. Once created, an installation image can then be used to create an installation on a group. :ivar `vas.shared.Installations.Installations` installations: The installations that have been created from the installation image :ivar `vas.shared.Security.Security` security: The resource's security :ivar int size: The installation image's size :ivar str version: The installation image's version """ @property def installations(self): self.__installations = self.__installations or self._create_resources_from_links('installation', self.__installation_class) return self.__installations @property def size(self): return self.__size @property def version(self): return self.__version def __init__(self, client, location, installation_class): super(InstallationImage, self).__init__(client, location) self.__installation_class = installation_class self.__size = self._details['size'] self.__version = self._details['version'] def reload(self): """Reloads the installation image's details from the server""" super(InstallationImage, self).reload() self.__installations = None def __str__(self): return "<{} version={} size={}>".format(self.__class__.__name__, self.__version, self.__size)
# vFabric Administration Server API # Copyright (c) 2012 VMware, Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from vas.shared.Deletable import Deletable from vas.shared.MutableCollection import MutableCollection from vas.shared.Resource import Resource class InstallationImages(MutableCollection): """A collection of installation images :ivar `vas.shared.Security.Security` security: The resource's security """ def __init__(self, client, location, installation_image_class): super(InstallationImages, self).__init__(client, location, 'installation-images', installation_image_class) def create(self, path, version): """Creates an installation image by uploading a file to the server and assigning it a version :param str path: The path of the file to upload :param str version: The installation image's version :rtype: :class:`vas.shared.InstallationImages.InstallationImage` :return: The new installation image """ return self._create_multipart(path, {'version': version}) class InstallationImage(Resource, Deletable): """A product binary, typically are .zip or .tar.gz file, that has been uploaded to the server. Once created, an installation image can then be used to create an installation on a group. :ivar `vas.shared.Installations.Installations` installations: The installations that have been created from the installation image :ivar `vas.shared.Security.Security` security: The resource's security :ivar int size: The installation image's size :ivar str version: The installation image's version """ @property def installations(self): self.__installations = self.__installations or self._create_resources_from_links('installation', self.__installation_class) return self.__installations @property def size(self): return self.__size @property def version(self): return self.__version def __init__(self, client, location, installation_class): super(InstallationImage, self).__init__(client, location) self.__installation_class = installation_class self.__size = self._details['size'] self.__version = self._details['version'] def reload(self): """Reloads the installation image's details from the server""" super(InstallationImage, self).reload() self.__installations = None def __str__(self): return "<{} version={} size={}>".format(self.__class__.__name__, self.__version, self.__size)
en
0.831124
# vFabric Administration Server API # Copyright (c) 2012 VMware, Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. A collection of installation images :ivar `vas.shared.Security.Security` security: The resource's security Creates an installation image by uploading a file to the server and assigning it a version :param str path: The path of the file to upload :param str version: The installation image's version :rtype: :class:`vas.shared.InstallationImages.InstallationImage` :return: The new installation image A product binary, typically are .zip or .tar.gz file, that has been uploaded to the server. Once created, an installation image can then be used to create an installation on a group. :ivar `vas.shared.Installations.Installations` installations: The installations that have been created from the installation image :ivar `vas.shared.Security.Security` security: The resource's security :ivar int size: The installation image's size :ivar str version: The installation image's version Reloads the installation image's details from the server
2.082409
2
src/semantickit/app/lsi_model.py
dhchenx/semantic-kit
1
6617359
<gh_stars>1-10 import logging logging.basicConfig(format='%(asctime)s : %(levelname)s : %(message)s', level=logging.INFO) from gensim import corpora def build_lsi_model(data_path="sentences.txt",stopwords_path="stopwords_english.txt",save_dict_path="model_dict.dict",save_corpus_path="model_corpus.mm"): documents = [] with open(data_path, encoding="utf-8") as file: documents = [l.strip() for l in file] stoplist = [] with open(stopwords_path, encoding="utf-8") as file: stoplist = [l.strip() for l in file] texts = [[word for word in document.lower().split() if word not in stoplist] for document in documents] # remove words that appear only once from collections import defaultdict frequency = defaultdict(int) for text in texts: for token in text: frequency[token] += 1 texts = [[token for token in text if frequency[token] > 1] for text in texts] from pprint import pprint # pretty-printer pprint(texts) dictionary = corpora.Dictionary(texts) dictionary.save(save_dict_path) # store the dictionary, for future reference print(dictionary) print(dictionary.token2id) # new_doc = "Human computer interaction" # new_vec = dictionary.doc2bow(new_doc.lower().split()) # print(new_vec) # the word "interaction" does not appear in the dictionary and is ignored corpus = [dictionary.doc2bow(text) for text in texts] corpora.MmCorpus.serialize(save_corpus_path, corpus) # store to disk, for later use print(corpus) # build_lsi_model()
import logging logging.basicConfig(format='%(asctime)s : %(levelname)s : %(message)s', level=logging.INFO) from gensim import corpora def build_lsi_model(data_path="sentences.txt",stopwords_path="stopwords_english.txt",save_dict_path="model_dict.dict",save_corpus_path="model_corpus.mm"): documents = [] with open(data_path, encoding="utf-8") as file: documents = [l.strip() for l in file] stoplist = [] with open(stopwords_path, encoding="utf-8") as file: stoplist = [l.strip() for l in file] texts = [[word for word in document.lower().split() if word not in stoplist] for document in documents] # remove words that appear only once from collections import defaultdict frequency = defaultdict(int) for text in texts: for token in text: frequency[token] += 1 texts = [[token for token in text if frequency[token] > 1] for text in texts] from pprint import pprint # pretty-printer pprint(texts) dictionary = corpora.Dictionary(texts) dictionary.save(save_dict_path) # store the dictionary, for future reference print(dictionary) print(dictionary.token2id) # new_doc = "Human computer interaction" # new_vec = dictionary.doc2bow(new_doc.lower().split()) # print(new_vec) # the word "interaction" does not appear in the dictionary and is ignored corpus = [dictionary.doc2bow(text) for text in texts] corpora.MmCorpus.serialize(save_corpus_path, corpus) # store to disk, for later use print(corpus) # build_lsi_model()
en
0.769021
# remove words that appear only once # pretty-printer # store the dictionary, for future reference # new_doc = "Human computer interaction" # new_vec = dictionary.doc2bow(new_doc.lower().split()) # print(new_vec) # the word "interaction" does not appear in the dictionary and is ignored # store to disk, for later use # build_lsi_model()
2.782916
3
def_square.py
BjornChrisnach/intro_to_python_UTA_Arlington
0
6617360
# Write a function that accepts a number as argument and returns # the square of the number. For example if the number passed to # the function is 5 then your function should return 25. # def my_square(input_number): # square = input_number**2 # return int(square) def my_square(x): result = x**2 return int(result)
# Write a function that accepts a number as argument and returns # the square of the number. For example if the number passed to # the function is 5 then your function should return 25. # def my_square(input_number): # square = input_number**2 # return int(square) def my_square(x): result = x**2 return int(result)
en
0.600839
# Write a function that accepts a number as argument and returns # the square of the number. For example if the number passed to # the function is 5 then your function should return 25. # def my_square(input_number): # square = input_number**2 # return int(square)
4.137019
4
Networks/web_crawler/stephjspider.py
mischiefsleep/Den-Core-2019
0
6617361
<filename>Networks/web_crawler/stephjspider.py #!/usr/bin/python3 # <NAME> # <EMAIL> # Simple Web Scraper, gets all links and images from a single webpage. import requests from parsel import Selector import os import time start = time.time() ScanDir = '/tmp/Web_Crawler' # Check for directory and create one for output of scan if not os.path.exists(ScanDir): os.mkdir(ScanDir) print("Directory" , ScanDir , " created.") else: print("Directory" , ScanDir, " already exists!") # Get input for website we would like to crawl website = input("What site are we crawling? ") # GET request to the site response = requests.get(website) ## Setup for scraping tool # "response.txt" contain all web page content selector = Selector(response.text) # Extracting href attribute from anchor tag <a href="*"> href_links = selector.xpath('//a/@href').getall() #Extracting img src attribute from img tag <img src="*"> image_links = selector.xpath('//img/@src').getall() # Print out the web page links in order, separated by line print('***************************** Web Page Links ************************************') print(*href_links, sep = "\n") print(*href_links, file=open('/tmp/Web_Crawler/Web_links.txt', 'w')) print('*****************************************************************') # Print image links from website, separated by line print('***************************** Image Links ************************************') print(*image_links, sep = "\n") print(*image_links, file=open('/tmp/Web_Crawler/Image_links.txt', 'w')) print('*****************************************************************') # Amount of time the spider took to crawl the site. end = time.time() print("Time taken in seconds : ", (end-start))
<filename>Networks/web_crawler/stephjspider.py #!/usr/bin/python3 # <NAME> # <EMAIL> # Simple Web Scraper, gets all links and images from a single webpage. import requests from parsel import Selector import os import time start = time.time() ScanDir = '/tmp/Web_Crawler' # Check for directory and create one for output of scan if not os.path.exists(ScanDir): os.mkdir(ScanDir) print("Directory" , ScanDir , " created.") else: print("Directory" , ScanDir, " already exists!") # Get input for website we would like to crawl website = input("What site are we crawling? ") # GET request to the site response = requests.get(website) ## Setup for scraping tool # "response.txt" contain all web page content selector = Selector(response.text) # Extracting href attribute from anchor tag <a href="*"> href_links = selector.xpath('//a/@href').getall() #Extracting img src attribute from img tag <img src="*"> image_links = selector.xpath('//img/@src').getall() # Print out the web page links in order, separated by line print('***************************** Web Page Links ************************************') print(*href_links, sep = "\n") print(*href_links, file=open('/tmp/Web_Crawler/Web_links.txt', 'w')) print('*****************************************************************') # Print image links from website, separated by line print('***************************** Image Links ************************************') print(*image_links, sep = "\n") print(*image_links, file=open('/tmp/Web_Crawler/Image_links.txt', 'w')) print('*****************************************************************') # Amount of time the spider took to crawl the site. end = time.time() print("Time taken in seconds : ", (end-start))
en
0.827264
#!/usr/bin/python3 # <NAME> # <EMAIL> # Simple Web Scraper, gets all links and images from a single webpage. # Check for directory and create one for output of scan # Get input for website we would like to crawl # GET request to the site ## Setup for scraping tool # "response.txt" contain all web page content # Extracting href attribute from anchor tag <a href="*"> #Extracting img src attribute from img tag <img src="*"> # Print out the web page links in order, separated by line # Print image links from website, separated by line # Amount of time the spider took to crawl the site.
3.552307
4
examples/sts_b_web.py
anwar1103/semantic-text-similarit
167
6617362
<filename>examples/sts_b_web.py<gh_stars>100-1000 from semantic_text_similarity.models import WebBertSimilarity from semantic_text_similarity.data import load_sts_b_data from scipy.stats import pearsonr train, dev, test = load_sts_b_data() model = WebBertSimilarity() predictions = model.predict(dev) print(pearsonr([instance["similarity"] for instance in dev], predictions))
<filename>examples/sts_b_web.py<gh_stars>100-1000 from semantic_text_similarity.models import WebBertSimilarity from semantic_text_similarity.data import load_sts_b_data from scipy.stats import pearsonr train, dev, test = load_sts_b_data() model = WebBertSimilarity() predictions = model.predict(dev) print(pearsonr([instance["similarity"] for instance in dev], predictions))
none
1
2.246262
2
tia/db_curators/_exmpl_h5fileRW.py
jmakov/market_tia
1
6617363
from tables import * class struct(IsDescription): priceAvg = Float64Col() #writing filename = "db/asd.h5" fl = Filters(complevel=9, complib='blosc', shuffle=1) #enable compression #from http://pytables.github.com/usersguide/libref/helper_classes.html#tables.Filters.complevel h5file = openFile(filename, mode="w", title="Mt.GoxMarketDB", filters= fl)#, filters=fl) group = h5file.createGroup("/", 'MtGox', 'Mt.Gox') table = h5file.createTable(group, 'ticker', struct, "Readout example") #create table for chans row_table = table.row for i in xrange(1000000): row_table['priceAvg'] = i row_table.append() table.flush() h5file.close() #reading h5file = openFile(filename, mode="r", filters= fl) for i in h5file: print i mytable = h5file.root.MtGox.ticker for i in mytable.iterrows(): print i["priceAvg"] h5file.close()
from tables import * class struct(IsDescription): priceAvg = Float64Col() #writing filename = "db/asd.h5" fl = Filters(complevel=9, complib='blosc', shuffle=1) #enable compression #from http://pytables.github.com/usersguide/libref/helper_classes.html#tables.Filters.complevel h5file = openFile(filename, mode="w", title="Mt.GoxMarketDB", filters= fl)#, filters=fl) group = h5file.createGroup("/", 'MtGox', 'Mt.Gox') table = h5file.createTable(group, 'ticker', struct, "Readout example") #create table for chans row_table = table.row for i in xrange(1000000): row_table['priceAvg'] = i row_table.append() table.flush() h5file.close() #reading h5file = openFile(filename, mode="r", filters= fl) for i in h5file: print i mytable = h5file.root.MtGox.ticker for i in mytable.iterrows(): print i["priceAvg"] h5file.close()
en
0.336617
#writing #enable compression #from http://pytables.github.com/usersguide/libref/helper_classes.html#tables.Filters.complevel #, filters=fl) #create table for chans #reading
2.756556
3
CYBER_SLAP.py
cyberninjaz/a-lot-of-stuff
0
6617364
<gh_stars>0 from random import randint class Player(): hp = 1000 energy = 100 name = None def __init__ (self, name): self.name = name def isAlive(self): return self.hp > 0 and self.energy > 0 p1 = Player('<NAME>') print('p1.name') p2 = Player('<NAME>') print(f'Hi {p2.name}') class Attack(): name = None mindamage = None maxdamage = None energy = None hpheal = None energyheal = None def __init__ (self, name, mnD, mxD, e, hh, eh): self.name = name self.mindamage = mnD self.maxdamage = mxD self.energy = e self.hpheal = hh self.energyheal = eh def use(self, user, target): target.hp -= randint(self.mindamage, self.maxdamage) user.energy -= self.energy user.hp += self.hpheal user.energy += self.energyheal print('BOOM!!!') def printStats(self): print(f'{self.name}: Damage: {self.mindamage}-{self.maxdamage}, Energy: -{self.energy}, Health Heal: {self.hpheal}, Energy Heal: {self.energyheal}') dogecoin = Attack('Dogecoin', 200, 300, 30, 0, 0) bitcoin = Attack('Bitcoin', 200, 200, 20, 0, 0) ethereum = Attack('Ethereum', 150, 150, 10, 0, 0) litecoin = Attack('Litecoin', 100, 150, 5, 0, 0) medicine = Attack('Medicine', 0, 0, 0, 100, 0) food = Attack('Food', 0, 0, 0, 0, 10) moves = [dogecoin, bitcoin, ethereum, litecoin, medicine, food] def options(): for x in moves: x.printStats() while p1.hp > 0 and p2.hp > 0 and p1.energy > 0 and p2.energy > 0: options() move = input('Move: ') for x in moves: if move == x.name: x.use(p1, p2) break print(f'Player 2 health: {p2.hp}') print(f'Player 1 energy: {p1.energy}') options() move = input('Move: ') for x in moves: if move == x.name: x.use(p2, p1) break print(f'Player 1 health: {p1.hp}') print(f'Player 2 energy: {p2.energy}') if p1.energy == 0 or p1.hp == 0: print('PLAYER 2 WON!!!') elif p2.energy == 0 or p2.hp == 0: print('PLAYER 1 WON!!!')
from random import randint class Player(): hp = 1000 energy = 100 name = None def __init__ (self, name): self.name = name def isAlive(self): return self.hp > 0 and self.energy > 0 p1 = Player('<NAME>') print('p1.name') p2 = Player('<NAME>') print(f'Hi {p2.name}') class Attack(): name = None mindamage = None maxdamage = None energy = None hpheal = None energyheal = None def __init__ (self, name, mnD, mxD, e, hh, eh): self.name = name self.mindamage = mnD self.maxdamage = mxD self.energy = e self.hpheal = hh self.energyheal = eh def use(self, user, target): target.hp -= randint(self.mindamage, self.maxdamage) user.energy -= self.energy user.hp += self.hpheal user.energy += self.energyheal print('BOOM!!!') def printStats(self): print(f'{self.name}: Damage: {self.mindamage}-{self.maxdamage}, Energy: -{self.energy}, Health Heal: {self.hpheal}, Energy Heal: {self.energyheal}') dogecoin = Attack('Dogecoin', 200, 300, 30, 0, 0) bitcoin = Attack('Bitcoin', 200, 200, 20, 0, 0) ethereum = Attack('Ethereum', 150, 150, 10, 0, 0) litecoin = Attack('Litecoin', 100, 150, 5, 0, 0) medicine = Attack('Medicine', 0, 0, 0, 100, 0) food = Attack('Food', 0, 0, 0, 0, 10) moves = [dogecoin, bitcoin, ethereum, litecoin, medicine, food] def options(): for x in moves: x.printStats() while p1.hp > 0 and p2.hp > 0 and p1.energy > 0 and p2.energy > 0: options() move = input('Move: ') for x in moves: if move == x.name: x.use(p1, p2) break print(f'Player 2 health: {p2.hp}') print(f'Player 1 energy: {p1.energy}') options() move = input('Move: ') for x in moves: if move == x.name: x.use(p2, p1) break print(f'Player 1 health: {p1.hp}') print(f'Player 2 energy: {p2.energy}') if p1.energy == 0 or p1.hp == 0: print('PLAYER 2 WON!!!') elif p2.energy == 0 or p2.hp == 0: print('PLAYER 1 WON!!!')
none
1
3.279297
3
net_models/models/__init__.py
mihudec/netcm
0
6617365
<gh_stars>0 import inspect from net_models.models.BaseModels import * from net_models.models.services import * from net_models.models.interfaces import * from net_models.models.routing import * models_map = {k:v for k, v in dict(globals()).items() if inspect.isclass(v) and issubclass(v, BaseNetModel)}
import inspect from net_models.models.BaseModels import * from net_models.models.services import * from net_models.models.interfaces import * from net_models.models.routing import * models_map = {k:v for k, v in dict(globals()).items() if inspect.isclass(v) and issubclass(v, BaseNetModel)}
none
1
1.767454
2
Server/app.py
orlandoamorim/Swift-Keylogger
0
6617366
from flask import Flask from flask import request app = Flask(__name__) fob=open('log.txt','a') @app.route('/keylogger', methods=['POST']) def receive_keys(): if request.method == "POST": if request.is_json: data = request.get_json() fob.write(data['input']) print(data['input']) fob.write('\n') return "Ok", 200 app.run()
from flask import Flask from flask import request app = Flask(__name__) fob=open('log.txt','a') @app.route('/keylogger', methods=['POST']) def receive_keys(): if request.method == "POST": if request.is_json: data = request.get_json() fob.write(data['input']) print(data['input']) fob.write('\n') return "Ok", 200 app.run()
none
1
2.709582
3
tests/lib/cytest/bootstrap.py
andyjost/Sprite
1
6617367
''' Defines in pure ICurry a few simple modules designed for system testing. ''' from curry.icurry import * from curry.icurry.json import load from curry import unboxed # An arbitrary choice id. _cid = 527 cid = unboxed(_cid) def blk(expr): return IBlock(vardecls=[], assigns=[], stmt=expr) def retbody(expr): return IFuncBody(blk(IReturn(expr))) def getbootstrap(): return IModule( name='bootstrap' , imports=['Prelude'] , types=[ IType( name='bootstrap.NUM' , constructors=[ IConstructor('bootstrap.N', 0) # Nullary , IConstructor('bootstrap.M', 0) # A distinct nullary, to test choices. , IConstructor('bootstrap.U', 1) # Unary , IConstructor('bootstrap.B', 2) # Binary ] ) ] , functions=[ IFunction('bootstrap.ZN', 0, body=retbody(ICCall('bootstrap.N'))) , IFunction('bootstrap.ZF', 0, body=retbody(ICCall('Prelude._Failure'))) , IFunction('bootstrap.ZQ', 0, body=retbody( ICCall('Prelude._Choice', [_cid, ICCall('bootstrap.N'), ICCall('bootstrap.M')]) )) # ^^^ # Not correctly typed, but three arguments are needed here. , IFunction('bootstrap.ZW', 0, body=retbody(ICCall('Prelude._Fwd', [ICCall('bootstrap.N')]))) # Evaluates its argument and then returns a FWD node refering to it. , IFunction('bootstrap.Z' , 1, body=IFuncBody(IBlock( vardecls=[IVarDecl(1)] , assigns=[IVarAssign(1, IVarAccess(0, path=[0]))] , stmt=ICaseCons( 1 , branches=[ IConsBranch("bootstrap.N", 0, blk(IReturn(IVar(1)))) , IConsBranch("bootstrap.M", 0, blk(IReturn(IVar(1)))) , IConsBranch("bootstrap.U", 1, blk(IReturn(IFCall("Prelude.failed")))) , IConsBranch("bootstrap.B", 2, blk(IReturn(IFCall("Prelude.failed")))) ] ) ))) ] ) def getlist(): return IModule( name='mylist', imports=['Prelude'], functions=[] , types=[ IType( name='mylist.List' , constructors=[ IConstructor('mylist.Cons', 2) , IConstructor('mylist.Nil', 0) ] ) ] ) def getx(): return IModule( name='X', imports=['Prelude'], functions=[] , types=[ IType( name='X.X' , constructors=[IConstructor('X.X', 1)] ) ] ) def getexample(): return load('data/json/example.json')
''' Defines in pure ICurry a few simple modules designed for system testing. ''' from curry.icurry import * from curry.icurry.json import load from curry import unboxed # An arbitrary choice id. _cid = 527 cid = unboxed(_cid) def blk(expr): return IBlock(vardecls=[], assigns=[], stmt=expr) def retbody(expr): return IFuncBody(blk(IReturn(expr))) def getbootstrap(): return IModule( name='bootstrap' , imports=['Prelude'] , types=[ IType( name='bootstrap.NUM' , constructors=[ IConstructor('bootstrap.N', 0) # Nullary , IConstructor('bootstrap.M', 0) # A distinct nullary, to test choices. , IConstructor('bootstrap.U', 1) # Unary , IConstructor('bootstrap.B', 2) # Binary ] ) ] , functions=[ IFunction('bootstrap.ZN', 0, body=retbody(ICCall('bootstrap.N'))) , IFunction('bootstrap.ZF', 0, body=retbody(ICCall('Prelude._Failure'))) , IFunction('bootstrap.ZQ', 0, body=retbody( ICCall('Prelude._Choice', [_cid, ICCall('bootstrap.N'), ICCall('bootstrap.M')]) )) # ^^^ # Not correctly typed, but three arguments are needed here. , IFunction('bootstrap.ZW', 0, body=retbody(ICCall('Prelude._Fwd', [ICCall('bootstrap.N')]))) # Evaluates its argument and then returns a FWD node refering to it. , IFunction('bootstrap.Z' , 1, body=IFuncBody(IBlock( vardecls=[IVarDecl(1)] , assigns=[IVarAssign(1, IVarAccess(0, path=[0]))] , stmt=ICaseCons( 1 , branches=[ IConsBranch("bootstrap.N", 0, blk(IReturn(IVar(1)))) , IConsBranch("bootstrap.M", 0, blk(IReturn(IVar(1)))) , IConsBranch("bootstrap.U", 1, blk(IReturn(IFCall("Prelude.failed")))) , IConsBranch("bootstrap.B", 2, blk(IReturn(IFCall("Prelude.failed")))) ] ) ))) ] ) def getlist(): return IModule( name='mylist', imports=['Prelude'], functions=[] , types=[ IType( name='mylist.List' , constructors=[ IConstructor('mylist.Cons', 2) , IConstructor('mylist.Nil', 0) ] ) ] ) def getx(): return IModule( name='X', imports=['Prelude'], functions=[] , types=[ IType( name='X.X' , constructors=[IConstructor('X.X', 1)] ) ] ) def getexample(): return load('data/json/example.json')
en
0.868464
Defines in pure ICurry a few simple modules designed for system testing. # An arbitrary choice id. # Nullary # A distinct nullary, to test choices. # Unary # Binary # ^^^ # Not correctly typed, but three arguments are needed here. # Evaluates its argument and then returns a FWD node refering to it.
2.497217
2
optaux/helper_functions/characterize_auxotrophs.py
coltonlloyd/OptAux
1
6617368
import cobra from cobra.flux_analysis.parsimonious import optimize_minimal_flux import numpy as np def get_auxotrophic_mets_per_ko(cons_model, KOs, growth_rate=.1): metabolite_list = [] model = cons_model.copy() for r in KOs: model.reactions.get_by_id(r).knock_out() if model.optimize().f > growth_rate: return [] solver = cobra.solvers.solver_dict['gurobi'] lp = solver.create_problem(model) for rxn in model.reactions.query('EX_'): old_bounds = (rxn.lower_bound, rxn.upper_bound) index = model.reactions.index(rxn) solver.change_variable_bounds(lp, index, -10., old_bounds[1]) solver.solve_problem(lp) # get the status and growth rate status = solver.get_status(lp) # reset the problem solver.change_variable_bounds(lp, index, old_bounds[0], old_bounds[1]) f = solver.get_objective_value(lp) if status == "optimal" else 0. if f > .1: metabolite_list.append(rxn.id) return metabolite_list def get_avg_flux_required(cons_model, KOs, aux_metabolite_list): fluxes = [] model = cons_model.copy() biomass = list(model.objective.keys())[0] for r2 in KOs: model.reactions.get_by_id(r2).knock_out() for r in aux_metabolite_list: if r == 'EX_h2o_e': continue r_obj = model.reactions.get_by_id(r) model.objective = biomass r_obj.lower_bound = -10 # sol = model.optimize() biomass.lower_bound = .1 biomass.upper_bound = .1 model.objective = r_obj sol2 = model.optimize() try: print(r, sol2.x_dict[r]) fluxes.append(sol2.x_dict[r]) except: print(r, KOs, 'ISSUE') r_obj.lower_bound = 0. biomass.lower_bound = 0. biomass.upper_bound = 1000. if len(fluxes) > 0: return np.array(fluxes).mean() else: return None def get_blocked_biomass(cons_model, KOs): blocked = [] model = cons_model.copy() biomass = list(model.objective.keys())[0] for r in KOs: model.reactions.get_by_id(r).knock_out() for metabolite in biomass.reactants: demand = cobra.Reaction('DM_' + metabolite.id) demand.add_metabolites({metabolite: -1}) model.add_reaction(demand) model.change_objective(demand) sol2 = model.optimize() if sol2.f < .1: blocked.append(metabolite.id) return blocked def gene_names_per_kos(model, KOs): gene_names = [] for ko in KOs: print(model.reactions.get_by_id(ko).gene_name_reaction_rule) gene_names.append( model.reactions.get_by_id(ko).gene_name_reaction_rule) return gene_names def genes_per_kos(model, KOs): genes = [] for ko in KOs: genes.append(model.reactions.get_by_id(ko).gene_reaction_rule) return genes def to_string(list): return ', '.join(list) def and_join_strings(list): return ' & '.join(list) def id_to_name(model, ids): names = [] for i in ids: if i.startswith('EX_'): names.append(model.reactions.get_by_id(i).name) else: names.append(model.metabolites.get_by_id(i).name) return names
import cobra from cobra.flux_analysis.parsimonious import optimize_minimal_flux import numpy as np def get_auxotrophic_mets_per_ko(cons_model, KOs, growth_rate=.1): metabolite_list = [] model = cons_model.copy() for r in KOs: model.reactions.get_by_id(r).knock_out() if model.optimize().f > growth_rate: return [] solver = cobra.solvers.solver_dict['gurobi'] lp = solver.create_problem(model) for rxn in model.reactions.query('EX_'): old_bounds = (rxn.lower_bound, rxn.upper_bound) index = model.reactions.index(rxn) solver.change_variable_bounds(lp, index, -10., old_bounds[1]) solver.solve_problem(lp) # get the status and growth rate status = solver.get_status(lp) # reset the problem solver.change_variable_bounds(lp, index, old_bounds[0], old_bounds[1]) f = solver.get_objective_value(lp) if status == "optimal" else 0. if f > .1: metabolite_list.append(rxn.id) return metabolite_list def get_avg_flux_required(cons_model, KOs, aux_metabolite_list): fluxes = [] model = cons_model.copy() biomass = list(model.objective.keys())[0] for r2 in KOs: model.reactions.get_by_id(r2).knock_out() for r in aux_metabolite_list: if r == 'EX_h2o_e': continue r_obj = model.reactions.get_by_id(r) model.objective = biomass r_obj.lower_bound = -10 # sol = model.optimize() biomass.lower_bound = .1 biomass.upper_bound = .1 model.objective = r_obj sol2 = model.optimize() try: print(r, sol2.x_dict[r]) fluxes.append(sol2.x_dict[r]) except: print(r, KOs, 'ISSUE') r_obj.lower_bound = 0. biomass.lower_bound = 0. biomass.upper_bound = 1000. if len(fluxes) > 0: return np.array(fluxes).mean() else: return None def get_blocked_biomass(cons_model, KOs): blocked = [] model = cons_model.copy() biomass = list(model.objective.keys())[0] for r in KOs: model.reactions.get_by_id(r).knock_out() for metabolite in biomass.reactants: demand = cobra.Reaction('DM_' + metabolite.id) demand.add_metabolites({metabolite: -1}) model.add_reaction(demand) model.change_objective(demand) sol2 = model.optimize() if sol2.f < .1: blocked.append(metabolite.id) return blocked def gene_names_per_kos(model, KOs): gene_names = [] for ko in KOs: print(model.reactions.get_by_id(ko).gene_name_reaction_rule) gene_names.append( model.reactions.get_by_id(ko).gene_name_reaction_rule) return gene_names def genes_per_kos(model, KOs): genes = [] for ko in KOs: genes.append(model.reactions.get_by_id(ko).gene_reaction_rule) return genes def to_string(list): return ', '.join(list) def and_join_strings(list): return ' & '.join(list) def id_to_name(model, ids): names = [] for i in ids: if i.startswith('EX_'): names.append(model.reactions.get_by_id(i).name) else: names.append(model.metabolites.get_by_id(i).name) return names
en
0.711163
# get the status and growth rate # reset the problem # sol = model.optimize()
2.178311
2
nice/utils/optimization/heuristic.py
DBrughmans/NICE
17
6617369
from abc import ABC,abstractmethod from nice.utils.optimization.reward import * import numpy as np class optimization(ABC): @abstractmethod def optimize(self): pass class best_first(optimization): def __init__(self,data,reward_function:RewardFunction): self.reward_function = reward_function self.data = data def optimize(self,NN): CF_candidate = self.data.X.copy() stop = False while stop == False: diff = np.where(CF_candidate != NN)[1] X_prune = np.tile(CF_candidate, (len(diff), 1)) for r, c in enumerate(diff): X_prune[r, c] = NN[0, c] CF_candidate = self.reward_function.calculate_reward(X_prune,CF_candidate) if self.data.predict_fn(CF_candidate).argmax() in self.data.target_class: return CF_candidate
from abc import ABC,abstractmethod from nice.utils.optimization.reward import * import numpy as np class optimization(ABC): @abstractmethod def optimize(self): pass class best_first(optimization): def __init__(self,data,reward_function:RewardFunction): self.reward_function = reward_function self.data = data def optimize(self,NN): CF_candidate = self.data.X.copy() stop = False while stop == False: diff = np.where(CF_candidate != NN)[1] X_prune = np.tile(CF_candidate, (len(diff), 1)) for r, c in enumerate(diff): X_prune[r, c] = NN[0, c] CF_candidate = self.reward_function.calculate_reward(X_prune,CF_candidate) if self.data.predict_fn(CF_candidate).argmax() in self.data.target_class: return CF_candidate
none
1
3.246669
3
pyoptix/matrix4x4.py
juhyeonkim95/PyOptiX
0
6617370
import math import numpy as np class Matrix4x4: def __init__(self): self.matrix = np.eye(4, dtype=np.float32) @staticmethod def from_basis(u, v, w, c): matrix = Matrix4x4() for i in range(3): matrix.matrix[i, 0] = u[i] matrix.matrix[i, 1] = v[i] matrix.matrix[i, 2] = w[i] matrix.matrix[i, 3] = c[i] return matrix def inverse(self): ret = Matrix4x4() ret.matrix[0:3, 0:3] = self.matrix[0:3, 0:3].transpose() ret.matrix[0:3, 3] = -ret.matrix[0:3, 0:3].dot(self.matrix[0:3, 3]) return ret def to_parameters(self, as_degree=False): x, y, z = self.matrix[0:3, 3] a, b, c = self.mat2euler(self.matrix[0:3, 0:3]) if as_degree: a = math.degrees(a) b = math.degrees(b) c = math.degrees(c) ret = [x, y, z, a, b, c] return np.array(ret) @staticmethod def mat2euler(M, cy_thresh=None): M = np.asarray(M) if cy_thresh is None: try: cy_thresh = np.finfo(M.dtype).eps * 4 except ValueError: cy_thresh = np.finfo(float).eps * 4.0 r11, r12, r13, r21, r22, r23, r31, r32, r33 = M.flat cy = math.sqrt(r33 * r33 + r23 * r23) if cy > cy_thresh: z = math.atan2(-r12, r11) y = math.atan2(r13, cy) x = math.atan2(-r23, r33) else: z = math.atan2(r21, r22) y = math.atan2(r13, cy) x = 0.0 return x, y, z
import math import numpy as np class Matrix4x4: def __init__(self): self.matrix = np.eye(4, dtype=np.float32) @staticmethod def from_basis(u, v, w, c): matrix = Matrix4x4() for i in range(3): matrix.matrix[i, 0] = u[i] matrix.matrix[i, 1] = v[i] matrix.matrix[i, 2] = w[i] matrix.matrix[i, 3] = c[i] return matrix def inverse(self): ret = Matrix4x4() ret.matrix[0:3, 0:3] = self.matrix[0:3, 0:3].transpose() ret.matrix[0:3, 3] = -ret.matrix[0:3, 0:3].dot(self.matrix[0:3, 3]) return ret def to_parameters(self, as_degree=False): x, y, z = self.matrix[0:3, 3] a, b, c = self.mat2euler(self.matrix[0:3, 0:3]) if as_degree: a = math.degrees(a) b = math.degrees(b) c = math.degrees(c) ret = [x, y, z, a, b, c] return np.array(ret) @staticmethod def mat2euler(M, cy_thresh=None): M = np.asarray(M) if cy_thresh is None: try: cy_thresh = np.finfo(M.dtype).eps * 4 except ValueError: cy_thresh = np.finfo(float).eps * 4.0 r11, r12, r13, r21, r22, r23, r31, r32, r33 = M.flat cy = math.sqrt(r33 * r33 + r23 * r23) if cy > cy_thresh: z = math.atan2(-r12, r11) y = math.atan2(r13, cy) x = math.atan2(-r23, r33) else: z = math.atan2(r21, r22) y = math.atan2(r13, cy) x = 0.0 return x, y, z
none
1
2.581553
3
models/train_classifier.py
rojandhimal/Disaster_Response_Pipelines
1
6617371
<reponame>rojandhimal/Disaster_Response_Pipelines<filename>models/train_classifier.py # import libraries import nltk import numpy as np import sqlite3 nltk.download(['punkt', 'wordnet']) from nltk.tokenize import word_tokenize, RegexpTokenizer from nltk.stem import WordNetLemmatizer import pandas as pd from sqlalchemy import create_engine import re from sklearn.pipeline import Pipeline from sklearn.ensemble import RandomForestClassifier from sklearn.multioutput import MultiOutputClassifier from sklearn.model_selection import train_test_split, GridSearchCV from sklearn.feature_extraction.text import CountVectorizer, TfidfTransformer from sklearn.metrics import precision_recall_fscore_support, classification_report from sklearn.tree import DecisionTreeClassifier import pickle import os import sys def load_data(database_filepath): """ This function load data from database from given database_filepath. process and slit the data as label and features (x ,y, categoory_name) Input args: Database file path Output : returnd seperated feature and labels (X,y,categoory_name) """ table_name = "Disaster" engine = create_engine(f"sqlite:///{database_filepath}") df = pd.read_sql_table(table_name,engine) # drop columns with null df = df[~(df.isnull().any(axis=1))|((df.original.isnull())&~(df.offer.isnull()))] X = df['message'] y = df.iloc[:, 4:] category_names = list(df.columns[4:]) return X,y,category_names def tokenize(text): """ This function take text and return token of words Input args: Text Output: List of clean token """ url_regex = 'http[s]?://(?:[a-zA-Z]|[0-9]|[$-_@.&+]|[!*\(\),]|(?:%[0-9a-fA-F][0-9a-fA-F]))+' detected_urls = re.findall(url_regex, text) for url in detected_urls: text = text.replace(url, "urlplaceholder") tokens = word_tokenize(text) lemmatizer = WordNetLemmatizer() clean_tokens = [] for tok in tokens: clean_tok = lemmatizer.lemmatize(tok).lower().strip() clean_tokens.append(clean_tok) return clean_tokens def build_model(): """ Build Multiclass Randomforest model Create pipeline Hypertune model Input : N/A Output: returns Hypertuned model """ pipeline = Pipeline([ ('vect', CountVectorizer(tokenizer=tokenize)), ('tfidf', TfidfTransformer()), ('clf', MultiOutputClassifier(RandomForestClassifier())) ]) parameters = {'clf__estimator__max_depth': [10, 50, None], 'clf__estimator__min_samples_leaf':[2, 5, 10]} cv = GridSearchCV(pipeline, param_grid=parameters) return cv def evaluate_model(model, X_test, Y_test, category_names): ''' This function evaluate the model and return the classification and accurancy score. Inputs: Model, X_test, y_test, Catgegory_names Outputs: Prints the Classification report & Accuracy Score ''' Y_pred = model.predict(X_test) # print scores print(classification_report(Y_test.iloc[:,1:].values, np.array([x[1:] for x in Y_pred]), target_names=category_names)) def save_model(model, model_filepath): ''' Function to save the model Input: model and the file path to save the model Output: save the model as pickle file in the give filepath ''' pickle.dump(model, open(model_filepath, 'wb')) def main(): if len(sys.argv) == 3: database_filepath, model_filepath = sys.argv[1:] print('Loading data...\n DATABASE: {}'.format(database_filepath)) X, Y, category_names = load_data(database_filepath) X_train, X_test, Y_train, Y_test = train_test_split(X, Y, test_size=0.2) print('Building model...') model = build_model() print('Training model...') model.fit(X_train.as_matrix(), Y_train.as_matrix()) print('Evaluating model...') evaluate_model(model, X_test, Y_test, category_names) ###WILL NEED TO CXLEAN THIS UP print('TYPE OF MODEL') print(type(model)) print('Saving model...\n MODEL: {}'.format(model_filepath)) save_model(model, model_filepath) print('Trained model saved!') else: print('Please provide the filepath of the disaster messages database '\ 'as the first argument and the filepath of the pickle file to '\ 'save the model to as the second argument. \n\nExample: python '\ 'train_classifier.py ../data/DisasterResponse.db classifier.pkl') if __name__ == '__main__': main()
# import libraries import nltk import numpy as np import sqlite3 nltk.download(['punkt', 'wordnet']) from nltk.tokenize import word_tokenize, RegexpTokenizer from nltk.stem import WordNetLemmatizer import pandas as pd from sqlalchemy import create_engine import re from sklearn.pipeline import Pipeline from sklearn.ensemble import RandomForestClassifier from sklearn.multioutput import MultiOutputClassifier from sklearn.model_selection import train_test_split, GridSearchCV from sklearn.feature_extraction.text import CountVectorizer, TfidfTransformer from sklearn.metrics import precision_recall_fscore_support, classification_report from sklearn.tree import DecisionTreeClassifier import pickle import os import sys def load_data(database_filepath): """ This function load data from database from given database_filepath. process and slit the data as label and features (x ,y, categoory_name) Input args: Database file path Output : returnd seperated feature and labels (X,y,categoory_name) """ table_name = "Disaster" engine = create_engine(f"sqlite:///{database_filepath}") df = pd.read_sql_table(table_name,engine) # drop columns with null df = df[~(df.isnull().any(axis=1))|((df.original.isnull())&~(df.offer.isnull()))] X = df['message'] y = df.iloc[:, 4:] category_names = list(df.columns[4:]) return X,y,category_names def tokenize(text): """ This function take text and return token of words Input args: Text Output: List of clean token """ url_regex = 'http[s]?://(?:[a-zA-Z]|[0-9]|[$-_@.&+]|[!*\(\),]|(?:%[0-9a-fA-F][0-9a-fA-F]))+' detected_urls = re.findall(url_regex, text) for url in detected_urls: text = text.replace(url, "urlplaceholder") tokens = word_tokenize(text) lemmatizer = WordNetLemmatizer() clean_tokens = [] for tok in tokens: clean_tok = lemmatizer.lemmatize(tok).lower().strip() clean_tokens.append(clean_tok) return clean_tokens def build_model(): """ Build Multiclass Randomforest model Create pipeline Hypertune model Input : N/A Output: returns Hypertuned model """ pipeline = Pipeline([ ('vect', CountVectorizer(tokenizer=tokenize)), ('tfidf', TfidfTransformer()), ('clf', MultiOutputClassifier(RandomForestClassifier())) ]) parameters = {'clf__estimator__max_depth': [10, 50, None], 'clf__estimator__min_samples_leaf':[2, 5, 10]} cv = GridSearchCV(pipeline, param_grid=parameters) return cv def evaluate_model(model, X_test, Y_test, category_names): ''' This function evaluate the model and return the classification and accurancy score. Inputs: Model, X_test, y_test, Catgegory_names Outputs: Prints the Classification report & Accuracy Score ''' Y_pred = model.predict(X_test) # print scores print(classification_report(Y_test.iloc[:,1:].values, np.array([x[1:] for x in Y_pred]), target_names=category_names)) def save_model(model, model_filepath): ''' Function to save the model Input: model and the file path to save the model Output: save the model as pickle file in the give filepath ''' pickle.dump(model, open(model_filepath, 'wb')) def main(): if len(sys.argv) == 3: database_filepath, model_filepath = sys.argv[1:] print('Loading data...\n DATABASE: {}'.format(database_filepath)) X, Y, category_names = load_data(database_filepath) X_train, X_test, Y_train, Y_test = train_test_split(X, Y, test_size=0.2) print('Building model...') model = build_model() print('Training model...') model.fit(X_train.as_matrix(), Y_train.as_matrix()) print('Evaluating model...') evaluate_model(model, X_test, Y_test, category_names) ###WILL NEED TO CXLEAN THIS UP print('TYPE OF MODEL') print(type(model)) print('Saving model...\n MODEL: {}'.format(model_filepath)) save_model(model, model_filepath) print('Trained model saved!') else: print('Please provide the filepath of the disaster messages database '\ 'as the first argument and the filepath of the pickle file to '\ 'save the model to as the second argument. \n\nExample: python '\ 'train_classifier.py ../data/DisasterResponse.db classifier.pkl') if __name__ == '__main__': main()
en
0.688438
# import libraries This function load data from database from given database_filepath. process and slit the data as label and features (x ,y, categoory_name) Input args: Database file path Output : returnd seperated feature and labels (X,y,categoory_name) # drop columns with null This function take text and return token of words Input args: Text Output: List of clean token Build Multiclass Randomforest model Create pipeline Hypertune model Input : N/A Output: returns Hypertuned model This function evaluate the model and return the classification and accurancy score. Inputs: Model, X_test, y_test, Catgegory_names Outputs: Prints the Classification report & Accuracy Score # print scores Function to save the model Input: model and the file path to save the model Output: save the model as pickle file in the give filepath ###WILL NEED TO CXLEAN THIS UP
2.839686
3
seg/lib/models/nets/hrnet.py
Frank-Abagnal/HRFormer
254
6617372
##+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ ## Created by: RainbowSecret ## Microsoft Research ## <EMAIL> ## Copyright (c) 2018 ## ## This source code is licensed under the MIT-style license found in the ## LICENSE file in the root directory of this source tree ##+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ import os import pdb import torch import torch.nn as nn import torch.nn.functional as F from lib.models.backbones.backbone_selector import BackboneSelector from lib.models.tools.module_helper import ModuleHelper class HRNet_W48(nn.Module): """ deep high-resolution representation learning for human pose estimation, CVPR2019 """ def __init__(self, configer): super(HRNet_W48, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() # extra added layers in_channels = 720 # 48 + 96 + 192 + 384 self.cls_head = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), nn.Dropout2d(0.10), nn.Conv2d( in_channels, self.num_classes, kernel_size=1, stride=1, padding=0, bias=False, ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out = self.cls_head(feats) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out class HRNet_W48_ASPOCR(nn.Module): def __init__(self, configer): super(HRNet_W48_ASPOCR, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() # extra added layers in_channels = 720 # 48 + 96 + 192 + 384 from lib.models.modules.spatial_ocr_block import SpatialOCR_ASP_Module self.asp_ocr_head = SpatialOCR_ASP_Module( features=720, hidden_features=256, out_features=256, dilations=(24, 48, 72), num_classes=self.num_classes, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 256, self.num_classes, kernel_size=1, stride=1, padding=0, bias=False ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, 512, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(512, bn_type=self.configer.get("network", "bn_type")), nn.Conv2d( 512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=False ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.asp_ocr_head(feats, out_aux) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out class HRNet_W48_OCR(nn.Module): def __init__(self, configer): super(HRNet_W48_OCR, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 self.conv3x3 = nn.Sequential( nn.Conv2d(in_channels, 512, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(512, bn_type=self.configer.get("network", "bn_type")), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=512, key_channels=256, out_channels=512, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), nn.Conv2d( in_channels, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True, ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.conv3x3(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out class HRNet_W48_OCR_B(nn.Module): """ Considering that the 3x3 convolution on the 4x resolution feature map is expensive, we can decrease the intermediate channels from 512 to 256 w/o performance loss. """ def __init__(self, configer): super(HRNet_W48_OCR_B, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 # 48 + 96 + 192 + 384 self.conv3x3 = nn.Sequential( nn.Conv2d(in_channels, 256, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(256, bn_type=self.configer.get("network", "bn_type")), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=256, key_channels=128, out_channels=256, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 256, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, 256, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(256, bn_type=self.configer.get("network", "bn_type")), nn.Conv2d( 256, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.conv3x3(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out class HRNet_W48_SegTR(nn.Module): def __init__(self, configer): super(HRNet_W48_SegTR, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 self.conv3x3 = nn.Sequential( nn.Conv2d(in_channels, 512, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(512, bn_type=self.configer.get("network", "bn_type")), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=512, key_channels=256, out_channels=512, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), nn.Conv2d( in_channels, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True, ), ) self.local_attn = LocalAttention( in_channels=512, embed_dim=256, down_factor=[8, 8], rpe=False, norm_layer=ModuleHelper.BatchNorm2d( bn_type=self.configer.get("network", "bn_type") ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.conv3x3(feats) # pre- local attention feats = self.local_attn(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out def _no_grad_trunc_normal_(tensor, mean, std, a, b): # Cut & paste from PyTorch official master until it's in a few official releases - RW # Method based on https://people.sc.fsu.edu/~jburkardt/presentations/truncated_normal.pdf def norm_cdf(x): # Computes standard normal cumulative distribution function return (1.0 + math.erf(x / math.sqrt(2.0))) / 2.0 if (mean < a - 2 * std) or (mean > b + 2 * std): warnings.warn( "mean is more than 2 std from [a, b] in nn.init.trunc_normal_. " "The distribution of values may be incorrect.", stacklevel=2, ) with torch.no_grad(): # Values are generated by using a truncated uniform distribution and # then using the inverse CDF for the normal distribution. # Get upper and lower cdf values l = norm_cdf((a - mean) / std) u = norm_cdf((b - mean) / std) # Uniformly fill tensor with values from [l, u], then translate to # [2l-1, 2u-1]. tensor.uniform_(2 * l - 1, 2 * u - 1) # Use inverse cdf transform for normal distribution to get truncated # standard normal tensor.erfinv_() # Transform to proper mean, std tensor.mul_(std * math.sqrt(2.0)) tensor.add_(mean) # Clamp to ensure it's in the proper range tensor.clamp_(min=a, max=b) return tensor def trunc_normal_(tensor, mean=0.0, std=1.0, a=-2.0, b=2.0): return _no_grad_trunc_normal_(tensor, mean, std, a, b) class HRNet_W48_SegTREmbedding(nn.Module): def __init__(self, configer): super(HRNet_W48_SegTREmbedding, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 ocr_mid_channels = 512 ocr_key_channels = 256 self.conv3x3 = nn.Sequential( nn.Conv2d( in_channels, ocr_mid_channels, kernel_size=3, stride=1, padding=1 ), ModuleHelper.BNReLU( ocr_mid_channels, bn_type=self.configer.get("network", "bn_type") ), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=ocr_mid_channels, key_channels=ocr_key_channels, out_channels=ocr_mid_channels, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Parameter(torch.zeros(1, ocr_mid_channels, self.num_classes)) trunc_normal_(self.cls_head, std=0.02) # self.cls_head = nn.Conv2d(512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True) self.aux_head_proj = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=1, stride=1, padding=0), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), ) self.aux_head = nn.Parameter(torch.zeros(1, in_channels, self.num_classes)) # self.business_layer.append(self.aux_head) trunc_normal_(self.aux_head, std=0.02) self.local_attn = LocalAttention( in_channels=ocr_mid_channels, embed_dim=ocr_key_channels, down_factor=[8, 8], rpe=False, norm_layer=ModuleHelper.BatchNorm2d( bn_type=self.configer.get("network", "bn_type") ), ) def forward(self, x_): x = self.backbone(x_) b, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) aux_feat = self.aux_head_proj(feats) out_aux = torch.bmm( self.aux_head.repeat(b, 1, 1).permute(0, 2, 1), aux_feat.flatten(2) ).view(b, -1, h, w) # out_aux = self.aux_head(feats) feats = self.conv3x3(feats) # pre- local attention feats = self.local_attn(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = torch.bmm( self.cls_head.repeat(b, 1, 1).permute(0, 2, 1), feats.flatten(2) ).view(b, -1, h, w) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out
##+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ ## Created by: RainbowSecret ## Microsoft Research ## <EMAIL> ## Copyright (c) 2018 ## ## This source code is licensed under the MIT-style license found in the ## LICENSE file in the root directory of this source tree ##+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ import os import pdb import torch import torch.nn as nn import torch.nn.functional as F from lib.models.backbones.backbone_selector import BackboneSelector from lib.models.tools.module_helper import ModuleHelper class HRNet_W48(nn.Module): """ deep high-resolution representation learning for human pose estimation, CVPR2019 """ def __init__(self, configer): super(HRNet_W48, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() # extra added layers in_channels = 720 # 48 + 96 + 192 + 384 self.cls_head = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), nn.Dropout2d(0.10), nn.Conv2d( in_channels, self.num_classes, kernel_size=1, stride=1, padding=0, bias=False, ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out = self.cls_head(feats) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out class HRNet_W48_ASPOCR(nn.Module): def __init__(self, configer): super(HRNet_W48_ASPOCR, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() # extra added layers in_channels = 720 # 48 + 96 + 192 + 384 from lib.models.modules.spatial_ocr_block import SpatialOCR_ASP_Module self.asp_ocr_head = SpatialOCR_ASP_Module( features=720, hidden_features=256, out_features=256, dilations=(24, 48, 72), num_classes=self.num_classes, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 256, self.num_classes, kernel_size=1, stride=1, padding=0, bias=False ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, 512, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(512, bn_type=self.configer.get("network", "bn_type")), nn.Conv2d( 512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=False ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.asp_ocr_head(feats, out_aux) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out class HRNet_W48_OCR(nn.Module): def __init__(self, configer): super(HRNet_W48_OCR, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 self.conv3x3 = nn.Sequential( nn.Conv2d(in_channels, 512, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(512, bn_type=self.configer.get("network", "bn_type")), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=512, key_channels=256, out_channels=512, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), nn.Conv2d( in_channels, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True, ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.conv3x3(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out class HRNet_W48_OCR_B(nn.Module): """ Considering that the 3x3 convolution on the 4x resolution feature map is expensive, we can decrease the intermediate channels from 512 to 256 w/o performance loss. """ def __init__(self, configer): super(HRNet_W48_OCR_B, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 # 48 + 96 + 192 + 384 self.conv3x3 = nn.Sequential( nn.Conv2d(in_channels, 256, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(256, bn_type=self.configer.get("network", "bn_type")), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=256, key_channels=128, out_channels=256, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 256, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, 256, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(256, bn_type=self.configer.get("network", "bn_type")), nn.Conv2d( 256, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.conv3x3(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out class HRNet_W48_SegTR(nn.Module): def __init__(self, configer): super(HRNet_W48_SegTR, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 self.conv3x3 = nn.Sequential( nn.Conv2d(in_channels, 512, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU(512, bn_type=self.configer.get("network", "bn_type")), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=512, key_channels=256, out_channels=512, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Conv2d( 512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True ) self.aux_head = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=3, stride=1, padding=1), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), nn.Conv2d( in_channels, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True, ), ) self.local_attn = LocalAttention( in_channels=512, embed_dim=256, down_factor=[8, 8], rpe=False, norm_layer=ModuleHelper.BatchNorm2d( bn_type=self.configer.get("network", "bn_type") ), ) def forward(self, x_): x = self.backbone(x_) _, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) out_aux = self.aux_head(feats) feats = self.conv3x3(feats) # pre- local attention feats = self.local_attn(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = self.cls_head(feats) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out def _no_grad_trunc_normal_(tensor, mean, std, a, b): # Cut & paste from PyTorch official master until it's in a few official releases - RW # Method based on https://people.sc.fsu.edu/~jburkardt/presentations/truncated_normal.pdf def norm_cdf(x): # Computes standard normal cumulative distribution function return (1.0 + math.erf(x / math.sqrt(2.0))) / 2.0 if (mean < a - 2 * std) or (mean > b + 2 * std): warnings.warn( "mean is more than 2 std from [a, b] in nn.init.trunc_normal_. " "The distribution of values may be incorrect.", stacklevel=2, ) with torch.no_grad(): # Values are generated by using a truncated uniform distribution and # then using the inverse CDF for the normal distribution. # Get upper and lower cdf values l = norm_cdf((a - mean) / std) u = norm_cdf((b - mean) / std) # Uniformly fill tensor with values from [l, u], then translate to # [2l-1, 2u-1]. tensor.uniform_(2 * l - 1, 2 * u - 1) # Use inverse cdf transform for normal distribution to get truncated # standard normal tensor.erfinv_() # Transform to proper mean, std tensor.mul_(std * math.sqrt(2.0)) tensor.add_(mean) # Clamp to ensure it's in the proper range tensor.clamp_(min=a, max=b) return tensor def trunc_normal_(tensor, mean=0.0, std=1.0, a=-2.0, b=2.0): return _no_grad_trunc_normal_(tensor, mean, std, a, b) class HRNet_W48_SegTREmbedding(nn.Module): def __init__(self, configer): super(HRNet_W48_SegTREmbedding, self).__init__() self.configer = configer self.num_classes = self.configer.get("data", "num_classes") self.backbone = BackboneSelector(configer).get_backbone() in_channels = 720 ocr_mid_channels = 512 ocr_key_channels = 256 self.conv3x3 = nn.Sequential( nn.Conv2d( in_channels, ocr_mid_channels, kernel_size=3, stride=1, padding=1 ), ModuleHelper.BNReLU( ocr_mid_channels, bn_type=self.configer.get("network", "bn_type") ), ) from lib.models.modules.spatial_ocr_block import SpatialGather_Module self.ocr_gather_head = SpatialGather_Module(self.num_classes) from lib.models.modules.spatial_ocr_block import SpatialOCR_Module self.ocr_distri_head = SpatialOCR_Module( in_channels=ocr_mid_channels, key_channels=ocr_key_channels, out_channels=ocr_mid_channels, scale=1, dropout=0.05, bn_type=self.configer.get("network", "bn_type"), ) self.cls_head = nn.Parameter(torch.zeros(1, ocr_mid_channels, self.num_classes)) trunc_normal_(self.cls_head, std=0.02) # self.cls_head = nn.Conv2d(512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True) self.aux_head_proj = nn.Sequential( nn.Conv2d(in_channels, in_channels, kernel_size=1, stride=1, padding=0), ModuleHelper.BNReLU( in_channels, bn_type=self.configer.get("network", "bn_type") ), ) self.aux_head = nn.Parameter(torch.zeros(1, in_channels, self.num_classes)) # self.business_layer.append(self.aux_head) trunc_normal_(self.aux_head, std=0.02) self.local_attn = LocalAttention( in_channels=ocr_mid_channels, embed_dim=ocr_key_channels, down_factor=[8, 8], rpe=False, norm_layer=ModuleHelper.BatchNorm2d( bn_type=self.configer.get("network", "bn_type") ), ) def forward(self, x_): x = self.backbone(x_) b, _, h, w = x[0].size() feat1 = x[0] feat2 = F.interpolate(x[1], size=(h, w), mode="bilinear", align_corners=True) feat3 = F.interpolate(x[2], size=(h, w), mode="bilinear", align_corners=True) feat4 = F.interpolate(x[3], size=(h, w), mode="bilinear", align_corners=True) feats = torch.cat([feat1, feat2, feat3, feat4], 1) aux_feat = self.aux_head_proj(feats) out_aux = torch.bmm( self.aux_head.repeat(b, 1, 1).permute(0, 2, 1), aux_feat.flatten(2) ).view(b, -1, h, w) # out_aux = self.aux_head(feats) feats = self.conv3x3(feats) # pre- local attention feats = self.local_attn(feats) context = self.ocr_gather_head(feats, out_aux) feats = self.ocr_distri_head(feats, context) out = torch.bmm( self.cls_head.repeat(b, 1, 1).permute(0, 2, 1), feats.flatten(2) ).view(b, -1, h, w) out_aux = F.interpolate( out_aux, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) out = F.interpolate( out, size=(x_.size(2), x_.size(3)), mode="bilinear", align_corners=True ) return out_aux, out
en
0.757793
##+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ ## Created by: RainbowSecret ## Microsoft Research ## <EMAIL> ## Copyright (c) 2018 ## ## This source code is licensed under the MIT-style license found in the ## LICENSE file in the root directory of this source tree ##+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ deep high-resolution representation learning for human pose estimation, CVPR2019 # extra added layers # 48 + 96 + 192 + 384 # extra added layers # 48 + 96 + 192 + 384 Considering that the 3x3 convolution on the 4x resolution feature map is expensive, we can decrease the intermediate channels from 512 to 256 w/o performance loss. # 48 + 96 + 192 + 384 # pre- local attention # Cut & paste from PyTorch official master until it's in a few official releases - RW # Method based on https://people.sc.fsu.edu/~jburkardt/presentations/truncated_normal.pdf # Computes standard normal cumulative distribution function # Values are generated by using a truncated uniform distribution and # then using the inverse CDF for the normal distribution. # Get upper and lower cdf values # Uniformly fill tensor with values from [l, u], then translate to # [2l-1, 2u-1]. # Use inverse cdf transform for normal distribution to get truncated # standard normal # Transform to proper mean, std # Clamp to ensure it's in the proper range # self.cls_head = nn.Conv2d(512, self.num_classes, kernel_size=1, stride=1, padding=0, bias=True) # self.business_layer.append(self.aux_head) # out_aux = self.aux_head(feats) # pre- local attention
2.094691
2
scripts/uncertainty_scripts/train_local_latent.py
neuroailab/curiosity_deprecated
0
6617373
<reponame>neuroailab/curiosity_deprecated ''' Local test for latent space model training. ''' import sys sys.path.append('curiosity') sys.path.append('tfutils') import tensorflow as tf from curiosity.interaction import train from curiosity.interaction.models import mario_world_model_config from tfutils import base, optimizer import numpy as np NUM_BATCHES_PER_EPOCH = 1e8 STATE_DESC = 'depths1' params = { 'model_params' : { 'cfg' : { 'world_model' : mario_world_model_config, 'uncertainty_model' : { 'state_shape' : [2, 64, 64, 3], 'action_dim' : 8, 'n_action_samples' : 50, 'encode' : { 'encode_depth' : 5, 'encode' : { 1 : {'conv' : {'filter_size' : 3, 'stride' : 2, 'num_filters' : 20}}, 2 : {'conv' : {'filter_size' : 3, 'stride' : 1, 'num_filters' : 20}}, 3 : {'conv' : {'filter_size' : 3, 'stride' : 2, 'num_filters' : 20}}, 4 : {'conv' : {'filter_size' : 3, 'stride' : 1, 'num_filters' : 10}}, 5 : {'conv' : {'filter_size' : 3, 'stride' : 2, 'num_filters' : 5}}, } }, 'mlp' : { 'hidden_depth' : 2, 'hidden' : {1 : {'num_features' : 20, 'dropout' : .75}, 2 : {'num_features' : 1, 'activation' : 'identity'} } }, 'state_descriptor' : STATE_DESC }, 'seed' : 0 }, }, 'optimizer_params' : { 'world_model' : { 'fut_model' : { 'func': optimizer.ClipOptimizer, 'optimizer_class': tf.train.AdamOptimizer, 'clip': True, }, 'act_model' : { 'func': optimizer.ClipOptimizer, 'optimizer_class': tf.train.AdamOptimizer, 'clip': True, } }, 'uncertainty_model' : { 'func': optimizer.ClipOptimizer, 'optimizer_class': tf.train.AdamOptimizer, 'clip': True, } }, 'learning_rate_params' : { 'world_model' : { 'act_model' : { 'func': tf.train.exponential_decay, 'learning_rate': 1e-5, 'decay_rate': 1., 'decay_steps': NUM_BATCHES_PER_EPOCH, # exponential decay each epoch 'staircase': True }, 'fut_model' : { 'func': tf.train.exponential_decay, 'learning_rate': 1e-5, 'decay_rate': 1., 'decay_steps': NUM_BATCHES_PER_EPOCH, # exponential decay each epoch 'staircase': True } }, 'uncertainty_model' : { 'func': tf.train.exponential_decay, 'learning_rate': 1e-5, 'decay_rate': 1., 'decay_steps': NUM_BATCHES_PER_EPOCH, # exponential decay each epoch 'staircase': True } }, 'data_params' : { 'action_limits' : np.array([1., 1.] + [80. for _ in range(6)]), 'full_info_action' : True }, 'visualize' : True, 'exp_id' : 'test_latent' } if __name__ == '__main__': train.train_local(**params)
''' Local test for latent space model training. ''' import sys sys.path.append('curiosity') sys.path.append('tfutils') import tensorflow as tf from curiosity.interaction import train from curiosity.interaction.models import mario_world_model_config from tfutils import base, optimizer import numpy as np NUM_BATCHES_PER_EPOCH = 1e8 STATE_DESC = 'depths1' params = { 'model_params' : { 'cfg' : { 'world_model' : mario_world_model_config, 'uncertainty_model' : { 'state_shape' : [2, 64, 64, 3], 'action_dim' : 8, 'n_action_samples' : 50, 'encode' : { 'encode_depth' : 5, 'encode' : { 1 : {'conv' : {'filter_size' : 3, 'stride' : 2, 'num_filters' : 20}}, 2 : {'conv' : {'filter_size' : 3, 'stride' : 1, 'num_filters' : 20}}, 3 : {'conv' : {'filter_size' : 3, 'stride' : 2, 'num_filters' : 20}}, 4 : {'conv' : {'filter_size' : 3, 'stride' : 1, 'num_filters' : 10}}, 5 : {'conv' : {'filter_size' : 3, 'stride' : 2, 'num_filters' : 5}}, } }, 'mlp' : { 'hidden_depth' : 2, 'hidden' : {1 : {'num_features' : 20, 'dropout' : .75}, 2 : {'num_features' : 1, 'activation' : 'identity'} } }, 'state_descriptor' : STATE_DESC }, 'seed' : 0 }, }, 'optimizer_params' : { 'world_model' : { 'fut_model' : { 'func': optimizer.ClipOptimizer, 'optimizer_class': tf.train.AdamOptimizer, 'clip': True, }, 'act_model' : { 'func': optimizer.ClipOptimizer, 'optimizer_class': tf.train.AdamOptimizer, 'clip': True, } }, 'uncertainty_model' : { 'func': optimizer.ClipOptimizer, 'optimizer_class': tf.train.AdamOptimizer, 'clip': True, } }, 'learning_rate_params' : { 'world_model' : { 'act_model' : { 'func': tf.train.exponential_decay, 'learning_rate': 1e-5, 'decay_rate': 1., 'decay_steps': NUM_BATCHES_PER_EPOCH, # exponential decay each epoch 'staircase': True }, 'fut_model' : { 'func': tf.train.exponential_decay, 'learning_rate': 1e-5, 'decay_rate': 1., 'decay_steps': NUM_BATCHES_PER_EPOCH, # exponential decay each epoch 'staircase': True } }, 'uncertainty_model' : { 'func': tf.train.exponential_decay, 'learning_rate': 1e-5, 'decay_rate': 1., 'decay_steps': NUM_BATCHES_PER_EPOCH, # exponential decay each epoch 'staircase': True } }, 'data_params' : { 'action_limits' : np.array([1., 1.] + [80. for _ in range(6)]), 'full_info_action' : True }, 'visualize' : True, 'exp_id' : 'test_latent' } if __name__ == '__main__': train.train_local(**params)
en
0.673614
Local test for latent space model training. # exponential decay each epoch # exponential decay each epoch # exponential decay each epoch
2.221317
2
Data_Conversion/animation.py
simay1224/K-project-UI
0
6617374
# -*- coding: utf-8 -*- """ Created on Fri Dec 02 13:04:16 2016 @author: liuqi """ JointType_SpineBase = 0 JointType_SpineMid = 1 JointType_Neck = 2 JointType_Head = 3 JointType_ShoulderLeft = 4 JointType_ElbowLeft = 5 JointType_WristLeft = 6 JointType_HandLeft = 7 JointType_ShoulderRight = 8 JointType_ElbowRight = 9 JointType_WristRight = 10 JointType_HandRight = 11 JointType_HipLeft = 12 JointType_KneeLeft = 13 JointType_AnkleLeft = 14 JointType_FootLeft = 15 JointType_HipRight = 16 JointType_KneeRight = 17 JointType_AnkleRight = 18 JointType_FootRight = 19 JointType_SpineShoulder = 20 JointType_HandTipLeft = 21 JointType_ThumbLeft = 22 JointType_HandTipRight = 23 JointType_ThumbRight = 24 import cPickle as pk import matplotlib.pyplot as plt from mpl_toolkits.mplot3d import Axes3D ############################ # Motion capture ########################### src_path_M = 'E:/Kinect_gaussian_5to7/Unified_M_data/ex6/' src_path_K = 'E:/Kinect_gaussian_5to7/Unified_K_data/ex6/' m_data_path = 'Qingyuan_2017-03-06 01.43.26 PM_ex6_FPS30_motion_unified'+'.pkl' k_data_path = 'Qingyuan_data20170306134320_unified_ex6'+'.pkl' data_all = pk.load(file(src_path_M+m_data_path)) kdata_all = pk.load(file(src_path_K+k_data_path)) NUM_LABELS = len(data_all) # total number of the joints NUM_FRAMES = len(data_all[0][1]) # total number of the frames kNUM_FRAMES = len(kdata_all[0][1]) fig = plt.figure() ax = fig.add_subplot(111, projection='3d') ax.set_xlim(-500,300) ax.set_ylim(-1000,400) ax.set_zlim(50,600) ax.set_xlabel('Z axis') ax.set_ylabel('X axis') ax.set_zlabel('Y axis') xs = [] ys = [] zs = [] kxs = [] kys = [] kzs = [] for joint_idx in data_all.keys() : xs.append(0) ys.append(0) zs.append(0) kxs.append(0) kys.append(0) kzs.append(0) l_M, = ax.plot(xs,ys,zs, marker='o', linestyle='None', color='r',label='MoCam Joints') l_K, = ax.plot(kxs,kys,kzs, marker='o', linestyle='None', color='b',label='Kinect Joints') ax.legend( loc=1) plt.draw() for frame_no in xrange(min(kNUM_FRAMES,NUM_FRAMES)): xs = [] ys = [] zs = [] kxs = [] kys = [] kzs = [] for joint_idx in data_all.keys() : xs.append(data_all[joint_idx][0][frame_no]) ys.append(data_all[joint_idx][1][frame_no]) zs.append(data_all[joint_idx][2][frame_no]) kxs.append(kdata_all[joint_idx][0][frame_no]-500) kys.append(kdata_all[joint_idx][1][frame_no]) kzs.append(kdata_all[joint_idx][2][frame_no]) l_M.set_data(xs,zs) l_M.set_3d_properties(ys) l_K.set_data(kxs,kzs) l_K.set_3d_properties(kys) plt.pause(0.0001)
# -*- coding: utf-8 -*- """ Created on Fri Dec 02 13:04:16 2016 @author: liuqi """ JointType_SpineBase = 0 JointType_SpineMid = 1 JointType_Neck = 2 JointType_Head = 3 JointType_ShoulderLeft = 4 JointType_ElbowLeft = 5 JointType_WristLeft = 6 JointType_HandLeft = 7 JointType_ShoulderRight = 8 JointType_ElbowRight = 9 JointType_WristRight = 10 JointType_HandRight = 11 JointType_HipLeft = 12 JointType_KneeLeft = 13 JointType_AnkleLeft = 14 JointType_FootLeft = 15 JointType_HipRight = 16 JointType_KneeRight = 17 JointType_AnkleRight = 18 JointType_FootRight = 19 JointType_SpineShoulder = 20 JointType_HandTipLeft = 21 JointType_ThumbLeft = 22 JointType_HandTipRight = 23 JointType_ThumbRight = 24 import cPickle as pk import matplotlib.pyplot as plt from mpl_toolkits.mplot3d import Axes3D ############################ # Motion capture ########################### src_path_M = 'E:/Kinect_gaussian_5to7/Unified_M_data/ex6/' src_path_K = 'E:/Kinect_gaussian_5to7/Unified_K_data/ex6/' m_data_path = 'Qingyuan_2017-03-06 01.43.26 PM_ex6_FPS30_motion_unified'+'.pkl' k_data_path = 'Qingyuan_data20170306134320_unified_ex6'+'.pkl' data_all = pk.load(file(src_path_M+m_data_path)) kdata_all = pk.load(file(src_path_K+k_data_path)) NUM_LABELS = len(data_all) # total number of the joints NUM_FRAMES = len(data_all[0][1]) # total number of the frames kNUM_FRAMES = len(kdata_all[0][1]) fig = plt.figure() ax = fig.add_subplot(111, projection='3d') ax.set_xlim(-500,300) ax.set_ylim(-1000,400) ax.set_zlim(50,600) ax.set_xlabel('Z axis') ax.set_ylabel('X axis') ax.set_zlabel('Y axis') xs = [] ys = [] zs = [] kxs = [] kys = [] kzs = [] for joint_idx in data_all.keys() : xs.append(0) ys.append(0) zs.append(0) kxs.append(0) kys.append(0) kzs.append(0) l_M, = ax.plot(xs,ys,zs, marker='o', linestyle='None', color='r',label='MoCam Joints') l_K, = ax.plot(kxs,kys,kzs, marker='o', linestyle='None', color='b',label='Kinect Joints') ax.legend( loc=1) plt.draw() for frame_no in xrange(min(kNUM_FRAMES,NUM_FRAMES)): xs = [] ys = [] zs = [] kxs = [] kys = [] kzs = [] for joint_idx in data_all.keys() : xs.append(data_all[joint_idx][0][frame_no]) ys.append(data_all[joint_idx][1][frame_no]) zs.append(data_all[joint_idx][2][frame_no]) kxs.append(kdata_all[joint_idx][0][frame_no]-500) kys.append(kdata_all[joint_idx][1][frame_no]) kzs.append(kdata_all[joint_idx][2][frame_no]) l_M.set_data(xs,zs) l_M.set_3d_properties(ys) l_K.set_data(kxs,kzs) l_K.set_3d_properties(kys) plt.pause(0.0001)
en
0.369231
# -*- coding: utf-8 -*- Created on Fri Dec 02 13:04:16 2016 @author: liuqi ############################ # Motion capture ########################### # total number of the joints # total number of the frames
1.46261
1
app/api/views.py
nikhiljohn10/django-api-template
0
6617375
from rest_framework import viewsets from api.serializers import ManufacturerSerializer, CarSerializer, OwnershipSerializer, OwnerSerializer from api.models import Manufacturer, Car, Ownership, Owner class ManufacturerViewSet(viewsets.ModelViewSet): queryset = Manufacturer.objects.all() serializer_class = ManufacturerSerializer class CarViewSet(viewsets.ModelViewSet): queryset = Car.objects.all() serializer_class = CarSerializer class OwnershipViewSet(viewsets.ModelViewSet): queryset = Ownership.objects.all() serializer_class = OwnershipSerializer class OwnerViewSet(viewsets.ModelViewSet): queryset = Owner.objects.all() serializer_class = OwnerSerializer
from rest_framework import viewsets from api.serializers import ManufacturerSerializer, CarSerializer, OwnershipSerializer, OwnerSerializer from api.models import Manufacturer, Car, Ownership, Owner class ManufacturerViewSet(viewsets.ModelViewSet): queryset = Manufacturer.objects.all() serializer_class = ManufacturerSerializer class CarViewSet(viewsets.ModelViewSet): queryset = Car.objects.all() serializer_class = CarSerializer class OwnershipViewSet(viewsets.ModelViewSet): queryset = Ownership.objects.all() serializer_class = OwnershipSerializer class OwnerViewSet(viewsets.ModelViewSet): queryset = Owner.objects.all() serializer_class = OwnerSerializer
none
1
2.144288
2
src/sentry/identity/bitbucket/provider.py
AlexWayfer/sentry
4
6617376
<filename>src/sentry/identity/bitbucket/provider.py from __future__ import absolute_import from sentry.pipeline import PipelineView from sentry.utils.http import absolute_uri from sentry.identity.base import Provider class BitbucketIdentityProvider(Provider): key = 'bitbucket' name = 'Bitbucket' def get_pipeline_views(self): return [BitbucketLoginView()] class BitbucketLoginView(PipelineView): def dispatch(self, request, pipeline): jwt = request.GET.get('jwt') if jwt is None: return self.redirect( 'https://bitbucket.org/site/addons/authorize?descriptor_uri=%s' % ( absolute_uri('/extensions/bitbucket/descriptor/'), )) return pipeline.next_step()
<filename>src/sentry/identity/bitbucket/provider.py from __future__ import absolute_import from sentry.pipeline import PipelineView from sentry.utils.http import absolute_uri from sentry.identity.base import Provider class BitbucketIdentityProvider(Provider): key = 'bitbucket' name = 'Bitbucket' def get_pipeline_views(self): return [BitbucketLoginView()] class BitbucketLoginView(PipelineView): def dispatch(self, request, pipeline): jwt = request.GET.get('jwt') if jwt is None: return self.redirect( 'https://bitbucket.org/site/addons/authorize?descriptor_uri=%s' % ( absolute_uri('/extensions/bitbucket/descriptor/'), )) return pipeline.next_step()
none
1
2.099218
2
rabin/prime.py
LukasForst/rabin-crypto
0
6617377
from typing import Tuple import Crypto.Util.number as number from rabin.crypto_configuration import PRIME_LENGTH_BITS from rabin.dto import RabinCryptoKey, RabinSecretKey, RabinPublicKey def euklids_algorithm(a: int, b: int) -> Tuple[int, int, int]: """ Euklids algorithm returning GCD = X*a + Y*b. >>> a, b = 3, 13 >>> gcd, ax, by = euklids_algorithm(a, b) >>> gcd == ax*a + by*b True """ if a == 0: return b, 0, 1 gcd, x1, y1 = euklids_algorithm(b % a, a) x = y1 - (b // a) * x1 y = x1 return gcd, x, y def generate_rabin_key(bit_len: int = PRIME_LENGTH_BITS) -> RabinCryptoKey: """ Securely generate whole key material for Rabin cryptosystem. """ p, q = _get_private_key_prime(bit_len), _get_private_key_prime(bit_len) return RabinCryptoKey( private=RabinSecretKey(p=p, q=q), public=RabinPublicKey(n=p * q) ) def _get_private_key_prime(bit_len: int) -> int: while True: # cryptographically secure way how to generate prime number # internally it uses urandom, which is suitable for cryptographic use p = number.getPrime(bit_len) if p % 4 == 3: return p
from typing import Tuple import Crypto.Util.number as number from rabin.crypto_configuration import PRIME_LENGTH_BITS from rabin.dto import RabinCryptoKey, RabinSecretKey, RabinPublicKey def euklids_algorithm(a: int, b: int) -> Tuple[int, int, int]: """ Euklids algorithm returning GCD = X*a + Y*b. >>> a, b = 3, 13 >>> gcd, ax, by = euklids_algorithm(a, b) >>> gcd == ax*a + by*b True """ if a == 0: return b, 0, 1 gcd, x1, y1 = euklids_algorithm(b % a, a) x = y1 - (b // a) * x1 y = x1 return gcd, x, y def generate_rabin_key(bit_len: int = PRIME_LENGTH_BITS) -> RabinCryptoKey: """ Securely generate whole key material for Rabin cryptosystem. """ p, q = _get_private_key_prime(bit_len), _get_private_key_prime(bit_len) return RabinCryptoKey( private=RabinSecretKey(p=p, q=q), public=RabinPublicKey(n=p * q) ) def _get_private_key_prime(bit_len: int) -> int: while True: # cryptographically secure way how to generate prime number # internally it uses urandom, which is suitable for cryptographic use p = number.getPrime(bit_len) if p % 4 == 3: return p
en
0.736576
Euklids algorithm returning GCD = X*a + Y*b. >>> a, b = 3, 13 >>> gcd, ax, by = euklids_algorithm(a, b) >>> gcd == ax*a + by*b True Securely generate whole key material for Rabin cryptosystem. # cryptographically secure way how to generate prime number # internally it uses urandom, which is suitable for cryptographic use
3.466294
3
leetcode/python/easy/p788_rotatedDigits.py
kefirzhang/algorithms
0
6617378
class Solution: def rotatedDigits(self, N: int) -> int: # 1-》 2 5 6 9 0 -》 0 1 8 -1 3 4 7 helper = [0, 0, 1, -1, -1, 1, 1, -1, 0, 1] total = 0 for i in range(1, N + 1): i = str(i) if len(i) <= 1: if helper[int(i)] == 1: total += 1 print(i) else: left = int(i[:-1]) right = int(i[-1]) if helper[left] == -1 or helper[right] == -1: helper.append(-1) elif helper[left] == 0 and helper[right] == 0: helper.append(0) else: helper.append(1) total += 1 # print(i) return total slu = Solution() print(slu.rotatedDigits(100))
class Solution: def rotatedDigits(self, N: int) -> int: # 1-》 2 5 6 9 0 -》 0 1 8 -1 3 4 7 helper = [0, 0, 1, -1, -1, 1, 1, -1, 0, 1] total = 0 for i in range(1, N + 1): i = str(i) if len(i) <= 1: if helper[int(i)] == 1: total += 1 print(i) else: left = int(i[:-1]) right = int(i[-1]) if helper[left] == -1 or helper[right] == -1: helper.append(-1) elif helper[left] == 0 and helper[right] == 0: helper.append(0) else: helper.append(1) total += 1 # print(i) return total slu = Solution() print(slu.rotatedDigits(100))
zh
0.653068
# 1-》 2 5 6 9 0 -》 0 1 8 -1 3 4 7 # print(i)
3.155795
3
domain/arrive_info.py
kex5n/Vehicles-Dispatch-Simulator
0
6617379
<filename>domain/arrive_info.py from enum import Enum # random.seed(1234) # np.random.seed(1234) # torch.manual_seed(1234) # torch.cuda.manual_seed_all(1234) # torch.backends.cudnn.deterministic = True class ArriveInfo(Enum): REJECT = "Reject" SUCCESS = "Success"
<filename>domain/arrive_info.py from enum import Enum # random.seed(1234) # np.random.seed(1234) # torch.manual_seed(1234) # torch.cuda.manual_seed_all(1234) # torch.backends.cudnn.deterministic = True class ArriveInfo(Enum): REJECT = "Reject" SUCCESS = "Success"
en
0.180819
# random.seed(1234) # np.random.seed(1234) # torch.manual_seed(1234) # torch.cuda.manual_seed_all(1234) # torch.backends.cudnn.deterministic = True
2.022767
2
04_Django/Django_db/Relation_db/models.py
DajuanM/DHPythonDemo
0
6617380
<gh_stars>0 from django.db import models # Create your models here. class School(models.Model): school_id = models.IntegerField() school_name = models.CharField(max_length=20) #manager = models.OneToOneField(Manager) def __str__(self): return self.school_name class Manager(models.Model): manager_id = models.IntegerField() manager_name = models.CharField(max_length=20) my_school = models.OneToOneField(School) def __str__(self): return self.manager_name
from django.db import models # Create your models here. class School(models.Model): school_id = models.IntegerField() school_name = models.CharField(max_length=20) #manager = models.OneToOneField(Manager) def __str__(self): return self.school_name class Manager(models.Model): manager_id = models.IntegerField() manager_name = models.CharField(max_length=20) my_school = models.OneToOneField(School) def __str__(self): return self.manager_name
en
0.872256
# Create your models here. #manager = models.OneToOneField(Manager)
2.668559
3
ronpy/__init__.py
rhsmits91/ronpy
0
6617381
from . import decorators from . import logger __version__ = '0.0.1' def get_version(): return __version__
from . import decorators from . import logger __version__ = '0.0.1' def get_version(): return __version__
none
1
1.734751
2
user.py
Niraj-Kamdar/PlayStore-Database
0
6617382
from __future__ import print_function, unicode_literals import itertools import sys from clint.textui import colored, indent, puts from pyfiglet import figlet_format as figlet from PyInquirer import Separator, Token, prompt, style_from_dict from playstore import PlayStore def convert(val, ans): if "int" in val: return int(ans) elif "numeric" in val: return float(ans) elif "bool" == val: return True if ans == "true" else False else: return ans db = PlayStore() puts(colored.green(figlet("PlayStore"))) style = style_from_dict( { Token.Separator: "#<PASSWORD>", Token.QuestionMark: "#<PASSWORD>", Token.Selected: "#<PASSWORD>", # default Token.Pointer: "#<PASSWORD> bold", Token.Instruction: "#<PASSWORD>", # default Token.Answer: "#<PASSWORD> bold", Token.Question: "#<PASSWORD>", } ) q1 = [ { "type": "input", "message": "Enter your userid (email)", "name": "userid", "validate": lambda text: len(text) != 0 or "Enter a valid userid", }, { "type": "list", "message": "Select option", "name": "product", "choices": [{"name": "App"}, {"name": "Book"}, {"name": "Account"}], "validate": lambda answer: "You must choose a product." if len(answer) == 0 else True, }, ] a1 = prompt(q1, style=style) if a1["product"] == "App": q2 = [ { "type": "list", "message": "Select option", "name": "option", "choices": [{"name": "Install"}, {"name": "Update"}, {"name": "Uninstall"}, {"name": "Wishlist"}], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q3 = [ { "type": "list", "message": "Select option", "name": "option", "choices": [ {"name": "previously installed apps"}, {"name": "wishlisted apps"}, {"name": "trending apps"}, {"name": "best rated apps"}, {"name": "category wise apps"}, {"name": "search apps"}, ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q4 = [ { "type": "checkbox", "message": "Select app you want to install", "name": "install", "choices": [], } ] q5 = [ { "type": "checkbox", "message": "Select category from which you want to install app", "name": "category", "choices": [], } ] q6 = [ { "type": "confirm", "name": "buy", "message": "Do you want to buy the app?", "default": False, } ] q7 = [ { "type": "list", "message": "Select payment method", "name": "payment", "choices": [], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q8 = [ { "type": "list", "message": "Enter rating", "name": "rating", "choices": [1, 2, 3, 4, 5], }, { "type": "input", "message": "Give Review", "name": "comment", } ] dcommand = {"Uninstall": False, "Update": True, "Feedback": True} a2 = prompt(q2, style=style) if a2["option"] == "Install": a3 = prompt(q3, style=style) if a3["option"] == "previously installed apps": apps = db.downloaded_app(a1["userid"], False, False) apps = dict(apps) if apps == {}: puts( colored.red( "You don't have any app in previously installed apps!" ) ) sys.exit() for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "wishlisted apps": apps = db.get_wishlist(a1["userid"], True, False) apps = dict(apps) if apps == {}: puts( colored.red( "You don't have any app in wishlisted apps!" ) ) sys.exit() for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "trending apps": apps = db.trending(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "best rated apps": apps = db.best_rated(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "category wise apps": cats = db.get_category() for i in itertools.chain.from_iterable(cats): q5[0]["choices"].append({"name": i}) a5 = prompt(q5, style=style) for i in a5["category"]: apps = db.category_wise(i, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) else: q9 = [ { "type": "input", "message": "Enter name of the app", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("app", "appname, appid", where="name='{}'".format(a9["search"]), output=False) apps = db.display_query(s, output=False) if apps == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) if a4["install"] == []: puts(colored.red("You have to select at least one app.")) else: for i in a4["install"]: s = db.download(a1["userid"], apps[i]) if not s: puts( colored.red( "{} is a paid app, you have to pay to download it".format(i) ) ) a6 = prompt(q6, style=style) pays = {} if a6["buy"]: for j in ("debitcard", "creditcard", "ewallet", "netbanking"): q7[0]["choices"].append(Separator("= {} =".format(j))) payments = db.get_payment(a1["userid"], j, False) payments = dict(payments) for k in payments.keys(): q7[0]["choices"].append({"name": k}) pays.update(dict(payments)) a7 = prompt(q7, style=style) s = db.download(a1["userid"], apps[i], pays.get(a7["payment"])) if s: puts(colored.green("{} downloaded successfully.".format(i))) else: puts(colored.red("download of {} failed. may be because your card has been expired".format(i))) else: puts(colored.green("{} downloaded successfully.".format(i))) elif a2["option"] in dcommand: apps = db.downloaded_app(a1["userid"], True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) q4[0]["message"] = "Select app you want to {}".format(a2["option"]) a4 = prompt(q4, style=style) if a4["install"] == []: puts(colored.red("You have to select at least one app.")) elif a2["option"] == "Feedback": for i in a4["install"]: puts(colored.green(i)) a8 = prompt(q8, style=style) db.feedback(a1["userid"], apps[i], a8["rating"], a8["comment"]) else: for i in a4["install"]: s = db.download(a1["userid"], apps[i], install=dcommand[a2["option"]]) puts(colored.green("{} {}ed successfully.".format(i, a2["option"]))) elif a2["option"] == "Wishlist": q3 = [ { "type": "list", "message": "Select option", "name": "option", "choices": [ {"name": "remove wishlisted apps"}, {"name": "trending apps"}, {"name": "best rated apps"}, {"name": "category wise apps"}, {"name": "search apps"} ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q4 = [ { "type": "checkbox", "message": "Select app you want to add to/(remove from) wishlist ", "name": "install", "choices": [], } ] a3 = prompt(q3, style=style) if a3["option"] == "remove wishlisted apps": apps = db.get_wishlist(a1["userid"], True, False) if apps == []: puts(colored.red("Your wishlist is empty!")) sys.exit() apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "trending apps": apps = db.trending(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "best rated apps": apps = db.best_rated(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "category wise apps": cats = db.get_category() for i in itertools.chain.from_iterable(cats): q5[0]["choices"].append({"name": i}) a5 = prompt(q5, style=style) for i in a5["category"]: apps = db.category_wise(i, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) else: q9 = [ { "type": "input", "message": "Enter name of the app", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("app", "appname, appid", where="name='{}'".format(a9["search"]), output=False) apps = db.display_query(s, output=False) if apps == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) if a4["install"] == []: puts(colored.red("You have to select at least one app.")) elif a3["option"] == "remove wishlisted apps": for i in a4["install"]: db.remove_wishlist(a1["userid"], apps[i]) puts(colored.green("{} removed from wishlist successfully.".format(i))) else: for i in a4["install"]: s = db.wishlist(a1["userid"], apps[i]) if not s: puts(colored.red("App can't be added to wishlist because app is already downloaded/wishlisted.")) else: puts(colored.green("{} added to wishlist successfully.".format(i))) elif a1["product"] == "Book": q2 = [ { "type": "list", "message": "Select category from which you want to show/purchase book.", "name": "option", "choices": [ {"name": "wishlisted books"}, {"name": "best rated books"}, {"name": "genre wise books"}, {"name": "my library"}, {"name": "search books"}, {"name": "wishlist books"}, ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q3 = [ { "type": "checkbox", "message": "Select book you want to purchase", "name": "purchase", "choices": [], } ] q4 = [ { "type": "checkbox", "message": "Select genre from which you want to purchase book", "name": "genre", "choices": [], } ] q6 = [ { "type": "confirm", "name": "buy", "message": "Do you want to buy the app?", "default": False, } ] q7 = [ { "type": "list", "message": "Select payment method", "name": "payment", "choices": [], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q8 = [ { "type": "list", "message": "Enter rating", "name": "rating", "choices": ['1', '2', '3', '4', '5'], }, { "type": "input", "message": "Give Review", "name": "comment", } ] a2 = prompt(q2, style=style) if a2["option"] == "wishlisted books": books = db.get_wishlist(a1["userid"], False, False) books = dict(books) if books == {}: puts( colored.red( "You don't have any book in wishlisted books!" ) ) sys.exit() for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "best rated books": books = db.best_rated(False, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "genre wise books": cats = db.get_genre() for i in itertools.chain.from_iterable(cats): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) for i in a4["genre"]: books = db.genre_wise(i, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "my library": books = db.downloaded_book(a1["userid"], False) books = dict(books) if books == {}: puts( colored.red( "You don't have any books in your library!" ) ) sys.exit() q3[0]["message"] = "Select books if you want to give feedback" for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) if a3["purchase"] != []: for i in a3["purchase"]: puts(colored.green(i)) a8 = prompt(q8, style=style) s = db.feedback(a1["userid"], books[i], a8["rating"], a8["comment"]) print(s) sys.exit() elif a2["option"] == "search books": q9 = [ { "type": "input", "message": "Enter name of the book", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("book", "name, isbn", where="name='{}'".format(a9["search"]), output=False) books = db.display_query(s, output=False) if books == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) else: q2 = [ { "type": "list", "message": "Select category from which you want to wishlist/unwishlist book.", "name": "option", "choices": [ {"name": "remove wishlisted books"}, {"name": "best rated books"}, {"name": "genre wise books"}, {"name": "search books"} ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q4 = [ { "type": "checkbox", "message": "Select book you want to add to wishlist", "name": "purchase", "choices": [], } ] q3 = [ { "type": "checkbox", "message": "Select genre from which you want to add book to your wishlist", "name": "category", "choices": [], } ] a2 = prompt(q2, style=style) if a2["option"] == "remove wishlisted books": books = db.get_wishlist(a1["userid"], False, False) books = dict(books) if books == {}: puts( colored.red( "You don't have any book in wishlisted books!" ) ) sys.exit() for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "best rated books": books = db.best_rated(False, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "genre wise books": cats = db.get_genre() for i in itertools.chain.from_iterable(cats): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) for i in a4["genre"]: books = db.genre_wise(i, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) else: q9 = [ { "type": "input", "message": "Enter name of the book", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("book", "name, isbn", where="name='{}'".format(a9["search"]), output=False) books = db.display_query(s, output=False) if books == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) if a3["purchase"] == []: puts(colored.red("You have to select at least one book.")) else: for i in a3["purchase"]: s = db.wishlist(a1["userid"], books[i], False) if not s: puts(colored.red("Book can't be added to wishlist because book is already downloaded/wishlisted.")) else: puts(colored.green("{} added to wishlist successfully.".format(i))) sys.exit() if a3["purchase"] == []: puts(colored.red("You have to select at least one book.")) else: for i in a3["purchase"]: s = db.download(a1["userid"], books[i], isApp=False) if not s: puts( colored.red( "{} is a paid book, you have to pay to download it".format(i) ) ) a6 = prompt(q6, style=style) pays = {} if a6["buy"]: for j in ("debitcard", "creditcard", "ewallet", "netbanking"): q7[0]["choices"].append(Separator("= {} =".format(j))) payments = db.get_payment(a1["userid"], j, False) payments = dict(payments) for k in payments.keys(): q7[0]["choices"].append({"name": k}) pays.update(dict(payments)) a7 = prompt(q7, style=style) s = db.download(a1["userid"], books[i], pays.get(a7["payment"]), isApp=False) print(s) if s: puts(colored.green("{} added to your library successfully.".format(i))) else: puts(colored.green("{} added to your library successfully.".format(i))) elif a1["product"] == "Account": q2 = [ { "type": "list", "message": "Select option", "name": "option", "choices": ["add payment method", "edit user details", "delete account"], } ] q3 = [ { "type": "list", "message": "Select payment method you want to add", "name": "option", "choices": ["credit card", "debit card", "ewallet", "netbanking"], } ] q4 = [ { "type": "checkbox", "message": "Select fields you want to update", "name": "option", "choices": ["userid", "username", "country", "autoupdate"] } ] q6 = [ { "type": "confirm", "message": "Are you sure you want to delete your account.", "name": "option", } ] a2 = prompt(q2, style=style) if a2["option"] == "add payment method": a3 = prompt(q3, style=style) d = {} if a3["option"] in {"credit card", "debit card"}: for i in ("name", "expdate", "cardno"): q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format(i) a5 = prompt(q5, style=style) d.update(i=a5["option"]) db.add_card(d["name"], a1["userid"], d["expdate"], d["cardno"], "".join(a3["option"].split())) elif a3["option"] == "ewallet": for i in ("name", "walletid"): q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format(i) a5 = prompt(q5, style=style) d.update(i=a5["option"]) db.add_wallet(a1["userid"], d["name"], d["walletid"]) else: q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format("bank name") a5 = prompt(q5, style=style) db.add_netbank(a1["userid"], a5["option"]) elif a2["option"] == "edit user details": a4 = prompt(q4, style=style) if a4["option"] != []: ans = [] for i in a4["option"]: q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format(i) a5 = prompt(q5, style=style) ans.append(a5["option"]) kwargs = dict([a4["option"], ans]) db.update("users", "userid='{}'".format(a1["userid"]), **kwargs) else: a6 = prompt(q6, style=style) if a6["option"]: db.delete("users", userid=a1["userid"])
from __future__ import print_function, unicode_literals import itertools import sys from clint.textui import colored, indent, puts from pyfiglet import figlet_format as figlet from PyInquirer import Separator, Token, prompt, style_from_dict from playstore import PlayStore def convert(val, ans): if "int" in val: return int(ans) elif "numeric" in val: return float(ans) elif "bool" == val: return True if ans == "true" else False else: return ans db = PlayStore() puts(colored.green(figlet("PlayStore"))) style = style_from_dict( { Token.Separator: "#<PASSWORD>", Token.QuestionMark: "#<PASSWORD>", Token.Selected: "#<PASSWORD>", # default Token.Pointer: "#<PASSWORD> bold", Token.Instruction: "#<PASSWORD>", # default Token.Answer: "#<PASSWORD> bold", Token.Question: "#<PASSWORD>", } ) q1 = [ { "type": "input", "message": "Enter your userid (email)", "name": "userid", "validate": lambda text: len(text) != 0 or "Enter a valid userid", }, { "type": "list", "message": "Select option", "name": "product", "choices": [{"name": "App"}, {"name": "Book"}, {"name": "Account"}], "validate": lambda answer: "You must choose a product." if len(answer) == 0 else True, }, ] a1 = prompt(q1, style=style) if a1["product"] == "App": q2 = [ { "type": "list", "message": "Select option", "name": "option", "choices": [{"name": "Install"}, {"name": "Update"}, {"name": "Uninstall"}, {"name": "Wishlist"}], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q3 = [ { "type": "list", "message": "Select option", "name": "option", "choices": [ {"name": "previously installed apps"}, {"name": "wishlisted apps"}, {"name": "trending apps"}, {"name": "best rated apps"}, {"name": "category wise apps"}, {"name": "search apps"}, ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q4 = [ { "type": "checkbox", "message": "Select app you want to install", "name": "install", "choices": [], } ] q5 = [ { "type": "checkbox", "message": "Select category from which you want to install app", "name": "category", "choices": [], } ] q6 = [ { "type": "confirm", "name": "buy", "message": "Do you want to buy the app?", "default": False, } ] q7 = [ { "type": "list", "message": "Select payment method", "name": "payment", "choices": [], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q8 = [ { "type": "list", "message": "Enter rating", "name": "rating", "choices": [1, 2, 3, 4, 5], }, { "type": "input", "message": "Give Review", "name": "comment", } ] dcommand = {"Uninstall": False, "Update": True, "Feedback": True} a2 = prompt(q2, style=style) if a2["option"] == "Install": a3 = prompt(q3, style=style) if a3["option"] == "previously installed apps": apps = db.downloaded_app(a1["userid"], False, False) apps = dict(apps) if apps == {}: puts( colored.red( "You don't have any app in previously installed apps!" ) ) sys.exit() for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "wishlisted apps": apps = db.get_wishlist(a1["userid"], True, False) apps = dict(apps) if apps == {}: puts( colored.red( "You don't have any app in wishlisted apps!" ) ) sys.exit() for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "trending apps": apps = db.trending(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "best rated apps": apps = db.best_rated(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "category wise apps": cats = db.get_category() for i in itertools.chain.from_iterable(cats): q5[0]["choices"].append({"name": i}) a5 = prompt(q5, style=style) for i in a5["category"]: apps = db.category_wise(i, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) else: q9 = [ { "type": "input", "message": "Enter name of the app", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("app", "appname, appid", where="name='{}'".format(a9["search"]), output=False) apps = db.display_query(s, output=False) if apps == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) if a4["install"] == []: puts(colored.red("You have to select at least one app.")) else: for i in a4["install"]: s = db.download(a1["userid"], apps[i]) if not s: puts( colored.red( "{} is a paid app, you have to pay to download it".format(i) ) ) a6 = prompt(q6, style=style) pays = {} if a6["buy"]: for j in ("debitcard", "creditcard", "ewallet", "netbanking"): q7[0]["choices"].append(Separator("= {} =".format(j))) payments = db.get_payment(a1["userid"], j, False) payments = dict(payments) for k in payments.keys(): q7[0]["choices"].append({"name": k}) pays.update(dict(payments)) a7 = prompt(q7, style=style) s = db.download(a1["userid"], apps[i], pays.get(a7["payment"])) if s: puts(colored.green("{} downloaded successfully.".format(i))) else: puts(colored.red("download of {} failed. may be because your card has been expired".format(i))) else: puts(colored.green("{} downloaded successfully.".format(i))) elif a2["option"] in dcommand: apps = db.downloaded_app(a1["userid"], True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) q4[0]["message"] = "Select app you want to {}".format(a2["option"]) a4 = prompt(q4, style=style) if a4["install"] == []: puts(colored.red("You have to select at least one app.")) elif a2["option"] == "Feedback": for i in a4["install"]: puts(colored.green(i)) a8 = prompt(q8, style=style) db.feedback(a1["userid"], apps[i], a8["rating"], a8["comment"]) else: for i in a4["install"]: s = db.download(a1["userid"], apps[i], install=dcommand[a2["option"]]) puts(colored.green("{} {}ed successfully.".format(i, a2["option"]))) elif a2["option"] == "Wishlist": q3 = [ { "type": "list", "message": "Select option", "name": "option", "choices": [ {"name": "remove wishlisted apps"}, {"name": "trending apps"}, {"name": "best rated apps"}, {"name": "category wise apps"}, {"name": "search apps"} ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q4 = [ { "type": "checkbox", "message": "Select app you want to add to/(remove from) wishlist ", "name": "install", "choices": [], } ] a3 = prompt(q3, style=style) if a3["option"] == "remove wishlisted apps": apps = db.get_wishlist(a1["userid"], True, False) if apps == []: puts(colored.red("Your wishlist is empty!")) sys.exit() apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "trending apps": apps = db.trending(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "best rated apps": apps = db.best_rated(True, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) elif a3["option"] == "category wise apps": cats = db.get_category() for i in itertools.chain.from_iterable(cats): q5[0]["choices"].append({"name": i}) a5 = prompt(q5, style=style) for i in a5["category"]: apps = db.category_wise(i, False) apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) else: q9 = [ { "type": "input", "message": "Enter name of the app", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("app", "appname, appid", where="name='{}'".format(a9["search"]), output=False) apps = db.display_query(s, output=False) if apps == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: apps = dict(apps) for i in apps.keys(): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) if a4["install"] == []: puts(colored.red("You have to select at least one app.")) elif a3["option"] == "remove wishlisted apps": for i in a4["install"]: db.remove_wishlist(a1["userid"], apps[i]) puts(colored.green("{} removed from wishlist successfully.".format(i))) else: for i in a4["install"]: s = db.wishlist(a1["userid"], apps[i]) if not s: puts(colored.red("App can't be added to wishlist because app is already downloaded/wishlisted.")) else: puts(colored.green("{} added to wishlist successfully.".format(i))) elif a1["product"] == "Book": q2 = [ { "type": "list", "message": "Select category from which you want to show/purchase book.", "name": "option", "choices": [ {"name": "wishlisted books"}, {"name": "best rated books"}, {"name": "genre wise books"}, {"name": "my library"}, {"name": "search books"}, {"name": "wishlist books"}, ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q3 = [ { "type": "checkbox", "message": "Select book you want to purchase", "name": "purchase", "choices": [], } ] q4 = [ { "type": "checkbox", "message": "Select genre from which you want to purchase book", "name": "genre", "choices": [], } ] q6 = [ { "type": "confirm", "name": "buy", "message": "Do you want to buy the app?", "default": False, } ] q7 = [ { "type": "list", "message": "Select payment method", "name": "payment", "choices": [], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q8 = [ { "type": "list", "message": "Enter rating", "name": "rating", "choices": ['1', '2', '3', '4', '5'], }, { "type": "input", "message": "Give Review", "name": "comment", } ] a2 = prompt(q2, style=style) if a2["option"] == "wishlisted books": books = db.get_wishlist(a1["userid"], False, False) books = dict(books) if books == {}: puts( colored.red( "You don't have any book in wishlisted books!" ) ) sys.exit() for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "best rated books": books = db.best_rated(False, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "genre wise books": cats = db.get_genre() for i in itertools.chain.from_iterable(cats): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) for i in a4["genre"]: books = db.genre_wise(i, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "my library": books = db.downloaded_book(a1["userid"], False) books = dict(books) if books == {}: puts( colored.red( "You don't have any books in your library!" ) ) sys.exit() q3[0]["message"] = "Select books if you want to give feedback" for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) if a3["purchase"] != []: for i in a3["purchase"]: puts(colored.green(i)) a8 = prompt(q8, style=style) s = db.feedback(a1["userid"], books[i], a8["rating"], a8["comment"]) print(s) sys.exit() elif a2["option"] == "search books": q9 = [ { "type": "input", "message": "Enter name of the book", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("book", "name, isbn", where="name='{}'".format(a9["search"]), output=False) books = db.display_query(s, output=False) if books == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) else: q2 = [ { "type": "list", "message": "Select category from which you want to wishlist/unwishlist book.", "name": "option", "choices": [ {"name": "remove wishlisted books"}, {"name": "best rated books"}, {"name": "genre wise books"}, {"name": "search books"} ], "validate": lambda answer: "You must choose at least one option." if len(answer) == 0 else True, } ] q4 = [ { "type": "checkbox", "message": "Select book you want to add to wishlist", "name": "purchase", "choices": [], } ] q3 = [ { "type": "checkbox", "message": "Select genre from which you want to add book to your wishlist", "name": "category", "choices": [], } ] a2 = prompt(q2, style=style) if a2["option"] == "remove wishlisted books": books = db.get_wishlist(a1["userid"], False, False) books = dict(books) if books == {}: puts( colored.red( "You don't have any book in wishlisted books!" ) ) sys.exit() for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "best rated books": books = db.best_rated(False, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) elif a2["option"] == "genre wise books": cats = db.get_genre() for i in itertools.chain.from_iterable(cats): q4[0]["choices"].append({"name": i}) a4 = prompt(q4, style=style) for i in a4["genre"]: books = db.genre_wise(i, False) books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) else: q9 = [ { "type": "input", "message": "Enter name of the book", "name": "search", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] a9 = prompt(q9, style=style) s = db.get("book", "name, isbn", where="name='{}'".format(a9["search"]), output=False) books = db.display_query(s, output=False) if books == []: puts( colored.red( "{} does not exist in database.".format(a9["search"]) ) ) else: books = dict(books) for i in books.keys(): q3[0]["choices"].append({"name": i}) a3 = prompt(q3, style=style) if a3["purchase"] == []: puts(colored.red("You have to select at least one book.")) else: for i in a3["purchase"]: s = db.wishlist(a1["userid"], books[i], False) if not s: puts(colored.red("Book can't be added to wishlist because book is already downloaded/wishlisted.")) else: puts(colored.green("{} added to wishlist successfully.".format(i))) sys.exit() if a3["purchase"] == []: puts(colored.red("You have to select at least one book.")) else: for i in a3["purchase"]: s = db.download(a1["userid"], books[i], isApp=False) if not s: puts( colored.red( "{} is a paid book, you have to pay to download it".format(i) ) ) a6 = prompt(q6, style=style) pays = {} if a6["buy"]: for j in ("debitcard", "creditcard", "ewallet", "netbanking"): q7[0]["choices"].append(Separator("= {} =".format(j))) payments = db.get_payment(a1["userid"], j, False) payments = dict(payments) for k in payments.keys(): q7[0]["choices"].append({"name": k}) pays.update(dict(payments)) a7 = prompt(q7, style=style) s = db.download(a1["userid"], books[i], pays.get(a7["payment"]), isApp=False) print(s) if s: puts(colored.green("{} added to your library successfully.".format(i))) else: puts(colored.green("{} added to your library successfully.".format(i))) elif a1["product"] == "Account": q2 = [ { "type": "list", "message": "Select option", "name": "option", "choices": ["add payment method", "edit user details", "delete account"], } ] q3 = [ { "type": "list", "message": "Select payment method you want to add", "name": "option", "choices": ["credit card", "debit card", "ewallet", "netbanking"], } ] q4 = [ { "type": "checkbox", "message": "Select fields you want to update", "name": "option", "choices": ["userid", "username", "country", "autoupdate"] } ] q6 = [ { "type": "confirm", "message": "Are you sure you want to delete your account.", "name": "option", } ] a2 = prompt(q2, style=style) if a2["option"] == "add payment method": a3 = prompt(q3, style=style) d = {} if a3["option"] in {"credit card", "debit card"}: for i in ("name", "expdate", "cardno"): q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format(i) a5 = prompt(q5, style=style) d.update(i=a5["option"]) db.add_card(d["name"], a1["userid"], d["expdate"], d["cardno"], "".join(a3["option"].split())) elif a3["option"] == "ewallet": for i in ("name", "walletid"): q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format(i) a5 = prompt(q5, style=style) d.update(i=a5["option"]) db.add_wallet(a1["userid"], d["name"], d["walletid"]) else: q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format("bank name") a5 = prompt(q5, style=style) db.add_netbank(a1["userid"], a5["option"]) elif a2["option"] == "edit user details": a4 = prompt(q4, style=style) if a4["option"] != []: ans = [] for i in a4["option"]: q5 = [ { "type": "input", "message": "Enter {}", "name": "option", "validate": lambda text: len(text) != 0 or "Field can't be empty.", } ] q5[0]["message"] = q5[0]["message"].format(i) a5 = prompt(q5, style=style) ans.append(a5["option"]) kwargs = dict([a4["option"], ans]) db.update("users", "userid='{}'".format(a1["userid"]), **kwargs) else: a6 = prompt(q6, style=style) if a6["option"]: db.delete("users", userid=a1["userid"])
fi
0.049314
# default # default
3.105864
3
gpsimage/api.py
dima-kov/gpsimage
4
6617383
<reponame>dima-kov/gpsimage #!/usr/bin/python # coding: utf8 from .base import GPSImage def open(path): """Open GPSImage :param ``image``: Image filepath """ return GPSImage(path)
#!/usr/bin/python # coding: utf8 from .base import GPSImage def open(path): """Open GPSImage :param ``image``: Image filepath """ return GPSImage(path)
en
0.299711
#!/usr/bin/python # coding: utf8 Open GPSImage :param ``image``: Image filepath
2.112419
2
Trakttv.bundle/Contents/Tests/tests/helpers/__init__.py
disrupted/Trakttv.bundle
1,346
6617384
from tests.helpers.io import *
from tests.helpers.io import *
none
1
1.049776
1
main.py
ricardochavezt/reading-list-mover
0
6617385
<reponame>ricardochavezt/reading-list-mover<filename>main.py import sys import json import urllib.request, urllib.error, urllib.parse import simplejson from xml.dom.minidom import parseString import xml.dom.minidom import oauth2 import configparser from io import StringIO import gzip class OAuthClient: def __init__(self, key, secret, user, password): consumer = oauth2.Consumer(key, secret) client = oauth2.Client(consumer) resp, content = client.request(self.token_url, "POST", urllib.parse.urlencode({ 'x_auth_mode': 'client_auth', 'x_auth_username': user, 'x_auth_password': password })) token = dict(urllib.parse.parse_qsl(content.decode('UTF-8'))) token = oauth2.Token(token['oauth_token'], token['oauth_token_secret']) self.http = oauth2.Client(consumer, token) def getBookmarks(self): response, data = self.http.request(self.get_url, method='GET') bookmarks = [] jsonData = simplejson.loads(data) for b in simplejson.loads(data)['bookmarks']: article = b['article'] bookmarks.append({'url' : article['url'], 'title' : article['title']}) return bookmarks def addBookmark(self, bookmark): self.http.request(self.add_url, method='POST', body=urllib.parse.urlencode({ 'url': bookmark['url'], 'title': bookmark['title'].encode('utf-8') })) class Readability(OAuthClient): def __init__(self, key, secret, user, password): self.token_url = 'https://www.readability.com/api/rest/v1/oauth/access_token/' self.get_url = 'https://www.readability.com/api/rest/v1/bookmarks' self.add_url = 'https://www.readability.com/api/rest/v1/bookmarks' OAuthClient.__init__(self, key, secret, user, password) class Instapaper(OAuthClient): def __init__(self, key, secret, user, password): self.token_url = 'https://www.instapaper.com/api/1/oauth/access_token' self.get_url = 'https://www.instapaper.com/api/1/bookmarks/list?limit=500' self.add_url = 'https://www.instapaper.com/api/1/bookmarks/add' OAuthClient.__init__(self, key, secret, user, password) def getBookmarks(self): response, data = self.http.request(self.get_url, method='GET') bookmarks = [] jsonData = simplejson.loads(data) return [{'url': b['url'], 'title': b['title']} for b in jsonData if b['type'] == 'bookmark'] class HttpAuthClient: def __init__(self, user, password): passman = urllib.request.HTTPPasswordMgrWithDefaultRealm() passman.add_password(None, self.get_url, user, password) passman.add_password(None, self.add_url, user, password) authhandler = urllib.request.HTTPBasicAuthHandler(passman) self.url_opener = urllib.request.build_opener(authhandler) def open(self, url, data=None): return self.url_opener.open(url, data) class StackOverflow: def __init__(self, user): self.get_url = 'http://api.stackexchange.com/2.1/users/' + user + '/favorites?order=desc&sort=activity&site=stackoverflow' def getBookmarks(self): rsp = urllib.request.urlopen(self.get_url) if rsp.info().get('Content-Encoding') == 'gzip': buf = StringIO(rsp.read()) rsp = gzip.GzipFile(fileobj=buf) data = json.load(rsp) return [{'url' : b['link'], 'title' : b['title']} for b in data['items']] def addBookmark(self, bookmark): raise Exception('Not supported') class Github: def __init__(self, user): self.get_url = 'https://api.github.com/users/' + user + '/starred' def getBookmarks(self): rsp = urllib.request.urlopen(self.get_url) data = json.load(rsp) return [{'url' : b['url'], 'title' : b['name']} for b in data] def addBookmark(self, bookmark): raise Exception('Not supported') class Twitter: def __init__(self, user, api_key, api_secret, access_token, access_token_secret): self.get_url = "https://api.twitter.com/1.1/favorites/list.json?screen_name=" + user self.tweet_url_prefix = "https://twitter.com/" + user + "/status/" consumer = oauth2.Consumer(api_key, api_secret) token = oauth2.Token(access_token, access_token_secret) self.http = oauth2.Client(consumer, token) def getBookmarks(self): response, data = self.http.request(self.get_url, method='GET') bookmarks = [] for b in simplejson.loads(data): bookmarks.append({'url' : self.tweet_url_prefix + b['id_str'], 'title' : b['text']}) return bookmarks def addBookmark(self, bookmark): raise Exception('Not supported') class Diigo(HttpAuthClient): def __init__(self, user, password, key): self.get_url = 'https://secure.diigo.com/api/v2/bookmarks?key=' + key + '&user=' + user self.add_url = 'https://secure.diigo.com/api/v2/bookmarks' self.key = key HttpAuthClient.__init__(self, user, password) def getBookmarks(self): data = json.load(self.open(self.get_url)) return [{'url' : b['url'], 'title' : b['title']} for b in data] def addBookmark(self, bookmark): add_args=urllib.parse.urlencode({'url' : bookmark['url'], 'title' : bookmark['title'], 'key' : self.key, 'shared' : 'yes'}) self.open(self.add_url, add_args) ''' During testing the Diigo service sometimes returned a '500 Server error' when adding lots of bookmarks in rapid succession, adding a brief pause between 'add' operations seemed to fix it - YMMV time.sleep(1) ''' class DeliciousLike(HttpAuthClient): def __init__(self, user, password): HttpAuthClient.__init__(self, user, password) def getBookmarks(self): xml = self.open(self.get_url).read() dom = parseString(xml) urls = [] for n in dom.firstChild.childNodes: if n.nodeType == n.ELEMENT_NODE: urls.append({'url' : n.getAttribute('href'), 'title' : n.getAttribute('description')}) return urls def addBookmark(self, bookmark): params = urllib.parse.urlencode({'url' : bookmark['url'], 'description' : bookmark['title'].encode('utf-8')}) self.open(self.add_url + params) class PinBoard(DeliciousLike): def __init__(self, user, password): self.get_url = 'https://api.pinboard.in/v1/posts/all' self.add_url = 'https://api.pinboard.in/v1/posts/add?' DeliciousLike.__init__(self, user, password) class PinBoard2(DeliciousLike): def __init__(self, user, token): auth_token = user + ':' + token self.get_url = 'https://api.pinboard.in/v1/posts/all?auth_token=' + auth_token self.add_url = 'https://api.pinboard.in/v1/posts/add?auth_token=' + auth_token + '&' def open(self, url, data=None): return urllib.request.urlopen(url, data) class Delicious(DeliciousLike): def __init__(self, user, password): self.get_url = 'https://api.del.icio.us/v1/posts/all' self.add_url = 'https://api.del.icio.us/v1/posts/add?' DeliciousLike.__init__(self, user, password) class Pocket: def __init__(self, user, password, key): base_args=urllib.parse.urlencode({'username' : user, 'password' : password, 'apikey' : key}) self.get_url = 'https://readitlaterlist.com/v2/get?' + base_args + '&' self.add_url = 'https://readitlaterlist.com/v2/add?' + base_args + '&' def getBookmarks(self): get_args=urllib.parse.urlencode({'state' : 'unread'}) data = json.load(urllib.request.urlopen(self.get_url + get_args)) return [{'url' : b['url'], 'title' : b['title']} for b in list(data['list'].values())] def addBookmark(self, bookmark): add_args=urllib.parse.urlencode({'url' : bookmark['url']}) urllib.request.urlopen(self.add_url + add_args) config = configparser.RawConfigParser() config.read('config.txt') def buildReadability(): SECTION = 'Readability' return Readability(config.get(SECTION, 'key'), config.get(SECTION, 'secret'), config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildPocket(): SECTION = 'Pocket' return Pocket(config.get(SECTION, 'user'), config.get(SECTION, 'password'), config.get(SECTION, 'key')) def buildPinBoard(): SECTION = 'PinBoard' return PinBoard(config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildPinBoard2(): SECTION = 'PinBoard' return PinBoard2(config.get(SECTION, 'user'), config.get(SECTION, 'token')) def buildDelicious(): SECTION = 'Delicious' return Delicious(config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildInstapaper(): SECTION = 'Instapaper' return Instapaper(config.get(SECTION, 'key'), config.get(SECTION, 'secret'), config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildDiigo(): SECTION = 'Diigo' return Diigo(config.get(SECTION, 'user'), config.get(SECTION, 'password'), config.get(SECTION, 'key')) def buildStackOverflow(): SECTION = 'StackOverflow' return StackOverflow(config.get(SECTION, 'user')) def buildGithub(): SECTION = 'Github' return Github(config.get(SECTION, 'user')) def buildTwitter(): SECTION = 'Twitter' return Twitter(config.get(SECTION, 'user'), config.get(SECTION, 'api_key'), config.get(SECTION, 'api_secret'), config.get(SECTION, 'access_token'), config.get(SECTION, 'access_token_secret'))
import sys import json import urllib.request, urllib.error, urllib.parse import simplejson from xml.dom.minidom import parseString import xml.dom.minidom import oauth2 import configparser from io import StringIO import gzip class OAuthClient: def __init__(self, key, secret, user, password): consumer = oauth2.Consumer(key, secret) client = oauth2.Client(consumer) resp, content = client.request(self.token_url, "POST", urllib.parse.urlencode({ 'x_auth_mode': 'client_auth', 'x_auth_username': user, 'x_auth_password': password })) token = dict(urllib.parse.parse_qsl(content.decode('UTF-8'))) token = oauth2.Token(token['oauth_token'], token['oauth_token_secret']) self.http = oauth2.Client(consumer, token) def getBookmarks(self): response, data = self.http.request(self.get_url, method='GET') bookmarks = [] jsonData = simplejson.loads(data) for b in simplejson.loads(data)['bookmarks']: article = b['article'] bookmarks.append({'url' : article['url'], 'title' : article['title']}) return bookmarks def addBookmark(self, bookmark): self.http.request(self.add_url, method='POST', body=urllib.parse.urlencode({ 'url': bookmark['url'], 'title': bookmark['title'].encode('utf-8') })) class Readability(OAuthClient): def __init__(self, key, secret, user, password): self.token_url = 'https://www.readability.com/api/rest/v1/oauth/access_token/' self.get_url = 'https://www.readability.com/api/rest/v1/bookmarks' self.add_url = 'https://www.readability.com/api/rest/v1/bookmarks' OAuthClient.__init__(self, key, secret, user, password) class Instapaper(OAuthClient): def __init__(self, key, secret, user, password): self.token_url = 'https://www.instapaper.com/api/1/oauth/access_token' self.get_url = 'https://www.instapaper.com/api/1/bookmarks/list?limit=500' self.add_url = 'https://www.instapaper.com/api/1/bookmarks/add' OAuthClient.__init__(self, key, secret, user, password) def getBookmarks(self): response, data = self.http.request(self.get_url, method='GET') bookmarks = [] jsonData = simplejson.loads(data) return [{'url': b['url'], 'title': b['title']} for b in jsonData if b['type'] == 'bookmark'] class HttpAuthClient: def __init__(self, user, password): passman = urllib.request.HTTPPasswordMgrWithDefaultRealm() passman.add_password(None, self.get_url, user, password) passman.add_password(None, self.add_url, user, password) authhandler = urllib.request.HTTPBasicAuthHandler(passman) self.url_opener = urllib.request.build_opener(authhandler) def open(self, url, data=None): return self.url_opener.open(url, data) class StackOverflow: def __init__(self, user): self.get_url = 'http://api.stackexchange.com/2.1/users/' + user + '/favorites?order=desc&sort=activity&site=stackoverflow' def getBookmarks(self): rsp = urllib.request.urlopen(self.get_url) if rsp.info().get('Content-Encoding') == 'gzip': buf = StringIO(rsp.read()) rsp = gzip.GzipFile(fileobj=buf) data = json.load(rsp) return [{'url' : b['link'], 'title' : b['title']} for b in data['items']] def addBookmark(self, bookmark): raise Exception('Not supported') class Github: def __init__(self, user): self.get_url = 'https://api.github.com/users/' + user + '/starred' def getBookmarks(self): rsp = urllib.request.urlopen(self.get_url) data = json.load(rsp) return [{'url' : b['url'], 'title' : b['name']} for b in data] def addBookmark(self, bookmark): raise Exception('Not supported') class Twitter: def __init__(self, user, api_key, api_secret, access_token, access_token_secret): self.get_url = "https://api.twitter.com/1.1/favorites/list.json?screen_name=" + user self.tweet_url_prefix = "https://twitter.com/" + user + "/status/" consumer = oauth2.Consumer(api_key, api_secret) token = oauth2.Token(access_token, access_token_secret) self.http = oauth2.Client(consumer, token) def getBookmarks(self): response, data = self.http.request(self.get_url, method='GET') bookmarks = [] for b in simplejson.loads(data): bookmarks.append({'url' : self.tweet_url_prefix + b['id_str'], 'title' : b['text']}) return bookmarks def addBookmark(self, bookmark): raise Exception('Not supported') class Diigo(HttpAuthClient): def __init__(self, user, password, key): self.get_url = 'https://secure.diigo.com/api/v2/bookmarks?key=' + key + '&user=' + user self.add_url = 'https://secure.diigo.com/api/v2/bookmarks' self.key = key HttpAuthClient.__init__(self, user, password) def getBookmarks(self): data = json.load(self.open(self.get_url)) return [{'url' : b['url'], 'title' : b['title']} for b in data] def addBookmark(self, bookmark): add_args=urllib.parse.urlencode({'url' : bookmark['url'], 'title' : bookmark['title'], 'key' : self.key, 'shared' : 'yes'}) self.open(self.add_url, add_args) ''' During testing the Diigo service sometimes returned a '500 Server error' when adding lots of bookmarks in rapid succession, adding a brief pause between 'add' operations seemed to fix it - YMMV time.sleep(1) ''' class DeliciousLike(HttpAuthClient): def __init__(self, user, password): HttpAuthClient.__init__(self, user, password) def getBookmarks(self): xml = self.open(self.get_url).read() dom = parseString(xml) urls = [] for n in dom.firstChild.childNodes: if n.nodeType == n.ELEMENT_NODE: urls.append({'url' : n.getAttribute('href'), 'title' : n.getAttribute('description')}) return urls def addBookmark(self, bookmark): params = urllib.parse.urlencode({'url' : bookmark['url'], 'description' : bookmark['title'].encode('utf-8')}) self.open(self.add_url + params) class PinBoard(DeliciousLike): def __init__(self, user, password): self.get_url = 'https://api.pinboard.in/v1/posts/all' self.add_url = 'https://api.pinboard.in/v1/posts/add?' DeliciousLike.__init__(self, user, password) class PinBoard2(DeliciousLike): def __init__(self, user, token): auth_token = user + ':' + token self.get_url = 'https://api.pinboard.in/v1/posts/all?auth_token=' + auth_token self.add_url = 'https://api.pinboard.in/v1/posts/add?auth_token=' + auth_token + '&' def open(self, url, data=None): return urllib.request.urlopen(url, data) class Delicious(DeliciousLike): def __init__(self, user, password): self.get_url = 'https://api.del.icio.us/v1/posts/all' self.add_url = 'https://api.del.icio.us/v1/posts/add?' DeliciousLike.__init__(self, user, password) class Pocket: def __init__(self, user, password, key): base_args=urllib.parse.urlencode({'username' : user, 'password' : password, 'apikey' : key}) self.get_url = 'https://readitlaterlist.com/v2/get?' + base_args + '&' self.add_url = 'https://readitlaterlist.com/v2/add?' + base_args + '&' def getBookmarks(self): get_args=urllib.parse.urlencode({'state' : 'unread'}) data = json.load(urllib.request.urlopen(self.get_url + get_args)) return [{'url' : b['url'], 'title' : b['title']} for b in list(data['list'].values())] def addBookmark(self, bookmark): add_args=urllib.parse.urlencode({'url' : bookmark['url']}) urllib.request.urlopen(self.add_url + add_args) config = configparser.RawConfigParser() config.read('config.txt') def buildReadability(): SECTION = 'Readability' return Readability(config.get(SECTION, 'key'), config.get(SECTION, 'secret'), config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildPocket(): SECTION = 'Pocket' return Pocket(config.get(SECTION, 'user'), config.get(SECTION, 'password'), config.get(SECTION, 'key')) def buildPinBoard(): SECTION = 'PinBoard' return PinBoard(config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildPinBoard2(): SECTION = 'PinBoard' return PinBoard2(config.get(SECTION, 'user'), config.get(SECTION, 'token')) def buildDelicious(): SECTION = 'Delicious' return Delicious(config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildInstapaper(): SECTION = 'Instapaper' return Instapaper(config.get(SECTION, 'key'), config.get(SECTION, 'secret'), config.get(SECTION, 'user'), config.get(SECTION, 'password')) def buildDiigo(): SECTION = 'Diigo' return Diigo(config.get(SECTION, 'user'), config.get(SECTION, 'password'), config.get(SECTION, 'key')) def buildStackOverflow(): SECTION = 'StackOverflow' return StackOverflow(config.get(SECTION, 'user')) def buildGithub(): SECTION = 'Github' return Github(config.get(SECTION, 'user')) def buildTwitter(): SECTION = 'Twitter' return Twitter(config.get(SECTION, 'user'), config.get(SECTION, 'api_key'), config.get(SECTION, 'api_secret'), config.get(SECTION, 'access_token'), config.get(SECTION, 'access_token_secret'))
en
0.878872
During testing the Diigo service sometimes returned a '500 Server error' when adding lots of bookmarks in rapid succession, adding a brief pause between 'add' operations seemed to fix it - YMMV time.sleep(1)
2.887411
3
Lessons/source/try_this.py
campbellmarianna/Core-Data-Structures
0
6617386
<gh_stars>0 #encode function psuedocode # Inpsired by <NAME> # create var with string type named encode_str # create var current_power value with value int 0 # create var finished set to False # create empty list named list_of_powers # Run a loop while finished is False # multiply the given bass with an exponent of the var set to zero store the product in a var named power_vlue # check if power_value is less than the given number # if it is insert current_power at index[ ] zero into the list list_of_power # okay if that first condition wasn't true check if the power_value is equal to the number # if it is insert current_power at index 0 # set finished to True # if none of the first conditions were true # set finished to True # loop through list_of_powers # multiply given bases by power and set that equal to a variable power_value # divide given number by power_value and set it to limit make that value stored in limit as a int() # deincrement by the product times the limit # increment encode_str var by string
#encode function psuedocode # Inpsired by <NAME> # create var with string type named encode_str # create var current_power value with value int 0 # create var finished set to False # create empty list named list_of_powers # Run a loop while finished is False # multiply the given bass with an exponent of the var set to zero store the product in a var named power_vlue # check if power_value is less than the given number # if it is insert current_power at index[ ] zero into the list list_of_power # okay if that first condition wasn't true check if the power_value is equal to the number # if it is insert current_power at index 0 # set finished to True # if none of the first conditions were true # set finished to True # loop through list_of_powers # multiply given bases by power and set that equal to a variable power_value # divide given number by power_value and set it to limit make that value stored in limit as a int() # deincrement by the product times the limit # increment encode_str var by string
en
0.840113
#encode function psuedocode # Inpsired by <NAME> # create var with string type named encode_str # create var current_power value with value int 0 # create var finished set to False # create empty list named list_of_powers # Run a loop while finished is False # multiply the given bass with an exponent of the var set to zero store the product in a var named power_vlue # check if power_value is less than the given number # if it is insert current_power at index[ ] zero into the list list_of_power # okay if that first condition wasn't true check if the power_value is equal to the number # if it is insert current_power at index 0 # set finished to True # if none of the first conditions were true # set finished to True # loop through list_of_powers # multiply given bases by power and set that equal to a variable power_value # divide given number by power_value and set it to limit make that value stored in limit as a int() # deincrement by the product times the limit # increment encode_str var by string
3.506721
4
selenium__examples/hide_window__invisible__headless.py
DazEB2/SimplePyScripts
117
6617387
#!/usr/bin/env python3 # -*- coding: utf-8 -*- __author__ = 'ipetrash' # pip install selenium from selenium import webdriver from selenium.webdriver.firefox.options import Options options = Options() options.add_argument('--headless') driver = webdriver.Firefox(options=options) driver.get('https://www.google.com/doodles') print('Title: "{}"'.format(driver.title)) driver.quit()
#!/usr/bin/env python3 # -*- coding: utf-8 -*- __author__ = 'ipetrash' # pip install selenium from selenium import webdriver from selenium.webdriver.firefox.options import Options options = Options() options.add_argument('--headless') driver = webdriver.Firefox(options=options) driver.get('https://www.google.com/doodles') print('Title: "{}"'.format(driver.title)) driver.quit()
en
0.318347
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # pip install selenium
2.517881
3
search/coinsearch.py
skwongg/coins
1
6617388
from elasticsearch import Elasticsearch from coin.models import Coin import requests import os es = Elasticsearch() def build_coin_index(): es.indices.create(index='coins', ignore=400) response = es.search() for coin in Coin.objects.all(): es.index(index="coins", doc_type="coin", id=coin.id, body={ "id": coin.pk, "name": coin.name, "ticker": coin.ticker, "pair": coin.pair, "price": coin.price, "btc_price": coin.btc_price, "icon_url": coin.icon_url } ) def search(querystring): ES_COIN_SEARCH_URL = os.environ.get("ES_COIN_SEARCH_URL") + """size=10&q=pair:*{0}*""".format(querystring) res = requests.get(ES_COIN_SEARCH_URL).json() return res
from elasticsearch import Elasticsearch from coin.models import Coin import requests import os es = Elasticsearch() def build_coin_index(): es.indices.create(index='coins', ignore=400) response = es.search() for coin in Coin.objects.all(): es.index(index="coins", doc_type="coin", id=coin.id, body={ "id": coin.pk, "name": coin.name, "ticker": coin.ticker, "pair": coin.pair, "price": coin.price, "btc_price": coin.btc_price, "icon_url": coin.icon_url } ) def search(querystring): ES_COIN_SEARCH_URL = os.environ.get("ES_COIN_SEARCH_URL") + """size=10&q=pair:*{0}*""".format(querystring) res = requests.get(ES_COIN_SEARCH_URL).json() return res
en
0.111233
size=10&q=pair:*{0}*
2.789344
3
rl_toolkit/utils/variable_container.py
markub3327/rl-toolk
7
6617389
<gh_stars>1-10 import reverb import tensorflow as tf class VariableContainer: def __init__( self, # --- db_server: str, # --- table: str, variables: dict, ): self._table = table self._variables = variables # Initializes the reverb client self.tf_client = reverb.TFClient(server_address=db_server) # variables signature for variable container table self.signature = tf.nest.map_structure( lambda variable: tf.TensorSpec(variable.shape, dtype=variable.dtype), self._variables, ) self.dtypes = tf.nest.map_structure(lambda spec: spec.dtype, self.signature) def update_variables(self): sample = self.tf_client.sample(self._table, data_dtypes=[self.dtypes]).data[0] for variable, value in zip( tf.nest.flatten(self._variables), tf.nest.flatten(sample) ): variable.assign(value) def push_variables(self): self.tf_client.insert( data=tf.nest.flatten(self._variables), tables=tf.constant([self._table]), priorities=tf.constant([1.0], dtype=tf.float64), ) def __getitem__(self, key): return self._variables[key]
import reverb import tensorflow as tf class VariableContainer: def __init__( self, # --- db_server: str, # --- table: str, variables: dict, ): self._table = table self._variables = variables # Initializes the reverb client self.tf_client = reverb.TFClient(server_address=db_server) # variables signature for variable container table self.signature = tf.nest.map_structure( lambda variable: tf.TensorSpec(variable.shape, dtype=variable.dtype), self._variables, ) self.dtypes = tf.nest.map_structure(lambda spec: spec.dtype, self.signature) def update_variables(self): sample = self.tf_client.sample(self._table, data_dtypes=[self.dtypes]).data[0] for variable, value in zip( tf.nest.flatten(self._variables), tf.nest.flatten(sample) ): variable.assign(value) def push_variables(self): self.tf_client.insert( data=tf.nest.flatten(self._variables), tables=tf.constant([self._table]), priorities=tf.constant([1.0], dtype=tf.float64), ) def __getitem__(self, key): return self._variables[key]
en
0.780953
# --- # --- # Initializes the reverb client # variables signature for variable container table
2.365169
2
Visualizer/Source/Visualizer/Plotting/TablePlot.py
NB4444/BachelorProjectEnergyManager
0
6617390
import pandas from IPython.display import display from typing import Any, List from Visualizer.Plotting.Plot import Plot class TablePlot(Plot): def __init__(self, title: str, table: List[Any], columns: List[str], maximum_column_width: int = None, maximum_columns: int = None, minimum_rows: int = None, maximum_rows: int = 50, interpolate: bool = False): super().__init__(title) self.table = table self.columns = columns self.maximum_column_width = maximum_column_width self.maximum_columns = maximum_columns self.minimum_rows = minimum_rows self.maximum_rows = maximum_rows self.interpolate = interpolate def on_plot(self): pandas.options.display.max_colwidth = self.maximum_column_width pandas.options.display.max_columns = self.maximum_columns pandas.options.display.min_rows = self.minimum_rows pandas.options.display.max_rows = self.maximum_rows display(self.pandas_table) @property def pandas_table(self): table = pandas.DataFrame(self.table, columns=self.columns).infer_objects() return table.interpolate(method="linear", limit_direction="both") if self.interpolate else table def merge(self, table_plot: "TablePlot"): # Add columns from the other table added_columns = 0 for column in table_plot.columns: if column not in self.columns: self.columns.append(column) added_columns += 1 # Add new empty values for any new columns new_table = [] for row in self.table: new_table.append(row + added_columns * [float("NaN")]) self.table = new_table # Add rows from the other table for row in table_plot.table: new_row = [] for column in self.columns: new_row.append(row[table_plot.columns.index(column)] if column in table_plot.columns else float("NaN")) self.table.append(new_row)
import pandas from IPython.display import display from typing import Any, List from Visualizer.Plotting.Plot import Plot class TablePlot(Plot): def __init__(self, title: str, table: List[Any], columns: List[str], maximum_column_width: int = None, maximum_columns: int = None, minimum_rows: int = None, maximum_rows: int = 50, interpolate: bool = False): super().__init__(title) self.table = table self.columns = columns self.maximum_column_width = maximum_column_width self.maximum_columns = maximum_columns self.minimum_rows = minimum_rows self.maximum_rows = maximum_rows self.interpolate = interpolate def on_plot(self): pandas.options.display.max_colwidth = self.maximum_column_width pandas.options.display.max_columns = self.maximum_columns pandas.options.display.min_rows = self.minimum_rows pandas.options.display.max_rows = self.maximum_rows display(self.pandas_table) @property def pandas_table(self): table = pandas.DataFrame(self.table, columns=self.columns).infer_objects() return table.interpolate(method="linear", limit_direction="both") if self.interpolate else table def merge(self, table_plot: "TablePlot"): # Add columns from the other table added_columns = 0 for column in table_plot.columns: if column not in self.columns: self.columns.append(column) added_columns += 1 # Add new empty values for any new columns new_table = [] for row in self.table: new_table.append(row + added_columns * [float("NaN")]) self.table = new_table # Add rows from the other table for row in table_plot.table: new_row = [] for column in self.columns: new_row.append(row[table_plot.columns.index(column)] if column in table_plot.columns else float("NaN")) self.table.append(new_row)
en
0.274878
# Add columns from the other table # Add new empty values for any new columns # Add rows from the other table
3.028429
3
alembic/versions/00031_85a1c0888f3d_.py
awesome-archive/ReadableWebProxy
193
6617391
<filename>alembic/versions/00031_85a1c0888f3d_.py """empty message Revision ID: <KEY> Revises: <PASSWORD> Create Date: 2017-03-08 04:51:21.957091 """ # revision identifiers, used by Alembic. revision = '<KEY>' down_revision = 'be<PASSWORD>' branch_labels = None depends_on = None from alembic import op import sqlalchemy as sa from sqlalchemy_utils.types import TSVectorType from sqlalchemy_searchable import make_searchable import sqlalchemy_utils # Patch in knowledge of the citext type, so it reflects properly. from sqlalchemy.dialects.postgresql.base import ischema_names import citext import queue import datetime from sqlalchemy.dialects.postgresql import ENUM from sqlalchemy.dialects.postgresql import JSON from sqlalchemy.dialects.postgresql import TSVECTOR ischema_names['citext'] = citext.CIText from sqlalchemy.ext.declarative import declarative_base from sqlalchemy.orm import sessionmaker, Session as BaseSession, relationship from sqlalchemy import Column from sqlalchemy import BigInteger from sqlalchemy import Integer from sqlalchemy import Text from sqlalchemy import Float from sqlalchemy import Boolean from sqlalchemy import DateTime from sqlalchemy import ForeignKey from sqlalchemy import PrimaryKeyConstraint from sqlalchemy import UniqueConstraint from sqlalchemy.orm import relationship from sqlalchemy.schema import UniqueConstraint Session = sessionmaker() Base = declarative_base() class RssFeedEntry(Base): __versioned__ = {} __tablename__ = 'rss_parser_funcs' name = 'rss_parser_funcs' id = Column(BigInteger, primary_key = True, index = True) last_changed = Column(DateTime, nullable=False) def upgrade(): ### commands auto generated by Alembic - please adjust! ### op.add_column('rss_parser_funcs', sa.Column('last_changed', sa.DateTime(), nullable=True)) op.add_column('rss_parser_funcs_version', sa.Column('last_changed', sa.DateTime(), autoincrement=False, nullable=True)) bind = op.get_bind() sess = Session(bind=bind) print("Updating date/time stamps for functions.") sess.query(RssFeedEntry).update({'last_changed' : datetime.datetime.now()}) sess.commit() print("Update done.") op.alter_column('rss_parser_funcs', 'last_changed', nullable=False) ### end Alembic commands ### def downgrade(): ### commands auto generated by Alembic - please adjust! ### op.drop_column('rss_parser_funcs_version', 'last_changed') op.drop_column('rss_parser_funcs', 'last_changed') ### end Alembic commands ###
<filename>alembic/versions/00031_85a1c0888f3d_.py """empty message Revision ID: <KEY> Revises: <PASSWORD> Create Date: 2017-03-08 04:51:21.957091 """ # revision identifiers, used by Alembic. revision = '<KEY>' down_revision = 'be<PASSWORD>' branch_labels = None depends_on = None from alembic import op import sqlalchemy as sa from sqlalchemy_utils.types import TSVectorType from sqlalchemy_searchable import make_searchable import sqlalchemy_utils # Patch in knowledge of the citext type, so it reflects properly. from sqlalchemy.dialects.postgresql.base import ischema_names import citext import queue import datetime from sqlalchemy.dialects.postgresql import ENUM from sqlalchemy.dialects.postgresql import JSON from sqlalchemy.dialects.postgresql import TSVECTOR ischema_names['citext'] = citext.CIText from sqlalchemy.ext.declarative import declarative_base from sqlalchemy.orm import sessionmaker, Session as BaseSession, relationship from sqlalchemy import Column from sqlalchemy import BigInteger from sqlalchemy import Integer from sqlalchemy import Text from sqlalchemy import Float from sqlalchemy import Boolean from sqlalchemy import DateTime from sqlalchemy import ForeignKey from sqlalchemy import PrimaryKeyConstraint from sqlalchemy import UniqueConstraint from sqlalchemy.orm import relationship from sqlalchemy.schema import UniqueConstraint Session = sessionmaker() Base = declarative_base() class RssFeedEntry(Base): __versioned__ = {} __tablename__ = 'rss_parser_funcs' name = 'rss_parser_funcs' id = Column(BigInteger, primary_key = True, index = True) last_changed = Column(DateTime, nullable=False) def upgrade(): ### commands auto generated by Alembic - please adjust! ### op.add_column('rss_parser_funcs', sa.Column('last_changed', sa.DateTime(), nullable=True)) op.add_column('rss_parser_funcs_version', sa.Column('last_changed', sa.DateTime(), autoincrement=False, nullable=True)) bind = op.get_bind() sess = Session(bind=bind) print("Updating date/time stamps for functions.") sess.query(RssFeedEntry).update({'last_changed' : datetime.datetime.now()}) sess.commit() print("Update done.") op.alter_column('rss_parser_funcs', 'last_changed', nullable=False) ### end Alembic commands ### def downgrade(): ### commands auto generated by Alembic - please adjust! ### op.drop_column('rss_parser_funcs_version', 'last_changed') op.drop_column('rss_parser_funcs', 'last_changed') ### end Alembic commands ###
en
0.513848
empty message Revision ID: <KEY> Revises: <PASSWORD> Create Date: 2017-03-08 04:51:21.957091 # revision identifiers, used by Alembic. # Patch in knowledge of the citext type, so it reflects properly. ### commands auto generated by Alembic - please adjust! ### ### end Alembic commands ### ### commands auto generated by Alembic - please adjust! ### ### end Alembic commands ###
1.751234
2
tools/count_blueprints.py
uggla/nova-specs
44
6617392
#!/usr/bin/env python # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import argparse import os import lib def get_options(): parser = argparse.ArgumentParser( description='Count blueprints for a given release. Requires ' 'launchpadlib to be installed.') parser.add_argument('release', help='The release to process.', choices=lib.get_releases()) return parser.parse_args() def count_blueprints(release): lp_nova = lib.get_lp_nova('count-specs') # Valid specifications are specifications that are not obsolete. blueprints = lp_nova.getSeries(name=release).valid_specifications targeted = len(blueprints) approved = 0 implemented = 0 unapproved_blueprint_names = set() for blueprint in blueprints: if blueprint.definition_status == 'Approved': approved += 1 else: unapproved_blueprint_names.add(blueprint.name) if blueprint.implementation_status == 'Implemented': implemented += 1 print('') print('Summary') print('-------') print('Number of Targeted blueprints: %d' % targeted) print('Number of Approved blueprints: %d' % approved) print('Number of Implemented blueprints: %d' % implemented) # Check for approved specs whose blueprints have not been approved cwd = os.getcwd() approved_dir = os.path.join(cwd, 'specs', release, 'approved') approved_specs = os.listdir(approved_dir) template_file = '%s-template.rst' % release for spec_fname in sorted(approved_specs): # get the blueprint name, it should be the name of the rst file if not spec_fname.endswith('.rst'): continue # check for the template file and skip that if spec_fname == template_file: continue bp_name = spec_fname.split('.rst')[0] if bp_name in unapproved_blueprint_names: print('WARNING: Blueprint for spec %s needs approval.' % spec_fname) def main(): opts = get_options() count_blueprints(opts.release) if __name__ == '__main__': main()
#!/usr/bin/env python # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import argparse import os import lib def get_options(): parser = argparse.ArgumentParser( description='Count blueprints for a given release. Requires ' 'launchpadlib to be installed.') parser.add_argument('release', help='The release to process.', choices=lib.get_releases()) return parser.parse_args() def count_blueprints(release): lp_nova = lib.get_lp_nova('count-specs') # Valid specifications are specifications that are not obsolete. blueprints = lp_nova.getSeries(name=release).valid_specifications targeted = len(blueprints) approved = 0 implemented = 0 unapproved_blueprint_names = set() for blueprint in blueprints: if blueprint.definition_status == 'Approved': approved += 1 else: unapproved_blueprint_names.add(blueprint.name) if blueprint.implementation_status == 'Implemented': implemented += 1 print('') print('Summary') print('-------') print('Number of Targeted blueprints: %d' % targeted) print('Number of Approved blueprints: %d' % approved) print('Number of Implemented blueprints: %d' % implemented) # Check for approved specs whose blueprints have not been approved cwd = os.getcwd() approved_dir = os.path.join(cwd, 'specs', release, 'approved') approved_specs = os.listdir(approved_dir) template_file = '%s-template.rst' % release for spec_fname in sorted(approved_specs): # get the blueprint name, it should be the name of the rst file if not spec_fname.endswith('.rst'): continue # check for the template file and skip that if spec_fname == template_file: continue bp_name = spec_fname.split('.rst')[0] if bp_name in unapproved_blueprint_names: print('WARNING: Blueprint for spec %s needs approval.' % spec_fname) def main(): opts = get_options() count_blueprints(opts.release) if __name__ == '__main__': main()
en
0.867795
#!/usr/bin/env python # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # Valid specifications are specifications that are not obsolete. # Check for approved specs whose blueprints have not been approved # get the blueprint name, it should be the name of the rst file # check for the template file and skip that
2.628018
3
tests/__init__.py
ludwiglierhammer/index_calculator
0
6617393
<filename>tests/__init__.py """Unit test package for index_calculator."""
<filename>tests/__init__.py """Unit test package for index_calculator."""
en
0.640701
Unit test package for index_calculator.
1.227488
1
scrapy_proxy_crawler/pipelines.py
DengZuoheng/scrapy_proxy_crawler
0
6617394
<reponame>DengZuoheng/scrapy_proxy_crawler<gh_stars>0 # -*- coding: utf-8 -*- # Define your item pipelines here # # Don't forget to add your pipeline to the ITEM_PIPELINES setting # See: http://doc.scrapy.org/en/latest/topics/item-pipeline.html from scrapy_proxy_crawler.items import * class ScrapyProxyCrawlerPipeline(object): def process_item(self, item, spider): if isinstance(item, ProxyItem): spider.logger.info("Accepted proxy: %s" % item['addr']) return item
# -*- coding: utf-8 -*- # Define your item pipelines here # # Don't forget to add your pipeline to the ITEM_PIPELINES setting # See: http://doc.scrapy.org/en/latest/topics/item-pipeline.html from scrapy_proxy_crawler.items import * class ScrapyProxyCrawlerPipeline(object): def process_item(self, item, spider): if isinstance(item, ProxyItem): spider.logger.info("Accepted proxy: %s" % item['addr']) return item
en
0.663433
# -*- coding: utf-8 -*- # Define your item pipelines here # # Don't forget to add your pipeline to the ITEM_PIPELINES setting # See: http://doc.scrapy.org/en/latest/topics/item-pipeline.html
2.042523
2
boto3_type_annotations/boto3_type_annotations/rekognition/paginator.py
cowboygneox/boto3_type_annotations
119
6617395
<filename>boto3_type_annotations/boto3_type_annotations/rekognition/paginator.py from typing import Dict from botocore.paginate import Paginator class ListCollections(Paginator): def paginate(self, PaginationConfig: Dict = None) -> Dict: pass class ListFaces(Paginator): def paginate(self, CollectionId: str, PaginationConfig: Dict = None) -> Dict: pass class ListStreamProcessors(Paginator): def paginate(self, PaginationConfig: Dict = None) -> Dict: pass
<filename>boto3_type_annotations/boto3_type_annotations/rekognition/paginator.py from typing import Dict from botocore.paginate import Paginator class ListCollections(Paginator): def paginate(self, PaginationConfig: Dict = None) -> Dict: pass class ListFaces(Paginator): def paginate(self, CollectionId: str, PaginationConfig: Dict = None) -> Dict: pass class ListStreamProcessors(Paginator): def paginate(self, PaginationConfig: Dict = None) -> Dict: pass
none
1
2.204705
2
2.py
syheliel/CyberBattleSim-1
0
6617396
from diagrams import Diagram, Node,Edge from diagrams.custom import Custom shapes = [ "box","polygon","ellipse","oval","circle", "point","egg","triangle","plaintext","plain", "diamond","trapezium","parallelogram","house","pentagon", "hexagon","septagon","octagon","doublecircle","doubleoctagon", "Mdiamond","Msquare","Mcircle", "rect","rectangle","square","star","none","underline","cylinder", "tripleoctagon","invtriangle","invtrapezium","invhouse", "note","tab","folder","box3d","component","promoter", "cds","terminator","utr","primersite","restrictionsite", "fivepoverhang","threepoverhang","noverhang","assembly", "signature","insulator","ribosite","rnastab","proteasesite", "proteinstab","rpromoter","rarrow","larrow","lpromoter", ] num_shapes = len(shapes) shapes_per_row = 5 num_of_rows = int(num_shapes / shapes_per_row) + (num_shapes % shapes_per_row > 0) with Diagram("\n\nUsing Graphviz Shapes") as diag: for row in range(num_of_rows)[::-1]: items_in_row = shapes_per_row - (row+1) * shapes_per_row // num_shapes shapes_i = row * shapes_per_row node_list = [ 'Node(' f'shape="{shapes[shapes_i+item_num]}", ' f'label="\\n"+"{shapes[shapes_i+item_num]}", ' 'labelloc="t", ' 'style="solid") - Edge(penwidth="0.0")' for item_num in range(items_in_row)[:-1] ] + ['Node(' f'shape="{shapes[shapes_i+items_in_row-1]}", ' f'label="\\n"+"{shapes[shapes_i+items_in_row-1]}", ' 'labelloc="t", ' 'style="solid")'] node_row = "-".join(node_list) print(len(node_list)) eval(node_row) diag
from diagrams import Diagram, Node,Edge from diagrams.custom import Custom shapes = [ "box","polygon","ellipse","oval","circle", "point","egg","triangle","plaintext","plain", "diamond","trapezium","parallelogram","house","pentagon", "hexagon","septagon","octagon","doublecircle","doubleoctagon", "Mdiamond","Msquare","Mcircle", "rect","rectangle","square","star","none","underline","cylinder", "tripleoctagon","invtriangle","invtrapezium","invhouse", "note","tab","folder","box3d","component","promoter", "cds","terminator","utr","primersite","restrictionsite", "fivepoverhang","threepoverhang","noverhang","assembly", "signature","insulator","ribosite","rnastab","proteasesite", "proteinstab","rpromoter","rarrow","larrow","lpromoter", ] num_shapes = len(shapes) shapes_per_row = 5 num_of_rows = int(num_shapes / shapes_per_row) + (num_shapes % shapes_per_row > 0) with Diagram("\n\nUsing Graphviz Shapes") as diag: for row in range(num_of_rows)[::-1]: items_in_row = shapes_per_row - (row+1) * shapes_per_row // num_shapes shapes_i = row * shapes_per_row node_list = [ 'Node(' f'shape="{shapes[shapes_i+item_num]}", ' f'label="\\n"+"{shapes[shapes_i+item_num]}", ' 'labelloc="t", ' 'style="solid") - Edge(penwidth="0.0")' for item_num in range(items_in_row)[:-1] ] + ['Node(' f'shape="{shapes[shapes_i+items_in_row-1]}", ' f'label="\\n"+"{shapes[shapes_i+items_in_row-1]}", ' 'labelloc="t", ' 'style="solid")'] node_row = "-".join(node_list) print(len(node_list)) eval(node_row) diag
none
1
3.013172
3
rectarea.py
roshanrobotics/python-program
0
6617397
class rect(): def __init__(self,width,length): self.width=width self.length=length def area(self): return self.width*self.length a=int(input("Enter length of rectangle: ")) b=int(input("Enter width of rectangle: ")) obj=rect(a,b) print("Area of rectangle:",obj.area())
class rect(): def __init__(self,width,length): self.width=width self.length=length def area(self): return self.width*self.length a=int(input("Enter length of rectangle: ")) b=int(input("Enter width of rectangle: ")) obj=rect(a,b) print("Area of rectangle:",obj.area())
none
1
3.949383
4
src/lecture1/hog_svm.py
Fassial/zju-intern
1
6617398
<reponame>Fassial/zju-intern """ Created on July 25 01:45, 2020 @author: fassial """ import math import numpy as np from sklearn.svm import SVC # local dep import preprocess class hog_svm: def __init__(self): self.svm = SVC( C = 1.0 ) def train(x_train, y_train, batch_size = 100): n_cycle = math.ceil(x_train.shape[0] / batch_size) print("training...") for i in range(n_cycle): print("training..." + str(i) + "/" + str(n_cycle)) xi_train = x_train[i*batch_size:(i+1)*batch_size,:] if (i+1)*batch_size <= x_train.shape[0] else x_train[i*batch_size:,:] yi_train = y_train[i*batch_size:(i+1)*batch_size] if (i+1)*batch_size <= y_train.shape[0] else y_train[i*batch_size:] self.svm.fit(xi_train, yi_train) def score(x_test, y_test, batch_size = 100): score = 0 n_cycle = math.ceil(x_test.shape[0] / batch_size) print("testing...") for i in range(n_cycle): print("testing..." + str(i) + "/" + str(n_cycle)) xi_test = x_test[i*batch_size:(i+1)*batch_size,:] if (i+1)*batch_size <= x_test.shape[0] else x_test[i*batch_size:,:] yi_test = y_test[i*batch_size:(i+1)*batch_size] if (i+1)*batch_size <= y_test.shape[0] else y_test[i*batch_size:] score += self.svm.score(xi_test, yi_test) * xi_test.shape[0] score /= x_test.shape[0] return score if __name__ == "__main__": hog_svm_inst = hog_svm() x_train, y_train, x_test, y_test = preprocess.load_data() hog_svm_inst.train(x_train, y_train) score = hog_svm_inst.score(x_test, y_test) print("score: " + str(score))
""" Created on July 25 01:45, 2020 @author: fassial """ import math import numpy as np from sklearn.svm import SVC # local dep import preprocess class hog_svm: def __init__(self): self.svm = SVC( C = 1.0 ) def train(x_train, y_train, batch_size = 100): n_cycle = math.ceil(x_train.shape[0] / batch_size) print("training...") for i in range(n_cycle): print("training..." + str(i) + "/" + str(n_cycle)) xi_train = x_train[i*batch_size:(i+1)*batch_size,:] if (i+1)*batch_size <= x_train.shape[0] else x_train[i*batch_size:,:] yi_train = y_train[i*batch_size:(i+1)*batch_size] if (i+1)*batch_size <= y_train.shape[0] else y_train[i*batch_size:] self.svm.fit(xi_train, yi_train) def score(x_test, y_test, batch_size = 100): score = 0 n_cycle = math.ceil(x_test.shape[0] / batch_size) print("testing...") for i in range(n_cycle): print("testing..." + str(i) + "/" + str(n_cycle)) xi_test = x_test[i*batch_size:(i+1)*batch_size,:] if (i+1)*batch_size <= x_test.shape[0] else x_test[i*batch_size:,:] yi_test = y_test[i*batch_size:(i+1)*batch_size] if (i+1)*batch_size <= y_test.shape[0] else y_test[i*batch_size:] score += self.svm.score(xi_test, yi_test) * xi_test.shape[0] score /= x_test.shape[0] return score if __name__ == "__main__": hog_svm_inst = hog_svm() x_train, y_train, x_test, y_test = preprocess.load_data() hog_svm_inst.train(x_train, y_train) score = hog_svm_inst.score(x_test, y_test) print("score: " + str(score))
en
0.873684
Created on July 25 01:45, 2020 @author: fassial # local dep
2.711082
3
986_interval_list_intersect.py
ojhaanshu87/LeetCode
0
6617399
<filename>986_interval_list_intersect.py """ Given two lists of closed intervals, each list of intervals is pairwise disjoint and in sorted order. Return the intersection of these two interval lists. (Formally, a closed interval [a, b] (with a <= b) denotes the set of real numbers x with a <= x <= b. The intersection of two closed intervals is a set of real numbers that is either empty, or can be represented as a closed interval. For example, the intersection of [1, 3] and [2, 4] is [2, 3].) Input: A = [[0,2],[5,10],[13,23],[24,25]], B = [[1,5],[8,12],[15,24],[25,26]] Output: [[1,2],[5,5],[8,10],[15,23],[24,24],[25,25]] Note: 0 <= A.length < 1000 0 <= B.length < 1000 0 <= A[i].start, A[i].end, B[i].start, B[i].end < 10^9 """ #ALGORITHM #If A[0] has the smallest endpoint, it can only intersect B[0]. After, we can discard A[0] since it cannot intersect anything else. #Similarly, if B[0] has the smallest endpoint, it can only intersect A[0], and we can discard B[0] after since it cannot intersect anything else. #We use two pointers, i and j, to virtually manage "discarding" A[0] or B[0] repeatedly. #Time Complexity: O(M + N)O(M+N), where M, NM,N are the lengths of A and B respectively. #Space Complexity: O(M + N)O(M+N), the maximum size of the answer. class Solution(object): def intervalIntersection(self, A, B): res, ptr_a, ptr_b = [], 0, 0 while ptr_a < len(A) and ptr_b < len(B): start = max(A[ptr_a][0], B[ptr_b][0]) end = min(A[ptr_a][1], B[ptr_b][1]) if start <= end: res.append([start, end]) #remove interval with smallest endpoint if A[ptr_a][1] < B[ptr_b][1]: ptr_a += 1 else: ptr_b += 1 return res
<filename>986_interval_list_intersect.py """ Given two lists of closed intervals, each list of intervals is pairwise disjoint and in sorted order. Return the intersection of these two interval lists. (Formally, a closed interval [a, b] (with a <= b) denotes the set of real numbers x with a <= x <= b. The intersection of two closed intervals is a set of real numbers that is either empty, or can be represented as a closed interval. For example, the intersection of [1, 3] and [2, 4] is [2, 3].) Input: A = [[0,2],[5,10],[13,23],[24,25]], B = [[1,5],[8,12],[15,24],[25,26]] Output: [[1,2],[5,5],[8,10],[15,23],[24,24],[25,25]] Note: 0 <= A.length < 1000 0 <= B.length < 1000 0 <= A[i].start, A[i].end, B[i].start, B[i].end < 10^9 """ #ALGORITHM #If A[0] has the smallest endpoint, it can only intersect B[0]. After, we can discard A[0] since it cannot intersect anything else. #Similarly, if B[0] has the smallest endpoint, it can only intersect A[0], and we can discard B[0] after since it cannot intersect anything else. #We use two pointers, i and j, to virtually manage "discarding" A[0] or B[0] repeatedly. #Time Complexity: O(M + N)O(M+N), where M, NM,N are the lengths of A and B respectively. #Space Complexity: O(M + N)O(M+N), the maximum size of the answer. class Solution(object): def intervalIntersection(self, A, B): res, ptr_a, ptr_b = [], 0, 0 while ptr_a < len(A) and ptr_b < len(B): start = max(A[ptr_a][0], B[ptr_b][0]) end = min(A[ptr_a][1], B[ptr_b][1]) if start <= end: res.append([start, end]) #remove interval with smallest endpoint if A[ptr_a][1] < B[ptr_b][1]: ptr_a += 1 else: ptr_b += 1 return res
en
0.901523
Given two lists of closed intervals, each list of intervals is pairwise disjoint and in sorted order. Return the intersection of these two interval lists. (Formally, a closed interval [a, b] (with a <= b) denotes the set of real numbers x with a <= x <= b. The intersection of two closed intervals is a set of real numbers that is either empty, or can be represented as a closed interval. For example, the intersection of [1, 3] and [2, 4] is [2, 3].) Input: A = [[0,2],[5,10],[13,23],[24,25]], B = [[1,5],[8,12],[15,24],[25,26]] Output: [[1,2],[5,5],[8,10],[15,23],[24,24],[25,25]] Note: 0 <= A.length < 1000 0 <= B.length < 1000 0 <= A[i].start, A[i].end, B[i].start, B[i].end < 10^9 #ALGORITHM #If A[0] has the smallest endpoint, it can only intersect B[0]. After, we can discard A[0] since it cannot intersect anything else. #Similarly, if B[0] has the smallest endpoint, it can only intersect A[0], and we can discard B[0] after since it cannot intersect anything else. #We use two pointers, i and j, to virtually manage "discarding" A[0] or B[0] repeatedly. #Time Complexity: O(M + N)O(M+N), where M, NM,N are the lengths of A and B respectively. #Space Complexity: O(M + N)O(M+N), the maximum size of the answer. #remove interval with smallest endpoint
3.895559
4
chapter5/beautifulsoup_csv.py
mysodalife/spider_program
3
6617400
# -*- coding: utf-8 -*- # @Time : 2018/10/12 11:37 # @Author : sodalife # @File : beautifulsoup_csv.py # @Description : csv 文件来存储 import csv import requests import chardet import re from lxml import etree User_Agent = 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/69.0.3497.100 Safari/537.36' headers = {'User-Agent': User_Agent} response = requests.get('http://seputu.com', headers=headers) response.encoding = chardet.detect(response.content)['encoding'] html = etree.HTML(response.text) mulus = html.xpath('.//div[@class="mulu"]') pattern = re.compile(r'\s*\[(.*)\]\s+(.*)') rows = [] for mulu in mulus: h2_text = mulu.xpath('.//h2/text()') if len(h2_text) > 0: title = h2_text[0] print(title.encode('utf-8')) a_s = mulu.xpath('./div[@class="box"]/ul/li/a') for a in a_s: href = a.xpath('./@href')[0] box_title = a.xpath('./@title')[0] match = re.search(pattern, box_title) if match is not None: date = match.group(1) # bytes 转 str real_title = match.group(2) content = [title, real_title, href, date] rows.append(content) headers = ['title', 'read_title', 'href', 'date'] with open('qiye.csv', 'w', newline='') as f: f_csv = csv.writer(f) f_csv.writerow(headers) f_csv.writerows(rows)
# -*- coding: utf-8 -*- # @Time : 2018/10/12 11:37 # @Author : sodalife # @File : beautifulsoup_csv.py # @Description : csv 文件来存储 import csv import requests import chardet import re from lxml import etree User_Agent = 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/69.0.3497.100 Safari/537.36' headers = {'User-Agent': User_Agent} response = requests.get('http://seputu.com', headers=headers) response.encoding = chardet.detect(response.content)['encoding'] html = etree.HTML(response.text) mulus = html.xpath('.//div[@class="mulu"]') pattern = re.compile(r'\s*\[(.*)\]\s+(.*)') rows = [] for mulu in mulus: h2_text = mulu.xpath('.//h2/text()') if len(h2_text) > 0: title = h2_text[0] print(title.encode('utf-8')) a_s = mulu.xpath('./div[@class="box"]/ul/li/a') for a in a_s: href = a.xpath('./@href')[0] box_title = a.xpath('./@title')[0] match = re.search(pattern, box_title) if match is not None: date = match.group(1) # bytes 转 str real_title = match.group(2) content = [title, real_title, href, date] rows.append(content) headers = ['title', 'read_title', 'href', 'date'] with open('qiye.csv', 'w', newline='') as f: f_csv = csv.writer(f) f_csv.writerow(headers) f_csv.writerows(rows)
en
0.262871
# -*- coding: utf-8 -*- # @Time : 2018/10/12 11:37 # @Author : sodalife # @File : beautifulsoup_csv.py # @Description : csv 文件来存储 # bytes 转 str
3.061314
3
qaoa_vrp/build_circuit.py
vivekkatial/HAQC
1
6617401
import base64 import uuid from collections import defaultdict from itertools import count import networkx as nx import numpy as np from qiskit import Aer, execute from qiskit.providers.aer import QasmSimulator from qiskit.aqua import QuantumInstance, aqua_globals from qiskit.aqua.algorithms import QAOA, NumPyMinimumEigensolver from qiskit.aqua.components.optimizers import ADAM, AQGD, COBYLA, NELDER_MEAD from qiskit.circuit import Parameter from qiskit.finance.applications.ising import portfolio from qiskit.optimization import QuadraticProgram from qiskit.optimization.converters import QuadraticProgramToQubo from qiskit.optimization.algorithms import ( MinimumEigenOptimizer, RecursiveMinimumEigenOptimizer, ) def build_qubos(clusters, depot_info, A=30): """A function to build QUBO formulations using qiskit clusters (list): A list of `networkX` graph objects that contain the clusters (including depot) depot_info (dict): A dictionary consisting of the depot information A (int): A penalty (defualt is `A=30` as discussed in Feld) Returns: list: A list of QUBO formulations """ qubos = [] for subgraph in clusters: cluster = clusters[subgraph] constrained_qp = QuadraticProgram() connected_elems = list(cluster.edges) no_nodes = len(cluster.nodes) # vars_lookup = create_vars_lookup(cluster, depot_id) Create vars_look_up for indexing # Create binary variables for each node at each timestep binary_vars = [] for node in cluster.nodes: if node == depot_info["id"]: # Not including depot continue for i in range(no_nodes - 1): # no_timesteps = no_nodes - depot binary_vars.append("X" + str(node) + str(i + 1)) for var in binary_vars: constrained_qp.binary_var(var) # Calculate constraint coefficients (linear and quadratic terms) linear = {} quadratic = {} # Linear cost for travelling from depot to a node in the first and last step for edge in connected_elems: if edge[0] == depot_info["id"]: # Starting node start_var = "X" + str(edge[1]) + str(1) linear[start_var] = cluster[edge[0]][edge[1]]["cost"] # Last node last_var = "X" + str(edge[1]) + str(no_nodes - 1) linear[last_var] = cluster[edge[0]][edge[1]]["cost"] # Allowing for having the depot as the 2nd node on the ordered edge pair (so just reversing the code above) elif edge[1] == depot_info["id"]: # Starting node start_var = "X" + str(edge[0]) + str(1) linear[start_var] = cluster[edge[0]][edge[1]]["cost"] # Last node last_var = "X" + str(edge[0]) + str(no_nodes - 1) linear[last_var] = cluster[edge[0]][edge[1]]["cost"] else: # Now quadratic cost for travelling between nodes apart from depot for j in range(no_nodes - 2): pairing = ( "X" + str(edge[0]) + str(j + 1), "X" + str(edge[1]) + str(j + 2), ) quadratic[pairing] = cluster[edge[0]][edge[1]]["cost"] # Backwards directions pairing = ( "X" + str(edge[1]) + str(j + 1), "X" + str(edge[0]) + str(j + 2), ) quadratic[pairing] = cluster[edge[0]][edge[1]]["cost"] for node in cluster.nodes: if node == depot_info["id"]: # Not depot continue # If node is not connected to the depot, increase cost when starting at that node if (depot_info["id"], node) not in connected_elems: var = "X" + str(node) + str(1) if var in linear: linear[var] += A else: linear[var] = A # Likewise if the ending node is not connected to the depot var = "X" + str(node) + str(no_nodes - 1) if var in linear: linear[var] += A else: linear[var] = A for node2 in cluster.nodes: if ( node2 != depot_info["id"] and node2 != node and (node, node2) not in cluster.edges ): # Not depot, and different node, and if the two nodes are not connected, add penalty when travelling between them for j in range(no_nodes - 2): # Adding cost for travelling from node to node2, pairing = ( "X" + str(node) + str(j + 1), "X" + str(node2) + str(j + 2), ) if pairing in quadratic: quadratic[pairing] += A else: quadratic[pairing] = A # Reverse Direction pairing = ( "X" + str(node2) + str(j + 1), "X" + str(node) + str(j + 2), ) if pairing in quadratic: quadratic[pairing] += A else: quadratic[pairing] = A # Input linear and quadratic terms for minimizing qubo objective function constrained_qp.minimize(linear=linear, quadratic=quadratic) # Now add constraints to make sure each node is visited exactly once: node_constraint = {} for r in range(no_nodes - 1): var = "X" + str(node) + str(r + 1) node_constraint[var] = 1 constrained_qp.linear_constraint( linear=node_constraint, sense="==", rhs=1, name="visit_node{}_once".format(node), ) # Now add constraints to make sure each vehicle is only at one node for each timestep: for r in range(no_nodes - 1): timestep_constraint = {} for node in cluster.nodes: if node == depot_info["id"]: continue var = "X" + str(node) + str(r + 1) timestep_constraint[var] = 1 constrained_qp.linear_constraint( linear=timestep_constraint, sense="==", rhs=1, name="timestep{}_one_node".format(r + 1), ) # Convert unconstrained to QUBO converter = QuadraticProgramToQubo(penalty=A) qubo = converter.convert(constrained_qp) # Append each QP to QUBO qubos.append(qubo) return qubos def solve_qubo_qaoa(qubo, p, backend, points=None): """ Create QAOA from given qubo, and solves for both the exact value and the QAOA Args: qubo (object): qiskit QUBO object p (int): the number of layers in the QAOA circuit (p value) Returns: exact_result (dict): the exact result of the MinimumEigenOptimizer qaoa_result (dict): the result of running the QAOA """ exact_mes = NumPyMinimumEigensolver() exact = MinimumEigenOptimizer(exact_mes) exact_result = exact.solve(qubo) op, offset = qubo.to_ising() if backend == "statevector_simulator": method = Aer.get_backend("statevector_simulator") elif backend == "matrix_product_state": method = QasmSimulator(method="matrix_product_state") num_qubits = qubo.get_num_vars() quantum_instance = QuantumInstance( method, shots=(2 ** np.sqrt(num_qubits)) * 2048, seed_simulator=aqua_globals.random_seed, seed_transpiler=aqua_globals.random_seed, ) qaoa_meas = QAOA( quantum_instance=quantum_instance, p=p, initial_point=list(2 * np.pi * np.random.random(2 * p)), ) qaoa = MinimumEigenOptimizer(qaoa_meas) qaoa_result = qaoa.solve(qubo) num_qubits = qaoa.min_eigen_solver.get_optimal_circuit().num_qubits return qaoa_result, exact_result, offset, num_qubits def interp_point(optimal_point): """Method to interpolate to next point from the optimal point found from the previous layer Args: optimal_point (np.array): Optimal point from previous layer Returns: point (list): the informed next point """ optimal_point = list(optimal_point) p = int(len(optimal_point) / 2) gammas = [0] + optimal_point[0:p] + [0] betas = [0] + optimal_point[p : 2 * p] + [0] interp_gammas = [0] + gammas interp_betas = [0] + betas for i in range(1, p + 2): interp_gammas[i] = gammas[i - 1] * (i - 1) / p + gammas[i] * (p + 1 - i) / p interp_betas[i] = betas[i - 1] * (i - 1) / p + betas[i] * (p + 1 - i) / p point = interp_gammas[1 : p + 2] + interp_betas[1 : p + 2] return point def get_fourier_points(last_expectation_value, p): """""" points = ( list(last_expectation_value[:p]) + [0] + list(last_expectation_value[p:]) + [0] ) print(points) return points def index_to_selection(i, num_assets): """ Creates an index for the string value suggestion (used in print_result) Args: i (int): the index of the given string num_assets (int): the number of qubits in the given index string Returns: x (dict): dictionary result of the given index in binary """ s = "{0:b}".format(i).rjust(num_assets) x = np.array([1 if s[i] == "1" else 0 for i in reversed(range(num_assets))]) return x def print_result(qubo, qaoa_result, num_qubits, exact_value, backend): """ Prints the results of the QAOA in a nice form Args: qubo (object): qiskit QUBO object result (dict): the result of the QAOA num_qubits (int): the number of qubits in the QAOA circuit """ if backend == "statevector_simulator": eigenvector = ( qaoa_result.min_eigen_solver_result["eigenstate"] if isinstance(qaoa_result.min_eigen_solver_result["eigenstate"], np.ndarray) else qaoa_result.min_eigen_solver_result["eigenstate"].to_matrix() ) probabilities = np.abs(eigenvector) ** 2 elif backend == "matrix_product_state": probabilities = [] for eigenstate in qaoa_result.min_eigen_solver_result["eigenstate"]: probabilities.append( qaoa_result.min_eigen_solver_result["eigenstate"][eigenstate] / 1024 ) i_sorted = reversed(np.argsort(probabilities)) print("----------------- Full result ---------------------") print("index\tselection\t\tvalue\t\tprobability") print("---------------------------------------------------") exact_probs = [] solution_data = {} for index, i in enumerate(i_sorted): x = index_to_selection(i, num_qubits) probability = probabilities[i] if index == 0 or index == 1: print( "%d\t%10s\t%.4f\t\t%.4f" % (index, x, qubo.objective.evaluate(x), probability) ) if qubo.objective.evaluate(x) == exact_value: print( "%d\t%10s\t%.4f\t\t%.4f" % (index, x, qubo.objective.evaluate(x), probability) ) exact_probs.append(probability) solution_data[f"{x}"] = { "index": index, "energy": qubo.objective.evaluate(x), "probability": probability, } print("\n") return exact_probs, solution_data def assign_parameters(circuit, params_expr, params): """ Args: circuit ([type]): [description] params_expr ([type]): [description] params ([type]): [description] Returns: [type]: [description] """ # Assign params_expr -> params circuit2 = circuit.assign_parameters( {params_expr[i]: params[i] for i in range(len(params))}, inplace=False ) return circuit2 def to_hamiltonian_dicts(quadratic_program: QuadraticProgram): """ Converts a Qiskit QuadraticProgram for QAOA to pair of dictionaries representing the Hamiltonian. Based on qiskit.optimization.QuadraticProgram.to_ising. Args: quadratic_program (QuadraticProgram): Qiskit QuadraticProgram representing a QAOA problem Returns: num_nodes (int): Integer number of qubits linear_terms (defaultdict[int, float]): Coefficients of Z_i terms in the Hamiltonian. quadratic_terms (defaultdict[Tuple[int, int], float]): Coefficients of Z_i Z_j terms in the Hamiltonian """ # if problem has variables that are not binary, raise an error if quadratic_program.get_num_vars() > quadratic_program.get_num_binary_vars(): raise ValueError( "The type of variable must be a binary variable. " "Use a QuadraticProgramToQubo converter to convert " "integer variables to binary variables. " "If the problem contains continuous variables, " "currently we can not apply VQE/QAOA directly. " "you might want to use an ADMM optimizer " "for the problem. " ) # if constraints exist, raise an error if quadratic_program.linear_constraints or quadratic_program.quadratic_constraints: raise ValueError( "An constraint exists. " "The method supports only model with no constraints. " "Use a QuadraticProgramToQubo converter. " "It converts inequality constraints to equality " "constraints, and then, it converters equality " "constraints to penalty terms of the object function." ) # initialize Hamiltonian. num_nodes = quadratic_program.get_num_vars() linear_terms = defaultdict(float) quadratic_terms = defaultdict(float) # set a sign corresponding to a maximized or minimized problem. # sign == 1 is for minimized problem. sign == -1 is for maximized problem. sense = quadratic_program.objective.sense.value # convert linear parts of the object function into Hamiltonian. for i, coeff in quadratic_program.objective.linear.to_dict().items(): linear_terms[i] -= sense * coeff / 2 # create Pauli terms for pair, coeff in quadratic_program.objective.quadratic.to_dict().items(): weight = sense * coeff / 4 i, j = sorted(pair) if i != j: quadratic_terms[i, j] += weight linear_terms[i] -= weight linear_terms[j] -= weight return num_nodes, linear_terms, quadratic_terms
import base64 import uuid from collections import defaultdict from itertools import count import networkx as nx import numpy as np from qiskit import Aer, execute from qiskit.providers.aer import QasmSimulator from qiskit.aqua import QuantumInstance, aqua_globals from qiskit.aqua.algorithms import QAOA, NumPyMinimumEigensolver from qiskit.aqua.components.optimizers import ADAM, AQGD, COBYLA, NELDER_MEAD from qiskit.circuit import Parameter from qiskit.finance.applications.ising import portfolio from qiskit.optimization import QuadraticProgram from qiskit.optimization.converters import QuadraticProgramToQubo from qiskit.optimization.algorithms import ( MinimumEigenOptimizer, RecursiveMinimumEigenOptimizer, ) def build_qubos(clusters, depot_info, A=30): """A function to build QUBO formulations using qiskit clusters (list): A list of `networkX` graph objects that contain the clusters (including depot) depot_info (dict): A dictionary consisting of the depot information A (int): A penalty (defualt is `A=30` as discussed in Feld) Returns: list: A list of QUBO formulations """ qubos = [] for subgraph in clusters: cluster = clusters[subgraph] constrained_qp = QuadraticProgram() connected_elems = list(cluster.edges) no_nodes = len(cluster.nodes) # vars_lookup = create_vars_lookup(cluster, depot_id) Create vars_look_up for indexing # Create binary variables for each node at each timestep binary_vars = [] for node in cluster.nodes: if node == depot_info["id"]: # Not including depot continue for i in range(no_nodes - 1): # no_timesteps = no_nodes - depot binary_vars.append("X" + str(node) + str(i + 1)) for var in binary_vars: constrained_qp.binary_var(var) # Calculate constraint coefficients (linear and quadratic terms) linear = {} quadratic = {} # Linear cost for travelling from depot to a node in the first and last step for edge in connected_elems: if edge[0] == depot_info["id"]: # Starting node start_var = "X" + str(edge[1]) + str(1) linear[start_var] = cluster[edge[0]][edge[1]]["cost"] # Last node last_var = "X" + str(edge[1]) + str(no_nodes - 1) linear[last_var] = cluster[edge[0]][edge[1]]["cost"] # Allowing for having the depot as the 2nd node on the ordered edge pair (so just reversing the code above) elif edge[1] == depot_info["id"]: # Starting node start_var = "X" + str(edge[0]) + str(1) linear[start_var] = cluster[edge[0]][edge[1]]["cost"] # Last node last_var = "X" + str(edge[0]) + str(no_nodes - 1) linear[last_var] = cluster[edge[0]][edge[1]]["cost"] else: # Now quadratic cost for travelling between nodes apart from depot for j in range(no_nodes - 2): pairing = ( "X" + str(edge[0]) + str(j + 1), "X" + str(edge[1]) + str(j + 2), ) quadratic[pairing] = cluster[edge[0]][edge[1]]["cost"] # Backwards directions pairing = ( "X" + str(edge[1]) + str(j + 1), "X" + str(edge[0]) + str(j + 2), ) quadratic[pairing] = cluster[edge[0]][edge[1]]["cost"] for node in cluster.nodes: if node == depot_info["id"]: # Not depot continue # If node is not connected to the depot, increase cost when starting at that node if (depot_info["id"], node) not in connected_elems: var = "X" + str(node) + str(1) if var in linear: linear[var] += A else: linear[var] = A # Likewise if the ending node is not connected to the depot var = "X" + str(node) + str(no_nodes - 1) if var in linear: linear[var] += A else: linear[var] = A for node2 in cluster.nodes: if ( node2 != depot_info["id"] and node2 != node and (node, node2) not in cluster.edges ): # Not depot, and different node, and if the two nodes are not connected, add penalty when travelling between them for j in range(no_nodes - 2): # Adding cost for travelling from node to node2, pairing = ( "X" + str(node) + str(j + 1), "X" + str(node2) + str(j + 2), ) if pairing in quadratic: quadratic[pairing] += A else: quadratic[pairing] = A # Reverse Direction pairing = ( "X" + str(node2) + str(j + 1), "X" + str(node) + str(j + 2), ) if pairing in quadratic: quadratic[pairing] += A else: quadratic[pairing] = A # Input linear and quadratic terms for minimizing qubo objective function constrained_qp.minimize(linear=linear, quadratic=quadratic) # Now add constraints to make sure each node is visited exactly once: node_constraint = {} for r in range(no_nodes - 1): var = "X" + str(node) + str(r + 1) node_constraint[var] = 1 constrained_qp.linear_constraint( linear=node_constraint, sense="==", rhs=1, name="visit_node{}_once".format(node), ) # Now add constraints to make sure each vehicle is only at one node for each timestep: for r in range(no_nodes - 1): timestep_constraint = {} for node in cluster.nodes: if node == depot_info["id"]: continue var = "X" + str(node) + str(r + 1) timestep_constraint[var] = 1 constrained_qp.linear_constraint( linear=timestep_constraint, sense="==", rhs=1, name="timestep{}_one_node".format(r + 1), ) # Convert unconstrained to QUBO converter = QuadraticProgramToQubo(penalty=A) qubo = converter.convert(constrained_qp) # Append each QP to QUBO qubos.append(qubo) return qubos def solve_qubo_qaoa(qubo, p, backend, points=None): """ Create QAOA from given qubo, and solves for both the exact value and the QAOA Args: qubo (object): qiskit QUBO object p (int): the number of layers in the QAOA circuit (p value) Returns: exact_result (dict): the exact result of the MinimumEigenOptimizer qaoa_result (dict): the result of running the QAOA """ exact_mes = NumPyMinimumEigensolver() exact = MinimumEigenOptimizer(exact_mes) exact_result = exact.solve(qubo) op, offset = qubo.to_ising() if backend == "statevector_simulator": method = Aer.get_backend("statevector_simulator") elif backend == "matrix_product_state": method = QasmSimulator(method="matrix_product_state") num_qubits = qubo.get_num_vars() quantum_instance = QuantumInstance( method, shots=(2 ** np.sqrt(num_qubits)) * 2048, seed_simulator=aqua_globals.random_seed, seed_transpiler=aqua_globals.random_seed, ) qaoa_meas = QAOA( quantum_instance=quantum_instance, p=p, initial_point=list(2 * np.pi * np.random.random(2 * p)), ) qaoa = MinimumEigenOptimizer(qaoa_meas) qaoa_result = qaoa.solve(qubo) num_qubits = qaoa.min_eigen_solver.get_optimal_circuit().num_qubits return qaoa_result, exact_result, offset, num_qubits def interp_point(optimal_point): """Method to interpolate to next point from the optimal point found from the previous layer Args: optimal_point (np.array): Optimal point from previous layer Returns: point (list): the informed next point """ optimal_point = list(optimal_point) p = int(len(optimal_point) / 2) gammas = [0] + optimal_point[0:p] + [0] betas = [0] + optimal_point[p : 2 * p] + [0] interp_gammas = [0] + gammas interp_betas = [0] + betas for i in range(1, p + 2): interp_gammas[i] = gammas[i - 1] * (i - 1) / p + gammas[i] * (p + 1 - i) / p interp_betas[i] = betas[i - 1] * (i - 1) / p + betas[i] * (p + 1 - i) / p point = interp_gammas[1 : p + 2] + interp_betas[1 : p + 2] return point def get_fourier_points(last_expectation_value, p): """""" points = ( list(last_expectation_value[:p]) + [0] + list(last_expectation_value[p:]) + [0] ) print(points) return points def index_to_selection(i, num_assets): """ Creates an index for the string value suggestion (used in print_result) Args: i (int): the index of the given string num_assets (int): the number of qubits in the given index string Returns: x (dict): dictionary result of the given index in binary """ s = "{0:b}".format(i).rjust(num_assets) x = np.array([1 if s[i] == "1" else 0 for i in reversed(range(num_assets))]) return x def print_result(qubo, qaoa_result, num_qubits, exact_value, backend): """ Prints the results of the QAOA in a nice form Args: qubo (object): qiskit QUBO object result (dict): the result of the QAOA num_qubits (int): the number of qubits in the QAOA circuit """ if backend == "statevector_simulator": eigenvector = ( qaoa_result.min_eigen_solver_result["eigenstate"] if isinstance(qaoa_result.min_eigen_solver_result["eigenstate"], np.ndarray) else qaoa_result.min_eigen_solver_result["eigenstate"].to_matrix() ) probabilities = np.abs(eigenvector) ** 2 elif backend == "matrix_product_state": probabilities = [] for eigenstate in qaoa_result.min_eigen_solver_result["eigenstate"]: probabilities.append( qaoa_result.min_eigen_solver_result["eigenstate"][eigenstate] / 1024 ) i_sorted = reversed(np.argsort(probabilities)) print("----------------- Full result ---------------------") print("index\tselection\t\tvalue\t\tprobability") print("---------------------------------------------------") exact_probs = [] solution_data = {} for index, i in enumerate(i_sorted): x = index_to_selection(i, num_qubits) probability = probabilities[i] if index == 0 or index == 1: print( "%d\t%10s\t%.4f\t\t%.4f" % (index, x, qubo.objective.evaluate(x), probability) ) if qubo.objective.evaluate(x) == exact_value: print( "%d\t%10s\t%.4f\t\t%.4f" % (index, x, qubo.objective.evaluate(x), probability) ) exact_probs.append(probability) solution_data[f"{x}"] = { "index": index, "energy": qubo.objective.evaluate(x), "probability": probability, } print("\n") return exact_probs, solution_data def assign_parameters(circuit, params_expr, params): """ Args: circuit ([type]): [description] params_expr ([type]): [description] params ([type]): [description] Returns: [type]: [description] """ # Assign params_expr -> params circuit2 = circuit.assign_parameters( {params_expr[i]: params[i] for i in range(len(params))}, inplace=False ) return circuit2 def to_hamiltonian_dicts(quadratic_program: QuadraticProgram): """ Converts a Qiskit QuadraticProgram for QAOA to pair of dictionaries representing the Hamiltonian. Based on qiskit.optimization.QuadraticProgram.to_ising. Args: quadratic_program (QuadraticProgram): Qiskit QuadraticProgram representing a QAOA problem Returns: num_nodes (int): Integer number of qubits linear_terms (defaultdict[int, float]): Coefficients of Z_i terms in the Hamiltonian. quadratic_terms (defaultdict[Tuple[int, int], float]): Coefficients of Z_i Z_j terms in the Hamiltonian """ # if problem has variables that are not binary, raise an error if quadratic_program.get_num_vars() > quadratic_program.get_num_binary_vars(): raise ValueError( "The type of variable must be a binary variable. " "Use a QuadraticProgramToQubo converter to convert " "integer variables to binary variables. " "If the problem contains continuous variables, " "currently we can not apply VQE/QAOA directly. " "you might want to use an ADMM optimizer " "for the problem. " ) # if constraints exist, raise an error if quadratic_program.linear_constraints or quadratic_program.quadratic_constraints: raise ValueError( "An constraint exists. " "The method supports only model with no constraints. " "Use a QuadraticProgramToQubo converter. " "It converts inequality constraints to equality " "constraints, and then, it converters equality " "constraints to penalty terms of the object function." ) # initialize Hamiltonian. num_nodes = quadratic_program.get_num_vars() linear_terms = defaultdict(float) quadratic_terms = defaultdict(float) # set a sign corresponding to a maximized or minimized problem. # sign == 1 is for minimized problem. sign == -1 is for maximized problem. sense = quadratic_program.objective.sense.value # convert linear parts of the object function into Hamiltonian. for i, coeff in quadratic_program.objective.linear.to_dict().items(): linear_terms[i] -= sense * coeff / 2 # create Pauli terms for pair, coeff in quadratic_program.objective.quadratic.to_dict().items(): weight = sense * coeff / 4 i, j = sorted(pair) if i != j: quadratic_terms[i, j] += weight linear_terms[i] -= weight linear_terms[j] -= weight return num_nodes, linear_terms, quadratic_terms
en
0.742067
A function to build QUBO formulations using qiskit clusters (list): A list of `networkX` graph objects that contain the clusters (including depot) depot_info (dict): A dictionary consisting of the depot information A (int): A penalty (defualt is `A=30` as discussed in Feld) Returns: list: A list of QUBO formulations # vars_lookup = create_vars_lookup(cluster, depot_id) Create vars_look_up for indexing # Create binary variables for each node at each timestep # Not including depot # no_timesteps = no_nodes - depot # Calculate constraint coefficients (linear and quadratic terms) # Linear cost for travelling from depot to a node in the first and last step # Starting node # Last node # Allowing for having the depot as the 2nd node on the ordered edge pair (so just reversing the code above) # Starting node # Last node # Now quadratic cost for travelling between nodes apart from depot # Backwards directions # Not depot # If node is not connected to the depot, increase cost when starting at that node # Likewise if the ending node is not connected to the depot # Not depot, and different node, and if the two nodes are not connected, add penalty when travelling between them # Adding cost for travelling from node to node2, # Reverse Direction # Input linear and quadratic terms for minimizing qubo objective function # Now add constraints to make sure each node is visited exactly once: # Now add constraints to make sure each vehicle is only at one node for each timestep: # Convert unconstrained to QUBO # Append each QP to QUBO Create QAOA from given qubo, and solves for both the exact value and the QAOA Args: qubo (object): qiskit QUBO object p (int): the number of layers in the QAOA circuit (p value) Returns: exact_result (dict): the exact result of the MinimumEigenOptimizer qaoa_result (dict): the result of running the QAOA Method to interpolate to next point from the optimal point found from the previous layer Args: optimal_point (np.array): Optimal point from previous layer Returns: point (list): the informed next point Creates an index for the string value suggestion (used in print_result) Args: i (int): the index of the given string num_assets (int): the number of qubits in the given index string Returns: x (dict): dictionary result of the given index in binary Prints the results of the QAOA in a nice form Args: qubo (object): qiskit QUBO object result (dict): the result of the QAOA num_qubits (int): the number of qubits in the QAOA circuit Args: circuit ([type]): [description] params_expr ([type]): [description] params ([type]): [description] Returns: [type]: [description] # Assign params_expr -> params Converts a Qiskit QuadraticProgram for QAOA to pair of dictionaries representing the Hamiltonian. Based on qiskit.optimization.QuadraticProgram.to_ising. Args: quadratic_program (QuadraticProgram): Qiskit QuadraticProgram representing a QAOA problem Returns: num_nodes (int): Integer number of qubits linear_terms (defaultdict[int, float]): Coefficients of Z_i terms in the Hamiltonian. quadratic_terms (defaultdict[Tuple[int, int], float]): Coefficients of Z_i Z_j terms in the Hamiltonian # if problem has variables that are not binary, raise an error # if constraints exist, raise an error # initialize Hamiltonian. # set a sign corresponding to a maximized or minimized problem. # sign == 1 is for minimized problem. sign == -1 is for maximized problem. # convert linear parts of the object function into Hamiltonian. # create Pauli terms
2.189062
2
survey/admin.py
suger-luck/health
0
6617402
from django.contrib import admin from survey.models import user, questions # Register your models here. # 注册用户类 class UserTabularInline(admin.TabularInline): """在编辑页中显示子类信息(表格的形式显示)""" # 关联子类对象 model = questions list_display = ['submit_time'] # 显示额外的编辑对象 extra = 1 class UserAdmin(admin.ModelAdmin): inlines = [UserTabularInline] admin.site.register(user, UserAdmin) admin.site.register(questions)
from django.contrib import admin from survey.models import user, questions # Register your models here. # 注册用户类 class UserTabularInline(admin.TabularInline): """在编辑页中显示子类信息(表格的形式显示)""" # 关联子类对象 model = questions list_display = ['submit_time'] # 显示额外的编辑对象 extra = 1 class UserAdmin(admin.ModelAdmin): inlines = [UserTabularInline] admin.site.register(user, UserAdmin) admin.site.register(questions)
zh
0.772461
# Register your models here. # 注册用户类 在编辑页中显示子类信息(表格的形式显示) # 关联子类对象 # 显示额外的编辑对象
2.079622
2
hw2/lab2.py
mironalex/CN
1
6617403
<filename>hw2/lab2.py from functools import reduce from hw1.ex12 import solve_ex1 import numpy as np import random def solve_diagonal_system(system, result): assert len(system.shape) == 2 assert system.shape[0] == system.shape[1], "Must be a square matrix" solution = np.zeros((system.shape[1], 1)) lines, columns = system.shape for idx in reversed(range(0, lines)): line_offset = reduce(lambda accumulator, comb: accumulator + comb[0] * comb[1], zip(system[idx, idx + 1:], solution[idx + 1:, 0]), 0) solution[idx, 0] = (result[idx, 0] - line_offset) / system[idx][idx] return solution def reduce_system(system, result, column=0): if column == system.shape[1]: return idx = column + system[column:, column].argmax() system[[column, idx]] = system[[idx, column]] result[[column, idx]] = result[[idx, column]] for line in range(column + 1, system.shape[0]): epsilon = solve_ex1() if -epsilon <= system[line, column] <= epsilon: continue normalization_factor = system[column, column] / system[line, column] system[line] *= normalization_factor system[line] -= system[column] result[line, 0] *= normalization_factor result[line, 0] -= result[column, 0] reduce_system(system, result, column=column + 1) def solve_system(system, result): internal_system = np.copy(system) internal_result = np.copy(result) reduce_system(internal_system, internal_result) return solve_diagonal_system(internal_system, internal_result) def generate_random_system(size): system = [] for i in range(0, size): current_line = [] for j in range(0, size): current_line.append(random.random() * 10) system.append(current_line) result = [] for i in range(0, size): result.append([random.random() * 10]) return np.array(system), result def flip(vali_list): result = [] for x in vali_list: result.append(x[0]) return result if __name__ == '__main__': sys_result_pair = generate_random_system(100) system = sys_result_pair[0] result = sys_result_pair[1] try: determinant = np.linalg.det(system) if determinant == 0: raise ValueError("Error: Determinant is 0") except ValueError as error: print(repr(error)) exit(1) solution = solve_system( system, result ) np_solution = np.linalg.solve(system, result) """ print("Solution =", solution) print("NP Solution =", np_solution) """ solution_norm = solution - np_solution print("Norma solutia noastra - solutia biblioteca =", np.linalg.norm(solution_norm)) solution_mul_sys = np.matmul(system, solution) - result print("Norma solutia noastra * sistemul - rezultatul =", np.linalg.norm(solution_mul_sys)) np_solution_mul_sys = np.matmul(system, np_solution) - result print("Norma solutia biblioteca * sistemul - rezultatul =", np.linalg.norm(np_solution_mul_sys)) """ solution_result = np.matmul(system, solution) print("A * x_sol =", solution_result) print("Result = ", result) print("Norm: ", np.linalg.norm(result - solution_result)) """
<filename>hw2/lab2.py from functools import reduce from hw1.ex12 import solve_ex1 import numpy as np import random def solve_diagonal_system(system, result): assert len(system.shape) == 2 assert system.shape[0] == system.shape[1], "Must be a square matrix" solution = np.zeros((system.shape[1], 1)) lines, columns = system.shape for idx in reversed(range(0, lines)): line_offset = reduce(lambda accumulator, comb: accumulator + comb[0] * comb[1], zip(system[idx, idx + 1:], solution[idx + 1:, 0]), 0) solution[idx, 0] = (result[idx, 0] - line_offset) / system[idx][idx] return solution def reduce_system(system, result, column=0): if column == system.shape[1]: return idx = column + system[column:, column].argmax() system[[column, idx]] = system[[idx, column]] result[[column, idx]] = result[[idx, column]] for line in range(column + 1, system.shape[0]): epsilon = solve_ex1() if -epsilon <= system[line, column] <= epsilon: continue normalization_factor = system[column, column] / system[line, column] system[line] *= normalization_factor system[line] -= system[column] result[line, 0] *= normalization_factor result[line, 0] -= result[column, 0] reduce_system(system, result, column=column + 1) def solve_system(system, result): internal_system = np.copy(system) internal_result = np.copy(result) reduce_system(internal_system, internal_result) return solve_diagonal_system(internal_system, internal_result) def generate_random_system(size): system = [] for i in range(0, size): current_line = [] for j in range(0, size): current_line.append(random.random() * 10) system.append(current_line) result = [] for i in range(0, size): result.append([random.random() * 10]) return np.array(system), result def flip(vali_list): result = [] for x in vali_list: result.append(x[0]) return result if __name__ == '__main__': sys_result_pair = generate_random_system(100) system = sys_result_pair[0] result = sys_result_pair[1] try: determinant = np.linalg.det(system) if determinant == 0: raise ValueError("Error: Determinant is 0") except ValueError as error: print(repr(error)) exit(1) solution = solve_system( system, result ) np_solution = np.linalg.solve(system, result) """ print("Solution =", solution) print("NP Solution =", np_solution) """ solution_norm = solution - np_solution print("Norma solutia noastra - solutia biblioteca =", np.linalg.norm(solution_norm)) solution_mul_sys = np.matmul(system, solution) - result print("Norma solutia noastra * sistemul - rezultatul =", np.linalg.norm(solution_mul_sys)) np_solution_mul_sys = np.matmul(system, np_solution) - result print("Norma solutia biblioteca * sistemul - rezultatul =", np.linalg.norm(np_solution_mul_sys)) """ solution_result = np.matmul(system, solution) print("A * x_sol =", solution_result) print("Result = ", result) print("Norm: ", np.linalg.norm(result - solution_result)) """
en
0.411053
print("Solution =", solution) print("NP Solution =", np_solution) solution_result = np.matmul(system, solution) print("A * x_sol =", solution_result) print("Result = ", result) print("Norm: ", np.linalg.norm(result - solution_result))
2.846333
3
movies/views.py
mikeku1116/django-filter-package
0
6617404
from django.shortcuts import render from .models import Movie from .filters import MovieFilter def index(request): movies = Movie.objects.all() movieFilter = MovieFilter(queryset=movies) if request.method == "POST": movieFilter = MovieFilter(request.POST, queryset=movies) context = { 'movieFilter': movieFilter } return render(request, 'movies/index.html', context)
from django.shortcuts import render from .models import Movie from .filters import MovieFilter def index(request): movies = Movie.objects.all() movieFilter = MovieFilter(queryset=movies) if request.method == "POST": movieFilter = MovieFilter(request.POST, queryset=movies) context = { 'movieFilter': movieFilter } return render(request, 'movies/index.html', context)
none
1
1.978744
2
hokudai_furima/product/tests.py
TetsuFe/hokuma
1
6617405
from django.test import TestCase, Client from django.urls import reverse from django.utils import timezone import datetime from hokudai_furima.account.models import User from hokudai_furima.product.models import Product from hokudai_furima.chat.models import Chat, Talk def create_user(username, email, password): user = User.objects.create_user(username=username, email=email, password=password, is_active=True) return user def comfirm_site_rules(user): user.is_rules_confirmed = True user.save() return user def activate_user(user): user.is_active = True user.save() return user def create_product(user, title, description, price): product = Product.objects.create(seller=user, title=title, description=description, price=price) return product def create_chat(product, product_wanting_user, product_seller): chat = Chat.objects.create(product=product, product_wanting_user=product_wanting_user, product_seller=product_seller, created_date=timezone.now()) return chat def add_talk_to_chat(talker, chat, sentence, days): time = timezone.now() + datetime.timedelta(days=days) talk = Talk.objects.create(talker=talker, chat=chat, sentence=sentence, created_date=time) chat.talk_set.add(talk) class ProductDirectChatViewTests(TestCase): def test_two_past_questions(self): """ The questions index page may display multiple questions. """ seller = create_user('test1', '<EMAIL>', 'hokuma1') wanting_user = create_user('test2', '<EMAIL>', 'hokuma2') seller = activate_user(seller) wanting_user = activate_user(wanting_user) seller = comfirm_site_rules(seller) wanting_user = comfirm_site_rules(wanting_user) product = create_product(seller, 'テスト商品', 'テスト商品です', 100) chat = create_chat(product, wanting_user, seller) add_talk_to_chat(talker=wanting_user, chat=chat, sentence='購入希望送らせていただきました', days=-2) add_talk_to_chat(talker=seller, chat=chat, sentence='購入希望ありがとうございます!', days=-1) client = Client() client.force_login(seller, backend='django.contrib.auth.backends.ModelBackend') response = client.get(reverse('product:product_direct_chat', kwargs={'product_pk': product.pk, 'wanting_user_pk': wanting_user.pk})) self.assertQuerysetEqual( response.context['talks'], ['<Talk: Talk object (1)>', '<Talk: Talk object (2)>'] ) class ProductDetailsViewTests(TestCase): def test_product_details(self): seller = create_user('test1', '<EMAIL>', 'hokuma1') seller = activate_user(seller) seller = comfirm_site_rules(seller) product = create_product(seller, 'テスト商品', 'テスト商品です', 100) client = Client() response = client.get(reverse('product:product_details', kwargs={'pk': product.pk})) self.assertEqual( response.context['product'], product )
from django.test import TestCase, Client from django.urls import reverse from django.utils import timezone import datetime from hokudai_furima.account.models import User from hokudai_furima.product.models import Product from hokudai_furima.chat.models import Chat, Talk def create_user(username, email, password): user = User.objects.create_user(username=username, email=email, password=password, is_active=True) return user def comfirm_site_rules(user): user.is_rules_confirmed = True user.save() return user def activate_user(user): user.is_active = True user.save() return user def create_product(user, title, description, price): product = Product.objects.create(seller=user, title=title, description=description, price=price) return product def create_chat(product, product_wanting_user, product_seller): chat = Chat.objects.create(product=product, product_wanting_user=product_wanting_user, product_seller=product_seller, created_date=timezone.now()) return chat def add_talk_to_chat(talker, chat, sentence, days): time = timezone.now() + datetime.timedelta(days=days) talk = Talk.objects.create(talker=talker, chat=chat, sentence=sentence, created_date=time) chat.talk_set.add(talk) class ProductDirectChatViewTests(TestCase): def test_two_past_questions(self): """ The questions index page may display multiple questions. """ seller = create_user('test1', '<EMAIL>', 'hokuma1') wanting_user = create_user('test2', '<EMAIL>', 'hokuma2') seller = activate_user(seller) wanting_user = activate_user(wanting_user) seller = comfirm_site_rules(seller) wanting_user = comfirm_site_rules(wanting_user) product = create_product(seller, 'テスト商品', 'テスト商品です', 100) chat = create_chat(product, wanting_user, seller) add_talk_to_chat(talker=wanting_user, chat=chat, sentence='購入希望送らせていただきました', days=-2) add_talk_to_chat(talker=seller, chat=chat, sentence='購入希望ありがとうございます!', days=-1) client = Client() client.force_login(seller, backend='django.contrib.auth.backends.ModelBackend') response = client.get(reverse('product:product_direct_chat', kwargs={'product_pk': product.pk, 'wanting_user_pk': wanting_user.pk})) self.assertQuerysetEqual( response.context['talks'], ['<Talk: Talk object (1)>', '<Talk: Talk object (2)>'] ) class ProductDetailsViewTests(TestCase): def test_product_details(self): seller = create_user('test1', '<EMAIL>', 'hokuma1') seller = activate_user(seller) seller = comfirm_site_rules(seller) product = create_product(seller, 'テスト商品', 'テスト商品です', 100) client = Client() response = client.get(reverse('product:product_details', kwargs={'pk': product.pk})) self.assertEqual( response.context['product'], product )
en
0.61382
The questions index page may display multiple questions.
2.314805
2
gerryopt/trace/_cmp_op.py
pjrule/gerryopt
0
6617406
<gh_stars>0 """Tracing for comparison expressions.""" from itertools import product from typing import Union from gerryopt.trace._expr import TracedExpr from gerryopt.trace._constant import Constant, coerce_constants from gerryopt.trace.opcodes import (CmpOpcode, CMP_OPCODE_TO_REPR, CMP_OPCODE_TO_METHOD_NAME) from gerryopt.trace.types import (is_scalar, is_ndarray, is_possibly_ndarray, scalar_type, size_intersection, type_union, type_product, make_ndarray, binary_broadcast, Scalar) Val = Union[TracedExpr, Scalar] class CmpOp(TracedExpr): """A binary operation expression.""" left: TracedExpr right: TracedExpr op: CmpOpcode def __init__(self, left: Val, right: Val, op: CmpOpcode): self.left, self.right = coerce_constants(left, right) self.op = op self.dtype = None for (lhs, rhs) in type_product(self.left.dtype, self.right.dtype): self.dtype = type_union(self.dtype, binary_broadcast(bool, lhs, rhs)) def __repr__(self): opcode_repr = CMP_OPCODE_TO_REPR[self.op] return f'CmpOp({opcode_repr}, {self.left}, {self.right})' # Dynamically inject comparison tracing into generic expressions. for op, name in CMP_OPCODE_TO_METHOD_NAME.items(): setattr(TracedExpr, f'__{name}__', lambda self, other, _op=op: CmpOp(self, other, _op))
"""Tracing for comparison expressions.""" from itertools import product from typing import Union from gerryopt.trace._expr import TracedExpr from gerryopt.trace._constant import Constant, coerce_constants from gerryopt.trace.opcodes import (CmpOpcode, CMP_OPCODE_TO_REPR, CMP_OPCODE_TO_METHOD_NAME) from gerryopt.trace.types import (is_scalar, is_ndarray, is_possibly_ndarray, scalar_type, size_intersection, type_union, type_product, make_ndarray, binary_broadcast, Scalar) Val = Union[TracedExpr, Scalar] class CmpOp(TracedExpr): """A binary operation expression.""" left: TracedExpr right: TracedExpr op: CmpOpcode def __init__(self, left: Val, right: Val, op: CmpOpcode): self.left, self.right = coerce_constants(left, right) self.op = op self.dtype = None for (lhs, rhs) in type_product(self.left.dtype, self.right.dtype): self.dtype = type_union(self.dtype, binary_broadcast(bool, lhs, rhs)) def __repr__(self): opcode_repr = CMP_OPCODE_TO_REPR[self.op] return f'CmpOp({opcode_repr}, {self.left}, {self.right})' # Dynamically inject comparison tracing into generic expressions. for op, name in CMP_OPCODE_TO_METHOD_NAME.items(): setattr(TracedExpr, f'__{name}__', lambda self, other, _op=op: CmpOp(self, other, _op))
en
0.803874
Tracing for comparison expressions. A binary operation expression. # Dynamically inject comparison tracing into generic expressions.
2.524147
3
seq2seq/preprocess/get_relation2id_dict.py
JiexingQi/picard
2
6617407
def get_relation2id_dict(choice = "Default", use_coref = False, use_dependency = False): from .constants import RELATIONS, MAX_RELATIVE_DIST current_relation = [r for r in RELATIONS] if not use_coref: current_relation = [r for r in current_relation if r not in ['co_relations', 'coref_relations']] if not use_dependency: current_relation = [r for r in current_relation if r not in ['Forward-Syntax', 'Backward-Syntax', 'None-Syntax']] if choice in ["Default"]: idx_list = [i for i in range(1, len(current_relation)+1)] elif choice == "DefaultWithoutSchemaEncoding": schema_encoding_rel = [] for rel in current_relation: split_rel = rel.split("-") try: src_type, tgt_type = split_rel[0], split_rel[1] except: continue if src_type in ["table", "column", "*"] and tgt_type in ["table", "column", "*"]: schema_encoding_rel.append(rel) current_relation = [r for r in current_relation if r not in schema_encoding_rel] idx_list = [i for i in range(1, len(current_relation)+1)] for rel in schema_encoding_rel: current_relation.append(rel) idx_list.append(0) elif choice == "DefaultWithoutSchemaLinking": schema_linking_rel = [] for rel in current_relation: split_rel = rel.split("-") try: src_type, tgt_type = split_rel[0], split_rel[1] except: continue if (src_type in ["question"] and tgt_type in ["table", "column", "*"]) or (tgt_type in ["question"] and src_type in ["table", "column", "*"]): schema_linking_rel.append(rel) current_relation = [r for r in current_relation if r not in schema_linking_rel] idx_list = [i for i in range(1, len(current_relation)+1)] for rel in schema_linking_rel: current_relation.append(rel) idx_list.append(0) elif choice == "MinType": idx_list = [] dummy_idx = 8 for rel in current_relation: if rel in ['question-column-partialmatch', 'question-table-partialmatch']: idx_list.append(1) elif rel in ['question-column-exactmatch', 'question-table-exactmatch']: idx_list.append(2) elif rel in ['question-column-valuematch']: idx_list.append(3) elif rel in ['question-table-nomatch', 'question-column-nomatch']: idx_list.append(4) elif rel in ['table-column-pk']: idx_list.append(5) elif rel in ['table-column-has']: idx_list.append(6) elif rel in ['column-column-fk']: idx_list.append(7) elif rel in ['question-question-generic'] + ['question-question-dist' + str(i) if i != 0 else 'question-question-identity' for i in range(- MAX_RELATIVE_DIST, MAX_RELATIVE_DIST + 1)]: idx_list.append(dummy_idx) dummy_idx += 1 else: idx_list.append(0) elif choice == "Dependency_MinType": idx_list = [] dummy_idx = 8 for rel in current_relation: if rel in ['question-column-partialmatch', 'question-table-partialmatch']: idx_list.append(1) elif rel in ['question-column-exactmatch', 'question-table-exactmatch']: idx_list.append(2) elif rel in ['question-column-valuematch']: idx_list.append(3) elif rel in ['question-table-nomatch', 'question-column-nomatch']: idx_list.append(4) elif rel in ['table-column-pk']: idx_list.append(5) elif rel in ['table-column-has']: idx_list.append(6) elif rel in ['column-column-fk']: idx_list.append(7) elif rel in ['Forward-Syntax', 'Backward-Syntax', 'None-Syntax']: idx_list.append(dummy_idx) dummy_idx += 1 else: idx_list.append(0) else: raise NotImplementedError RELATION2ID_DICT = dict(zip(current_relation, idx_list)) idx_list.append(0) current_relation.append("None") ID2RELATION_DICT = dict(zip(idx_list, current_relation)) return RELATION2ID_DICT, ID2RELATION_DICT, max(idx_list)
def get_relation2id_dict(choice = "Default", use_coref = False, use_dependency = False): from .constants import RELATIONS, MAX_RELATIVE_DIST current_relation = [r for r in RELATIONS] if not use_coref: current_relation = [r for r in current_relation if r not in ['co_relations', 'coref_relations']] if not use_dependency: current_relation = [r for r in current_relation if r not in ['Forward-Syntax', 'Backward-Syntax', 'None-Syntax']] if choice in ["Default"]: idx_list = [i for i in range(1, len(current_relation)+1)] elif choice == "DefaultWithoutSchemaEncoding": schema_encoding_rel = [] for rel in current_relation: split_rel = rel.split("-") try: src_type, tgt_type = split_rel[0], split_rel[1] except: continue if src_type in ["table", "column", "*"] and tgt_type in ["table", "column", "*"]: schema_encoding_rel.append(rel) current_relation = [r for r in current_relation if r not in schema_encoding_rel] idx_list = [i for i in range(1, len(current_relation)+1)] for rel in schema_encoding_rel: current_relation.append(rel) idx_list.append(0) elif choice == "DefaultWithoutSchemaLinking": schema_linking_rel = [] for rel in current_relation: split_rel = rel.split("-") try: src_type, tgt_type = split_rel[0], split_rel[1] except: continue if (src_type in ["question"] and tgt_type in ["table", "column", "*"]) or (tgt_type in ["question"] and src_type in ["table", "column", "*"]): schema_linking_rel.append(rel) current_relation = [r for r in current_relation if r not in schema_linking_rel] idx_list = [i for i in range(1, len(current_relation)+1)] for rel in schema_linking_rel: current_relation.append(rel) idx_list.append(0) elif choice == "MinType": idx_list = [] dummy_idx = 8 for rel in current_relation: if rel in ['question-column-partialmatch', 'question-table-partialmatch']: idx_list.append(1) elif rel in ['question-column-exactmatch', 'question-table-exactmatch']: idx_list.append(2) elif rel in ['question-column-valuematch']: idx_list.append(3) elif rel in ['question-table-nomatch', 'question-column-nomatch']: idx_list.append(4) elif rel in ['table-column-pk']: idx_list.append(5) elif rel in ['table-column-has']: idx_list.append(6) elif rel in ['column-column-fk']: idx_list.append(7) elif rel in ['question-question-generic'] + ['question-question-dist' + str(i) if i != 0 else 'question-question-identity' for i in range(- MAX_RELATIVE_DIST, MAX_RELATIVE_DIST + 1)]: idx_list.append(dummy_idx) dummy_idx += 1 else: idx_list.append(0) elif choice == "Dependency_MinType": idx_list = [] dummy_idx = 8 for rel in current_relation: if rel in ['question-column-partialmatch', 'question-table-partialmatch']: idx_list.append(1) elif rel in ['question-column-exactmatch', 'question-table-exactmatch']: idx_list.append(2) elif rel in ['question-column-valuematch']: idx_list.append(3) elif rel in ['question-table-nomatch', 'question-column-nomatch']: idx_list.append(4) elif rel in ['table-column-pk']: idx_list.append(5) elif rel in ['table-column-has']: idx_list.append(6) elif rel in ['column-column-fk']: idx_list.append(7) elif rel in ['Forward-Syntax', 'Backward-Syntax', 'None-Syntax']: idx_list.append(dummy_idx) dummy_idx += 1 else: idx_list.append(0) else: raise NotImplementedError RELATION2ID_DICT = dict(zip(current_relation, idx_list)) idx_list.append(0) current_relation.append("None") ID2RELATION_DICT = dict(zip(idx_list, current_relation)) return RELATION2ID_DICT, ID2RELATION_DICT, max(idx_list)
none
1
2.682308
3
tests/inspectortodo/validator/__init__.py
code-acrobat/InspectorTodo
8
6617408
<reponame>code-acrobat/InspectorTodo # Copyright 2018 TNG Technology Consulting GmbH, Unterföhring, Germany # Licensed under the Apache License, Version 2.0 - see LICENSE.md in project root directory
# Copyright 2018 TNG Technology Consulting GmbH, Unterföhring, Germany # Licensed under the Apache License, Version 2.0 - see LICENSE.md in project root directory
en
0.643204
# Copyright 2018 TNG Technology Consulting GmbH, Unterföhring, Germany # Licensed under the Apache License, Version 2.0 - see LICENSE.md in project root directory
0.83033
1
wtl/wtparser/parsers/base.py
elegion/djangodash2013
0
6617409
<reponame>elegion/djangodash2013 from __future__ import unicode_literals import re class BaseParser(object): language = 'unknown' filename = 'unknown' def detect(self, content): return False def _detect_by_regex(self, content, pats): return any(re.compile(p, re.MULTILINE).search(content) for p in pats) def get_platform(self, lines): return None def get_version(self, lines): return None def get_packages(self, lines): return None def parse(self, content): lines = content.splitlines() return { 'filename': self.filename, 'language': self.language, 'platform': self.get_platform(lines), 'version': self.get_version(lines), 'packages': self.get_packages(lines), }
from __future__ import unicode_literals import re class BaseParser(object): language = 'unknown' filename = 'unknown' def detect(self, content): return False def _detect_by_regex(self, content, pats): return any(re.compile(p, re.MULTILINE).search(content) for p in pats) def get_platform(self, lines): return None def get_version(self, lines): return None def get_packages(self, lines): return None def parse(self, content): lines = content.splitlines() return { 'filename': self.filename, 'language': self.language, 'platform': self.get_platform(lines), 'version': self.get_version(lines), 'packages': self.get_packages(lines), }
none
1
2.66283
3
setup.py
joezuntz/DESC_BPZ
0
6617410
<gh_stars>0 from setuptools import setup, find_namespace_packages packages = find_namespace_packages() setup( name="desc_bpz", version="0.0.1", author="<NAME>, <NAME>, <NAME>," "<NAME>, LSST DESC PZWG", author_email="<EMAIL>", packages=packages, package_data={ "": ["*.h5", "*.yaml", "*.sed", "*.res", "*.AB", "*.columns", "*.pars"], "tests": ["*.h5", "*.yaml"], "SED": ["*.sed"], "FILTER": ["*.res"], "AB": ["*.AB"], "scripts": ["*.columns, *.pars"] }, include_package_data=True, license="BSD 3-Clause License", description="Python3 version of BPZ used in DESC", url="https://github.com/LSSTDESC/DESC_BPZ", long_description=open("README.md").read(), classifiers=[ "Development Status :: 4 - Beta", "License :: OSI Approved :: BSD 3-Clause", "Intended Audience :: Developers", "Intended Audience :: Science/Research", "Operating System :: OS Independent", "Programming Language :: Python" ], install_requires=['numpy', 'scipy', 'pandas>=1.1', 'h5py', ], python_requires='>=3.5', setup_requires=['pytest-runner'], tests_require=['pytest'], )
from setuptools import setup, find_namespace_packages packages = find_namespace_packages() setup( name="desc_bpz", version="0.0.1", author="<NAME>, <NAME>, <NAME>," "<NAME>, LSST DESC PZWG", author_email="<EMAIL>", packages=packages, package_data={ "": ["*.h5", "*.yaml", "*.sed", "*.res", "*.AB", "*.columns", "*.pars"], "tests": ["*.h5", "*.yaml"], "SED": ["*.sed"], "FILTER": ["*.res"], "AB": ["*.AB"], "scripts": ["*.columns, *.pars"] }, include_package_data=True, license="BSD 3-Clause License", description="Python3 version of BPZ used in DESC", url="https://github.com/LSSTDESC/DESC_BPZ", long_description=open("README.md").read(), classifiers=[ "Development Status :: 4 - Beta", "License :: OSI Approved :: BSD 3-Clause", "Intended Audience :: Developers", "Intended Audience :: Science/Research", "Operating System :: OS Independent", "Programming Language :: Python" ], install_requires=['numpy', 'scipy', 'pandas>=1.1', 'h5py', ], python_requires='>=3.5', setup_requires=['pytest-runner'], tests_require=['pytest'], )
none
1
1.502804
2
setup.py
philastrophist/pygmmis
0
6617411
from setuptools import setup setup( name="pygmmis", description="Gaussian mixture model for incomplete, truncated, and noisy data", long_description="Gaussian mixture model for incomplete, truncated, and noisy data", version='1.1.0', author="<NAME>", author_email="<EMAIL>", license='MIT', py_modules=["pygmmis"], url="https://github.com/pmelchior/pygmmis", classifiers=[ "Development Status :: 5 - Production/Stable", "License :: OSI Approved :: MIT License", "Intended Audience :: Developers", "Intended Audience :: Science/Research", "Operating System :: OS Independent", "Programming Language :: Python", "Topic :: Scientific/Engineering :: Information Analysis" ], requires=["numpy","scipy","multiprocessing","parmap"] )
from setuptools import setup setup( name="pygmmis", description="Gaussian mixture model for incomplete, truncated, and noisy data", long_description="Gaussian mixture model for incomplete, truncated, and noisy data", version='1.1.0', author="<NAME>", author_email="<EMAIL>", license='MIT', py_modules=["pygmmis"], url="https://github.com/pmelchior/pygmmis", classifiers=[ "Development Status :: 5 - Production/Stable", "License :: OSI Approved :: MIT License", "Intended Audience :: Developers", "Intended Audience :: Science/Research", "Operating System :: OS Independent", "Programming Language :: Python", "Topic :: Scientific/Engineering :: Information Analysis" ], requires=["numpy","scipy","multiprocessing","parmap"] )
none
1
0.981673
1
src/spaceone/inventory/model/load_balancer.py
choonho/plugin-google-cloud-compute-inven-collector
3
6617412
from schematics import Model from schematics.types import StringType, IntType, DictType, ListType class LoadBalancer(Model): type = StringType(choices=('HTTP', 'TCP', 'UDP')) name = StringType() dns = StringType(default="") port = ListType(IntType()) protocol = ListType(StringType()) scheme = StringType(choices=('EXTERNAL', 'INTERNAL')) tags = DictType(StringType, default={})
from schematics import Model from schematics.types import StringType, IntType, DictType, ListType class LoadBalancer(Model): type = StringType(choices=('HTTP', 'TCP', 'UDP')) name = StringType() dns = StringType(default="") port = ListType(IntType()) protocol = ListType(StringType()) scheme = StringType(choices=('EXTERNAL', 'INTERNAL')) tags = DictType(StringType, default={})
none
1
2.585566
3
validateResult.py
mundanePeo/faceRecognition
14
6617413
<reponame>mundanePeo/faceRecognition<gh_stars>10-100 from requests_toolbelt import MultipartEncoder from datetime import date, timedelta from tqdm import tqdm from config.configLoad import config_data import requests import base64 import os import json import argparse BASE_DIR = 'static/people' people_list = os.listdir(BASE_DIR) url = 'https://api-cn.faceplusplus.com/facepp/v3/compare' getDay = None def getSomeday(day=1): today = date.today() oneday = timedelta(days=day) someday = today-oneday return someday def prepare(): global getDay parser = argparse.ArgumentParser() parser.add_argument("-d", "--date", type=int, default=1, help="验证指定日期的识别结果,1代表以今天为基准向前一天也即昨天") args = parser.parse_args() d = args.date getDay = getSomeday(d) test_pair = os.path.join('static', f'{getDay}_resultRecord.txt') return test_pair def getData(file_path): if not os.path.exists(file_path) or not (isinstance(file_path, str) and file_path.endswith('.txt')): raise FileExistsError with open(file_path, 'r') as f: test_data = f.readlines() return test_data def validation(test_data: list): if len(people_list) == 0: raise FileNotFoundError count = 0. far = 0. frr = 0. sum = len(test_data) runningLog = [] runningLog.append(str(getDay)) runningLog.append("\n") print("————————————————————validation start!————————————————————") for i in tqdm(range(len(test_data))): file1, _ = test_data[i].split(' ') # print("now : ", file1) runningLog.append(file1) runningLog.append("\t") _ = _.strip('\n') respeo = 0 end = 0. with open(file1, 'rb') as f: img1 = base64.b64encode(f.read()).decode() for j in range(len(people_list)): peo = people_list[j] peo_dir = os.path.join(BASE_DIR, peo) img_list = os.listdir(peo_dir) index = 0 while True: file2 = os.path.join(peo_dir, img_list[index]) # print("validate image ", file2) with open(file2, 'rb') as f: img2 = base64.b64encode(f.read()).decode() params = MultipartEncoder(fields={'api_key': config_data['validate']['api_key'], 'api_secret': config_data['validate']['api_secret'], 'image_base64_1': img1, 'image_base64_2': img2 },) r = requests.post(url, data=params, headers={'Content-Type': params.content_type}) result = r.content result = result.decode() result = dict(json.loads(result)) # print(result) if 'error_message' not in result.keys(): if 'confidence' not in result.keys() or 'thresholds' not in result.keys(): break confidence = result['confidence'] thresh = result['thresholds'] if confidence <= thresh['1e-3']: output = 0 elif confidence >= thresh['1e-5']: output = 1 else: output = 1 if output == 1: respeo = int(peo) break index += 1 else: if str(result['error_message']) not in runningLog: runningLog.append(str(result['error_message'])) runningLog.append("\t") break index += 1 if index == 3: end = j break if respeo != 0: break elif end == len(people_list)-1 and index == 3: respeo = -3 elif end < len(people_list)-1 and index < 3: respeo = -2 break # print("final id is ", respeo) # print("initial id is ", _) runningLog.append(f"final:{respeo}\t") runningLog.append(f"initial:{_}\n") with open('runningLog.txt', 'a+') as f: f.writelines(runningLog) runningLog.clear() if respeo == int(_): count += 1 elif respeo == -3 or ((10000001<=respeo<=10000009) and respeo != int(_)): far += 1 else: sum -= 1 with open('validateResult.txt', 'a+') as f: line = [str(getDay), '\t', f'precision: {count/sum}\t', f'far: {far}\t', f'frrProb: {far/sum}\n'] f.writelines(line) print("————————————————————validation end!————————————————————") if __name__ == "__main__": try: file_name = prepare() test_data = getData(file_name) validation(test_data) except FileExistsError as e: print("The record of your input day is not exist!") except FileNotFoundError as e: print("Don't find images in static/people")
from requests_toolbelt import MultipartEncoder from datetime import date, timedelta from tqdm import tqdm from config.configLoad import config_data import requests import base64 import os import json import argparse BASE_DIR = 'static/people' people_list = os.listdir(BASE_DIR) url = 'https://api-cn.faceplusplus.com/facepp/v3/compare' getDay = None def getSomeday(day=1): today = date.today() oneday = timedelta(days=day) someday = today-oneday return someday def prepare(): global getDay parser = argparse.ArgumentParser() parser.add_argument("-d", "--date", type=int, default=1, help="验证指定日期的识别结果,1代表以今天为基准向前一天也即昨天") args = parser.parse_args() d = args.date getDay = getSomeday(d) test_pair = os.path.join('static', f'{getDay}_resultRecord.txt') return test_pair def getData(file_path): if not os.path.exists(file_path) or not (isinstance(file_path, str) and file_path.endswith('.txt')): raise FileExistsError with open(file_path, 'r') as f: test_data = f.readlines() return test_data def validation(test_data: list): if len(people_list) == 0: raise FileNotFoundError count = 0. far = 0. frr = 0. sum = len(test_data) runningLog = [] runningLog.append(str(getDay)) runningLog.append("\n") print("————————————————————validation start!————————————————————") for i in tqdm(range(len(test_data))): file1, _ = test_data[i].split(' ') # print("now : ", file1) runningLog.append(file1) runningLog.append("\t") _ = _.strip('\n') respeo = 0 end = 0. with open(file1, 'rb') as f: img1 = base64.b64encode(f.read()).decode() for j in range(len(people_list)): peo = people_list[j] peo_dir = os.path.join(BASE_DIR, peo) img_list = os.listdir(peo_dir) index = 0 while True: file2 = os.path.join(peo_dir, img_list[index]) # print("validate image ", file2) with open(file2, 'rb') as f: img2 = base64.b64encode(f.read()).decode() params = MultipartEncoder(fields={'api_key': config_data['validate']['api_key'], 'api_secret': config_data['validate']['api_secret'], 'image_base64_1': img1, 'image_base64_2': img2 },) r = requests.post(url, data=params, headers={'Content-Type': params.content_type}) result = r.content result = result.decode() result = dict(json.loads(result)) # print(result) if 'error_message' not in result.keys(): if 'confidence' not in result.keys() or 'thresholds' not in result.keys(): break confidence = result['confidence'] thresh = result['thresholds'] if confidence <= thresh['1e-3']: output = 0 elif confidence >= thresh['1e-5']: output = 1 else: output = 1 if output == 1: respeo = int(peo) break index += 1 else: if str(result['error_message']) not in runningLog: runningLog.append(str(result['error_message'])) runningLog.append("\t") break index += 1 if index == 3: end = j break if respeo != 0: break elif end == len(people_list)-1 and index == 3: respeo = -3 elif end < len(people_list)-1 and index < 3: respeo = -2 break # print("final id is ", respeo) # print("initial id is ", _) runningLog.append(f"final:{respeo}\t") runningLog.append(f"initial:{_}\n") with open('runningLog.txt', 'a+') as f: f.writelines(runningLog) runningLog.clear() if respeo == int(_): count += 1 elif respeo == -3 or ((10000001<=respeo<=10000009) and respeo != int(_)): far += 1 else: sum -= 1 with open('validateResult.txt', 'a+') as f: line = [str(getDay), '\t', f'precision: {count/sum}\t', f'far: {far}\t', f'frrProb: {far/sum}\n'] f.writelines(line) print("————————————————————validation end!————————————————————") if __name__ == "__main__": try: file_name = prepare() test_data = getData(file_name) validation(test_data) except FileExistsError as e: print("The record of your input day is not exist!") except FileNotFoundError as e: print("Don't find images in static/people")
en
0.632409
# print("now : ", file1) # print("validate image ", file2) # print(result) # print("final id is ", respeo) # print("initial id is ", _)
2.506389
3
WorkingDirectory/DaisyPipeline/transformers/ca_cnib_rtf2dtbook/rtf2xml-py/rtf2xml/get_char_map.py
sensusaps/RoboBraille.Web.API
7
6617414
######################################################################### # # # # # copyright 2002 <NAME> # # # # This program is distributed in the hope that it will be useful, # # but WITHOUT ANY WARRANTY; without even the implied warranty of # # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # # General Public License for more details. # # # # You should have received a copy of the GNU General Public License # # along with this program; if not, write to the Free Software # # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA # # 02111-1307 USA # # # # # ######################################################################### import sys, os, rtf2xml.copy, string class GetCharMap: """ Return the character map for the given value """ def __init__(self, bug_handler, char_file): """ Required: 'char_file'--the file with the mappings Returns: nothing """ self.__char_file = char_file def get_char_map(self, map): found_map = 0 map_dict = {} read_obj = open(self.__char_file, 'r') line = 1 while line: line = read_obj.readline() begin_element = '<%s>' % map; end_element = '</%s>' % map if not found_map: if string.find(line, begin_element) >= 0: found_map = 1 else: if string.find(line, end_element) >= 0: break else: line = line[:-1] fields = line.split(':') fields[1].replace('\\colon', ':') map_dict[fields[1]] = fields[3] read_obj.close() if not found_map: msg = 'no map found\n' msg += 'map is "%s"\n' raise self.__bug_handler, msg return map_dict
######################################################################### # # # # # copyright 2002 <NAME> # # # # This program is distributed in the hope that it will be useful, # # but WITHOUT ANY WARRANTY; without even the implied warranty of # # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # # General Public License for more details. # # # # You should have received a copy of the GNU General Public License # # along with this program; if not, write to the Free Software # # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA # # 02111-1307 USA # # # # # ######################################################################### import sys, os, rtf2xml.copy, string class GetCharMap: """ Return the character map for the given value """ def __init__(self, bug_handler, char_file): """ Required: 'char_file'--the file with the mappings Returns: nothing """ self.__char_file = char_file def get_char_map(self, map): found_map = 0 map_dict = {} read_obj = open(self.__char_file, 'r') line = 1 while line: line = read_obj.readline() begin_element = '<%s>' % map; end_element = '</%s>' % map if not found_map: if string.find(line, begin_element) >= 0: found_map = 1 else: if string.find(line, end_element) >= 0: break else: line = line[:-1] fields = line.split(':') fields[1].replace('\\colon', ':') map_dict[fields[1]] = fields[3] read_obj.close() if not found_map: msg = 'no map found\n' msg += 'map is "%s"\n' raise self.__bug_handler, msg return map_dict
en
0.599726
######################################################################### # # # # # copyright 2002 <NAME> # # # # This program is distributed in the hope that it will be useful, # # but WITHOUT ANY WARRANTY; without even the implied warranty of # # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # # General Public License for more details. # # # # You should have received a copy of the GNU General Public License # # along with this program; if not, write to the Free Software # # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA # # 02111-1307 USA # # # # # ######################################################################### Return the character map for the given value Required: 'char_file'--the file with the mappings Returns: nothing
2.922932
3
ss.py
tylerparsons/secretsanta
1
6617415
import sys import random import secretsanta as ss import datetime as dt # CSV column mappings FAM_MEMBER_COL = 0 FAM_FAMILY_COL = 1 CONN_SOURCE_COL = 0 CONN_TARGET_COL = 1 CONN_YEAR_COL = 2 def loadFamilyMembers(csvPath): ''' Returns families, a map of members to their associated families, and members, a map of families to a set of its members. ''' with open(csvPath, 'r') as file: families = {} members = {} for line in file: data = line.strip().split(',') member = data[FAM_MEMBER_COL] family = data[FAM_FAMILY_COL] families[member] = family if family not in members: members[family] = set() members[family].add(member) return families, members def loadConnections(csvPath, families, members): with open(csvPath, 'r') as file: connections = ss.ConnectionGraph(families, members) for line in file: data = line.strip().split(',') source = data[CONN_SOURCE_COL] target = data[CONN_TARGET_COL] year = data[CONN_YEAR_COL] connections.add(source, target, year) return connections def saveConnections(csvPath, connections): with open(csvPath, 'w') as file: file.write('giver,receiver,year,weight\n') for conn in connections: file.write(','.join([ conn.source, conn.target, str(conn.year), str(conn.weight) ]) + '\n') def main(): argc = len(sys.argv) if argc != 4 and argc != 5: print('usage: ss.py <familyFile> <oldConnFile> ' + '<newConnFile> [<connYear>]') exit(1) familyFile = sys.argv[1] oldConnFile = sys.argv[2] newConnFile = sys.argv[3] connYear = int(sys.argv[4]) if argc == 5 else dt.datetime.now().year families, members = loadFamilyMembers(familyFile) oldConnections = loadConnections(oldConnFile, families, members) santa = ss.SecretSanta(families, members, oldConnections) newConnections = santa.genConnections(connYear) totalWeight = sum(conn.weight for conn in newConnections) print('Generated new connections for %d with total weight %d' % (connYear, totalWeight)) saveConnections(newConnFile, newConnections) if __name__ == '__main__': main()
import sys import random import secretsanta as ss import datetime as dt # CSV column mappings FAM_MEMBER_COL = 0 FAM_FAMILY_COL = 1 CONN_SOURCE_COL = 0 CONN_TARGET_COL = 1 CONN_YEAR_COL = 2 def loadFamilyMembers(csvPath): ''' Returns families, a map of members to their associated families, and members, a map of families to a set of its members. ''' with open(csvPath, 'r') as file: families = {} members = {} for line in file: data = line.strip().split(',') member = data[FAM_MEMBER_COL] family = data[FAM_FAMILY_COL] families[member] = family if family not in members: members[family] = set() members[family].add(member) return families, members def loadConnections(csvPath, families, members): with open(csvPath, 'r') as file: connections = ss.ConnectionGraph(families, members) for line in file: data = line.strip().split(',') source = data[CONN_SOURCE_COL] target = data[CONN_TARGET_COL] year = data[CONN_YEAR_COL] connections.add(source, target, year) return connections def saveConnections(csvPath, connections): with open(csvPath, 'w') as file: file.write('giver,receiver,year,weight\n') for conn in connections: file.write(','.join([ conn.source, conn.target, str(conn.year), str(conn.weight) ]) + '\n') def main(): argc = len(sys.argv) if argc != 4 and argc != 5: print('usage: ss.py <familyFile> <oldConnFile> ' + '<newConnFile> [<connYear>]') exit(1) familyFile = sys.argv[1] oldConnFile = sys.argv[2] newConnFile = sys.argv[3] connYear = int(sys.argv[4]) if argc == 5 else dt.datetime.now().year families, members = loadFamilyMembers(familyFile) oldConnections = loadConnections(oldConnFile, families, members) santa = ss.SecretSanta(families, members, oldConnections) newConnections = santa.genConnections(connYear) totalWeight = sum(conn.weight for conn in newConnections) print('Generated new connections for %d with total weight %d' % (connYear, totalWeight)) saveConnections(newConnFile, newConnections) if __name__ == '__main__': main()
en
0.965213
# CSV column mappings Returns families, a map of members to their associated families, and members, a map of families to a set of its members.
2.821219
3
python/test/test_1_3_URLify.py
cjoverbay/cracking-the-code-interview-solutions
0
6617416
<gh_stars>0 import unittest from python.solution.chapter_01_arrays_and_strings import problem_1_3_URLify # Grab all specific implementations from this solution implementations = [] for attr in [getattr(problem_1_3_URLify, x) for x in dir(problem_1_3_URLify)]: if callable(attr): implementations.append(attr) class Tests(unittest.TestCase): def setUp(self): pass def test_handles_spaces(self): for urlify in implementations: self.assertSequenceEqual(urlify([c for c in 'Mr <NAME> ']), [c for c in 'Mr%20John%20Smith']) def test_handles_empty(self): for urlify in implementations: self.assertSequenceEqual(urlify([]), []) def test_handles_no_spaces(self): for urlify in implementations: self.assertSequenceEqual(urlify([c for c in 'nospaces']), [c for c in 'nospaces'])
import unittest from python.solution.chapter_01_arrays_and_strings import problem_1_3_URLify # Grab all specific implementations from this solution implementations = [] for attr in [getattr(problem_1_3_URLify, x) for x in dir(problem_1_3_URLify)]: if callable(attr): implementations.append(attr) class Tests(unittest.TestCase): def setUp(self): pass def test_handles_spaces(self): for urlify in implementations: self.assertSequenceEqual(urlify([c for c in 'Mr <NAME> ']), [c for c in 'Mr%20John%20Smith']) def test_handles_empty(self): for urlify in implementations: self.assertSequenceEqual(urlify([]), []) def test_handles_no_spaces(self): for urlify in implementations: self.assertSequenceEqual(urlify([c for c in 'nospaces']), [c for c in 'nospaces'])
en
0.790878
# Grab all specific implementations from this solution
3.157712
3
utils.py
kanesp/Image_WGAN_GP
7
6617417
<gh_stars>1-10 import os import matplotlib.pyplot as plt import numpy as np import torch from torch.autograd import Variable import torch.autograd as autograd def mkdir(dir): if not os.path.exists(dir): os.makedirs(dir) def savefig(fname, dpi=None): dpi = 150 if dpi == None else dpi plt.savefig(fname, dpi=dpi, format='png') cuda = True if torch.cuda.is_available() else False Tensor = torch.cuda.FloatTensor if cuda else torch.FloatTensor def compute_gradient_penalty(D, real_samples, fake_samples): """Calculates the gradient penalty loss for WGAN GP""" # Random weight term for interpolation between real and fake samples alpha = Tensor(np.random.random((real_samples.size(0), 1, 1, 1))) # Get random interpolation between real and fake samples interpolates = (alpha * real_samples + ((1 - alpha) * fake_samples)).requires_grad_(True) d_interpolates = D(interpolates) fake = Variable(Tensor(real_samples.shape[0], 1).fill_(1.0), requires_grad=False) # Get gradient w.r.t. interpolates gradients = autograd.grad( outputs=d_interpolates, inputs=interpolates, grad_outputs=fake, create_graph=True, retain_graph=True, only_inputs=True, )[0] gradients = gradients.view(gradients.size(0), -1) gradient_penalty = ((gradients.norm(2, dim=1) - 1) ** 2).mean() return gradient_penalty
import os import matplotlib.pyplot as plt import numpy as np import torch from torch.autograd import Variable import torch.autograd as autograd def mkdir(dir): if not os.path.exists(dir): os.makedirs(dir) def savefig(fname, dpi=None): dpi = 150 if dpi == None else dpi plt.savefig(fname, dpi=dpi, format='png') cuda = True if torch.cuda.is_available() else False Tensor = torch.cuda.FloatTensor if cuda else torch.FloatTensor def compute_gradient_penalty(D, real_samples, fake_samples): """Calculates the gradient penalty loss for WGAN GP""" # Random weight term for interpolation between real and fake samples alpha = Tensor(np.random.random((real_samples.size(0), 1, 1, 1))) # Get random interpolation between real and fake samples interpolates = (alpha * real_samples + ((1 - alpha) * fake_samples)).requires_grad_(True) d_interpolates = D(interpolates) fake = Variable(Tensor(real_samples.shape[0], 1).fill_(1.0), requires_grad=False) # Get gradient w.r.t. interpolates gradients = autograd.grad( outputs=d_interpolates, inputs=interpolates, grad_outputs=fake, create_graph=True, retain_graph=True, only_inputs=True, )[0] gradients = gradients.view(gradients.size(0), -1) gradient_penalty = ((gradients.norm(2, dim=1) - 1) ** 2).mean() return gradient_penalty
en
0.794879
Calculates the gradient penalty loss for WGAN GP # Random weight term for interpolation between real and fake samples # Get random interpolation between real and fake samples # Get gradient w.r.t. interpolates
2.271276
2
Codeforces/A_Little_Elephant_and_Rozdil.py
anubhab-code/Competitive-Programming
0
6617418
n=int(input()) z=list(map(int,input().split())) k=min(z) if z.count(k)>=2: print("Still Rozdil") else: print(z.index(k)+1)
n=int(input()) z=list(map(int,input().split())) k=min(z) if z.count(k)>=2: print("Still Rozdil") else: print(z.index(k)+1)
none
1
3.280355
3
python_module/SuperGLU/Util/Tests/Suite.py
GeneralizedLearningUtilities/SuperGLU
8
6617419
<filename>python_module/SuperGLU/Util/Tests/Suite.py<gh_stars>1-10 import unittest import SuperGLU.Util.Tests.TestGenerator_UnitTests as TestGenerator_UnitTests import SuperGLU.Util.Tests.Serialization_UnitTests as Serialization_UnitTests def TestSuite(): """ Returns a TestSuite object that covers the Util module """ suite = unittest.TestSuite() loader = unittest.TestLoader() modules = [TestGenerator_UnitTests, Serialization_UnitTests] for m in modules: suite.addTests(loader.loadTestsFromModule(m)) return suite if __name__ == "__main__": import sys sys.exit(not unittest.TextTestRunner().run(TestSuite()))
<filename>python_module/SuperGLU/Util/Tests/Suite.py<gh_stars>1-10 import unittest import SuperGLU.Util.Tests.TestGenerator_UnitTests as TestGenerator_UnitTests import SuperGLU.Util.Tests.Serialization_UnitTests as Serialization_UnitTests def TestSuite(): """ Returns a TestSuite object that covers the Util module """ suite = unittest.TestSuite() loader = unittest.TestLoader() modules = [TestGenerator_UnitTests, Serialization_UnitTests] for m in modules: suite.addTests(loader.loadTestsFromModule(m)) return suite if __name__ == "__main__": import sys sys.exit(not unittest.TextTestRunner().run(TestSuite()))
en
0.482674
Returns a TestSuite object that covers the Util module
2.047481
2
kubedriver/persistence/config_map_persister.py
manojn97/kubernetes-driver
2
6617420
<filename>kubedriver/persistence/config_map_persister.py from kubernetes.client.rest import ApiException from kubedriver.kubeobjects import ObjectConfiguration, ObjectAttributes from .exceptions import RecordNotFoundError, PersistenceError, InvalidRecordError from openshift.dynamic.exceptions import DynamicApiError, NotFoundError, BadRequestError class ConfigMapPersister: def __init__(self, stored_type_name, kube_api_ctl, storage_namespace, record_builder, cm_api_version='v1', cm_kind='ConfigMap', cm_data_field='data'): self.stored_type_name = stored_type_name self.kube_api_ctl = kube_api_ctl self.storage_namespace = storage_namespace self.record_builder = record_builder self.cm_api_version = cm_api_version self.cm_kind = cm_kind self.cm_data_field = cm_data_field def __raise_error(self, operation, exception, config_map_name): if isinstance(exception, DynamicApiError): summary = exception.summary() else: summary = str(exception) message = f'Failed to {operation} record for {self.stored_type_name} \'{config_map_name}\' as an error occurred: {summary}' if isinstance(exception, NotFoundError): raise RecordNotFoundError(message) from exception elif isinstance(exception, BadRequestError): raise InvalidRecordError(message) from exception else: raise PersistenceError(message) from exception def build_record_reference(self, uid, record_name): return { 'apiVersion': self.cm_api_version, 'kind': self.cm_kind, 'metadata': { 'name': record_name, 'namespace': self.storage_namespace, 'uid': uid } } def get_record_uid(self, record_name): record_cm = self.__get_config_map_for(record_name) return record_cm.metadata.uid def create(self, record_name, record_data, labels=None): cm_config = self.__build_config_map_for_record(record_name, record_data, labels=labels) try: self.kube_api_ctl.create_object(cm_config, default_namespace=self.storage_namespace) except ApiException as e: self.__raise_error('create', e, record_name) def update(self, record_name, record_data): existing_cm = self.__get_config_map_for(record_name) cm_config = self.__build_config_map_for_record(record_name, record_data, existing_cm=existing_cm) try: self.kube_api_ctl.update_object(cm_config, default_namespace=self.storage_namespace) except ApiException as e: self.__raise_error('update', e, record_name) def __get_config_map_for(self, record_name): try: record_cm = self.kube_api_ctl.read_object(self.cm_api_version, self.cm_kind, record_name, namespace=self.storage_namespace) return record_cm except ApiException as e: self.__raise_error('read', e, record_name) def get(self, record_name): record_cm = self.__get_config_map_for(record_name) return self.__read_config_map_to_record(record_cm) def delete(self, record_name): try: self.kube_api_ctl.delete_object(self.cm_api_version, self.cm_kind, record_name, namespace=self.storage_namespace) except ApiException as e: self.__raise_error('delete', e, record_name) def __build_config_map_for_record(self, record_name, record_data, labels=None, existing_cm=None): if labels == None: labels = {} if existing_cm is not None and existing_cm.metadata is not None and existing_cm.metadata.labels is not None: merged_labels = {} merged_labels.update(existing_cm.metadata.labels) merged_labels.update(labels) labels = merged_labels cm_obj_config = { ObjectAttributes.API_VERSION: self.cm_api_version, ObjectAttributes.KIND: self.cm_kind, ObjectAttributes.METADATA: { ObjectAttributes.NAME: record_name, ObjectAttributes.NAMESPACE: self.storage_namespace, ObjectAttributes.LABELS: labels }, self.cm_data_field: { 'record': self.record_builder.to_record(record_data) } } return ObjectConfiguration(cm_obj_config) def __read_config_map_to_record(self, config_map): cm_data = config_map.data record_data = cm_data.get('record') return self.record_builder.from_record(record_data)
<filename>kubedriver/persistence/config_map_persister.py from kubernetes.client.rest import ApiException from kubedriver.kubeobjects import ObjectConfiguration, ObjectAttributes from .exceptions import RecordNotFoundError, PersistenceError, InvalidRecordError from openshift.dynamic.exceptions import DynamicApiError, NotFoundError, BadRequestError class ConfigMapPersister: def __init__(self, stored_type_name, kube_api_ctl, storage_namespace, record_builder, cm_api_version='v1', cm_kind='ConfigMap', cm_data_field='data'): self.stored_type_name = stored_type_name self.kube_api_ctl = kube_api_ctl self.storage_namespace = storage_namespace self.record_builder = record_builder self.cm_api_version = cm_api_version self.cm_kind = cm_kind self.cm_data_field = cm_data_field def __raise_error(self, operation, exception, config_map_name): if isinstance(exception, DynamicApiError): summary = exception.summary() else: summary = str(exception) message = f'Failed to {operation} record for {self.stored_type_name} \'{config_map_name}\' as an error occurred: {summary}' if isinstance(exception, NotFoundError): raise RecordNotFoundError(message) from exception elif isinstance(exception, BadRequestError): raise InvalidRecordError(message) from exception else: raise PersistenceError(message) from exception def build_record_reference(self, uid, record_name): return { 'apiVersion': self.cm_api_version, 'kind': self.cm_kind, 'metadata': { 'name': record_name, 'namespace': self.storage_namespace, 'uid': uid } } def get_record_uid(self, record_name): record_cm = self.__get_config_map_for(record_name) return record_cm.metadata.uid def create(self, record_name, record_data, labels=None): cm_config = self.__build_config_map_for_record(record_name, record_data, labels=labels) try: self.kube_api_ctl.create_object(cm_config, default_namespace=self.storage_namespace) except ApiException as e: self.__raise_error('create', e, record_name) def update(self, record_name, record_data): existing_cm = self.__get_config_map_for(record_name) cm_config = self.__build_config_map_for_record(record_name, record_data, existing_cm=existing_cm) try: self.kube_api_ctl.update_object(cm_config, default_namespace=self.storage_namespace) except ApiException as e: self.__raise_error('update', e, record_name) def __get_config_map_for(self, record_name): try: record_cm = self.kube_api_ctl.read_object(self.cm_api_version, self.cm_kind, record_name, namespace=self.storage_namespace) return record_cm except ApiException as e: self.__raise_error('read', e, record_name) def get(self, record_name): record_cm = self.__get_config_map_for(record_name) return self.__read_config_map_to_record(record_cm) def delete(self, record_name): try: self.kube_api_ctl.delete_object(self.cm_api_version, self.cm_kind, record_name, namespace=self.storage_namespace) except ApiException as e: self.__raise_error('delete', e, record_name) def __build_config_map_for_record(self, record_name, record_data, labels=None, existing_cm=None): if labels == None: labels = {} if existing_cm is not None and existing_cm.metadata is not None and existing_cm.metadata.labels is not None: merged_labels = {} merged_labels.update(existing_cm.metadata.labels) merged_labels.update(labels) labels = merged_labels cm_obj_config = { ObjectAttributes.API_VERSION: self.cm_api_version, ObjectAttributes.KIND: self.cm_kind, ObjectAttributes.METADATA: { ObjectAttributes.NAME: record_name, ObjectAttributes.NAMESPACE: self.storage_namespace, ObjectAttributes.LABELS: labels }, self.cm_data_field: { 'record': self.record_builder.to_record(record_data) } } return ObjectConfiguration(cm_obj_config) def __read_config_map_to_record(self, config_map): cm_data = config_map.data record_data = cm_data.get('record') return self.record_builder.from_record(record_data)
none
1
2.220463
2
hearline/models/efficientnet_b0.py
ibkuroyagi/hear2021-submit
0
6617421
<filename>hearline/models/efficientnet_b0.py """EfficientNet.""" import logging import torch import torch.nn as nn import torchaudio.transforms as T from efficientnet_pytorch import EfficientNet class EfficientNet_b0(nn.Module): def __init__( self, sample_rate=16000, n_fft=400, hop_length=160, n_mels=64, n_embedding=512, n_aug=None, ): super(self.__class__, self).__init__() self.spectrogram_extracter = T.MelSpectrogram( sample_rate=sample_rate, n_fft=n_fft, win_length=n_fft, hop_length=hop_length, power=2.0, n_mels=n_mels, ) self.efficientnet = EfficientNet.from_name( model_name="efficientnet-b0", in_channels=1 ) self.fc1 = nn.Linear(1280, n_embedding, bias=True) self.layer_norm = torch.nn.LayerNorm(normalized_shape=n_embedding) self.fc2 = torch.nn.Linear(n_embedding, n_embedding, bias=False) self.sample_rate = sample_rate self.scene_embedding_size = n_embedding self.timestamp_embedding_size = n_embedding self.n_timestamp = None self.n_aug = n_aug if n_aug is not None: self.aug_fc = nn.Linear(n_embedding, n_aug, bias=True) def forward(self, X): """X: (batch_size, T', mels)""" # logging.info(f"X:{X.shape}") if len(X.shape) == 2: # X: (batch_size, wave_length)->(batch_size, T', mels) X = self.spectrogram_extracter(X).transpose(1, 2) x = X.unsqueeze(1) # (B, 1, T', mels) x = self.efficientnet.extract_features(x) # logging.info(f"x:{x.shape}") x = x.max(dim=3)[0] # logging.info(f"x:{x.shape}") embedding_h = self.fc1(x.transpose(1, 2)).transpose(1, 2) self.n_timestamp = embedding_h.shape[2] # logging.info(f"embedding_h: {embedding_h.shape}") embed = torch.tanh(self.layer_norm(embedding_h.max(dim=2)[0])) embedding_z = self.fc2(embed) output_dict = { # (B, T', timestamp_embedding_size) "framewise_embedding": embedding_h.transpose(1, 2), # (B, scene_embedding_size) "clipwise_embedding": embedding_h.max(dim=2)[0], "embedding_z": embedding_z, # (B, n_embedding) } if self.n_aug is not None: output_dict["aug_output"] = self.aug_fc(embed) return output_dict
<filename>hearline/models/efficientnet_b0.py """EfficientNet.""" import logging import torch import torch.nn as nn import torchaudio.transforms as T from efficientnet_pytorch import EfficientNet class EfficientNet_b0(nn.Module): def __init__( self, sample_rate=16000, n_fft=400, hop_length=160, n_mels=64, n_embedding=512, n_aug=None, ): super(self.__class__, self).__init__() self.spectrogram_extracter = T.MelSpectrogram( sample_rate=sample_rate, n_fft=n_fft, win_length=n_fft, hop_length=hop_length, power=2.0, n_mels=n_mels, ) self.efficientnet = EfficientNet.from_name( model_name="efficientnet-b0", in_channels=1 ) self.fc1 = nn.Linear(1280, n_embedding, bias=True) self.layer_norm = torch.nn.LayerNorm(normalized_shape=n_embedding) self.fc2 = torch.nn.Linear(n_embedding, n_embedding, bias=False) self.sample_rate = sample_rate self.scene_embedding_size = n_embedding self.timestamp_embedding_size = n_embedding self.n_timestamp = None self.n_aug = n_aug if n_aug is not None: self.aug_fc = nn.Linear(n_embedding, n_aug, bias=True) def forward(self, X): """X: (batch_size, T', mels)""" # logging.info(f"X:{X.shape}") if len(X.shape) == 2: # X: (batch_size, wave_length)->(batch_size, T', mels) X = self.spectrogram_extracter(X).transpose(1, 2) x = X.unsqueeze(1) # (B, 1, T', mels) x = self.efficientnet.extract_features(x) # logging.info(f"x:{x.shape}") x = x.max(dim=3)[0] # logging.info(f"x:{x.shape}") embedding_h = self.fc1(x.transpose(1, 2)).transpose(1, 2) self.n_timestamp = embedding_h.shape[2] # logging.info(f"embedding_h: {embedding_h.shape}") embed = torch.tanh(self.layer_norm(embedding_h.max(dim=2)[0])) embedding_z = self.fc2(embed) output_dict = { # (B, T', timestamp_embedding_size) "framewise_embedding": embedding_h.transpose(1, 2), # (B, scene_embedding_size) "clipwise_embedding": embedding_h.max(dim=2)[0], "embedding_z": embedding_z, # (B, n_embedding) } if self.n_aug is not None: output_dict["aug_output"] = self.aug_fc(embed) return output_dict
en
0.534536
EfficientNet. X: (batch_size, T', mels) # logging.info(f"X:{X.shape}") # X: (batch_size, wave_length)->(batch_size, T', mels) # (B, 1, T', mels) # logging.info(f"x:{x.shape}") # logging.info(f"x:{x.shape}") # logging.info(f"embedding_h: {embedding_h.shape}") # (B, T', timestamp_embedding_size) # (B, scene_embedding_size) # (B, n_embedding)
2.288063
2
spaceopt/variable.py
ar-nowaczynski/spaceopt
46
6617422
<reponame>ar-nowaczynski/spaceopt<filename>spaceopt/variable.py import random from collections import Counter from typing import Union import pandas as pd class Variable: _ALLOWED_VTYPES = (float, int, str, bool) def __init__(self, name: str, values: list) -> None: self._verify_name(name) self.name = name self._verify_values(values) self.values = values self.vtype = self._get_vtype_from_values() @property def is_categorical(self) -> bool: return self.vtype is str def sample(self) -> Union[float, int, str, bool]: return random.choice(self.values) def encode(self, df: pd.DataFrame) -> pd.DataFrame: if self.is_categorical: encoding = dict(zip(self.values, range(len(self.values)))) df[self.name] = df[self.name].map(encoding) return df def decode(self, df: pd.DataFrame) -> pd.DataFrame: if self.is_categorical: decoding = dict(zip(range(len(self.values)), self.values)) df[self.name] = df[self.name].map(decoding) return df def _get_vtype_from_values(self) -> type: vtypes = [type(value) for value in self.values] cnt = Counter(vtypes) if len(cnt) != 1: value_types = "\n".join([f"{v} : {type(v)}" for v in self.values]) raise RuntimeError( f"Multiple value types for a {self.__class__.__name__}" f" named {repr(self.name)}" f" with values={self.values}." f" Encountered value types:\n{value_types}\n" "All values should be of the same type." f" Allowed value types: {self._ALLOWED_VTYPES}." ) vtype = cnt.most_common()[0][0] if vtype not in self._ALLOWED_VTYPES: raise RuntimeError( f"All values={self.values} for a {self.__class__.__name__}" f" named {repr(self.name)}" f" are of type {vtype}, which is not allowed." f" Please use one of: {self._ALLOWED_VTYPES}." ) return vtype def _verify_name(self, name: str) -> None: if not isinstance(name, str): raise TypeError( f"Invalid name={name} for a {self.__class__.__name__}." f" Provided name is of type {type(name)}," f" but it should be of type {str}." ) def _verify_values(self, values: list) -> None: if not isinstance(values, list): raise TypeError( f"{self.__class__.__name__} named {repr(self.name)}" f" has values={values}" f" of type {type(values)}," f" but it should be of type {list}." ) if len(values) == 0: raise ValueError( f"{self.__class__.__name__} named {repr(self.name)}" " has an empty list of values." ) def __str__(self) -> str: indent = " " * 4 innerstr = [ f"name={repr(self.name)}", f"values={self.values}", f"vtype={self.vtype}", f"is_categorical={self.is_categorical}", ] innerstr = indent + (",\n" + indent).join(innerstr) outstr = "{cls}(\n{innerstr}\n)".format( cls=self.__class__.__name__, innerstr=innerstr, ) return outstr
import random from collections import Counter from typing import Union import pandas as pd class Variable: _ALLOWED_VTYPES = (float, int, str, bool) def __init__(self, name: str, values: list) -> None: self._verify_name(name) self.name = name self._verify_values(values) self.values = values self.vtype = self._get_vtype_from_values() @property def is_categorical(self) -> bool: return self.vtype is str def sample(self) -> Union[float, int, str, bool]: return random.choice(self.values) def encode(self, df: pd.DataFrame) -> pd.DataFrame: if self.is_categorical: encoding = dict(zip(self.values, range(len(self.values)))) df[self.name] = df[self.name].map(encoding) return df def decode(self, df: pd.DataFrame) -> pd.DataFrame: if self.is_categorical: decoding = dict(zip(range(len(self.values)), self.values)) df[self.name] = df[self.name].map(decoding) return df def _get_vtype_from_values(self) -> type: vtypes = [type(value) for value in self.values] cnt = Counter(vtypes) if len(cnt) != 1: value_types = "\n".join([f"{v} : {type(v)}" for v in self.values]) raise RuntimeError( f"Multiple value types for a {self.__class__.__name__}" f" named {repr(self.name)}" f" with values={self.values}." f" Encountered value types:\n{value_types}\n" "All values should be of the same type." f" Allowed value types: {self._ALLOWED_VTYPES}." ) vtype = cnt.most_common()[0][0] if vtype not in self._ALLOWED_VTYPES: raise RuntimeError( f"All values={self.values} for a {self.__class__.__name__}" f" named {repr(self.name)}" f" are of type {vtype}, which is not allowed." f" Please use one of: {self._ALLOWED_VTYPES}." ) return vtype def _verify_name(self, name: str) -> None: if not isinstance(name, str): raise TypeError( f"Invalid name={name} for a {self.__class__.__name__}." f" Provided name is of type {type(name)}," f" but it should be of type {str}." ) def _verify_values(self, values: list) -> None: if not isinstance(values, list): raise TypeError( f"{self.__class__.__name__} named {repr(self.name)}" f" has values={values}" f" of type {type(values)}," f" but it should be of type {list}." ) if len(values) == 0: raise ValueError( f"{self.__class__.__name__} named {repr(self.name)}" " has an empty list of values." ) def __str__(self) -> str: indent = " " * 4 innerstr = [ f"name={repr(self.name)}", f"values={self.values}", f"vtype={self.vtype}", f"is_categorical={self.is_categorical}", ] innerstr = indent + (",\n" + indent).join(innerstr) outstr = "{cls}(\n{innerstr}\n)".format( cls=self.__class__.__name__, innerstr=innerstr, ) return outstr
none
1
2.841173
3
GeoDataCabSim.py
hornbartho/Vehicle-Simulation
0
6617423
import gpxpy import matplotlib.pyplot as plt import datetime from geopy import distance from geopy.distance import geodesic from math import sqrt, floor, pi, sin import numpy as np import pandas as pd import plotly.plotly as py import plotly.graph_objs as go import haversine import math as mth ######################################### g = 9.81 Weight = 380 + 170 Tire_Radius = 0.318 Cd = 0.825 Frontal_Area_Cab = 1.84*1.14 rho = 1.225 Vmax = 50 Vs = Vmax/3.6 effmotor = 0.785 effgearbox = 0.98 effelectrical = 0.9 Battery_Cap = 7.2 Pressure_Tire = 2.2 Average_Trip_Distance = 2 Change_In_Altitude = 20 Cab_Acceleration = 0.76 ######################################## gpx_file = open('Test track.gpx', 'r') gpx = gpxpy.parse(gpx_file) data = gpx.tracks[0].segments[0].points start = data[0] finish = data[-1] df = pd.DataFrame(columns=['lon', 'lat', 'alt', 'time']) for point in data: df = df.append({'lon': point.longitude, 'lat' : point.latitude, 'alt' : point.elevation, 'time' : point.time}, ignore_index=True) Time_Seconds = np.linspace(0,len(df['alt'])-1,len(df['alt'])) Altitude = df['alt'] Longatude = df['lon'] Latitude = df['lat'] x = np.zeros(len(df)) i = 0 while i < len(df)-1: Data_Now = (Longatude[i],Latitude[i]) Data_Next = (Longatude[i+1],Latitude[i+1]) x[i] = geodesic(Data_Now, Data_Next).meters i += 1 Speed = x Degree = np.zeros(len(df)) n = 0 while n < len(df)-1: Ratio = (Altitude[n+1] - Altitude[n]) / x[n] Degree[n] = ((mth.asin(Ratio))/((mth.pi)*2))*360 n += 1 Acceleration = np.zeros(len(df)) k = 0 while k < len(df)-1: Difference = Speed[k+1] - Speed[k] if Difference < 0: Acceleration[k] = 0 elif Difference > 0.76: Acceleration[k] = 0.76 else: Acceleration[k] = Difference k += 1 Crr = 0.005 + (1 / Pressure_Tire)*(0.01 + 0.0095*((Speed*3.6) / 100)**2) theta = (Degree*pi)/180 FORCE_Rolling_Resistance = Crr*Weight*g FORCE_Drag = 0.5*Cd*Frontal_Area_Cab*(rho*(Speed**2)) FORCE_Incline = Weight*g*theta FORCE_Acceleration = Weight*Acceleration FORCE_Resultant = FORCE_Rolling_Resistance + FORCE_Drag + FORCE_Incline + FORCE_Acceleration TORQUE_Wheel = FORCE_Resultant*Tire_Radius Radial_Wheel_Speed = Speed/Tire_Radius eff = effmotor*effgearbox*effelectrical Pout = TORQUE_Wheel*Radial_Wheel_Speed Pin = (Pout/(eff)) Energy = np.sum(Pin) plt.plot(Time_Seconds,Speed) plt.show() ###############################################################################
import gpxpy import matplotlib.pyplot as plt import datetime from geopy import distance from geopy.distance import geodesic from math import sqrt, floor, pi, sin import numpy as np import pandas as pd import plotly.plotly as py import plotly.graph_objs as go import haversine import math as mth ######################################### g = 9.81 Weight = 380 + 170 Tire_Radius = 0.318 Cd = 0.825 Frontal_Area_Cab = 1.84*1.14 rho = 1.225 Vmax = 50 Vs = Vmax/3.6 effmotor = 0.785 effgearbox = 0.98 effelectrical = 0.9 Battery_Cap = 7.2 Pressure_Tire = 2.2 Average_Trip_Distance = 2 Change_In_Altitude = 20 Cab_Acceleration = 0.76 ######################################## gpx_file = open('Test track.gpx', 'r') gpx = gpxpy.parse(gpx_file) data = gpx.tracks[0].segments[0].points start = data[0] finish = data[-1] df = pd.DataFrame(columns=['lon', 'lat', 'alt', 'time']) for point in data: df = df.append({'lon': point.longitude, 'lat' : point.latitude, 'alt' : point.elevation, 'time' : point.time}, ignore_index=True) Time_Seconds = np.linspace(0,len(df['alt'])-1,len(df['alt'])) Altitude = df['alt'] Longatude = df['lon'] Latitude = df['lat'] x = np.zeros(len(df)) i = 0 while i < len(df)-1: Data_Now = (Longatude[i],Latitude[i]) Data_Next = (Longatude[i+1],Latitude[i+1]) x[i] = geodesic(Data_Now, Data_Next).meters i += 1 Speed = x Degree = np.zeros(len(df)) n = 0 while n < len(df)-1: Ratio = (Altitude[n+1] - Altitude[n]) / x[n] Degree[n] = ((mth.asin(Ratio))/((mth.pi)*2))*360 n += 1 Acceleration = np.zeros(len(df)) k = 0 while k < len(df)-1: Difference = Speed[k+1] - Speed[k] if Difference < 0: Acceleration[k] = 0 elif Difference > 0.76: Acceleration[k] = 0.76 else: Acceleration[k] = Difference k += 1 Crr = 0.005 + (1 / Pressure_Tire)*(0.01 + 0.0095*((Speed*3.6) / 100)**2) theta = (Degree*pi)/180 FORCE_Rolling_Resistance = Crr*Weight*g FORCE_Drag = 0.5*Cd*Frontal_Area_Cab*(rho*(Speed**2)) FORCE_Incline = Weight*g*theta FORCE_Acceleration = Weight*Acceleration FORCE_Resultant = FORCE_Rolling_Resistance + FORCE_Drag + FORCE_Incline + FORCE_Acceleration TORQUE_Wheel = FORCE_Resultant*Tire_Radius Radial_Wheel_Speed = Speed/Tire_Radius eff = effmotor*effgearbox*effelectrical Pout = TORQUE_Wheel*Radial_Wheel_Speed Pin = (Pout/(eff)) Energy = np.sum(Pin) plt.plot(Time_Seconds,Speed) plt.show() ###############################################################################
de
0.874044
######################################### ######################################## ###############################################################################
2.642863
3
Omniglot/model.py
yaohungt/Demystifying_Self_Supervised_Learning
21
6617424
import torch import torch.nn as nn import torch.nn.functional as F from torchvision.models.resnet import resnet18, resnet34, resnet50 class Model(nn.Module): def __init__(self, feature_dim=128, resnet_depth=18): super(Model, self).__init__() self.f = [] if resnet_depth == 18: my_resnet = resnet18() resnet_output_dim = 512 elif resnet_depth == 34: my_resnet = resnet34() resnet_output_dim = 512 elif resnet_depth == 50: my_resnet = resnet50() resnet_output_dim = 2048 for name, module in my_resnet.named_children(): if name == 'conv1': module = nn.Conv2d(3, 64, kernel_size=3, stride=1, padding=1, bias=False) if not isinstance(module, nn.Linear) and not isinstance(module, nn.MaxPool2d): self.f.append(module) # encoder self.f = nn.Sequential(*self.f) # projection head self.g = nn.Sequential(nn.Linear(resnet_output_dim, 512, bias=False), nn.BatchNorm1d(512), nn.ReLU(inplace=True), nn.Linear(512, feature_dim, bias=True)) def forward(self, x): x = self.f(x) feature = torch.flatten(x, start_dim=1) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) # for 105x105 size ''' class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=64, kernel_size=10, stride=1, padding=0), # out: 96 nn.BatchNorm2d(num_features=64), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 48 nn.Conv2d(in_channels=64, out_channels=128, kernel_size=7, stride=1, padding=0), # out: 42 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 21 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=4, stride=1, padding=0), # out: 18 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 9 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=4, stride=1, padding=0), # out: 6 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) ''' # for 28x28 size (using max_pool) class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x, norm=True): feature = self.f(x) out = self.g(feature) if norm: return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) else: return F.normalize(feature, dim=-1), out # for 28x28 size (not using maxpool) ''' class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=0), # out: 3 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) ''' # + # for 28x28 size class Lambda(nn.Module): def __init__(self, func): super(Lambda, self).__init__() self.func = func def forward(self, x): return self.func(x) class Recon_Omniglot_Model(nn.Module): def __init__(self): super(Recon_Omniglot_Model, self).__init__() # reconstructer (approximately the inverse of the encoder) self.f = nn.Sequential( nn.Linear(1024, 9*128, bias=False), nn.BatchNorm1d(num_features=9*128), nn.ReLU(inplace=True), # (9*128 -> 3*3*128) Lambda(lambda x: x.view(-1, 128, 3, 3)), nn.ConvTranspose2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=0, output_padding=0, bias=False), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.ConvTranspose2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1, output_padding=1, bias=False), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.ConvTranspose2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1, output_padding=1, bias=False), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.ConvTranspose2d(in_channels=128, out_channels=1, kernel_size=3, stride=1, padding=1, output_padding=0, bias=True), # out: 28 #nn.Sigmoid(), ) def forward(self, x): recon = self.f(x) return recon # - # for 56x56 size ''' class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 56 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 28 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) '''
import torch import torch.nn as nn import torch.nn.functional as F from torchvision.models.resnet import resnet18, resnet34, resnet50 class Model(nn.Module): def __init__(self, feature_dim=128, resnet_depth=18): super(Model, self).__init__() self.f = [] if resnet_depth == 18: my_resnet = resnet18() resnet_output_dim = 512 elif resnet_depth == 34: my_resnet = resnet34() resnet_output_dim = 512 elif resnet_depth == 50: my_resnet = resnet50() resnet_output_dim = 2048 for name, module in my_resnet.named_children(): if name == 'conv1': module = nn.Conv2d(3, 64, kernel_size=3, stride=1, padding=1, bias=False) if not isinstance(module, nn.Linear) and not isinstance(module, nn.MaxPool2d): self.f.append(module) # encoder self.f = nn.Sequential(*self.f) # projection head self.g = nn.Sequential(nn.Linear(resnet_output_dim, 512, bias=False), nn.BatchNorm1d(512), nn.ReLU(inplace=True), nn.Linear(512, feature_dim, bias=True)) def forward(self, x): x = self.f(x) feature = torch.flatten(x, start_dim=1) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) # for 105x105 size ''' class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=64, kernel_size=10, stride=1, padding=0), # out: 96 nn.BatchNorm2d(num_features=64), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 48 nn.Conv2d(in_channels=64, out_channels=128, kernel_size=7, stride=1, padding=0), # out: 42 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 21 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=4, stride=1, padding=0), # out: 18 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 9 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=4, stride=1, padding=0), # out: 6 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) ''' # for 28x28 size (using max_pool) class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x, norm=True): feature = self.f(x) out = self.g(feature) if norm: return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) else: return F.normalize(feature, dim=-1), out # for 28x28 size (not using maxpool) ''' class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=0), # out: 3 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) ''' # + # for 28x28 size class Lambda(nn.Module): def __init__(self, func): super(Lambda, self).__init__() self.func = func def forward(self, x): return self.func(x) class Recon_Omniglot_Model(nn.Module): def __init__(self): super(Recon_Omniglot_Model, self).__init__() # reconstructer (approximately the inverse of the encoder) self.f = nn.Sequential( nn.Linear(1024, 9*128, bias=False), nn.BatchNorm1d(num_features=9*128), nn.ReLU(inplace=True), # (9*128 -> 3*3*128) Lambda(lambda x: x.view(-1, 128, 3, 3)), nn.ConvTranspose2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=0, output_padding=0, bias=False), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.ConvTranspose2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1, output_padding=1, bias=False), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.ConvTranspose2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1, output_padding=1, bias=False), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.ConvTranspose2d(in_channels=128, out_channels=1, kernel_size=3, stride=1, padding=1, output_padding=0, bias=True), # out: 28 #nn.Sigmoid(), ) def forward(self, x): recon = self.f(x) return recon # - # for 56x56 size ''' class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 56 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 28 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) '''
en
0.449118
# encoder # projection head # for 105x105 size class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=64, kernel_size=10, stride=1, padding=0), # out: 96 nn.BatchNorm2d(num_features=64), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 48 nn.Conv2d(in_channels=64, out_channels=128, kernel_size=7, stride=1, padding=0), # out: 42 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 21 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=4, stride=1, padding=0), # out: 18 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 9 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=4, stride=1, padding=0), # out: 6 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) # for 28x28 size (using max_pool) # encoder # out: 28 #nn.MaxPool2d(kernel_size=2, stride=2), # out: 28 # out: 14 # out: 14 # out: 7 # out: 7 # out: 3 # projection head # for 28x28 size (not using maxpool) class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=2, padding=0), # out: 3 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), #nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1) # + # for 28x28 size # reconstructer (approximately the inverse of the encoder) # (9*128 -> 3*3*128) # out: 7 # out: 14 # out: 28 # out: 28 #nn.Sigmoid(), # - # for 56x56 size class Omniglot_Model(nn.Module): def __init__(self): super(Omniglot_Model, self).__init__() # encoder self.f = nn.Sequential( nn.Conv2d(in_channels=1, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 56 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 28 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 28 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 14 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 14 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 7 nn.Conv2d(in_channels=128, out_channels=128, kernel_size=3, stride=1, padding=1), # out: 7 nn.BatchNorm2d(num_features=128), nn.ReLU(inplace=True), nn.MaxPool2d(kernel_size=2, stride=2), # out: 3 nn.Flatten(), nn.Linear(9*128, 1024), ) # projection head self.g = nn.Identity() def forward(self, x): feature = self.f(x) out = self.g(feature) return F.normalize(feature, dim=-1), F.normalize(out, dim=-1)
2.700084
3
example_app/example_app/dags/dynamic_dag101.py
dhan16/airflow
0
6617425
import datetime as dt from datetime import datetime from airflow import DAG from airflow.operators.python_operator import PythonOperator default_args = { 'owner': 'me', 'start_date': dt.datetime(2018, 1, 1), 'retries': 1, 'retry_delay': dt.timedelta(minutes=5), } def create_dag(dag_id, schedule, dag_number, default_args): dag = DAG(dag_id, schedule_interval=schedule, catchup=False, default_args=default_args) def hello_world1(*args): print('hello_world1 DAG_ID:{} This is DAG: {}'.format(dag_id, str(dag_number))) def hello_world2(*args): print('hello_world2 DAG_ID:{} This is DAG: {} args:{}'.format(dag_id, str(dag_number), args)) with dag: t1 = PythonOperator(task_id='hello_world1',python_callable=hello_world1) t2 = PythonOperator(task_id='hello_world2',python_callable=hello_world2) return dag # build a dag for each number in range(10) for n in range(1, 10): dag_id = 'dynamic_dag101_{}'.format(str(n)) globals()[dag_id] = create_dag(dag_id, '@daily', n, default_args)
import datetime as dt from datetime import datetime from airflow import DAG from airflow.operators.python_operator import PythonOperator default_args = { 'owner': 'me', 'start_date': dt.datetime(2018, 1, 1), 'retries': 1, 'retry_delay': dt.timedelta(minutes=5), } def create_dag(dag_id, schedule, dag_number, default_args): dag = DAG(dag_id, schedule_interval=schedule, catchup=False, default_args=default_args) def hello_world1(*args): print('hello_world1 DAG_ID:{} This is DAG: {}'.format(dag_id, str(dag_number))) def hello_world2(*args): print('hello_world2 DAG_ID:{} This is DAG: {} args:{}'.format(dag_id, str(dag_number), args)) with dag: t1 = PythonOperator(task_id='hello_world1',python_callable=hello_world1) t2 = PythonOperator(task_id='hello_world2',python_callable=hello_world2) return dag # build a dag for each number in range(10) for n in range(1, 10): dag_id = 'dynamic_dag101_{}'.format(str(n)) globals()[dag_id] = create_dag(dag_id, '@daily', n, default_args)
en
0.540912
# build a dag for each number in range(10)
2.842634
3
qa/migrations/0012_auto_20180225_2334.py
userimack/my_quora_app
0
6617426
# -*- coding: utf-8 -*- # Generated by Django 1.11 on 2018-02-25 18:04 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('qa', '0011_ratequestion'), ] operations = [ migrations.AlterModelOptions( name='answer', options={'ordering': ['-date']}, ), migrations.AlterModelOptions( name='category', options={'ordering': ['-name'], 'verbose_name_plural': 'Categories'}, ), migrations.AlterModelOptions( name='question', options={'ordering': ['-date']}, ), migrations.AlterField( model_name='ratequestion', name='rating', field=models.BooleanField(help_text='Rate the question'), ), ]
# -*- coding: utf-8 -*- # Generated by Django 1.11 on 2018-02-25 18:04 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('qa', '0011_ratequestion'), ] operations = [ migrations.AlterModelOptions( name='answer', options={'ordering': ['-date']}, ), migrations.AlterModelOptions( name='category', options={'ordering': ['-name'], 'verbose_name_plural': 'Categories'}, ), migrations.AlterModelOptions( name='question', options={'ordering': ['-date']}, ), migrations.AlterField( model_name='ratequestion', name='rating', field=models.BooleanField(help_text='Rate the question'), ), ]
en
0.749665
# -*- coding: utf-8 -*- # Generated by Django 1.11 on 2018-02-25 18:04
1.649531
2
MiGRIDS/Model/Controls/predictLoad0.py
mmuellerstoffels/GBSTools
8
6617427
<reponame>mmuellerstoffels/GBSTools # Project: GBS Tool # Author: <NAME>, <EMAIL> # Date: February 16, 2018 # License: MIT License (see LICENSE file of this package for more information) # imports import numpy as np # calculate a short term future load class predictLoad: def __init__(self): self.futureLoad = 0 def predictLoad(self, SO): # simple calculation, return the mean of the last 1 hour load #startIdx = max(SO.idx - int(3600/SO.timeStep), 0) #stopIdx = SO.idx+1 self.futureLoad = SO.DM.realLoad1hrTrend[SO.masterIdx] #np.mean(SO.DM.realLoad[startIdx:stopIdx])
# Project: GBS Tool # Author: <NAME>, <EMAIL> # Date: February 16, 2018 # License: MIT License (see LICENSE file of this package for more information) # imports import numpy as np # calculate a short term future load class predictLoad: def __init__(self): self.futureLoad = 0 def predictLoad(self, SO): # simple calculation, return the mean of the last 1 hour load #startIdx = max(SO.idx - int(3600/SO.timeStep), 0) #stopIdx = SO.idx+1 self.futureLoad = SO.DM.realLoad1hrTrend[SO.masterIdx] #np.mean(SO.DM.realLoad[startIdx:stopIdx])
en
0.681462
# Project: GBS Tool # Author: <NAME>, <EMAIL> # Date: February 16, 2018 # License: MIT License (see LICENSE file of this package for more information) # imports # calculate a short term future load # simple calculation, return the mean of the last 1 hour load #startIdx = max(SO.idx - int(3600/SO.timeStep), 0) #stopIdx = SO.idx+1 #np.mean(SO.DM.realLoad[startIdx:stopIdx])
2.267359
2
goldenbraid/tests/test_views.py
bioinfcomav/goldebraid
0
6617428
# Copyright 2013 <NAME>, Univ.Politecnica Valencia, Consejo Superior de # Investigaciones Cientificas # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os.path from cStringIO import StringIO from django.test import TestCase, Client from django.core.urlresolvers import reverse from django.core.files.uploadedfile import SimpleUploadedFile from django.conf import settings as proj_settings from django.contrib.auth.models import User from Bio import SeqIO import goldenbraid from goldenbraid.views.feature import FeatureForm from goldenbraid.tests.test_fixtures import FIXTURES_TO_LOAD from goldenbraid.models import Feature from goldenbraid.tags import VECTOR_TYPE_NAME, MODULE_TYPE_NAME TEST_DATA = os.path.join(os.path.split(goldenbraid.__path__[0])[0], 'goldenbraid', 'tests', 'data') class FeatureTestViews(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_feature_page(self): client = Client() url = reverse('feature_view', kwargs={'uniquename': 'pAn11'}) response = client.get(url) assert response.status_code == 200 assert "Feature pAn11" in str(response) def test_add_feature_form(self): test_data = os.path.join(os.path.split(goldenbraid.__path__[0])[0], 'goldenbraid', 'tests', 'data') # test of the form gb_path = os.path.join(test_data, 'pAn11_uniq.gb') post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': 'CDS', 'vector': 'pDGB1_alpha1'} uploaded_fhand = open(gb_path) file_dict = {'gbfile': SimpleUploadedFile(uploaded_fhand.name, uploaded_fhand.read())} form = FeatureForm(post_dict, file_dict) self.assertTrue(form.is_valid()) # test of the form with blanck values gb_path = os.path.join(test_data, 'pAn11_uniq.gb') post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': 'CDS', 'vector': 'pDGB1_alpha1'} uploaded_fhand = open(gb_path) file_dict = {} form = FeatureForm(post_dict, file_dict) self.assertFalse(form.is_valid()) # test of the form with wrong type post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': 'vecto'} uploaded_fhand = open(gb_path) file_dict = {'gbfile': SimpleUploadedFile(uploaded_fhand.name, uploaded_fhand.read())} form = FeatureForm(post_dict, file_dict) self.assertFalse(form.is_valid()) assert form.errors.get('type') # vector does not exist # test of the form with wrong type post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': VECTOR_TYPE_NAME, 'enzyme_out': 'vector1_enz_out', 'vector': 'vector1'} uploaded_fhand = open(gb_path) file_dict = {'gbfile': SimpleUploadedFile(uploaded_fhand.name, uploaded_fhand.read())} form = FeatureForm(post_dict, file_dict) self.assertFalse(form.is_valid()) assert form.errors.get('vector') def test_add_feature_view(self): # test of the form page # test of the form User.objects.create_user(username='admin', email='<EMAIL>', password='password') gb_path = os.path.join(TEST_DATA, 'pAn11_uniq.gb') client = Client() url = reverse('add_feature') # no login, no access response = client.post(url, {'name': 'vector1', 'type': MODULE_TYPE_NAME, 'description': 'vector1 desc', 'reference': 'vector1 ref', 'vector': 'pDGB1_omega1R', 'gbfile': open(gb_path)}) assert response.status_code == 302 client.login(username='admin', password='password') # show form response = client.get(url) assert "pDGB1_alpha1" in str(response) # add a feature url = reverse('add_feature') response = client.post(url, {'name': 'vector1', 'type': MODULE_TYPE_NAME, 'description': 'vector1 desc', 'reference': 'vector1 ref', 'vector': 'pDGB1_omega1R', 'gbfile': open(gb_path)}) assert response.status_code == 302 # TODO url to genbank file # response = client.get('/media/genbank_files/pAn11.gb') feat = Feature.objects.get(uniquename='pAn11_uniq') assert feat.name == 'vector1' assert feat.props == {u'Description': [u'vector1 desc'], u'Reference': [u'vector1 ref']} # add a feature url = reverse('add_feature') gb_path = os.path.join(TEST_DATA, 'GB_DOMEST_15.gb') response = client.post(url, {'name': 'vector1', 'type': 'TU', 'description': 'vector1 desc', 'reference': 'vector1 ref', 'vector': 'pDGB1_alpha2', 'gbfile': open(gb_path)}) assert response.status_code == 200 os.remove(os.path.join(proj_settings.MEDIA_ROOT, feat.genbank_file.name)) def test_search_feature(self): client = Client() url = reverse('search_features') response = client.get(url) assert response.status_code == 200 assert "<option value=" in str(response) response = client.post(url, {'name_or_description': 'pAn11'}) assert response.status_code == 302 response = client.post(url, {'kind': 'TER'}) assert response.status_code == 200 assert "<td>This is a pGreen destiny vector of the" in str(response) client.login(username='test', password='<PASSWORD>') response = client.post(url, {'only_user': True}) assert response.status_code == 200 assert 'pDGB2_alpha2R' in str(response) class MultipartiteFreeTestViews(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_view(self): client = Client() url = reverse('multipartite_view_free') response = client.get(url) assert "pDGB2_alpha1R" in str(response) url = reverse('multipartite_view_free', kwargs={'form_num': '1'}) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11'}) assert "An11" in str(response) url = reverse('multipartite_view_free', kwargs={'form_num': '2'}) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11', 'part_2': 'pLuciferas'}) assert 'feature does not exist' in str(response) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11', 'part_2': 'pLuciferase'}) assert "pT35S" in str(response) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11', 'part_2': 'pLuciferase', 'part_3': 'pT35S'}) assert "<p>You have assembled in the GoldenBraid" in str(response) # reverse vector url = reverse('multipartite_view_free_genbank') response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'pMYB12', 'part_3': 'pTerm2A11', 'vector': 'pDGB1_alpha1R'}) assert response.status_code == 200 seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') assert seqrec1.name == 'GB_UA_E' multipartite_free_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBMybrev_uniq.gb') seqrec2 = SeqIO.read(gb_path, 'gb') multipartite_free_seq2 = str(seqrec2.seq)[4:] multipartite_free_seq2 += str(seqrec2.seq)[:4] assert multipartite_free_seq1 == multipartite_free_seq2 # with more than one part of the same type url = reverse('multipartite_view_free', kwargs={'form_num': '5'}) response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'GB0365', 'part_3': 'GB0653', 'part_4': 'GB0655', 'part_5': 'pT35S', 'vector': 'pDGB1_alpha1'}) assert "<p>Other.2:<a href='/feature/GB0655'>GB0655</a></p>" in str(response) def test_genbank_view(self): 'it test that the genbank file is generated' client = Client() url = reverse('multipartite_view_free_genbank') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'vector': 'pDGB1_omega1', 'part_1': 'pPE8', 'part_2': 'pANT1', 'part_3': 'pTnos'}) assert 'GB_UA_E' in str(response) assert 'LOCUS' in str(response) response = client.post(url, {'assembled_seq': 'aaa', 'vector': 'pDGB1_omega1', 'part_1': 'pPE8', 'part_2': 'pANT1', 'part_3': 'pTnos'}) assert 'GB_UA_F' in str(response) assert 'LOCUS' in str(response) # with more than one part of the same type response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'GB0365', 'part_3': 'GB0653', 'part_4': 'GB0655', 'part_5': 'pT35S', 'vector': 'pDGB1_alpha1'}) assert '(pP2A11,GB0365,GB0653,GB0655,pT35S)pDGB1_alpha1' in str(response) def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('multipartite_view_free_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'vector': 'pDGB1_omega1', 'part_1': 'pPE8', 'part_2': 'pANT1', 'part_3': 'pTnos'}) assert "75 ng of pPE8" in str(response) # with more than one part of the same type response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'GB0365', 'part_3': 'GB0653', 'part_4': 'GB0655', 'part_5': 'pT35S', 'vector': 'pDGB1_alpha1'}) assert "75 ng of GB0653" in str(response) def test_mantras_bug(self): 'it test that the protocol file is generated' client = Client() client.login(username='admin', password='password') url = reverse('multipartite_view_add') response = client.get(url) assert response.status_code == 200 response = client.post(url, {'Other': 'GB_UD_186', 'Other.2': 'GB_UD_188', 'Vector': 'pDGB1_alpha1', 'category': 'free', 'name': 'aa', 'description': '', 'reference': 'aa', 'order': 'Other:Other.2'}) class MultipartiteTestViews(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_empty_type(self): client = Client() url = reverse('multipartite_view', kwargs={'multi_type': ''}) response = client.get(url) assert "/do/multipartite/basic" in response.content def test_basic_type(self): 'It tests the basic typo of the form' client = Client() url = reverse('multipartite_view', kwargs={'multi_type': 'basic'}) response = client.post(url) assert """<p><label for="id_TER">Ter:</label>""" in str(response) assert """<select id="id_TER" maxlength="100" name="TER">""" in str(response) assert """<option value="pDGB1_alpha1R">pDGB1_alpha""" in str(response) client = Client() url = reverse('multipartite_view', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) # print response assert 'error' not in response assert response.status_code == 200 client = Client() url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) assert "LOCUS" in str(response) client = Client() url = reverse('multipartite_view', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTno'}) err1 = """<ul class="errorlist"><li>This field is required.</li></ul""" assert err1 in str(response) err2 = """<ul class="errorlist"><li>This feature does not exist in""" assert err2 in str(response) # forward vector url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pP35S', "CDS": 'pMYB12', "TER": 'pTnos', 'Vector': 'pDGB1_omega2'}) seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') multipartite_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBMyb_uniq.gb') seqrec2 = SeqIO.read(gb_path, 'gb') multipartite_seq2 = str(seqrec2.seq) assert multipartite_seq1 == multipartite_seq2 # reverse vector url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pP2A11', "CDS": 'pMYB12', "TER": 'pTerm2A11', 'Vector': 'pDGB1_alpha1R'}) assert response.status_code == 200 seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') multipartite_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBMybrev_uniq.gb') seqrec2 = SeqIO.read(gb_path, 'gb') multipartite_seq2 = str(seqrec2.seq)[4:] multipartite_seq2 += str(seqrec2.seq)[:4] assert multipartite_seq1 == multipartite_seq2 def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('multipartite_view_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'multi_type': 'basic', "PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) assert "75 ng of pPE8" in str(response) def test_genbank_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'multi_type': 'basic', "PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) assert 'LOCUS' in str(response) class BipartiteViewTest(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_bipartite(self): client = Client() # do initial url = reverse('bipartite_view') response = client.get(url) assert """<option value="GB0125">GB0125 - pEGB 35S:Rosea:Tnos</option>""" in str(response) # do page 1 url = reverse('bipartite_view', kwargs={'form_num': '1'}) response = client.post(url, {'part_1': 'GB0125'}) assert 'readonly' in str(response) assert 'value="GB0125"' in str(response) assert """<p><label for="id_part_2">Part 2:</label>""" in str(response) # do page 2 url = reverse('bipartite_view', kwargs={'form_num': '2'}) response = client.post(url, {'part_1': 'GB0125', 'part_2': 'GB0126'}) assert 'value="GB0126"' in str(response) assert "pDGB1_omega1" in str(response) # do page 3 url = reverse('bipartite_view', kwargs={'form_num': '3'}) response = client.post(url, {'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1'}) assert """<INPUT type="hidden" name="Vector" value="pDGB1_omega1">""" in str(response) assert """ <p>The resulted sequence of the assembly is""" in str(response) # forward vector url = reverse('bipartite_view_genbank') response = client.post(url, {'part_1': 'GB0129', 'part_2': 'GB0131', 'Vector': 'pDGB1_alpha1'}) assert response.status_code == 200 seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') bipartite_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBRosDelMyb.gb') seqrec2 = SeqIO.read(gb_path, 'gb') bipartite_seq2 = str(seqrec2.seq) assert bipartite_seq1 == bipartite_seq2 # check bipartite_view_genbank def test_genbank_view(self): 'it test that the genbank file is generated' client = Client() url = reverse('bipartite_view_genbank') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq':'aaa', 'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1'}) assert 'LOCUS' in str(response) # check bipartite_view_protocol def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('bipartite_view_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'name': 'kk', 'Description': 'desc', 'Reference': 'ref', 'assembled_seq': 'aaa', 'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1'}) assert 'Bipartite Assembly Protocol' in str(response) # check bipartite_view_add def test_add_view(self): 'it test that the protocol file is generated' User.objects.create_user(username='admin', email='<EMAIL>', password='password') client = Client() client.login(username='admin', password='password') url = reverse('bipartite_view_add') response = client.get(url) assert response.status_code == 200 response = client.post(url, {'assembled_seq': 'aaa', 'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1', 'name': 'aa', 'description': '', 'reference': 'aa'}) assert response.status_code == 302 class DomesticationViewTest(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_domestication(self): client = Client() # do initial url = reverse('domestication_view') response = client.get(url) assert ("""<option value="NTAG (B2)">NTAG (B2)</option>""") in str(response) # send data to formulary to test validations gb_path = os.path.join(TEST_DATA, 'domseq.gb') # add seq and category response = client.post(url, {'seq': open(gb_path), 'category': 'NTAG (B2)'}) # print str(response) assert """<ul class="errorlist"><li>The provided s""" in str(response) # not add a sequence response = client.post(url, {'seq': '', 'category': 'NTAG (B2)'}) assert """<ul class="errorlist"><li>Fasta or genbank File Required</li></ul>""" in str(response) # add category, prefix and suffix response = client.post(url, {'seq': open(gb_path), 'prefix': 'ggac', 'suffix': 'cgtc', 'category': '3UTR+TERM (B6-C1)'}) assert """<ul class="errorlist"><li>Can not use category and prefix/suffix simoultaneously</li></ul>"""in str(response) # add category and suffix response = client.post(url, {'seq': open(gb_path), 'prefix': '', 'suffix': 'cgtc', 'category': '3UTR+TERM (B6-C1)'}) assert """<ul class="errorlist"><li>Can not use category and prefix/suffix simoultaneously</li></ul>"""in str(response) # add suffix response = client.post(url, {'seq': open(gb_path), 'prefix': '', 'suffix': 'cgtc', 'category': ''}) assert """<ul class="errorlist"><li>You must provide prefix and suffix together</li></ul>""" in str(response) # not add category nor prefix and suffix response = client.post(url, {'seq': open(gb_path), 'prefix': '', 'suffix': '', 'category': ''}) assert """<ul class="errorlist"><li>At least we need category or prefix/suffix pair</li></ul>""" in str(response) # check that uses validators response = client.post(url, {'seq': open(gb_path), 'category': 'CDS (B3-B4-B5)'}) assert 'The provided seq must start with start' in str(response) response = client.post(url, {'seq': open(gb_path), 'category': 'goi (B2-B3)'}) assert 'The provided seq must have less' in str(response) # sequence start with atg fasta_path = os.path.join(TEST_DATA, 'domseqatg.fasta') response = client.post(url, {'seq': open(fasta_path), 'category': 'SP (B3)'}) assert 'The provided seq must start with start' not in str(response) # domesticate with prefix and suffix response = client.post(url, {'seq': open(gb_path), 'suffix': 'ACCT', 'prefix': 'TTCC'}) assert "<p>Prefix:TTCC</p>" in str(response) residues = str(SeqIO.read(open(gb_path), format='gb').seq) response = client.post(url, {'residues': residues, 'category': 'CDS (B3-B4-B5)'}) assert 'The provided seq must start with start' in str(response) def test_genbank_view(self): 'it test that the genbank file is generated' client = Client() url = reverse('domestication_view_genbank') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'seq': 'gagaggggggggagagagattcccctctccccccccccccccccccccccccccccccccccccctttgacctcgaaacgccccc', 'prefix': 'ggag', 'suffix': 'aatg', 'category': 'PROM+5UTR+NTAG (A1-A2-A3-B1-B2)', 'seq_name': 'test', 'with_intron': '0'}) assert 'LOCUS' in str(response) # check bipartite_view_protocol def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('domestication_view_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'seq': 'gagaggggggggagagagattcccctctccccccccccccccccctccccccccccccccccccccccccccctttgacctcgaaacgccccc', 'prefix': 'ggag', 'suffix': 'aatg', 'category': 'PROM+5UTR+NTAG (A1-A2-A3-B1-B2)', 'seq_name': 'test', 'with_intron': '0'}) assert "Oligo forward: GCGCCGTCTCGCTCGGGAGGAGAGGGGGGGGAGAGAGAT" in str(response)
# Copyright 2013 <NAME>, Univ.Politecnica Valencia, Consejo Superior de # Investigaciones Cientificas # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os.path from cStringIO import StringIO from django.test import TestCase, Client from django.core.urlresolvers import reverse from django.core.files.uploadedfile import SimpleUploadedFile from django.conf import settings as proj_settings from django.contrib.auth.models import User from Bio import SeqIO import goldenbraid from goldenbraid.views.feature import FeatureForm from goldenbraid.tests.test_fixtures import FIXTURES_TO_LOAD from goldenbraid.models import Feature from goldenbraid.tags import VECTOR_TYPE_NAME, MODULE_TYPE_NAME TEST_DATA = os.path.join(os.path.split(goldenbraid.__path__[0])[0], 'goldenbraid', 'tests', 'data') class FeatureTestViews(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_feature_page(self): client = Client() url = reverse('feature_view', kwargs={'uniquename': 'pAn11'}) response = client.get(url) assert response.status_code == 200 assert "Feature pAn11" in str(response) def test_add_feature_form(self): test_data = os.path.join(os.path.split(goldenbraid.__path__[0])[0], 'goldenbraid', 'tests', 'data') # test of the form gb_path = os.path.join(test_data, 'pAn11_uniq.gb') post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': 'CDS', 'vector': 'pDGB1_alpha1'} uploaded_fhand = open(gb_path) file_dict = {'gbfile': SimpleUploadedFile(uploaded_fhand.name, uploaded_fhand.read())} form = FeatureForm(post_dict, file_dict) self.assertTrue(form.is_valid()) # test of the form with blanck values gb_path = os.path.join(test_data, 'pAn11_uniq.gb') post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': 'CDS', 'vector': 'pDGB1_alpha1'} uploaded_fhand = open(gb_path) file_dict = {} form = FeatureForm(post_dict, file_dict) self.assertFalse(form.is_valid()) # test of the form with wrong type post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': 'vecto'} uploaded_fhand = open(gb_path) file_dict = {'gbfile': SimpleUploadedFile(uploaded_fhand.name, uploaded_fhand.read())} form = FeatureForm(post_dict, file_dict) self.assertFalse(form.is_valid()) assert form.errors.get('type') # vector does not exist # test of the form with wrong type post_dict = {'uniquename': 'vector1', 'name': 'vector1', 'type': VECTOR_TYPE_NAME, 'enzyme_out': 'vector1_enz_out', 'vector': 'vector1'} uploaded_fhand = open(gb_path) file_dict = {'gbfile': SimpleUploadedFile(uploaded_fhand.name, uploaded_fhand.read())} form = FeatureForm(post_dict, file_dict) self.assertFalse(form.is_valid()) assert form.errors.get('vector') def test_add_feature_view(self): # test of the form page # test of the form User.objects.create_user(username='admin', email='<EMAIL>', password='password') gb_path = os.path.join(TEST_DATA, 'pAn11_uniq.gb') client = Client() url = reverse('add_feature') # no login, no access response = client.post(url, {'name': 'vector1', 'type': MODULE_TYPE_NAME, 'description': 'vector1 desc', 'reference': 'vector1 ref', 'vector': 'pDGB1_omega1R', 'gbfile': open(gb_path)}) assert response.status_code == 302 client.login(username='admin', password='password') # show form response = client.get(url) assert "pDGB1_alpha1" in str(response) # add a feature url = reverse('add_feature') response = client.post(url, {'name': 'vector1', 'type': MODULE_TYPE_NAME, 'description': 'vector1 desc', 'reference': 'vector1 ref', 'vector': 'pDGB1_omega1R', 'gbfile': open(gb_path)}) assert response.status_code == 302 # TODO url to genbank file # response = client.get('/media/genbank_files/pAn11.gb') feat = Feature.objects.get(uniquename='pAn11_uniq') assert feat.name == 'vector1' assert feat.props == {u'Description': [u'vector1 desc'], u'Reference': [u'vector1 ref']} # add a feature url = reverse('add_feature') gb_path = os.path.join(TEST_DATA, 'GB_DOMEST_15.gb') response = client.post(url, {'name': 'vector1', 'type': 'TU', 'description': 'vector1 desc', 'reference': 'vector1 ref', 'vector': 'pDGB1_alpha2', 'gbfile': open(gb_path)}) assert response.status_code == 200 os.remove(os.path.join(proj_settings.MEDIA_ROOT, feat.genbank_file.name)) def test_search_feature(self): client = Client() url = reverse('search_features') response = client.get(url) assert response.status_code == 200 assert "<option value=" in str(response) response = client.post(url, {'name_or_description': 'pAn11'}) assert response.status_code == 302 response = client.post(url, {'kind': 'TER'}) assert response.status_code == 200 assert "<td>This is a pGreen destiny vector of the" in str(response) client.login(username='test', password='<PASSWORD>') response = client.post(url, {'only_user': True}) assert response.status_code == 200 assert 'pDGB2_alpha2R' in str(response) class MultipartiteFreeTestViews(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_view(self): client = Client() url = reverse('multipartite_view_free') response = client.get(url) assert "pDGB2_alpha1R" in str(response) url = reverse('multipartite_view_free', kwargs={'form_num': '1'}) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11'}) assert "An11" in str(response) url = reverse('multipartite_view_free', kwargs={'form_num': '2'}) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11', 'part_2': 'pLuciferas'}) assert 'feature does not exist' in str(response) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11', 'part_2': 'pLuciferase'}) assert "pT35S" in str(response) response = client.post(url, {'vector': 'pDGB2_alpha1R', 'part_1': 'pP2A11', 'part_2': 'pLuciferase', 'part_3': 'pT35S'}) assert "<p>You have assembled in the GoldenBraid" in str(response) # reverse vector url = reverse('multipartite_view_free_genbank') response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'pMYB12', 'part_3': 'pTerm2A11', 'vector': 'pDGB1_alpha1R'}) assert response.status_code == 200 seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') assert seqrec1.name == 'GB_UA_E' multipartite_free_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBMybrev_uniq.gb') seqrec2 = SeqIO.read(gb_path, 'gb') multipartite_free_seq2 = str(seqrec2.seq)[4:] multipartite_free_seq2 += str(seqrec2.seq)[:4] assert multipartite_free_seq1 == multipartite_free_seq2 # with more than one part of the same type url = reverse('multipartite_view_free', kwargs={'form_num': '5'}) response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'GB0365', 'part_3': 'GB0653', 'part_4': 'GB0655', 'part_5': 'pT35S', 'vector': 'pDGB1_alpha1'}) assert "<p>Other.2:<a href='/feature/GB0655'>GB0655</a></p>" in str(response) def test_genbank_view(self): 'it test that the genbank file is generated' client = Client() url = reverse('multipartite_view_free_genbank') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'vector': 'pDGB1_omega1', 'part_1': 'pPE8', 'part_2': 'pANT1', 'part_3': 'pTnos'}) assert 'GB_UA_E' in str(response) assert 'LOCUS' in str(response) response = client.post(url, {'assembled_seq': 'aaa', 'vector': 'pDGB1_omega1', 'part_1': 'pPE8', 'part_2': 'pANT1', 'part_3': 'pTnos'}) assert 'GB_UA_F' in str(response) assert 'LOCUS' in str(response) # with more than one part of the same type response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'GB0365', 'part_3': 'GB0653', 'part_4': 'GB0655', 'part_5': 'pT35S', 'vector': 'pDGB1_alpha1'}) assert '(pP2A11,GB0365,GB0653,GB0655,pT35S)pDGB1_alpha1' in str(response) def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('multipartite_view_free_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'vector': 'pDGB1_omega1', 'part_1': 'pPE8', 'part_2': 'pANT1', 'part_3': 'pTnos'}) assert "75 ng of pPE8" in str(response) # with more than one part of the same type response = client.post(url, {'part_1': 'pP2A11', 'part_2': 'GB0365', 'part_3': 'GB0653', 'part_4': 'GB0655', 'part_5': 'pT35S', 'vector': 'pDGB1_alpha1'}) assert "75 ng of GB0653" in str(response) def test_mantras_bug(self): 'it test that the protocol file is generated' client = Client() client.login(username='admin', password='password') url = reverse('multipartite_view_add') response = client.get(url) assert response.status_code == 200 response = client.post(url, {'Other': 'GB_UD_186', 'Other.2': 'GB_UD_188', 'Vector': 'pDGB1_alpha1', 'category': 'free', 'name': 'aa', 'description': '', 'reference': 'aa', 'order': 'Other:Other.2'}) class MultipartiteTestViews(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_empty_type(self): client = Client() url = reverse('multipartite_view', kwargs={'multi_type': ''}) response = client.get(url) assert "/do/multipartite/basic" in response.content def test_basic_type(self): 'It tests the basic typo of the form' client = Client() url = reverse('multipartite_view', kwargs={'multi_type': 'basic'}) response = client.post(url) assert """<p><label for="id_TER">Ter:</label>""" in str(response) assert """<select id="id_TER" maxlength="100" name="TER">""" in str(response) assert """<option value="pDGB1_alpha1R">pDGB1_alpha""" in str(response) client = Client() url = reverse('multipartite_view', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) # print response assert 'error' not in response assert response.status_code == 200 client = Client() url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) assert "LOCUS" in str(response) client = Client() url = reverse('multipartite_view', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTno'}) err1 = """<ul class="errorlist"><li>This field is required.</li></ul""" assert err1 in str(response) err2 = """<ul class="errorlist"><li>This feature does not exist in""" assert err2 in str(response) # forward vector url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pP35S', "CDS": 'pMYB12', "TER": 'pTnos', 'Vector': 'pDGB1_omega2'}) seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') multipartite_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBMyb_uniq.gb') seqrec2 = SeqIO.read(gb_path, 'gb') multipartite_seq2 = str(seqrec2.seq) assert multipartite_seq1 == multipartite_seq2 # reverse vector url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.post(url, {"PROM+UTR+ATG": 'pP2A11', "CDS": 'pMYB12', "TER": 'pTerm2A11', 'Vector': 'pDGB1_alpha1R'}) assert response.status_code == 200 seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') multipartite_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBMybrev_uniq.gb') seqrec2 = SeqIO.read(gb_path, 'gb') multipartite_seq2 = str(seqrec2.seq)[4:] multipartite_seq2 += str(seqrec2.seq)[:4] assert multipartite_seq1 == multipartite_seq2 def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('multipartite_view_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'multi_type': 'basic', "PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) assert "75 ng of pPE8" in str(response) def test_genbank_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('multipartite_view_genbank', kwargs={'multi_type': 'basic'}) response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq': 'aaa', 'multi_type': 'basic', "PROM+UTR+ATG": 'pPE8', "CDS": 'pANT1', "TER": 'pTnos', 'Vector': 'pDGB1_alpha1'}) assert 'LOCUS' in str(response) class BipartiteViewTest(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_bipartite(self): client = Client() # do initial url = reverse('bipartite_view') response = client.get(url) assert """<option value="GB0125">GB0125 - pEGB 35S:Rosea:Tnos</option>""" in str(response) # do page 1 url = reverse('bipartite_view', kwargs={'form_num': '1'}) response = client.post(url, {'part_1': 'GB0125'}) assert 'readonly' in str(response) assert 'value="GB0125"' in str(response) assert """<p><label for="id_part_2">Part 2:</label>""" in str(response) # do page 2 url = reverse('bipartite_view', kwargs={'form_num': '2'}) response = client.post(url, {'part_1': 'GB0125', 'part_2': 'GB0126'}) assert 'value="GB0126"' in str(response) assert "pDGB1_omega1" in str(response) # do page 3 url = reverse('bipartite_view', kwargs={'form_num': '3'}) response = client.post(url, {'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1'}) assert """<INPUT type="hidden" name="Vector" value="pDGB1_omega1">""" in str(response) assert """ <p>The resulted sequence of the assembly is""" in str(response) # forward vector url = reverse('bipartite_view_genbank') response = client.post(url, {'part_1': 'GB0129', 'part_2': 'GB0131', 'Vector': 'pDGB1_alpha1'}) assert response.status_code == 200 seqrec1 = SeqIO.read(StringIO(str(response)), 'gb') bipartite_seq1 = str(seqrec1.seq) gb_path = os.path.join(TEST_DATA, 'pEGBRosDelMyb.gb') seqrec2 = SeqIO.read(gb_path, 'gb') bipartite_seq2 = str(seqrec2.seq) assert bipartite_seq1 == bipartite_seq2 # check bipartite_view_genbank def test_genbank_view(self): 'it test that the genbank file is generated' client = Client() url = reverse('bipartite_view_genbank') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'assembled_seq':'aaa', 'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1'}) assert 'LOCUS' in str(response) # check bipartite_view_protocol def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('bipartite_view_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'name': 'kk', 'Description': 'desc', 'Reference': 'ref', 'assembled_seq': 'aaa', 'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1'}) assert 'Bipartite Assembly Protocol' in str(response) # check bipartite_view_add def test_add_view(self): 'it test that the protocol file is generated' User.objects.create_user(username='admin', email='<EMAIL>', password='password') client = Client() client.login(username='admin', password='password') url = reverse('bipartite_view_add') response = client.get(url) assert response.status_code == 200 response = client.post(url, {'assembled_seq': 'aaa', 'part_1': 'GB0125', 'part_2': 'GB0126', 'Vector': 'pDGB1_omega1', 'name': 'aa', 'description': '', 'reference': 'aa'}) assert response.status_code == 302 class DomesticationViewTest(TestCase): fixtures = FIXTURES_TO_LOAD multi_db = True def test_domestication(self): client = Client() # do initial url = reverse('domestication_view') response = client.get(url) assert ("""<option value="NTAG (B2)">NTAG (B2)</option>""") in str(response) # send data to formulary to test validations gb_path = os.path.join(TEST_DATA, 'domseq.gb') # add seq and category response = client.post(url, {'seq': open(gb_path), 'category': 'NTAG (B2)'}) # print str(response) assert """<ul class="errorlist"><li>The provided s""" in str(response) # not add a sequence response = client.post(url, {'seq': '', 'category': 'NTAG (B2)'}) assert """<ul class="errorlist"><li>Fasta or genbank File Required</li></ul>""" in str(response) # add category, prefix and suffix response = client.post(url, {'seq': open(gb_path), 'prefix': 'ggac', 'suffix': 'cgtc', 'category': '3UTR+TERM (B6-C1)'}) assert """<ul class="errorlist"><li>Can not use category and prefix/suffix simoultaneously</li></ul>"""in str(response) # add category and suffix response = client.post(url, {'seq': open(gb_path), 'prefix': '', 'suffix': 'cgtc', 'category': '3UTR+TERM (B6-C1)'}) assert """<ul class="errorlist"><li>Can not use category and prefix/suffix simoultaneously</li></ul>"""in str(response) # add suffix response = client.post(url, {'seq': open(gb_path), 'prefix': '', 'suffix': 'cgtc', 'category': ''}) assert """<ul class="errorlist"><li>You must provide prefix and suffix together</li></ul>""" in str(response) # not add category nor prefix and suffix response = client.post(url, {'seq': open(gb_path), 'prefix': '', 'suffix': '', 'category': ''}) assert """<ul class="errorlist"><li>At least we need category or prefix/suffix pair</li></ul>""" in str(response) # check that uses validators response = client.post(url, {'seq': open(gb_path), 'category': 'CDS (B3-B4-B5)'}) assert 'The provided seq must start with start' in str(response) response = client.post(url, {'seq': open(gb_path), 'category': 'goi (B2-B3)'}) assert 'The provided seq must have less' in str(response) # sequence start with atg fasta_path = os.path.join(TEST_DATA, 'domseqatg.fasta') response = client.post(url, {'seq': open(fasta_path), 'category': 'SP (B3)'}) assert 'The provided seq must start with start' not in str(response) # domesticate with prefix and suffix response = client.post(url, {'seq': open(gb_path), 'suffix': 'ACCT', 'prefix': 'TTCC'}) assert "<p>Prefix:TTCC</p>" in str(response) residues = str(SeqIO.read(open(gb_path), format='gb').seq) response = client.post(url, {'residues': residues, 'category': 'CDS (B3-B4-B5)'}) assert 'The provided seq must start with start' in str(response) def test_genbank_view(self): 'it test that the genbank file is generated' client = Client() url = reverse('domestication_view_genbank') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'seq': 'gagaggggggggagagagattcccctctccccccccccccccccccccccccccccccccccccctttgacctcgaaacgccccc', 'prefix': 'ggag', 'suffix': 'aatg', 'category': 'PROM+5UTR+NTAG (A1-A2-A3-B1-B2)', 'seq_name': 'test', 'with_intron': '0'}) assert 'LOCUS' in str(response) # check bipartite_view_protocol def test_protocol_view(self): 'it test that the protocol file is generated' client = Client() url = reverse('domestication_view_protocol') response = client.get(url) assert response.status_code == 400 response = client.post(url, {'seq': 'gagaggggggggagagagattcccctctccccccccccccccccctccccccccccccccccccccccccccctttgacctcgaaacgccccc', 'prefix': 'ggag', 'suffix': 'aatg', 'category': 'PROM+5UTR+NTAG (A1-A2-A3-B1-B2)', 'seq_name': 'test', 'with_intron': '0'}) assert "Oligo forward: GCGCCGTCTCGCTCGGGAGGAGAGGGGGGGGAGAGAGAT" in str(response)
en
0.58667
# Copyright 2013 <NAME>, Univ.Politecnica Valencia, Consejo Superior de # Investigaciones Cientificas # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # test of the form # test of the form with blanck values # test of the form with wrong type # vector does not exist # test of the form with wrong type # test of the form page # test of the form # no login, no access # show form # add a feature # TODO url to genbank file # response = client.get('/media/genbank_files/pAn11.gb') # add a feature # reverse vector # with more than one part of the same type # with more than one part of the same type # with more than one part of the same type <p><label for="id_TER">Ter:</label> <select id="id_TER" maxlength="100" name="TER"> <option value="pDGB1_alpha1R">pDGB1_alpha # print response <ul class="errorlist"><li>This field is required.</li></ul <ul class="errorlist"><li>This feature does not exist in # forward vector # reverse vector # do initial <option value="GB0125">GB0125 - pEGB 35S:Rosea:Tnos</option> # do page 1 <p><label for="id_part_2">Part 2:</label> # do page 2 # do page 3 <INPUT type="hidden" name="Vector" value="pDGB1_omega1"> <p>The resulted sequence of the assembly is # forward vector # check bipartite_view_genbank # check bipartite_view_protocol # check bipartite_view_add # do initial <option value="NTAG (B2)">NTAG (B2)</option> # send data to formulary to test validations # add seq and category # print str(response) <ul class="errorlist"><li>The provided s # not add a sequence <ul class="errorlist"><li>Fasta or genbank File Required</li></ul> # add category, prefix and suffix <ul class="errorlist"><li>Can not use category and prefix/suffix simoultaneously</li></ul> # add category and suffix <ul class="errorlist"><li>Can not use category and prefix/suffix simoultaneously</li></ul> # add suffix <ul class="errorlist"><li>You must provide prefix and suffix together</li></ul> # not add category nor prefix and suffix <ul class="errorlist"><li>At least we need category or prefix/suffix pair</li></ul> # check that uses validators # sequence start with atg # domesticate with prefix and suffix # check bipartite_view_protocol
2.094356
2
points2mesh/idiss_toy_example.py
Hyde46/pc2mesh
0
6617429
<reponame>Hyde46/pc2mesh import tensorflow as tf import numpy as np from tensorpack import * from tensorpack.input_source import QueueInput from tensorpack.dataflow import (PrintData, BatchData) from wrs_df import * from tabulate import tabulate from scipy.spatial.distance import pdist, squareform np.random.seed(42) tf.set_random_seed(42) class FakePointCloud(object): """ docstring for FakePointCloud """ def __init__(self, B, N, K, Din, Dout, Dp, N2=1, scaling=1): super(FakePointCloud, self).__init__() assert K < N self.B = B self.N = N self.K = K self.Din = Din self.Dout = Dout self.Dp = Dp self.N2 = N2 dtype = np.float64 def find_neighbors(positions, K): # B, Dpos, N all_neighbors = [] for batch in positions: distances = squareform(pdist(batch.T, 'euclidean')) all_neighbors.append(np.argsort(distances, axis=1)[:, :K]) return np.array(all_neighbors).transpose(0, 2, 1) def random_values(shape): return np.random.randn(*shape).astype(np.float32) self.theta = random_values( [1, self.Dp, self.Din, self.Dout]).astype(dtype) self.bias = random_values([self.Din, self.Dout]).astype(dtype) self.position = random_values([self.B, self.Dp, self.N]).astype(dtype) self.features = random_values([self.B, self.Din, self.N]).astype(dtype) self.neighborhood = find_neighbors( self.position, self.K).astype(dtype=np.int32) def init_ops(self, dtype=np.float32): self.theta_op = tf.convert_to_tensor(self.theta.astype(dtype)) self.bias_op = tf.convert_to_tensor(self.bias.astype(dtype)) self.features_op = tf.convert_to_tensor(self.features.astype(dtype)) self.position_op = tf.convert_to_tensor(self.position.astype(dtype)) self.neighborhood_op = tf.convert_to_tensor(self.neighborhood) def expected_feature_shape(self): return [self.B, self.Din, self.N] def expected_output_shape(self): return [self.B, self.Dout, self.N] def fake_pc_loader(): for k in range(1): pc = FakePointCloud(B=1, N=6, K=3, Din=3, Dout=3, Dp=3) pc.init_ops(dtype=np.float32) yield np.array([pc.position, pc.features+10]) if __name__ == '__main__': # Generate point cloud df = DataFromGenerator(fake_pc_loader) df = WRSDataFlow( df, neighborhood_sizes=3, sample_sizes=[6, 3]) df.reset_state() for d in df: # kdt_coarse = KDTree(d[0], leaf_size=16, metric='euclidean') # kdt_sparse = KDTree(d[4], leaf_size=16, metric='euclidean') # neighborhood = kdt_sparse.query( # kdt_coarse.data, k = 4, dualtree = False, return_distance = False) # print d[0] # print d[1] print d[2] print d[3] print " " # print d[4] # print d[5] print d[6] print d[7] print " " ''' # print d[8] print d[9] print d[10] print d[11] print "" print "" '''
import tensorflow as tf import numpy as np from tensorpack import * from tensorpack.input_source import QueueInput from tensorpack.dataflow import (PrintData, BatchData) from wrs_df import * from tabulate import tabulate from scipy.spatial.distance import pdist, squareform np.random.seed(42) tf.set_random_seed(42) class FakePointCloud(object): """ docstring for FakePointCloud """ def __init__(self, B, N, K, Din, Dout, Dp, N2=1, scaling=1): super(FakePointCloud, self).__init__() assert K < N self.B = B self.N = N self.K = K self.Din = Din self.Dout = Dout self.Dp = Dp self.N2 = N2 dtype = np.float64 def find_neighbors(positions, K): # B, Dpos, N all_neighbors = [] for batch in positions: distances = squareform(pdist(batch.T, 'euclidean')) all_neighbors.append(np.argsort(distances, axis=1)[:, :K]) return np.array(all_neighbors).transpose(0, 2, 1) def random_values(shape): return np.random.randn(*shape).astype(np.float32) self.theta = random_values( [1, self.Dp, self.Din, self.Dout]).astype(dtype) self.bias = random_values([self.Din, self.Dout]).astype(dtype) self.position = random_values([self.B, self.Dp, self.N]).astype(dtype) self.features = random_values([self.B, self.Din, self.N]).astype(dtype) self.neighborhood = find_neighbors( self.position, self.K).astype(dtype=np.int32) def init_ops(self, dtype=np.float32): self.theta_op = tf.convert_to_tensor(self.theta.astype(dtype)) self.bias_op = tf.convert_to_tensor(self.bias.astype(dtype)) self.features_op = tf.convert_to_tensor(self.features.astype(dtype)) self.position_op = tf.convert_to_tensor(self.position.astype(dtype)) self.neighborhood_op = tf.convert_to_tensor(self.neighborhood) def expected_feature_shape(self): return [self.B, self.Din, self.N] def expected_output_shape(self): return [self.B, self.Dout, self.N] def fake_pc_loader(): for k in range(1): pc = FakePointCloud(B=1, N=6, K=3, Din=3, Dout=3, Dp=3) pc.init_ops(dtype=np.float32) yield np.array([pc.position, pc.features+10]) if __name__ == '__main__': # Generate point cloud df = DataFromGenerator(fake_pc_loader) df = WRSDataFlow( df, neighborhood_sizes=3, sample_sizes=[6, 3]) df.reset_state() for d in df: # kdt_coarse = KDTree(d[0], leaf_size=16, metric='euclidean') # kdt_sparse = KDTree(d[4], leaf_size=16, metric='euclidean') # neighborhood = kdt_sparse.query( # kdt_coarse.data, k = 4, dualtree = False, return_distance = False) # print d[0] # print d[1] print d[2] print d[3] print " " # print d[4] # print d[5] print d[6] print d[7] print " " ''' # print d[8] print d[9] print d[10] print d[11] print "" print "" '''
en
0.499295
docstring for FakePointCloud # B, Dpos, N # Generate point cloud # kdt_coarse = KDTree(d[0], leaf_size=16, metric='euclidean') # kdt_sparse = KDTree(d[4], leaf_size=16, metric='euclidean') # neighborhood = kdt_sparse.query( # kdt_coarse.data, k = 4, dualtree = False, return_distance = False) # print d[0] # print d[1] # print d[4] # print d[5] # print d[8] print d[9] print d[10] print d[11] print "" print ""
2.21397
2
utils/mobility.py
pengyuan/markov2tensor
1
6617430
<reponame>pengyuan/markov2tensor<gh_stars>1-10 #!/usr/bin/env python # coding: UTF-8 """ gowalla_filter: SELECT user,COUNT(unkown) as loc,COUNT(DISTINCT unkown) as distinct_loc,COUNT(unkown)/COUNT(DISTINCT unkown) as ratio FROM raw a GROUP BY `user` ORDER BY ratio desc; 找出那些比率(所有地点/不同地点)合适的用户 所有地点决定了tensor的稀疏度;不同地点决定了tensor的dimensionality eg:找到了用户id为147986的所有记录,并将unknow一栏替换为字母(为了方便分析) """ from __future__ import division import MySQLdb from scipy import linalg import numpy as np from numpy.matlib import eye, identity from preprocess import settings __author__ = '<NAME> <<EMAIL>>' __copyright__ = 'Copyright (c) 2014 <NAME>' __license__ = 'Public domain' #连接数据库 def init_data(users, train = 1): conn = MySQLdb.connect(host = settings.HOST, user = settings.USER, passwd = settings.PASSWORD, db=settings.DB) cursor = conn.cursor() result = 0 #得到用户所有位置移动信息,按时间排序 #select distinct poi_name from staypoint where user_id in (0,3,4,5,30) and province = '北京市' and district = "海淀区"; try: if len(users) == 1: sql = "select distinct(poi_name) from staypoint where user_id = "+ str(users[0]) +" and province = '北京市' and district = '海淀区' order by id" else: sql = "select distinct(poi_name) from staypoint where user_id in "+ users.__str__() +" and province = '北京市' and district = '海淀区' order by id" print sql result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() #print len(result) pois_axis = {} axis_pois = {} index = 0 for item in result: pois_axis[item] = index axis_pois[index] = item index += 1 datas = {} predicts = {} recommends = {} for user in users: try: sql = "select poi_name from staypoint where user_id = "+ str(user) +" and province = '北京市' and district = '海淀区' order by id" result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() data = [] length = int(len(result) * train) train_data = result[:length] remain_data = result[length:] for item in train_data: data.append(pois_axis[item]) train_set = set(train_data) predict = [] recommend = [] for item in remain_data: if item in train_set: predict.append(pois_axis[item]) else: recommend.append(pois_axis[item]) datas[user] = data predicts[user] = predict recommends[user] = recommend cursor.close() conn.close() # print pois_axis # print axis_pois # print datas return axis_pois, datas, predicts, recommends # 连接数据库 '''strategy 1: arrival_slot; 2: existance''' def init_data2(users, train, time_slice): conn = MySQLdb.connect(host = settings.HOST, user = settings.USER, passwd = settings.PASSWORD, db=settings.DB) cursor = conn.cursor() result = 0 #得到用户所有位置移动信息,按时间排序 #select distinct poi_name from staypoint where user_id in (0,3,4,5,30) and province = '北京市' and district = "海淀区"; try: if len(users) == 1: sql = "select distinct(poi_name) from staypoint where user_id = "+ str(users[0]) +" and province = '北京市' and district = '海淀区' order by id" else: sql = "select distinct(poi_name) from staypoint where user_id in "+ users.__str__() +" and province = '北京市' and district = '海淀区' order by id" print sql result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() # print len(result) pois_axis = {} axis_pois = {} index = 0 for item in result: pois_axis[item[0]] = index axis_pois[index] = item[0] index += 1 datas = {} predicts = {} recommends = {} # trains = {} time_slot = range(0, time_slice) for user in users: try: # sql = "select poi_name from staypoint where user_id = "+ str(user) +" and province = '北京市' and district = '海淀区' and arrival_timestamp % 86400 div 3600 = "+str(slot) sql = "select poi_name, arrival_timestamp from staypoint where user_id = "+ str(user) +" and province = '北京市' and district = '海淀区' order by id" result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() data = {} for slot in time_slot: data[slot] = [] length = int(len(result) * train) train_data = result[:length] remain_data = result[length:] # train_data_list = [] for item in train_data: # print data.keys() index = item[1] % 86400 // (3600 * (24 // time_slice)) # print type(index) # print data.has_key(index) data[index].append(pois_axis[item[0]]) # train_data_list.append(pois_axis[item[0]]) datas[user] = data # train_set = set(train_data_list) # print "trainset: ", train_set predict = {} recommend = {} for slot in time_slot: recommend[slot] = set() predict[slot] = set() for item in remain_data: axis = pois_axis[item[0]] index = item[1] % 86400 // (3600 * (24 // time_slice)) if axis in set(data[index]): predict[index].add(pois_axis[item[0]]) else: recommend[index].add(pois_axis[item[0]]) predicts[user] = predict recommends[user] = recommend # trains[user] = train_set cursor.close() conn.close() # print pois_axis # print axis_pois # print datas return axis_pois, datas, predicts, recommends # 从线性停留点序列计算马儿可夫转移矩阵或转移张量 def trans(data, dimensionality, order): # 得到停留点序列长度 data_length = len(data) if order == 2: tensor = [[0 for i in range(dimensionality)] for j in range(dimensionality)] for index in range(data_length-1): check_list = data[index:index+2] tensor[check_list[0]][check_list[1]] += 1 for item in range(dimensionality): count_sum = 0 for item2 in range(dimensionality): count_sum += tensor[item][item2] if 0 == count_sum: continue else: for item3 in range(dimensionality): tensor[item][item3] = tensor[item][item3] / count_sum elif order == 3: # 三维数组,元素初始化为零 tensor = [[[0 for i in range(dimensionality)] for j in range(dimensionality)] for k in range(dimensionality)] for index in range(data_length-2): check_list = data[index:index+3] tensor[check_list[0]][check_list[1]][check_list[2]] += 1 for item in range(dimensionality): for item2 in range(dimensionality): count_sum = 0 for item3 in range(dimensionality): count_sum += tensor[item][item2][item3] if 0 == count_sum: continue else: for item4 in range(dimensionality): tensor[item][item2][item4] = tensor[item][item2][item4] / count_sum return tensor # 从线性停留点序列统计用户-时间-频数 def trans2(data_map, poi_dimension, users, time_slice): user_dimension = len(users) # 三维数组,元素初始化为零 tensor = [[[0 for poi in range(poi_dimension)] for time in range(0, time_slice)] for user in range(user_dimension)] print np.array(tensor).shape for key in data_map.keys(): data = data_map[key] for slot in range(0, time_slice): poi_list = data[slot] for poi in poi_list: tensor[users.index(key)][slot][poi] += 1 # for item in range(dimensionality): # for item2 in range(dimensionality): # count_sum = 0 # for item3 in range(dimensionality): # count_sum += tensor[item][item2][item3] # if 0 == count_sum: # continue # else: # for item4 in range(dimensionality): # tensor[item][item2][item4] = tensor[item][item2][item4] / count_sum return tensor def is_contain_zero(vector): length = len(vector) while(True): if vector[length-1] == 0: length -= 1 else: break return vector.any(0), length-1 def matrix_sn_nn(res): # # print tensor[:-1] # x = np.array(matrix) # # # sum(1) 按行求和 # print "sum: ", x.sum(1) # # U, s, Vh = linalg.svd(matrix, full_matrices=True) # # print type(s) # # # print U # U2 = U[:, :] # # print U2 # # V2 = Vh[:, :] # # s = s[:] # S = np.diag(s) # # print S # # # S = linalg.diagsvd(s, 6, 6) # # print np.allclose(tensor, np.dot(U, np.dot(S, Vh))) # # print np.allclose(matrix, np.dot(U2, np.dot(S, V2))) # # temp = U2.transpose().sum(1) # print "temp1: ", temp.shape # temp = np.array([temp]).transpose() # print "temp2: ", temp.shape # # # print type(temp) # # print identity(4) # # # # # # print type(eye(4)) # # print eye(4).shape[1] # # flag, num = is_contain_zero(temp) # nr = U2.shape[1] # # print "is_contains_zero: ", flag, num # # if flag: # print nr, num, type(np.zeros((nr, num-1))), type(temp) # print np.zeros((nr, num-1)).shape # print temp.shape, np.ones((nr, 1)).shape # # print np.sum([[0, 1], [0, 5]], axis=1) # # # temp_matrix = np.concatenate((np.zeros((nr, num-1)), temp-np.ones((nr, 1))), 1) # sigma = identity(nr) + np.concatenate((temp_matrix, np.zeros((nr, nr-num))), 1) # else: # sigma = np.diag(temp) # # res = U2.dot(sigma) print "res1: ", res res = np.array(res) nc = res.shape[1] res_min = res.min() # print np.transpose(S) if res_min >= -1: param = 1 else: param = 1/abs(res_min) param_matrix = (1/(nc+param))*(np.ones((nc, nc)) + param * eye(nc)) result = res.dot(param_matrix) print result.sum(1) return np.array(result)#, sigma, param_matrix if __name__ == '__main__': # init_data((0, 3, 4, 5, 30)) #res, sigma, param = matrix_sn_nn([[2**0.5/2, -2**0.5/2], [2**0.5/2, 2**0.5/2]]) #res, sigma, param = matrix_sn_nn([[0.2, 0.8], [0.3, 0.7]]) # print "res2: ", res,res[0][0],res[0][1] # print "sigma: ", sigma # print "param: ", param.dot(np.linalg.inv(param)) # res = matrix_sn_nn([[0.1, 0.2, 0.3, 0.4], [0.3, 0.6, 0.05, 0.05]]) res = matrix_sn_nn([[-0.1, 0.2, 0.5, 0.5], [0.3, 0.6, 0.1, 0]]) print "res2:", res
#!/usr/bin/env python # coding: UTF-8 """ gowalla_filter: SELECT user,COUNT(unkown) as loc,COUNT(DISTINCT unkown) as distinct_loc,COUNT(unkown)/COUNT(DISTINCT unkown) as ratio FROM raw a GROUP BY `user` ORDER BY ratio desc; 找出那些比率(所有地点/不同地点)合适的用户 所有地点决定了tensor的稀疏度;不同地点决定了tensor的dimensionality eg:找到了用户id为147986的所有记录,并将unknow一栏替换为字母(为了方便分析) """ from __future__ import division import MySQLdb from scipy import linalg import numpy as np from numpy.matlib import eye, identity from preprocess import settings __author__ = '<NAME> <<EMAIL>>' __copyright__ = 'Copyright (c) 2014 <NAME>' __license__ = 'Public domain' #连接数据库 def init_data(users, train = 1): conn = MySQLdb.connect(host = settings.HOST, user = settings.USER, passwd = settings.PASSWORD, db=settings.DB) cursor = conn.cursor() result = 0 #得到用户所有位置移动信息,按时间排序 #select distinct poi_name from staypoint where user_id in (0,3,4,5,30) and province = '北京市' and district = "海淀区"; try: if len(users) == 1: sql = "select distinct(poi_name) from staypoint where user_id = "+ str(users[0]) +" and province = '北京市' and district = '海淀区' order by id" else: sql = "select distinct(poi_name) from staypoint where user_id in "+ users.__str__() +" and province = '北京市' and district = '海淀区' order by id" print sql result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() #print len(result) pois_axis = {} axis_pois = {} index = 0 for item in result: pois_axis[item] = index axis_pois[index] = item index += 1 datas = {} predicts = {} recommends = {} for user in users: try: sql = "select poi_name from staypoint where user_id = "+ str(user) +" and province = '北京市' and district = '海淀区' order by id" result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() data = [] length = int(len(result) * train) train_data = result[:length] remain_data = result[length:] for item in train_data: data.append(pois_axis[item]) train_set = set(train_data) predict = [] recommend = [] for item in remain_data: if item in train_set: predict.append(pois_axis[item]) else: recommend.append(pois_axis[item]) datas[user] = data predicts[user] = predict recommends[user] = recommend cursor.close() conn.close() # print pois_axis # print axis_pois # print datas return axis_pois, datas, predicts, recommends # 连接数据库 '''strategy 1: arrival_slot; 2: existance''' def init_data2(users, train, time_slice): conn = MySQLdb.connect(host = settings.HOST, user = settings.USER, passwd = settings.PASSWORD, db=settings.DB) cursor = conn.cursor() result = 0 #得到用户所有位置移动信息,按时间排序 #select distinct poi_name from staypoint where user_id in (0,3,4,5,30) and province = '北京市' and district = "海淀区"; try: if len(users) == 1: sql = "select distinct(poi_name) from staypoint where user_id = "+ str(users[0]) +" and province = '北京市' and district = '海淀区' order by id" else: sql = "select distinct(poi_name) from staypoint where user_id in "+ users.__str__() +" and province = '北京市' and district = '海淀区' order by id" print sql result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() # print len(result) pois_axis = {} axis_pois = {} index = 0 for item in result: pois_axis[item[0]] = index axis_pois[index] = item[0] index += 1 datas = {} predicts = {} recommends = {} # trains = {} time_slot = range(0, time_slice) for user in users: try: # sql = "select poi_name from staypoint where user_id = "+ str(user) +" and province = '北京市' and district = '海淀区' and arrival_timestamp % 86400 div 3600 = "+str(slot) sql = "select poi_name, arrival_timestamp from staypoint where user_id = "+ str(user) +" and province = '北京市' and district = '海淀区' order by id" result = cursor.execute(sql) result = cursor.fetchall() conn.commit() except Exception, e: print e conn.rollback() data = {} for slot in time_slot: data[slot] = [] length = int(len(result) * train) train_data = result[:length] remain_data = result[length:] # train_data_list = [] for item in train_data: # print data.keys() index = item[1] % 86400 // (3600 * (24 // time_slice)) # print type(index) # print data.has_key(index) data[index].append(pois_axis[item[0]]) # train_data_list.append(pois_axis[item[0]]) datas[user] = data # train_set = set(train_data_list) # print "trainset: ", train_set predict = {} recommend = {} for slot in time_slot: recommend[slot] = set() predict[slot] = set() for item in remain_data: axis = pois_axis[item[0]] index = item[1] % 86400 // (3600 * (24 // time_slice)) if axis in set(data[index]): predict[index].add(pois_axis[item[0]]) else: recommend[index].add(pois_axis[item[0]]) predicts[user] = predict recommends[user] = recommend # trains[user] = train_set cursor.close() conn.close() # print pois_axis # print axis_pois # print datas return axis_pois, datas, predicts, recommends # 从线性停留点序列计算马儿可夫转移矩阵或转移张量 def trans(data, dimensionality, order): # 得到停留点序列长度 data_length = len(data) if order == 2: tensor = [[0 for i in range(dimensionality)] for j in range(dimensionality)] for index in range(data_length-1): check_list = data[index:index+2] tensor[check_list[0]][check_list[1]] += 1 for item in range(dimensionality): count_sum = 0 for item2 in range(dimensionality): count_sum += tensor[item][item2] if 0 == count_sum: continue else: for item3 in range(dimensionality): tensor[item][item3] = tensor[item][item3] / count_sum elif order == 3: # 三维数组,元素初始化为零 tensor = [[[0 for i in range(dimensionality)] for j in range(dimensionality)] for k in range(dimensionality)] for index in range(data_length-2): check_list = data[index:index+3] tensor[check_list[0]][check_list[1]][check_list[2]] += 1 for item in range(dimensionality): for item2 in range(dimensionality): count_sum = 0 for item3 in range(dimensionality): count_sum += tensor[item][item2][item3] if 0 == count_sum: continue else: for item4 in range(dimensionality): tensor[item][item2][item4] = tensor[item][item2][item4] / count_sum return tensor # 从线性停留点序列统计用户-时间-频数 def trans2(data_map, poi_dimension, users, time_slice): user_dimension = len(users) # 三维数组,元素初始化为零 tensor = [[[0 for poi in range(poi_dimension)] for time in range(0, time_slice)] for user in range(user_dimension)] print np.array(tensor).shape for key in data_map.keys(): data = data_map[key] for slot in range(0, time_slice): poi_list = data[slot] for poi in poi_list: tensor[users.index(key)][slot][poi] += 1 # for item in range(dimensionality): # for item2 in range(dimensionality): # count_sum = 0 # for item3 in range(dimensionality): # count_sum += tensor[item][item2][item3] # if 0 == count_sum: # continue # else: # for item4 in range(dimensionality): # tensor[item][item2][item4] = tensor[item][item2][item4] / count_sum return tensor def is_contain_zero(vector): length = len(vector) while(True): if vector[length-1] == 0: length -= 1 else: break return vector.any(0), length-1 def matrix_sn_nn(res): # # print tensor[:-1] # x = np.array(matrix) # # # sum(1) 按行求和 # print "sum: ", x.sum(1) # # U, s, Vh = linalg.svd(matrix, full_matrices=True) # # print type(s) # # # print U # U2 = U[:, :] # # print U2 # # V2 = Vh[:, :] # # s = s[:] # S = np.diag(s) # # print S # # # S = linalg.diagsvd(s, 6, 6) # # print np.allclose(tensor, np.dot(U, np.dot(S, Vh))) # # print np.allclose(matrix, np.dot(U2, np.dot(S, V2))) # # temp = U2.transpose().sum(1) # print "temp1: ", temp.shape # temp = np.array([temp]).transpose() # print "temp2: ", temp.shape # # # print type(temp) # # print identity(4) # # # # # # print type(eye(4)) # # print eye(4).shape[1] # # flag, num = is_contain_zero(temp) # nr = U2.shape[1] # # print "is_contains_zero: ", flag, num # # if flag: # print nr, num, type(np.zeros((nr, num-1))), type(temp) # print np.zeros((nr, num-1)).shape # print temp.shape, np.ones((nr, 1)).shape # # print np.sum([[0, 1], [0, 5]], axis=1) # # # temp_matrix = np.concatenate((np.zeros((nr, num-1)), temp-np.ones((nr, 1))), 1) # sigma = identity(nr) + np.concatenate((temp_matrix, np.zeros((nr, nr-num))), 1) # else: # sigma = np.diag(temp) # # res = U2.dot(sigma) print "res1: ", res res = np.array(res) nc = res.shape[1] res_min = res.min() # print np.transpose(S) if res_min >= -1: param = 1 else: param = 1/abs(res_min) param_matrix = (1/(nc+param))*(np.ones((nc, nc)) + param * eye(nc)) result = res.dot(param_matrix) print result.sum(1) return np.array(result)#, sigma, param_matrix if __name__ == '__main__': # init_data((0, 3, 4, 5, 30)) #res, sigma, param = matrix_sn_nn([[2**0.5/2, -2**0.5/2], [2**0.5/2, 2**0.5/2]]) #res, sigma, param = matrix_sn_nn([[0.2, 0.8], [0.3, 0.7]]) # print "res2: ", res,res[0][0],res[0][1] # print "sigma: ", sigma # print "param: ", param.dot(np.linalg.inv(param)) # res = matrix_sn_nn([[0.1, 0.2, 0.3, 0.4], [0.3, 0.6, 0.05, 0.05]]) res = matrix_sn_nn([[-0.1, 0.2, 0.5, 0.5], [0.3, 0.6, 0.1, 0]]) print "res2:", res
en
0.357107
#!/usr/bin/env python # coding: UTF-8 gowalla_filter: SELECT user,COUNT(unkown) as loc,COUNT(DISTINCT unkown) as distinct_loc,COUNT(unkown)/COUNT(DISTINCT unkown) as ratio FROM raw a GROUP BY `user` ORDER BY ratio desc; 找出那些比率(所有地点/不同地点)合适的用户 所有地点决定了tensor的稀疏度;不同地点决定了tensor的dimensionality eg:找到了用户id为147986的所有记录,并将unknow一栏替换为字母(为了方便分析) #连接数据库 #得到用户所有位置移动信息,按时间排序 #select distinct poi_name from staypoint where user_id in (0,3,4,5,30) and province = '北京市' and district = "海淀区"; #print len(result) # print pois_axis # print axis_pois # print datas # 连接数据库 strategy 1: arrival_slot; 2: existance #得到用户所有位置移动信息,按时间排序 #select distinct poi_name from staypoint where user_id in (0,3,4,5,30) and province = '北京市' and district = "海淀区"; # print len(result) # trains = {} # sql = "select poi_name from staypoint where user_id = "+ str(user) +" and province = '北京市' and district = '海淀区' and arrival_timestamp % 86400 div 3600 = "+str(slot) # train_data_list = [] # print data.keys() # print type(index) # print data.has_key(index) # train_data_list.append(pois_axis[item[0]]) # train_set = set(train_data_list) # print "trainset: ", train_set # trains[user] = train_set # print pois_axis # print axis_pois # print datas # 从线性停留点序列计算马儿可夫转移矩阵或转移张量 # 得到停留点序列长度 # 三维数组,元素初始化为零 # 从线性停留点序列统计用户-时间-频数 # 三维数组,元素初始化为零 # for item in range(dimensionality): # for item2 in range(dimensionality): # count_sum = 0 # for item3 in range(dimensionality): # count_sum += tensor[item][item2][item3] # if 0 == count_sum: # continue # else: # for item4 in range(dimensionality): # tensor[item][item2][item4] = tensor[item][item2][item4] / count_sum # # print tensor[:-1] # x = np.array(matrix) # # # sum(1) 按行求和 # print "sum: ", x.sum(1) # # U, s, Vh = linalg.svd(matrix, full_matrices=True) # # print type(s) # # # print U # U2 = U[:, :] # # print U2 # # V2 = Vh[:, :] # # s = s[:] # S = np.diag(s) # # print S # # # S = linalg.diagsvd(s, 6, 6) # # print np.allclose(tensor, np.dot(U, np.dot(S, Vh))) # # print np.allclose(matrix, np.dot(U2, np.dot(S, V2))) # # temp = U2.transpose().sum(1) # print "temp1: ", temp.shape # temp = np.array([temp]).transpose() # print "temp2: ", temp.shape # # # print type(temp) # # print identity(4) # # # # # # print type(eye(4)) # # print eye(4).shape[1] # # flag, num = is_contain_zero(temp) # nr = U2.shape[1] # # print "is_contains_zero: ", flag, num # # if flag: # print nr, num, type(np.zeros((nr, num-1))), type(temp) # print np.zeros((nr, num-1)).shape # print temp.shape, np.ones((nr, 1)).shape # # print np.sum([[0, 1], [0, 5]], axis=1) # # # temp_matrix = np.concatenate((np.zeros((nr, num-1)), temp-np.ones((nr, 1))), 1) # sigma = identity(nr) + np.concatenate((temp_matrix, np.zeros((nr, nr-num))), 1) # else: # sigma = np.diag(temp) # # res = U2.dot(sigma) # print np.transpose(S) #, sigma, param_matrix # init_data((0, 3, 4, 5, 30)) #res, sigma, param = matrix_sn_nn([[2**0.5/2, -2**0.5/2], [2**0.5/2, 2**0.5/2]]) #res, sigma, param = matrix_sn_nn([[0.2, 0.8], [0.3, 0.7]]) # print "res2: ", res,res[0][0],res[0][1] # print "sigma: ", sigma # print "param: ", param.dot(np.linalg.inv(param)) # res = matrix_sn_nn([[0.1, 0.2, 0.3, 0.4], [0.3, 0.6, 0.05, 0.05]])
2.651484
3
tests/test_lapjv.py
DavidStirling/centrosome
0
6617431
<reponame>DavidStirling/centrosome<gh_stars>0 from __future__ import absolute_import import numpy as np import unittest import centrosome.lapjv as LAPJV from centrosome.filter import permutations from six.moves import range from six.moves import zip class TestLAPJVPYX(unittest.TestCase): def test_01_01_reduction_transfer(self): """Test the reduction transfer implementation""" cases = [ dict( i=[0, 1, 2], j=[0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6], count=[3, 3, 3], x=[2, 0, 1], y=[1, 2, 0], c=[5.0, 4.0, 1.0, 2.0, 6.0, 4.0, 4.0, 3.0, 7.0], u_in=[0.0, 0.0, 0.0], v_in=[1.0, 2.0, 3.0], u_out=[2.0, 3.0, 6.0], v_out=[-2.0, -4.0, 1.0], ), dict( i=[1, 2, 3], j=[0, 1, 2, 0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6, 9], count=[3, 3, 3, 3], x=[3, 2, 0, 1], y=[1, 2, 0, 3], c=[0.0, 0.0, 0.0, 5.0, 4.0, 1.0, 2.0, 6.0, 4.0, 4.0, 3.0, 7.0], u_in=[0.0, 0.0, 0.0, 0.0], v_in=[1.0, 2.0, 3.0, 0.0], u_out=[0.0, 2.0, 3.0, 6.0], v_out=[-2.0, -4.0, 1.0, 0.0], ), ] for case in cases: u = np.ascontiguousarray(case["u_in"], np.float64) v = np.ascontiguousarray(case["v_in"], np.float64) LAPJV.reduction_transfer( np.ascontiguousarray(case["i"], np.uint32), np.ascontiguousarray(case["j"], np.uint32), np.ascontiguousarray(case["idx"], np.uint32), np.ascontiguousarray(case["count"], np.uint32), np.ascontiguousarray(case["x"], np.uint32), u, v, np.ascontiguousarray(case["c"], np.float64), ) expected_u = np.array(case["u_out"]) expected_v = np.array(case["v_out"]) np.testing.assert_array_almost_equal(expected_u, u) np.testing.assert_array_almost_equal(expected_v, v) def test_02_01_augmenting_row_reduction(self): cases = [ dict( n=3, ii=[1], jj=[0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6], count=[3, 3, 3], x=[1, 3, 0], y=[2, 0, 3], u_in=[1.0, 2.0, 3.0], v_in=[1.0, 2.0, 3.0], c=[3.0, 6.0, 5.0, 5.0, 5.0, 7.1, 8.0, 11.0, 9.0], u_out=[1.0, 2.0, 3.0], v_out=[1.0, 1.0, 3.0], x_out=[2, 1, 0], y_out=[2, 1, 0], ) ] for case in cases: u = np.ascontiguousarray(case["u_in"], np.float64) v = np.ascontiguousarray(case["v_in"], np.float64) x = np.ascontiguousarray(case["x"], np.uint32) y = np.ascontiguousarray(case["y"], np.uint32) LAPJV.augmenting_row_reduction( case["n"], np.ascontiguousarray(case["ii"], np.uint32), np.ascontiguousarray(case["jj"], np.uint32), np.ascontiguousarray(case["idx"], np.uint32), np.ascontiguousarray(case["count"], np.uint32), x, y, u, v, np.ascontiguousarray(case["c"], np.float64), ) expected_u = np.array(case["u_out"]) expected_v = np.array(case["v_out"]) expected_x = np.array(case["x_out"]) expected_y = np.array(case["y_out"]) np.testing.assert_array_almost_equal(expected_u, u) np.testing.assert_array_almost_equal(expected_v, v) np.testing.assert_array_equal(expected_x, x) np.testing.assert_array_equal(expected_y, y) def test_03_01_augment(self): cases = [ dict( n=3, i=[2], j=[0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6], count=[3, 3, 3], x_in=[0, 1, 3], x_out=[0, 1, 2], y_in=[0, 1, 3], y_out=[0, 1, 2], u_in=[4, 0, 2], v_in=[-1, 1, 1], u_out=[4, 0, 2], v_out=[-1, 1, 1], c=[3, 5, 7, 4, 1, 6, 2, 3, 3], ) ] for case in cases: n = case["n"] i = np.ascontiguousarray(case["i"], np.uint32) j = np.ascontiguousarray(case["j"], np.uint32) idx = np.ascontiguousarray(case["idx"], np.uint32) count = np.ascontiguousarray(case["count"], np.uint32) x = np.ascontiguousarray(case["x_in"], np.uint32) y = np.ascontiguousarray(case["y_in"], np.uint32) u = np.ascontiguousarray(case["u_in"], np.float64) v = np.ascontiguousarray(case["v_in"], np.float64) c = np.ascontiguousarray(case["c"], np.float64) LAPJV.augment(n, i, j, idx, count, x, y, u, v, c) np.testing.assert_array_equal(x, case["x_out"]) np.testing.assert_array_equal(y, case["y_out"]) np.testing.assert_almost_equal(u, case["u_out"]) np.testing.assert_almost_equal(v, case["v_out"]) class TestLAPJV(unittest.TestCase): def test_01_02(self): r = np.random.RandomState() r.seed(11) for reductions in [0, 2]: for _ in range(100): c = r.randint(1, 10, (5, 5)) i, j = np.mgrid[0:5, 0:5] i = i.flatten() j = j.flatten() x, y, u, v = LAPJV.lapjv(i, j, c.flatten(), True, reductions) min_cost = np.sum(c) best = None for permutation in permutations([0, 1, 2, 3, 4]): cost = sum([c[i, permutation[i]] for i in range(5)]) if cost < min_cost: best = list(permutation) min_cost = cost result_cost = sum([c[i, x[i]] for i in range(5)]) self.assertAlmostEqual(min_cost, result_cost) def test_01_03(self): """Regression tests of matrices that crashed lapjv""" dd = [ np.array( [ [0.0, 0.0, 0.0], [1.0, 1.0, 5.34621029], [1.0, 7.0, 55.0], [2.0, 2.0, 2.09806089], [2.0, 8.0, 55.0], [3.0, 3.0, 4.82063029], [3.0, 9.0, 55.0], [4.0, 4.0, 3.99481917], [4.0, 10.0, 55.0], [5.0, 5.0, 3.18959054], [5.0, 11.0, 55.0], [6.0, 1.0, 55.0], [6.0, 7.0, 0.0], [6.0, 8.0, 0.0], [6.0, 9.0, 0.0], [6.0, 10.0, 0.0], [6.0, 11.0, 0.0], [7.0, 2.0, 55.0], [7.0, 7.0, 0.0], [7.0, 8.0, 0.0], [7.0, 9.0, 0.0], [7.0, 10.0, 0.0], [7.0, 11.0, 0.0], [8.0, 3.0, 55.0], [8.0, 7.0, 0.0], [8.0, 8.0, 0.0], [8.0, 9.0, 0.0], [8.0, 10.0, 0.0], [8.0, 11.0, 0.0], [9.0, 4.0, 55.0], [9.0, 7.0, 0.0], [9.0, 8.0, 0.0], [9.0, 9.0, 0.0], [9.0, 10.0, 0.0], [9.0, 11.0, 0.0], [10.0, 5.0, 55.0], [10.0, 7.0, 0.0], [10.0, 8.0, 0.0], [10.0, 9.0, 0.0], [10.0, 10.0, 0.0], [10.0, 11.0, 0.0], [11.0, 6.0, 55.0], [11.0, 7.0, 0.0], [11.0, 8.0, 0.0], [11.0, 9.0, 0.0], [11.0, 10.0, 0.0], [11.0, 11.0, 0.0], ] ), np.array( [ [0.0, 0.0, 0.0], [1.0, 1.0, 1.12227977], [1.0, 6.0, 55.0], [2.0, 2.0, 18.66735253], [2.0, 4.0, 16.2875504], [2.0, 7.0, 55.0], [3.0, 5.0, 1.29944194], [3.0, 8.0, 55.0], [4.0, 5.0, 32.61892281], [4.0, 9.0, 55.0], [5.0, 1.0, 55.0], [5.0, 6.0, 0.0], [5.0, 7.0, 0.0], [5.0, 8.0, 0.0], [5.0, 9.0, 0.0], [6.0, 2.0, 55.0], [6.0, 6.0, 0.0], [6.0, 7.0, 0.0], [6.0, 8.0, 0.0], [6.0, 9.0, 0.0], [7.0, 3.0, 55.0], [7.0, 6.0, 0.0], [7.0, 7.0, 0.0], [7.0, 8.0, 0.0], [7.0, 9.0, 0.0], [8.0, 4.0, 55.0], [8.0, 6.0, 0.0], [8.0, 7.0, 0.0], [8.0, 8.0, 0.0], [8.0, 9.0, 0.0], [9.0, 5.0, 55.0], [9.0, 6.0, 0.0], [9.0, 7.0, 0.0], [9.0, 8.0, 0.0], [9.0, 9.0, 0.0], ] ), ] expected_costs = [74.5, 1000000] for d, ec in zip(dd, expected_costs): n = np.max(d[:, 0].astype(int)) + 1 x, y = LAPJV.lapjv(d[:, 0].astype(int), d[:, 1].astype(int), d[:, 2]) c = np.ones((n, n)) * 1000000 c[d[:, 0].astype(int), d[:, 1].astype(int)] = d[:, 2] self.assertTrue(np.sum(c[np.arange(n), x]) < ec) self.assertTrue(np.sum(c[y, np.arange(n)]) < ec)
from __future__ import absolute_import import numpy as np import unittest import centrosome.lapjv as LAPJV from centrosome.filter import permutations from six.moves import range from six.moves import zip class TestLAPJVPYX(unittest.TestCase): def test_01_01_reduction_transfer(self): """Test the reduction transfer implementation""" cases = [ dict( i=[0, 1, 2], j=[0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6], count=[3, 3, 3], x=[2, 0, 1], y=[1, 2, 0], c=[5.0, 4.0, 1.0, 2.0, 6.0, 4.0, 4.0, 3.0, 7.0], u_in=[0.0, 0.0, 0.0], v_in=[1.0, 2.0, 3.0], u_out=[2.0, 3.0, 6.0], v_out=[-2.0, -4.0, 1.0], ), dict( i=[1, 2, 3], j=[0, 1, 2, 0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6, 9], count=[3, 3, 3, 3], x=[3, 2, 0, 1], y=[1, 2, 0, 3], c=[0.0, 0.0, 0.0, 5.0, 4.0, 1.0, 2.0, 6.0, 4.0, 4.0, 3.0, 7.0], u_in=[0.0, 0.0, 0.0, 0.0], v_in=[1.0, 2.0, 3.0, 0.0], u_out=[0.0, 2.0, 3.0, 6.0], v_out=[-2.0, -4.0, 1.0, 0.0], ), ] for case in cases: u = np.ascontiguousarray(case["u_in"], np.float64) v = np.ascontiguousarray(case["v_in"], np.float64) LAPJV.reduction_transfer( np.ascontiguousarray(case["i"], np.uint32), np.ascontiguousarray(case["j"], np.uint32), np.ascontiguousarray(case["idx"], np.uint32), np.ascontiguousarray(case["count"], np.uint32), np.ascontiguousarray(case["x"], np.uint32), u, v, np.ascontiguousarray(case["c"], np.float64), ) expected_u = np.array(case["u_out"]) expected_v = np.array(case["v_out"]) np.testing.assert_array_almost_equal(expected_u, u) np.testing.assert_array_almost_equal(expected_v, v) def test_02_01_augmenting_row_reduction(self): cases = [ dict( n=3, ii=[1], jj=[0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6], count=[3, 3, 3], x=[1, 3, 0], y=[2, 0, 3], u_in=[1.0, 2.0, 3.0], v_in=[1.0, 2.0, 3.0], c=[3.0, 6.0, 5.0, 5.0, 5.0, 7.1, 8.0, 11.0, 9.0], u_out=[1.0, 2.0, 3.0], v_out=[1.0, 1.0, 3.0], x_out=[2, 1, 0], y_out=[2, 1, 0], ) ] for case in cases: u = np.ascontiguousarray(case["u_in"], np.float64) v = np.ascontiguousarray(case["v_in"], np.float64) x = np.ascontiguousarray(case["x"], np.uint32) y = np.ascontiguousarray(case["y"], np.uint32) LAPJV.augmenting_row_reduction( case["n"], np.ascontiguousarray(case["ii"], np.uint32), np.ascontiguousarray(case["jj"], np.uint32), np.ascontiguousarray(case["idx"], np.uint32), np.ascontiguousarray(case["count"], np.uint32), x, y, u, v, np.ascontiguousarray(case["c"], np.float64), ) expected_u = np.array(case["u_out"]) expected_v = np.array(case["v_out"]) expected_x = np.array(case["x_out"]) expected_y = np.array(case["y_out"]) np.testing.assert_array_almost_equal(expected_u, u) np.testing.assert_array_almost_equal(expected_v, v) np.testing.assert_array_equal(expected_x, x) np.testing.assert_array_equal(expected_y, y) def test_03_01_augment(self): cases = [ dict( n=3, i=[2], j=[0, 1, 2, 0, 1, 2, 0, 1, 2], idx=[0, 3, 6], count=[3, 3, 3], x_in=[0, 1, 3], x_out=[0, 1, 2], y_in=[0, 1, 3], y_out=[0, 1, 2], u_in=[4, 0, 2], v_in=[-1, 1, 1], u_out=[4, 0, 2], v_out=[-1, 1, 1], c=[3, 5, 7, 4, 1, 6, 2, 3, 3], ) ] for case in cases: n = case["n"] i = np.ascontiguousarray(case["i"], np.uint32) j = np.ascontiguousarray(case["j"], np.uint32) idx = np.ascontiguousarray(case["idx"], np.uint32) count = np.ascontiguousarray(case["count"], np.uint32) x = np.ascontiguousarray(case["x_in"], np.uint32) y = np.ascontiguousarray(case["y_in"], np.uint32) u = np.ascontiguousarray(case["u_in"], np.float64) v = np.ascontiguousarray(case["v_in"], np.float64) c = np.ascontiguousarray(case["c"], np.float64) LAPJV.augment(n, i, j, idx, count, x, y, u, v, c) np.testing.assert_array_equal(x, case["x_out"]) np.testing.assert_array_equal(y, case["y_out"]) np.testing.assert_almost_equal(u, case["u_out"]) np.testing.assert_almost_equal(v, case["v_out"]) class TestLAPJV(unittest.TestCase): def test_01_02(self): r = np.random.RandomState() r.seed(11) for reductions in [0, 2]: for _ in range(100): c = r.randint(1, 10, (5, 5)) i, j = np.mgrid[0:5, 0:5] i = i.flatten() j = j.flatten() x, y, u, v = LAPJV.lapjv(i, j, c.flatten(), True, reductions) min_cost = np.sum(c) best = None for permutation in permutations([0, 1, 2, 3, 4]): cost = sum([c[i, permutation[i]] for i in range(5)]) if cost < min_cost: best = list(permutation) min_cost = cost result_cost = sum([c[i, x[i]] for i in range(5)]) self.assertAlmostEqual(min_cost, result_cost) def test_01_03(self): """Regression tests of matrices that crashed lapjv""" dd = [ np.array( [ [0.0, 0.0, 0.0], [1.0, 1.0, 5.34621029], [1.0, 7.0, 55.0], [2.0, 2.0, 2.09806089], [2.0, 8.0, 55.0], [3.0, 3.0, 4.82063029], [3.0, 9.0, 55.0], [4.0, 4.0, 3.99481917], [4.0, 10.0, 55.0], [5.0, 5.0, 3.18959054], [5.0, 11.0, 55.0], [6.0, 1.0, 55.0], [6.0, 7.0, 0.0], [6.0, 8.0, 0.0], [6.0, 9.0, 0.0], [6.0, 10.0, 0.0], [6.0, 11.0, 0.0], [7.0, 2.0, 55.0], [7.0, 7.0, 0.0], [7.0, 8.0, 0.0], [7.0, 9.0, 0.0], [7.0, 10.0, 0.0], [7.0, 11.0, 0.0], [8.0, 3.0, 55.0], [8.0, 7.0, 0.0], [8.0, 8.0, 0.0], [8.0, 9.0, 0.0], [8.0, 10.0, 0.0], [8.0, 11.0, 0.0], [9.0, 4.0, 55.0], [9.0, 7.0, 0.0], [9.0, 8.0, 0.0], [9.0, 9.0, 0.0], [9.0, 10.0, 0.0], [9.0, 11.0, 0.0], [10.0, 5.0, 55.0], [10.0, 7.0, 0.0], [10.0, 8.0, 0.0], [10.0, 9.0, 0.0], [10.0, 10.0, 0.0], [10.0, 11.0, 0.0], [11.0, 6.0, 55.0], [11.0, 7.0, 0.0], [11.0, 8.0, 0.0], [11.0, 9.0, 0.0], [11.0, 10.0, 0.0], [11.0, 11.0, 0.0], ] ), np.array( [ [0.0, 0.0, 0.0], [1.0, 1.0, 1.12227977], [1.0, 6.0, 55.0], [2.0, 2.0, 18.66735253], [2.0, 4.0, 16.2875504], [2.0, 7.0, 55.0], [3.0, 5.0, 1.29944194], [3.0, 8.0, 55.0], [4.0, 5.0, 32.61892281], [4.0, 9.0, 55.0], [5.0, 1.0, 55.0], [5.0, 6.0, 0.0], [5.0, 7.0, 0.0], [5.0, 8.0, 0.0], [5.0, 9.0, 0.0], [6.0, 2.0, 55.0], [6.0, 6.0, 0.0], [6.0, 7.0, 0.0], [6.0, 8.0, 0.0], [6.0, 9.0, 0.0], [7.0, 3.0, 55.0], [7.0, 6.0, 0.0], [7.0, 7.0, 0.0], [7.0, 8.0, 0.0], [7.0, 9.0, 0.0], [8.0, 4.0, 55.0], [8.0, 6.0, 0.0], [8.0, 7.0, 0.0], [8.0, 8.0, 0.0], [8.0, 9.0, 0.0], [9.0, 5.0, 55.0], [9.0, 6.0, 0.0], [9.0, 7.0, 0.0], [9.0, 8.0, 0.0], [9.0, 9.0, 0.0], ] ), ] expected_costs = [74.5, 1000000] for d, ec in zip(dd, expected_costs): n = np.max(d[:, 0].astype(int)) + 1 x, y = LAPJV.lapjv(d[:, 0].astype(int), d[:, 1].astype(int), d[:, 2]) c = np.ones((n, n)) * 1000000 c[d[:, 0].astype(int), d[:, 1].astype(int)] = d[:, 2] self.assertTrue(np.sum(c[np.arange(n), x]) < ec) self.assertTrue(np.sum(c[y, np.arange(n)]) < ec)
en
0.729436
Test the reduction transfer implementation Regression tests of matrices that crashed lapjv
2.222825
2
Semester V/Kripto/xor_.py
RianWardanaPutra/School
0
6617432
def encrypt(plain, password): plainIntVector = [] for i in plain: plainIntVector.append(ord(i)) passwordIntVector = [] for i in password: passwordIntVector.append(ord(i)) plainIndex = 0 cipherIntVector = [] while plainIndex < len(plain): for i in range(len(password)): if plainIndex == len(plain): break oneCharCipher = plainIntVector[plainIndex] ^ passwordIntVector[i] cipherIntVector.append(oneCharCipher) plainIndex += 1 return cipherIntVector def decrypt(cipher, password): cipherIndex = 0 plainIntVector = [] while cipherIndex < len(cipher): for i in password: if cipherIndex == len(cipher): break oneCharPlain = cipher[cipherIndex] ^ ord(i) plainIntVector.append(oneCharPlain) cipherIndex += 1 plain = [chr(i) for i in plainIntVector] plain = ''.join(plain) return plain plain = input("Plain text: ") password = input("Password: ") cipher = encrypt(plain, password) print("Cipher: ", end='') for i in cipher: print(i, end=' ') print("\nPlaintext: " + decrypt(cipher, password))
def encrypt(plain, password): plainIntVector = [] for i in plain: plainIntVector.append(ord(i)) passwordIntVector = [] for i in password: passwordIntVector.append(ord(i)) plainIndex = 0 cipherIntVector = [] while plainIndex < len(plain): for i in range(len(password)): if plainIndex == len(plain): break oneCharCipher = plainIntVector[plainIndex] ^ passwordIntVector[i] cipherIntVector.append(oneCharCipher) plainIndex += 1 return cipherIntVector def decrypt(cipher, password): cipherIndex = 0 plainIntVector = [] while cipherIndex < len(cipher): for i in password: if cipherIndex == len(cipher): break oneCharPlain = cipher[cipherIndex] ^ ord(i) plainIntVector.append(oneCharPlain) cipherIndex += 1 plain = [chr(i) for i in plainIntVector] plain = ''.join(plain) return plain plain = input("Plain text: ") password = input("Password: ") cipher = encrypt(plain, password) print("Cipher: ", end='') for i in cipher: print(i, end=' ') print("\nPlaintext: " + decrypt(cipher, password))
none
1
3.597596
4
cart/urls.py
connectbushra/Django-Ecommerce-App
1
6617433
from django.contrib import admin from django.contrib.staticfiles.urls import staticfiles_urlpatterns from django.urls import path,include from . import views from django.conf.urls import url from django.conf.urls import handler404 app_name = 'cart' urlpatterns = [ path('', views.HomeView.as_view(), name='MyView'), path('checkout/',views.checkout.as_view(),name="checkout"), path('payment/',views.payment.as_view(),name="payment"), path('product/<slug>/',views.ItemDetailView.as_view(), name='product'), path('cart_add_item/<slug>', views.cart_add_item, name='cart_add_item'), path('home_add_item/<slug>', views.home_add_item, name='home_add_item'), path('add_qty/<slug>', views.add_qty, name='add_qty'), path('delete_item/<slug>/', views.delete_item, name='delete_item'), path('remove_qty/<slug>/', views.remove_qty, name='remove_qty'), path('order-details/', views.OrderSummary.as_view(), name='order-details'), path('<slug:category_slug>/',views.categories, name="categories"), path('brands/<brand_slug>/',views.brands, name="brands"), path('filter-data', views.filter_data, name='filter_data'), # path('paginator', views.paginator, name='paginator'), path('wish_list/<int:id>', views.wish_list, name="wish_list"), path('verification/', include('verify_email.urls')), path('search',views.search, name="search"), path('review/<int:id>', views.review, name='review'), ]
from django.contrib import admin from django.contrib.staticfiles.urls import staticfiles_urlpatterns from django.urls import path,include from . import views from django.conf.urls import url from django.conf.urls import handler404 app_name = 'cart' urlpatterns = [ path('', views.HomeView.as_view(), name='MyView'), path('checkout/',views.checkout.as_view(),name="checkout"), path('payment/',views.payment.as_view(),name="payment"), path('product/<slug>/',views.ItemDetailView.as_view(), name='product'), path('cart_add_item/<slug>', views.cart_add_item, name='cart_add_item'), path('home_add_item/<slug>', views.home_add_item, name='home_add_item'), path('add_qty/<slug>', views.add_qty, name='add_qty'), path('delete_item/<slug>/', views.delete_item, name='delete_item'), path('remove_qty/<slug>/', views.remove_qty, name='remove_qty'), path('order-details/', views.OrderSummary.as_view(), name='order-details'), path('<slug:category_slug>/',views.categories, name="categories"), path('brands/<brand_slug>/',views.brands, name="brands"), path('filter-data', views.filter_data, name='filter_data'), # path('paginator', views.paginator, name='paginator'), path('wish_list/<int:id>', views.wish_list, name="wish_list"), path('verification/', include('verify_email.urls')), path('search',views.search, name="search"), path('review/<int:id>', views.review, name='review'), ]
la
0.259927
# path('paginator', views.paginator, name='paginator'),
1.910411
2
hoomd/hpmc/__init__.py
USF-GT-Molecular-Modeling/hoomd-blue
0
6617434
# Copyright (c) 2009-2022 The Regents of the University of Michigan. # Part of HOOMD-blue, released under the BSD 3-Clause License. """Hard particle Monte Carlo. In hard particle Monte Carlo (HPMC) simulations, the particles in the system state have extended shapes. The potential energy of the system is infinite when any particle shapes overlap. Pair (:doc:`module-hpmc-pair`) and external (:doc:`module-hpmc-external`) potentials compute the potential energy when there are no shape overlaps. `hpmc` employs the Metropolis Monte Carlo algorithm to sample equilibrium configurations of the system. To perform HPMC simulations, assign a HPMC integrator (`hoomd.hpmc.integrate`) to the `hoomd.Simulation` operations. The HPMC integrator defines the particle shapes and performs local trial moves on the particle positions and orientations. HPMC updaters (`hoomd.hpmc.update`) interoperate with the integrator to perform additional types of trial moves, including box moves, cluster moves, and particle insertion/removal. Use HPMC computes (`hoomd.hpmc.compute`) to compute properties of the system state, such as the free volume or pressure. See Also: `Anderson 2016 <https://dx.doi.org/10.1016/j.cpc.2016.02.024>`_ further describes the theory and implementation. """ # need to import all submodules defined in this directory from hoomd.hpmc import integrate from hoomd.hpmc import update from hoomd.hpmc import compute from hoomd.hpmc import tune from hoomd.hpmc import pair from hoomd.hpmc import external from hoomd.hpmc import nec from hoomd.hpmc import shape_move
# Copyright (c) 2009-2022 The Regents of the University of Michigan. # Part of HOOMD-blue, released under the BSD 3-Clause License. """Hard particle Monte Carlo. In hard particle Monte Carlo (HPMC) simulations, the particles in the system state have extended shapes. The potential energy of the system is infinite when any particle shapes overlap. Pair (:doc:`module-hpmc-pair`) and external (:doc:`module-hpmc-external`) potentials compute the potential energy when there are no shape overlaps. `hpmc` employs the Metropolis Monte Carlo algorithm to sample equilibrium configurations of the system. To perform HPMC simulations, assign a HPMC integrator (`hoomd.hpmc.integrate`) to the `hoomd.Simulation` operations. The HPMC integrator defines the particle shapes and performs local trial moves on the particle positions and orientations. HPMC updaters (`hoomd.hpmc.update`) interoperate with the integrator to perform additional types of trial moves, including box moves, cluster moves, and particle insertion/removal. Use HPMC computes (`hoomd.hpmc.compute`) to compute properties of the system state, such as the free volume or pressure. See Also: `Anderson 2016 <https://dx.doi.org/10.1016/j.cpc.2016.02.024>`_ further describes the theory and implementation. """ # need to import all submodules defined in this directory from hoomd.hpmc import integrate from hoomd.hpmc import update from hoomd.hpmc import compute from hoomd.hpmc import tune from hoomd.hpmc import pair from hoomd.hpmc import external from hoomd.hpmc import nec from hoomd.hpmc import shape_move
en
0.792015
# Copyright (c) 2009-2022 The Regents of the University of Michigan. # Part of HOOMD-blue, released under the BSD 3-Clause License. Hard particle Monte Carlo. In hard particle Monte Carlo (HPMC) simulations, the particles in the system state have extended shapes. The potential energy of the system is infinite when any particle shapes overlap. Pair (:doc:`module-hpmc-pair`) and external (:doc:`module-hpmc-external`) potentials compute the potential energy when there are no shape overlaps. `hpmc` employs the Metropolis Monte Carlo algorithm to sample equilibrium configurations of the system. To perform HPMC simulations, assign a HPMC integrator (`hoomd.hpmc.integrate`) to the `hoomd.Simulation` operations. The HPMC integrator defines the particle shapes and performs local trial moves on the particle positions and orientations. HPMC updaters (`hoomd.hpmc.update`) interoperate with the integrator to perform additional types of trial moves, including box moves, cluster moves, and particle insertion/removal. Use HPMC computes (`hoomd.hpmc.compute`) to compute properties of the system state, such as the free volume or pressure. See Also: `Anderson 2016 <https://dx.doi.org/10.1016/j.cpc.2016.02.024>`_ further describes the theory and implementation. # need to import all submodules defined in this directory
2.204019
2
sdk/python/pulumi_alicloud/eventbridge/rule.py
pulumi/pulumi-alicloud
42
6617435
<filename>sdk/python/pulumi_alicloud/eventbridge/rule.py # coding=utf-8 # *** WARNING: this file was generated by the Pulumi Terraform Bridge (tfgen) Tool. *** # *** Do not edit by hand unless you're certain you know what you are doing! *** import warnings import pulumi import pulumi.runtime from typing import Any, Mapping, Optional, Sequence, Union, overload from .. import _utilities from . import outputs from ._inputs import * __all__ = ['RuleArgs', 'Rule'] @pulumi.input_type class RuleArgs: def __init__(__self__, *, event_bus_name: pulumi.Input[str], filter_pattern: pulumi.Input[str], rule_name: pulumi.Input[str], targets: pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]], description: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None): """ The set of arguments for constructing a Rule resource. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]] targets: The target of rule. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ pulumi.set(__self__, "event_bus_name", event_bus_name) pulumi.set(__self__, "filter_pattern", filter_pattern) pulumi.set(__self__, "rule_name", rule_name) pulumi.set(__self__, "targets", targets) if description is not None: pulumi.set(__self__, "description", description) if status is not None: pulumi.set(__self__, "status", status) @property @pulumi.getter(name="eventBusName") def event_bus_name(self) -> pulumi.Input[str]: """ The name of event bus. """ return pulumi.get(self, "event_bus_name") @event_bus_name.setter def event_bus_name(self, value: pulumi.Input[str]): pulumi.set(self, "event_bus_name", value) @property @pulumi.getter(name="filterPattern") def filter_pattern(self) -> pulumi.Input[str]: """ The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). """ return pulumi.get(self, "filter_pattern") @filter_pattern.setter def filter_pattern(self, value: pulumi.Input[str]): pulumi.set(self, "filter_pattern", value) @property @pulumi.getter(name="ruleName") def rule_name(self) -> pulumi.Input[str]: """ The name of rule. """ return pulumi.get(self, "rule_name") @rule_name.setter def rule_name(self, value: pulumi.Input[str]): pulumi.set(self, "rule_name", value) @property @pulumi.getter def targets(self) -> pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]: """ The target of rule. """ return pulumi.get(self, "targets") @targets.setter def targets(self, value: pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]): pulumi.set(self, "targets", value) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of rule. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter def status(self) -> Optional[pulumi.Input[str]]: """ Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ return pulumi.get(self, "status") @status.setter def status(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "status", value) @pulumi.input_type class _RuleState: def __init__(__self__, *, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]] = None): """ Input properties used for looking up and filtering Rule resources. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]] targets: The target of rule. """ if description is not None: pulumi.set(__self__, "description", description) if event_bus_name is not None: pulumi.set(__self__, "event_bus_name", event_bus_name) if filter_pattern is not None: pulumi.set(__self__, "filter_pattern", filter_pattern) if rule_name is not None: pulumi.set(__self__, "rule_name", rule_name) if status is not None: pulumi.set(__self__, "status", status) if targets is not None: pulumi.set(__self__, "targets", targets) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of rule. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter(name="eventBusName") def event_bus_name(self) -> Optional[pulumi.Input[str]]: """ The name of event bus. """ return pulumi.get(self, "event_bus_name") @event_bus_name.setter def event_bus_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "event_bus_name", value) @property @pulumi.getter(name="filterPattern") def filter_pattern(self) -> Optional[pulumi.Input[str]]: """ The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). """ return pulumi.get(self, "filter_pattern") @filter_pattern.setter def filter_pattern(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "filter_pattern", value) @property @pulumi.getter(name="ruleName") def rule_name(self) -> Optional[pulumi.Input[str]]: """ The name of rule. """ return pulumi.get(self, "rule_name") @rule_name.setter def rule_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "rule_name", value) @property @pulumi.getter def status(self) -> Optional[pulumi.Input[str]]: """ Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ return pulumi.get(self, "status") @status.setter def status(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "status", value) @property @pulumi.getter def targets(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]]: """ The target of rule. """ return pulumi.get(self, "targets") @targets.setter def targets(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]]): pulumi.set(self, "targets", value) class Rule(pulumi.CustomResource): @overload def __init__(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]]] = None, __props__=None): """ Provides a Event Bridge Rule resource. For information about Event Bridge Rule and how to use it, see [What is Rule](https://help.aliyun.com/document_detail/167854.html). > **NOTE:** Available in v1.129.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_event_bus = alicloud.eventbridge.EventBus("exampleEventBus", event_bus_name="example_value") example_rule = alicloud.eventbridge.Rule("exampleRule", event_bus_name=example_event_bus.id, rule_name=var["name"], description="test", filter_pattern="{\"source\":[\"crmabc.newsletter\"],\"type\":[\"UserSignUp\", \"UserLogin\"]}", targets=[alicloud.eventbridge.RuleTargetArgs( target_id="tf-test", endpoint="acs:mns:cn-hangzhou:118938335****:queues/tf-test", type="acs.mns.queue", param_lists=[ alicloud.eventbridge.RuleTargetParamListArgs( resource_key="queue", form="CONSTANT", value="tf-testaccEbRule", ), alicloud.eventbridge.RuleTargetParamListArgs( resource_key="Body", form="ORIGINAL", ), ], )]) ``` ## Import Event Bridge Rule can be imported using the id, e.g. ```sh $ pulumi import alicloud:eventbridge/rule:Rule example <event_bus_name>:<rule_name> ``` :param str resource_name: The name of the resource. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]] targets: The target of rule. """ ... @overload def __init__(__self__, resource_name: str, args: RuleArgs, opts: Optional[pulumi.ResourceOptions] = None): """ Provides a Event Bridge Rule resource. For information about Event Bridge Rule and how to use it, see [What is Rule](https://help.aliyun.com/document_detail/167854.html). > **NOTE:** Available in v1.129.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_event_bus = alicloud.eventbridge.EventBus("exampleEventBus", event_bus_name="example_value") example_rule = alicloud.eventbridge.Rule("exampleRule", event_bus_name=example_event_bus.id, rule_name=var["name"], description="test", filter_pattern="{\"source\":[\"crmabc.newsletter\"],\"type\":[\"UserSignUp\", \"UserLogin\"]}", targets=[alicloud.eventbridge.RuleTargetArgs( target_id="tf-test", endpoint="acs:mns:cn-hangzhou:118938335****:queues/tf-test", type="acs.mns.queue", param_lists=[ alicloud.eventbridge.RuleTargetParamListArgs( resource_key="queue", form="CONSTANT", value="tf-testaccEbRule", ), alicloud.eventbridge.RuleTargetParamListArgs( resource_key="Body", form="ORIGINAL", ), ], )]) ``` ## Import Event Bridge Rule can be imported using the id, e.g. ```sh $ pulumi import alicloud:eventbridge/rule:Rule example <event_bus_name>:<rule_name> ``` :param str resource_name: The name of the resource. :param RuleArgs args: The arguments to use to populate this resource's properties. :param pulumi.ResourceOptions opts: Options for the resource. """ ... def __init__(__self__, resource_name: str, *args, **kwargs): resource_args, opts = _utilities.get_resource_args_opts(RuleArgs, pulumi.ResourceOptions, *args, **kwargs) if resource_args is not None: __self__._internal_init(resource_name, opts, **resource_args.__dict__) else: __self__._internal_init(resource_name, *args, **kwargs) def _internal_init(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]]] = None, __props__=None): if opts is None: opts = pulumi.ResourceOptions() if not isinstance(opts, pulumi.ResourceOptions): raise TypeError('Expected resource options to be a ResourceOptions instance') if opts.version is None: opts.version = _utilities.get_version() if opts.id is None: if __props__ is not None: raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource') __props__ = RuleArgs.__new__(RuleArgs) __props__.__dict__["description"] = description if event_bus_name is None and not opts.urn: raise TypeError("Missing required property 'event_bus_name'") __props__.__dict__["event_bus_name"] = event_bus_name if filter_pattern is None and not opts.urn: raise TypeError("Missing required property 'filter_pattern'") __props__.__dict__["filter_pattern"] = filter_pattern if rule_name is None and not opts.urn: raise TypeError("Missing required property 'rule_name'") __props__.__dict__["rule_name"] = rule_name __props__.__dict__["status"] = status if targets is None and not opts.urn: raise TypeError("Missing required property 'targets'") __props__.__dict__["targets"] = targets super(Rule, __self__).__init__( 'alicloud:eventbridge/rule:Rule', resource_name, __props__, opts) @staticmethod def get(resource_name: str, id: pulumi.Input[str], opts: Optional[pulumi.ResourceOptions] = None, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]]] = None) -> 'Rule': """ Get an existing Rule resource's state with the given name, id, and optional extra properties used to qualify the lookup. :param str resource_name: The unique name of the resulting resource. :param pulumi.Input[str] id: The unique provider ID of the resource to lookup. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]] targets: The target of rule. """ opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id)) __props__ = _RuleState.__new__(_RuleState) __props__.__dict__["description"] = description __props__.__dict__["event_bus_name"] = event_bus_name __props__.__dict__["filter_pattern"] = filter_pattern __props__.__dict__["rule_name"] = rule_name __props__.__dict__["status"] = status __props__.__dict__["targets"] = targets return Rule(resource_name, opts=opts, __props__=__props__) @property @pulumi.getter def description(self) -> pulumi.Output[Optional[str]]: """ The description of rule. """ return pulumi.get(self, "description") @property @pulumi.getter(name="eventBusName") def event_bus_name(self) -> pulumi.Output[str]: """ The name of event bus. """ return pulumi.get(self, "event_bus_name") @property @pulumi.getter(name="filterPattern") def filter_pattern(self) -> pulumi.Output[str]: """ The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). """ return pulumi.get(self, "filter_pattern") @property @pulumi.getter(name="ruleName") def rule_name(self) -> pulumi.Output[str]: """ The name of rule. """ return pulumi.get(self, "rule_name") @property @pulumi.getter def status(self) -> pulumi.Output[str]: """ Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ return pulumi.get(self, "status") @property @pulumi.getter def targets(self) -> pulumi.Output[Sequence['outputs.RuleTarget']]: """ The target of rule. """ return pulumi.get(self, "targets")
<filename>sdk/python/pulumi_alicloud/eventbridge/rule.py # coding=utf-8 # *** WARNING: this file was generated by the Pulumi Terraform Bridge (tfgen) Tool. *** # *** Do not edit by hand unless you're certain you know what you are doing! *** import warnings import pulumi import pulumi.runtime from typing import Any, Mapping, Optional, Sequence, Union, overload from .. import _utilities from . import outputs from ._inputs import * __all__ = ['RuleArgs', 'Rule'] @pulumi.input_type class RuleArgs: def __init__(__self__, *, event_bus_name: pulumi.Input[str], filter_pattern: pulumi.Input[str], rule_name: pulumi.Input[str], targets: pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]], description: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None): """ The set of arguments for constructing a Rule resource. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]] targets: The target of rule. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ pulumi.set(__self__, "event_bus_name", event_bus_name) pulumi.set(__self__, "filter_pattern", filter_pattern) pulumi.set(__self__, "rule_name", rule_name) pulumi.set(__self__, "targets", targets) if description is not None: pulumi.set(__self__, "description", description) if status is not None: pulumi.set(__self__, "status", status) @property @pulumi.getter(name="eventBusName") def event_bus_name(self) -> pulumi.Input[str]: """ The name of event bus. """ return pulumi.get(self, "event_bus_name") @event_bus_name.setter def event_bus_name(self, value: pulumi.Input[str]): pulumi.set(self, "event_bus_name", value) @property @pulumi.getter(name="filterPattern") def filter_pattern(self) -> pulumi.Input[str]: """ The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). """ return pulumi.get(self, "filter_pattern") @filter_pattern.setter def filter_pattern(self, value: pulumi.Input[str]): pulumi.set(self, "filter_pattern", value) @property @pulumi.getter(name="ruleName") def rule_name(self) -> pulumi.Input[str]: """ The name of rule. """ return pulumi.get(self, "rule_name") @rule_name.setter def rule_name(self, value: pulumi.Input[str]): pulumi.set(self, "rule_name", value) @property @pulumi.getter def targets(self) -> pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]: """ The target of rule. """ return pulumi.get(self, "targets") @targets.setter def targets(self, value: pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]): pulumi.set(self, "targets", value) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of rule. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter def status(self) -> Optional[pulumi.Input[str]]: """ Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ return pulumi.get(self, "status") @status.setter def status(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "status", value) @pulumi.input_type class _RuleState: def __init__(__self__, *, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]] = None): """ Input properties used for looking up and filtering Rule resources. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]] targets: The target of rule. """ if description is not None: pulumi.set(__self__, "description", description) if event_bus_name is not None: pulumi.set(__self__, "event_bus_name", event_bus_name) if filter_pattern is not None: pulumi.set(__self__, "filter_pattern", filter_pattern) if rule_name is not None: pulumi.set(__self__, "rule_name", rule_name) if status is not None: pulumi.set(__self__, "status", status) if targets is not None: pulumi.set(__self__, "targets", targets) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of rule. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter(name="eventBusName") def event_bus_name(self) -> Optional[pulumi.Input[str]]: """ The name of event bus. """ return pulumi.get(self, "event_bus_name") @event_bus_name.setter def event_bus_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "event_bus_name", value) @property @pulumi.getter(name="filterPattern") def filter_pattern(self) -> Optional[pulumi.Input[str]]: """ The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). """ return pulumi.get(self, "filter_pattern") @filter_pattern.setter def filter_pattern(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "filter_pattern", value) @property @pulumi.getter(name="ruleName") def rule_name(self) -> Optional[pulumi.Input[str]]: """ The name of rule. """ return pulumi.get(self, "rule_name") @rule_name.setter def rule_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "rule_name", value) @property @pulumi.getter def status(self) -> Optional[pulumi.Input[str]]: """ Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ return pulumi.get(self, "status") @status.setter def status(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "status", value) @property @pulumi.getter def targets(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]]: """ The target of rule. """ return pulumi.get(self, "targets") @targets.setter def targets(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]]]): pulumi.set(self, "targets", value) class Rule(pulumi.CustomResource): @overload def __init__(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]]] = None, __props__=None): """ Provides a Event Bridge Rule resource. For information about Event Bridge Rule and how to use it, see [What is Rule](https://help.aliyun.com/document_detail/167854.html). > **NOTE:** Available in v1.129.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_event_bus = alicloud.eventbridge.EventBus("exampleEventBus", event_bus_name="example_value") example_rule = alicloud.eventbridge.Rule("exampleRule", event_bus_name=example_event_bus.id, rule_name=var["name"], description="test", filter_pattern="{\"source\":[\"crmabc.newsletter\"],\"type\":[\"UserSignUp\", \"UserLogin\"]}", targets=[alicloud.eventbridge.RuleTargetArgs( target_id="tf-test", endpoint="acs:mns:cn-hangzhou:118938335****:queues/tf-test", type="acs.mns.queue", param_lists=[ alicloud.eventbridge.RuleTargetParamListArgs( resource_key="queue", form="CONSTANT", value="tf-testaccEbRule", ), alicloud.eventbridge.RuleTargetParamListArgs( resource_key="Body", form="ORIGINAL", ), ], )]) ``` ## Import Event Bridge Rule can be imported using the id, e.g. ```sh $ pulumi import alicloud:eventbridge/rule:Rule example <event_bus_name>:<rule_name> ``` :param str resource_name: The name of the resource. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]] targets: The target of rule. """ ... @overload def __init__(__self__, resource_name: str, args: RuleArgs, opts: Optional[pulumi.ResourceOptions] = None): """ Provides a Event Bridge Rule resource. For information about Event Bridge Rule and how to use it, see [What is Rule](https://help.aliyun.com/document_detail/167854.html). > **NOTE:** Available in v1.129.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_event_bus = alicloud.eventbridge.EventBus("exampleEventBus", event_bus_name="example_value") example_rule = alicloud.eventbridge.Rule("exampleRule", event_bus_name=example_event_bus.id, rule_name=var["name"], description="test", filter_pattern="{\"source\":[\"crmabc.newsletter\"],\"type\":[\"UserSignUp\", \"UserLogin\"]}", targets=[alicloud.eventbridge.RuleTargetArgs( target_id="tf-test", endpoint="acs:mns:cn-hangzhou:118938335****:queues/tf-test", type="acs.mns.queue", param_lists=[ alicloud.eventbridge.RuleTargetParamListArgs( resource_key="queue", form="CONSTANT", value="tf-testaccEbRule", ), alicloud.eventbridge.RuleTargetParamListArgs( resource_key="Body", form="ORIGINAL", ), ], )]) ``` ## Import Event Bridge Rule can be imported using the id, e.g. ```sh $ pulumi import alicloud:eventbridge/rule:Rule example <event_bus_name>:<rule_name> ``` :param str resource_name: The name of the resource. :param RuleArgs args: The arguments to use to populate this resource's properties. :param pulumi.ResourceOptions opts: Options for the resource. """ ... def __init__(__self__, resource_name: str, *args, **kwargs): resource_args, opts = _utilities.get_resource_args_opts(RuleArgs, pulumi.ResourceOptions, *args, **kwargs) if resource_args is not None: __self__._internal_init(resource_name, opts, **resource_args.__dict__) else: __self__._internal_init(resource_name, *args, **kwargs) def _internal_init(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]]] = None, __props__=None): if opts is None: opts = pulumi.ResourceOptions() if not isinstance(opts, pulumi.ResourceOptions): raise TypeError('Expected resource options to be a ResourceOptions instance') if opts.version is None: opts.version = _utilities.get_version() if opts.id is None: if __props__ is not None: raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource') __props__ = RuleArgs.__new__(RuleArgs) __props__.__dict__["description"] = description if event_bus_name is None and not opts.urn: raise TypeError("Missing required property 'event_bus_name'") __props__.__dict__["event_bus_name"] = event_bus_name if filter_pattern is None and not opts.urn: raise TypeError("Missing required property 'filter_pattern'") __props__.__dict__["filter_pattern"] = filter_pattern if rule_name is None and not opts.urn: raise TypeError("Missing required property 'rule_name'") __props__.__dict__["rule_name"] = rule_name __props__.__dict__["status"] = status if targets is None and not opts.urn: raise TypeError("Missing required property 'targets'") __props__.__dict__["targets"] = targets super(Rule, __self__).__init__( 'alicloud:eventbridge/rule:Rule', resource_name, __props__, opts) @staticmethod def get(resource_name: str, id: pulumi.Input[str], opts: Optional[pulumi.ResourceOptions] = None, description: Optional[pulumi.Input[str]] = None, event_bus_name: Optional[pulumi.Input[str]] = None, filter_pattern: Optional[pulumi.Input[str]] = None, rule_name: Optional[pulumi.Input[str]] = None, status: Optional[pulumi.Input[str]] = None, targets: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]]] = None) -> 'Rule': """ Get an existing Rule resource's state with the given name, id, and optional extra properties used to qualify the lookup. :param str resource_name: The unique name of the resulting resource. :param pulumi.Input[str] id: The unique provider ID of the resource to lookup. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]] targets: The target of rule. """ opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id)) __props__ = _RuleState.__new__(_RuleState) __props__.__dict__["description"] = description __props__.__dict__["event_bus_name"] = event_bus_name __props__.__dict__["filter_pattern"] = filter_pattern __props__.__dict__["rule_name"] = rule_name __props__.__dict__["status"] = status __props__.__dict__["targets"] = targets return Rule(resource_name, opts=opts, __props__=__props__) @property @pulumi.getter def description(self) -> pulumi.Output[Optional[str]]: """ The description of rule. """ return pulumi.get(self, "description") @property @pulumi.getter(name="eventBusName") def event_bus_name(self) -> pulumi.Output[str]: """ The name of event bus. """ return pulumi.get(self, "event_bus_name") @property @pulumi.getter(name="filterPattern") def filter_pattern(self) -> pulumi.Output[str]: """ The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). """ return pulumi.get(self, "filter_pattern") @property @pulumi.getter(name="ruleName") def rule_name(self) -> pulumi.Output[str]: """ The name of rule. """ return pulumi.get(self, "rule_name") @property @pulumi.getter def status(self) -> pulumi.Output[str]: """ Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. """ return pulumi.get(self, "status") @property @pulumi.getter def targets(self) -> pulumi.Output[Sequence['outputs.RuleTarget']]: """ The target of rule. """ return pulumi.get(self, "targets")
en
0.551394
# coding=utf-8 # *** WARNING: this file was generated by the Pulumi Terraform Bridge (tfgen) Tool. *** # *** Do not edit by hand unless you're certain you know what you are doing! *** The set of arguments for constructing a Rule resource. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]] targets: The target of rule. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. The name of event bus. The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). The name of rule. The target of rule. The description of rule. Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. Input properties used for looking up and filtering Rule resources. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input['RuleTargetArgs']]] targets: The target of rule. The description of rule. The name of event bus. The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). The name of rule. Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. The target of rule. Provides a Event Bridge Rule resource. For information about Event Bridge Rule and how to use it, see [What is Rule](https://help.aliyun.com/document_detail/167854.html). > **NOTE:** Available in v1.129.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_event_bus = alicloud.eventbridge.EventBus("exampleEventBus", event_bus_name="example_value") example_rule = alicloud.eventbridge.Rule("exampleRule", event_bus_name=example_event_bus.id, rule_name=var["name"], description="test", filter_pattern="{\"source\":[\"crmabc.newsletter\"],\"type\":[\"UserSignUp\", \"UserLogin\"]}", targets=[alicloud.eventbridge.RuleTargetArgs( target_id="tf-test", endpoint="acs:mns:cn-hangzhou:118938335****:queues/tf-test", type="acs.mns.queue", param_lists=[ alicloud.eventbridge.RuleTargetParamListArgs( resource_key="queue", form="CONSTANT", value="tf-testaccEbRule", ), alicloud.eventbridge.RuleTargetParamListArgs( resource_key="Body", form="ORIGINAL", ), ], )]) ``` ## Import Event Bridge Rule can be imported using the id, e.g. ```sh $ pulumi import alicloud:eventbridge/rule:Rule example <event_bus_name>:<rule_name> ``` :param str resource_name: The name of the resource. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]] targets: The target of rule. Provides a Event Bridge Rule resource. For information about Event Bridge Rule and how to use it, see [What is Rule](https://help.aliyun.com/document_detail/167854.html). > **NOTE:** Available in v1.129.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_event_bus = alicloud.eventbridge.EventBus("exampleEventBus", event_bus_name="example_value") example_rule = alicloud.eventbridge.Rule("exampleRule", event_bus_name=example_event_bus.id, rule_name=var["name"], description="test", filter_pattern="{\"source\":[\"crmabc.newsletter\"],\"type\":[\"UserSignUp\", \"UserLogin\"]}", targets=[alicloud.eventbridge.RuleTargetArgs( target_id="tf-test", endpoint="acs:mns:cn-hangzhou:118938335****:queues/tf-test", type="acs.mns.queue", param_lists=[ alicloud.eventbridge.RuleTargetParamListArgs( resource_key="queue", form="CONSTANT", value="tf-testaccEbRule", ), alicloud.eventbridge.RuleTargetParamListArgs( resource_key="Body", form="ORIGINAL", ), ], )]) ``` ## Import Event Bridge Rule can be imported using the id, e.g. ```sh $ pulumi import alicloud:eventbridge/rule:Rule example <event_bus_name>:<rule_name> ``` :param str resource_name: The name of the resource. :param RuleArgs args: The arguments to use to populate this resource's properties. :param pulumi.ResourceOptions opts: Options for the resource. Get an existing Rule resource's state with the given name, id, and optional extra properties used to qualify the lookup. :param str resource_name: The unique name of the resulting resource. :param pulumi.Input[str] id: The unique provider ID of the resource to lookup. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] description: The description of rule. :param pulumi.Input[str] event_bus_name: The name of event bus. :param pulumi.Input[str] filter_pattern: The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). :param pulumi.Input[str] rule_name: The name of rule. :param pulumi.Input[str] status: Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['RuleTargetArgs']]]] targets: The target of rule. The description of rule. The name of event bus. The pattern to match interested events. Event mode, JSON format. The value description is as follows: `stringEqual` mode. `stringExpression` mode. Each field has up to 5 expressions (map structure). The name of rule. Rule status, either Enable or Disable. Valid values: `DISABLE`, `ENABLE`. The target of rule.
1.989375
2
kafka_topic_dumper/progress_percentage.py
Cobliteam/kafka-topic-dumper
6
6617436
<reponame>Cobliteam/kafka-topic-dumper import logging import os import threading logger = logging.getLogger(__name__) logger.setLevel(logging.INFO) class ProgressPercentage(object): def __init__(self, filename, filesize=None): self._filename = filename if filesize is not None: self._size = filesize else: self._size = float(os.path.getsize(filename)) self._seen_so_far = 0 self._lock = threading.Lock() def __call__(self, bytes_amount): # To simplify we'll assume this is hooked up # to a single filename. with self._lock: self._seen_so_far += bytes_amount percentage = (self._seen_so_far / self._size) * 100 msg = "{:40s} {:10} / {:10} ({:03g}%)" logger.info(msg.format( self._filename, self._seen_so_far, self._size, percentage))
import logging import os import threading logger = logging.getLogger(__name__) logger.setLevel(logging.INFO) class ProgressPercentage(object): def __init__(self, filename, filesize=None): self._filename = filename if filesize is not None: self._size = filesize else: self._size = float(os.path.getsize(filename)) self._seen_so_far = 0 self._lock = threading.Lock() def __call__(self, bytes_amount): # To simplify we'll assume this is hooked up # to a single filename. with self._lock: self._seen_so_far += bytes_amount percentage = (self._seen_so_far / self._size) * 100 msg = "{:40s} {:10} / {:10} ({:03g}%)" logger.info(msg.format( self._filename, self._seen_so_far, self._size, percentage))
en
0.956525
# To simplify we'll assume this is hooked up # to a single filename.
2.953835
3
app/site_manager/__init__.py
KaiserMovet/K-homeServer
2
6617437
<reponame>KaiserMovet/K-homeServer<gh_stars>1-10 from .main_site import MainSite
from .main_site import MainSite
none
1
1.016096
1
pybgg_json/pybgg_json.py
SnarkAttack/pybgg-json
1
6617438
<gh_stars>1-10 import json import datetime import collections import xml.etree.ElementTree as ElementTree import pybgg_json.pybgg_utils as pybgg_utils from pybgg_json.pybgg_cache import PyBggCache MIN_DATE = datetime.date.min.strftime("%Y-%m-%d") MAX_DATE = datetime.date.max.strftime("%Y-%m-%d") class PyBggInterface(object): def __init__(self, cache=PyBggCache()): self.cache = cache def thing_item_request(self, id, thing_type='', versions=0, videos=0, stats=0, historical=0, marketplace=0, comments=0, ratingcomments=0, page=1, page_size=100, date_from=MIN_DATE, date_to=MAX_DATE): # Date from and date to are not currently supported by BoardGameGeek thing_items_url = ( f"thing?id={id}&thing_type={thing_type}&versions={versions}&videos={videos}&" f"stats={stats}&historical={historical}&marketplace={marketplace}&comments={comments}&" f"ratingcomments={ratingcomments}&page={page}&page_size={page_size}" ) root = pybgg_utils._make_request(thing_items_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def family_item_request(self, id, family_type=''): family_items_url = ( f"family?id={id}&type={family_type}" ) root = pybgg_utils._make_request(family_items_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def forum_list_request(self, id, type='thing'): forum_list_url = ( f"forumlist?id={id}&type={type}" ) root = pybgg_utils._make_request(forum_list_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def forum_request(self, id, page=1): forum_url = ( f"forum?id={id}&page={page}" ) root = pybgg_utils._make_request(forum_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def thread_request(self, id, min_article_id=0, min_article_date='', count=-1, username=''): thread_url = ( f"thread?id={id}&minarticleid={min_article_id}&minarticledate={min_article_date}" ) if count != -1: thread_url += f"&count={count}" root = pybgg_utils._make_request(thread_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def user_request(self, name, buddies=0, guilds=0, hot=0, top=0, domain='boardgame', page=1): user_url = ( f"user?name={name}&buddies={buddies}&guilds={guilds}&hot={hot}&top={top}&" f"domain={domain}&page={page}" ) root = pybgg_utils._make_request(user_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def guild_request(self, id, members=0, sorttype='username', page=1): guild_url = ( f"guild?id={id}&members={members}&sort={sorttype}&page={page}" ) root = pybgg_utils._make_request(guild_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) # Must use either username or id AND type def plays_request(self, username=None, id=None, type=None, mindate=MIN_DATE, maxdate=MAX_DATE, subtype='boardgame', page=1): if username is None and (id is None or type is None): return {} else: if username is not None: identifier = f"username={username}" else: identifier = f"id={id}&type={type}" plays_url = ( f"plays?{identifier}&mindate={mindate}&maxdate={maxdate}&subtype={subtype}&" f"page={page}" ) root = pybgg_utils._make_request(plays_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def collection_request(self, username, subtype='boardgame', exclude_subtype=None, id=None, brief=None, stats=None, own=None, rated=None, playerd=None, comment=None, trade=None, want=None, wishlist=None, wishlist_priority=None, preordered=None, wanttoplay=None, wanttobuy=None, prevowned=None, hasparts=None, wantparts=None, minrating=None, rating=None, minbggrating=None, bggrating=None, minplays=None, maxplays=None, showprivate=None, collid=None, modifiedsince=MIN_DATE): collection_url = ( f"collection?username={username}&subtype={subtype}" ) for arg, arg_val in locals().items(): if arg_val is not None: collection_url += f"{arg}={arg_val}&" collection_url += f"modifiedsince={modifiedsince}" root = pybgg_utils._make_request(collection_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root))
import json import datetime import collections import xml.etree.ElementTree as ElementTree import pybgg_json.pybgg_utils as pybgg_utils from pybgg_json.pybgg_cache import PyBggCache MIN_DATE = datetime.date.min.strftime("%Y-%m-%d") MAX_DATE = datetime.date.max.strftime("%Y-%m-%d") class PyBggInterface(object): def __init__(self, cache=PyBggCache()): self.cache = cache def thing_item_request(self, id, thing_type='', versions=0, videos=0, stats=0, historical=0, marketplace=0, comments=0, ratingcomments=0, page=1, page_size=100, date_from=MIN_DATE, date_to=MAX_DATE): # Date from and date to are not currently supported by BoardGameGeek thing_items_url = ( f"thing?id={id}&thing_type={thing_type}&versions={versions}&videos={videos}&" f"stats={stats}&historical={historical}&marketplace={marketplace}&comments={comments}&" f"ratingcomments={ratingcomments}&page={page}&page_size={page_size}" ) root = pybgg_utils._make_request(thing_items_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def family_item_request(self, id, family_type=''): family_items_url = ( f"family?id={id}&type={family_type}" ) root = pybgg_utils._make_request(family_items_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def forum_list_request(self, id, type='thing'): forum_list_url = ( f"forumlist?id={id}&type={type}" ) root = pybgg_utils._make_request(forum_list_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def forum_request(self, id, page=1): forum_url = ( f"forum?id={id}&page={page}" ) root = pybgg_utils._make_request(forum_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def thread_request(self, id, min_article_id=0, min_article_date='', count=-1, username=''): thread_url = ( f"thread?id={id}&minarticleid={min_article_id}&minarticledate={min_article_date}" ) if count != -1: thread_url += f"&count={count}" root = pybgg_utils._make_request(thread_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def user_request(self, name, buddies=0, guilds=0, hot=0, top=0, domain='boardgame', page=1): user_url = ( f"user?name={name}&buddies={buddies}&guilds={guilds}&hot={hot}&top={top}&" f"domain={domain}&page={page}" ) root = pybgg_utils._make_request(user_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def guild_request(self, id, members=0, sorttype='username', page=1): guild_url = ( f"guild?id={id}&members={members}&sort={sorttype}&page={page}" ) root = pybgg_utils._make_request(guild_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) # Must use either username or id AND type def plays_request(self, username=None, id=None, type=None, mindate=MIN_DATE, maxdate=MAX_DATE, subtype='boardgame', page=1): if username is None and (id is None or type is None): return {} else: if username is not None: identifier = f"username={username}" else: identifier = f"id={id}&type={type}" plays_url = ( f"plays?{identifier}&mindate={mindate}&maxdate={maxdate}&subtype={subtype}&" f"page={page}" ) root = pybgg_utils._make_request(plays_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root)) def collection_request(self, username, subtype='boardgame', exclude_subtype=None, id=None, brief=None, stats=None, own=None, rated=None, playerd=None, comment=None, trade=None, want=None, wishlist=None, wishlist_priority=None, preordered=None, wanttoplay=None, wanttobuy=None, prevowned=None, hasparts=None, wantparts=None, minrating=None, rating=None, minbggrating=None, bggrating=None, minplays=None, maxplays=None, showprivate=None, collid=None, modifiedsince=MIN_DATE): collection_url = ( f"collection?username={username}&subtype={subtype}" ) for arg, arg_val in locals().items(): if arg_val is not None: collection_url += f"{arg}={arg_val}&" collection_url += f"modifiedsince={modifiedsince}" root = pybgg_utils._make_request(collection_url) return json.dumps(pybgg_utils._generate_dict_from_element_tree(root))
en
0.938812
# Date from and date to are not currently supported by BoardGameGeek # Must use either username or id AND type
2.477622
2
starcraft_agents/distributions.py
ShawnSpooner/starcraft_agents
3
6617439
import torch import torch.nn as nn class Multinoulli(object): def __init__(self): super(Multinoulli, self).__init__() self.neglogp = nn.CrossEntropyLoss() def entropy(self, logits): a0 = logits - torch.max(logits) ea0 = torch.exp(a0) z0 = ea0.sum(-1, keepdim=True) p0 = ea0 / z0 return (p0 * (torch.log(z0) - a0)).sum(-1) def negative_log_probability(self, logits, actions): return self.neglogp(logits, actions)
import torch import torch.nn as nn class Multinoulli(object): def __init__(self): super(Multinoulli, self).__init__() self.neglogp = nn.CrossEntropyLoss() def entropy(self, logits): a0 = logits - torch.max(logits) ea0 = torch.exp(a0) z0 = ea0.sum(-1, keepdim=True) p0 = ea0 / z0 return (p0 * (torch.log(z0) - a0)).sum(-1) def negative_log_probability(self, logits, actions): return self.neglogp(logits, actions)
none
1
2.786385
3
betty/cropper/migrations/0001_initial.py
theonion/betty-cropper
14
6617440
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations import django.core.files.storage import betty.cropper.models import jsonfield.fields class Migration(migrations.Migration): dependencies = [ ] operations = [ migrations.CreateModel( name='Image', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('name', models.CharField(max_length=255)), ('credit', models.CharField(max_length=120, null=True, blank=True)), ('source', models.FileField(storage=django.core.files.storage.FileSystemStorage(base_url='/', location='/private/var/folders/_3/mlzyzxsj5lb617stmlnstkgr0000gp/T/virtualenv.xyQsXv9C/images'), max_length=255, null=True, upload_to=betty.cropper.models.source_upload_to, blank=True)), ('optimized', models.FileField(storage=django.core.files.storage.FileSystemStorage(base_url='/', location='/private/var/folders/_3/mlzyzxsj5lb617stmlnstkgr0000gp/T/virtualenv.xyQsXv9C/images'), max_length=255, null=True, upload_to=betty.cropper.models.optimized_upload_to, blank=True)), ('height', models.IntegerField(null=True, blank=True)), ('width', models.IntegerField(null=True, blank=True)), ('selections', jsonfield.fields.JSONField(null=True, blank=True)), ('jpeg_quality', models.IntegerField(null=True, blank=True)), ('animated', models.BooleanField(default=False)), ], options={ 'permissions': (('read', 'Can search images, and see the detail data'), ('crop', 'Can crop images')), }, bases=(models.Model,), ), ]
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations import django.core.files.storage import betty.cropper.models import jsonfield.fields class Migration(migrations.Migration): dependencies = [ ] operations = [ migrations.CreateModel( name='Image', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('name', models.CharField(max_length=255)), ('credit', models.CharField(max_length=120, null=True, blank=True)), ('source', models.FileField(storage=django.core.files.storage.FileSystemStorage(base_url='/', location='/private/var/folders/_3/mlzyzxsj5lb617stmlnstkgr0000gp/T/virtualenv.xyQsXv9C/images'), max_length=255, null=True, upload_to=betty.cropper.models.source_upload_to, blank=True)), ('optimized', models.FileField(storage=django.core.files.storage.FileSystemStorage(base_url='/', location='/private/var/folders/_3/mlzyzxsj5lb617stmlnstkgr0000gp/T/virtualenv.xyQsXv9C/images'), max_length=255, null=True, upload_to=betty.cropper.models.optimized_upload_to, blank=True)), ('height', models.IntegerField(null=True, blank=True)), ('width', models.IntegerField(null=True, blank=True)), ('selections', jsonfield.fields.JSONField(null=True, blank=True)), ('jpeg_quality', models.IntegerField(null=True, blank=True)), ('animated', models.BooleanField(default=False)), ], options={ 'permissions': (('read', 'Can search images, and see the detail data'), ('crop', 'Can crop images')), }, bases=(models.Model,), ), ]
en
0.769321
# -*- coding: utf-8 -*-
1.810046
2
globals.py
DariHernandez/SNIIM-Extractor
0
6617441
<filename>globals.py global status global loading status = "Loading..." loading = False
<filename>globals.py global status global loading status = "Loading..." loading = False
none
1
1.275184
1
python/tfdlpack/core.py
VoVAllen/tf-dlpack
39
6617442
<filename>python/tfdlpack/core.py<gh_stars>10-100 # pylint: disable=no-name-in-module, invalid-name, no-member """core functions""" import tensorflow as tf from tensorflow.python.framework import load_library from . import libinfo from .capsule_api import to_capsule, get_capsule_address # version number __version__ = libinfo.__version__ # find lib libname = libinfo.get_libname(tf.__version__) dlpack_ops = load_library.load_op_library(libinfo.find_lib_path(libname)[0]) _to_dlpack_address = dlpack_ops.to_dlpack _from_dlpack = dlpack_ops.from_dlpack _get_device_and_dtype = dlpack_ops.get_device_and_dtype _destruct_dlpack = dlpack_ops.destruct_dlpack def _destruct_capsule(dlm_address): with tf.device("cpu"): _destruct_dlpack(dlm_address) def to_dlpack(tf_tensor): """Convert the given tensorflow tensor to DLPack format. """ with tf.device(tf_tensor.device): cap = to_capsule(_to_dlpack_address(tf_tensor)) return cap def get_device_and_dtype(dl_capsule): """Get capsule's device and its corresponding dtype First element is device type and second is device id (according to DLPack protocal) Third element is the tf data type (can be convert to tf type by tf.DType(d) ) """ ptr = get_capsule_address(dl_capsule) with tf.device('/cpu:0'): ad_tensor = tf.constant([ptr], dtype=tf.uint64) return _get_device_and_dtype(ad_tensor).numpy() def from_dlpack(dl_capsule): """Convert capsule to tf tensor""" device_and_dtype = get_device_and_dtype(dl_capsule) device = device_and_dtype[:2] dtype = device_and_dtype[2] ptr = get_capsule_address(dl_capsule, consume=True) if device[0] == 1: tf_device_type = "cpu" tf_device_id = int(device[1]) elif device[0] == 2: tf_device_type = "gpu" tf_device_id = int(device[1]) else: raise RuntimeError("Unsupported Device") tf_device = "/{}:{}".format(tf_device_type, tf_device_id) with tf.device("cpu:0"): ad_tensor = tf.constant([ptr], dtype=tf.uint64) with tf.device(tf_device): tf_tensor = _from_dlpack(ad_tensor, T=tf.DType(dtype)) return tf_tensor
<filename>python/tfdlpack/core.py<gh_stars>10-100 # pylint: disable=no-name-in-module, invalid-name, no-member """core functions""" import tensorflow as tf from tensorflow.python.framework import load_library from . import libinfo from .capsule_api import to_capsule, get_capsule_address # version number __version__ = libinfo.__version__ # find lib libname = libinfo.get_libname(tf.__version__) dlpack_ops = load_library.load_op_library(libinfo.find_lib_path(libname)[0]) _to_dlpack_address = dlpack_ops.to_dlpack _from_dlpack = dlpack_ops.from_dlpack _get_device_and_dtype = dlpack_ops.get_device_and_dtype _destruct_dlpack = dlpack_ops.destruct_dlpack def _destruct_capsule(dlm_address): with tf.device("cpu"): _destruct_dlpack(dlm_address) def to_dlpack(tf_tensor): """Convert the given tensorflow tensor to DLPack format. """ with tf.device(tf_tensor.device): cap = to_capsule(_to_dlpack_address(tf_tensor)) return cap def get_device_and_dtype(dl_capsule): """Get capsule's device and its corresponding dtype First element is device type and second is device id (according to DLPack protocal) Third element is the tf data type (can be convert to tf type by tf.DType(d) ) """ ptr = get_capsule_address(dl_capsule) with tf.device('/cpu:0'): ad_tensor = tf.constant([ptr], dtype=tf.uint64) return _get_device_and_dtype(ad_tensor).numpy() def from_dlpack(dl_capsule): """Convert capsule to tf tensor""" device_and_dtype = get_device_and_dtype(dl_capsule) device = device_and_dtype[:2] dtype = device_and_dtype[2] ptr = get_capsule_address(dl_capsule, consume=True) if device[0] == 1: tf_device_type = "cpu" tf_device_id = int(device[1]) elif device[0] == 2: tf_device_type = "gpu" tf_device_id = int(device[1]) else: raise RuntimeError("Unsupported Device") tf_device = "/{}:{}".format(tf_device_type, tf_device_id) with tf.device("cpu:0"): ad_tensor = tf.constant([ptr], dtype=tf.uint64) with tf.device(tf_device): tf_tensor = _from_dlpack(ad_tensor, T=tf.DType(dtype)) return tf_tensor
en
0.736157
# pylint: disable=no-name-in-module, invalid-name, no-member core functions # version number # find lib Convert the given tensorflow tensor to DLPack format. Get capsule's device and its corresponding dtype First element is device type and second is device id (according to DLPack protocal) Third element is the tf data type (can be convert to tf type by tf.DType(d) ) Convert capsule to tf tensor
2.403927
2
PolicyGradient/Car.py
TobiasLee/ReinforcementLearningPractice
2
6617443
import gym from RL_agent import PolicyGradient import matplotlib.pyplot as plt threshold = -2000 render = False env = gym.make("MountainCar-v0") env.seed(1) env = env.unwrapped print(env.action_space) print(env.observation_space) print(env.observation_space.high) print(env.observation_space.low) RL = PolicyGradient( n_actions=env.action_space.n, n_features = env.observation_space.shape[0], lr = 0.02, reward_decay = 0.995 ) for i in range(1000): observation = env.reset() while True: if render: env.render() action = RL.choose_action(observation) observation_, reward, done, info = env.step(action) RL.store_transition(observation, action, reward) if done: # episode finished ep_rs_sum = sum(RL.ep_rs) if "running_reward" not in globals(): running_reward = ep_rs_sum else: running_reward = running_reward * 0.99 + ep_rs_sum * 0.01 if running_reward > threshold: render = True print("episode: ", i, " reward: ", int(running_reward)) vt = RL.learn() if i == 30: plt.plot(vt) plt.ylabel('normalized state-action value') plt.show() break observation = observation_ # update states
import gym from RL_agent import PolicyGradient import matplotlib.pyplot as plt threshold = -2000 render = False env = gym.make("MountainCar-v0") env.seed(1) env = env.unwrapped print(env.action_space) print(env.observation_space) print(env.observation_space.high) print(env.observation_space.low) RL = PolicyGradient( n_actions=env.action_space.n, n_features = env.observation_space.shape[0], lr = 0.02, reward_decay = 0.995 ) for i in range(1000): observation = env.reset() while True: if render: env.render() action = RL.choose_action(observation) observation_, reward, done, info = env.step(action) RL.store_transition(observation, action, reward) if done: # episode finished ep_rs_sum = sum(RL.ep_rs) if "running_reward" not in globals(): running_reward = ep_rs_sum else: running_reward = running_reward * 0.99 + ep_rs_sum * 0.01 if running_reward > threshold: render = True print("episode: ", i, " reward: ", int(running_reward)) vt = RL.learn() if i == 30: plt.plot(vt) plt.ylabel('normalized state-action value') plt.show() break observation = observation_ # update states
en
0.940109
# episode finished # update states
2.877755
3
object_pool/__init__.py
btmorex/object_pool
12
6617444
from contextlib import contextmanager import threading from time import time __version__ = 0.2 class ObjectPoolTimeout(RuntimeError): pass class ObjectPool(object): def __init__(self, create, max_size=None): self._create = create self._max_size = max_size self._size = 0 self._items = [] self._mutex = threading.Lock() self._item_available = threading.Condition(self._mutex) def get(self, timeout=None): with self._mutex: if not self._items and (self._max_size is None or self._size < self._max_size): item = self._create() self._size += 1 else: if timeout is not None: end = time() + timeout while not self._items: remaining = timeout if timeout is not None: remaining = end - time() if remaining <= 0.0: raise ObjectPoolTimeout self._item_available.wait(remaining) item = self._items.pop() return item def put(self, item): with self._mutex: self._items.append(item) self._item_available.notify() @contextmanager def item(self): item = self.get() try: yield item finally: self.put(item)
from contextlib import contextmanager import threading from time import time __version__ = 0.2 class ObjectPoolTimeout(RuntimeError): pass class ObjectPool(object): def __init__(self, create, max_size=None): self._create = create self._max_size = max_size self._size = 0 self._items = [] self._mutex = threading.Lock() self._item_available = threading.Condition(self._mutex) def get(self, timeout=None): with self._mutex: if not self._items and (self._max_size is None or self._size < self._max_size): item = self._create() self._size += 1 else: if timeout is not None: end = time() + timeout while not self._items: remaining = timeout if timeout is not None: remaining = end - time() if remaining <= 0.0: raise ObjectPoolTimeout self._item_available.wait(remaining) item = self._items.pop() return item def put(self, item): with self._mutex: self._items.append(item) self._item_available.notify() @contextmanager def item(self): item = self.get() try: yield item finally: self.put(item)
none
1
3.097675
3
src/misc/fold.py
Ynakatsuka/nishika-22
4
6617445
<gh_stars>1-10 import os import pprint import sys import hydra import pandas as pd from hydra.utils import instantiate from omegaconf import DictConfig, OmegaConf sys.path.append("src/") @hydra.main(config_path="../../config", config_name="default") def main(config: DictConfig) -> None: print("-" * 100) pprint.PrettyPrinter(indent=2).pprint( OmegaConf.to_container(config, resolve=True) ) fold_column = config.fold.fold_column train = pd.read_csv(config.fold.input_path) print(train.head(3)) print(train.shape) y = train[config.competition.target_column] groups = None if hasattr(config.competition, "group_column") and ( config.competition.group_column is not None ): groups = train[config.competition.group_column] # split train[fold_column] = 0 kfold = instantiate(config.fold.fold) for f, (_, valid_index) in enumerate( kfold.split(train, y=y, groups=groups) ): train.loc[valid_index, fold_column] = f path = os.path.join(config.save_dir, config.fold.csv_filename) train.to_csv(path, index=False) if __name__ == "__main__": main()
import os import pprint import sys import hydra import pandas as pd from hydra.utils import instantiate from omegaconf import DictConfig, OmegaConf sys.path.append("src/") @hydra.main(config_path="../../config", config_name="default") def main(config: DictConfig) -> None: print("-" * 100) pprint.PrettyPrinter(indent=2).pprint( OmegaConf.to_container(config, resolve=True) ) fold_column = config.fold.fold_column train = pd.read_csv(config.fold.input_path) print(train.head(3)) print(train.shape) y = train[config.competition.target_column] groups = None if hasattr(config.competition, "group_column") and ( config.competition.group_column is not None ): groups = train[config.competition.group_column] # split train[fold_column] = 0 kfold = instantiate(config.fold.fold) for f, (_, valid_index) in enumerate( kfold.split(train, y=y, groups=groups) ): train.loc[valid_index, fold_column] = f path = os.path.join(config.save_dir, config.fold.csv_filename) train.to_csv(path, index=False) if __name__ == "__main__": main()
none
1
2.464822
2
starter_app/utils/jinja.py
reorx/django_starter_pack
2
6617446
import jinja2 from jinja2 import PackageLoader from django.utils.timezone import template_localtime from django.http import HttpResponse from django.views.generic import View root_pkg_name = 'starter_app' template_dir_name = 'templates' def get_jinja2_env(): loader = PackageLoader(root_pkg_name, package_path=template_dir_name) env = jinja2.Environment(loader=loader) env.filters.update({ 'localtime': template_localtime, }) env.globals.update({ 'localtime': template_localtime, }) # env.filters['round_str'] = round_str return env jinja2_env = get_jinja2_env() def get_template(name): return jinja2_env.get_template(name) # jinja2 equivant of django.shortcuts.render def render(request, template_name, context: dict, status=200): return HttpResponse( get_template(template_name).render(**context), status=status, ) class WebView(View): template_name = '' def render_to_response(self, template_name=None, context=None, status=200): if context is None: context = {} if not template_name: template_name = self.template_name # add functions here # context.update( # foo=foo, # ) return render( self.request, template_name, context, status=status, )
import jinja2 from jinja2 import PackageLoader from django.utils.timezone import template_localtime from django.http import HttpResponse from django.views.generic import View root_pkg_name = 'starter_app' template_dir_name = 'templates' def get_jinja2_env(): loader = PackageLoader(root_pkg_name, package_path=template_dir_name) env = jinja2.Environment(loader=loader) env.filters.update({ 'localtime': template_localtime, }) env.globals.update({ 'localtime': template_localtime, }) # env.filters['round_str'] = round_str return env jinja2_env = get_jinja2_env() def get_template(name): return jinja2_env.get_template(name) # jinja2 equivant of django.shortcuts.render def render(request, template_name, context: dict, status=200): return HttpResponse( get_template(template_name).render(**context), status=status, ) class WebView(View): template_name = '' def render_to_response(self, template_name=None, context=None, status=200): if context is None: context = {} if not template_name: template_name = self.template_name # add functions here # context.update( # foo=foo, # ) return render( self.request, template_name, context, status=status, )
en
0.169769
# env.filters['round_str'] = round_str # jinja2 equivant of django.shortcuts.render # add functions here # context.update( # foo=foo, # )
2.229072
2
tests/__init__.py
oscarlorentzon/repstruct
2
6617447
<reponame>oscarlorentzon/repstruct __author__ = 'osclor'
__author__ = 'osclor'
none
1
1.050442
1
reseller_cashback/authentication/apps.py
cesarbruschetta/reseller-cashback
1
6617448
from django.apps import AppConfig class AuthConfig(AppConfig): # type: ignore name = 'authentication'
from django.apps import AppConfig class AuthConfig(AppConfig): # type: ignore name = 'authentication'
it
0.190853
# type: ignore
1.239366
1
layout/urls.py
AsianMiracle/django-base-template
26
6617449
<gh_stars>10-100 """urlconf for the layout application""" from django.conf.urls import url from layout.views import home urlpatterns =[ url(r'^$', home), ]
"""urlconf for the layout application""" from django.conf.urls import url from layout.views import home urlpatterns =[ url(r'^$', home), ]
en
0.836434
urlconf for the layout application
1.422279
1
locale/pot/api/plotting/_autosummary/pyvista-Plotter-add_mesh-1.py
tkoyama010/pyvista-doc-translations
4
6617450
# Add a sphere to the plotter and show it with a custom scalar # bar title. # import pyvista sphere = pyvista.Sphere() sphere['Data'] = sphere.points[:, 2] plotter = pyvista.Plotter() _ = plotter.add_mesh(sphere, scalar_bar_args={'title': 'Z Position'}) plotter.show() # # Plot using RGB on a single cell. Note that since the number of # points and the number of cells are identical, we have to pass # ``preference='cell'``. # import pyvista import numpy as np vertices = np.array([[0, 0, 0], [1, 0, 0], [.5, .667, 0], [0.5, .33, 0.667]]) faces = np.hstack([[3, 0, 1, 2], [3, 0, 3, 2], [3, 0, 1, 3], [3, 1, 2, 3]]) mesh = pyvista.PolyData(vertices, faces) mesh.cell_data['colors'] = [[255, 255, 255], [0, 255, 0], [0, 0, 255], [255, 0, 0]] plotter = pyvista.Plotter() _ = plotter.add_mesh(mesh, scalars='colors', lighting=False, rgb=True, preference='cell') plotter.camera_position='xy' plotter.show() # # Note how this varies from ``preference=='point'``. This is # because each point is now being individually colored, versus # in ``preference=='point'``, each cell face is individually # colored. # plotter = pyvista.Plotter() _ = plotter.add_mesh(mesh, scalars='colors', lighting=False, rgb=True, preference='point') plotter.camera_position='xy' plotter.show()
# Add a sphere to the plotter and show it with a custom scalar # bar title. # import pyvista sphere = pyvista.Sphere() sphere['Data'] = sphere.points[:, 2] plotter = pyvista.Plotter() _ = plotter.add_mesh(sphere, scalar_bar_args={'title': 'Z Position'}) plotter.show() # # Plot using RGB on a single cell. Note that since the number of # points and the number of cells are identical, we have to pass # ``preference='cell'``. # import pyvista import numpy as np vertices = np.array([[0, 0, 0], [1, 0, 0], [.5, .667, 0], [0.5, .33, 0.667]]) faces = np.hstack([[3, 0, 1, 2], [3, 0, 3, 2], [3, 0, 1, 3], [3, 1, 2, 3]]) mesh = pyvista.PolyData(vertices, faces) mesh.cell_data['colors'] = [[255, 255, 255], [0, 255, 0], [0, 0, 255], [255, 0, 0]] plotter = pyvista.Plotter() _ = plotter.add_mesh(mesh, scalars='colors', lighting=False, rgb=True, preference='cell') plotter.camera_position='xy' plotter.show() # # Note how this varies from ``preference=='point'``. This is # because each point is now being individually colored, versus # in ``preference=='point'``, each cell face is individually # colored. # plotter = pyvista.Plotter() _ = plotter.add_mesh(mesh, scalars='colors', lighting=False, rgb=True, preference='point') plotter.camera_position='xy' plotter.show()
en
0.888998
# Add a sphere to the plotter and show it with a custom scalar # bar title. # # # Plot using RGB on a single cell. Note that since the number of # points and the number of cells are identical, we have to pass # ``preference='cell'``. # # # Note how this varies from ``preference=='point'``. This is # because each point is now being individually colored, versus # in ``preference=='point'``, each cell face is individually # colored. #
3.121056
3