ID stringlengths 10 16 | Name stringlengths 1 14 | DBD stringclasses 75
values | Is TF? stringclasses 2
values | TF assessment stringclasses 5
values | Binding mode stringclasses 4
values | Motif status stringclasses 4
values | Notes stringclasses 11
values | Comments stringlengths 10 585 ⌀ | Committee notes stringclasses 79
values | MTW Notes stringclasses 44
values | TRH Notes stringclasses 96
values | SL notes stringclasses 35
values | AJ notes stringclasses 124
values | Disagree on Assessment stringclasses 1
value | Disagree on Binding stringclasses 1
value | Author1 stringclasses 7
values | Assesment1 stringclasses 5
values | Binding1 stringclasses 4
values | Comment1 stringlengths 3 401 ⌀ | Notes1 stringclasses 161
values | Author2 stringclasses 8
values | Assesment2 stringclasses 5
values | Binding2 stringclasses 6
values | Comment2 stringlengths 3 502 ⌀ | Notes2 stringclasses 61
values | Vaquerizas 2009 TF classification stringclasses 7
values | CisBP considers it as a TF? stringclasses 3
values | TFclass considers it as a TF? stringclasses 2
values | TF-CAT classification stringlengths 1 200 ⌀ | Is a GO TF stringclasses 3
values | PDB stringclasses 208
values |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ENSG00000144366 | GULP1 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding | null | null | null | null | null | null | null | Arttu Jolma | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | bZIP like region of the protein is just a 33 amino acid fragment | null | Sam Lambert | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Truncated bZIP domain - lacks DNA-contacting residues and only contains the leucine zipper portion | null | No | Yes | No | No | No | null |
ENSG00000108924 | HLF | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:8065331 | Yes | null |
ENSG00000095066 | HOOK2 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding | null | null | null | null | null | null | null | Matt Weirauch | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | Laura Campitelli | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000140575 | IQGAP1 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | bZIP domain in the protein is just a fragment. | null | null | bZIP domain in the protein is probably just a fragment | null | null | null | null | Arttu Jolma | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | bZIP domain in the protein is probably just a fragment | Sam Lambert | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000140044 | JDP2 | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | TF Gene_Transcription Factor Binding: tf co-factor binding_TF PPI; Transactivation_PMIDS:12052888 | Yes | null |
ENSG00000177606 | JUN | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:12215258;15494506 | Yes | 1JNM |
ENSG00000171223 | JUNB | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | Prefers forming heterodimers with FOS; FOSB; FOSL1 and FOSL2 over homodimers (PMID:12805554); but, clearly can bind DNA specifically in vitro. | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 2 Obligate heteromer | Prefers forming heterodimers with FOS; FOSB; FOSL1 and FOSL2 over homodimer; PMID:12805554 | null | Sam Lambert | Has known motif | 2 Obligate heteromer | JUNB binds as a homodimer in vitro; but is also a well-characterized member of the AP-1 complex with FOS family bZIP TFs and prefers to heterodimerize (PMID:12805554) | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:12121977 | Yes | null |
ENSG00000130522 | JUND | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:2504580 | Yes | null |
ENSG00000163808 | KIF15 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Has a bZIP like fragment that lacks the basic region required for DNA binding and a STE-domain that is classified as a potential DBD in CIS-BP. It is a kinesin operating in the microtubule system (PMID: 24419385) | null | null | null | null | null | null | null | Arttu Jolma | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Has a bZIP like fragment that misses the basic region and a STE-domain that is classified as a DBD in CIS-BP. It is a kinesin operating in the microtubule system PMID: 24419385 | null | Matt Weirauch | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000171401 | KRT13 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding | null | null | null | null | null | null | null | Sam Lambert | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | Laura Campitelli | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000178573 | MAF | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | Yes | null |
ENSG00000182759 | MAFA | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:15665000 | Yes | 4EOT |
ENSG00000204103 | MAFB | bZIP | Yes | Known motif | 1 Monomer or homomultimer | 100%ID - in vitro | null | PDB:2WTY is a homodimer crystallised with TAATTGCTGACTCAGCAAAT sequence | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | PDB:2WTY is a homodimer crystallised with TAATTGCTGACTCAGCAAAT sequence | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_Transcription Factor Binding: tf co-factor binding_TF PPI_PMIDS:17158225;9571165 | Yes | 2WTY |
ENSG00000185022 | MAFF | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; TF PPI; Transactivation_PMIDS:8107826;12490281 | Yes | null |
ENSG00000197063 | MAFG | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Other_PMIDS:9421508;15574414 | Yes | 3A5T |
ENSG00000198517 | MAFK | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Other; Transactivation_PMIDS:11013233;14960151 | Yes | null |
ENSG00000159256 | MORC3 | bZIP | No | ssDNA/RNA binding | 4 Not a DNA binding protein | No motif | null | Lacks a canonical bZIP DBD but: regulates TP53 activity (PMID: 17332504]), binds RNA in vitro (PMID: 11927593), and may be required for influenza A transcription during viral infection (PMID: 26202233). | null | binds RNA in vitro [PubMed:11927593 | null | null | null | null | null | Sam Lambert | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | Laura Campitelli | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Lacks canonical DBD but: Regulates TP53 activity [PubMed:17332504]; binds RNA in vitro [PubMed:11927593]; and may be required for influenza A transcription during viral infection [PubMed:26202233] | null | No | Yes | No | No | No | null |
ENSG00000080986 | NDC80 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding | null | null | null | null | null | null | null | Yimeng Yin | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | Pratyush Das | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000123405 | NFE2 | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:8469283 | Yes | null |
ENSG00000082641 | NFE2L1 | bZIP | Yes | Known motif | 2 Obligate heteromer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | Tested on HT-SELEX and PBM. Neither yielded a motif. Likely an obligate heteromer (PMID: 23661758). | null | null | null | null | PMID: 23661758 | Disagree | Disagree | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Matt Weirauch | Likely to be sequence specific TF | 2 Obligate heteromer | Looks like an obligate hetereomer. | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:8036168 | Yes | null |
ENSG00000116044 | NFE2L2 | bZIP | Yes | Known motif | 2 Obligate heteromer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | Has been tested by both PBM and HT-SELEX. Neither yielded a motif. Likely obligate heteromer. | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific__PMIDS:0; | Yes | null |
ENSG00000050344 | NFE2L3 | bZIP | Yes | Known motif | 2 Obligate heteromer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | Tested on HT-SELEX and PBM. Neither yielded a motif. Likely an obligate heteromer (PMID: 23661758). Strong preference for forming heterodimers with MAFG and MAFK over homodimers (PMID: 12805554). | null | null | null | null | PMID: 23661758 | Disagree | null | Arttu Jolma | Has known motif | 2 Obligate heteromer | Suspect motif. This site is not a bZIP target sequence! Based on pmid:12805554 has strong preference for forming heterodimers with MAFG and MAFK over homodimer based on Newman et al 2003 | null | Matt Weirauch | Unlikely to be sequence specific TF | 2 Obligate heteromer | Cant find evidence that it binds DNA; other than as an obligate heteromer. Failed on both PBMs and SELEX. | Might need to revisit - I cant find evidence beyond that supporting it heterodimerizes. | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:10037736;15385560 | Yes | null |
ENSG00000165030 | NFIL3 | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:7565758;10074173 | Yes | null |
ENSG00000148572 | NRBF2 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding | null | null | null | null | null | null | null | Jussi Taipale | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | Matt Weirauch | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | likely a cofactor | null | No | Yes | No | No | No | null |
ENSG00000129535 | NRL | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:8552602;8939891;12566383;15001570;17335001;8552602;8552602;10887186;15001570 | Yes | null |
ENSG00000162869 | PPP1R21 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Protein lacks the basic region these proteins use to contact the DNA | null | null | null | null | protein lacks the basic region these proteins use to contact the DNA | null | Disagree | Laura Campitelli | Unlikely to be sequence specific TF | 3 Low specificity DNA-binding protein | null | null | Yimeng Yin | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000131242 | RAB11FIP4 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Likely false-positive - appears to function primarily in the cytoplasm (PMID: 12470645). | null | null | null | null | null | null | null | Laura Campitelli | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Appears to function primarily in the cytoplasm [PMID: 12470645] | null | Yimeng Yin | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000152193 | RNF219 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Not a proper bZIP; contains only a small leucine zipper region but lacks the DNA-interfacing basic part. | null | null | null | null | null | null | null | Arttu Jolma | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Not a proper bZIP; contains only a small leusine zipper region but lacks the DNA-interfacing basic part | null | Yimeng Yin | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | No | Yes | No | No | No | null |
ENSG00000153130 | SCOC | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | Not a proper bZIP; contains only a small leucine zipper region but lacks the DNA-interfacing basic part. | null | null | null | null | null | Disagree | Disagree | Arttu Jolma | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Not a proper bZIP; contains only a small leusine zipper region but lacks the DNA-interfacing basic part | null | Pratyush Das | Likely to be sequence specific TF | 1 Monomer or homomultimer | PMID: 19801406 says that ScoC protein binds directly to the promoter region of ywfBCDEFG. | null | No | Yes | No | No | No | null |
ENSG00000167074 | TEF | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | Matt Weirauch | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:8396764;8440239;14702338 | Yes | null |
ENSG00000115993 | TRAK2 | bZIP | No | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No motif | null | The bZIP domain is only a partial 40AA sequence that will not bind DNA. | null | null | bZIP domain in the protein is probably just a fragment | null | null | null | null | Tim Hughes | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Included only because it's in CisBP. But I can't find it in CisBP. | Included only because it's in CisBP. But I can't find it in CisBP. | Arttu Jolma | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | The bZIP domain reported in CIS-BP for this protein is only partial 40AA sequence that will not bind DNA | The bZIP domain reported in CIS-BP for this protein is only partial 40AA sequence that will not bind DNA | No | Yes | No | No | No | null |
ENSG00000100219 | XBP1 | bZIP | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | Disagree | null | Tim Hughes | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:2321018 | Yes | null |
ENSG00000267179 | AC008770.3 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | null | null | null | null | null | null | null | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | Yimeng Yin | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | No | Yes | No | No | No | null |
ENSG00000233757 | AC092835.1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | KRAB C2H2 Protein | null | null | null | null | null | null | null | Arttu Jolma | Likely to be sequence specific TF | 1 Monomer or homomultimer | Has a nice cassette of znfC2H2 domains and a KRAB domain | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | KRAB C2H2 Protein | null | No | |||||
ENSG00000264668 | AC138696.1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | 100%ID - in vitro | null | null | null | null | null | null | null | null | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | Pratyush Das | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | No | Yes | No | No | No | null |
ENSG00000139154 | AEBP2 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | null | null | null | null | null | null | null | null | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | C2H2; check for amino-acids required for DNA binding | Pratyush Das | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | No | null |
ENSG00000105127 | AKAP8 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | (PMID: 26683827) uses SELEX to show binding to G/C rich DNA, and confirms association with rDNA promoters. Also claims it has a C2H2 domain. Interpro says it has a "C2H2 AKAP95-type 1" and a "C2H2 AKAP95-type 2" domain. SMART does identify a single C2H2 domain. | This is a single C2H2 protein. PMID: 26683827 uses SELEX to show binding to G/C rich DNA, and confirms association with rDNA promoters. Also claims it has a C2H2 domain. Interpro says it has a "C2H2 AKAP95-type 1" and a "C2H2 AKAP95-type 2" domain. SMART does identify a single C2H2 domain - switch to "Single C2H2". | null | null | null | null | null | Disagree | Jussi Taipale | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | Pratyush Das | Unlikely to be sequence specific TF | 3 Low specificity DNA-binding protein | PMID: 26683827 says alias AKAP95 has a preference for GC-rich DNA in vitro. | null | x | No | No | No | No | null |
ENSG00000011243 | AKAP8L | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | This is homologous to the AKAP8/AKAP95 protein. which has been shown by SELEX to bind GC rich sequences (PMID: 26683827). | null | null | null | null | null | null | null | Tim Hughes | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | Pratyush Das | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | This is homologous to AKAP95 protein which has been shown by SELEX to bind GC rich sequence (PMID: 26683827) and it has C2H2 domains (UniProtKB - Q9ULX6). | null | x | No | No | No | No | null |
ENSG00000163516 | ANKZF1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | null | SMART shows one C2H2 zinc finger | null | null | null | null | Disagree | null | Yimeng Yin | Likely to be sequence specific TF | 3 Low specificity DNA-binding protein | protien wtih one C2H2 finger | null | Pratyush Das | Unlikely to be sequence specific TF | 3 Low specificity DNA-binding protein | null | needs a revisit; C2H2 protein | c | No | No | No | No | null |
ENSG00000166454 | ATMIN | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | null | null | null | null | null | null | null | null | Arttu Jolma | Likely to be sequence specific TF | 1 Monomer or homomultimer | Has znfC2H2 domains and specificity appears to be unknown; the protein knockout is embryonic lethal leading to loss of lungs and trachea PMID: 20975950 | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | Based on the presence of a canonical DBD | null | x | Yes | No | No | No | null |
ENSG00000119866 | BCL11A | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | Models seem similar; but I couldn't find out whether they were independent or just derived from reanalysis of the same data. Models are also suspiciously ETS-like | null | b | Yes | Yes | No | Yes | null |
ENSG00000127152 | BCL11B | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | Fishy motifs! | a | Yes | Yes | No | Yes | null |
ENSG00000113916 | BCL6 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:12097386;15659391 | Yes | null |
ENSG00000161940 | BCL6B | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | No | null |
ENSG00000169594 | BNC1 | C2H2 ZF | Yes | Inferred motif | 1 Monomer or homomultimer | In vivo/Misc source | null | null | null | null | null | null | null | Disagree | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Yimeng Yin | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | Yes | null |
ENSG00000173068 | BNC2 | C2H2 ZF | Yes | Inferred motif | 1 Monomer or homomultimer | In vivo/Misc source | Has a putative AT-hook | null | null | null | null | null | null | null | null | Yimeng Yin | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | Pratyush Das | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | No | null |
ENSG00000130940 | CASZ1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | null | null | null | null | null | null | null | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | ENSEMBL/SMART/Prosite_patterns/ZIF-RC identify C2H2 domains using string matching that are not identified using HMM searches | null | Pratyush Das | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | b | No | Yes | No | No | null |
ENSG00000159588 | CCDC17 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | null | null | null | null | null | null | null | null | Jussi Taipale | Likely to be sequence specific TF | 3 Low specificity DNA-binding protein | null | single C2H2; check for residues required for DNA binding | Arttu Jolma | Likely to be sequence specific TF | 3 Low specificity DNA-binding protein | Has only one znfC2H2 domain | null | No | Yes | No | No | No | null |
ENSG00000198824 | CHAMP1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | null | null | null | null | null | null | Disagree | Disagree | Jussi Taipale | Likely to be sequence specific TF | 3 Low specificity DNA-binding protein | null | C2H2; check for amino-acids required for DNA binding | Sam Lambert | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Does not contain any canonical ZF DBDs by Pfam HMM scanning; and only contains 1 ZF by string matching (Source: UNIPROT). No evidence for or against DNA-binding in the literature | null | c | No | No | No | No | null |
ENSG00000147183 | CPXCR1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | null | null | null | null | null | null | Disagree | Disagree | Sam Lambert | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Does not contain canonical C2H2 motifs; Jaz domain suggests RNA binding | null | Yimeng Yin | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | c | No | No | No | No | null |
ENSG00000102974 | CTCF | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | Has a putative AT-hook | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:8246978;15143173 | Yes | null |
ENSG00000124092 | CTCFL | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | C2H2; check for amino-acids required for DNA binding | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | Yes | null |
ENSG00000011332 | DPF1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | This protein contains C2H2 ZFs missed by Pfam scanning. | Single C2H2 domains missed by pfam, and motif in Yin et al. | null | null | null | null | Disagree | null | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | PHD and C2H2 | check for residues required for DNA binding | Sam Lambert | Has known motif | 1 Monomer or homomultimer | This protein contains C2H2 zfs missed by Pfam scanning. | null | b | Yes | No | No | No | null |
ENSG00000205683 | DPF3 | C2H2 ZF | Yes | Inferred motif | 1 Monomer or homomultimer | High-throughput in vitro | Single C2H2 domain | Single C2H2 ZF. PHD domains mediate recognition of acetylated histones (PMID: 20613843); unclear if the ZF contributes DNA-binding specificity to the interaction. | null | null | null | null | null | null | Disagree | Jussi Taipale | Likely to be sequence specific TF | 3 Low specificity DNA-binding protein | null | C2H2; check for amino-acids required for DNA binding | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | Single C2H2 ZF. PHD domains mediate recognition of acetylated histones (PMID:20613843); unclear if the ZF contributes DNA-binding specificity to the interaction. Labelled Class 1 in the absence of negative data | null | x | Yes | No | No | No | null |
ENSG00000134874 | DZIP1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain; Has a putative AT-hook | null | null | null | null | null | null | Disagree | Disagree | Tim Hughes | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Hedgehog singling protein that sequesters GLI3 and is involved in ciliogenesis. No evidence that it is sequence specific. Only a single C2H2 domain. | null | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | C2H2; check for amino-acids required for DNA binding | x | Yes | No | No | No | null |
ENSG00000167967 | E4F1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | null | null | null | null | null | null | Disagree | Disagree | Jussi Taipale | Likely to be sequence specific TF | 2 Obligate heteromer | null | could need processing or be an obligate heteromer | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | PMID: 25843721 has a ChIP-seq motif with CTTTACGGC -consensus that disagrees with the HOCOMOCO and Transfac data (These two latter ones could be derived from re-analysis of the same data) | null | a | Yes | Yes | TF Gene Candidate__DNA Binding_PMIDS:2169022 | Yes | null |
ENSG00000102189 | EEA1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | Based on (PMID: 20534488), the protein has a C2H2 ZF domain; but it uses the domain for contacting RAB5A rather than for binding DNA. | null | null | null | null | null | null | null | Arttu Jolma | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | Based on PMID: 20534488 the protein has a znfC2H2 domain; but it uses the domain for contacting RAB5A rather then binding DNA | null | Pratyush Das | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | PMID: 20534488 | null | x | No | No | No | No | null |
ENSG00000120738 | EGR1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | One of the Transfac motifs is an obvious ETS-PWM | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:8336701;9858508;10049687 | Yes | 1A1F |
ENSG00000122877 | EGR2 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | Binds HOX4A promoter (PMID:21836637) | null | null | null | null | null | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | Binds HOX4A promoter (PMID:21836637) | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:12687019 | Yes | null |
ENSG00000179388 | EGR3 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene Candidate_DNA-Binding: sequence-specific_Transactivation_PMIDS:1906159 | Yes | null |
ENSG00000135625 | EGR4 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:17192429 | Yes | null |
ENSG00000164334 | FAM170A | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | Degenerate C2H2-ZFP. Localizes to the nucleus and overexpression upregulates other genes (PMID: 20162441). | null | Degenerate C2H2-ZFP, localizes to the nucleus and overexpression upregulates other genes [PMID: 20162441] | null | null | null | null | null | Jussi Taipale | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | where does the evidence that this should be a TF come from?? | Laura Campitelli | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | null | b | No | No | No | No | null |
ENSG00000128610 | FEZF1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | ChIP-seq motif is consistent with recognition code (RCADE) | null | null | null | null | null | null | Disagree | null | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | conflicting motifs; check amino-acids required for binding | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | c | Yes | Yes | No | Yes | null |
ENSG00000153266 | FEZF2 | C2H2 ZF | Yes | Inferred motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | Indirect motif has 91% DBD Identity with fly erm | null | c | Yes | Yes | TF Gene Candidate__DNA Binding_PMIDS:12469125 | Yes | null |
ENSG00000179943 | FIZ1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | Protein has a decent cassette of C2H2 ZF domains (not all are detected by Pfam). It has been also shown to interact with homeodomain protein CRX (PMID: 18854042) and MAF-subtype bZIP protein NRL (PMID: 12566383). | null | null | null | null | null | null | null | Arttu Jolma | Likely to be sequence specific TF | 1 Monomer or homomultimer | Protein has a decent cassette of znfC2H2 domains. It has been also shown to interact with homeodomain protein CRX PMID: 18854042 and MAF-subtype bZIP protein NRL PMID: 12566383 | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | No | null |
ENSG00000162676 | GFI1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:8754800 | Yes | 2KMK |
ENSG00000165702 | GFI1B | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | No | null |
ENSG00000111087 | GLI1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:10559945;11719506;15087129 | No | 2GLI |
ENSG00000074047 | GLI2 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_Transactivation_PMIDS:2850480;3563490 | Yes | null |
ENSG00000106571 | GLI3 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:10433919;12435627;16396903 | Yes | null |
ENSG00000250571 | GLI4 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect | Protein is not closely homologous to GLI1-3 proteins. | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | Protein is not closely homologous to GLI1-3 proteins | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | No | Yes | Yes | No | Yes | null |
ENSG00000174332 | GLIS1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | No | null |
ENSG00000126603 | GLIS2 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | TF Gene Candidate_Transcription Factor Binding: tf co-factor binding_Transactivation_PMIDS:11741991;16326862 | No | null |
ENSG00000107249 | GLIS3 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | No | null |
ENSG00000122034 | GTF3A | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | ChIP-seq motif is consistent with recognition code (RCADE) | null | null | null | null | null | null | Disagree | null | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | C2H2; check for amino-acids required for DNA binding | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | x | Yes | Yes | No | No | 1TF3 |
ENSG00000125812 | GZF1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | null | null | null | null | null | null | null | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | TRANSFAC-only motifs need to be examined for source | Pratyush Das | Has known motif | 1 Monomer or homomultimer | PMID: 16049025 | null | b | Yes | Yes | No | Yes | null |
ENSG00000177374 | HIC1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:15231840 | Yes | null |
ENSG00000169635 | HIC2 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | No | null |
ENSG00000172273 | HINFP | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | Yes | null |
ENSG00000095951 | HIVEP1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | null | null | null | null | null | null | Disagree | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | null | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | C2H2; check for amino-acids required for DNA binding | a | Yes | Yes | No | No | null |
ENSG00000010818 | HIVEP2 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | null | null | null | null | null | null | Disagree | null | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | check for residues required for DNA binding | Sam Lambert | Has known motif | 1 Monomer or homomultimer | No in-vitro evidence for similarity to the Transfac/Hocomoco motif | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:10207097 | Yes | null |
ENSG00000127124 | HIVEP3 | C2H2 ZF | Yes | Inferred motif | 1 Monomer or homomultimer | In vivo/Misc source | Has a putative AT-hook | Binds to NFKB-like consensus sequence to repress transcription (PMID: 21189157). PWMs for HIVEP1 and 2 in Transfac and Hocomoco are also NFKB-like. | null | null | null | null | null | null | null | Arttu Jolma | Likely to be sequence specific TF | 1 Monomer or homomultimer | Binds to NFKB-like consensus sequence to repress transcription based on PMID: 21189157. PWMs for HIVEP1 and 2 in Transfac and Hocomoco are also NFKB-like | null | Pratyush Das | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | Yes | null |
ENSG00000181666 | HKR1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | ChIP-seq motif is consistent with recognition code (RCADE) | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | Trono motif is unavailable | null | b | Yes | Yes | No | No | null |
ENSG00000185811 | IKZF1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | null | null | null | null | null | null | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:15841184 | Yes | null |
ENSG00000030419 | IKZF2 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | null | null | null | likely to be obligate heteromer; needs to be verified in vitro | null | null | null | null | Jussi Taipale | Has known motif | 2 Obligate heteromer | null | likely to be obligate heteromer; needs to be verified in vitro | Sam Lambert | Has known motif | 2 Obligate heteromer | Unclear whether Transfac motifs are homo- or heterodimer motifs. | null | b | Yes | Yes | No | Yes | null |
ENSG00000161405 | IKZF3 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | ChIP-seq motif is consistent with recognition code (RCADE) | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_Transcription Factor Binding: tf co-factor binding; DNA-Binding: sequence-specific_DNA Binding; TF PPI; Transactivation_PMIDS:9155026 | Yes | null |
ENSG00000123411 | IKZF4 | C2H2 ZF | Yes | Inferred motif | 1 Monomer or homomultimer | In vivo/Misc source | null | null | null | null | null | null | null | Disagree | null | Tim Hughes | Has known motif | 1 Monomer or homomultimer | null | Need to check all the TRANSFAC-only motifs | Yimeng Yin | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | Yes | null |
ENSG00000095574 | IKZF5 | C2H2 ZF | Yes | Inferred motif | 1 Monomer or homomultimer | In vivo/Misc source | null | null | null | null | null | null | null | Disagree | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | Transfac motif is dubious; seems more like a bZIP dimer | null | Yimeng Yin | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | Yes | null |
ENSG00000173404 | INSM1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | In vivo/Misc source | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | C2H2; check for amino-acids required for DNA binding | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | Yes | null |
ENSG00000168348 | INSM2 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | null | null | null | null | null | null | null | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | Yimeng Yin | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | No | null |
ENSG00000153814 | JAZF1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | null | null | null | null | null | null | null | null | Sam Lambert | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | Pratyush Das | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | null | a | Yes | No | No | No | null |
ENSG00000136504 | KAT7 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | null | null | null | null | null | null | null | Disagree | Disagree | Jussi Taipale | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | null | chromatin modifier; many of these contain AT hooks or other low specificity DBDs | Pratyush Das | Likely to be sequence specific TF | null | It has ZnF domains | null | x | Yes | Yes | No | No | null |
ENSG00000176407 | KCMF1 | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | No evidence of DNA-binding in the literature; and has evidence of E3 ligase activity (PMID:15581609). | null | null | null | null | null | Disagree | Disagree | Jussi Taipale | Likely to be sequence specific TF | 1 Monomer or homomultimer | null | C2H2; check for amino-acids required for DNA binding | Sam Lambert | Unlikely to be sequence specific TF | 4 Not a DNA binding protein | No evidence of DNA-binding in the literature; and has evidence of E3 ligase activity (PMID:15581609). | null | b | Yes | No | No | No | null |
ENSG00000151657 | KIN | C2H2 ZF | Yes | Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Single C2H2 domain | Binds curved DNA (PMID: 8078469). | null | null | null | null | null | Disagree | null | Arttu Jolma | Unlikely to be sequence specific TF | 3 Low specificity DNA-binding protein | Binds curved DNA based on PMID: 8078469 | null | Yimeng Yin | Likely to be sequence specific TF | 3 Low specificity DNA-binding protein | a protein with one C2H2 finger | null | x | No | No | No | No | null |
ENSG00000105610 | KLF1 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Jussi Taipale | Has known motif | 1 Monomer or homomultimer | null | check amino-acids required for binding | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Transactivation_PMIDS:11092887 | Yes | null |
ENSG00000155090 | KLF10 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:15087465 | Yes | null |
ENSG00000172059 | KLF11 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Arttu Jolma | Has known motif | 1 Monomer or homomultimer | null | null | Laura Campitelli | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | No | Yes | null |
ENSG00000118922 | KLF12 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding; Other_PMIDS:9858544 | Yes | null |
ENSG00000169926 | KLF13 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Sam Lambert | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | a | Yes | Yes | TF Gene_DNA-Binding: sequence-specific_DNA Binding_PMIDS:10642511;16303770 | No | null |
ENSG00000266265 | KLF14 | C2H2 ZF | Yes | Known motif | 1 Monomer or homomultimer | High-throughput in vitro | null | null | null | null | null | null | null | null | null | Yimeng Yin | Has known motif | 1 Monomer or homomultimer | null | null | Pratyush Das | Has known motif | 1 Monomer or homomultimer | null | null | b | Yes | Yes | No | No | null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.