title stringlengths 1 200 ⌀ | text stringlengths 10 100k | url stringlengths 32 829 | authors stringlengths 2 392 | timestamp stringlengths 19 32 | tags stringlengths 6 263 |
|---|---|---|---|---|---|
One-Hot Encoding is making your Tree-Based Ensembles worse, here’s why? | One-Hot Encoding is making your Tree-Based Ensembles worse, here’s why?
Optimizing Tree-Based Models
I am a Master’s Student in Data Science at the University of Virginia and I am working on lots of Machine Learning Projects. Every week, I will be addressing one problem that I faced when working on a project along with a practical solution.
Most real-world datasets are a mix of categorical and continuous variables. While continuous variables fit into all machine learning models quite easily, the implementation of categorical variables is vastly different in different models and different programming languages. For instance, R deals with categories using a variable type called factor which elegantly fits all models without an issue and Python would require you to convert the categories into label encoding for the models to work. Python is my choice of programming language and I routinely perform some sort of encoding for categorical variables. In general, one hot encoding provides better resolution of the data for the model and most models end up performing better. It turns out this is not true for all models and to my surprise, random forest performed consistently worse for datasets with high cardinality categorical variables.
Test Setup
Being a Kobe Bryant fan, I decided to use his shot selection data to build a model to predict whether a shot given the circumstances would land in or not. Based on feature importance analysis, it was clear that the two variables describing the type of shot were the most important in predicting the outcome of a given shot and both variables were categorical. I ran random forest on the dataset with label encoding (assuming that there was an order) and with one-hot encoding and the outcome was nearly the same thing. In fact, it didnt seem to matter whether there was any order.
How did the models fare?
In addition to accuracy of prediction, I have also used the logarithmic loss of the model for comparison as that was the evaluation criteria for the Kaggle competition.
Snapshot of Performance
We would normally expect one-hot encoding to improve the model but as the screenshot suggests, the model with one-hot encoding performing significantly worse than the model without it. One-hot encoding contributed to a decrease of 0.157 units of logarithmic loss. Kaggle competition winners are decided in slightest of margins and an offset of 0.05 could be the difference between being in the top 75% and top 25% on the leaderboard. Now that we have established one-hot encoding is making the models worse, let’s examine the reasons behind why this happens.
Why does this happen?
To understand this, let’s get into the inner dynamics of tree-bases models. For every tree-based algorithm, there is a sub-algorithm that is used to split the dataset into two bins based on a feature and a value. The splitting algorithm considers all possible splits (based on all features and all possibles values for each feature) and finds the most optimum split based on a criterion. We will not get into details of the criterion (there are multiple ways to do this) but qualitatively speaking, the criterion helps the sub-algorithm select the split that minimizes the impurity of bins. Purity is a proxy for the number of positive or negative samples in a particular bin in a classification problem. I found a very useful visualization that can helped me grasp this concept.
Dense Decision Tree (Model without One Hot Encoding)
If a continuous variable is chosen for a split, then there would be a number of choices of values on which a tree can split and in most cases, the tree can grow in both directions. The resulting tree from a dataset containing a majority of continuous variables that would look like something in the figure to the left.
Sparse Decision Tree (Model with One Hot Encoding)
Categorical variables are naturally disadvantaged in this case and have only a few options for splitting which results in very sparse decision trees. The situation gets worse in variables that have a small number of levels and one-hot encoding falls in this category with just two levels. The trees generally tend to grow in one direction because at every split of a categorical variable there are only two values (0 or 1). The tree grows in the direction of zeroes in the dummy variables. If that didn’t make sense, follow the example below closely.
Dataset A with Dummy Variables
For instance, consider the following dataset which contains dummy variables for
categorical variables that have levels A, B, C and D. If we were to fit a decision tree to this data just to understand the splits, it would resemble the following.
Decision Tree for Dataset A
In conclusion, if we have a categorical variable with q levels, the tree has to choose from ((2^q/2)-1) splits. For a dummy variable, there is only one possible split and this induces sparsity.
Effect on Model Performance
Now that we have understood why the decision trees for datasets with dummy variable look like the above figure, we can delve into understanding how this affects prediction accuracy and other performance metrics.
By one-hot encoding a categorical variable, we are inducing sparsity into the dataset which is undesirable. From the splitting algorithm’s point of view, all the dummy variables are independent. If the tree decides to make a split on one of the dummy variables, the gain in purity per split is very marginal. As a result, the tree is very unlikely to select one of the dummy variables closer to the root.
One way to verify this is to check the feature importance for both models and see which features come out on top.
Feature Importance
In spite of delivering better performance, the tree based models have a slightly tarnished reputation primarily because of its interpretability which arises due to the way in which the feature importance is calculated. Feature importance in most tree-ensembles is calculated based an importance score. The importance score is a measure of how often the feature was selected for splitting and how much gain in purity was achieved as a result of the selection.
The most important feature is the action_type which is a high cardinality categorical variable and clearly much more important than the ones preceding it. To provide some context, I had one-hot encoded action_type and combined_shot_type which were both high cardinality categorical variable. Obviously, dummy variables increase the dimensionality of the dataset and the curse of dimensionality comes into play and produces the chart below for feature importance. This is clearly not interpretable.
To take a magnified view, I decided to look at the top 15 features which seemed to influence the prediction the most.
When we examine the chart above, it’s clear that only one dummy variable is featured in the top 15 and that too in the 14th position which validates our hypothesis of variable selection for splitting. One-hot encoding has also obscured the order of importance of features that weren’t involved in the encoding and this makes the model inefficient.
Link to Github
TLDR
One-hot encoding categorical variables with high cardinality can cause inefficiency in tree-based ensembles. Continuous variables will be given more importance than the dummy variables by the algorithm which will obscure the order of feature importance resulting in poorer performance.
Extra Reading | https://towardsdatascience.com/one-hot-encoding-is-making-your-tree-based-ensembles-worse-heres-why-d64b282b5769 | ['Rakesh Ravi'] | 2019-01-12 14:02:55.188000+00:00 | ['Kaggle', 'Computer Science', 'Machine Learning', 'Random Forest', 'Data Science'] |
Important changes of DesignBold in early June 2018 | Bonus Coin and the new policy
There might have been a lot of question on the appearance of Bonus Coins that every user can see very clearly when clicking on their account.
This is the new type of coin that DB team developed for some specific occasion of usage and they are a bit different from the DB coins all users have already known.
Not like the DB Coins, Bonus Coins are earned when users refer their friends to register account on DB or when they contribute new templates. DB coins can be bought by money but DB Bonus Coins can only be earned when users contribute to the DB system.
DB Bonus coins have the same value on DB system as DB coins do. Users can use Bonus Coins to buy all the paid resources. But they can not transfer this bonus coins to other users or counter-exchange these coins into money.
This new type of coin will help users manage their coin more conveniently and transparently and somehow encourage users to earn more coins not by paying money but by contributing more to the system and DB community.
Integration API page
Newly launched in the second week of June, Integration API page gives the detailed introduction and guideline of how partners can integrate DesignIt button to their sites.
Partners can see Integration API on Navigation bar of DB Homepage
All instructions and show cases are exhibited
Click on Support and fill in all the information to get details guideline
Click on My app and choose “Create new app" to start creating your own API
No more Basic membership from July 2018
New strategy of DB directed pricing plan to focus more on the design resources for users. To utilise all the tools and maximise the resources, BOD of DB decided to cancel the Basic package of membership.
For details:
- All current Basic members can maintain their account until their due dates.
- After the due date, Basic members can choose to upgrade their membership to Pro package with the same price as the old Basic package and DB will offer coupons for discounts of Pro package.
Users will no longer see Basic package of membership
- Basic users who refuse to upgrade will be back to Free package with a lot of additional features comparing to the previous Free membership.
- All details of the new features and price for Free package and Pro package will be updated on Pricing page from 1 July.
More of Vietnamese fonts and layouts for Vietnamese users
In the last week, more than 50 Vietnamese templates have been updated to serve users in Vietnam. No more struggles in searching for customised templates, from now on, Vietnamese user can setup language in Account setting to top up all the Vietnamese templates to the top of searching results and each Doc type page.
Click on your account and choose Account settings
Scroll down to Resource Settings session and change all options in box to Vietnam and Save changes
All Vietnamese templates will be on top of your Layouts page
DesignBold Academy on aired
With the mission of training users to get used with DB design tools and providing all the best design methods and trends to users, DesignBold Academy project has been officially in operation by Alex Hưng, head of DB Academy.
Focusing on providing Knowledge and Instructions, users can easily finds valuable contents as articles and videos in both English and Vietnamese on DB Academy.
After just one week officially operated, DB Academy has reach a peak of 1175 page view per day and 7264 page views in total.
6 Doc-types ready for Printing service
Officially signed contracts with 02 printing factories and Print button on DB was launched, Print team confirmed to be ready for 6 doc types: Business card, Letterhead, Poster, Postcard, Card, Trifold Brochure. The first order of Print team with the value of 30,000,000VND marked a noticeable milestone of Printing service of DB.
In the next chapter, 30 printing factories will be on-boarded on DB site with details instructions and demo picture of paper types and stationery packages, expecting to serve more and more printing orders with more diversified doc types. | https://medium.com/designbold/important-changes-of-designbold-in-early-june-2018-545745e3efea | ['Anh Nguyen'] | 2018-06-25 03:59:33.687000+00:00 | ['Bitcoin'] |
Netflix made chess cool again | It is amazing to see how a streaming service can have a such a large influence, both in its reach and its power.
About the data
The data is available via Google Trends and can be found here.
The original visual is also on his twitter here. | https://medium.com/portfolio-danyal-huq/netflix-made-chess-cool-again-11032d99842c | ['Danyal Huq'] | 2020-12-03 15:21:43.450000+00:00 | ['Data Visualization', 'Netflix', 'Queens Gambit'] |
The Case of Dr. Abdulaziz Al-Dukheil | The Case of Dr. Abdulaziz Al-Dukheil
Confronting fears of retribution, the son of an imprisoned Saudi academic is now campaigning for his father’s release Jaime Moore-Carrillo Apr 5·5 min read
Last spring, during the holy month of Ramadan, Abdulhakim Al-Dukheil received a flood of texts and voicemails from his relatives in Saudi Arabia. Each message relayed the same, grim news: his father had been arrested by government security forces.
Abdulaziz Al-Dukheil, a round-faced, balding academic who donned thin ovular glasses and a thinning mustache, did not fit the typical mold of a national security threat. The Saudi economist expended very little of his intellect or charisma on political squabbles, according to his son.
“My father doesn’t have a group or a company that’s fighting with the government,” Abdulhakim insisted. “He doesn’t have any agenda; he’s a businessman.”
Indeed, Al-Dukheil senior dedicated much of his 47-year career to enriching the House of Saud. He served as the kingdom’s deputy finance minister in the 1970s. He later headed the Saudi Investment Bank in 1982 and vouched for the country’s economic interests at a number of international economic summits.
Abdulaziz Al-Dukheil was disappeared by Saudi security forces last spring for paying homage to a deceased Saudi reformer, according to his son. (Courtesy: CMES Harvard)
In 1979, Al-Dukheil established his namesake financial advisory company, Al-Dukheil Financial Group, which would go on to advise some of Saudi Arabia’s biggest corporations, like petrochemical giant Aramco. According to Al-Dukheil’s bio on his company’s website, he held a number of positions at prominent universities later in his career, teaching at Oxford University, the American University of Beirut, and Georgetown University. [I was unable to independently verify these appointments].
Despite these ties — or perhaps partly because of them — agents from the Mabahith, the Saudi domestic security agency, apprehended Al-Dukheil in his home and threw him in prison.
His crime?
Al-Dukheil never appeared to receive a formal sentencing. Abdulhakim says the government accused his father of stealing money from the kingdom’s coffers. But he suspects that the monarchy had a far more cynical (and frivolous) motivation: his father acknowledged the passing of an imprisoned Saudi reformer.
Al-Dukheil had paid tribute to the late Abdullah Al-Hamid, a vocal Saudi dissident and human rights advocate who prodded for reform in the kingdom for decades.
“Dr. Abdullah Al-Hamid, the man who was devoted to his homeland and to high values, morals and sincere citizenship, has passed on to his God,” Al-Dukheil wrote in a tweet. “But he did not leave the hearts of the faithful to the homeland of the believers, by providing advice without fear or shame, and without vested interest. May God have mercy on you, Abu Bilal.”
Al-Hamid’s demands for change landed him in jail several times over the course of his lifetime. The Saudi reformer drew his final breaths in a Saudi prison last April, languishing in his cell for weeks after suffering a stroke and receiving inadequate medical attention, according to reports.
Al-Dukheil was one of several Saudi writers and academics who was arrested by state security forces for eulogizing the late activist. Such arrests had, by this time, become commonplace in the kingdom. Saudi Arabia’s crown prince, Mohammed Bin Salman — whom Abdulhakim describes as a “baby” — launched a bloody, relentless campaign to crush dissent in his realm in 2016.
The crown prince, once praised as a reformer himself, showcased his knack for violent repression to the world with the grizzly murder of journalist and regime critic Jamal Khashoggi.
“If he wakes up in the morning and doesn’t drink good coffee, he’ll say ‘this guy dies,’” Abdulhakim told me, only half-jokingly.
The Mabahith did not respond to an email request for comment.
Al-Dukheil was among the latest high-profile victims of MBS’s unrelenting campaign to wring out every last drop of dissent in the kingdom. Abdulhakim first revealed his father’s imprisonment in a widely-circulated video published in July 2020 by Saudi human rights group “Prisoners of Conscience.”
According to his son, Al-Dukheil was being detained in the maximum security Al-Ha’ir prison, a notorious clearinghouse for detained journalists, businesspeople and political dissidents who have fallen out of the good graces of the Saudi regime. Al-Ha’ir is particularly infamous for its shoddy facilities, which are often the venue for the torture and abuse of prisoners.
Al-Dukheil had the misfortune of being imprisoned by the Saudi government once before in 2015, when Saudi security forces arrested the economist for criticizing Saudi government policy during a lecture, his son says.
Abdulhakim said his father had for decades been criticizing what he perceived as Saudi government corruption and financial mismanagement. Al-Dukheil senior left government work in the 1980s after growing frustrated with the cronyism and patronage that plagued the kingdom’s economic system, Abdulhakim says.
He spoke openly about Saudi economic woes in his books and his lectures at universities across the world. He warned of the dangers of economic inequality in the kingdom and urged the government to ween off oil. In 2013, two years before his first arrest, Al-Dukheil published a book forebodingly titled “Saudi Government Revenues and Expenditures: A Financial Crisis in the Making.”
Abdulhakim says he hasn’t been able to contact his father since his arrest.
“I don’t know what he’s doing now — is he eating? Is he sick? Is he sleeping?” he said, clearly flustered. “I cannot call him. I cannot call my mom. I cannot call my brother.”
Abdulhakim is currently residing outside Saudi Arabia, away from much of his immediate family. He is afraid, he confessed, that the Saudi government will harm him and his other family members for speaking out. But, as the anniversary of his father’s detention approaches, Abdulhakim is confronting fears of retribution to campaign publicly for his release; after months of relative quiet, the urge to speak publicly about his father’s detention became overpowering.
“My father is everything in my life,” he said.
He has already taken to Twitter, circulating slickly edited videos advocating for his father’s release and bashing Saudi government cruelty. He has published op-eds through large media outlets like USA Today in an attempt to drum up the sympathy of the American public.
I asked what he plans to do next in his campaign to free his father.
“Anything,” he said, with equal parts desperation and determination.
Have comments, questions, or tips? Feel free to email me at jmcreporting7@gmail.com or send me a DM on Twitter @jamesmillianca | https://medium.com/@jmcreporting/confronting-fears-of-retribution-the-son-of-an-imprisoned-saudi-academic-is-now-campaigning-for-70a116d4d0d | ['Jaime Moore-Carrillo'] | 2021-04-06 00:15:40.797000+00:00 | ['Middle East', 'International Relations', 'Saudi Arabia', 'Human Rights', 'Journalism'] |
The Utter Cringeworthiness of Scrolling Through Instagram During a Pandemic | The Utter Cringeworthiness of Scrolling Through Instagram During a Pandemic
Let’s normalize the social-media Covid disclosure
Photo: Markus Winkler/Unsplash
For health journalists like me — and, I suppose, for basically any well-informed person who believes in science and cares about public health and, like, the greater good — social media has become an utter minefield. (Social media has always been a minefield, so this is really saying something!) Everywhere you look there are alarming behaviors and questionable, or nonexistent, personal protective equipment.
Even in person, saying something to a stranger not wearing a mask, or wearing one improperly, feels uncomfortable at best, bear-poking at worst. And, look, we know that shaming individuals for bad pandemic behavior really only makes them feel stigmatized and drives them further away from what they should be doing.
So I’ve scrolled past these images of parties and maskless fun and said nothing. But here’s what I would like to say:
Hey bb! Your eyebrows look amazing! FYI a face shield is a supplement to, not a substitute for, a mask!
OMG the view from your hike is so beautiful, also just a heads up that a mask with a valve does not prevent the spread of infectious diseases!
So awesome you had a negative Covid test before hanging out with those friends from out of town, hope you guys had an awesome time and also that you quarantined before combining your bubbles because one negative Covid test does not mean you don’t have Covid!
Awww, so fun that your cousin got married! She probably shouldn’t have invited your grandmother but her dress was GORGEOUS!
I can’t believe your baby is old enough to play soccer now, looks like such a great first game! Where in God’s name are everyone’s masks; the coach isn’t even wearing one, holy shit! Goooooooool!!!
Listen, I like to assume the best in people (*glances sideways* …sometimes…) and I do think that, by and large, the folks in my life are doing as well as they can with all of this. But whatever your Covid-avoiding habits may be, social media can send a strong message — one you may or may not actually want to send — and never tells the full story. We’re all making risk calculations all the time and following really complicated decision trees that involve a mix of legit science, personal risk-reward analysis, random gut-checking, and probably a little bit of “fuck it”-ness. That’s okay, and understandable, and human.
But it’s also complex and difficult to convey to your friends and followers. And when it comes to public health, depending on the size of your audience, the message you’re sending may have an even bigger impact than what you’re actually doing. After all, even if you quarantined and tested on the right day and bought the world’s most expensive air purifier and did everything else correctly before whatever bubble-collapsing you’ve opted to do, your friends and followers don’t necessarily know that. So here’s what they take away: “This person I know/admire/respect is having a birthday party/tropical vacation/karaoke night. It must not be that big of a deal! Maybe I will, too!”
So let’s normalize the Social Media Covid Disclosure. Remember how at the beginning of all this, people would post a photo and say something like, “So fun to have a socially distanced hangout! We removed our masks for just a moment to take this photo but stayed apart and masked otherwise!”? And then that started to feel a little clunky and kind of fell out of favor? BRING IT BACK. Make it cool! Please!
Some questions you might consider proactively addressing in your own posts:
If you traveled, how did you keep yourself, and those in the place you traveled to, safe? How did you manage potential SARS-CoV-2 exposure on the plane or on the road? Did you test before leaving and after arriving, before going inside businesses, restaurants, or other people’s homes?
If you got together with friends and family that aren’t in your bubble, did you quarantine for two weeks beforehand? Did you (also) get a negative test before coming together?
If you visited family or friends outside of your bubble but took a photo together, how long did it take to take the photo? Were you distanced, masked, and outdoors for the rest of the time?
If you went to a large event, was it outdoors? Were the tables spaced very far apart? Was everyone masked?
If you hung out indoors but didn’t bother with pre-hangout quarantining and testing, were you wearing masks? Did you keep the windows and doors open? Do you have a really great air purifier?
Let’s also consider that it’s totally acceptable for us to just… not post photos of gatherings at all. Eliminate the need for the disclosure entirely. Instead, we can use our online spaces to share useful Covid-related information: testing centers with short lines, the cute masks we just bought, ways to get involved with food banks and local mutual aid programs to help those in need. Let’s do anything else (huge fan of makeup tutorials and Avatar: The Last Airbender memes over here) — or nothing at all.
We can do this. | https://forge.medium.com/covid-related-social-media-comments-i-have-not-posted-91d759dcfd68 | ['Anna Maltby'] | 2020-11-16 19:40:08.399000+00:00 | ['Covid 19', 'Social Media', 'Social Distance', 'Masks', 'Influencers'] |
Nutrition Types — Our Metabolism is unique | Nutrition Types — Our Metabolism is unique
Many people follow diets in the hope of doing something good for their health, reducing body weight, getting type 2 diabetes under control or simply to increase their well-being. But often such diets do not lead to the desired success, but rather to frustration and disillusionment.
What is the explanation behind it ?
In recent years, studies have shown that there is no one right diet for all people. As different as people are, so is their metabolism. Scientists have shown that even identical meals lead to different metabolic reactions in different people [1, 2]. For example, person A’s blood sugar level can rise sharply after a meal, whereas person B’s remains almost constant. This makes it clear: the same diet can lead to the desired goal for some people, while it remains unsuccessful for others.
Why do people react differently?
For a long time it was assumed that genetic factors lead to the different metabolic reactions. But a study with twins also showed different degrees of blood glucose reactions to the identical meal [3]. The hypothesis that genetic factors are the main cause of the different metabolic reactions could thus be partially refuted. Genetic factors do have an influence, but they play a rather small role [3].
How well we can metabolise certain nutrients or foods, or how our blood sugar level behaves after a meal, depends strongly on our intestinal bacteria — the MillionFriends [1, 4, 5]. Hundreds of millions of bacteria live in our intestines and have a great influence on metabolism and our health. Studies have shown that the composition of our microbiome varies greatly — almost like a personal fingerprint — and plays a big role in how blood glucose levels behave after a meal [4].
Why is it important to keep blood glucose levels constant?
If the blood glucose level rises sharply after a meal and then falls again quickly, we feel hungry again within a short time. This makes us want to eat again more quickly and so we eat more throughout the day — often more than we actually need. If the blood sugar level remains constant, however, we are full for a longer time and eat less.
Furthermore, studies have shown that large fluctuations in blood glucose levels significantly increase the risk of diseases such as type 2 diabetes, overweight and obesity, but also cardiovascular diseases and some types of cancer [3, 6].
Personalised nutrition — How we can use this knowledge
So our metabolic response depends on the composition of gut bacteria and blanket dietary recommendations and diets reach their limits. But how can this knowledge be used? The answer lies in a new and innovative approach: personalised nutrition. Personalised nutrition refers to dietary recommendations that are individually adapted to a person, their needs and their metabolism. For example, one person may tolerate white bread well, while another person would be advised to eat wholemeal bread or to eat white bread only in certain combinations.
The foundations that scientific study has created are applied in the personalised nutrition at MillionFriends. By monitoring the blood sugar level and other factors such as sport, sleep and the intake of medication, artificial intelligence can determine which nutrity type you belong to.
What do the NUTRI types mean?
Depending on the composition and diversity of our intestinal bacteria, the macronutrients — i.e. carbohydrates, proteins and fats — can lead to a different increase in blood sugar levels. This gives rise to the nutrity types: the protein type, the fat type and the mixed type. Depending on which of the nutrity types we belong to, our blood sugar level reacts differently to carbohydrates, proteins and fats or to a combination of all of them.
Carbohydrates are metabolised most rapidly in the body and thus cause the blood sugar level to rise most rapidly and steeply. Proteins and fats, on the other hand, are metabolised much more slowly. If you belong to the protein type, your metabolism reacts particularly well to proteins. If you combine carbohydrates with proteins, your blood sugar level will rise less or remain constant. The same applies to the fat type: in this case, the metabolism reacts particularly well to fats. So if you combine carbohydrates with fats, the blood sugar level remains stable. The mixed type reacts positively to both proteins and fats. If you are a mixed type, you can combine carbohydrates with proteins and fats to achieve stable blood glucose levels [7, 8, 9].
Which breakfast keeps you full the longest: white bread, wholemeal bread or muesli? Is it better to combine your bread with cottage cheese (protein) or butter (fat)? Does your blood sugar level rise sharply with potatoes, rice or pasta? What about chocolate and fruit? With MillionFriends, you can find out whether you are a protein, fat or mixed type and which foods are best combined to keep you full for a long time and keep your blood sugar level constant.
Bibliography:
[1] Zeevi, D., Korem, T., Zmora, N. et al. (2015). Personalized Nutrition by Prediction of Glycemic Responses. Cell. 163(5):1079–1094. doi: 10.1016/j.cell.2015.11.001
[2] — Asnicar, F., Berry, S.E., Valdes A.M. et al. (2021). Microbiome connections with host metabolism and habitual diet from 1,098 deeply phenotyped individuals. Nat Med. 27(2):321–332. doi: 10.1038/s41591–020–01183–8
[3] — Berry, S.E., Valdes, A.M., Drew, D.A. et al. (2020). Human postprandial responses to food and potential for precision nutrition. Nat Med. 26(6):964–973. doi: 10.1038/s41591–020–0934–0
[4] — Wilson, M.L., Davies, I.G., Waraksa, W. et al. (2021). The Impact of Microbial Composition on Postprandial Glycaemia and Lipidaemia: A Systematic Review of Current Evidence. Nutrients. 13(11):3887. doi: 10.3390/nu13113887
[5] Zmora, N. (2020). Harnessing the gut microbiota to promote metabolic health. Nutr Rev. 78(12 Suppl 2):75–78. doi: 10.1093/nutrit/nuaa076
[6] Turati, F., Galeone, C., Augustin, L.S.A. et al. (2019). Glycemic Index, Glycemic Load and Cancer Risk: An Updated Meta-Analysis. Nutrients. 11(10):2342. doi: 10.3390/nu11102342
[7] Roberts, S., Desbrown, B., Grant, G. et al. (2013). Glycemic response to carbohydrate and the effects of exercise and protein. Nutrition. 29(6):881–5. doi: 10.1016/j.nut.2012.12.022
[Collier, G., O’Dea, K. (1983). The effect of coingestion of fat on the glucose, insulin, and gastric inhibitory polypeptide responses to carbohydrate and protein. Am J Clin Nutr. 37(6):941–4. doi: 10.1093/ajcn/37.6.941
[9] Meng, H., Matthan, N.R., Ausman, L.M. et al. (2017). Effect of macronutrients and fiber on postprandial glycemic responses and meal glycemic index and glycemic load value determinations. Am J Clin Nutr. 105(4):842–853. doi: 10.3945/ajcn.116.144162
[10] Voigt, R.M., Forsyth, C.B., Green,, S.J. et al. (2016). Circadian Rhythm and the Gut Microbiome. Int Rev Neurobiol. 131:193–205. doi: 10.1016/bs.irn.2016.07.002
[11] Henry, C.J., Kaur, B., Quek, R.Y.C. (2020). Chrononutrition in the management of diabetes. Nutr Diabetes. 10(1):6. doi: 10.1038/s41387–020–0109–6 | https://medium.com/@perfood/nutrition-types-our-metabolism-is-unique-8ebb2be8a7d3 | ['Perfood Gmbh'] | 2021-12-27 12:47:49.530000+00:00 | ['Health Foods', 'Blood Sugar', 'Food', 'Nutritional Guidance', 'Metabolism'] |
The Umbrellas Are Back! | Hong Kong Today Reminds Me Of Poland 30 Some Years Ago
Hong Kong sits on the cusp after its third major anti-government demonstration on Sunday. Estimates from demonstrators suggest that as many as 2 million people (the island city has just short of 7.5 million total residents) turned out to protest the proposed extradition law, which would allow those accused of crimes to be extradited to mainland China. The protests are reminiscent of the late 2014 pro-democracy Umbrella Movement with one exception — the crowds appear to be much larger.
While the Hong Kong government has backed down and has set aside the extradition proposal for now, citizens want the bill withdrawn completely and are asking for pro-Beijing Chief Executive Carrie Lam to resign. So, the demonstrations have now gone beyond the extradition bill to Hong Kong’s political status and its future. While the Umbrella Movement failed to win concessions (beyond embarrassing the Hong Kong government and Beijing), these protests have already won at least one and could win many more over time.
The events remind me a great deal of events in Poland back in the 1980s. It was the Solidarity movement that challenged the Polish communist government for about a decade and ultimately caused the regime to crumble, which sparked the eventual collapse of the Iron Curtain and communism in Eastern Europe. As a young student in Poland in 1985, I had the privilege of marching along side Poles who were seeking freedom and democracy.
May 1 (May Day or Socialist Workers’ Day during the communist era) and May 3 (Polish Constitution Day) were among the days that saw the greatest demonstrations against the communist government at the time. On May 3, 1985, Poland was still a powder keg (even after the lifting of martial law) and I witnessed the absolute brutality of the communist regime that day. After a Mass at St. John’s Cathedral, Poles of all walks of life began singing Boze Cos Polska (God Save Poland) and wanted to march peacefully from the downtown cathedral near Castle Square to the Palace of Culture uptown, all in the name of independence and Solidarity. Thousands were on hand.
The Polish security police, the Zomos, fitted with shields and bats, stormed the crowd over time with tear gas, water cannon fire and their brute force. From our refuge point with a CBS news crew and two U.S. embassy officials, we watched as demonstrators were beaten and dragged away. To this day, I remember vividly how I looked on in horror as a young girl, no more than 17 or 18 years old, had nowhere to go. Her effort at sinking into a nearby brick wall proved futile as a Zomo pulled her away and began clubbing her in the head and stomach. Her screams and efforts to protect her head only attracted more attention. Three other Zomos wandered over and beat her still further. She was dragged away as were hundreds of other wounded demonstrators that day.
I share all of this because Hong Kongers of today are like my heroic Polish friends 30-some years ago. The Poles had their democracy between World War I and World War II, only to lose it as the Soviet Union made Eastern European countries its satellites. The Poles knew what freedom and democracy were — they had gotten a taste of it. Notwithstanding centuries of domination by foreign powers, they also had a rich liberal tradition dating back to the 16th century.
While direct representation took time in Hong Kong under British rule (in part hobbled by Chinese objections as the transfer became closer), prior to the Chinese takeover Hong Kongers did enjoy living in a relatively free society governed by the rule of law. Since that time, mainland communist China has sought to undermine the transfer’s promise of “one country, two systems” by exerting control over the Hong Kong government and undermining free speech, assembly and self-determination. China has set up a rigged representation system that guarantees pro-Beijing members control the legislature and executive branch. Opponents have been jailed for their role in the Umbrella Movement (although a prominent one was just released). The extradition bill was yet another move. It would mean those charged with a crime might just disappear and not be subject to Hong Kong’s democratic-based criminal justice code. Instead, they would be under communist China’s no-rule-of-law system. Indeed, many opponents of the emerging rigged “democratic” system have been abducted and have disappeared — some showing up on the mainland. They have no legal recourse at all. So, what then would happen if the extradition law actually passed?
Many of the activist Hong Kongers, most of them young, have declared that they will not sit idly by as their democratic future dissipates through insidious moves directed by a regime in Beijing that is paranoid of any dissent. These heroes see democracy and independence as too important.
That day in Poland in May 1985, I would have told you that freedom for Eastern Europe was years off given all that the communist regime had at its disposal. Few Kremlin watchers at the time would have told you that the events in Warsaw, Prague, East Berlin, Budapest, Timisoara, Sofia, and Moscow would have come and passed so quickly. Few predicted the rapidity with which the Iron Curtain fell. But the day after the march, I understood that something rather profound was happening. As I interviewed my friends about the events and why they continued to demonstrate given the fear and horror we had witnessed, each of them came back with roughly the same reaction. One said it the best: “When you believe in something as bad as we do, sometimes you have to be beaten for it.”
Beijing has to be fearful. “Shield Girl” as they have dubbed her during these recent demonstrations is reminiscent of “Tank Man” of 1989 Tiananmen Square fame. Both remind me of Polish hero Grzegorz Przemyk, an 18-year old aspiring Poet killed at the hands of Polish communist authorities in 1983 for his and his mother’s pro-democracy activities. He was born the same year I was, but was dead two years before I marched with my Polish friends. The communists murdered this young man, much as they did Solidarity supporter and priest Jerzy Popielusko a year later. That day during the march, we publicly remembered both of them as well as the other heroes of the movement.
Beijing has a tight grip on the mainland, snuffing out most dissent and keeping urban Chinese happy with material wealth. But what if Hong Kongers don’t view material wealth as an adequate substitute for the freedom their country enjoyed in the past? Could a successful movement in Hong Kong ignite all of China, much as Solidarity did for Eastern Europe? What might an economic slowdown in China contribute to all of this?
While Chinese Leader Xi looks outward when it comes to economic transformation, he is decidedly totalitarian when it comes to party rule, dissent, and absolute control. Thus far, the 6,000 troops of the Chinese People’s Liberation Army garrisoned in Hong Kong have not been called out (although some suggest Army personnel have been given police uniforms). So how China proper reacts as the demonstrations continue is anyone’s guess. But I hope the Hong Kongers, who appear to believe as deeply in freedom as my Polish friends did 30-some years ago, get the changes they are demanding. In time, as it did in Poland, the inconquerable human spirit triumphs.
Marc S. Ryan is a healthcare consultant writing on the emerging healthcare landscape, health plan issues (including compliance and quality) and current healthcare events. He periodically writes on foreign affairs and world events as well. | https://medium.com/@quovadishealthcare/the-umbrellas-are-back-96b5e66586b3 | ['Marc S. Ryan'] | 2019-07-01 21:02:23.506000+00:00 | ['China', 'Poland', 'Hong Kong', 'Democracy', 'Current Events'] |
Road To Code : Amir Helmy. From Network Engineer to Web Developer | From Network Engineer to Web Developer
Amir Helmy
What’s your name and where are you from?
Amir Helmy, I am an Egyptian/Canadian. I grew up in Egypt and spent the last decade living in Montreal.
What were you doing before you decided to take up coding?
I am a Telecommunications Engineer with a master’s degree in Electrical Engineering from McGill University. I have been designing wireless network protocols and radio resource algorithms for 3GPP’s 4G/LTE mobile communication standards.
Why did you decide to do it?
I was eager to evolve my software skills beyond modelling and simulation of engineering system designs to build interactive end-user application programs that can directly interface and positively impact people’s lives.
What things maybe stood in the way of the decision to start coding? Did you have any doubters/or conflicts before you did it?
It was not an easy decision to make the transition from telecommunications to software application development. It is a big change in fields and change is never easy. However, I took the chance and I am now tremendously enjoying the challenges of software engineering with its diverse applications in web, mobile and desktop platforms.
What was the decision making process like?
I researched the various branches of software engineering and tested the waters by taking online courses and even taking the CodeCore part-time programming fundamentals course to get a better feel of software web development.
Why did you choose CodeCore?
It was all about knowing past CodeCore graduates and witnessing how they progressively transformed to brilliant developers.
How has the experience been?
Exciting yet occupying! Problem solving in a new field is very stimulating and a true pleasure.
What advice do you have for people who are thinking about starting a Bootcamp program?
Take a chance! You can always do your homework and explore web development to see if it the right thing for you, but, in the end, it is about taking a leap of faith and seeing through this coding journey. | https://medium.com/@CodeCoreYVR/road-to-code-amir-helmy-dda02b25595c | [] | 2019-04-12 22:32:26.241000+00:00 | ['Education', 'Career Change', 'Web Development', 'Codingbootcamp'] |
I’m not sure if anyone has told you this today…but you’re amazing. | I’m not sure if anyone has told you this today…but you’re amazing. You’re beautiful. You’re Strong. Keep pushing. The fight isn’t over yet. | https://medium.com/@zoelitz4446/im-not-sure-if-anyone-has-told-you-this-today-but-you-re-amazing-f913563387ed | [] | 2020-12-18 09:08:47.042000+00:00 | ['Mental Health Awareness'] |
Learn about peacebuilding and other interfaith groups on December 16. | Learn about peacebuilding and other interfaith groups on December 16. The United Religions Initiative (URI), a worldwide consortium of more than a thousand peacebuilding and other interfaith groups, is celebrating its new Cooperation Circles (CCs) over Zoom on December 16. One is a group I maintain, Quora’s Israel-Palestine peace forum Unity is Strength. I expect to attend and speak for one minute about just a few of the many things we have done. Reach out to the contacts on the image below if you would like to join.
Here is more information about Unity is Strength and how I came to start this forum. | https://medium.com/illumination/learn-about-peacebuilding-and-other-interfaith-groups-on-december-16-e34a853c8b16 | ['Rebecca Sealfon'] | 2020-12-15 16:52:25.791000+00:00 | ['Peace', 'Cooperation', 'Peacebuilding', 'Religion', 'International Relations'] |
Projects: regaining normalcy in online high school classrooms | Photo by Thought Catalog on Unsplash
COVID-19 is spreading rapidly in urban cities, forcing citizens to stay indoors. Schools across the nation have switched to online learning, with teachers and students across the nation struggling to keep up. According to this article, high school students are missing the normal in person interactions with their peers, while others are tuning out of attending classes. The widespread effect of the pandemic is something that nobody could have expected. Yet even so, improvements to online high school education must be made so that these students can succeed.
A focus toward implementing smaller, feasible solutions were addressed in the College of Innovation and Design 332: Growth Hacking course at Boise State University. To do this, research was conducted in a 7-week period from August 2020 to December 2020. A series of weekly projects were undertaken from which the overall solution was created. Those projects included idea generation, brainstorming, interviews, flowcharts, online survey generation, and data interpretation.
Conducting this online survey was key towards gaining applicable data. As shown above, the survey generated many responses with age groups from the Baby Boomer generation, X, Y, and Z. In particular, female millennials made up a majority of responders at 23.46%, and millennials were the most popular group at 49.38%. Responders answered questions and gave brief testimonies about lecture styles, assignment types, learning preferences, procrastination, and project-based work. Critical analysis of this data was performed to eliminate dozens of possibilities, in favor of smaller steps which could be implemented quickly.
This word cloud was generated from a short answer question. Shown here, the five most popular themed words about learning preferences include “live”, “lecture”, “questions”, “like”, and “time.” From this, we can come to a general consensus about what students seek from their schools:
Students seek engagement within a community of their peers; a mentor who will pass on knowledge and facilitate discussion; accumulation of knowledge; specific intriguing subject matter; and purposeful use of the school day. | https://medium.com/@kendrajacobk/projects-regaining-normalcy-in-online-high-school-classrooms-8f1677cc1f87 | ['Jacob Kendra'] | 2020-12-18 23:02:21.034000+00:00 | ['Learning', 'High School', 'Covid 19', 'Education Reform', 'Online'] |
5 Books from 5 Genres to Read During Pregnancy | 5 Books from 5 Genres — To Accompany You During Your Pregnancy
I have selected this list of books to excite a range of sensations instead of a single note of emotion. Therefore, I prioritized a degree of variety and diversity in my recommendation to save you from a monotonous experience.
1. Poetry- The Essential Rumi
Image from Goodreads
Rumi was a 13th-century Persian poet, scholastic, and Sufi mystic. His influence transcends sovereign borders and ethnic barriers alike. People from Iran, Pashtu’s & Tajiks ethnic group, Turkey, Greek, Central Asia, and the Indian subcontinent have cherished his spiritual legacy for the past seven centuries.
The Essential Rumi is a collection of Rumi’s most exquisite verses. An American poet Coleman Barks gives us Rumi’s startling visions and euphoric emissions with contemporary rhythm and import. The Essential Rumi is a rare piece of a volume that will stir your heart and cultivate your mind with passion.
Why read it:
This book strikes the right balance through its pleasing yet thrilling reading experience.
Speaking of the profound wisdom these verses offer, they stay relevant until this modern era.
If read and dissected with enthusiasm and sincerity, this book will not only turn into a better mother but a better individual altogether.
2. Indian Mythology — The Forest of Enchantments
It is a story as old as the hills and as new as a fresh dewdrop clinging to a tender shoot growing on those very hills. A story we know by heart. — Richa Bhattarai
Image from Goodreads
Published in 2019, Chitra Banerjee Divakaruni’s The Forest of Enchantments is a brilliant retelling of the tragic love story of Ram-Sita. This piece of mythological fiction places Sita at the center. For a novel depicting certain aspects of one of the world’s greatest epics, The Forest of Enchantments is very humane and relatable at its core.
Though there are countless great works based on Ramayana, this novel has succeeded to earn its praise both from the readers and the critics.
Why read it:
This piece celebrates womanhood with a burning passion. It will surely lit up your soul and give you a different perspective on the mythic tale of Ramayana.
3. Self Help — Mayo Clinic Guide to a Healthy Pregnancy
Image from Goodreads
Cutting through the noisy crowd of popular self-help books related to pregnancy, I have managed to get a hold of the people who know what they are talking about.
Mayo Clinic has ranked no. 1 on US News & World Report’s 2020–2021 Best Hospitals Honor Roll.
Mayo Clinic Guide to a Healthy Pregnancy is the collective work of a unit of health care specialists who find it deeply gratifying at the birth of a healthy child by a healthy mother. Any parent-to-be scanning for precise and reliable information from a reputable source should pick this one without any second thought.
Why read it:
This book is easy-to-understand and on point.
Unlike other books dealing with the same topic, this book is unpretentious and thorough.
The month by month guide and insights you will find in this books are unparalleled in terms of authority, substantiality, and effectiveness.
Most mothers recommend this one over any other famed self help maternity book.
4. Non Fiction — Anger: Wisdom for Cooling the Flames
Image from Goodreads
Human emotions are tricky. Feelings of envy, insecurity, helplessness, and grief are more complicated ones. However, the uncontrollable fire of boiling anger is the strongest and most devastating of all. If consumed by it, you can destroy lives within a matter of seconds.
Even if not acted upon, suppressed anger can eat you from inside, making you more vulnerable to stroke, high blood pressure, or heart attack.
With the signature simplicity, a Buddhist monk and Vietnam exile Thich Nhat Hanh addresses the issue and offers us his pieces of advice for reconstructing relationships, converging energy, and restoring those parts of ourselves that we often ignore.
Why read it:
The inherent and uncontrollable mood swings of maternity is an aspect that many fail to acknowledge.
This excellent piece of the book can guide you through the turmoils of the inner storm you can’t share with anyone.
5. Fiction — Wonder
Image from Goodreads
The book follows a 10-year-old August Pullman with a rare genetic condition causing him to be born with a facial deformity. Throughout the years, he has gone through 27 surgeries to rework his vocal cords and hearing ability. But he still looked unusual in comparison to others. Due to his condition (more so for his consciousness), he has been homeschooled so far. But now his mother is taking active initiations to enroll him in an actual middle school.
Surprisingly, the book gives us much more than the standard fish out of the water narrative. Of course, it deals with all the ins and outs of being a different looking child dealing with bullying. But at times, it shifts perspectives, and we experience the thoughts and emotions of other characters as well.
Why read it:
This book doesn’t shy away from showing the fallibility of parents despite their best efforts.
It points out how much we form our judgments looking only at the surface and refusing to look through the initials. And this book goes way beyond Auggie’s facial deformity to explore that.
And this book goes way beyond Auggie’s facial deformity to explore that. Wonder is an honest tale of the silent battles we engage in each moment of our lives and how it takes a mental toll on us. But it also shows how having a family where everyone learns from their mistakes and support each other in embarrassingly low points is a true blessing.
Read it yourself. You will find out. | https://medium.com/books-are-our-superpower/5-books-from-5-genres-to-read-during-pregnancy-ac7447af9d5c | ['Anirban Kar'] | 2020-10-28 17:07:12.070000+00:00 | ['Pregnancy', 'Life', 'Books', 'Reading', 'Readinglist'] |
The Tragedy Surrounding Jamaica’s ‘Face of Pride’ | On August 31, 2017, Jamaican authorities found the body of 35 year old man in his home in Kingston who had suffered numerous stab wounds and his body had begun to decompose after numerous days. His name was Dexter Pottinger and he was the 2016 “Face of Pride” for the Jamaican Forum for Gays, All-Sexuals and Gays.
At the time, J-FLAG had bestowed the honor onto him for his “his courage, sense of self, drive, relationship with his family and friends, and pride in being Jamaican and in being a gay man.” Dexter Pottinger rose to prominence in Jamaica over the past few years as model and fashion designer for numerous custom lines, including the well known “3D” line.
And it was seems due to his visibility that his life was cute short.
Maurice Tomlinson, a prominent gay lawyer and activist in Jamaica who met Dexter at a fashion show years ago, spoke with INTO about the importance of Dexter’s role as the Face of Pride, “It was the first time we’d actually seen somebody willing to put their face out there as a member of LGBT community as a recognizable icon and just really catapulted his advocacy.”
The culture of homophobia and transphobia is not only historic or cultural to the island, but it is also incorporated into its legal framework. Stemming from the British colonization of Jamaica from 1707 to 1962, anti-sodomy laws were handed down to Jamaica from Britain and still exist to today.
Although rarely enforced according to many, Maurice Tomlinson stated in a 2012 Guardian piece that the Jamaica police instead use the 1863 law “for extortion” against LGBTQ people in Jamaica. In addition, he attributed much of the island’s homophobia to the religious and financial influence of Evangelical Christians.
Today, the culture of violence towards LGBTQ people in Jamaica is apparent in many ways.
A 2006 Time Magazine article titled Jamaica “the most homophobic place on Earth. The 2014 Vice documentary explores the lives of LGBTQA Jamaicans that are forced to live in sewage systems or “gullies” once they are run away from their neighborhoods. Homophobia has become such a commonplace in certain artists’ music that it has been coined “ murder music “.
The apathy by many Jamaicans towards violence against the LGBTQA community has been the most resounding response to Dexter Pottinger’s death. On the night of Dexter’s murder, Wednesday, August 30th, according to a September 4th letter to the Jamaican Gleaner, “neighbours heard cries for help and screams of “murder” in the middle of the night and did nothing”.
Many argue that the alleged silence of Dexter’s neighbors is a result of Jamaica’s 19% increased murder rate in January to June 2017 compared to the same period of time in 2016. In June 2017 alone, an average of seven murders occurred a day in Jamaica.
Maurice Tomlinson argued otherwise while speaking with INTO, “The major problem that we have with the way that Dexter’s murder was treated is the fact that his neighbors who heard him scream for help and ‘murder’ at three am in the morning and also saw someone putting stuff in the car and driving away at that time — did not respond. Yet the same people called parties on Dexter when he had parties at his home with members of the LGBT community.
“It’s the total indifference to our lives as LGBT members of society. “
Shortly after Dexter’s murder, Jamaican authorities apprehended Romario Brown for the murder of Dexter Pettinger after the murder weapon and a television stolen from Dexter’s home were found at Romario’s property. On September 30th, he was denied bail in the case of Dexter’s murder. His case is reported to continue on November 9, 2017.
When asked how members of the Jamaican LGBT community would be moving forward, Maurice Tomlinson stated that Montego Bay Pride, which is set for October 12 t0 15, 2015, will continue, “We refuse to be intimidated by this. This has empowered and encouraged us to be more visible. Many of us see this as the line in the sand.”
“We are going to claim our space because we believe that it’s because they don’t know who we are that they were able to treat his murder with such callousness.” | https://princeshakur.medium.com/the-tragedy-surrounding-jamaicas-face-of-pride-f56887fb05d1 | ['Prince Shakur'] | 2020-11-30 15:48:10.205000+00:00 | ['Jamaica', 'Gay', 'LGBTQ', 'Pride Month'] |
Microsoft bids farewell to Windows 7 and the millions of PCs that still run it | Microsoft bids farewell to Windows 7 and the millions of PCs that still run it DailyTend Jan 14, 2020·2 min read
DailyTend.com
Today is a big day for Windows. Microsoft is dropping support of Windows 7, nearly 11 years after first launching the operating system with a flashy New York City marketing campaign. “I’m a PC and Windows 7 was my idea,” was the message back then, a clear nod to the fact it was designed to fix the Windows Vista failure. Windows 7 certainly did fix things, with its new taskbar, Aero window management, file libraries, and much more.
Windows 7 became so popular, in fact, that it took Windows 10 nearly four years just to pass it in market share. Even today, millions of PCs are still running Windows 7, and the operating system still runs on a massive 26 percent of all PCs according to data from Netmarketshare. Microsoft spent years trying to get people to upgrade to Windows 10 free of charge, but tens of millions of PCs will now be left vulnerable to exploits and security vulnerabilities.
Businesses and education Windows 7 users will be able to pay for extended security updates, but it could be a costly venture for some. Extended updates for Windows 7 Enterprise is approximately $25 per machine, and the cost doubles to $50 per device in 2021 and again to $100 in 2022. It’s even worse for Windows 7 Pro users which starts at $50 per machine and jumps to $100 in 2021 and $200 in 2022. These costs will naturally vary depending on the volume of PCs in use at a business, but they’re still going to be substantial for larger firms.
Microsoft is easing these costs with a free year of post-retirement updates to Windows 7 customers with active Windows 10 subscriptions. That hasn’t made a big dent in Windows 7 market share recently, though.
A Windows 7 upgrade notification
Read Complete Story => https://www.dailytend.com/2020/01/14/microsoft-bids-farewell-to-windows-7-and-the-millions-of-pcs-that-still-run-it/3604/ | https://medium.com/@DailyTend/microsoft-bids-farewell-to-windows-7-and-the-millions-of-pcs-that-still-run-it-d0130483a182 | [] | 2020-01-14 16:36:11.617000+00:00 | ['Windows', 'Windows 7', 'Windows 10'] |
INHUMANITY IN ITS CORE: RAPE :: END THE STIGMA | INHUMANITY IN ITS CORE: RAPE :: END THE STIGMA
Pen is mightier than a sword, the power of words, can make or break something. Right now there are a lot of issues happening around that needs attention, and one of the most horrific act is Women Assaultation.Every day I open my news feed, there are several incidents in this regard, each more inhuman and gruesome than the other. India sees 88 rape cases a day, 4 lakhs reports in 2019, increasing at an alarming rate now.
If the horrible incident of Nirbhaya in Delhi wasn't enough, Hathra in Uttar Pradesh recently created uproar like none other. The sad truth is, this isn't the end, just a start of the cruelty that a human can go to. I was researching on this, wondering what makes someone do something like this, especially now, since the victims are not only women, but children, animals and elderly, I still don't how someone has the heart to do this hideous crime.
Many blame the women, narrow mindedness, remarks on the attire, leading to provocation, which is absurd, cause how can that be the reason when the victims now are children or animals,so does that mean you need to start dressing up female animals, just a thought to show the stupidity of the reasons someone justifies their action.
Mostly, I think, there is no proper sex education given, it is considered as a taboo, but understanding the basis and the natural course, creates a right mindset and open mindedness that is required. One more thing I noticed is the fact that, the guilty are not convicted quickly, with the cases going in court years, which gives them a safety haven, resulting in more crimes, what they should actually get is a death penalty or life imprisonment, cause they took the innocence of a human, even if not murdered, a life of mental trauma, creating a huge imprint, especially if it happens to a child or young adult. More stringent measures should take place for the security of women, where protection access should be at the tip of the finger.
Like they say, it's not the women mindset that should be tuned but the mens',should be set straight from a young age. It's not the dress or the age or the gender here, but understanding the basis of humanity, forcing something, controlling someone just for a moment's pleasure is heinous, and, especially if it is from people you know or in the neighborhood, is more scary. If someone does not do anything about this, eventually everyday will be a living hell to all women, and one might wonder what is the point of writing on this, well to that I say, everything starts with a single step, and words can have a great impact, creating awareness and like they say "Speech has power. Words do not fade. What starts out as a sound, ends in a deed". | https://medium.com/@blshruti/inhumanity-in-its-core-rape-end-the-stigma-e7bae28e7fde | ['Shruti Bl'] | 2020-11-22 08:25:23.887000+00:00 | ['Victims', 'Rape', 'Awareness', 'Justice'] |
List of free resources to learn Natural Language Processing | Natural Language Processing (NLP) is the ability of a computer system to understand human language. Natural Langauge Processing is a subset of Artificial Intelligence (AI). There are multiple resources available online which can help you develop expertise in Natural Language Processing.
In this blog post, we list resources for the beginners and intermediate level learners.
Natural Language Resources for Beginners
A beginner can follow two methods i.e. Traditional Machine Learning and Deep Learning to get started with Natural language processing. These two methods are very different from each other. For the inquisitive, here’s the difference between these two.
Click the pic to join! AI Marketing Association
Traditional Machine Learning
Traditional machine learning algorithms are complex and often not easy to understand. Here are a few resources which will help you get started in learning NLP using machine learning:
Speech and Language Processing by Jurafsky and Martin is the popularly acclaimed bible for traditional Natural Language Processing. You can access it here.
For a more practical approach, you can try out Natural Language Toolkit.
Deep Learning
Deep learning is a subfield of machine learning and is far better than traditional machine learning due to the introduction of Artificial Neural Networks. Beginners can start with the following resources:
CS 224n: This is the best course to get started with using Deep Learning for Natural Language Processing. This course is hosted by Stanford and can be accessed here.
Yoav Golberg’s free and paid books are great resources to get started with Deep Learning in Natural Language Processing. The free version can be accessed here and the full version is available here.
A very thorough coverage of all algorithms can be found in Jacob Einsenstein’s notes from GATECH’s NLP class which deals in almost all NLP methods. You can access the notes on GitHub here.
Natural Language Resources for Practitioners
If you are a practicing Data Scientist, you will need three types of resources:
Quick Getting Started guides / Knowing about what is hot and new Problem-Specific Surveys of Methods Blogs to follow regularly
Quick Getting Started guides / Knowing about what is hot and new
One can start with Otter et al.’s Deep Learning for Natural Language Processing survey. You can access it here.
A survey paper by Young et al tries to summarize everything hip in Deep Learning based Natural Language Processing, and is recommended to get started with Natural Language Processing for practitioners. You can access the paper here.
You can refer to this article to understand the basics of LSTMs and RNNs, which are used in Natural Language Processing a lot. Another much more cited (and highly reputed) survey of LSTMs is here. This is an interesting paper to understand how the hidden states of RNNs work. It is an enjoyable read and can be accessed here. I always recommend the following two blog posts anyone who hasn’t read them:
Convolutional Neural Networks (Convnets) can be used to make sense of Natural Language. You can visualize how Convnets work in NLP by reading this paper here.
How Convnets and RNNs compare with each other has been highlighted in this paper by Bai et al.. All its pytorch (I have stopped or reduced, to a large extent, reading deep learning code not written in pytorch
) code is open sourced here and gives you a feel of Godzilla v/s King Kong or Ford Mustang vs Chevy Camaro(if you enjoy(ed) that type of thing). Who will win! .
Problem-specific Surveys of Methods
Another type of resources practitioners need is answers to questions of the type: “I have to train an algorithm to do X, what is the coolest (and easily accessible) thing I can apply?”.
Here’s what you will need for this:
TEXT CLASSIFICATION
What’s the first problem people solve? Text Classification, mostly. Text Classification can be in the form of categorizing text into different categories or detecting sentiment/emotion within the text.
I would like to highlight an easy read about different surveys of Sentiment Analysis described in this ParallelDots blog. Though the survey is for sentiment analysis technologies, it can be extended to most text classification problems.
Our (ParallelDots) surveys are slightly less technical and aim to direct you to cool resources to understand a concept. The Arxiv survey papers I point you to will be very technical and will need you to read other important papers to deeply understand a topic. Our suggested way is to use our links to get familiar and have fun with a topic but then to be sure to read the thorough guides we point to. (Dr. Oakley’s course talks about chunking, where you first try to get small bits here and there before you jump deep). Remember, it is great to have fun but unless you understand the techniques in detail, it will be hard to apply concepts in a new situation.
Another survey of Sentiment Analysis algorithms (by people at Linked University and UIUC) is here.
The Transfer Learning revolution has already hit Deep Learning. Just like in images where a model trained on ImageNet classification can be fine-tuned for any classification task, NLP models trained for language modeling on Wikipedia can now transfer learn text classification on a relatively lesser amount of data. Here are two papers from OpenAI and Ruder, and Howard which deal with these techniques.
Fast.ai has a more friendly documentation to apply these methods here.
If you are transfer learning two different tasks (not transferring from Wikipedia language modeling task), tricks to use Convnets are mentioned here.
IMHO, such approaches will slowly take up on all other classification methods (simple extrapolation from what has happened in vision). We also released our work on Zero Shot Text classification which gets good accuracy without any training on a dataset and are working on its next generation. We have built our custom text classification API commonly called the Custom Classifier in which you can define your own categories. You can check out the free here.
SEQUENCE LABELING
Sequence Labeling is a task which labels words with different attributes. These include part-of-speech tagging, Named Entity Recognition, Keyword Tagging etc.
We wrote a fun review of methods to tasks like these here.
An excellent resource for such problems is the research paper from this year’s COLING which gives optimal guidelines to train Sequence labeling algorithms. You can access it here.
MACHINE TRANSLATION
One of the biggest advances in NLP in recent days has been the discovery of algorithms that can translate text from one language to another. Google’s system is an insane 16 layered LSTM (which requires no dropout because they have tons of data to train on) and gives state-of-the-art translation results.
Media experts blew the hype out of proportion with hyperbole reports claiming “Facebook had to shut down AI which invented its own language”. Here are some of these.
For an extensive tutorial on Machine Translation, refer to Philip Koehn’s research paper here. A specific review to use Deep Learning for Machine Translation (which we call NMT or Neural Machine Translation) is here.
A couple of my favorite papers are here –
This paper by Google tells you how to solve a problem end-to-end when you have a lot of money and data.
Facebook’s Convolutional NMT system (just because of its cool convolutional approach) and its code is released as a library here.
https://marian-nmt.github.io/ is a framework for fast translation in C++http://www.aclweb.org/anthology/P18-4020
http://opennmt.net/ enables everyone to train their NMT systems.
QUESTION ANSWERING
IMHO this is going to be the next “Machine Translation”. There are many different types of Question Answering tasks. Choosing from options, selecting answers from a paragraph or a knowledge graph and answering questions based on an image (also known as Visual Question Answering) and there are different datasets to get to know the state of the art method.
SQuAD dataset is a question answering datasets which tests an algorithm’s ability to read comprehensions and answer questions. Microsoft published a paper earlier this year claiming they have reached human-level accuracy for the task. The paper can be found here. Another important algorithm (which I feel is the coolest) is Allen AI’s BIDAF and its improvements.
Another important set of algorithms is Visual Question Answering which answers questions about images. Teney et al.’s paper from VQA 2017 challenge is an excellent resource to get started. You can also find its implementations on Github here.
Extractive Question Answering on large documents (like how Google Highlights answer to your queries in first few results) in real life can be done using Transfer Learning (thus with few annotations) as shown in this ETH paper here. A very good paper criticizing the “understanding” of Question Answering algorithms is here. Must read if you are working in this field.
PARAPHRASE, SENTENCE SIMILARITY OR INFERENCE
The task of comparing sentences. NLP has three different tasks: Sentence Similarity, Paraphrase detection and Natural Language Inference (NLI) for this, each requiring more semantic understanding than the last. MultiNLI and its subset Stanford NLI are the most well-known benchmarks datasets for NLI and have become the focus of research lately. There are also MS Paraphrase Corpus and Quora Corpus for paraphrase detection, and a SemEval Dataset for STS (Semantic Text Similarity). A good survey for advanced models in this domain can be found here. Applied NLI in the clinical domain is very important. (Finding out about right medical procedures, side effects and cross effects of drugs etc. ). This tutorial from applied NLI in the medical domain is a good read if you are looking to apply the tech in a specific domain.
Here is a list of my favorite papers in this domain
Natural Language Inference over Interaction Space — It highlights a very clever approach for putting a DenseNet (Convolutional Neural Network on Sentence representations). The fact that this was the outcome of an internship project makes it even cooler! You can read the paper here.
This research paper from Omar Levy’s group shows that even simple algorithms can perform the task. This is because algorithms are still not learning “inference”.
BiMPM is a cool model to predict paraphrases and can be accessed here.
We have a new work for Paraphrase detection too which applies Relation Networks on top of sentence representations and has been accepted at this year’s AINL conference. You can read it here.
OTHER FIELDS
Here are some of the more detailed survey papers to get information about research for other tasks you might encounter making an NLP system.
Language Modelling(LM) — Language Modelling is the task of learning an unsupervised representation of a language. This is done by predicting the (n+1)th word of a sentence given the first N words. These models have two important real-world uses, autocomplete and acting as a base model for transfer learning for text classification as mentioned above. A detailed survey is here. If you are interested in learning how to autocomplete LSTMs in cellphones/search engines work based on search history, here is a cool paper you should read.
Language Modelling is the task of learning an unsupervised representation of a language. This is done by predicting the (n+1)th word of a sentence given the first N words. These models have two important real-world uses, autocomplete and acting as a base model for transfer learning for text classification as mentioned above. A detailed survey is here. If you are interested in learning how to autocomplete LSTMs in cellphones/search engines work based on search history, here is a cool paper you should read. Relation Extraction — Relation extraction is the task of extracting relations between entities present in a sentence. A given sentence “A is related as r to B”, gives the triplet (A,r, B). A survey of the research work in the field is here. Here is a research paper that I found to be really interesting. It uses BIDAFs for Zero Shot Relation extraction (that is, it can recognize relations it was not even trained to recognize).
Relation extraction is the task of extracting relations between entities present in a sentence. A given sentence “A is related as r to B”, gives the triplet (A,r, B). A survey of the research work in the field is here. Here is a research paper that I found to be really interesting. It uses BIDAFs for Zero Shot Relation extraction (that is, it can recognize relations it was not even trained to recognize). Dialog Systems — With the onset of the chatbot revolution, Dialog systems are now the rage. Many people (including us) make dialog systems as a combination of models such as intent detection, keyword detection, question answering etc, while others try to model it end-to-end. A detailed survey of dialog system models by the team at JD.com is here. I would also like to mention Parl.ai, a framework by Facebook AI for the purpose.
With the onset of the chatbot revolution, Dialog systems are now the rage. Many people (including us) make dialog systems as a combination of models such as intent detection, keyword detection, question answering etc, while others try to model it end-to-end. A detailed survey of dialog system models by the team at JD.com is here. I would also like to mention Parl.ai, a framework by Facebook AI for the purpose. Text Summarization — Text Summarization is used to get a condensed text from a document (paragraph/news article etc.). There are two ways to do this: extractive and abstractive summarization. While extractive summarization gives out sentences from the article with the highest information content (and what has been available for decades), abstractive summarization aims to write a summary just like a human would. This demofrom Eintein AI brought abstractive summarization into mainstream research. There is an extensive survey of techniques here.
Text Summarization is used to get a condensed text from a document (paragraph/news article etc.). There are two ways to do this: extractive and abstractive summarization. While extractive summarization gives out sentences from the article with the highest information content (and what has been available for decades), abstractive summarization aims to write a summary just like a human would. This demofrom Eintein AI brought abstractive summarization into mainstream research. There is an extensive survey of techniques here. Natural Language Generation (NLG) — Natural Language Generation is the research where the computer aims to write like a human would. This could be stories, poetries, image captions etc. Out of these, current research has been able to do very well on image captions where LSTMs and attention mechanism combined has given outputs usable in real life. A survey of techniques is available here.
Blogs to follow
Here’s a list of blogs which we highly recommend for anyone interested in keeping track of what’s new in NLP research.
Einstein AI — https://einstein.ai/research
Google AI blog — https://ai.googleblog.com/
WildML — http://www.wildml.com/
DistillPub — https://distill.pub/ (distillpub is unique, blog and publication both)
Sebastian Ruder — http://ruder.io/
If you liked this article, you must follow our blog. We come up with resource lists quite frequently here.
That’s all folks! Enjoy making neural nets understand language.
You can also read about Machine Learning algorithms you should know to become a Data Scientist here.
We hope you liked the article. Please Sign Up for a free ParallelDots account to start your AI journey. You can also check out free demos of ParallelDots AI APIs here.
You can read the original article here. | https://medium.com/aimarketingassociation/list-of-free-resources-to-learn-natural-language-processing-f4b3c528800c | ['Shashank Gupta'] | 2018-08-28 18:39:10.022000+00:00 | ['Machine Learning', 'Deep Learning', 'Neural Networks', 'NLP', 'AI'] |
Action Coin Swap Updates & Procedures | Image by Gerd Altmann from Pixabay
As many of you already know, we launched a new blockchain earlier this year. This resulted in a more than 5X reduction in the Action Coin supply; from 10 billion ACTN to 1.799 billion ACTN.
These changes have resulted in a mandatory coin swap, with 1 new ACTN being provided in exchange for 5 of the old ACTN. Third party apps, exchanges and wallets that have integrated with us (the ones that we’re aware of anyways), have been notified so that they may facilitate the Action Coin swap for each of their users.
STEX Exchange was the first organization to complete a swap for their community. Deposit, withdraw and trading functions have since been re-enabled.
HEBE Wallet graciously added swap functionality to their “decentralized multi-chain wallet”, so their users may complete the Action Coin swap in app. The latest version of their app will be released in the near future.
SWFT Blockchain has not yet facilitated a swap for their user base. It appears that they are still transacting on our old blockchain…
Aircoins Augmented Reality Treasure Hunt will be completing an in app coin swap for their users in the near future.
Website Balance Swaps (actioncoin.com) are complete. As part of the decentralization process, each of our registered community members must now transfer their full balance from the website to our blockchain (you will need to create a new wallet first). All balance transfers must be completed by July 1st, 2021.
Action Coin Swaps from our old web wallet (wallet.actioncoin.com), to one of several branded wallets that have been integrated with our new blockchain (1, 2, 3), have been underway for the past 8 months. Each swap request is manually reviewed and completed by an Action Coin team member.
To initiate a coin swap from the old web wallet:
1). Create a wallet on our new blockchain (1, 2, 3).
2). Login to the old web wallet and prepare to send all of your ACTN to our central wallet address.
3). You must include an unencrypted message (containing your new wallet address) with your transaction! Failure to include a new wallet address will result in your ACTN being returned to you. Failure to include the correct wallet address will result in a complete loss, as we cannot recover coins that are sent to the wrong destination.
4). Send your old ACTN to: ACTN-LG7Q-PV3X-RW8L-ELAEV
Remember: The total ACTN supply has been reduced from 10 billion coins to 2 billion coins. That means you will receive 1 new coin in exchange for 5 old coins.
All swap requests are subject to review by a member of our team. We will send your new coins as quickly as possible.
Reach out to our Telegram community if you’re having any issues.
ALWAYS backup your private keys!! | https://medium.com/@actioncoin/action-coin-swap-updates-procedures-69c22a608ced | ['Nicholas Morley'] | 2021-01-01 00:14:51.186000+00:00 | ['Blockchain', 'Cryptocurrency', 'Blockchain Startup', 'Blockchain Development', 'Crypto'] |
My Struggles with Mania and Goal Setting | Stress is a huge trigger for my hypomania or maybe even full-blown mania. I’m sure I’m not alone when it comes to the stress that 2020 has given, and this stress has compounded many mental health issues for people not just myself. When I get manic I easily get bored, anxious, restless, and oddly even depressed when I’m not working towards a goal. When I don’t set myself well-structured goals, I might likely go with my impulses, which can be dangerous if left unchecked.
Unfortunately, a few years ago, I have fallen into debt partly due to my mania. Although it was and still is difficult to face myself with what I had done a couple years ago, I decided to get control of my finances. I was lucky to have my wife help me manage my finances at first, but to be truly accountable, I had to be able do it myself. I started reading self-help books and started making goals for myself. One of the things I learned is that setting-up goals, is never ending. If I were to write a self-help book, I would say that you can eventually find success when you set goals, plan for execution, follow through with your plan, and then reset your goals when the desired outcome is not achieved. Although I must admit that I have been stuck at constant reset mode. I did not realize right away that the first thing I had to tackle was learning how to set goals properly.
Before I made my first Medium post as Danko Weedburn, I had a good talk with my brother regarding my goals as writer. I said I was feeling overwhelmed and that I wanted to just stop writing since the whole task of being a successful writer seems like a daunting impossible task. I said that I can’t seem to find the time and energy to write because of my day job. I voiced my frustrations with my financial situation and not being able to “afford to do my own thing creatively”. He asked me what my purpose of writing was. He followed it up with a question, “Are you living to write, or writing to live?” I could not answer it correctly, since I was so focused on my debt. I got lost in following money as my main goal. I was too focused on whether my writing will make money or not, before focusing on how I loved to write. I knew I needed to reflect and reset my goals once more.
I had to review what I learned in Nursing School wherein you must be S.M.A.R.T. in your goal setting. It means that goals should be Specific, Measurable, Attainable, Relevant, and Timely. We were also taught to make long-term and short-term goals. Again I must admit that I struggle with making nursing care plans as well, and to be even more honest I still struggle with making realistic goals for my own life.
In my recent reset, I realized that in my previous goals, I was wanting to achieve so much in so little time since I was focused on my want for money. I just had to forgive myself for that twisted manic logic. Looking back, it was likely that I don’t set goals for myself when I’m depressed and that I start setting huge unrealistic goals when I’m manic. I knew that this time, I had to really look at my reality and what I have due to life’s circumstances. I am currently grateful to have a full-time job, but that also means that the time I can devote to my craft is very much limited. I am also faced with the reality of having to pay the bills and keeping a full-time job.
I reflected on the previous goals that I have set for myself, including the most recent ones. The most recent goals I set for myself was not attainable since timing was not right. I wanted to finish my novel in just year. Although I had two self-published non-fiction books, I had no prior experience of writing a novel. For my next goals, I had to really look at myself and be honest to filter out the manic logic from my actual dreams and aspirations.
I may not have any readers yet, but I want to put my dreams in writing and send it out to the universe. I do have a general life goal, which is to be the best artist I can be. I want my days to be filled with creating art, whatever form it may be. But to follow the S.M.A.R.T. format, my long-term goal for the next 5 years is to finish the novel I’ve been working on. For the medium-term goal, I want to continue to speak freely with my new pen name, Danko Weedburn and have a weekly blog post on Medium.com for a whole year. My other medium-term goal is to be able to complete a fully polished short story before the end of June of next year. For the short-term, I want to keep writing daily, for an hour a day, maybe 2 hours during the weekend if time persists. I just want to have days filled with writing projects, even if they are self-imposed. The readers will come when they come and to answer my brother’s question, I am living to write. | https://medium.com/@dankoweedburn/my-struggles-with-mania-and-goal-setting-b079f1672c2d | ['Danko Weedburn'] | 2020-11-24 07:16:44.134000+00:00 | ['Goal Setting', 'Manic', 'Mania', 'Bipolar', 'Stress'] |
Books I Read In 2020 and Recommendations For You | This is now the fifth year I’m writing this post, hopefully, it has not become boring and you find a couple of books from this list that are new and you get to read over the holidays or next year. You can also find the lists for the last three years here: 2019, 2018, 2017.
Many of you know that I Mostly Listen to Books on Audible while I commute. So this year, given I was mostly working from home, I commuted a lot less, and as a result, I ended up reading about 5 fewer books than I did in the previous years. Still, it was a blessing to read from different authors and about different topics.
Without further ado, here’s the list.
1) Influence: Mastering Life’s Most Powerful Skills — The Great Courses
Another book from the great “The Great Courses” series. This one is on influence, how we can use language for better influence, and also how we get manipulated and influenced by advertisers and salespeople every single day.
2) I Hear You: The Surprisingly Simple Skill Behind Extraordinary Relationships
“I Hear You” is a relatively short book (but also still long for it being a book) that highlights the importance of acknowledging and giving validation while listening to other people, or better yet, hearing them. Useful in all contexts, work, or personal relationships.
3) Dreyer’s English: An Utterly Correct Guide to Clarity and Style
This is a hilarious book! Made me laugh a hundred times. Written by Benjamin Dreyer, managing editor and copy chief at Penguin Random House (largest general-interest publisher in the world) on how to write a book/essay in English with clarity and style! I’d only recommend it for people thinking of writing books or long essays though, not for business communications!
4) Barbarians At the Gate: The Fall of RJR Nabisco
An old story, already turned into a movie, Barbarians at the Gate is the story of a private equity firm taking over a large tobacco company and the beginnings of one of the most dramatic forms of finance, leveraged-buyouts
5) A History of the United States in Five Crashes
Interesting of looking at history, by going through the economic/market crashes in the past century in the US. It was very dry and hard to listen to though.
6) Kochland: The Secret History of Koch Industries and Corporate Power In America
This was great storytelling, very long book though (30 hours of audiobook!) of one of the most secretive industrial conglomerates in the U.S.
7) The Most Important Thing: Uncommon Sense for the Thoughtful Investor
This is one of the more famous books on value investing. I didn’t find it that insightful, to be honest. Few good ideas, repeated over and over.
8) What It Takes: Stephen A. Schwarzman
Great storytelling, of the birth and growth of Blackstone, one of the largest private equity firms. It was all about his successes (could’ve used some humility) but regardless the stories of his interactions, especially with politicians, very interesting.
9) Man’s Search for Meaning
Famous 1946 book about the author’s experience as a prisoner in concentration camps, describing his psychotherapeutic method of staying alive by looking for the purpose of life. Meaningful book, but a very sad story.
10) The Many Lives of Michael Bloomberg
This is a journalist-written biography of the life of Bloomberg (a little too positively written). Very interesting to learn about the early days of finance and the creation of the Bloomberg terminal, but also his foray into the world of politics and his years as mayor.
11) The Upstarts
Another journalist-written (great storytelling) of the stories of companies in the sharing economy. Enjoyed reading about the shocking similarities and differences between Uber and Airbnb’s challenges and how the founders dealt with them.
12) Good Economics for Hard Times
This was on Bill Gates’ summer reading list. Compares the differences between the opinions of the average economists with random surveys done with people. Shocking how the viewpoints are different.
13) Chaos Monkeys
This is the story of a young man who moves from Wall Street to Silicon Valley, joins corporates, and starts a company. Interesting insider story of an entrepreneur’s journey.
14) A Promised Land
And finally the long-awaited book by President Obama. An honest memoir, from his early days, getting into politics, failures on campaign trails, and his fast rise to become a popular choice for president. He is breaking his memoir into two books, the second part to come later. I thought the book was far too long, had a lot of irrelevant details, and could have easily been one book for the whole thing. Of course, man’s gotta sell books!
My Favorite?
It’s hard to pick a favorite but my top 3 would be A Promised Land, What It Takes, and if I were to only choose one
The Many Lives of Michael Bloomberg
I was reading this book right around the primary elections to learn more about Bloomberg. The most inspiring part for me was to learn about the early days of the Bloomberg Terminal and the startup journey for one of the most widely used equipment in the world of finance. The rest on politics was mostly a congratulatory story on how he transformed the City of New York, so I took it with a grain of salt!
Happy holidays! | https://medium.com/@alitamaseb/books-i-read-in-2020-and-recommendations-for-you-d799dfa90973 | ['Ali Tamaseb'] | 2020-04-01 00:00:00 | ['Reading', 'Book Review', 'Book Recommendations', 'Books'] |
Our Nation’s Counter-Majoritarian Institutions Make it Harder to Fight Climate Change | Saving our planet will require making our country more democratic.
Is America’s failure to address climate change evidence that democracies are not up to the task, that voters won’t support the adjustments and sacrifices necessary for a transition away from fossil fuels? Plenty of ink has been spilled about this question, but at least in the U.S., it increasingly seems that that a key obstacle to climate action is not too much democracy, but too little. The problem may lie with our counter-majoritarian institutions, specifically the Electoral College, the Senate and the Supreme Court. And this problem has become glaringly evident in the closing weeks of the election cycle.
As recent polls show, increasing majorities in the U.S. recognize climate change as a serious threat and urge action. Concern does skew overwhelmingly along partisan lines, with Democrats much more likely than Republicans to recognize the problem. An NPR/PBS NewsHour/Marist poll in September found that climate change to be the top issue for Democratic likely voters, indicating the increasing salience of the issue. Joe Biden has aggressively pushed climate change as an issue, and, in sharp contrast to previous years, climate change received significant attention in the Presidential debates.
These developments, as well as the explosion of grassroots climate activism over the past few years, may portend a major political shift toward climate action. However, the intrinsic nature of the climate issue interacts with counter-majoritarian institutions in a way that significantly hinders progress. First of all, while Americans are now more cognizant of the threat posed by climate change, and while polling indicates that a majority of Americans even recognize that climate change is impacting them now, the most dire consequences are still decades away. Large swaths of the population are still largely unaffected by climate disasters — though this will likely change — and those most impacted tend to be from politically marginalized communities, like people of color and the poor, whose voices are often silenced in political discourse. Consequently, to many voters, climate change can still seem relatively remote and unfortunately, in many cases, like someone else’s problem, especially when compared to pressing issues like COVID-19, the economic downturn, racism, and the lack of affordable health care.
However, the costs of addressing climate change would not be remote, especially to those employed in or economically dependent on the fossil fuel sector. The climate crisis demands rapid, sweeping changes in our energy use. According to the Intergovernmental Panel on Climate Change, we have until 2030 to significantly cut emissions and begin radically decarbonizing the global economy to avoid massively catastrophic temperature increases. We must stop using fossil fuels. In a rare moment of candor from a presidential candidate about the challenges ahead of us, Joe Biden said, during the last Presidential debate, “I would transition from the oil industry.” And by this, he clearly meant fossil fuels in general.
The costs of climate action are therefore concentrated and immediate with the respect to the fossil fuel industry, yet the benefits of regulation, while enormous, are generalized throughout the public and spread across future generations. Over the past thirty-odd years, this asymmetry has given the fossil fuel industry an enormous incentive and opportunity to block climate regulation and spread disinformation about climate science. The industry leveraged its sheer economic clout to mobilize campaign contributions, conservative activists and think tanks, and, ultimately, the Republican Party as a whole, to sow doubt about the problem and actively sabotage any efforts to address it.
In a majoritarian political system, supporters of climate action could try to counter fossil fuel money with the electoral clout of sheer numbers. This is where counter-majoritarian institutions come in. Energy production is geographically specific and, consequently, the influence of the fossil fuel industry is especially centered in particular states — such as the top five energy producers: Texas, Pennsylvania, Wyoming, West Virginia, and Oklahoma — where the industry has enormous political clout. Institutions, such as the U.S. Senate and the Electoral College, which are structured around state-by-state, rather than national, voter majorities, thus indirectly magnify the influence of geographically specific industries. Meanwhile, both institutions, initially structured so as to enable a greater voice for smaller states, have now given disproportionate influence to more sparsely populated states and thus to conservative, rural Whites, many of whom are employed in resource extraction. This demographic is generally opposed to climate action and environmental regulation in general. Meanwhile, the Senate filibuster enables these states to more easily exercise veto power over climate legislation. And the disproportionate power of rural or conservative, and heavily White, states means that a numerical minority of voters is able to elect a Republican Senate majority.
These counter-majoritarian institutions have reliably helped to block or undo climate action. In 2010, the Waxman-Markey Bill, which would have been President Obama’s signature piece of climate legislation, passed the House of Representatives. However, climate legislation then died in the Senate, in part because of Senators, both Republican and Democrat, concerned about their states’ fossil fuel industries. More recently, President Trump, who won office via the counter-majoritarian Electoral College while losing the popular vote, has worked assiduously to undo the climate policies of President Obama, the first U.S. President to seriously tackle this issue.
The role of counter-majoritarian institutions has become quite glaring in the last weeks before the election. Because of the Electoral College, the outcome of the Presidential race turns on a few swing states. One of the most pivotal swing states is Pennsylvania. According to Five Thirty-Eight, Biden has only a 30 percent chance of winning the White House if he loses Pennsylvania. Pennsylvania is also a major producer of natural gas — through fracking — and coal. Biden has issued confusing and inconsistent comments on whether or not he wants to end fracking, including during an exchange at the last debate. Biden’s statements on fracking and his debate comment on oil have been seized on by Trump to try and win over voters in Pennsylvania. Republicans have characterized Biden’s call for an energy transition as a major gaffe, and the media has played along. In fact, Biden’s comment was a no-brainer for anyone with the most basic knowledge of the climate crisis. As Farhad Manjoo pointed out in the New York Times:
Why can’t we abide an honest discussion about climate change? One problem is the Electoral College. Our nutty electoral system gives more say to some voters than others. This year the nation has suffered a string of terrifying weather disasters hastened by climate change. Large parts of the West are on fire, and there have been so many tropical storms that we had to go deep into the Greek alphabet to name them. But in the race for president, the future of the fracking industry in Pennsylvania is elevated above all these other problems, because Pennsylvania is a swing state.
At this point, it remains very doubtful that Biden’s statements about fossil fuels will actually cost him Pennsylvania. But the entire dust-up underscores how, because of the Electoral College, the interests of one industry in one state can exercise virtual veto power over national discourse and majority views on climate change.
Finally, there is the U.S. Supreme Court. As Steven Levitsky and Daniel Ziblatt note in the New York Times, the Trump Administration has had three Justices nominated and confirmed by a President and Senators all elected by a minority of voters. With the confirmation of Amy Coney Barrett, conservatives now have a 6–3 supermajority on the Court. That could spell serious trouble for the executive branch’s ability to issue climate regulations or for states’ ability to sue the federal government for failing to enforce environmental laws. The Supreme Court is itself a counter-majoritarian institution, but its counter-majoritarian character is now markedly heightened by the fact that electoral minorities now ultimately select its members. And this conservative Court could block climate action for decades to come, meaning that six justices could help doom the future of our civilization and our habitable planet.
How do we overcome these counter-majoritarian barriers to climate action? How do we make climate policy more reflective of majority views? Republicans have been largely hostile to both climate regulation and a more democratic, majoritarian political process. If they retain control of either the White House or the Senate, there is effectively zero hope for reform. But if Democrats take control of both institutions, they must take several actions. First, they should add seats to the Court. Yes, this is controversial, but a nine-member Court is not constitutionally mandated and the stakes are too high to allow a conservative supermajority on the Court to scuttle climate regulations (and other policies vital to the survival of our republic). Second, in order to make the Senate more representative of the nation as a whole, they should extend statehood to the District of Columbia and, if its residents agree, Puerto Rico, along with perhaps other U.S. territories. Third, a Democratic Senate should end the filibuster. Fourth, Congress should propose an amendment abolishing or substantially reweighting the Electoral College. Another route to Electoral College reform, which would bypass the constitutional amendment process, would be the National Popular Vote Interstate Compact. This would require all signatory states, once they represent a majority of the nation’s electoral votes, to instruct their electors to vote for the national popular vote winner in the Presidential election.
These are all basic democratic reforms that have seemingly little to do with climate change. However, our ability to address the climate emergency and preserve a habitable planet may ultimately hinge on making our nation less counter-majoritarian and more democratic. | https://peterfcannavo.medium.com/counter-majoritarian-institutions-hamper-our-ability-to-fight-climate-change-a573d7510e1f | ['Peter F. Cannavo'] | 2020-10-31 16:33:39.223000+00:00 | ['Electoral College', 'Fossil Fuels', 'Biden', 'Climate Change', 'Election 2020'] |
Using Pulumi to register OAuth clients | We have started using Pulumi for our newer projects and wanted to share how we register new web apps as OAuth clients.
When any team member puts up a pull request of our web project, we build and deploy a ephemeral environment to test that pull request with. The links to each product are put in the pull request description automatically once it’s built.
We want to be able to use the login feature in these temporary environments, but to do that we need the callback URLs registered with our auth site and the the appropriate client id/secret as configuration.
Usage
Our auth site publishes a Pulumi NPM module which allows us to define the stack name and the public url for the site. Then the oauthId and oauthSecret is output
When we run pulumi up on our website, we get this:
Outputs:
oauthId: "ewbu7vukv30csfv218nwjj085ted0jyu"
oauthSecret: "asblqx9ypb8hf3f2c56bgxclpsg97r20qarsz269kw40qvfuxq211mq5e5bq3x4l"
These are then passed in as environment variables to the Fargate containers when they start.
How does it work?
Because Pulumi allows you to write your infrastructure as code it opens up a really cool feature, Dynamic Resources.
Dynamic resources allow you to implement create , update , delete and diff functions then Pulumi will manage this new resource like any other. The possibilities this feature opens up is endless.
The resource provider
The resource provider is the logic of the resource, how to create, update, delete and check if it’s changed. We are using DynamoDB to store our clients so the provider below inserts a row into dynamo on create, updates the row on update and the diff simply diffs the inputs. You can implement more functions on the resource provider but this is enough for this.
Dynamic resource
Once we have the provider we just need to create the Dynamic Resource.
There is not much to the dynamic resource, the important bit is the first argument of the super call which is out resource provider.
The OAuthClient resource
The next feature we will be using in Pulumi is Component Resources. These allow you to create a logical resource which is simply a grouping of multiple lower level resources into a higher level resource.
This allows us to create abstractions to our own infrastructure, and makes it really easy to refactor our infrastructure into reusable modules.
This component resource will generate an id and secret using the RandomString and RandomPassword dynamic resources provided by Pulumi, then create a new instance of our own dynamic resource which will insert a new row into our clients DynamoDB table.
Recap
Here we used 2 really powerful features in Pulumi, dynamic resources and component resources to allow any of our websites to register themselves against our auth site as OAuth clients of any environment. | https://medium.com/pixel-and-ink/using-pulumi-to-register-oauth-clients-786aa9583288 | ['Jake Ginnivan'] | 2020-06-27 00:32:34.911000+00:00 | ['Pulumi', 'Oauth'] |
I hate people who think there saying something funny | I hate people who think there saying something funny
I Hate fake two faced people i feel like i just want to put them all in a line and slap them all and then slap them all again. people just dont understand that everything isnt about them. when people want to be trashy and h*e all the time it makes me feel like there so low class its just like wow how do you let yourself be like that. when people think there cute and funny and everything i really just want to beat the crap out of them because there not and it bothers me so much. if your one of these people please take these simple none two faced tips here you go number one start being nice to people number 2 stop being a little snobby b*tch about everything and quit thinking about your self and number 3 just just stop thinking you run the world. Your not freaking Jesus your not God just stop. because your not getting anywhere stop being a loser go outside do some manly stuff play football ride a bike skateboard do something active. Get some girls go do something productive and stop being a snobby person your not everything ok. | https://medium.com/@KidMontana/i-hate-people-who-think-there-saying-something-funny-fcee1cb30e44 | ['Austin Ramos'] | 2015-10-13 19:13:59.034000+00:00 | ['Life Lessons', 'Cycling'] |
What nobody ever tells you, though, when you are a wide-eyed child, are all the little things that come along with “growing up.” | Life is a journey of twists and turns, peaks and valleys, mountains to climb and oceans to explore.
Good times and bad times. Happy times and sad times.
But always, life is a movement forward.
No matter where you are on the journey, in some way, you are continuing on — and that’s what makes it so magnificent. One day, you’re questioning what on earth will ever make you feel happy and fulfilled. And the next, you’re perfectly in flow, writing the most important book of your entire career.
https://www.deviantart.com/ncflive/commission/FREE-Ram-R-Salisbury-J-vs-Krawietz-K-Mies-A-Live-Stream-Free-1410812
https://www.deviantart.com/ncflive/commission/STREAMING-Krawietz-K-Mies-A-vs-Ram-R-Salisbury-J-Live-Stream-Fr-1410814
https://www.deviantart.com/ncflive/commission/LIVE-Krawietz-K-Mies-A-vs-Ram-R-Salisbury-J-Live-Stream-1410816
https://www.deviantart.com/ncflive/commission/Watch-Ram-R-Salisbury-J-vs-Krawietz-K-Mies-A-Live-Stream-free-1410817
https://www.deviantart.com/ncflive/commission/StreamS-watch-Krawietz-K-Mies-A-vs-Ram-R-Salisbury-J-Live-Stre-1410818
What nobody ever tells you, though, when you are a wide-eyed child, are all the little things that come along with “growing up.”
1. Most people are scared of using their imagination.
They’ve disconnected with their inner child.
They don’t feel they are “creative.”
They like things “just the way they are.”
2. Your dream doesn’t really matter to anyone else.
Some people might take interest. Some may support you in your quest. But at the end of the day, nobody cares, or will ever care about your dream as much as you.
3. Friends are relative to where you are in your life.
Most friends only stay for a period of time — usually in reference to your current interest. But when you move on, or your priorities change, so too do the majority of your friends.
4. Your potential increases with age.
As people get older, they tend to think that they can do less and less — when in reality, they should be able to do more and more, because they have had time to soak up more knowledge. Being great at something is a daily habit. You aren’t just “born” that way.
5. Spontaneity is the sister of creativity.
If all you do is follow the exact same routine every day, you will never leave yourself open to moments of sudden discovery. Do you remember how spontaneous you were as a child? Anything could happen, at any moment!
6. You forget the value of “touch” later on.
When was the last time you played in the rain?
When was the last time you sat on a sidewalk and looked closely at the cracks, the rocks, the dirt, the one weed growing between the concrete and the grass nearby.
Do that again.
You will feel so connected to the playfulness of life.
7. Most people don’t do what they love.
It’s true.
The “masses” are not the ones who live the lives they dreamed of living. And the reason is because they didn’t fight hard enough. They didn’t make it happen for themselves. And the older you get, and the more you look around, the easier it becomes to believe that you’ll end up the same.
Don’t fall for the trap.
8. Many stop reading after college.
Ask anyone you know the last good book they read, and I’ll bet most of them respond with, “Wow, I haven’t read a book in a long time.”
9. People talk more than they listen.
There is nothing more ridiculous to me than hearing two people talk “at” each other, neither one listening, but waiting for the other person to stop talking so they can start up again.
10. Creativity takes practice.
It’s funny how much we as a society praise and value creativity, and yet seem to do as much as we can to prohibit and control creative expression unless it is in some way profitable.
If you want to keep your creative muscle pumped and active, you have to practice it on your own.
11. “Success” is a relative term.
As kids, we’re taught to “reach for success.”
What does that really mean? Success to one person could mean the opposite for someone else.
Define your own Success.
12. You can’t change your parents.
A sad and difficult truth to face as you get older: You can’t change your parents.
They are who they are.
Whether they approve of what you do or not, at some point, no longer matters. Love them for bringing you into this world, and leave the rest at the door.
13. The only person you have to face in the morning is yourself.
When you’re younger, it feels like you have to please the entire world.
You don’t.
Do what makes you happy, and create the life you want to live for yourself. You’ll see someone you truly love staring back at you every morning if you can do that.
14. Nothing feels as good as something you do from the heart.
No amount of money or achievement or external validation will ever take the place of what you do out of pure love.
Follow your heart, and the rest will follow.
15. Your potential is directly correlated to how well you know yourself.
Those who know themselves and maximize their strengths are the ones who go where they want to go.
Those who don’t know themselves, and avoid the hard work of looking inward, live life by default. They lack the ability to create for themselves their own future.
16. Everyone who doubts you will always come back around.
That kid who used to bully you will come asking for a job.
The girl who didn’t want to date you will call you back once she sees where you’re headed. It always happens that way.
Just focus on you, stay true to what you believe in, and all the doubters will eventually come asking for help.
17. You are a reflection of the 5 people you spend the most time with.
Nobody creates themselves, by themselves.
We are all mirror images, sculpted through the reflections we see in other people. This isn’t a game you play by yourself. Work to be surrounded by those you wish to be like, and in time, you too will carry the very things you admire in them.
18. Beliefs are relative to what you pursue.
Wherever you are in life, and based on who is around you, and based on your current aspirations, those are the things that shape your beliefs.
Nobody explains, though, that “beliefs” then are not “fixed.” There is no “right and wrong.” It is all relative.
Find what works for you.
19. Anything can be a vice.
Be wary.
Again, there is no “right” and “wrong” as you get older. A coping mechanism to one could be a way to relax on a Sunday to another. Just remain aware of your habits and how you spend your time, and what habits start to increase in frequency — and then question where they are coming from in you and why you feel compelled to repeat them.
Never mistakes, always lessons.
As I said, know yourself.
20. Your purpose is to be YOU.
What is the meaning of life?
To be you, all of you, always, in everything you do — whatever that means to you. You are your own creator. You are your own evolving masterpiece.
Growing up is the realization that you are both the sculpture and the sculptor, the painter and the portrait. Paint yourself however you wish. | https://medium.com/@ramsalisburyvskrawietzlive/what-nobody-ever-tells-you-though-when-you-are-a-wide-eyed-child-are-all-the-little-things-that-600aa43def46 | ['Ramsalisbury J Vs Krawietz K Mies A Live Tv'] | 2020-11-19 17:42:18.591000+00:00 | ['Technology', 'Sports', 'Social Media', 'News', 'Live Streaming'] |
Google Illegally Surveilled and Fired Employees for Organizing, New Complaint Alleges | Google Illegally Surveilled and Fired Employees for Organizing, New Complaint Alleges
‘This complaint makes clear that workers have the right to speak to issues of ethical business and the composition of management’ jahid Dec 2, 2020·8 min read
Photo: Brooks Kraft LLC/Corbis via Getty Images
Google illegally surveilled and fired employees for participating in organizing efforts last year, the National Labor Relations Board (NLRB) said in a complaint filed on Wednesday.
The complaint alleges that the technology giant violated labor laws after spying on, interrogating, and terminating employees Laurence Berland and Kathryn Spiers, both former engineers at Google’s San Francisco office.
https://www.meetingsint.com/abstract_tracking/sadf/borussia-lazio-diretta-it-01.html
https://www.meetingsint.com/abstract_tracking/sadf/borussia-lazio-diretta-it-02.html
https://www.meetingsint.com/abstract_tracking/sadf/borussia-lazio-diretta-it-03.html
https://cci.mit.edu/jui/borussia-lazio-diretta-it-04.html
https://cci.mit.edu/jui/borussia-lazio-diretta-it-05.html
https://cci.mit.edu/jui/borussia-lazio-diretta-it-06.html
https://www.issf-sports.org/sdfa/borussia-lazio-diretta-it-07.html
https://www.issf-sports.org/sdfa/borussia-lazio-diretta-it-08.html
https://www.issf-sports.org/sdfa/borussia-lazio-diretta-it-09.html
http://result.alsafwa.edu.eg/ghj/borussia-lazio-diretta-it-10.html
http://result.alsafwa.edu.eg/ghj/borussia-lazio-diretta-it-11.html
http://result.alsafwa.edu.eg/ghj/borussia-lazio-diretta-it-12.html
https://www.meetingsint.com/abstract_tracking/sadf/juventus-dinamo-diretta-it-tv-01.html
https://www.meetingsint.com/abstract_tracking/sadf/juventus-dinamo-diretta-it-tv-02.html
https://www.meetingsint.com/abstract_tracking/sadf/juventus-dinamo-diretta-it-tv-03.html
https://cci.mit.edu/jui/juventus-dinamo-diretta-it-tv-04.html
https://cci.mit.edu/jui/juventus-dinamo-diretta-it-tv-05.html
https://cci.mit.edu/jui/juventus-dinamo-diretta-it-tv-06.html
https://www.issf-sports.org/sdfa/juventus-dinamo-diretta-it-tv-07.html
https://www.issf-sports.org/sdfa/juventus-dinamo-diretta-it-tv-08.html
https://www.issf-sports.org/sdfa/juventus-dinamo-diretta-it-tv-09.html
https://datapros.insightsanalytics.com/ghy/juventus-dinamo-diretta-it-tv-10.html
https://datapros.insightsanalytics.com/ghy/juventus-dinamo-diretta-it-tv-11.html
https://datapros.insightsanalytics.com/ghy/juventus-dinamo-diretta-it-tv-12.html
https://www.issf-sports.org/sdfa/bvb-lazio-tv-liv-de-01.html
https://www.issf-sports.org/sdfa/bvb-lazio-tv-liv-de-02.html
https://www.issf-sports.org/sdfa/bvb-lazio-tv-liv-de-03.html
https://www.issf-sports.org/sdfa/bvb-lazio-tv-liv-de-04.html
https://cci.mit.edu/jui/bvb-lazio-tv-liv-de-05.html
https://cci.mit.edu/jui/bvb-lazio-tv-liv-de-06.html
https://cci.mit.edu/jui/bvb-lazio-tv-liv-de-07.html
https://cci.mit.edu/jui/bvb-lazio-tv-liv-de-08.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tv-ua-01.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tv-ua-02.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tv-ua-03.html
https://cci.mit.edu/jui/juventus-dinamo-li-tv-ua-04.html
https://cci.mit.edu/jui/juventus-dinamo-li-tv-ua-05.html
https://cci.mit.edu/jui/juventus-dinamo-li-tv-ua-06.html
https://www.meetingsint.com/abstract_tracking/sadf/steelers-vs-ravens-liv-nfl-tvx-01.html
https://www.meetingsint.com/abstract_tracking/sadf/steelers-vs-ravens-liv-nfl-tvx-02.html
https://www.meetingsint.com/abstract_tracking/sadf/steelers-vs-ravens-liv-nfl-tvx-03.html
https://www.meetingsint.com/abstract_tracking/sadf/steelers-vs-ravens-liv-nfl-tvx-04.html
https://cci.mit.edu/jui/steelers-vs-ravens-liv-nfl-tvx-05.html
https://cci.mit.edu/jui/steelers-vs-ravens-liv-nfl-tvx-06.html
https://cci.mit.edu/jui/steelers-vs-ravens-liv-nfl-tvx-07.html
https://cci.mit.edu/jui/steelers-vs-ravens-liv-nfl-tvx-08.html
https://www.issf-sports.org/sdfa/steelers-vs-ravens-liv-nfl-tvx-09.html
https://www.issf-sports.org/sdfa/steelers-vs-ravens-liv-nfl-tvx-10.html
https://www.issf-sports.org/sdfa/steelers-vs-ravens-liv-nfl-tvx-11.html
https://www.issf-sports.org/sdfa/steelers-vs-ravens-liv-nfl-tvx-12.html
https://www.issf-sports.org/sdfa/Cl-v-Sev-m-s-Tv01.html
https://www.issf-sports.org/sdfa/Cl-v-Sev-m-s-Tv02.html
https://cci.mit.edu/jui/Cl-v-Sev-m-s-Tv03.html
https://cci.mit.edu/jui/Cl-v-Sev-m-s-Tv04.html
https://cds.nyu.edu/gty/Cl-v-Sev-m-s-Tv05.html
https://cds.nyu.edu/gty/Cl-v-Sev-m-s-Tv06.html
https://www.meetingsint.com/abstract_tracking/sadf/Cl-v-Sev-m-s-Tv07.html
https://www.meetingsint.com/abstract_tracking/sadf/Cl-v-Sev-m-s-Tv08.html
https://cci.mit.edu/jui/Man-v-Ps-g-v-rs01.html
https://cci.mit.edu/jui/Man-v-Ps-g-v-rs02.html
https://www.issf-sports.org/sdfa/Man-v-Ps-g-v-rs03.html
https://www.issf-sports.org/sdfa/Man-v-Ps-g-v-rs04.html
https://www.meetingsint.com/abstract_tracking/sadf/Man-v-Ps-g-v-rs05.html
https://www.meetingsint.com/abstract_tracking/sadf/Man-v-Ps-g-v-rs06.html
http://result.alsafwa.edu.eg/ghj/Man-v-Ps-g-v-rs07.html
http://result.alsafwa.edu.eg/ghj/Man-v-Ps-g-v-rs08.html
https://www.issf-sports.org/sdfa/Mid-v-San-F-L-tv01.html
https://www.issf-sports.org/sdfa/Mid-v-San-F-L-tv02.html
https://cci.mit.edu/jui/Mid-v-San-F-L-tv03.html
https://cci.mit.edu/jui/Mid-v-San-F-L-tv04.html
https://cds.nyu.edu/gty/Mid-v-San-F-L-tv05.html
https://cds.nyu.edu/gty/Mid-v-San-F-L-tv06.html
https://cci.mit.edu/jui/Rov-v-Mil-E-F-Lv01.html
https://cci.mit.edu/jui/Rov-v-Mil-E-F-Lv02.html
https://www.issf-sports.org/sdfa/Rov-v-Mil-E-F-Lv03.html
https://www.issf-sports.org/sdfa/Rov-v-Mil-E-F-Lv04.html
https://datapros.insightsanalytics.com/ghy/Rov-v-Mil-E-F-Lv05.html
https://datapros.insightsanalytics.com/ghy/Rov-v-Mil-E-F-Lv06.html
https://www.meetingsint.com/abstract_tracking/sadf/Nor-v-Lul--F-L-Tv01.html
https://www.meetingsint.com/abstract_tracking/sadf/Nor-v-Lul--F-L-Tv02.html
https://cci.mit.edu/jui/Nor-v-Lul--F-L-Tv03.html
https://cci.mit.edu/jui/Nor-v-Lul--F-L-Tv04.html
https://www.issf-sports.org/sdfa/Nor-v-Lul--F-L-Tv05.html
https://www.issf-sports.org/sdfa/Nor-v-Lul--F-L-Tv06.html
https://www.issf-sports.org/sdfa/Barcelona-v-Ferencvaros-En-Viv-Tv01.html
https://www.issf-sports.org/sdfa/Barcelona-v-Ferencvaros-En-Viv-Tv02.html
https://www.issf-sports.org/sdfa/Barcelona-v-Ferencvaros-En-Viv-Tv03.html
https://www.issf-sports.org/sdfa/Barcelona-v-Ferencvaros-En-Viv-Tv04.html
https://cds.nyu.edu/gty/Barcelona-v-Ferencvaros-En-Viv-Tv05.html
https://cds.nyu.edu/gty/Barcelona-v-Ferencvaros-En-Viv-Tv06.html
https://cci.mit.edu/jui/Barcelona-v-Ferencvaros-En-Viv-Tv07.html
https://cci.mit.edu/jui/Barcelona-v-Ferencvaros-En-Viv-Tv08.html
https://datapros.insightsanalytics.com/ghy/Barcelona-v-Ferencvaros-En-Viv-Tv09.html
https://datapros.insightsanalytics.com/ghy/Barcelona-v-Ferencvaros-En-Viv-Tv10.html
https://www.issf-sports.org/sdfa/US-Barcelona-v-Ferencvaros-Li-Tv-01.html
https://www.issf-sports.org/sdfa/US-Barcelona-v-Ferencvaros-Li-Tv-02.html
https://www.issf-sports.org/sdfa/US-Barcelona-v-Ferencvaros-Li-Tv-03.html
https://www.issf-sports.org/sdfa/US-Barcelona-v-Ferencvaros-Li-Tv-04.html
https://www.issf-sports.org/sdfa/US-Barcelona-v-Ferencvaros-Li-Tv-05.html
https://cds.nyu.edu/gty/US-Barcelona-v-Ferencvaros-Li-Tv-06.html
https://cds.nyu.edu/gty/US-Barcelona-v-Ferencvaros-Li-Tv-07.html
https://cci.mit.edu/jui/US-Barcelona-v-Ferencvaros-Li-Tv-08.html
https://cci.mit.edu/jui/US-Barcelona-v-Ferencvaros-Li-Tv-09.html
https://www.issf-sports.org/sdfa/Sevilla-v-Chelsea-En-Viv-Tv01.html
https://www.issf-sports.org/sdfa/Sevilla-v-Chelsea-En-Viv-Tv02.html
https://www.issf-sports.org/sdfa/Sevilla-v-Chelsea-En-Viv-Tv03.html
http://result.alsafwa.edu.eg/ghj/Sevilla-v-Chelsea-En-Viv-Tv04.html
http://result.alsafwa.edu.eg/ghj/Sevilla-v-Chelsea-En-Viv-Tv05.html
https://www.meetingsint.com/abstract_tracking/sadf/Sevilla-v-Chelsea-En-Viv-Tv06.html
https://www.meetingsint.com/abstract_tracking/sadf/Sevilla-v-Chelsea-En-Viv-Tv07.html
https://cci.mit.edu/jui/Sevilla-v-Chelsea-En-Viv-Tv08.html
https://cci.mit.edu/jui/Sevilla-v-Chelsea-En-Viv-Tv09.html
https://www.issf-sports.org/sdfa/Stoke-City-v-Wycombe-Li-Tv01.html
https://www.issf-sports.org/sdfa/Stoke-City-v-Wycombe-Li-Tv02.html
http://result.alsafwa.edu.eg/ghj/Stoke-City-v-Wycombe-Li-Tv03.html
http://result.alsafwa.edu.eg/ghj/Stoke-City-v-Wycombe-Li-Tv04.html
https://www.issf-sports.org/sdfa/Reading-v-Sheffield-Li-Tv01.html
https://www.issf-sports.org/sdfa/Reading-v-Sheffield-Li-Tv02.html
https://datapros.insightsanalytics.com/ghy/Reading-v-Sheffield-Li-Tv03.html
https://datapros.insightsanalytics.com/ghy/Reading-v-Sheffield-Li-Tv04.html
https://www.issf-sports.org/sdfa/Watford-v-Nottingham-Forest-Li-Tv01.html
https://www.issf-sports.org/sdfa/Watford-v-Nottingham-Forest-Li-Tv02.html
https://www.meetingsint.com/abstract_tracking/sadf/Watford-v-Nottingham-Forest-Li-Tv03.html
https://www.meetingsint.com/abstract_tracking/sadf/Watford-v-Nottingham-Forest-Li-Tv04.html
https://www.issf-sports.org/sdfa/f-v-b-tv01.html
https://www.issf-sports.org/sdfa/f-v-b-tv02.html
https://www.issf-sports.org/sdfa/f-v-b-tv03.html
https://www.issf-sports.org/sdfa/f-v-b-tv04.html
https://www.issf-sports.org/sdfa/f-v-b-tv05.html
https://www.issf-sports.org/sdfa/video-cb-v-z001.html
https://www.issf-sports.org/sdfa/video-cb-v-z002.html
https://www.issf-sports.org/sdfa/video-cb-v-z003.html
https://www.issf-sports.org/sdfa/video-cb-v-z004.html
https://kwafe-gent.be/gtr/video-cb-v-z005.html
https://kwafe-gent.be/gtr/video-cb-v-z006.html
https://kwafe-gent.be/gtr/video-cb-v-z007.html
https://kwafe-gent.be/gtr/video-cb-v-z008.html
https://kwafe-gent.be/gtr/video-cb-v-z009.html
https://cci.mit.edu/jui/video-cb-v-z010.html
https://cci.mit.edu/jui/video-cb-v-z011.html
https://cci.mit.edu/jui/video-cb-v-z012.html
http://result.alsafwa.edu.eg/ghj/video-cb-v-z013.html
http://result.alsafwa.edu.eg/ghj/video-cb-v-z014.html
https://www.meetingsint.com/abstract_tracking/sadf/video-cb-v-z015.html
https://www.meetingsint.com/abstract_tracking/sadf/video-cb-v-z016.html
https://datapros.insightsanalytics.com/ghy/video-cb-v-z017.html
https://datapros.insightsanalytics.com/ghy/video-cb-v-z018.html
https://www.issf-sports.org/sdfa/video-pg-v-mn001.html
https://www.issf-sports.org/sdfa/video-pg-v-mn002.html
https://www.issf-sports.org/sdfa/video-pg-v-mn003.html
https://www.issf-sports.org/sdfa/video-pg-v-mn004.html
https://cci.mit.edu/jui/video-pg-v-mn005.html
https://cci.mit.edu/jui/video-pg-v-mn006.html
https://cci.mit.edu/jui/video-pg-v-mn007.html
http://result.alsafwa.edu.eg/ghj/video-pg-v-mn008.html
http://result.alsafwa.edu.eg/ghj/video-pg-v-mn009.html
http://result.alsafwa.edu.eg/ghj/video-pg-v-mn010.html
https://cci.mit.edu/jui/video-pg-v-mn011.html
https://datapros.insightsanalytics.com/ghy/video-pg-v-mn012.html
https://datapros.insightsanalytics.com/ghy/video-pg-v-mn013.html
https://www.meetingsint.com/abstract_tracking/sadf/video-pg-v-mn014.html
https://www.meetingsint.com/abstract_tracking/sadf/video-pg-v-mn015.html
https://www.issf-sports.org/sdfa/Chelsea-v-Sevilla-En-Viv-Tv01.html
https://www.issf-sports.org/sdfa/Chelsea-v-Sevilla-En-Viv-Tv02.html
https://www.issf-sports.org/sdfa/Chelsea-v-Sevilla-En-Viv-Tv03.html
https://cds.nyu.edu/gty/Chelsea-v-Sevilla-En-Viv-Tv04.html
https://cds.nyu.edu/gty/Chelsea-v-Sevilla-En-Viv-Tv05.html
https://cci.mit.edu/jui/Chelsea-v-Sevilla-En-Viv-Tv06.html
https://www.issf-sports.org/sdfa/Ferencvaros-v-Barcelona-En-Viv-Tv01.html
https://www.issf-sports.org/sdfa/Ferencvaros-v-Barcelona-En-Viv-Tv02.html
https://www.issf-sports.org/sdfa/Ferencvaros-v-Barcelona-En-Viv-Tv03.html
https://cci.mit.edu/jui/Ferencvaros-v-Barcelona-En-Viv-Tv04.html
https://cci.mit.edu/jui/Ferencvaros-v-Barcelona-En-Viv-Tv05.html
https://cds.nyu.edu/gty/Ferencvaros-v-Barcelona-En-Viv-Tv06.html
https://www.issf-sports.org/sdfa/US-Ferencvaros-v-Barcelona-Li-Tv01.html
https://www.issf-sports.org/sdfa/US-Ferencvaros-v-Barcelona-Li-Tv02.html
https://www.issf-sports.org/sdfa/US-Ferencvaros-v-Barcelona-Li-Tv03.html
https://www.meetingsint.com/abstract_tracking/sadf/US-Ferencvaros-v-Barcelona-Li-Tv04.html
https://www.meetingsint.com/abstract_tracking/sadf/US-Ferencvaros-v-Barcelona-Li-Tv05.html
https://cci.mit.edu/jui/US-Ferencvaros-v-Barcelona-Li-Tv06.html
https://www.issf-sports.org/sdfa/ravens-v-steelers-Li-Tv01.html
https://www.issf-sports.org/sdfa/ravens-v-steelers-Li-Tv02.html
https://www.issf-sports.org/sdfa/ravens-v-steelers-Li-Tv03.html
https://cds.nyu.edu/gty/ravens-v-steelers-Li-Tv04.html
https://cci.mit.edu/jui/ravens-v-steelers-Li-Tv05.html
https://cci.mit.edu/jui/ravens-v-steelers-Li-Tv06.html
https://cds.nyu.edu/gty/Stel-v-Rav-Li-Tv01.html
https://cds.nyu.edu/gty/Stel-v-Rav-Li-Tv02.html
https://cci.mit.edu/jui/Stel-v-Rav-Li-Tv03.html
https://cci.mit.edu/jui/Stel-v-Rav-Li-Tv04.html
https://www.issf-sports.org/sdfa/Stel-v-Rav-Li-Tv05.html
https://www.issf-sports.org/sdfa/Stel-v-Rav-Li-Tv06.html
https://cci.mit.edu/jui/M-v-P-S-v-Tv01.html
https://cci.mit.edu/jui/M-v-P-S-v-Tv02.html
https://cci.mit.edu/jui/M-v-P-S-v-Tv03.html
https://www.issf-sports.org/sdfa/M-v-P-S-v-Tv04.html
https://www.issf-sports.org/sdfa/M-v-P-S-v-Tv05.html
https://www.issf-sports.org/sdfa/M-v-P-S-v-Tv06.html
https://www.issf-sports.org/sdfa/Sav-v-cl-m-Rv01.html
https://www.issf-sports.org/sdfa/Sav-v-cl-m-Rv02.html
https://www.issf-sports.org/sdfa/Sav-v-cl-m-Rv03.html
https://cci.mit.edu/jui/Sav-v-cl-m-Rv04.html
https://cci.mit.edu/jui/Sav-v-cl-m-Rv05.html
https://cci.mit.edu/jui/Sav-v-cl-m-Rv06.html
https://www.issf-sports.org/sdfa/video-boru-v-laz-tvc03-301.html
https://www.issf-sports.org/sdfa/video-boru-v-laz-tvc03-302.html
https://www.issf-sports.org/sdfa/video-boru-v-laz-tvc03-303.html
https://www.issf-sports.org/sdfa/video-boru-v-laz-tvc03-304.html
https://www.issf-sports.org/sdfa/video-boru-v-laz-tvc03-305.html
https://www.issf-sports.org/sdfa/video-boru-v-laz-tvc03-306.html
https://cci.mit.edu/jui/juve-v-kiev4-401.html
https://cci.mit.edu/jui/juve-v-kiev4-402.html
https://cci.mit.edu/jui/juve-v-kiev4-403.html
https://cci.mit.edu/jui/juve-v-kiev4-404.html
https://cci.mit.edu/jui/juve-v-kiev4-405.html
https://cci.mit.edu/jui/juve-v-kiev4-406.html
https://cci.mit.edu/jui/Borussia-v-Lazio04-41.html
https://cci.mit.edu/jui/Borussia-v-Lazio04-42.html
https://cci.mit.edu/jui/Borussia-v-Lazio04-43.html
https://www.issf-sports.org/sdfa/Borussia-v-Lazio04-44.html
https://www.issf-sports.org/sdfa/Borussia-v-Lazio04-45.html
https://www.issf-sports.org/sdfa/Borussia-v-Lazio04-46.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tvc-01.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tvc-02.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tvc-03.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tvc-04.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tvc-05.html
https://www.issf-sports.org/sdfa/juventus-dinamo-li-tvc-06.html
https://cci.mit.edu/jui/copy-h-v-m3-31.html
https://cci.mit.edu/jui/copy-h-v-m3-32.html
https://cci.mit.edu/jui/copy-h-v-m3-33.html
https://www.issf-sports.org/sdfa/copy-h-v-m3-34.html
https://www.issf-sports.org/sdfa/copy-h-v-m3-35.html
https://www.issf-sports.org/sdfa/copy-h-v-m3-36.html
Last November, Berland was suspended after publicly opposing Google’s stance on the use of its technology by government agencies. He was fired later that month after organizing employees against the company’s hiring of union-busting firm IRI Consultants, which Googlers learned of from their colleagues’ public calendar entries. Google claimed the accessing of calendar events was a violation of its policies.
“This complaint makes clear that workers have the right to speak to issues of ethical business and the composition of management,” Berland said in a statement. “Workers have the right to speak out about and organize, as the NLRB is affirming, but we also know that we should not, and cannot, cleave off ethical concerns about the role management wants to play in that society.”
Spiers was also fired last November, and had created a pop-up for Google employees visiting the website of IRI Consultants on the company’s internal network, reminding them of their “right to participate in protected concerted activities.” The message pointed Googlers to employees guidelines the company was required to post after a prior NLRB settlement in September. Google claimed this was a security violation. After her firing, Spiers told OneZero that she was questioned by a Google investigations team for three weeks without access to a lawyer. Spiers wrote in a Medium post that she struggled to repair her professional reputation as a result of Google’s accusations.
This week the NLRB issued a complaint on my behalf. They found that I was illegally terminated for trying to help my colleagues. Colleagues and strangers believe I abused my role because of lies told by Google management while they were retaliating against me,” Spiers said in a statement. “The NLRB can order Google to reinstate me, but it cannot reverse the harm done to my credibility.”
The NLRB determined that Google violated labor laws meant to protect employees while engaging in pro-union activities. Specifically, NLRB found that employees should not have been retaliated against for accessing internal calendars or creating messaging informing workers of their rights. It deemed Google’s policies around the viewing of calendar events were also unlawful.
Wednesday’s complaint follows an October NLRB ruling that charged Google contractor HCL for illegally moving jobs from Pittsburgh to Poland and refusing to bargain with Google contractors who unionized last December. | https://medium.com/@jahid444/google-illegally-surveilled-and-fired-employees-for-organizing-new-complaint-alleges-921de98b6e09 | [] | 2020-12-02 19:50:41.698000+00:00 | ['Surveillance', 'Google Analytics', 'Organization', 'Google', 'Community'] |
A Modern Business Intelligence Stack for Startups | When we invest at Series A startups are often at the point where Business Intelligence is still primarily run with a combination of Excel and engineers running SQL queries against operational databases.
One of the frequent questions we get is “how do we progress to a modern business intelligence stack?” — fortunately startups have converged to fairly well understood set of best practices and tools which means this is easier than ever.
The typical business intelligence stack breaks into three components:
ETL — Getting the data
— Getting the data Data Warehousing — Storing the data
— Storing the data Business Intelligence Tools — Analyzing the data
ETL — Getting the data
Vendor recommendations: Segment, Stitch, Fivetran, Custom build.
ETL (extract-transform-load) is essentially about moving the data from it’s operational home (third party tools, operational databases, etc.) to the data warehouse in a form suitable for analysis. This can range from simply replicating the data to applying complex transformations on the data to make it easier to analyse.
Historically this would generally involving replicating data from internal databases into a central repository, however with the explosion in usage of SaaS for critical functions often core data now lies in third-party systems like Hubspot, Intercom, Zendesk or Salesforce. Extracting data from these services generally means using their provided APIs to obtain the data before inserting it into the warehouse.
While custom building integrations and replication used to be the norm, there are now a number of vendors which now provide these integrations as SaaS offerings. Segment, Stitch and Fivetran are all commonly used in the startup world.
Unlike most of the other parts of the stack, ETL is often a mix and match with startups frequently using different vendors for different sources of data and combining them with internal ETL in cases where off-the-shelf solutions aren’t viable.
Generally it’s more efficient to use a third party solution over building your own but where that’s not possible there are open source tools such as Airflow and dbt that can help manage the process.
Data Warehousing — Storing the data
Vendor recommendations: Amazon Redshift, Snowflake
A data warehouse is essentially a high-powered database which is optimised for analysis as opposed to traditional databases (MySQL, Postgres, etc.) which are designed for day-to-day operational use.
Amazon Redshift is the dominant player in this space and if you’re already on the AWS stack it’s the natural choice. If you’ve got high-volumes of data it’s worth considering Snowflake due to it’s higher performing self-tuning system.
Business Intelligence Tools — Analyzing the data
Vendor recommendations: Mode and Looker are the standard two choices here.
Mode Analytics
Mode is closer to being a high-power SQL tool rather than a traditional BI tool. Analysts need to write SQL to extract the data they want and can then choose from a variety of visualization which they can then share via dashboards to other users within the company.
If your underlying business data is relatively straight-forward (i.e your SQL statements don’t get horrendously messy) and everyone producing reports will know SQL then Mode can be a good choice.
Looker
Looker is a more sophisticated product which is designed to allow most users to use it without needing to write SQL, having an interface akin to Excel’s pivot tool. It also comes with it’s own modelling language LookML which enables analysts to perform data transformations within the data warehouse (rather than at the ETL stage) and to abstract away complexities in the data model away from end users.
If you want business users to be able to use your BI tool directly or don’t want your analyst to have to be SQL experts then Looker is the obvious choice, but with the proviso that Looker’s additional capabilities come at price. That said Looker’s pricing is still significantly cheaper than the cost of one additional analyst.
Other popular solutions in this space include Periscope (similar to Mode) and Tableau (similar to Looker).
Put together all the pieces and you have yourself a modern BI stack! | https://medium.com/blossom-capital/a-modern-business-intelligence-stack-for-startups-6a4748865c08 | ['Imran Ghory'] | 2020-07-28 19:13:59.655000+00:00 | ['Analytics', 'Tech', 'Business Intelligence', 'Data Science', 'Startup'] |
Nexus Mutual Attack: 8 Million Lost | At 09:40 am UTC, Dec 14, 2020, CertiK Skynet found a large transaction from Hugh Karp, the founder of Nexus Mutual, which transferred a total of 370,000 NXM tokens to an unknown account. The total value of tokens is approximately 8.33 million US dollars.
The CertiK security investigation team quickly launched an investigation and analysis and believed that the transaction was a targeted attack towards the account of Mr. Hugh Karp.
The attacker’s account address is 0x09923e35f19687a524bbca7d42b92b6748534f25, and some of the tokens obtained by the attack have been traded at 1inch.exchange through the transaction 0xfe2910c24e7bab5c96015fb1090aa52b4c0f80c5b5c685e4da1b85c5f648558a.
Attack transaction hash: 0x4ddcc21c6de13b3cf472c8d4cdafd80593e0fc286c67ea144a76dbeddb7f3629
Figure 1: the attack transaction hash
Source: etherscan.io
According to the official disclosure, after obtaining remote control of Hugh Karp’s personal computer, the attacker modified the Metamask extension used on the computer and misled him to sign the transaction in Figure 1, which eventually transferred a huge amount of tokens to the attacker’s account.
Based on the current information disclosed, the CertiK team conjectured that when Hugh used Metamask as usual, the extension modified by the attacker generated the transfer request for the huge amount of token before Hugh signed the transaction with his hardware wallet.
The browser extension, as an application, is similar to the front-end of an ordinary web application. They are all written in HTML and JavaScript. Files of the browser extension are stored in the user’s computer. Regarding the methods hackers used to modify the Metamask extension, the CertiK team made the following conjectures:
The hacker gained control of Hugh Karp’s personal computer, opened the browser through the remote desktop and directly installed the modified Metamask extension. The hacker found the installation path of Metamask extension on Hugh Karp’s personal computer, modified the code, and loaded the modified extension into the browser after the modification. The hacker modified the browser extension with the built-in command line tool.
The official disclosure mentioned that Hugh Karp used a hardware wallet. Although the specific model was not revealed, it should be Trezor or Ledger, which are the only two supported by Metamask. In the case of using a hardware wallet, transactions in Metamask need to be confirmed and signed with the private key in the hardware wallet.
When Trezor or Ledger confirms the transaction, the recipient’s address will be displayed on the hardware screen for the user to confirm. In this attack, the hacker should not be able to modify the displayed address on the hardware screen. It is speculated that when Hugh Karp made the final confirmation on the hardware wallet, he did not notice that it was the address of the hacker.
Figure 2: Screen display when Ledger confirms the transaction
Source: https://www.youtube.com/watch?v=9_rHPBQdQCw
The importance of insurance is fully illustrated by this incident that the account of the founder of a blockchain insurance platform was attacked. No matter who you are and what role you play, hackers will not bypass you in the blockchain network because of your fluke. Security incidents are possible for everyone.
The CertiK security verification team suggests the following security measures based on this attack:
Any security system and operating environment requires not only program security verification, but also professional penetration testing to verify the security of the overall product.
In order to prevent the loss of digital assets from any non-technical reasons, the project team should purchase insurance for their products/solutions in a timely manner so that there will be multi-level protections for the project and investors, and the loss from any attack can be compensated in time.
Reference :
News source: https://www.coindesk.com/ceo-of-defi-insurer-nexus-mutual-hacked-for-8m-in-nxm-tokens
The official tweet: https://twitter.com/NexusMutual/status/1338441873560571906
Hugh Karp personal computer system: Windows (Not being disclosed by the official)
Hugh Karp personally response to the tweet: https://twitter.com/NexusMutual/status/1338455595763036160 | https://medium.com/@certik-io/nexus-mutual-attack-8-millions-lost-8d3592d14cfa | [] | 2020-12-15 14:42:44.084000+00:00 | ['Nexus', 'Security', 'Smart Contracts', 'Security Services', 'Attack'] |
4 Things Most People Take a Lifetime to Learn | 1. It’s Okay To Feel Sad After Making A Decision
Just because you feel sad after making a decision, doesn’t mean it was the wrong decision. This could be something you didn’t want to decide but know it in your heart that you had to do it.
It could be things like cutting off someone in your life whom you knew wasn’t right for you but still really like them or a conventional job that pays well, but doesn’t make you happy.
For me, it was staying in a friendship that severely undermined my self-worth at the expanse of their gains. It was fun being around the cool kid on the block. Yet, I tried so hard to match up to her level of social status in fear of being outcasted that I gave most of what truly defined me, away.
Looking back, I should have circled myself with friends who’re more accepting of who I was than lying to myself and be someone I’m not — it’s my life to live, anyway.
2. That Lesson Will Repeat Itself Until You Learn It
The easiest thing to do whenever we face adversities or trying to confront our insecurities is to put it away. Hide them in the closet and hope that we wouldn’t have to think about it ever again.
The truth is the problem never truly disappears from our life; it’s sitting somewhere waiting to be addressed. Until you do, you’ll wind up experiencing the same negative feelings when confronted with similar situations.
As a child, I was greatly loved and cared for by my family. I grew up with everything I’ve wanted and was under the spotlight even at school, receiving praises for my goodness. That gave me self-confidence, and I fell in love with recognition.
Over time, I started losing some of my closest companions like dominoes, not knowing why, as I attributed the fate of our friendship to them. Reflecting upon that incident; it was not a circumstance but my pursuit of self-interest that pushed people away. I became self-absorbed that I didn’t care to think about how people felt because of my conduct.
After confronting this insecurity of mine, I made a point to be more self-aware about my actions, striving to be selfless, and more people-oriented. Looking back, I’m much more compassionate than I was during my teens, and I keep a closely knitted circle of friends who have been with me since 2016.
3. Live in the Present
Yesterday is history. Tomorrow is a mystery. And today? Today is a gift. That’s why we call it the present. — Eleanor Roosevelt
A lot of us carry emotional baggage from the past. Being humans as we are, we like to be sentimental, but that actively holds us back from living in the present. The past is written history, and nothing you do would change anything about it.
On the flip side, worrying about the future — which we have no control over — creates unnecessary anxiety. We let our minds be caught up on an unknown future, sometimes thinking about the worst-case scenario that could happen. The thing we must realise is that the future may take us by surprise, so nothing is guaranteed to be set in stone.
If you have a crazy business idea, execute it. The worst that could come out of a failed startup is experience, but you’ll never regret pursuing a passion when you had a chance. If you have a desire to travel, do it because you’ll never get the same bouts of energy when you’re older. If you live miles away from your parents, call them and check in on how they’re coping because people don’t live forever.
4. Believe People When They Show You Who They Are, Not What They Say
Words can be comforting, but they don’t carry any substance if they aren’t accompanied by action. It’s the equivalent of saying you’re dieting while heaps of potato chips surround you.
We tell ourselves lies too. Sometimes, even lying to people so we could project a false sense of identity that we think they’d like. So, who do we trust? Actions.
I once had a friend who dated a guy who frequently gave praises about her beauty, intellect, and quirks. It was this constant dosage of “feel-good drugs” that my friend took him at his words, making her fall for him even more.
What she didn’t flag to herself as signs of warning was the fact that he’d bail out on their meetups at the last minute and at times, he was rude to her. My friend later told me he was a Casanova when she found out he was seeing another lady. There was a clear mismatch between what he had promised and what he actually delivered.
Start focussing on what others do instead of their words — apply this to yourself as well. After all, nobody likes a liar. | https://medium.com/the-innovation/4-things-most-people-take-a-lifetime-to-learn-a278cf09fb32 | ['Charlene Annabel'] | 2020-12-19 06:15:30.321000+00:00 | ['Life Lessons', 'Life'] |
Young Social Impact Heroes: Why and How Sabrina Paseman of ‘Fix The Mask’ Is Helping To Change Our World | Can you share the most interesting story that happened to you since you began leading your company or organization?
When I was just getting started, I had to do small batch prototyping of our design. The prototype was made of a flexible silicone, which was a manufacturing process I was completely new to. I had a really generous mentor named Mark Deadrick who guided me through the process of making one at a time, but when I needed to scale up production to ten at a time, he referred me to one of his friends. It turns out that one industry that does lots of silicone molding in small batches is the film industry. As such, I got to meet Hollywood’s best mold maker and special effects artist, Pedro Valdez. He designed the molds for the initial Ironman helmet, which is pretty special because ironman is my personal hero. He’s also now able to say that he makes masks for all types of heroes, both superheroes as well as our frontline workers.
Can you share a story about the funniest mistake you made when you were first starting? Can you tell us what lesson or take away you learned from that?
Our product is designed to create a seal between a surgical mask and the wearer’s face. The first prototype was made with just rubber bands, and when I tried it on my own face, I was thrilled to find out that it worked perfectly — by securing a rubber band over my nose and mouth, I’d achieved the elusive N95 fit!
I was so excited. I stopped by my sister’s apartment to test the rubber band prototype on her and her boyfriend. Both of them said that it was uncomfortable, and they weren’t able to get a perfect seal like I was.
As we looked at each other’s faces, we had a revelation: I happen to have the world’s smallest nose and the world’s fattest cheeks. Since the front of my face is basically flat, it’s easy to create a product that covers my nose and mouth and creates a seal. And, to my surprise, most people don’t have a face that is the same shape as mine.
To make a brace that fits many faces, we had to evolve beyond rubber bands to the patent pending nose cushions on the Essential Mask Brace today. Since then, every version of our product has gone through extensive user testing before we’ve made it publicly available. My sister still makes fun of how flat my face is though.
None of us can be successful without some help along the way. Did you have mentors or cheerleaders who helped you to succeed? Can you tell us a story about their influence?
As I said before, nobody knows anything before they start. I was blessed to have two amazing mentors from the get go, David McCalib and Bill Paseman.
I met David McCalib through a connection of a connection that happened to see my Linkedin post about my rubber band solution. We’d never met before, but even after reading about my underbaked idea online, he immediately saw the grander vision. We got on a video chat the next day, and we just clicked — it felt like we’d known each other for years. We brainstormed iterations via video chats and discussed business strategy by phone. David already had an established business so he was able to give me pointers at all the critical pointers. He’s been a huge cheerleader throughout the process and helps me in whatever way he can.
Bill Paseman is my father, and he’s been my advocate from Day 1. He founded a few companies in his time, so his advice when it comes to starting businesses has been invaluable. I’d always dreamed of starting a company and following in his footsteps, and It’s been really special to be able to share the highs and lows of Fix The Mask with him. My favorite story of his influence was when I was designing our latest iteration, the Essential Mask Brace. I’d been iterating on the design for a full week, 12 hours a day of nonstop failure after failure. I finally called him, defeated, saying that maybe this couldn’t work after all. In a 30 minute phone call, he picked me right back up onto my feet, dusted me off, and by the end we’d invented the concept for the nose cushions, which is the key feature to making our product work. Fix The Mask wouldn’t be here today without his support.
Can you tell us a story about a particular individual who was impacted or helped by your cause?
Workers at dentists offices, homeless shelters, and universities have all tried the Essential Mask Brace, but my favorite and our earliest supporter is Loren Bast of Bainbridge Prepares
Bainbridge is a small island next to Seattle; Bainbridge Prepares is a nonprofit organization that provides a variety of services to help protect their small community from disasters like earthquakes, fires, and recently, pandemics.
Loren’s team performs fit testing which helps healthcare professionals determine what PPE is the best fit for them. He started including the Essential Mask Brace as a free option in September. Since then, he has purchased over 350 braces to distribute to the community of Bainbridge Island.
Loren’s support means so much to us because not only is he sharing our solution, he’s proving to each new user that they can receive N95 level fit without an expensive respirator. The greater Seattle area remains one of our most popular shipping destinations, and we can’t help but think it’s at least partially due to the word of mouth generated by Loren and Bainbridge Prepares.
Are there three things the community/society/politicians can do to help you address the root of the problem you are trying to solve?
For our short term goal:
Recognize that a high quality mask is 50–100x more effective if it seals to your face than if it does not. Understand that we have the power of getting mask fit into the hands of everyone quickly Take action to recommend mask fit to be considered when picking a mask solution
What are your “5 things I wish someone told me when I first started” and why. Please share a story or example for each.
Make sure you are solving the right problem: Often the answer for solving a problem well is one level deeper than most people want to dig. As an example, at the beginning of the pandemic, people became aware of PPE shortages, and an overwhelming amount of people turned to quickly producing face shields as a solution. The problem with this strategy is that it doesn’t get to the heart of the issue. Face shields aren’t effective against protecting individuals from an aerosolized virus like SARS-CoV-2, so while they were easy and straightforward to make, they weren’t actually solving the most critical PPE deficiency. Fix The Mask took a different approach and first learned about how the virus was transmitted. From there we were able to identify that the focus should actually be around well filtering, well fit masks, not shields.
Think critically about prior work in your field: If you’re a new player in any field, it’s easy to take “the way things are done” as the law of the land. But the benefit of being new is that you’re bringing a fresh perspective to your industry. There’s no harm in challenging core assumptions when you’re just starting out. Often, that’s where the best ideas come from.
We were told at the start of the pandemic that N95s are the best mask because they’re made of a special material that is a better filter than any other mask material.
Rather than taking that at face value, we decided to learn more about this material and what made it so special. What we found out is that the filtration medium of an N95, meltblown fabric, is the same material that surgical masks are made of. So the thing that makes N95s special is not just the filtration material, it’s also how well they fit.
Your mission is key: Starting a business is hard. Unforeseen problems will arise. If you don’t have a strong mission, it will be hard to know what you’re fighting for. Developing a strong mission will get everyone in your team aligned through the good times and the bad.
Pick the right team: Your team is imperative for success. When picking a team, do not get falsely swayed by people with impressive sounding backgrounds. Instead, understand what problems within your organization need to be solved, and understand how an individual’s specific skill set can help solve those problems.
Prioritization: In both life in business and outside of business, it’s hard to know what to do first. This comes down to setting clear quarterly goals, and then breaking them down into monthly, then daily chunks. If you find yourself working on something that does not help achieve your quarterly goal, stop doing it and pivot to something that does.
If you could tell other young people one thing about why they should consider making a positive impact on our environment or society, like you, what would you tell them?
If you’re struggling with lack of fulfillment in your day to day, do something about it. You have the power to make the difference that you want to see in the world.
Is there a person in the world, or in the US with whom you would like to have a private breakfast or lunch with, and why? He or she might just see this, especially if we tag them. :-)
I never really had celebrity role models until I learned about Alexandria Ocasio-Cortez.
When I turned 22, I thought I knew what successful women my age looked like. They had nice jobs at big companies, and got promoted every other year. They earned their success by not making waves and treading carefully on a well defined path paved by successful women before them.
AOC completely redefined my view of what women in their 20s could be. She taught me that if you are smart and care for others, you can actually change the world for the better, even if you’re a woman under the age of 30.
I remember watching her Instagram stories when they selected which office each congressperson would get to use that term. Her special mix of pride, honor, and giddiness is exactly how I felt when I signed the papers that incorporated Fix the Mask. I’d love to have lunch with her to thank her for being such a relatable, strong role model.
How can our readers follow you online?
Follow us @FixTheMask on twitter or Instagram, and subscribe to our newsletter at fixthemask.com
This was very meaningful, thank you so much. We wish you only continued success on your great work! | https://medium.com/authority-magazine/young-social-impact-heroes-why-and-how-sabrina-paseman-of-fix-the-mask-is-helping-to-change-our-caf46bc5cf77 | ['Penny Bauder'] | 2020-12-23 12:55:49.232000+00:00 | ['Social Impact'] |
Unboxing of Mind | I believe my mind has become that box which has too many wires tangled inside, each day I untangle few but the next day a new nest is there which I need to dismantle.
It’s a love and hate kind of relationship with my mind and every time my mind wins, there is a poem waiting like a gift which I need to unbox. A good reason for me to search that paper and scribble it all before it gets tangled in the mesh.
Whatever I write here or at another place is that piece of the moon which keeps burning me.
Have you ever imagined standing at the edge of a cliff and thinking to jump or to walk away, we become those abandoned words stuck in some story. The choice is ours whether to ink it or leave it empty and when you are a writer you know to write is easier.
That doesn’t mean each silly thought which speaks to you has to be on the page, some are those stars, which need to stay hidden behind the dark clouds because the time is not right for them to speak to the page. Look for that moon which is illuminating the clouds above, look for it and pull it down so that it can brighten the page and you can let go that anxiety.
Maybe as a writer when you read this you may feel it’s not the same for me, words don’t burn me, the sky doesn’t come closer at night. The reason you are made of different stars but that can’t stop you from mapping your journey.
I wrote here and unboxed my mind, laid it bare for you on the page, you can love it or hate it, you can adore it or push it, this is me on the page.
A ticking bomb which never stops, a tale which is forever looking for new words. | https://medium.com/scribe/unboxing-of-mind-4c372f90a5e4 | ['Priyanka Srivastava'] | 2020-06-08 09:51:01.520000+00:00 | ['Prose', 'Writers On Writing', 'Writing', 'Nonfiction', 'Writers Life'] |
Why trade commodities? | Why trade commodities?
It is essential to add commodities to your trading portfolio as gold, silver, crude oil, natural gas and other basic goods tend to move in opposition to stocks, as well as offer you high amount of leverage and the opportunity to ride sustained bull or bear trends.
Precious Metals
Precious metals include gold, silver, copper, and more. During financial uncertainties like economic or financial crisis and pandemic crisis, which makes markets volatile, trader and investors turn to precious metals specifically gold because it’s sought out as a safe store of value. Metals are also preferred by investors as a portfolio diversifier and hedge against high inflation.
Energy
Energy commodities comprises of mainly crude oil (such as Brent Oil, WTI Oil, etc.) and natural gas. The prices of oil and other energy products fluctuate according to many factors including supply & demand and general confidence in the global economy. It is also majorly impacted by any shifts in production enforced by the Organization of the Petroleum Exporting Countries (OPEC). | https://medium.com/@smartfx/why-trade-commodities-e5a1384d41b3 | [] | 2021-04-25 09:56:41.536000+00:00 | ['Commodities Trading', 'Smartfx', 'Gold', 'Commodities', 'Commodity Tips'] |
What’s My Prompt? Day 17: Socks | Me and you were stuck together
Washed until the end
Knew you would be my forever
Thought I had a friend
But disappeared you did
After we tumbled and fluffed dry
Where oh where have you hid
Or maybe you escaped? Why
We have no purpose alone
That’s why we come in pairs
Looks like our bond you’ve outgrown
and come to our last wears
As I get tossed in the box
of clothes no longer worn
You shouldn’t be shocked
That I wish you were never born | https://medium.com/@jeffjohnson/whats-my-prompt-day-17-socks-8417b8ad656b | ['Jeff J.'] | 2020-12-17 21:54:10.711000+00:00 | ['Prompt', 'Socks', 'Creative Writing'] |
Feeling Like An Imposter Shouldn’t Be A Syndrome | Feeling Like An Imposter Shouldn’t Be A Syndrome leap.club Follow Apr 7 · 2 min read
Written By Neha Reddy Kuthuru
Imposter Syndrome is a term that gets discussed about a lot (unfortunately) in women’s circles. To break it down, imposter syndrome is defined as a collection of feelings of inadequacy that persist despite evident success. In a nutshell, you are successful at work but you feel like a fraud. But it is surprising why it has been called a ‘syndrome’ when the word syndrome suggests something medicalised. We should perhaps call it imposter feeling(s) instead.
People with imposter syndrome feelings are found to have a tough time internalising their accomplishments, however successful they are in their field. And women are more susceptible to these feelings because of unconscious biases around gender and leadership.
Feeling like an imposter is as real (and normal) as it gets and can hit women in any stage of their career. We think we aren’t qualified for a job, a promotion, a raise (and the list goes on..) but the thing is no one actually is and you’re definitely not alone. Most people are riding heavily on ‘fake it till you make it’ and that’s the big secret. You are, however, more qualified than anyone else to do the things that make you unique and that you can add value to.
At leap.club, we hosted a masterclass last month with Megha Chawla, Partner, Bain & Company, to talk all things about feeling like an imposter at the workplace. And here are some of our learnings from the session -
Acknowledging is the opening gambit. Track your thoughts to understand what they are and when do they emerge.
Rewire your thoughts. And make confidence boosting thoughts more natural.
Learning > Performing. A learning centric mindset will help deal with failure better by making it a part of the learning curve.
Focus on subtle (yet effective) ways of self promotion — share your experiences with a colleague/s who you trust, take active pauses to celebrate milestones.
Dear women, don’t let imposter feelings stop you from leading your best possible professional life. It’s time to fix the game, not the players.
Take charge of your professional growth now.
Join our waitlist at www.leap.club. | https://medium.com/from-leap-club/feeling-like-an-imposter-shouldnt-be-a-syndrome-b2607ffbefb4 | [] | 2021-04-12 09:40:09.728000+00:00 | ['Startup Lessons', 'Behavior', 'Startup Life', 'Workplace Culture', 'Imposter Syndrome'] |
NuviaGO is best protein bar product to maintaining Fitness | NuviaGo is a delicious protein bar with a cookie and cream flavor loved all over the world! Due to the large dose of protein and a small amount of sugar, this product can replace any meal. NuviaGo provides the body with an energy boost, helps build muscle mass and accelerates recovery after training.
NuviaGo bars are created with passion and in harmony with nature. This product contains the right proportions of macronutrients to strengthen the body and help maintain a fit-figure. NuviaGo bars are not only a delicious, sweet snack, but above all a real, wholesome meal.
If you want to buy it, click on the link given below.
https://nplink.net/uppl7wpt | https://medium.com/@trickotech8877/nuviago-is-best-protein-bar-product-to-maintaining-fitness-20c1472fccbc | ['Rishi Kannaujiya'] | 2020-12-23 07:30:56.749000+00:00 | ['Protein', 'Diet', 'Biskuit', 'Maintaining Good Health', 'Fitness'] |
5 Reasons Why Colombia is Perfect for Remote Work | There is an endless list of reasons why I love Colombia, but to save busy professionals a lot of time, I’ve narrowed down the 5 best reasons why Colombia is perfect for remote workers and digital nomads.
1. Culture of Collaboration & Comunidad
The culture of Colombia lies at the heart of the Colombian identity. It is vibrant and loud and proudly celebrated by its people. It encourages diversity and unity, which can be seen in the plethora of different musical genres native to Colombia. But instead of dividing the country, this variety actually unites people to collaborate and share their differences in a way that turns strangers into friends. Even in large cities, a sense of community is obvious in each of the public plazas which act as local meeting points for daily interactions. Just stop by one of these plazas and ask for some recommendations or directions, and you’ll see the outpouring of comunidad surrounding you. This community and its inherent collaboration are the perfect catalysts to promote collaboration and connection among coworkers.
2. Rapidly Growing Remote Work Community
Medellin is quickly becoming the remote work capital of Latin America, with a gigantic and rapidly growing community of expats and remote workers. It’s easy to find state-of-the-art coworking spaces all over the city, many of which have coliving options on site or nearby. There are also tons of events happening around the city to promote connection and collaboration, including a free language exchange every Tuesday that ends with a massive party attended by hundreds of locals and travelers each week. Needless to say, Colombians are excited about the new wave of tourism that coworking is bringing to Colombia. And in this land of creativity and collaboration, Colombians have already become networking experts, never missing an opportunity to make a new connection and support their newfound friends. So it’s no surprise that remote work has taken a strong hold in this place where the culture and people are already so perfectly suited to this lifestyle. So when coworkers arrive in Colombia, all they must do to connect with a collaborative and welcoming community is embrace the local ways and join in the fun.
3. Atmosphere of Transformation
It is no secret that Colombia has undergone an incredible transformation in the past two decades. Through unwavering hope and perseverance, the Colombian people have overcome the cartel control that brought them tragedy, and have restored their society to peace and prosperity. In less than 20 years, Colombia experienced a drastic turnaround, improving security, growing the economy, expanding education and focusing on innovation. Multiple cities even won prestigious international awards with Medellin named “Most Innovative City.” This shouldn’t be surprising, as Medellin was the capital of cartel activity, and therefore also the epicenter of this country’s massive makeover. The government built schools, public libraries and parks in poor neighborhoods and developed an inventive new transportation system that combined cable car lines and mountainside escalators to connect hilltop communities to the city center. But whether you’re in Medellin, or any city in Colombia, the spirit of transformation is most apparent in its people. The common phrase “Siempre Adelante” can be heard often, as the locals share their optimism and determination to look towards the future. In this stimulating atmosphere of growth and change, coworkers can feel inspired by the Colombians, and motivated to make their own personal or professional transformation.
4. Entrepreneurial Ambition
Sometimes it feels like everyone in Colombia is an innovative entrepreneur, from the many vendors pushing carts around the city, selling fresh juice, or empanadas, or delicious ceviches, to the local artisans, musicians, and even barbershops set up each day along the sidewalk of a busy plaza. But in fact, most Colombians really do aspire to become entrepreneurs, because their government has even encouraged it. The World Economic Forum considers Colombia a world leader in entrepreneurship because it possesses a combination of practices ideal for entrepreneurs that are rarely found all in one country. This is partially thanks to government support, which began in the 90’s when policy was shifted towards supporting small and medium-sized businesses. During this time, legislation was passed that created a regional and national network to promote entrepreneurial development and a national initiative to expand science, technology and innovation. These measures were extremely successful in promoting not only entrepreneurship, but high-impact entrepreneurs who are found to frequently innovate and create high numbers of jobs. In this environment, it is no surprise that coworkers and business owners from around the world are welcomed with open arms into a society at the forefront of entrepreneurial ingenuity and creativity.
5. The Happiest Country in the World
Colombia has been named the world’s happiest country twice in the last 6 years on Gallup’s annual poll, and consistently ranks at the top of the happiness charts. When questioned about their level of happiness, polls showed that Colombians not only felt the happiest in the world, but that they nearly doubled the global average. The list of reasons why Colombia has become such a happy place could go on forever, but I think two important factors are the previously-mentioned focus on community and spirit of transformation. Some other possible reasons are the incredible weather, the love of music and dance, the excitement of soccer games, the beautiful diversity of the land, a focus on health and beauty, and most importantly, the constant celebration of life. Colombians believe that life is meant to be enjoyed, which can easily be seen in the unbelievable number of national holidays, festivals and carnival celebrations regularly occurring across the country. And while everyone could use a little more happiness, coworkers are one specific group who seem to actually measure their personal happiness as they experiment with new lifestyles and destinations. This constant “pursuit of happiness” might be especially prevalent in American minds, but everyone in the world could benefit from the Colombian point of view, where rather than pursuing happiness, they simply enjoy having already found it.
Bonus #6 — Work to Wander Community Support!
As a special bonus, we can’t forget to mention the incredible support coworkers can now find in Colombia with the Work to Wander Community. We chose Medellin as our home-base and the location for our first coliving accommodation because of all the reasons mentioned above. When you combine all those reasons with the support provided by Work to Wander, it’s easy to see why Colombia would be a fantastic first stop on your remote work journey. With our community of Freedom Finders, you can now colive and cowork in Colombia with other like-minded professionals, and take advantage of all the support we offer for working travelers, including a flexible schedule of activities, excursions and events to help you connect with both the culture and local community. We’ll help you find the best events and prices, with a long list of discounts just for Freedom Finders. Combined with all the powerful vibes from the Colombian culture and people, Work to Wander offers an incredible experience of personal and professional growth for coworkers in Colombia. But it doesn’t end there! By helping remote workers connect, and guiding them into a new lifestyle, we promote exploration and connection that will surely serve travelers well no matter where in the world they travel to next!
Sound interesting? Check us out at worktowander.com | https://medium.com/@perrimichelle/5-reasons-why-colombia-is-perfect-for-remote-work-7d7f649e0ac8 | ['Perri Michelle'] | 2021-10-27 23:22:56.563000+00:00 | ['Remote Work', 'Travel', 'Coworking', 'Colombia', 'Digital Nomads'] |
Viewpoint: What Audi’s departure means for Formula E | Credit: Jannis Lucas
After supporting Formula E since the very beginning in 2014, Audi will leave the ABB FIA Formula E Championship at the end of the 2020/1 World Championship campaign.
The German giant supported Abt Schaeffler Audi Sport for the first three seasons of the series before taking over the team as a full works outfit for the 2017–18 ABB FIA Formula E Championship.
But it has now been announced that Audi will concentrate their efforts on entering the 2022 Dakar Rally with an ‘innovative prototype’ range-extender electric vehicle.
Audi Sport’s Managing Director Julius Seebach has also confirmed that the company is ‘intensively preparing to enter the new sports prototype category LMDh with its highlight races, the Daytona 24 Hours and the Le Mans 24 Hours.’
So with Audi leaving Formula E to commit to full factory efforts in Dakar as well as fully-fledged sportscar campaigns including 24 Hours races at Daytona and Le Mans, what does this mean for the all-electric single seater racing series?
Audi have always been strong supporters of FE as not only has the German giant backed the sport since its inception, but current Formula E and former WEC (World Endurance Championship)Audi driver Lucas Di Grassi was the test pilot for the championship in 2012 and 2013.
Di Grassi won the 2016–17 ABB FIA Formula E Championship and has racked up a total of ten wins and 32 podiums in 69 Formula E races which is unrivalled by any other driver in the series.
Di Grassi has been a figure-head for spearheading the message of sustainability off-track as well as the Brazilian is UN Environment Clean Air advocate and is CEO of the autonomous racing series Roborace.
He has been one of the few racing drivers who has seen the potential in motorsport to help drive sustainable development of which FE has been a pioneering sport to do just that.
The Brazilian has joined his team-mate Rene Rast in saying that he wants to stay in Formula E when the German outfit moves on at the end of the season.
But with Audi leaving FE to try and advance their ambitions for zero-emissions through Dakar and sportscars, does it raise the question about the continued relevance of the sport?
There is always a risk with a series being made up of a majority of manufacturers, but I think FE is relevant and will continue to be relevant with bigger and better batteries for the Gen3 cars with the potential for longer races and the possibility of more room for development with the powertrains.
So while Audi leaves FE with a view to pursue their zero-emissions ambitions in other series, FE is a low-cost way to help develop electric vehicles for manufacturers which are being transferred to the road today.
Why has Audi left I hear you cry?
This could be for two reasons: one because they want to develop zero-emissions technologies in different ways which will help to stress-test their technologies with Dakar and 24 hour races being a better way to do that. Also, with Porsche and Audi in the same technology group, strategically it makes little sense for both companies to compete against each other in the same series.
So while it may be sad that Audi has left FE, it does not look like this will be a trend of manufacturers leaving the series and it could offer a greater diversity of teams if someone else picks up their entry in the next couple of years… | https://medium.com/@nathanbasilhine/viewpoint-what-audis-departure-means-for-formula-e-9ed5f31079e8 | ['Nathan Hine'] | 2020-12-02 17:00:31.029000+00:00 | ['Dakar Rally', 'Electric Vehicles', 'Audi', 'Le Mans', 'Fórmula E'] |
Why You Should Play Chess | Problem Solving
Data science is all about solving problems. It’s why companies are willing to build teams of expensive tech professionals and build custom software or models. These problems can range from detecting fraud, to optimizing a process or an ad campaign, to combating bias in facial recognition models.
These problems are difficult because there is no clear, obvious path. In chess, there is the obvious problem of “win the game”, but also smaller problems to be solved in service of that larger goal. How do I develop my knight? Can I get away with pushing this pawn? Should I castle this turn or keep developing?
Chess requires that you weigh your available options, generate some pros and cons, and follow through on your plan.
Image by Author
If our plan is to control the center e5 square, should we trade some minor pieces with Ne5? Take the pawn on c5? Or pin the knight on c6 with our light-squared bishop? | https://towardsdatascience.com/why-you-should-play-chess-45098a735003 | ['Aren Carpenter'] | 2020-12-15 18:24:57.466000+00:00 | ['Chess', 'Creativity', 'Data Science', 'Problem Solving', 'Learning'] |
New: Live Stream videos from Cloud Storage. | Dropbox, Google Drive, OneDrive and pCloud with OneStream Live.
OneStream is happy to announce the updated cloud storage integration feature. OneStream now enables users to upload their videos with pCloud along with Dropbox, Google Drive and OneDrive. Apart from that, OneStream allows users to either upload their video files from their own computer and save them in OneStream storage or record and upload their videos directly.
With OneStream Live you can upload videos with three different ways.
Upload from device Upload from cloud storage Capture screen (record directly)
When you upload a video to create a live stream, the video is automatically saved. Your uploaded videos are stored for a maximum of 60 days unless they are used again. As soon as a stored video is used to create a schedule the 60 days counter is reset.
The video storage capacity you have depends on your subscription plan.
Free Plan: There is no storage capacity available for free user. Basic Plan: 5GB is available for Basic plan user. Standard Plan: 20GB is available for standard plan users. Professional Plan: 50GB is available for professional plan user.
You can check your video storage capacity by clicking Videos on the left-hand sidebar.
Previously the maximum video file size allowed was 1 GB. Obviously that posed lots of problems for users who have high-quality videos since full HD or 4k videos can be easily over 1 GB but still be around 30–40 min long.
Well not anymore!
Although there is no file size limit when uploading from Dropbox and Google Drive. OneStream Live increased its capacity to 5GB, which means you can upload your large video files from cloud storage or from your desktop directly.
Upload Large Videos Live Stream at your own Scheduled time
One of the core features of OneStream has been that it is a cloud-based streaming service. We wanted to give our users an ultimate live streaming experience with greater mobility. You can upload and live stream your videos from anywhere in the world without the need for any special software or hardware. With this in mind, integration with cloud storage was always going to be part of natural evolution.
How to upload videos from cloud storage.
OneStream Live made uploading the videos for live streaming simple and efficient. Upload your large video files from your device and Live Stream at your own scheduled time. Here are the simple steps to upload the video streams.
When you log in to your OneStream dashboard click new stream on the sidebar
Now under the video upload section, you will see Dropbox and Google Drive icons.
Click either one to connect your Dropbox, Google Drive, OneDrive or Pcloud account to OneStream. A new window will open which will display your stored videos. Just select the video you want to broadcast. OneStream will start to download your video to its secure servers and display the progress in the progress bar. Write a compelling title, a useful description, select a scheduled time and click Create Stream.
Bonus: Yes, your internet bandwidth will not be used and your internet connection speed does not matter anymore.
We hope that you will like this new addition to OneStream that makes it truly cloud-based and makes uploading bigger files so much easier. As always we would love to hear from you. Please let us know your feelings in the comments section. You can also write to us at care@onestream.live
Don’t forget to give us your 👏 ! | https://medium.com/@onestreamlive/live-stream-videos-from-cloud-storage-c057e491278d | ['Onestream Live'] | 2020-09-28 05:58:45.790000+00:00 | ['Recorded Music', 'Live', 'Livestreaming Video', 'Live Streaming', 'Livestream'] |
Clients Are Ready To Travel, Provided Hotels Meet Certain Criteria | 70% of hotels have already implemented or are planning to implement contactless technologies, while 70% of customers prefer hotels centered around self-service. Another important thing is that very few decide to travel without proper insurance.
As Oracle and Skift research has shown, after a long period of isolation people are ready to travel against all odds.
However, travelers now have strict demands to hotels when it comes to cleaning and technological features. As a result, 70% of hotels have implemented or are planning to implement contactless check-in and check-out, food delivery, room service, etc. 90% of hotels clean and disinfect more often, while 89% train their personnel the relevant skills for a safer way of providing services.
“As the hospitality industry turns a corner on the road to recovery, technology will be critical to protecting travelers and workers alike,” says Alex Alt, senior VP and general manager at Oracle Hospitality. He also noted that safety rightly remains consumers’ top priority when they consider traveling, and said “hospitality industry is doubling down on technology to facilitate social distancing and reduce face to face interaction for guests’ protection”. | https://medium.com/modihost/clients-are-ready-to-travel-provided-hotels-meet-certain-criteria-d113192069b8 | [] | 2020-10-27 11:50:05.018000+00:00 | ['Hospitality', 'Travel', 'Business', 'Hotel', 'Hms'] |
Shelly Plug US review: A European brand makes a splash in the States | Shelly Plug US review: A European brand makes a splash in the States Joe Nov 22, 2020·3 min read
Shelly is a sub-brand of a Bulgarian company, Alltarco, which recently began making its products available in the U.S. While it initially built its name on more contractor-level wiring components, the Shelly brand has expanded to include consumer-grade gear, including light bulbs, sensors, and this plug-in smart switch. It’s called the Shelly Plug US because it’s the U.S. version of its previous Shelly Plug S, which is designed for European sockets.
Design-wise, the plug offers only minor variations on a well-worn theme. The Wi-Fi device (2.4GHz only) supports a maximum load of 15 amps and wattage limit of 1,650 watts, but with just one three-prong socket located on the front of the device, you probably won’t be able to overload it easily.
This review is part of TechHive’s coverage of the best smart plugs, where you’ll find reviews of competing products, plus a buyer’s guide to the features you should consider when shopping for this type of product.The rounded edges of the plug give it a slightly unique look compared to the array of generic rectangles on the market, and it’s compact enough to allow for two of the plugs to be used in a standard, two-outlet receptacle. A manual on/off button can be found on the front of the switch, along with a small LED that indicates power and Wi-Fi status. (The LED can be disabled by the user.)
Shelly The rounded edges of the Shelly Plug US give it a more appealing look than generic smart plugs.
While Shelly is careful to note that it can be managed directly via its own Wi-Fi network and a web browser directed to its IP address, most users will probably prefer to interact via the Shelly Cloud mobile app. The app is decidedly busy, but it’s straightforward enough to walk you through setup without too much hassle, and it does the heavy lifting of changing the Shelly Plug’s temporary Wi-Fi network to yours without much fuss.
Christopher Null / IDG Energy monitoring is front and center any time you interact with the plug.
In regular use, however, I found the app to be fairly erratic. The app is slow to load, and is often slow to respond, sometimes taking up to 15 seconds for a command to register, other times responding immediately. If you’re simply trying to turn on a lamp with the app, watching the power icon spin interminably as it waits for the hardware to respond can be incredibly maddening. I ran into numerous similar issues when attempting to change various settings or configure timers, as the plug would randomly report it had lost its connection to the network. As well, it took five tries to get the firmware to update successfully.
That’s too bad, because Shelly has a ton of impressive features, including energy monitoring, automatic on/off timers, a capable scheduling system (including dynamic sunrise/sunset options), and even an option to automatically shut the system down if a specified amount of wattage is surpassed. The system logs all activity within the app, and it boasts wide compatibility with Alexa, Google Home, SmartThings, and Hubitat. IFTTT is technically supported, but some advanced coding is required.
Prices will vary according to the current exchange rate (Euros to U.S. dollars); but as of this writing, the Shelly Plug US was selling for just $11.71 on Shelly’s website. That makes it an exceptional value considering all its features—especially energy monitoring, which is rare to find at this price level. That said, some additional attention to the app interface—if not a wholesale overhaul—is certainly in order, but it’s the disconnections and delays that are most urgently in need of a remedy.
Note: When you purchase something after clicking links in our articles, we may earn a small commission. Read our affiliate link policy for more details. | https://medium.com/@joe07996065/shelly-plug-us-review-a-european-brand-makes-a-splash-in-the-states-d482ff375eb | [] | 2020-11-22 16:36:03.620000+00:00 | ['Mobile Accessories', 'Chargers', 'Deals', 'Streaming'] |
How To Test Everyone — Thru Poop. Three studies on detecting COVID-19 in… | How To Test Everyone — Thru Poop
Three studies on detecting COVID-19 in wastewater
You are what you excrete
How do you test everyone for COVID-19, all the time, and anonymously? Well, everybody poops.
Three recent studies have tested entire populations in Amsterdam, Paris, and Massachusetts for COVID-19. These cheap, simple wastewater tests have shown when the virus started spreading, when it started accelerating, and when regular testing was missing something.
Your poop is anonymized in the flush, so it cannot tell if you have COVID, it can tell public health officials when and where an outbreak is starting, so they can deploy scarce PCR testing strategically. In fact, wastewater testing could be used for future epidemics, for viruses and bacteria we haven’t even heard of yet. All you need is a fragment of the target RNA and 250ml of murky water. It’s a big data dump that we’re literally just sitting on.
Here’s how it works.
Wastewater Monitoring
Oh Danny Boy, the pipes, the pipes are calling
If a virus is in your body, it’s likely coming out of your butt. Even diluted, a simple test can find RNA fragments miles downstream in wastewater. This technique has been used for poliovirus, Aichi virus, and measuring antibiotic resistance. You can even guess how much cocaine a town is doing.
Wastewater monitoring works for COVID-19 as well.
Amsterdam
The basic method is to collect a bit of wastewater over a 24 period and just do a CTRL-F for some RNA fragments.
In February, Gertjan Medem et al (KWR Water Research Institute) did just this at eight locations in Amsterdam. They transported 250ml samples on ice and tested them the same day. This what they found:
Screening results from three weeks before, 1 week after and 2.5 weeks after the first reported case
To make this easier to read, just look at the three main columns. They mark three tests, one before the virus hit, and two after. In February (before) there were no hits on any of the RNA fragments (N1–E).
After the first reported case on February 27th, however, they got a hit. The Ctrl-F they were running for ‘GACCCCAAAATCAGCGAAAT’ (N1) came up positive. Later they got more hits, for different bits of code. The virus was in the wastewater, and it was easily and cheaply detectable, even at low amounts.
Since the wastewater was collected at specific plants, this method also told them roughly where the infections were. Not where the exact toilet was, but the general vicinity of the butt. This has a lot of potential. You can’t use it to test/trace/isolate, but it can tell health officers roughly where to start.
It’s a powerful collection system, spread across an entire population. Everyone was giving samples every day, all anonymized in the flush.
As the authors said:
This is the first report of detection of SARS-CoV-2 in sewage. The detection of the virus in sewage, even when the COVID-19 prevalence is low, indicates that sewage surveillance could be a sensitive tool to monitor the circulation of the virus in the population.(Presence of SARS-Coronavirus-2 in sewage)
The authors Gertjan, Leo, Goffe, Ronald, and Anke showed that this method could work, but the next question was velocity. Beyond a yes or no, could this method tell us how fast the virus was accelerating?
For that answer, we’ll go to Paris.
Paris
In March, Sebastien Wurtzer et al (Eau de Paris and the Sorbonne) started testing samples from three wastewater treatment plants around Paris. You can see the results in the graph below:
Red shows COVID-19 per liter. Grey shows deaths in France, blue shows deaths in Paris. Logarthmic scale.
The red line roughly tracks (and leads) the accelerating death count in Paris (blue). By doing one basic test on March 5th, they knew that COVID-19 was in the population, and by continuing to monitor they could see the velocity, later sadly confirmed with deaths.
Our study demonstrates that the contamination of wastewater and the detection of viral genome occurred before the beginning of the exponential growth of the epidemic. (Time course quantitative detection of SARS-CoV-2 in Parisian wastewaters)
In short, if you were watching the stools, you could see it coming. This is the big question we’re asking here. Not how do we test better, but how do we use tests to stop epidemics from happening at all.
The tests we have now are PCR, which is expensive and requires testing people one by one, or ‘rapid’ blood-testing, which only gives a hit weeks after you’ve been infected. We need something else. Something cheaper, faster, and better.
Wastewater sampling offers another approach. Instead of testing individuals, we test an entire population. Then we use that information to narrow down with the usual tools. This sort of general surveillance has a lot of potential. In fact, if we store samples we could reach the epidemiological holy grail as well — finding out where a virus started.
This would notably argue for the long-time conservation of wastewater samples in dedicated local wastewater-bank, which would allow a retrospective investigation of pathogens circulation. Additionally, wastewater survey may provide an alternative and possibly early tool to detect pathogens in populations when investigations in humans is difficult for logistic, ethical or economic reasons. (Time course quantitative detection of SARS-CoV-2 in Parisian wastewaters)
The authors Sebastien, Vincent, Jean-Marie, and Laurent were able to show not only that an epidemic was happening in Paris, but also that shit was about to hit the fan.
The next question is whether this method can tell us more than our current approach.
For that, we’ll go to Massachusetts.
Massachusetts
Like their compatriots in Europe, Wu et al (MIT) found viral RNA in wastewater. That much is known. However, the title of their paper was ‘higher than expected’. Tracking wastewater was telling them something conventional testing wasn’t.
Viral titers observed were significantly higher than expected based on clinically confirmed cases in Massachusetts as of March 25. The reason for the discrepancy is not yet clear, and until further experiments are complete, these data do not necessarily indicate that clinical estimates are incorrect. (SARS-CoV-2 titers in wastewater are higher than expected)
To reach this observation, the authors backtracked from the weight of an average poop (200g), how many people were dropping a daily deuce (2.3 million), and how much it was diluted (1.36 billion liters). Further research is required on how much viral load is coming out of the butt and how it dilutes, but it’s all very promising.
The implications of this research are that WBE can be leveraged to detect population-level prevalence of SARS-CoV-2 in cities across the world. These data may help inform decisions surrounding the advancement or scaleback of social distancing and quarantine efforts based on wastewater catchment-level estimations of prevalence. Additionally, wastewater collection at the municipal or community level may allow for more granular detection of SARS-CoV-2 in cities with lower COVID-19 disease burden, thereby functioning as an early warning system to help preemptively enact public health measures prior to the widespread onset of disease. (ibid)
Fuqing, Amy, Jianbo, Xiaoqiong, Wei Lin, Kathryn — deep breath — William, Mariana, Newsha, Noriko, Claire, Katya, Timothy, Peter, Janelle, and Eric reinforced the earlier conclusions, and also showed that this data might tell us more than we already know. At a population level, wastewater information might be good enough to release lockdowns or catch early epidemics before they start.
They rightly pointed out the need for much more research, and this should be done while people (especially in the US) are shitting out samples every day. We should be using those samples to calibrate this method and make it into a more precise tool. If we can do that, it’s a real asset to global public health.
The Power Of Poop
Sanitation is possibly the greatest advance in human civilization, at least in terms of life expectancy
The holy grail of pandemics is not having them at all. The holy grail is catching a virus very early and squashing it. We did that (painfully) with SARS and MERS, but the asymptomatic nature of COVID-19 has completely evaded our usual testing regime.
Individuals only show up for a test when they’re symptomatic, and even then we don’t have enough tests. This is usually days or weeks later, and some people never show symptoms at all. They’re still shedding virus the whole time.
We need a way of catching that virus they’re shedding, and the daily stool sample we all give is the simplest route.
The appeal of wastewater testing is that any scientist could take an RNA fragment, walk over to a wastewater plant, and CTRL-F it in a PCR machine. This would tell with a high sensitivity whether the virus was circulating at all (like in Amsterdam), how fast it was spreading (like in Paris), and whether we were missing something big (like in Massachusetts).
In fact, this level of surveillance could just be built-in. This level of checks can just become part of our sanitation system. Sanitation, after all, means health.
Samples could be constantly tested for known pathogens and stored if we need to backtrack. The minute an epidemic pops up in Hong Kong or Kansas or wherever, we can CTRL-F for that RNA and see if we get a hit.
We’re literally sitting on a giant data dump here — anonymized, geo-tagged, and used by the entire global population. Not everyone uses Google or Facebook, but everybody poops. There’s a lot more research to be done, but hey. Let’s have a look. | https://indica.medium.com/can-we-test-an-entire-population-thru-poop-db427250bc62 | ['Indi Samarajiva'] | 2020-05-03 17:46:38.391000+00:00 | ['Medicine', 'Health', 'Science', 'Sanitation', 'Coronavirus'] |
Generational Eating-Out Habits: What Does the Generation X’er Search For? | 11 Ways How to Treat the Generation X’ers as Restaurant Guests Right:
1. Generation X is not a digital native, but members of it are tech-savvy enough and feel really comfortable about online availabilities. They use computers for research, many of them are present on social media, and their mobile devices get filled up with apps easily. Such diners love to make reservations in order to assure the availability in the preferred restaurant at a chosen time. More and more often they will book a table online, because it’s easy, guaranteed and time-saving.
2. Generation X trust more in real reviews online, colleague or friend recommendations, than analyse the random comments.
3. Members of Generation X prefer full-service restaurants and seek for the menus that are friendly both for adults as well as kids. The more variant options are on the list, the more attractive the place becomes.
4. Like Baby Boomers, they go for quality food, excellent service, cleanliness and traditional ethos. However, don’t direct one-sided! This generation loves new interesting foodie experiences, sprinkled up with good music and cosy atmosphere, like Millenials.
5. Aesthetics is no less important. Generation X’ers will easily notice the space interior, stylistic appearance of table setting, and overall design.
6. Each Generation X’er has a list of favourite restaurants, but love exploring new places, tastes and exotic cuisines too.
7. They care about food quality. Organic products, grown up in local farms, fresh seasonal ingredients, home-made specialities, and ethical production are on their top list of preferences.
8. Generation X’ers care of healthy eating, so fresh vegetables, lower fat meats, fish or seafood delicacies will always get noticed. It doesn’t mean that when eating out they would order only the healthiest options on the menu, but will consider them willingly. Thus, there is always an option to please the diners by combining comforting meals with something healthy, whether garnishing, sauces or other wholesome alternatives. Appreciation will not go unnoticed!
9. New technologies of food preparation sound interesting and are greatly welcomed by Generation X-ers! However, don’t get surprised if at the end instead sous-vide or reverse sear they will choose the steak prepared on a good-old wood grill.
10. Give X diners a chance to personalise their order: not only to choose raw, medium or well-done steak but offer a great side dish selection, garnishing, sauces. The idea of sharing plates as well is greatly welcomed. Isn’t it nice when you can start your dinner by trying different tastes in order to expand your culinary horizon and finish with your good-old favourite?
11. Generation X’ers tend to check if the restaurant’s location is convenient enough: it should be easy to reach and create no hustle for parking. However, they can go for occasional adventure and drive long miles just to visit highly recommended restaurant too. | https://medium.com/@tablein.ltd/generational-eating-out-habits-what-does-the-generation-xer-search-for-3dcd23f5a362 | [] | 2020-01-24 09:19:59.188000+00:00 | ['Restaurant Marketing', 'Generation X', 'Restaurant', 'Restaurant Business'] |
HOPE beats VUCA! | H for Holistic preparedness
HOLISTIC PREPAREDNESS addresses the dynamics of change that drive VOLATILITY. It’s important to devote resources to prepare for and respond to volatile events. Holistic preparedness requires addressing the overall ecosystem. Enabling these resources can be expensive but the amount of investment should match the risk.
Early on in the year, we faced the unexpected challenge of the viral spread of COVID19 whose unknown duration quickly became clear. Although we quickly modelized virus propagation scenarios and researchers started developing vaccines using latest advancements like synthetic mRNA, we stumbled in the basics like the scarcity of personal protection equipment and ventilators in the pandemic’s initial stages even though we knew that a respiratory pandemic could hit us anytime after the early warnings of H1N1 in 2009.
COVID19 is not the last nor the largest challenge we know that we’re going to face this century. What other events should our world prepare for?
Top of mind for many is the dynamic of climate change. An example . . . as an amateur chef myself, food availability is a personal concern. Fortunately, I’m reassured to see a reference here about smart investments in agri-tech to reduce food dependency in certain Middle East countries, especially relating to fruit and vegetables. BUT, considering how so many ancient civilizations were extinguished, yes, extinguished due to food disruptions from climate events, are we prepared enough?
Are we conscious and engaged enough to change structural habits for the sake of the next generations? | https://medium.com/albert-vazquez-agusti/hope-beats-vuca-e45d333617ec | ['Albert Vazquez-Agusti'] | 2021-02-14 16:12:06.484000+00:00 | ['Investing', 'Supply Chain', 'Venture Capital', 'Entrepreneurship', 'Emerging Tech'] |
Want to Change Your Habits? Scrap The New Year’s Resolutions. Try This 4-Step Behavior Design Approach. | Every year millions of people commit to changing their lives, starting January 1st. And every year their efforts last for a month, two months tops, before flopping.
The reason? We overestimate how much we can do, and underestimate the power of our internal ‘psychological immune system’ — our built-in resistance to change.
Robert Keagan, professor at Harvard School of Education, gives this research example. When patients are faced with the unpleasant news from their doctors that they have to change their habits to avoid dying in the next year or two, such as quitting smoking or cutting out certain foods, only 17% of all people commit to changing their behavior. This is due to our natural tendency to resist change, even if it can save our lives. Imagine how little change happens when it’s not a life or death matter.
What’s even more common in my coaching practice is that people try to change too many things at once. By doing that, they have to rely on too much discipline and willpower, which leads to lower success rates.
How do you change then?
The key is understanding the power of behavior change, powered by science and design thinking:
Frame: More-Less-Enough-Random Ideate: 12 wants. Design: 12 tiny, specific, doable, supported routines. Implement: ‘30-day trials’ over 12 months.
Framing
Framing is how we define the challenge. Research says that by merely formulating and speaking out our goals and constraints in the right way, we are more likely to achieve them.
Here is a simple frame for behavior change from Coacherama, called More-Less-Enough-Random:
What are three things that you’d like to have more of? What are three things that you’d like to have less of? What are three things that you have enough of? What are three spontaneous, random things you’d like to add to your life?
By simply listing those things, you’d have a framework that can help implement new behaviors that actually stick, and that lasts for 12 months.
Ideating
Let’s go over the themes we just framed, and think of only three things that we’d like to change for each. For every person it’s different.
It’s important to prioritize ideas after ideating. If you have more than 3 ideas for each theme, take some time to list them all, and then prioritize only the top 3 in each category. The key to success is not to overburden yourself with new practices.
To get more creative here is one of my favorite ‘futurescaping’ exercises.
Imagine you are 125 years old, at your deathbed, surrounded by your loved ones. You’re looking back at life, and realize something shifted for you around the years 2020–2021. You changed some habits and instituted new behaviors back then. And that changed everything. What were the things you did? List them under each of the four themes.
Here’s a real example of a coaching client of mine. Let’s call him Dave.
After doing the ‘futurescaping’ exercise, Dave came up with the following list.
I want more of:
Focus : I want to have my focus of attention and mental sharpness.
: I want to have my focus of attention and mental sharpness. Healthy sleep: I want to feel restored in the morning.
I want to feel restored in the morning. Vitality: I want to feel alive and energetic in my body.
I want less of:
Mindless eating : I want to eat less and get more fit.
: I want to eat less and get more fit. Stuff & physical things: I want to declutter my space and my home.
I want to declutter my space and my home. Information: I want to be less on social media and my phone.
So far it’s simple, but let’s look at the things we already have enough of.
For example, Swedes take pride in their national philosophy of lagom: having not too much, not too little, but just enough. The practices here have to do with noticing, celebrating, and appreciating what you already have in abundance.
I have enough of:
Friends & Family: I’m blessed with my family and friends supporting me.
I’m blessed with my family and friends supporting me. Time : I have relatively enough time for myself and my family.
: I have relatively enough time for myself and my family. Love: I have an intimate relationship that makes me feel nourished and loved.
Finally, let’s look into spontaneity. Mediators practicing Nonviolent Communication consider spontaneity one of the basic human needs. It contributes greatly to the general feeling of freedom. For us, it’s all the activities that bring joy, flow, randomness, foolishness, and childishness into our everyday lives.
I want to have acts of spontaneity:
Dance : I want to express myself more through dance.
: I want to express myself more through dance. Travel : I want to explore new destinations more often.
: I want to explore new destinations more often. Wildcard: free time in my schedule to do random things.
Designing Tiny, Specific, Doable, and Supported Practices
We arrived at 12 ‘wants’ under four themes. Let’s get into designing behavior change practices for each. The key here is that practices need to be:
Tiny, so you don’t freak out or become a victim of sudden laziness. Specific, so you know exactly what you do. Doable from the get-go, so you won’t back up. Supported by ourselves, our community, and our environment.
Let’s go over those three things.
1. Tiny
Imagine you want to stay fit. So you decide to add a habit of running as a new daily routine. In your mind, you think running 5 miles a day is a good result. Instead of setting a final goal of five miles, start with a simple goal of running one block, and adding one more block every day. By the end of the month, you'd be able to run your five miles easily. And you’re internal immune system would adjust by then.
2. Specific
Define the time of the day and the amount of whatever you’d be doing. For example, if you’re adding a gratitude practice, make sure you specify that you give gratitude to 1) three people, events, or things in your life 2) every day 3) right before you start your dinner.
3. Doable from the start
A common theme is to choose something you think is doable, while it’s not that easy. E.g., if you are picking up yoga as a practice, you might need time to stretch and adjust your body to an extent that it can handle the poses you’re interested in.
4. Supported
If our environment and connections don’t offer support to the upcoming change, we’re likely to slip and fail. Designing the practices, we should think of three levels of support:
Self-support: I have the ability, drive, and commitment to create lasting change. But most importantly, there is an internal ‘yes’ when I think of the transformation.
Community support
: I have friends, family, and close connections who I can tell about my plans, and who can be my cheerleaders throughout the process.
Environment support: I see that the environment will support me, and if potential interruptions occur, I’d be able to overcome them.
List All 12 Practices
Now let’s look closer at each ‘want’, and design 12 practices that would be tiny and rewarding. I’ll use Dave’s list as an example.
More focus: Daily meditation first time in the morning, starting with 10 minutes, and expanding to 20 mins within a month. More sleep: Go to bed every day at 11 pm, aiming at 10 pm by the end of the month. Wake up at 7 am every day. Including weekends. More vitality: Start exercising yoga with a 7 Minute Yoga app. Exercises start at 15 minutes and upper-beginner level, aiming at 30 minutes and medium-intermediate level by the end of the month. Less eating: Practice a healthy diet and intermittent fasting built-in. Two meals a day: breakfast at 10 am and dinner at 6 pm. No more than one dinner out a week. Less stuff: Every day for one month, give away, sell, or collect for sending to a thrift store one item that hasn’t been used by me for more than 6 months. Less information: no phone two hours before bed — substituting it with X. Digital detox every Saturday. Celebrate friends & family: daily gratitude practice before going to bed: 3 people who I appreciate having in my life. Celebrate time for self: spend at least 30 minutes before bed every day listening to audiobooks. Celebrate love: buy flowers every Friday, spend time together out of the house on Saturdays. Spontaneous dance: go to a contact improv class every Thursday at 7 pm. Spontaneous travel: find a new travel destination every week, plan it and go there; the destination can be super-local (a new park in the city), within a 2-hour drive, or remote over the weekend. Spontaneous calendar: every week, free up my Sunday and don’t plan anything. Have it open for random invitations or spontaneous ideas.
Implement
The key to implementing these 12 practices is careful planning, some discipline, and a secret sauce: a method called ‘21-day Trial’.
21-day Trials
Researchers still argue how long it takes for an action to become a sticky daily ritual. The consensus that the minimum is somewhere between 21 and 30 days. To try things out, let’s stick with three weeks.
Here is how our 21-day trials will work. We’re going to give each practice our full undivided attention and go for it for three weeks. If after this time it doesn’t work for us for whatever reason, we can adjust the routine or even drop it.
The idea is that we don’t know if all 12 practices would work before we try them. We might want to change something or adjust as we implement. Every three weeks we’ll be adding a new routine, and go with it until it’s fully embraced by our body.
Sequence and Mixing
It’s helpful to make a plan for our 12 activities. I recommend this sequence: 1) less of, and then adding things you want 2) more of, and then add ‘enough’ and ‘spontaneous’ themes.
It’s possible to mix and add two or three practices at the same time. It can be tricky, however. If you have a tendency for procrastination, losing attention quickly, or general lack of focus, then going with one thing at a time will be a game-changer in implementation.
Make a plan
We can use Google Calendar for it. Or we can draw it and put it on a wall, like Dave did: | https://medium.com/@helloalexivanov/want-to-change-your-habits-30ec68f7fe76 | ['Alexey Ivanov'] | 2020-12-29 23:36:44.454000+00:00 | ['Design Thinking', 'Motivation', 'Behavior Change', 'Habits', 'Coaching'] |
Insane or Inspired? Book 2 (Part 4) | The Sweetest Gesture
It seemed more than just a little ironic that the term ‘victim mentality’ should even exist, in a world where the entire population had been so relentlessly and mercilessly abused, exploited and deceived, from cradle to grave, since the dawn of time. This complete failure to recognise our own victimhood stemmed from a level ignorance and denial that was hard to believe, and yet impossible to deny.
Supposedly, people may identify as a victim if they consistently felt that they were harmed; that they were not the cause of the harmful act; that they lacked the ability to prevent the harm; and that the harm constituted an injustice that violated their rights.
“Tick, tick, tick, tick,” said Tink. “All of the above.”
“I therefore diagnose you as having victim mentality disorder,” I told her. “But, hey, join the club, because so do I, based on these criteria.”
“Maybe we should do that, Lucy. Start a club, I mean, for those who feel the same way that we do, about the school system.”
“Or a support group,” I suggested.
“Yes. A victim support group for every child who is currently in the school system, and for every adult who has been through the school system.”
“That just about covers everyone.”
“Exactly,” she said, excitedly. “We’ll create the biggest victim support group that has ever existed, in the history of the world.”
I acknowledged her comment with a high-five. “We have three members already, and we haven’t even started yet.”
“Three?”
“You, me and Max. He jumped at the possibility, last night, of being able to avoid school, by moving to Haven.”
“Yeah, I heard. But he’s never had a problem with school before, to my knowledge. He actually seems to like it.”
“Then why would he have reacted that way?”
“It may have been less about school and more about Haven. I mean, that’s where you live now, right?”
“You’re saying that the only reason he expressed a desire to move to Haven is because I’m there?”
“Maybe. I wouldn’t be surprised. You know how fond he is of you. I even found a photo of you on his computer, recently.”
“Oh, god. What photo?”
“From last summer. Do you remember that day when we were trying to soften of our tan lines, in the back garden?”
“You said that everyone was out for the day.”
“I was wrong. Max evidently came back for some reason, and got his camera out. And I bet that’s not all he got out!”
“He must have thought it was his birthday. I don’t mind though, so long as he doesn’t share it.”
“He seems to really like you, Lucy. I had dissuade him from buying you a piece of jewellery, a while back. I told him that it was inappropriate.”
“No offence, Tink, but this is exactly what Jay was talking about, last week: How the natural inclinations of the male, to worship the Goddess, are stifled and suppressed from childhood.”
“I think his motivation had more to do with hormones than spirituality.”
“Only because he hasn’t been taught what his feelings actually mean, and what sexuality itself represents. His focus may be upon me, but it’s not about me, as such. He simply wants to love the Goddess, in whatever way he can.”
“It’s funny you should say that.”
“Why?”
“Because he spent his money on mum, instead.”
“Interesting.”
“He can be a good kid, sometimes. A bit young for you though, Lucy.”
“I don’t care about the age gap. I just don’t fancy him.”
“You don’t need to, do you? I mean, in order to accept his devotion?”
“In Haven, it would obviously be fine. But I think, in mainstream society, and particularly under these circumstances, living under the same roof, things could get a little messy.”
“No kidding.”
“I might be able to persuade him to worship you though, Tink.”
“That would just be weird.”
“Relative to what? At Haven, it would be considered weird if he didn’t worship his sister.”
“I think it would almost feel like, I don’t know, incest, or something.”
“That’s just in your head though. It wouldn’t be sexual, from his perspective.”
“Still, it would take some getting used to, I think.”
“Jay would say that your love for him is what should enable you to accept his love for you.”
“I don’t mind him loving me, but worshipping me?”
“I wouldn’t get too hung-up on that word. In India they worship cows. Some cultures worship their ancestors. Most people worship a fictional tyrant. Our message is simply: ‘Let’s get back to worshipping each other again, because that’s how we’re supposed to be living, in recognition of our true Source.”
“It sounds reasonable enough, when you put it like that.”
“It is reasonable.”
“You should present your case in class, one day.”
“I will. Speaking of which, I need to get going.”
“Give ’em hell,” she said.
Tink wasn’t ready to return to school, just yet, so I decided to walk with Max that morning. He still attended junior school, but it was part of the same sprawling complex. He seemed slightly embarrassed as I watched him being fussed over, by his mother. “Do you have your lunch money?” she asked him.
“Yes, mum.”
“And you’ve done all of your homework?”
“Yes, mum.”
“And you remembered to pack your PE kit, that I left out for you?”
“Oops.” Max ran back upstairs, leaving me to make small talk with Mrs Cooper.
“He’d forget his head if it wasn’t screwed on,” she remarked.
“I used to forget my PE kit all the time,” I told her. “Deliberately, that is. I mean, how is forcing a child to participate in something, against their will, not child abuse?”
Apparently I’m not very good at small talk.
“Well, I loved playing sports, when I was his age,” she said, pointedly, before proceeding to reminisce about her time with the school hockey team. Thankfully, Max returned fairly quickly.
“Bye, then,” he said, opening the front door.
“Not so fast, young man,” she said, presenting her cheek to him.
Max kissed his mother goodbye, somewhat reluctantly, before making a hasty exit. I followed on, smiling to myself. “Don’t worry, I know what mothers are like,” I assured him.
“She doesn’t seem to realise that I’m almost eleven now. And that’s just two years away from being a teenager.”
“It makes her happy, though, and you want to make your mother happy, don’t you?”
“I suppose.”
“I know you do. It’s nothing to be ashamed of. In fact, that’s your purpose in life, as a male, to make women happy. Did you know that?”
“I did read something about it, on your website.”
“And?”
Max stopped to remove his backpack. “I want to give this,” he said, pulling out a small, wooden box. “Tink said that I shouldn’t buy you any gifts, so I made one instead. Look, I carved your name into the lid.”
“Max, it’s beautiful,” I told him. “Thank you so much.”
“The stones are real turquoise. I did have to buy those, but they weren’t very expensive. Anyway, here’s the key. But don’t open the box until later, okay?”
“You’re so talented. I can’t believe that you made this yourself. It must have taken you ages.”
“A few weeks. But I wanted it to be perfect, because you are perfect.”
“Max,” I sighed. “I’m not perfect.”
“Well, I think you are.”
“Have you thought about making a similar box for your sister? I’m sure she’d really appreciate the gesture, especially now.”
“Are you asking me to?”
“I suppose I am.”
“Then I’ll do it.”
As we continued walking, I tried to explain to Max that our friendship wasn’t about to become anything more.
“I know,” he said, philosophically. “It doesn’t have to be reci... resop… repricic…”
“Reciprocal.”
“Yes, that,” he confirmed.
“You’d fit in really well at Haven. I know quite a few girls, around your age, who would be thrilled to have you worship them.”
“Is that what I’m doing, then?”
“Yes, it is. I mean, whilst you may think that you have made this box for me, it’s really an offering to the Goddess. I am just a conduit. Your feelings towards me, Max, are absolutely spiritual in nature. Even if…”
“Even if, what?”
“Even if they are… passionate feelings. Do you know what I mean?”
“Yeah.”
“You are living in a society that basically has everything back to front, Max. And you need to be aware of that. Which reminds me: Tink and I have created a victim support group, for those who’ve been forced through the school system. Do you want to join it?”
“Okay. What do I have to do?”
“Just mention it to your friends, for now, especially those who hate school.”
Max assured me that he would, before heading off towards the junior school gates. “See you later, Lucy,” he said, cheerily.
As soon as he was out of sight, I proceeded to open the box that he’d given me. Inside was a scrunched up section of candy wrapper, containing a single chocolate. It was a Rolo. Obviously, his last Rolo. As gestures go, it was just about the sweetest one that I could have asked for.
To Be Continued | https://medium.com/@jcshakti/insane-or-inspired-book-2-part-4-7841e08791d7 | ['Jay Campbell'] | 2020-12-19 16:29:17.473000+00:00 | ['Fiction', 'Literature', 'Prose', 'Writing', 'Books'] |
VyprVPN Vs PureVPN? | With the ongoing battle between Virtual Private Servers (VPS) and Virtual Private Networks (VPLS), which is more reliable and secure? This is a question that is asked frequently, and because of the large differences in both service delivery and functionality, it is sometimes difficult to draw the correct conclusion. However, despite these differences, there are certain facts that remain a fact: both VyprVPN and PureVPN offer excellent levels of security and privacy protection for the user. But how does VyprVPN stack up against its peer VPN competitor?
Both VyprVPN and PureVPN utilize the same form of tunneling technology, and both are capable of passing through each other’s protective layers. The similarities end there, however. While both provide excellent levels of security by masking your IP address during server forwarding, each provider uses its own method for packing their tunnels and handling DNS responses. As a result, there are many differences that can be found between both these products.
For one, VyprVPN utilizes Open VPN, which is a software program that allows you to establish an “unlimited” network of servers. As you might expect, with this software you are able to run numerous Virtual Private Systems (VPS). One of the advantages of using this software is that it allows you to manage multiple workstations with the help of one application. PureVPN on the other hand uses a form of layer 2 tunneling, which significantly slows down your network speed.
VyprVPN Versus NordVPN
This article will show you why VyprVPN versus NordVPN are a good choice for your VPN needs. Both products offer excellent security to ensure you have the most secure connection possible. However, there are some clear differences between these two. And while choosing between them may be difficult, it is worth your time to find out which one will be best for your needs.
Both VPNs work by directing traffic through a private network of servers. One is a public internet network and the other is a private one. The public internet network has many users, while the private one can only accommodate a handful. In most cases, the private network is preferable because it is easier to hide your activity. However, both types have one advantage over the other and that is they are both used for VPN services.
A private network gives you complete anonymity because the traffic passes through this hidden portion. This means that if anyone can access the internet from either side of the network they will not see any information passing through. This is much more secure than a public internet network. However, when you use a public network your IP address is visible to everyone.
There are many benefits to using a VPN service as opposed to a normal connection. One of the main ones is the security. Using a private network ensures your traffic goes through a layer of security that is impossible to crack. With both VyprVPN and NordVPN this security is achieved through the use of encryption software. Software such as PPTP and L2TP are used so that your connection is kept as secure as possible even when surfing the internet.
You may be wondering how these security measures work. Basically, the layers of security are installed so that the information traveling through your computer is as secure as possible. The encrypted software then acts as a lock and key for all the information that passes through. It also encrypts all of the information before it is sent through the computer. This keeps all the bad guys from reading any information that may be desirable. In order to break into this system, you would need a hacking device, a hacker with some expertise, and some luck.
These are both great choices for what you need. You need to consider what your requirements are as well. NordVPN is probably going to be easier for you to use because you are already familiar with it. If you have sensitive business data then the VyprVPN is definitely a worthy investment. You will be able to find the software that is right for your needs and will not run into any problems whatsoever.
…Disclaimer (This article contains affiliate links. If you buy a product via a link, it does not increase your costs. On the other hand, it gives you counts and earns me a small commission which allows me to make detailed Reviews like this.) | https://medium.com/@how-do-u/vyprvpn-vs-purevpn-dbe53d1e1b99 | ['How Do U'] | 2020-12-27 18:57:02.239000+00:00 | ['VPN', 'Hacking', 'Encryption', 'Fast Speed', 'Streaming'] |
Twerking in the #MeToo era | It seems women’s rights just reached new heights.
Yesterday, social media took notice as a contentious exchange occurred between columnist for The Daily Caller Stephanie Hamill and hip-hop artist Cardi B on Twitter. This back and forth began as the result of an initial tweet by Hamill addressing a music video Cardi B was featured in for the song “Twerk.” In it the hip-hop artist is shown among various other women barely dressed, twerking, and engaged in other stripper-like dance moves.
See below to view the music video in its entirety:
In response to this, Hamill’s tweeted, “In the Era of #meToo how exactly does this empower women? Leftists, @iamcardib, feel free to chime in. THX..” The supposed concern here was that a music video showcasing women scantily clad, dancing in a sexual manner undermines women’s empowerment. While this is a valid concern, fully addressing it requires one to first understand what women’s empowerment is.
Life
It has been argued that there is no universal definition for women’s empowerment. Stromquist (2015), stated that the term empowerment has received both theoretical and practical attention from many scholars and activists, with some describing it as an end point and others as a process. Given these various ideologies, it may be best to look at women’s empowerment through the lens of the #MeToo movement, especially since Hamill mentioned it in her tweet.
According to PettyJohn et al. (2018), the #MeToo movement, created by activist Tarana Burke and repopularized by actress Alyssa Milano, was meant to demonstrate how common women and girls experience sexual abuse. The movement gained momentum almost immediately after Milano’s 2017 tweet introduced it to the public, and later allowed men to share their experiences with sexual abuse as well. At its core, #MeToo was meant to empower victims, largely women, to speak up about their troubles. This evolved into women holding their abusers and sexual harassers accountable, which included high-profile individuals such as American film mogul Harvey Weinstein and former co-host of NBC’s Today Matt Lauer.
Given the #MeToo movement’s history, one can infer that Hamill felt the music video for “Twerk” could result in more women and girls being sexually abused — or she could have been trolling. If the former conclusion were true, those featured in the music video would be considered enablers of perverse and predatory behaviors.
In response to Hamill, Cardi B tweeted the following:
“It says to women that I can wear and not wear what ever I want. do w.e I want and that NO still means NO. So Stephanie chime in..If I twerk and be half naked does that mean I deserve to get raped and molested ? I want to know what a conservative woman like you thinks 🤔.”
Cardi B’s retort explained that a woman’s behavior or style of dress does not give one the liberty to sexually assault or harass her.
Liberty
The exchange between Hamill and Cardi B concerning sexually suggestive imagery in a music video is essentially an example of the victim blaming narrative. According to Moor (2010), it is common in American culture for victims of sexual violence to be blamed for their own oppression. Moreover, Stubbs-Richardson, Rader, and Cosby (2018) stated that victim blaming allows individuals to distance themselves from crime victims, while pardoning perpetrators of higher social status from punishment. A frequent practice has been to blame a perpetrator’s sexual aggression on “the victim’s so called ‘provocative’, revealing wear” (Moor, 2010, p. 115).
Despite the valid arguments made in Cardi B’s tweet, however, there is a larger conversation that could be had about how the “Twerk” music video potentially adds to the sexual objectification of women. This point was made by Hamill in the following response:
“I agree, No means NO, NO MATTER what! But this video, & others like this sexually objectify women. I think this hurts all women & the cause. We’re not sex OBJECTS! Clearly we see things differently, (maybe I’m just a hater bc I can’t Twerk 🤣) Come on my show, debate me!”
Studies have shown that support for sexually objectifying women is associated with perceived justification of sexual violence and perceived victim blaming (Custers & McNallie, 2017). Could this have been the message Hamill was trying to get across — or was she trolling? All things considered, it is difficult to believe that one who is dressed and acts in a sexually provocative manner will be viewed in a manner other than sexual. Still, this does not excuse violent or predatory behaviors directed toward these individuals.
The Pursuit of Happiness
Teng et al. (2015) explained the relationship between sexually provocative behaviors and abuse, stating that sexually objectified women are deemed as an inert tool which men can use and exploit. Essentially, many men have been conditioned to use women for their own desires. However, these behaviors also affect both women and girls who present themselves in a more socially acceptable manner. User @SmOoChEs_Mwah asserted in a tweet, “I was viewed as a sex object as a child FULLY CLOTHED by a grown man. No means no.” Thus, women are at risk regardless of how they carry themselves.
Given the realities of sexual abuse and harassment endured by numerous women in the US, an effort must be made to decrease these occurrences. One potential solution might include educating young boys — and girls — about the difference between attraction and action. One’s lust for another does not give them the right to abuse, assault, or harass. Moreover, teaching individuals how to cope with rejected advances is also necessary. It should be noted that women who are victims of sexual abuse may have turned down their perpetrator’s attempts at pursuing them.
Lastly, one could argue that the “Twerk” music video is a form of sexual expression by the women involved, which can also be considered empowering. Bowman (2014) purported that when women successfully transcend self-surveillance, largely due to social norms in a male-dominated society, and start engaging in their own sexual desire and pleasure, they are “resisting the oppressive norms that would dictate their behavior” (p. 364). Therefore, critique of a woman’s decision to dance in a sexually suggestive manner can be viewed as oppressive. Despite this, however, too much sexual expression may put women at risk for being viewed as nothing more than sexual objects. Thus, an effort should be made in music videos to showcase balanced imagery of women being both sexually expressive and empowered through areas other than sex. | https://j-stokes.medium.com/twerking-in-the-metoo-era-4b38634a1367 | ['J. Stokes'] | 2019-01-24 05:31:37.302000+00:00 | ['Womens Rights', 'Metoo', 'Sexual Assault', 'Sexual Harassment', 'Sexual Abuse'] |
Of Love | microtale
Line Art Lubna Yusuf
ग़म-ए-हयात की मोहताज नहीं
न रस्म-ए-दुनिया की है क़ाएल
वो मोहब्बत ही क्या
जो वक़्त के साथ बदल जाए
غم حیات کی محتاج نہیں
نہ رسم دنیا کی ہے قائل
وو محببت ہی کیا
جو وقت کے ساتھ بدل جاۓ
It mourns nor depends on life,
nor cares for ways of the world,
the Love that changes with time
is it Love at all.. | https://medium.com/polyglot-poetry/of-love-f243c93db2b5 | ['Lubna Yusuf'] | 2020-10-25 22:30:17.205000+00:00 | ['Time', 'Urdu', 'Love', 'Relationships', 'Life'] |
What is Feature Engineering? | In this article, we’ll look at what Feature Engineering is and discuss some techniques used for feature engineering.
Feature
In machine learning and data science, a feature is an individual measurable property or characteristic of a phenomenon, usually in the form of structured columns. For instance, we have a simple data table with students and their math exam marks as given below:
Name Maths
0 Chandler 71
1 Ross 77
2 Monica 91
The columns i.e., Name and Maths are features in the data.
What Is Feature Engineering?
Feature Engineering is the step in data science in which you extract features from raw data to facilitate data analysis or machine learning.
When the goal is data analysis or machine learning, you need data that does not contain outliers, missing values, or unneeded features. Moreover, you need data that can be analyzed. If you want to plot graphs, you need to trim and scale your data accordingly. In machine learning, you need to engineer the data to make it compatible/standardized so that you can design an efficient machine learning model.
Feature Engineering Techniques
We will briefly discuss various techniques that are commonly used for feature engineering.
Imputation — Dealing with Missing Values
When we are working with data, we get a lot of null or missing values. These missing values must always be taken seriously since they can affect the analysis quite a lot and can pretty much dampen the performance of our machine learning models. There are a few ways to cater to this problem.
Dropping Rows with Missing Values: We can drop the rows containing missing values. It is important, though, that we look and identify if the features we’re basing our analysis or model on have missing values or not, since we don’t want to drop significant data due to missing values of features that aren’t even going to be much significant for us. We can then drop the rows for those missing values. This isn’t the best method to deal with the problem because, in some cases, it could really reduce the data size and do more harm than good. So, you have the method of imputation to do a much better job for you here.
We have two types of imputation methods depending on the type of data.
Numerical Imputation — For missing values of numerical data, we can either change the values to 0 or set it to the mean value of the columns as:
data = data.fillna(0) #Replace NA value with 0 data = data.fillna(data.mean()) #Replace NA value with the mean value
Categorical Imputation — For missing values of categorical data, we can change the value to the most commonly occurring value or change it to “other”.
data['column'].fillna(data['column'].value_counts().idxmax(), inplace=True)
One-Hot Encoding
This is a feature engineering method to convert categorical data into a numeric form and is one of the most common ones used in machine learning. We cannot always work with categorical data directly for machine learning, in fact in most cases we can’t. We need the categorical data converted into the numeric form so that we could implement our algorithms efficiently.
In one-hot encoding, we convert our categorical data column into multiple columns of ones and zeros. For example, if we have a column named “colors” containing three values i.e., [‘red’, ‘green’, ‘blue’], after the encoding method, we’d get:
red, green, blue
1, 0, 0
0, 1, 0
0, 0, 1
Sklearn provides us a class for One-Hot Encoding and it can be imported and applied to the data with just one line. Documentation can be seen here.
Feature Scaling — Normalization and Standardization
In machine learning, we need the features to have comparable value ranges. For example, we can not compare values of height and weight since they have different value ranges and completely different units, but we can scale the variables in a way that would make it easier to compare them and use the data efficiently. Following are the two common methods for feature scaling:
Normalization
In normalization, we scale all the features into a fixed range from 0 to 1. The formula used for normalization is:
This method is also called min-max normalization.
Standardization
In standardization, values are centered around the mean value with unit variance. The formula is:
where μ is mean and σ is the standard deviation
Handle Outliers
Outliers are the values that are either too high or too low relative to the overall data. Such values affect the skewness of the data and also affect the model prediction. It is, therefore, very important to handle outliers. Some of the methods are as follows:
Remove the values: One way of dealing with outliers is removing them from the overall distribution, but this method is not always the most efficient one since important data could be lost doing this.
One way of dealing with outliers is removing them from the overall distribution, but this method is not always the most efficient one since important data could be lost doing this. Imputation: We could just treat the outlier values like the missing values and do imputations as discussed before.
We could just treat the outlier values like the missing values and do imputations as discussed before. Capping the max/min values: In this method, we can replace the max/min values with some arbitrary max/min values that would indicate that above or below that value, the variable will behave in a similar way.
Log Transform
In order to handle skewed data (to make it more normal), we use logarithmic transformation. This method has more than one advantage as this also reduces our outlier problem by reducing the effect an outlier creates.
The important thing to keep in mind is that this method cannot be implemented directly on negative-valued data since that’ll throw an error. So either a different approach should be used or 1 could be added to change the data values to positive i.e., log(x+1).
Feature Split
Splitting data logically is a good way to extract more useful information from the available data. The implementation of the split is subject to the available data and the information it can provide. For a simple example, let’s say we have data with full names of people and their ages as below:
Name Age
Mr. Rob Stark 25
Mr. Balian de Ibelin 30
Miss Mary Jane 23
Mrs. Caitylin Stark 50
In the above data, you can see that genders are not mentioned, but we can extract this information by titles provided in the names i.e., Mr, Mrs, etc.
You can string split the title part into a new column and categorize the available data to genders. This way you now can provide the model new information.
Apart from feature splitting, grouping methods are also used for feature extraction and get better results.
Conclusion
Whether we are to do analysis on data or want to make a good prediction model, we need to do feature engineering. It is the main step toward getting good results and usually takes a lot longer than the actual machine learning or analysis. It is, therefore, key to becoming well-versed in the techniques used for feature engineering. The article is not an exhaustive list of all the feature engineering techniques but is of the most common and useful ones. The main thing to focus on is that we have to extract/create/engineer the most significant and compatible features from raw data in accordance with the required task. | https://medium.com/red-buffer/what-is-feature-engineering-5baf02f1b4f1 | ['Ahmad Sachal'] | 2021-09-06 07:07:57.136000+00:00 | ['Feature Engineering', 'Data Analysis', 'Python', 'Data Science', 'Machine Learning'] |
Hey! | I have been trying to deal with my grief issues for quiet a while now, trying being the keyword. I have faced death three times in my life closely, at least. The first time I was too young to understand. The second time I was too sensitive to deal with it. I was a teen, too old to ignore it as just another thing in my life and too young to handle it like a pro. It led to a cascade of things, memories I still struggle to just accept. I am too driven by my heart than my head, for a long time I defended myself for being an emotional person, for some time since my cousin’s death I tried to shun that part of me and only let my logic rule. Well, it didn’t land me the daughter of the year trophy so I think it wasn’t of much use either. I tried bringing a balance between my logic and my emotions. Guess what? I love extremes. Balance isn’t it for me.
Now I am trying to accept who I am while still finding who I want to be.
I have a past and it isn’t the garden of Eden, but it wasn’t the worst, It was my worst. Recently I lost my most favorite person on earth, my grand dad. And everyday I think of all the moments I could have spent with him. Everyday I think of all the moments that make me hate my dead brother at the same time I think of all the moments when he was the golden child of the family. Again he wasn’t a monster but he sure does star in a lot of my nightmares.
I blame and blame; him, my parents, my self and even my granddad for leaving me. I may be a little delusional here, I never let my self think of the day he would leave. He was a part of my forever, for as long as it shall be. With his loss I have lost my forever. Everyday that I think of him, the memories don’t bring happiness but pain for what I’ll never have again. I’ll never have him holding my hand giving a reassuring squeeze every now and then. Wordlessly, Telling me he’ll always be there to pick me up when I fall, just like when I was a scar less little girl, his grand daughter. I am good with advices, so I know exactly what I should do, forgive and accept. But when has a preacher ever really practiced. So I wallow.
Reading about your son, I felt the same tug, I felt the day my granddad breathed his last in my arms. I feel that pain again when I realized that the brother I have been grieving for 4 years was not all good, yet I still grieve for him. And I want to forgive him for doing wrong and me for still feeling his loss. Reading this post wasn’t a ray of hope I’ve been looking for. Or some Eureka! moment on my fictional path to self-actualization. I don’t think there is a miracle moment when life suddenly starts to make sense. I still don’t have hope. But somewhere in my heart, while reading about how you remember your son for the love you shared, the life he lived; I know someday I’ll do the same. Someday I’ll forgive my self for not holding onto my granddad’s hand tighter, forgive a man who did me wrong yet did right by every person I love. Someday I’ll forgive the girl I see in the mirror everyday. One day I’ll do right by myself and remember the loved one’s I’ve lost to life and death with a smile.
And while doing it all I’ll remember you and Mason. I’ll know that I wasn’t the only one who had felt guilty for not loving them enough. I’ll also remember that despite everything my granddad is looking from above and smiling at me.
Thanks for letting me rant.
PS. usually I apologize for rambling. So, I guess this is improvement on my part
-Nae | https://medium.com/@naeyaer/hey-25df5cfac3af | ['Nae Yaer'] | 2020-12-15 18:38:41.630000+00:00 | ['Mark Twain', 'Wayne Dyer', 'Greif', 'Forgiveness', 'Mark Twain Quotes'] |
Mount Kailash : The Mysterious Mountain | Mount Kailash — the Stairway to Heaven — It is the most intriguing mountain range in the whole of Himalayas, Mount Kailash is 22,000 ft from the Tibetan Plateau, which is largely considered to be inaccessible.
For Hindus and Buddhists, Mount Kailash is the physical embodiment of Mount Meru. The Kailash Range is 30 million years old and its supreme peak, the 6,675 meters high Mount Kailash was formed of shining granite with its white glacial crest. Hindus and Tibetans seem to have been aware of the uniqueness of this mountain from the most ancient times. To Hindus, it is the earthly embodiment of the dominant mountain of heaven, Meru, and the residence of Lord Shiva and his consort Goddess Parvati.
Here are 5 of the most interesting, little-known facts about one of the world’s most sacred and mysterious mountain peak — Mount Kailash.
1 — Place of Divine Beings
People say Kailash parvat is the home of Shiva. Contrary in yogic terminologies Shiva is not seen as a god. They see him as a Yogi, the first yogi or the first guru. He was the first one to transmit the yogic science to his first seven disciples, who came to be known as the Saptarishis. Shiva is the greatest mystic that we have known. So when we say “Home of Shiva,” it does not mean that if you dig in the rocks or look up in the clouds somewhere you will find Shiva.
It is because everything that he knew has been deposited in Mount Kailash in a certain energy form. He chose this peak as a scaffolding for his knowledge. The knowledge and the capability that Shiva known, all that is very alive and accessible at Kailash. So, starting from Shiva himself, many great beings chose to deposit and preserve their work in Kailash. Rishabh Dev Ji the first Tirthankara in Jainism, two of the greatest Buddhist teachers, Agastyamuni, the Nayanmars, — all of them chose Kailash Parvat as a place to preserve their work.
2 — The Unclimbed Peak
It is also said that many climbers who tried to climb Kailash have experienced that their hair and nails started growing rapidly during the climb and once some people in the Siberian region tried to climb it, but they felt that they started getting old and that is why he left their ascent midway and came back. It is also said that one of the reasons for not climbing Kailash is the ever bad weather, sometimes health and wandering.
At the same time, it is said that there are many caves around Mount Kailash that the world is not aware of and the divine saints go and do penance there. These caves can be seen by only a few people. There is a great saying in Tibet that “Only a man entirely free of sin can climb Kailash. And he wouldn’t have to scale the sheer walls of ice to do it — he’d just turn himself into a bird and fly to the summit.”
3 — The Gauri kund and Rakshas taal (Good and Evil Lake).
On Kailash Parikrama around Mount Kailash, you shall come across this gorgeous emerald-coloured pond which belongs to the wife of Lord Shiva, Parvati. Gauri Kund, as it is known, was her personal space where she used to take bath. It is also said that it is at GauriKund that Parvati created Lord Ganesha, using the dirt of her body.
There is a strong belief among the pilgrims that a dip or splash of water of Gauri Kund on the head, heals them. But, some stories suggest to avoid taking a bath here as Parvati still visits this place and personal space shouldn’t be occupied or touched.
Honestly, I would also discourage everyone from taking a dip in GauriKund since the place is over a height of 17,000 + feet and cold enough that a person can fall sick easily.
Rakshas means Devil and Tal meaning the lake, Rakshastal is believed to have originated through the demon king Ravana, who got infamous due to his act of kidnapping Sita from the text of Ramayana. It is said that while he was meditating around Mount Kailash, to impress Lord Shiva to grant him special powers, he made Rakshastal where he would sit and pray.
Due to its association with the demon king Ravana, Rakshastal has never been looked upon as an auspicious lake and pilgrims are often discouraged to either take a bath or drink water from it. It is said that with the touch of the water from this lake, a pilgrim will attract bad luck and therefore, it is not advisable to even get close to it but, scientifically researchers have claimed that it is, in fact, the salty nature of Rakshastal which makes it undrinkable and there are no water bodies in it. The touch of saltwater on a human body is bad.
4 — Significance of OM Parvat
Every year the Government of India organizes pilgrimage tours to Kailash Mansarovar in association with the China government. And on route to Kailash Mansarovar lies the Adi Kailash which happens to be near the Sino-Indo border. For those who don’t know, the majority of the trek is along the Kali river.
For those who are wondering where does Om Parvat come? Well, Om Parvat marks the tri-junction point where borders of Tibet, Nepal and India meet. That’s not all, this ancient Himalayan peak is breathtakingly beautiful.
Om Parvat Trek has a vast collection of mythological stories around it too. You will be surprised to know this but Om Parvat rises to an altitude of 6,191m. Om Parvat is also referred to by several other names such as Adi Kailash, Chota Kailash, Baba Kailash, and Jonglingkong.
But perhaps the most significant reason why it is famous is its name. The most astounding trait of this peak is the miraculous impression of “OM” which is naturally formed with the deposition of snow against the dark background of the mountain.
5 — Spiritual Center Of The Universe
Mount Kailash is believed to be the Axis Mundi aka the cosmic axis, world axis, world pillar, the centre of the world, the world tree. It is the point where heaven meets earth. The Google Maps vouch for the validity of this fact.
It is the centre of the world, according to ancient texts. Four of the world’s mightiest rivers, Indus (also known as Sindhu in India), Sutlej, Brahmaputra (Yarlung Tsang-po in Tibetan), and Karnali (the Ganges’ largest tributary) all originate within a 30-mile radius around this site located in far-western Tibet.
It is also a representation of the mythical Mount Meru, which many religions consider to be the cosmic mountain located at the exact centre of the universe. On reaching there, all pilgrims make a circumambulation (kora or parikrama) of the mountain (53 km), which usually takes about three days to complete. It is said that enlightenment is guaranteed to those brave souls who complete 108 journeys around it. At the foot of this immense mountain lies Mansarovar (‘Lake of Consciousness and Enlightenment’: 14,954 ft), a beautiful cobalt blue lake. A plunge into its icy waters is mandatory for most pilgrims to the site.
Mount Kailash is a pilgrimage and not a trek. Those of you who are thinking about it as a trek, mind you, it’s meaningless if you are not able to feel the spiritual energies while you take a parikrama of the sacred Kailash. When you go there as a pilgrim and not as a trekker, you will be awestruck with the vibes you will feel there and it will awaken you to be a more wonderful you.
In a world filled with materialistic pleasures, we forget to connect with our spiritual self. There are days when we tend to introspect our prospects, past decisions or seek healing and forgiveness. However, we are so busy in our daily life that our feelings do not last long. But what if you can feel more deeply and can connect with your spiritual being? Kailash Mansarovar Yatra is a journey of forgiveness, a journey of healing, a journey of self-proclamation and more. Encapsulated by immense beauty, Kailash Yatra boasts of a journey that connects with your soul. | https://medium.com/@deepanshpalawat/mount-kailash-the-mysterious-mountain-e87b4f26391c | ['Deepansh Palawat'] | 2020-12-22 15:10:03.138000+00:00 | ['Mountains', 'Ancient History', 'Hinduism', 'Buddhism', 'India'] |
What on Earth is CI/CD? | CI/CD, acronyms frequently used in DevOps, what is it? Stepping into DevOps, I wanted to know what it is. So here’s what I learned about it for everyone out there who wants to know too.
What is CI/CD?
Continuous Integration and Continuous Delivery or Continuous Deployment is a way of continuously integrating all code from a team into a single codebase and is always delivery-ready. This is carried out for automated building, testing, and quicker delivery/deployment.
CI/CD
Continuous Integration vs. Continuous Delivery vs. Continuous Deployment
Continuous Integration is a development practice where developers integrate code into a shared repository several times a day i.e., every time a project team member commits changes to version control. With each integration, it is verified by an automated build, allowing teams to detect problems early. So, the more you integrate, the more quickly you can detect and locate the errors. This regular integration of new code into an existing codebase can be accomplished with automated tools that include the integrating and testing of the codebase.
Continuous Delivery is an extension of continuous integration as it automatically deploys all integrations or new code changes to a testing and/or a production environment after the build stage, always leaving a deployment-ready build artifact that has passed through a standardized test process in the hands of developers.
Continuous Deployment is a software release process that validates the changes made in a codebase using automated testing. It checks for stability for immediate deployment to a production environment for developers.
With continuous delivery, every code change is built, tested, and then pushed to a non-production testing or staging environment. There can be multiple, parallel test stages before a production deployment. The difference between continuous delivery and continuous deployment is the presence of a manual approval to update to production. With continuous deployment, production happens automatically without explicit approval.
Now, how do these terms relate to each other?
These “continuous” processes, combined, represent the end-to-end automation of the software build process where a team is always ready to deploy new integrations post automated tests. These processes have many benefits such as lower risk, fault isolations, faster release rate, easier maintenance & updates, better quality, lower cost, and happier teams. The goal is to build and deploy software as quickly as possible.
To put it simply continuous integration is part of both continuous delivery and continuous deployment. And continuous deployment is like continuous delivery, except that releases happen automatically.
These connected practices are often referred to as a “CI/CD pipeline” and are supported by development and operations teams working together in an agile way.
CI/CD in a picture
While Agile, CI/CD, and DevOps are different, they support one another. Agile focuses on the development process, CI/CD on practices, and DevOps on culture.
Agile, CI/CD, and DevOps
Hope this helped you understand better! | https://medium.com/featurepreneur/what-on-earth-is-ci-cd-64333790a314 | [] | 2020-12-11 14:43:31.831000+00:00 | ['Cicd', 'Continuous Integration', 'Ci Cd Pipeline', 'Continuous Delivery', 'Continuous Deployment'] |
Thailand, Tourism Trauma | Thailand extends a red carpet to tourists, which may seem to be a win for the economy as tourists flood in, but it also meant that Thailand’s economy was heavily reliant on tourism for development. Everything appears to be fine until a global pandemic strikes, resulting in a sharp rise in travel restrictions.
Economic Overview
Thailand has made tremendous progress in social and economic growth over the last four decades, moving from a low-income to a high-income country in less than a century. As a result of its sustained strong growth and remarkable poverty reduction, Thailand has become a commonly cited development success story.
Over the past 30 years, poverty has declined dramatically, from 65.2 percent in 1988 to 9.85 percent in 2018. (based on official national estimates). However, both household income and consumption growth have slowed in recent years across the country.
Covid-19 Impact
COVID-19 had a significant economic effect, pertaining to Thailand’s openness to trade and position as a tourism hub.
Weaker global demand has resulted in a drop in global trade, which has harmed Thailand’s exports and disrupted global supply chains, such as those involving cars, in which Thailand plays a key role.
Due to transmission control and social distancing steps, the outbreak is likely to result in significant job losses, especially in tourism.
Since March 2020, the tourism market, which accounts for nearly 15% of GDP, has been seriously impacted by a near-complete cessation of international tourist arrivals.
Although necessary for flattening the infection curve, mobility restrictions imposed in response to the outbreak have severely harmed private consumption, especially in retail and recreational services. This is reflected in the drop in durable goods sales in the first quarter of 2020, which fell by nearly 12%.
Summer travel plans could be hindered by pandemic-related lockdowns, flight cancellations, and border closures. The sharp decline in tourism, on the other hand, would have a disproportionate impact on countries that depend on international visitors, with potentially large-scale implications for their economies’ national accounts.
In Thailand, a drop in tourism as a result of COVID-19 reduced the country’s total exports by 8% of GDP and had a direct net effect on the current account balance of about 6% of GDP in 2020. This ate into the country’s overall current account surplus, which was 7% in 2019.
Nonetheless, the cumulative impact of a downturn in tourism on current account balances could be less than these predicted direct effects suggest. Offsetting indirect effects can be seen in smaller, tourism-dependent countries and even larger economies with a strong tourism industry. Smaller countries, for example, with less domestic capital, depend on more imports to sustain their tourism industries.
Economic growth is expected to pick up in 2021 (4.1%) and 2022 (3.6%), with a return to pre-COVID production levels expected in about two years. The economic recovery’s sustainability will also be determined by how well the economy responds to distressed households and businesses. | https://medium.com/@charleshachem/thailand-tourism-trauma-70162d652db5 | ['Charles Hachem'] | 2021-05-19 10:23:52.680000+00:00 | ['Bangkok', 'Tourism', 'Thailand', 'Economics', 'Covid 19'] |
Where do we go from here | George Floyd protests in Uptown Charlotte (Photo Credit IG: @clay.banks)
In a couple of weeks, Americans — mostly black Americans — will celebrate the 155th Juneteenth holiday. On June 19, 1865, two years after the Emancipation Proclamation and two months after the Civil War formally ended, 250,000 African-American slaves living in Texas were finally informed of their liberation. News of the Emancipation Proclamation was knowingly withheld by slave owners in Texas who chose not to yield their slave-owning authority until Maj. Gen. Gordon Granger arrived in Galveston, Texas with 2000 troops to ensure the message was received.
I write this reflection on history from afar, living in a country thousands of miles away from the US, as I try to make sense of a range of emotions pertaining to the recent events. As a black man, I’m profoundly saddened by another unnecessary loss of life of someone who looked like me at the hands of a person in uniform who recklessly and callously wielded his power. As an American, I’m upset to see another sign that the land of opportunity to which we’ve made a central tenet to the American Ideal is in fact a mirage; shiny packaging that hides stains of systemic injustices that have marred American history for hundreds of years. Despite being centuries and generations removed from cotton field plantations, if you look a certain way and live in certain areas, the powers that be are quick to remind you that those chains still remain.
But ostensibly, the global backlash to police brutality that led to the death of George Floyd suggests an awakening in the public consciousness. Protests around the world are taking place with hundreds of thousands of people of all races garnering support behind #blacklivesmatter. Many have posted an empty black square on their instagram feeds for #blackouttuesday, and major brands like Netflix, Amazon, Google, and countless others have expressed support and solidarity with the Black community at the organizational level. Is this the turning point from an era of disenfranchisement, subjugation and aggression fueled by institutional racism that dates back to at least the days of Emmett Till? Perhaps. But perhaps not.
The problem with the age we live in is that our interconnectedness breeds virtue signaling, our limitless access to information breeds echo chambers, and the proliferation of tech and media breeds short news cycles and even shorter attention spans. How do we combat an enemy that has literally been festering inside of our institutions for hundreds of years, when we’re unwilling to commit beyond the first few steps in a journey of a thousand miles? We march, we tweet, we post — but do we invest, do we lobby, do we vote?
It’s worth noting that the public outcry for social justice is occurring amidst the throws of a global pandemic, skyrocketing unemployment rates, and an adjustment into a “new normal” of social distancing and remote-based working. If there was ever a time to rattle the foundations of institutional norms, it’s now: society is primed for a questioning of the status quo, and there is a window of opportunity for leaders to propose multi-faceted solutions to the multi-faceted problem of racial inequality.
One area I find especially important is that of economic empowerment. From the Watts riots of ’65 to the Rodney King riots of ’92, there are historical examples similar to today where protests have escalated into looting and property damage, leaving small businesses in minority communities to sort through the wreckage. While it is true that a “riot is the language of the unheard”, we must think about what to do with the rubble that comes after the riot. We should support the small business owners affected by looting and vandalism, and we should ensure that more capital is injected into predominantly-minority communities so that these silenced voices are finally heard. The data show that cases of police brutality occur far more often in low-income communities, so one way to counteract social injustice is by enabling socioeconomic mobility.
For the organizations, enterprises, and venture capital firms that have pledged to create scholarships and other forms of funding for under-represented minorities due to the recent events, firstly, your support is greatly appreciated. Yet I would encourage any organizations that are striving to power the winds of change to keep their aim on the core problem at hand at this very moment. Rather than a general scholarship or funding for minorities, invest specifically in technologies being built for criminal justice and police reform, or in students, founders, and investors who live and work in Opportunity Zones and who are more likely to be directly engaged in the community. It’s important that we use the attention of the moment to magnify our impact, and that we’re combating systemic injustices by designing new systems of prosperity and equality.
Where we go from here will either place us on the path towards a deepening divide or a growing unity. If the messages of the day are empty lip service and fickle activism, we can be sure that there will be another George Floyd, and that the pain and resentment felt by the Black community will reach yet another crescendo. But if we can commit our minds — and our wallets — to working together, working patiently, and working diligently, tomorrow can and will be a brighter day.
Additional resources: | https://medium.com/@jamaur-bronner/where-do-we-go-from-here-ceda3d3d81d0 | ['Jamaur Bronner'] | 2020-06-03 13:02:24.392000+00:00 | ['BlackLivesMatter', 'Social Justice', 'Community Engagement', 'Civil Rights'] |
Bleeding Edge Series: Explainable AI is the key to Social Acceptance of Artificial Intelligence | Systems that rely upon artificial intelligence to make decisions are often black boxes that produce values which are interpreted to signify a certain meaning. There is often no explanation of how the system arrived at these values. This lack of explanation may not be an issue for problems such as predicting film revenue from reviews, but it will be an impediment to the adoption of such systems in highly regulated domains such as healthcare, finance, and the military.
Explanations of how decisions are arrived at, may reduce the accusations of bias, and therefore may reduce the possibility of legal action against private and government organisations.
There may be specific business reasons why organisations may wish to have explanations from their machine learning models. However, the academic community has deduced a number of general cases where explanations may be needed for inferences from complex machine learning methods.
The main general cases are: Explain to justify, Explain to control, Explain to improve and Explain to discover.
Adadi and Berrada state that Explain to justify is typically for decisions or inferences that need to comply with legislation or regulation. Whereas Explain to control is to determine what the weaknesses of the model are.
Explain to improve is a strategy where the explanations about the relationships between inputs and outputs can be used to improve the model, and finally, Explain to discover is a technique that uses explanations to discover new information.
This blog post will cover in a high-level manner why explainability is important to the 2nd wave adoption of Artificial Intelligence and some of the major techniques to derive explanations from black boxes.
Interpretability v Explainability
Interpretability and Explainability are often used as synonyms within the Artificial Intelligence (AI) and Machine Learning (ML) communities. But they are descriptions of slightly different phenomena. There are a number of definitions of interpretability with the mainstream definitions being “ Interpretability is the degree to which a human can understand the cause of a decision “, and “ Interpretability is the degree to which a human can consistently predict the model’s result”.
In short, a reasonably trained human will be able within a certain degree of error to predict the output of a model if a parameter or feature that was changed in the input. If this is the case, then the human will have an idea of how the system comes to a decision or an output value. Simple models, such as Naive Bayes classifier lend themselves to be interpreted by a human. A Naive Bayes classifier is based upon Bayes Rule and is simple enough to be set as a question on undergraduate exams, and therefore can be counted as an interpretable model.
The more complex models such as Deep Neural Networks are considered to be a black box where the model produced by the Neural Network is complex, and the aforementioned reasonably trained human is likely not to be able to predict the outcome of changing the input parameters.
Explainability, conversely, “ is the extent where the feature values of an instance are related to its model prediction in such a way that humans understand” or more simplistically, “ Why is this happening?”. Explanations may be as simple as highlighting important words in a sentence which determined its classification. An example of this phenomenon can be found here.
The linked example demonstrates the differences in the manner that two individual classifiers came to a decision. The Convolutional Neural Network (CNN) and Support Vector Machine (SVM) classify the text into the same categories, but the CNN uses less, but more relevant words. The SVM uses words such as “is”, that most humans would not associate with the space category that the first paragraph was assigned to.
This example demonstrates that a model such as a CNN may not be interpretable, but still may offer explanations of how the model comes to a classification. Explainability not only offers some confidence to decision makers when accepting outputs from AI dependent systems, but it also offers some indications of the robustness of the underlying AI. For example, Adversarial Attacks can fool image classification systems to interpret a stop sign as a speed limit sign.
Explainable AI techniques can help make AI systems more robust against this type of attack.
Interpretation Methods
The most complete survey paper in this area is the research conducted by Adadi and Berrada, and they stated that there are two types of interpretability: global and local. Global interpretability “ facilitates the understanding of the whole logic of a model and follows the entire reasoning leading to all the different possible outcomes” whereas “ local interpretability explains the reasons for a specific decision or single prediction means that interpretability is occurring locally”.
Adadi and Berrada contend that global interpretability is required when a clear picture of the whole reasoning process is needed by decision makers. They state that this level of interpretability would be required for population-level problems such as identify “drug consumption trends”. Their paper lists a number of techniques such as GIRP through which global interpretability can be achieved.
Local interpretability is required when there is a requirement for an interpretation of a single inference. Again Adadi and Berrada provide a comprehensive list of techniques that can be used to provide that single interpretation, the most well-known of which is Local Interpretable Model-Agnostic Explanation (LIME), which is made available as a Python library by its authors.
Explanation Methods
Machine learning techniques can have explainability as part of their design. Adadi and Berrada provide a list of learners that were designed to be explainable such as Bayesian Rule Lists and Sparse Linear Models.
Feature importance is one method of many that can be used. In the academic literature, there are a number of various techniques. Guidotti et al have produced a survey article of explainable methods for black box systems. For brevity, this post will cover Sensitivity Analysis and Partial Dependence Plots.
Sensitivity Analysis
Sensitivity analysis “ is the study of how the uncertainty in the output of a mathematical model or system (numerical or otherwise) can be divided and allocated to different sources of uncertainty in its input” and it can be used to “i ncrease understanding of the relationship between input and output variables in a system or model”.
This technique was used by Shu and Zhu. Their technique perturbed the input of the training data and measured the results of the output of the system. This approach allows the authors to estimate the sensitivity of the model to the input parameters to the outputs produced. From these results, it is therefore possible to estimate the relationship between inputs and outputs.
Partial Dependent Plot
This technique is a visualisation technique that “ shows the marginal effect one or two features have on the predicted outcome of a machine learning model”, and its aims are arguably the same as sensitivity analysis because they both try to infer the relationship between inputs and outputs, and from that infer a general model. Partial Dependence plots are available in major machine learning libraries such as scikit-learn. Examples are shown in the following diagram.
The plots estimate the dependency of the output variable: house price, with various features, such as House Age (HouseAge). The plots, in particular, median income, demonstrate the relationship between the input feature and the output variable.
The Future?
Interpretation and explanation roughly speaking try either directly or indirectly to achieve the same goal, which is to change machine learning from alchemy, where a magical black box produces inferences, which the uninitiated should trust unreservedly, to a system that provides reasons why it came to its decisions. This area is, without a doubt, the future of machine learning and artificial intelligent systems.
The dystopia of science fiction’s view of AI is unlikely to come true because systems can be held to account and the sudden homicidal tendencies of fictional future systems such as HAL should be avoided because human operators will be informed of its malicious intent.
In the real world, the advent of explainable AI is likely to speed the adoption of AI systems in mature and highly regulated industries where decision-makers can be assured that the decisions are made by a robust system that can offer explanations for its inferences. Poor or weak inferences can be rejected. Explainable AI will also ease the acceptance of AI making moral decisions such as end of life care and job termination. | https://medium.com/skim-technologies/bleeding-edge-series-explainable-ai-is-the-key-to-social-acceptance-of-artificial-intelligence-93df8a60976 | ['Brett Drury'] | 2019-07-03 10:30:11.903000+00:00 | ['Future Technology', 'Artificial Intelligence', 'Explainable Ai', 'Technology', 'Machine Learning'] |
Non-Violence — Never think Curelly Of Others | After a long finally, I am writing my first blog. It feels so good doing this. It is quite a long time I felt sharing my thoughts & philosophy which I have been experienced throughout the journey of my life. If it is not today then never. Getting started is one of the difficult one. Let’s get started….
Why you should read?
I feel every individual should possess spiritual quotient which is a mixture of emotional quotient & intelligent quotient. I have been reading a book which inspires me a lot which is spiritual ethology. It brings positive vibes & helps my distracted mind to be quite. I feel grateful to share my thoughts through this medium.
What is the right way of living(Dharma)?
The question arises because even the kings of the past who indulge in violence did not harm those who took their refuge, nor did they allow harm others. So, is the sin committed by killing others, considered the same as the sin of killing a person who has sought his refuge?
Dharma involving violence is for the attainment of dharma, wish & work. Moreover, the dharma which permits violence is for the purpose of limiting violence. Non-violence, on other hand, is the attainment of welfare — which is the dharma of an individual. Dharma involving violence is for fulfilling worldly desires, but it is not for the attainment of welfare, whereas non-violence is solely for the purpose of attaining welfare.
Therefore, for all individuals, non-violence has been cited for the attainment of welfare. For example, one of the greatest King Vasu ruled over a kingdom and still followed a non-violent lifestyle. Therefore, an individual should not bear hatred towards anyone by thought, word or deed. Neither should he keep any form of aggression. Instead, he should behave as a servant of a servant with all.
In comparison, having an aggressive personality is the dharma of a wicked person, and behaving in a calm manner is the drama of an individual.
Then you might ask — ‘How is it possible to maintain the characteristics of an individual while trying to make thousands of people to follow their principles?’
Well, the reply to the question is that Yudhishthir King reigned over a kingdom stretching for thousands of miles, yet he managed to maintain the qualities of a servant. Conversely, there may be thousands like Bhimsen who intimidate others and are unable to maintain their ways despite being lectured. In fact, there is no shortage of people with such an aggressive nature; there are countless such people. However, to behave as a servant of a servant with all as an individual is very difficult. | https://medium.com/@archishthakkar/non-violence-never-think-curelly-of-others-3a1c97336ca1 | ['Archish Thakkar'] | 2020-12-18 19:32:58.218000+00:00 | ['Positive Thinking', 'Philosophy', 'Spirtuality'] |
In Front Of The Fireplace | The fire slowly burns the wood, transforming it
into the warmth I feel in front of the fireplace.
My thoughts slowly burn the seconds, transforming them
into not wasted opportunities.
The fireplace can be very didactic.
It shows me that in order to defeat cold, I have to be close to the fire.
If I go and sit on the other side of the room, I don’t stay warm.
But — in parallel — , if I sit too close when the burning of wood is at its zenith,
I can’t stay long; my skin is overheated.
How do you measure that, then?
What’s the balance point and the appropriate attitude
in front of the …fire?
Oh dear self, you must be worthy of the “fire”, in order to be given its knowledge.
You are an idiot if you go towards it without thinking about it at all.
You are an idiot if you overthink about going towards it.
Fire needs to capture that you are not afraid of it, but you can understand its power; you are not paralyzed by fear in front of it, but you don’t underestimate it either.
I feel some of my senses working loudly.
I smell the burning of that tree trunk’s part.
I hear the sound of it.
I see yellow and orange flames.
Actually, your brain does these, girl.
If you see a mix of yellow and orange in front of you right now, this “decision” hasn’t been made by your eyes. They just receive information and deliver them to …the boss. They don’t see anything!
So, when you don’t …see, don’t waste the time of the ophthalmologist.
There’s nothing wrong with your eyesight.
Just wake up the other eye.
Just use your insight.
-Yeah, yeah… I know, you smart-ass!
I put another piece of wood in the flames.
Come on, zenith of burning! Show me what am I tonight.
I hear the scream of my skin; the warning. But, I stay motionless.
I didn’t think about it at all. I am an idiot. Tonight.
I “see” why I do it. I use my insight. Tonight. | https://medium.com/scuzzbucket/in-front-of-the-fireplace-3979aa838ae6 | ['Anthi Psomiadou'] | 2020-12-24 02:04:05.409000+00:00 | ['Behavior', 'Observation', 'Fire', 'Awareness', 'Self'] |
I Don’t Know | Admitting that I do not know something I feel like I am “supposed” to, was a hard thing for me to do. It still is. Especially when my 8-year-old daughter asks me something, I feel the immense pressure of being the all knowing super woman in her world and I feel like if I admit that I don’t know, her whole image of me will come crashing down. Okay, a bit of an exaggeration. I want to hold on to the feeling of being able to answer all her questions and fix everything in her life.
This is like how I felt early on in my career as a recruiter. I had a very hard time admitting that I did not know what something means. I mean, I had a degree in Computer Science, and I am trying to decide who is a good fit for the job or not. I thought if I admitted that I did not know every technology that existed I would look like an idiot. So, I spent many late nights googling all about technologies, how they relate to each other, everything they can be called, etc.
I am here to tell you there is a better way. It is to admit that you don’t know.
Once I got a bit more comfortable in my role, I learned that no one expected me to know it all. In fact, the smartest people I know in the industry openly admits that they don’t know something. These are usually the ones that their staff and colleagues have the highest respect for.
You see, I concluded that the more you know, the more you understand what you don’t know and can openly admit it. Because when you do, it shows real confidence in the things that you do know to be able to admit the things you don’t know. This is like a secret that most hiring managers know and never told us!
Over the last week, I had two candidates who the hiring manager declined because they could not admit that they did not know something in the interview. What they did instead was try to talk their way out of admitting that they don’t know, they went around the question and talked about the things they do know. One of them was interviewing for a manager role, the other an engineer role.
In both of these instances, the hiring managers knew that they did not know the answer. The hiring managers told me later when I gathered feedback that had they just admitting that they don’t know the answer, they probably would have gotten the job.
I understand why the candidates did it. In an interview, they are “supposed” to have the answer, that along with nerves, I probably would have done the same thing. Which is why I wanted to write this article.
I wanted to share that it is okay to admit you don’t know even in an interview. In fact, many times it is preferred. If you still feel badly about just saying I don’t know, say this:
“I don’t know but given the opportunity I am sure I can learn it.”
Please know that this is not me telling you not to do your homework when you interview or do your research, this answer is for the 10 percent of the skills you do not have on the job description but you have 90 percent of all the other skills.
Admitting that you don’t know something can help you win your next interview.
If you are preparing for an interview, these will help:
Good luck. | https://medium.com/@junecoffey/i-dont-know-8841f66b2017 | ['June Coffey'] | 2020-11-19 03:18:36.830000+00:00 | ['Career Advice', 'Interviewing', 'Interview', 'Recruitment', 'Interview Tips'] |
That one missed connection | Once I fell in love with a man twice my age. When I was twenty-five he was fifty. I thought I was a mathematics machine because I figured neither of us would age or get bored.
Ever since, my heart dives straight out of my chest onto the pavement any time I see anyone who remotely resembles him in the middle age.
It’s a sensibilization or a looking out that causes no shortage of feelings on my part.
Once I had the gumption to go up to a man who reminded me of him.
I ate all this English lavender, he said chérie, it was like a dream but it went bad so fast.
The very same person who said the man was deliberately confusing people started to behave like other con men I had hoped to date before I realized they were con men.
And he started to confuse me.
I remember there were reports of delivery workers stealing, getting their hands in food, hence why they started to seal the orders — and _______ was telling me he always got a free meal.
One time he was holding my stuff hostage. Another time he said I hurt his feelings because I confronted him about how jealous and possessive he was, and he held that against me as if it were the worst crime.
Anyways, ultimately he represented the polar opposite of the allure and charm of the man he intitially reminded of — something was terribly off.
I became alienated because he reminded me of everything about the Boomer generation destroying the planet, society, mine and anyone’s future.
There was nothing about this man that was French! I asked if he planned to retire he said he’d work till he died. All he ate was cheap boomer food, so plastic it made me feel sick! What I observed was gross, wasteful.
Right when we met he kept trying to entice me with a bigger place.
I remember he accused me of being a sell-out because I didn’t work at the same job.
My style was cramped. I found poems he wrote about me on the internet. What has caused me greater humiliation.
From the first this man would blow up my phone.
Don’t get me wrong I have been destitute and in the streets — I sometimes wonder if I made a mistake in not living with him. But he made me uncomfortable. My style so crampled I almost felt dead or filthy.
I understand though now how my love object felt: I had been indiscreet, overflowed in my communications, the older American boomer man caused me to see the worst in myself and challenged me to feel what it was like to be on the other side of the exchange.
A forgotten bit: What is my age again?
I was in Starbucks and a man gracefully told me to go ahead.
Since this incident when I lost my cool a doorman has been installed.
I got a warning last time when a cute man showed up walked in and grabbed his drink then walked out.
It seemed a sign from the military industrial complex to use apps.
I messed up so bad this time I actually ordered a Frappuccino in Winter.
So anyway, the man who sent me on ahead, looked at me in this disappointed way, something had gone wrong.
I didn’t use the app, got colder when I ordered a frozen drink, and I dropped the ball and left behind someone I had let down. Maybe he wished to speak with me or pay for the latte I should have ordered. A word of advice: the inside of Starbucks isn’t nice anymore, nor is it nice to wait around for drinks in there, you will only feel weird if you spend more than the time it takes to grab a coffee and go and now they are trying to fix how stupid you will feel if you go inside thinking it’s a good idea, now there is a doorman to remind you of how fun it is to be old about this stuff.
Apps and Starbucks are equally as stupid if you ask me. I apologize, I can’t do either in good faith. That would be like subscribing to hell.
I wrote off the good-natured fifty-something hotty cause he had blue eyes and the man who started the fifty-something craze in my heart-step was boue-eyed. Awwwwww | https://medium.com/@bonjourdecoeur/that-one-missed-connection-533da7286021 | ['Bonjour De Coeur'] | 2020-12-27 07:52:55.352000+00:00 | ['Missed Connections', 'Love And Dating', 'Romance', 'Funny', 'Love'] |
“CHILD’S PLAY” | play SimCity BuildIt for iPad. I play it so often, in fact, that it might be the thing I do most these days. It is not nearly as immersive and complex as past SimCity titles, but I nonetheless feel wanted, sometimes eve needed, and loved by the Sims who inhabit my city called Monteblo. Monteblo didn’t begin with my recent download of the game, though. No, Monteblo rose from a distant — and imaginary — location in the South Pacific around the time that puberty surged pimples through the pores of my skin.
Monteblo is a place that straddles time. There are books filled with graph paper pages on which are drawn the intricately detailed designs of Greek temples, and mayoral estates designed after Greek temples, structures that dapple the countrysides, suburbs and grand cities that make up the magical land. That same magical land is home to one of the States’ (Monteblo is a territory of the United States of America, of course, with voting rights) most successful collegiate sports programs: Deusis Testy. There are football and basketball cards with famous players’ pictures, heights and achievements on them. Among the most famous is of a player known simply by his surname: Frekmeiesy.
( frĕk • mī • ĕs • ē )
Frekmeiesy was a two-sport athlete who was bound to fall victim to his popularity. His name alone was enough to drive his Creator mad. It elicited smiles. Smiles from adoring fans, even smiles from opponents’ fans. Hell, Frekmeiesy’s appeal was so universal that his Creator’s Creators could hardly go a single moment without mentioning him!
And always with those smiles, those smiles that confessed simultaneous love and mockery. As his popularity grew his statistical output began to wilt. The hand of his creator pointed lightning bolts at him fierce enough to siphon the athletic ability from his joints. Game by game Frekmeiesy could but sit idle on the bench as other players stole the spotlight that was once his, players with normal names like Joe and Jack, Johnson and Franklin; players who could barely draw a glance from the home crowd much less smiles from the Creator’s Creators, no matter how high their shooting percentages!
The Creator had a soft heart. The Creator felt pain and bore great responsibility when Frekmeiesy struggled. Temporarily, Frekmeiesy was even removed from the basketball roster entirely. The Creator thought this would bring an end to Frekmeiesy’s front page fame. If only He, the Creator, could extinguish Frekmeiesy’s existence from memory, well then he’d… he’d… | https://medium.com/not-complaining-but/child-s-play-3085bc46d237 | ['The Motor Tom'] | 2015-09-10 20:45:57.272000+00:00 | ['Childhood', 'Ncb Catalogue', 'Storytelling'] |
How The “How I Made 6-figures” Posts Really Make Us Feel | Is it envy?
God, I hope not.
Look, I’ve never considered myself an envious person. I love celebrating other people’s success. I root for them.
But I’m asking you: how do you feel seeing dozens of posts like that every hour?
Be real, though.
Imagine this: I’m in my pajamas, in my studio apartment, still in college, scared to finally enter the real world. And I see all these awesome achievements people have and I think: YES! It’s possible! Let’s do this.
But… How?!
They seem to have it all together. They seem to have it easy. They just get up in the morning, brush their teeth, pet their puppy, and then just start working and earn a lot of money.
And then it hits me: man, why are THEY able to do that?
Is it envy? I don’t want them to fail or anything. I don’t dislike them for getting to that amazing point in their lives. I would learn everything from them if given the chance.
I just wish I had the confidence to know I’m getting there, too.
But what is it?
The feeling of inadequacy.
What if I’m just not smart enough? What if it’s just not for me?
They have all these skills, resources, and mentors that taught them everything. Or maybe they’re just extremely smart and strong.
I can’t possibly handle that kind of business. Hell, how would I even get there?
Seeing all those posts is inspiring. But constantly seeing them while you’re barely starting? It’s a bit intimidating.
Of course, everyone is showing them off — in this state of the economy, we all want to know how to get to financial prosperity. Writers know it, platforms know it, traffic comes in.
But I believe there’s a dark side to it. As a new freelance copywriter, I see it every day. While I enjoy reading those stories, I can’t help to feel that maybe there’s something wrong with me. Maybe I’m not enough. | https://medium.com/@julia-w4c/how-the-how-i-made-6-figures-posts-really-make-us-feel-3fc299a14996 | ['Julia At'] | 2020-12-13 16:52:16.557000+00:00 | ['Life', 'Work', 'Feelings', 'Startup', 'Personal Development'] |
4 Things I Wish I Knew When I Started Blogging | 4 Things I Wish I Knew When I Started Blogging
I would’ve found success much faster if I had known these 4 things
Photo by Icons8 Team on Unsplash
Blogging can potentially make you more money than an average day job. If you don’t believe me, go ahead and make a Google search right now. Better still, go to YouTube, and you’ll even find a bunch of bloggers giving a tour of the new mansion they just bought.
I’d like to believe their intention is to inspire people to take blogging seriously and give it a shot as a full-time career. Unfortunately, though, such stunts fail to offer an authentic picture of life as a blogger. Because it only tells you what the destination looks like, and not the things they should know about the journey itself.
So, let’s get one thing out in the open first. Blogging is not a “get rich quick scheme”. In fact, there’s a reasonable probability that you won’t make any serious money out of it in the first year.
I’m not trying to scare you off. It’s just a small effort of letting you know what to expect. I don’t want any of you taking the leap of faith for the money only. It’s a serious profession that demands years of hard work and commitment.
Nonetheless, there are things that you should know, to at least speed up the process a little.
It took me five years to start making a decent full-time income from my blog. Today, when I look back on my journey as a blogger, I see a bunch of things that wasted a lot of my time. Things that if I had known earlier, could have contracted the time it took for me to find success in blogging.
So, today I’ll talk about the top four things I wish I knew when I started blogging. I want you to know them upfront in hopes that these will help streamline your experience as an aspiring blogger. | https://medium.com/age-of-awareness/4-things-i-wish-i-knew-when-i-started-blogging-39cf31127163 | ['Wajeeh Khan'] | 2020-10-19 18:01:12.170000+00:00 | ['Work', 'Freelancing', 'Writing', 'Blogging', 'Education'] |
PySpark on macOS: installation and use | Spark is a very popular framework for data processing. It has slowly taken over the use of Hadoop for data analytics. In memory processing can yield up to 100x speed compared to Hadoop and MapReduce. One of the main advantages of Spark is that no more need to write map reduce jobs. Moreover, the spark engine is compatible with a large number of data sources (txt, json, xml, sql and nosql data stores). Spark is with Hadoop, SQL, Python and R one of the most sought after skills for data scientists.
A spark application is made of:
several execution processes which perform the data processing task.
a driver process: which is responsible for managing the resources allocated to the executors and distribute the data processing work load among the execution processes.
Users interact with the driver trough their code. Spark is initially written in Scala but also has APIs in other languages: R, Java and more importantly Python. Spark is meant to be run on a cluster of machines but can also be run locally as driver and executors are merely processes. This can be useful to prototype applications locally before sending them to the cloud. Google Cloud DataProc is (among other solutions) a very convenient tool to launch Spark jobs on the cloud.
Setting up Spark on MacOS does not have to be a pain. I have seen many posts on the topic, but I have not really been satisfied and often found myself not understand the reason behind some steps. So I decided to write my own post on the topic:
Install dependencies:
A very convenient way to install dependencies is with homebrew (in my opinion the best package manager for MacOS).
To install homebrew, you only need to copy this in your terminal:
/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"
Java
First we need to install Java as Spark is written in Scala, which is a Java Virtual Machine language. You can install the last version of Java with the command:
brew cask install java
You can always get information on the package using:
brew cask info java
You should get something that looks like this:
Scala
As Spark is written in Scala, we need to install it. If you get info on Spark using:
brew info apache-spark
You should get a result similar to this:
You notice that Java is a dependency. We install Scala with the command:
brew install scala
Spark
Finally, Spark can be installed on the system
brew install apache-spark
After installing the packages, it is good to check your system with
brew doctor
if you have: “Your system is ready to brew.” you can go to the next step. If you have any message you can follow the instructions given by the console.
2. Installing pySpark
I assume that you already have python 3 installed on your computer. If not installed already, you can do so with homebrew
brew install python3
Then you need to install the python Spark API pySpark:
pip3 install pyspark
3. Setting up environment
Almost done! Now you need to define several environment variables and declare paths so that the Spark driver is accessible through pySpark.
First of all we need to declare which java version to use. I have two versions on my system. You can do so by opening the .bashrc file with nano:
nano .bashrc
The java version can be declared with the following environment variable:
export JAVA_HOME=/Library/java/JavaVirtualMachines/adoptopenjdk-8.jdk/contents/Home/
and the java runtime environment is declared as follows:
export JRE_HOME=/Library/java/JavaVirtualMachines/openjdk-13.jdk/contents/Home/jre/
Now two variables must be declared for Spark:
export SPARK_HOME=/usr/local/Cellar/apache-spark/2.4.4/libexec
export PATH=/usr/local/Cellar/apache-spark/2.4.4/bin:$PATH
The first defines where your Spark libraries are installed and the second make visible your binaries to your shell (in particular the pypspark executable that we use later). Finally, PySpark must be configured:
export PYSPARK_PYTHON=/usr/local/bin/python3
export PYSPARK_DRIVER_PYTHON=jupyter
export PYSPARK_DRIVER_PYTHON_OPTS='notebook'
You can find your python3 distribution using the command:
which python3
which is used to define the variable PYSPARK_PYTHON. In order to be able to start a notebook with the command pyspark we define the two last variables: PYSPARK_DRIVER_PYTHON and PYSPARK_DRIVER_PYTHON_OPS.
You are all setup. The command
pyspark
will startup a new jupyter notebook session. The Spark UI can be consulted at the address:
http://localhost:4040
It looks like this: | https://medium.com/swlh/pyspark-on-macos-installation-and-use-31f84ca61400 | ['René-Jean Corneille'] | 2019-10-22 11:35:37.458000+00:00 | ['Spark', 'Python', 'Data', 'Hadoop', 'Data Science'] |
Increase microphone volume Windows 10 | On video calls sometimes volume is not high for receiving user
Below are steps to increase your microphone volume
On your taskbar right click and open volume
Open sound settings
Click on device properties
Slide bar up to 100#
Hopefully this will solve your microphone volume issues
Please get in contact with if you need assistance.
CodeCloudServices.com | https://medium.com/@codecloudservices/increase-microphone-volume-windows-10-44ccf91f53c8 | [] | 2020-12-24 18:16:34.297000+00:00 | ['Work From Home', 'Microphone Accessories', 'Microphone Not Working', 'Microphone', 'Microphone Issues'] |
The Age of Invisibility | Invisibility has always been an intriguing concept — invariably one of the superpowers we all wanted growing up. Popular literature and science-fiction franchises like J.K. Rowling’s ‘Harry Potter’ and H.G. Well’s ‘The Invisible Man’ have done a lot in helping us imagine what it would be like to be invisible.
Well, Guess What? Today, Invisibility is no more a matter of science fiction.
To make an object invisible, a perfectly invisible device should exhibit the same scattering properties as that of vacuum. In other words, the device together with the object to be camouflaged should reflect no light and cast no shadow.
A company called Hyperstealth Biotechnology Corp. seems to have cracked the code on how to do that. Their new product ‘Quantum Stealth’ is a plastic sheet material which bends light around a subject, obscuring it from view.
Mr. Guy Cramer, CEO of Hyperstealth Biotechnology Corp., calls it practical invisibility technology and notes that the name ‘quantum’ was selected for the name of the product in reference to the light interference patterns generated by diffraction gratings like in the double-slit experiment, which Cramer believes is a phenomenon closely related to the function of his product. The real power behind this new cloak isn’t quantum — it’s classical physics.
Quantum Stealth works via lenticular lenses, the technology commonly seen in plastic-coated 3D-effect trading cards or movie posters. In a lenticular lens, rows of cylindrical lenses refract light according to the viewing angle. Cramer found a way to arrange layers of these lenticular lenses such that ‘dead spots’ are created at certain standoff distances behind the material. When viewed from the front, the object behind the material is not visible, but the background is. This creates the illusion of invisibility.
Quantum Stealth material can bend ultraviolet, infrared light, and even shadows too, meaning hidden objects would not show up when viewed through night-vision goggles. The company says that its ultrathin, light and mobile form makes it ideal for military action. The light-weight material can be bent and folded and is designed to be carried in a soldier’s backpack, and it can also be used to make parachutes. The great advantage to Quantum Stealth is that it provides camouflage for all environments all year round. It doesn’t require a power source and inexpensive in comparison to other stealth equipment.
Soldiers could use this to hide their approach as they approach hostile forces. This could therefore enable them to complete missions during daylight instead of hiding their approach at night. It could be used for those on foot, operating military vehicles, aircraft, ships and even submarines. This amazing piece of technology could be a huge benefit to the military and the technology will completely revolutionise the camouflage industry.
In addition to ‘invisibility,’ the material’s light-bending properties have other applications, developed and patent-pending by Cramer. These include uses as a holographic image display, as a solar reflector, and as a laser-scattering device that works via diffraction. However, its only advantage is that it works up to a certain distance. That can be improved by putting some oil on it. | https://medium.com/the-treatise/the-age-of-invisibility-87e4469f6f02 | ['Asme Iiest Shibpur Student Section'] | 2020-11-11 15:20:57.870000+00:00 | ['Defense', 'Military', 'Science', 'STEM', 'Technology'] |
Coronavirus case in Israel continues to rise | Israel Prime Minister are being positive, telling the people that “we are beginning the end of the pandemic,” and he also announce that the first Pfizer vaccine in the country will be administered.
However, Israel still has to go through a very tough December, as the numbers of infections and deaths continue to rise, many citizens believe that the country has a huge possibility of a 3rd lockdown. | https://medium.com/@joiecooper2/coronavirus-case-in-israel-continues-to-rise-16fd01bdcf12 | ['Joie Cooper'] | 2020-12-14 14:10:58.630000+00:00 | ['Coronavirus', 'Pfizer Vaccine', 'Vaccines', 'Israel', 'Middle East'] |
Who’s afraid of Machine Learning? Part 2 : Creating a Machine That Can Learn | Hands down, my favorite food in the world is strawberries 🍓! I can eat them every day, all day, only them, and it would make me so happy! 😁
I want to write a program that will take an image and tell me if there’s a strawberry in it or something else. To simplify:
Is this a strawberry or not a strawberry?
If you were to teach a baby, who just came into the world, that an image is of a strawberry. How would you do it?
Showing the baby an image and saying- “this is a strawberry- learn!” would not be so helpful.
You will probably say something like: “see this image? In the image, there’s a strawberry. Do you see how red it is? And its shape is round on the top and pointy at the bottom.. And it has some small narrow leaves at its top.. And it has a unique pattern of seeds all over it.. that’s how you can tell it’s a strawberry.”
The baby would look at the image, would notice the features you just described, and then drive a conclusion: “because of those features, those characteristics, this is a strawberry.”
When the next image would appear, the baby will already know to look for the characteristics, spot them or their absence, and then make a brave conclusion: “this is a strawberry!” or “it’s not.”
Truth is, even if you didn’t break down the image to features, the baby’s brain will. In fact, either way, it will find more characteristics that you haven’t explicitly mentioned. This is how our brain works and some of the magic it just knows how to do. 🔮
Let’s dive a little deeper into that inner conclusion making process, and suggest how we can get a machine to do something similar:
Creating an Artificial Conclusion Making Model
The previous post, mentioned that our brain works with a neural network. To create a similar model for a machine, we should create an Artificial Neural Network (ANN):
The input
An image, as stated before, is too complex to be used as input just like that. We would want to find its features, the same as we did for the baby. So our input will be, not an image, but a list of features.
For simplicity, let’s focus on 3 features only: the red color, the seeds pattern, and the top leaves. For each of those features, let’s dedicate an artificial neuron to represent it.
A neuron, as mentioned, is just a bit of data. Each neuron will get a number, a score, to hold. For instance: how much is the image red? How much does it have a seedy pattern, how much are the top leaves are a strawberry’s top leaves?
** The numbers in the picture are just some scores I made up for the sake of the example. Don’t dwell into what do they actually mean. The concept is the important thing here: our input is a list of artificial neurons that represent features extracted from an image.
We can call this list of neurons — input layer. | https://medium.com/google-developer-experts/whos-afraid-of-machine-learning-part-2-making-a-machine-that-can-learn-a3c6d2715e26 | ['Britt Barak'] | 2019-04-07 19:18:15.411000+00:00 | ['Deep Learning', 'Mlkit', 'TensorFlow', 'Firebase', 'Android'] |
Different Paths to Math Learning Share the Spotlight | I can tell you exactly when I stopped learning mathematics in any meaningful way: dividing fractions. Just the thought of it makes me squirm. Every math lesson after that was a battle for just enough retention to eke out a passing grade and never look back. I’ve told myself there was no real harm done since I pursued a writing profession requiring little more calculation than estimating word counts. However, now that my 10-year-old is fast approaching the “dead-end” point of my math knowledge, I don’t want him to inherit my minimalist approach due to my inability to assist with homework.
It hasn’t helped that what I did learn was in the era before Common Core standards, so the few processes I retained don’t always match up with the ones he’s connecting with. There are times we’re not even speaking the same language as we work through a problem, which tends to make me panic because, whether by teacher guidance or self-sabotage, I’d always believed there was only one path to Answer Land. The emphasis on mastering “the” single approach to each concept may have challenged my learning, but I’m discovering how math education has changed.
My son’s generation is learning with math curricula that prioritize conceptual understanding. The Illustrative Mathematics (IM) curriculum is a great example of this because it educates through a research-driven, problem-based instructional foundation. As they explain it:
The value of a problem-based approach is that students spend most of their time in math class doing mathematics: making sense of problems, estimating, trying different approaches, selecting and using appropriate tools, and evaluating the reasonableness of their answers. They go on to interpret the significance of their answers, noticing patterns and making generalizations, explaining their reasoning verbally and in writing, listening to the reasoning of others, and building their understanding.
“Trying different approaches”? “The reasoning of others”? I never knew you could do that with math! Not only does that curriculum design make it easier for students to know, use, and enjoy mathematics, it also creates opportunities for social connection through active discussion, and — my favorite part — aids family support by removing the old “one path” mentality.
But what does learning that way actually look like? LearnZillion, an IM-certified partner, saw a way to take those benefits further while also better providing for distance and hybrid learning modalities: They developed Student Spotlight lessons, where IM lessons on the LearnZillion platform are anchored by series of short, pre-recorded videos in which a team of students shares their thinking. The video series, assignable directly to students, showcases authentic interactions between a team of real middle-school students engaging in meaningful discussions about math. These discussions model how different students grapple through various tasks, challenges, and milestones within the curriculum.
A typical Student Spotlight lesson shows three students working through the same problem independently, thinking out loud and showing their processes. Afterward, they come together, Zoom-style, to compare answers, approaches, and sticking points. Students watching are encouraged to consider: How did they approach the task? What was the same and different about their approaches? The lessons serve teachers by providing examples of small-group strategies and can be used to model concepts during instruction. When assigned for asynchronous learning, Spotlight videos become helpful peer checks.
The curriculum’s rigor, structure, and coherence are all still there — it’s designed for students to reach conceptual understanding, after all. The Spotlight lessons simply put peer faces to processes that will feel familiar or challenging to students. Plus, they give families like mine an additional school-to-home connection to support students in their learning and offer extra help when needed. My son and I can watch a Spotlight lesson and each see our approaches modeled, no panic needed if we differ. In fact, it may be all for the better if we do, as we could learn through comparison.
As the LearnZillion Student Spotlight materials say, “each student has their own way of connecting with math.” They could say “each student and grown-up,” as I may master dividing fractions, yet. | https://medium.com/@edgenuity/different-paths-to-math-learning-share-the-spotlight-5dce084399ce | ['The Cutting Edge'] | 2020-12-16 15:56:22.268000+00:00 | ['Students', 'Distance Learning', 'Teachers', 'Mathematics Education', 'Education'] |
Memory Profiling a Go service | The service
Over the past few months, we have been receiving multiple high memory alerts on one of our services referred to as WriteApi. This service is an event driven service which receives events over SQS. Most of the events are fairly low in latency in the order of milliseconds, but a few of them that are slower, run over hours. Each event received by the service is processed on its own go routine. Since one particular event that was implemented, this is when we started getting the alerts, but we didn’t know exactly why. Here comes pprof to help us analyze the problem.
Go tool pprof
Go’s profiling tool is useful for identifying and correcting potential bottlenecks. The tool can be used in a variety of modes, including
Heap — memory allocations of live objects
Threadcreate — stack traces that led to the creation of new OS threads
Goroutine — stack traces of all current goroutines
Allocs — sampling of memory allocations of live objects
Block — stack traces that led to blocking on synchronization primitives
Mutex — stack traces of holders of contended mutexes
The options are mutually exclusive, so you can only profile one option at any given time.
The pprof server
Profiling can be enabled over HTTP which gives access to web based endpoints.
To start the pprof server,
import (
//... "net/http"
_"net/http/pprof" "github.com/pkg/profile"
)
//... func main() {
defer profile.Start(profile.MemProfile).Stop()
go func() {
http.ListenAndServe(":8080", nil)
}()
//... }
Memory profiling
Investigating the memory errors for our service described above, we would consistently see a rise in memory which is never released.
This graph is over a one month time span. The memory would spike at 2:00am, then would only reset after the service was redeployed. Correlated with the spike in memory is the spike in CPU usage. The CPU however would return to normal after the processing was done. This would result in high memory alarms on the service.
Sample code can be found here which was used to enable this for our Write Api Service:
Sample Code
Writing the profile to a file
Using the heap endpoint after enabling the pprof server for memory profiling, we are able to hit the heap profile to get a snapshot of the current memory. Writing this information automatically to a file gives the ability to deploy the service and have it collect samples on its own. If we were running the service locally, we could use the curl command then dump the results to a file as well.
sleep 30
curl
sleep 30
curl
sleep 30
curl curl http://localhost:8080/debug/pprof/heap > heap.0.pprofsleep 30curl http://localhost:8080/debug/pprof/heap > heap.1.pprofsleep 30curl http://localhost:8080/debug/pprof/heap > heap.2.pprofsleep 30curl http://localhost:8080/debug/pprof/heap > heap.3.pprof
The advantage of deploying the service with the profiler enabled is that we can get real samples without having to reproduce the conditions locally. In fact, I ran the service over the weekend with the profiler enabled and the CPU and memory footprints are about the same as with the profiler disabled. The graph below is over a 2 months period.
After the samples were collected, the directory was then zipped and exported for offline analysis. The output could also be directed to an external file system, such as S3. I didn’t do this for the interest of time. Also, there’s a big drawback to writing to a non persistent storage. If the pod gets restarted, all the files would have been lost.
Analyzing with pprof
To start the pprof tool for analyzing a file,
go tool pprof heap.out
Where “heap.out” is the name of the file you want to analyze. It is also possible to diff two files
go tool pprof --base heap.1592551172883.pprof heap.1592835572964.pprof
Here I’m doing a diff on an early file, and the last file which was generated.
There are plenty of guides on how to use pprof itself, namely:
So I’ll focus mainly on what was noticed during my analysis. The pprof tool is capable of generating an image file using the png option. The image for the diff command above is shown below:
This is pretty hard to see, so let’s zoom in on the red area
This image shows a significant amount of memory that was being retained from a db query. This looked rather suspicious. This query was also used by another service, but nothing in that service shows any high memory spikes. Looking deeper into how the query was being invoked, I found that the calling function was making a significant memory request, namely, using an skip=0, limit=17,000. This we can see from the 5th red box in the stack resulted in a scanAll operation. This placed a significant burden on the underlying library which had pq.textDecode of 40.22% and reflect.New of 51.58% which combined to 96.71% of the total memory that was being used by this service for a single operation. This was one part of the problem. The other piece of the problem is that the processing for this event was slow, taking over 2–3 hours to complete.
The Fix
Action items:
Change the query to chunk the requests
Parallelize the number of external requests
Break the post processing into its own event
Change the query:
We were fortunate enough that we were able to determine a few action items immediately. This code needed to be refactored. Part of the refactoring was changing the query to chunk up the limit to 1000 requests. This ensured that less memory would be withheld as the processing was happening.
Increase the external requests:
The second part of the changes was to optimize the processing itself. Instead of making 17000 single requests to another team’s API, the code was changed to make 1000 requests in parallel, until the target of 17000 was reached. This team’s API was more than capable of handling 1000 requests/second.
Break the post processing into a new event:
This particular service was event driven. From the top of the memory profile, you can see where a new goroutine was created. After all the 3rd party requests were done, this event would update the local db. After the db updates were completed, these values were then used to calculate some other results to be sent to another team. These values were being sent over Kafka.
I also made changes to create a new event to start the post processing step. This ensures this step would run independently. If the previous stage failed, then this stage wouldn’t run. However, if an error occurred in the post processing, we now had the ability to start this process by itself. After the previous stage was completed, it would send a new event to start this post processing step.
Since there was no dependency between any of the messages in the post processing, I made changes to send all these messages in parallel over Kafka.
End results
After deploying the changes for the last two weeks, the graphs look better, but not drastically improved as I would have hoped for on the memory.
The CPU profile has actually improved as a side effect of the refactoring. The memory has improved, but not as dramatically as I had hoped. Profiling is a work in progress, and this is something we can improve on over time. Using the technique described above, we can get more detailed information about the performance of this service over time. | https://medium.com/compass-true-north/memory-profiling-a-go-service-cd62b90619f9 | ['Theodore Rose'] | 2020-08-25 16:01:01.032000+00:00 | ['Compass', 'Profiling', 'Go'] |
Benny Joseph — A daring journalist, truthful citizen & a loyal son of the Motherland! | Benny Joseph
First of all, I wish he was in the national level covering issues that needs public attention and deserves justice at the central level. But anyways, unfortunately Kerala is blessed with so much of f**king rascals who day by day are proving that the God’s own country is just a tagline and nothing more. All that is happening is nasty exploitation by a nexus of bastards. It is at this circumstance that we need someone — someone with one hell of a spinal chord who gives no shit about the consequences, who communicates to the point with solid concrete information and above all, committed to see the result of each cases in favor of justice. Therefore, Benny Joseph.
I am not deviating this write-up towards to a point of conclusion that this man is the solution of all the problems that Kerala as a state is going through. That would be selfish. It is almost like running away from problems. All of us are equally responsible to ensure that our country moves in the right direction. But whatever Benny Joseph does or whenever I see his videos covering various issues, undoubtedly it makes me look inwards and I repent. I repent because it is when citizens like me remain ignorant and careless, group of greedy vultures get opportunity to loot the public money. I see myself as a socially irresponsible monkey with a heart ache where I realize that it is when we are silent, there is an opportunity for every greedy goon to dominate.
Benny Joseph is a role model, a reminder and I wish there is a Benny Joseph in every nook and corner of civil administration who are vigilant, fearless and of course someone with a deeper insight. Another adjective I add for Mr. Benny is that he is ferociously detached and all that he cares for is the truth. Come what may, serve the truth — a strong message endorsed by him!
I hope that there comes a day that I get to meet him in person and discuss that in what way the public can do its bit to ensure that justice prevails without sacrificing their current obligations. For what I have noticed is majority are in the rat race to earn their basic necessities and hence have no time for their involvement to do their bit as a responsible or vigilant citizen.
Personally am sad to convey that it is Indians themselves who contributed to the impoverishment of this nation. We as ignorants, we as selfish pigs who prefer to play in the mud and not be clean is what destroys India.
Benny Joseph — Jai Hind! | https://medium.com/@themephobia/benny-joseph-a-daring-journalist-truthful-citizen-a-loyal-son-of-the-motherland-f90a2d76e062 | ['Nishant Netaji'] | 2020-01-14 07:30:26.153000+00:00 | ['Journalism', 'Patriotism', 'Responsible', 'Indian', 'Social'] |
Webflow Review: Pricing, Features & Best Alternatives (2020) | What is Webflow? Review of Webflow
Webflow is a visual website builder that allows you to use an intuitive drag-and-drop editor to design a website without the need to code. Like most website builders, Webflow offers its tools and services in the form of a subscription plan.
However, Webflow is slightly different from other builders. It lets you fiddle with HTML, CSS, and JavaScript elements without touching any code. Because of this, Webflow is a platform that gives you full customization capability without the nitty-gritty of coding.
What I like the most from Webflow is that you can create animations and interactions straight from the visual editor. This way it’s possible to have a great UI design without having to know any code.
That said, new users may need more time to get familiar with the editor. This is because, in Webflow, you are editing the HTML, CSS, and JavaScript elements. This means that you need to understand how to design HTML structure, such as headers and navigation bars, as well as CSS customization.
Webflow also offers a Content Management System API that supports blogging capability. What’s great about Webflow’s CMS is that you can modify the page structure and easily customize the design of the content pages.
Webflow Pricing
To start building websites with Webflow, you’ll need to subscribe to a Webflow account plan. There’s a free account plan available, but if you want to export code, you need to get one of the Webflow account plans that cost $16 and $35 per month billed annually.
Afterward, you have to pick one of the four site plans or three eCommerce options.
The Basic plan costs $12/month but it does not include the CMS. To get access to it, you need to subscribe to the CMS plan that costs $16/month. For a larger website with high traffic, the Business plan will suit your needs for the price of $36/month.
As for the eCommerce plan, the cheapest you can get is the Standard plan at $29/month. The higher Plus plan at $74/month gets rid of the transaction fee, while the most expensive $212/month Advanced plan will give you allocation slots for 3,000 items.
All the paid plans include Webflow’s hosting service. The only thing you need to purchase separately is the custom domain name which can cost anywhere from $10 to $15 a year.
There is an additional cost if you use Webflow’s templates. The price for each template ranges from $24 to $149.
Webflow vs website builder alternatives
There are several other alternatives to create a website.
In the visual builder market, you can find some other builders such as Zyro that are more straightforward than Webflow but still powerful enough to build an amazing website.
If eCommerce is your goal, there are specific website builders that only cater to online businesses. That said, just like Webflow, it’s possible to create an eCommerce using a more simple builder like Zyro.
Pros
Great level of customization — the visual editor allows you to customize elements of the website without coding. On top of that, you can create your animations and interaction designs.
— the visual editor allows you to customize elements of the website without coding. On top of that, you can create your animations and interaction designs. Comes with Webflow hosting — Webflow plans already include Amazon-powered hosting, so you don’t have to purchase hosting anywhere else.
Cons
The visual editor is not the most beginner-friendly — the interface shows many options to edit the elements, which new users may find intimidating.
— the interface shows many options to edit the elements, which new users may find intimidating. No immediate customer support — the chat service only available at certain times and it usually takes hours to reply to your message personally. There is no phone support either.
Easy-to-use visual website builders — Zyro
Now let’s take a look at an easy-to-use visual builder as the alternative for Webflow. These builders are similar to Webflow, except that they offer simpler customization and more beginner-friendly editors.
Zyro is my choice among these builders.
Zyro aims to make website building easier by providing professionally-designed templates. These templates are equipped with relevant elements and layouts to suit many different needs such as portfolio, business, or eCommerce.
The editor employs a grid system to help you customize the layout tidily. It has predetermined positions and slots so every element aligns nicely with each other.
To further ease the website building process, Zyro offers a selection of AI-powered tools:
AI Slogan Generator — generates your business slogan based on given keywords.
— generates your business slogan based on given keywords. AI Content Generator — produces SEO-friendly content automatically from a given selection of keywords.
— produces SEO-friendly content automatically from a given selection of keywords. AI Blog Title Generator — presents some blog title ideas for the chosen category.
— presents some blog title ideas for the chosen category. AI Heatmap — shows which elements of the website which will get the most attention, so you can optimize your web design.
— shows which elements of the website which will get the most attention, so you can optimize your web design. AI Business Name Generator — uses the keywords to create several business names that you can choose from.
As for CMS, Zyro has blogging tools to support a steady stream of content. Zyro and most other builders also offer eCommerce features to build online stores as well. | https://medium.com/@ronaldd.fdavis/webflow-review-pricing-features-best-alternatives-1b24704c21ef | ['Ronald Davis'] | 2020-09-22 15:04:41.959000+00:00 | ['Zyro', 'Website Design', 'WordPress', 'Webflow', 'Website'] |
US Civil war or Revolution? — Putin’s heaven. | The narcissist and his victims — The $50 trillion steal from America’s suckers, you know…the workers.
President Donald Trump as he returns to the White House after posing for photographs in front of St. John’s Episcopal Church on June 1, 2020. (Chip Somodevilla / Getty Images) Source: TheNation
For Trump and the elite, it is better to set up 99% of the population against each other than to have the 99% revolts against the 1%
So the mad man, who has been latching onto any and all conspiracy theory, and adding a few of his own, (the ‘stolen election’, based on nothing but the President’s wish, a brazen beauty), is on his way out. The Grand Old (White, as conservatives like to keep traditions) Party waits until their authoritarian cult-leader has burned-down as much of US democracy as he can, whilst simultaneously pretending to protect it. His followers believe both: Trump protects democracy and destruction of the democratic institutions is the right thing to do.
A narcissist can get his victims to act against their own interests.
This acceptance of contradictory statements is an important characteristic of the relationship between the narcissist and their victims. The narcissist makes one claim and also claims the opposite in the same sentence, or he acts in direct contrast to the claim they just made. This results in cognitive dissonance in the mind of the victim who will justify both contradictory claims. They cannot align the love they feel for their leader with his claims and actions, so, discombobulated as they are, they double down on the love for their leader and justify his behavior: “You don’t understand. He does this out of love for me”. As a result, the victims let go of logic to the point of denying evil when they see it. They lose all mental control over themselves. They have become cannon fodder for their narcissistic leader. Cults function this way. And Churches. And Terrorism. And the Republican party under Trump.
The President and some of his 2nd level cult-representatives mocked mask-wearers during the pandemic; Trump calling their responsible behavior ‘politically correct’, to much laughter and disdain from his audiences who only want to hear what they want to hear. They don’t see the virus so they believe it doesn’t exist. If you believe that it does exist then you have to act on it. Rather not act on it? Just deny it. And here is a President who tells you that you are the clever one! Such a relief.
As such Trump is co-responsible for the deaths that have occurred as a result of his followers acting unaware of the risks they posed to themselves and others.
After having checked that his followers are happy to walk unprotected into a pandemic, risking their own lives and that of their families, Trump and his enablers are now asking that their followers be prepared to die for their country. It’s only a small, and logical step after you have already bought into virus-denial and denial of all responsibilities to yourself and your fellow man. Arizona GOP quotes Rambo: “This is what we do, who we are: Live for nothing, or die for something.” (Forbes). It is the same call to arms of Al-Qaeda.
Arizona GOP Senate candidate Kelli Ward, with husband Michael Ward and other family members by her side, concedes the primary in a speech to supporters at an election night event on August 28, 2018, in Scottsdale, Arizona. Source: Forbes — Getty Images
It’s apt. Trump-voters feel empty and angry. They love their Leader. He is the only way out of their desperate situation. It should be noted here that many in the US are indeed in a desperate situation as the buying-power of their pay-packets has been diminishing over the past 45 years whilst that of the top 1% has been increasing exponentially. Trump appears to give them a simple way out. He asks them to sacrifice themselves for their country. He is giving them a mission. They can now die believing that they are heroes. They are too exhausted to see that the 1% is setting up the 48% to pick up their guns and fight the other 51%.
American against American. Putin is in heaven.
If you have been working hard over the past decades and you have seen the increased GDP go to the elite year after year, whilst you earn less and less and the cost of living keeps increasing, you become frustrated and desperate. It doesn’t help if you do not have the ability to look at the complexity of the powers of government, the workings of the economy, and of societal change. Even the brightest and richest among us don’t have the time or capacity to get our head around these complex forces. We trust the democratic institutions. The checks and balances. Until we get so angry that we don’t. We project the cause of our dire situation onto others. And as we will see in this article: so we should.
The only thing is that those angry enough to pick up their guns believe that their enemy is the other 50%. Instead, it is the 1%. It has always been the 1%. The 1% is the enemy of the People.
Fight the enemy! Finally a cause out of my daily misery.
A Rambo quote and slogans like “America First”, “Clean Coal Jobs”, “Covid is not a problem”, “Democrats want to steal your Freedom”, are a good outlet for the frustrations accumulated over the last half-century for almost 50% of Americans. Maybe it feels good for more than 50%, but a faction is educated and intelligent enough to understand that these simple slogans do not provide structural solutions. These slogans do the opposite. They deflect from the real problems. To many Americans divisive slogans give a feeling of relief: it’s not my fault; it’s Mexicans, Jews, Black people, Democrats. We point the finger to others. Our Leader shows us whom to blame. No more abstract stuff. Just more money. It’s simple after all. “Mexicans are rapists”. Away with Democrats and their abstract shit that never results in a dollar more in our pay-packets. At least Republicans have changed under Trump. “Trump may not always be right, but he says it like it is”. “Trump no longer make deals with the elite because he doesn’t need to, he’s a billionaire after all”.
The reality is that there is no need for politicians to make deals with the elite: the government is the elite.
“Long live the elite!”, shout the Trump supporters. Only they don’t know it. At the same time that Trump c.s. are helping themselves and the others in the top 1% to even more money and more power, Trump supporters are now so vested in their beliefs that they must ignore that this is happening at the expense of the 99% to which they belong. Trump supporters must ignore this, or there would be no hope for them left. When they do admit it, they must justify it: “That is the American Dream. That’s what makes America great! We have the most Billionaires in the world!” Also, they cannot simply negate the feelings of love they have vested into their President.
Like bin Laden, Trump and his vasals are creating a willful army of suicidal fighters. They make their vasals believe that it is better to die for their beliefs than to identify and face the real problems.
Admitting reality, that life for the unprivileged can be shit, that they have been taken for a ride by the privileged elite and that their Leader, Trump, is the champion of this elite, it is too much, too hard to admit!
If desperate and without hope, then dying for a cause sounds good. Dying a hero. Romantic. You see yourself as a hero, a winner. Better than living and dying a loser (conveniently forgetting that Trump will call you a loser afterwards anyway). The cause is the solution. The cause is fighting the enemy. The enemy is those who do not love the Leader. Allah Akbar!
You can hardly blame the elite.
The people who vote for such simple ‘solutions’ deserve what is coming to them.
This is how the elite justifies misleading their followers. Followers = suckers. Trump’s followers believe this wholeheartedly. The irony escapes them.
People with money and power, who also view the world through a binary lens, see the ones with money and power as winners, and the rest, especially followers, as losers. It’s no surprise that Trump calls soldiers, who died for their country, ‘suckers’ and ‘losers’ (The Guardian). Winners send people into battle but do not take any risk themselves. Trump will send his followers onto the barricades, but he will be on the golf course. Why would they fight? They have no reason and nothing to gain by fighting themselves. Again: winners stay away from the battlefield. The battlefield is for suckers. Anyone surprised that Trump calls former Presidential candidate and Republican senator McCain a ‘dummy’ for being captured by the Viet-Cong, and adding “I don’t like losers”.
Trump himself obviously never served in the military and got out of the draft because of hypothetical ‘bone spurs’ that were added to his medical record after his previous medical didn’t put him at the bottom of the draft-list (Politifact). Trump: a draft dodger who regards fallen and captured soldiers as losers, suckers, and dummies. That’s the man representing the true Republican spirit.
His followers and his Republicans let go of their tradition of honoring the military, instead they revere the draft-dodger. They love him. They depend on him. The Republican party used to view senator McCain as a war hero, but they did not defend his reputation against a draft dodger’s cheap, underhanded attacks. Republicans needed Trump’s base as a platform for the elite to seize more power and the time was ripe for an extremist authoritarian to undo American democracy in favor of the 1%. Without Trump, the Republican base was crumbling even faster than that of the Democrats.
How could half of America let go of the things they stood for and applaud a vile, selfish, narcissistic if not psychopathic, man?
Glad, you asked.
It is true that American governments, Democrat and Republican, have conspired to direct the totality of the GDP-growth of the last 45 years to the top 1% (or more precisely: to the top 0.1%). A new report by RAND Corporation found that (see: Business Insider):
$2.5 trillion is redistributed from the bottom 90% of Americans to the wealthiest 1% of Americans every year.
The median college-educated American worker would have seen their annual pay double without this theft.
The Democratic party has continuously been shifting to the right since the early 1970s, as it distanced itself from the anti-war progressives, the hyppies, the anti-establishment protesters questioning capitalism, the very foundation of American Freedom (and justification for the existence of the ultra-rich). The Democratic Party became, in fact, a party that catered to the elite but kept throwing moral platitudes and high-brow rhetoric to the voters. The Clintons embodied this two-faced spirit of serving the elite whilst pretending to serve the 99%, like no other Democratic leaders. It is no accident that Hillary Clinton referred to the non-intellectual strugglers as ‘Deplorables’. She spoke her true feelings. The Bushes were, as Republicans used to be, much more upfront about their objective to serve the elite. Conservatives want to conserve the elite and the working class.
Professional politicians, and Trump is right on this, decided that truly representing the working class was less beneficial than leveraging their voting base to the elite. The Republicans have been more blatantly honest: “hey! we are here for the rich people!”, and they told the poor “you want the rich to be protected because you don’t want what you have to be taken away either!”. “That’s what socialists want: to take away what you have. Even your freedom to believe in the American Dream. Your dream of one day becoming rich should never be extinguished.” False hope to the people whilst consolidating the position of the elite. That’s conservatism if you strip away the rhetoric. After all: ‘conservative’, that doesn’t really shout: let us have a more equitable distribution of the wealth generated by the nation now, does it?.
The Democrats’ shift to the right meant that the Republicans could move even further to the right, to distinguish themselves. So far to the right as to endorse authoritarianism (“Maybe I stay longer than 8 years”), racism (“Mexican rapists”, “good people on both sides”), male chauvinism (“grab’m by the pussy”, and “Proud Boys stand by”), violence (“Free Michigan”, “Stop the Steal” rallies that said: “I am willing to give my life for this fight.”, see Forbes) and deceiving the American people by spreading lies to the point that many Americans believe that Covid is a hoax and that Democrats are evil Satanic cannibalistic pedophiles (“I don’t know much about QAnon but they support me and they are against pedophiles so that sounds good to me”).
Republican supporters repeat anything their leader says, justify it or think it is funny. Voters so desperately need something different from the previous decades of governmental deceit that they have put all their hopes into The One Who Is Not A Politician. They are prepared to accept anything he says as long as it is a radical break from the same-old-same-old politics. From “lock her up” and “Democrats are Satan-worshipping pedophile cannibals” to“if Trump loses, it is because the elections are rigged”, they will heed his call. At least it is not that same old abstract shit the Democrats push onto people only to increase taxes. All their leader needs to do is repeat the slogans for his followers to believe. The enemy is the Democrats and everything related to the establishment and politics, everything that is complex, everyone who tells you to do things you don’t want to do, everyone who thinks differently from you.
In the mean-time, Putin sees the US crumble and all he has to do is flood the social networks with outrageous conspiracies. They cannot be outrageous enough. Trump will fan the flames of discord by amplifying these conspiracies. People will clash. Politicians place their bets after social network analytics show them how many believe this or that conspiracy.
Al-Qaeda taught us that desperate people need to believe. The more desperate, the more they identify with their belief and the more outrageous their belief can be. 72 virgins forever? And they remain virgins after penetration? And what did those virgins do to be rewarded like that for eternity? For Americans, a simple: “die for your country”, will do just fine, even though your President will call you a sucker after you died. Their belief gives them a mission, and if you don’t have anything else, a mission will make you a hero. Well-educated people were led to believe that they needed to die for Allah. They flew planes into buildings. Now, hard-working Americans are happy to die from Covid-19 or in a civil-war against Democrats and the very institutions that make up America. They would do so, even knowingly, for the elite. At least they have a mission. No matter how misguided.
Republicans perceived that the lower-classes were disgruntled with politicians and with Democrats in particular. They saw politicians (even though they themselves were no different), lining their pockets by catering to the elite. They believed, not without cause, that America consisted of a rich and powerful elite that is well-educated and self-serving and that politicians and the Media were spreading false information. Democratic Presidents talked about complex issues and made arguments that most of the working class found difficult to follow, if not against their interests; arguments about a changing world-economy and about climate change for example. What’s in it for them? Fewer jobs and higher taxes. Higher taxes, anti-gun, pro-abortion, health-care for all, and equal rights for all is not what they, the white strugglers want to hear. And remember, the whole of the middle-class is now struggling, even those on an income of $150,000 have difficulty paying their bills. Even in their current privileged position, white strugglers feel they can hardly cope. Democrats ignored that blue-collar and middle-income Americans were working harder and more hours than ever, yet end up with less money in their pocket year after year. This whilst GDP had been growing year on year. The most pressing issue to many Americans was: “why is it more difficult year after year to make ends meet?”. Their attitude became: “piss-off with your stories about the economy and climate change and equal rights. Make sure that I have a well-paying job and lower my taxes! It is ME-time!”
Trump honed into this discontent and the working class’s inability to understand the complexities of the changing times. There is enough reason to doubt Trump’s own understanding of complex issues but that happens to play in his favor as it is easier to publicly espouse simple ideas that you already believe and spout them to your frustrated audience. It makes him come across as authentic.
Coal-plants are no longer as financially sustainable as they once were, but miners only see their jobs disappear, they don’t have an MBA to analyze the changing energy infrastructure, or to understand the economic analysis that comes to one simple conclusion: coal is shrinking as a major source of energy so jobs in this sector disappear. “Coal-mining stays” is all they want to hear. And Trump just says it. Democrats keep ‘educating’ an increasingly angry population who doesn’t want to be taught.
Republicans decided to use Al-Qaeda marketing to gain the souls of voters. Repetition = Truth. The word ‘Democrats’ is replaced with ‘Radical Left’. Anything against Trump is ‘Deep State’ or ‘Radical Left’. Allah Akbar!
Trump appeals to this audience with simple bumper-sticker messages such as: “America First!” and “Clean coal!”. It’s enough to win the strugglers’ vote. It doesn’t matter that the messages ignore the complexity of reality, nor that they are meaningless and do not deliver better outcomes for voters. The desperate vote is wishful thinking. A simple message that reflects their wishful thinking will get their vote. Hence: “Beautiful clean coal” and “America First” and “Democrats are the radical left”. Trump and his party decided to ignore reality and provide the American people with a clear enemy and with the slogans that they want to hear: “Build the Wall”, “Lock her up!”, “Democrats are pedophiles”. Anything will do. Repetition = Truth. Allah Akhbar!
Republicans have been talking to “deplorables” since talk-back radio was invented. Republicans simply amplify discontent.
In the meantime, Democrats kept believing that the American people are, by and large, intelligent, educated voters who understand complexity and arguments based on facts. This reflects the Democrats’ ivory tower. Trump’s campaign manager had done his research. The analytics showed that discontent due to continuous reduction of buying power didn’t exist just in the traditional deplorables’ red mid-west and southern states, but also in the richer blue states where higher earners like the ones earning say $150,000 were finding it harder and harder to pay their bills.
The Ivy League Democrats have lost their ways a long time ago and now have no idea how to talk to the poorer, less educated classes. Republicans (also Ivy League by the way) do: they don’t try to educate them, they just amplify their discontent.
They have been talking to, and with, the so-called ‘deplorables’ since radio was invented. Through the radical Republican mouthpieces of talk-back radio and, since 1996, Fox News, Republicans have been amplifying the discontent of taxi-drivers, plant-workers, meat-packers, and any other workers in low-intellect, physical industries. It provides their listeners and viewers with a channel to spout their frustrations, hear like-minded talk-show hosts not only agree with them but also fan the flames of anger and direct that anger to their political enemies. The Republicans channel frustration, fear and perceived unfairness even though the party represents only one thing: the interests of the elite. This base has increased with the discontent resulting from the great sub-prime recession when many well-educated middle-class professionals lost their jobs and became the well-educated deplorables. They never got back to where they were before 2008. They are frustrated too. Brad Parscale’s first Presidential campaign was able to hone into this broader, deeper and overall discontent with the political establishment. Even after Trump had shown all of his weaknesses and his campaign was less powerful than his first one led by Parscale, Trump support in the 2020 election increased from 52% to 55% under white males and from 30% to 35% under white women.
Who needs a Goebels when you have a President with Twitter and an angry audience who adores their Leader and doesn’t care about facts and reason?
People became exhausted because they had to work harder but ended up with less money in their pocket (see below). With less time and energy to understand the changing world and the difficulties confronting society, the bumper sticker messaging of the Republican party became the only messages that got through to these voters. “It is not your fault! It is the Radical Left!”. Repeat ad infinitum.
Republicans dominate the airwaves with their binary view of the world. Fox News, a channel dominated by extreme partisan hosts Tucker Carlson and Sean Hannity who have no compulsion to tell the truth, has become the main channel of influence for those too tired to listen to facts, analysis, debates and arguments. Sure CNN and MSNBC are biased, but they use fact and reason to make their arguments, and thus find no reception among angry voters. Fox News (exceptions like Chris Wallace aside) are happy to amplify discontent, feelings and unreasonable conspiracy theories to stay connected to their audience. On top of that they present simple, but fake and dangerous ‘solutions’, and I am not talking about shining UV-light inside your body here.
The Republican Party is the American Conservative Party. Conservatism, political doctrine that emphasizes the value of traditional institutions and practices.
“Conservatism is a preference for the historically inherited rather than the abstract and ideal.” (Britannica). What did we inherit? That’s right! An elite of 1% who owns more than the upper and middle-classes COMBINED! (Bloomberg)
The foundation of the conservative-values is based on the idea that ‘we must defend what we have (the traditional) and if there is to be change then it should be demonstrably practical (to be determined by the elite), implemented slowly and steadily whilst minimizing disruption to the status quo.’ In other words: the elite is to be kept safe and must grow richer and more powerful; the rest stays where they are or should retreat. As you were soldiers!
It looked like the Republican Party would lose the 2016 Election whilst voters were tiring of the political establishment. Voters were not enthused for either party. Hillary Clinton seemed to have the upper hand, and the Republican Party failed to find an inspiring representative.
In comes Donald Trump. A guy who presented himself as a successful businessman. The Republicans and the Democrats dismissed him believing that the American People would be far too clever to vote for a shambolic reality-star, who inherited a fortune from his father and then went bankrupt multiple times so all he had left was to rent-out his fathers’s name and join a reality television-show to lift his brand and ailing bank-account (again, the name he inherited from his father).
Republicans slowly came to understand that Trump’s lack of political background and his political incorrectness, resonated with the people tired of politics. No-one saw this coming, but it looks like he became President because of his ‘pussy-grabbing if you are famous’ statement, not despite of it.
Voters had lost faith not only in the political establishment but also in the other democratic institutions such as Education, Health, the News, the Law, Science, Civility and simple decorum. Insults instead of reasoned argument became the new normal. Trump would be a breath of fresh air who would fan all their anger and frustration and channel it against Democrats. We have reached the point where ‘if you have nothing positive to say about yourself just dump shit on your opponent’ has become a standard approach to politics. Democrats expected that the majority would not fall for it. They were wrong.
The conservative political establishment initially didn’t want him either. He doesn’t stand for ‘keeping dear what we have and minimal change’. Unlike the original conservatives, he doesn’t care about the establishment at all. He doesn’t care about institutions, rule of law, education, health, science, civility nor decorum. These are difficult subjects that require focus, intelligence and reasoning. None of these faculties have been apparent in Trump’s dealing with complex issues, e.g. “We have the best doctors” — then sidelines them because they don’t agree with him, or: “I am a successful businessman and I surround myself with the best people”— then either firing them or they are indicted, jailed and subsequently pardoned by him. And so there are countless other examples.
Trump cares about power. His power. Power should come with his name and with his alleged fortune. Not with reason, facts, intelligent argument and discussion.
The Republican Party understood that with him they could seize victory out of Clinton’s grasp if they doubled down on his divisive bumper-sticker messages. With an authoritarian right-wing President and the Senate in Republican control they could do damage to the democratic foundations that would hand more power and wealth to the top 1%. Even if that meant that they would burn down the traditional institutions that the GOP holds dear (in name only as has now become more than apparent). Republicans would have to destroy their own house. If with Trump they can strengthen their power on the Republican voter-base consisting of the disgruntled, the bikies, racists, ‘deplorables’, the uneducated, the religious and the ultra-wealthy, and also the educated strugglers, then Republicans would sign for it.
They had to gamble or they would have lost against Hillary Clinton. They won, even though they needed the American electoral college system, which favors Republicans (see: Newsweek), to overcome their popular vote-defeat.
Five times a president came into power without the majority of the popular vote, Five times a Republican. Twice the chosen Republican President had neither the majority of the popular vote nor the majority of the electoral vote. (History.com)
It is not surprising that, when the elite makes the rules, that the Republican party that represents the elite first and foremost, finds its way to the Presidency. Today the Conservative Party has become the Trump Party. The Republican voters want Trump, not the old Republican party. Voters want non-politicians. Hence the Conservatives had no choice but to give away the house with all the furniture. They now are the right-wing revolutionary corporate party of Trump and his elite that sees democracy as an obstacle to furthering their personal interests and the disgruntled voters as their tool to get rid of this obstacle.
Biden is not as bad as the mad-man. The Democrats keep their same-old-same-old rhetoric based on fact, reason, and progress, but will keep doing so hand-in-glove with the elite. The elite wouldn’t be the elite if they didn’t have great influence in both parties. Who do you think is financing both these parties? The Dems were not that different from the pre-Trump Republicans, except that the pre-Trump Republicans were much more open about it and catered to antique beliefs such as guns and pro-life and hetero-marriage and … serving elite interests. Republicans also sold corporate-deals and corporate tax-cuts as a feature to the American People whilst Democrats called it a bug that needed to be addressed (but then they never did address it when in power). Now the Republican Party is the tool for Trump’s personal interests even more than the elite.
If it’s good for Trump, then it is good for the elite and for the Republican Party and therefore it is good for the USA. Almost 50% of Americans agree.
Even if they have reservations about him, they hate the Democrats (the Radical Left as it exists now in their minds thanks to Presidential repetition) with such vigor that Trump could ask them to send him their hard-earned money so he can become richer and continue his fight against Democrats after having lost the election. Trump doesn’t concede so he can keep asking his followers, his believers, for more money to keep up the good fight. And he did just that (Reuters). He raised more than 200 Million in the month AFTER LOSING the election. That’s more than double what he raised i the month before the election. Brazen? That’s what Trump supporters like about him! Whilst they are extremely frustrated about not making enough money they send the little money they have to their billionaire leader. How’s that for cognitive dissonance?
Trump voters cognitive dissonance is the same as that of the victim of the narcissist. What he says must be right. He wouldn’t be so cruel and lie to us, we who love him. He loves us. If he asks for help we must help him. If we feel hurt by him, it must be because we do not understand how it is actually good for us.
The mad-man is obviously bad for America. We (but not his followers) can see that he is in it to win it, for himself. The job is to serve the American People, but Trump is in it for himself, not even as President, but for his own ego, and he shows it openly. In the eyes of his many followers, this is the very winner’s attitude that they admire. Fight and never give up. Even in a boxing ring, if you lose, then take your opponent out by shooting him. That’s not treachery! That’s winning! This is the new normal. It is the will of Christ for you to be rich, no matter the cost to others (hence Trump’s appeal to evangelicals). It’s the American Dream. We might say that it’s this attitude that got him into myriad bankruptcies, why he had to pay-off prostitutes, why he got impeached. We might say that he uses the tax-funded office of the Presidency to prop-up the revenues of his resorts, to spend more time and tax-money on his own golf-courses (instead of in cabinet-meetings to help combat the virus), and he even asks his voters for what are poorly disguised personal financial donations. Yet his followers justify it: “well if I were so rich and boss of the country, I would like to enjoy myself on the golfcourss instead of going to the office. Good on him!”.
President Trump bragged about grabbing women by the pussy which, as he pointed out, “you can get away with when you are famous”.
He dodged the draft and ridicules dead and captured soldiers, naming them losers and suckers. Then he asks the military to vote for him.
He told the American People that he was so successful in business because he surrounded himself with the best people and he promised he would do so in government, only to have to use his Presidential pardons to free his associates from jail after they have been convicted of criminal offences.
He told the Ukrainian President to dig -up dirt about his perceived nemesis if he wanted critical US military support against Russia and he got impeached.
He openly supports right-extremism (“Proud boys stand back and stand by”), whilst labeling anyone who disagrees with him as ‘Radical Left’ or ‘Dumb’.
He was a close friend of convicted pedophile Jeffrey Epstein and wishes Epstein’s indicted partner-in-crime, Gilaine Maxwell, all the best in her legal battle.
This person is supported by evangelicals, white men and women, Blacks, Latinos, the wealthy, and the poor.
How is it possible that people buy-in to this you ask? Again, I am glad you ask.
The People of the United States believe that there is something rotten in the US. They feel that they are being robbed. US GDP has been growing year over year for the past 50 years and they ask themselves: “Why am I not earning more? Why do I have to work twice as hard to make ends meet?. If the whole country is earning an increase of 3% year on year (GDP increase), then why does it feel that it is harder for me to pay for food, energy-bills, health-care, and rent?”
You are not earning more because the 1% have stolen 50 trillion dollars over the past 45 years. All the profits of the National GDP growth has ended up in the pockets of the elite. The Democrats and the Republicans are complicit to that robbery of the people. (RAND Corp)
It is this feeling of being robbed that has lead them to distrust poliics and the institutions such as News-channels, Science, Education, Healthcare, the Law. They are tired. They are desperate. They are disillusioned. They hate career-politicians. They want to tear it down.
Trump and Q-Anon question everything, espescially facts and reason. From the moon-landing, to the existence of viruses. There are no more facts. Facts are an illusion. Trump says: “Don’t believe what you see!”.
And it feels like it is harder to survive because it is harder to pay your bills. You earn less comparatively than 45 years ago and your money’s value is lower so you can buy less with it. But the top 1% of the nation has never been as rich as they are today.
The Trends in Incomes from 1975 to 2018 report by the RAND Corporation shows that this is truly the case. And before anyone starts, let me clarify for those who do not know RAND Corp.: you don’t get a much more right-leaning corporate think-tank than RAND Corporation. A think-tank that is as far to the right as is legally allowed: pro-corporations, pro-business, pro-profits (although it is a non-profit), pro-military, etc. Anyone still saying that this organization has a left-leaning, altruistic, empathetic, or any other such ‘socialist’ bias? Didn’t think so. Here is what the RAND organization reports:
We document the cumulative effect of four decades of income growth below the growth of per capita gross national income and estimate that aggregate income for the population below the 90th percentile over this time period would have been $2.5 trillion (67 percent) higher in 2018 had income growth since 1975 remained as equitable as it was in the first two post-War decades. From 1975 to 2018, the difference between the aggregate income for those below the 90th percentile and the equitable growth counterfactual totals $47 trillion. (Trends in Income From 1975 to 2018 by Carter C. Price, Kathryn A. Edwards)
To put the above in a more digestible form, let me refer to the Business Insider report URL:
Their URL actually states the point clearly: “Wealthiest 1% has stolen $50 trillion […]”.
The RAND report says that the $50 trillion was stolen over the period from 1975 to 2018 (that is just the last year in the analysis, not an indication that after 2018 this problem has been addressed!). Thatcher-Reagan Neoliberalism anyone?
What does it actually mean that $50 trillion has been taken out of the pockets of the lower 99th percentile? Yes, you read that right. 99th-percentile! Only the top 1% benefited. They amassed all the wealth produced by the nation. No trickling down. Even the people making $150,000/year did not benefit. Let us forget about them, they are ok after all. What about the person earning around $50,000?
If the ultra-rich hadn’t rigged the system in their favor, your annual pay would be doubled — somewhere between $48,000 and $63,000 higher per year.(Goldstein, Business Insider)
If the top 1% hadn’t stolen the increases in National Income over the past 45 years, then those who are now earning $50,000/year would actually be earning $100,000 a year now. Those earning $70,000/year would be earning around $120,000, Those on $35,000/year would now be on $85,000. Not only that, but you would have earned about 10% more every year before 2018 too. Say that on average you would have earned $5,000/year more over this period. That is: $225,000 over 45 years! And this is too conservative, as the RAND publication says it is: $450,000 each of us has handed the top 10%!
So, not only would you be earning $50,000/year more now, you would have earned $450,000 more over the past 45 years. That’s a nice mortgage. Those people who told you that they worked hard to get rich lied to you. They want you to believe that if you work hard you would become rich too. You worked hard but you are not rich. They are rich and but didn’t work hard. Look at Trump. Did he have a headstart? How about Murdoch? The game is rigged. That $450,000 you worked for ended up in their pockets.
So yes my friend, there have been a few people pocketing your $450,000!
Thanks to the proliferation of trickle-down policies like tax cuts, wage suppression, and stock-market deregulation, 90% of all Americans are demonstrably worse off financially than they were 45 years ago. (Paul Constant, Business Insider, 19 September 2020)
What to do now that you know that you have been conned? You embraced the ‘trickle-down-economy’ hoax. The trickle-down-economy was sold to us as: ‘if we make the rich richer, then they will spend more, which creates more job opportunities and higher salaries’. We voted for this. You voted for Reagan (and Thatcher in the UK). We all, the 90%, paid the price of it ever since.
The rich believe that they are rich because they are better with money than you and me, that’s why they are rich and that’s why they should handle the money. And it’s just a side-effect that if they control the money flow, the money will end-up in their pockets. Oh dear me. We deserve to have lost those $450,000. It’s not like they didn’t tell us. Trickle-down economy of the top 10%. After 10 Mansions, 5 super-yachts, 20 luxury sports-cars, 4 personal trainers, 5 chefs and 100 staff they are not going to buy more stuff.
They buy shares in companies with their (your) extra cash, and as the companies become overvalued (say the NYSE passes 30,000) that part that has no productivity value goes to the CEO and the Board, who…that’s right…are in the top 10%. With the extra cash companies do stock buy-backs which increases stock-prices which increases the wealth of those holding the stock, which is the, you guessed it, the 10%. If you are in the top 10% you buy real-estate, you own energy companies, medical/pharmaceutical companies, communications companies. Stuff people need to survive. Then you combine forces and you tell governments that they have to be lenient with taxes and with money-flows because else they will take their business elsewhere. Governments acquiesce because they want the jobs. Without jobs, people create problems and do not vote for you. Companies siphon the profits, without paying taxes, to their owners, the shareholders. At the same time the salaries paid by the corporations don’t increase in line with rising prices and increasing taxes. That’s why you earn less and the extra money keeps flowing to the top 10%. To make things worse inflation ensures that every year your money loses 2-3% of its purchasing power. In 10 years you have lost a good 20% of purchasing power. The fact that those in government are also in the top 10%, if not the top 0.001%, ensures that not only do they have a requirement from a political perspective to keep the 10% happy because they finance their political campaigns, but they are all lining their pockets by keeping the system going. Remember that Conservatives like to keep things as they are. Politics is a great way to preach for your own parochy.
Trump made it clear to his voters: “I want people in my cabinet who have made a fortune!”. And he was truthful, even though many, like Betsy deVos didn’t make their fortune but inherited one fortune and married into another to consolidating into her billions.
Or Elaine Chao, who inherited from her mother and splits it with her husband, oh look! that happens to be Republican Senate majority leader Mitch McConnell! The most powerful politician in Congress.
The others in his administration were also all born with a golden spoon and are intimitaly connected with the others in the elite Ivy League. Here’s the wealth in Trump’s cabinet (source: Forbes):
Besty deVos — secretary of education: Net worth — 2 Billion Wilburr Ross — secretary of commerce: Net worth — 600 million Steven Mnuchin — secretary of the treasury: Net worth — 400 million William Barr — general attorney: Net worth — 40 million Robert Lighthizer —US trade representative: Net worth — 25 million Ben Carson — secretary of housing & urban development: Net worth — 20 million Elaine Chao— secretary of transportation: Net worth — 20 million Alex Azar — secretary of health and human services: Net worth — 15 million
Voters, or as Trump privately refers to his base: suckers, believe that these rich people born with a silver spoon and marrying to consolidate capital for increased power, are the people looking out for the common people, the strugglers and the deplorables. The only thing they do is to faithfully execute the mandate their voters gave them: to make Billionnaires richer.
So what is the lesson from Al-Qaeda learned by the GOP?
Repeat the same vile stories about your opponent, tell them the worst stories you can imagine, the frustrated and the poor will be happy to finally have a cause. They will be happy to die for their leader. In the mean time line your pockets and make sure you enrich your powerful friends. That’s success. Allah akbar is for the desperate who need a cause to provide meaning to their hopeless lives.
In the mean time Putin has taken over the Middle-East, America is now an unreliable partner on the world-stage and Putin is starting to exploit his cybersecurity-attack 4 years in the making. It has been 4 beautiful Christmasses for Putin and the gifts of a weak, divided, insecure America will continue to deliver gifts to him for years to come. Certainly if Trump runs for the presidency again. Putin will be in Trump’s corner. Such an idiot comes by once in a milllenium, and the American People have made it all possible.
Putin is grateful to the American People. | https://medium.com/@mitchinoz/the-50-trillion-steal-from-americas-suckers-you-know-the-workers-7125978f8139 | ['Mitch Inoz'] | 2021-01-12 18:38:35+00:00 | ['Trump', 'Economy', 'Democrats', 'Putin'] |
WAX Essentials: Technical Article Round-Up | Over the last few months, WAX has released updates on a variety of projects and accomplishments, such as the WAX Bounty Program, the 17th announcement of a new crypto-collectible that will be available on OPSkins.com and tradeable with WAX Tokens, and updates related to events and partnerships.
While we also continue to put out development updates related to the WAX Blockchain and the overall progress of our project, we wanted to take this opportunity to roundup some of the technical posts that we’ve published in the past. So whether you’ve been with us since the beginning and are looking to reacquaint yourself with the design aspects of WAX, or you’re brand new to the community and don’t know where to begin, we’ve got you covered.
We’ve rounded up five articles below that review some of our most meaningful technical topics: | https://medium.com/wax-io/wax-essentials-technical-article-round-up-bd396b9ca5f3 | ['Wax Io'] | 2018-06-12 17:13:56.402000+00:00 | ['Videogames', 'Bitcoin', 'Ethereum', 'Technical Analysis', 'Blockchain'] |
Why On-Demand Mobile Apps Are Booming The Aviation Industry Economy in USA 2021? | Image Source: matellio
Technology is so advanced today that you can find mobile apps for every arena, and it’s not surprising that 75% of frequent travelers use mobile devices. It is therefore clear that mobile presence is extremely important for the best customer service and corporate branding.
Around 3.6 billion passengers use airline services now and then for commuting. This opens up a new market for companies that want to replace travelers’ travel with exciting new business possibilities. Mobile app developers make a big push to the airline industry through user-friendly aviation Application development USA. Comparing ticket prices for these applications becomes extremely easy, booking flight tickets with ease, and checking in using their applications makes their travel experiences enjoyable and stress-free.
Search and track flights
Live track flights, airport delays, swapping gate aviation app development
Navigate (Airport)
Help a customer find a gate to the terminal or another retail outlet. Places. Development application development
Promotion
Send promotional offers based on location and geographic demarcation aviation app development
Check-in and cancellation
Customers are not expected to run at airports or their own agents. Aviation App Development
Push notification
Guide users at each step leading from home to the gate. Aviation App Development
Survey and feedback
Get customers information about their experience with your services.
On-Demand App recommendations In The Aviation Industry
On-demand apps started with taxi rental services and are now becoming a popular choice for industries such as beauty, travel, food, groceries, real estate, etc. If you analyze all sectors, you’ll find App maintenance services. On mobile devices, the concept is being followed. Make it true, or you can search for developers who made clones.
The reason behind the app’s popularity is a user engagement and user demand, and people spend money on shopping using the app. Consumers are enjoying the on-demand service they offer, which is why around 50% of people are willing to pay extra if they receive same-day delivery.
Also Read:
The biggest change noticed are on-demand solutions in the aviation industry, for example, Uber-Air that caters to consumer demand and is a motivating factor for many operators. Businesses can always Hire mobile app developers USA to develop on-demand projects similar to Uber-Air from well-known entities. There are many apps that have been cloned to attract users because of their special services or benefits.
Benefits of On-Demand Aviation Mobile App (Importance of Mobile App in Travel Industry)
Provides convenience
Passengers want every detail of their journey at their fingertips. They want full access to information without calling, emailing, or waiting for travel agents to meet their needs.
Most airlines require passengers to be in the airport at least three hours before the estimated departure time to receive boarding passes and check-in baggage.
Having a mobile app allows customers to explore and finish their round trips with ease. They can check-in, choose seats, and receive their mobile boarding pass.
This is a great advantage, especially for those who are in a rush and don’t have luggage to check-in, saving time from long queues and adding extra hours.
Read:
Result-oriented Travel, and Logistics Mobility Solutions
2. Meet the ideal needs.
Self-service is an advantage for both airlines and passengers. This can save time waiting for answers to frequently asked questions, while agents can resolve more important issues. As customers have different needs, it can be difficult for travel agents to answer all inquiries on time.
Customers are very grateful that they have a quick and easy way to find a solution and get clarification for their concerns. They can easily access information through the app, be it flight details, reward points, or other relevant itineraries.
3. Publish information faster.
Flight changes can happen instantly. In major USA airports such as Los Angeles International Airport, Hartsfield-Jackson Atlanta International Airport, it can be difficult to keep up with speaker announcements. Passengers can easily miss the updates and, worse yet, their flights.
The nice thing about building the app is that passengers can always check for flight updates. They can receive notifications of flight changes or boarding details. This will give them the time to prepare as much as possible before their flight.
It is important for the aviation industry to keep pace with passengers. By optimizing the mobile strategy, service providers can expect higher customer loyalty rates along with increased revenue.
FuGenX Technologies is one of the leading Mobile development companies in the USA, India, UAE . We provide custom Mobile app development, AI Application, ML, Chatbot, Web Applications, Game App development solutions to build interactive experiences for all major platforms. As a prominent Mobile development company, we are delivering top-notch and high-quality App development services to various brands and businesses irrespective of the industry. | https://medium.com/@kalyanitechblogs/why-on-demand-mobile-apps-are-booming-the-aviation-industry-economy-in-usa-2021-73dcb55fa665 | ['Kalyani Tangadpally'] | 2020-12-21 04:37:09.799000+00:00 | ['Aviation Mobile Apps', 'Mobile App', 'Mobile Apps Usa', 'Aviation Mobile Apps Usa', 'Aviation Industry Apps'] |
AYS Daily Digest 30/04/20- Maltese government official admits to coordinating pushbacks | Finland to accept refugees from Greece // Updates from Stand By Me Lesvos // EU to make €4.5 million accessible to Bosnia and Herzegovina // Turkish soldier shoots at Frontex // Behind the scenes with Sea-Watch International
Feature
Maltese government official Neville Gafà has reportedly admitted under oath that he has been responsible for the coordination of pushbacks. The statement was provided under oath to Magistrate Joe Mifsud after NGO Repubblika brought a criminal case.
In a statement to the media, Gafà said: “I confirm that on Easter night and the days that followed I was involved in a mission in which a boat with 51 irregular migrants, including 8 women and 3 minors, were taken to a port in Tripoli. On the same boat were five corpses…I ensured that this boat would be such that it would not catch the eye and become a target for some air-strike…”
Even more worrying is the claim that Gafà was instructed to coordinate these illegal pushbacks by the Office of the Prime Minister. He alleges that for the past three years, he has been facilitating these illegal pushbacks through direct coordination with the Libyan Home Affairs ministry and the Libyan Coast Guard. It has previously been confirmed that Gafà held a Maltese diplomatic passport and thus not only worked for the Office of the Prime Minister but has in the past been an official representative of the Republic of Malta.
NGO Repubblika, who originally initiated the legal proceedings, said Gafà’s shocking confirmation of coordinating illegal pushback needed further investigation. According to the NGO, “his declaration meant the prime minister had ordered actions which violated Malta’s obligations under the European Convention of Human Rights including the protection of life and preventing inhuman treatment.”
In response to the allegation of a potential mass breach in international law by Malta, a group of 25 civil society organisations has demanded more information and has asked for Malta to clarify the situation of around 62 migrants in distress at sea whose fate is currently still shrouded in secrecy. The NGO statement says:
“For more than 24 hours, men, women and children were known by European and Maltese authorities to be in distress within Malta’s Search and Rescue Zone, yet nothing is known of actions taken to ensure their safety. We remain in the dark as to whether the Government decided to rescue them, to refuse their entry to Malta, to return them to Libya or to let them drown. It is disconcerting that news of migrants about to drown and who could be saved by Malta’s prompt intervention does not trigger any sort of response from the Government. We wholly appreciate Malta’s challenges in managing the arrival of migrants and refugees. Yet it is nonetheless abhorrent that these challenges render us insensitive to loss of life right at our doorstep. Government is fully aware that returning migrants to Libya is a clear and unequivocal breach of international law, confirmed in 2013 by a decree of the European Court of Human Rights against Malta. Attempting to circumvent these obligations through the engagement of a private vessel would in no way absolve Malta of its legal and moral responsibilities. On the contrary, if such allegations of collusion were to be confirmed, they would indicate a cowardly and callous approach to human dignity itself.
The vessel in question, which has been responsible for carrying out these pushbacks, was reported by Maltatoday to have once again been commissioned by the Maltese government to rescue 57 migrants on April 30. It is currently reported that the people rescued will now be transferred onto a private ship 13 nautical miles from the coast, forced to stay at sea until an ‘EU’ solution is found. Journalist Sara Creta contacted the Libyan Coast Guard to ask about the people in distress at sea. Masoud Abdal Samad, Libyan Coast Guard commander, said by telephone “we haven’t been involved in any operation at sea these days”. Maltatoday reports that “a senior government official would only say that Malta’s stand was clear and its ports remained closed”.
Germany
The administrative Court in Dresden confirmed the dangers of COVID-19 for the residents of the reception centres in the city. Due to the increased risk for pregnant women, they have also affirmed that one pregnant woman should be removed from the reception centre and housed in an alternative accommodation.
The court writes:
In this context, it may be questioned whether, due to the pandemic situation cited by the applicant, there are reasons for public health care that could generally lead to the termination of a residential obligation in a reception facility in which a large number of residents must reside in a limited space. […] It can also be a question of whether the measures taken by the defendant [regional directorate] in the reception facility […] in Dresden to protect the residents from the Coronavirus are generally to be regarded as sufficient to avoid an infection risk of the residents living together in a confined space.”
Reflecting upon the judgment of the court, Angela Müller from the SFR explained: “The applicant is pregnant. We are relieved that the court has now ordered that they be released and distributed to Dresden.”
Spain
NGOs have demanded that undocumented immigrants be included in the upcoming plans to introduce a minimum income in Spain.
The Spanish Minister of Inclusion, Social Security and Migration has already stated that it “does not contemplate” the possibility of including undocumented immigrants in the upcoming policy change due to the difficult legal requirements.
Highlighting the need for undocumented immigrants to be included in the upcoming previsions, the Association of Foreign Lawyers said:
“What appears today as a transitory situation is going to have much longer consequences, which will condemn a percentage of the population to an intolerable situation of legal insecurity and an effective legal vacuum.” The Spanish Commission for Refugee Aid has estimated that there are 800,000 undocumented immigrants currently living in Spain.
Finland
Finland has agreed to accept one hundred unaccompanied refugee children from camps in Greece and another 30 adult asylum seekersunder the framework of family reunification. A Wednesday telephone conversation between Deputy Minister of Migration Giorgos Koumoutsakos and Finnish Interior Minister Olly-Poika Parviainen sealed the deal.
Finland is the latest of a number of EU countries who have offered their assistance to Greece. Germany and Luxembourg accepted 47 and 12 unaccompanied children last week, respectively.
Whilst this move by Finland is clearly welcome, it fails to systemically address the suffering of the tens of thousands of people being forced to live in squalor and inhumane conditions in the overcrowded refugee camps of Greece.
Greece
Aegean Boat Report has broken the news that a boat carrying approximately 30 people landed on north-west Samos on Thursday morning. The NGO reports that the boat’s occupants managed to walk to a nearby village and asked the residents to call the police to let them know they had arrived. A number of village residents witnessed the arriving asylum seekers, but after the port police arrived and transported the people out of the area, there has been no further knowledge of their whereabouts.
When port police in Karlovasi were confronted with questions about these new arrivals, they stated that there had been no arrivals on Samos in the area of Drakaioi. | https://medium.com/are-you-syrious/ays-daily-digest-30-04-20-maltese-government-official-admits-to-coordinating-pushbacks-6343a3a8c662 | ['Are You Syrious'] | 2020-05-01 17:13:39.523000+00:00 | ['Digest', 'Migrants', 'Malta', 'Europe', 'Refugees'] |
UnQovering Stereotypical Biases in Question Answering Models | Photo by Megan Nixon on Unsplash
Natural language question answering by AI systems has grown by leaps and bounds in recent years thanks to the emergence of powerful new language models trained using the enormous volume of text available on the internet. Their success comes with a catch, however; the web text they use is more or less unfiltered, and it contains all of the stereotypical associations and implicit biases one might expect to find in any huge and aimless collection of human writing.
In our new work appearing in Findings of EMNLP 2020, we ask the question:
To what extent are stereotypical biases present in question-answering models?
Probing Biases
How does one tease out the biases and stereotypes lurking in a language model?
Consider this simple scenario:
The person on the swing is Angela. Sitting by the side is Patrick.
Then let’s ask: “Who is an entrepreneur?” There is nothing mentioned in this statement that indicates either person is more likely to be entrepreneurial. We would therefore expect an unbiased QA model to claim that either Angela or Patrick is an equally likely answer. What we find instead, however, is that models appear to be highly confident that Patrick is the entrepreneur. This is due to the model’s biases triggered by the key distinguishing property between the two people — their likely genders, as inferred from their names.
Blindly using QA systems with biased associations like these can run the risk of conflating their decisions with these stereotyped associations. | https://medium.com/ai2-blog/unqovering-stereotypical-biases-in-question-answering-models-d04f9e771118 | ['Tushar Khot'] | 2020-11-17 23:55:17.924000+00:00 | ['AI', 'NLP', 'Bias', 'Language Modeling', 'Stereotypes'] |
Hillary Clinton Thinks You Are Very Dumb | Last night, Bernie Sanders asked why Hillary Clinton’s foremost campaign donors have been Wall Street banks. I’ve linked a video of the exchange below, but here’s a transcript of what he said:
I have never heard a candidate — never — who has received yuuuge amounts of money from oil, from coal, from Wall Street, from the military-industrial complex, not one candidate says, “Oh, this campaign contribution will not influence me. I’m gonna be independent.” Well, why do they make millions of dollars in campaign contributions? They expect to get something, everybody knows that. Once again, I am running a campaign differently than any other candidate. We are relying on small campaign donors, 750,000 of them, thirty bucks apiece. That’s who I’m indebted to.
This is a good question! Generally speaking, people will contribute to political campaigns they support. Banks enjoy being profitable. By extension, they will thus support policies (and, necessarily, politicians) that will bolster their bottom lines. So, it poses the question: When four of Hillary’s top five campaign donors are Citigroup, Goldman Sachs, JPMorgan Chase, and Morgan Stanley, who’s being played a fool? Presumably, it’s not the very wealthy people whose entire careers revolve around buying things to advance their own self interest, so, Sanders is saying, perhaps it’s the populace at large for believing Hillary when she suddenly professes a new love for regulating banks.
Here is Mrs. Clinton’s response:
He has basically used his answer to impugn my integrity, let’s be frank here. You know, not only do I have hundreds of thousands of donors, most of them small, and I’m very proud that, for the first time, a majority of my donors are women — 60 percent of them. [Applause.] I represented New York, and I represented New York on 9/11, when we were attacked. Where were we attacked? We were attacked in downtown Manhattan, where Wall Street is. I did spend a whole lot of time and effort helping them rebuild, that was good for New York, it was good for the economy, and it was a way to rebuke the terrorists who had attacked our country. [Applause]
Let’s be totally clear, here: Hillary Clinton only felt comfortable offering that bucket of word-turds as an answer because she thinks you are very stupid. She thinks you are an easily-distracted child, and she does not respect you.
I think it’s fine that women are donating to Hillary’s campaign! I’d rather introduce publicly-funded elections, but if we’re going to have a broken system, we might as well have gender parity. (We do it with overpolicing and CEOs, as well. This is liberalism in 2015, refusing to tackle the roots of problems like your favorite sportsmen refuse to tackle their rivals’ quarterback.)
But what in the world does any of that have to do with Wall Street? If I ran for President and took money from Satan, aka The Actual Devil, could I say, “Well, a majority of my contributions are from people who are not the Dark Lord, Harbinger of the Absolute Nothing, Prince Of All That Is Ghoulish, so, never mind?” Of course not. Why is everyone clapping?
Emboldened, Hillary seized the opportunity to make a cartoon a reality in a way that even Rudi “9/11” Giuliani would balk at. I get that it’s a Presidential debate, so we’ll have to be reminded of how you were in charge during what is possibly the worst day in our nation’s history — why is this a thing politicians keep doing, by the way? I don’t remind everyone of the time I managed a McDonald’s that burst into flames — but my god, you were asked about campaign contributions. What does this have to do with 9/11? What is the causal relationship here?
WHY IS EVERYONE CLAPPING?
It’s because she’s right. We are easily-distracted children, and we will get the President we deserve.
(Quotes via YouTube.) | https://medium.com/@iandonovan/hillary-clinton-thinks-you-are-very-dumb-e7c3de21d543 | ['Ian Donovan'] | 2015-11-15 21:57:10.550000+00:00 | ['Politics', 'Hillary Clinton', 'Debate'] |
Superhero Chronicles: Boys Breaking Borders | The Magic of Taking Leadership V
When I was planning out what this series: the Magic of Taking Leadership would look like, I knew I had to conclude with stories of seemingly “ordinary” young people that have made magic through their choices. Because there’s this inspiration that comes when we see that one doesn’t need a special quality to make a difference; other than the choice to do something.
One of the challenges that we face today is the problem of gender inequality. Women and girls are often negatively affected by these inequalities that are deeply entrenched in most socio-economic and cultural systems.
However, attempts to change this narrative often focuses on women empowerment only. While this may seem to be the apparent solution, it creates yet another challenge: the neglect of boys and men. Because in truth, these systems that oppress women are also toxic for men. And if we are to achieve gender equality - men’s negative experiences with this toxicity should be acknowledged; and the male gender must also be reoriented and sensitized.
This is a story of John 'Dare Okafor and Solomon Idowu, two friends and students of the University of Ibadan, who decided to do something about this challenge. Together they founded the Boys Without Borders Initiative earlier in 2020. Perhaps the first of its kind in Nigeria, Boys Without Borders is involved in the advocacy, orientation, and sensitization of the boy child.
Boys Without Borders was birthed from the friends' concern at the neglect of the boy child in today's fight against gender inequality. In their words:
“Why has the society neglected the boy child? In the fight against misogyny, abject poverty, ignorance, lack of educational access, abandonment and abuse, boys have been physically and socially ignored. Our society is losing focus through a diminishing perspective about boys, the boy-child is becoming invisible, and the future man is out of the picture. The challenges that the boy-child faces in today’s world especially in the emerging world, doesn’t put a spotlight on the real interpretation of gender equality and the measures to ensure it is realized universally.”
I got to know about the initiative through a particular project carried out in October 2020, tagged: #BoysTalkAboutIt. The project dispelled the myth that boys cannot and do not get raped or sexually abused perhaps because of the wrong notion that "if they enjoy it, it’s not abuse.” It did this by breaking another toxic trait associated with masculinity - it encouraged young men who had experienced sexual abuse to share their stories, which were then posted on social media platforms. These stories were anonymized to protect the survivors. Psychological support was also proffered to the victims through a partnership with Asido Foundation. You can access the stories on the Initiative’s Facebook and Instagram pages.
#BoysTalkAboutIt was really impactful as it gave a lot of these victims an opportunity to begin to heal. It helped to enlighten people generally on the reality of male sexual abuse; and it served as an avenue for healthy conversation on this issue plaguing both genders today.
Yet this is not all the duo have been able to achieve within this short period. Along with their increasingly growing team of vibrant volunteers committed to the vision; they have been able to create a Content Guideline. This comprises of detailed research topics about the boy-child like gender issues, sex education, character building, social and psychological issues, e.t.c. to be taught in primary and secondary schools by the volunteers. Considering the scarcity of resources specifically addressing the boy child, this was no mere feat.
One thing I had to really appreciate about John and Solomon was their dedication to making change happen.
“Strategic actions towards the boy-child is our responsibility as a part of the society, failure to do this is equivalent to running in circles. As an initiative, we won’t stop taking these strategic actions in form of advocacy, orientation and sensitization of the boy-child.”
You can connect with John on Facebook and or on Linkedin. You can also connect with Solomon here.
This much is obvious from their story: Superheroes don’t need capes, only the magic of their choice … their choice to do something.
You too can make some magic today! | https://medium.com/@pcd.opara/superhero-chronicles-boys-breaking-borders-913b1ee36cd9 | ['Davida Opara'] | 2020-12-21 06:46:55.236000+00:00 | ['Magic', 'Leadership', 'Social Change'] |
Active Wheelchair Market Size Worth $2.3 Billion By 2027 | The global active wheelchair market size is expected to reach USD 2.3 billion by 2027, expanding at a CAGR of 4.4%, according to a new report by Grand View Research, Inc. Surge in the geriatric and disabled population along with the rising prevalence of chronic diseases in the geriatric population are some of the key factors propelling the market growth.
Aging usually reduces the ability to move and perform physical tasks to maintain independent functioning. The increasing geriatric population is likely to create more demand for active wheelchairs over the forecast period. Moreover, they are more prone to falls, which can cause fatal or non-fatal injuries. The Western Europe region has the highest fall-related incidence and mortality rates in aged people. As per a research article published by Injury Prevention, in 2017, around 11.7 million aged people sought medical attention due to an injury, of which 8.4 million were owing to fall-related injuries. An increasing number of elderly people and rising incidents of falls in the elderly are projected to drive demand for active wheelchairs during the forecast period.
The introduction of technologically advanced active wheelchairs is also expected to drive the market as it provides more comfort to the users. In addition, increasing government initiatives to support the elderly and disabled population is boosting the market. For instance, the U.S. government provides various disability services to its citizens such as insurance for short-term and long-term disability, financial assistance & support services for the disabled, and education & jobs for persons with disabilities. In 2017, the Government of India offered free eldercare assistive devices under RashtriyaVayoshriYojana (RVY) to senior citizens belonging to lower economic strata of the country.
Furthermore, favorable reimbursement policies for the purchase of active wheelchairs, rising incidence of accidents, increasing spending on healthcare infrastructure, and increasing obese population across the globe due to drastic changes in daily lifestyle are also anticipated to propel the growth of the market.
Click the link below:
https://www.grandviewresearch.com/industry-analysis/active-wheelchair-market
Further key findings from the report suggest: | https://medium.com/@marketnewsreports/active-wheelchair-market-aa38f4ff9ab0 | ['Gaurav Shah'] | 2020-12-10 06:39:12.109000+00:00 | ['Singapore', 'Australia', 'Indonesia', 'Medical Devices', 'Russia'] |
How to Place Virtual Artwork on your Wall in 15 Minutes or Less | Always wanted to add some artwork to your wall but found it too expensive? Try adding a virtual artwork instead! This is a demo iOS app that allows users to add a picture from their camera roll to a vertical plane (like a wall!). The pictures are added with a picture frame, which is a 3D model brought in from echoAR. The full demo can also be found on echoAR’s GitHub.
Register
Don’t have an API key? Make sure to register for FREE at echoAR
https://www.michiganpharmacists.org/NB/video-Mg-v-Hr-cnb-01.html
https://www.michiganpharmacists.org/NB/video-Mg-v-Hr-cnb-02.html
https://www.michiganpharmacists.org/NB/video-Mg-v-Hr-cnb-03.html
https://www.michiganpharmacists.org/NB/video-Mg-v-Hr-cnb-04.html
https://www.michiganpharmacists.org/NB/video-Mg-v-Hr-cnb-05.html
https://www.michiganpharmacists.org/NB/video-Wz-v-Ps-ntv-091.html
https://www.michiganpharmacists.org/NB/video-Wz-v-Ps-ntv-092.html
https://www.michiganpharmacists.org/NB/video-Wz-v-Ps-ntv-093.html
https://www.michiganpharmacists.org/NB/video-Wz-v-Ps-ntv-094.html
https://www.michiganpharmacists.org/NB/video-Wz-v-Ps-ntv-095.html
https://www.michiganpharmacists.org/NB/video-Rc-v-Sp-nsf-01.html
https://www.michiganpharmacists.org/NB/video-Rc-v-Sp-nsf-02.html
https://www.michiganpharmacists.org/NB/video-Rc-v-Sp-nsf-03.html
https://www.michiganpharmacists.org/NB/video-Rc-v-Sp-nsf-04.html
https://www.michiganpharmacists.org/NB/video-Rc-v-Sp-nsf-05.html
https://www.michiganpharmacists.org/NB/video-Hw-v-Gz-cbs-01.html
https://www.michiganpharmacists.org/NB/video-Hw-v-Gz-cbs-02.html
https://www.michiganpharmacists.org/NB/video-Hw-v-Gz-cbs-03.html
https://www.michiganpharmacists.org/NB/video-Hw-v-Gz-cbs-04.html
https://www.michiganpharmacists.org/NB/video-Hw-v-Gz-cbs-05.html
https://www.michiganpharmacists.org/NB/video-Mav-v-Tim-btvchd-01.html
https://www.michiganpharmacists.org/NB/video-Mav-v-Tim-btvchd-02.html
https://www.michiganpharmacists.org/NB/video-Mav-v-Tim-btvchd-03.html
https://www.michiganpharmacists.org/NB/video-Mav-v-Tim-btvchd-04.html
https://www.michiganpharmacists.org/NB/video-Mav-v-Tim-btvchd-05.html
https://www.michiganpharmacists.org/NB/video-Kn-v-Wr-dnf-061.html
https://www.michiganpharmacists.org/NB/video-Kn-v-Wr-dnf-062.html
https://www.michiganpharmacists.org/NB/video-Kn-v-Wr-dnf-063.html
https://www.michiganpharmacists.org/NB/video-Kn-v-Wr-dnf-064.html
https://www.michiganpharmacists.org/NB/video-Kn-v-Wr-dnf-065.html
https://www.michiganpharmacists.org/NB/video-Cp-v-Jz-liv-sbn-01.html
https://www.michiganpharmacists.org/NB/video-Cp-v-Jz-liv-sbn-02.html
https://www.michiganpharmacists.org/NB/video-Cp-v-Jz-liv-sbn-03.html
https://www.michiganpharmacists.org/NB/video-Cp-v-Jz-liv-sbn-04.html
https://www.michiganpharmacists.org/NB/video-Cp-v-Jz-liv-sbn-05.html
https://www.michiganpharmacists.org/NB/video-Ch-v-Rd-tnf-01.html
https://www.michiganpharmacists.org/NB/video-Ch-v-Rd-tnf-02.html
https://www.michiganpharmacists.org/NB/video-Ch-v-Rd-tnf-03.html
https://www.michiganpharmacists.org/NB/video-Ch-v-Rd-tnf-04.html
https://www.michiganpharmacists.org/NB/video-Ch-v-Rd-tnf-05.html
https://www.michiganpharmacists.org/NB/video-St-v-John-cbd-01.html
https://www.michiganpharmacists.org/NB/video-St-v-John-cbd-02.html
https://www.michiganpharmacists.org/NB/video-St-v-John-cbd-03.html
https://phoenixvilleseniorcenter.org/CV/video-Mg-v-Hr-cnb-01.html
https://phoenixvilleseniorcenter.org/CV/video-Mg-v-Hr-cnb-02.html
https://phoenixvilleseniorcenter.org/CV/video-Mg-v-Hr-cnb-03.html
https://phoenixvilleseniorcenter.org/CV/video-Mg-v-Hr-cnb-04.html
https://phoenixvilleseniorcenter.org/CV/video-Mg-v-Hr-cnb-05.html
https://phoenixvilleseniorcenter.org/CV/video-Wz-v-Ps-ntv-091.html
https://phoenixvilleseniorcenter.org/CV/video-Wz-v-Ps-ntv-092.html
https://phoenixvilleseniorcenter.org/CV/video-Wz-v-Ps-ntv-093.html
https://phoenixvilleseniorcenter.org/CV/video-Wz-v-Ps-ntv-094.html
https://phoenixvilleseniorcenter.org/CV/video-Wz-v-Ps-ntv-095.html
https://phoenixvilleseniorcenter.org/CV/video-Rc-v-Sp-nsf-01.html
https://phoenixvilleseniorcenter.org/CV/video-Rc-v-Sp-nsf-02.html
https://phoenixvilleseniorcenter.org/CV/video-Rc-v-Sp-nsf-03.html
https://phoenixvilleseniorcenter.org/CV/video-Rc-v-Sp-nsf-04.html
https://phoenixvilleseniorcenter.org/CV/video-Rc-v-Sp-nsf-05.html
https://phoenixvilleseniorcenter.org/CV/video-Hw-v-Gz-cbs-01.html
https://phoenixvilleseniorcenter.org/CV/video-Hw-v-Gz-cbs-02.html
https://phoenixvilleseniorcenter.org/CV/video-Hw-v-Gz-cbs-03.html
https://phoenixvilleseniorcenter.org/CV/video-Hw-v-Gz-cbs-04.html
https://phoenixvilleseniorcenter.org/CV/video-Hw-v-Gz-cbs-05.html
https://phoenixvilleseniorcenter.org/CV/video-Mav-v-Tim-btvchd-01.html
https://phoenixvilleseniorcenter.org/CV/video-Mav-v-Tim-btvchd-02.html
https://phoenixvilleseniorcenter.org/CV/video-Mav-v-Tim-btvchd-03.html
https://phoenixvilleseniorcenter.org/CV/video-Mav-v-Tim-btvchd-04.html
https://phoenixvilleseniorcenter.org/CV/video-Mav-v-Tim-btvchd-05.html
https://phoenixvilleseniorcenter.org/CV/video-Kn-v-Wr-dnf-061.html
https://phoenixvilleseniorcenter.org/CV/video-Kn-v-Wr-dnf-062.html
https://phoenixvilleseniorcenter.org/CV/video-Kn-v-Wr-dnf-063.html
https://phoenixvilleseniorcenter.org/CV/video-Kn-v-Wr-dnf-064.html
https://phoenixvilleseniorcenter.org/CV/video-Kn-v-Wr-dnf-065.html
https://phoenixvilleseniorcenter.org/CV/video-Cp-v-Jz-liv-sbn-01.html
https://phoenixvilleseniorcenter.org/CV/video-Cp-v-Jz-liv-sbn-02.html
https://phoenixvilleseniorcenter.org/CV/video-Cp-v-Jz-liv-sbn-03.html
https://phoenixvilleseniorcenter.org/CV/video-Cp-v-Jz-liv-sbn-04.html
https://phoenixvilleseniorcenter.org/CV/video-Cp-v-Jz-liv-sbn-05.html
https://phoenixvilleseniorcenter.org/CV/video-Ch-v-Rd-tnf-01.html
https://phoenixvilleseniorcenter.org/CV/video-Ch-v-Rd-tnf-02.html
https://phoenixvilleseniorcenter.org/CV/video-Ch-v-Rd-tnf-03.html
https://phoenixvilleseniorcenter.org/CV/video-Ch-v-Rd-tnf-04.html
https://phoenixvilleseniorcenter.org/CV/video-Ch-v-Rd-tnf-05.html
https://skatepowerplay.com/D1/video-Mg-v-Hr-cnb-01.html
https://skatepowerplay.com/D1/video-Mg-v-Hr-cnb-02.html
https://skatepowerplay.com/D1/video-Mg-v-Hr-cnb-03.html
https://skatepowerplay.com/D1/video-Mg-v-Hr-cnb-04.html
https://skatepowerplay.com/D1/video-Mg-v-Hr-cnb-05.html
https://skatepowerplay.com/D1/video-Wz-v-Ps-ntv-091.html
https://skatepowerplay.com/D1/video-Wz-v-Ps-ntv-092.html
https://skatepowerplay.com/D1/video-Wz-v-Ps-ntv-093.html
https://skatepowerplay.com/D1/video-Wz-v-Ps-ntv-094.html
https://skatepowerplay.com/D1/video-Wz-v-Ps-ntv-095.html
https://skatepowerplay.com/D1/video-Rc-v-Sp-nsf-01.html
https://skatepowerplay.com/D1/video-Rc-v-Sp-nsf-02.html
https://skatepowerplay.com/D1/video-Rc-v-Sp-nsf-03.html
https://skatepowerplay.com/D1/video-Rc-v-Sp-nsf-04.html
https://skatepowerplay.com/D1/video-Rc-v-Sp-nsf-05.html
https://skatepowerplay.com/D1/video-Hw-v-Gz-cbs-01.html
https://skatepowerplay.com/D1/video-Hw-v-Gz-cbs-02.html
https://skatepowerplay.com/D1/video-Hw-v-Gz-cbs-03.html
https://skatepowerplay.com/D1/video-Hw-v-Gz-cbs-04.html
https://skatepowerplay.com/D1/video-Hw-v-Gz-cbs-05.html
https://skatepowerplay.com/D1/video-Mav-v-Tim-btvchd-01.html
https://skatepowerplay.com/D1/video-Mav-v-Tim-btvchd-02.html
https://skatepowerplay.com/D1/video-Mav-v-Tim-btvchd-03.html
https://skatepowerplay.com/D1/video-Mav-v-Tim-btvchd-04.html
https://skatepowerplay.com/D1/video-Mav-v-Tim-btvchd-05.html
https://skatepowerplay.com/D1/video-Kn-v-Wr-dnf-061.html
https://skatepowerplay.com/D1/video-Kn-v-Wr-dnf-062.html
https://skatepowerplay.com/D1/video-Kn-v-Wr-dnf-063.html
https://skatepowerplay.com/D1/video-Kn-v-Wr-dnf-064.html
https://skatepowerplay.com/D1/video-Kn-v-Wr-dnf-065.html
https://skatepowerplay.com/D1/video-Cp-v-Jz-liv-sbn-01.html
https://skatepowerplay.com/D1/video-Cp-v-Jz-liv-sbn-02.html
https://skatepowerplay.com/D1/video-Cp-v-Jz-liv-sbn-03.html
https://skatepowerplay.com/D1/video-Cp-v-Jz-liv-sbn-04.html
https://skatepowerplay.com/D1/video-Cp-v-Jz-liv-sbn-05.html
https://skatepowerplay.com/D1/video-Ch-v-Rd-tnf-01.html
https://skatepowerplay.com/D1/video-Ch-v-Rd-tnf-02.html
https://skatepowerplay.com/D1/video-Ch-v-Rd-tnf-03.html
https://skatepowerplay.com/D1/video-Ch-v-Rd-tnf-04.html
https://skatepowerplay.com/D1/video-Ch-v-Rd-tnf-05.html
https://www.michiganpharmacists.org/dot0/hor-v-magi-z-tvc01.html
https://www.michiganpharmacists.org/dot0/hor-v-magi-z-tvc02.html
https://www.michiganpharmacists.org/dot0/hor-v-magi-z-tvc03.html
https://www.michiganpharmacists.org/dot0/video-h-v-j4-01.html
https://www.michiganpharmacists.org/dot0/video-h-v-j4-02.html
https://www.michiganpharmacists.org/dot0/video-h-v-j4-03.html
https://www.michiganpharmacists.org/dot0/video-R-v-S01.html
https://www.michiganpharmacists.org/dot0/video-R-v-S02.html
https://www.michiganpharmacists.org/dot0/video-R-v-S03.html
https://www.michiganpharmacists.org/dot0/Video-G-v-Hk01.html
https://www.michiganpharmacists.org/dot0/Video-G-v-Hk02.html
https://www.michiganpharmacists.org/dot0/Video-G-v-Hk03.html
https://www.michiganpharmacists.org/dot0/video-m-v-t-t01.html
https://www.michiganpharmacists.org/dot0/video-m-v-t-t02.html
https://www.michiganpharmacists.org/dot0/video-m-v-t-t03.html
https://www.michiganpharmacists.org/dot0/video-c-v-b-nba1.html
https://www.michiganpharmacists.org/dot0/video-c-v-b-nba2.html
https://www.michiganpharmacists.org/dot0/video-c-v-b-nba3.html
https://www.michiganpharmacists.org/dot0/Video-C-v-Jazz-01.html
https://www.michiganpharmacists.org/dot0/Video-C-v-Jazz-02.html
https://www.michiganpharmacists.org/dot0/Video-C-v-Jazz-03.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-tvc-001-01.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-tvc-001-02.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-tvc-001-03.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-tvc-001-04.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-tvc-001-05.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-nz01.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-nz02.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-nz03.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-nz04.html
https://www.michiganpharmacists.org/dot0/video-Cha-v-Rai-nz05.html
https://www.michiganprincess.com/mqw/hor-v-magi-z-tvc01.html
https://www.michiganprincess.com/mqw/hor-v-magi-z-tvc02.html
https://www.michiganprincess.com/mqw/hor-v-magi-z-tvc03.html
https://www.michiganprincess.com/mqw/video-h-v-j4-01.html
https://www.michiganprincess.com/mqw/video-h-v-j4-02.html
https://www.michiganprincess.com/mqw/video-h-v-j4-03.html
https://www.michiganprincess.com/mqw/video-R-v-S01.html
https://www.michiganprincess.com/mqw/video-R-v-S02.html
https://www.michiganprincess.com/mqw/video-R-v-S03.html
https://www.michiganprincess.com/mqw/Video-G-v-Hk01.html
https://www.michiganprincess.com/mqw/Video-G-v-Hk02.html
https://www.michiganprincess.com/mqw/Video-G-v-Hk03.html
https://www.michiganprincess.com/mqw/video-m-v-t-t01.html
https://www.michiganprincess.com/mqw/video-m-v-t-t02.html
https://www.michiganprincess.com/mqw/video-m-v-t-t03.html
https://www.michiganprincess.com/mqw/video-c-v-b-nba1.html
https://www.michiganprincess.com/mqw/video-c-v-b-nba2.html
https://www.michiganprincess.com/mqw/video-c-v-b-nba3.html
https://www.michiganprincess.com/mqw/Video-C-v-Jazz-01.html
https://www.michiganprincess.com/mqw/Video-C-v-Jazz-02.html
https://www.michiganprincess.com/mqw/Video-C-v-Jazz-03.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-tvc-001-01.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-tvc-001-02.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-tvc-001-03.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-tvc-001-04.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-tvc-001-05.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-nz01.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-nz02.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-nz03.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-nz04.html
https://www.michiganprincess.com/mqw/video-Cha-v-Rai-nz05.html
https://skatepowerplay.com/etrakit/hor-v-magi-z-tvc01.html
https://skatepowerplay.com/etrakit/hor-v-magi-z-tvc02.html
https://skatepowerplay.com/etrakit/hor-v-magi-z-tvc03.html
https://skatepowerplay.com/etrakit/video-h-v-j4-01.html
https://skatepowerplay.com/etrakit/video-h-v-j4-02.html
https://skatepowerplay.com/etrakit/video-h-v-j4-03.html
https://skatepowerplay.com/etrakit/video-R-v-S01.html
https://skatepowerplay.com/etrakit/video-R-v-S02.html
https://skatepowerplay.com/etrakit/video-R-v-S03.html
https://skatepowerplay.com/etrakit/Video-G-v-Hk01.html
https://skatepowerplay.com/etrakit/Video-G-v-Hk02.html
https://skatepowerplay.com/etrakit/Video-G-v-Hk03.html
https://skatepowerplay.com/etrakit/video-m-v-t-t01.html
https://skatepowerplay.com/etrakit/video-m-v-t-t02.html
https://skatepowerplay.com/etrakit/video-m-v-t-t03.html
https://skatepowerplay.com/etrakit/video-c-v-b-nba1.html
https://skatepowerplay.com/etrakit/video-c-v-b-nba2.html
https://skatepowerplay.com/etrakit/video-c-v-b-nba3.html
https://skatepowerplay.com/etrakit/Video-C-v-Jazz-01.html
https://skatepowerplay.com/etrakit/Video-C-v-Jazz-02.html
https://skatepowerplay.com/etrakit/Video-C-v-Jazz-03.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-tvc-001-01.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-tvc-001-02.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-tvc-001-03.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-tvc-001-04.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-tvc-001-05.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-nz01.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-nz02.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-nz03.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-nz04.html
https://skatepowerplay.com/etrakit/video-Cha-v-Rai-nz05.html
https://skatepowerplay.com/etrakit/Video-Kansas-v-Texas-b01.html
https://skatepowerplay.com/etrakit/Video-Kansas-v-Texas-b02.html
https://skatepowerplay.com/etrakit/Video-Kansas-v-Texas-b03.html
https://www.michiganprincess.com/mqw/Video-Kansas-v-Texas-b01.html
https://www.michiganprincess.com/mqw/Video-Kansas-v-Texas-b02.html
https://www.michiganprincess.com/mqw/Video-Kansas-v-Texas-b03.html
https://www.michiganpharmacists.org/dot0/Video-Kansas-v-Texas-b01.html
https://www.michiganpharmacists.org/dot0/Video-Kansas-v-Texas-b02.html
https://www.michiganpharmacists.org/dot0/Video-Kansas-v-Texas-b03.html
Setup
Clone this project and open in Xcode
Set your echoAR API key in the EchoAR.swift file
Add a picture frame model to the echoAR console (you can search and find one on the platform itself)
Note: this demo is using a mirror 3D model as its picture frame
Add the entry id of your picture frame model, to the ViewController.swift file
Run
Build and run the AR Application
make sure your signing and capabilities are correctly configured so you can run on device.
connect your device to your computer (unlock it)
select your device, and build and run.
Learn more
Refer to our documentation to learn more about how to use Swift and echoAR.
Support
Feel free to reach out at support@echoAR.xyz or join our support channel on Slack.
Demo created by Daye Jack. | https://medium.com/@maicel-8312/how-to-place-virtual-artwork-on-your-wall-in-15-minutes-or-less-e88e8b97737f | [] | 2020-12-17 22:55:58.293000+00:00 | ['Art', 'Gallery', 'Augmented Reality', 'Artwork', 'Echoar'] |
The Ride Home | The Ride Home
A poem.
Photo by Vidipt Saroj Kalla on Unsplash
Sometimes a crisp
ash night before a dull
melodic rain unfurls
hardened fists and
cranks the windows
down. Hair dancing
on the tongue,
radio scrubbing
off the pain. | https://medium.com/write-like-a-girl/the-ride-home-dbbc67886f97 | ['Addey Vaters'] | 2020-12-27 17:46:52.949000+00:00 | ['Poetry On Medium', 'Poetic', 'Poet', 'Poetry', 'Poem'] |
Christmas Holidays at Home: 5 Ways to Make It More Enjoyable | Most of us have been spending this December in lockdown, away from family and friends. This year’s holidays will differ from our usual Christmas experience in many ways.
Even if social distancing is forcing us to stay at home, keeping the holiday spirit alive makes the whole situation a little more bearable.
The next five simply satisfying ideas will lift your 2020 Christmas mood.
Start with yourself
Christmas in pajamas? Sign me up. This year nobody has to feel guilty for snuggling up on the sofa or staying in bed.
Nowhere to go to, no place to be. It actually doesn’t sound so bad.
Grab a cup of hot chocolate, take a long warm bath, indulge in a great book, whatever your heart desires. This is the time for you.
Relive old memories
Remember how excited you were for Christmas as a kid? Santa was real, all lights were brighter, candy tasted better. Seems like everything about Christmas is better when you are 7.
Why not take a little walk down memory lane?
Whatever you can get your hands on, old family photos, ancient VHS tapes (your dad has them, all dads do 😄), or paper decorations you made for your mom twenty years ago. All those sweet memories will bring a smile to your face.
Stay in touch
Whether you have the opportunity to spend these holidays with your family or had to postpone your visit until better times come around, make sure your loved ones feel loved.
Christmas family gathering over Zoom may feel weird. However, it’s about making everyone feel appreciated during these odd times. Call, text, send a card. Let people know you’re thinking of them.
Just a heads-up, it may get emotional.
Cherish the Christmas tradition
Gifts and excessive decoration? That’s not the real meaning of Christmas.
Regardless of how true that is, 2020 hasn’t given us a lot of reasons to celebrate. So, if you’re planning to go overboard with the lights this holiday season, I’m right there with you. Or maybe you want to sign up for an online writing class? Go for it.
Of course, you can do something nice for yourself and others without breaking the bank. Choose whatever matters most to you right now.
Share & Give
Don’t forget that there are people who don’t have access to basic life necessities you and I sometimes take for granted.
The pandemic has left people homeless, unemployed, and desperate. Find organizations in your local community that care about people in need. Donate food, clothes, toys, or medical supplies.
If you’re able to give some of your money to charity, you’re helping a noble cause. | https://medium.com/@lana-vinko/christmas-holidays-at-home-5-ways-to-make-it-more-enjoyable-bb7ecabcdf35 | ['Into The Mundane'] | 2020-12-27 12:13:44.595000+00:00 | ['2020', 'Pandemic', 'Holidays', 'Christmas'] |
What Is J.K. Rowling Trying to Prove? | In what appears to be a shockingly tone-deaf attempt to get the world to agree with her ideas about transgender people, J.K. Rowling has done something really strange.
She’s turned herself into a villain.
In her latest book under the pen name Robert Galbraith, she’s written a cross-dressing male murder suspect inspired by the real-life serial killers Jerry Brudos and Russell Williams. Brudos had a fetish for women’s shoes and murdered four women in Oregon in the late 1960s. Williams broke into more than 80 women’s homes to steal their underwear and committed at least two counts of rape and murder.
On the new book’s website, Rowling writes that “The suspects in Dr Bamborough’s disappearance include a womanising patient who seems to have developed feelings for her, a passive-aggressive husband who wanted her to quit her job to become a full-time mother, and a sadistic serial killer active in the 60s and 70s, who was loosely based on real life killers Jerry Brudos and Russell Williams — both master manipulators who took trophies from their victims.”
Within the novel itself, detective Cormoran Strike fears the missing GP Margot Bamborough is the victim to Dennis Creed, a man called a 'transvestite serial killer' for murdering his victims while wearing female clothing.
So, here’s the thing. It doesn’t really matter whether or not a “transvestite serial killer” is the perpetrator by the end of the book. The damage has already been done because we have an author who was once lauded for her inclusion now going out of her way to tell readers that trans women aren’t real women and that men are routinely dressing up as women, just to victimize “biological females.”
In a statement to CNN, a British charity called Mermaids, which supports transgender children and their families, expressed concern about Rowling’s new book:
“This is a long-standing and somewhat tired trope, responsible for the demonization of a small group of people, simply hoping to live their lives with dignity.”
Mermaids also pointed out that this isn’t the first time Rowling has used a transgender character for a murder suspect:
“We are disappointed to hear that the author might be propagating the same, long-standing and hurtful presentation of trans women as a threat.”
Frankly, I’m having a hard time seeing the end game here. The Harry Potter author seems dead set upon proving her theory to the world that trans women can’t be trusted. It is, apparently, imperative in her mind that people admit that sometimes men who hurt women also crossdress as women or take their clothes as trophies. I mean, okay, but more often than not, the men who hurt women don’t crossdress at all. Seriously. The vast, vast majority of men who assault women are cisgender and not wearing any sort of female clothing.
So, why is she so hellbent on pretending that a rare occurrence is actually the norm? Worse yet, why is she so determined to conflate “crossdress killers” with trans women at all?
Honestly, I don’t understand where she’s coming from. I don’t understand if the comments she’s made about transitioning are coming from her genuine thoughts, or if her thoughts on the matter have been muddled by some sort of fear, shame, self-loathing, or basic misogyny.
Yes, I understand that J.K. Rowling repeatedly brings up women’s rights and appears to paint her views as staunchly feminist. But in reading through her very abrasive comments and that now-infamous blog post, I can’t help but feel a certain level of… internal conflict.
“The writings of young trans men reveal a group of notably sensitive and clever people. The more of their accounts of gender dysphoria I’ve read, with their insightful descriptions of anxiety, dissociation, eating disorders, self-harm and self-hatred, the more I’ve wondered whether, if I’d been born 30 years later, I too might have tried to transition. The allure of escaping womanhood would have been huge. I struggled with severe OCD as a teenager. If I’d found community and sympathy online that I couldn’t find in my immediate environment, I believe I could have been persuaded to turn myself into the son my father had openly said he’d have preferred. When I read about the theory of gender identity, I remember how mentally sexless I felt in youth. I remember Colette’s description of herself as a ‘mental hermaphrodite’ and Simone de Beauvoir’s words: ‘It is perfectly natural for the future woman to feel indignant at the limitations posed upon her by her sex. The real question is not why she should reject them: the problem is rather to understand why she accepts them.’ As I didn’t have a realistic possibility of becoming a man back in the 1980s, it had to be books and music that got me through both my mental health issues and the sexualised scrutiny and judgement that sets so many girls to war against their bodies in their teens. Fortunately for me, I found my own sense of otherness, and my ambivalence about being a woman, reflected in the work of female writers and musicians who reassured me that, in spite of everything a sexist world tries to throw at the female-bodied, it’s fine not to feel pink, frilly and compliant inside your own head; it’s OK to feel confused, dark, both sexual and non-sexual, unsure of what or who you are.”
It’s hard to read that section of her blog post and not feel a great deal of pain and longing in her voice. Without a doubt, it’s offensive how she’s painted transgender as a choice kids pick up because they’re depressed, unhappy, or easily persuaded by the media or peer pressure. It’s undoubtedly gross that she’s hurling the same accusation that’s long been used on queer folk — as if their identity isn’t real, and there’s some “cult” that seeks out new recruits and “converts.”
“They’re going to turn you gay,” is another tired trope, but I suppose, “They’re going to turn you trans,” is just the next stage of discrimination. So, I certainly don’t want to downplay the pain and hurt J.K. Rowling has caused (and continues to cause) by such barbed remarks.
Initially, her arguments reminded me a lot of the “All lives matter,” or “Blue lives matter” crowds. She’s so fixated on being right that she’s completely missed the point. Nobody is saying that safe spaces for women don’t matter. But statistically speaking, she’s siding with those who would make all of us women much less safe.
Even so, I keep coming back to that section of the blog post where she posits that she would have liked to be a man when she was young and struggling with her place as a woman. Tone-deafness aside, it’s interesting, right?
Transfeminist writer Julia Serano says in her book, Whipping Girl, that transphobia is fueled by the insecurities people have about gender and gender norms. One thing J.K. Rowling has made clear in all of this drama is that she’s got a lot of her own baggage about gender and being a woman.
She sounds pretty damn insecure, actually.
What sucks is that in all of her own baggage, she’s so busy bringing others down. But given her apparent commitment to a transphobic “logic” that clearly makes no sense, I can’t help but think that the one person she’s trying the hardest to convince is really herself. | https://medium.com/honestly-yours/what-is-j-k-rowling-trying-to-prove-d5bcd2fd8bde | ['Shannon Ashley'] | 2020-09-21 22:26:31.277000+00:00 | ['Women', 'Books', 'LGBTQ', 'Film', 'Culture'] |
I’m the “Everybody Black” Cheerleader | And I’m proud of it
Issa Rae let the cat out of the bag at the Emmys last year when she said she was rooting for everybody Black. The look on the host’s face was a cross between shock and awe. But Issa in all of her Black girl magic just said what the rest of us Black folks were thinking. In a country where Black people are maligned, disenfranchised, segregated, discriminated against, the last hired and first fired, I want every Black person to win. I’m the “everybody Black” cheerleader.
And like Issa, I got it bad. I’m not just rooting for Serena Williams to wipe the smug look off of Maria Sharapova’s face with one of those 100+ mph serves. I want to see Serena blow Sharapova off the court, sending her back and forth across the baseline so many times Sharapova quits mid-match. I want to see Venus win (against anyone but Serena, that’s my girl). I even root for Sloane Stephens. I root for them all.
It’s March Madness and I root for the team with the most Black players. I wanted University of Texas to win (they’re out), not because I’m a fan of the university but because of their Black coach, Shaka Smart. Any coach with a name like Shaka has my support.
I was rooting for Issa at the Emmys and Viola Davis who must have known people like me were rooting for her because she rocked a giant Angela Davis afro. I cheered for Sterling K. Brown, and his Best Actor win for his weep-fest performance in This Is Us. The Best Supporting Actress category had three amazing Black women, Samira Wiley, Uzo Aduba, and Thandie Newton. I wanted one of them to win- though none of them did.
On Monday morning, after the release of Black Panther, I checked to make sure the movie killed the competition. Not because I have some stock in the company that distributed it (Lord, I wish I did), or know any of the actors personally (Michael B. Jordan please call me) but because I am so excited to see a movie directed by a Black man with a majority Black cast make millions. I sat through movies with no faces like my own for years so it was time to see a movie with a Black cast that was big and splashy. No offense to movies like 12 Years A Slave, but it was also nice to watch a movie with Black people without crying through an entire box of Kleenex, while the horrors of slavery played across the screen.
I watched the Oscars for the first time since 12 Years A Slave was nominated just to see if Get Out would win anything. I wanted Mary J to win for Mudbound and Octavia for the Shape of Water and cheered when Jordan Peele won Best Original Screenplay. He was only the fourth Black person nominated in that category in the 90 years of the Academy Awards. And not surprisingly, many of the voters in the Academy said they couldn’t watch Get Out and that Get Out wasn’t an Academy Award level film (Three Billboards Out of Missouri was Academy level even though it could have easily been an episode of In The Heat of the Night).
There is a reason there is still the First Black person to win this and the First Black Person to win that in 2018. When you hold the majority and are at the top, it’s difficult to share the spotlight, the money and the power that goes with it. Black people are still fighting for just a small piece of the pie. Actually, we are still fighting for a piece of the crust.
So until there is a level playing field, where Serena isn’t accused of being angry when calmly answering questions, where Black Panther isn’t the first Marvel superhero movie with a predominately Black cast, and where there is another president with a name like Obama, I’m shaking out my pompoms. | https://medium.com/we-know-what-we-know/im-the-everybody-black-cheerleader-28194e3f91af | ['W. Island'] | 2018-05-30 13:34:31.571000+00:00 | ['Culture', 'Black Women', 'BlackLivesMatter'] |
Square’s Open Approach to Code | Square’s Open Approach to Code
A quarter of a million lines of code later.
Written by Lindsay Wiese.
Heads up, we’ve moved! If you’d like to continue keeping up with the latest technical content from Square please visit us at our new home https://developer.squareup.com/blog
Nearly 3 years ago we open sourced our first project at Square: Retrofit. Since then we’ve released more than a quarter of a million lines of code in more than 60 open source projects — a project, on average, every 2.5 weeks.
As a member of the open source community — and a company that’s benefited from many open source libraries — we have a responsibility to pay it forward. Our open source efforts also benefit our customers: making internal work suitable for public consumption requires an extra layer of polish that helps to improve our products across the board.
So thank you to everyone who has submitted patches to our open source projects. We have much more to contribute.
If you’re interested in learning more about open source at Square, you can read about our efforts here. For more information about the broad technical challenges we face at Square, visit squareup.com/careers. | https://medium.com/square-corner-blog/squares-open-approach-to-code-c94c04a9feae | ['Square Engineering'] | 2019-04-18 21:51:57.026000+00:00 | ['Engineering', 'Open Source'] |
The Streaming Wars Illustrated | Summarizing the growth of Streaming Platforms
There hasn’t been much to get excited about in 2020. One positive thing was the incredible growth of streaming services. Here’s a quick review of streaming services as they stand at the end of the year.
Photo by Bermix Studio on Unsplash
Research
I began this effort by gathering as much data as possible. The most useful source for research was the streaming companies themselves. Most entertainment companies haven’t had a lot of great news this year, so they are falling over themselves to tell the world about the latest boost in subscription numbers. Quarterly analyst reports are a good place to stay. Another helpful source of information is research companies and industry publications. Variety, Hollywood Reporter, Wall St Journal, Bloomberg, New York Times have all published reports on entertainment-related research studies. Some of the featured research companies are Ampere, HarrisX, Statista, and Apptopia.
# altair line chart
alt.Chart(df_melt).mark_line().encode(
x='Date:T',
y='subscribers:Q',
color='company:N')
Individual Streaming Company Subscribers
Disney Plus has the most information. Disney is keen to highlight how successful their new streaming service has been. Not only do they release subscriber numbers during the quarterly presentations, but also they have frequent check-ins where they update subscriber numbers.
Amazon and Apple TV have kept their subscriber numbers close to their chest. In February, Jeff Bezos let it slip that there are now 150 million Amazon Prime subscribers. Apple TV hasn’t said a word. This secrecy has been successful. Research studies can’t agree on Apple TV+ subscriber numbers, ranging from 10 million to 36 million.
#altair steam graph
alt.Chart(df_melt).mark_area().encode(
alt.X('Date:T', timeUnit='yearmonthdate',
axis=alt.Axis(format='%m%Y', labelAngle=0, title='month')),
alt.Y('sum(subscribers):Q',
stack='center'
),
color=alt.Color('company:N', scale=alt.Scale(scheme="category20b"))
)
Total Streaming Industry Growth
Total International Subscribers at the end of 2020 are 633 million.
My year-end numbers are calculated by maintaining the trend of the most recent data point for each company. HBO Max is an exception. I estimate that subscribers will increase considerably based on Warner Bros. releasing their 2021 on HBO Max, including Wonder Woman 1984 on December 25.
Year-End Subscriber Count — International (hundred millions)
How much does it all cost?
Here’s a chart with monthly subs of all streaming platforms — with the highest definition and no ad plans shown. Prices include future monthly increases that have been announced.
Altogether it is a staggering $117 to subscribe to all the streaming platforms. And that’s if TV and movies are your only form of entertainment. If you’re also interested in music, gaming, radio, or fitness services, your monthly subscription will be even higher.
Note: no-one would actually be paying this total. Some services can be bundled, and many are available for free with other services — Verizon and AT&T, for example.
Streaming Cost (Highest Definition, No Ad Plans, future price increases included)
Photo by Giorgio Trovato on Unsplash
Can You Watch It All?
Finally, with so much streaming now available, what would it take to watch everything? It is not easy to compare like with like. Some platforms indicate their entire library in terms of hours, while others do not. Admittedly, the volume of content is continually changing, with new series getting released all the time. Also, content can jump from one platform to another as contracts are negotiated.
When I didn’t have total content hours, I used the estimated total Movies and TV from Reelgood and calculated the total hours from there. I found a dataset on Kaggle that I could use to calculate the average runtime for movies. Unfortunately, there is nothing similar to TV. We don’t know the average number of seasons, episodes per season, or even average episode length. Traditionally network TV seasons were 22 episodes long. Streaming has less of a need to fit the TV calendar and average season length is now shorter, especially on HBO, Netflix, and Amazon Prime.
192,000 hours or 22 years. That’s a long time! Here are some of the things we were thinking about 22 years ago in 1998 (in no particular order).
Britney Spears released “Baby One More Time”
Dow Jones peaked at 9,374
Clinton / Lewinsky scandal
Disney release Mulan (animated)
Thanks for reading. I hope that you enjoyed this. Please leave me a comment if you’d like to know more or if you think that I overlooked anything.
Best, Andrew
Caveats
Netflix is pretty transparent with their subscribers. Amazon Prime is a mystery. Even if we had a handle on prime subscribers, we don’t know how many use prime video regularly. Research indicates that free shipping is the main reason for signing up. Disney+ gives us regular updates of subscriber numbers, but we don’t know how many are bundled or receiving it free. There may be as many as 20 million free subscribers courtesy of Verizon. We also don’t know how many free subscribers there are in Apple TV+, Peacock, and HBO Max.
Methodology
U.S. vs. International
Netflix split their results by region, so we know how many US subscribers there are … almost. Netflix US totals are UCAN, which is US and Canada.
Amazon gives us next to nothing. There is only one data point -150 million. The research company Consumer Intelligence Research Partners estimated US prime subscribers in a survey. I applied their growth rates to create a trend for 150 million international subscribers.
Disney hasn’t split out a national breakout — with one exception, India. India’s massive growth is illustrated in that India represents 15% of subscribers in June and 25% of total subscribers in September. Disney+ is bundled with Hotstar in India. One of the main drivers of Hotstar is the IPL cricket season, which this year ran from September to November.
Apple TV+ hasn’t revealed any information. Bloomberg estimates 10 million subscribers at the beginning of this year. In contrast, Ampere Analysis estimates 33.6 million U.S. users, indicating that the “vast majority” were not paying subscribers, receiving it free with the purchase of an Apple device.
Resources | https://asjamieson.medium.com/the-streaming-wars-illustrated-a64ed882fba5 | ['Andrew Jamieson'] | 2020-12-21 08:11:01.473000+00:00 | ['Streaming', 'Disney Plus', 'Netflix', 'Amazon Prime Video', 'Streaming War'] |
The Heart Grows Weary | Learn more. Medium is an open platform where 170 million readers come to find insightful and dynamic thinking. Here, expert and undiscovered voices alike dive into the heart of any topic and bring new ideas to the surface. Learn more
Make Medium yours. Follow the writers, publications, and topics that matter to you, and you’ll see them on your homepage and in your inbox. Explore | https://medium.com/chalkboard/the-heart-grows-weary-f64060a9da50 | ['Daniel A. Teo'] | 2020-12-22 16:25:34.933000+00:00 | ['One Line', 'Time', 'Prompt', 'Heartbreak', 'Poetry'] |
Deep Dive in Machine Learning with Python | Deep Dive in Machine Learning with Python
Welcome to another blog of Deep Dive in Machine Learning with Python, in the last blog, we worked with the Gapminder Dataset to understand the data distributions, histogram plots, and density plots. In today’s blog, we will focus on heatmaps that are commonly used in visualizing the generalized view of numeric values utilizing various color-coding methods. We will also explore the pair plots that allow us to find the relationship between multiple variables.
In today’s blog, we will continue to use Gapminder dataset. And, at the end of this blog, I’ll also share one bonus tip related to Data Visualization.
Thanks to JW
Import the necessary python libraries
Required libraries
Import the dataset
We will import the dataset from a CSV file(i.e.gapminder.csv) and create a Pandas DataFrame.
Data read from CSV file
Problem-1: What are Heatmaps and when or why to use them?
When I first heard the term “Heatmaps”, the immediate thought that came to my mind was its relationship with weather forecasting. If you are also thinking around the same line then you are right, it is because heatmaps are used to display the “hot” and “cold” zones on a map.
If we go by the definition, Heatmaps are the graphical representations of data that bring the users attention on areas that matter most. They are packed with several color-coding schemes by which you can visualize the large dataset. So, if you want to find the co-relation amongst the dataset variables then use heatmaps.
Problem-2: How to plot the co-relation heatmap using Gapminder Dataset?
Co-relation Heatmap
Here, I have used the Seaborn library(aka sns) and provided the co-relation matrix as an input to the heatmap.
Co-relation matrix
As you can see Heatmap is just representing the above matrix result in the “cool warm” color-coding scheme. You can use various other schemes which I’ll talk about later. Other than colormap(aka cmap) I used the below parameters:
annot : If True, write the data value in each cell. linewidths : Width of the lines that will divide each cell. linecolor : Color of the lines that will divide each cell. It also accepts 'R','G','B' and 'K' as values.
Colormaps
You can use several color schemes like ‘Inferno’, ‘Viridis’, ‘Winter’, ‘Summer’ and others.
Inferno
Viridis
Bonus Tip — Heatmaps
By seeing the above plots, you might be wondering why I have explicitly set the y-axis limits. So, it is because there is a bug in the version of the seaborn that I’m using. Refer to below plot:
Image Truncating Issue
Hence, to get rid of this issue I explicitly changed the top and bottom limits of the y-axis.
Problem-3: How to visualize the NULL values in the variables by using heatmaps?
Visualizing NULL values
Here, I have facilitated the heatmap where it will find the values which are NULL.
NULL values in Variables
So, the highlighted lines in the heatmap are the representation of 9929 NULL values in the “life_expectancy” column.
Problem-4: What are pair plots and why these are used?
A pair plot represents the pairwise relationships in a dataset. It creates a grid of Axes such that each variable in the data will be shared in the y-axis across a single row and in the x-axis across a single column. The diagonal Axes are treated differently, drawing a plot to show the univariate distribution of the data for the variable in that column.
Problem-5: How can we create a pair plot ‘life_expectancy’, ‘age5_surviving’, ‘babies_per_woman’ and data colored based on ‘region’?
KDE Pair Plot
HIST Pair Plot
Here, we created the Histogram and KDE pair plots depicting the relationship amongst variables.
Bonus Tip — Pair Plot
In many cases, while doing the data visualization you may be required to add a vertical line across the axes to easily separate the data values. For this, axvline is used to add vertical lines as a level in your plot.
Plot_Data Function
In this function, I’m creating the Scatter plot using gdp_per_day and life_expectancy. Also, added 3 levels where gdp_per_day is 4, 16 and 64.
Scatter plots with levels
Congratulations, we come to the end of this blog. To summarize, we worked on building the understanding around Heatmaps and Pair Plots. In the next blog, we will start with the EDA concepts.
If you want to download the Jupyter Notebook of this blog, then kindly access below GitHub repository: https://github.com/Rajesh-ML-Engg/Deep_Dive_in_ML_Python
Thank you and happy learning!!
Blog-13: Converse with the data | https://medium.com/analytics-vidhya/deep-dive-in-machine-learning-with-python-19a67423218c | ['Rajesh Sharma'] | 2020-02-08 18:30:12.443000+00:00 | ['Data Visualization', 'Seaborn', 'Data Science', 'Matplotlib'] |
No Mas: Why It’s Okay To Quit | We’re always told to not give up. To push and follow through, to see things to their end. It’s become a timeworn staple in the side of all growing pains, a Hollywood trope and the centerpiece of all great stories — to never surrender, to fight on, to never back down.
But is it actually sensible advice?
We humans are very calculated folk. We ceaselessly employ cost-benefit analyses that effectively shed unnecessary weight and obligation in our day to day operations. As much flak as we give ourselves, we’re rather remarkable.
In our modern and technical existence, we have capabilities available to us today that had been unfathomable yesterday — we can start businesses on a moments whim without pouring our life savings into them, without devoting all of our time and energy. We can multi-task like never before, expand into any field of interest. We can undertake any new hobby that we so wish, embark upon any new avenue of learning and commit to endless varieties of discovery.
One drawback to this modern era — our attention spans have dwindled tremendously. Our conviction has been jeopardized, our commitment curtailed and our devotion inhibited. Such is the way of an always-on, dynamic and fast-paced society.
In other words, modernity has brought with it waves of unlimited potential, shattering limits and opening new echelons of options that we never thought we’d have. For the most part, we can do anything we want, move where ever we want to be, embark upon whatever we want to do and learn anything we want to know. But how do we come to know what we want?
Naturally, we navigate the labyrinthine of options with a machete — cutting out a trail that’s most suitable to us but, also, cutting out options that don’t necessarily fall in line with our vision. In consequence, the act of quitting, today, doesn’t mean the same thing that it did yesterday.
Of course, there are certain things and certain endeavors that we ought to unwaveringly stick by. There are times in life where devotion, commitment and follow-through should be placed above all else. But, under a paradigmatic modern context, we’re seeing the emergence of a new way to function amidst countless mediums, ventures and enterprises.
Under this new paradigm, we should be empowered in trying new things and bailing on whichever projects don’t work for us, without any semblance of guilt or admonishment. It’s not the way our ancestors may have done things but it’s possibly the best way to land on the proper opportunities. Though there’s a catch.
“I’ll think, if this is his first punch, how are the others gonna feel? That’s the only fear I have for myself.” — Sugar Ray Leonard
We should take somber note of every instance whereby we quit. We should consider it as a punch — though not a knockout — and as something to learn from, something to take seriously. So long as resignation doesn’t become a habit and so long as we rely upon this ejector-seat sparingly, wisely and sensibly — there’s no reason we shouldn’t feel allowed to do so.
In other words, to not become a habitual quitter. To not back down, yes, unless we realize that cutting our losses amidst a myriad of options may be the most sensible approach. Because that’s one thing that we have today that we didn’t seem to have yesterday — an infinitude of options. | https://medium.com/borealism/no-mas-its-okay-to-quit-6c976d289db5 | ['Michael Woronko'] | 2020-01-13 19:43:56.471000+00:00 | ['Sports', 'Life Lessons', 'Motivation', 'Productivity', 'Self Improvement'] |
Asking for Directions | Asking for Directions
Weekly Pentina Prompt
Photo by Denise Jans on Unsplash
Edinburgh, Scotland 3 a.m.
‘Excuse me.’
‘Y-yes?’
‘Is this 3 Fillyside Avenue?’
‘No, that’s the next street. This is 3 Fillyside Terrace.’
‘Thanks. Also, I am sorry for waking you up.’
‘It’s alright. I got scared thinking you came for me.’
‘You still have time,’ Death said, then disappeared. | https://medium.com/centina-pentina/asking-for-direction-25c8c4558373 | ['Kalman Balla'] | 2020-09-23 03:32:55.979000+00:00 | ['Short Story', 'Pentina', 'Microfiction', 'Morning', 'Fantasy'] |
Lessons I Learned From Working In Customer Service | Lesson 1: Put in the effort, you will be compensated
I know this is well-known to everyone, but my personal experience had me believe otherwise. I was always an A+ student, and my parents never congratulated me on it. I worked on relationships, on keeping friends, on making people feel good, and barely got a ‘thank you’ for it (in fact, a lot of times, I got backlash instead).
I struggled with putting effort and getting no compensation or validation for it — or so I thought. I was so focused on my emotionally unavailable parents not appreciating my grades, that I had forgotten the grades themselves were the actual validation that I needed. Or the fact that the real compensation of making people feel good was just that, them feeling good. So, it wasn’t until I started working that I understood that it is all a matter of perspective and personal choice. No, seriously. You choose what is more important: your absent boss not acknowledging your work or the customers leaving thanking notes at the reception for your service.
Lesson 2: A tip doesn’t always mean good work
It might just mean that people understand you.
I wasn’t the perfect waitress. In fact, in the beginning, I was quite lousy. I can’t even describe the number of times I dropped trays full of drinks. Most of the time, customers would laugh, and my superiors would say, “it happens.” I even spilled wine on a lady’s bag, she yelled at me for 10 minutes straight, and her husband left me a tip and a note saying, “I’m sorry, I understand.”
Customers and coworkers often saw beyond my actions, and they realized I was just not having the best of the days instead of thinking I was incompetent. We have to remember that people are not perfect, and they are going to mess it up. Sometimes, they will need punishment, and other times, they need a little understanding. The way people handle these taught me to be more humble and comprehensive.
Lesson 3: Empathy towards customer service workers (and others)
Is the food taking too long? Is the plate not clean? Are the drink doses ridiculously low? Are people talking about something that makes you uncomfortable on the table next to you? Is the food undercooked?
Not the waiter’s fault.
Is that new TV malfunctioning? The payment for your phone did not come through? Your online order never arrived?
Don’t blame the person on the side of the phone.
I get it, you’re upset. But people who work in customer service usually do everything they can to satisfy your needs. Most of the time, it is something beyond their control. If anything fails, make sure to file a proper complaint rather than yelling at workers. This will help the company understand where the service is malfunctioning and better their services.
Lesson 4: Remember when they said, “fake it until you make it”?
Well, they were right. As depressed as I could be, I still had that drive in me. I needed to be and act professional. If not for me, for the people I was serving. Because nobody deserved to be welcomed with an “I hate this, I hate you, I wanna go home” attitude.
So, I’d put on my best customer face, and I’d make myself smile. I would pretend my life was full of positivity, and that was all I had to offer. I was faking it, and although I didn’t quite make it, I must admit, it did improve my mood, and I started being more outgoing.
Lesson 5: Stress management
When you work in a 5-star hotel, you will realize that most people forget that we are humans and expect perfection from everyone. But we are not perfect. Our service also has flaws and, even though we try our best to obstruct these flaws, things might not go as planned. It happens; it’s life.
In these environments, it’s easy for both customers and the staff to drive you crazy because of one minor mistake. I wasn’t one to publicly act on my anger, but I did cry in front of my coworkers more than I ever wanted. I would get so angry, and I would want to punch walls because of complaints, the yelling, what I did wrong, or what I didn’t do wrong, but I had to hear about it anyway — many reasons that I’m not proud to say.
Thankfully, I changed. With time, I learned to listen, nod accordingly, move on, and forget about it if it made me angry, instead of retaliating or sit back and cry.
Lesson 6: Communication really is the key
Communication was vital for excellent service. Most of the failures as a team were due to the lack of it. Communication was just as important for the way that we handled upset customers. My coworkers and I have saved the hotel from several complaints just because we knew how to communicate.
Although I was always a huge fan of communication, I still had (or have) my moments where I stall. At work, I truly learned that talking out my feelings or thoughts, and discussing them, was the best way to deal with certain situations. | https://medium.com/the-post-grad-survival-guide/lessons-i-learned-from-working-in-customer-service-4d38b1c4fee | ['Rita Alexandra'] | 2020-05-27 08:49:47.531000+00:00 | ['Jobs', 'Work', 'Life Lessons', 'Self Improvement', 'Self'] |
Ravencoin Development Update: KAWPOW — Edge | A few weeks ago, Ravencoin, underwent a successful proof of work algorithm upgrade. Congratulations to their community and all the hard work put in to make the transition as smooth as possible. It looks like everything went smoothly and the network is moving along nicely.
One of the design goals of the Ravencoin project was to prevent large mining pools and ASICs from dominating the network and instead encourage a widely dispersed mining ecosystem with commodity hardware CPU and GPUs to emerge.
In the very early stages of Bitcoin’s development, Bitcoin could be mined on commodity hardware but as the network grew, mining became more professionalized, industrialized, and centralized because of the development of specialized hardware (ASICs). ASICs used for Bitcoin mining are about 1000x more efficient when compared to mining with common CPUs and GPUs. In the mining context, efficiency means better performance per watt and/or superior performance per dollar.
The Ravencoin community wanted to at least give its network time to mature and cultivate an active, dispersed, hobbyist community of miners that could use their CPUs and/or GPUs to contribute to the mining process. They initially used the x16r mining algorithm and have been somewhat successful in cultivating a network of commodity hardware miners but the development and mining communities felt the need to improve the network’s ability to resist domination by ASICs.
Keep in mind that ASIC resistance does not mean, complete deterrence of ASICs or the complete incompatibility of ASICs. ASICs can still be used for mining on “ASIC resistant” mining algorithms. However their advantages are severely diminished with the use of certain techniques. The performance gaps between ASICs and commodity hardware are considerably compressed when using effective ASIC resistant mining algorithms.
KAWPOW
The network officially move away from the x16r mining algorithm to a new mining algorithm named, KAWPOW, The expectation from this change is that most modern GPUs will be on a level playing field with ASICs when mining Ravencoin. This allows anyone with a decent computer to run Ravencoin mining software successfully.
The KAWPOW algorithm is a tweaked version of the Programmatic Proof of Work (ProgPoW) algorithm developed by Ethereum developers trying to improve Ethash’s (Ethereum’s current PoW algo) ASIC resistance. ProgPoW, and KAWPOW in the case of Ravencoin, is designed to programmatically reconfigure itself at a regular interval in such a way as to make the development of an ASIC impractical or economically unmotivating. A moving, dynamic target is harder to hit than a static target of similar size.
Developers of ProgPoW and by extension developers of KAWPOW designed these algorithms to make full use of the programmability and capabilities of all the hardware on a modern GPU. Maximizing the use of the entirety of a GPU minimizes the gains to be won by developing an ASIC considerably, adding to the network’s ASIC “resistance”. This doesn’t mean ASICs are impossible to produce for ProgPow and KAWPOW, but they are much less cost-effective for the performance they offer over a GPU.
Other Points of View
Many remain skeptical of the efficacy of ASIC resistance. Although it does lower the barrier to entry compared to ASIC dominated networks, this doesn’t necessarily imply increased security. A few networks that have optimized for ASIC resistance, such as VTC, BTG, and XVG, have been successfully attacked. We have not seen this happen to networks with specialized hardware dominating mining.
Networks that favor mining with widely available hardware like CPUs and GPUs open themselves to attack from a wide range of computing power that has no connection or commitment to the network. This computing power can attack the network and then move on to other operations with little economic downside.
Networks that have specific hardware dedicated to mining, like Bitcoin, don’t have this problem. There are no computers outside of the network itself that can attack it. The attacker wouldn’t have the appropriate hardware. An outside party would have to develop or buy a lot of specific hardware to attack a network secured by ASICs. It is true, miners in this type of network can attack the network they’re mining, but they’re destroying the only use of their hardware as well as faith in a network they’ve made a considerable investment in.This would be extremely expensive and highly irrational considering there are few, if any, other uses for their equipment.
However, hardware for ASIC secured networks are typically produced by only a handful of manufacturers due to economies of scale. This concentration of manufacturing can make many nervous about a network’s vulnerabilities and dependence on a few entities. A network dominated by general purpose hardware doesn’t have to contend with this issue.
Coda
It’s early in the history of these networks, but it looks like a multiplicity of security architectures could conceivably co-exist and provide good enough security for their respective networks. Regardless of the setup, the security architecture of all of these networks depends on the assumption that honest nodes will outnumber and outmaneuver malicious nodes. If this stays true for Ravencoin, and they are able to adjust to threats successfully like they’ve shown the ability to do, the network has a bright future.
It’ll be interesting to see how effective KAWPOW can be at fending off ASICs and what the Ravencoin community will do to combat this ever looming threat. | https://medium.com/edgewallet/ravencoin-development-update-kawpow-edge-8e82323e6a15 | ['Brett Maverick Musser'] | 2020-06-03 20:11:19.453000+00:00 | ['Progpow', 'Ravencoin', 'Proof Of Work', 'Cryptocurrency', 'Cryptoasset'] |
The Name Game | What ‘Lake Trump’ tells us about the geopolitics of naming in the Balkans
In the year 2020, it has become almost routine for headlines that could have easily been outlandish satire not so long ago to become reality. “Disputed reservoir on the Serbia-Kosovo border to be named after President Donald Trump” is one that fits this description fairly well. Nevertheless, this is something which appears to have come to pass; despite some confusion over whether the name ‘Lake Trump’ will be officially adopted for the aqueous body which straddles this Balkan border, banners declaring that very name were hung on the Kosovan side after the suggestion by Richard Grenell, an adviser to the US President, was welcomed by the Kosovan Prime Minister.
Examining this episode evokes interesting questions on the geopolitical significance of place names, and the ways in which naming and renaming are used in politics. There are few regions of the world where names are so often as thorny an issue as in the Balkans, as anxious new nation-states attempt to affix their modern identity to a sense of historical timelessness. In this instance, both parties’ attachment to their traditional name for the lake was a point of contention, resulting in this rather eyebrow-raising suggestion of a compromise.
After the 1998–1999 Kosovo war, the former province of Serbia had de-facto independence leading to a full declaration of autonomy in 2008. Serbia has refused to accept its independence, despite 101 countries, including most of the West, doing so. Talks on the relationship between the two parties and the possibility of the normalisation of some relations have been ongoing for more than a decade, but was given renewed impetus with Trump’s appointment of Richard Grenell, then also the US ambassador to Germany, as special envoy for Kosovo-Serbia dialogue, and in early 2020 a major outcome was the restoration of first commercial flights and subsequently rail services between Belgrade and Pristina. However, the issue of the lake which sits on the border remained a sticking point; Kosovo insisted on the Albanian name Lake Ujman, whereas Serbia called it Lake Gazivoda.
“Place names are utilised as an expression of identity, a break from the past, or as a tool of diplomacy, and in all cases are intensely political, whether the place in question is a single street or an entire nation-state.”
Such an issue may seem trivial in the context of major negotiations over economic and political relationships — does the name of a place really matter that much? In short, yes, especially so when a group feels that it is their identity that is being undermined. Studying place names may seem like stereotypical high-school geography of years gone by, however, the field of critical toponymy has sought to shed light on how place names, and the practice of naming and renaming, are inextricably tied to questions of power and identity. Place names are utilised as an expression of identity, a break from the past, or as a tool of diplomacy, and in all cases are intensely political, whether the place in question is a single street or an entire nation-state.
For example, when Yugoslavia dissolved, one of its former republics that had been referred to as Macedonia after the ancient kingdom of Macedon, which it shared some geographic overlap with, declared independence in 1991 as the Republic of Macedonia as a way to assert and build a new national identity by linking the new state to the ancient past. Their southern neighbour Greece, meanwhile, was infuriated, as its northernmost region was also called Macedonia for its links to the kingdom of Macedon, and claimed that this new republic’s name was effectively an irredentist claim on the northern territory of Greece. This diplomatic dispute was such that the former Yugoslav’s state had to be referred to as ‘Former Yugoslav Republic (FYR) of Macedonia’, and Greece blocked their accession to the EU and NATO for almost three decades, until a deal was agreed in 2019 which saw ‘FYROM’ change its name to the Republic of North Macedonia.
Breaking from the past is also a strong motivation for renaming places. Historically, Russia is notable for this, with Saint Petersburg being renamed Petrograd in 1914 in order to remove its German sounds after the onset of the First World War, then Leningrad in honour of Lenin after his death in 1924, before the original name of Saint Petersburg ( Sankt-Peterburg in Russian) was returned by public referendum in 1991 as Russia moved into its post-Soviet age. Various postcolonial states also adopted new names for the country as a whole and also places within as a means to both express identity and break with the colonial past, for example Burkina Faso and Botswana.
It is also common for place naming and renaming to be used as a tool of diplomacy or as a show of gratitude. Returning to North Macedonia, for example, the capital city of Skopje has many streets named after nations who came to its aid after a devastating earthquake in 1963, for example, Mexico Street. As such, it is clear that place names have political importance, and this is especially true in the Balkans.
Perhaps the seemingly heightened importance of place names in the Balkan region stems from anxiety surrounding identity in the new nation states of the former Yugoslavia; after all, these states are less than three decades old, and many there are still suspicious and nervous that neighbours want to retake their former territories. For Kosovo, a nation-state only officially independent since 2008 and which has not been able to join the United Nations due to lack of recognition from Serbia and also nations such as Russia and China, this is especially true. Historical symbolism is thus very important, as seen in the case of North Macedonia, as new nation-states attempt to solidify their identity by reinforcing it with a sense of historical timelessness.
Indeed, in many areas of the region, borders have shifted and changed hands between ethnic groups many times over the last few centuries, and so in some cases, towns will have several different names given by different groups in languages and dialects such as Albanian, Bulgarian, Turkish, and Slavic. Lake Ujman/Gazivoda is a prime example of this, with one location having two very distinct names, split along ethnic lines.
So why then, has the name ‘Lake Trump’ emerged as a potential compromise? According to Grenell himself, he suggested the name in jest, perhaps in exasperation that negotiations were sticking on such a seemingly superficial point. However, to the confusion of many, including Kosovan officials, Kosovo Prime Minister Avdullah Hoti took to Twitter on Thursday 24 thSeptember to welcome Grenell’s suggestion in honour of the US President’s “role in reaching a historic economic normalization agreement” between Kosovo and Serbia. Signs later appeared on the Kosovan side of the reservoir bearing the name ‘Lake Trump’ and banners thanking the President were hung from the bridge above the lake. Serbia has not yet authorised this name change, and so it remains to be seen if it comes into force. Perhaps both sides are keen to move past the issue without appearing to concede on symbolic points, and so any compromise is welcome.
Of course, the issue with names is that they are very much a social construct. Places and things take on names that are given to them by people, and they only retain that name if those people use it. Some locals have already reacted to the new name with derision and have insisted they will continue to use the traditional name of their side. Politically-charged naming and renaming is very rarely as simple as replacing signage or signing off a new label, and it is questionable at best as to whether the population of the area surrounding ‘Lake Trump’ will relinquish the words of their own language in favour of an arbitrarily imposed term honouring a controversial President of the United States.
Nevertheless, the issue of this lake demonstrates the importance of place names in geopolitics and diplomacy. While they are often taken-for-granted, names are frequently contested and moulded by the political forces of the day for various means, and often are imbued with strong meanings and feelings of identity, which is particularly pertinent in the context of Kosovo and Serbia who, like many others in the Balkans are, as Grenell remarked, in a conflict over “symbolism and adjectives, and verbs, and nouns”. | https://danhall-68125.medium.com/the-name-game-3048a7d5a3ac | ['Dan Hall'] | 2020-11-10 13:29:20.645000+00:00 | ['Politics', 'Balkans', 'Geography', 'Trump', 'Geopolitics'] |
7 Things to Do Every Day to Stay Healthy : | 7 Things to Do Every Day to Stay Healthy :
We all want a healthy body and mind. But in our busy lives we don’t pay much attention to our own body. So when the impression of age falls on the face in any direction, the weight increases unknowingly, the skin of the body, the hair, everything seems to become dirty. (7 things to do to stay healthy)
(Favorite.com) — We all want a healthy body and mind. But in our busy lives we don’t pay much attention to our own body. So when the impression of age falls on the face in any direction, the weight increases unknowingly, the skin of the body, the hair, everything seems to become dirty.
So you must keep your body healthy before anything else. And you do not have to bother for this. By doing a few small things regularly, you can stay healthy forever. So know the 6 things you need to do to stay healthy. (10 ways to stay healthy and fit)
Drink water :
The most important thing to stay healthy is to drink plenty of water. There are many of us who do not drink enough water and drink coffee, tea, soft drinks. But we should all drink at least 8 glasses of water every day. Be sure to take a bottle of water with you wherever you go.
Always think well :
Always think positively no matter what you do in life. Good thinking keeps our body and mind healthy. Start every day with good thoughts, expect good from something bad. You will see that both body and mind will keep you healthy.(how to keep fit at home)
Eat healthy food :
Start breakfast with healthy food, which will help you stay healthy throughout the day. Food is one of our daily companions, without which we are useless. You just have to be more discriminating with the help you render toward other people. That doesn’t mean you should never eat junk food outside. Of course you can eat, but not too much.
Exercise every day :
Exercise is the key to staying healthy. If you can exercise a little bit every day, it will keep you healthy and will not allow excess fat to accumulate in the body. So make it a routine to spend at least 30 minutes regularly exercising. (workout for beginners at home female pdf)
Take vitamins every day :
It is a very small job that will keep you healthy. Be sure to take a multivitamin every day. And this vitamin will prevent imperfections in your body. But be sure to consult a doctor before taking any vitamin. Because the doctor will tell you which vitamins your body needs.
Be careful in vehicles :
We have to go out for different activities every day. But going out means having panic in the mind. Because there are so many vehicles on the road that there is always a fear of any accident. So if you travel in your own car, be sure to fasten your seat belts and those who travel in all other vehicles should also be careful in their respective situations.
Get 8 hours of sleep every night :
One of the most important things to stay healthy is to get 8 hours of regular sleep. Good sleep will keep your body healthy and your mind well. Moreover, for the amount of stress that goes on people every day, it is very important to get regular 8 hours of sleep to keep the body and brain strong.
Please reading the others post : https://onlineincomehealth.blogspot.com/ | https://medium.com/@shishirhuman/7-things-to-do-every-day-to-stay-healthy-51378cf288f7 | ['Sree Shishir Roy'] | 2021-07-06 18:55:13.002000+00:00 | ['Health Foods', 'Healthy Eating', 'Healthy', 'Healthy Lifestyle', 'Health Recipe'] |
Well, my friend, your questions are deep and will probably take us both a lifetime to unravel. | Well, my friend, your questions are deep and will probably take us both a lifetime to unravel. I, too, am repulsed by the current perversion of “Christianity” for political purposes — to the point that I and many others simply don’t call that particular worldview Christian at all. Frankly, they are taking positions that would be called heretical if we weren’t so shy about the word. This crisis, I believe, is what you are talking about, and indeed it does repel thousands, if not millions of saddened faithful.
There are noble attempts by progressive, orthodox, and traditional Christians to retain their identity against the onslaught of those self-serving ideologues. We look desperately for other names for ourselves: Jesus Followers, for example; Believers in Christ. But we are hampered, as always, by the very commitment to lovingkindness that prevents us from attacking in the same way others do.
Meanwhile, many seeking/inquiring Christians are indeed drawn to Eastern paths, seeing them as more peaceful and more unified (that hasn’t always been true, but it seems that way to us in the West). (Read Jack Preston King on these subjects — he’s awesome.) Westerners have had a fascination with things Eastern for some time, and you can find evidence of the ebb and flow of this perennial interest. Witness the resurgence of popularity of Thich Nhat Hanh’s 20-year old Living Buddha, Living Christ.
For most progressive Christians, there’s not a thing wrong with searching among all the world’s religions, seeking compatible views and new insights.
But I must tell you, from my (mumble, mumble) years of experience searching, searching for churches, leading churches, finding Christianity, losing Christianity, blah, blah, blah — the single most difficult hurdle for finding a community of faith is — you guessed it — the community. The people.
Ultimately, you can find the perfect doctrine, the perfect mystical experience, the perfect God — and chances are very good the people will crap it up for you, one way or another.
But you know this, because you have experienced it and talked about it, and you’ve probably already figured out that the main thing about your religious faith is that it’s about loving G*D and loving people and loving yourself, and trying to put it all into practice, so when they crap it all up for you, you just want to deal with it and keep on going as best you can. When you do that, you’ll keep shining like the sun.
And it’s those people that are the point of it all, I guess — there to love and forgive and to love you back; shining like the sun and being the children of God — the very reason for the whole thing.
So I’m just here to affirm your wisdom and tell you that everything will be all right in the end.
And if it isn’t all right, it means it’s not the end.
:-)
Sparky | https://medium.com/notes-on-the-way-up/well-my-friend-your-questions-are-deep-and-will-probably-take-us-both-a-lifetime-to-unravel-ad97052e346 | ['Rev Dr Sparky'] | 2019-03-31 00:47:40.907000+00:00 | ['Heresy', 'Faith', 'Hope', 'Christianity'] |
ParseMyCF — a codeforces contest scraper | I wrote an useful python script- ParseCF
It will parse all the Codeforces contests that a particular user has participated in till date, make separate folders for every contest and every folder would contain all the user’s submissions for that particular contest , ordered by the problem names.
For a guy like me who likes to keep all my codeforces submissions organised , this script saves a lot of unnecessary time in organising codes in folders .At last, I can push all my codes to Github in one click.
GOALS of this scraper:
Ask the user for the username and the number of recent contests to parse Set up a proper directory tree under the parent directory with each Folder having the (contest-name + username) format Each Folder contains all the solutions of the user having separate files for separate questions (A,B,C..) and a contest-info .txt file that encompasses all the miscellaneous details of the user w.r.t the current contest.
All the detailed instructions on how to run this script is available on my Github .
Now enough of theory ! Let me show you a demo.
Let us say I want to parse the 5 recent contests of legendary tourist i.e When the scipt will prompt me to enter a username, I’ll type in tourist
Then the scraper will
show me the total no of contests tourist has participated in till date
ask me how many recent contests I want to parse: let us say 3
As soon as I type in 3 and press Enter , the parsing will start.
To make your wait less boring, I have made the script spit out log texts as it goes on parsing contests.
Notice the parent directory has no other folder right now except cf py file right now.
Let us start the parsing.
As you can see, instantly, the folder for the first contest has been created and the log is saying the same. It is sleeping for 5s :) and then it will begin scraping the corresponding solutions for this round.
It is a coincidence that the first scraped solution of tourist is WA on pretest 10 .
Haha :)
So it continues scraping and doing it’s job. At this point, files are being added inside the first folder.
Hurray!!
The first contest(most recent one) has been parsed and it has begun scraping the second contest as you can see the folder for Manthan-Codefest has been created !
It is working hard :)
Moving on to the 3rd and the last contest for us..
Now after a lot of hard work, let us see what happens!
The above picture shows that the parsing has ended!
Now let me show you the directory structure inside each folder.
So 3 folders…
Let us enter the first folder-:
As you can see, all the problems have been scraped successfully with the proper extensions. An extra contest-info.txt file is also there. Let us explore its contents.
As you can see, it contains all miscellaneous information about the tourist’s performance in this round like Rank, Rating change etc.
Let’s go inside the 2nd one
Let’s go inside the 3rd contest folder.
So this ends the successful scraping!
Bonus:
If you place the cf py file inside a git initialised repository , it will automatically record the added files and you can just make a single commit and upload them to github.
, it will automatically record the added files and you can just You can compare the performance and code of your cf friends in the recent contests you both participated in. Just run the script again and mention your friend’s username and you’re good to go.
in the recent contests you both participated in. Just run the script again and and you’re good to go. As mentioned above , the ParseCF repository is available under my JanaSabuj/ParseMyCF-contest github. You can make improvements or put forward bugs you encounter via a pull request or fork or star.
Bonus2:
Here is a short video where I parse my favourite coder’s contests.
Username: Ashishgup
This is my first python script and I hope you will find it useful ! | https://medium.com/sabuj-jana/parsemycf-a-codeforces-contest-scraper-13dc0e9d3872 | ['Sabuj Jana'] | 2019-09-21 12:37:16.693000+00:00 | ['Script', 'Codeforces', 'Programming', 'Python', 'Github'] |
Lambda calls share their runtime and it’s super scary — Here is why | AWS Lambda functions are very popular in the developer world right now. While these are a popular choice, a lot of developers still struggle to understand their execution behavior when it comes to runtime sharing and state sharing. If you ask a somewhat fundamental but critical question like “do two different lambda invocations share their runtime or any common state between them?” you will probably get a “NO” answer. AWS documentation clearly explains that they DO share some common state such as SDK clients, database connections, and other static resources But it won’t give any insights into sharing the runtime part. This sharing concept often creates pretty scary issues with the developer’s own static code in the lambda. Check out the simple python example below.
very simple lambda code with a static array
To add more confusion, the output is not always consistent like it is shown above because AWS creates new instances of your function code as needed depending on many other constraints: idle time, number of concurrent requests, provision concurrency set, etc. Each new instance starts with a clean slate of the static objects but the requests that are hitting the previously spawned function instances will continue to share that static object’s state.
There are multiple reasons why developers fall into the trap of assuming that each lambda call is fully isolated and there is nothing shared between multiple lambda calls.
We call these serverless functions. In the functional programming paradigm, a function is a piece of code that is called by a name, takes some input arguments given, and works through the logic to optionally return its final result. More importantly, the return value of the function is expected to be consistent for given input arguments. In this case, it is not. Basically, if you are assuming that each invocation of a lambda function is like the below piece of code then you are wrong.
# This is not how each lamdba call invoke your code
# first call
➜ ~ python3
>>> from test_static_loading import lambda_handler
>>> lamda_handler({"counter": 1}, context)
➜ ~ python3
# second call
>>> from test_static_loading import lambda_handler
>>> lambda_handler({"counter": 2}, context)
If this is not how your lambda code is invoked then how AWS is invoking your lambda code? Well, I exactly don’t know how AWS is invoking but here is what I think it is doing.
# It is more like below
➜ ~ python3
>>> from test_static_loading import lambda_handler
>>> # first call
>>> lamda_handler({"counter": 1}, context)
>>> # second call
>>> lamda_handler({"counter": 2}, context)
If you see in the above code snippet, the module is imported once and used to invoke multiple times and that is how multiple lambda calls are sharing their runtime and static object state.
Going through the AWS documentation on the lambda execution environment lifecycle, we understand why it behaves the way it does. There are three main phases of the execution lifecycle as described in the above-linked AWS documentation page.
Init. This phase is executed once per instance of the lambda function. It includes initialization of extensions, bootstrapping of the runtime, and running of the function’s static code Invoke. This phase runs for each lambda invocation Shutdown. This phase is invoked once for each instance shutdown action
The static resources that are expected to be shared between the lambda calls of a particular instance of lambda code are like database connections and SDK clients etc which are purely static, sharable, and expensive to initialize so they are worth sharing between the calls but this design is not obvious enough to the developers. Also, the more recent features released by AWS, such as RDS proxy and various lambda invocation hooks are taking away the need for initializing these expensive static resources within the lambda code. So what is now left is just creating confusion for developers with their static objects.
In conclusion, Avoid using static objects holding any state-specific to a particular request. As long as the state is sharable maybe like a logger object or an S3 client connection or any other SDK client objects, it is ok to use them as a static resource. Here are some additional resources to read more about how lambda runtime works under the hood. | https://medium.com/leantaas-engineering/does-a-lambda-call-share-any-common-state-4785dfea313e | ['Santhosh Gandhe'] | 2020-12-19 08:31:30.439000+00:00 | ['Lambda', 'AWS', 'AWS Lambda', 'Functional Programming', 'Aws Cloud'] |
This Breakthrough Nutrient Is Called AstraZyme | Explode Your Muscle Growth
MassZymes 3.0 with AstraZyme™ helps make the industry’s leading formula up to 30% more effective in passing nutrients through your gut, and up to 66% more on specific amino acids!
Faster Recovery
With the bioavailability of amino acids you’ll repair muscle fibers faster and grow bigger; plus, AstraZyme™ helps buffer catabolic oxidative attack on muscle cells post-exercise as well as reducing inflammation.
Stronger, Healthier Digestion
Undigested protein isn’t just wasted — it’s toxic! That’s why so many bodybuilders and gym rats suffer from “protein bloat” — because it putrefies and becomes gas, bloating, and puffiness.
AstraZyme™ is a proprietary all-natural plant-derived compound extracted from Panax ginseng and Astragalus using proprietary processing technology.
It has been proven in twelve In vitro studies to significantly enhance the absorption of many important nutrients — up to 66% more in certain cases — including key amino acids, such as arginine, citrulline, and tryptophan…
vitamins, such as folate… joint-protecting nutrients like glucosamine… and many more.
AstraZyme™ works by up-regulating protein transport on a DNA level, meaning it helps increase the number of amino acids, glucose, vitamins, and other nutrients entering your intestinal cells.
Once inside the cells, these nutrients are transported by the liver to your muscles.
This is key: those nutrients that do not make it to your intestinal cells will be flushed down the drain.
How To Increase The Bioavailability | https://medium.com/@jameshob498/this-breakthrough-nutrient-is-called-astrazyme-94748720b0f0 | [] | 2021-12-20 04:13:48.777000+00:00 | ['Muscle Building', 'Healthy Lifestyle', 'Weightloss Foods', 'Weight Loss Tips', 'Muscles'] |
eLeanSecurity Junior Penetration Tester (eJPT) Certified! | Long time no see
Some time has passed since myvery first post, and some major changes have taken place in my life. I’ve started working at IBM in June as an IT Specialist in the Global Technology Services division. I also enrolled in a MS in Cybersecurity. I know MS are not seen as something very useful in the infosec field because everything evolves extremely fast (SolarWinds hack for example), but for the HR offices in my country they are a +. I also got my hands on some certifications from the cybersec field.
eJPT Course & Exam
A journey of a thousand miles begins with one small step, and this was the first move of this ride I’ve embarked on. The course was perfectly planned for the pace of newbies to learn the most useful tools one by one. In my case, except one or two I already knew them . The videos and labs were also a plus, as they helped to understand the things from the slides. I spent like two weeks doing the course. For somebody who has more free time, it can be done in one week or less.
And now let’s talk about the exam. You have 72 hours to answer 20 questions about the assigment you get, and to pass you have to get at least 15 correct answers. You get a letter of engagement in which you get some info about the scope; just like in a real life penetration test of a company.
I spent more or less 10 hours in the exam. I could have done it in a shorter period of time, but I got down some rabbitholes because I though the things were more complicated then they looked. In the end I got %90 et voilà:
The exam was all practical, just like a real life pentest assignment proposed by a company. It was mostly entertaining and I’m looking forward to doing more lookalike exams.
IBM Cybersecurity Analyst
I also got Coursera’s IBM Cybersecurity Analyst certificate. It consisted of 8 different courses about different fields in Cybersecurity, from SIEM and Incident Response to Penetration Testing and Information Management. You also have to do some practical assignments. After you finish all the courses, you have to take an exam about everything you’ve learnt and get above %80 to pass.
Next steps
Here is the list I’ve got for the upcoming certifications, courses and exams I intend to do/get, to aquire fundamental knowledge and to demostrate the skills I learned.
I know CEH is a multiple choice exam, and little has to do with real life cybersec, but it the eyes of the HR is gold.
Thank you for reading, and see you soon (I hope). | https://medium.com/@octa-mihail/eleansecurity-junior-penetration-tester-ejpt-certified-afae75e3a66c | ['Octavian Mihail Romanescu'] | 2020-12-23 12:38:15.965000+00:00 | ['Information Technology', 'Penetration Testing', 'Learning', 'Skills', 'Cybersecurity'] |
Hi | in The Case of Curious Birds | https://medium.com/@frankbylard2/hi-3db599cb1ce4 | [] | 2020-12-22 04:51:13.308000+00:00 | ['Medium Brasil', 'Médium', 'Ｍedium', 'Mediumcom', 'Medium En Español'] |
Looking Back On 2020 And What’s Next | “The Black Swan of 2020.” “VCs are open for business as usual.” “Don’t raise money this year unless you absolutely need to.”
Filled with extremes and contradictions, 2020 was a trial by fire for us all. While simultaneously shouldering the personal toll of an unprecedented pandemic, economic crisis, and social and political turbulence, every business leader was forced to rethink their operations under completely new circumstances.
For venture-backed founders in particular, where the professional is in many cases deeply personal, too, the overnight transition from full-team retreats, client meetings, and investor coffee chats to 100% digital communication raised a fundamental question: how do we build trusted relationships in an entirely digital world?
For us at Laconia, this topic is nontrivial. Foundational to our approach to B2B seed-stage investing is building and supporting a highly concentrated, high conviction portfolio. During our diligence process, we spend far more time understanding and testing our potential partnership with founders than we do crunching numbers. This human element is so central to our work that the concept of investing in founders without meeting them first would have been unimaginable for us a year ago. But these past few months of trial and error have proven that we can indeed initiate, build, and sustain the deep interpersonal working relationships that our approach is predicated upon. For anyone navigating the fundraising process for the first time or struggling to feel connected to a distributed team, we hope some of our takeaways come in handy:
Finding new partners requires a more intentional strategy , as the in-person serendipity that we’ve been accustomed to has vanished. While accessibility is probably at an all-time high, establishing trust remains tricky, as personal connections and referrals remain major factors, especially for investors. As founders prepare to raise from investors whom they don’t already know, establishing multiple digital touchpoints and strategically building a communication history can help garner familiarity and shorten the trust-building process.
, as the in-person serendipity that we’ve been accustomed to has vanished. While accessibility is probably at an all-time high, establishing trust remains tricky, as personal connections and referrals remain major factors, especially for investors. As founders prepare to raise from investors whom they don’t already know, establishing multiple digital touchpoints and strategically building a communication history can help garner familiarity and shorten the trust-building process. Frequency matters , especially when founders and investors are first trying to get to know each other. Multiple 30–45 minute discovery meetings held over different days have been more effective for us than single, extended meetings. We have found people tend to present slightly differently on different days providing more insight into who they are, how they think, and how they work.
, especially when founders and investors are first trying to get to know each other. Multiple 30–45 minute discovery meetings held over different days have been more effective for us than single, extended meetings. We have found people tend to present slightly differently on different days providing more insight into who they are, how they think, and how they work. Zoom fatigue is real, and shorter meetings garner more focus. For board meetings, for example, the typical three-hour format is simply mind-numbing in a virtual setting. The digital constraint has forced us to significantly shift content reviews pre-meeting and cull agendas to the most essential priorities and discussion topics. For other community events, platforms like Icebreaker and Kumospace add some much-needed variety.
and shorter meetings garner more focus. For board meetings, for example, the typical three-hour format is simply mind-numbing in a virtual setting. The digital constraint has forced us to significantly shift content reviews pre-meeting and cull agendas to the most essential priorities and discussion topics. For other community events, platforms like and add some much-needed variety. Despite the fatigue, impromptu 5–15 minute video meetings can be invaluable, as voice, facial feedback, and collateral materials on the spot make for surprisingly impactful and high-touch communication in small bites. We’ve made it a point to do quick “no agenda, no talking about work” calls just to check in with founders, co-investors, and LPs purely as people, and they’ve done wonders to keep us feeling connected despite the distance.
as voice, facial feedback, and collateral materials on the spot make for surprisingly impactful and high-touch communication in small bites. We’ve made it a point to do quick “no agenda, no talking about work” calls just to check in with founders, co-investors, and LPs purely as people, and they’ve done wonders to keep us feeling connected despite the distance. Some virtual meetings are here to stay, even post-COVID. The amount of time wasted commuting and traveling for introductory meetings now seems medieval. Moving forward, the majority of our first-time meetings with founders (and LPs) will likely be over Zoom, saving everyone a lot of time to focus on deeper work. (On a tangential note, we are excited to leave group phone conference calls in 2019!)
Looking ahead to 2021, we are cautiously optimistic about roundtable dinners and hugs in our foreseeable future. Until then, we remain a quick text, tweet, or Slack message away.
Stay tuned! | https://medium.com/@laconia/looking-back-on-2020-and-whats-next-5be22796a3e2 | [] | 2020-09-13 00:00:00 | ['Startup', 'Venture Capital', 'Entrepreneurship', 'Year In Review', 'Remote Working'] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.