name
string
code
string
asm
string
file
string
clang::interp::Record::Record(clang::RecordDecl const*, llvm::SmallVector<clang::interp::Record::Base, 8u>&&, llvm::SmallVector<clang::interp::Record::Field, 8u>&&, llvm::SmallVector<clang::interp::Record::Base, 2u>&&, unsigned int, unsigned int)
Record::Record(const RecordDecl *Decl, BaseList &&SrcBases, FieldList &&SrcFields, VirtualBaseList &&SrcVirtualBases, unsigned VirtualSize, unsigned BaseSize) : Decl(Decl), Bases(std::move(SrcBases)), Fields(std::move(SrcFields)), BaseSize(BaseSize), VirtualSize(VirtualSize), IsU...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x38, %rsp movl %r9d, (%rsp) movq %r8, 0x8(%rsp) movq %rcx, %r14 movq %rsi, %rbp movq %rdi, %rbx movq %rsi, (%rdi) addq $0x8, %rdi movq %rdx, %rsi callq 0xf19906 leaq 0x118(%rbx), %rdi movq %r14, %rsi callq 0xf19926 leaq 0x1e8(%rbx), %r13 leaq 0x1f...
/AST/Interp/Record.cpp
bool llvm::DenseMapBase<llvm::DenseMap<clang::RecordDecl const*, clang::interp::Record::Base const*, llvm::DenseMapInfo<clang::RecordDecl const*, void>, llvm::detail::DenseMapPair<clang::RecordDecl const*, clang::interp::Record::Base const*>>, clang::RecordDecl const*, clang::interp::Record::Base const*, llvm::DenseMap...
unsigned getNumBuckets() const { return NumBuckets; }
movl 0x10(%rdi), %ecx testl %ecx, %ecx je 0xf19f64 pushq %rbx movq (%rdi), %rdi movq (%rsi), %rsi movl %esi, %eax shrl $0x4, %eax movl %esi, %r8d shrl $0x9, %r8d xorl %eax, %r8d decl %ecx movl $0x1, %r10d xorl %r9d, %r9d andl %ecx, %r8d movq %r8, %rax shlq $0x4, %rax leaq (%rdi,%rax), %r11 movq (%rdi,%rax), %rbx movb $...
/llvm/ADT/DenseMap.h
llvm::DenseMapBase<llvm::DenseMap<clang::BlockDecl const*, unsigned int, llvm::DenseMapInfo<clang::BlockDecl const*, void>, llvm::detail::DenseMapPair<clang::BlockDecl const*, unsigned int>>, clang::BlockDecl const*, unsigned int, llvm::DenseMapInfo<clang::BlockDecl const*, void>, llvm::detail::DenseMapPair<clang::Bloc...
unsigned getNumEntries() const { return NumEntries; }
movl 0x8(%rdi), %ecx testl %ecx, %ecx jne 0xf1cb43 cmpl $0x0, 0xc(%rdi) je 0xf1cb7d shll $0x2, %ecx movl 0x10(%rdi), %eax cmpl %eax, %ecx setae %cl cmpl $0x41, %eax setb %dl orb %cl, %dl je 0xf1cb7e movq (%rdi), %rcx shlq $0x4, %rax xorl %edx, %edx cmpq %rdx, %rax je 0xf1cb78 movq $-0x1000, (%rcx,%rdx) # imm = 0xF000...
/llvm/ADT/DenseMap.h
bool llvm::DenseMapBase<llvm::DenseMap<std::pair<clang::DeclContext const*, clang::IdentifierInfo*>, unsigned int, llvm::DenseMapInfo<std::pair<clang::DeclContext const*, clang::IdentifierInfo*>, void>, llvm::detail::DenseMapPair<std::pair<clang::DeclContext const*, clang::IdentifierInfo*>, unsigned int>>, std::pair<cl...
bool LookupBucketFor(const LookupKeyT &Val, const BucketT *&FoundBucket) const { const BucketT *BucketsPtr = getBuckets(); const unsigned NumBuckets = getNumBuckets(); if (NumBuckets == 0) { FoundBucket = nullptr; return false; } // FoundTombstone - Keep track of...
pushq %rbp pushq %r15 pushq %r14 pushq %rbx pushq %rax movq %rdx, %rbx movl 0x10(%rdi), %ebp testl %ebp, %ebp je 0xf29624 movq %rsi, %r14 movq (%rdi), %r15 movq %rsi, %rdi callq 0xf29642 decl %ebp movq (%r14), %rsi movq 0x8(%r14), %rdi pushq $0x1 popq %r8 xorl %edx, %edx movq $-0x2000, %r10 # imm = 0xE000 andl...
/llvm/ADT/DenseMap.h
clang::JSONNodeDumper::writeBareSourceLocation(clang::SourceLocation, bool)
void JSONNodeDumper::writeBareSourceLocation(SourceLocation Loc, bool IsSpelling) { PresumedLoc Presumed = SM.getPresumedLoc(Loc); unsigned ActualLine = IsSpelling ? SM.getSpellingLineNumber(Loc) : SM.getExpansionLineNumber(Loc); Stri...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x98, %rsp movl %edx, %r14d movl %esi, %ebp movq %rdi, %rbx movq 0x4c8(%rdi), %rsi leaq 0x40(%rsp), %rdi pushq $0x1 popq %rcx movl %ebp, %edx callq 0x107fb50 movq 0x4c8(%rbx), %rdi movl %ebp, %esi xorl %edx, %edx testl %r14d, %r14d je 0xf2c1b2 call...
/AST/JSONNodeDumper.cpp
clang::JSONNodeDumper::createCXXRecordDefinitionData(clang::CXXRecordDecl const*)
llvm::json::Object JSONNodeDumper::createCXXRecordDefinitionData(const CXXRecordDecl *RD) { llvm::json::Object Ret; // This data is common to all C++ classes. FIELD1(isGenericLambda); FIELD1(isLambda); FIELD1(isEmpty); FIELD1(isAggregate); FIELD1(isStandardLayout); FIELD1(isTriviallyCopyable); FIELD1...
pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x60, %rsp movq %rdx, %r14 movq %rdi, %rbx callq 0xf2e200 movq %r14, %rdi callq 0xe22826 testb %al, %al je 0xf2c9fc leaq 0x38(%rsp), %r15 movw $0x1, (%r15) movb $0x1, 0x8(%r15) leaq 0x352a71(%rip), %rsi # 0x127f43a leaq 0x8(%rsp), %r12 movq %r12, %rdi call...
/AST/JSONNodeDumper.cpp
clang::JSONNodeDumper::VisitObjCBoxedExpr(clang::ObjCBoxedExpr const*)
void JSONNodeDumper::Visit(const comments::Comment *C, const comments::FullComment *FC) { if (!C) return; JOS.attribute("id", createPointerRepresentation(C)); JOS.attribute("kind", C->getCommentKindName()); JOS.attributeObject("loc", [C, this] { writeSourceL...
pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0xa0, %rsp movq 0x18(%rsi), %r12 testq %r12, %r12 je 0xf31beb movq %rdi, %r15 leaq 0x10(%rsp), %rax movq %rax, -0x10(%rax) andq $0x0, -0x8(%rax) movb $0x0, (%rax) leaq 0x68(%rsp), %r14 movq %rsp, %rbx movq %r14, %rdi movq %rbx, %rsi callq 0x45b7c2 movq 0x28(%...
/AST/JSONNodeDumper.cpp
void llvm::SmallVectorImpl<clang::FieldDecl*>::append<clang::FieldDecl**, void>(clang::FieldDecl**, clang::FieldDecl**)
void append(ItTy in_start, ItTy in_end) { this->assertSafeToAddRange(in_start, in_end); size_type NumInputs = std::distance(in_start, in_end); this->reserve(this->size() + NumInputs); this->uninitialized_copy(in_start, in_end, this->end()); this->set_size(this->size() + NumInputs); }
pushq %r15 pushq %r14 pushq %r12 pushq %rbx pushq %rax movq %rdx, %r14 movq %rsi, %r15 movq %rdi, %rbx movq %rdx, %r12 subq %rsi, %r12 sarq $0x3, %r12 movl 0x8(%rdi), %esi addq %r12, %rsi callq 0x86e6bc subq %r15, %r14 je 0xf5b2f4 movl 0x8(%rbx), %edi shlq $0x3, %rdi addq (%rbx), %rdi movq %r15, %rsi movq %r14, %rdx ca...
/llvm/ADT/SmallVector.h
clang::OMPMetaDirective* clang::OMPExecutableDirective::createEmptyDirective<clang::OMPMetaDirective>(clang::ASTContext const&, unsigned int, bool, unsigned int)
static T *createEmptyDirective(const ASTContext &C, unsigned NumClauses, bool HasAssociatedStmt = false, unsigned NumChildren = 0) { void *Mem = C.Allocate(sizeof(T) + OMPChildren::size(NumClauses, HasAssociatedStmt, ...
pushq %rbp pushq %r15 pushq %r14 pushq %r12 pushq %rbx movl %ecx, %ebx movl %edx, %ebp movl %esi, %r14d movl %esi, %eax movl %edx, %ecx addl %ebx, %ecx addq %rax, %rcx leaq 0x38(,%rcx,8), %rsi addq $0x850, %rdi # imm = 0x850 pushq $0x3 popq %rdx callq 0x467060 movq %rax, %r15 leaq 0x28(%rax), %r12 movl %r14d...
/clang/AST/StmtOpenMP.h
llvm::SmallVectorTemplateBase<clang::CompoundStmt*, true>::growAndAssign(unsigned long, clang::CompoundStmt*)
void growAndAssign(size_t NumElts, T Elt) { // Elt has been copied in case it's an internal reference, side-stepping // reference invalidation problems without losing the realloc optimization. this->set_size(0); this->grow(NumElts); std::uninitialized_fill_n(this->begin(), NumElts, Elt); this->s...
pushq %r15 pushq %r14 pushq %rbx subq $0x10, %rsp movq %rsi, %rbx movq %rdi, %r14 leaq 0x8(%rsp), %r15 movq %rdx, (%r15) andl $0x0, 0x8(%rdi) callq 0xf82bd6 movq (%r14), %rdi movq %rbx, %rsi movq %r15, %rdx callq 0xf82bed movl %ebx, 0x8(%r14) addq $0x10, %rsp popq %rbx popq %r14 popq %r15 retq
/llvm/ADT/SmallVector.h
llvm::raw_ostream& clang::printOpenACCDirectiveKind<llvm::raw_ostream>(llvm::raw_ostream&, clang::OpenACCDirectiveKind)
inline StreamTy &printOpenACCDirectiveKind(StreamTy &Out, OpenACCDirectiveKind K) { switch (K) { case OpenACCDirectiveKind::Parallel: return Out << "parallel"; case OpenACCDirectiveKind::Serial: return Out << "serial"; case OpenACCDirectiveKind::Kernels: ...
movslq %esi, %rax leaq 0x2ff035(%rip), %rcx # 0x12883a4 movslq (%rcx,%rax,4), %rsi addq %rcx, %rsi jmp 0x45143e nop
/clang/Basic/OpenACCKinds.h
(anonymous namespace)::StmtProfiler::VisitCXXConstructExpr(clang::CXXConstructExpr const*)
void StmtProfiler::VisitCXXConstructExpr(const CXXConstructExpr *S) { VisitExpr(S); VisitDecl(S->getConstructor()); ID.AddBoolean(S->isElidable()); }
pushq %r14 pushq %rbx pushq %rax movq %rsi, %rbx movq %rdi, %r14 callq 0xf8b398 movq 0x10(%rbx), %rsi movq (%r14), %rax movq %r14, %rdi callq *0x18(%rax) movq 0x8(%r14), %rdi movl (%rbx), %esi shrl $0x12, %esi andl $0x1, %esi addq $0x8, %rsp popq %rbx popq %r14 jmp 0xd90c86
/AST/StmtProfile.cpp
clang::SubstTemplateTemplateParmPackStorage::Profile(llvm::FoldingSetNodeID&, clang::ASTContext&)
void SubstTemplateTemplateParmPackStorage::Profile(llvm::FoldingSetNodeID &ID, ASTContext &Context) { Profile(ID, Context, getArgumentPack(), getAssociatedDecl(), getIndex(), getFinal()); }
subq $0x18, %rsp movq 0x10(%rdi), %rcx movl (%rdi), %r8d movl %r8d, %r9d shrl $0x11, %r9d movq %rsp, %rax movl $0x9, (%rax) movq %rcx, 0x8(%rax) movl %r9d, 0x4(%rax) movq 0x18(%rdi), %r9 movq %r9, %rcx andq $-0x8, %rcx shrl $0x2, %r8d andl $0x7fff, %r8d # imm = 0x7FFF andl $0x4, %r9d shrl $0x2, %r9d movq %rsi...
/AST/TemplateName.cpp
clang::TextNodeDumper::visitBlockCommandComment(clang::comments::BlockCommandComment const*, clang::comments::FullComment const*)
void TextNodeDumper::visitBlockCommandComment( const comments::BlockCommandComment *C, const comments::FullComment *) { OS << " Name=\"" << getCommandName(C->getCommandID()) << "\""; for (unsigned i = 0, e = C->getNumArgs(); i != e; ++i) OS << " Arg[" << i << "]=\"" << C->getArgText(i) << "\""; }
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx pushq %rax movq %rsi, %rbx movq %rdi, %r14 movq 0x448(%rdi), %rdi leaq 0x2f9315(%rip), %rsi # 0x128b946 callq 0x45143e movq %rax, %r15 movl 0xc(%rbx), %esi shrl $0x8, %esi andl $0xfffff, %esi # imm = 0xFFFFF movq %r14, %rdi callq 0xf9209a mov...
/AST/TextNodeDumper.cpp
clang::TextNodeDumper::VisitFieldDecl(clang::FieldDecl const*)
void TextNodeDumper::VisitFieldDecl(const FieldDecl *D) { dumpName(D); dumpType(D->getType()); if (D->isMutable()) OS << " mutable"; if (D->isModulePrivate()) OS << " __module_private__"; }
pushq %r14 pushq %rbx pushq %rax movq %rsi, %r14 movq %rdi, %rbx callq 0xf91ac0 movq 0x30(%r14), %rsi movq %rbx, %rdi callq 0xf8f244 testb $0x2, 0x44(%r14) je 0xf965f7 movq 0x448(%rbx), %rdi leaq 0x2f09ea(%rip), %rsi # 0x1286fdc callq 0x45143e movl 0x8(%r14), %eax andl $0x7, %eax cmpl $0x4, %eax jne 0xf9661d movq 0x...
/AST/TextNodeDumper.cpp
clang::TextNodeDumper::VisitOMPRequiresDecl(clang::OMPRequiresDecl const*)
void TextNodeDumper::VisitOMPRequiresDecl(const OMPRequiresDecl *D) { for (const auto *C : D->clauselists()) { AddChild([=] { if (!C) { ColorScope Color(OS, ShowColors, NullColor); OS << "<<<NULL>>> OMPClause"; return; } { ColorScope Color(OS, ShowColors, AttrColo...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x98, %rsp movq %rdi, %rbx movq 0x28(%rsi), %rax leaq 0x10(%rax), %r12 movl (%rax), %ecx leaq 0x10(%rax,%rcx,8), %r14 leaq 0x50(%rsp), %r13 leaq 0x10(%rdi), %r15 pushq $0x1 popq %rbp movq %r14, 0x30(%rsp) cmpq %r14, %r12 je 0xf96edf movq (%r12), %r...
/AST/TextNodeDumper.cpp
clang::ObjCObjectType::isSpecialized() const
bool ObjCObjectType::isSpecialized() const { // If we have type arguments written here, the type is specialized. if (ObjCObjectTypeBits.NumTypeArgs > 0) return true; // Otherwise, check whether the base type is specialized. if (const auto objcObject = getBaseType()->getAs<ObjCObjectType>()) { // Termin...
movzwl 0x12(%rdi), %eax movb $0x1, %cl testw $0x3f8, %ax # imm = 0x3F8 jne 0xfa3b32 pushq %rbx movq 0x18(%rdi), %rax andq $-0x10, %rax movq (%rax), %rdi callq 0x4eda7e movq %rax, %rbx testq %rax, %rax je 0xfa3b1f cmpb $0x22, 0x10(%rbx) jne 0xfa3b21 xorl %eax, %eax jmp 0xfa3b29 jmp 0xfa3b29 movq %rbx, %rdi c...
/AST/Type.cpp
clang::ObjCObjectTypeImpl::Profile(llvm::FoldingSetNodeID&, clang::QualType, llvm::ArrayRef<clang::QualType>, llvm::ArrayRef<clang::ObjCProtocolDecl*>, bool)
void ObjCObjectTypeImpl::Profile(llvm::FoldingSetNodeID &ID, QualType BaseType, ArrayRef<QualType> typeArgs, ArrayRef<ObjCProtocolDecl *> protocols, bool isKindOf) { ID.AddPointer(BaseTy...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx pushq %rax movq %r9, %rbx movq %r8, %r14 movq %rcx, %r12 movq %rdx, %r13 movq %rdi, %r15 movb 0x40(%rsp), %al movb %al, 0x7(%rsp) callq 0x49582e movq %r15, %rdi movq %r12, %rsi callq 0x49582e shlq $0x3, %r12 xorl %ebp, %ebp cmpq %rbp, %r12 je 0xfaa3fc mo...
/AST/Type.cpp
clang::LinkageComputer::computeTypeLinkageInfo(clang::Type const*)
LinkageInfo LinkageComputer::computeTypeLinkageInfo(const Type *T) { switch (T->getTypeClass()) { #define TYPE(Class,Base) #define NON_CANONICAL_TYPE(Class,Base) case Type::Class: #include "clang/AST/TypeNodes.inc" llvm_unreachable("didn't expect a non-canonical type here"); #define TYPE(Class,Base) #define DEPE...
pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x10, %rsp movq %rsi, %r14 movq %rdi, %rbx movzbl 0x10(%rsi), %eax addl $-0x2, %eax leaq 0x2e4a21(%rip), %rcx # 0x128f11c movslq (%rcx,%rax,4), %rax addq %rcx, %rax jmpq *%rax movb $0x16, 0xf(%rsp) jmp 0xfaa71b movq 0x20(%r14), %rsi movq %rbx, %rdi callq 0...
/AST/Type.cpp
clang::AutoType::Profile(llvm::FoldingSetNodeID&, clang::ASTContext const&, clang::QualType, clang::AutoTypeKeyword, bool, clang::ConceptDecl*, llvm::ArrayRef<clang::TemplateArgument>)
void AutoType::Profile(llvm::FoldingSetNodeID &ID, const ASTContext &Context, QualType Deduced, AutoTypeKeyword Keyword, bool IsDependent, ConceptDecl *CD, ArrayRef<TemplateArgument> Arguments) { ID.AddPointer(Deduced.getAsOpaquePtr()); ID.AddInteger...
pushq %rbp pushq %r15 pushq %r14 pushq %r12 pushq %rbx movq %r9, %r15 movl %r8d, %ebp movl %ecx, %r12d movq %rsi, %rbx movq %rdi, %r14 movq %rdx, %rsi callq 0x49582e movq %r14, %rdi movl %r12d, %esi callq 0x4957e2 movq %r14, %rdi movl %ebp, %esi callq 0xd90c86 movq %r14, %rdi movq %r15, %rsi callq 0x49582e movq 0x30(%r...
/AST/Type.cpp
llvm::MutableArrayRef<clang::QualType> llvm::ArrayRef<clang::QualType>::copy<clang::ASTContext>(clang::ASTContext&)
MutableArrayRef<T> copy(Allocator &A) { T *Buff = A.template Allocate<T>(Length); std::uninitialized_copy(begin(), end(), Buff); return MutableArrayRef<T>(Buff, Length); }
pushq %rbx movq %rsi, %rax movq %rdi, %rbx movq 0x8(%rdi), %rsi movq %rax, %rdi callq 0xfab558 movq (%rbx), %rcx movq 0x8(%rbx), %rdx shlq $0x3, %rdx xorl %esi, %esi cmpq %rsi, %rdx je 0xfab551 movq (%rcx,%rsi), %rdi movq %rdi, (%rax,%rsi) addq $0x8, %rsi jmp 0xfab53e movq 0x8(%rbx), %rdx popq %rbx retq nop
/llvm/ADT/ArrayRef.h
(anonymous namespace)::TypePrinter::print(clang::Type const*, clang::Qualifiers, llvm::raw_ostream&, llvm::StringRef)
void TypePrinter::print(const Type *T, Qualifiers Quals, raw_ostream &OS, StringRef PlaceHolder) { if (!T) { OS << "NULL TYPE"; return; } SaveAndRestore PHVal(HasEmptyPlaceHolder, PlaceHolder.empty()); printBefore(T, Quals, OS); OS << PlaceHolder; printAfter(T, Quals, OS); ...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx pushq %rax movq %rcx, %rbx testq %rsi, %rsi je 0xfaee07 movq %r9, %r12 movq %r8, %r13 movq %rsi, %r15 movq %rdi, %r14 testq %r9, %r9 movb 0x14(%rdi), %bpl sete 0x14(%rdi) movq %rbx, %rcx callq 0xfaf1f2 movq %rbx, %rdi movq %r13, %rsi movq %r12, %rdx call...
/AST/TypePrinter.cpp
llvm::DenseMapIterator<clang::BaseSubobject, clang::VTableLayout::AddressPointLocation, llvm::DenseMapInfo<clang::BaseSubobject, void>, llvm::detail::DenseMapPair<clang::BaseSubobject, clang::VTableLayout::AddressPointLocation>, true>::operator++()
inline DenseMapIterator& operator++() { // Preincrement assert(isHandleInSync() && "invalid iterator access!"); assert(Ptr != End && "incrementing end() iterator"); if (shouldReverseIterate<KeyT>()) { --Ptr; RetreatPastEmptyBuckets(); return *this; } ++Ptr; AdvancePastEmptyBuc...
pushq %rbx movq %rdi, %rbx addq $0x18, (%rdi) callq 0xfb6862 movq %rbx, %rax popq %rbx retq
/llvm/ADT/DenseMap.h
(anonymous namespace)::ItaniumVTableBuilder::LayoutPrimaryAndSecondaryVTables(clang::BaseSubobject, bool, bool, clang::CharUnits)
void ItaniumVTableBuilder::LayoutPrimaryAndSecondaryVTables( BaseSubobject Base, bool BaseIsMorallyVirtual, bool BaseIsVirtualInLayoutClass, CharUnits OffsetInLayoutClass) { assert(Base.getBase()->isDynamicClass() && "class does not have a vtable!"); unsigned VTableIndex = Components.size(); VTableIndice...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x528, %rsp # imm = 0x528 movq %r9, %rbp movl %r8d, %ebx movl %ecx, 0x64(%rsp) movq %rdx, %r15 movq %rsi, %r14 movq %rdi, %r12 leaq 0xa0(%rdi), %r13 movl 0xa8(%rdi), %esi addq $0x368, %rdi # imm = 0x368 movq %rsi, 0x88(%rsp) c...
/AST/VTableBuilder.cpp
llvm::DenseMapBase<llvm::DenseMap<clang::BaseSubobject, llvm::detail::DenseSetEmpty, llvm::DenseMapInfo<clang::BaseSubobject, void>, llvm::detail::DenseSetPair<clang::BaseSubobject>>, clang::BaseSubobject, llvm::detail::DenseSetEmpty, llvm::DenseMapInfo<clang::BaseSubobject, void>, llvm::detail::DenseSetPair<clang::Bas...
unsigned getMinBucketToReserveForEntries(unsigned NumEntries) { // Ensure that "NumEntries * 4 < NumBuckets * 3" if (NumEntries == 0) return 0; // +1 is required because of the strict equality. // For example if NumEntries is 48, we need to return 401. return NextPowerOf2(NumEntries * 4 / 3 + ...
testl %esi, %esi je 0xfbdbd4 pushq %rax shll $0x2, %esi pushq $0x3 popq %rcx movl %esi, %eax xorl %edx, %edx divl %ecx leal 0x1(%rax), %edi callq 0x45e847 addq $0x8, %rsp retq xorl %eax, %eax retq nop
/llvm/ADT/DenseMap.h
std::pair<llvm::DenseMapIterator<clang::CXXRecordDecl const*, unsigned int, llvm::DenseMapInfo<clang::CXXRecordDecl const*, void>, llvm::detail::DenseMapPair<clang::CXXRecordDecl const*, unsigned int>, false>, bool> llvm::DenseMapBase<llvm::DenseMap<clang::CXXRecordDecl const*, unsigned int, llvm::DenseMapInfo<clang::C...
std::pair<iterator, bool> try_emplace(const KeyT &Key, Ts &&... Args) { BucketT *TheBucket; if (LookupBucketFor(Key, TheBucket)) return std::make_pair(makeIterator(TheBucket, shouldReverseIterate<KeyT>() ? getBuckets() ...
pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x10, %rsp movq %rcx, %r15 movq %rdx, %r12 movq %rsi, %r14 movq %rdi, %rbx leaq 0x8(%rsp), %r13 movq %rsi, %rdi movq %rdx, %rsi movq %r13, %rdx callq 0x70ac00 movl %eax, %ecx movq (%r13), %rax testb %cl, %cl je 0xfc32f0 xorl %ecx, %ecx jmp 0xfc3303 movq %r14,...
/llvm/ADT/DenseMap.h
clang::comments::Parser::isTokBlockCommand()
bool is(tok::TokenKind K) const LLVM_READONLY { return Kind == K; }
movl 0x34(%rdi), %eax andl $-0x2, %eax cmpl $0x4, %eax jne 0xfc7237 pushq %rax movq 0x28(%rdi), %rax movl 0x38(%rdi), %esi movq %rax, %rdi callq 0xe08ad8 movb 0x13(%rax), %al andb $0x2, %al shrb %al addq $0x8, %rsp retq xorl %eax, %eax retq
/clang/AST/CommentLexer.h
llvm::SmallVectorImpl<clang::interp::Scope::Local>::operator=(llvm::SmallVectorImpl<clang::interp::Scope::Local>&&)
SmallVectorImpl<T> &SmallVectorImpl<T>::operator=(SmallVectorImpl<T> &&RHS) { // Avoid self-assignment. if (this == &RHS) return *this; // If the RHS isn't small, clear this vector and then steal its buffer. if (!RHS.isSmall()) { this->assignRemote(std::move(RHS)); return *this; } // If we already...
pushq %r15 pushq %r14 pushq %r12 pushq %rbx pushq %rax movq %rdi, %rbx cmpq %rsi, %rdi je 0xfd5f36 movq %rsi, %r14 movq (%rsi), %rsi leaq 0x10(%r14), %rax cmpq %rax, %rsi je 0xfd5eb8 movq %rbx, %rdi movq %r14, %rsi callq 0xfd5f46 jmp 0xfd5f36 movl 0x8(%r14), %r15d movl 0x8(%rbx), %r12d cmpl %r15d, %r12d jae 0xfd5edc cm...
/llvm/ADT/SmallVector.h
llvm::DenseMap<clang::ParmVarDecl const*, clang::interp::ParamOffset, llvm::DenseMapInfo<clang::ParmVarDecl const*, void>, llvm::detail::DenseMapPair<clang::ParmVarDecl const*, clang::interp::ParamOffset>>::grow(unsigned int)
void grow(unsigned AtLeast) { unsigned OldNumBuckets = NumBuckets; BucketT *OldBuckets = Buckets; allocateBuckets(std::max<unsigned>(64, static_cast<unsigned>(NextPowerOf2(AtLeast-1)))); assert(Buckets); if (!OldBuckets) { this->BaseT::initEmpty(); return; } this->moveFromOldBu...
pushq %r15 pushq %r14 pushq %rbx movq %rdi, %r15 movl 0x10(%rdi), %ebx movq (%rdi), %r14 leal -0x1(%rsi), %edi callq 0x45e847 cmpl $0x41, %eax pushq $0x40 popq %rsi cmovael %eax, %esi movq %r15, %rdi callq 0xe9a076 testq %r14, %r14 je 0xfd66dc shlq $0x4, %rbx leaq (%r14,%rbx), %rdx movq %r15, %rdi movq %r14, %rsi callq...
/llvm/ADT/DenseMap.h
llvm::DenseMap<clang::FunctionDecl const*, std::unique_ptr<clang::interp::Function, std::default_delete<clang::interp::Function>>, llvm::DenseMapInfo<clang::FunctionDecl const*, void>, llvm::detail::DenseMapPair<clang::FunctionDecl const*, std::unique_ptr<clang::interp::Function, std::default_delete<clang::interp::Func...
void grow(unsigned AtLeast) { unsigned OldNumBuckets = NumBuckets; BucketT *OldBuckets = Buckets; allocateBuckets(std::max<unsigned>(64, static_cast<unsigned>(NextPowerOf2(AtLeast-1)))); assert(Buckets); if (!OldBuckets) { this->BaseT::initEmpty(); return; } this->moveFromOldBu...
pushq %r15 pushq %r14 pushq %rbx movq %rdi, %r15 movl 0x10(%rdi), %ebx movq (%rdi), %r14 leal -0x1(%rsi), %edi callq 0x45e847 cmpl $0x41, %eax pushq $0x40 popq %rsi cmovael %eax, %esi movq %r15, %rdi callq 0xe99596 testq %r14, %r14 je 0xfd68d0 shlq $0x4, %rbx leaq (%r14,%rbx), %rdx movq %r15, %rdi movq %r14, %rsi callq...
/llvm/ADT/DenseMap.h
clang::interp::Compiler<clang::interp::ByteCodeEmitter>::collectBaseOffset(clang::QualType, clang::QualType)
unsigned Compiler<Emitter>::collectBaseOffset(const QualType BaseType, const QualType DerivedType) { const auto extractRecordDecl = [](QualType Ty) -> const CXXRecordDecl * { if (const auto *PT = dyn_cast<PointerType>(Ty)) return PT->getPointeeType()->getAsCXXRe...
pushq %r15 pushq %r14 pushq %r12 pushq %rbx pushq %rax movq %rdx, %rbx movq %rdi, %r14 leaq 0x7(%rsp), %r15 movq %r15, %rdi callq 0xfe4182 movq %rax, %r12 movq %r15, %rdi movq %rbx, %rsi callq 0xfe4182 movq 0x1e8(%r14), %rdi movq %r12, %rsi movq %rax, %rdx callq 0xe994a4 addq $0x8, %rsp popq %rbx popq %r12 popq %r14 po...
/AST/Interp/Compiler.cpp
clang::interp::Compiler<clang::interp::ByteCodeEmitter>::visitZeroInitializer(clang::interp::PrimType, clang::QualType, clang::Expr const*)
bool Compiler<Emitter>::visitZeroInitializer(PrimType T, QualType QT, const Expr *E) { switch (T) { case PT_Bool: return this->emitZeroBool(E); case PT_Sint8: return this->emitZeroSint8(E); case PT_Uint8: return this->emitZeroUint8(E); case PT_Sint16: ...
pushq %r15 pushq %r14 pushq %r12 pushq %rbx subq $0x48, %rsp movq %rcx, %r14 movq %rdi, %rbx movl %esi, %eax leaq 0x2bb1fa(%rip), %rcx # 0x1293d50 movslq (%rcx,%rax,4), %rax addq %rcx, %rax jmpq *%rax orq $0x4, %r14 movq %rsp, %rsi movq %r14, (%rsi) movq %rbx, %rdi callq 0xfd59a0 jmp 0xfd8d16 orq $0x4, %r14 movq %rs...
/AST/Interp/Compiler.cpp
clang::interp::LocalScope<clang::interp::ByteCodeEmitter>::destroyLocals()
bool destroyLocals() { if (!Idx) return true; bool Success = this->emitDestructors(); this->Ctx->emitDestroy(*Idx, SourceInfo{}); removeStoredOpaqueValues(); this->Idx = std::nullopt; return Success; }
pushq %rbp pushq %rbx pushq %rax movb $0x1, %bpl cmpb $0x1, 0x24(%rdi) jne 0xfde1c2 movq %rdi, %rbx movq (%rdi), %rax callq *0x28(%rax) movl %eax, %ebp movq 0x8(%rbx), %rdi movl 0x20(%rbx), %esi movq %rsp, %rdx andq $0x0, (%rdx) callq 0xfcfcbc movq %rbx, %rdi callq 0xff0e9c cmpb $0x1, 0x24(%rbx) jne 0xfde1c2 movb $0x0,...
/AST/Interp/Compiler.h
clang::interp::Compiler<clang::interp::ByteCodeEmitter>::VisitCompoundAssignOperator(clang::CompoundAssignOperator const*)
bool Compiler<Emitter>::VisitCompoundAssignOperator( const CompoundAssignOperator *E) { const Expr *LHS = E->getLHS(); const Expr *RHS = E->getRHS(); std::optional<PrimType> LHSComputationT = classify(E->getComputationLHSType()); std::optional<PrimType> LT = classify(LHS->getType()); std::optional<...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x48, %rsp movq %rsi, %r13 movq %rdi, %rbx movq 0x10(%rsi), %r15 movq 0x18(%rsi), %r14 movq 0x20(%rsi), %rsi callq 0xfd84fc movq %rax, 0x30(%rsp) movq 0x8(%r15), %rsi movq %rbx, %rdi callq 0xfd84fc movq %rax, %rbp movq 0x8(%r14), %rsi movq %rbx, %r...
/AST/Interp/Compiler.cpp
clang::interp::Compiler<clang::interp::ByteCodeEmitter>::VisitPointerCompoundAssignOperator(clang::CompoundAssignOperator const*)
bool Compiler<Emitter>::VisitPointerCompoundAssignOperator( const CompoundAssignOperator *E) { BinaryOperatorKind Op = E->getOpcode(); const Expr *LHS = E->getLHS(); const Expr *RHS = E->getRHS(); std::optional<PrimType> LT = classify(LHS->getType()); std::optional<PrimType> RT = classify(RHS->getType());...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x18, %rsp movq %rsi, %r14 movq %rdi, %rbx movl (%rsi), %r15d shrl $0x12, %r15d andl $0x3f, %r15d movq 0x10(%rsi), %r13 movq 0x18(%rsi), %r12 movq 0x8(%r13), %rsi callq 0xfd84fc movq %rax, %rbp movq 0x8(%r12), %rsi movq %rbx, %rdi callq 0xfd84fc mo...
/AST/Interp/Compiler.cpp
clang::interp::Compiler<clang::interp::EvalEmitter>::VisitPointerCompoundAssignOperator(clang::CompoundAssignOperator const*)
bool Compiler<Emitter>::VisitPointerCompoundAssignOperator( const CompoundAssignOperator *E) { BinaryOperatorKind Op = E->getOpcode(); const Expr *LHS = E->getLHS(); const Expr *RHS = E->getRHS(); std::optional<PrimType> LT = classify(LHS->getType()); std::optional<PrimType> RT = classify(RHS->getType());...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x18, %rsp movq %rsi, %r14 movq %rdi, %rbx movl (%rsi), %r15d shrl $0x12, %r15d andl $0x3f, %r15d movq 0x10(%rsi), %r13 movq 0x18(%rsi), %r12 movq 0x8(%r13), %rsi callq 0xfe5330 movq %rax, %rbp movq 0x8(%r12), %rsi movq %rbx, %rdi callq 0xfe5330 mo...
/AST/Interp/Compiler.cpp
llvm::SmallVectorTemplateBase<llvm::SmallVector<clang::interp::Scope::Local, 8u>, false>::moveElementsForGrow(llvm::SmallVector<clang::interp::Scope::Local, 8u>*)
void SmallVectorTemplateBase<T, TriviallyCopyable>::moveElementsForGrow( T *NewElts) { // Move the elements over. this->uninitialized_move(this->begin(), this->end(), NewElts); // Destroy the original elements. destroy_range(this->begin(), this->end()); }
pushq %rbx movq %rsi, %rdx movq %rdi, %rbx movq (%rdi), %rdi movl 0x8(%rbx), %eax imulq $0x90, %rax, %rsi addq %rdi, %rsi callq 0xff126a movq (%rbx), %rdi movl 0x8(%rbx), %eax imulq $0x90, %rax, %rsi addq %rdi, %rsi popq %rbx jmp 0xe99980
/llvm/ADT/SmallVector.h
void moveArrayTy<clang::interp::Integral<32u, false>>(clang::interp::Block*, std::byte const*, std::byte*, clang::interp::Descriptor const*)
static void moveArrayTy(Block *, const std::byte *Src, std::byte *Dst, const Descriptor *D) { // FIXME: Get rid of the const_cast. InitMapPtr &SrcIMP = *reinterpret_cast<InitMapPtr *>(const_cast<std::byte *>(Src)); if (SrcIMP) { // We only ever invoke the moveFunc when moving blo...
pushq %r15 pushq %r14 pushq %rbx movq %rcx, %r15 movq %rdx, %rbx movq %rsi, %r14 cmpb $0x1, 0x18(%rsi) jne 0xff35c5 movq %r14, %rdi callq 0xff341a movl 0xc(%r15), %eax cmpl $-0x1, %eax je 0xff35d6 xorl %edx, %edx divl 0x8(%r15) jmp 0xff35d8 xorl %eax, %eax xorl %ecx, %ecx cmpq %rcx, %rax je 0xff35ed movl 0x20(%r14,%rcx...
/AST/Interp/Descriptor.cpp
llvm::DenseMapBase<llvm::DenseMap<unsigned int, unsigned int, llvm::DenseMapInfo<unsigned int, void>, llvm::detail::DenseMapPair<unsigned int, unsigned int>>, unsigned int, unsigned int, llvm::DenseMapInfo<unsigned int, void>, llvm::detail::DenseMapPair<unsigned int, unsigned int>>::find(unsigned int const&) const
const_iterator find(const_arg_type_t<KeyT> Val) const { const BucketT *TheBucket; if (LookupBucketFor(Val, TheBucket)) return makeConstIterator(TheBucket, shouldReverseIterate<KeyT>() ? getBuckets() : getBucketsEnd(...
pushq %rbx subq $0x10, %rsp movq %rdi, %rbx leaq 0x8(%rsp), %rdx callq 0x4e8e92 testb %al, %al je 0xff65d1 movq 0x8(%rsp), %rax movl 0x10(%rbx), %edx shlq $0x3, %rdx addq (%rbx), %rdx jmp 0xff65de movl 0x10(%rbx), %eax shlq $0x3, %rax addq (%rbx), %rax movq %rax, %rdx addq $0x10, %rsp popq %rbx retq
/llvm/ADT/DenseMap.h
clang::HeaderSearch::getUniqueFrameworkName(llvm::StringRef)
StringRef HeaderSearch::getUniqueFrameworkName(StringRef Framework) { return FrameworkNames.insert(Framework).first->first(); }
pushq %rax addq $0x7e8, %rdi # imm = 0x7E8 callq 0x4f1bfc movq (%rax), %rax movq (%rax), %rdx addq $0x8, %rax popq %rcx retq
/Lex/HeaderSearch.cpp
bool llvm::DenseMapBase<llvm::DenseMap<clang::DirectoryEntry const*, bool, llvm::DenseMapInfo<clang::DirectoryEntry const*, void>, llvm::detail::DenseMapPair<clang::DirectoryEntry const*, bool>>, clang::DirectoryEntry const*, bool, llvm::DenseMapInfo<clang::DirectoryEntry const*, void>, llvm::detail::DenseMapPair<clang...
unsigned getNumBuckets() const { return NumBuckets; }
movl 0x10(%rdi), %ecx testl %ecx, %ecx je 0xffb75c pushq %rbx movq (%rdi), %rdi movq (%rsi), %rsi movl %esi, %eax shrl $0x4, %eax movl %esi, %r8d shrl $0x9, %r8d xorl %eax, %r8d decl %ecx movl $0x1, %r10d xorl %r9d, %r9d andl %ecx, %r8d movq %r8, %rax shlq $0x4, %rax leaq (%rdi,%rax), %r11 movq (%rdi,%rax), %rbx movb $...
/llvm/ADT/DenseMap.h
llvm::DenseMap<clang::DirectoryEntry const*, bool, llvm::DenseMapInfo<clang::DirectoryEntry const*, void>, llvm::detail::DenseMapPair<clang::DirectoryEntry const*, bool>>::allocateBuckets(unsigned int)
bool allocateBuckets(unsigned Num) { NumBuckets = Num; if (NumBuckets == 0) { Buckets = nullptr; return false; } Buckets = static_cast<BucketT *>( allocate_buffer(sizeof(BucketT) * NumBuckets, alignof(BucketT))); return true; }
pushq %rbp pushq %rbx pushq %rax movl %esi, %ebp movq %rdi, %rbx movl %esi, 0x10(%rdi) testl %esi, %esi je 0xffb859 movl %ebp, %edi shlq $0x4, %rdi pushq $0x8 popq %rsi callq 0x464061 jmp 0xffb85b xorl %eax, %eax testl %ebp, %ebp setne %cl movq %rax, (%rbx) movl %ecx, %eax addq $0x8, %rsp popq %rbx popq %rbp retq
/llvm/ADT/DenseMap.h
clang::Lexer::tryReadUCN(char const*&, char const*, clang::Token*)
uint32_t Lexer::tryReadUCN(const char *&StartPtr, const char *SlashLoc, Token *Result) { unsigned CharSize; std::optional<uint32_t> CodePointOpt; char Kind = getCharAndSize(StartPtr, CharSize); if (Kind == 'u' || Kind == 'U') CodePointOpt = tryReadNumericUCN(StartPtr, SlashLoc, R...
pushq %r15 pushq %r14 pushq %r12 pushq %rbx subq $0x98, %rsp movq %rcx, %r14 movq %rdx, %r15 movq %rsi, %r12 movq %rdi, %rbx movq (%rsi), %rsi leaq 0x4(%rsp), %rdx callq 0x1001274 movl %eax, %ecx andb $-0x21, %al cmpb $0x55, %al jne 0x1000b68 movq %rbx, %rdi movq %r12, %rsi movq %r15, %rdx movq %r14, %rcx callq 0x10039...
/Lex/Lexer.cpp
llvm::DenseMapBase<llvm::DenseMap<long, llvm::TinyPtrVector<clang::Module*>, llvm::DenseMapInfo<long, void>, llvm::detail::DenseMapPair<long, llvm::TinyPtrVector<clang::Module*>>>, long, llvm::TinyPtrVector<clang::Module*>, llvm::DenseMapInfo<long, void>, llvm::detail::DenseMapPair<long, llvm::TinyPtrVector<clang::Modu...
void moveFromOldBuckets(BucketT *OldBucketsBegin, BucketT *OldBucketsEnd) { initEmpty(); // Insert all the old elements. const KeyT EmptyKey = getEmptyKey(); const KeyT TombstoneKey = getTombstoneKey(); for (BucketT *B = OldBucketsBegin, *E = OldBucketsEnd; B != E; ++B) { if (!KeyInfoT::isEqu...
pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x10, %rsp movq %rdx, %rbx movq %rsi, %r14 movq %rdi, %r15 callq 0x10154aa addq $0x8, %r14 movabsq $0x7ffffffffffffffd, %r13 # imm = 0x7FFFFFFFFFFFFFFD leaq 0x8(%rsp), %r12 leaq -0x8(%r14), %rsi cmpq %rbx, %rsi je 0x10167ba cmpq %r13, (%rsi) jg 0x10167b4 movq...
/llvm/ADT/DenseMap.h
(anonymous namespace)::PragmaUnsafeBufferUsageHandler::HandlePragma(clang::Preprocessor&, clang::PragmaIntroducer, clang::Token&)
void HandlePragma(Preprocessor &PP, PragmaIntroducer Introducer, Token &FirstToken) override { Token Tok; PP.LexUnexpandedToken(Tok); if (Tok.isNot(tok::identifier)) { PP.Diag(Tok, diag::err_pp_pragma_unsafe_buffer_usage_syntax); return; } IdentifierInfo *II = Tok.g...
pushq %r15 pushq %r14 pushq %rbx subq $0xa0, %rsp movq %rsi, %rbx leaq 0x8(%rsp), %r14 movq %rsi, %rdi movq %r14, %rsi callq 0x54f528 cmpw $0x5, 0x10(%r14) jne 0x1034871 leaq 0x8(%rsp), %r15 movq %r15, %rdi callq 0x4f5f74 movq %rax, %r14 movl (%r15), %eax movl %eax, 0x4(%rsp) leaq 0x1782bd(%rip), %rsi # 0x11acaf8 mo...
/Lex/Pragma.cpp
clang::PreprocessingRecord::allocateSkippedRanges(unsigned int)
unsigned PreprocessingRecord::allocateSkippedRanges(unsigned NumRanges) { unsigned Result = SkippedRanges.size(); SkippedRanges.resize(SkippedRanges.size() + NumRanges); SkippedRangesAllLoaded = false; return Result; }
pushq %r14 pushq %rbx pushq %rax movq %rdi, %rbx movq 0xa8(%rdi), %r14 subq 0xa0(%rdi), %r14 addq $0xa0, %rdi sarq $0x3, %r14 movl %esi, %esi addq %r14, %rsi callq 0x10359d2 movb $0x0, 0xb8(%rbx) movl %r14d, %eax addq $0x8, %rsp popq %rbx popq %r14 retq
/Lex/PreprocessingRecord.cpp
clang::Preprocessor::getTotalMemory() const
size_t Preprocessor::getTotalMemory() const { return BP.getTotalMemory() + llvm::capacity_in_bytes(MacroExpandedTokens) + Predefines.capacity() /* Predefines buffer. */ // FIXME: Include sizes from all submodules, and include MacroInfo sizes, // and ModuleMacros. + llvm::capacity_in_bytes(CurSubmo...
pushq %rbx movq %rdi, %rbx addq $0x80, %rdi callq 0x792824 movq %rax, %rcx movl 0x9a4(%rbx), %eax imulq $0x18, %rax, %rax addq %rcx, %rax leaq 0x938(%rbx), %rcx cmpq %rcx, 0x928(%rbx) je 0x1037785 movq 0x938(%rbx), %rcx jmp 0x1037788 pushq $0xf popq %rcx movq 0x698(%rbx), %rdx movl 0x10(%rdx), %edx movl 0x8e0(%rbx), %e...
/Lex/Preprocessor.cpp
clang::getOperatorSpelling(clang::OverloadedOperatorKind)
const char *clang::getOperatorSpelling(OverloadedOperatorKind Operator) { switch (Operator) { case OO_None: case NUM_OVERLOADED_OPERATORS: return nullptr; #define OVERLOADED_OPERATOR(Name,Spelling,Token,Unary,Binary,MemberOnly) \ case OO_##Name: return Spelling; #include "clang/Basic/OperatorKinds.def" }...
movslq %edi, %rax leaq 0x94db35(%rip), %rcx # 0x19bc250 movq (%rcx,%rax,8), %rax retq
/Basic/IdentifierTable.cpp
clang::IdentifierTable::getFutureCompatDiagKind(clang::IdentifierInfo const&, clang::LangOptions const&)
diag::kind IdentifierTable::getFutureCompatDiagKind(const IdentifierInfo &II, const LangOptions &LangOpts) { assert(II.isFutureCompatKeyword() && "diagnostic should not be needed"); unsigned Flags = llvm::StringSwitch<unsigned>(II.getName()) #define KEYWORD(NAME, FLAGS) .Ca...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x28, %rsp movq %rdx, 0x8(%rsp) movq 0x10(%rsi), %rax movl (%rax), %ecx addq $0x10, %rax leaq 0x10(%rsp), %rdi movq %rax, (%rdi) movq %rcx, 0x8(%rdi) movb $0x0, 0x14(%rdi) leaq 0x3b361a(%rip), %rsi # 0x1421de8 pushq $0x4 popq %r12 movq %r12, %rd...
/Basic/IdentifierTable.cpp
clang::LangOptions::remapPathPrefix(llvm::SmallVectorImpl<char>&) const
void LangOptions::remapPathPrefix(SmallVectorImpl<char> &Path) const { for (const auto &Entry : MacroPrefixMap) if (llvm::sys::path::replace_path_prefix(Path, Entry.first, Entry.second)) break; }
pushq %r15 pushq %r14 pushq %rbx movq %rsi, %rbx movq %rdi, %r14 movq 0x260(%rdi), %r15 addq $0x250, %r14 # imm = 0x250 cmpq %r14, %r15 je 0x1070e56 movq 0x20(%r15), %rsi movq 0x28(%r15), %rdx movq 0x40(%r15), %rcx movq 0x48(%r15), %r8 movq %rbx, %rdi xorl %r9d, %r9d callq 0x481a65 testb %al, %al jne 0x1070e...
/Basic/LangOptions.cpp
llvm::DenseMap<clang::FileID, std::unique_ptr<std::map<unsigned int, clang::SourceLocation, std::less<unsigned int>, std::allocator<std::pair<unsigned int const, clang::SourceLocation>>>, std::default_delete<std::map<unsigned int, clang::SourceLocation, std::less<unsigned int>, std::allocator<std::pair<unsigned int con...
void init(unsigned InitNumEntries) { auto InitBuckets = BaseT::getMinBucketToReserveForEntries(InitNumEntries); if (allocateBuckets(InitBuckets)) { this->BaseT::initEmpty(); } else { NumEntries = 0; NumTombstones = 0; } }
pushq %rbx movq %rdi, %rbx callq 0x1081cfa movq %rbx, %rdi movl %eax, %esi callq 0x1081d1c testb %al, %al je 0x1081cf2 movq %rbx, %rdi popq %rbx jmp 0x1081d4e andq $0x0, 0x8(%rbx) popq %rbx retq nop
/llvm/ADT/DenseMap.h
llvm::DenseMapBase<llvm::DenseMap<std::pair<clang::FileID, clang::FileID>, clang::InBeforeInTUCacheEntry, llvm::DenseMapInfo<std::pair<clang::FileID, clang::FileID>, void>, llvm::detail::DenseMapPair<std::pair<clang::FileID, clang::FileID>, clang::InBeforeInTUCacheEntry>>, std::pair<clang::FileID, clang::FileID>, clang...
void moveFromOldBuckets(BucketT *OldBucketsBegin, BucketT *OldBucketsEnd) { initEmpty(); // Insert all the old elements. const KeyT EmptyKey = getEmptyKey(); const KeyT TombstoneKey = getTombstoneKey(); for (BucketT *B = OldBucketsBegin, *E = OldBucketsEnd; B != E; ++B) { if (!KeyInfoT::isEqu...
pushq %r15 pushq %r14 pushq %r12 pushq %rbx pushq %rax movq %rdx, %rbx movq %rsi, %r14 movq %rdi, %r15 callq 0x1081cb0 movq %rsp, %r12 cmpq %rbx, %r14 je 0x10829b7 movl (%r14), %eax movl 0x4(%r14), %ecx movl %eax, %edx orl %ecx, %edx je 0x10829b1 andl %ecx, %eax cmpl $-0x1, %eax je 0x10829b1 movq %r15, %rdi movq %r14, ...
/llvm/ADT/DenseMap.h
bool llvm::is_contained<llvm::StringLiteral const (&) [3], llvm::StringRef>(llvm::StringLiteral const (&) [3], llvm::StringRef const&)
bool is_contained(R &&Range, const E &Element) { if constexpr (detail::HasMemberContains<R, E>) return Range.contains(Element); else if constexpr (detail::HasMemberFind<R, E>) return Range.find(Element) != Range.end(); else return std::find(adl_begin(Range), adl_end(Range), Element) != adl_...
pushq %rbx movq %rsi, %rdx leaq 0x30(%rdi), %rbx movq %rbx, %rsi callq 0x10a847d cmpq %rbx, %rax setne %al popq %rbx retq
/llvm/ADT/STLExtras.h
clang::targets::WebAssembly64TargetInfo::~WebAssembly64TargetInfo()
class LLVM_LIBRARY_VISIBILITY WebAssembly64TargetInfo : public WebAssemblyTargetInfo { public: explicit WebAssembly64TargetInfo(const llvm::Triple &T, const TargetOptions &Opts) : WebAssemblyTargetInfo(T, Opts) { LongAlign = LongWidth = 64; PointerAlign = PointerWi...
pushq %rbx movq %rdi, %rbx callq 0x109b388 movl $0x220, %esi # imm = 0x220 movq %rbx, %rdi popq %rbx jmp 0x4360d0 nop
/Basic/Targets/WebAssembly.h
llvm::omp::getBestVariantMatchForContext(llvm::SmallVectorImpl<llvm::omp::VariantMatchInfo> const&, llvm::omp::OMPContext const&)
int llvm::omp::getBestVariantMatchForContext( const SmallVectorImpl<VariantMatchInfo> &VMIs, const OMPContext &Ctx) { APInt BestScore(64, 0); int BestVMIIdx = -1; const VariantMatchInfo *BestVMI = nullptr; for (unsigned u = 0, e = VMIs.size(); u < e; ++u) { const VariantMatchInfo &VMI = VMIs[u]; ...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0xb8, %rsp movq %rsi, 0x38(%rsp) movq %rdi, %rbx leaq 0x68(%rsp), %rsi movl $0x40, 0x8(%rsi) andq $0x0, (%rsi) movq %rsi, %rdi callq 0x468540 movq %rbx, 0x30(%rsp) movl 0x8(%rbx), %eax movq %rax, 0x40(%rsp) pushq $-0x1 popq %rax movl %eax, (%rsp) x...
/Frontend/OpenMP/OMPContext.cpp
void llvm::cl::ValuesClass::apply<llvm::cl::opt<llvm::GVDAGType, false, llvm::cl::parser<llvm::GVDAGType>>>(llvm::cl::opt<llvm::GVDAGType, false, llvm::cl::parser<llvm::GVDAGType>>&) const
void apply(Opt &O) const { for (const auto &Value : Values) O.getParser().addLiteralOption(Value.Name, Value.Value, Value.Description); }
pushq %r15 pushq %r14 pushq %rbx movq %rsi, %rbx movq (%rdi), %r14 movl 0x8(%rdi), %eax addq $0x98, %rbx imulq $0x28, %rax, %r15 testq %r15, %r15 je 0x10cb91d movq (%r14), %rsi movq 0x8(%r14), %rdx leaq 0x10(%r14), %rcx movq 0x18(%r14), %r8 movq 0x20(%r14), %r9 movq %rbx, %rdi callq 0x10cb924 addq $0x28, %r14 addq $-0x...
/llvm/Support/CommandLine.h
llvm::cl::opt<bool, false, llvm::cl::parser<bool>>::opt<char [44], llvm::cl::OptionHidden, llvm::cl::desc, llvm::cl::initializer<bool>>(char const (&) [44], llvm::cl::OptionHidden const&, llvm::cl::desc const&, llvm::cl::initializer<bool> const&)
explicit opt(const Mods &... Ms) : Option(llvm::cl::Optional, NotHidden), Parser(*this) { apply(this, Ms...); done(); }
pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx movq %r8, %rbx movq %rcx, %r15 movq %rdx, %r12 movq %rsi, %r13 movq %rdi, %r14 xorl %esi, %esi xorl %edx, %edx callq 0x453f88 movb $0x0, 0x80(%r14) andq $0x0, 0x90(%r14) leaq 0x8279b8(%rip), %rax # 0x18f7298 addq $0x10, %rax movq %rax, 0x88(%r14) leaq 0x827e8e(%...
/llvm/Support/CommandLine.h
llvm::InstrProfSymtab::InstrProfSymtab()
InstrProfSymtab() : VTableAddrMap(VTableAddrMapAllocator) {}
pushq %rbx movq %rdi, %rbx xorps %xmm0, %xmm0 movups %xmm0, 0x1c(%rdi) movups %xmm0, 0x10(%rdi) movups %xmm0, (%rdi) movl $0x8, 0x2c(%rdi) movups %xmm0, 0x30(%rdi) movabsq $0x800000000, %rax # imm = 0x800000000 movq %rax, 0x40(%rdi) addq $0x78, %rdi movups %xmm0, 0x48(%rbx) movups %xmm0, 0x58(%rbx) movups %xmm0, 0...
/llvm/ProfileData/InstrProf.h
llvm::InstrProfReader::error(llvm::instrprof_error, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>> const&)
Error error(instrprof_error Err, const std::string &ErrMsg = "") { LastError = Err; LastErrorMsg = ErrMsg; if (Err == instrprof_error::success) return Error::success(); return make_error<InstrProfError>(Err, ErrMsg); }
pushq %rbp pushq %r14 pushq %rbx subq $0x10, %rsp movq %rcx, %r14 movl %edx, %ebp movq %rdi, %rbx movl %edx, 0xc(%rsp) movl %edx, 0x8(%rsi) leaq 0x10(%rsi), %rdi movq %rcx, %rsi callq 0x4367b0 testl %ebp, %ebp je 0x10d3709 leaq 0xc(%rsp), %rsi movq %rbx, %rdi movq %r14, %rdx callq 0x10d551c jmp 0x10d370d andq $0x0, (%r...
/llvm/ProfileData/InstrProfReader.h
llvm::OnDiskIterableChainedHashTable<llvm::memprof::FrameLookupTrait>::Create(unsigned char const*, unsigned char const*, unsigned char const*, llvm::memprof::FrameLookupTrait const&)
static OnDiskIterableChainedHashTable * Create(const unsigned char *Buckets, const unsigned char *const Payload, const unsigned char *const Base, const Info &InfoObj = Info()) { assert(Buckets > Base); auto NumBucketsAndEntries = OnDiskIterableChainedHashTable<Info>::readNumBucketsAndEntries(...
pushq %r15 pushq %r14 pushq %r12 pushq %rbx pushq %rax movq %rdx, %rbx movq %rsi, %r14 movq %rdi, %r15 leaq 0x10(%rdi), %r12 pushq $0x30 popq %rdi callq 0x436820 movups (%r15), %xmm0 movups %xmm0, (%rax) movq %r12, 0x10(%rax) movq %rbx, 0x18(%rax) movq %r14, 0x28(%rax) addq $0x8, %rsp popq %rbx popq %r12 popq %r14 popq...
/llvm/Support/OnDiskHashTable.h
llvm::cl::opt<int, false, llvm::cl::parser<int>>::opt<char [28], llvm::cl::OptionHidden, llvm::cl::initializer<int>, llvm::cl::desc>(char const (&) [28], llvm::cl::OptionHidden const&, llvm::cl::initializer<int> const&, llvm::cl::desc const&)
explicit opt(const Mods &... Ms) : Option(llvm::cl::Optional, NotHidden), Parser(*this) { apply(this, Ms...); done(); }
pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx movq %r8, %rbx movq %rcx, %r15 movq %rdx, %r12 movq %rsi, %r13 movq %rdi, %r14 xorl %esi, %esi xorl %edx, %edx callq 0x453f88 andl $0x0, 0x80(%r14) andq $0x0, 0x90(%r14) leaq 0x80c616(%rip), %rax # 0x18f7a58 addq $0x10, %rax movq %rax, 0x88(%r14) leaq 0x80c25c(%...
/llvm/Support/CommandLine.h
llvm::MachO::swapStruct(llvm::MachO::mach_header_64&)
[[nodiscard]] constexpr T byteswap(T V) noexcept { if constexpr (sizeof(T) == 1) { return V; } else if constexpr (sizeof(T) == 2) { uint16_t UV = V; #if defined(_MSC_VER) && !defined(_DEBUG) // The DLL version of the runtime lacks these functions (bug!?), but in a // release build they're replaced w...
movdqu (%rdi), %xmm0 movdqu 0x10(%rdi), %xmm1 pxor %xmm2, %xmm2 movdqa %xmm0, %xmm3 punpckhbw %xmm2, %xmm3 # xmm3 = xmm3[8],xmm2[8],xmm3[9],xmm2[9],xmm3[10],xmm2[10],xmm3[11],xmm2[11],xmm3[12],xmm2[12],xmm3[13],xmm2[13],xmm3[14],xmm2[14],xmm3[15],xmm2[15] pshuflw $0x1b, %xmm3, %xmm3 # xmm3 = xmm3[3,2,1,0,4,5,6,7...
/llvm/ADT/bit.h
llvm::object::WasmObjectFile::parseExportSection(llvm::object::WasmObjectFile::ReadContext&)
Error WasmObjectFile::parseExportSection(ReadContext &Ctx) { uint32_t Count = readVaruint32(Ctx); Exports.reserve(Count); Symbols.reserve(Count); for (uint32_t I = 0; I < Count; I++) { wasm::WasmExport Ex; Ex.Name = readString(Ctx); Ex.Kind = readUint8(Ctx); Ex.Index = readVaruint32(Ctx); co...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0xc8, %rsp movq %rdx, %r14 movq %rsi, %r13 movq %rdi, 0x8(%rsp) movq %rdx, %rdi callq 0x10fe406 movl %eax, %ebp leaq 0x1a8(%r13), %r12 movl %eax, %ebx movq %r12, %rdi movq %rbx, %rsi callq 0x1101b50 leaq 0x218(%r13), %r15 movq %r15, %rdi movq %rbx,...
/Object/WasmObjectFile.cpp
llvm::AsmToken::getStringContents() const
[[nodiscard]] StringRef slice(size_t Start, size_t End) const { Start = std::min(Start, Length); End = std::clamp(End, Start, Length); return StringRef(Data + Start, End - Start); }
movq 0x8(%rdi), %rax movq 0x10(%rdi), %rcx xorl %esi, %esi movq %rcx, %rdi addq $-0x1, %rdi setb %sil adcq $0x0, %rax cmpq %rsi, %rdi pushq $0x1 popq %rdx cmovaeq %rdi, %rdx cmpq %rcx, %rdx cmovaeq %rcx, %rdx subq %rsi, %rdx retq
/llvm/ADT/StringRef.h
bool llvm::function_ref<bool ()>::callback_fn<(anonymous namespace)::AsmParser::parseDirectiveAscii(llvm::StringRef, bool)::$_0>(long)
static Ret callback_fn(intptr_t callable, Params ...params) { return (*reinterpret_cast<Callable*>(callable))( std::forward<Params>(params)...); }
pushq %rbp pushq %r15 pushq %r14 pushq %rbx subq $0x28, %rsp movq %rdi, %r14 movq (%rdi), %rbx leaq 0x18(%rsp), %rax movq %rax, -0x10(%rax) andq $0x0, -0x8(%rax) movb $0x0, (%rax) movq (%rbx), %rax movq %rbx, %rdi callq *0x108(%rax) movb $0x1, %bpl testb %al, %al jne 0x113509d leaq 0x8(%rsp), %r15 movq (%rbx), %rax mov...
/llvm/ADT/STLFunctionalExtras.h
llvm::APFloat::getNaN(llvm::fltSemantics const&, bool, unsigned long)
static APFloat getNaN(const fltSemantics &Sem, bool Negative = false, uint64_t payload = 0) { if (payload) { APInt intPayload(64, payload); return getQNaN(Sem, Negative, &intPayload); } else { return getQNaN(Sem, Negative, nullptr); } }
pushq %rbp pushq %r15 pushq %r14 pushq %rbx subq $0x18, %rsp movl %edx, %ebp movq %rsi, %r14 movq %rdi, %rbx testq %rcx, %rcx je 0x1135759 leaq 0x8(%rsp), %r15 movl $0x40, 0x8(%r15) movq %rcx, (%r15) movq %r15, %rdi callq 0x468540 movzbl %bpl, %edx movq %rbx, %rdi movq %r14, %rsi movq %r15, %rcx callq 0xe7b740 movq %r1...
/llvm/ADT/APFloat.h
llvm::AsmRewrite& llvm::SmallVectorTemplateBase<llvm::AsmRewrite, true>::growAndEmplaceBack<llvm::AsmRewriteKind, llvm::SMLoc&, long>(llvm::AsmRewriteKind&&, llvm::SMLoc&, long&&)
T &growAndEmplaceBack(ArgTypes &&... Args) { // Use push_back with a copy in case Args has an internal reference, // side-stepping reference invalidation problems without losing the realloc // optimization. push_back(T(std::forward<ArgTypes>(Args)...)); return this->back(); }
pushq %rbx subq $0x80, %rsp movq %rdi, %rbx movl (%rsi), %eax movq (%rdx), %rdx movl (%rcx), %ecx movq %rsp, %rsi movl %eax, (%rsi) movq %rdx, 0x8(%rsi) movl %ecx, 0x10(%rsi) xorl %eax, %eax movb %al, 0x14(%rsi) xorps %xmm0, %xmm0 movups %xmm0, 0x38(%rsi) movups %xmm0, 0x48(%rsi) movups %xmm0, 0x58(%rsi) andq $0x0, 0x6...
/llvm/ADT/SmallVector.h
(anonymous namespace)::AsmParser::applyModifierToExpr(llvm::MCExpr const*, llvm::MCSymbolRefExpr::VariantKind)
const MCExpr * AsmParser::applyModifierToExpr(const MCExpr *E, MCSymbolRefExpr::VariantKind Variant) { // Ask the target implementation about this expression first. const MCExpr *NewE = getTargetParser().applyModifierToExpr(E, Variant, Ctx); if (NewE) return NewE; // Recurse o...
pushq %rbp pushq %r15 pushq %r14 pushq %r12 pushq %rbx subq $0x80, %rsp movl %edx, %ebp movq %rsi, %r14 movq %rdi, %rbx movq 0x8(%rdi), %rdi movq 0xe0(%rbx), %rcx movq (%rdi), %rax callq *0xa8(%rax) testq %rax, %rax jne 0x1138416 movzbl (%r14), %eax leaq 0x30060d(%rip), %rcx # 0x1438a18 movslq (%rcx,%rax,4), %rax ad...
/MC/MCParser/AsmParser.cpp
bool llvm::MCAsmParserExtension::HandleDirective<(anonymous namespace)::COFFAsmParser, &(anonymous namespace)::COFFAsmParser::ParseDirectiveSafeSEH(llvm::StringRef, llvm::SMLoc)>(llvm::MCAsmParserExtension*, llvm::StringRef, llvm::SMLoc)
static bool HandleDirective(MCAsmParserExtension *Target, StringRef Directive, SMLoc DirectiveLoc) { T *Obj = static_cast<T*>(Target); return (Obj->*Handler)(Directive, DirectiveLoc); }
pushq %r14 pushq %rbx subq $0x38, %rsp movq %rdi, %rbx xorps %xmm0, %xmm0 movq %rsp, %rsi movaps %xmm0, (%rsi) movq 0x8(%rdi), %rdi movq (%rdi), %rax callq *0xc0(%rax) testb %al, %al je 0x1139831 leaq 0x30013e(%rip), %rax # 0x143996d jmp 0x113989c movq 0x8(%rbx), %rdi movq (%rdi), %rax callq *0x28(%rax) movq 0x8(%ra...
/llvm/MC/MCParser/MCAsmParserExtension.h
bool llvm::MCAsmParserExtension::HandleDirective<(anonymous namespace)::ELFAsmParser, &(anonymous namespace)::ELFAsmParser::ParseDirectivePopSection(llvm::StringRef, llvm::SMLoc)>(llvm::MCAsmParserExtension*, llvm::StringRef, llvm::SMLoc)
static bool HandleDirective(MCAsmParserExtension *Target, StringRef Directive, SMLoc DirectiveLoc) { T *Obj = static_cast<T*>(Target); return (Obj->*Handler)(Directive, DirectiveLoc); }
pushq %rbx subq $0x30, %rsp movq %rdi, %rbx movq 0x8(%rdi), %rdi movq (%rdi), %rax callq *0x38(%rax) movq %rax, %rdi callq 0x115479c testb %al, %al je 0x113f386 xorl %eax, %eax jmp 0x113f3a3 leaq 0x2fbd3c(%rip), %rax # 0x143b0c9 leaq 0x8(%rsp), %rsi movq %rax, (%rsi) movw $0x103, 0x20(%rsi) # imm = 0x103 movq %...
/llvm/MC/MCParser/MCAsmParserExtension.h
bool llvm::DenseMapBase<llvm::DenseMap<unsigned int, llvm::MCCVFunctionInfo::LineInfo, llvm::DenseMapInfo<unsigned int, void>, llvm::detail::DenseMapPair<unsigned int, llvm::MCCVFunctionInfo::LineInfo>>, unsigned int, llvm::MCCVFunctionInfo::LineInfo, llvm::DenseMapInfo<unsigned int, void>, llvm::detail::DenseMapPair<u...
unsigned getNumBuckets() const { return NumBuckets; }
movl 0x10(%rdi), %ecx testl %ecx, %ecx je 0x114444c pushq %rbx movq (%rdi), %rdi movl (%rsi), %esi imull $0x25, %esi, %r8d decl %ecx movl $0x1, %r10d xorl %r9d, %r9d andl %ecx, %r8d movq %r8, %rax shlq $0x4, %rax leaq (%rdi,%rax), %r11 movl (%rdi,%rax), %ebx movb $0x1, %al cmpl %ebx, %esi je 0x114445c cmpl $-0x1, %ebx ...
/llvm/ADT/DenseMap.h
llvm::MCContext::recordELFMergeableSectionInfo(llvm::StringRef, unsigned int, unsigned int, unsigned int)
void MCContext::recordELFMergeableSectionInfo(StringRef SectionName, unsigned Flags, unsigned UniqueID, unsigned EntrySize) { bool IsMergeable = Flags & ELF::SHF_MERGE; if (UniqueID == GenericSectionID) { ELFSeenGenericM...
pushq %rbp pushq %r15 pushq %r14 pushq %rbx subq $0x48, %rsp movl %r9d, %ebp movl %r8d, %ebx movl %ecx, %r15d movq %rdi, %r14 movq %rsi, (%rsp) movq %rdx, 0x8(%rsp) cmpl $-0x1, %r8d je 0x11471eb testb $0x10, %r15b jne 0x11471ff movq %r14, %rdi callq 0x1147234 testb %al, %al jne 0x11471ff jmp 0x1147229 leaq 0x968(%r14),...
/MC/MCContext.cpp
llvm::detail::DenseMapPair<std::pair<unsigned int, unsigned int>, llvm::MCSymbol*>* llvm::DenseMapBase<llvm::DenseMap<std::pair<unsigned int, unsigned int>, llvm::MCSymbol*, llvm::DenseMapInfo<std::pair<unsigned int, unsigned int>, void>, llvm::detail::DenseMapPair<std::pair<unsigned int, unsigned int>, llvm::MCSymbol*...
BucketT *InsertIntoBucketImpl(const KeyT &Key, const LookupKeyT &Lookup, BucketT *TheBucket) { incrementEpoch(); // If the load of the hash table is more than 3/4, or if fewer than 1/8 of // the buckets are empty (meaning that many are filled with tombstones), // grow th...
pushq %r14 pushq %rbx pushq %rax movq %rdx, %r14 movq %rdi, %rbx movq %rcx, (%rsp) movl 0x8(%rdi), %eax movl 0x10(%rdi), %esi leal 0x4(,%rax,4), %ecx leal (%rsi,%rsi,2), %edx cmpl %edx, %ecx jae 0x1149567 notl %eax addl %esi, %eax subl 0xc(%rbx), %eax movl %esi, %ecx shrl $0x3, %ecx cmpl %ecx, %eax jbe 0x1149569 incl 0...
/llvm/ADT/DenseMap.h
split(llvm::StringRef, char, std::pair<llvm::StringRef, llvm::StringRef>&)
static Error split(StringRef Str, char Separator, std::pair<StringRef, StringRef> &Split) { assert(!Str.empty() && "parse error, string can't be empty here"); Split = Str.split(Separator); if (Split.second.empty() && Split.first != Str) return reportError("Trailing separator in datalayout s...
pushq %r15 pushq %r14 pushq %rbx subq $0x40, %rsp movq %r8, %r14 movq %rdi, %rbx leaq 0x8(%rsp), %rax movq %rsi, (%rax) movq %rdx, 0x8(%rax) leaq 0x18(%rsp), %r15 movq %r15, %rdi movq %rax, %rsi movl %ecx, %edx callq 0x45ac2e movups (%r15), %xmm0 movups %xmm0, (%r14) movups 0x10(%r15), %xmm0 movups %xmm0, 0x10(%r14) cm...
/IR/DataLayout.cpp
llvm::Error getIntInBytes<unsigned int>(llvm::StringRef, unsigned int&)
static Error getIntInBytes(StringRef R, IntTy &Result) { if (Error Err = getInt<IntTy>(R, Result)) return Err; if (Result % 8) return reportError("number of bits must be a byte width multiple"); Result /= 8; return Error::success(); }
pushq %r14 pushq %rbx subq $0x28, %rsp movq %rcx, %r14 movq %rdi, %rbx callq 0x1158d7d cmpq $0x0, (%rbx) jne 0x1158e39 movl (%r14), %eax testb $0x7, %al je 0x1158e2f leaq 0x2efdf1(%rip), %rax # 0x1448c0a movq %rsp, %rsi movq %rax, (%rsi) movw $0x103, 0x20(%rsi) # imm = 0x103 movq %rbx, %rdi callq 0x1158dcc jmp ...
/IR/DataLayout.cpp
getAddrSpace(llvm::StringRef, unsigned int&)
static Error getAddrSpace(StringRef R, unsigned &AddrSpace) { if (Error Err = getInt(R, AddrSpace)) return Err; if (!isUInt<24>(AddrSpace)) return reportError("Invalid address space, must be a 24-bit integer"); return Error::success(); }
pushq %r14 pushq %rbx subq $0x28, %rsp movq %rcx, %r14 movq %rdi, %rbx callq 0x1158d7d cmpq $0x0, (%rbx) jne 0x1158f11 cmpl $0x1000000, (%r14) # imm = 0x1000000 jae 0x1158ef6 andq $0x0, (%rbx) jmp 0x1158f11 leaq 0x2ef771(%rip), %rax # 0x144866e movq %rsp, %rsi movq %rax, (%rsi) movw $0x103, 0x20(%rsi) # im...
/IR/DataLayout.cpp
llvm::cl::opt<(anonymous namespace)::PassDebugLevel, false, llvm::cl::parser<(anonymous namespace)::PassDebugLevel>>::printOptionValue(unsigned long, bool) const
void printOptionValue(size_t GlobalWidth, bool Force) const override { if (Force || !this->getDefault().compare(this->getValue())) { cl::printOptionDiff<ParserClass>(*this, Parser, this->getValue(), this->getDefault(), GlobalWidth); } }
movq %rsi, %r8 movq %rdi, %rsi movl 0x80(%rdi), %eax testl %edx, %edx je 0x1159954 subq $0x18, %rsp leaq 0x98(%rsi), %rdi leaq 0x88(%rsi), %rcx leaq 0x9edfed(%rip), %r9 # 0x1b47928 leaq 0x8(%rsp), %rdx movq %r9, (%rdx) movb $0x1, 0xc(%rdx) movl %eax, 0x8(%rdx) callq 0x45b55e addq $0x18, %rsp retq cmpb $0x1, 0x94(%r...
/llvm/Support/CommandLine.h
llvm::cl::opt<llvm::ChangePrinter, false, llvm::cl::parser<llvm::ChangePrinter>>::opt<char [14], llvm::cl::desc, llvm::cl::OptionHidden, llvm::cl::ValueExpected, llvm::cl::initializer<llvm::ChangePrinter>, llvm::cl::ValuesClass>(char const (&) [14], llvm::cl::desc const&, llvm::cl::OptionHidden const&, llvm::cl::ValueE...
explicit opt(const Mods &... Ms) : Option(llvm::cl::Optional, NotHidden), Parser(*this) { apply(this, Ms...); done(); }
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x18, %rsp movq %r9, 0x10(%rsp) movq %r8, %r15 movq %rcx, %r12 movq %rdx, %r13 movq %rsi, %rbp movq %rdi, %r14 movq 0x50(%rsp), %rbx xorl %esi, %esi xorl %edx, %edx callq 0x453f88 andl $0x0, 0x80(%r14) andq $0x0, 0x90(%r14) leaq 0x9ed0cf(%rip), %ra...
/llvm/Support/CommandLine.h
llvm::AArch64::ExtensionSet::enable(llvm::AArch64::ArchExtKind)
void AArch64::ExtensionSet::enable(ArchExtKind E) { if (Enabled.test(E)) return; LLVM_DEBUG(llvm::dbgs() << "Enable " << lookupExtensionByID(E).UserVisibleName << "\n"); Touched.set(E); Enabled.set(E); // Recursively enable all features that this one depends on. This handles all // of the simple case...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx pushq %rax movl %esi, %r12d movq %rdi, %rbx pushq $0x1 popq %r13 pushq $0x4 popq %r14 leaq 0x353f34(%rip), %r15 # 0x14b4190 movq %r13, %rax movl %r12d, %ecx shlq %cl, %rax movl %r12d, %ecx shrl $0x6, %ecx movq (%rbx,%rcx,8), %rdx btq %r12, %rdx jb 0x1...
/TargetParser/AArch64TargetParser.cpp
llvm::Triple::getWatchOSVersion() const
VersionTuple Triple::getWatchOSVersion() const { switch (getOS()) { default: llvm_unreachable("unexpected OS for Darwin triple"); case Darwin: case MacOSX: // Ignore the version from the triple. This is only handled because the // the clang driver combines OS X and IOS support into a common Darwin ...
cmpl $0x1b, 0x2c(%rdi) jne 0x1172996 pushq %rax callq 0x11727ce movq %rax, %rcx movq %rdx, %rsi xorl %edx, %edx testl %ecx, %ecx pushq $0x2 popq %rax cmovneq %rcx, %rax cmovneq %rsi, %rdx addq $0x8, %rsp retq pushq $0x2 popq %rax xorl %edx, %edx retq
/TargetParser/Triple.cpp
llvm::json::sortedElements(llvm::json::Object const&)
std::vector<const Object::value_type *> sortedElements(const Object &O) { std::vector<const Object::value_type *> Elements; for (const auto &E : O) Elements.push_back(&E); llvm::sort(Elements, [](const Object::value_type *L, const Object::value_type *R) { return L->first < R->first...
pushq %r15 pushq %r14 pushq %r12 pushq %rbx subq $0x18, %rsp movq %rsi, %r15 movq %rdi, %rbx xorps %xmm0, %xmm0 movups %xmm0, (%rdi) andq $0x0, 0x10(%rdi) movq %rsi, %rdi callq 0x106248a leaq 0x8(%rsp), %r14 movq %rax, (%r14) movq %rdx, 0x8(%r14) movl 0x10(%r15), %r12d shlq $0x6, %r12 addq (%r15), %r12 movq %rsp, %r15 ...
/Support/JSON.cpp
llvm::json::OStream::value(llvm::json::Value const&)
void llvm::json::OStream::value(const Value &V) { switch (V.kind()) { case Value::Null: valueBegin(); OS << "null"; return; case Value::Boolean: valueBegin(); OS << (*V.getAsBoolean() ? "true" : "false"); return; case Value::Number: valueBegin(); if (V.Type == Value::T_Integer) ...
pushq %r15 pushq %r14 pushq %rbx subq $0x20, %rsp movq %rsi, %rbx movq %rdi, %r14 movq %rsi, %rdi callq 0x117a176 cmpl $0x5, %eax ja 0x117ad70 movl %eax, %eax leaq 0x33f247(%rip), %rcx # 0x14b9e60 movslq (%rcx,%rax,4), %rax addq %rcx, %rax jmpq *%rax movq %r14, %rdi callq 0x117ad7a movq 0xa0(%r14), %rdi leaq 0x32f45...
/Support/JSON.cpp
llvm::LockFileManager::processStillExecuting(llvm::StringRef, int)
bool LockFileManager::processStillExecuting(StringRef HostID, int PID) { #if LLVM_ON_UNIX && !defined(__ANDROID__) SmallString<256> StoredHostID; if (getHostID(StoredHostID)) return true; // Conservatively assume it's executing on error. // Check whether the process is dead. If so, we're done. if (StoredHo...
pushq %rbp pushq %r15 pushq %r14 pushq %rbx subq $0x118, %rsp # imm = 0x118 movl %edx, %ebp movq %rsi, %r14 movq %rdi, %r15 leaq 0x18(%rsp), %rax movq %rax, -0x18(%rax) andq $0x0, -0x10(%rax) movq $0x100, -0x8(%rax) # imm = 0x100 movq %rsp, %rdi callq 0x117c7f9 movb $0x1, %bl testl %eax, %eax jne 0x117c...
/Support/LockFileManager.cpp
llvm_strlcpy
size_t llvm_strlcpy(char *dst, const char *src, size_t siz) { char *d = dst; const char *s = src; size_t n = siz; /* Copy as many bytes as will fit */ if (n != 0) { while (--n != 0) { if ((*d++ = *s++) == '\0') break; } } /* Not enough room in dst, add NUL and traverse rest of src */ if (n == 0) { ...
movq %rsi, %rax movq %rsi, %rcx testq %rdx, %rdx je 0x118aa88 decq %rdx xorl %ecx, %ecx cmpq %rcx, %rdx je 0x118aa81 movb (%rax,%rcx), %sil movb %sil, (%rdi,%rcx) incq %rcx testb %sil, %sil jne 0x118aa64 addq %rax, %rcx movq %rcx, %rdx jmp 0x118aa94 movb $0x0, (%rdi,%rcx) addq %rax, %rcx leaq 0x1(%rcx), %rdx cmpb $0x0,...
/Support/regstrlcpy.c
llvm::itanium_demangle::Node* llvm::itanium_demangle::AbstractManglingParser<llvm::itanium_demangle::ManglingParser<(anonymous namespace)::DefaultAllocator>, (anonymous namespace)::DefaultAllocator>::make<llvm::itanium_demangle::NameType, char const (&) [10]>(char const (&) [10])
Node *make(Args &&... args) { return ASTAllocator.template makeNode<T>(std::forward<Args>(args)...); }
pushq %r14 pushq %rbx pushq %rax movq %rsi, %rbx addq $0x330, %rdi # imm = 0x330 pushq $0x20 popq %rsi callq 0x118e49e movq %rax, %r14 movq %rbx, %rdi callq 0x4362b0 movb $0x8, 0x8(%r14) movzwl 0x9(%r14), %ecx andl $0xfffff000, %ecx # imm = 0xFFFFF000 orl $0x540, %ecx # imm = 0x540 movw %cx,...
/llvm/Demangle/ItaniumDemangle.h
spoa::test::SpoaTest_GlobalConvexWithQualities_Test::SpoaTest_GlobalConvexWithQualities_Test()
TEST_F(SpoaTest, GlobalConvexWithQualities) { Initialize(AlignmentType::kNW, 5, -4, -8, -6, -10, -2, true); Align(); std::string c = "ATGATGCGCTTTGTTGGCGCGGTGGCTTGATGCAGGGGCTAATCGACCTCTGGCAACCACTTTTCCATGACA" "GGAGTTGAATATGGCATTCAGTAATCCCTTCGATGATCCGCAGGGAGCGTTTTACATATTGCGCAATGCGCA" "GGGGCAATTCA...
pushq %r15 pushq %r14 pushq %rbx movq %rdi, %rbx callq 0x2abfe leaq 0x52de4(%rip), %rax # 0x64a58 leaq 0x10(%rbx), %r14 vxorps %xmm0, %xmm0, %xmm0 leaq 0x30(%rbx), %rdi movq %rax, (%rbx) vmovups %ymm0, 0x10(%rbx) vzeroupper callq 0x12a24 leaq 0x52a31(%rip), %rax # 0x646c8 movq %rax, (%rbx) popq %rbx popq %r14 p...
/rvaser[P]spoa/test/spoa_test.cpp
spoa::test::SpoaTest_SemiGlobalConvexWithQualities_Test::SpoaTest_SemiGlobalConvexWithQualities_Test()
TEST_F(SpoaTest, SemiGlobalConvexWithQualities) { Initialize(AlignmentType::kOV, 5, -4, -8, -6, -10, -2, true); Align(); std::string c = "GTATGATGCGCTTTGTTGGCGCGGTGGCTTGATGCAGGGGCTAATCGACCTCTGGCAACCACTTTTCCATGA" "CAGGAGTTGAATATGGCATTCAGTAATCCCTTCGATGATCCGCAGGGAGCGTTTTACATATTGCGCAATGCG" "CAGGGGC...
pushq %r15 pushq %r14 pushq %rbx movq %rdi, %rbx callq 0x2abfe leaq 0x52992(%rip), %rax # 0x64a58 leaq 0x10(%rbx), %r14 vxorps %xmm0, %xmm0, %xmm0 leaq 0x30(%rbx), %rdi movq %rax, (%rbx) vmovups %ymm0, 0x10(%rbx) vzeroupper callq 0x12a24 leaq 0x527ef(%rip), %rax # 0x648d8 movq %rax, (%rbx) popq %rbx popq %r14 p...
/rvaser[P]spoa/test/spoa_test.cpp
testing::internal::PrettyUnitTestResultPrinter::OnTestIterationStart(testing::UnitTest const&, int)
void PrettyUnitTestResultPrinter::OnTestIterationStart( const UnitTest& unit_test, int iteration) { if (GTEST_FLAG(repeat) != 1) printf("\nRepeating all tests (iteration %d) . . .\n\n", iteration + 1); const char* const filter = GTEST_FLAG(filter).c_str(); // Prints the filter if it's not *. This remin...
pushq %rbp pushq %r14 pushq %rbx subq $0x40, %rsp cmpl $0x1, 0x39b95(%rip) # 0x66728 movq %rsi, %rbx je 0x2cbaa incl %edx leaq 0x2146c(%rip), %rdi # 0x4e00d xorl %eax, %eax movl %edx, %esi callq 0xa080 movq 0x39b27(%rip), %rcx # 0x666d8 testq %rcx, %rcx je 0x2cbc1 cmpb $0x2a, (%rcx) jne 0x2cbc1 cmpb $0x0, 0...
/rvaser[P]spoa/build_O3/_deps/googletest-src/googletest/src/gtest.cc
testing::internal::ComparisonBase<testing::internal::EqMatcher<std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>>>, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>>, testing::internal::AnyEq>::operator testing::Matcher<std::__cxx11::basic_string<char, std::char_...
operator Matcher<Lhs>() const { return Matcher<Lhs>(new Impl<const Lhs&>(rhs_)); }
pushq %r15 pushq %r14 pushq %rbx movq %rdi, %rbx movl $0x28, %edi movq %rsi, %r15 callq 0xa4b0 movq %rax, %r14 leaq 0x22f15(%rip), %rdx # 0x65c60 leaq 0x18(%r14), %rcx leaq 0x8(%r14), %rdi movq %rdx, (%r14) movq %rcx, 0x8(%r14) movq (%r15), %rsi movq 0x8(%r15), %rdx addq %rsi, %rdx callq 0xf6ee leaq 0x22d58(%rip), ...
/rvaser[P]spoa/build_O3/_deps/googletest-src/googletest/include/gtest/gtest-matchers.h
testing::internal::DeathTestImpl::~DeathTestImpl()
~DeathTestImpl() override { GTEST_DEATH_TEST_CHECK_(read_fd_ == -1); }
pushq %rbx subq $0xf0, %rsp leaq 0x22119(%rip), %rax # 0x655c0 movq %rax, (%rdi) cmpl $-0x1, 0x34(%rdi) jne 0x434d3 leaq 0x22611(%rip), %rax # 0x65ac8 movq %rax, 0x10(%rdi) movq 0x20(%rdi), %rdi addq $0xf0, %rsp testq %rdi, %rdi je 0x434d1 popq %rbx jmp 0x45ae6 popq %rbx retq leaq 0xe0(%rsp), %rax movq %rax, -0...
/rvaser[P]spoa/build_O3/_deps/googletest-src/googletest/src/gtest-death-test.cc
testing::internal::ThreadLocal<std::vector<testing::internal::TraceInfo, std::allocator<testing::internal::TraceInfo>>>::CreateKey()
static pthread_key_t CreateKey() { pthread_key_t key; // When a thread exits, DeleteThreadLocalValue() will be called on // the object managed for that thread. GTEST_CHECK_POSIX_SUCCESS_( pthread_key_create(&key, &DeleteThreadLocalValue)); return key; }
pushq %rbx subq $0x10, %rsp leaq -0x4a(%rip), %rsi # 0x47db6 leaq 0xc(%rsp), %rdi callq 0xa910 testl %eax, %eax je 0x47e73 leaq 0x717d(%rip), %rdx # 0x4ef92 leaq 0x8(%rsp), %rdi movl $0x3, %esi movl $0x6f5, %ecx # imm = 0x6F5 movl %eax, %ebx callq 0x3d9ae movq 0x1e1b6(%rip), %rdi # 0x65fe8 lea...
/rvaser[P]spoa/build_O3/_deps/googletest-src/googletest/include/gtest/internal/gtest-port.h
testing::internal::ThreadLocal<std::vector<testing::internal::TraceInfo, std::allocator<testing::internal::TraceInfo>>>::DefaultValueHolderFactory::MakeNewHolder() const
virtual ValueHolder* MakeNewHolder() const { return new ValueHolder(); }
pushq %rax movl $0x20, %edi callq 0xa4b0 leaq 0x1dd4c(%rip), %rcx # 0x65bf8 vxorps %xmm0, %xmm0, %xmm0 movq %rcx, (%rax) vmovups %xmm0, 0x8(%rax) movq $0x0, 0x18(%rax) popq %rcx retq
/rvaser[P]spoa/build_O3/_deps/googletest-src/googletest/include/gtest/internal/gtest-port.h
cmCTestGlobalVC::DoModification(cmCTestVC::PathStatus, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>> const&)
void cmCTestGlobalVC::DoModification(PathStatus status, std::string const& path) { std::string dir = cmSystemTools::GetFilenamePath(path); std::string name = cmSystemTools::GetFilenameName(path); File& file = this->Dirs[dir][name]; file.Status = status; // For local modifi...
pushq %rbp pushq %r14 pushq %rbx subq $0x40, %rsp movq %rdx, %r14 movl %esi, %ebp movq %rdi, %rbx leaq 0x20(%rsp), %rdi movq %rdx, %rsi callq 0x4897be movq %rsp, %rdi movq %r14, %rsi callq 0x48975c leaq 0x188(%rbx), %rdi leaq 0x20(%rsp), %rsi callq 0xeb1f8 movq %rsp, %rsi movq %rax, %rdi callq 0xeb274 movl %ebp, (%rax)...
/JKorbelRA[P]CMake/Source/CTest/cmCTestGlobalVC.cxx
cmCTestGlobalVC::WriteXMLGlobal(cmXMLWriter&)
void cmCTestGlobalVC::WriteXMLGlobal(cmXMLWriter& xml) { if (!this->NewRevision.empty()) { xml.Element("Revision", this->NewRevision); } if (!this->OldRevision.empty() && this->OldRevision != this->NewRevision) { xml.Element("PriorRevision", this->OldRevision); } }
pushq %r15 pushq %r14 pushq %r12 pushq %rbx subq $0x28, %rsp movq %rsi, %rbx movq %rdi, %r15 leaq 0x1d8(%rdi), %r14 cmpq $0x0, 0x1e0(%rdi) je 0x117a83 leaq 0x18(%rsp), %r12 movq %r12, -0x10(%r12) leaq 0x52e2c7(%rip), %rsi # 0x645d02 leaq 0x52e2c8(%rip), %rdx # 0x645d0a leaq 0x8(%rsp), %rdi callq 0x5c768 leaq 0x8(...
/JKorbelRA[P]CMake/Source/CTest/cmCTestGlobalVC.cxx
cmCTestResourceGroups_yypop_buffer_state(void*)
void yypop_buffer_state (yyscan_t yyscanner) { struct yyguts_t * yyg = (struct yyguts_t*)yyscanner; if (!YY_CURRENT_BUFFER) return; yy_delete_buffer(YY_CURRENT_BUFFER , yyscanner); YY_CURRENT_BUFFER_LVALUE = NULL; if (yyg->yy_buffer_stack_top > 0) --yyg->yy_buffer_stack_top; if (YY_CURRENT_BUFFER) { yy...
movq 0x28(%rdi), %rax testq %rax, %rax je 0x118e2c pushq %rbx movq %rdi, %rbx movq 0x18(%rdi), %rcx movq (%rax,%rcx,8), %rdi testq %rdi, %rdi je 0x118e2b movq %rbx, %rsi callq 0x118c58 movq 0x18(%rbx), %rax movq 0x28(%rbx), %rcx movq $0x0, (%rcx,%rax,8) testq %rax, %rax je 0x118deb decq %rax movq %rax, 0x18(%rbx) jmp 0...
/JKorbelRA[P]CMake/Source/LexerParser/cmCTestResourceGroupsLexer.cxx
cmCTestResourceGroups_yylex_destroy(void*)
int yylex_destroy (yyscan_t yyscanner) { struct yyguts_t * yyg = (struct yyguts_t*)yyscanner; /* Pop the buffer stack, destroying each element. */ while(YY_CURRENT_BUFFER){ yy_delete_buffer( YY_CURRENT_BUFFER , yyscanner ); YY_CURRENT_BUFFER_LVALUE = NULL; yypop_buffer_state(yyscanner); } /* Destroy...
pushq %rbx movq %rdi, %rbx movq 0x28(%rdi), %rdi testq %rdi, %rdi je 0x1190f0 movq 0x18(%rbx), %rax movq (%rdi,%rax,8), %rax testq %rax, %rax je 0x1190f2 movq %rax, %rdi movq %rbx, %rsi callq 0x118c58 movq 0x18(%rbx), %rax movq 0x28(%rbx), %rcx movq $0x0, (%rcx,%rax,8) movq %rbx, %rdi callq 0x118dab movq 0x28(%rbx), %r...
/JKorbelRA[P]CMake/Source/LexerParser/cmCTestResourceGroupsLexer.cxx
cmProcess::Buffer::GetLine(std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>>&)
bool cmProcess::Buffer::GetLine(std::string& line) { // Scan for the next newline. for (size_type sz = this->size(); this->Last != sz; ++this->Last) { if ((*this)[this->Last] == '\n' || (*this)[this->Last] == '\0') { // Extract the range first..last as a line. const char* text = this->data() + this-...
pushq %r15 pushq %r14 pushq %rbx movq %rdi, %rbx movq (%rdi), %r14 movq 0x8(%rdi), %rax movq %rax, %rcx subq %r14, %rcx movq 0x20(%rdi), %rdx cmpq %rcx, %rdx je 0x119cbc movzbl (%r14,%rdx), %edi cmpl $0xa, %edi je 0x119d0a testl %edi, %edi je 0x119d0a incq %rdx movq %rdx, 0x20(%rbx) cmpq %rdx, %rcx jne 0x119ca2 movq 0x...
/JKorbelRA[P]CMake/Source/CTest/cmProcess.cxx
bool (anonymous namespace)::AllocateCTestResources<(anonymous namespace)::RoundRobinAllocationStrategy>(std::map<std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>>, cmCTestResourceAllocator::Resource, std::less<std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>>>, ...
bool AllocateCTestResources( const std::map<std::string, cmCTestResourceAllocator::Resource>& resources, const std::vector<std::string>& resourcesSorted, std::size_t currentIndex, std::vector<cmCTestBinPackerAllocation*>& allocations) { // Iterate through all large enough resources until we find a solution st...
pushq %rbp pushq %r15 pushq %r14 pushq %r13 pushq %r12 pushq %rbx subq $0x98, %rsp movq %rsi, %r15 movq %rdi, 0x10(%rsp) movq (%rsi), %rsi cmpq %rsi, 0x8(%r15) je 0x11af66 movq %rcx, %r14 movq %rdx, %rbp leaq 0x1(%rdx), %rax movq %rax, 0x18(%rsp) xorl %r13d, %r13d movq %rcx, 0x20(%rsp) movq %rdx, 0x60(%rsp) movq %r13, ...
/JKorbelRA[P]CMake/Source/CTest/cmCTestBinPacker.cxx
cmAffinity::GetProcessorsAvailable()
std::set<size_t> GetProcessorsAvailable() { std::set<size_t> processorsAvailable; #ifdef CM_HAVE_CPU_AFFINITY int cpumask_size = uv_cpumask_size(); if (cpumask_size > 0) { # ifdef _WIN32 DWORD_PTR procmask; DWORD_PTR sysmask; if (GetProcessAffinityMask(GetCurrentProcess(), &procmask, &sysmask) != ...
pushq %rbp pushq %r15 pushq %r14 pushq %r12 pushq %rbx subq $0x90, %rsp movq %rdi, %rbx leaq 0x8(%rdi), %rax movl $0x0, 0x8(%rdi) xorl %ecx, %ecx movq %rcx, 0x10(%rdi) movq %rax, 0x18(%rdi) movq %rax, 0x20(%rdi) movq %rcx, 0x28(%rdi) callq 0x62007e movl %eax, %ebp testl %eax, %eax jle 0x11fdd0 xorps %xmm0, %xmm0 leaq 0...
/JKorbelRA[P]CMake/Source/cmAffinity.cxx
ArgumentParser::Instance::Bind(std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char>>&)
void Instance::Bind(std::string& val) { this->Bind( [&val](cm::string_view arg) -> Continue { val = std::string(arg); return Continue::No; }, ExpectAtLeast{ 1 }); }
pushq %r14 pushq %rbx subq $0x28, %rsp movq %rdi, %rbx leaq 0x8(%rsp), %r14 movq $0x0, 0x8(%r14) movq %rsi, (%r14) leaq 0x5d7(%rip), %rax # 0x1207f4 movq %rax, 0x18(%r14) leaq 0x626(%rip), %rax # 0x12084e movq %rax, 0x10(%r14) addq $0x40, %rdi movq %r14, %rsi callq 0x120a92 movq $0x1, 0x38(%rbx) movq 0x10(%...
/JKorbelRA[P]CMake/Source/cmArgumentParser.cxx