blob_id
string
repo_name
string
path
string
length_bytes
int64
score
float64
int_score
int64
text
string
a986b19083aadd6d87d4499340f5c04b585c5a0f
v1ctor/advent-of-code-2019
/day15/run.py
4,973
3.78125
4
import sys from computer import Computer class Droid: def __init__(self, memory): self.x = 0 self.y = 0 self.path = [] self.visited = {} self.oxygen = None self.computer = Computer(memory) def move(self, direction): self.path.append(direction) if direction == 1: self.y -= 1 elif direction == 2: self.y += 1 elif direction == 3: self.x -= 1 else: self.x += 1 def direction(self, source, direction): if direction == 1: return (source[0], source[1] - 1) elif direction == 2: return (source[0], source[1] + 1) elif direction == 3: return (source[0] - 1, source[1]) else: return (source[0] + 1, source[1]) def target(self, direction): return self.direction((self.x, self.y), direction) def backtrack(self): direction = self.path[-1] if direction == 1: self.move(2) self.path = self.path[:-2] return 2 elif direction == 2: self.move(1) self.path = self.path[:-2] return 1 elif direction == 3: self.move(4) self.path = self.path[:-2] return 4 else: self.move(3) self.path = self.path[:-2] return 3 def __dfs(self): min_path = None # The idea is to implement DFS with backtracking and keeping a minimum path # The droid cannot do BFS because it has to return to the starting position anyway for i in range(1, 5): target = self.target(i) if target in self.visited: continue self.computer.send(i) self.computer.run() status = self.computer.receive() self.visited[target] = status print("target {} direction {} status {} path {}".format(target, i, status, self.path)) if status != 0: self.move(i) # oxygen if status == 2: # if we found oxygen it means tha none of the neighbours of this node can have a shorter path self.oxygen = target min_path = len(self.path) break # moved if status != 0: result = self.__dfs() if result != None and (min_path is None or result < min_path): min_path = result direction = self.backtrack() self.computer.send(direction) self.computer.run() if self.computer.receive() == 0: print("Error!") return None return min_path def search_oxygen(self): self.visited = {} return self.__dfs() def draw_map(self): maxX = 0 minX = 0 maxY = 0 minY = 0 for key in self.visited.keys(): if key[0] < minX: minX = key[0] if key[0] > maxX: maxX = key[0] if key[1] < minY: minY = key[1] if key[1] > maxY: maxY = key[1] sizeX = abs(minX) + maxX + 1 sizeY = abs(minY) + maxY + 1 result = [[]] * sizeY for y in range(sizeY): result[y] = ["."] * sizeX for x in range(sizeX): pos = (x - abs(minX), y - abs(minY)) if pos in self.visited: status = self.visited[pos] if status == 0: result[y][x] = "#" if status == 2: result[y][x] = "o" print(''.join(result[y])) def fill_oxygen(self): if self.oxygen is None or self.oxygen not in self.visited or self.visited[self.oxygen] != 2: return None visited = {} queue = [] time = 0 queue.append((self.oxygen, 0)) while len(queue) > 0: current = queue[0][0] time = queue[0][1] queue = queue[1:] for i in range(1, 5): direction = self.direction(current, i) if direction not in visited and direction in self.visited and self.visited[direction] == 1: visited[direction] = True queue.append((direction, time + 1)) return time def main(): filename = "input.txt" play = False if len(sys.argv) > 1: filename = sys.argv[1] if len(sys.argv) > 2 and sys.argv[2] == "--play": play = True f = open(filename) s = f.readline() memory = list(map(int, s.split(","))) droid = Droid(memory) source = droid.search_oxygen() print(source) droid.draw_map() time = droid.fill_oxygen() print(time) if __name__== "__main__": main()
74b46e64b42bb5d3c980fa47d9fa7ca448ddbe51
Aleksa21052001/vezbanje2
/vezba 4/osnovni_zadaci/zadatak6.py
378
3.75
4
""" Napisati program koji pita korisnika da unese nekoliko reči odvojenih razmakom, potom ispisuje iste te reči, samo što umesto razmaka ih program spoji dvotačkom. Potrebno je koristiti funkcije split i join. """ def main(): tekst = input("Unesite reci odvojene razmakom: ") reci = tekst.split(" ") novi_tekst = ":".join(reci) print(novi_tekst) main()
89ac0f2163e23b2562fe734719c3e7916caf96c1
dwaipayan05/Django-Task
/friends/helper_function.py
537
3.515625
4
from math import radians,degrees,cos,sin,acos def distance_finder(latitude_1,longitude_1,latitude_2,longitude_2): latitude_1 = radians(latitude_1) latitude_2 = radians(latitude_2) longitude_difference = radians(longitude_1 - longitude_2) distance = (sin(latitude_1)*sin(latitude_2)+cos(latitude_1)*cos(latitude_2)*cos(longitude_difference)) resToMile = degrees(acos(distance)) * 69.09 resToMt = resToMile / 0.00062137119223733 restokm = resToMt / 1000 return restokm print(distance_finder(70,5,5,5))
246b5786f688257d2d7d58046c4ffa794a1ad5df
B-Benja/Little_Programs
/SpotifyPlaylist_charts/main.py
1,519
3.84375
4
# creates a Charts 100 Playlist in Spotify based on the input date import requests from bs4 import BeautifulSoup import spotipy from spotipy.oauth2 import SpotifyOAuth CHARTS = "https://www.billboard.com/charts/hot-100/" sp = spotipy.Spotify(auth_manager=SpotifyOAuth( scope="playlist-modify-private", redirect_uri="http://example.com", client_id="YOUR CLIENT ID", client_secret="YOUR SECRET", show_dialog = True, cache_path = "token.txt" )) user_id = sp.current_user()["id"] # ask for a date user_input = input("Which date do you want to travel to? Type it in the following format: YYYY-MM-DD: ") # scrape the top 100 songs from that date from billboard.com response = requests.get(CHARTS + user_input).text soup = BeautifulSoup(response, "html.parser") top100 = soup.find_all(name="span", class_="chart-element__information__song text--truncate color--primary") top100 = [song.getText() for song in top100] song_uris = [] year = user_input.split("-")[0] for song in top100: # use song name and year to get the song on spotify title = sp.search(q=f"track:{song} year:{year}", type="track") #print(title) try: uri = title["tracks"]["items"][0]["uri"] song_uris.append(uri) except IndexError: print(f"{song} not on Spotify.") #print(song_uris) # create a playlist with the date playlist = sp.user_playlist_create(user=user_id, name=f"{user_input} Top 100", public=False) sp.playlist_add_items(playlist_id=playlist["id"], items=song_uris)
cb2e6f687afafeefb435c806d80f4325cb5968f5
KrolMateusz/Crypto
/Alghoritms/cesar_cipher_more_symbols.py
1,101
4.09375
4
def main(): text = 'This is my secret message.' print(encryption(text, 13)) print(decryption(encryption(text, 13), 13)) def encryption(plaintext, key): alphabet = ' !"#$%&\'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghijklmnopqrstuvwxyz{|}~' cipher = '' for symbol in plaintext: if symbol in alphabet: index = alphabet.find(symbol) num = index + key if num >= len(alphabet): num -= len(alphabet) cipher += alphabet[num] else: cipher += symbol return cipher def decryption(cipher, key): alphabet = ' !"#$%&\'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghijklmnopqrstuvwxyz{|}~' plaintext = '' for symbol in cipher: if symbol in alphabet: index = alphabet.find(symbol) num = index - key if num < 0: num += len(alphabet) plaintext += alphabet[num] else: plaintext += symbol return plaintext if __name__ == '__main__': main()
2ff7976defbe53686db9c9f471a6e7152e9c2e04
umbs/practice
/IK/sorting/Quicksort.py
2,334
4
4
from random import randint def swap(arr, i, j): arr[i], arr[j] = arr[j], arr[i] def get_pivot_index(start, end): ''' start and end indices, are both inclusive ''' return randint(start, end) def partition(arr, start, end, p_idx): ''' Use Lumoto's algorithm. When paritioning is done, swap element at 'end' where pivot is present with 'le' +----------+-+----------+-+--------------+-+ | <= | | > | | ?? | | +----------+-+----------+-+--------------+-+ ^ ^ ^ le cur end le = all elements less than or equal to pivot. It points to the next position an element must go if it is <= pivot cur = currently examining element start = Well, start of the array end = end of the array. This is the pivot element p_idx = Initially, pivot is here. Swap it to the end, to make it easy to partition. ''' swap(arr, end, p_idx) le, cur, pivot = start, start, arr[end] while cur < end: if arr[cur] <= pivot: swap(arr, le, cur) le, cur = le+1, cur+1 else: cur += 1 swap(arr, le, cur) return le def test_partition(arr, p_idx): ''' Given pivot index, confirm that all values before it are less than or equal and all values later are greater than pivot ''' for i in range(p_idx+1): if(arr[i] > arr[p_idx]): return False for i in range(p_idx+1, len(arr)): if(arr[i] <= arr[p_idx]): return False return True def Quicksort(arr, start, end): if start >= end: return p_old = get_pivot_index(start, end) p_final = partition(arr, start, end, p_old) Quicksort(arr, start, p_final-1) Quicksort(arr, p_final+1, end) def test_quicksort(arr): ''' Test for ascending array ''' for i in range(1, len(arr)): if arr[i-1] > arr[i]: return False return True if __name__ == "__main__": for i in range(100): arr_sz = 100 arr = [randint(-15, 15) for _ in range(arr_sz)] Quicksort(arr, 0, arr_sz-1) if not test_quicksort(arr): print("Quicksort Failed") print(arr) break
24d4ac4ec72f660b95013fde2e2298d7ce5e9fe5
KMrsR/HMR_python
/PythonTutor/lesson_6_04.py
736
3.921875
4
''' Условие В первый день спортсмен пробежал x километров, а затем он каждый день увеличивал пробег на 10% от предыдущего значения. По данному числу y определите номер дня, на который пробег спортсмена составит не менее y километров. Программа получает на вход действительные числа x и y и должна вывести одно натуральное число. ''' #************************************************** x = input() y = input() prob=int(x) i=1 while prob<int(y): prob*=1.1 i+=1 print(i)
db25167b4151fb2b994859a4c6c885ccec49769b
stasvorosh/pythonintask
/BITs/2014/Abdrahmanova_G_I/task_7_1.py
1,397
4.1875
4
#Задача 7. Вариант 1. #Разработайте систему начисления очков для задачи 6, в соответствии с которой игрок получал бы большее количество баллов за меньшее количество попыток. import random guessesTaken=0 print('Компьютер загадал имя одного из трех мушкетеров - товарищей д`Артаньяна. \nТвоя цель отгадать имя загаданного мушкетера.') musketry=random.choice(["Атос", "Партос", "Арамис"]) while guessesTaken < 2: print('Загаданное имя мушкетера: ') guess=input() guessesTaken=guessesTaken+1 if guess!=musketry: print('Неверно!') if guess==musketry: break if guess==musketry: print('Верно! Число использованных попыток: ', guessesTaken) if guessesTaken==1: print('Количество заработанных баллов: ', 100) if guessesTaken==2: print('Количество заработанных баллов: ', 50) if guess!=musketry: print('Попытки кончились') print('Вы не набрали баллов') input('Нажмите Enter') #Abdrahmanova G. I. #28.03.2016
b85ae7232cfb36ed4c028abb2c79011942ab3080
DaevernGanendrah/ACIP
/Day5/University.py
1,745
3.796875
4
class Person: def __init__(self,name): self.Name = name class Student(Person): def __init__(self,name,cgpa): super(Student,self).__init__(name) self.CGPA = cgpa class Staff(Person): def __init__(self,name,salary): super(Staff,self).__init__(name) if(salary<1100): raise Exception("Salary ${} too low!".format(salary)) self.Salary = salary class Lecturer(Staff): def __init__(self,name,salary,allowance): super(Lecturer,self).__init__(name,salary) #Constructor chaining self.Allowance = allowance class Clerk(Staff): def __init__(self,name,salary,otRate): super(Clerk,self).__init__(name,salary) #Constructor chaining self.OTRate = otRate self.OTHours = 0 class Manager(Staff): def __init__(self,name,salary,carAllowance): super(Manager,self).__init__(name,salary) self.CarAllowance = carAllowance def getMonthlySalary(self): return (1.0-0.11)*self.Salary + self.CarAllowance class HRManager(Manager): def __init__(self,name,salary): super(HRManager,self).__init__(name,salary,500) class SalesManager(Manager): def __init__(self,name,salary,carAllowance,petrolAllowance): super(SalesManager,self).__init__(name,salary,carAllowance) self.PetrolAllowance = petrolAllowance self.MonthlySales = 0.0 m = Manager("Ali",5000,600) print("Name:{}\tMonthly Salary:${}".format(m.Name,m.getMonthlySalary())) hrm = HRManager("Ahmad",4000) print("Name:{}\tMonthly Salary:${}".format(hrm.Name,hrm.getMonthlySalary())) sm = SalesManager("Abu",5000,600,800) sm.MonthlySales = 100000 print("Name:{}\tMonthly Salary:${}".format(sm.Name,sm.getMonthlySalary()))
dff539e7421fc9aee8a5cbadf9d25411dc3355ef
notesonartificialintelligence/07-01-20
/chapter_5/toppings_updated.py
410
3.59375
4
#Gabriel Abraham #notesonartificialintelligence #Python Crash Course - Chapter 5 requested_topping = ["mushrooms","extra cheese","ground beef"] if "mushrooms" in requested_topping: print("Adding Mushrooms") if "pepperoni" in requested_topping: print("Adding Pepperoni") if "extra cheese" in requested_topping: print("Adding Extra Cheese.") print("\n Finished making you pizza.") #Using the not eual operator !=
9cee0e1a8c1b305c0ad63452f892a1986c92ab6e
jarvislam1999/CMSSW-12100-Homework
/pp/coding/santa.py
2,796
3.546875
4
''' Practice problem for classes ''' import random PRESENT_PRODUCTION_TIME = 1.8 class Present(object): ''' Class for representing presents ''' def __init__(self, start_time): self._production_end_time = start_time + PRESENT_PRODUCTION_TIME def present_ready(self, current_time): return current_time >= self._production_end_time ### YOUR ELF CLASS GOES HERE class Santa(object): ''' Class for representing Santa ''' def __init__(self): self._total_num_presents = 0 self._total_num_ready_presents = 0 self._elves = [] self._next_elf_index = 0 def get_total_num_presents(self): return self._total_num_presents def get_total_num_ready_presents(self): return self._total_num_ready_presents def gather_elves(self, num_elves): self._elves = [Elf() for i in range(num_elves)] def distribute_presents_to_make(self, num_presents_to_make, current_time): elf_index = self._next_elf_index for i in range(num_presents_to_make): present = Present(current_time) self._elves[elf_index].add_present(present) elf_index = (elf_index + 1) % len(self._elves) self._next_elf_index = elf_index self._total_num_presents += num_presents_to_make def collect_ready_presents_from_elves(self, current_time): total = sum(elf.remove_presents(current_time) for elf in self._elves) self._total_num_ready_presents += total class Elf(object): def __init__(self): self.presents =[] def add_present(self, present): self.presents.append(present) def remove_presents(self, current_time): count = 0 new_l = [] for present in self.presents: if (present.present_ready(current_time)): count +=1 else: new_l.append(present) self.presents = new_l return count def simulate_Santa(num_elves, max_time, seed=None): ''' Simulate Santa's workshop. ''' if seed: random.seed(seed) # initilize santa = Santa() santa.gather_elves(num_elves) for i in range(max_time): #odd hours, assign work to elves if i%2: num_presents_to_make = random.randrange(100, 200) santa.distribute_presents_to_make(num_presents_to_make, i) #even hours, collect presents from elves else: santa.collect_ready_presents_from_elves(i) print("Santa has {} presents ready, and {} presents in progress!".format (santa.get_total_num_presents(), santa.get_total_num_presents() - santa.get_total_num_ready_presents())) if __name__ == "__main__": simulate_Santa(100, 100) simulate_Santa(200, 1000)
c6324a2477616cd751ab36a2a13cb5cf6ee6bc29
coy0725/leetcode
/python/029_Divide_Two_Integers.py
1,295
3.546875
4
# class Solution(object): # def divide(self, dividend, divisor): # """ # :type dividend: int # :type divisor: int # :rtype: int # """ import math class Solution(object): def divide(self, dividend, divisor): if divisor == 0: return MAX_INT if dividend == 0: return 0 isPositive = (dividend < 0) == (divisor < 0) m = abs(dividend) n = abs(divisor) # ln and exp res = math.log(m) - math.log(n) res = int(math.exp(res)) if isPositive: return min(res, 2147483647) return max(0 - res, -2147483648) # def divide(self, dividend, divisor): # # (dividend >= 0) ^ (divisor < 0) # isPositive = (dividend < 0) == (divisor < 0) # dividend, divisor, result = abs(dividend), abs(divisor), 0 # while dividend >= divisor: # n, nb = 1, divisor # # fast minus # while dividend >= nb: # dividend, result = dividend - nb, result + n # n, nb = n << 1, nb << 1 # if isPositive: # return min(result, 2147483647) # return max(-result, -2147483648) if __name__ == '__main__': s = Solution() print s.divide(1, 1)
efadb2e1e080cdd45adebccc096cdf8f59e7b9e4
abdullahalmamun0/Python_Full_Course
/05_flow_control.py
1,272
3.984375
4
# ============================================================================= # Flow Control # ============================================================================= #If - statement a = "Chocolate" b = "Cadfdfke" c = "Shinchan" if a=="Chocolate": print("Home work done") if c == "Doraemon": print("Eat food") else: print("Not eating") elif b == "Cake": print("Home work done") else: print("Home work not finished") print("codinglaugh") #while - loop i = 1 while i<=5: print("okk") i += 1 # i = i+1 #1,2,3,4,5,6 #while - loop while True: print("okkey") #while - nested loop i = 1 j = 1 while i<=5: while j<=5: print("i=",i," j=",j,sep="") j += 1 else: print("j is end") i += 1 j = 1 #for loop a = "codinglaugh" #tuple,list,set,dictionary,string for i in a: print(i) #range for loop for i in range(1,11,3): #start,end,step print(i) #nested loop for i in range(1,6): for j in range(1,6): print("i=",i," j=",j,sep="") else: print("j is end") # break for i in range(1,6): pass i = 1 while i<=5: if i == 3: pass print(i) i += 1 a = 5 a = None print(type(20>2))
0925c64567a9ca5a195c853ff32e677df0ddd44e
alphatamago/gopatterns
/examples/find_frequent_patterns.py
3,648
3.640625
4
""" Example program that uses PatternIndex to find most often occurring patterns in a SGS collection. """ import fnmatch import os import sys import numpy as np import pandas as pd from gopatterns.common import * from gopatterns.indexer import PatternIndex, BLACK, WHITE def main(argv): description = "Identifying patterns in a collection of SGF files." usage = ("%s <sgf dir> <pattern height>" " <pattern width> <min_stones> <max_stones>" " <max_num_moves>") % argv[0] pathname = "" pattern_dim1 = 0 pattern_dim2 = 0 min_stones_in_pattern = 0 max_stones_in_pattern = 0 max_moves = 0 only_corners = False try: pathname = argv[1] pattern_dim1 = int(argv[2]) pattern_dim2 = int(argv[3]) min_stones_in_pattern = int(argv[4]) max_stones_in_pattern = int(argv[5]) max_moves = int(argv[6]) only_corners = (argv[7].lower()=='true') except: print(description) print(usage) sys.exit(1) output_fname = None if len(argv) == 9: output_fname = argv[8] + ".txt" if os.path.isfile(output_fname): print("File already exisits, specify a new name:", output_fname) sys.exit(1) pd_output_fname = argv[8] print("pathname:", pathname) print("pattern size:", pattern_dim1, "x", pattern_dim2) print("min_stones_in_pattern:", min_stones_in_pattern) print("max_stones_in_pattern", max_stones_in_pattern) print("max_moves per game:", max_moves) print("only_corner:", only_corners) index = PatternIndex(pat_dim=(pattern_dim1, pattern_dim2), min_stones_in_pattern=min_stones_in_pattern, max_stones_in_pattern=max_stones_in_pattern, max_moves=max_moves, only_corners=only_corners) num_games = 0 matches = [] for root, dirnames, filenames in os.walk(pathname): for filename in fnmatch.filter(filenames, '*.sgf'): path = os.path.join(root, filename) print("Processing", path) index.find_patterns_in_game(path) num_games += 1 sorted_patterns = index.get_frequent_patterns() print ("Number patterns found:", len(index.index_), "number of games:", num_games) print ("Examples:") num_show = 25 print("Most popular", num_show) for v in sorted_patterns[:num_show]: print ("Number matches:", len(v.matches)) pretty_print (v.pattern) if index.num_patterns() > num_show: print() print("... skipping", index.num_patterns() - num_show, "patterns") if output_fname is not None: sys.stdout = open(output_fname, "w") print ("#patterns :", len(index.index_), "#games :", num_games) matches = [] patterns = [] num_matches = [] for v in sorted_patterns: matches.append(','.join(v.matches)) num_matches.append(len(v.matches)) patterns.append(np_pattern_to_string(v.pattern)) print ("#matches :", len(v.matches)) pretty_print (v.pattern) print() df = pd.DataFrame(data={'pattern' : patterns, # 'matched_sgf': matches} 'frequency' : num_matches}) df.to_csv(path_or_buf = "collection_%s_numgames_%s_numpatterns_%s.csv" % (pd_output_fname, num_games, len(sorted_patterns)), index = False) if __name__ == '__main__': main(sys.argv)
78936e2d334ab9714c226ce0ed413ec7b10ecac2
psinguyen/Phansinguyen---C4T6
/Shoppy.py
1,137
3.875
4
list = [] while True: command = input("Welcome to our shop, what do you want (C, R, U, D)? ") if command == "C": new = input("Enter new item: ") list.append(new) for c in list: print("*", c) if command == "R": for c in list: print("*", c) if command == "U": update = int(input("Update position? ")) trade = input("Enter new item: ") n = 1 listed = list for c in list: list.remove(c) list.append(n) n=n+1 for e in list: if e==update: list.remove(e) list.append(trade) for m in listed: for n in list: if n == trade: list.remove(n) list.append(trade) else: list.remove(n) list.append(m) for y in list: print("*", y) list=listed if command == "D": remove = input("Delete position? ") list.remove(remove) for c in color_list: print("*", c)
130e0125f85a2f518aff72816650a43ca936af3a
Shashank-Bandi/Py-Practice
/list14.py
126
3.90625
4
l=eval(input("Enter list values to see if its empty :")) if not l: print("Empty") else: print("Contains Value:")
28cb69c1d50b79a810aef5b7eeb35cbc2ab824d6
mucheniski/curso-em-video-python
/Mundo2/003EstruturasDeRepeticao/071SimuladorCaixaEletronico.py
585
3.671875
4
valor = int(input('Qual valor deseja sacar? ')) total = valor cadulaAtual = 50 contCedulas = 0 while True: if total >= cadulaAtual: total -= cadulaAtual contCedulas += 1 else: if contCedulas > 0: print(f'{contCedulas} cedulas de R${cadulaAtual}') if cadulaAtual == 50: cadulaAtual = 20 elif cadulaAtual == 20: cadulaAtual = 10 elif cadulaAtual == 10: cadulaAtual = 1 contCedulas = 0 if total == 0: break print('Finalizado')
aa657c5ab4c7cc7990f0344ed633c1e364c351f6
SethHWeidman/algorithms_python
/01_interview_questions/01_ctci/02_Chapter_2/04_partition.py
1,397
4.09375
4
from data_structures import Node, UnorderedList def partition_linked_list(u: UnorderedList, x: int) -> Node: """ Passes in an unordered list. Returns the head of a list that has been "paritioned" around x Input: 3 -> 5 -> 8 -> 5 -> 10 -> 2 -> 1 (partition: 5) Output: 3 -> 1 -> 2 -> 10 -> 5 -> 5 -> 8 """ before_start = None before_end = None after_start = None after_end = None node = u.head while node: next_node = node.get_next() node.set_next(None) if node.get_data() < x: if not before_start: before_start = node before_end = before_start else: before_end.set_next(node) before_end = node else: if not after_start: after_start = node after_end = after_start else: after_end.set_next(node) after_end = node node = next_node if not before_start: return after_start before_end.set_next(after_start) return before_start if __name__ == "__main__": u = UnorderedList() u.add(3) u.add(5) u.add(8) u.add(5) u.add(10) u.add(2) u.add(1) print(u) new_head = partition_linked_list(u, 5) while new_head: print(new_head) new_head = new_head.get_next()
956acca70a2f7a8c85bddeb741f5168c41970772
Hegemony/Python-Practice
/LeetCode practice/Top 100/206.Reverse List.py
578
3.796875
4
# Definition for singly-linked list. class ListNode: def __init__(self, x): self.val = x self.next = None class Solution: def reverseList(self, head: ListNode) -> ListNode: p = head res = [] while p != None: res.append(p.val) p = p.next if len(res) == 0: return None res.reverse() head1 = ListNode(res[0]) q = head1 for i in range(1, len(res)): q.next = ListNode(res[i]) q = q.next return head1
aee456fe260896bbc80d4db393f0a18f87c76bcd
MXS-PICHUY/EVIDENCIA_3-S3
/PANDA DATAFRAME ACCESO A ELEMENTOS.py
665
3.53125
4
import pandas as pd import random SEPARADOR=('*'*20)+'\n' diccionario_notas_aleatorias={\ 'crescencio':[random.randrange(60,101) for x in range(3)],\ 'domitila':[80,100,57], 'rutilio':[80,70,57], 'panfilo':[20,100,100],\ 'ludoviko':[100,100,100]} notas_diccionario=pd.DataFrame(diccionario_notas_aleatorias) notas_diccionario.index=['programacion','base de datos','contabilidad'] print(notas_diccionario['domitila']) print() print(notas_diccionario.domitila) print(SEPARADOR) print(notas_diccionario.loc['programacion']) print() print(notas_diccionario.loc['bases de datos']) print() print(notas_diccionario.loc['contabilidad'])
954c1544de5a9a616469f2946784531c50b73037
garderobin/Leetcode
/leetcode_python2/lc923_3sum_with_multiplicity.py
2,440
3.828125
4
# coding=utf-8 import itertools from abc import ABCMeta, abstractmethod from collections import Counter class ThreeSumWithMultiplicity: __metaclass__ = ABCMeta @abstractmethod def three_sum_multi(self, A, target): """ :type A: List[int] :type target: int :rtype: int """ class ThreeSumWithMultiplicityImplCountingSort(ThreeSumWithMultiplicity): def three_sum_multi(self, A, target): c = Counter(A) res = 0 for i, j in itertools.combinations_with_replacement(c, 2): # 不用担心c[i] == 1的情况,因为接下来乘出来会是0 k = target - i - j if i == j == k: res += c[i] * (c[i] - 1) * (c[i] - 2) / 6 elif i == j != k: res += c[i] * (c[i] - 1) / 2 * c[k] elif k > i and k > j: res += c[i] * c[j] * c[k] return res % (10 ** 9 + 7) class ThreeSumWithMultiplicityImplCounter(ThreeSumWithMultiplicity): """ Time: O(n ^ 2) Space: O(n) """ def three_sum_multi(self, A, target): orig_res = 0 counter = Counter(A) counts = sorted(counter.items()) # sort这一步不能少 m = len(counts) for i, (key, count) in enumerate(counts): if key + key + key > target: break # use of this element only once for j in xrange(i + 1, m): j_key, j_count = counts[j] new_target = target - key - j_key if new_target < j_key: break # use j_key for twice if j_count > 1 and new_target == j_key: orig_res += count * j_count * (j_count - 1) / 2 # use j_key for once elif new_target > j_key and new_target in counter: orig_res += count * j_count * counter[new_target] # use this element twice new_target = target - key if count > 1 and new_target - key in counter: if new_target - key > key: left = count * (count - 1) / 2 orig_res += counter[new_target - key] * left # use this element 3 times if count > 2 and key * 3 == target: orig_res += count * (count - 1) * (count - 2) / 6 return orig_res % 1000000007
48299ba972821abd2c821b86486ed0eefc42cab9
siddacool/py-test-2017
/python_gui_cookbook/ch1/res1_first-gui.py
443
3.65625
4
import tkinter as tk from tkinter import ttk win = tk.Tk() win.title('Sid\'s GUI') #win.resizable(0, 0) # Label aLabel = ttk.Label(win, text="Just Something") aLabel.grid(column=0, row=0) # Button Click() def clickMe(): action.configure(text=" You Clicked! ") aLabel.configure(text="Dude", foreground='red') # Add a Button action = ttk.Button(win, text="Do Not Press", command=clickMe) action.grid(column=1, row=0) win.mainloop()
0cd9679ca4dbc5d425c4322b0fe0d26cd9950d37
mingxoxo/Algorithm
/baekjoon/2110.py
693
3.625
4
# 공유기 설치 # 22.08.03 # https://www.acmicpc.net/problem/2110 # https://www.acmicpc.net/board/view/8301 import sys input = sys.stdin.readline def binary_search(C, cor): start, end = 1, cor[-1] - cor[0] result = 1 while start <= end: mid = (start + end) // 2 tmp = cor[0] cnt = 1 for i in range(1, len(cor)): if cor[i] - tmp >= mid: tmp = cor[i] cnt += 1 if cnt < C: end = mid - 1 else: result = mid start = mid + 1 return result N, C = map(int, input().split()) cor = sorted([int(input()) for _ in range(N)]) print(binary_search(C, cor))
76676f195147b37a5c07cd8dff74f2e40d6f56a3
henrypigg/GroceryListGenerator
/classes.py
2,333
3.703125
4
class Meal: def __init__(self, name, ingredients): self.name = name self.ingredients = ingredients def __repr__(self): nl = '\n ' return (f"{self.name}:{nl}" f"{nl.join([ingredient['amount'] + ' ' + ingredient['units'] + ' ' + ingredient['name'] for ingredient in self.ingredients])}") class UnitConverter: dry_conversions = { "cup": 1, "oz": 8, "tbs": 16, "tsp": 48, "gram": 225, } liquid_conversions = { "pint": 0.5, "cup": 1, "oz": 8, "tbs": 16, "tsp": 48, "ml": 237, } def convert_unit(self, convert_from, convert_to, amount, liquid=False): if liquid is True: if convert_from in self.liquid_conversions: return float(self.liquid_conversions[convert_from]) / float(self.liquid_conversions[convert_to]) * float(amount) else: print(f"ERROR: {convert_from} not in liquid conversions") return 0 else: if convert_from in self.dry_conversions: return float(self.dry_conversions[convert_from]) / float(self.dry_conversions[convert_to]) * float(amount) else: print(f"ERROR: {convert_from} not in dry conversions") return 0 class GroceryList: ingredients = {} unit_converter = UnitConverter() def __repr__(self): display_list = "Groceries:\n" nl = '\n' for key, ingredient in self.ingredients.items(): display_list += f" {ingredient['amount']} {ingredient['units']} {key + nl}" return display_list def add_meal(self, meal, count): for ingredient in meal.ingredients: key = ingredient['name'] if key in self.ingredients: converted_amount = self.unit_converter.convert_unit( ingredient['units'], self.ingredients[key]['units'], ingredient['amount'] ) self.ingredients[key]['amount'] += converted_amount * count else: self.ingredients[key] = { 'amount': float(ingredient['amount']) * count, 'units': ingredient['units'] }
c36e06dab986704261cbab56266e027b24fdafda
A-Why-not-fork-repositories-Good-Luck/challenge-python-web-scrapper
/day_fin/exporter.py
321
3.703125
4
import csv def save_to_file(jobs, job_name): print(f"SAVE TO FILE: {job_name}.csv") file_name = job_name+".csv" file = open(f"{job_name}.csv", mode="w") writer = csv.writer(file) writer.writerow(["title", "company", "link"]) for job in jobs: writer.writerow(list(job.values())) return
2d035bcd1cad683a5fe823c4f5ad333acfa521f0
aksh45/pow-2
/pow2.py
103
4.09375
4
n = int(input()) if n & n-1 !=0: print("Num is not power of 2") else: print("Num is power of 2")
46a5981dc7ee31f5e2760fd19526e347b52d66d9
cybelewang/leetcode-python
/code812LargestTriangleArea.py
914
4.21875
4
""" 812 Largest Triangle Area You have a list of points in the plane. Return the area of the largest triangle that can be formed by any 3 of the points. Example: Input: points = [[0,0],[0,1],[1,0],[0,2],[2,0]] Output: 2 Explanation: The five points are show in the figure below. The red triangle is the largest. Notes: 3 <= points.length <= 50. No points will be duplicated. -50 <= points[i][j] <= 50. Answers within 10^-6 of the true value will be accepted as correct. """ import itertools class Solution: def largestTriangleArea(self, points): """ :type points: List[List[int]] :rtype: float """ def area(p, q, r): return .5 * abs(p[0]*q[1]+q[0]*r[1]+r[0]*p[1] -p[1]*q[0]-q[1]*r[0]-r[1]*p[0]) return max(area(*triangle) for triangle in itertools.combinations(points, 3))
e15938f2292d0226a9b27fa00f04758fbb7c8391
arunraman/Code-Katas
/Interview/Backtracking/generate_paranthesis.py
589
3.5625
4
class Solution(): def generateParenthesis(self, n): result = [] self.generateparenthesisRecursive(result, "", n , n) print result def generateparenthesisRecursive(self, result, current, left, right): if left == 0 and right == 0: result.append(current) return result if left > 0: self.generateparenthesisRecursive(result, current + "(", left - 1, right) if left < right: self.generateparenthesisRecursive(result, current + ")", left, right - 1) S = Solution() S.generateParenthesis(3)
06e4d9047bab3245301a369b239c59d79975b567
jadenpadua/Data-Structures-and-Algorithms
/bruteforce/mean.py
127
3.578125
4
#given a list of numbers, calculate the mean rounded to one decimal place def mean(nums): return round(sum(nums)/len(nums),1)
fe622c20adf94a15bfaee3417444b141fcc555d4
jactive/demo
/python/lang/dip/ch05/special_class_methods.py
1,179
3.59375
4
class X: def __setitem__(self, k, v): print '%s.__setitem__ is invoked, k="%s", v="%s"' % (self, k, v) def __getitem__(self, k): print '%s.__getitem__ is invoked, k="%s"' % (self, k) return "__getitem__ always return this string" def __delitem__(self, k): print '%s.__delitem__ is invoked, k="%s"' % (self, k) # The return value is not visible in caller return "__delitem__ always return this string" def __len__(self): print '%s.__len__ is invoked. int must be returned' % self #! TypeError: __len__() should return an int #! return '__len__ always return 13' return 13 def __str__(self): ret = object.__str__(self) print '# __str__ is invoked. %s will be returned' % ret return ret def __repr__(self): ret = object.__repr__(self) print '# __repr__ is invoked. %s will be returned' % ret return ret def __cmp__(self, other): print '%s.__cmp__ is invoked.' % self return 1 if '__main__' == __name__: x = X() x['my key'] = 'my val' print x['my key'] print len(x) print x x2 = X() b = x == x2 print b del x['my key1']
ee0b71b6e8fe4f6a569cda05f97b42da25d25819
rafaeltorrez/Ejerciciospropuestos_02
/18460697_Ejercicios_python02/condiciones/Ejercicio_04.py
799
4.09375
4
print("===========================================") print(" Ejercicio 04 condiciones ") print("===========================================") multiplo=0 numero1=int(input("Ingresa el valor numero 1 ")) numero2=int(input("Ingresa el valor numero 2 ")) if numero1>numero2: multiplo=numero1%numero2 if multiplo==0: print(f"el numero {numero1} es multiplo de {numero2}") else: print(f"el numero {numero1} No es multiplo de {numero2}") elif numero2>numero1: multiplo=numero2%numero1 if multiplo==0: print(f"el numero {numero2} es multiplo de {numero1}") else: print(f"el numero {numero2} No es multiplo de {numero1}") elif numero1==numero2: print(f"el numero {numero1} es igual a {numero2}")
96e8f074a49128c50ea88443cacb5ce1dc103f25
wondervvall/python_hw
/hw2.py
198
3.890625
4
x=int(input('x=')) if(100>=x>=90): print('A') elif(x>=80): print('B') elif(x>=70): print('C') elif(0<x<70): print('F')
42eadc33b5a66ffe652301bfc62a7e5e5fe758fa
soham-pradhan/OS-Mini-Project-in-Python
/OS PROJECT.py
9,426
3.640625
4
from tkinter import * import tkinter import webbrowser def gui(): top = tkinter.Tk() top.geometry("550x550") top.configure(background='pink') def move(): if message.winfo_x() + message.move >= message.x_limit or message.winfo_x() + message.move < 0: message.move = -message.move message.place(x=message.winfo_x() + message.move) message.after(message.delay, move) message = Label(top, text = 'THE OS PROJECT') message.config (fg = 'white',bg='red' ,font=('times','24')) message.x_limit = 290 message.move = 2 message.delay = 25 message.place(x=1,y=20) message.after(25, move) def close_window(): top.destroy() def gui2(): webbrowser.open('https://en.wikipedia.org/wiki/Page_replacement_algorithm') label2=tkinter.Label(text="TOPIC -PAGE REPLACEMENT ALGORITHMS",font=("times new roman",12),fg='white',bg='red') label2.place(x=20,y=80) label2=tkinter.Label(text="CREDITS :",font=("times new roman",12),fg='white',bg='red') label2.place(x=20,y=290) label3=tkinter.Label(text="SOHAM PRADHAN -16102B0003",font=("Times New Roman",12),fg='white',bg='blue') label3.place(x=20,y=340) label3=tkinter.Label(text="ABHI KADAM -16102B0004",font=("Times New Roman",12),fg='white',bg='blue') label3.place(x=20,y=360) label3=tkinter.Label(text="MAYUR WANVE -16102B0009",font=("Times New Roman",12),fg='white',bg='blue') label3.place(x=20,y=380) label3=tkinter.Label(text="ATHARVA JOSHI -16104B0003",font=("Times New Roman",12),fg='white',bg='blue') label3.place(x=20,y=400) label4=tkinter.Label(text="ANUPAMA MHATRE -16104B0069",font=("Times New Roman",12),fg='white',bg='blue') label4.place(x=20,y=420) label5=tkinter.Label(text="WHAT ARE PAGE REPLACEMENT ALGORITHMS ?",font=("Times New Roman",12),fg='white',bg='green') label5.place(x=20,y=120) label6=tkinter.Label(text="I WANT TO SEE HOW THEY WORK",font=("Times New Roman",12),fg='white',bg='green') label6.place(x=20,y=200) button1=tkinter.Button(text="CLICK ME",command =gui2,fg='white',bg='green') button1.place(x=20,y=160) button1=tkinter.Button(text="CLICK ME",command =close_window,fg='white',bg='green') button1.place(x=20,y=240) top.mainloop() def max1(l): max2=l[0] pos=0 for i in range(1,frame): if max2<l[i]: max2=l[i] pos=i return pos def search(l,ele): for i in range(len(l)): if ele==l[i]: return 1 return 0 def fifo(n,frame): outmat=[] for i in range(frame): outmat.append([]) sign = "_" for i in range(frame): for j in range(n): outmat[i].append(sign) temp=[] hit=0 m=0 for i in range(frame): temp.append(0) c=0 for i in range(n): flag=0 if c==frame: break for j in range(len(temp)): if l[i]==temp[j] and i!=j: hit+=1 flag=1 break if flag==0: temp[c]=l[i] c+=1 for q in range(len(temp)): for w in range(n): if q<=w: outmat[q][w]=temp[q] for z in range(i,n): count=0 for k in range(frame): if l[z]==temp[count]: hit+=1 break else: count+=1 if count==frame: u=m%frame temp[u]=l[z] m+=1 for itr in range(z,n): outmat[u][itr]=temp[u] print() print("FIFO:") print() for dis in range(len(l)): print(" ",l[dis],end=" ") print() for h in range(n): print("---",end="-") print() for x in range(frame): print("|",end=" ") for y in range(n): print(outmat[x][y],end=" | ") print() for y in range(n): print("---",end="-") print() print("Hit = ",hit) hratio=(hit/n) print("Hit ratio = ",hratio) return(hit) def lru(n,frame): outmat=[] for i in range(frame): outmat.append([]) sign = "_" for i in range(frame): for j in range(n): outmat[i].append(sign) temp=[] hit=0 m=0 for i in range(frame): temp.append(0) c=0 for i in range(n): flag=0 if c==frame: break for j in range(len(temp)): if l[i]==temp[j]: hit+=1 flag=1 break if flag==0: temp[c]=l[i] c+=1 for q in range(len(temp)): for w in range(n): if q<=w: outmat[q][w]=temp[q] for q in range(i,n): if search(temp,l[q]): #if hit hit+=1 else: ctemp=[] for r in range(frame): #finding lru element count=0 ctemp.append(0) for w in range(q-1,-1,-1): if l[w]!=temp[r]: count+=1 else: break ctemp[r]=count pos=max1(ctemp) temp[pos]=l[q] for itr in range(q,n): outmat[pos][itr]=temp[pos] print() print("LRU:") print() for dis in range(len(l)): print(" ",l[dis],end=" ") print() for h in range(n): print("---",end="-") print() for x in range(frame): print("|",end=" ") for y in range(n): print(outmat[x][y],end=" | ") print() for y in range(n): print("---",end="-") print() print("Hit = ",hit) hratio=(hit/n) print("Hit ratio = ",hratio) return(hit) def optimal(n,frame): outmat=[] for i in range(frame): outmat.append([]) sign = "_" for i in range(frame): for j in range(n): outmat[i].append(sign) temp=[] hit=0 m=0 for i in range(frame): temp.append(0) c=0 for i in range(n): flag=0 if c==frame: break for j in range(len(temp)): if l[i]==temp[j]: hit+=1 flag=1 break if flag==0: temp[c]=l[i] c+=1 for q in range(len(temp)): for w in range(n): if q<=w: outmat[q][w]=temp[q] for q in range(i,n): if search(temp,l[q]): #if hit hit+=1 else: ctemp=[] for r in range(frame): #finding lru element count=0 ctemp.append(0) for w in range(q+1,n): if l[w]!=temp[r]: count+=1 else: break ctemp[r]=count pos=max1(ctemp) temp[pos]=l[q] for itr in range(q,n): outmat[pos][itr]=temp[pos] print() print("OPTIMAL:") print() for dis in range(len(l)): print(" ",l[dis],end=" ") print() for h in range(n): print("---",end="-") print() for x in range(frame): print("|",end=" ") for y in range(n): print(outmat[x][y],end=" | ") print() for y in range(n): print("---",end="-") print() print("Hit = ",hit) hratio=(hit/n) print("Hit ratio = ",hratio) return(hit) def analyze(n,frame): hits=[] hits.append(fifo(n,frame)) hits.append(lru(n,frame)) hits.append(optimal(n,frame)) max1=hits[0] pos=0 for i in range(1,3): if max1<hits[i]: max1=hits[i] pos=i if max1==hits[0]==hits[1]: print("Any method can be used to solve the problem") elif max1==hits[0]: if max1==hits[1]: print("FIFO and LRU methods are suitable for these inputs") elif max1==hits[2]: print("FIFO and OPTIMAL methods are suitable for these inputs") elif max1==hits[1]: print("LRU and OPTIMAL methods are suitable for these inputs") else: if pos==0: print("FIFO is the best suitable method for these inputs") elif pos==1: print("LRU is the best suitable method for these inputs") elif pos==2: print("OPTIMAL is the best suitable method for these inputs") gui() n=int(input("Enter total number of pages to insert:")) frame=int(input("Enter total number of cache frames:")) l=[] for i in range(n): print("Enter number",i+1,":") x=int(input()) l.append(x) while(True): ch=int(input("Enter choice 1:FIFO 2:LRU 3:OPTIMAL 4:Analyze 5:Exit:")) if ch==1: fifo(n,frame) elif ch==2: lru(n,frame) elif ch==3: optimal(n,frame) elif ch==4: analyze(n,frame) break elif ch==5: break else: print("Invalid choice") '''Try these inputs: number of elements = 10 frames = 4 numbers= 1 5 4 3 1 2 6 7 3 2 Same number of hits'''
49970737eb9ba2aad15a4ebd510dab8794d88317
sun2everyone/python_study
/guess_number.py
2,177
3.734375
4
# объявление функции import random def is_valid_int(input): if input.isdigit() and int(input)>0 and int(input)==float(input): return True else: return False def is_valid(input, limit): if is_valid_int(input) and 1<=int(input)<=limit: return True else: return False def check_bool(input): if input.lower()=='y': return 1 elif input.lower()=='n': return 0 else: return -1 def gen_random(n=100): return random.randint(1,n) print('Добро пожаловать в числовую угадайку') def get_value(): n = input('Выберите верхнюю границу диапазона чисел:') while not is_valid_int(n): print('А может быть все-таки введем целое положительное число?') n = input('Выберите верхнюю границу диапазона чисел:') n = int(n) print('Отгадываем число от 1 до',n) return n limit = get_value() rnd=rnd = random.randint(1,limit) count=0 while True: n = input('Введите целое число от 1 до '+str(limit)+' включительно:') if not is_valid(n, limit): print('А может быть все-таки введем целое число от 1 до ',limit,'?',sep='') continue else: n=int(n) count+=1 if n>rnd: print('Ваше число больше загаданного, попробуйте еще разок') elif n<rnd: print('Ваше число меньше загаданного, попробуйте еще разок') else: print('Вы угадали, поздравляем! Сделано попыток:',count) ans=-1 while ans<0: ans=check_bool(input('Сыграть еще? y/n')) if not ans: break else: limit = get_value() rnd = random.randint(1, limit) count=0 print('Спасибо, что играли в числовую угадайку. Еще увидимся...')
f8c5cfc34baa994563c6e2eaa7e533523c71831a
vvalleru/leetcode-solutions
/ExcelSheetColumnTitle.py
240
3.59375
4
class Solution: # @return a string def convertToTitle(self, num): result = '' while num > 0: num -= 1 result = chr(65 + num % 26) + result num /= 26 return result
fe27590b90809393984d35c5b3074e81b08cf9db
Kunal3Kumar/Assignment
/fibonacci.py
355
4.09375
4
#WAP in python to print fibonacci searis Last_term = int(input("How many terms? ")) x = 0 y = 1 count = 0 if Last_term == 1: print("Fibonacci searis upto",Last_term,":") print(x) else: print("Fibonacci searis:") while count < Last_term: print(x) z = x + y x = y y = z count += 1
46206639a2a9e25184b8106244adc4c7ac712a15
tiendong96/Python
/PythonPractice/WeightConverter.py
374
3.75
4
def converter(weight, metric): newWeight = 0 if(metric.lower() == 'l'): newWeight = weight * .45 print(f'You are {newWeight} kgs') else: newWeight = weight / .45 print(f'You are {newWeight} lbs') if __name__ == '__main__': weight = float(input("Weight: ")) metric = input("(L)bs or (K)g: ") converter(weight, metric)
1c27e8641ae57e729746df2b9ed9ca1b7ba21e89
pinardy/Digital-World
/Week 7/ps7_fact.py
263
3.625
4
def fact(n): if n == 0: return 1 elif n == 1: return 1 else: start = 1 for i in range(1,n+1): start *= i return start #print fact(3) #print fact(5) #print fact(4) #print fact(1)
5f7dcddfe68d2f7c45761d46f64d5d92aa11d77e
achalv/hap.py
/abbreviation.py
435
3.5625
4
def isAbbr(abbr, str): abbrLen = len(abbr) hashtable = {} for char in xrange(0,abbrLen,1): try: abbrCharPos = str.index(abbr[char]) hashtable[char] = abbrCharPos except: return False if ((hashtable.values())==(sorted(hashtable.values()))): return True else: return False def tests(): print isAbbr("acl", "achal") print isAbbr("m", "ken") print isAbbr("bbe", "barbie") if __name__ == '__main__': tests()
0b9803740e18b4b71f7149a7f1180f6820e96f9d
kavigayamini/UdemyCources_Python
/Python workshop/Day 3/ex4.py
173
3.75
4
# Python lists colors = ['red','green','blue','yellow','orange','purple','brown'] print(colors) print(type(colors)) numbers = [1,2,'three','four',5.0, 6.0] print(numbers)
33d79f1f61e65e1873868cd601db26af3a2190c1
jpgsaraceni/python
/básico/listas/listas.py
1,270
4.40625
4
""" Lista é um tipo de dado (é um vetor). Pode ter como elementos qualquer tipo de dados (pode misturar) Cada elemento está associado a um índice, análogo às str mesmas regras de fatiamento e range das str """ exemplo = ['índice 0', 'índice 1', 'etc.', 'a'] # pode acessar o índice e alterar para qualquer tipo de dado diretamente # exemplo[1] = 4 # + entre duas listas (mesmo numéricas) é concatenar # .extend(<lista>) concatena na lista. pode só um termo também. # .append(<valor>) insere o valor ao final da lista # .insert(<n>, <v>) insere v no índice n # .pop() tira o último elemento # del(<lista>[<range>]) apaga valores # max(<lista>) e min(<lista>) # list(range(n,m)) retorna uma lista de n a m-1. i = 0 for x in exemplo: print(exemplo[i]) i += 1 # .startswith(<caractere>) # .lower() # aceita lista dentro de lista (como matriz) """ lista = [1, 2, 3, 4] a, b, c, d = lista # atribui cada elemento a cada var - desempacotamento se colocar asterisco antes de uma var cria uma lista com os elementos que sobram. a, *lista2, d = lista # lista2 recebe 2 e 3. por convenção usar *_ para não usar os outros elementos da lista. """ lista = [1,2,3,4] a, b, *n = lista # *n pega o resto da lista print(a, b) print(*lista) # desempacota
a695fafb011949f3d7d8ba845d8f187eb25ae719
Oleksandr015/Codewars_answers
/codewarce_solutions/iq_test.py
292
3.71875
4
def iq_test(numbers): l = numbers.split(' ') even = [i for i in l if int(i)%2==0] odd = [i for i in l if int(i)%2!=0] if len(even) == 1: return l.index(even[0])+1 else: return l.index(odd[0])+1 if __name__ == '__main__': print(iq_test("2 4 7 8 10"))
2d7cafc6c17aa6af6b97da42d306d770e8028ea7
klknet/geeks4geeks
/datastructure/array/rearrange.py
5,084
4.03125
4
""" Double the first element and move zero to end. """ import functools def double_and_move(arr): """ Double the first element equals to next element and move zeros to end. :param arr: :return: """ for i in range(len(arr) - 1): if arr[i + 1] != 0 and arr[i] == arr[i + 1]: arr[i] <<= 1 arr[i + 1] = 0 count = 0 for i in range(len(arr)): if arr[i] != 0: arr[count], arr[i] = arr[i], arr[count] count += 1 return arr def reorder_index(arr, idx): """ Reorder an array according to given indexes. :param arr: :param idx: :return: """ i = 0 while i < len(arr): if i != idx[i]: i1 = i i2 = idx[i] arr[i1], arr[i2] = arr[i2], arr[i1] idx[i1], idx[i2] = idx[i2], idx[i1] else: i += 1 return arr, idx def rearrange_pos_neg(arr): """ Rearrange positive and negative numbers with constants extra space. :param arr: :return: """ for i in range(1, len(arr)): if arr[i] >= 0: continue j = i temp = arr[i] while j > 0: if arr[j - 1] > 0: arr[j] = arr[j - 1] j -= 1 else: break arr[j] = temp return arr def rearrange_pos_neg1(arr): """ Using merge sort in place sort. :param arr: :return: """ merge_sort(arr, 0, len(arr) - 1) return arr def merge_sort(arr, l, r): if l < r: m = int((l + r) / 2) merge_sort(arr, l, m) merge_sort(arr, m + 1, r) merge(arr, l, r, m) def merge(arr, l, r, m): i, j = l, m + 1 while i <= m and arr[i] < 0: i += 1 while j <= r and arr[j] < 0: j += 1 reverse(arr, i, m) reverse(arr, m + 1, j - 1) reverse(arr, i, j - 1) def reverse(arr, s, e): while s < e: arr[s], arr[e] = arr[e], arr[s] s += 1 e -= 1 def arrange_biggest_num(arr): """ Arrange given numbers to form the biggest number. :param arr: :return: """ arr.sort(key=functools.cmp_to_key(my_cmp), reverse=True) res = '' for i in arr: res += str(i) return res def my_cmp(x, y): if x == y: return 0 if int(str(x) + str(y)) > int(str(y) + str(x)): return 1 return -1 def arrange_i_j(arr): """ Rearrange an array such thant arr[j] = i if arr[i] = j. :param arr: :return: """ for i in range(len(arr)): arr[i] += 1 for i in range(len(arr)): if arr[i] > 0: swap_i_j(arr, i, arr[i]) for i in range(len(arr)): arr[i] = -arr[i] - 1 return arr def swap_i_j(arr, idx, val): next_idx = val - 1 if arr[next_idx] > 0: tmp = arr[next_idx] arr[next_idx] = -idx - 1 swap_i_j(arr, next_idx, tmp) def rearrange_wave(arr): arr.sort(reverse=False) for i in range(1, len(arr) - 1, 2): arr[i], arr[i + 1] = arr[i + 1], arr[i] return arr def rearrange_wave1(arr): for i in range(len(arr) - 1): if i & 1 == 0: if arr[i] > arr[i + 1]: arr[i], arr[i + 1] = arr[i + 1], arr[i] else: if arr[i] < arr[i + 1]: arr[i], arr[i + 1] = arr[i + 1], arr[i] return arr def replace_mul_prev_next(arr): """ Replace every arr element by multiplication of previous and next. :param arr: :return: """ if len(arr) <= 1: return arr prev = arr[0] arr[0] = arr[0] * arr[1] for i in range(1, len(arr) - 1): cur = arr[i] arr[i] = prev * arr[i + 1] prev = cur arr[-1] = arr[-1] * prev return arr def segregate_arr(arr): """ Segregate even and odd numbers. :param arr: :return: """ i = j = 0 while j < len(arr): if arr[j] & 1 == 0: arr[i], arr[j] = arr[j], arr[i] i += 1 j += 1 return arr print("Double the first element equals to next element and move zeros to end.\n", double_and_move([0, 2, 2, 2, 0, 6, 6, 0, 0, 8])) print("Reorder an array according to given indexes.\n", reorder_index([50, 40, 70, 60, 90], [3, 0, 4, 1, 2])) print("arrange positive and negative numbers.\n", rearrange_pos_neg([-12, 11, -13, -5, 6, -7, 5, -3, -6])) print("arrange positive and negative numbers.\n", rearrange_pos_neg1([-12, 11, -13, -5, 6, -7, 5, -3, -6])) print("Form the biggest number.\n", arrange_biggest_num([54, 546, 548, 60])) print("swap arr[i] = j if arr[j] = i.\n", arrange_i_j([1, 3, 0, 2])) print("swap arr[i] = j if arr[j] = i.\n", arrange_i_j([2, 0, 1, 4, 5, 3])) print("rearrange arr in wave order.\n", rearrange_wave([6, 4, 2, 1, 8, 3, 10])) print("rearrange arr in wave order.\n", rearrange_wave1([6, 4, 2, 1, 8, 3])) print("replace element by multiplication previous and next.\n", replace_mul_prev_next([2, 3, 4, 5, 6])) print("segregate even and odd numbers.\n", segregate_arr([1, 9, 5, 3, 2, 6, 7, 11]))
f95354af3f2295ee80a3dcd0fe74f4ae38e74d38
jpcorreia99/aws-ML
/comprehend/sentiment.py
475
3.609375
4
# uses amazon comprehend to evaluate the sentiment of a given input import boto3 text = input("Insert a phrase whose sentiment will be evaluated: ") client = boto3.client('comprehend') req_resp = client.detect_sentiment(LanguageCode="en", Text=text) print("The detected sentiment was: " + req_resp['Sentiment']) for sentiment, confidence_value in req_resp['SentimentScore'].items(): print(sentiment + ": " + str(confidence_value))
3927206ffe922374d1b4b8638ce841ecadf11f16
quanewang/public
/reverse_stack.py
262
4.0625
4
def reverse(s): if not s: return s x = s.pop() reverse(s) insert(s, x) return s def insert(s, x): if not s: s.append(x) else: y = s.pop() insert(s, x) s.append(y) print reverse([1, 2, 3, 4])
b4ea8348ffde4fda27e1578c19269638bcd32024
davcodee/hacktober
/hello.py
583
3.984375
4
def suma(x,y): """Esta funcion hace una suma""" res=x+y return res def resta(x,y): """Esta funcion hace una resta""" return x-y def division(x,y): """Esta funcion hace una division""" div = x/y return div def multiplicacion(x,y): """Esta funcion hace una multiplicacion""" m = x*y return m def modulo(x,y): """Esta funcion hace una suma""" def potencia(x,n): return x ** n def factorial(n): if n == 1: return n else: return n * factorial(n-1) print(potencia(5,2)) if __name__ == "__main__": print(division(10,5)) print(factorial(5))
3f739547b63e185ab21002abd68768ce7ef60dd0
arkch99/CodeBucket
/CSE_Lab_Bucket/IT Workshop-Python/Day 10/prog15/prog15.py
895
3.765625
4
import module_fun as mf while(1): print("Press i to access function number i(eg:-1 for fun1)\nPress 6 to exit") c=int(input()) if c==1: print("Enter x and y:") x,y=input().split() x=int(x) y=int(y) print("Result=",mf.f1(x,y)) elif c==2: print("Enter n and r:") n,r=input().split() n=int(n) r=int(r) print("Result=",mf.f2(n,r)) elif c==3: n=int(input("Enter n:")) print("Result=",mf.f3(n)) elif c==4: print("Enter m and n") m,n=input().split() m=int(m) n=int(n) print("Result=",mf.f4(m,n)) elif c==5: print("Enter m and x") m,x=input().split() m=int(m) x=int(n) print("Result=",mf.f5(m,x)) elif c==6: print("Thanks") break else: print("Wrong input")
97b70861783db6640a05ba8f54088aa5e3380166
c-tham/PythonOOP
/03-Product/03-Product.py
1,851
3.828125
4
class Product(object): def __init__(self, price, item_name, weight, brand): self.price = price self.item_name = item_name self.weight = weight self.brand = brand self.status = "for sale" self.display_info() def sell(self): print "Item sold" self.tax(0.05) self.status = 'sold' self.display_info() return(self) def tax(self, tax): self.tax = tax print "Sale Tax: ", self.tax print "Tax Amount: ", self.price * self.tax if self.tax == 0: print "Tax cannot be zero!" return(self) self.price = self.price + (self.price * self.tax) return(self) def returnitem(self, reason): self.reason = reason print "Item return: ", self.reason if self.reason == 'defective': self.status = 'defective' self.price = 0 elif self.reason == 'box': self.status = 'for sale' elif self.reason == 'opened': self.status = 'used' self.price = self.price * 0.8 self.display_info() return(self) def display_info(self): print "Item Name: ", self.item_name print "Item Brand: ", self.brand print "Item Price: ", self.price print "Item Weight: ", self.weight print "Item status: ", self.status print "****************************" return(self) # phone1 = Product(500,"Iphone7","5oz","Apple") # phone1.sell().display_info() # phone1.returnitem("opened").display_info() phone1 = Product(500,"Iphone7","5oz","Apple") phone1.sell() phone1.returnitem("opened") phone2 = Product(600,"Iphone8","5oz","Apple") phone2.sell() phone2.returnitem("box") phone3 = Product(700,"IphoneX","5oz","Apple") phone3.sell() phone3.returnitem("defective")
e3c7130f3be8ecfe84c1acf0439afec427b37bea
numpee/ngsim
/moving_circles.py
851
3.578125
4
import numpy as np import matplotlib.pyplot as plt import matplotlib.patches as patches import matplotlib.animation as animation fig = plt.figure() ax = fig.add_subplot(111) plt.xlim(-100, 100) plt.ylim(-100, 100) width = 5 bars = 25 RB = [] # Establish RB as a Python list for a in range(bars): RB.append(patches.Rectangle((a*15-140,-100), width, 200, color="blue", alpha=0.50)) def init(): for a in range(bars): ax.add_patch(RB[a]) return RB def animate(i): for a in range(bars): temp = np.array(RB[i].get_xy()) temp[0] = temp[0] + 3; RB[i].set_xy(temp) return RB anim = animation.FuncAnimation(fig, animate, init_func=init, frames=15, interval=20, blit=True) plt.show()
28f3c284def08b41865d5e983f0b01ab69c35b81
Rashi1997/Python_Exercises
/37.TextFile.py
491
3.625
4
"""Write a program that given a text file will create a new text file in which all the lines from the original file are numbered from 1 to n (where n is the number of lines in the file).""" loc="C:/Users/rasdhar/Desktop/Python Training/37/text_file.txt" f=open(loc) lines=f.read().split("\n") f.close() f_output=open("C:/Users/rasdhar/Desktop/Python Training/37/list_text_file.txt",'w') i=1 for line in lines: f_output.write(str(i)+". "+line+"\n") i+=1 f_output.close()
1a420c9e8ea34cd6f2d87396bd20a4cada16e77d
rlampe2/Advent_of_Code2016
/Day06/one.py
751
3.921875
4
# Author: Ryan Lampe # 5/18/2020 # Advent of Code 2016 # Day 6, Problem 1 from collections import Counter # Have a list of lists for each index, and add all the characters in that column to it. # Then for each list, print the most common character index = {} with open('input.txt', 'r') as file: lines = file.read().splitlines() # Use instead of readlines to get rid of newlines for i in range(0, len(lines[0])): index[i] = [] # create a list at that index for line in lines: for i in range(0, len(line)): index[i].append(line[i]) # Find most common char: for i in range(0, len(lines[0])): c = Counter(index[i]).most_common(1) for key, val in c: print(key) # There's only one entry in c, but want just the key
5396b9bbb4ef164871b78234797602a9225355c9
K-Jaswanth/DSP-Lab-and-Assignments
/prime_number.py
358
3.71875
4
#Prime numbers upto a limit print("Jaswanth sai - 121910313044") lower = int(input("Enter the lower limit:")) higher = int(input("Enter the higher limit:")) #logic begins here for a in range(lower,higher): if a>1: for i in range(2,a): if(a%i==0): break else: print(a)
92b909a5ea80d7b0f4a1298e9f225f3867beed24
hankyeolk/PythonStudy
/sorting/sequential search.py
592
3.796875
4
#순차 탐색 (Sequential Search) example_list = [17, 92, 18, 33, 58, 5, 33, 42] def seqS(a, x): for i in range(len(a)): if a[i] == x: return i return -1 #else를 쓰면 끝까지 가지 않고 종료해버림 print(seqS(example_list, 900)) def seqS2(a, x): k = [] for i in range(len(a)): if a[i] == x: k.append(i) return k print(seqS2(example_list, 900)) s_num = [39, 14, 67, 105] s_name = ["justin", "john", "mike", "summer"] def seqS3(a, b, x): for i in range(len(a)): if a[i] == x: return b[i] return "?" print(seqS3(s_num, s_name, 67))
f8b55c65691273d6de3f61078a02030a24f94ce4
kuanyingchou/tinyvim
/tinyvim.py
1,323
3.703125
4
class TextCpn: def __init__(self): self.content = [[]] self.showLineNumber = True self.cursor_x = 0 self.cursor_y = 0 def __str__(self): prefix = '' no = 1 res = '' for line in self.content: if self.showLineNumber: res = res + str(no) + '. ' for char in line: res = res + char res = res + '\n' no = no + 1 return res; def insert(self, c): current_line = self.content[self.cursor_y] if c == '\n': self.content[self.cursor_y] = current_line[:self.cursor_x] self.content.insert(self.cursor_y + 1, current_line[self.cursor_x:]) self.move_down() else: current_line.insert(self.cursor_x, c) self.move_right() #def new_line(self): # self.content.append(['']) def move_right(self): current_line = self.content[self.cursor_y] if self.cursor_x < len(current_line): self.cursor_x = self.cursor_x + 1 def move_left(self): if self.cursor_x > 0: self.cursor_x = self.cursor_x - 1 def move_down(self): self.cursor_y = self.cursor_y + 1 if __name__ == '__main__': txt = TextCpn() txt.insert('h') txt.insert('e') txt.insert('l') txt.insert('l') txt.insert('o') txt.insert('\n') txt.insert('b') txt.insert('y') txt.insert('e') print(txt)
7f2f7f669a58e39a94623588dbab424a501ee873
54lihaoxin/leetcode_python
/src/MinimumPathSum/solution.py
1,353
3.765625
4
# Minimum Path Sum # # Given a m x n grid filled with non-negative numbers, find a path from top left to bottom right which minimizes the sum of all numbers along its path. # # Note: You can only move either down or right at any point in time. debug = True debug = False # from CommonClasses import * # hxl: comment out this line for submission class Solution: # @param grid, a list of lists of integers # @return an integer def minPathSum(self, grid): minDict = {} i = len(grid) - 1 while 0 <= i: j = len(grid[0]) - 1 while 0 <= j: if i == len(grid) - 1 and j == len(grid[0]) - 1: minDict[(i, j)] = grid[i][j] elif i == len(grid) - 1 and j < len(grid[0]) - 1: minDict[(i, j)] = grid[i][j] + minDict[(i, j + 1)] elif i < len(grid) - 1 and j == len(grid[0]) - 1: minDict[(i, j)] = grid[i][j] + minDict[(i + 1, j)] else: minDict[(i, j)] = grid[i][j] + min(minDict[(i + 1, j)], minDict[(i, j + 1)]) if debug: print i, j, self.minDict[(i, j)], self.minDict j -= 1 i -= 1 return minDict[(0, 0)]
a7fbea43f7a571864dc0de5e7453ba10684948e2
sokazaki/leetcode_solutions
/problems/0716_max_stack.py
1,026
3.734375
4
# O(1) push/pop/top/peekMax, O(N) popMax Time Complexity / O(N) Space Complexity Solution with Two Stack class MaxStack: def __init__(self): self.stack=[] self.maxstack=[] def push(self, x): self.stack.append(x) if not self.maxstack: self.maxstack.append(x) else: self.maxstack.append(max(x, self.maxstack[-1])) def pop(self): self.maxstack.pop() return self.stack.pop() def top(self): return self.stack[-1] def peekMax(self): return self.maxstack[-1] def popMax(self): n = self.maxstack.pop() tmp = [] while n != self.stack[-1]: tmp.append(self.pop()) self.stack.pop() for i in range(len(tmp)-1, -1, -1): self.push(tmp[i]) return n # Your MaxStack object will be instantiated and called as such: # obj = MaxStack() # obj.push(x) # param_2 = obj.pop() # param_3 = obj.top() # param_4 = obj.peekMax() # param_5 = obj.popMax()
46430e85f76969326da72bda5d92277c641f5b34
Phillip215/digitalcrafts
/week1/day4/loopingOverLists.py
408
4.09375
4
pets = ["dog", "cat", "ham"] print(len(pets)) # Loop over a list index = 0 while index < len(pets): pet = pets[index] print("What pet are ya? Well I'm a %s" % pet ) index += 1 # For in loops are better to use than a while loop for pet in pets: print(pet) # How to combine lists first = [1, 2, 3, 4] first.extend([5, 6, 7]) print(first) # TO delete a item in a list del first[1] print(first)
e44be145405d1b08bba120c5e2e2adf10383dc6b
gurudurairaj/gp
/holiday.py
84
3.609375
4
a=["Saturday","Sunday"] g=input() if g in a: print("yes") else: print("no")
347c634bfad24cf322e4fdfecff755527bad3ca6
AcubeK/LeDoMaiHanh-Fundamental-C4E23
/Season 4/D4/intro.py
506
3.59375
4
# # person = ["Bucko", "Mind", "Home", 18, 6, 896, True, ] # person = {} # print(person) # print(type(person)) person = { # Key & Key value "Name": "Bucko", "Location": "Mind", "Age": 18 } # print(person) # person["Death_counts"] = 896 # C # # print(person["Name"]) # R # key = "Name" # U # print(person[key]) # if key in person: # print(person[key]) # else: # print("Not found.")
4151ac521d2105a8430a602050ad798db2e3deb0
dshapiro1dev/RuCoBo
/src/examples/builtin_types/Numbers.py
1,517
4.5
4
# numbers in python can take different forms # integers: round numbers like 1, 12, -5 # floats: numbers with decimals like 3.553 , 1.0505, 3.1415, and 5.000000 integer1 = 37 integer2 = 12 divd = integer1 / integer2 print(type(integer1)) # integer print(type(integer2)) # integer print(type(divd)) # float # notice: if we divide one integer by another - and dont get a clean integer, the result is a float i1 = 6 i2 = 3 print(type(i1/i2)) # even if the result is an integer - python automatically says a division of 2 integers gets a float # we can also convert from one type to another # lets say we have a string - and we want an integer mystr = "37" theint = int(mystr) # int() converts the string into an integer print(theint) # now what happens if we try convert a float to an int myflt = 3.1415926 myint = int(myflt) print(myint) # 3 -> we drop the decimal and converted to an integer (close enough to PI) # all the arithmetic operations are natural - but Python has some specific charaters f1 = 2.17 f2 = 3.22 f3 = -333.33 print(f1+f2) # addition print(f1-f2) # subtraction print(f1==f2) # equivalence test (note: the double == tests if 2 things are equal, the single = assigns a value) print(f1/f2) # division print(f1*f2) # multiplication print(f1 ** f2) # f1 to the power of f2 print(abs(f3)) # absolute value # for the mathematically inclined - python even has complex numbers c1 = complex(2,3) # 2 + 3i 2 = real part 3 = imaginary part print(c1) # prints out: 2 + 3j
20e6f290bc2fa83c3a6deaed30c4c51fb2315b2d
beginstudy/python_newstudy
/mountain_poll.py
606
3.859375
4
responses = {} #设置一个标志,指出调查是否继续 投票活动 = True while 投票活动: #提示输入被调查者的名字和回答 name = input("\n请问你的名字是?") response = input("你想住多少天?") #将答卷存储在字典中 responses[name] = response #看看是否还有人要参与调查 repeat = input("还有人要参与调查吗?(yes/no)") if repeat == 'no': 投票活动 = False #调查结束,显示结果 print("\n---调查结果---") for name,response in responses.items(): print(name + "想住" + response + '天。')
2e543c5e77465f3981b32667f1585f01d0bd1e69
mohammadfebrir/learningPython
/sec2Lec6Ex5-function.py
279
4.15625
4
num1 = int(input("input number1: ")) num2 = int(input("input number2: ")) if num1>num2: print("first is greater") print("difference is " +str(num1 - num2)) elif num1<num2: print("first is less") print("difference is " +str(num1 - num2)) else: print("numbers are equal")
e91d8b362e1764f5c795f6b37d10aed2b1337608
KenjaminButton/runestone_thinkcspy
/12_dictionaries/exercises/12.7.3.exercise.py
1,104
4.0625
4
''' Write a program called alice_words.py that creates a text file named alice_words.txt containing an alphabetical listing of all the words, and the number of times each occurs, in the text version of Alice’s Adventures in Wonderland. (You can obtain a free plain text version of the book, along with many others, from http://www.gutenberg.org.) The first 10 lines of your output file should look something like this: Word Count a 631 a-piece 1 abide 1 able 1 about 94 above 3 absence 1 absurd 2 ''' import string infile = open('alice.txt', 'r') text = infile.readlines() counts = {} for line in text: for word in line: counts[word] = counts.get (word, 0) +1 ''' if word != " ": if word != ".": ''' word_keys = sorted(counts.keys()) infile.close() outfile = open("alice_words.txt", 'w') outfile.write("Word \t \t Count \n") outfile.write("======================= \n") for word in word_keys: outfile.write("%-12s%d\n" % (word.lower(), counts[word])) outfile.close()
9aec265c285174de8e26804bd55061d8e4be6ebb
msanchezzg/UVaOnlineJudge
/10000-10999/10945/motherBear_10945.py
220
3.796875
4
while True: s = input() if s == 'DONE': break s = [c.upper() for c in s if c.isalpha()] s2 = s[::-1] if s == s2: print('You won\'t be eaten!') else: print('Uh oh..')
05b311c21c2f33b185c4d1696a5bdfcc000bc6f0
natrine/guessnumber
/guess.py
804
4.03125
4
import random correctNum = random.randint(1, 100) def guessNum(): guess = input("Guess an integer from 1 to 100: ") try: guess = int(guess) if guess < 1 or guess > 100: print("Please guess between 1 and 100.\n") guessNum() elif guess > correctNum: print("Too high! Guess again.\n") guessNum() elif guess < correctNum: print("Too low! Guess again.\n") guessNum() else: # guess = correctNum print("Good job, you guessed correctly!\nThe number is " + str(correctNum) + ".\n") except ValueError: print("Please guess an integer. \n") guessNum() guessNum() close = input("Press enter to exit this program. ")
c9b599aaa1c9c57022723bad51ad9b13a3e1ff09
Amir324/itc_bootcamp_winter2020
/Python/200310161111_Mimic.py
3,358
4.1875
4
#!/usr/bin/python -tt ## adapted to Python3 for ITC - 17/10/18 ## - also added pep8 and naming convention compliance ## # Copyright 2010 Google Inc. # Licensed under the Apache License, Version 2.0 # http://www.apache.org/licenses/LICENSE-2.0 # Google's Python Class # http://code.google.com/edu/languages/google-python-class/ """Mimic pyquick exercise -- optional extra exercise. Google's Python Class Read in the file specified on the command line. Do a simple split() on whitespace to obtain all the words in the file. Rather than read the file line by line, it's easier to read it into one giant string and split it once. Build a "mimic" dict that maps each word that appears in the file to a list of all the words that immediately follow that word in the file. The list of words can be be in any order and should include duplicates. So for example the key "and" might have the list ["then", "best", "then", "after", ...] listing all the words which came after "and" in the text. We'll say that the empty string is what comes before the first word in the file. With the mimic dict, it's fairly easy to emit random text that mimics the original. Print a word, then look up what words might come next and pick one at random as the next work. Use the empty string as the first word to prime things. If we ever get stuck with a word that is not in the dict, go back to the empty string to keep things moving. Note: the standard python module 'random' includes a random.choice(list) method which picks a random element from a non-empty list. For fun, feed your program to itself as input. Could work on getting it to put in linebreaks around 70 columns, so the output looks better. """ import random import sys PATH = 'alice_mimic.txt' NUMBER_OF_WORDS = 200 NUMBER_OF_ARGS = 2 FILE_NAME = 1 def mimic_dict(filename): """Returns mimic dict mapping each word to list of words which follow it.""" mimic_dict = {} prev = '' try: with open(filename, 'r+') as file: data = [line.strip().split() for line in file] for line in data: for word in line: if not prev in mimic_dict: mimic_dict[prev] = [word.strip()] else: mimic_dict[prev].append(word.strip()) prev = word return mimic_dict except: sys.exit("can't read a file") def print_mimic(mimic_dict, word): """Given mimic dict and start word, prints 200 random words.""" try: for num in range(NUMBER_OF_WORDS): print(word) next_word = mimic_dict.get(word) if not next_word: next_word = mimic_dict[''] word = random.choice(next_word) except: sys.exit('something went wrong :(') def test_mimic_dict(): """ testing the mimic_dict() function """ assert type(mimic_dict(PATH)) == dict print('testing function mimic_dict() passed!') def main(): """ Provided main(), calls print_mimic and mimic() and get user's input: filename.txt """ test_mimic_dict() if len(sys.argv) != NUMBER_OF_ARGS: print('usage: ./mimic.py file-to-read') sys.exit(FILE_NAME) my_dict = mimic_dict(sys.argv[FILE_NAME]) print_mimic(my_dict, '') if __name__ == "__main__": main()
f53fc4b9d84e5fc5b7fcc98df2d560bd4af0ea54
RCNOverwatcher/Python-Challenges
/Sources/Challenges/070.py
204
4.09375
4
countries = ("England", "Scotland", "Ireland", "Wales", "United Kingdom") print (countries) ask = input("Enter the number you want to locate the country for") ask = int(ask) - 1 print(countries[int(ask)])
639781db273d5e14d8c5da5b56491941b4c391d7
OdilGaniyev/pythondarslari
/main.py
523
3.609375
4
# import random # for i in range (10): # print (random.random()) # kiritilganSon = int(input("son->")) # tasodifiySon = random.randint(1,5) # if kiritilganSon == tasodifiySon: # print(tasodifiySon) # print("Yutdingiz") # else: # print("tasodifiySon") # print("Dam oling") import random while True: tasodifiySon = random.randint(1,4) kritilganSon = int(input("son->")) if kritilganSon == tasodifiySon: print("Yutdingiz") break else: print("Omadingiz kelmadi")
60ffa7dc990107ce62e16086df9008e36b7b834a
isaacv15/sophiaClass
/main.py
1,284
4.15625
4
import random guessesTaken = 0 print("Hello what is your name?") myName = input() number = random.randint(1,20) print("Hello, " + myName + "! I am thinking of a number between 1 and 20, you have 5 guesses to guess the correct answer. If you can guess the number correctly I will tell you my name.") while guessesTaken < 5: print("Take your guess!") guess = input() if (guess.isdigit() == False): print("Your input was invalid.") validInput = False while (validInput == False): guess = input("Take your guess!") if (guess.isdigit() == True): validInput = True guess = int(guess) guessesTaken = guessesTaken + 1 if guess < number: print("Your guess is low!") if guess > number: print("Your guess is high!") if guess == number: break if guess == number: if guessesTaken == 1: print("Good job " + myName + "! You guessed my number in 1 guess! My name is Isaac Varghese, its been a pleasure playing with you!") else: print("Good job " + myName + "! You guessed my number in " + str(guessesTaken) + " guesses! My name is Isaac Varghese, its been a pleasure playing with you!") if guess != number: number = str(number) print("Nope, I'm sorry, the number I was thinking of was " + number + ".")
7394ccb4619cb41d06fbea711dead41a66ab81a4
Alexanderklau/Algorithm
/Greedy_alg/leetcode/minimum-deletion-cost-to-avoid-repeating-letters.py
1,552
3.5
4
# coding: utf-8 __author__ = 'Yemilice_lau' """ 给你一个字符串 s 和一个整数数组 cost ,其中 cost[i] 是从 s 中删除字符 i 的代价。 返回使字符串任意相邻两个字母不相同的最小删除成本。 请注意,删除一个字符后,删除其他字符的成本不会改变。 示例 1: 输入:s = "abaac", cost = [1,2,3,4,5] 输出:3 解释:删除字母 "a" 的成本为 3,然后得到 "abac"(字符串中相邻两个字母不相同)。 示例 2: 输入:s = "abc", cost = [1,2,3] 输出:0 解释:无需删除任何字母,因为字符串中不存在相邻两个字母相同的情况。 示例 3: 输入:s = "aabaa", cost = [1,2,3,4,1] 输出:2 解释:删除第一个和最后一个字母,得到字符串 ("aba") 。 """ cost = [3,5,10,7,5,3,5,5,4,8,1] s = "aaabbbabbbb" class Solution(object): def minCost(self, s, cost): n = 0 k = 0 new_s = list(s) while n + 1 < len(cost): print(n) print(cost) print(new_s) print(new_s[n], new_s[n + 1]) if new_s[n] == new_s[n + 1]: if cost[n] < cost[n + 1]: k += cost[n] new_s.pop(n) cost.pop(n) n -= 1 else: k += cost[n + 1] new_s.pop(n + 1) cost.pop(n + 1) n -= 1 n += 1 return k z = Solution() print(z.minCost(s, cost))
85273adc94aa5c424281c37225b358f2af428ef8
ganhan999/ForLeetcode
/605、种花问题.py
1,030
4.03125
4
""" 假设有一个很长的花坛,一部分地块种植了花,另一部分却没有。可是,花不能种植在相邻的地块上,它们会争夺水源,两者都会死去。 给你一个整数数组flowerbed 表示花坛,由若干 0 和 1 组成,其中 0 表示没种植花,1 表示种植了花。另有一个数n ,能否在不打破种植规则的情况下种入n朵花?能则返回 true ,不能则返回 false。 示例 1: 输入:flowerbed = [1,0,0,0,1], n = 1 输出:true 示例 2: 输入:flowerbed = [1,0,0,0,1], n = 2 输出:false """ """ 连续三个0则可以种一盆花 """ class Solution: def canPlaceFlowers(self, flowerbed: List[int], n: int) -> bool: flowerbed = [0] + flowerbed#前后都补0 flowerbed = flowerbed + [0]#前后都补0 for i in range(1, len(flowerbed) - 1): if flowerbed[i - 1] == 0 and flowerbed[i] == 0 and flowerbed[i + 1] == 0: n = n - 1 flowerbed[i] = 1 return n <= 0
141a55ff8bd941d5f9c006393c7512a4c7603e06
gaur1616/Huffman_Decoding
/Prefix_free_code.py
3,473
3.78125
4
import string #Class definition of tree for generating a Prefix Free Code class Tree: def __init__(self, cargo, left=None, right=None): self.cargo = cargo self.left = left self.right = right self.freq = 0 self.code ='' def __str__(self): return str(self.cargo) def getLetter(self): return self.letter def setLetter(self,value): self.letter=value def getFreq(self): return self.freq def setFreq(self,value): self.freq=value def getCode(self): return self.code def setCode(self,value): self.code=value #Stack definition to sort and store the created trees/symbols class Stack: def __init__(self): self.items = [] def isEmpty(self): return self.items == [] def push(self, item): self.items.append(item) def pop(self): return self.items.pop() def peek(self): return self.items[len(self.items)-1] def size(self): return len(self.items) #Sort and Store in Stack: def sortedInsert(S, element): if (S.isEmpty() or element.freq < S.peek().freq): S.push(element) else: temp = S.pop() sortedInsert(S, element) S.push(temp) #To visualise the tree: def print_tree_indented(tree, level=0): if tree == None: return print_tree_indented(tree.right, level+1) print ' ' * level + str(tree.cargo) + ' ' + str(tree.code) print_tree_indented(tree.left, level+1) #Code Assignment for the generated prefix free tree: def update_code(tree, appcode): if tree == None: return update_code(tree.right, appcode+'1') tree.code=tree.code+ appcode update_code(tree.left, appcode+'0') #Codebook Creation for encoding: def create_codebook(tree): if tree == None: return create_codebook(tree.right) if len(tree.cargo)==1: wf.write(tree.cargo+' , '+tree.code+'\n') create_codebook(tree.left) #File Handling: Open and Reading the text in the file: rf=open('D:\Documents\UB Course\Subjects\ITC\Homework\Exercise 4\Input Text.txt','r') para=rf.read() rf.close() #Length of the Paragraph read: length_para=float(len(para)) #Creating a dictionary: dictionary= string.ascii_lowercase + string.ascii_uppercase + string.punctuation + ' ' + string.digits #Relative Frequency of each symbol: codebook=[]; for i in range(len(dictionary)): letter_count=string.count(para,dictionary[i]) codebook.append([dictionary[i],letter_count]) sym_tocode=Stack() #Stack of all alphabets and punctuations with non zero frequency in a sorted manner for element in codebook: if element[1]!=0: newNode=Tree(element[0]); newNode.freq=element[1] sortedInsert(sym_tocode, newNode) #Prefix free code tree generation while sym_tocode.size()>1: t1=sym_tocode.pop() t2=sym_tocode.pop() mytree=Tree('(N)', t2, t1) mytree.freq=t1.freq+t2.freq sortedInsert(sym_tocode, mytree) print_tree_indented(sym_tocode.peek()) #Code generation for the generated tree update_code(sym_tocode.peek(), '') #Generating Prefix Free Code Documentation for the provided text: wf=open('D:\Documents\UB Course\Subjects\ITC\Homework\Exercise 4\Prefix Free Code.txt','w') create_codebook(sym_tocode.peek()) wf.close()
38788ef6ac45bf5c876be539f996ee3ed64623dd
SimonBrown94/Battleships
/Player.py
5,203
4
4
import Board import Ship import random class Player: def __init__(self, board_size, bot, diff, ships): self.ships = [] self.board_size = board_size self.my_board = Board.Board(board_size) self.opp_board = Board.Board(board_size) self.remaining_attacks = [] self.attack_stack = [] self.opp_ships = [] self.turns = 0 for i in ships: self.opp_ships.append(i) if bot == 'P': self.bot = False elif bot == 'C': self.bot = True for i in range(board_size): for j in range(board_size): self.remaining_attacks.append([i, j]) self.diff = diff def add_ship(self, ship_number, length): # Add a ship to the player if not self.bot: # This section is for human players # Print the current board and state ships length self.my_board.print_board() print("Ship: " + str(ship_number) + ", Length: " + str(length)) valid_position = False # Ask for position and check if it is valid while not valid_position: x = input("Ship " + str(ship_number) + " x coordinate = ") y = input("Ship " + str(ship_number) + " y coordinate = ") d = input("Ship " + str(ship_number) + " direction = ").lower() if d == 'h': if not x.isnumeric() or int(x) + length > self.board_size: print("Invalid ship position, please choose again (ship goes off the board)") continue for i in range(length): if self.my_board.board[int(y), int(x) + i] == 'S': print("Invalid ship position, please choose again (ship overlaps another ship") valid_position = False break else: x = int(x) y = int(y) valid_position = True elif d == 'v': if not y.isnumeric() or int(y) + length > self.board_size: print("Invalid ship position, please choose again (ship goes off the board)") continue for i in range(length): if self.my_board.board[int(y) + i, int(x)] == 'S': print("Invalid ship position, please choose again (ship overlaps another ship)") valid_position = False break else: x = int(x) y = int(y) valid_position = True else: print("Invalid direction, please choose again (must be 'h' or 'v')") else: # This section is for if the computer has to generate ship positions d = random.choice(['h', 'v']) valid_position = False while not valid_position: if d == 'h': x = random.randrange(self.board_size - length) y = random.randrange(self.board_size) else: x = random.randrange(self.board_size) y = random.randrange(self.board_size - length) if d == 'h': for i in range(length): if self.my_board.board[y, x + i] == 'S': valid_position = False break else: valid_position = True elif d == 'v': for i in range(length): if self.my_board.board[y + i, x] == 'S': valid_position = False break else: valid_position = True # Once the valid coordinates are chosen, add a new ship and update the boards self.ships.append(Ship.Ship(x, y, length, d)) for coord in self.ships[ship_number].coords: self.my_board.coord_update(coord[0], coord[1], 'S') def opp_attack(self, x, y): # Check the input coordinates against the coordinates of each ship, if hit then update ship for ship in self.ships: for i in range(len(ship.coords)): if [x, y] == ship.coords[i]: action = ship.update_ship(i) if action == "Hit": return action, [] elif action == "Sank!": return action, ship.coords return "Miss", [] def still_alive(self): # If a player has at least one ship which is not dead then the are still alive for ship in self.ships: if not ship.dead: return True return False
7df7b9d0d411db6008f1b7468cd11e43fce42630
sidmaskey13/python_assignments
/DT45.py
107
3.78125
4
given_tuple = (1,2,3,4,5,6) to_index = 4 print(f"{to_index} is in index {given_tuple.index(to_index)}")
60b3e7c45b40ff621c654d6adcf77b8ee14b866c
Peixinho20/Fundamentos-da-Computacao
/python2/frase-sem-caracter.py
272
4.15625
4
#Faça um programa que leia uma string e um caractere e crie uma outra string sem o caractere lido. frase = raw_input("Digite uma frase: ") caracter = raw_input("Escolha um caractere: ") palavras = frase.split(caracter) junto = ''.join(palavras) #print frase print junto
3bd5e5ce5e68028327ec01be32dd16030c5ef1d9
roeisavion/roeisproject2
/תרגילים המהצגת/4.2.py
174
4.03125
4
a=int(input("enter a number1")) for i in range (2,a) : if i!=a and a%i==0 : print("the number is non-prime") break else: print("the number is prime")
86f7c0e8a25f873638c2a99eff659a73c87092ac
Mansoorshareef1996/Grocery-stimulation-using-python
/grocery stimulation.py
10,759
4.4375
4
#!/usr/bin/python3 from random import seed, randrange from header6 import * N = 10 # Setting the vale of N as 10 def rnd(low, high): ''' It Generates random numbers :param : low,high :return: The random number in the range low,high ''' return randrange(low, high + 1) # returns the random number in the range low and high def arrival(clock, picking): ''' It is used to calculate the arrival time of the customer :param:clock,picking :return: The next arrival time and the next pick of the customer ''' next_arr_time = clock + rnd(MIN_INT_ARR, MAX_INT_ARR) # The next arrival time is calculated by adding the clock with the rnd of minimum interarrival time and max interarrival if N > 0: # Customer has arrived, calculate the time it takes to pick print("Arriving to Store: " + str(clock)) # Printing the arriving to store time customer = { "atime": clock, # Arrival time "ptime": clock + rnd(MIN_PICK, MAX_PICK), # Finish pick time "wtime": 0, # waiting time in checkout line "dtime": 0 # departing time from store of a customer } # Dictionary of the customer to capture the data values of customer as a single unit picking.append(customer) # Append the customer to the picking # Find the minimum pick time from the list of pickers next_pick = None # The next pick is intially None for customer in picking: # for loop for the customers in picking if next_pick is None or customer["ptime"] < next_pick: # If the value of next pick is none or the customer[ptime] is greater than next pick next_pick = customer["ptime"] # If the if statemnt is satisfied then next pick is equals to customer[ptime] return next_arr_time, next_pick # Return the value of next arrival time and next pick time def shopping(clock, picking, checkout): ''' Move customers who have finished picking and add it to the check out Next customer is the customer that has the lowest value :param:clock,picking,checkout: It is the checkout time and picking time of customer :return:the next pick and the checkout time ''' finished_picking_customer = None # The value of finished picking customer is None for customer in picking: #for loop for customers in picking if customer["ptime"] == clock: #If the cutomer ptime is equal to the clock if N > 0: # If the value of N is greater than 0 print("Picking Grocery Done: " + str(clock)) # Print the picking is done and the time finished_picking_customer = customer # Updating the customers who have finished picking break picking.remove(finished_picking_customer) # Remove the customers from picking who are done with their picking # If the checkout is busy with someone else then the person will have to # go to the line. The person's departure time is dependent on the last person # in check out if len(checkout) == 0: # If the length of the checkout is zero than finished_picking_customer["dtime"] = clock + rnd(MIN_SERV, MAX_SERV) #The departing time of the customers who have finished picking is calculated with the given formula above checkout.append(finished_picking_customer) # Update the checkout list with the customers who have finished picking items # Find the minimum pick time from the list of pickers next_pick = None # The value of next pick is None for customer in picking: # For loop for customer in picking if next_pick is None or customer["ptime"] < next_pick: # If the next pick is none or the customer picking time completion is greater than next pick next_pick = customer["ptime"] # The value of next pick is the customer time of completion of picking up the grocery items return next_pick, checkout[0]["dtime"] # It returns the next pick value and the checkout time of departing time def update_stat(cust, total): ''' Update the stats :param:customer,total ''' total["num"] += 1 # Total is calculated as the total[num]+1 total["pick"] += cust["ptime"] - cust["atime"] # The total pick time is calculated as the customer picking completion time minus the customer arrival time serv_time = cust["dtime"] - cust["ptime"] # The service time is calculated as the customer departure time minus the customer picking completion time if cust["wtime"] > 0: # If the customer waiting time is greater than zero wait_time = cust["wtime"] - cust["ptime"] # waiting time is the customer wait time ninus the customer picking time completion total["wait"] += wait_time # total wait time is calculated as the taotal wait time plus the wait time serv_time = cust["dtime"] - cust["wtime"] # The serving time is the customer departing time minus the customer wait time total["serv"] += serv_time # Total serving time is the total serv time plus the serving time total["shop"] += cust["dtime"] - cust["atime"] #Total shoping time is the customer departing time minus the customer arrival time def print_stat(total): ''' printing the stats :param:total ''' num_shopped = "{:,}".format(total["num"])# The total number of shopped customer is calculated avg_pick = "{:,.3f}".format(total["pick"] / total["num"]) # The average pick tme is calculated avg_shop = "{:,.3f}".format(total["shop"] / total["num"]) # The average shop time is calculated avg_wait = "{:,.3f}".format(total["wait"] / total["num"]) # The average wait time is clculated avg_serv = "{:,.3f}".format(total["serv"] / total["num"]) # The average serving time is calculated spacing = len(num_shopped) # The spacing is calculated as the length of the number of customers shopped if len(avg_pick) > spacing: # If the lengh of average pick is greater than than the spacing spacing = len(avg_pick) # The value of spacing is set as the length of the average pick if len(avg_shop) > spacing: # If the length of average shoppe is greater than spacing spacing = len(avg_shop) # spacing is the value of length of average shoppe if len(avg_wait) > spacing: # If the length of average is greater than spacing spacing = len(avg_wait) # The value of spacing is length of average wait time print("Num of customers shopped = " + num_shopped.rjust(spacing)) # Printing the customer shoppe print("Avg grocery pick time = " + avg_pick.rjust(spacing)) # Printing the Average grocery pick time print("Avg wait time in checkout = " + avg_wait.rjust(spacing)) # Printing the average wait time in checkout print("Avg serv time in checkout = " + avg_serv.rjust(spacing)) # Printing the average serve time in checkout print("Avg time in store = " + avg_shop.rjust(spacing)) # Printing the Average time in store def departure(clock, checkout, total): ''' The departure of the customer is calculated :param: clock,checkout,total ''' global N # Depart the next customer cust = checkout.pop(0) if N > 0: # If the value of N is greater than 0 print("Departing from Store: " + str(clock)) # Print the Departing from store time print('\n') # Including the spaces N -= 1 # The value of N is calculated as N minus 1 update_stat(cust, total) # The stats is updated with the customer and total value if len(checkout) > 0: # If the length of checkout is greater than checkout[0]["wtime"] = clock # The checkout of cust at zero wait time is the value of clock checkout[0]["dtime"] = clock + rnd(MIN_SERV, MAX_SERV) # The checkout of customer o depart time is calculated using the above formula return checkout[0]["dtime"] # The Checkout of customer o depart time is returned if the length of checkout is greater than zero return None # Return the None value def update_clock(next_arr, next_pick, next_dept): ''' The clock time is updated :param:next_arr,next_pick,next_dept: The value of clock is updated based on the parameters :return:the next clock value ''' # Find the smallest clock time next_clock = next_arr if next_pick is not None and next_pick < next_clock: # If the next pick is not none and next pic is greater than next clock next_clock = next_pick # The next clock is set as the value of next pick if next_dept is not None and next_dept < next_clock: # If the next dept is not None and the next dept is greater than next clcck next_clock = next_dept # The next clock value is the value of next departure value return next_clock # Return the value of next clock def main(): ''' Entry point in the program ''' seed(SEED) # Before generating the random number we call the SEED function clock = 0 # Intialize the clock # Initialize events next_arr = 0 # arrival time of the next customer next_pick = None # time of a customer who is next to finish picking up the grocery items next_serv = None # the time of a customer who is next to be served in the checkout line next_dept = None # the departing time of a next customer from the store. # Initialize the statistical values total = { "num": 0, # total number of customers departed from the store "pick": 0, # accumulated grocery picking times "wait": 0, # accumulated waiting times "serv": 0, # accumulated service times "shop": 0 # accumulated time spent in the store over all customers } picking = [] # List of Picking checkout = [] # List of Checkout while clock < SIMTIME: # if the value of clock is greater than SIMTIME if clock == next_arr: # If the value of clock is equals to the next arrival time next_arr, next_pick = arrival(clock, picking) # The next arrival and next pick time is set using the clock and picking values elif clock == next_pick: # If the value of clock is equals to the next pick value next_pick, next_dept = shopping(clock, picking, checkout) # It is calculated as the shopping using clock.picking and the picking elif clock == next_dept: #If the clock value is equals to the next departure then next_dept = departure(clock, checkout, total) # Departure is calculated as the clock,checkout and the total clock = update_clock(next_arr, next_pick, next_dept) # The valueof clock is updated using the next arrival time,next pick and next departure time print() # Calling the print fucntion print_stat(total) # Printing the stats using the the total main() # Calling the main function
09bc97e129edab7475876e7e0bad3fbe033c5dd3
GonzaloMonteodorisio/ejercicios-python-unsam
/Clase06/grafico_experimentos_promedios.py
921
3.609375
4
import matplotlib.pyplot as plt import numpy as np # from busqueda_secuencial import busqueda_secuencial_ from experimento_secuencial import generar_lista from experimento_secuencial_promedio import experimento_secuencial_promedio m = 10000 k = 1000 largos = np.arange(256) + 1 # estos son los largos de listas que voy a usar print(largos) comps_promedio = np.zeros(256) # aca guardo el promedio de comparaciones sobre una lista de largo i, para i entre 1 y 256. for i, n in enumerate(largos): lista = generar_lista(n, m) # genero lista de largo n comps_promedio[i] = experimento_secuencial_promedio(lista, m, k) print(comps_promedio) # ahora grafico largos de listas contra operaciones promedio de búsqueda. plt.plot(largos,comps_promedio,label = 'Búsqueda Secuencial') plt.xlabel("Largo de la lista") plt.ylabel("Cantidad de comparaciones") plt.title("Complejidad de la Búsqueda") plt.legend() plt.show()
5fa01229080654cea2ed627a01140b07154b183b
eduardosalomon/my-first-repo
/excercise.py
1,111
4.1875
4
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Created on Tue Oct 13 13:23:33 2020 @author: edu """ #n = input("Input number: " def is_even(n) : while n: if n % 2 == 0 : return True else: return False #%% def is_odd(n) : while n: if n % 2 == 1 : return True else: return False #%% Factorial def factorial(n): if n < 2: return 1 return n * factorial(n-1) n= int(input("Input interger: ")) print(factorial(n)) #%% Multiples def multiples(numbers, n): multi = [] for i in numbers: if i % n ==0: multi.append(i) return multi numbers= [1,2,3,4,5,6,7,8,9,10, 11,12,13,14,15,16,17,18,19,20, 21,22,23,24,25,26,27,28,29,30, 31,32,33,34,35,36,37,38,39,40, 41,42,43,44,45,46,47,48,49,50, 51,52,53,54,55,56,57,58,59,60, 61,62,63,64,65,66,67,68,69,70, 71,72,73,74,75,76,77,78,79,80, 81,82,83,84,85,86,87,88,89,90, 91,92,93,94,95,96,97,98,99,100]
7daeffdf98d493d10785473f485f2a0158123cbb
jpitman1010/Whiteboard
/HR-delete-a-node-from-a-linked-list.py
3,157
4.21875
4
# This challenge is part of a tutorial track by MyCodeSchool and is accompanied by a video lesson. # Delete the node at a given position in a linked list and return a reference to the head node. The head is at position 0. The list may be empty after you delete the node. In that case, return a null value. # Example # After removing the node at position , . # Function Description # Complete the deleteNode function in the editor below. # deleteNode has the following parameters: # - SinglyLinkedListNode pointer llist: a reference to the head node in the list # - int position: the position of the node to remove # Returns # - SinglyLinkedListNode pointer: a reference to the head of the modified list # Input Format # The first line of input contains an integer , the number of elements in the linked list. # Each of the next lines contains an integer, the node data values in order. # The last line contains an integer, , the position of the node to delete. # Constraints # , where is the element of the linked list. # Sample Input # 8 # 20 # 6 # 2 # 19 # 7 # 4 # 15 # 9 # 3 # Sample Output # 20 6 2 7 4 15 9 # Explanation # The original list is . After deleting the node at position , the list is . #!/bin/python3 import math import os import random import re import sys class SinglyLinkedListNode: def __init__(self, node_data): self.data = node_data self.next = None class SinglyLinkedList: def __init__(self): self.head = None self.tail = None def insert_node(self, node_data): node = SinglyLinkedListNode(node_data) if not self.head: self.head = node else: self.tail.next = node self.tail = node def print_singly_linked_list(node, sep, fptr): while node: fptr.write(str(node.data)) node = node.next if node: fptr.write(sep) # Complete the deleteNode function below. # # For your reference: # # SinglyLinkedListNode: # int data # SinglyLinkedListNode next # # def deleteNode(head, position): if position == 0: return head.next count = 1 prev = head current = head.next while count < position: prev = current current = current.next count += 1 prev.next = current.next prev=current current = current.next return head # Test Case 0: # Compiler Message # Success # Input (stdin) # Download # 8 # 20 # 6 # 2 # 19 # 7 # 4 # 15 # 9 # 3 # Expected Output # Download # 20 6 2 7 4 15 9 # Test Case 1: # Compiler Message # Success # Input (stdin) # Download # 4 # 11 # 9 # 2 # 9 # 1 # Expected Output # Download # 11 2 9 # Test Case 3-8 locked: # if __name__ == '__main__': # fptr = open(os.environ['OUTPUT_PATH'], 'w') # llist_count = int(input()) # llist = SinglyLinkedList() # for _ in range(llist_count): # llist_item = int(input()) # llist.insert_node(llist_item) # position = int(input()) # llist1 = deleteNode(llist.head, position) # print_singly_linked_list(llist1, ' ', fptr) # fptr.write('\n') # fptr.close()
27a6a582e21495da03010e3f11b0826e85ba16b9
l346wang/yelp-review-nlp
/playGround.py
222
3.6875
4
from nltk.corpus import stopwords stopWords = set(stopwords.words('english')) tokens = ['I', 'do', 'not', 'like', 'the', 'movie'] for w in tokens: print(w) if w not in stopWords and len(w) != 1: print(w)
31b9e3a89cac854c72ecf883e1ab6edda6a2358b
anna-s-dotcom/python_grundkurse_meineNotizen
/Tag03/listinlist.py
1,221
4.3125
4
# for i in range(3): # for j in range(5): # print(f"({i},{j})", end=" ") # print() inner=[0,1,2,3,4,5,] outer=[] for i in range(3): outer.append(inner) # print(outer) # # # for i in range(len(outer)): # print(outer[i]) # print() # # for i in outer: # print(i) # print() # print(outer) #alle schleifen geben untereinander alle elemente der listen aus outer=[[1,2,3], [4,5,6], [7,8,9]] # # for inner in outer: # for element in inner: # print(element) # print() # # #hier können den elementen der inneren Listen neue Werte zugewiesen werden # for inner in outer: # for i_inner in range(len(inner)): # print(inner[i_inner]) # print() # # #hier können den elementen der inneren Listen neuen Werte zugewiesen werden # for i_outer in range(len(outer)): # for i_inner in range(len(outer[i_outer])): # print(outer[i_outer][i_inner]) # print() # for i_outer in range(len(outer)): # for i_inner in range(len(outer[i_outer])): # print(outer[i_outer][i_inner], f"[{i_outer}], [{i_inner}]", end= " ,") # print() print(outer[0]) outer[0].append(78) print(outer[0]) print(outer)
07137db245532f40294510746df5eaa812c2f38d
wiput1999/PrePro60-Python
/Online/Week3/week3_earth_is_the_center2.py
2,024
4.03125
4
""" Earth is the center 2 """ def main(): """ Main function """ text = input() space = (20 - len(text))//2 print("|", " " * space, "%.20s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (50 - len(text))//2 print("|", " " * space, "%.50s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (40 - len(text))//2 print("|", " " * space, "%.40s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (30 - len(text))//2 print("|", " " * space, "%.30s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (22 - len(text))//2 print("|", " " * space, "%.22s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (14 - len(text))//2 print("|", " " * space, "%.14s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (20 - len(text))//2 print("|", " " * space, "%.20s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (42 - len(text))//2 print("|", " " * space, "%.42s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (60 - len(text))//2 print("|", " " * space, "%.60s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() space = (70 - len(text))//2 print("|", " " * space, "%.70s" %text, " " * space, "|", sep='') print("FOR DEBUG: Space = ", space, " Text Length = ", len(text), sep='') print() main()
e464fe1e1030cc679982e1c792b478b72c95ec5e
priyankarnd/Data-Pre-processing-Training
/Operations/concatenation.py
699
3.515625
4
import pandas as pd import numpy as np pd.set_option('display.max_rows', None) pd.set_option('display.max_columns', None) pd.set_option('display.width', None) pd.set_option('display.max_colwidth', None) # Data 1 df1 = pd.DataFrame([['a',1],['b',2]], columns = ['letter', 'number']) print(df1) # Data 2 df2 = pd.DataFrame([['c',3],['d',4]], columns = ['letter', 'number']) print(df2) # Concatenation print(pd.concat([df1, df2])) # Data 3 df3 = pd.DataFrame([['c', 3, 'cat'],['d', 4, 'dog']], columns = ['letter', 'number', 'animal']) print(df3) # Concatenation print(pd.concat([df1, df3])) #only columns common for both data frames are joined togther print(pd.concat([df1, df3], join="inner"))
7ac2ad4f0430d014665274752085884182fd05de
nitin-nizhawan/incubator
/prjs/prog/prblm/projecteuler/Prob120.py
609
3.5625
4
#!/usr/bin/python def rmax(n): retVal=[2,2] n2=n*n # for i in range (1,n,2): we should check only odd number and deliberately skip even one as for them rem is always 2, euler gives error if even numbers are not included, do not why it is so, i have sent a mail to one of the members for this for i in range (1,n): newRem=(2*i*n)%n2 if retVal[0]<newRem: retVal=[newRem,i] return retVal rmaxsum=0; for i in range(3,1001): rmaxval=rmax(i) print "a=%d ,rmax=%d , n=%d" % (i,rmaxval[0],rmaxval[1]) rmaxsum+=rmaxval[0] if rmaxval[1]%2==0: print "-----------------------------------" print rmaxsum
dfa19935cc3d6a34025ddcc2b8603da45ccb9d12
richnakasato/ctci-py
/3.4.queue_via_stacks.0.py
844
3.75
4
import random class QueueStacks(): def __init__(self): self.left = list() self.right = list() def __len__(self): return len(self.left) + len(self.right) def push(self, data): self.left.append(data) def _left_to_right(self): while len(self.left) > 0: self.right.append(self.left.pop()) def pop(self): if self.is_empty(): raise Exception('empty!') if len(self.right) == 0: self._left_to_right() return self.right.pop() def top(self): if self.is_empty(): raise Exception('empty!') if len(self.right) == 0: self._left_to_right() return self.right[-1] def is_empty(self): return len(self) == 0 def main(): pass if __name__ == "__main__": main()
652de0279fdba567b7211acab0a9b06860fbea7e
YaoYuBJTU/ADMM_Python
/ADMM_for_Solomon_and_Jingdong_Refactoring/ADMM Solomon C101.100/C101_100_ADMM.py
27,273
3.578125
4
import csv import time import copy import pandas as pd import matplotlib.pyplot as plt class Node: """ class name: Node represents physical nodes in the vehicle routing system including the origin node (depot, type=1), the destination node (depot, type=1), and the customers (type=2) """ def __init__(self): """ attributes of the Node object """ self.node_id = 0 self.x = 0.0 self.y = 0.0 self.type = 0 self.outgoing_node_id_list = [] self.outgoing_node_size = 0 self.outgoing_link_obj_list = [] self.demand = 0.0 self.activity_beginning_time = 0 self.activity_ending_time = 0 self.service_time = 0 self.base_profit_for_admm = 0 self.base_profit_for_lr = 0 class Link: """ class name: Link represents the physical links in the vehicle routing system the nodes incident to a link can be any physical node, including customers, origin depot, and destination depot """ def __init__(self): """ attributes of the Link object """ self.link_id = 0 self.from_node_id = 0 self.to_node_id = 0 # Q: how to compute the distance of a link? # A: ((customer1['x_coord'] - customer2['x_coord']) ** 2 + (customer1['y_coord'] - customer2['y_coord']) ** 2) ** 0.5 self.distance = 0.0 self.spend_tm = 1.0 class Agent: """ class name: Agent An Agent object represents a vehicle, which is a decision maker to carry out the logistics transportation missions """ def __init__(self): """ attributes of the Agent object """ self.agent_id = 0 self.from_node_id = 0 self.to_node_id = 0 self.departure_time_beginning = 0 self.arrival_time_ending = 0 self.capacity = 0 class VSState: """ class Name: VSState class for Vehicle Scheduling State member functions: __init__(): generate an VSState object my_copy(): given a VSState object, we can load the information from that VSState object through this function calculate_label_cost: calculate the label cost of the VSState object, it is used for label updating, objective function computation, and bound value finding generate_string_key: generate the string key of the VSState object """ def __init__(self): self.current_node_id = 0 self.m_visit_node_sequence = [] self.m_visit_time_sequence = [] self.m_used_vehicle_capacity = 0 self.passenger_service_state = [0] * g_number_of_nodes self.passenger_vehicle_visit_allowed_flag = [1] * g_number_of_nodes self.label_cost_for_admm = 0 self.label_cost_for_lr = 0 self.primal_label_cost = 0 self.total_travel_cost = 0 self.total_waiting_cost = 0 self.total_fixed_cost = 0 def my_copy(self, current_element): self.current_node_id = current_element.current_node_id self.m_visit_node_sequence = copy.copy(current_element.m_visit_node_sequence) self.m_visit_time_sequence = copy.copy(current_element.m_visit_time_sequence) self.m_used_vehicle_capacity = current_element.m_used_vehicle_capacity self.passenger_service_state = copy.copy(current_element.passenger_service_state) self.passenger_vehicle_visit_allowed_flag = copy.copy(current_element.passenger_vehicle_visit_allowed_flag) self.label_cost_for_admm = current_element.label_cost_for_admm self.label_cost_for_lr = current_element.label_cost_for_lr self.primal_label_cost = current_element.primal_label_cost # primal label cost is USED to compute the objective function value to the PRIMAL problem (namely, the upper bound value) self.total_travel_cost = current_element.total_travel_cost self.total_waiting_cost = current_element.total_waiting_cost self.total_fixed_cost = current_element.total_fixed_cost def calculate_label_cost(self): # fixed cost if from_node_id == 0 and to_node_id != g_number_of_nodes - 1: self.label_cost_for_admm += fixed_cost self.label_cost_for_lr += fixed_cost self.primal_label_cost += fixed_cost self.total_fixed_cost += fixed_cost # transportation cost self.label_cost_for_admm = self.label_cost_for_admm - g_node_list[to_node_id].base_profit_for_admm + link_obj.distance self.label_cost_for_lr = self.label_cost_for_lr - g_node_list[to_node_id].base_profit_for_lr + link_obj.distance self.primal_label_cost = self.primal_label_cost + link_obj.distance self.total_travel_cost = self.total_travel_cost + link_obj.distance # waiting cost if from_node_id != 0 and waiting_cost_flag == 1: self.label_cost_for_admm += (g_node_list[to_node_id].activity_beginning_time - next_time) * waiting_arc_cost self.label_cost_for_lr += (g_node_list[to_node_id].activity_beginning_time - next_time) * waiting_arc_cost self.primal_label_cost += (g_node_list[to_node_id].activity_beginning_time - next_time) * waiting_arc_cost self.total_waiting_cost += (g_node_list[to_node_id].activity_beginning_time - next_time) * waiting_arc_cost def generate_string_key(self): return self.current_node_id class TimeIndexedStateVector: """ class Name: TimeIndexedStateVector vector recording states at different time instants VSState objects will be stored in the member variables of this class """ def __init__(self): self.current_time = 0 self.m_VSStateVector = [] self.m_state_map = [] def m_find_state_index(self, string_key): if string_key in self.m_state_map: return self.m_state_map.index(string_key) else: return -1 def update_state(self, new_element, ul_flag): string_key = new_element.generate_string_key() # obtain the "string_key" of VSState object "new_element" state_index = self.m_find_state_index(string_key) # try to find the location of the "string_key" within "m_state_map" object if state_index == -1: self.m_VSStateVector.append(new_element) # just add the VSState object "new_element" into "m_VSStateVector" self.m_state_map.append(string_key) # add the "string_key" into "m_state_map" else: # (state_index != -1) if ul_flag == 0: # ADMM if new_element.label_cost_for_admm < self.m_VSStateVector[state_index].label_cost_for_admm: self.m_VSStateVector[state_index] = new_element else: # LR if new_element.label_cost_for_lr < self.m_VSStateVector[state_index].label_cost_for_lr: self.m_VSStateVector[state_index] = new_element def sort(self, ul_flag): if ul_flag == 0: # ADMM self.m_VSStateVector = sorted(self.m_VSStateVector, key=lambda x: x.label_cost_for_admm) self.m_state_map = [e.generate_string_key() for e in self.m_VSStateVector] else: # LR self.m_VSStateVector = sorted(self.m_VSStateVector, key=lambda x: x.label_cost_for_lr) self.m_state_map = [e.generate_string_key() for e in self.m_VSStateVector] def get_best_value(self): if len(self.m_VSStateVector) >= 1: return [self.m_VSStateVector[0].label_cost_for_admm, self.m_VSStateVector[0].label_cost_for_lr, self.m_VSStateVector[0].primal_label_cost] def read_input_data(): # global variables global g_number_of_nodes global g_number_of_customers global g_number_of_links global g_number_of_agents global g_number_of_time_intervals # step 1: read information of NODEs # step 1.1: establish origin depot node = Node() node.node_id = 0 node.type = 1 node.x = 40.0 node.y = 50.0 node.activity_beginning_time = 0 node.activity_ending_time = g_number_of_time_intervals g_node_list.append(node) g_number_of_nodes += 1 # step 1.2: establish customers with open(r"./input/input_node.csv", "r") as fp: print('Read input_node.csv') reader = csv.DictReader(fp) for line in reader: node = Node() node.node_id = int(line['NO.']) node.type = 2 node.x = float(line['XCOORD.']) node.y = float(line['YCOORD.']) node.demand = float(line['DEMAND']) node.activity_beginning_time = int(line['READYTIME']) node.activity_ending_time = int(line['DUEDATE']) node.service_time = int(line['SERVICETIME']) g_node_list.append(node) g_number_of_nodes += 1 g_number_of_customers += 1 print(f'The number of customers is {g_number_of_customers}') # step 1.3: establish destination depot node = Node() node.node_id = g_number_of_nodes node.type = 1 node.x = 40.0 node.y = 50.0 node.activity_beginning_time = 0 node.activity_ending_time = g_number_of_time_intervals g_node_list.append(node) g_number_of_nodes += 1 print(f'the number of nodes is {g_number_of_nodes}') # step 2: read information of LINKs with open(r"./input/input_link.csv", "r") as fp: print('Read input_link.csv') reader = csv.DictReader(fp) for line in reader: link = Link() link.link_id = int(line['ID']) link.from_node_id = int(line['from_node']) link.to_node_id = int(line['to_node']) link.distance = float(line['distance']) link.spend_tm = int(line['spend_tm']) # establish the correlation with nodes and links g_node_list[link.from_node_id].outgoing_node_id_list.append(link.to_node_id) # add the ID of the tail Node object into the "outbound_node_list" of the head Node object g_node_list[link.from_node_id].outgoing_node_size = len(g_node_list[link.from_node_id].outgoing_node_id_list) # update the "outbound_node_size" of the head Node object g_node_list[link.from_node_id].outgoing_link_obj_list.append(link) # add the Link object into the "outbound_link_list" of the head node of the Link instance g_link_list.append(link) g_number_of_links += 1 print(f'The number of links is {g_number_of_links}') # step 3: read information of AGENTs for i in range(g_number_of_agents): agent = Agent() agent.agent_id = i agent.from_node_id = 0 agent.to_node_id = g_number_of_nodes - 1 agent.departure_time_beginning = 0 agent.arrival_time_ending = g_number_of_time_intervals agent.capacity = 200 g_agent_list.append(agent) print(f'The number of agents is {g_number_of_agents}') def g_time_dependent_dynamic_programming(vehicle_id, origin_node, departure_time_beginning, destination_node, arrival_time_ending, beam_width, ul_flag): # :param ULFlag: 0 or 1, controls whether the dynamic programming is for ADMM algorithm or the pure Lagrangian relaxation # 0: ADMM (Upper Bound) ; 1: LR (Lower Bound) # global variables global g_ending_state_vector global waiting_cost_flag # 0: no need to wait; 1: need to wait global link_obj global from_node_id global to_node_id global next_time g_time_dependent_state_vector = [None] * (arrival_time_ending - departure_time_beginning + 1) if arrival_time_ending > g_number_of_time_intervals or g_node_list[origin_node].outgoing_node_size == 0: return MAX_LABEL_COST for t in range(departure_time_beginning, arrival_time_ending + 1): g_time_dependent_state_vector[t] = TimeIndexedStateVector() g_time_dependent_state_vector[t].current_time = t g_ending_state_vector[vehicle_id] = TimeIndexedStateVector() # origin node element = VSState() element.current_node_id = origin_node g_time_dependent_state_vector[departure_time_beginning].update_state(element, ul_flag) # start dynamic programming for t in range(departure_time_beginning, arrival_time_ending): g_time_dependent_state_vector[t].sort(ul_flag) for w in range(min(beam_width, len(g_time_dependent_state_vector[t].m_VSStateVector))): current_element = g_time_dependent_state_vector[t].m_VSStateVector[w] from_node_id = current_element.current_node_id from_node = g_node_list[from_node_id] for i in range(from_node.outgoing_node_size): to_node_id = from_node.outgoing_node_id_list[i] to_node = g_node_list[to_node_id] link_obj = from_node.outgoing_link_obj_list[i] next_time = t + link_obj.spend_tm # case i: to_node is the destination depot if to_node_id == destination_node: waiting_cost_flag = 0 # no need to wait new_element = VSState() new_element.my_copy(current_element) new_element.m_visit_node_sequence.append(to_node_id) new_element.m_visit_time_sequence.append(next_time) new_element.m_visit_node_sequence.append(to_node_id) new_element.m_visit_time_sequence.append(arrival_time_ending) new_element.calculate_label_cost() g_ending_state_vector[vehicle_id].update_state(new_element, ul_flag) continue # case ii: to_node is the origin depot if to_node_id == origin_node: continue # case iii: to_node is a customer if current_element.passenger_vehicle_visit_allowed_flag[to_node_id] == 0: # has been visited, no allow continue else: # current_element.passenger_vehicle_visit_allowed_flag[to_node_id] == 1 # time window constraint if next_time > to_node.activity_ending_time: continue if next_time + to_node.service_time > arrival_time_ending: continue # capacity constraint if current_element.m_used_vehicle_capacity + to_node.demand > g_agent_list[vehicle_id].capacity: continue # check whether it is needed to wait if next_time < to_node.activity_beginning_time: # need to wait waiting_cost_flag = 1 new_element = VSState() new_element.my_copy(current_element) new_element.current_node_id = to_node_id new_element.passenger_service_state[to_node_id] = 1 # change the entry of "passenger_service_state" to note that the "to_node" has been visited new_element.passenger_vehicle_visit_allowed_flag[to_node_id] = 0 # change the corresponding flag of "passenger_vehicle_visit_allowed_flag" to note that the vehicle "vehicle_id" can not visit this "to_node" again new_element.m_visit_node_sequence.append(to_node_id) new_element.m_visit_time_sequence.append(next_time) new_element.m_used_vehicle_capacity += to_node.demand new_element.m_visit_node_sequence.append(to_node_id) new_element.m_visit_time_sequence.append(to_node.activity_beginning_time) new_element.calculate_label_cost() new_element.m_visit_node_sequence.append(to_node_id) new_element.m_visit_time_sequence.append(to_node.activity_beginning_time + to_node.service_time) g_time_dependent_state_vector[to_node.activity_beginning_time + to_node.service_time].update_state(new_element, ul_flag) continue else: # do NOT need to wait waiting_cost_flag = 0 new_element = VSState() new_element.my_copy(current_element) new_element.current_node_id = to_node_id new_element.passenger_service_state[to_node_id] = 1 # change the entry of "passenger_service_state" to note that the "to_node" has been visited new_element.passenger_vehicle_visit_allowed_flag[to_node_id] = 0 # change the corresponding flag of "passenger_vehicle_visit_allowed_flag" to note that the vehicle "vehicle_id" can not visit this "to_node" again new_element.m_visit_node_sequence.append(to_node_id) new_element.m_visit_time_sequence.append(next_time) new_element.m_used_vehicle_capacity += to_node.demand new_element.calculate_label_cost() new_element.m_visit_node_sequence.append(to_node_id) new_element.m_visit_time_sequence.append(next_time + to_node.service_time) g_time_dependent_state_vector[next_time + to_node.service_time].update_state(new_element, ul_flag) continue g_ending_state_vector[vehicle_id].sort(ul_flag) return g_ending_state_vector[vehicle_id].get_best_value() def g_alternating_direction_method_of_multipliers(): # global variables global admm_local_lower_bound global admm_local_upper_bound global admm_global_lower_bound global admm_global_upper_bound global glo_lb global glo_ub global beam_width global path_node_seq global path_time_seq global g_number_of_admm_iterations global g_number_of_agents global g_number_of_nodes global service_times global repeat_served global un_served global record_profit global rho path_node_seq = [] path_time_seq = [] service_times = [] repeat_served = [] un_served = [] record_profit = [] global_upper_bound = MAX_LABEL_COST global_lower_bound = -MAX_LABEL_COST for i in range(g_number_of_admm_iterations): print(f"=== Iteration number for the ADMM: {i} ===") number_of_used_vehicles = 0 path_node_seq.append([]) path_time_seq.append([]) service_times.append([0] * g_number_of_nodes) repeat_served.append([]) un_served.append([]) record_profit.append([0] * g_number_of_nodes) if i > 0: service_times[i] = service_times[i - 1] for v in range(g_number_of_agents - 1): print(f"Dynamic programming for vehicle: {v}") # prepare mu^v_p if g_ending_state_vector[v] != None: for n in range(1, g_number_of_customers + 1): service_times[i][n] -= g_ending_state_vector[v].m_VSStateVector[0].passenger_service_state[n] for n in range(1, g_number_of_customers + 1): g_node_list[n].base_profit_for_admm = g_node_list[n].base_profit_for_lr + (1 - 2 * service_times[i][n]) * rho / 2.0 vehicle = g_agent_list[v] g_time_dependent_dynamic_programming(v, vehicle.from_node_id, vehicle.departure_time_beginning, vehicle.to_node_id, vehicle.arrival_time_ending, beam_width, 0) admm_local_upper_bound[i] += g_ending_state_vector[v].m_VSStateVector[0].primal_label_cost path_node_seq[i].append(g_ending_state_vector[v].m_VSStateVector[0].m_visit_node_sequence) path_time_seq[i].append(g_ending_state_vector[v].m_VSStateVector[0].m_visit_time_sequence) for n in range(1, g_number_of_customers + 1): service_times[i][n] += g_ending_state_vector[v].m_VSStateVector[0].passenger_service_state[n] if len(path_node_seq[i][v]) != 2: number_of_used_vehicles += 1 for n in range(1, g_number_of_customers + 1): if service_times[i][n] > 1: repeat_served[i].append(n) if service_times[i][n] == 0: un_served[i].append(n) admm_local_upper_bound[i] += 50 # number_of_used_vehicles += 1 record_profit[i].append(g_node_list[n].base_profit_for_lr) print(f"Number of used vehicles: {number_of_used_vehicles}") vehicle = g_agent_list[-1] g_time_dependent_dynamic_programming(vehicle.agent_id, vehicle.from_node_id, vehicle.departure_time_beginning, vehicle.to_node_id, vehicle.arrival_time_ending, beam_width, 1) admm_local_lower_bound[i] += g_number_of_agents * g_ending_state_vector[g_number_of_agents - 1].m_VSStateVector[0].label_cost_for_lr for n in range(1, g_number_of_customers + 1): admm_local_lower_bound[i] += g_node_list[n].base_profit_for_lr g_node_list[n].base_profit_for_lr += (1 - service_times[i][n]) * rho if glo_ub > admm_local_upper_bound[i]: glo_ub = admm_local_upper_bound[i] admm_global_upper_bound[i] = glo_ub if glo_lb < admm_local_lower_bound[i]: glo_lb = admm_local_lower_bound[i] admm_global_lower_bound[i] = glo_lb def output_data(): # output path finding result f = open("./output/output_path.csv", "w") f.write("iteration,vehicle_id,path_node_seq,path_time_seq,\n") for i in range(g_number_of_admm_iterations): for v in range(g_number_of_agents - 1): f.write(str(i) + ",") # iteration number of admm: "i" f.write(str(v) + ",") # ID of the vehicle: "v" str1 = "" # string which records the sequence of nodes in the path str2 = "" # string which records the sequence of time instants in the path for s in range(len(path_node_seq[i][v])): str1 = str1 + str(path_node_seq[i][v][s]) + "_" str2 = str2 + str(path_time_seq[i][v][s]) + "_" f.write(str1 + "," + str2 + ",\n") f.close() # output the Lagrangian multipliers f = open("./output/output_profit.csv", "w") f.write("iteration,") for n in range(1, g_number_of_customers + 1): f.write(str(n) + ",") f.write("\n") for i in range(g_number_of_admm_iterations): f.write(str(i) + ",") for n in range(g_number_of_customers): f.write(str(record_profit[i][n]) + ",") f.write("\n") f.close() # output the gap information f = open("./output/output_gap.csv", "w") f.write("iteration,local_lower_bound,local_upper_bound,global_lower_bound,global_upper_bound,repeated_services,missed_services,\n") for i in range(g_number_of_admm_iterations): f.write(str(i) + ",") # write the current iteration number f.write(str(admm_local_lower_bound[i]) + ",") # write the local lower bound value for the current iteration f.write(str(admm_local_upper_bound[i]) + ",") # write the local upper bound value for the current iteration f.write(str(admm_global_lower_bound[i]) + ",") # write the global upper bound value for the current iteration f.write(str(admm_global_upper_bound[i]) + ",") # write the global upper bound value for the current iteration for j in repeat_served[i]: f.write(str(j) + "; ") f.write(",") for k in un_served[i]: f.write(str(k) + "; ") f.write(",\n") f.close() # plot gap_df = pd.read_csv("./output/output_gap.csv") iter_list = list(gap_df['iteration']) glo_LB_list = list(gap_df['global_lower_bound']) glo_UB_list = list(gap_df['global_upper_bound']) loc_LB_list = list(gap_df['local_lower_bound']) loc_UB_list = list(gap_df['local_upper_bound']) plt.rcParams['savefig.dpi'] = 300 plt.rcParams['figure.dpi'] = 300 plt.figure() plt.plot(iter_list, glo_LB_list, color='orange', linestyle='--') plt.plot(iter_list, glo_UB_list, color="red") plt.xlabel('Number of iterations', fontname="Times New Roman") plt.ylabel('Objective value', fontname="Times New Roman") plt.legend(labels=['Global lower bound', 'Global upper bound'], loc='best', prop={'family': 'Times New Roman'}) plt.savefig("./output/fig_global_gap.svg") plt.show() plt.figure() plt.plot(iter_list, loc_LB_list, color='orange', linestyle='--') plt.plot(iter_list, loc_UB_list, color="red") plt.xlabel('Number of iterations', fontname="Times New Roman") plt.ylabel('Objective value', fontname="Times New Roman") plt.legend(labels=['Local lower bound', 'Local upper bound'], loc='best', prop={'family': 'Times New Roman'}) plt.savefig("./output/fig_local_gap.svg") plt.show() # plot the path finding result (spatial) plt.figure() for v in range(g_number_of_agents - 1): x_coord = [40] y_coord = [50] for s in range(len(path_node_seq[g_number_of_admm_iterations - 1][v])): # obtain the Node object node_ID = path_node_seq[-1][v][s] x_coord.append(g_node_list[node_ID].x) y_coord.append(g_node_list[node_ID].y) x_coord.append(40) y_coord.append(50) plt.plot(x_coord, y_coord, linewidth=0.5) # plot the planar illustration plt.scatter(40, 50, marker='^') x_coord = [] y_coord = [] for n in g_node_list[1:-1]: x_coord.append(n.x) y_coord.append(n.y) plt.xlabel("Longitude", fontname="Times New Roman") plt.ylabel("Latitude", fontname="Times New Roman") plt.scatter(x_coord, y_coord) plt.savefig("./output/fig_path.svg") plt.show() if __name__ == "__main__": fixed_cost = 0 waiting_arc_cost = 0 g_number_of_nodes = 0 g_number_of_customers = 0 g_number_of_links = 0 g_number_of_agents = 11 # this value is 11, the best-known solution utilizes 10 vehicles # 10 agents are used to compute the upper bound (Admm) , 1 agent is used to compute the lower bound (LR) g_number_of_time_intervals = 1236 g_number_of_admm_iterations = 16 MAX_LABEL_COST = 99999 beam_width = 100 rho = 1 g_node_list = [] g_link_list = [] g_agent_list = [] admm_local_lower_bound = [0] * g_number_of_admm_iterations # lower bound value of each iteration in the ADMM algorithm admm_local_upper_bound = [0] * g_number_of_admm_iterations # upper bound value of each iteration in the ADMM algorithm admm_global_lower_bound = [0] * g_number_of_admm_iterations # lower bound value of each iteration in the ADMM algorithm admm_global_upper_bound = [0] * g_number_of_admm_iterations # upper bound value of each iteration in the ADMM algorithm glo_lb = -99999 glo_ub = 99999 g_ending_state_vector = [None] * g_number_of_agents print("Reading data......") read_input_data() time_start = time.time() g_alternating_direction_method_of_multipliers() print(f'Processing time of ADMM: {time.time() - time_start: .2f} s') output_data()
d3770b89d5391c360d24be0f96a83903009c3ffe
TerrisGO/computation-of-flow-oscillation-in-pipes
/Designs/general/numerical_method.py
17,172
3.671875
4
# -*- coding: utf-8 -*- import matplotlib.pyplot as plt from Designs.general import friction_factor from prettytable import PrettyTable """This module is built to solve a differential equation of the form: d^2(z)/dt^2 + a * |dz/dt| * (dz/dt) + b*z = 0. where a = f/2D b = 2g/L if there are two reservoirs a = fk/2D where k = Le/L b = (gA/L)*((1/A1)+(1/A2)) where A = area of pipe A1 = area of first reservoir A2 = area of second reservoir reducing this 2nd order ODE to a system of 1st order ODE: we have: dz/dt = f(t, z, V) = V d^2(z)/dt^2 = dV/dt = g(t, z, V) = - a*|V|*V - b*z """ class NumericalMethod(object): # Assign given values of all numerical methods def __init__(self, D, L, v, e, g=9.81): """where v is the kinematic viscosity; unit in m^2/s. D is the diameter of pipe; unit in meters. L is the length of the pipe; unit in meters. e is the roughness height; unit in m. g is the acceleration due to gravity, 9.81m/s^2. A1 is the area of first reservoir A2 is the area of second reservoir D1 is the diameter of first reservoir D2 is the diameter of second reservoir f is the friction factor """ self.D = D self.L = L self.v = v self.e = e self.g = g self.b = (2*self.g)/self.L self.A1 = None # no reservoir 1 self.A2 = None # no reservoir 2 self.D1 = None self.D2 = None self.length_minor_losses = None self.Le = L self.f = None # self.pipe_label = "Pipe" self.reservoir_1_label = "Reservoir 1" self.reservoir_2_label = "Reservoir 2" self.exact_label = "Exact" self.trapezoidal_label = "Trapezoidal" self.runge_kutta_label = "Runge-Kutta" self.bashforth_label = "Adams Bashforth" self.moulton_label = "Adams Moulton" self.results = {} def set_initial_conditions(self, t0, z0, dzdt, h, t): """where t0 is the initial curr_time; unit in secs. z0 is the initial head of fluid at t0; unit in m. dzdt is the initial velocity at t0; unit in m/s. h is the curr_time step; unit in secs. t is the final curr_time; unit in secs. """ self.t0 = t0 self.z0 = z0 self.t = t self.h = h if h!=0 else 1 self.V0 = dzdt def set_reservoir_param(self, D1, D2, length_minor_losses, f=None): from math import pi A1 = (pi * (D1**2)) / 4.0 # Cross sectional area of a circular shape self.A1 = A1 A2 = (pi * (D2**2)) / 4.0 # Cross sectional area of a circular shape self.A2 = A2 A = (pi * (self.D**2)) / 4.0 # Cross sectional area of a circular shape self.A = A self.length_minor_losses = length_minor_losses Le = self.L + self.length_minor_losses # To get equivalent loss in pipe lenght self.Le = Le self.f = f # Formula for coefficient b when we have two reservoirs. self.b = ( (self.g * self.A) / self.L ) * ( (1/self.A1) + (1/self.A2) ) def interpolate(self, boundary_1, boundary_2, param_2): """Assumes boundary_1 is a list of two Real numbers boundary_2 is a list of two Real numbers param_2_middle is a Real numbers. Returns: a Real number that correspond to param_2_middle, which is the interpolation of boundary_1 and boundary_2 """ lower, upper = 0, 1 lower_1, upper_1 = boundary_1[lower], boundary_1[upper] lower_2, upper_2 = boundary_2[lower], boundary_2[upper] param_1 = (((param_2 - lower_2)*(upper_1 - lower_1))/(upper_2 - lower_2)) + lower_1 return param_1 def getF(self, V): # Returns a dictionary that contains friction factor and Reynolds number. ff = friction_factor.FrictionFactor(V, self.v, self.e, self.D) return ff.getF_and_R() # This represent dz/dt = V; where V is the velocity. def fn(self, t, z, V): return V # This control the value of 'a' in the 2nd order ODE def get_k(self): return self.Le / self.L # Please don't use 'g' variable for the function name because 'g' # has been used for the acceleration due to gravity; g = 9.81. # This represent d^2(z)/dt^2 = dv/dt = - a|V|V - bz; where V is the velocity def gn1(self, t, z, V): # function to get friction factor and Reynold's number given a velocity. # note that new friction factor is computed for each call of this # function ff = self.getF(V) if self.f == None else {"f": self.f, "R": None} f = ff["f"] # get friction factor R = ff["R"] # get Reynold's number k = self.get_k() a = (f*k)/(2*self.D) # k would be 1 if there is no reservoir since Le == L. # which would reduce a to a = f/2D return -(a * V*abs(V)) - (self.b * z) def k(self, t, z, V): return self.fn(t, z, V) def m(self, t, z, V): return self.gn1(t, z, V) # Runge-Kutta constant computation for 2nd order def runge_kutta_4th(self, tn, zn, Vn): if (not self.A1) or (not self.A2): ff = self.getF(Vn) f = ff["f"] # get friction factor R = ff["R"] # get Reynold's number self.results[tn] = (tn, zn, Vn, f, R) # track all the required values h = self.h k1 = h * self.k(tn, zn, Vn) m1 = h * self.m(tn, zn, Vn) k2 = h * self.k(tn + h/2.0, zn + k1/2.0, Vn + m1/2.0) m2 = h * self.m(tn + h/2.0, zn + k1/2.0, Vn + m1/2.0) k3 = h * self.k(tn + h/2.0, zn + k2/2.0, Vn + m2/2.0) m3 = h * self.m(tn + h/2.0, zn + k2/2.0, Vn + m2/2.0) k4 = h * self.k(tn + h, zn + k3, Vn + m3) m4 = h * self.m(tn + h, zn + k3, Vn + m3) zn = zn + (1/6.0) * (k1 + 2*k2 + 2*k3 + k4) Vn = Vn + (1/6.0) * (m1 + 2*m2 + 2*m3 + m4) return (zn, Vn) def get_turning_point(self, index, elem_dict): """Assumes index: an int elem_dict: a dictionary, where the key is an integer and value is a tuple of (time, head). Turning point definition: A number is a turning point if 1. its absolute value is greater than or less than both absolute value of previous number and the next number 2. and all three element are of the same sign. """ is_turning_point = False head_index = 1 time_index = 0 curr_head = elem_dict[index][head_index] curr_time = elem_dict[index][time_index] prev_index = index - 1 next_index = index + 1 # If element is at the start of the dictionary, # just check if the next element is a turning point neighbour. # See doc string for turning point definition. if index == 0: next_head = elem_dict[next_index][head_index] if abs(curr_head) >= abs(next_head): if curr_head < 0 and next_head < 0: is_turning_point = True if curr_head > 0 and next_head > 0: is_turning_point = True # If element is at the end of the dictionary, # just check if the previous element is a turning point neighbour. # See doc string for turning point definition. elif index == (len(elem_dict) - 1): prev_head = elem_dict[prev_index][head_index] if abs(curr_head) >= abs(prev_head): if curr_head < 0 and prev_head < 0: is_turning_point = True if curr_head > 0 and prev_head > 0: is_turning_point = True # Check if the both the previous and next element are turning point # neighbour. # See doc string for turning point definition. else: prev_head = elem_dict[prev_index][head_index] next_head = elem_dict[next_index][head_index] if abs(curr_head) > abs(prev_head) and abs(curr_head) > abs(next_head): # all element have to have the same sign to be a turning point if curr_head < 0 and prev_head < 0 and next_head < 0: is_turning_point = True if curr_head > 0 and prev_head > 0 and next_head > 0: is_turning_point = True if abs(curr_head) < abs(prev_head) and abs(curr_head) < abs(next_head): if curr_head < 0 and prev_head < 0 and next_head < 0: is_turning_point = True if curr_head > 0 and prev_head > 0 and next_head > 0: is_turning_point = True if is_turning_point: return (curr_time, curr_head) def get_all_turning_points_for_pipe_reservoir1_reservoir2(self, elems_dict): '''Assumes elems_dict is a dictionary that contains: key: a string (Pipe, Reservoir 1 or Reservoir 2) values: dictionary: key: an integer value: tuple of (time, head). ''' pipe_turning_points = {} reservoir_1_turning_points = {} reservoir_2_turning_points = {} # we must have at least 3 element to get a turning point first_dict = elems_dict[self.pipe_label] if len(first_dict) > 2: pipe_dict = elems_dict[self.pipe_label] reservoir_1_dict = elems_dict[self.reservoir_1_label] reservoir_2_dict = elems_dict[self.reservoir_2_label] for index in range(len(first_dict)): pipe_turning_point = self.get_turning_point(index, pipe_dict) if pipe_turning_point != None: pipe_turning_points[index] = pipe_turning_point reservoir_1_turning_point = self.get_turning_point(index, reservoir_1_dict) if reservoir_1_turning_point != None: reservoir_1_turning_points[index] = reservoir_1_turning_point reservoir_2_turning_point = self.get_turning_point(index, reservoir_2_dict) if reservoir_2_turning_point != None: reservoir_2_turning_points[index] = reservoir_2_turning_point # return turnining points for the pipe and the two reservoirs return {self.pipe_label: pipe_turning_points, self.reservoir_1_label: reservoir_1_turning_points, self.reservoir_2_label: reservoir_2_turning_points } def get_all_turning_points_for_pipe(self, elem_dict): '''Assumes elems_dict is a dictionary that contains: key: a string (Pipe, Reservoir 1 or Reservoir 2) value: dictionary: key: an integer value: tuple of (time, head). ''' pipe_dict = elem_dict[self.pipe_label] pipe_turning_points = {} # we must have at least 3 element to get a turning point if len(pipe_dict) > 2: for index in range(len(pipe_dict)): turning_point = self.get_turning_point(index, pipe_dict) if turning_point != None: pipe_turning_points[index] = turning_point return {self.pipe_label: pipe_turning_points} def plot_single_graph(self, fig="", _title="", t_label="", z_label="", t_vals=[], z_vals=[], _label="", color_plus_lineType=['r--', 'b--'], line_thickness=1.0): plt.figure(fig) plt.clf() plt.xlabel(t_label) plt.ylabel(z_label) plt.plot(t_vals, z_vals, color_plus_lineType[0], label = _label, linewidth = line_thickness) plt.legend(loc = 'upper right') plt.title(_title) plt.show() def plot_single(self, method_vals, _type, method_label="Numerical"): tvals = [] surge_vals = [] time, head = 0, 1 surge_dict = method_vals[_type] for key in ((surge_dict)): tvals.append(surge_dict[key][time]) surge_vals.append(surge_dict[key][head]) self.plot_single_graph(fig=f"{method_label} method ({_type})", _title=f"Graph of {_type} head Vs. Time", t_label="time, t", z_label="head, z", t_vals=tvals, z_vals=surge_vals, _label=f"{_type} (viscosity: {self.v})", color_plus_lineType=['b--', 'r--']) def plot_multiple_graphs(self, fig="", _title="", t_label="", z_label="", t_vals=[], z_vals=[], labels=(), color_plus_lineType=['b--', 'g^', 'ro'], line_thickness=.5): plt.figure(fig) plt.clf() plt.xlabel(t_label) plt.ylabel(z_label) y0, y1, y2 = 0, 1, 2 plt.plot(t_vals, z_vals[y0], color_plus_lineType[y0], label = labels[y0], linewidth = line_thickness) plt.plot(t_vals, z_vals[y1], color_plus_lineType[y1], label = labels[y1], linewidth = line_thickness) plt.plot(t_vals, z_vals[y2], color_plus_lineType[y2], label = labels[y2], linewidth = line_thickness) plt.legend(loc = 'upper right') plt.title(_title) plt.show() def plot_multiple(self, method_vals, _type, method_label="Numerical"): '''Assumes _type: string method_vals is a dictionary that contains: key: a string (Pipe, Reservoir 1 or Reservoir 2) value: dictionary; key: an integer value: tuple of (time, head). ''' tvals = [] pipe_vals, reservoir_1_vals, reservoir_2_vals = [], [], [] time, head = 0, 1 pipe_dict = method_vals[self.pipe_label] reservoir_1_dict = method_vals[self.reservoir_1_label] reservoir_2_dict = method_vals[self.reservoir_2_label] for key in ((pipe_dict)): tvals.append(pipe_dict[key][time]) pipe_vals.append(pipe_dict[key][head]) reservoir_1_vals.append(reservoir_1_dict[key][head]) reservoir_2_vals.append(reservoir_2_dict[key][head]) self.plot_multiple_graphs(fig=f"{method_label} method", _title=f"Graph of Pipe-Reservoirs head Vs. Time", t_label="time, t", z_label="head, z", t_vals=tvals, z_vals=(pipe_vals, reservoir_1_vals, reservoir_2_vals), labels=(self.pipe_label, self.reservoir_1_label, self.reservoir_2_label), color_plus_lineType=['b--', 'g^', 'ro']) def drawTable(self, method_vals, pipe_label="", reservoir_1_label="", reservoir_2_label=""): table = PrettyTable() sn_title = "sn" time_title = "curr_time" if self.A1 and self.A2: # if we have two reservoirs table.field_names = [sn_title, time_title, pipe_label, reservoir_1_label, reservoir_2_label] table.align = 'l' # align all values to the left for sn in (method_vals[self.pipe_label]): pipe = method_vals[self.pipe_label] reservoir_1 = method_vals[self.reservoir_1_label] reservoir_2 = method_vals[self.reservoir_2_label] t, z_pipe = pipe[sn] t, z_reservoir_1 = reservoir_1[sn] t, z_reservoir_2 = reservoir_2[sn] row = [sn, t, z_pipe, z_reservoir_1, z_reservoir_2] table.add_row(row) else: table.field_names = [sn_title, time_title, pipe_label] table.align = 'l' # align all values to the left for sn in (method_vals[self.pipe_label]): pipe = method_vals[self.pipe_label] t, z_pipe = pipe[sn] row = [sn, t, z_pipe] table.add_row(row) print(table) if __name__ == '__main__': pass
4818e2e0f57a597414d8d7f957abaf4422cf1251
Whatsupyuan/python_ws
/8.第八章-函数function/08_def_0803_defaultParameterVal.py
363
3.546875
4
'''函数声明 info="Russia" 为默认赋值 ''' def printInfo(username,info="Russia"): print("Hello ," + username) print("Info , " + info) print() # 函数调用时 , 使用参数名进行绑定 printInfo(username="Kobe",info="los angles") printInfo(info="clc",username="James") printInfo(username="yuan") printInfo(username="yuan" , info="bj")
0e5888a669f11c4a9f1bac450b826e30aa566e61
NurbekSakiev/Algorithms
/LeetCode/116_Populating_Next_Right_Pointers.py
1,201
3.921875
4
# Definition for binary tree with next pointer. # class TreeLinkNode: # def __init__(self, x): # self.val = x # self.left = None # self.right = None # self.next = None class Solution: # @param root, a tree link node # @return nothing def connect(self, root): if root: q = [root] while q: n = len(q) prev = None for i in range(n): node = q.pop() if node.left: q.insert(0,node.left) if node.right: q.insert(0,node.right) if prev: prev.next = node prev = node if i == n-1: node.next = None # Solution 2 def connect(self, root): if not root: return pre = root cur = None while pre.left: cur = pre while cur: cur.left.next = cur.right if cur.next: cur.right.next = cur.next.left cur = cur.next pre = pre.left
9c67219777740e16bf57d50c31e2597f15a2b089
Deeptiii/Coding
/Pattern_Sliding_Window/StringAnagrams.py
2,207
4.25
4
# String Anagrams (hard) # # Given a string and a pattern, find all anagrams of the pattern in the given string. # Anagram is actually a Permutation of a string. For example, “abc” has the following six anagrams: # abc # acb # bac # bca # cab # cba # Write a function to return a list of starting indices of the anagrams of the pattern in the given string. # Example 1: # Input: String="ppqp", Pattern="pq" # Output: [1, 2] # Explanation: The two anagrams of the pattern in the given string are "pq" and "qp". # Example 2: # Input: String="abbcabc", Pattern="abc" # Output: [2, 3, 4] # Explanation: The three anagrams of the pattern in the given string are "bca", "cab", and "abc". # https://leetcode.com/problems/find-all-anagrams-in-a-string/ class Solution: def findAnagrams(self, s: str, p: str) -> List[int]: winStart = 0 n = len(s) k = len(p) matched = 0 sub = {} res = [] for i in range(k): if p[i] not in sub: sub[p[i]] = 0 sub[p[i]]+=1 for winEnd in range(n): charEnd = s[winEnd] if charEnd in sub: sub[charEnd]-=1 if sub[charEnd] == 0: matched+=1 if matched == len(sub): res.append(winStart) if winEnd >= k-1: charStart = s[winStart] winStart+=1 if charStart in sub: if sub[charStart] == 0: matched-=1 sub[charStart]+=1 return res # winStart = 0 # n = len(s) # k = len(p) # ana = [] # ans = [] # p = sorted(p) # for winEnd in range(n): # charEnd = s[winEnd] # ana.append(charEnd) # if len(ana)>k: # ana.pop(0) # winStart+=1 # if k == len(ana) and sorted(ana) == p: # ans.append(winStart) # return ans
058834396a1625dc9ae49c4ede894e21f4371429
boknowswiki/mytraning
/lintcode/python/0070_binary_tree_level_order_traversal_II.py
970
3.875
4
#!/usr/bin/python -t # bfs, queue and tree traversal solution """ Definition of TreeNode: class TreeNode: def __init__(self, val): self.val = val self.left, self.right = None, None """ from collections import deque class Solution: """ @param root: A tree @return: buttom-up level order a list of lists of integer """ def levelOrderBottom(self, root): # write your code here ret = [] if root == None: return [] q = deque([root]) while q: level = [] for i in range(len(q)): node = q.popleft() if node.left: q.append(node.left) if node.right: q.append(node.right) level.append(node.val) #print level ret.append(level) ret.reverse() return ret
df2e72c0eec9f55ef0b2923b0faa38827fc6b21d
alokaviraj/python-program-2
/function sumofseries.py
205
3.71875
4
def sumofseries(): n=int(input("enter the last digit")); s=0; a=1; while(a<=n): s=s+a; a=a+1; print("sum=",s) sumofseries();
489fc05bf968770247ee16a0dd827e5f538105e3
wavetogether/wave_algorithm_challenge
/2020/2020-01/29/joy.py
187
3.515625
4
class Solution: def fizzBuzz(self, n: int) -> List[str]: return ["FizzBuzz" if (i%15 == 0) else "Fizz" if (i%3==0) else 'Buzz' if (i%5==0) else str(i) for i in range(1, n+1)]
fa7bb5906e6ef12966f203f7853d0b8ff985d133
sowmyamanojna/BT3051-Data-Structures-and-Algorithms
/rosalind/1_dna.py
755
3.859375
4
""" A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains. An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG." Given: A DNA string s of length at most 1000 nt. Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s . Sample Dataset AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC Sample Output 20 12 17 21 """ fin = open("rosalind_dna.txt", 'r') s = fin.read() d = {} for i in "ATGC": d[i] = 0 for i in s: d[i] += 1 for i in "ACGT": print d[i],
afc74f0bc3b7e441dae6888ff4f120ee38a2d2ac
brrgrr/LC101_Unit1
/think_python/5.13.2.py
841
4.375
4
''' Write a program to draw this. Assume the innermost square is 20 units per side and each successive square is 20 units bigger, per side, than the one inside it. ''' import turtle def draw_square(t, sz): """Get turtle t to draw a square with sz side""" for i in range(4): t.forward(sz) t.left(90) def main(): wn = turtle.Screen() wn.bgcolor("lightgreen") alex = turtle.Turtle() alex.color("salmon") alex.pensize(3) magic_number = 20 number_of_squares = 5 for i in range(number_of_squares): size = magic_number * (i+1) draw_square(alex,size) alex.up() alex.backward(magic_number/2) alex.right(90) alex.forward(magic_number/2) alex.left(90) alex.down() wn.exitonclick() if __name__ == "__main__": main()
b2963bb2c24bfbe85c071dc96eca82beada69863
andy-sweet/fcdiff
/fcdiff/util.py
1,498
3.59375
4
""" Provides convenient, but non-vital utilities. """ import numpy as np def N_to_C(N): """ Computes the number of connections for a network with N regions. Arguments --------- N : 2 <= int Number of regions. Returns ------- C : 1 <= int Number of connections. """ return N * (N - 1) / 2 def C_to_N(C): """ Computes the number of regions for a network with C connections. Arguments --------- C : 1 <= int Number of connections. Returns ------- N : 1 <= int Number of regions. """ N = (np.sqrt(8 * C + 1) - 1) / 2 + 1 return N def nm_to_c(n, m): """ Converts a pair of region indices (n, m) to a connection index. Arguments --------- n : 0 <= int First region index. m : n < int Second region index. Returns ------- c : 0 <= int < N * (N - 1) / 2 Connection index. Notes ----- N is the total number of regions. """ return N_to_C(n) + m def c_to_nm(c): """ Converts a connection index to a pair of region indices (n, m). Arguments --------- c : 0 <= int < N * (N - 1) / 2 Connection index. Returns ------- n : 0 <= int First region index. m : n < int Second region index. Notes ----- N is the total number of regions. """ n = np.floor((np.sqrt(8 * c + 1) - 1) / 2) + 1 m = c - N_to_C(n) return (n, m)
d871c82c2507d7f61beecfe93af7dfff85a877c5
inteljack/EL6183-Digital-Signal-Processing-Lab-2015-Fall
/project/Examples/Examples/PP2E/Dstruct/Classics/MoreGraphs/graph2.py
1,415
3.53125
4
# use exceptions to exit early class Silent: def found(self, soln): pass def final(self): pass class Interact: def found(self, soln): print 'Solution:', soln, 'length:', len(soln) answer = raw_input('More? ') # after each solution if answer not in ['Y', 'y', 'yes', 'Yes']: raise stopSearch def final(self): print 'No (more) solutions' # end of the search? silent = Silent() interact = Interact() # make one instance stopSearch = '' # exit search fast class Graph: mode = silent def __init__(self, label, extra=None): self.name = label self.data = extra self.arcs = [] def __repr__(self): return self.name def search(self, goal): Graph.solns = [] try: self.generate([self], goal) except stopSearch: pass else: self.mode.final() Graph.solns.sort(lambda x,y: cmp(len(x), len(y))) return Graph.solns def generate(self, path, goal): if self == goal: Graph.solns.append(path) self.mode.found(path) else: for arc in self.arcs: if arc not in path: arc.generate(path + [arc], goal)
856d6cef7540fb33d9fef9a114f97b201bdf6491
Larrydek/Python-UNSAM
/03 - Trabajando con datos/solucion_de_errores.py
2,672
3.671875
4
# -*- coding: utf-8 -*- """ Created on Fri Aug 20 16:31:25 2021 @author: Manjuanel """ #solucion_de_errores #ejercicios de errores en el código #%% #Ejercicio 3.1: Semántica #el error era semántico debido a que el código determinaba si la última letra era a o no. #no reconocía 'a' mayúscula #lo solucioné borrando el while y agregando un if con las dos condiciones def tiene_a(expresion): n = len(expresion) if 'a' in expresion or 'A' in expresion: return True else: return False print(tiene_a('UNSAM 2020')) print(tiene_a('abracadabra')) print(tiene_a('La novela 1984 de George Orwell')) #%% #Ejercicio 3.2: Sintáxis #Tenía múltiples errores sintácticos, agregué ':' y '==' #No funcionaba para mayúsculas def tiene_a(expresion): n = len(expresion) i = 0 while i<n: if expresion[i] == 'a' or expresion[i] == 'A': return True i += 1 return False print(tiene_a('UNSAM 2020')) print(tiene_a('La novela 1984 de George Orwell')) #%% #Ejercicio 3.3: Tipos #No funcionaba para números ya que el condicional del if es '1' (string) #transformé la variable a string para ser usada en todo el programa def tiene_uno(expresion): expresion = str(expresion) n = len(expresion) i = 0 tiene = False while (i<n) and not tiene: if expresion[i] == '1': tiene = True i += 1 return tiene print(tiene_uno('UNSAM 2020')) print(tiene_uno('La novela 1984 de George Orwell')) print(tiene_uno(1984)) #%% #Ejercicio 3.4: Alcances #La función nunca cerraba #Le agregué el return a la función para que devuelva C y pueda ser usada def suma(a,b): c = a + b return c a = 2 b = 3 c = suma(a,b) print(f"La suma da {a} + {b} = {c}") print(suma(2,3)) #%% #Ejercicio 3.5: Pisando memoria #El problema era que siempre llenaba el registro con el último dato del camión #Lo solucioné vaciando el registro despues de cada empuje de datos del camión al registro import csv from pprint import pprint def leer_camion(nombre_archivo): camion=[] registro={} with open(nombre_archivo,"rt") as f: filas = csv.reader(f) encabezado = next(filas) for fila in filas: registro[encabezado[0]] = fila[0] registro[encabezado[1]] = int(fila[1]) registro[encabezado[2]] = float(fila[2]) pprint(registro) #pprint(camion) camion.append(registro) registro = {} return camion camion = leer_camion('../Data/camion.csv') pprint(camion)
224a52779f8f9d3ecafc4300e9a425e18902d476
MCHARNETT/MITx-6.00.01-Week-5
/probelm 3.py
865
3.890625
4
# -*- coding: utf-8 -*- """ Created on Tue Jul 11 14:34:32 2017 @author: harne """ def isValidWord(word, hand, wordList): """ Returns True if word is in the wordList and is entirely composed of letters in the hand. Otherwise, returns False. Does not mutate hand or wordList. word: string hand: dictionary (string -> int) wordList: list of lowercase strings """ newHand = hand.copy() word = word.lower() for i in range(len(word)): if word[i] not in newHand: return False else: newHand[word[i]] -=1 if word in wordList: return True return False WORDLIST_FILENAME = "words.txt" print(isValidWord("rapture", hand, )) Expected False, but got True for word: 'rapture' and hand: {'r': 1, 'a': 3, 'p': 2, 'e': 1, 't': 1, 'u': 1}