input stringlengths 600 32.7k | label stringclasses 3
values |
|---|---|
"Thus novel approaches to effectively managing this disease at the molecular level could identify patients who have a higher or lower risk of relapse following surgery and provide biomarkers for the prediction of patient survival. In this regard the use of serum miRNAs as potential biomarkers for diagnosing and predict... | Lung_Cancer |
"In the liver lymphatic vessels run parallel to the interlobular vessels and bile duct. Lymphatic vessels can be classified as deep or superficial lymphatic collecting ducts. Superficial lymphatic collecting ducts are often found in the connective tissues of the liver capsule and the lymph is transferred into the paras... | Lung_Cancer |
"Lung and Intrathoracic Tumors Pathology and Laboratory Medicine Anatomical Pathology Surgical Pathology Radiology and Imaging Research and Analysis Methods Imaging Techniques Tumor Size and Computed Tomography Attenuation of Pulmonary Pure Ground-Glass Nodules Are Useful for Predicting Pathological Invasiveness Predic... | Lung_Cancer |
" distribution and reproduction in any medium provided the original author and source are credited. The epithelial mesenchymal transition (EMT) is an important process in tumor development. Despite previous investigations it remains unclear how p120-catenin (p120ctn) isoforms 1A and 3A affect the EMT of tumor cells. He... | Lung_Cancer |
"non-small cell lung cancer International Journal of Molecular Medicine 2010 25 4 517 523 2-s2.0-77749289244 20198299 38 Roy S Yu Y Padhye SB Sarkar FH Majumdar AP Difluorinated-curcumin (CDF) restores PTEN expression in colon cancer cells by down-regulating miR-21 PLoS One 2013 8 e68543 miR-21 expression was knocked... | Lung_Cancer |
"Purpose Although the EGF receptor tyrosine kinase inhibitors (EGFR-TKI) gefitinib have shown dramatic effects against EGFR mutant lung cancer patients become resistant by various mechanisms including gatekeeper EGFR-T790M mutation MET amplification and KRAS mutation thereafter relapsing. AZD6244 is a potent selective ... | Lung_Cancer |
"The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposurelagresponse association. In this contribution I illustrate... | Lung_Cancer |
"FISH analysis was performed on the 297 cases to evaluate ALK gene rearrangement status. Two hundred and eighty-six out of 297 cases were informative for FISH analysis and 33 cases were identified with ALK+?(E). Thirty of the 33 ALK+?cases showed strong ALK expression and the other 3 showed weak ALK expression. Therefo... | Lung_Cancer |
"The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: landimmail.nih.gov 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully app... | Lung_Cancer |
"The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opac... | Lung_Cancer |
"The cancer tissue used in this study was received from patients that had surgical resection of both the primary tumor and related metastases. None of the patients had received chemo- or radiotherapy before the resection of the primary tumor. Medical charts and pathology reports were reviewed to record clinical and pat... | Lung_Cancer |
"Angelique Whitehurst PhD. UT-Southwestern Medical Center 6001 Forest Park Drive Dallas TX 75390-8807. Phone (214)-645-6066. 214-645-6347 angelique.whitehurstutsouthwestern.edu. 13 6 2014 23 5 2014 15 7 2014 15 7 2015 74 14 3857 3869 Non-small cell lung cancer (NSCLC) is notorious for its paltry responses to first-line... | Lung_Cancer |
"Subsequently the principal investigator will report back to clinic A patients with estimated lung cancer risks (session 3). To ensure balance in the control clinic the principal investigator will also attend Clinic B sessions 2 and 3 (see flow charts). ¢At the eight week clinic and the 6-month follow-up clinic smokin... | Lung_Cancer |
"Although PLC may be present in liver carcinoma patients these patients might die as a result of other causes such as liver failure or hemorrhage due to cancer rupture before the typical symptoms of PLC manifest. On the basis of our experience and previous reports clinicians should exclude PLC when patients develop hyp... | Lung_Cancer |
"however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (). shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-op... | Lung_Cancer |
"cells treated with thiaminase are consistent with inhibition of BCKDH complex pyruvate dehydrogenase complex and transketolase inhibition. However inhibition of the same enzyme was shown to result in different metabolic consequences in the case of BCKDH where inhibition in RS4 cells caused a demonstrable increase in B... | Lung_Cancer |
"Purpose The aim of this prospective study was to evaluate whether [18F]FDG-PET/CT performed within two weeks of starting erlotinib therapy can predict tumor response defined by RECIST 1.1 criteria after 8 weeks of treatment in patients with inoperable (stage IIIA to IV) non-small cell lung cancer patients. Patients an... | Lung_Cancer |
"BronchioalveolarCarcinoma 1 (0.6) 2 (3.8) 5 (1.7) 16 (3.3) Other* 15 (8.7) 4 (7.5) 32 (10.6) 66 (13.5) *Other includes subjects with no information available. LDT ?=? laboratory-developed test; MD ?=? mutation detected; MND ?=? mutation not detected. SLCG inconclusive (n?=?27) data not shown. Statistical consideration... | Lung_Cancer |
"Thymidylate synthase (TS) gene expression in primary lung cancer patients: a large-scale study in Japanese population Ann Oncol 2011 22 1791 1797 10.1093/annonc/mdq730 21321092 Bosch-Barrera J Gazta±aga M Ceballos J Prez-Gracia JL Lpez-Picazo JM Garca-Foncillas J Ferrer M Sanz ML Pretel M Idoate MA Gil-Bazo I Toxic e... | Lung_Cancer |
" Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is ... | Lung_Cancer |
"Human cells were grown in 60-mm dishes to 90% confluence. Then a wound was produced by scraping the cell monolayer with a sterile P200 pipette tip. During the wound healing process time-lapse images were obtained every 10 min for 12 hours and the cell migration area was calculated ([healing area/wounding area]100%) u... | Lung_Cancer |
"trial in patients with advanced non-small-cell lung cancer. J Clin Oncol 2010 28 3076 3083 20479403 29. Miller VA Hirsh V Cadranel J Afatinib versus placebo for patients with advanced metastatic non-small-cell lung cancer after failure of erlotinib gefitinib or both and one or two lines of chemotherapy (LUX-Lung 1): a... | Lung_Cancer |
"The DICER algorithm (24) seeks one pair of linked modules at a time. A pair of modules is defined as linked if the sum of weights WG between them is high enough. We call the approach of DICER local as it finds one module pair at a time. The algorithm of Ulitsky et al. (17) aims to maximize the global score namely ... | Lung_Cancer |
"Former (quit ?1 y) 39 (48%) 30 (48%) 9 (50%) 10 (50%) 29 (48%) ?Never 9 (11%) 7 (11%) 2 (11%) 1.00e 2 (10%) 7 (11%) 1.00e Abbreviation: Adeno adenocarcinoma. a All P values shown are 2-sided. b White versus all other races. c Adenocarcinoma versus all other histologies. d Weight loss <5% versus ?5%. e Derived using th... | Lung_Cancer |
"Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurve... | Lung_Cancer |
"The lower replication rate of adipose meQTLs in whole-blood samples6 might be explained by the heterogeneity of different cell types in whole blood and by their more liberal P-value threshold (8.610?4) which led to the identification of a large number of weak cis-meQTLs. Compared with cis-regulation trans-eQTL regula... | Lung_Cancer |
"One limitation of this study is the small number of cases under study although 15 FISH-positive cases is comparable to most other studies. The relatively small number of FISH-negative cases may have affected our ability to identify FISH-negative IHC-positive cases. However the study design does permit an assessment of... | Lung_Cancer |
"Therefore using the combined sample from the LSC and PLuSS ROC curves were generated using the 3-gene model the full 11-gene model and covariates-only model in male former smokers (Figure 1). Likelihood ratio tests confirmed that both the 3-gene and 11-gene models are significantly more discriminative than the covari... | Lung_Cancer |
".0091577.g004 The peripheral mu opioid receptor antagonist methylnaltrexone (MNTX) inhibits EGF-induced phosphorylation of Src PI3 kinase and STAT3 in human lung cancer cells. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were either untreated (control) or treated with 100 nM MNTX alone 10 ng/ml EGF fo... | Lung_Cancer |
"However as in the phase I study a stabilisation of median haemoglobin values for multiple cycles as well as low rate of all-grade anaemia was observed. The result provides some support for the hypothesis that VEGF is a negative regulator of erythropoiesis and its inhibitors may have a role in the management of anaemia... | Lung_Cancer |
"]a 2 (29) [4?71] 2 (15) [2?45] 4 (20) [6?44] No. of patients n 10 13 23 No. of PFS eventsf n (%) 8 (80) 11 (85) 19 (83) PFS weeks [95% CI] 8 [2?25] 9 [5?18] 8 [5?18] PFS probability at 6 months [95% CI] 14 [1?45] 6 [0?25] No. of deaths n (%) 6 (60) 12 (92) 18 (78) OS weeks 36 [2 ] 26 [8?36] 26 [10?47] Survival prob... | Lung_Cancer |
"We split cis-meQTL SNPs into five categories according to the meQTL association strength (P>10?7 10?7>P>10?10 10?10>P>10?15 10?15>P>10?20 P<10?20). A SNP is determined to be related with a regulatory region if the SNP or any LD-related SNP (r2 ? 0.8) resides in the ChIP-Seq peaks of the regulatory regions. Regulatory ... | Lung_Cancer |
"Single agent and combination treatment protocols were well tolerated by mice with no weight loss or other signs of acute or delayed toxicity (A-C). Antitumor activity of AZD6244 and/or BEZ235 in mouse xenograft models of human tumors. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administ... | Lung_Cancer |
"Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells. (a) Upregulation of Hsp70 in lung cancer cell lines. Each cell extract was separated by SDS-PAGE and immunoblotted with an anti-Hsp70 or actin antibody (upper panel). The quantity of each protein was estimated by densitometric analysis using Sc... | Lung_Cancer |
" Control Asbestos Mesothelioma P TOL (mmol H2O2 equiv./L) 105.9 ± 92.5 145.1 ± 71.9b 196.3 ± 221.1cd 0.001 TAC (mmol Trolox equiv./L) 0.73 ± 0.34 1.27 ± 0.16c 0.8 ± 0.3f <0.001 OSI 159.3 ± 160.9 112.8 ± 48.3c 898.6 ± 129.7bf 0.007 CRP (mg/dL) 2.8 ± 1.7 4.4 ± 3.1 75.6 ± 54.8af <0.001 ?-1 antitrypsin (mg/dL) 146.7 ± 47.... | Lung_Cancer |
" In another study by the same group a set of different miRNAs could be used to differentiate hepatocellular carcinomas from metastatic tumors in the liver [25]. miRNA expression differs between tumor types within the same tumor type in different patients and between primary tumors and metastases. Hence it may not be s... | Lung_Cancer |
"This combination has two possible explanations. Firstly they might represent tumors which are not expressing ALK protein at detectable levels because of a false-positive FISH result or an absence of addiction to rearranged ALK protein despite presence of recombined ALK DNA. These tumors are unlikely to respond to criz... | Lung_Cancer |
"Among the remaining fifty unamplified cases eight (14%) also showed enhanced SETDB1 expression that could be associated with other upstream regulatory events. Overall our results indicate that the histone methyltransferase SETDB1 undergoes gene amplification in the natural history of lung tumorigenesis in non-small an... | Lung_Cancer |
"Then 1106 freshly prepared cells were suspended in 100 µl PBS and stained with combination of fluorochrome-coupled antibodies to CD11b and Gr1. Cells were collected by FCM. Data were analyzed with FlowJo software. Western Blot Analysis The western blot analysis was performed as described previously with some modifica... | Lung_Cancer |
"The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: landimmail.nih.gov 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully app... | Lung_Cancer |
" Bryant et al. Overall survivalAverage Za0.370.00011Beer (N = 442) Overall survivalAverage Zb0.620.00003Fisher0.500.00068GSEA0.650.00001Euclidean0.650.00001Mahalanobis0.670.00001GSE8894 (N = 61) Recurrent free survivalAverage Zb0.900.01163Fisher0.910.01076GSEA0.780.02899Euclidean0.870.01544Mahalanobis0.680.05485aDeriv... | Lung_Cancer |
"The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opac... | Lung_Cancer |
" nonsmall-cell lung cancer Clin Lung Cancer 10 252 256 19632943 Patel JD Hensing TA Rademaker A Hart EM Blum MG Milton DT Bonomi PD 2009 Phase II study of pemetrexed and carboplatin plus bevacizumab with maintenance pemetrexed and bevacizumab as first-line therapy for nonsquamous nonsmall-cell lung cancer J Clin Onc... | Lung_Cancer |
"CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a ... | Lung_Cancer |
"The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. S Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further devel... | Lung_Cancer |
"or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used a... | Lung_Cancer |
"n methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriat... | Lung_Cancer |
"Henry Ford Health System Detroit MI 48202 USA 7 2 2014 13 12 2013 6 1 2014 06 1 2015 59 1 173 188 The direct dose mapping (DDM) and energy/mass transfer mapping (EMT) are two essential algorithms for accumulating the dose from different anatomic phases to the reference phase when there is an motion or tumor/tissue def... | Lung_Cancer |
" discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E 12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltratio... | Lung_Cancer |
"Range 41.684.2 41.684.2 41.681.7 44.282.9 41.684.2 Sex .18 .61 ?Female 44 (54%) 37 (59%) 7 (39%) 12 (60%) 32 (52%) ?Male 37 (46%) 26 (41%) 11 (61%) 8 (40%) 29 (48%) Ethnicity .65 .18 ?Unknown 7 (8%) 5 (8%) 2 (11%) 0 (0%) 7 (11%) ?Non-Hispanic 74 (91%) 58 (92%) 16 (89%) 20 (100%) 54 (89%) Race .73b .75b ?African A... | Lung_Cancer |
"Complete surgical excision was impossible due to the nodules diverse sites. Palliative treatment using 2 mg/kg tramadol (tramadol Dongkwang Pharm Seoul Korea) and 2.2 mg/kg carprofen (rimadyl Pfizer New York NY U.S.A.) was applied to the dog twice per day for 3 months. Finally after respiratory distress began to emer... | Lung_Cancer |
"In one study the ferritin level was found to be higher in malignant pleural effusion than in benign pleural effusion [27]. An experimental study conducted in mesothelioma cases found raised copper levels in mesothelioma cells and reported copper as a possible marker of mesothelioma [28]. In our study the copper levels... | Lung_Cancer |
"Introduction Lung cancer is the leading cause of cancer-related deaths worldwide [1] whereas non-small cell lung cancer (NSCLC) represents the most frequent type of lung cancer [2]. NSCLC accounts for approximately 80% of all lung cancer cases and has a 5-year overall survival rate of less than 15% [3 4]. Approximatel... | Lung_Cancer |
"Overexpression of GFP-Sp1 decreased FOXO3 mRNA and protein levels in a dose-dependent manner (C panel a) whereas knockdown of Sp1 expression increased FOXO3 mRNA and protein levels (C panel b). These results indicate that Sp1 negatively regulates FOXO3 expression. Sp1 negatively regulates FOXO3 expression through reg... | Lung_Cancer |
"MB was supported by the European Regional Development Fund grant number FKZ:005-111-0027. GVM was supported by the Victorian Cancer Agency grant TS10_01. KKW is supported by the NIH CA122794 CA140594 CA163896 CA166480 and CA154303 grants. PKP was supported by a Uniting Against Lung Cancer grant. RKT is supported by th... | Lung_Cancer |
" Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your l... | Lung_Cancer |
"We therefore envision that the effects of phenothiazines per se as well as its potential chemosensitizing properties can help improve the outcome for relapsed SCLC patients who no longer respond to conventional treatment. In summary the present work uncovered a novel activity of phenothiazines as agents capable of inh... | Lung_Cancer |
"To understand the functional consequences of GWAS loci is challenging and multiple principles for post-GWAS functional characterization of genetic loci have been proposed including the exploration of epigenetic mechanisms46. In our study the top GWAS lung cancer loci were strongly associated with methylation levels o... | Lung_Cancer |
"The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an in... | Lung_Cancer |
"Ectopic expression of BANCR was achieved through pCDNA-BANCR transfection with an empty pCDNA3.1 vector used as a control. The expression levels of BANCR were detected by qPCR. Cell transfection Plasmid vectors (pCDNA3.1-BANCR and pCDNA3.1) for transfection were prepared using DNA Midiprep or Midiprep kits (Qiagen Hil... | Lung_Cancer |
"The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surf... | Lung_Cancer |
"This represents a 160-fold preference for ?v?6. As a reference point the maximum concentration of the imaging probe in the blood of a mouse is ~5 nM; this is substantially below the Kd of the H2009.1-10mer dimeric peptide for ?v?3 and ?v?5 and no binding of the peptide to these purified integrins was detected at this ... | Lung_Cancer |
"Product size was 203 bp. Southern blot analysis Genomic DNA from ESCs and ans was extracted with the Gentra Puregene Tissue Kit (Qiagen). Genetic chimerism in various tissues was determined by Southern blotting of EcoRV digested DNA hybridized to the Trp53 5? XbaI probe which is a 700 bp genomic XbaI fragment subclone... | Lung_Cancer |
"for use in lung cancer clinical trials Eur J Cancer Psychometric properties and responsiveness of the EORTC Quality of Life Questionnaire (QLQ-C30) in patients with breast ovarian and lung cancer Qual Life Res 1994 3 5 353 364 10.1007/BF00451727 7841968 Osoba D Aaronson N Zee B Sprangers M te Velde A Modification of t... | Lung_Cancer |
"Statistical analysis We used Chi-square test to examine the differences in the distributions of demographic characteristics and genotype frequencies between cases and controls. The NSCLC risk associated with CR1 tag SNPs was estimated as odds ratios (OR) and 95% confidence intervals (CI) computed by logistic regressio... | Lung_Cancer |
"The greater than 2-fold increase in affinity is indicative of multivalent binding of the peptide to the cell surface and not merely an increase in the number of peptide units. Attachment of the peptides to the CB-TE2A chelator does not affect the affinity of the peptide compared to the parental dimer of H2009.1-10mer.... | Lung_Cancer |
"Background A gene-based estimate of lung cancer risk in smokers has been shown to act as a smoking cessation motivator in hospital recruited subjects. The objective of this trial is to determine if this motivator is as effective in subjects recruited from an NHS primary care unit. Method/Design Subjects will be recrui... | Lung_Cancer |
"MassArray analysis 1 Sequencing+pyrosequencing 1 Sequencing+pyrosequencing+high-resolution melting 2 Sequencing+restriction fragment length polymorphism 1 Sequencing+single-strand conformational analysis 1 Sequencing+Taqman+PNA clamp 1 Sequencing+Therascreen kit 5 Sequencing+Therascreen kit+CAST PCR 1 SNaPshot+single-... | Lung_Cancer |
"DNA whole exome sequencing (DNA-WES) is currently the most popular technology; however this yields low sensitivity in low purity tumors. RNA sequencing (RNA-seq) covers the expressed exome with depth proportional to expression. We hypothesized that integrating DNA-WES and RNA-seq would enable superior mutation detecti... | Lung_Cancer |
"The work cannot be changed in any way or used commercially. Introduction: In nonsmall-cell lung cancer an exon 19 deletion and an L858R point mutation in the epidermal growth factor receptor (EGFR) are predictors of a response to EGFR-tyrosine kinase inhibitors. However it is uncertain whether other uncommon EGFR mut... | Lung_Cancer |
"Methylnaltrexone was developed at the University of Chicago and licensed to Progenics Pharmaceuticals subsequently sub-licensed to Salix Pharmaceuticals. Dr. Moss was a paid consultant for Progenics Pharmaceuticals and currently is a paid consultant for Salix Pharmaceuticals. He receives royalties through the Universi... | Lung_Cancer |
"Research has shown a strong association between a high lung cancer susceptibility score derived from family history of cancer the 20 SNPs COPD history (Auckland formula) and the development of lung cancers whereas healthy smokers matched for age gender and lifetime smoking habits had a relatively low score (n?=?446 lu... | Lung_Cancer |
"A decrease of 50% or more from baseline urinary prostaglandin E2 metabolite after a 5-day open-label run-in period was used to select eligible patients. One hundred twenty patients (median age 64 years) were randomized (78 to AP/E and 42 to P/E). Overall median TTP was 1.8 months in the AP/E group and 2.1 months in th... | Lung_Cancer |
"rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAA... | Lung_Cancer |
"The price of gefitinib is the most significant parameter that could reduce the incremental cost per QALY. Probabilistic sensitivity analysis indicated that the cost-effective probability of maintenance gefitinib was zero under the willingness-to-pay (WTP) threshold of $16349 (3per-capita gross domestic product of Chi... | Lung_Cancer |
"The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (7... | Lung_Cancer |
"They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation... | Lung_Cancer |
"The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have n... | Lung_Cancer |
"316 chips were used for sequencing on the Ion Torrent PGM for 65 cycles and the samples were barcoded. Ion PGM 200 Sequencing Kit was used for sequencing reactions as per the recommended protocol (Part # 4474004 Rev. B). The dataset has been deposited to the NIH Sequence Read Archive and the accession number is SRP028... | Lung_Cancer |
"Adenocarcinoma including cases with bronchioloalveolar carcinoma. Expression of miR-182 and correlations miR-182 was homogenously expressed mainly in the cytoplasm of tumor cells. There was also some unspecific nuclear staining (). The scoring was based on cytoplasmic staining. There was no staining of stromal cells e... | Lung_Cancer |
" Successful examples of this include the co-development (and co-approval) of the BRAF inhibitor vemurafenib and its companion diagnostic BRAF V600E mutation assay for BRAF-mutant metastatic melanoma[1] and the ALK inhibitor crizotinib and its companion diagnostic ALK fusion gene test in advanced ALK-fusion positive no... | Lung_Cancer |
"630±60?nm band pass filter) and green (?excitation: 470±40?nm band pass filter ?detection: 535±50?nm band pass filter) fluorescence channels. Flow cytometric analysis was assayed with the JC-1 Mitochondrial Membrane Potential Kit (AAT Bioquest Sunnyvale CA USA) according to the manufacturer's directions using a FACSCa... | Lung_Cancer |
"These results suggest that there may be lifelong differences in how BMI affects health in blacks versus whites. Several lines of evidence suggest that underlying physiological distinctions among different race and sex groups may contribute to the observed differences in the BMI-mortality association. The association b... | Lung_Cancer |
"METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both ... | Lung_Cancer |
"Rabbit anti-MOR antibody was purchased from GeneTex (San Antonio TX). Rabbit anti-EGFR rabbit anti-phosphotyrosine-EGFR (pY845 pY992 pY1045 pY1068) rabbit anti-Grb-2 rabbit anti-Gab-1 rabbit anti-phosphotyrosine-Gab-1 (pY307 pY627) rabbit anti-Src rabbit anti-phosphotyrosine-Src (pY416) rabbit anti-p85 PI3 kinase rabb... | Lung_Cancer |
"The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is repres... | Lung_Cancer |
"The mean Ct values for these five miRNAs were calculated excluding outliers (i.e. replicates with Ct values differing by more than one cycle from the median). In addition if CtU6ave and CtU48ave each did not occur within 32 cycles the assay was repeated. Samples with low U6 or U48 snRNA levels were not excluded from d... | Lung_Cancer |
"Since activation of the adaptive T cell response previously has been demonstrated to peak around day 1014 post vaccination with Ad-Ii-GP or Ad-GP it was somewhat unexpected to find that previous vaccination did not cause any difference in gene expression under these conditions [12] [21]. However this probably reflect... | Lung_Cancer |
"involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X ... | Lung_Cancer |
"and Cys-K-(PEG11-10mer-COCH3)2) peptide (3.0 mg 0.68 ?mol). Protected (tBu)2-AcD10 was obtained as a white solid (2.5 mg; yield: 73%). MALDI-TOF/MS: 5048.15 [M+H]+. Calc'd MS: 5047.49. After deprotection H2-AcD10 was obtained in quantitative yield. MALDI-TOF/MS: 4935.46 [M+H]+. Calc'd MS: 4934.85 Synthesis of H2(M10)2... | Lung_Cancer |
"Then we need to calculate a tail probability for a heterogeneous Bernoulli process. For the calculation for gene sets with coordinate down-regulated differential expression we need to focus on the combination of different components with (j1 = 2 j2 = 2 . . . jK = 2). Then we need to change the formulas for uSi and CE... | Lung_Cancer |
"Single agent and combination treatment protocols were well tolerated by mice with no weight loss or other signs of acute or delayed toxicity (A-C). Antitumor activity of AZD6244 and/or BEZ235 in mouse xenograft models of human tumors. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administ... | Lung_Cancer |
" PAX6 expression was recently found in tumors suggesting an oncogenic role [9]. PAX6 is frequently expressed in retinoblastoma pancreatic tumors and intestinal tumors [6] [10] [11]. PAX6 is also highly expressed in brain and breast cancer cell lines [9]. In pancreatic carcinoma cell lines the inhibition of PAX6 expres... | Lung_Cancer |
"oup A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of ... | Lung_Cancer |
"Implications This study provides a mechanistic basis for potential therapeutic interventions to prevent metastasis. NEDD9 invasion metastasis breast cancer MMP14 Int J Occup Environ Health Int J Occup Environ Health OEH International Journal of Occupational and Environmental health 1077-3525 2049-3967 Maney Publishing... | Lung_Cancer |
"Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients ... | Lung_Cancer |
"We retrospectively reviewed 91 patients with stage III NSCLC treated with definitive chemoradiation. All patients underwent a pretreatment diagnostic contrast enhanced CT (CE-CT) followed by a 4D-CT for treatment simulation. We used the average (average-CT) and expiratory (T50-CT) images from the 4D-CT along with the ... | Lung_Cancer |
"reads in RNA-seq but only a few mutant reads in DNA-WES such as the example Luminal A tumor with a single DNA mutant read in the PIK3CA hotspot. This study's results support that RNA sequencing could be beneficial when added to DNA sequencing in clinical settings. Future studies could explore alternative ways to integ... | Lung_Cancer |
"involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X ... | Lung_Cancer |
"Therefore using the combined sample from the LSC and PLuSS ROC curves were generated using the 3-gene model the full 11-gene model and covariates-only model in male former smokers (Figure 1). Likelihood ratio tests confirmed that both the 3-gene and 11-gene models are significantly more discriminative than the covari... | Lung_Cancer |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.