PMCID
stringclasses
24 values
Title
stringclasses
24 values
Sentences
stringlengths
2
40.7k
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
However, despite the observed upregulation of SHH and SOX2 in NG MIO-M1 cells, the expression of rhodopsin, a marker of mature neuronal cells, was not detected.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
This indicates that, although the cells possess the potential to differentiate into neuronal cells, the conditions employed in our protocol were not sufficient to fully induce this differentiation.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The lack of mature neuronal marker expression is likely due to the timing and duration of the experimental conditions.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
It may therefore be worthwhile to optimize the protocol in order to more accurately reflect the diabetic conditions in humans, with a view to promoting full neuronal differentiation.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Given the role of SHH in Müller cells reprogramming and the observed upregulation under sustained high-glucose and GF treatments, future experiments could investigate the effect of exogenous SHH treatment on human Müller cells.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
This approach would provide insights into the therapeutic potential of modulating SHH signaling to mitigate the adverse effects of reactive gliosis and enhance regenerative processes in the diabetic retina.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Although the current study provides important insights into the gliotic and reprogramming potential of Müller cells under different glucose treatments, some limitations should be considered.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The study employed the MIO-M1 cell line, which, although well established in human retinal research, may not fully capture the physiological complexity of Müller cells found in human retina.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Future research could benefit from using primary Müller cells to better reflect the in vivo context of human diabetic retinopathy.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
In addition, the effects of other stressors, such as oxidative stress or hypoxia, which also play a role in diabetic retinal damage, were not included in our model.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Inclusion of these factors could provide a more comprehensive understanding of the cellular mechanisms involved.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Despite these limitations, the current study contributes important insights into the gliotic and reprogramming potential of Müller cells under varying glucose conditions.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The Müller cell line (MIO-M1; YB-H3309, Ybio, Shanghai, China) was maintained under controlled conditions at 37 °C and cultured in Dulbecco’s Modified Eagle Medium (DMEM) (11966-025, Gibco, Grand Isle, VT, USA).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The culture medium was supplemented with 10% fetal bovine serum (FBS; Gibco), 5 mg/mL streptomycin, 5 U/mL penicillin (Gibco), and 5 mM (1 g/L) glucose or 25mM (4.5 g/L) glucose.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The experimental conditions, referred to as normoglycemic (NG) at 5 mM glucose and hyperglycemic (HG) at 25 mM glucose, represent in humans the normal physiological levels of glucose (100 mg/dL) and the hyperglycemic conditions, respectively .
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
In order to evaluate the influence of sustained high-glucose and glucose fluctuations (GFs) on cellular function, MIO-M1 cultured in NG and HG conditions were plated at a density of 10,000 cells/cm and exposed to different glucose treatments over 96 h, with media changes every 24 h. Treatments were as follow: Treatment I = constant basal glucose medium (5 mM for NG cells and 25 mM for HG cells); Treatment II = sustained high-glucose medium (25 mM for NG cells and 45 mM for HG cells); Treatment III = alternating basal (5 mM for NG cells and 25 mM for HG cells) and high-glucose medium (25 mM for NG cells and 45 mM for HG cells) every 24 h; Treatment IV = basal glucose medium (5 mM for NG cells and 25 mM for HG cells) for 72 h followed by high-glucose medium (25 mM for NG cells and 45 mM for HG cells) for the last 24 h; Treatment V = alternating low- (3 mM for NG cells and 5 mM for HG cells) and high-glucose (25 mM for NG cells and 45 mM for HG cells) medium every 24 h. A detailed scheme of the cell culture conditions and treatments is provided in Supplementary Figure S1.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
MIO-M1 cell lysates were prepared with RIPA buffer (25 mM Tris–HCl pH 7.5, 150 mM NaCl, 1% NP-40, 0.1% sodium dodecyl sulphate (SDS), 1% sodium deoxycholate, 10 mM sodium fluoride (NaF), 1 M phenylmethylsulphonyl fluoride (PMSF), 1 M sodium vanadate (NaVO3), containing EDTA-free protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA) and PhosSTOP™ (Roche, Penzberg, Germany).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The samples were incubated for 30 min at 4 °C, centrifuged at 13,000 rpm for 10 min at 4 °C, and then sonicated once (5 s, 10% power) .
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The protein concentration was determined using the Bradford assay.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Protein samples were separated by electrophoresis on 12% (v/v) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) gels and transferred to a polyvinylidene difluoride (PVDF) Transfer Membrane Hybond™ (Amersham Biosciences, Amersham, UK).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Membranes were then blocked with 5% non-fat dry milk in phosphate buffered saline (PBS) containing 0.05% (v/v) Tween 20 (PBS-T) for 1 h at room temperature, followed by overnight incubation at 4 °C with the primary antibodies.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The following primary antibodies were used: rabbit anti-GFAP (ab7260, Abcam, Cambridge, MA, USA, 1:5000); goat anti-SHH (ab240438, Abcam 1:250); mouse anti-HSP90 (ab79849, Abcam, 1:1000); rabbit anti-α-tubulin (SC-9104, La Santa Cruz Biotechnology, Dallas, TX, USA, 1:500) diluted with 5% BSA in PBS-T. Secondary HPR-conjugated antibodies (Amersham Biosciences, Uppsala, Sweden) diluted 1:5000 in 1% (w/v) non-fat dry milk in PBS-T were used to incubate the membrane for 1 h at room temperature.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Immunoreactive bands were detected by Amersham™ ECL™ Prime (Amersham Biosciences), according to the manufacturer’s protocol.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Chemical luminescent signals were detected using ImageQuant LAS 4000 mini (GE Healthcare, Chicago, IL, USA).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Densitometric analysis of the bands was performed using ImageJ software v1.53k.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
For normalization of protein expression, membranes were stripped using the Re-Blot Plus Mild Solution (10×) (Merck KGaA, Darmstadt, Germany), following the manufacturers’ protocol, and re-probed with rabbit anti-β-tubulin, mouse anti-HSP90.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
MIO-M1 cells grown on a 96-well plate were treated as indicated above.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
After washing with PBS, they were fixed with 4% paraformaldehyde (PFA) in PBS for 15 min and then permeabilized with 0.2% Triton X-100 in PBS for 10 min.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Cells were incubated with blocking buffer (3% BSA and 0.05% Tween-20 in PBS) for 1 h at room temperature, then incubated overnight at 4 °C with the following antibodies: rabbit anti-GFAP antibody (ab7260, Abcam, 1:500); goat anti-SHH antibody (ab240438, Abcam; 1:50); mouse anti-SOX2 antibody (sc-365823, La Santa Cruz Biotechnology, 1:500); rabbit anti-Vimentin antibody (ab45939, Abcam; 1:200).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Subsequently, cells were incubated with the following secondary antibodies: anti-rabbit conjugated with Alexa-Fluor-488 or Alexa-Fluor-568, anti-mouse conjugated with Alexa-Fluor-568 and with an anti-goat conjugated with Alexa-Fluor-568 (Invitrogen, Carlsbad, CA, USA, 1:500) diluted in PBS-T for 1 h at room temperature.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Following the staining of the nuclei with Hoechst 33242 dye (0.5 µg/mL, Invitrogen, Carlsbad, CA, USA) diluted in PBS, the cells were examined using a Leica DM6000 B (Leica Microsystems, Wetzlar, Germany).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Images were captured using the LAS AF acquisition software (2.6.0.7266, Leica Microsystems).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
For the quantification of MIO-M1 cells, 20 fields at 20× magnification were examined for GFAP, SOX2, and SHH in all glucose conditions.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Immunoreactive cells were counted in 3 independent experiments using the ImageJ program v1.53k; data were obtained by counting at least 500 cells for each group in at least three independent experiments.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
RNA was extracted from mouse tissues using Trizol Protocol (TRIzol™ Reagent, Invitrogen, ThermoFisher Scientific, Catalog number: 15596026, Waltham, MA, USA), according to the manufacturer’s recommendations.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
An amount of 1 μg of RNA was reverse transcribed using random primers and the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany), following the manufacturer’s specifications.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Gene expression was measured using iTaq Universal SYBR Green Supermix (Biorad Laboratories, Hercules, CA, USA).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Real-time PCR was performed in the LightCycler 96 Real-Time PCR System (Roche Diagnostics GmbH, Mannheim, Germany).
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
We used the following primers for the SOX-2 gene: SOX-2-F: GCTACAGCATGATGCAGGACCA; SOX-2-R: TCTGCGAGCTGGTCATGGAGTT; RHODOPSIN-F: AGCTCGTCTTCACCGTCAAGGA; RHODOPSIN-R: CCAGCAGATCAGGAAAGCGATG.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The GAPDH gene was used as a housekeeping gene for all experimental samples: GAPDH-F: TCGGAGTCAACGGATTTGGT; GAPDH-R: GAATTTGCCATGGGTGGAAT.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Gene expression levels were calculated using the 2 method.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
All the results are expressed as the mean ± SEM (standard error of the mean) of at least three independent experiments.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Statistically significant differences were assessed using Prism 6.05 (GraphPad PRISM Software, Inc., La Jolla, CA, USA) with Student’s t-test for statistical comparison between groups.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Differences between means were considered statistically significant when p-values were at least <0.05.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The results showed that MIO-M1 Müller cells exhibit distinct responses to different glucose treatments, which are strongly dependent on their metabolic environment.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
This differential response could have implications for the onset and progression of diabetic retinopathy.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
The increased levels of activation and dedifferentiation markers observed in NG MIO-M1 cells in response to different glucose treatments suggest a protective response that may occur in early or well-controlled diabetes.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
In contrast, the lack of response observed in HG MIO-M1 cells exposed to different glucose treatments may reflect an exhausted gliotic and reprogramming capacity, which could contribute to the development and progression of diabetic complications such as retinal neurodegeneration and diabetic retinopathy observed in uncontrolled diabetic patients exposed to prolonged metabolic glucose stress.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Although our results provide valuable insights, further in-depth studies are needed to elucidate the mechanisms involved and to explore the potential therapeutic implications for mitigating retinal neurodegeneration associated with diabetes.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
Extending these studies to primary Müller cells in future research would provide a more physiologically relevant system, helping to validate and refine our findings.
PMC11641291
Gliotic Response and Reprogramming Potential of Human Müller Cell Line MIO-M1 Exposed to High Glucose and Glucose Fluctuations.
This approach would provide a deeper understanding of the cellular response to sustained high-glucose and glucose fluctuations and could improve the development of targeted therapeutic strategies for retinal pathologies in human patients.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Human neural organoids, generated from pluripotent stem cells in vitro, are useful tools to study human brain development, evolution and disease.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
However, it is unclear which parts of the human brain are covered by existing protocols, and it has been difficult to quantitatively assess organoid variation and fidelity.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Here we integrate 36 single-cell transcriptomic datasets spanning 26 protocols into one integrated human neural organoid cell atlas totalling more than 1.7 million cells.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Mapping to developing human brain references shows primary cell types and states that have been generated in vitro, and estimates transcriptomic similarity between primary and organoid counterparts across protocols.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
We provide a programmatic interface to browse the atlas and query new datasets, and showcase the power of the atlas to annotate organoid cell types and evaluate new organoid protocols.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Finally, we show that the atlas can be used as a diverse control cohort to annotate and compare organoid models of neural disease, identifying genes and pathways that may underlie pathological mechanisms with the neural models.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
The human neural organoid cell atlas will be useful to assess organoid fidelity, characterize perturbed and diseased states and facilitate protocol development.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Human neural organoids, self-organizing three-dimensional human neural tissues grown in vitro, are becoming powerful tools for studying the mechanisms of human brain development, evolution and disease.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
They can be generated using external patterning factors (for example, morphogens) to guide their development towards certain brain regions or to drive the emergence of specific cell types (guided protocols).
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Conversely, unguided protocols rely on the self-patterning capacity of organoids to generate diverse cell types and states.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Single-cell RNA sequencing (scRNA-seq) is a powerful technology to characterize cell type heterogeneity in complex tissues, and has illuminated a remarkable heterogeneity of diverse progenitor, neuronal and glial cell types that can develop within neural organoids, as well as differentiation trajectories of certain neural lineages.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
The data also enable the comparison of human neural organoid cells to those in the primary human brain, and most analyses have revealed strong similarity in molecular signatures.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Substantial differences have also been reported, including differential gene expression linked to media components and perturbed metabolic signatures associated with glycolysis.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Nevertheless, analysis of organoid tissues supports a useful recapitulation of early brain development, and scRNA-seq methods have been applied to study the molecular basis of neural cell type fate determination, evolutionary differences in primates and pathological changes in neural disorders.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
However, it is unclear which portions of the developing central nervous system can be generated with existing protocols and which ones are still lacking.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
It has also remained challenging to systematically quantify the transcriptomic fidelity of neural organoid cells compared to their primary counterparts.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
In this study, we address these challenges by combining 36 scRNA-seq datasets covering numerous human neural organoid protocols into an integrated transcriptomic cell atlas.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
We establish an analytical pipeline that allows for the comprehensive and quantitative comparison of the organoid atlas to reference atlases of the developing human brain.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
We harmonize annotations of cell populations in the primary and organoid systems, estimate the capacity and precision of different neural organoid protocols to generate different brain regions, and identify primary cell populations that are under-represented in neural organoids.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
We estimate transcriptomic fidelity of neurons in neural organoids, and identify previously described cell stress as a universal factor distinguishing metabolic states of in vitro neurons from primary neurons without strongly affecting core identities of neuronal cell types.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
We map the data of a neural organoid morphogen screen to the integrated atlas to assess regional specificity and generation of new states.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
We also collect 11 scRNA-seq datasets modelling 10 different neural diseases, and map the integrated data to the neural organoid atlas for cell type annotation and differential expression (DE) analysis.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Finally, we show that the atlas can be expanded by projecting new data to the current atlas.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Together, our work provides a rich resource and a new framework to assess the fidelity of neural organoids, characterize perturbed and diseased states and streamline protocol development.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
To build a transcriptomic human neural organoid cell atlas (HNOCA), we collected scRNA-seq data and detailed, harmonized technical and biological metadata from 36 datasets, including 34 published and two as yet unpublished ones (Supplementary Table 1), accounting for 1.77 million cells after consistent preprocessing and quality control (Fig. 1a).
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
The HNOCA represents cell types and states generated with 26 distinct neural organoid differentiation protocols, including three unguided and 23 guided ones, at time points ranging from 7 to 450 days (Fig. 1b).
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
To remove batch effects, we implemented a three-step integration pipeline.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
First, we projected the HNOCA to a single-cell atlas of the developing human brain using reference similarity spectrum (RSS).
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Then, we developed snapseed (Methods) to perform preliminary marker-based hierarchical cell type annotation.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Last, we used scPoli for label-aware data integration based on the snapseed annotations.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Evaluation of different integration approaches using a previously established benchmarking pipeline showed that scPoli had the best performance for these datasets (Extended Data Fig. 1).
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
We performed clustering on the basis of the scPoli representation and annotated clusters on the basis of canonical marker gene expression, organoid sample age and the auto-generated cell type labels.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
A uniform manifold approximation and projection (UMAP) embedding highlighted three neuronal differentiation trajectories corresponding to dorsal telencephalic, ventral telencephalic and non-telencephalic populations as well as trajectories leading from progenitors to glial cell types such as astrocytes and oligodendrocytes precursors (Fig. 1c–e and Extended Data Fig. 2).
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Cells from both unguided and guided protocols were distributed across all trajectories (Fig. 1f).Fig.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
1Integrated HNOCA.a, Overview of HNOCA construction pipeline.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
b, Metadata of biological samples included in HNOCA.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
c–f, UMAP of the integrated HNOCA, coloured by level 2 cell type annotations (c), gene expression profiles of selected markers (d), sample ages (e) and differentiation protocol types (f).
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
g, Proportions of cells assigned to different cell types in the HNOCA.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Every stacked bar represents one biological sample, grouped by datasets and ordered by increasing sample ages.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Top bars show 36 datasets, organoid differentiation protocols, protocol types.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Bottom bars show the sample age.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
h, UMAP of the integrated HNOCA coloured by top-ranked diffusion component (DC1) on the real-time-informed transition matrix between cells.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
The stream arrows visualize the inferred flow of cell states toward more mature cells.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
i, Marker gene expression profiles along cortical pseudotime.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
j, UMAP of non-telencephalic neurons, coloured and labelled by clusters.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
k, Heatmap showing relative expression of selected genes across different non-telencephalic neuron clusters.
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
Coloured dots show cluster identities as shown in j. Cb, cerebellum; ChP, choroid plexus; CP, choroid plexus; Hy, hypothalamus; max.,
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
maximum; MB, midbrain; MH, medulla; min.,
PMC11578878
An integrated transcriptomic cell atlas of human neural organoids.
minimum; Oligo, oligodendrocyte; OPC, oligodendrocyte progenitor cell; PSC, pluripotent stem cell; telen.,