Mardiyyah/TAPT_data_V2_split · Datasets at Hugging Face

PMCID stringclasses 24 values	Title stringclasses 24 values	Sentences stringlengths 2 40.7k
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Fcgr1-Cre mice (Scott et al., 2018) were obtained from Prof. Bernard Malissen, CIML, Marseille and Clec4f-Cre mice (Scott et al., 2018) were crossed with Acvrl1 mice (Park et al., 2008) obtained from Paul Oh, Barrow Neurological Institute, Florida, USA.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Clec4f-Dtr mice (Scott et al., 2016) were crossed to CD45.1 mice (Janvier) for KC depletion and development experiments All mice were used between 6 and 12 weeks of age unless otherwise stated.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	All mice maintained at the VIB (Ghent University) under specific pathogen free conditions.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	All animals were randomly allocated to experimental groups.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	All experiments were performed in accordance with the ethical committee of the Faculty of Science, UGent and VIB.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Piglets (female, 10 weeks old) were purchased at a local farm and transported to the animal facilities of the Faculty of Veterinary Medicine.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The animals were housed in isolation units as blood donors and had access to feed and water ad libitum.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	At 30 weeks of age, the animals were euthanized by intravenous injection of sodium pentobarbital 20% (60mg/2.5kg) and livers were collected.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The animal study was reviewed and approved by the Ethical Committee of the Faculty of Veterinary Medicine (EC2018/55).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Study animals were clinically healthy Leghorn hens of approximately 58 weeks old collected from a commercial farm.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The hens were housed at the Faculty of Veterinary Medicine according to acceptable welfare standards and were observed at least twice daily for health problems.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Feed and water was offered ad libitum.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The chickens were euthanized through intravenous injection (in the wing) with sodium pentobarbital.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The EC approval number of this trial was EC2019/015.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Male Cynomolgus macaques (≥2 years) were sourced from China and supplied by Guangzhou Xiangguan Biotech Co., Ltd and confirmed healthy before being assigned to the study.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Animal handling, husbandry and euthanasia was performed by WuxiAppTec Co., Ltd., China according to local ethical guidelines (AAALAC accredited 2010).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Study animals consists of 4 groups, orally dosed once with a Janssen proprietary immune modulator or vehicle control.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Vehicle control animals only were used in this study.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Liver tissue samples were snap-frozen immediately after euthanasia.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Samples were thawed once before shipping to Ghent for snRNA-seq analysis.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Female syrian hamsters (Janvier) were housed per one or two in ventilated isolator cages at a temperature of 21°C, humidity of 55% and 12:12 dark/light cycles, with access to food and water ad libitum and cage enrichment.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	All hamsters had SPF status at arrival and manipulations were performed in a laminar flow cabinet.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Housing conditions and experimental procedures were approved by the ethical committee of KU Leuven (license P015-2020).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Animals were euthanized at 6-8 weeks of age by intraperitoneal injection of 200 mg/mL sodium pentobarbital and livers were collected for analysis.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Zebrafish were maintained under standard conditions, according to FELASA guidelines (Alestrom et al., 2019).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	All experimental procedures were approved by the ethical committee for animal welfare (CEBEA) from the ULB (Université Libre de Bruxelles) (Protocol #594N).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The following transgenic lines at 6 months of age were used: Tg(mpeg1:EGFP) (Ellett et al., 2011); Tg(kdrl:Cre) (Bertrand et al., 2010); Tg(actb2:loxP-STOP-loxP-DsRed) (Bertrand et al., 2010) enabling macs to be sorted for sequencing as DsRed, GFP double positive cells.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Patient studies were run in collaboration with Ghent University Hospital.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Liver biopsies (1–2mm) were isolated with informed consent from patients undergoing cholecystectomy or gastric bypass.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	In addition, liver biopsies were isolated from healthy adjacent tissue removed during liver resection due to colorectal cancer metastasis.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	In most cases, a second biopsy was also taken to evaluate liver histology.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	A full overview of all patient samples used in this study can be found in Table S6.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Paraffin-embedded human liver samples were obtained through collaboration with Dr. Jan Lerut (Université Catholique de Louvain, UCL).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	All studies were performed in accordance with the ethical committee of the Ghent University Hospital (study numbers: 2015/1334 and 2017/0539).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Liver cells were isolated by either ex vivo digestion (all species, except zebrafish) or in vivo liver perfusion (mice only) and digestion as described previously (Bonnardel et al., 2019; Scott et al., 2016).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Briefly, for ex vivo digestion, livers were isolated, cut into small pieces and incubated with 1mg/ml Collagenase A and 10U/ml DNAse at 37C for 20 mins with shaking.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	For in vivo digestion, after retrograde cannulation, livers were perfused for 1-2mins with an EGTA-containing solution, followed by a 5min (6ml/min) perfusion with 0.2mg/ml collagenase A. Livers were then removed, minced and incubated for 20mins with 0.4mg/ml collagenase A and 10U/ml DNase at 37°C.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	All subsequent procedures were performed at 4°C.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Samples were filtered over a 100μm mesh filter and red blood cells were lysed.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Samples were again filtered over a 40μm mesh filter.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	At this point in vivo digestion samples only were subjected to two centrifugation steps of 1 min at 50g to isolate hepatocytes.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Remaining liver cells (leukocytes, LSECs and HSCs; in vivo protocol) and total cells from the ex vivo digests were centrifuged at 400g for 5mins before proceeding to antibody staining for flow cytometry.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	A combination of Collagenase A and DNase were used to digest livers in both protocols to minimize cleavage of surface epitopes.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Dissected livers from 6 months old transgenic zebrafish were triturated and treated with Liberase TM at 33°C for 20 min.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Cells were then filtered through 40μm nylon mesh and washed with 2% FBS in PBS by centrifugation.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Sytox Red was then added to the samples at a final concentration of 5nM to exclude nonviable cells before proceeding to flow cytometry.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	DsRedGFP cells were then FACS-purified.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Nuclei were isolated from snap frozen liver tissue with a sucrose gradient as previously described (Habib et al., 2016).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Briefly, frozen liver tissue is homogenized using Kimble Douncer grinder set in 1ml homogenization buffer with RNAse inhibitors.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Homogenised tissue is then is then subjected to density gradient (29% cushion – Optiprep) ultracentrifugation (7700rpm, 4C, 30 mins).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	After resuspension, nuclei are stained with DAPI and intact nuclei were FACS-purified from remaining debris.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	To induce NAFLD and NASH, mice were fed a western diet (WD) high in fat, sugar and cholesterol for 24 or 36 weeks as described previously (Remmerie et al., 2020).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	This consisted of 58% fat, 1% cholesterol (Research Diets; D09061703i) and drinking water was supplemented with 23.1g/L fructose (MPBio) and 18.9g/L sucrose (VWR).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Control mice were fed a standard diet with 11kcal% fat with corn starch (D12328i; Research Diets).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Cells were pre-incubated with 2.4G2 antibody (Bioceros) to block Fc receptors and stained with appropriate antibodies at 4°C in the dark for 30-45 minutes.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Cell viability was assessed using Fixable Viability dyes (eFluor780 or eFluor506; Thermo Fischer) and cell suspensions were analyzed with a BD FACSymphony or purified using a BD Symphony S6, BD FACSAria II or III.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Nuclei were sorted on basis of DAPI positivity and size.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Analysis was performed with FlowJo software (BD).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Intracellular staining for CD207 was performed by fixing and permeabilizing extracellularly stained cells according to the manufacturer’s instructions using the FoxP3 Fixation/Permeabilization Kit (Thermo Fischer).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Confocal staining was performed as described previously (Bonnardel et al., 2019).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Immediately after sacrificing mice with CO2, inferior vena cava were cannulated and livers were perfused (4 mL/min) with Antigenfix (Diapath) for 5 min at room temperature.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	After excision, 2-3 mm slices of livers were fixed further by immersion in Antigenfix for 1h at 4°C, washed in PBS, infused overnight in 34% sucrose and frozen in Tissue-Tek OCT compound (Sakura Finetek).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	20 μm-thick slices cut on a cryostat (Microm HM 560, Thermo Scientific) were rehydrated in PBS for 5 min, permeabilized with 0,5% saponin and non-specific binding sites were blocked for 30 min with 2% bovine serum albumin, 1% fetal calf serum and 1% donkey or goat serum for 30 minutes.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Tissue sections were labeled overnight at 4°C with primary antibodies followed by incubation for 1h at room temperature with secondary antibodies.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	When two rat antibodies were used on the same section, the directly conjugated rat antibody was incubated for 1h after staining with the unconjugated and anti-rat secondary and after an additional blocking step with 1% rat serum for 30 minutes.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Slides were mounted in ProLong Diamond, imaged with a Zeiss LSM780 confocal microscope (Carl Zeiss, Oberkochen, Germany) with spectral detector and using spectral unmixing and analyzed using ImageJ and QuPath software.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Experiments were performed using the RNAScope Multiplex Fluorescent V2 Assay kit (ACDBio 323100).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Probes targeting intronic regions for Hs-Cd5l (ACDBio 850511), Mfa-Cd5l (ACDBio 873211), Mm-Cd5l (ACDBio 573271), Mm-Flt3 (ACDBio 487861), Mm-Xcr1 (ACDBio 562371), Mm-Mafb (ACDBio 438531) and Mm-Mgl2-O1 (ACDBio 822901) were custom-designed and synthesized.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	They were then labelled with TSA opal 520 (PerkinElmer FP1487001KT), TSA opal 540 (PerkinElmer FP1494001KT), TSA opal 570 (PerkinElmer FP1488001KT), TSA opal 620 (PerkinElmer FP1495001KT) or TSA opal 650 (PerkinElmer FP1496001KT).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Tissues were fixed for 16 hours in AntigenFix (Diapath P0016), dehydrated and embedded in OCT as described above.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Slices were pre-treated with hydrogen peroxide for 10 min and protease III for 20 min.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The recommended Antigen retrieval step was not performed in order to preserve epitope integrity.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Probes were hybridized and amplified according to the manufacturer’s instructions.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Slides were then stained for protein markers as described above.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Mice were euthanized by means of carbon dioxide (CO2) overdose.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The liver was excised and consequently trimmed, on ice, to smaller tissue pieces fitting the 10X Visium capture area.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Trimmed tissue pieces were embedded in Tissue-Tek® O.C.T.™ Compound (Sakura) and snap frozen in isopentane (Sigma) chilled by liquid nitrogen.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Embedded tissue pieces where stored at -80°C until cryosectioning.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	A 10X Visium Spatial Gene expression slide was placed in the cryostat (Cryostar NX70 Thermo Fisher) 30 minutes prior to cutting.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	10 μm sections where cut and placed within the capture area.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Single 10X Visium Spatial Gene expression slides were stored in an airtight container at -80°C until further processing.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	10X Visium cDNA libraries were generated according the manufacturer’s instructions.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	In short: Tissue sections where fixed in chilled Methanol.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	A H&E staining was performed to assess tissue morphology and quality.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Tissue was lysed and reverse transcription was performed followed by second strand synthesis and cDNA denaturation.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	cDNA was transferred to a PCR tube and concentration was determined by qPCR.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Spatially barcoded, full length cDNA was amplified by PCR.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Indexed sequencing libraries where generated via End Repair, A-tailing, adaptor ligation and sample index PCR.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Full length cDNA and indexed sequencing libraries were analyzed using the Qubit 4 fluorometer (Thermo Fisher) and Agilent 2100 BioAnalyzer.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Liver slices were prepared as described above for the classical Visium protocol.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Slices were dried for 1 min at 37°C and subsequently fixed using 1% paraformaldehyde in PBS.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Next, slices were blocked for 30 min (2% BSA, 0.1ug/ul Salmon Sperm, 0.5% Saponin, 1 U/μl protector RNase inhibitor (Roche) in 3X SSC) and incubated with the oligo-conjugated antibody staining mix (2% BSA, 0.1μg/μl Salmon Sperm, 0.5% Saponin, 1 U/μl protector RNase inhibitor, 10uM polyT-blocking oligo (TTTTTTTTTTTTTTTTTTTTTTTTT/3InvdT/), in 3X SSC) for 1h at 4°C.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Slides were mounted (90% glycerol, 1 U/μl protector RNase inhibitor) and imaged on Zeiss Axioscan Z1 at 20X magnification.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	Samples were then processed for a transcriptomic experiment as per manufacturer’s instructions (Visium, 10X Genomics) with modifications to also capture antibody tags.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	In short, tissue was permeabilized using Tissue Removal Enzyme (Tissue Optimization kit, 10x Genomics) for 9 minutes, as determined by a tissue optimization experiment (10X Genomics, Visium Spatial Tissue Optimization).
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	After reverse transcription, 2 μl of 100 μM FB additive primer (CCTTGGCACCCGAGAATTCCA) per sample was added to the second strand synthesis mix.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	During cDNA amplification 1 μl of 0,2 μM FB additive primer (CCTTGGCACCCGAGAATTCCA) was added.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	After cDNA amplification, antibody products and mRNA derived cDNA were separated by 0.6X SPRI select.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	The purified full-length cDNA fraction was quantified by qRT-PCR using KAPA SYBR FAST-qPCR kit on a PCR amplification and detection instrument.
PMC8809252	Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.	After enzymatic fragmentation indexed sequencing libraries were generated via End Repair, A-Tailing, adaptor ligation and sample index PCR.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Fcgr1-Cre mice (Scott et al., 2018) were obtained from Prof. Bernard Malissen, CIML, Marseille and Clec4f-Cre mice (Scott et al., 2018) were crossed with Acvrl1 mice (Park et al., 2008) obtained from Paul Oh, Barrow Neurological Institute, Florida, USA.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Clec4f-Dtr mice (Scott et al., 2016) were crossed to CD45.1 mice (Janvier) for KC depletion and development experiments All mice were used between 6 and 12 weeks of age unless otherwise stated.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

All mice maintained at the VIB (Ghent University) under specific pathogen free conditions.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

All animals were randomly allocated to experimental groups.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

All experiments were performed in accordance with the ethical committee of the Faculty of Science, UGent and VIB.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Piglets (female, 10 weeks old) were purchased at a local farm and transported to the animal facilities of the Faculty of Veterinary Medicine.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The animals were housed in isolation units as blood donors and had access to feed and water ad libitum.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

At 30 weeks of age, the animals were euthanized by intravenous injection of sodium pentobarbital 20% (60mg/2.5kg) and livers were collected.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The animal study was reviewed and approved by the Ethical Committee of the Faculty of Veterinary Medicine (EC2018/55).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Study animals were clinically healthy Leghorn hens of approximately 58 weeks old collected from a commercial farm.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The hens were housed at the Faculty of Veterinary Medicine according to acceptable welfare standards and were observed at least twice daily for health problems.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Feed and water was offered ad libitum.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The chickens were euthanized through intravenous injection (in the wing) with sodium pentobarbital.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The EC approval number of this trial was EC2019/015.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Male Cynomolgus macaques (≥2 years) were sourced from China and supplied by Guangzhou Xiangguan Biotech Co., Ltd and confirmed healthy before being assigned to the study.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Animal handling, husbandry and euthanasia was performed by WuxiAppTec Co., Ltd., China according to local ethical guidelines (AAALAC accredited 2010).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Study animals consists of 4 groups, orally dosed once with a Janssen proprietary immune modulator or vehicle control.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Vehicle control animals only were used in this study.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Liver tissue samples were snap-frozen immediately after euthanasia.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Samples were thawed once before shipping to Ghent for snRNA-seq analysis.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Female syrian hamsters (Janvier) were housed per one or two in ventilated isolator cages at a temperature of 21°C, humidity of 55% and 12:12 dark/light cycles, with access to food and water ad libitum and cage enrichment.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

All hamsters had SPF status at arrival and manipulations were performed in a laminar flow cabinet.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Housing conditions and experimental procedures were approved by the ethical committee of KU Leuven (license P015-2020).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Animals were euthanized at 6-8 weeks of age by intraperitoneal injection of 200 mg/mL sodium pentobarbital and livers were collected for analysis.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Zebrafish were maintained under standard conditions, according to FELASA guidelines (Alestrom et al., 2019).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

All experimental procedures were approved by the ethical committee for animal welfare (CEBEA) from the ULB (Université Libre de Bruxelles) (Protocol #594N).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The following transgenic lines at 6 months of age were used: Tg(mpeg1:EGFP) (Ellett et al., 2011); Tg(kdrl:Cre) (Bertrand et al., 2010); Tg(actb2:loxP-STOP-loxP-DsRed) (Bertrand et al., 2010) enabling macs to be sorted for sequencing as DsRed, GFP double positive cells.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Patient studies were run in collaboration with Ghent University Hospital.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Liver biopsies (1–2mm) were isolated with informed consent from patients undergoing cholecystectomy or gastric bypass.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

In addition, liver biopsies were isolated from healthy adjacent tissue removed during liver resection due to colorectal cancer metastasis.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

In most cases, a second biopsy was also taken to evaluate liver histology.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

A full overview of all patient samples used in this study can be found in Table S6.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Paraffin-embedded human liver samples were obtained through collaboration with Dr. Jan Lerut (Université Catholique de Louvain, UCL).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

All studies were performed in accordance with the ethical committee of the Ghent University Hospital (study numbers: 2015/1334 and 2017/0539).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Liver cells were isolated by either ex vivo digestion (all species, except zebrafish) or in vivo liver perfusion (mice only) and digestion as described previously (Bonnardel et al., 2019; Scott et al., 2016).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Briefly, for ex vivo digestion, livers were isolated, cut into small pieces and incubated with 1mg/ml Collagenase A and 10U/ml DNAse at 37C for 20 mins with shaking.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

For in vivo digestion, after retrograde cannulation, livers were perfused for 1-2mins with an EGTA-containing solution, followed by a 5min (6ml/min) perfusion with 0.2mg/ml collagenase A. Livers were then removed, minced and incubated for 20mins with 0.4mg/ml collagenase A and 10U/ml DNase at 37°C.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

All subsequent procedures were performed at 4°C.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Samples were filtered over a 100μm mesh filter and red blood cells were lysed.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Samples were again filtered over a 40μm mesh filter.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

At this point in vivo digestion samples only were subjected to two centrifugation steps of 1 min at 50g to isolate hepatocytes.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Remaining liver cells (leukocytes, LSECs and HSCs; in vivo protocol) and total cells from the ex vivo digests were centrifuged at 400g for 5mins before proceeding to antibody staining for flow cytometry.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

A combination of Collagenase A and DNase were used to digest livers in both protocols to minimize cleavage of surface epitopes.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Dissected livers from 6 months old transgenic zebrafish were triturated and treated with Liberase TM at 33°C for 20 min.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Cells were then filtered through 40μm nylon mesh and washed with 2% FBS in PBS by centrifugation.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Sytox Red was then added to the samples at a final concentration of 5nM to exclude nonviable cells before proceeding to flow cytometry.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

DsRedGFP cells were then FACS-purified.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Nuclei were isolated from snap frozen liver tissue with a sucrose gradient as previously described (Habib et al., 2016).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Briefly, frozen liver tissue is homogenized using Kimble Douncer grinder set in 1ml homogenization buffer with RNAse inhibitors.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Homogenised tissue is then is then subjected to density gradient (29% cushion – Optiprep) ultracentrifugation (7700rpm, 4C, 30 mins).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

After resuspension, nuclei are stained with DAPI and intact nuclei were FACS-purified from remaining debris.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

To induce NAFLD and NASH, mice were fed a western diet (WD) high in fat, sugar and cholesterol for 24 or 36 weeks as described previously (Remmerie et al., 2020).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

This consisted of 58% fat, 1% cholesterol (Research Diets; D09061703i) and drinking water was supplemented with 23.1g/L fructose (MPBio) and 18.9g/L sucrose (VWR).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Control mice were fed a standard diet with 11kcal% fat with corn starch (D12328i; Research Diets).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Cells were pre-incubated with 2.4G2 antibody (Bioceros) to block Fc receptors and stained with appropriate antibodies at 4°C in the dark for 30-45 minutes.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Cell viability was assessed using Fixable Viability dyes (eFluor780 or eFluor506; Thermo Fischer) and cell suspensions were analyzed with a BD FACSymphony or purified using a BD Symphony S6, BD FACSAria II or III.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Nuclei were sorted on basis of DAPI positivity and size.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Analysis was performed with FlowJo software (BD).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Intracellular staining for CD207 was performed by fixing and permeabilizing extracellularly stained cells according to the manufacturer’s instructions using the FoxP3 Fixation/Permeabilization Kit (Thermo Fischer).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Confocal staining was performed as described previously (Bonnardel et al., 2019).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Immediately after sacrificing mice with CO2, inferior vena cava were cannulated and livers were perfused (4 mL/min) with Antigenfix (Diapath) for 5 min at room temperature.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

After excision, 2-3 mm slices of livers were fixed further by immersion in Antigenfix for 1h at 4°C, washed in PBS, infused overnight in 34% sucrose and frozen in Tissue-Tek OCT compound (Sakura Finetek).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

20 μm-thick slices cut on a cryostat (Microm HM 560, Thermo Scientific) were rehydrated in PBS for 5 min, permeabilized with 0,5% saponin and non-specific binding sites were blocked for 30 min with 2% bovine serum albumin, 1% fetal calf serum and 1% donkey or goat serum for 30 minutes.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Tissue sections were labeled overnight at 4°C with primary antibodies followed by incubation for 1h at room temperature with secondary antibodies.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

When two rat antibodies were used on the same section, the directly conjugated rat antibody was incubated for 1h after staining with the unconjugated and anti-rat secondary and after an additional blocking step with 1% rat serum for 30 minutes.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Slides were mounted in ProLong Diamond, imaged with a Zeiss LSM780 confocal microscope (Carl Zeiss, Oberkochen, Germany) with spectral detector and using spectral unmixing and analyzed using ImageJ and QuPath software.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Experiments were performed using the RNAScope Multiplex Fluorescent V2 Assay kit (ACDBio 323100).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Probes targeting intronic regions for Hs-Cd5l (ACDBio 850511), Mfa-Cd5l (ACDBio 873211), Mm-Cd5l (ACDBio 573271), Mm-Flt3 (ACDBio 487861), Mm-Xcr1 (ACDBio 562371), Mm-Mafb (ACDBio 438531) and Mm-Mgl2-O1 (ACDBio 822901) were custom-designed and synthesized.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

They were then labelled with TSA opal 520 (PerkinElmer FP1487001KT), TSA opal 540 (PerkinElmer FP1494001KT), TSA opal 570 (PerkinElmer FP1488001KT), TSA opal 620 (PerkinElmer FP1495001KT) or TSA opal 650 (PerkinElmer FP1496001KT).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Tissues were fixed for 16 hours in AntigenFix (Diapath P0016), dehydrated and embedded in OCT as described above.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Slices were pre-treated with hydrogen peroxide for 10 min and protease III for 20 min.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The recommended Antigen retrieval step was not performed in order to preserve epitope integrity.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Probes were hybridized and amplified according to the manufacturer’s instructions.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Slides were then stained for protein markers as described above.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Mice were euthanized by means of carbon dioxide (CO2) overdose.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The liver was excised and consequently trimmed, on ice, to smaller tissue pieces fitting the 10X Visium capture area.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Trimmed tissue pieces were embedded in Tissue-Tek® O.C.T.™ Compound (Sakura) and snap frozen in isopentane (Sigma) chilled by liquid nitrogen.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Embedded tissue pieces where stored at -80°C until cryosectioning.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

A 10X Visium Spatial Gene expression slide was placed in the cryostat (Cryostar NX70 Thermo Fisher) 30 minutes prior to cutting.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

10 μm sections where cut and placed within the capture area.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Single 10X Visium Spatial Gene expression slides were stored in an airtight container at -80°C until further processing.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

10X Visium cDNA libraries were generated according the manufacturer’s instructions.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

In short: Tissue sections where fixed in chilled Methanol.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

A H&E staining was performed to assess tissue morphology and quality.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Tissue was lysed and reverse transcription was performed followed by second strand synthesis and cDNA denaturation.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

cDNA was transferred to a PCR tube and concentration was determined by qPCR.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Spatially barcoded, full length cDNA was amplified by PCR.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Indexed sequencing libraries where generated via End Repair, A-tailing, adaptor ligation and sample index PCR.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Full length cDNA and indexed sequencing libraries were analyzed using the Qubit 4 fluorometer (Thermo Fisher) and Agilent 2100 BioAnalyzer.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Liver slices were prepared as described above for the classical Visium protocol.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Slices were dried for 1 min at 37°C and subsequently fixed using 1% paraformaldehyde in PBS.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Next, slices were blocked for 30 min (2% BSA, 0.1ug/ul Salmon Sperm, 0.5% Saponin, 1 U/μl protector RNase inhibitor (Roche) in 3X SSC) and incubated with the oligo-conjugated antibody staining mix (2% BSA, 0.1μg/μl Salmon Sperm, 0.5% Saponin, 1 U/μl protector RNase inhibitor, 10uM polyT-blocking oligo (TTTTTTTTTTTTTTTTTTTTTTTTT/3InvdT/), in 3X SSC) for 1h at 4°C.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Slides were mounted (90% glycerol, 1 U/μl protector RNase inhibitor) and imaged on Zeiss Axioscan Z1 at 20X magnification.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

Samples were then processed for a transcriptomic experiment as per manufacturer’s instructions (Visium, 10X Genomics) with modifications to also capture antibody tags.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

In short, tissue was permeabilized using Tissue Removal Enzyme (Tissue Optimization kit, 10x Genomics) for 9 minutes, as determined by a tissue optimization experiment (10X Genomics, Visium Spatial Tissue Optimization).

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

After reverse transcription, 2 μl of 100 μM FB additive primer (CCTTGGCACCCGAGAATTCCA) per sample was added to the second strand synthesis mix.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

During cDNA amplification 1 μl of 0,2 μM FB additive primer (CCTTGGCACCCGAGAATTCCA) was added.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

After cDNA amplification, antibody products and mRNA derived cDNA were separated by 0.6X SPRI select.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

The purified full-length cDNA fraction was quantified by qRT-PCR using KAPA SYBR FAST-qPCR kit on a PCR amplification and detection instrument.

PMC8809252

Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches.

After enzymatic fragmentation indexed sequencing libraries were generated via End Repair, A-Tailing, adaptor ligation and sample index PCR.