PMCID
stringclasses 24
values | Title
stringclasses 24
values | Sentences
stringlengths 2
40.7k
|
|---|---|---|
PMC11075828
|
Direct and indirect effects of CYTOR lncRNA regulate HIV gene expression.
|
Primers on the HIV promoter: NFκB forward: 5’ - AGGTTTGACAGCCGCCTA -3’ NFκB Reverse: 5’ - AGAGACCCAGTACAGGCAAAA -3’ gapdh Forward: 5’ - AGCCACATCGCTCAGACAC -3’ gapdh Reverse: 5’ - GCCCAAACGACCAAATCC -3’ Primers for CYTOR: Forward: 5’- AACTTGCCAGCCTCCATC; Reverse: 5’- GAGCTTCCTGTTTCATCTCCC Primers for 7SK: Forward; 5‘- GAGGGCGATCTGGCTGCGACAT Reverse: 5‘- ACATGGAGCGGTGAGGGAGGAA Statistical evaluation was performed with GraphPad Prism 7 using two-way ANOVA with no correction for multiple comparisons.
|
PMC11075828
|
Direct and indirect effects of CYTOR lncRNA regulate HIV gene expression.
|
Number of independent data points refers to biological replicates.
|
PMC11075828
|
Direct and indirect effects of CYTOR lncRNA regulate HIV gene expression.
|
Each data point, as mentioned in the figure legends, represents the mean of 3–4 independent experiments with the errors calculated based on mean ± SD.
|
PMC11075828
|
Direct and indirect effects of CYTOR lncRNA regulate HIV gene expression.
|
Differences were considered statistically significant and denoted as ***p≤0.05; n.s.,
|
PMC11075828
|
Direct and indirect effects of CYTOR lncRNA regulate HIV gene expression.
|
not significant.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Gastrointestinal stromal tumors (GISTs) are typical gastrointestinal tract neoplasms.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Imatinib is the first-line therapy for GIST patients.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Drug resistance limits the long-term effectiveness of imatinib.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The regulatory effect of insulin-like growth factor 2 (IGF2) has been confirmed in various cancers and is related to resistance to chemotherapy and a worse prognosis.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
To further investigate the mechanism of IGF2 specific to GISTs.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
IGF2 was screened and analyzed using Gene Expression Omnibus (GEO: GSE225819) data.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
After IGF2 knockdown or overexpression by transfection, the phenotypes (proliferation, migration, invasion, apoptosis) of GIST cells were characterized by cell counting kit 8, Transwell, and flow cytometry assays.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We used western blotting to evaluate pathway-associated and epithelial-mesenchymal transition (EMT)-associated proteins.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We injected transfected cells into nude mice to establish a tumor xenograft model and observed the occurrence and metastasis of GIST.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Data from the GEO indicated that IGF2 expression is high in GISTs, associated with liver metastasis, and closely related to drug resistance.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GIST cells with high expression of IGF2 had increased proliferation and migration, invasiveness and EMT.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Knockdown of IGF2 significantly inhibited those activities.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
In addition, OE-IGF2 promoted GIST metastasis in vivo in nude mice.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
IGF2 activated IGF1R signaling in GIST cells, and IGF2/IGF1R-mediated glycolysis was required for GIST with liver metastasis.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GIST cells with IGF2 knockdown were sensitive to imatinib treatment when IGF2 overexpression significantly raised imatinib resistance.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Moreover, 2-deoxy-D-glucose (a glycolysis inhibitor) treatment reversed IGF2 overexpression-mediated imatinib resistance in GISTs.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
IGF2 targeting of IGF1R signaling inhibited metastasis and decreased imatinib resistance by driving glycolysis in GISTs.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Core Tip: Our study found that insulin-like growth factor 2 (IGF2) regulated metastasis and imatinib resistance in gastrointestinal stromal tumors (GISTs).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
IGF2 interacted with IGF1R to regulate glycolysis.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Our results confirm that IGF2 targeting of IGF1R signaling inhibited metastasis and improved imatinib chemosensitivity by driving glycolysis in GISTs and indicated that IGF2 might be used to reverse imatinib resistance in GIST patients.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Primary gastrointestinal stromal tumors (GISTs) account for 2% of gastrointestinal tumors.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GISTs are encoded by the receptor tyrosine kinase gene KIT or PDGFRA.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
These mutations cause ligand-dependent activation and constitutive activation of signal transduction mediated by PDGFRA or KIT.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The downstream molecular pathways of the KIT mutation include PI3K/AKT, JAK-STAT, Src family kinases, and Ras-ERK).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Activation of molecular pathways follows KIT activation and leads to the occurrence of GISTs tumors by activation of cell proliferation and inhibition of apoptosis signals .
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Imatinib remains the primary treatment of GIST patients with advanced or metastatic tumors.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Imatinib significantly improves the prognosis of patients in the advanced stages of the disease, but those undergoing imatinib treatment often encounter challenges associated with both primary and secondary drug resistance, which, unfortunately, restricts long-term efficacy.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Insulin-like growth factor 2 (IGF2) is a genomic imprinting gene in growth on the chromosome 11 short arm.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
IGF2 overexpression is observed in a variety.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
of cancers and is related to chemotherapy resistance and a worse prognosis[12-14].
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Studies of IGF1R have increased recently.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Insulin-like growth factor (IGF) is comprised of the two ligands IGF1 and IGF2, their target tyrosine kinase receptors, IGF1 receptor (IGF1R) and the insulin receptor, as well as the IGF2 receptor (IGF2R) and IGF-binding proteins that regulate IGF ligand availability.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
IGF1R, is a tyrosine kinase receptor with binding affinity for both IGF1 and IGF2 ligands.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Upon ligand binding, the activated tyrosine kinase domain initiates signaling cascades that specifically activate the GPTase Ras-Raf-ERK/MAPK and PI3K-AKT/mTOR pathways.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
These pathways, regulate the proliferation rate and apoptosis of cancer cells.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The IGF pathway family gene expression (such as IGF1, IGF2, and IGF1R) has been reported to distinguish subsets of GISTs wild type for KIT and PDGFRA.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Although data on IGF1R in GISTs have been reported[20-22], further research on the mechanisms of IGF2 and IGF1R in GISTs is needed.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Sequencing data from the Gene Expression Omnibus (GEO) database (GSE225819 and GSE155880) were examined by bioinformatics.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We found that IGF2 acted as a cancer-promoting factor and was involved in cell proliferation, apoptosis, liver metastasis, and epithelial-mesenchymal transition (EMT) in GISTs.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Moreover, the role of IGF2 in GIST cells and the IGF2-IGF1R regulatory axis contributed to imatinib resistance of GISTs by regulating glycolysis and represents a target for GISTs therapy.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Gene expression data based on RNA sequencing were obtained from the GEO.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Two eligible datasets (GSE225819, GSE155880) were combined.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The aligned reads were calculated by FeatureCounts (subread/2.0, http://subread.sourceforge.net/) and differentially expressed genes (DEGs) were analyzed by the R package DESeq2/3.1.0 (https://bioconductor.org/packages/release/bioc/html/DESeq2.html).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
A total of 2578 DEGs (1398 downregulated, and 1188 upregulated) were identified by screening GSE225819, including 20 normal samples and 20 GISTs samples with liver metastasis (|log2FC| > 1; P < 0.05) (Supplementary Table 1).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Based on Deseq2, 1386 DEGs (939 downregulated, and 447 upregulated) were identified by screened GSE155880 including seven Imatinib-sensitive samples and seven imatinib-resistant GIST patients (|log2FC| > 1; P < 0.05) (Supplementary Table 2).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
RGM-1 normal human gastric mucosal cells, GIST882, and GIST-T1 cells were cultured in Iscove's modified Dulbecco's medium containing10% fetal bovine serum and 1% antibiotics, The culture temperature was 37 °C with 5% CO2.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The imatinib concentration was increased from 1 nM to 100 nM over 10 mon and repeated to obtain imatinib-resistant GIST882 (GIST882-R) and GISTT1 (GISTT1R) cells.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GIST882 and GIST-T1 cells were transfected with OE-IGF2, sh-IGF2 plasmids and sh-NC, OE-NC negative controls (RiboBio, Beijing, China) using Lipofectamine 3000 (Invitrogen, Waltham, MA, United States) and cultured for 2 d. Transfection efficiency was determined by western blotting.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Imatinib mesylate was purchased from Selleckchem (Houston, TX, United States).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GIST-T1 and GIST-882 cells were treated with serial dilutions of 1 μM imatinib in dimethyl sulfoxide for 4 h. We lysed transfected cells with RIPA buffer, the total protein was purified, and the protein concentration was determined with bicinchoninic kits (ThermoFisher Scientific, Waltham, MA, United States).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The proteins were resolved by 10% SDS-PAGE and transferred to PVDF membranes for incubation with anti-IGF2 (1:1000, ab177467; Abcam, Cambridge, United Kingdom), anti-vimentin (1:1000, ab92547; Abcam), anti-N-cadherin (1:1000, ab76011; Abcam), anti-E-cadherin (1:1000, ab40772; Abcam), anti-Twist1 (1:1000, ab50887; Abcam), anti-IGF1R (1:1000, ab182408; Abcam), anti-p-IGF1R (1:1000, ab39398; Abcam), anti-PI3K (1:1000, ab302958; Abcam), anti-AKT (1:1000, MA5-14916; Invitrogen), anti-phospho-AKT (1:1000, PA5-95669; Invitrogen), and anti-β-actin (1:1000, ab8227; Abcam) primary antibodies overnight at 4 °C after blocking with skimmed milk (5%).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
After washing the primary antibodies away, the proteins were incubated with the anti-rabbit secondary antibody (1:5000; SA00001-2; SanYing Biotechnology Inc, Wuhan, China) for 1 h. The protein bands were visualized using an ECL chemiluminescence system, and the protein blots were quantified with Image J. The concentration of IGF2 was measured using ELISA kits (Abcam) according to the manufacturer′s instructions.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The samples were prepared from cell culture supernatants and the IGF2 concentration was measured at 450 nm using a microplate reader.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We determined GIST cell proliferation by cell counting kit-8 (CCK-8) assay.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
OE-IGF2- or sh-IGF2-transfected GIST882 and GIST-T1 cells were added to 96-well plates (1 × 10/well).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
After 1 d, we added CCK-8 reagent (10 μL, Catalog No. AD10; Dojindo Molecular Technologies, Kumamoto, Japan) to each well at room temperature.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Absorbance was monitored at 0, 24, 48, 72, and 96 h and the half inhibitory concentration of imatinib was determined at 450 nm.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
After overnight incubation, the cells were treated with imatinib at 0, 20, 40, 60, and 80 μmol/L for 48 h. CompuSyn software was used to calculate the combination index using the Chou-Talalay method to determine the antagonistic influence.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
For the migration assay, GIST cells were seeded into 8 µm well Transwell chambers (Corning; Corning, NY, United States).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The upper chamber was filled with 200 µL serum-free medium containing 2 × 10 cells and the lower chamber was filled with 500 μL complete medium (10% FBS).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
After 48 h, the cells were fixed with formaldehyde and stained with 0.2% crystal violet for 10 min.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
To assay cell invasion, 500 μL culture supernatant was collected from transfected cells and added to the upper Transwell chamber.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GIST cells (2 × 10 cells) in about 200 μL serum-free medium were added to the lower chamber.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The cells were cultured for 2 d at 37 °C with 5% CO2.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
After culturing, cells remaining in the lower chamber were removed with cotton swabs and those in the upper chamber were stained with 0.2% crystal violet for 5 min.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We used an inverted microscope to count the cells that had migrated through the membrane and invaded the upper chamber.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We bought 5-wk-old; male BALB/c nude mice from Vital River Laboratories (Beijing, China) and housed them for 1 wk to adapt to the environment.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GIST-T1 cells (5 × 10) transfected with OE-IGF2/OE-NC, sh-IGF2/sh-NC were injected into the inguinal skin and the mice were monitored for growth of the tumor for 7 d before being randomized to four groups and treated with imatinib 50 mg/kg daily.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
After 4 wk, we killed the mice with an overdose of pentobarbital.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
All animal experiments were approved by the Animal Ethics Committee of Beijing Viewsolid Biotechnology Co. LTD (Protocol No. VS2126A00170) and all methods followed the ARRIVE guidelines.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We fixed the liver tissue of mice in neutral formalin (10%), embedded it in paraffin, cut the tissue into 4 µm sections, and stained it with hematoxylin and eosin (HE).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The sections were observed with a microscope.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Cells were incubated in commercial seahorse XF assay medium plus pyruvate (1 mmol/L), glucose (10 mmol/L) and glutamine (2 mmol/L) 37 °C for 1 h in a CO2-free incubator.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The rate of extracellular acidification was measured before and after addition of oligomycin, glucose, and 2-deoxy-D-glucose (2-DG).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
FCCP, a mitochondrial uncoupling agent; oligomycin, an ATP synthase inhibitor; 2-DG, a glycolysis inhibitor; rotenone; and antimycin A were added and metabolic energy consumption was assayed with a Seahorse XF96 Analyzer (Agilent, Santa Clara, CA, United States).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The concentration of lactate in transfected cells was determined by ELISA with lactate assay kits (MAK064; Sigma-Aldrich, St Louis, MO, United States) according to the manufacturer’s protocol.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The optical density of each well was determined at 570 nm (Plate Reader AF2000; Eppendorf, Waltham, MA, United States).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
GIST cell apoptosis was assayed by flow cytometry (LSRII; BD Biosciences, Franklin Lakes, NJ, United States).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
using annexin V-FITC apoptosis detection kits.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The apoptosis rate was determined by analysis of Q2 and Q3 quadrant cells.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We used GraphPad Prism 7.0 for data analysis.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Data were reported as mean ± standard deviation of three independent experiments.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Single-group comparisons were done with Student’s t-tests.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Multiple group differences were compared by analysis of variance.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
P < 0.05 indicated significance.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Based on the limma R package, a total of 2578 (DEGs 1398 downregulated and 1188 upregulated) were screened out from GEO: GSE225819 data, including 20 normal samples and 20 GIST samples with liver metastasis (|log2FC| > 1; P < 0.05), suggesting that these DEGs may be involved in liver metastasis in GIST patients (Figure 1A).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The top 10 upregulated genes were PENK, IGF2, GPR20, CTSL, SCRG1, PNMAL1, NKX3-2, ANO1, PLAT, and BCHE.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The top 10 downregulated genes were ATP4B, GKN1, MT1G, GKN2, ATP4A, SPINK1, TSPAN8, TFF1, KCNE2, and REG1A (Supplementary Table 1).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Based on the Deseq2, 1386 DEGs (939 downregulated and 447 upregulated) were screened out in GSE155880, including seven Imatinib-sensitive samples and seven imatinib-resistant GIST patients (|log2FC| > 1; P < 0.05, Figure 1B).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
The intersection of the two analyses indicated that only IGF2 was involved in the drug resistance regulation and GIST metastasis in these DEGs (Supplementary Table 2).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Moreover, we evaluated IGF2 expression in the GIST cell line.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
By western blotting, expression levels of IGF2 in GIST882, GIST882-R, GIST-T1, and GIST-T1-R were higher than those in normal RGM-1.
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
Furthermore, IGF2 was significantly over expressed in GIST882-R/GIST-T1-R compared with other cell lines GIST882/GIST-T1 (P < 0.01, P < 0.001; Figure 1C).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
In addition, the expression levels of IGF2 in culture supernatants were measured using ELISA and compared (Figure 1D).
|
PMC11334037
|
Insulin-like growth factor 2 targets IGF1R signaling transduction to facilitate metastasis and imatinib resistance in gastrointestinal stromal tumors.
|
We found that the ELISA and western blot results (P < 0.05, P < 0.001) were similar.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.