contestId
int64 0
1.01k
| index
stringclasses 57
values | name
stringlengths 2
58
| type
stringclasses 2
values | rating
int64 0
3.5k
| tags
listlengths 0
11
| title
stringclasses 522
values | time-limit
stringclasses 8
values | memory-limit
stringclasses 8
values | problem-description
stringlengths 0
7.15k
| input-specification
stringlengths 0
2.05k
| output-specification
stringlengths 0
1.5k
| demo-input
listlengths 0
7
| demo-output
listlengths 0
7
| note
stringlengths 0
5.24k
| points
float64 0
425k
| test_cases
listlengths 0
402
| creationTimeSeconds
int64 1.37B
1.7B
| relativeTimeSeconds
int64 8
2.15B
| programmingLanguage
stringclasses 3
values | verdict
stringclasses 14
values | testset
stringclasses 12
values | passedTestCount
int64 0
1k
| timeConsumedMillis
int64 0
15k
| memoryConsumedBytes
int64 0
805M
| code
stringlengths 3
65.5k
| prompt
stringlengths 262
8.2k
| response
stringlengths 17
65.5k
| score
float64 -1
3.99
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
807
|
A
|
Is it rated?
|
PROGRAMMING
| 900
|
[
"implementation",
"sortings"
] | null | null |
Is it rated?
Here it is. The Ultimate Question of Competitive Programming, Codeforces, and Everything. And you are here to answer it.
Another Codeforces round has been conducted. No two participants have the same number of points. For each participant, from the top to the bottom of the standings, their rating before and after the round is known.
It's known that if at least one participant's rating has changed, then the round was rated for sure.
It's also known that if the round was rated and a participant with lower rating took a better place in the standings than a participant with higher rating, then at least one round participant's rating has changed.
In this problem, you should not make any other assumptions about the rating system.
Determine if the current round is rated, unrated, or it's impossible to determine whether it is rated of not.
|
The first line contains a single integer *n* (2<=≤<=*n*<=≤<=1000) — the number of round participants.
Each of the next *n* lines contains two integers *a**i* and *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=4126) — the rating of the *i*-th participant before and after the round, respectively. The participants are listed in order from the top to the bottom of the standings.
|
If the round is rated for sure, print "rated". If the round is unrated for sure, print "unrated". If it's impossible to determine whether the round is rated or not, print "maybe".
|
[
"6\n3060 3060\n2194 2194\n2876 2903\n2624 2624\n3007 2991\n2884 2884\n",
"4\n1500 1500\n1300 1300\n1200 1200\n1400 1400\n",
"5\n3123 3123\n2777 2777\n2246 2246\n2246 2246\n1699 1699\n"
] |
[
"rated\n",
"unrated\n",
"maybe\n"
] |
In the first example, the ratings of the participants in the third and fifth places have changed, therefore, the round was rated.
In the second example, no one's rating has changed, but the participant in the second place has lower rating than the participant in the fourth place. Therefore, if the round was rated, someone's rating would've changed for sure.
In the third example, no one's rating has changed, and the participants took places in non-increasing order of their rating. Therefore, it's impossible to determine whether the round is rated or not.
| 500
|
[
{
"input": "6\n3060 3060\n2194 2194\n2876 2903\n2624 2624\n3007 2991\n2884 2884",
"output": "rated"
},
{
"input": "4\n1500 1500\n1300 1300\n1200 1200\n1400 1400",
"output": "unrated"
},
{
"input": "5\n3123 3123\n2777 2777\n2246 2246\n2246 2246\n1699 1699",
"output": "maybe"
},
{
"input": "2\n1 1\n1 1",
"output": "maybe"
},
{
"input": "2\n4126 4126\n4126 4126",
"output": "maybe"
},
{
"input": "10\n446 446\n1331 1331\n3594 3594\n1346 1902\n91 91\n3590 3590\n2437 2437\n4007 3871\n2797 699\n1423 1423",
"output": "rated"
},
{
"input": "10\n4078 4078\n2876 2876\n1061 1061\n3721 3721\n143 143\n2992 2992\n3279 3279\n3389 3389\n1702 1702\n1110 1110",
"output": "unrated"
},
{
"input": "10\n4078 4078\n3721 3721\n3389 3389\n3279 3279\n2992 2992\n2876 2876\n1702 1702\n1110 1110\n1061 1061\n143 143",
"output": "maybe"
},
{
"input": "2\n3936 3936\n2967 2967",
"output": "maybe"
},
{
"input": "2\n1 1\n2 2",
"output": "unrated"
},
{
"input": "2\n2 2\n1 1",
"output": "maybe"
},
{
"input": "2\n2 1\n1 2",
"output": "rated"
},
{
"input": "2\n2967 2967\n3936 3936",
"output": "unrated"
},
{
"input": "3\n1200 1200\n1200 1200\n1300 1300",
"output": "unrated"
},
{
"input": "3\n3 3\n2 2\n1 1",
"output": "maybe"
},
{
"input": "3\n1 1\n1 1\n2 2",
"output": "unrated"
},
{
"input": "2\n3 2\n3 2",
"output": "rated"
},
{
"input": "3\n5 5\n4 4\n3 4",
"output": "rated"
},
{
"input": "3\n200 200\n200 200\n300 300",
"output": "unrated"
},
{
"input": "3\n1 1\n2 2\n3 3",
"output": "unrated"
},
{
"input": "5\n3123 3123\n2777 2777\n2246 2246\n2245 2245\n1699 1699",
"output": "maybe"
},
{
"input": "2\n10 10\n8 8",
"output": "maybe"
},
{
"input": "3\n1500 1500\n1500 1500\n1600 1600",
"output": "unrated"
},
{
"input": "3\n1500 1500\n1500 1500\n1700 1700",
"output": "unrated"
},
{
"input": "4\n100 100\n100 100\n70 70\n80 80",
"output": "unrated"
},
{
"input": "2\n1 2\n2 1",
"output": "rated"
},
{
"input": "3\n5 5\n4 3\n3 3",
"output": "rated"
},
{
"input": "3\n1600 1650\n1500 1550\n1400 1450",
"output": "rated"
},
{
"input": "4\n2000 2000\n1500 1500\n1500 1500\n1700 1700",
"output": "unrated"
},
{
"input": "4\n1500 1500\n1400 1400\n1400 1400\n1700 1700",
"output": "unrated"
},
{
"input": "2\n1600 1600\n1400 1400",
"output": "maybe"
},
{
"input": "2\n3 1\n9 8",
"output": "rated"
},
{
"input": "2\n2 1\n1 1",
"output": "rated"
},
{
"input": "4\n4123 4123\n4123 4123\n2670 2670\n3670 3670",
"output": "unrated"
},
{
"input": "2\n2 2\n3 3",
"output": "unrated"
},
{
"input": "2\n10 11\n5 4",
"output": "rated"
},
{
"input": "2\n15 14\n13 12",
"output": "rated"
},
{
"input": "2\n2 1\n2 2",
"output": "rated"
},
{
"input": "3\n2670 2670\n3670 3670\n4106 4106",
"output": "unrated"
},
{
"input": "3\n4 5\n3 3\n2 2",
"output": "rated"
},
{
"input": "2\n10 9\n10 10",
"output": "rated"
},
{
"input": "3\n1011 1011\n1011 999\n2200 2100",
"output": "rated"
},
{
"input": "2\n3 3\n5 5",
"output": "unrated"
},
{
"input": "2\n1500 1500\n3000 2000",
"output": "rated"
},
{
"input": "2\n5 6\n5 5",
"output": "rated"
},
{
"input": "3\n2000 2000\n1500 1501\n500 500",
"output": "rated"
},
{
"input": "2\n2 3\n2 2",
"output": "rated"
},
{
"input": "2\n3 3\n2 2",
"output": "maybe"
},
{
"input": "2\n1 2\n1 1",
"output": "rated"
},
{
"input": "4\n3123 3123\n2777 2777\n2246 2246\n1699 1699",
"output": "maybe"
},
{
"input": "2\n15 14\n14 13",
"output": "rated"
},
{
"input": "4\n3000 3000\n2900 2900\n3000 3000\n2900 2900",
"output": "unrated"
},
{
"input": "6\n30 3060\n24 2194\n26 2903\n24 2624\n37 2991\n24 2884",
"output": "rated"
},
{
"input": "2\n100 99\n100 100",
"output": "rated"
},
{
"input": "4\n2 2\n1 1\n1 1\n2 2",
"output": "unrated"
},
{
"input": "3\n100 101\n100 100\n100 100",
"output": "rated"
},
{
"input": "4\n1000 1001\n900 900\n950 950\n890 890",
"output": "rated"
},
{
"input": "2\n2 3\n1 1",
"output": "rated"
},
{
"input": "2\n2 2\n1 1",
"output": "maybe"
},
{
"input": "2\n3 2\n2 2",
"output": "rated"
},
{
"input": "2\n3 2\n3 3",
"output": "rated"
},
{
"input": "2\n1 1\n2 2",
"output": "unrated"
},
{
"input": "3\n3 2\n3 3\n3 3",
"output": "rated"
},
{
"input": "4\n1500 1501\n1300 1300\n1200 1200\n1400 1400",
"output": "rated"
},
{
"input": "3\n1000 1000\n500 500\n400 300",
"output": "rated"
},
{
"input": "5\n3123 3123\n2777 2777\n2246 2246\n2246 2246\n3000 3000",
"output": "unrated"
},
{
"input": "2\n1 1\n2 3",
"output": "rated"
},
{
"input": "2\n6 2\n6 2",
"output": "rated"
},
{
"input": "5\n3123 3123\n1699 1699\n2777 2777\n2246 2246\n2246 2246",
"output": "unrated"
},
{
"input": "2\n1500 1500\n1600 1600",
"output": "unrated"
},
{
"input": "5\n3123 3123\n2777 2777\n2246 2246\n2241 2241\n1699 1699",
"output": "maybe"
},
{
"input": "2\n20 30\n10 5",
"output": "rated"
},
{
"input": "3\n1 1\n2 2\n1 1",
"output": "unrated"
},
{
"input": "2\n1 2\n3 3",
"output": "rated"
},
{
"input": "5\n5 5\n4 4\n3 3\n2 2\n1 1",
"output": "maybe"
},
{
"input": "2\n2 2\n2 1",
"output": "rated"
},
{
"input": "2\n100 100\n90 89",
"output": "rated"
},
{
"input": "2\n1000 900\n2000 2000",
"output": "rated"
},
{
"input": "2\n50 10\n10 50",
"output": "rated"
},
{
"input": "2\n200 200\n100 100",
"output": "maybe"
},
{
"input": "3\n2 2\n2 2\n3 3",
"output": "unrated"
},
{
"input": "3\n1000 1000\n300 300\n100 100",
"output": "maybe"
},
{
"input": "4\n2 2\n2 2\n3 3\n4 4",
"output": "unrated"
},
{
"input": "2\n5 3\n6 3",
"output": "rated"
},
{
"input": "2\n1200 1100\n1200 1000",
"output": "rated"
},
{
"input": "2\n5 5\n4 4",
"output": "maybe"
},
{
"input": "2\n5 5\n3 3",
"output": "maybe"
},
{
"input": "5\n1500 1500\n1300 1300\n1200 1200\n1400 1400\n1100 1100",
"output": "unrated"
},
{
"input": "5\n10 10\n9 9\n8 8\n7 7\n6 6",
"output": "maybe"
},
{
"input": "3\n1000 1000\n300 300\n10 10",
"output": "maybe"
},
{
"input": "5\n6 6\n5 5\n4 4\n3 3\n2 2",
"output": "maybe"
},
{
"input": "2\n3 3\n1 1",
"output": "maybe"
},
{
"input": "4\n2 2\n2 2\n2 2\n3 3",
"output": "unrated"
},
{
"input": "2\n1000 1000\n700 700",
"output": "maybe"
},
{
"input": "2\n4 3\n5 3",
"output": "rated"
},
{
"input": "2\n1000 1000\n1100 1100",
"output": "unrated"
},
{
"input": "4\n5 5\n4 4\n3 3\n2 2",
"output": "maybe"
},
{
"input": "3\n1 1\n2 3\n2 2",
"output": "rated"
},
{
"input": "2\n1 2\n1 3",
"output": "rated"
},
{
"input": "2\n3 3\n1 2",
"output": "rated"
},
{
"input": "4\n1501 1500\n1300 1300\n1200 1200\n1400 1400",
"output": "rated"
},
{
"input": "5\n1 1\n2 2\n3 3\n4 4\n5 5",
"output": "unrated"
},
{
"input": "2\n10 10\n1 2",
"output": "rated"
},
{
"input": "6\n3123 3123\n2777 2777\n2246 2246\n2246 2246\n1699 1699\n1900 1900",
"output": "unrated"
},
{
"input": "6\n3123 3123\n2777 2777\n3000 3000\n2246 2246\n2246 2246\n1699 1699",
"output": "unrated"
},
{
"input": "2\n100 100\n110 110",
"output": "unrated"
},
{
"input": "3\n3 3\n3 3\n4 4",
"output": "unrated"
},
{
"input": "3\n3 3\n3 2\n4 4",
"output": "rated"
},
{
"input": "3\n5 2\n4 4\n3 3",
"output": "rated"
},
{
"input": "4\n4 4\n3 3\n2 2\n1 1",
"output": "maybe"
},
{
"input": "2\n1 1\n3 2",
"output": "rated"
},
{
"input": "5\n3123 3123\n2777 2777\n2246 2246\n2246 2246\n2699 2699",
"output": "unrated"
},
{
"input": "3\n3 3\n3 3\n3 4",
"output": "rated"
},
{
"input": "3\n1 2\n2 2\n3 3",
"output": "rated"
},
{
"input": "3\n1 2\n1 2\n1 2",
"output": "rated"
},
{
"input": "2\n2 1\n2 1",
"output": "rated"
},
{
"input": "2\n1 2\n3 4",
"output": "rated"
},
{
"input": "2\n3 2\n2 3",
"output": "rated"
},
{
"input": "3\n1500 1500\n1600 1600\n1600 1600",
"output": "unrated"
},
{
"input": "3\n1 1\n3 3\n4 4",
"output": "unrated"
},
{
"input": "3\n1 1\n2 2\n2 2",
"output": "unrated"
},
{
"input": "2\n10 12\n8 8",
"output": "rated"
},
{
"input": "5\n1200 1200\n1500 1500\n1500 1500\n1500 1500\n1500 1500",
"output": "unrated"
},
{
"input": "2\n1 2\n2 2",
"output": "rated"
},
{
"input": "3\n1500 1400\n1200 1200\n1100 1100",
"output": "rated"
},
{
"input": "2\n10 12\n10 10",
"output": "rated"
},
{
"input": "3\n1500 1500\n1400 1400\n1300 1300",
"output": "maybe"
},
{
"input": "3\n3 3\n4 4\n5 5",
"output": "unrated"
},
{
"input": "3\n2 6\n3 5\n4 4",
"output": "rated"
},
{
"input": "2\n5 6\n4 6",
"output": "rated"
},
{
"input": "4\n10 10\n10 10\n7 7\n8 8",
"output": "unrated"
},
{
"input": "2\n4 4\n3 3",
"output": "maybe"
}
] | 1,623,703,540
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 50
| 77
| 0
|
n = int(input())
count = 0
unrated = 0
may = 0
listX = []
listY = []
x , y = input().split()
listX.append(x)
listY.append(y)
for a in range(1 , n):
x , y = input().split()
listX.append(x)
listY.append(y)
if x != y:
count += 1
else:
if int(listX[a]) > int(listX[a-1]):
unrated += 1
elif int(listX[a]) <= int(listX[a-1]):
may += 1
if count > 0:
print("rated")
elif unrated > 0:
print("unrated")
elif may > 0:
print("maybe")
|
Title: Is it rated?
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Is it rated?
Here it is. The Ultimate Question of Competitive Programming, Codeforces, and Everything. And you are here to answer it.
Another Codeforces round has been conducted. No two participants have the same number of points. For each participant, from the top to the bottom of the standings, their rating before and after the round is known.
It's known that if at least one participant's rating has changed, then the round was rated for sure.
It's also known that if the round was rated and a participant with lower rating took a better place in the standings than a participant with higher rating, then at least one round participant's rating has changed.
In this problem, you should not make any other assumptions about the rating system.
Determine if the current round is rated, unrated, or it's impossible to determine whether it is rated of not.
Input Specification:
The first line contains a single integer *n* (2<=≤<=*n*<=≤<=1000) — the number of round participants.
Each of the next *n* lines contains two integers *a**i* and *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=4126) — the rating of the *i*-th participant before and after the round, respectively. The participants are listed in order from the top to the bottom of the standings.
Output Specification:
If the round is rated for sure, print "rated". If the round is unrated for sure, print "unrated". If it's impossible to determine whether the round is rated or not, print "maybe".
Demo Input:
['6\n3060 3060\n2194 2194\n2876 2903\n2624 2624\n3007 2991\n2884 2884\n', '4\n1500 1500\n1300 1300\n1200 1200\n1400 1400\n', '5\n3123 3123\n2777 2777\n2246 2246\n2246 2246\n1699 1699\n']
Demo Output:
['rated\n', 'unrated\n', 'maybe\n']
Note:
In the first example, the ratings of the participants in the third and fifth places have changed, therefore, the round was rated.
In the second example, no one's rating has changed, but the participant in the second place has lower rating than the participant in the fourth place. Therefore, if the round was rated, someone's rating would've changed for sure.
In the third example, no one's rating has changed, and the participants took places in non-increasing order of their rating. Therefore, it's impossible to determine whether the round is rated or not.
|
```python
n = int(input())
count = 0
unrated = 0
may = 0
listX = []
listY = []
x , y = input().split()
listX.append(x)
listY.append(y)
for a in range(1 , n):
x , y = input().split()
listX.append(x)
listY.append(y)
if x != y:
count += 1
else:
if int(listX[a]) > int(listX[a-1]):
unrated += 1
elif int(listX[a]) <= int(listX[a-1]):
may += 1
if count > 0:
print("rated")
elif unrated > 0:
print("unrated")
elif may > 0:
print("maybe")
```
| 0
|
|
952
|
D
|
I'm Feeling Lucky!
|
PROGRAMMING
| 1,800
|
[
"probabilities"
] | null | null |
You have one chip and one chance to play roulette. Are you feeling lucky?
|
none
|
Print your bet. Your chip must be placed entirely within some square (not on an edge or a corner shared by adjacent squares).
|
[] |
[] |
none
| 0
|
[
{
"input": "1",
"output": "Red"
},
{
"input": "2",
"output": "Red"
}
] | 1,616,563,580
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 61
| 0
|
print ("odd")
|
Title: I'm Feeling Lucky!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have one chip and one chance to play roulette. Are you feeling lucky?
Input Specification:
none
Output Specification:
Print your bet. Your chip must be placed entirely within some square (not on an edge or a corner shared by adjacent squares).
Note:
none
|
```python
print ("odd")
```
| 0
|
|
228
|
A
|
Is your horseshoe on the other hoof?
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party.
|
The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers.
|
Print a single integer — the minimum number of horseshoes Valera needs to buy.
|
[
"1 7 3 3\n",
"7 7 7 7\n"
] |
[
"1\n",
"3\n"
] |
none
| 500
|
[
{
"input": "1 7 3 3",
"output": "1"
},
{
"input": "7 7 7 7",
"output": "3"
},
{
"input": "81170865 673572653 756938629 995577259",
"output": "0"
},
{
"input": "3491663 217797045 522540872 715355328",
"output": "0"
},
{
"input": "251590420 586975278 916631563 586975278",
"output": "1"
},
{
"input": "259504825 377489979 588153796 377489979",
"output": "1"
},
{
"input": "652588203 931100304 931100304 652588203",
"output": "2"
},
{
"input": "391958720 651507265 391958720 651507265",
"output": "2"
},
{
"input": "90793237 90793237 90793237 90793237",
"output": "3"
},
{
"input": "551651653 551651653 551651653 551651653",
"output": "3"
},
{
"input": "156630260 609654355 668943582 973622757",
"output": "0"
},
{
"input": "17061017 110313588 434481173 796661222",
"output": "0"
},
{
"input": "24975422 256716298 337790533 690960249",
"output": "0"
},
{
"input": "255635360 732742923 798648949 883146723",
"output": "0"
},
{
"input": "133315691 265159773 734556507 265159773",
"output": "1"
},
{
"input": "28442865 741657755 978106882 978106882",
"output": "1"
},
{
"input": "131245479 174845575 497483467 131245479",
"output": "1"
},
{
"input": "139159884 616215581 958341883 616215581",
"output": "1"
},
{
"input": "147784432 947653080 947653080 947653080",
"output": "2"
},
{
"input": "94055790 756126496 756126496 94055790",
"output": "2"
},
{
"input": "240458500 511952208 240458500 511952208",
"output": "2"
},
{
"input": "681828506 972810624 972810624 681828506",
"output": "2"
},
{
"input": "454961014 454961014 454961014 454961014",
"output": "3"
},
{
"input": "915819430 915819430 915819430 915819430",
"output": "3"
},
{
"input": "671645142 671645142 671645142 671645142",
"output": "3"
},
{
"input": "132503558 132503558 132503558 132503558",
"output": "3"
},
{
"input": "5 5 999999 6",
"output": "1"
},
{
"input": "1 1 2 5",
"output": "1"
},
{
"input": "2 1 2 3",
"output": "1"
},
{
"input": "1 1 3 5",
"output": "1"
},
{
"input": "1 1 3 3",
"output": "2"
},
{
"input": "2 2 2 1",
"output": "2"
},
{
"input": "3 1 1 1",
"output": "2"
},
{
"input": "1 2 2 2",
"output": "2"
}
] | 1,693,736,911
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 62
| 0
|
try:
s = list(map(int, input().split()))
c = 0
for i in range(len(s) - 1):
if s[i] == s[i + 1]:
c = c + 1
print(c)
except:
pass
|
Title: Is your horseshoe on the other hoof?
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party.
Input Specification:
The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers.
Output Specification:
Print a single integer — the minimum number of horseshoes Valera needs to buy.
Demo Input:
['1 7 3 3\n', '7 7 7 7\n']
Demo Output:
['1\n', '3\n']
Note:
none
|
```python
try:
s = list(map(int, input().split()))
c = 0
for i in range(len(s) - 1):
if s[i] == s[i + 1]:
c = c + 1
print(c)
except:
pass
```
| 0
|
|
143
|
A
|
Help Vasilisa the Wise 2
|
PROGRAMMING
| 1,000
|
[
"brute force",
"math"
] | null | null |
Vasilisa the Wise from the Kingdom of Far Far Away got a magic box with a secret as a present from her friend Hellawisa the Wise from the Kingdom of A Little Closer. However, Vasilisa the Wise does not know what the box's secret is, since she cannot open it again. She hopes that you will help her one more time with that.
The box's lock looks as follows: it contains 4 identical deepenings for gems as a 2<=×<=2 square, and some integer numbers are written at the lock's edge near the deepenings. The example of a lock is given on the picture below.
The box is accompanied with 9 gems. Their shapes match the deepenings' shapes and each gem contains one number from 1 to 9 (each number is written on exactly one gem). The box will only open after it is decorated with gems correctly: that is, each deepening in the lock should be filled with exactly one gem. Also, the sums of numbers in the square's rows, columns and two diagonals of the square should match the numbers written at the lock's edge. For example, the above lock will open if we fill the deepenings with gems with numbers as is shown on the picture below.
Now Vasilisa the Wise wants to define, given the numbers on the box's lock, which gems she should put in the deepenings to open the box. Help Vasilisa to solve this challenging task.
|
The input contains numbers written on the edges of the lock of the box. The first line contains space-separated integers *r*1 and *r*2 that define the required sums of numbers in the rows of the square. The second line contains space-separated integers *c*1 and *c*2 that define the required sums of numbers in the columns of the square. The third line contains space-separated integers *d*1 and *d*2 that define the required sums of numbers on the main and on the side diagonals of the square (1<=≤<=*r*1,<=*r*2,<=*c*1,<=*c*2,<=*d*1,<=*d*2<=≤<=20). Correspondence between the above 6 variables and places where they are written is shown on the picture below. For more clarifications please look at the second sample test that demonstrates the example given in the problem statement.
|
Print the scheme of decorating the box with stones: two lines containing two space-separated integers from 1 to 9. The numbers should be pairwise different. If there is no solution for the given lock, then print the single number "-1" (without the quotes).
If there are several solutions, output any.
|
[
"3 7\n4 6\n5 5\n",
"11 10\n13 8\n5 16\n",
"1 2\n3 4\n5 6\n",
"10 10\n10 10\n10 10\n"
] |
[
"1 2\n3 4\n",
"4 7\n9 1\n",
"-1\n",
"-1\n"
] |
Pay attention to the last test from the statement: it is impossible to open the box because for that Vasilisa the Wise would need 4 identical gems containing number "5". However, Vasilisa only has one gem with each number from 1 to 9.
| 500
|
[
{
"input": "3 7\n4 6\n5 5",
"output": "1 2\n3 4"
},
{
"input": "11 10\n13 8\n5 16",
"output": "4 7\n9 1"
},
{
"input": "1 2\n3 4\n5 6",
"output": "-1"
},
{
"input": "10 10\n10 10\n10 10",
"output": "-1"
},
{
"input": "5 13\n8 10\n11 7",
"output": "3 2\n5 8"
},
{
"input": "12 17\n10 19\n13 16",
"output": "-1"
},
{
"input": "11 11\n17 5\n12 10",
"output": "9 2\n8 3"
},
{
"input": "12 11\n11 12\n16 7",
"output": "-1"
},
{
"input": "5 9\n7 7\n8 6",
"output": "3 2\n4 5"
},
{
"input": "10 7\n4 13\n11 6",
"output": "-1"
},
{
"input": "18 10\n16 12\n12 16",
"output": "-1"
},
{
"input": "13 6\n10 9\n6 13",
"output": "-1"
},
{
"input": "14 16\n16 14\n18 12",
"output": "-1"
},
{
"input": "16 10\n16 10\n12 14",
"output": "-1"
},
{
"input": "11 9\n12 8\n11 9",
"output": "-1"
},
{
"input": "5 14\n10 9\n10 9",
"output": "-1"
},
{
"input": "2 4\n1 5\n3 3",
"output": "-1"
},
{
"input": "17 16\n14 19\n18 15",
"output": "-1"
},
{
"input": "12 12\n14 10\n16 8",
"output": "9 3\n5 7"
},
{
"input": "15 11\n16 10\n9 17",
"output": "7 8\n9 2"
},
{
"input": "8 10\n9 9\n13 5",
"output": "6 2\n3 7"
},
{
"input": "13 7\n10 10\n5 15",
"output": "4 9\n6 1"
},
{
"input": "14 11\n9 16\n16 9",
"output": "-1"
},
{
"input": "12 8\n14 6\n8 12",
"output": "-1"
},
{
"input": "10 6\n6 10\n4 12",
"output": "-1"
},
{
"input": "10 8\n10 8\n4 14",
"output": "-1"
},
{
"input": "14 13\n9 18\n14 13",
"output": "-1"
},
{
"input": "9 14\n8 15\n8 15",
"output": "-1"
},
{
"input": "3 8\n2 9\n6 5",
"output": "-1"
},
{
"input": "14 17\n18 13\n15 16",
"output": "-1"
},
{
"input": "16 14\n15 15\n17 13",
"output": "9 7\n6 8"
},
{
"input": "14 11\n16 9\n13 12",
"output": "9 5\n7 4"
},
{
"input": "13 10\n11 12\n7 16",
"output": "4 9\n7 3"
},
{
"input": "14 8\n11 11\n13 9",
"output": "8 6\n3 5"
},
{
"input": "12 11\n13 10\n10 13",
"output": "-1"
},
{
"input": "6 5\n2 9\n5 6",
"output": "-1"
},
{
"input": "7 8\n8 7\n12 3",
"output": "-1"
},
{
"input": "7 11\n7 11\n6 12",
"output": "-1"
},
{
"input": "8 5\n11 2\n8 5",
"output": "-1"
},
{
"input": "10 16\n14 12\n14 12",
"output": "-1"
},
{
"input": "7 9\n4 12\n5 11",
"output": "-1"
},
{
"input": "11 13\n19 5\n12 12",
"output": "-1"
},
{
"input": "8 12\n5 15\n11 9",
"output": "2 6\n3 9"
},
{
"input": "16 5\n13 8\n10 11",
"output": "9 7\n4 1"
},
{
"input": "3 14\n8 9\n10 7",
"output": "2 1\n6 8"
},
{
"input": "12 14\n11 15\n9 17",
"output": "3 9\n8 6"
},
{
"input": "13 7\n9 11\n14 6",
"output": "8 5\n1 6"
},
{
"input": "13 8\n15 6\n11 10",
"output": "9 4\n6 2"
},
{
"input": "9 6\n5 10\n3 12",
"output": "1 8\n4 2"
},
{
"input": "12 7\n5 14\n8 11",
"output": "3 9\n2 5"
},
{
"input": "9 12\n3 17\n10 10",
"output": "-1"
},
{
"input": "3 8\n4 6\n5 5",
"output": "-1"
}
] | 1,549,308,267
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 5
| 218
| 0
|
def main():
r1 = r2 = c1 = c2 = d1 = d2 = None
h1 = h2 = h3 = h4 = 0
for i in range(3):
inp = list(input().split())
if i == 0:
r1 = int(inp[0])
r2 = int(inp[1])
elif i == 1:
c1 = int(inp[0])
c2 = int(inp[1])
else:
d1 = int(inp[0])
d2 = int(inp[1])
for i in range(1, 9, 1):
h1 = i
h2 = abs(r1 - h1)
h3 = abs(c1 - h1)
h4 = abs(c2 - h2)
if h1 != h2 and h1 != h3 and h1 != h4 and h1 != 0 and h2 != 0 and h3 != 0 and h4 != 0 and h1+h4 == d1 and h2+h3 == d2:
print(h1, h2)
print(h3, h4)
return
print(-1)
if __name__ == '__main__' : main()
|
Title: Help Vasilisa the Wise 2
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasilisa the Wise from the Kingdom of Far Far Away got a magic box with a secret as a present from her friend Hellawisa the Wise from the Kingdom of A Little Closer. However, Vasilisa the Wise does not know what the box's secret is, since she cannot open it again. She hopes that you will help her one more time with that.
The box's lock looks as follows: it contains 4 identical deepenings for gems as a 2<=×<=2 square, and some integer numbers are written at the lock's edge near the deepenings. The example of a lock is given on the picture below.
The box is accompanied with 9 gems. Their shapes match the deepenings' shapes and each gem contains one number from 1 to 9 (each number is written on exactly one gem). The box will only open after it is decorated with gems correctly: that is, each deepening in the lock should be filled with exactly one gem. Also, the sums of numbers in the square's rows, columns and two diagonals of the square should match the numbers written at the lock's edge. For example, the above lock will open if we fill the deepenings with gems with numbers as is shown on the picture below.
Now Vasilisa the Wise wants to define, given the numbers on the box's lock, which gems she should put in the deepenings to open the box. Help Vasilisa to solve this challenging task.
Input Specification:
The input contains numbers written on the edges of the lock of the box. The first line contains space-separated integers *r*1 and *r*2 that define the required sums of numbers in the rows of the square. The second line contains space-separated integers *c*1 and *c*2 that define the required sums of numbers in the columns of the square. The third line contains space-separated integers *d*1 and *d*2 that define the required sums of numbers on the main and on the side diagonals of the square (1<=≤<=*r*1,<=*r*2,<=*c*1,<=*c*2,<=*d*1,<=*d*2<=≤<=20). Correspondence between the above 6 variables and places where they are written is shown on the picture below. For more clarifications please look at the second sample test that demonstrates the example given in the problem statement.
Output Specification:
Print the scheme of decorating the box with stones: two lines containing two space-separated integers from 1 to 9. The numbers should be pairwise different. If there is no solution for the given lock, then print the single number "-1" (without the quotes).
If there are several solutions, output any.
Demo Input:
['3 7\n4 6\n5 5\n', '11 10\n13 8\n5 16\n', '1 2\n3 4\n5 6\n', '10 10\n10 10\n10 10\n']
Demo Output:
['1 2\n3 4\n', '4 7\n9 1\n', '-1\n', '-1\n']
Note:
Pay attention to the last test from the statement: it is impossible to open the box because for that Vasilisa the Wise would need 4 identical gems containing number "5". However, Vasilisa only has one gem with each number from 1 to 9.
|
```python
def main():
r1 = r2 = c1 = c2 = d1 = d2 = None
h1 = h2 = h3 = h4 = 0
for i in range(3):
inp = list(input().split())
if i == 0:
r1 = int(inp[0])
r2 = int(inp[1])
elif i == 1:
c1 = int(inp[0])
c2 = int(inp[1])
else:
d1 = int(inp[0])
d2 = int(inp[1])
for i in range(1, 9, 1):
h1 = i
h2 = abs(r1 - h1)
h3 = abs(c1 - h1)
h4 = abs(c2 - h2)
if h1 != h2 and h1 != h3 and h1 != h4 and h1 != 0 and h2 != 0 and h3 != 0 and h4 != 0 and h1+h4 == d1 and h2+h3 == d2:
print(h1, h2)
print(h3, h4)
return
print(-1)
if __name__ == '__main__' : main()
```
| 0
|
|
265
|
A
|
Colorful Stones (Simplified Edition)
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
|
The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
|
Print the final 1-based position of Liss in a single line.
|
[
"RGB\nRRR\n",
"RRRBGBRBBB\nBBBRR\n",
"BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n"
] |
[
"2\n",
"3\n",
"15\n"
] |
none
| 500
|
[
{
"input": "RGB\nRRR",
"output": "2"
},
{
"input": "RRRBGBRBBB\nBBBRR",
"output": "3"
},
{
"input": "BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB",
"output": "15"
},
{
"input": "G\nRRBBRBRRBR",
"output": "1"
},
{
"input": "RRRRRBRRBRRGRBGGRRRGRBBRBBBBBRGRBGBRRGBBBRBBGBRGBB\nB",
"output": "1"
},
{
"input": "RRGGBRGRBG\nBRRGGBBGGR",
"output": "7"
},
{
"input": "BBRRGBGGRGBRGBRBRBGR\nGGGRBGGGBRRRRGRBGBGRGRRBGRBGBG",
"output": "15"
},
{
"input": "GBRRBGBGBBBBRRRGBGRRRGBGBBBRGR\nRRGBRRGRBBBBBBGRRBBR",
"output": "8"
},
{
"input": "BRGRRGRGRRGBBGBBBRRBBRRBGBBGRGBBGGRGBRBGGGRRRBGGBB\nRGBBGRRBBBRRGRRBRBBRGBBGGGRGBGRRRRBRBGGBRBGGGRGBRR",
"output": "16"
},
{
"input": "GGRGGBRRGRGBRRGGRBBGGRRGBBBGBBBGGRBGGBRBBRGBRRRBRG\nGGRGRRRRRRRRRGBBBBRGBRGRGRRGBBRGGBRBBRBGBRGRRRRGGR",
"output": "18"
},
{
"input": "RBBRBGBBGGGBRRBGBRGRRGGRBBBBGRBGGBRRBGBBRBRGBBGGGG\nBRRGRBGRBGBRGBRBGGBBBGBBRGRBGRGRBGRBGGRRBGBRGRRBBG",
"output": "23"
},
{
"input": "RRGGRRBRGRGBRGBRGBBRGGGBRBGBRGBRGGBRBRGBGRRBBGGRBR\nBRGRBBBGRBGRRGGRRRRRRRRGGGGGGGGBGGGGGGGRGRBBRGRGBR",
"output": "14"
},
{
"input": "RBRBRRRRRGGR\nBBBBRRGGBGRBRGBBRGGGRGGBRRBRBRBGGG",
"output": "12"
},
{
"input": "GGRGGGBRGRGRBBRGGGRBGRRR\nGBBBBGBGBGBBBRGGRGGBGRRGRRRGBGB",
"output": "12"
},
{
"input": "RGRBGBRBBGBRRGGGBBGBRRBGRGBBBBBGRRRGGRBB\nBGR",
"output": "2"
},
{
"input": "R\nB",
"output": "1"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR",
"output": "50"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
},
{
"input": "R\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
}
] | 1,646,417,618
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 19
| 92
| 0
|
#Strings always win
W= str(input())
Q = str(input())
n = 0
for i in W:
if i in Q:
n+=1
Q =Q[Q.index(i)+1:]
else:
break
print(n+1)
|
Title: Colorful Stones (Simplified Edition)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
Input Specification:
The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
Output Specification:
Print the final 1-based position of Liss in a single line.
Demo Input:
['RGB\nRRR\n', 'RRRBGBRBBB\nBBBRR\n', 'BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n']
Demo Output:
['2\n', '3\n', '15\n']
Note:
none
|
```python
#Strings always win
W= str(input())
Q = str(input())
n = 0
for i in W:
if i in Q:
n+=1
Q =Q[Q.index(i)+1:]
else:
break
print(n+1)
```
| 3
|
|
435
|
A
|
Queue on Bus Stop
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
It's that time of the year when the Russians flood their countryside summer cottages (dachas) and the bus stop has a lot of people. People rarely go to the dacha on their own, it's usually a group, so the people stand in queue by groups.
The bus stop queue has *n* groups of people. The *i*-th group from the beginning has *a**i* people. Every 30 minutes an empty bus arrives at the bus stop, it can carry at most *m* people. Naturally, the people from the first group enter the bus first. Then go the people from the second group and so on. Note that the order of groups in the queue never changes. Moreover, if some group cannot fit all of its members into the current bus, it waits for the next bus together with other groups standing after it in the queue.
Your task is to determine how many buses is needed to transport all *n* groups to the dacha countryside.
|
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). The next line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*m*).
|
Print a single integer — the number of buses that is needed to transport all *n* groups to the dacha countryside.
|
[
"4 3\n2 3 2 1\n",
"3 4\n1 2 1\n"
] |
[
"3\n",
"1\n"
] |
none
| 500
|
[
{
"input": "4 3\n2 3 2 1",
"output": "3"
},
{
"input": "3 4\n1 2 1",
"output": "1"
},
{
"input": "1 5\n4",
"output": "1"
},
{
"input": "5 1\n1 1 1 1 1",
"output": "5"
},
{
"input": "6 4\n1 3 2 3 4 1",
"output": "5"
},
{
"input": "6 8\n6 1 1 1 4 5",
"output": "3"
},
{
"input": "10 10\n1 10 1 10 1 1 7 8 6 7",
"output": "8"
},
{
"input": "100 100\n85 50 17 89 65 89 5 20 86 26 16 21 85 14 44 31 87 31 6 2 48 67 8 80 79 1 48 36 97 1 5 30 79 50 78 12 2 55 76 100 54 40 26 81 97 96 68 56 87 14 51 17 54 37 52 33 69 62 38 63 74 15 62 78 9 19 67 2 60 58 93 60 18 96 55 48 34 7 79 82 32 58 90 67 20 50 27 15 7 89 98 10 11 15 99 49 4 51 77 52",
"output": "63"
},
{
"input": "10 1\n1 1 1 1 1 1 1 1 1 1",
"output": "10"
},
{
"input": "10 2\n2 2 1 1 1 1 1 2 1 2",
"output": "8"
},
{
"input": "10 3\n1 3 1 1 3 2 2 2 3 3",
"output": "9"
},
{
"input": "10 4\n2 1 1 1 3 4 4 4 1 2",
"output": "6"
},
{
"input": "10 5\n2 2 3 4 4 1 5 3 1 2",
"output": "7"
},
{
"input": "100 3\n1 2 3 2 1 2 2 3 1 3 3 2 2 1 1 2 2 1 1 1 1 2 3 3 2 1 1 2 2 2 3 3 3 2 1 3 1 3 3 2 3 1 2 2 2 3 2 1 1 3 3 3 3 2 1 1 2 3 2 2 3 2 3 2 2 3 2 2 2 2 3 3 3 1 3 3 1 1 2 3 2 2 2 2 3 3 3 2 1 2 3 1 1 2 3 3 1 3 3 2",
"output": "83"
},
{
"input": "100 7\n4 7 4 7 7 4 7 3 5 6 3 5 4 3 7 2 7 2 4 1 6 3 3 7 4 4 5 4 3 6 4 3 2 2 1 4 4 1 7 3 7 7 1 3 1 5 4 1 5 3 5 2 2 1 5 5 1 5 2 7 5 5 1 5 5 4 6 5 1 3 5 6 7 4 1 3 3 4 3 2 7 6 5 7 2 7 1 1 2 2 3 1 3 7 1 3 2 1 1 7",
"output": "71"
},
{
"input": "100 10\n3 4 8 10 8 6 4 3 7 7 6 2 3 1 3 10 1 7 9 3 5 5 2 6 2 9 1 7 4 2 4 1 6 1 7 10 2 5 3 7 6 4 6 2 8 8 8 6 6 10 3 7 4 3 4 1 7 9 3 6 3 6 1 4 9 3 8 1 10 1 4 10 7 7 9 5 3 8 10 2 1 10 8 7 10 8 5 3 1 2 1 10 6 1 5 3 3 5 7 2",
"output": "64"
},
{
"input": "100 15\n3 12 8 3 11 14 12 14 1 11 13 3 5 13 4 14 2 11 7 8 12 9 15 7 15 1 4 11 6 12 1 3 8 13 1 8 14 4 3 14 1 3 1 6 10 15 13 11 12 1 14 13 11 14 11 3 12 7 3 15 14 4 5 6 5 14 7 14 6 2 6 12 6 13 13 1 9 13 15 11 6 3 15 11 9 4 15 8 15 12 1 15 10 10 4 1 15 1 4 1",
"output": "71"
},
{
"input": "100 30\n7 14 22 16 11 13 7 29 20 19 22 6 12 16 1 8 27 21 22 3 15 27 20 12 4 19 1 26 26 22 25 17 29 25 16 29 29 28 16 26 25 14 16 20 5 21 5 15 19 13 17 21 17 19 23 13 1 25 6 30 16 19 12 10 28 8 15 13 14 24 19 30 12 19 22 1 3 14 16 3 20 26 15 19 9 10 19 27 2 16 10 22 15 13 19 3 24 9 8 13",
"output": "71"
},
{
"input": "100 40\n39 19 13 36 11 21 32 12 1 2 39 26 32 39 24 1 4 19 10 4 16 39 32 34 13 24 30 35 3 10 8 18 13 12 39 27 31 40 37 20 17 17 37 5 10 12 22 17 7 1 31 13 11 10 2 6 22 16 2 4 9 27 6 35 22 16 22 30 33 2 26 20 35 19 40 37 19 17 21 28 37 28 40 4 5 4 35 19 26 36 19 12 21 20 21 30 9 16 9 32",
"output": "65"
},
{
"input": "100 50\n2 46 4 6 38 19 15 34 10 35 37 30 3 25 5 45 40 45 33 31 6 20 10 44 11 9 2 14 35 5 9 23 20 2 48 22 25 35 38 31 24 33 35 16 4 30 27 10 12 22 6 24 12 30 23 21 14 12 32 21 7 12 25 43 18 34 34 28 47 13 28 43 18 39 44 42 35 26 35 14 8 29 32 20 29 3 20 6 20 9 9 27 8 42 10 37 42 27 8 1",
"output": "60"
},
{
"input": "100 60\n34 21 39 17 48 46 23 56 46 52 50 39 55 48 54 38 32 38 24 26 44 12 28 9 25 26 10 52 42 60 41 3 16 60 44 29 27 55 19 19 19 57 45 59 29 35 5 14 50 47 57 48 16 7 12 36 58 31 37 58 30 50 19 11 10 41 59 57 49 41 33 9 12 11 53 50 60 51 21 9 44 23 1 16 4 15 17 57 15 17 46 50 18 52 43 24 47 50 19 18",
"output": "74"
},
{
"input": "100 90\n74 65 49 41 3 79 61 83 50 40 13 57 90 14 62 77 36 10 3 5 5 40 50 75 32 26 3 71 79 54 88 50 46 20 42 59 30 36 83 86 60 62 82 68 62 80 18 65 28 28 81 74 62 33 61 35 33 83 90 72 6 6 51 4 22 20 29 10 8 3 84 69 12 17 24 16 12 64 80 74 68 59 1 59 15 59 37 58 79 83 51 56 81 14 37 45 19 31 61 90",
"output": "67"
},
{
"input": "100 99\n69 46 76 47 71 9 66 46 78 17 96 83 56 96 29 3 43 48 79 23 93 61 19 9 29 72 15 84 93 46 71 87 11 43 96 44 54 75 3 66 2 95 46 32 69 52 79 38 57 53 37 60 71 82 28 31 84 58 89 40 62 74 22 50 45 38 99 67 24 28 28 12 69 88 33 10 31 71 46 7 42 81 54 81 96 44 8 1 20 24 28 19 54 35 69 32 71 13 66 15",
"output": "68"
},
{
"input": "90 100\n25 52 88 89 36 17 57 64 66 11 89 61 54 92 48 51 18 42 44 92 6 14 67 100 16 21 17 88 85 73 33 11 94 84 56 72 4 80 90 78 96 5 62 70 54 70 94 80 10 91 100 89 98 87 69 74 88 63 53 79 38 94 89 52 21 82 67 79 100 81 2 40 30 69 34 15 12 33 87 52 95 18 51 30 15 39 30 99 46 84",
"output": "67"
},
{
"input": "5 100\n14 67 15 28 21",
"output": "2"
},
{
"input": "10 100\n2 17 53 94 95 57 36 47 68 48",
"output": "7"
},
{
"input": "1 100\n18",
"output": "1"
},
{
"input": "100 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "100"
},
{
"input": "30 100\n56 7 99 83 2 65 35 53 99 36 42 57 13 37 68 52 87 11 50 23 86 24 32 39 97 6 64 1 18 86",
"output": "18"
},
{
"input": "60 100\n18 75 43 88 45 43 20 59 59 79 62 39 53 21 28 46 54 53 97 81 18 15 2 95 84 9 36 70 30 76 17 19 83 40 45 32 31 70 23 14 44 35 79 84 97 96 99 60 3 73 64 83 6 12 67 86 70 89 18 61",
"output": "40"
},
{
"input": "1 73\n24",
"output": "1"
},
{
"input": "4 4\n1 4 4 4",
"output": "4"
},
{
"input": "2 6\n1 4",
"output": "1"
},
{
"input": "2 5\n5 5",
"output": "2"
}
] | 1,655,936,110
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 46
| 0
|
temp = [int(x) for x in input().split()]
something = [int(x) for x in input().split()]
something = sum(something)
if something % temp[1] != 0:
print((something // 3) + 1)
else:
print(something // 3)
|
Title: Queue on Bus Stop
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It's that time of the year when the Russians flood their countryside summer cottages (dachas) and the bus stop has a lot of people. People rarely go to the dacha on their own, it's usually a group, so the people stand in queue by groups.
The bus stop queue has *n* groups of people. The *i*-th group from the beginning has *a**i* people. Every 30 minutes an empty bus arrives at the bus stop, it can carry at most *m* people. Naturally, the people from the first group enter the bus first. Then go the people from the second group and so on. Note that the order of groups in the queue never changes. Moreover, if some group cannot fit all of its members into the current bus, it waits for the next bus together with other groups standing after it in the queue.
Your task is to determine how many buses is needed to transport all *n* groups to the dacha countryside.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). The next line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*m*).
Output Specification:
Print a single integer — the number of buses that is needed to transport all *n* groups to the dacha countryside.
Demo Input:
['4 3\n2 3 2 1\n', '3 4\n1 2 1\n']
Demo Output:
['3\n', '1\n']
Note:
none
|
```python
temp = [int(x) for x in input().split()]
something = [int(x) for x in input().split()]
something = sum(something)
if something % temp[1] != 0:
print((something // 3) + 1)
else:
print(something // 3)
```
| 0
|
|
66
|
B
|
Petya and Countryside
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] |
B. Petya and Countryside
|
2
|
256
|
Little Petya often travels to his grandmother in the countryside. The grandmother has a large garden, which can be represented as a rectangle 1<=×<=*n* in size, when viewed from above. This rectangle is divided into *n* equal square sections. The garden is very unusual as each of the square sections possesses its own fixed height and due to the newest irrigation system we can create artificial rain above each section.
Creating artificial rain is an expensive operation. That's why we limit ourselves to creating the artificial rain only above one section. At that, the water from each watered section will flow into its neighbouring sections if their height does not exceed the height of the section. That is, for example, the garden can be represented by a 1<=×<=5 rectangle, where the section heights are equal to 4, 2, 3, 3, 2. Then if we create an artificial rain over any of the sections with the height of 3, the water will flow over all the sections, except the ones with the height of 4. See the illustration of this example at the picture:
As Petya is keen on programming, he decided to find such a section that if we create artificial rain above it, the number of watered sections will be maximal. Help him.
|
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=1000). The second line contains *n* positive integers which are the height of the sections. All the numbers are no less than 1 and not more than 1000.
|
Print a single number, the maximal number of watered sections if we create artificial rain above exactly one section.
|
[
"1\n2\n",
"5\n1 2 1 2 1\n",
"8\n1 2 1 1 1 3 3 4\n"
] |
[
"1\n",
"3\n",
"6\n"
] |
none
| 1,000
|
[
{
"input": "1\n2",
"output": "1"
},
{
"input": "5\n1 2 1 2 1",
"output": "3"
},
{
"input": "8\n1 2 1 1 1 3 3 4",
"output": "6"
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10",
"output": "10"
},
{
"input": "10\n10 9 8 7 6 5 4 3 2 1",
"output": "10"
},
{
"input": "2\n100 100",
"output": "2"
},
{
"input": "3\n100 100 100",
"output": "3"
},
{
"input": "11\n1 2 3 4 5 6 5 4 3 2 1",
"output": "11"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 100 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 1 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "61"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 1 82 83 84 85 86 87 88 89 90 91 92 93 94 100 5 4 3 2 1",
"output": "81"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 1 86 87 88 89 90 91 92 93 100 6 5 4 3 2 1",
"output": "85"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 1 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 100 7 6 5 4 3 2 1",
"output": "61"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 100 8 7 6 1 4 3 2 1",
"output": "96"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 100 10 9 8 7 6 5 4 3 2 1",
"output": "100"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 1 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 100 11 10 9 8 7 6 5 4 3 2 1",
"output": "55"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 1 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 100 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "59"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 100 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "86"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 100 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "83"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 100 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 1 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "74"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 100 9 8 7 6 5 4 3 2 1",
"output": "100"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 100 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 1 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "52"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 100 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 1 2 1",
"output": "98"
},
{
"input": "10\n1 4 4 4 4 4 1 2 4 3",
"output": "7"
}
] | 1,578,775,754
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 80
| 964
| 307,200
|
n = int(input())
heights = list(map(int, input().split()))
ranges = []
current_range = 0
for i in range(n):
for j in range(i,n-1):
if heights[j] >= heights[j+1]:
current_range = current_range +1
else:
break
for j in range(i,0,-1):
if heights[j] >= heights[j-1]:
current_range = current_range + 1
else:
break
ranges.append(current_range)
current_range = 0
print(max(ranges)+1)
|
Title: Petya and Countryside
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Petya often travels to his grandmother in the countryside. The grandmother has a large garden, which can be represented as a rectangle 1<=×<=*n* in size, when viewed from above. This rectangle is divided into *n* equal square sections. The garden is very unusual as each of the square sections possesses its own fixed height and due to the newest irrigation system we can create artificial rain above each section.
Creating artificial rain is an expensive operation. That's why we limit ourselves to creating the artificial rain only above one section. At that, the water from each watered section will flow into its neighbouring sections if their height does not exceed the height of the section. That is, for example, the garden can be represented by a 1<=×<=5 rectangle, where the section heights are equal to 4, 2, 3, 3, 2. Then if we create an artificial rain over any of the sections with the height of 3, the water will flow over all the sections, except the ones with the height of 4. See the illustration of this example at the picture:
As Petya is keen on programming, he decided to find such a section that if we create artificial rain above it, the number of watered sections will be maximal. Help him.
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=1000). The second line contains *n* positive integers which are the height of the sections. All the numbers are no less than 1 and not more than 1000.
Output Specification:
Print a single number, the maximal number of watered sections if we create artificial rain above exactly one section.
Demo Input:
['1\n2\n', '5\n1 2 1 2 1\n', '8\n1 2 1 1 1 3 3 4\n']
Demo Output:
['1\n', '3\n', '6\n']
Note:
none
|
```python
n = int(input())
heights = list(map(int, input().split()))
ranges = []
current_range = 0
for i in range(n):
for j in range(i,n-1):
if heights[j] >= heights[j+1]:
current_range = current_range +1
else:
break
for j in range(i,0,-1):
if heights[j] >= heights[j-1]:
current_range = current_range + 1
else:
break
ranges.append(current_range)
current_range = 0
print(max(ranges)+1)
```
| 3.758428
|
268
|
A
|
Games
|
PROGRAMMING
| 800
|
[
"brute force"
] | null | null |
Manao works on a sports TV. He's spent much time watching the football games of some country. After a while he began to notice different patterns. For example, each team has two sets of uniforms: home uniform and guest uniform. When a team plays a game at home, the players put on the home uniform. When a team plays as a guest on somebody else's stadium, the players put on the guest uniform. The only exception to that rule is: when the home uniform color of the host team matches the guests' uniform, the host team puts on its guest uniform as well. For each team the color of the home and guest uniform is different.
There are *n* teams taking part in the national championship. The championship consists of *n*·(*n*<=-<=1) games: each team invites each other team to its stadium. At this point Manao wondered: how many times during the championship is a host team going to put on the guest uniform? Note that the order of the games does not affect this number.
You know the colors of the home and guest uniform for each team. For simplicity, the colors are numbered by integers in such a way that no two distinct colors have the same number. Help Manao find the answer to his question.
|
The first line contains an integer *n* (2<=≤<=*n*<=≤<=30). Each of the following *n* lines contains a pair of distinct space-separated integers *h**i*, *a**i* (1<=≤<=*h**i*,<=*a**i*<=≤<=100) — the colors of the *i*-th team's home and guest uniforms, respectively.
|
In a single line print the number of games where the host team is going to play in the guest uniform.
|
[
"3\n1 2\n2 4\n3 4\n",
"4\n100 42\n42 100\n5 42\n100 5\n",
"2\n1 2\n1 2\n"
] |
[
"1\n",
"5\n",
"0\n"
] |
In the first test case the championship consists of 6 games. The only game with the event in question is the game between teams 2 and 1 on the stadium of team 2.
In the second test sample the host team will have to wear guest uniform in the games between teams: 1 and 2, 2 and 1, 2 and 3, 3 and 4, 4 and 2 (the host team is written first).
| 500
|
[
{
"input": "3\n1 2\n2 4\n3 4",
"output": "1"
},
{
"input": "4\n100 42\n42 100\n5 42\n100 5",
"output": "5"
},
{
"input": "2\n1 2\n1 2",
"output": "0"
},
{
"input": "7\n4 7\n52 55\n16 4\n55 4\n20 99\n3 4\n7 52",
"output": "6"
},
{
"input": "10\n68 42\n1 35\n25 70\n59 79\n65 63\n46 6\n28 82\n92 62\n43 96\n37 28",
"output": "1"
},
{
"input": "30\n10 39\n89 1\n78 58\n75 99\n36 13\n77 50\n6 97\n79 28\n27 52\n56 5\n93 96\n40 21\n33 74\n26 37\n53 59\n98 56\n61 65\n42 57\n9 7\n25 63\n74 34\n96 84\n95 47\n12 23\n34 21\n71 6\n27 13\n15 47\n64 14\n12 77",
"output": "6"
},
{
"input": "30\n46 100\n87 53\n34 84\n44 66\n23 20\n50 34\n90 66\n17 39\n13 22\n94 33\n92 46\n63 78\n26 48\n44 61\n3 19\n41 84\n62 31\n65 89\n23 28\n58 57\n19 85\n26 60\n75 66\n69 67\n76 15\n64 15\n36 72\n90 89\n42 69\n45 35",
"output": "4"
},
{
"input": "2\n46 6\n6 46",
"output": "2"
},
{
"input": "29\n8 18\n33 75\n69 22\n97 95\n1 97\n78 10\n88 18\n13 3\n19 64\n98 12\n79 92\n41 72\n69 15\n98 31\n57 74\n15 56\n36 37\n15 66\n63 100\n16 42\n47 56\n6 4\n73 15\n30 24\n27 71\n12 19\n88 69\n85 6\n50 11",
"output": "10"
},
{
"input": "23\n43 78\n31 28\n58 80\n66 63\n20 4\n51 95\n40 20\n50 14\n5 34\n36 39\n77 42\n64 97\n62 89\n16 56\n8 34\n58 16\n37 35\n37 66\n8 54\n50 36\n24 8\n68 48\n85 33",
"output": "6"
},
{
"input": "13\n76 58\n32 85\n99 79\n23 58\n96 59\n72 35\n53 43\n96 55\n41 78\n75 10\n28 11\n72 7\n52 73",
"output": "0"
},
{
"input": "18\n6 90\n70 79\n26 52\n67 81\n29 95\n41 32\n94 88\n18 58\n59 65\n51 56\n64 68\n34 2\n6 98\n95 82\n34 2\n40 98\n83 78\n29 2",
"output": "1"
},
{
"input": "18\n6 90\n100 79\n26 100\n67 100\n29 100\n100 32\n94 88\n18 58\n59 65\n51 56\n64 68\n34 2\n6 98\n95 82\n34 2\n40 98\n83 78\n29 100",
"output": "8"
},
{
"input": "30\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1",
"output": "450"
},
{
"input": "30\n100 99\n58 59\n56 57\n54 55\n52 53\n50 51\n48 49\n46 47\n44 45\n42 43\n40 41\n38 39\n36 37\n34 35\n32 33\n30 31\n28 29\n26 27\n24 25\n22 23\n20 21\n18 19\n16 17\n14 15\n12 13\n10 11\n8 9\n6 7\n4 5\n2 3",
"output": "0"
},
{
"input": "15\n9 3\n2 6\n7 6\n5 10\n9 5\n8 1\n10 5\n2 8\n4 5\n9 8\n5 3\n3 8\n9 8\n4 10\n8 5",
"output": "20"
},
{
"input": "15\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n2 1\n1 2",
"output": "108"
},
{
"input": "25\n2 1\n1 2\n1 2\n1 2\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n1 2\n2 1\n2 1\n2 1\n2 1\n1 2",
"output": "312"
},
{
"input": "25\n91 57\n2 73\n54 57\n2 57\n23 57\n2 6\n57 54\n57 23\n91 54\n91 23\n57 23\n91 57\n54 2\n6 91\n57 54\n2 57\n57 91\n73 91\n57 23\n91 57\n2 73\n91 2\n23 6\n2 73\n23 6",
"output": "96"
},
{
"input": "28\n31 66\n31 91\n91 31\n97 66\n31 66\n31 66\n66 91\n91 31\n97 31\n91 97\n97 31\n66 31\n66 97\n91 31\n31 66\n31 66\n66 31\n31 97\n66 97\n97 31\n31 91\n66 91\n91 66\n31 66\n91 66\n66 31\n66 31\n91 97",
"output": "210"
},
{
"input": "29\n78 27\n50 68\n24 26\n68 43\n38 78\n26 38\n78 28\n28 26\n27 24\n23 38\n24 26\n24 43\n61 50\n38 78\n27 23\n61 26\n27 28\n43 23\n28 78\n43 27\n43 78\n27 61\n28 38\n61 78\n50 26\n43 27\n26 78\n28 50\n43 78",
"output": "73"
},
{
"input": "29\n80 27\n69 80\n27 80\n69 80\n80 27\n80 27\n80 27\n80 69\n27 69\n80 69\n80 27\n27 69\n69 27\n80 69\n27 69\n69 80\n27 69\n80 69\n80 27\n69 27\n27 69\n27 80\n80 27\n69 80\n27 69\n80 69\n69 80\n69 80\n27 80",
"output": "277"
},
{
"input": "30\n19 71\n7 89\n89 71\n21 7\n19 21\n7 89\n19 71\n89 8\n89 21\n19 8\n21 7\n8 89\n19 89\n7 21\n19 8\n19 7\n7 19\n8 21\n71 21\n71 89\n7 19\n7 19\n21 7\n21 19\n21 19\n71 8\n21 8\n71 19\n19 71\n8 21",
"output": "154"
},
{
"input": "30\n44 17\n44 17\n44 17\n17 44\n44 17\n44 17\n17 44\n17 44\n17 44\n44 17\n44 17\n44 17\n44 17\n44 17\n17 44\n17 44\n17 44\n44 17\n44 17\n17 44\n44 17\n44 17\n44 17\n17 44\n17 44\n44 17\n17 44\n44 17\n44 17\n44 17",
"output": "418"
},
{
"input": "22\n78 92\n15 92\n92 78\n78 80\n92 16\n24 80\n92 16\n16 92\n78 16\n24 78\n80 78\n92 80\n16 80\n80 78\n15 78\n92 16\n24 15\n24 80\n80 16\n16 80\n92 80\n24 80",
"output": "74"
},
{
"input": "24\n9 83\n90 31\n83 3\n83 3\n21 31\n83 3\n32 31\n12 21\n31 21\n90 32\n32 21\n12 9\n12 31\n9 83\n83 12\n32 3\n32 83\n90 31\n9 32\n31 21\n83 90\n32 21\n21 3\n32 9",
"output": "59"
},
{
"input": "30\n67 21\n85 39\n85 87\n21 39\n66 85\n10 95\n10 21\n87 85\n82 21\n67 21\n95 10\n21 39\n82 21\n21 66\n66 39\n95 30\n67 85\n66 82\n85 82\n21 66\n10 39\n67 10\n21 85\n10 82\n85 95\n10 85\n21 39\n85 39\n39 10\n95 67",
"output": "100"
},
{
"input": "4\n8 7\n8 7\n7 8\n7 8",
"output": "8"
},
{
"input": "6\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1",
"output": "10"
},
{
"input": "12\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1",
"output": "72"
},
{
"input": "4\n1 2\n1 2\n2 1\n2 1",
"output": "8"
}
] | 1,674,643,209
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 31
| 124
| 0
|
import math
ri=lambda:map(int,input().split())
def f():
mtr=[]
otv=0
n=int(input())
for _ in range(n):
a=list(ri())
mtr.append(a)
for i in range(n):
for j in range(n):
if i!=j:
if mtr[i][0]==mtr[j][1]:
otv+=1
print(otv)
f()
|
Title: Games
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Manao works on a sports TV. He's spent much time watching the football games of some country. After a while he began to notice different patterns. For example, each team has two sets of uniforms: home uniform and guest uniform. When a team plays a game at home, the players put on the home uniform. When a team plays as a guest on somebody else's stadium, the players put on the guest uniform. The only exception to that rule is: when the home uniform color of the host team matches the guests' uniform, the host team puts on its guest uniform as well. For each team the color of the home and guest uniform is different.
There are *n* teams taking part in the national championship. The championship consists of *n*·(*n*<=-<=1) games: each team invites each other team to its stadium. At this point Manao wondered: how many times during the championship is a host team going to put on the guest uniform? Note that the order of the games does not affect this number.
You know the colors of the home and guest uniform for each team. For simplicity, the colors are numbered by integers in such a way that no two distinct colors have the same number. Help Manao find the answer to his question.
Input Specification:
The first line contains an integer *n* (2<=≤<=*n*<=≤<=30). Each of the following *n* lines contains a pair of distinct space-separated integers *h**i*, *a**i* (1<=≤<=*h**i*,<=*a**i*<=≤<=100) — the colors of the *i*-th team's home and guest uniforms, respectively.
Output Specification:
In a single line print the number of games where the host team is going to play in the guest uniform.
Demo Input:
['3\n1 2\n2 4\n3 4\n', '4\n100 42\n42 100\n5 42\n100 5\n', '2\n1 2\n1 2\n']
Demo Output:
['1\n', '5\n', '0\n']
Note:
In the first test case the championship consists of 6 games. The only game with the event in question is the game between teams 2 and 1 on the stadium of team 2.
In the second test sample the host team will have to wear guest uniform in the games between teams: 1 and 2, 2 and 1, 2 and 3, 3 and 4, 4 and 2 (the host team is written first).
|
```python
import math
ri=lambda:map(int,input().split())
def f():
mtr=[]
otv=0
n=int(input())
for _ in range(n):
a=list(ri())
mtr.append(a)
for i in range(n):
for j in range(n):
if i!=j:
if mtr[i][0]==mtr[j][1]:
otv+=1
print(otv)
f()
```
| 3
|
|
229
|
B
|
Planets
|
PROGRAMMING
| 1,700
|
[
"binary search",
"data structures",
"graphs",
"shortest paths"
] | null | null |
Goa'uld Apophis captured Jack O'Neill's team again! Jack himself was able to escape, but by that time Apophis's ship had already jumped to hyperspace. But Jack knows on what planet will Apophis land. In order to save his friends, Jack must repeatedly go through stargates to get to this planet.
Overall the galaxy has *n* planets, indexed with numbers from 1 to *n*. Jack is on the planet with index 1, and Apophis will land on the planet with index *n*. Jack can move between some pairs of planets through stargates (he can move in both directions); the transfer takes a positive, and, perhaps, for different pairs of planets unequal number of seconds. Jack begins his journey at time 0.
It can be that other travellers are arriving to the planet where Jack is currently located. In this case, Jack has to wait for exactly 1 second before he can use the stargate. That is, if at time *t* another traveller arrives to the planet, Jack can only pass through the stargate at time *t*<=+<=1, unless there are more travellers arriving at time *t*<=+<=1 to the same planet.
Knowing the information about travel times between the planets, and the times when Jack would not be able to use the stargate on particular planets, determine the minimum time in which he can get to the planet with index *n*.
|
The first line contains two space-separated integers: *n* (2<=≤<=*n*<=≤<=105), the number of planets in the galaxy, and *m* (0<=≤<=*m*<=≤<=105) — the number of pairs of planets between which Jack can travel using stargates. Then *m* lines follow, containing three integers each: the *i*-th line contains numbers of planets *a**i* and *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*, *a**i*<=≠<=*b**i*), which are connected through stargates, and the integer transfer time (in seconds) *c**i* (1<=≤<=*c**i*<=≤<=104) between these planets. It is guaranteed that between any pair of planets there is at most one stargate connection.
Then *n* lines follow: the *i*-th line contains an integer *k**i* (0<=≤<=*k**i*<=≤<=105) that denotes the number of moments of time when other travellers arrive to the planet with index *i*. Then *k**i* distinct space-separated integers *t**ij* (0<=≤<=*t**ij*<=<<=109) follow, sorted in ascending order. An integer *t**ij* means that at time *t**ij* (in seconds) another traveller arrives to the planet *i*. It is guaranteed that the sum of all *k**i* does not exceed 105.
|
Print a single number — the least amount of time Jack needs to get from planet 1 to planet *n*. If Jack can't get to planet *n* in any amount of time, print number -1.
|
[
"4 6\n1 2 2\n1 3 3\n1 4 8\n2 3 4\n2 4 5\n3 4 3\n0\n1 3\n2 3 4\n0\n",
"3 1\n1 2 3\n0\n1 3\n0\n"
] |
[
"7\n",
"-1\n"
] |
In the first sample Jack has three ways to go from planet 1. If he moves to planet 4 at once, he spends 8 seconds. If he transfers to planet 3, he spends 3 seconds, but as other travellers arrive to planet 3 at time 3 and 4, he can travel to planet 4 only at time 5, thus spending 8 seconds in total. But if Jack moves to planet 2, and then — to planet 4, then he spends a total of only 2 + 5 = 7 seconds.
In the second sample one can't get from planet 1 to planet 3 by moving through stargates.
| 500
|
[
{
"input": "4 6\n1 2 2\n1 3 3\n1 4 8\n2 3 4\n2 4 5\n3 4 3\n0\n1 3\n2 3 4\n0",
"output": "7"
},
{
"input": "3 1\n1 2 3\n0\n1 3\n0",
"output": "-1"
},
{
"input": "2 1\n1 2 3\n0\n1 3",
"output": "3"
},
{
"input": "2 1\n1 2 3\n1 0\n0",
"output": "4"
},
{
"input": "3 3\n1 2 5\n2 3 6\n1 3 7\n0\n0\n0",
"output": "7"
},
{
"input": "3 3\n1 2 3\n2 3 2\n1 3 7\n0\n0\n0",
"output": "5"
},
{
"input": "2 0\n0\n0",
"output": "-1"
},
{
"input": "3 1\n1 2 3\n1 1\n1 5\n0",
"output": "-1"
},
{
"input": "2 1\n1 2 3\n0\n2 2 4",
"output": "3"
},
{
"input": "2 1\n1 2 1\n0\n0",
"output": "1"
},
{
"input": "2 1\n2 1 10000\n0\n0",
"output": "10000"
},
{
"input": "2 1\n1 2 3\n0\n3 3 4 5",
"output": "3"
},
{
"input": "3 0\n0\n0\n0",
"output": "-1"
},
{
"input": "3 2\n1 2 5\n2 3 7\n2 0 1\n3 4 5 6\n3 11 12 13",
"output": "14"
},
{
"input": "2 1\n1 2 3\n3 0 1 2\n3 5 6 7",
"output": "6"
},
{
"input": "3 3\n1 2 3\n2 3 2\n1 3 7\n0\n4 3 4 5 6\n0",
"output": "7"
},
{
"input": "6 7\n1 2 1\n1 3 8\n2 4 2\n4 3 3\n3 5 4\n4 6 100\n5 6 5\n0\n0\n1 7\n2 3 4\n0\n0",
"output": "17"
},
{
"input": "3 3\n1 2 3\n2 3 2\n1 3 6\n0\n1 3\n0",
"output": "6"
},
{
"input": "7 7\n1 2 1\n2 4 2\n2 3 2\n3 6 2\n6 5 2\n4 5 3\n5 7 7\n0\n0\n0\n3 3 4 5\n0\n0\n0",
"output": "14"
},
{
"input": "7 6\n1 2 1\n1 3 1\n1 4 1\n1 5 1\n1 6 1\n1 7 1\n1 0\n0\n0\n0\n0\n0\n0",
"output": "2"
},
{
"input": "8 10\n1 2 3\n2 8 3\n1 4 1\n4 3 6\n3 7 7\n4 5 5\n5 7 2\n7 8 1\n1 6 8\n6 8 7\n0\n4 1 2 3 4\n0\n0\n0\n0\n0\n0",
"output": "8"
},
{
"input": "7 6\n1 2 1\n1 3 2\n2 4 3\n2 5 4\n3 5 6\n3 6 7\n0\n3 1 2 3\n2 2 3\n0\n2 7 8\n0\n0",
"output": "-1"
}
] | 1,684,942,160
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 1
| 218
| 4,198,400
|
# auther yeling
from typing import List
from bisect import *
from collections import *
from functools import *
from itertools import *
from math import *
from queue import PriorityQueue
import string
INF = 2 ** 64 - 1
MOD = 10 ** 9 + 7
YES="Yes"
NO="No"
mi = lambda :map(int,input().split())
li = lambda :list(mi())
def solve(n, m, edges, t):
dis = [INF]*(1 + n)
dis[1] = 0
vis = [False] * (1 + n)
stack = PriorityQueue()
#(index,w)
g = [list() for _ in range(1 + n)]
for v in edges:
#print(v)
g[v[0]].append((v[1],v[2]))
g[v[1]].append((v[0],v[2]))
#(dis,index)
stack.put((0,1))
while not stack.empty():
curr = stack.get()
if vis[curr[1]] == True:
continue
vis[curr[1]] = True
for v in g[curr[1]]:
if v[0] != curr[1] and vis[v[0]] == False:
tempDis = dis[curr[1]] + v[1]
while tempDis in t[v[0] - 1]:
tempDis += 1
dis[v[0]] = min(dis[v[0]], tempDis)
stack.put((dis[v[0]], v[0]))
print(dis[n])
return
n,m = li()
edges = []
for _ in range(m):
edges.append(li())
t = []
for _ in range(n):
t.append(set(li()[1:]))
solve(n, m, edges, t)
|
Title: Planets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Goa'uld Apophis captured Jack O'Neill's team again! Jack himself was able to escape, but by that time Apophis's ship had already jumped to hyperspace. But Jack knows on what planet will Apophis land. In order to save his friends, Jack must repeatedly go through stargates to get to this planet.
Overall the galaxy has *n* planets, indexed with numbers from 1 to *n*. Jack is on the planet with index 1, and Apophis will land on the planet with index *n*. Jack can move between some pairs of planets through stargates (he can move in both directions); the transfer takes a positive, and, perhaps, for different pairs of planets unequal number of seconds. Jack begins his journey at time 0.
It can be that other travellers are arriving to the planet where Jack is currently located. In this case, Jack has to wait for exactly 1 second before he can use the stargate. That is, if at time *t* another traveller arrives to the planet, Jack can only pass through the stargate at time *t*<=+<=1, unless there are more travellers arriving at time *t*<=+<=1 to the same planet.
Knowing the information about travel times between the planets, and the times when Jack would not be able to use the stargate on particular planets, determine the minimum time in which he can get to the planet with index *n*.
Input Specification:
The first line contains two space-separated integers: *n* (2<=≤<=*n*<=≤<=105), the number of planets in the galaxy, and *m* (0<=≤<=*m*<=≤<=105) — the number of pairs of planets between which Jack can travel using stargates. Then *m* lines follow, containing three integers each: the *i*-th line contains numbers of planets *a**i* and *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*, *a**i*<=≠<=*b**i*), which are connected through stargates, and the integer transfer time (in seconds) *c**i* (1<=≤<=*c**i*<=≤<=104) between these planets. It is guaranteed that between any pair of planets there is at most one stargate connection.
Then *n* lines follow: the *i*-th line contains an integer *k**i* (0<=≤<=*k**i*<=≤<=105) that denotes the number of moments of time when other travellers arrive to the planet with index *i*. Then *k**i* distinct space-separated integers *t**ij* (0<=≤<=*t**ij*<=<<=109) follow, sorted in ascending order. An integer *t**ij* means that at time *t**ij* (in seconds) another traveller arrives to the planet *i*. It is guaranteed that the sum of all *k**i* does not exceed 105.
Output Specification:
Print a single number — the least amount of time Jack needs to get from planet 1 to planet *n*. If Jack can't get to planet *n* in any amount of time, print number -1.
Demo Input:
['4 6\n1 2 2\n1 3 3\n1 4 8\n2 3 4\n2 4 5\n3 4 3\n0\n1 3\n2 3 4\n0\n', '3 1\n1 2 3\n0\n1 3\n0\n']
Demo Output:
['7\n', '-1\n']
Note:
In the first sample Jack has three ways to go from planet 1. If he moves to planet 4 at once, he spends 8 seconds. If he transfers to planet 3, he spends 3 seconds, but as other travellers arrive to planet 3 at time 3 and 4, he can travel to planet 4 only at time 5, thus spending 8 seconds in total. But if Jack moves to planet 2, and then — to planet 4, then he spends a total of only 2 + 5 = 7 seconds.
In the second sample one can't get from planet 1 to planet 3 by moving through stargates.
|
```python
# auther yeling
from typing import List
from bisect import *
from collections import *
from functools import *
from itertools import *
from math import *
from queue import PriorityQueue
import string
INF = 2 ** 64 - 1
MOD = 10 ** 9 + 7
YES="Yes"
NO="No"
mi = lambda :map(int,input().split())
li = lambda :list(mi())
def solve(n, m, edges, t):
dis = [INF]*(1 + n)
dis[1] = 0
vis = [False] * (1 + n)
stack = PriorityQueue()
#(index,w)
g = [list() for _ in range(1 + n)]
for v in edges:
#print(v)
g[v[0]].append((v[1],v[2]))
g[v[1]].append((v[0],v[2]))
#(dis,index)
stack.put((0,1))
while not stack.empty():
curr = stack.get()
if vis[curr[1]] == True:
continue
vis[curr[1]] = True
for v in g[curr[1]]:
if v[0] != curr[1] and vis[v[0]] == False:
tempDis = dis[curr[1]] + v[1]
while tempDis in t[v[0] - 1]:
tempDis += 1
dis[v[0]] = min(dis[v[0]], tempDis)
stack.put((dis[v[0]], v[0]))
print(dis[n])
return
n,m = li()
edges = []
for _ in range(m):
edges.append(li())
t = []
for _ in range(n):
t.append(set(li()[1:]))
solve(n, m, edges, t)
```
| 0
|
|
464
|
A
|
No to Palindromes!
|
PROGRAMMING
| 1,700
|
[
"greedy",
"strings"
] | null | null |
Paul hates palindromes. He assumes that string *s* is tolerable if each its character is one of the first *p* letters of the English alphabet and *s* doesn't contain any palindrome contiguous substring of length 2 or more.
Paul has found a tolerable string *s* of length *n*. Help him find the lexicographically next tolerable string of the same length or else state that such string does not exist.
|
The first line contains two space-separated integers: *n* and *p* (1<=≤<=*n*<=≤<=1000; 1<=≤<=*p*<=≤<=26). The second line contains string *s*, consisting of *n* small English letters. It is guaranteed that the string is tolerable (according to the above definition).
|
If the lexicographically next tolerable string of the same length exists, print it. Otherwise, print "NO" (without the quotes).
|
[
"3 3\ncba\n",
"3 4\ncba\n",
"4 4\nabcd\n"
] |
[
"NO\n",
"cbd\n",
"abda\n"
] |
String *s* is lexicographically larger (or simply larger) than string *t* with the same length, if there is number *i*, such that *s*<sub class="lower-index">1</sub> = *t*<sub class="lower-index">1</sub>, ..., *s*<sub class="lower-index">*i*</sub> = *t*<sub class="lower-index">*i*</sub>, *s*<sub class="lower-index">*i* + 1</sub> > *t*<sub class="lower-index">*i* + 1</sub>.
The lexicographically next tolerable string is the lexicographically minimum tolerable string which is larger than the given one.
A palindrome is a string that reads the same forward or reversed.
| 500
|
[
{
"input": "3 3\ncba",
"output": "NO"
},
{
"input": "3 4\ncba",
"output": "cbd"
},
{
"input": "4 4\nabcd",
"output": "abda"
},
{
"input": "2 2\nab",
"output": "ba"
},
{
"input": "2 2\nba",
"output": "NO"
},
{
"input": "1 2\na",
"output": "b"
},
{
"input": "1 2\nb",
"output": "NO"
},
{
"input": "1 1\na",
"output": "NO"
},
{
"input": "3 4\ncdb",
"output": "dab"
},
{
"input": "7 26\nzyxzyxz",
"output": "NO"
},
{
"input": "10 5\nabcabcabca",
"output": "abcabcabcd"
},
{
"input": "10 10\nfajegfaicb",
"output": "fajegfaicd"
},
{
"input": "1 26\no",
"output": "p"
},
{
"input": "1 2\nb",
"output": "NO"
},
{
"input": "1 26\nz",
"output": "NO"
},
{
"input": "3 3\ncab",
"output": "cba"
},
{
"input": "3 26\nyzx",
"output": "zab"
},
{
"input": "5 5\naceba",
"output": "acebc"
},
{
"input": "10 3\ncbacbacbac",
"output": "NO"
},
{
"input": "11 3\nabcabcabcab",
"output": "acbacbacbac"
},
{
"input": "12 10\nabcabcabcabc",
"output": "abcabcabcabd"
},
{
"input": "13 7\ngfegfegfegfeg",
"output": "NO"
},
{
"input": "15 11\ncgjkbadjfbdaikj",
"output": "cgjkbadjfbdajba"
},
{
"input": "17 4\ndabcadcbdcadbcdbc",
"output": "dabcadcbdcadcabca"
},
{
"input": "26 26\nahnxdnbfcriersyzdihuecojdi",
"output": "ahnxdnbfcriersyzdihuecojdk"
},
{
"input": "30 7\ncedcfedcfgcfgcbadcadgfaegfacgf",
"output": "cedcfedcfgcfgcbadcadgfaegfadba"
},
{
"input": "70 4\ndcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbd",
"output": "NO"
},
{
"input": "77 7\ncadgbagbcaecgfaegcdbeafbacbdfgaedgcdeabgebaecbeacgfebagedcegdafdgeacegfegfegf",
"output": "cadgbagbcaecgfaegcdbeafbacbdfgaedgcdeabgebaecbeacgfebagedcegdafdgeacfabcabcab"
},
{
"input": "100 4\nabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcd"
},
{
"input": "333 5\nedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedcedc",
"output": "NO"
},
{
"input": "3 3\nacb",
"output": "bac"
},
{
"input": "17 26\nbazyxzyxzyxzyxzyx",
"output": "bcabcabcabcabcabc"
},
{
"input": "6 3\nacbacb",
"output": "bacbac"
},
{
"input": "6 3\nabcabc",
"output": "acbacb"
},
{
"input": "302 4\nabdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcbdcb",
"output": "acbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbac"
},
{
"input": "30 26\nabcabcabczyxzyxzyxzyxzyxzyxzyx",
"output": "abcabcabdabcabcabcabcabcabcabc"
},
{
"input": "300 3\nabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabc",
"output": "acbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacbacb"
},
{
"input": "2 4\ncd",
"output": "da"
}
] | 1,692,162,996
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 8
| 92
| 2,150,400
|
import math
import sys
from random import randint as rn
import random
import functools
from heapq import heappop, heappush
def solve():
n, p = map(int, input().split())
s = list(str(input()))
if p == 1:
print('NO')
return
if p == 2:
if len(s) == 1:
if s[0] == 'a':
print('b')
else:
print('NO')
elif len(s) == 2:
if s[0] + s[1] == 'ab':
print('ba')
else:
print('NO')
else:
print('NO')
return
e = [chr(i) for i in range(ord('a'), ord('a') + p)]
next_chr = {}
for i in range(p):
next_chr[e[i]] = e[(i + 1) % p]
def fill_with_min(start):
for i in range(start, len(s)):
for j in e:
if j != s[max(0, i - 1)] and j != s[max(0, i - 2)]:
s[i] = j
break
def check(pos):
return s[pos] not in [s[max(0, pos - 1)], s[max(0, pos - 2)]]
for i in range(n - 1, -1, -1):
while next_chr[s[i]] != 'a':
s[i] = next_chr[s[i]]
if check(i):
fill_with_min(i + 1)
print(''.join(s))
return
if s[0] == e[-1]:
print('NO')
else:
s[0] = next_chr[s[0]]
fill_with_min(1)
print(''.join(s))
return
if __name__ == '__main__':
multitest = 0
if multitest:
t = int(sys.stdin.readline())
for _ in range(t):
solve()
else:
solve()
# gen()
|
Title: No to Palindromes!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Paul hates palindromes. He assumes that string *s* is tolerable if each its character is one of the first *p* letters of the English alphabet and *s* doesn't contain any palindrome contiguous substring of length 2 or more.
Paul has found a tolerable string *s* of length *n*. Help him find the lexicographically next tolerable string of the same length or else state that such string does not exist.
Input Specification:
The first line contains two space-separated integers: *n* and *p* (1<=≤<=*n*<=≤<=1000; 1<=≤<=*p*<=≤<=26). The second line contains string *s*, consisting of *n* small English letters. It is guaranteed that the string is tolerable (according to the above definition).
Output Specification:
If the lexicographically next tolerable string of the same length exists, print it. Otherwise, print "NO" (without the quotes).
Demo Input:
['3 3\ncba\n', '3 4\ncba\n', '4 4\nabcd\n']
Demo Output:
['NO\n', 'cbd\n', 'abda\n']
Note:
String *s* is lexicographically larger (or simply larger) than string *t* with the same length, if there is number *i*, such that *s*<sub class="lower-index">1</sub> = *t*<sub class="lower-index">1</sub>, ..., *s*<sub class="lower-index">*i*</sub> = *t*<sub class="lower-index">*i*</sub>, *s*<sub class="lower-index">*i* + 1</sub> > *t*<sub class="lower-index">*i* + 1</sub>.
The lexicographically next tolerable string is the lexicographically minimum tolerable string which is larger than the given one.
A palindrome is a string that reads the same forward or reversed.
|
```python
import math
import sys
from random import randint as rn
import random
import functools
from heapq import heappop, heappush
def solve():
n, p = map(int, input().split())
s = list(str(input()))
if p == 1:
print('NO')
return
if p == 2:
if len(s) == 1:
if s[0] == 'a':
print('b')
else:
print('NO')
elif len(s) == 2:
if s[0] + s[1] == 'ab':
print('ba')
else:
print('NO')
else:
print('NO')
return
e = [chr(i) for i in range(ord('a'), ord('a') + p)]
next_chr = {}
for i in range(p):
next_chr[e[i]] = e[(i + 1) % p]
def fill_with_min(start):
for i in range(start, len(s)):
for j in e:
if j != s[max(0, i - 1)] and j != s[max(0, i - 2)]:
s[i] = j
break
def check(pos):
return s[pos] not in [s[max(0, pos - 1)], s[max(0, pos - 2)]]
for i in range(n - 1, -1, -1):
while next_chr[s[i]] != 'a':
s[i] = next_chr[s[i]]
if check(i):
fill_with_min(i + 1)
print(''.join(s))
return
if s[0] == e[-1]:
print('NO')
else:
s[0] = next_chr[s[0]]
fill_with_min(1)
print(''.join(s))
return
if __name__ == '__main__':
multitest = 0
if multitest:
t = int(sys.stdin.readline())
for _ in range(t):
solve()
else:
solve()
# gen()
```
| 0
|
|
84
|
A
|
Toy Army
|
PROGRAMMING
| 900
|
[
"math",
"number theory"
] |
A. Toy Army
|
2
|
256
|
The hero of our story, Valera, and his best friend Arcady are still in school, and therefore they spend all the free time playing turn-based strategy "GAGA: Go And Go Again". The gameplay is as follows.
There are two armies on the playing field each of which consists of *n* men (*n* is always even). The current player specifies for each of her soldiers an enemy's soldier he will shoot (a target) and then all the player's soldiers shot simultaneously. This is a game world, and so each soldier shoots perfectly, that is he absolutely always hits the specified target. If an enemy soldier is hit, he will surely die. It may happen that several soldiers had been indicated the same target. Killed soldiers do not participate in the game anymore.
The game "GAGA" consists of three steps: first Valera makes a move, then Arcady, then Valera again and the game ends.
You are asked to calculate the maximum total number of soldiers that may be killed during the game.
|
The input data consist of a single integer *n* (2<=≤<=*n*<=≤<=108, *n* is even). Please note that before the game starts there are 2*n* soldiers on the fields.
|
Print a single number — a maximum total number of soldiers that could be killed in the course of the game in three turns.
|
[
"2\n",
"4\n"
] |
[
"3\n",
"6\n"
] |
The first sample test:
1) Valera's soldiers 1 and 2 shoot at Arcady's soldier 1.
2) Arcady's soldier 2 shoots at Valera's soldier 1.
3) Valera's soldier 1 shoots at Arcady's soldier 2.
There are 3 soldiers killed in total: Valera's soldier 1 and Arcady's soldiers 1 and 2.
| 500
|
[
{
"input": "2",
"output": "3"
},
{
"input": "4",
"output": "6"
},
{
"input": "6",
"output": "9"
},
{
"input": "8",
"output": "12"
},
{
"input": "10",
"output": "15"
},
{
"input": "140",
"output": "210"
},
{
"input": "500",
"output": "750"
},
{
"input": "1000",
"output": "1500"
},
{
"input": "2000",
"output": "3000"
},
{
"input": "50000",
"output": "75000"
},
{
"input": "10000",
"output": "15000"
},
{
"input": "25460",
"output": "38190"
},
{
"input": "54646",
"output": "81969"
},
{
"input": "59790",
"output": "89685"
},
{
"input": "578456",
"output": "867684"
},
{
"input": "56798056",
"output": "85197084"
},
{
"input": "8457980",
"output": "12686970"
},
{
"input": "5687986",
"output": "8531979"
},
{
"input": "10984932",
"output": "16477398"
},
{
"input": "99999994",
"output": "149999991"
},
{
"input": "99999996",
"output": "149999994"
},
{
"input": "99999998",
"output": "149999997"
},
{
"input": "100000000",
"output": "150000000"
}
] | 1,627,216,098
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 23
| 154
| 6,758,400
|
n=int(input())
if n%4:
print(2*n-n//4*2-1)
else:
print(2*n-n//4*2)
|
Title: Toy Army
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The hero of our story, Valera, and his best friend Arcady are still in school, and therefore they spend all the free time playing turn-based strategy "GAGA: Go And Go Again". The gameplay is as follows.
There are two armies on the playing field each of which consists of *n* men (*n* is always even). The current player specifies for each of her soldiers an enemy's soldier he will shoot (a target) and then all the player's soldiers shot simultaneously. This is a game world, and so each soldier shoots perfectly, that is he absolutely always hits the specified target. If an enemy soldier is hit, he will surely die. It may happen that several soldiers had been indicated the same target. Killed soldiers do not participate in the game anymore.
The game "GAGA" consists of three steps: first Valera makes a move, then Arcady, then Valera again and the game ends.
You are asked to calculate the maximum total number of soldiers that may be killed during the game.
Input Specification:
The input data consist of a single integer *n* (2<=≤<=*n*<=≤<=108, *n* is even). Please note that before the game starts there are 2*n* soldiers on the fields.
Output Specification:
Print a single number — a maximum total number of soldiers that could be killed in the course of the game in three turns.
Demo Input:
['2\n', '4\n']
Demo Output:
['3\n', '6\n']
Note:
The first sample test:
1) Valera's soldiers 1 and 2 shoot at Arcady's soldier 1.
2) Arcady's soldier 2 shoots at Valera's soldier 1.
3) Valera's soldier 1 shoots at Arcady's soldier 2.
There are 3 soldiers killed in total: Valera's soldier 1 and Arcady's soldiers 1 and 2.
|
```python
n=int(input())
if n%4:
print(2*n-n//4*2-1)
else:
print(2*n-n//4*2)
```
| 3.948911
|
1,011
|
A
|
Stages
|
PROGRAMMING
| 900
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
Natasha is going to fly to Mars. She needs to build a rocket, which consists of several stages in some order. Each of the stages is defined by a lowercase Latin letter. This way, the rocket can be described by the string — concatenation of letters, which correspond to the stages.
There are $n$ stages available. The rocket must contain exactly $k$ of them. Stages in the rocket should be ordered by their weight. So, after the stage with some letter can go only stage with a letter, which is at least two positions after in the alphabet (skipping one letter in between, or even more). For example, after letter 'c' can't go letters 'a', 'b', 'c' and 'd', but can go letters 'e', 'f', ..., 'z'.
For the rocket to fly as far as possible, its weight should be minimal. The weight of the rocket is equal to the sum of the weights of its stages. The weight of the stage is the number of its letter in the alphabet. For example, the stage 'a 'weighs one ton,' b 'weighs two tons, and' z' — $26$ tons.
Build the rocket with the minimal weight or determine, that it is impossible to build a rocket at all. Each stage can be used at most once.
|
The first line of input contains two integers — $n$ and $k$ ($1 \le k \le n \le 50$) – the number of available stages and the number of stages to use in the rocket.
The second line contains string $s$, which consists of exactly $n$ lowercase Latin letters. Each letter defines a new stage, which can be used to build the rocket. Each stage can be used at most once.
|
Print a single integer — the minimal total weight of the rocket or -1, if it is impossible to build the rocket at all.
|
[
"5 3\nxyabd\n",
"7 4\nproblem\n",
"2 2\nab\n",
"12 1\nabaabbaaabbb\n"
] |
[
"29",
"34",
"-1",
"1"
] |
In the first example, the following rockets satisfy the condition:
- "adx" (weight is $1+4+24=29$);- "ady" (weight is $1+4+25=30$);- "bdx" (weight is $2+4+24=30$);- "bdy" (weight is $2+4+25=31$).
Rocket "adx" has the minimal weight, so the answer is $29$.
In the second example, target rocket is "belo". Its weight is $2+5+12+15=34$.
In the third example, $n=k=2$, so the rocket must have both stages: 'a' and 'b'. This rocket doesn't satisfy the condition, because these letters are adjacent in the alphabet. Answer is -1.
| 500
|
[
{
"input": "5 3\nxyabd",
"output": "29"
},
{
"input": "7 4\nproblem",
"output": "34"
},
{
"input": "2 2\nab",
"output": "-1"
},
{
"input": "12 1\nabaabbaaabbb",
"output": "1"
},
{
"input": "50 13\nqwertyuiopasdfghjklzxcvbnmaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "169"
},
{
"input": "50 14\nqwertyuiopasdfghjklzxcvbnmaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "-1"
},
{
"input": "1 1\na",
"output": "1"
},
{
"input": "50 1\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "1"
},
{
"input": "50 2\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "-1"
},
{
"input": "13 13\nuwgmkyqeiaocs",
"output": "169"
},
{
"input": "13 13\nhzdxpbfvrltnj",
"output": "182"
},
{
"input": "1 1\nn",
"output": "14"
},
{
"input": "10 8\nsmzeblyjqw",
"output": "113"
},
{
"input": "20 20\ntzmvhskkyugkuuxpvtbh",
"output": "-1"
},
{
"input": "30 15\nwjzolzzkfulwgioksfxmcxmnnjtoav",
"output": "-1"
},
{
"input": "40 30\nxumfrflllrrgswehqtsskefixhcxjrxbjmrpsshv",
"output": "-1"
},
{
"input": "50 31\nahbyyoxltryqdmvenemaqnbakglgqolxnaifnqtoclnnqiabpz",
"output": "-1"
},
{
"input": "10 7\niuiukrxcml",
"output": "99"
},
{
"input": "38 2\nvjzarfykmrsrvwbwfwldsulhxtykmjbnwmdufa",
"output": "5"
},
{
"input": "12 6\nfwseyrarkwcd",
"output": "61"
},
{
"input": "2 2\nac",
"output": "4"
},
{
"input": "1 1\nc",
"output": "3"
},
{
"input": "2 2\nad",
"output": "5"
},
{
"input": "2 1\nac",
"output": "1"
},
{
"input": "4 3\nadjz",
"output": "15"
},
{
"input": "3 3\naoz",
"output": "42"
},
{
"input": "3 1\nzzz",
"output": "26"
},
{
"input": "2 1\nxz",
"output": "24"
},
{
"input": "5 1\naaddd",
"output": "1"
}
] | 1,613,813,177
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 29
| 108
| 0
|
n,k=list(map(int,input().split()))
a=sorted(input())
temp,count=-1,0
for i in range(n):
if k==0:
break
if ord(a[i])>=temp+2:
count+=ord(a[i])-97+1
temp=ord(a[i])
k-=1
if k==0:
print(count)
else:
print(-1)
|
Title: Stages
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Natasha is going to fly to Mars. She needs to build a rocket, which consists of several stages in some order. Each of the stages is defined by a lowercase Latin letter. This way, the rocket can be described by the string — concatenation of letters, which correspond to the stages.
There are $n$ stages available. The rocket must contain exactly $k$ of them. Stages in the rocket should be ordered by their weight. So, after the stage with some letter can go only stage with a letter, which is at least two positions after in the alphabet (skipping one letter in between, or even more). For example, after letter 'c' can't go letters 'a', 'b', 'c' and 'd', but can go letters 'e', 'f', ..., 'z'.
For the rocket to fly as far as possible, its weight should be minimal. The weight of the rocket is equal to the sum of the weights of its stages. The weight of the stage is the number of its letter in the alphabet. For example, the stage 'a 'weighs one ton,' b 'weighs two tons, and' z' — $26$ tons.
Build the rocket with the minimal weight or determine, that it is impossible to build a rocket at all. Each stage can be used at most once.
Input Specification:
The first line of input contains two integers — $n$ and $k$ ($1 \le k \le n \le 50$) – the number of available stages and the number of stages to use in the rocket.
The second line contains string $s$, which consists of exactly $n$ lowercase Latin letters. Each letter defines a new stage, which can be used to build the rocket. Each stage can be used at most once.
Output Specification:
Print a single integer — the minimal total weight of the rocket or -1, if it is impossible to build the rocket at all.
Demo Input:
['5 3\nxyabd\n', '7 4\nproblem\n', '2 2\nab\n', '12 1\nabaabbaaabbb\n']
Demo Output:
['29', '34', '-1', '1']
Note:
In the first example, the following rockets satisfy the condition:
- "adx" (weight is $1+4+24=29$);- "ady" (weight is $1+4+25=30$);- "bdx" (weight is $2+4+24=30$);- "bdy" (weight is $2+4+25=31$).
Rocket "adx" has the minimal weight, so the answer is $29$.
In the second example, target rocket is "belo". Its weight is $2+5+12+15=34$.
In the third example, $n=k=2$, so the rocket must have both stages: 'a' and 'b'. This rocket doesn't satisfy the condition, because these letters are adjacent in the alphabet. Answer is -1.
|
```python
n,k=list(map(int,input().split()))
a=sorted(input())
temp,count=-1,0
for i in range(n):
if k==0:
break
if ord(a[i])>=temp+2:
count+=ord(a[i])-97+1
temp=ord(a[i])
k-=1
if k==0:
print(count)
else:
print(-1)
```
| 3
|
|
984
|
B
|
Minesweeper
|
PROGRAMMING
| 1,100
|
[
"implementation"
] | null | null |
One day Alex decided to remember childhood when computers were not too powerful and lots of people played only default games. Alex enjoyed playing Minesweeper that time. He imagined that he saved world from bombs planted by terrorists, but he rarely won.
Alex has grown up since then, so he easily wins the most difficult levels. This quickly bored him, and he thought: what if the computer gave him invalid fields in the childhood and Alex could not win because of it?
He needs your help to check it.
A Minesweeper field is a rectangle $n \times m$, where each cell is either empty, or contains a digit from $1$ to $8$, or a bomb. The field is valid if for each cell:
- if there is a digit $k$ in the cell, then exactly $k$ neighboring cells have bombs. - if the cell is empty, then all neighboring cells have no bombs.
Two cells are neighbors if they have a common side or a corner (i. e. a cell has at most $8$ neighboring cells).
|
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 100$) — the sizes of the field.
The next $n$ lines contain the description of the field. Each line contains $m$ characters, each of them is "." (if this cell is empty), "*" (if there is bomb in this cell), or a digit from $1$ to $8$, inclusive.
|
Print "YES", if the field is valid and "NO" otherwise.
You can choose the case (lower or upper) for each letter arbitrarily.
|
[
"3 3\n111\n1*1\n111\n",
"2 4\n*.*.\n1211\n"
] |
[
"YES",
"NO"
] |
In the second example the answer is "NO" because, if the positions of the bombs are preserved, the first line of the field should be *2*1.
You can read more about Minesweeper in [Wikipedia's article](https://en.wikipedia.org/wiki/Minesweeper_(video_game)).
| 1,000
|
[
{
"input": "3 3\n111\n1*1\n111",
"output": "YES"
},
{
"input": "2 4\n*.*.\n1211",
"output": "NO"
},
{
"input": "1 10\n.....1*1..",
"output": "YES"
},
{
"input": "1 1\n4",
"output": "NO"
},
{
"input": "10 10\n..........\n...111111.\n..13*21*1.\n.12**2111.\n.1*542..11\n.13**1..1*\n..2*31..11\n..111..111\n.......1*1\n.......111",
"output": "YES"
},
{
"input": "10 17\n12*2*22123*31....\n2*333*3*4***3211.\n*22*213**4***3*1.\n11111.12224*6*21.\n221..111.14**4311\n**2233*212****2*1\n*55***4*13*544421\n2***54*322*21**31\n13*4*33*221114*4*\n.1122*22*1...2*31",
"output": "YES"
},
{
"input": "10 10\n**********\n**********\n**********\n**********\n**********\n******3***\n**********\n**********\n**********\n***3.5****",
"output": "NO"
},
{
"input": "21 10\n62637783*1\n23*51**531\n35*7*6.**.\n.*3***581*\n2.32*745**\n83*7*6*6*5\n*74.**6**3\n323*6**7*6\n3454*67.*1\n**63265*6*\n3725*4553*\n24****5**4\n23.34****4\n55257*1*4*\n4*3253*456\n**.3*45488\n*7318**4*5\n234.*4557*\n12..21*.*3\n286.225*4*\n834*11*.3*",
"output": "NO"
},
{
"input": "10 10\n**********\n*********6\n*********5\n**********\n**********\n**********\n**********\n**********\n**********\n**********",
"output": "NO"
},
{
"input": "100 1\n.\n.\n.\n.\n1\n*\n2\n*\n1\n.\n.\n.\n.\n.\n.\n1\n*\n1\n1\n*\n1\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n1\n*\n2\n*\n*\n*\n1\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n1\n*\n2\n*\n1\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.",
"output": "YES"
},
{
"input": "1 100\n*************5****5****************************************************4****************************",
"output": "NO"
},
{
"input": "1 100\n.....1*1........1*1................................1*1...1**11*1.......1*1....1.....1*1.....1*1...1*",
"output": "NO"
},
{
"input": "1 10\n881111882*",
"output": "NO"
},
{
"input": "5 5\n*2221\n24**2\n*3*5*\n3425*\n**12*",
"output": "NO"
},
{
"input": "5 5\n****2\n4***4\n3****\n3*563\n*22**",
"output": "NO"
},
{
"input": "5 5\n***2.\n5**31\n**6**\n***43\n**31*",
"output": "NO"
},
{
"input": "5 5\n*32**\n4*3*4\n**44*\n**45*\n*4***",
"output": "NO"
},
{
"input": "3 3\n***\n*2*\n***",
"output": "NO"
},
{
"input": "1 1\n*",
"output": "YES"
},
{
"input": "1 2\n*1",
"output": "YES"
},
{
"input": "1 2\n*2",
"output": "NO"
},
{
"input": "2 2\n32\n**",
"output": "NO"
},
{
"input": "3 3\n...\n232\n***",
"output": "YES"
},
{
"input": "3 2\n..\n11\n.*",
"output": "NO"
},
{
"input": "2 3\n1*2\n3*2",
"output": "NO"
},
{
"input": "1 3\n.*.",
"output": "NO"
},
{
"input": "3 1\n.\n*\n.",
"output": "NO"
},
{
"input": "3 1\n1\n*\n1",
"output": "YES"
},
{
"input": "3 1\n*\n1\n*",
"output": "NO"
},
{
"input": "1 3\n1**",
"output": "YES"
},
{
"input": "1 1\n8",
"output": "NO"
},
{
"input": "1 1\n.",
"output": "YES"
},
{
"input": "1 2\n2*",
"output": "NO"
},
{
"input": "2 1\n*\n2",
"output": "NO"
},
{
"input": "2 1\n*\n*",
"output": "YES"
},
{
"input": "2 1\n.\n1",
"output": "NO"
},
{
"input": "1 3\n..1",
"output": "NO"
},
{
"input": "3 3\n112\n1*1\n111",
"output": "NO"
},
{
"input": "3 3\n11.\n1*1\n111",
"output": "NO"
},
{
"input": "3 3\n151\n1*1\n111",
"output": "NO"
},
{
"input": "3 3\n1.1\n1*1\n111",
"output": "NO"
},
{
"input": "3 3\n611\n1*1\n111",
"output": "NO"
},
{
"input": "3 3\n.11\n1*1\n111",
"output": "NO"
},
{
"input": "3 3\n111\n2*1\n111",
"output": "NO"
},
{
"input": "3 3\n111\n**1\n111",
"output": "NO"
},
{
"input": "3 3\n111\n5*1\n111",
"output": "NO"
},
{
"input": "3 3\n111\n.*1\n111",
"output": "NO"
},
{
"input": "3 3\n111\n1*1\n411",
"output": "NO"
},
{
"input": "3 3\n111\n1*1\n.11",
"output": "NO"
},
{
"input": "3 3\n111\n1*1\n121",
"output": "NO"
},
{
"input": "3 3\n111\n1*1\n1.1",
"output": "NO"
},
{
"input": "3 3\n111\n1*1\n115",
"output": "NO"
},
{
"input": "3 3\n111\n1*1\n11.",
"output": "NO"
},
{
"input": "3 3\n111\n1*4\n111",
"output": "NO"
},
{
"input": "3 3\n111\n1*.\n111",
"output": "NO"
},
{
"input": "1 4\n*222",
"output": "NO"
},
{
"input": "1 1\n*",
"output": "YES"
},
{
"input": "2 2\n**\n**",
"output": "YES"
},
{
"input": "3 3\n***\n*.*\n***",
"output": "NO"
},
{
"input": "3 3\n***\n***\n***",
"output": "YES"
},
{
"input": "3 3\n***\n*4*\n***",
"output": "NO"
},
{
"input": "2 6\n....1.\n.....*",
"output": "NO"
},
{
"input": "5 5\n*****\n*****\n*****\n*****\n*****",
"output": "YES"
},
{
"input": "4 1\n.\n*\n.\n.",
"output": "NO"
},
{
"input": "2 2\n2*\n11",
"output": "NO"
},
{
"input": "3 3\n888\n888\n888",
"output": "NO"
},
{
"input": "1 4\n*22*",
"output": "NO"
}
] | 1,617,459,819
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 84
| 140
| 2,662,400
|
n, m = map(int, input().split())
a = [input().replace('.', '0') for i in range(n)]
for i in range(n):
for j in range(m):
if a[i][j] != '*' and int(a[i][j]) != sum(map(lambda b: b[max(0, j - 1) : j + 2].count('*'), a[max(0, i - 1) : i + 2])):
print('NO')
exit()
print('YES')
|
Title: Minesweeper
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Alex decided to remember childhood when computers were not too powerful and lots of people played only default games. Alex enjoyed playing Minesweeper that time. He imagined that he saved world from bombs planted by terrorists, but he rarely won.
Alex has grown up since then, so he easily wins the most difficult levels. This quickly bored him, and he thought: what if the computer gave him invalid fields in the childhood and Alex could not win because of it?
He needs your help to check it.
A Minesweeper field is a rectangle $n \times m$, where each cell is either empty, or contains a digit from $1$ to $8$, or a bomb. The field is valid if for each cell:
- if there is a digit $k$ in the cell, then exactly $k$ neighboring cells have bombs. - if the cell is empty, then all neighboring cells have no bombs.
Two cells are neighbors if they have a common side or a corner (i. e. a cell has at most $8$ neighboring cells).
Input Specification:
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 100$) — the sizes of the field.
The next $n$ lines contain the description of the field. Each line contains $m$ characters, each of them is "." (if this cell is empty), "*" (if there is bomb in this cell), or a digit from $1$ to $8$, inclusive.
Output Specification:
Print "YES", if the field is valid and "NO" otherwise.
You can choose the case (lower or upper) for each letter arbitrarily.
Demo Input:
['3 3\n111\n1*1\n111\n', '2 4\n*.*.\n1211\n']
Demo Output:
['YES', 'NO']
Note:
In the second example the answer is "NO" because, if the positions of the bombs are preserved, the first line of the field should be *2*1.
You can read more about Minesweeper in [Wikipedia's article](https://en.wikipedia.org/wiki/Minesweeper_(video_game)).
|
```python
n, m = map(int, input().split())
a = [input().replace('.', '0') for i in range(n)]
for i in range(n):
for j in range(m):
if a[i][j] != '*' and int(a[i][j]) != sum(map(lambda b: b[max(0, j - 1) : j + 2].count('*'), a[max(0, i - 1) : i + 2])):
print('NO')
exit()
print('YES')
```
| 3
|
|
538
|
A
|
Cutting Banner
|
PROGRAMMING
| 1,400
|
[
"brute force",
"implementation"
] | null | null |
A large banner with word CODEFORCES was ordered for the 1000-th onsite round of Codeforcesω that takes place on the Miami beach. Unfortunately, the company that made the banner mixed up two orders and delivered somebody else's banner that contains someone else's word. The word on the banner consists only of upper-case English letters.
There is very little time to correct the mistake. All that we can manage to do is to cut out some substring from the banner, i.e. several consecutive letters. After that all the resulting parts of the banner will be glued into a single piece (if the beginning or the end of the original banner was cut out, only one part remains); it is not allowed change the relative order of parts of the banner (i.e. after a substring is cut, several first and last letters are left, it is allowed only to glue the last letters to the right of the first letters). Thus, for example, for example, you can cut a substring out from string 'TEMPLATE' and get string 'TEMPLE' (if you cut out string AT), 'PLATE' (if you cut out TEM), 'T' (if you cut out EMPLATE), etc.
Help the organizers of the round determine whether it is possible to cut out of the banner some substring in such a way that the remaining parts formed word CODEFORCES.
|
The single line of the input contains the word written on the banner. The word only consists of upper-case English letters. The word is non-empty and its length doesn't exceed 100 characters. It is guaranteed that the word isn't word CODEFORCES.
|
Print 'YES', if there exists a way to cut out the substring, and 'NO' otherwise (without the quotes).
|
[
"CODEWAITFORITFORCES\n",
"BOTTOMCODER\n",
"DECODEFORCES\n",
"DOGEFORCES\n"
] |
[
"YES\n",
"NO\n",
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "CODEWAITFORITFORCES",
"output": "YES"
},
{
"input": "BOTTOMCODER",
"output": "NO"
},
{
"input": "DECODEFORCES",
"output": "YES"
},
{
"input": "DOGEFORCES",
"output": "NO"
},
{
"input": "ABACABA",
"output": "NO"
},
{
"input": "CODEFORCE",
"output": "NO"
},
{
"input": "C",
"output": "NO"
},
{
"input": "NQTSMZEBLY",
"output": "NO"
},
{
"input": "CODEFZORCES",
"output": "YES"
},
{
"input": "EDYKHVZCNTLJUUOQGHPTIOETQNFLLWEKZOHIUAXELGECABVSBIBGQODQXVYFKBYJWTGBYHVSSNTINKWSINWSMALUSIWNJMTCOOVF",
"output": "NO"
},
{
"input": "OCECFDSRDE",
"output": "NO"
},
{
"input": "MDBUWCZFFZKFMJTTJFXRHTGRPREORKDVUXOEMFYSOMSQGHUKGYCRCVJTNDLFDEWFS",
"output": "NO"
},
{
"input": "CODEFYTORCHES",
"output": "NO"
},
{
"input": "BCODEFORCES",
"output": "YES"
},
{
"input": "CVODEFORCES",
"output": "YES"
},
{
"input": "COAKDEFORCES",
"output": "YES"
},
{
"input": "CODFMWEFORCES",
"output": "YES"
},
{
"input": "CODEVCSYRFORCES",
"output": "YES"
},
{
"input": "CODEFXHHPWCVQORCES",
"output": "YES"
},
{
"input": "CODEFORQWUFJLOFFXTXRCES",
"output": "YES"
},
{
"input": "CODEFORBWFURYIDURNRKRDLHCLXZCES",
"output": "YES"
},
{
"input": "CODEFORCQSYSLYKCDFFUPSAZCJIAENCKZUFJZEINQIES",
"output": "YES"
},
{
"input": "CODEFORCEVENMDBQLSVPQIIBGSHBVOPYZXNWVSTVWDRONUREYJJIJIPMEBPQDCPFS",
"output": "YES"
},
{
"input": "CODEFORCESCFNNPAHNHDIPPBAUSPKJYAQDBVZNLSTSDCREZACVLMRFGVKGVHHZLXOHCTJDBQKIDWBUXDUJARLWGFGFCTTXUCAZB",
"output": "YES"
},
{
"input": "CODJRDPDEFOROES",
"output": "NO"
},
{
"input": "CODEFOGSIUZMZCMWAVQHNYFEKIEZQMAZOVEMDRMOEDBHAXPLBLDYYXCVTOOSJZVSQAKFXTBTZFWAYRZEMDEMVDJTDRXXAQBURCES",
"output": "YES"
},
{
"input": "CODEMKUYHAZSGJBQLXTHUCZZRJJJXUSEBOCNZASOKDZHMSGWZSDFBGHXFLABVPDQBJYXSHHAZAKHSTRGOKJYHRVSSUGDCMFOGCES",
"output": "NO"
},
{
"input": "CODEFORCESCODEFORCESCODEFORCESCODEFORCESCODEFORCESCODEFORCESCODEFORCESCODEFORCESCODEFORCES",
"output": "YES"
},
{
"input": "CCODEFORCESODECODEFORCCODEFORCESODCODEFORCESEFCODEFORCESORCODEFORCESCESCESFORCODEFORCESCES",
"output": "NO"
},
{
"input": "CCODEFORCESC",
"output": "NO"
},
{
"input": "CODEAFORBCES",
"output": "NO"
},
{
"input": "CODERRRRRFORCRRRRES",
"output": "NO"
},
{
"input": "CODELFORCELS",
"output": "NO"
},
{
"input": "CPOPDPEPFPOPRPCPEPS",
"output": "NO"
},
{
"input": "COXDEXFORXCEXS",
"output": "NO"
},
{
"input": "CODAAAAAFORCES",
"output": "NO"
},
{
"input": "CAOADEFORCES",
"output": "NO"
},
{
"input": "FORCESXCODE",
"output": "NO"
},
{
"input": "FORCESACODE",
"output": "NO"
},
{
"input": "ACAOADAEFORCES",
"output": "NO"
},
{
"input": "CCODEFORCESS",
"output": "NO"
},
{
"input": "ZCODEFORCEZ",
"output": "NO"
},
{
"input": "CODXEFORXCES",
"output": "NO"
},
{
"input": "CODEFORCEZ",
"output": "NO"
},
{
"input": "CODEFORCEST",
"output": "YES"
},
{
"input": "AXODEFORCES",
"output": "NO"
},
{
"input": "RCODEFORCESR",
"output": "NO"
},
{
"input": "CODECODEFORCESFORCES",
"output": "YES"
},
{
"input": "TTTWWWCODEFORCES",
"output": "YES"
},
{
"input": "CODEFORRCEST",
"output": "NO"
},
{
"input": "UJYTYUCODEFORCES",
"output": "YES"
},
{
"input": "CODEXXXXXXXXXXXXXXXXXXCODEFORCESXXXXXXXXXXXXXXXXXXXXXFORCES",
"output": "YES"
},
{
"input": "COXEDYFORCES",
"output": "NO"
},
{
"input": "UJYTYCODEFORCES",
"output": "YES"
},
{
"input": "UJYTCODEFORCES",
"output": "YES"
}
] | 1,552,895,162
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 28
| 109
| 0
|
S = 'CODEFORCES'
s = str(input())
a = False
for i in range(len(S)):
k = s.find(S[:len(S) - i])
if k != -1:
if s.find(S[len(S) - i:], k) != -1:
a = True
if a:
print('YES')
else:
print('NO')
|
Title: Cutting Banner
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A large banner with word CODEFORCES was ordered for the 1000-th onsite round of Codeforcesω that takes place on the Miami beach. Unfortunately, the company that made the banner mixed up two orders and delivered somebody else's banner that contains someone else's word. The word on the banner consists only of upper-case English letters.
There is very little time to correct the mistake. All that we can manage to do is to cut out some substring from the banner, i.e. several consecutive letters. After that all the resulting parts of the banner will be glued into a single piece (if the beginning or the end of the original banner was cut out, only one part remains); it is not allowed change the relative order of parts of the banner (i.e. after a substring is cut, several first and last letters are left, it is allowed only to glue the last letters to the right of the first letters). Thus, for example, for example, you can cut a substring out from string 'TEMPLATE' and get string 'TEMPLE' (if you cut out string AT), 'PLATE' (if you cut out TEM), 'T' (if you cut out EMPLATE), etc.
Help the organizers of the round determine whether it is possible to cut out of the banner some substring in such a way that the remaining parts formed word CODEFORCES.
Input Specification:
The single line of the input contains the word written on the banner. The word only consists of upper-case English letters. The word is non-empty and its length doesn't exceed 100 characters. It is guaranteed that the word isn't word CODEFORCES.
Output Specification:
Print 'YES', if there exists a way to cut out the substring, and 'NO' otherwise (without the quotes).
Demo Input:
['CODEWAITFORITFORCES\n', 'BOTTOMCODER\n', 'DECODEFORCES\n', 'DOGEFORCES\n']
Demo Output:
['YES\n', 'NO\n', 'YES\n', 'NO\n']
Note:
none
|
```python
S = 'CODEFORCES'
s = str(input())
a = False
for i in range(len(S)):
k = s.find(S[:len(S) - i])
if k != -1:
if s.find(S[len(S) - i:], k) != -1:
a = True
if a:
print('YES')
else:
print('NO')
```
| 0
|
|
888
|
D
|
Almost Identity Permutations
|
PROGRAMMING
| 1,600
|
[
"combinatorics",
"dp",
"math"
] | null | null |
A permutation *p* of size *n* is an array such that every integer from 1 to *n* occurs exactly once in this array.
Let's call a permutation an almost identity permutation iff there exist at least *n*<=-<=*k* indices *i* (1<=≤<=*i*<=≤<=*n*) such that *p**i*<==<=*i*.
Your task is to count the number of almost identity permutations for given numbers *n* and *k*.
|
The first line contains two integers *n* and *k* (4<=≤<=*n*<=≤<=1000, 1<=≤<=*k*<=≤<=4).
|
Print the number of almost identity permutations for given *n* and *k*.
|
[
"4 1\n",
"4 2\n",
"5 3\n",
"5 4\n"
] |
[
"1\n",
"7\n",
"31\n",
"76\n"
] |
none
| 0
|
[
{
"input": "4 1",
"output": "1"
},
{
"input": "4 2",
"output": "7"
},
{
"input": "5 3",
"output": "31"
},
{
"input": "5 4",
"output": "76"
},
{
"input": "200 1",
"output": "1"
},
{
"input": "200 2",
"output": "19901"
},
{
"input": "200 3",
"output": "2646701"
},
{
"input": "200 4",
"output": "584811251"
},
{
"input": "400 1",
"output": "1"
},
{
"input": "400 2",
"output": "79801"
},
{
"input": "400 3",
"output": "21253401"
},
{
"input": "400 4",
"output": "9477912501"
},
{
"input": "600 1",
"output": "1"
},
{
"input": "600 2",
"output": "179701"
},
{
"input": "600 3",
"output": "71820101"
},
{
"input": "600 4",
"output": "48187303751"
},
{
"input": "800 1",
"output": "1"
},
{
"input": "800 2",
"output": "319601"
},
{
"input": "800 3",
"output": "170346801"
},
{
"input": "800 4",
"output": "152620985001"
},
{
"input": "1000 1",
"output": "1"
},
{
"input": "1000 2",
"output": "499501"
},
{
"input": "1000 3",
"output": "332833501"
},
{
"input": "1000 4",
"output": "373086956251"
},
{
"input": "4 4",
"output": "24"
}
] | 1,661,513,816
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 25
| 46
| 0
|
from math import factorial as fact
errors = [1, 0, 1, 2, 9]
def cnk(n, k):
return fact(n) // (fact(k) * fact(n - k))
s = 0
n, k = map(int, input().split())
for i in range(k + 1):
s += cnk(n, i) * errors[i]
print(s)
|
Title: Almost Identity Permutations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A permutation *p* of size *n* is an array such that every integer from 1 to *n* occurs exactly once in this array.
Let's call a permutation an almost identity permutation iff there exist at least *n*<=-<=*k* indices *i* (1<=≤<=*i*<=≤<=*n*) such that *p**i*<==<=*i*.
Your task is to count the number of almost identity permutations for given numbers *n* and *k*.
Input Specification:
The first line contains two integers *n* and *k* (4<=≤<=*n*<=≤<=1000, 1<=≤<=*k*<=≤<=4).
Output Specification:
Print the number of almost identity permutations for given *n* and *k*.
Demo Input:
['4 1\n', '4 2\n', '5 3\n', '5 4\n']
Demo Output:
['1\n', '7\n', '31\n', '76\n']
Note:
none
|
```python
from math import factorial as fact
errors = [1, 0, 1, 2, 9]
def cnk(n, k):
return fact(n) // (fact(k) * fact(n - k))
s = 0
n, k = map(int, input().split())
for i in range(k + 1):
s += cnk(n, i) * errors[i]
print(s)
```
| 3
|
|
432
|
A
|
Choosing Teams
|
PROGRAMMING
| 800
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
The Saratov State University Olympiad Programmers Training Center (SSU OPTC) has *n* students. For each student you know the number of times he/she has participated in the ACM ICPC world programming championship. According to the ACM ICPC rules, each person can participate in the world championship at most 5 times.
The head of the SSU OPTC is recently gathering teams to participate in the world championship. Each team must consist of exactly three people, at that, any person cannot be a member of two or more teams. What maximum number of teams can the head make if he wants each team to participate in the world championship with the same members at least *k* times?
|
The first line contains two integers, *n* and *k* (1<=≤<=*n*<=≤<=2000; 1<=≤<=*k*<=≤<=5). The next line contains *n* integers: *y*1,<=*y*2,<=...,<=*y**n* (0<=≤<=*y**i*<=≤<=5), where *y**i* shows the number of times the *i*-th person participated in the ACM ICPC world championship.
|
Print a single number — the answer to the problem.
|
[
"5 2\n0 4 5 1 0\n",
"6 4\n0 1 2 3 4 5\n",
"6 5\n0 0 0 0 0 0\n"
] |
[
"1\n",
"0\n",
"2\n"
] |
In the first sample only one team could be made: the first, the fourth and the fifth participants.
In the second sample no teams could be created.
In the third sample two teams could be created. Any partition into two teams fits.
| 500
|
[
{
"input": "5 2\n0 4 5 1 0",
"output": "1"
},
{
"input": "6 4\n0 1 2 3 4 5",
"output": "0"
},
{
"input": "6 5\n0 0 0 0 0 0",
"output": "2"
},
{
"input": "3 4\n0 1 0",
"output": "1"
},
{
"input": "3 4\n0 2 0",
"output": "0"
},
{
"input": "6 5\n0 0 0 0 0 0",
"output": "2"
},
{
"input": "12 2\n0 1 2 3 4 0 1 2 3 4 0 1",
"output": "3"
},
{
"input": "15 2\n0 1 2 3 4 0 1 2 3 4 0 1 2 3 4",
"output": "4"
},
{
"input": "13 1\n5 0 5 0 1 5 0 4 1 1 1 4 1",
"output": "3"
},
{
"input": "20 1\n5 0 4 2 2 3 2 1 2 4 1 3 5 5 5 4 4 1 3 0",
"output": "5"
},
{
"input": "20 2\n1 4 5 1 3 4 0 5 0 3 3 0 4 0 0 1 4 2 0 4",
"output": "4"
},
{
"input": "20 2\n1 4 5 1 3 4 0 5 0 3 3 0 4 0 0 1 4 2 0 4",
"output": "4"
},
{
"input": "20 2\n1 4 5 1 3 4 0 5 0 3 3 0 4 0 0 1 4 2 0 4",
"output": "4"
},
{
"input": "20 2\n1 4 5 1 3 4 0 5 0 3 3 0 4 0 0 1 4 2 0 4",
"output": "4"
},
{
"input": "6 3\n4 4 4 4 4 4",
"output": "0"
},
{
"input": "1 4\n1",
"output": "0"
},
{
"input": "1 1\n0",
"output": "0"
},
{
"input": "2 3\n0 0",
"output": "0"
}
] | 1,659,847,835
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 35
| 46
| 0
|
import math
num = input()
num = num.split(" ")
k = int(num[1])
arr = input()
arr = arr.split(" ")
count = 0
j = 0
countPeople = 0
while j < len(arr):
if int(arr[j]) + k <= 5:
countPeople += 1
arr.remove(arr[j])
if countPeople == 3:
countPeople = 0
count += 1
print(count)
|
Title: Choosing Teams
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Saratov State University Olympiad Programmers Training Center (SSU OPTC) has *n* students. For each student you know the number of times he/she has participated in the ACM ICPC world programming championship. According to the ACM ICPC rules, each person can participate in the world championship at most 5 times.
The head of the SSU OPTC is recently gathering teams to participate in the world championship. Each team must consist of exactly three people, at that, any person cannot be a member of two or more teams. What maximum number of teams can the head make if he wants each team to participate in the world championship with the same members at least *k* times?
Input Specification:
The first line contains two integers, *n* and *k* (1<=≤<=*n*<=≤<=2000; 1<=≤<=*k*<=≤<=5). The next line contains *n* integers: *y*1,<=*y*2,<=...,<=*y**n* (0<=≤<=*y**i*<=≤<=5), where *y**i* shows the number of times the *i*-th person participated in the ACM ICPC world championship.
Output Specification:
Print a single number — the answer to the problem.
Demo Input:
['5 2\n0 4 5 1 0\n', '6 4\n0 1 2 3 4 5\n', '6 5\n0 0 0 0 0 0\n']
Demo Output:
['1\n', '0\n', '2\n']
Note:
In the first sample only one team could be made: the first, the fourth and the fifth participants.
In the second sample no teams could be created.
In the third sample two teams could be created. Any partition into two teams fits.
|
```python
import math
num = input()
num = num.split(" ")
k = int(num[1])
arr = input()
arr = arr.split(" ")
count = 0
j = 0
countPeople = 0
while j < len(arr):
if int(arr[j]) + k <= 5:
countPeople += 1
arr.remove(arr[j])
if countPeople == 3:
countPeople = 0
count += 1
print(count)
```
| 3
|
|
215
|
A
|
Bicycle Chain
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation"
] | null | null |
Vasya's bicycle chain drive consists of two parts: *n* stars are attached to the pedal axle, *m* stars are attached to the rear wheel axle. The chain helps to rotate the rear wheel by transmitting the pedal rotation.
We know that the *i*-th star on the pedal axle has *a**i* (0<=<<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*) teeth, and the *j*-th star on the rear wheel axle has *b**j* (0<=<<=*b*1<=<<=*b*2<=<<=...<=<<=*b**m*) teeth. Any pair (*i*,<=*j*) (1<=≤<=*i*<=≤<=*n*; 1<=≤<=*j*<=≤<=*m*) is called a gear and sets the indexes of stars to which the chain is currently attached. Gear (*i*,<=*j*) has a gear ratio, equal to the value .
Since Vasya likes integers, he wants to find such gears (*i*,<=*j*), that their ratios are integers. On the other hand, Vasya likes fast driving, so among all "integer" gears (*i*,<=*j*) he wants to choose a gear with the maximum ratio. Help him to find the number of such gears.
In the problem, fraction denotes division in real numbers, that is, no rounding is performed.
|
The first input line contains integer *n* (1<=≤<=*n*<=≤<=50) — the number of stars on the bicycle's pedal axle. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=104) in the order of strict increasing.
The third input line contains integer *m* (1<=≤<=*m*<=≤<=50) — the number of stars on the rear wheel axle. The fourth line contains *m* integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b**i*<=≤<=104) in the order of strict increasing.
It is guaranteed that there exists at least one gear (*i*,<=*j*), that its gear ratio is an integer. The numbers on the lines are separated by spaces.
|
Print the number of "integer" gears with the maximum ratio among all "integer" gears.
|
[
"2\n4 5\n3\n12 13 15\n",
"4\n1 2 3 4\n5\n10 11 12 13 14\n"
] |
[
"2\n",
"1\n"
] |
In the first sample the maximum "integer" gear ratio equals 3. There are two gears that have such gear ratio. For one of them *a*<sub class="lower-index">1</sub> = 4, *b*<sub class="lower-index">1</sub> = 12, and for the other *a*<sub class="lower-index">2</sub> = 5, *b*<sub class="lower-index">3</sub> = 15.
| 500
|
[
{
"input": "2\n4 5\n3\n12 13 15",
"output": "2"
},
{
"input": "4\n1 2 3 4\n5\n10 11 12 13 14",
"output": "1"
},
{
"input": "1\n1\n1\n1",
"output": "1"
},
{
"input": "2\n1 2\n1\n1",
"output": "1"
},
{
"input": "1\n1\n2\n1 2",
"output": "1"
},
{
"input": "4\n3 7 11 13\n4\n51 119 187 221",
"output": "4"
},
{
"input": "4\n2 3 4 5\n3\n1 2 3",
"output": "2"
},
{
"input": "10\n6 12 13 20 48 53 74 92 96 97\n10\n1 21 32 36 47 54 69 75 95 97",
"output": "1"
},
{
"input": "10\n5 9 10 14 15 17 19 22 24 26\n10\n2 11 17 19 21 22 24 25 27 28",
"output": "1"
},
{
"input": "10\n24 53 56 126 354 432 442 740 795 856\n10\n273 438 494 619 689 711 894 947 954 958",
"output": "1"
},
{
"input": "10\n3 4 6 7 8 10 14 16 19 20\n10\n3 4 5 7 8 10 15 16 18 20",
"output": "1"
},
{
"input": "10\n1 6 8 14 15 17 25 27 34 39\n10\n1 8 16 17 19 22 32 39 44 50",
"output": "1"
},
{
"input": "10\n5 21 22 23 25 32 35 36 38 39\n10\n3 7 8 9 18 21 23 24 36 38",
"output": "4"
},
{
"input": "50\n5 8 13 16 19 20 21 22 24 27 28 29 30 32 33 34 35 43 45 48 50 51 54 55 58 59 60 61 62 65 70 71 72 76 78 79 80 81 83 84 85 87 89 91 92 94 97 98 99 100\n50\n2 3 5 6 7 10 15 16 17 20 23 28 29 30 31 34 36 37 40 42 45 46 48 54 55 56 58 59 61 62 69 70 71 72 75 76 78 82 84 85 86 87 88 89 90 91 92 97 99 100",
"output": "1"
},
{
"input": "50\n3 5 6 8 9 11 13 19 21 23 24 32 34 35 42 50 51 52 56 58 59 69 70 72 73 75 76 77 78 80 83 88 90 95 96 100 101 102 108 109 113 119 124 135 138 141 142 143 145 150\n50\n5 8 10 11 18 19 23 30 35 43 51 53 55 58 63 68 69 71 77 78 79 82 83 86 88 89 91 92 93 94 96 102 103 105 109 110 113 114 116 123 124 126 127 132 133 135 136 137 142 149",
"output": "1"
},
{
"input": "50\n6 16 24 25 27 33 36 40 51 60 62 65 71 72 75 77 85 87 91 93 98 102 103 106 117 118 120 121 122 123 125 131 134 136 143 148 155 157 160 161 164 166 170 178 184 187 188 192 194 197\n50\n5 9 17 23 27 34 40 44 47 59 62 70 81 82 87 88 89 90 98 101 102 110 113 114 115 116 119 122 124 128 130 137 138 140 144 150 152 155 159 164 166 169 171 175 185 186 187 189 190 193",
"output": "1"
},
{
"input": "50\n14 22 23 31 32 35 48 63 76 79 88 97 101 102 103 104 106 113 114 115 116 126 136 138 145 152 155 156 162 170 172 173 179 180 182 203 208 210 212 222 226 229 231 232 235 237 245 246 247 248\n50\n2 5 6 16 28 44 45 46 54 55 56 63 72 80 87 93 94 96 97 100 101 103 132 135 140 160 164 165 167 168 173 180 182 185 186 192 194 198 199 202 203 211 213 216 217 227 232 233 236 245",
"output": "1"
},
{
"input": "50\n14 19 33 35 38 41 51 54 69 70 71 73 76 80 84 94 102 104 105 106 107 113 121 128 131 168 180 181 187 191 195 201 205 207 210 216 220 238 249 251 263 271 272 275 281 283 285 286 291 294\n50\n2 3 5 20 21 35 38 40 43 48 49 52 55 64 73 77 82 97 109 113 119 121 125 132 137 139 145 146 149 180 182 197 203 229 234 241 244 251 264 271 274 281 284 285 287 291 292 293 294 298",
"output": "1"
},
{
"input": "50\n2 4 5 16 18 19 22 23 25 26 34 44 48 54 67 79 80 84 92 110 116 133 138 154 163 171 174 202 205 218 228 229 234 245 247 249 250 263 270 272 274 275 277 283 289 310 312 334 339 342\n50\n1 5 17 18 25 37 46 47 48 59 67 75 80 83 84 107 115 122 137 141 159 162 175 180 184 204 221 224 240 243 247 248 249 258 259 260 264 266 269 271 274 293 294 306 329 330 334 335 342 350",
"output": "1"
},
{
"input": "50\n6 9 11 21 28 39 42 56 60 63 81 88 91 95 105 110 117 125 149 165 174 176 185 189 193 196 205 231 233 268 278 279 281 286 289 292 298 303 305 306 334 342 350 353 361 371 372 375 376 378\n50\n6 17 20 43 45 52 58 59 82 83 88 102 111 118 121 131 145 173 190 191 200 216 224 225 232 235 243 256 260 271 290 291 321 322 323 329 331 333 334 341 343 348 351 354 356 360 366 379 387 388",
"output": "1"
},
{
"input": "10\n17 239 443 467 661 1069 1823 2333 3767 4201\n20\n51 83 97 457 593 717 997 1329 1401 1459 1471 1983 2371 2539 3207 3251 3329 5469 6637 6999",
"output": "8"
},
{
"input": "20\n179 359 401 467 521 601 919 941 1103 1279 1709 1913 1949 2003 2099 2143 2179 2213 2399 4673\n20\n151 181 191 251 421 967 1109 1181 1249 1447 1471 1553 1619 2327 2551 2791 3049 3727 6071 7813",
"output": "3"
},
{
"input": "20\n79 113 151 709 809 983 1291 1399 1409 1429 2377 2659 2671 2897 3217 3511 3557 3797 3823 4363\n10\n19 101 659 797 1027 1963 2129 2971 3299 9217",
"output": "3"
},
{
"input": "30\n19 47 109 179 307 331 389 401 461 509 547 569 617 853 883 1249 1361 1381 1511 1723 1741 1783 2459 2531 2621 3533 3821 4091 5557 6217\n20\n401 443 563 941 967 997 1535 1567 1655 1747 1787 1945 1999 2251 2305 2543 2735 4415 6245 7555",
"output": "8"
},
{
"input": "30\n3 43 97 179 257 313 353 359 367 389 397 457 547 599 601 647 1013 1021 1063 1433 1481 1531 1669 3181 3373 3559 3769 4157 4549 5197\n50\n13 15 17 19 29 79 113 193 197 199 215 223 271 293 359 485 487 569 601 683 895 919 941 967 1283 1285 1289 1549 1565 1765 1795 1835 1907 1931 1945 1985 1993 2285 2731 2735 2995 3257 4049 4139 5105 5315 7165 7405 7655 8345",
"output": "20"
},
{
"input": "50\n11 17 23 53 59 109 137 149 173 251 353 379 419 421 439 503 593 607 661 773 821 877 941 997 1061 1117 1153 1229 1289 1297 1321 1609 1747 2311 2389 2543 2693 3041 3083 3137 3181 3209 3331 3373 3617 3767 4201 4409 4931 6379\n50\n55 59 67 73 85 89 101 115 211 263 295 353 545 599 607 685 739 745 997 1031 1255 1493 1523 1667 1709 1895 1949 2161 2195 2965 3019 3035 3305 3361 3373 3673 3739 3865 3881 4231 4253 4385 4985 5305 5585 5765 6145 6445 8045 8735",
"output": "23"
},
{
"input": "5\n33 78 146 3055 4268\n5\n2211 2584 5226 9402 9782",
"output": "3"
},
{
"input": "5\n35 48 52 86 8001\n10\n332 3430 3554 4704 4860 5096 6215 7583 8228 8428",
"output": "4"
},
{
"input": "10\n97 184 207 228 269 2084 4450 6396 7214 9457\n16\n338 1179 1284 1545 1570 2444 3167 3395 3397 5550 6440 7245 7804 7980 9415 9959",
"output": "5"
},
{
"input": "30\n25 30 41 57 58 62 70 72 76 79 84 85 88 91 98 101 104 109 119 129 136 139 148 151 926 1372 3093 3936 5423 7350\n25\n1600 1920 2624 3648 3712 3968 4480 4608 4864 5056 5376 5440 5632 5824 6272 6464 6656 6934 6976 7616 8256 8704 8896 9472 9664",
"output": "24"
},
{
"input": "5\n33 78 146 3055 4268\n5\n2211 2584 5226 9402 9782",
"output": "3"
},
{
"input": "5\n35 48 52 86 8001\n10\n332 3430 3554 4704 4860 5096 6215 7583 8228 8428",
"output": "4"
},
{
"input": "10\n97 184 207 228 269 2084 4450 6396 7214 9457\n16\n338 1179 1284 1545 1570 2444 3167 3395 3397 5550 6440 7245 7804 7980 9415 9959",
"output": "5"
},
{
"input": "30\n25 30 41 57 58 62 70 72 76 79 84 85 88 91 98 101 104 109 119 129 136 139 148 151 926 1372 3093 3936 5423 7350\n25\n1600 1920 2624 3648 3712 3968 4480 4608 4864 5056 5376 5440 5632 5824 6272 6464 6656 6934 6976 7616 8256 8704 8896 9472 9664",
"output": "24"
},
{
"input": "47\n66 262 357 457 513 530 538 540 592 691 707 979 1015 1242 1246 1667 1823 1886 1963 2133 2649 2679 2916 2949 3413 3523 3699 3958 4393 4922 5233 5306 5799 6036 6302 6629 7208 7282 7315 7822 7833 7927 8068 8150 8870 8962 9987\n39\n167 199 360 528 1515 1643 1986 1988 2154 2397 2856 3552 3656 3784 3980 4096 4104 4240 4320 4736 4951 5266 5656 5849 5850 6169 6517 6875 7244 7339 7689 7832 8120 8716 9503 9509 9933 9936 9968",
"output": "12"
},
{
"input": "1\n94\n50\n423 446 485 1214 1468 1507 1853 1930 1999 2258 2271 2285 2425 2543 2715 2743 2992 3196 4074 4108 4448 4475 4652 5057 5250 5312 5356 5375 5731 5986 6298 6501 6521 7146 7255 7276 7332 7481 7998 8141 8413 8665 8908 9221 9336 9491 9504 9677 9693 9706",
"output": "1"
},
{
"input": "50\n51 67 75 186 194 355 512 561 720 876 1077 1221 1503 1820 2153 2385 2568 2608 2937 2969 3271 3311 3481 4081 4093 4171 4255 4256 4829 5020 5192 5636 5817 6156 6712 6717 7153 7436 7608 7612 7866 7988 8264 8293 8867 9311 9879 9882 9889 9908\n1\n5394",
"output": "1"
},
{
"input": "50\n26 367 495 585 675 789 855 1185 1312 1606 2037 2241 2587 2612 2628 2807 2873 2924 3774 4067 4376 4668 4902 5001 5082 5100 5104 5209 5345 5515 5661 5777 5902 5907 6155 6323 6675 6791 7503 8159 8207 8254 8740 8848 8855 8933 9069 9164 9171 9586\n5\n1557 6246 7545 8074 8284",
"output": "1"
},
{
"input": "5\n25 58 91 110 2658\n50\n21 372 909 1172 1517 1554 1797 1802 1843 1977 2006 2025 2137 2225 2317 2507 2645 2754 2919 3024 3202 3212 3267 3852 4374 4487 4553 4668 4883 4911 4916 5016 5021 5068 5104 5162 5683 5856 6374 6871 7333 7531 8099 8135 8173 8215 8462 8776 9433 9790",
"output": "4"
},
{
"input": "45\n37 48 56 59 69 70 79 83 85 86 99 114 131 134 135 145 156 250 1739 1947 2116 2315 2449 3104 3666 4008 4406 4723 4829 5345 5836 6262 6296 6870 7065 7110 7130 7510 7595 8092 8442 8574 9032 9091 9355\n50\n343 846 893 1110 1651 1837 2162 2331 2596 3012 3024 3131 3294 3394 3528 3717 3997 4125 4347 4410 4581 4977 5030 5070 5119 5229 5355 5413 5418 5474 5763 5940 6151 6161 6164 6237 6506 6519 6783 7182 7413 7534 8069 8253 8442 8505 9135 9308 9828 9902",
"output": "17"
},
{
"input": "50\n17 20 22 28 36 38 46 47 48 50 52 57 58 62 63 69 70 74 75 78 79 81 82 86 87 90 93 95 103 202 292 442 1756 1769 2208 2311 2799 2957 3483 4280 4324 4932 5109 5204 6225 6354 6561 7136 8754 9670\n40\n68 214 957 1649 1940 2078 2134 2716 3492 3686 4462 4559 4656 4756 4850 5044 5490 5529 5592 5626 6014 6111 6693 6790 7178 7275 7566 7663 7702 7857 7954 8342 8511 8730 8957 9021 9215 9377 9445 9991",
"output": "28"
},
{
"input": "39\n10 13 21 25 36 38 47 48 58 64 68 69 73 79 86 972 2012 2215 2267 2503 3717 3945 4197 4800 5266 6169 6612 6824 7023 7322 7582 7766 8381 8626 8879 9079 9088 9838 9968\n50\n432 877 970 1152 1202 1223 1261 1435 1454 1578 1843 1907 2003 2037 2183 2195 2215 2425 3065 3492 3615 3637 3686 3946 4189 4415 4559 4656 4665 4707 4886 4887 5626 5703 5955 6208 6521 6581 6596 6693 6985 7013 7081 7343 7663 8332 8342 8637 9207 9862",
"output": "15"
},
{
"input": "50\n7 144 269 339 395 505 625 688 709 950 1102 1152 1350 1381 1641 1830 1977 1999 2093 2180 2718 3308 3574 4168 4232 4259 4393 4689 4982 5154 5476 5581 5635 5721 6159 6302 6741 7010 7152 7315 7417 7482 8116 8239 8640 9347 9395 9614 9661 9822\n20\n84 162 292 1728 1866 2088 3228 3470 4068 5318 5470 6060 6380 6929 7500 8256 8399 8467 8508 9691",
"output": "8"
},
{
"input": "50\n159 880 1070 1139 1358 1608 1691 1841 2073 2171 2213 2597 2692 2759 2879 2931 3173 3217 3441 4201 4878 5106 5129 5253 5395 5647 5968 6019 6130 6276 6286 6330 6409 6728 7488 7713 7765 7828 7899 8064 8264 8457 8483 8685 8900 8946 8965 9133 9187 9638\n45\n57 159 1070 1139 1391 1608 1691 1841 2171 2213 2692 2759 2931 3173 3217 3441 4201 4878 5106 5129 5253 5647 5968 6130 6276 6286 6409 7488 7694 7713 7765 7828 7899 8003 8064 8081 8244 8264 8685 8900 8946 8965 9133 9638 9673",
"output": "38"
},
{
"input": "3\n3 4 5\n3\n6 20 25",
"output": "2"
},
{
"input": "4\n2 3 5 8\n4\n2 6 8 10",
"output": "1"
},
{
"input": "4\n3 5 7 11\n4\n3 5 7 22",
"output": "1"
},
{
"input": "2\n2 3\n3\n20 30 50",
"output": "1"
},
{
"input": "3\n1 2 3\n4\n2 4 6 49",
"output": "1"
},
{
"input": "2\n4 5\n3\n12 15 20",
"output": "1"
},
{
"input": "3\n2 5 7\n3\n4 5 7",
"output": "1"
},
{
"input": "3\n3 5 8\n3\n6 8 10",
"output": "2"
},
{
"input": "2\n2 3\n4\n4 6 9 33",
"output": "1"
},
{
"input": "2\n2 3\n4\n4 6 21 40",
"output": "1"
},
{
"input": "3\n4 9 10\n3\n8 9 10",
"output": "1"
},
{
"input": "5\n1 5 6 9 51\n5\n5 12 18 27 10000",
"output": "1"
},
{
"input": "13\n1 2 3 4 5 6 7 8 9 10 11 12 13\n1\n14",
"output": "1"
}
] | 1,567,925,945
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 57
| 218
| 0
|
def BicycleChain(n,a,m,b):
maxGear = 0
cntMax = 0
for x in b:
for y in a:
ratio = x/y
if ratio.is_integer():
if ratio>maxGear:
cntMax = 1
maxGear = ratio
elif ratio==maxGear:
cntMax+=1
return cntMax
n = int(input())
a = [int(x) for x in input().split()]
m = int(input())
b = [int(x) for x in input().split()]
print(BicycleChain(n,a,m,b))
|
Title: Bicycle Chain
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya's bicycle chain drive consists of two parts: *n* stars are attached to the pedal axle, *m* stars are attached to the rear wheel axle. The chain helps to rotate the rear wheel by transmitting the pedal rotation.
We know that the *i*-th star on the pedal axle has *a**i* (0<=<<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*) teeth, and the *j*-th star on the rear wheel axle has *b**j* (0<=<<=*b*1<=<<=*b*2<=<<=...<=<<=*b**m*) teeth. Any pair (*i*,<=*j*) (1<=≤<=*i*<=≤<=*n*; 1<=≤<=*j*<=≤<=*m*) is called a gear and sets the indexes of stars to which the chain is currently attached. Gear (*i*,<=*j*) has a gear ratio, equal to the value .
Since Vasya likes integers, he wants to find such gears (*i*,<=*j*), that their ratios are integers. On the other hand, Vasya likes fast driving, so among all "integer" gears (*i*,<=*j*) he wants to choose a gear with the maximum ratio. Help him to find the number of such gears.
In the problem, fraction denotes division in real numbers, that is, no rounding is performed.
Input Specification:
The first input line contains integer *n* (1<=≤<=*n*<=≤<=50) — the number of stars on the bicycle's pedal axle. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=104) in the order of strict increasing.
The third input line contains integer *m* (1<=≤<=*m*<=≤<=50) — the number of stars on the rear wheel axle. The fourth line contains *m* integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b**i*<=≤<=104) in the order of strict increasing.
It is guaranteed that there exists at least one gear (*i*,<=*j*), that its gear ratio is an integer. The numbers on the lines are separated by spaces.
Output Specification:
Print the number of "integer" gears with the maximum ratio among all "integer" gears.
Demo Input:
['2\n4 5\n3\n12 13 15\n', '4\n1 2 3 4\n5\n10 11 12 13 14\n']
Demo Output:
['2\n', '1\n']
Note:
In the first sample the maximum "integer" gear ratio equals 3. There are two gears that have such gear ratio. For one of them *a*<sub class="lower-index">1</sub> = 4, *b*<sub class="lower-index">1</sub> = 12, and for the other *a*<sub class="lower-index">2</sub> = 5, *b*<sub class="lower-index">3</sub> = 15.
|
```python
def BicycleChain(n,a,m,b):
maxGear = 0
cntMax = 0
for x in b:
for y in a:
ratio = x/y
if ratio.is_integer():
if ratio>maxGear:
cntMax = 1
maxGear = ratio
elif ratio==maxGear:
cntMax+=1
return cntMax
n = int(input())
a = [int(x) for x in input().split()]
m = int(input())
b = [int(x) for x in input().split()]
print(BicycleChain(n,a,m,b))
```
| 3
|
|
414
|
B
|
Mashmokh and ACM
|
PROGRAMMING
| 1,400
|
[
"combinatorics",
"dp",
"number theory"
] | null | null |
Mashmokh's boss, Bimokh, didn't like Mashmokh. So he fired him. Mashmokh decided to go to university and participate in ACM instead of finding a new job. He wants to become a member of Bamokh's team. In order to join he was given some programming tasks and one week to solve them. Mashmokh is not a very experienced programmer. Actually he is not a programmer at all. So he wasn't able to solve them. That's why he asked you to help him with these tasks. One of these tasks is the following.
A sequence of *l* integers *b*1,<=*b*2,<=...,<=*b**l* (1<=≤<=*b*1<=≤<=*b*2<=≤<=...<=≤<=*b**l*<=≤<=*n*) is called good if each number divides (without a remainder) by the next number in the sequence. More formally for all *i* (1<=≤<=*i*<=≤<=*l*<=-<=1).
Given *n* and *k* find the number of good sequences of length *k*. As the answer can be rather large print it modulo 1000000007 (109<=+<=7).
|
The first line of input contains two space-separated integers *n*,<=*k* (1<=≤<=*n*,<=*k*<=≤<=2000).
|
Output a single integer — the number of good sequences of length *k* modulo 1000000007 (109<=+<=7).
|
[
"3 2\n",
"6 4\n",
"2 1\n"
] |
[
"5\n",
"39\n",
"2\n"
] |
In the first sample the good sequences are: [1, 1], [2, 2], [3, 3], [1, 2], [1, 3].
| 1,000
|
[
{
"input": "3 2",
"output": "5"
},
{
"input": "6 4",
"output": "39"
},
{
"input": "2 1",
"output": "2"
},
{
"input": "1478 194",
"output": "312087753"
},
{
"input": "1415 562",
"output": "953558593"
},
{
"input": "1266 844",
"output": "735042656"
},
{
"input": "680 1091",
"output": "351905328"
},
{
"input": "1229 1315",
"output": "100240813"
},
{
"input": "1766 1038",
"output": "435768250"
},
{
"input": "1000 1",
"output": "1000"
},
{
"input": "2000 100",
"output": "983281065"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "2000 1000",
"output": "228299266"
},
{
"input": "1928 1504",
"output": "81660104"
},
{
"input": "2000 2000",
"output": "585712681"
},
{
"input": "29 99",
"output": "23125873"
},
{
"input": "56 48",
"output": "20742237"
},
{
"input": "209 370",
"output": "804680894"
},
{
"input": "83 37",
"output": "22793555"
},
{
"input": "49 110",
"output": "956247348"
},
{
"input": "217 3",
"output": "4131"
},
{
"input": "162 161",
"output": "591739753"
},
{
"input": "273 871",
"output": "151578252"
},
{
"input": "43 1640",
"output": "173064407"
},
{
"input": "1472 854",
"output": "748682383"
},
{
"input": "1639 1056",
"output": "467464129"
},
{
"input": "359 896",
"output": "770361185"
},
{
"input": "1544 648",
"output": "9278889"
},
{
"input": "436 1302",
"output": "874366220"
},
{
"input": "1858 743",
"output": "785912917"
},
{
"input": "991 1094",
"output": "483493131"
},
{
"input": "1013 1550",
"output": "613533467"
},
{
"input": "675 741",
"output": "474968598"
},
{
"input": "1420 1223",
"output": "922677437"
},
{
"input": "1544 1794",
"output": "933285446"
},
{
"input": "1903 1612",
"output": "620810276"
},
{
"input": "500 1304",
"output": "706176027"
},
{
"input": "525 314",
"output": "245394744"
},
{
"input": "39 1930",
"output": "992125404"
},
{
"input": "1895 753",
"output": "180474828"
},
{
"input": "1722 1474",
"output": "742424590"
},
{
"input": "1153 1823",
"output": "791493066"
},
{
"input": "1409 734",
"output": "627413973"
},
{
"input": "478 1301",
"output": "476483030"
},
{
"input": "1887 1729",
"output": "730033374"
},
{
"input": "1610 774",
"output": "50897314"
},
{
"input": "1770 679",
"output": "235295539"
},
{
"input": "987 1292",
"output": "560110556"
},
{
"input": "1707 1117",
"output": "237674323"
},
{
"input": "1424 1431",
"output": "184145444"
},
{
"input": "86 1078",
"output": "252515343"
},
{
"input": "1066 995",
"output": "180753612"
},
{
"input": "1024 133",
"output": "392603027"
},
{
"input": "659 974",
"output": "397026719"
},
{
"input": "1349 1606",
"output": "522392901"
},
{
"input": "473 211",
"output": "809550224"
},
{
"input": "634 1825",
"output": "438513382"
},
{
"input": "22 373",
"output": "907321755"
},
{
"input": "531 147",
"output": "242883376"
},
{
"input": "1307 1247",
"output": "21512331"
},
{
"input": "415 735",
"output": "393705804"
},
{
"input": "1659 1501",
"output": "225266660"
},
{
"input": "1454 296",
"output": "750032659"
},
{
"input": "158 772",
"output": "850911301"
},
{
"input": "2000 1",
"output": "2000"
}
] | 1,535,201,045
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
#include <iostream>
#define ll long long
#define mod 1000000007
#include <bits/stdc++.h>
using namespace std;
int main()
{
int n,k;
cin>>n>>k;
ll dp[k+1][n+1];
int i,j,l;
for(i=0;i<=k;i++){
for(j=0;j<=n;j++){
dp[i][j]=0;
}
}
for(i=0;i<=n;i++) dp[1][i]=1;
for(i=2;i<=k;i++){
for(j=1;j<=n;j++){
for(l=j;l<=n;l+=j){
dp[i][l]=(dp[i][l]+dp[i-1][j])%(mod);
}
}
}
ll sum=0;
for(i=1;i<=n;i++) sum+=dp[k][i];
cout<<(sum%mod)<<endl;
return 0;
}
|
Title: Mashmokh and ACM
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mashmokh's boss, Bimokh, didn't like Mashmokh. So he fired him. Mashmokh decided to go to university and participate in ACM instead of finding a new job. He wants to become a member of Bamokh's team. In order to join he was given some programming tasks and one week to solve them. Mashmokh is not a very experienced programmer. Actually he is not a programmer at all. So he wasn't able to solve them. That's why he asked you to help him with these tasks. One of these tasks is the following.
A sequence of *l* integers *b*1,<=*b*2,<=...,<=*b**l* (1<=≤<=*b*1<=≤<=*b*2<=≤<=...<=≤<=*b**l*<=≤<=*n*) is called good if each number divides (without a remainder) by the next number in the sequence. More formally for all *i* (1<=≤<=*i*<=≤<=*l*<=-<=1).
Given *n* and *k* find the number of good sequences of length *k*. As the answer can be rather large print it modulo 1000000007 (109<=+<=7).
Input Specification:
The first line of input contains two space-separated integers *n*,<=*k* (1<=≤<=*n*,<=*k*<=≤<=2000).
Output Specification:
Output a single integer — the number of good sequences of length *k* modulo 1000000007 (109<=+<=7).
Demo Input:
['3 2\n', '6 4\n', '2 1\n']
Demo Output:
['5\n', '39\n', '2\n']
Note:
In the first sample the good sequences are: [1, 1], [2, 2], [3, 3], [1, 2], [1, 3].
|
```python
#include <iostream>
#define ll long long
#define mod 1000000007
#include <bits/stdc++.h>
using namespace std;
int main()
{
int n,k;
cin>>n>>k;
ll dp[k+1][n+1];
int i,j,l;
for(i=0;i<=k;i++){
for(j=0;j<=n;j++){
dp[i][j]=0;
}
}
for(i=0;i<=n;i++) dp[1][i]=1;
for(i=2;i<=k;i++){
for(j=1;j<=n;j++){
for(l=j;l<=n;l+=j){
dp[i][l]=(dp[i][l]+dp[i-1][j])%(mod);
}
}
}
ll sum=0;
for(i=1;i<=n;i++) sum+=dp[k][i];
cout<<(sum%mod)<<endl;
return 0;
}
```
| -1
|
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,671,537,527
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 92
| 0
|
a=input()
a=[*a]
u=0
l=0
for i in range(len(a)):
if a[i].isupper()==True:
u+=1
else:
l+=1
if u==l:
(x)=("".join(a))
print(x.lower())
elif u>l:
x=("".join(a))
print(x.upper())
else:
x=("".join(a))
print(x.lower())
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
a=input()
a=[*a]
u=0
l=0
for i in range(len(a)):
if a[i].isupper()==True:
u+=1
else:
l+=1
if u==l:
(x)=("".join(a))
print(x.lower())
elif u>l:
x=("".join(a))
print(x.upper())
else:
x=("".join(a))
print(x.lower())
```
| 3.977
|
258
|
A
|
Little Elephant and Bits
|
PROGRAMMING
| 1,100
|
[
"greedy",
"math"
] | null | null |
The Little Elephant has an integer *a*, written in the binary notation. He wants to write this number on a piece of paper.
To make sure that the number *a* fits on the piece of paper, the Little Elephant ought to delete exactly one any digit from number *a* in the binary record. At that a new number appears. It consists of the remaining binary digits, written in the corresponding order (possible, with leading zeroes).
The Little Elephant wants the number he is going to write on the paper to be as large as possible. Help him find the maximum number that he can obtain after deleting exactly one binary digit and print it in the binary notation.
|
The single line contains integer *a*, written in the binary notation without leading zeroes. This number contains more than 1 and at most 105 digits.
|
In the single line print the number that is written without leading zeroes in the binary notation — the answer to the problem.
|
[
"101\n",
"110010\n"
] |
[
"11\n",
"11010\n"
] |
In the first sample the best strategy is to delete the second digit. That results in number 11<sub class="lower-index">2</sub> = 3<sub class="lower-index">10</sub>.
In the second sample the best strategy is to delete the third or fourth digits — that results in number 11010<sub class="lower-index">2</sub> = 26<sub class="lower-index">10</sub>.
| 500
|
[
{
"input": "101",
"output": "11"
},
{
"input": "110010",
"output": "11010"
},
{
"input": "10000",
"output": "1000"
},
{
"input": "1111111110",
"output": "111111111"
},
{
"input": "10100101011110101",
"output": "1100101011110101"
},
{
"input": "111010010111",
"output": "11110010111"
},
{
"input": "11110111011100000000",
"output": "1111111011100000000"
},
{
"input": "11110010010100001110110101110011110110100111101",
"output": "1111010010100001110110101110011110110100111101"
},
{
"input": "1001011111010010100111111",
"output": "101011111010010100111111"
},
{
"input": "1111111111",
"output": "111111111"
},
{
"input": "1111111111111111111100111101001110110111111000001111110101001101001110011000001011001111111000110101",
"output": "111111111111111111110111101001110110111111000001111110101001101001110011000001011001111111000110101"
},
{
"input": "11010110000100100101111110111001001010011000011011000010010100111010101000111010011101101111110001111000101000001100011101110100",
"output": "1110110000100100101111110111001001010011000011011000010010100111010101000111010011101101111110001111000101000001100011101110100"
},
{
"input": "11111111111111111111111110110111001101100111010010101101101001011100011011000111010011110010101100010001011101011010010100001000011100001101101001100010100001001010010100100001111110100110011000101100001111111011010111001011111110111101000100101001001011",
"output": "1111111111111111111111111110111001101100111010010101101101001011100011011000111010011110010101100010001011101011010010100001000011100001101101001100010100001001010010100100001111110100110011000101100001111111011010111001011111110111101000100101001001011"
},
{
"input": "11100010010010000110101101101100111111001010001101101001001111010110010111001011010000001100110101000101111000001111101111110010000010101110011110101101010110001100011101111011100010011101100111110010111111100110101000000111101000000000110100100101111101000110101010101101001110001110000101011010101100011100100111100010001011010010001100011111110010011010011000111000100111100010110100011010010101011011011111110100001110000011011",
"output": "1110010010010000110101101101100111111001010001101101001001111010110010111001011010000001100110101000101111000001111101111110010000010101110011110101101010110001100011101111011100010011101100111110010111111100110101000000111101000000000110100100101111101000110101010101101001110001110000101011010101100011100100111100010001011010010001100011111110010011010011000111000100111100010110100011010010101011011011111110100001110000011011"
},
{
"input": "11",
"output": "1"
},
{
"input": "111",
"output": "11"
},
{
"input": "111111",
"output": "11111"
},
{
"input": "11111",
"output": "1111"
},
{
"input": "1111",
"output": "111"
}
] | 1,683,851,638
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 16
| 2,000
| 8,192,000
|
def obterMaiorValor(numeroBinario):
maiorValor = 0
for i in range(len(numeroBinario)):
numeroReduzido = numeroBinario[:i] + numeroBinario[i+1:]
valorDecimal = int(numeroReduzido, 2)
if valorDecimal > maiorValor:
maiorValor = valorDecimal
return bin(maiorValor)[2:]
numeroBinario = input()
maiorValorBinario = obterMaiorValor(numeroBinario)
print(maiorValorBinario)
|
Title: Little Elephant and Bits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant has an integer *a*, written in the binary notation. He wants to write this number on a piece of paper.
To make sure that the number *a* fits on the piece of paper, the Little Elephant ought to delete exactly one any digit from number *a* in the binary record. At that a new number appears. It consists of the remaining binary digits, written in the corresponding order (possible, with leading zeroes).
The Little Elephant wants the number he is going to write on the paper to be as large as possible. Help him find the maximum number that he can obtain after deleting exactly one binary digit and print it in the binary notation.
Input Specification:
The single line contains integer *a*, written in the binary notation without leading zeroes. This number contains more than 1 and at most 105 digits.
Output Specification:
In the single line print the number that is written without leading zeroes in the binary notation — the answer to the problem.
Demo Input:
['101\n', '110010\n']
Demo Output:
['11\n', '11010\n']
Note:
In the first sample the best strategy is to delete the second digit. That results in number 11<sub class="lower-index">2</sub> = 3<sub class="lower-index">10</sub>.
In the second sample the best strategy is to delete the third or fourth digits — that results in number 11010<sub class="lower-index">2</sub> = 26<sub class="lower-index">10</sub>.
|
```python
def obterMaiorValor(numeroBinario):
maiorValor = 0
for i in range(len(numeroBinario)):
numeroReduzido = numeroBinario[:i] + numeroBinario[i+1:]
valorDecimal = int(numeroReduzido, 2)
if valorDecimal > maiorValor:
maiorValor = valorDecimal
return bin(maiorValor)[2:]
numeroBinario = input()
maiorValorBinario = obterMaiorValor(numeroBinario)
print(maiorValorBinario)
```
| 0
|
|
102
|
B
|
Sum of Digits
|
PROGRAMMING
| 1,000
|
[
"implementation"
] |
B. Sum of Digits
|
2
|
265
|
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit?
|
The first line contains the only integer *n* (0<=≤<=*n*<=≤<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes.
|
Print the number of times a number can be replaced by the sum of its digits until it only contains one digit.
|
[
"0\n",
"10\n",
"991\n"
] |
[
"0\n",
"1\n",
"3\n"
] |
In the first sample the number already is one-digit — Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991 → 19 → 10 → 1. After three transformations the number becomes one-digit.
| 1,000
|
[
{
"input": "0",
"output": "0"
},
{
"input": "10",
"output": "1"
},
{
"input": "991",
"output": "3"
},
{
"input": "99",
"output": "2"
},
{
"input": "100",
"output": "1"
},
{
"input": "123456789",
"output": "2"
},
{
"input": "32",
"output": "1"
},
{
"input": "86",
"output": "2"
},
{
"input": "2",
"output": "0"
},
{
"input": "8",
"output": "0"
},
{
"input": "34",
"output": "1"
},
{
"input": "13",
"output": "1"
},
{
"input": "28",
"output": "2"
},
{
"input": "23",
"output": "1"
},
{
"input": "57",
"output": "2"
},
{
"input": "29",
"output": "2"
},
{
"input": "353869285",
"output": "3"
},
{
"input": "549548646",
"output": "2"
},
{
"input": "858893424",
"output": "2"
},
{
"input": "644818852",
"output": "3"
},
{
"input": "360322525",
"output": "3"
},
{
"input": "122937520",
"output": "2"
},
{
"input": "288403032",
"output": "2"
},
{
"input": "677257481",
"output": "3"
},
{
"input": "58059561",
"output": "3"
},
{
"input": "211288847",
"output": "2"
},
{
"input": "339900034079539584",
"output": "2"
},
{
"input": "784084029310269952",
"output": "3"
},
{
"input": "774730557264864000",
"output": "3"
},
{
"input": "478233807148352256",
"output": "3"
},
{
"input": "165646874056812544",
"output": "3"
},
{
"input": "477533739511673792",
"output": "3"
},
{
"input": "660119944377002240",
"output": "3"
},
{
"input": "448375218506078080",
"output": "3"
},
{
"input": "77213334785795616",
"output": "3"
},
{
"input": "165767221702271872",
"output": "3"
},
{
"input": "1",
"output": "0"
},
{
"input": "5",
"output": "0"
},
{
"input": "8",
"output": "0"
},
{
"input": "156161456146164104103460452045416165146141414651641564105461465156445621465146514562146145465165145145614561465145614561",
"output": "3"
},
{
"input": "9",
"output": "0"
}
] | 1,612,048,398
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 51
| 184
| 1,433,600
|
l = [*map(int, input().strip())]
count = 0
while len(l) > 1:
count += 1
s = 0
for d in l:
s += d
l = [*map(int, str(s))]
print(count)
|
Title: Sum of Digits
Time Limit: 2 seconds
Memory Limit: 265 megabytes
Problem Description:
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit?
Input Specification:
The first line contains the only integer *n* (0<=≤<=*n*<=≤<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes.
Output Specification:
Print the number of times a number can be replaced by the sum of its digits until it only contains one digit.
Demo Input:
['0\n', '10\n', '991\n']
Demo Output:
['0\n', '1\n', '3\n']
Note:
In the first sample the number already is one-digit — Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991 → 19 → 10 → 1. After three transformations the number becomes one-digit.
|
```python
l = [*map(int, input().strip())]
count = 0
while len(l) > 1:
count += 1
s = 0
for d in l:
s += d
l = [*map(int, str(s))]
print(count)
```
| 3.95142
|
779
|
B
|
Weird Rounding
|
PROGRAMMING
| 1,100
|
[
"brute force",
"greedy"
] | null | null |
Polycarp is crazy about round numbers. He especially likes the numbers divisible by 10*k*.
In the given number of *n* Polycarp wants to remove the least number of digits to get a number that is divisible by 10*k*. For example, if *k*<==<=3, in the number 30020 it is enough to delete a single digit (2). In this case, the result is 3000 that is divisible by 103<==<=1000.
Write a program that prints the minimum number of digits to be deleted from the given integer number *n*, so that the result is divisible by 10*k*. The result should not start with the unnecessary leading zero (i.e., zero can start only the number 0, which is required to be written as exactly one digit).
It is guaranteed that the answer exists.
|
The only line of the input contains two integer numbers *n* and *k* (0<=≤<=*n*<=≤<=2<=000<=000<=000, 1<=≤<=*k*<=≤<=9).
It is guaranteed that the answer exists. All numbers in the input are written in traditional notation of integers, that is, without any extra leading zeros.
|
Print *w* — the required minimal number of digits to erase. After removing the appropriate *w* digits from the number *n*, the result should have a value that is divisible by 10*k*. The result can start with digit 0 in the single case (the result is zero and written by exactly the only digit 0).
|
[
"30020 3\n",
"100 9\n",
"10203049 2\n"
] |
[
"1\n",
"2\n",
"3\n"
] |
In the example 2 you can remove two digits: 1 and any 0. The result is number 0 which is divisible by any number.
| 1,000
|
[
{
"input": "30020 3",
"output": "1"
},
{
"input": "100 9",
"output": "2"
},
{
"input": "10203049 2",
"output": "3"
},
{
"input": "0 1",
"output": "0"
},
{
"input": "0 9",
"output": "0"
},
{
"input": "100 2",
"output": "0"
},
{
"input": "102030404 2",
"output": "2"
},
{
"input": "1000999999 3",
"output": "6"
},
{
"input": "12000000 4",
"output": "0"
},
{
"input": "1090090090 5",
"output": "2"
},
{
"input": "10 1",
"output": "0"
},
{
"input": "10 2",
"output": "1"
},
{
"input": "10 9",
"output": "1"
},
{
"input": "100 1",
"output": "0"
},
{
"input": "100 3",
"output": "2"
},
{
"input": "101010110 3",
"output": "3"
},
{
"input": "101010110 1",
"output": "0"
},
{
"input": "101010110 2",
"output": "2"
},
{
"input": "101010110 4",
"output": "4"
},
{
"input": "101010110 5",
"output": "8"
},
{
"input": "101010110 9",
"output": "8"
},
{
"input": "1234567890 1",
"output": "0"
},
{
"input": "1234567890 2",
"output": "9"
},
{
"input": "1234567890 9",
"output": "9"
},
{
"input": "2000000000 1",
"output": "0"
},
{
"input": "2000000000 2",
"output": "0"
},
{
"input": "2000000000 3",
"output": "0"
},
{
"input": "2000000000 9",
"output": "0"
},
{
"input": "1010101010 1",
"output": "0"
},
{
"input": "1010101010 2",
"output": "1"
},
{
"input": "1010101010 3",
"output": "2"
},
{
"input": "1010101010 4",
"output": "3"
},
{
"input": "1010101010 5",
"output": "4"
},
{
"input": "1010101010 6",
"output": "9"
},
{
"input": "1010101010 7",
"output": "9"
},
{
"input": "1010101010 8",
"output": "9"
},
{
"input": "1010101010 9",
"output": "9"
},
{
"input": "10001000 1",
"output": "0"
},
{
"input": "10001000 2",
"output": "0"
},
{
"input": "10001000 3",
"output": "0"
},
{
"input": "10001000 4",
"output": "1"
},
{
"input": "10001000 5",
"output": "1"
},
{
"input": "10001000 6",
"output": "1"
},
{
"input": "10001000 7",
"output": "7"
},
{
"input": "10001000 8",
"output": "7"
},
{
"input": "10001000 9",
"output": "7"
},
{
"input": "1000000001 1",
"output": "1"
},
{
"input": "1000000001 2",
"output": "1"
},
{
"input": "1000000001 3",
"output": "1"
},
{
"input": "1000000001 6",
"output": "1"
},
{
"input": "1000000001 7",
"output": "1"
},
{
"input": "1000000001 8",
"output": "1"
},
{
"input": "1000000001 9",
"output": "9"
},
{
"input": "1000 1",
"output": "0"
},
{
"input": "100001100 3",
"output": "2"
},
{
"input": "7057 6",
"output": "3"
},
{
"input": "30000000 5",
"output": "0"
},
{
"input": "470 1",
"output": "0"
},
{
"input": "500500000 4",
"output": "0"
},
{
"input": "2103 8",
"output": "3"
},
{
"input": "600000000 2",
"output": "0"
},
{
"input": "708404442 1",
"output": "4"
},
{
"input": "5000140 6",
"output": "6"
},
{
"input": "1100047 3",
"output": "2"
},
{
"input": "309500 5",
"output": "5"
},
{
"input": "70053160 4",
"output": "7"
},
{
"input": "44000 1",
"output": "0"
},
{
"input": "400370000 3",
"output": "0"
},
{
"input": "5800 6",
"output": "3"
},
{
"input": "20700050 1",
"output": "0"
},
{
"input": "650 1",
"output": "0"
},
{
"input": "320005070 6",
"output": "8"
},
{
"input": "370000 4",
"output": "0"
},
{
"input": "1011 2",
"output": "3"
},
{
"input": "1000111 5",
"output": "6"
},
{
"input": "1001111 5",
"output": "6"
},
{
"input": "99990 3",
"output": "4"
},
{
"input": "10100200 6",
"output": "7"
},
{
"input": "200 3",
"output": "2"
},
{
"input": "103055 3",
"output": "5"
},
{
"input": "1030555 3",
"output": "6"
},
{
"input": "100111 4",
"output": "5"
},
{
"input": "101 2",
"output": "2"
},
{
"input": "1001 3",
"output": "3"
},
{
"input": "100000 6",
"output": "5"
},
{
"input": "1100000 6",
"output": "6"
},
{
"input": "123450 2",
"output": "5"
},
{
"input": "1003 3",
"output": "3"
},
{
"input": "1111100 4",
"output": "6"
},
{
"input": "532415007 8",
"output": "8"
},
{
"input": "801 2",
"output": "2"
},
{
"input": "1230 2",
"output": "3"
},
{
"input": "9900 3",
"output": "3"
},
{
"input": "14540444 2",
"output": "7"
},
{
"input": "11111100 4",
"output": "7"
},
{
"input": "11001 3",
"output": "4"
},
{
"input": "1011110 3",
"output": "6"
},
{
"input": "15450112 2",
"output": "7"
},
{
"input": "2220 3",
"output": "3"
},
{
"input": "90099 3",
"output": "4"
},
{
"input": "10005 4",
"output": "4"
},
{
"input": "1010 3",
"output": "3"
},
{
"input": "444444400 3",
"output": "8"
},
{
"input": "10020 4",
"output": "4"
},
{
"input": "10303 3",
"output": "4"
},
{
"input": "123000 4",
"output": "5"
},
{
"input": "12300 3",
"output": "4"
},
{
"input": "101 1",
"output": "1"
},
{
"input": "500001 8",
"output": "5"
},
{
"input": "121002 3",
"output": "5"
},
{
"input": "10011 3",
"output": "4"
},
{
"input": "505050 4",
"output": "5"
},
{
"input": "1421011 2",
"output": "6"
},
{
"input": "1202022 3",
"output": "6"
},
{
"input": "1000023 7",
"output": "6"
},
{
"input": "110 2",
"output": "2"
},
{
"input": "111000 4",
"output": "5"
},
{
"input": "10340 3",
"output": "4"
},
{
"input": "101 9",
"output": "2"
},
{
"input": "2001 3",
"output": "3"
},
{
"input": "122320 2",
"output": "5"
},
{
"input": "22200 3",
"output": "4"
},
{
"input": "11110 2",
"output": "4"
},
{
"input": "11010 3",
"output": "4"
},
{
"input": "1000002333 6",
"output": "9"
},
{
"input": "101010 4",
"output": "5"
},
{
"input": "210 9",
"output": "2"
},
{
"input": "500555 3",
"output": "5"
},
{
"input": "1110111 3",
"output": "6"
},
{
"input": "1100000000 9",
"output": "9"
},
{
"input": "11000 4",
"output": "4"
},
{
"input": "100 4",
"output": "2"
},
{
"input": "234560 3",
"output": "5"
},
{
"input": "10230 3",
"output": "4"
},
{
"input": "10030234 5",
"output": "7"
},
{
"input": "1200 3",
"output": "3"
},
{
"input": "123400 3",
"output": "5"
},
{
"input": "1034543 4",
"output": "6"
},
{
"input": "10100 4",
"output": "4"
},
{
"input": "10 5",
"output": "1"
},
{
"input": "4501022 3",
"output": "6"
},
{
"input": "12340 2",
"output": "4"
},
{
"input": "30020 4",
"output": "4"
},
{
"input": "1111100 6",
"output": "6"
},
{
"input": "10101 5",
"output": "4"
},
{
"input": "32132100 3",
"output": "7"
},
{
"input": "1000023 6",
"output": "6"
},
{
"input": "12300 4",
"output": "4"
},
{
"input": "78400 3",
"output": "4"
},
{
"input": "10203049 5",
"output": "7"
},
{
"input": "404044 3",
"output": "5"
},
{
"input": "1024 2",
"output": "3"
},
{
"input": "505 2",
"output": "2"
},
{
"input": "20 2",
"output": "1"
},
{
"input": "1111100 3",
"output": "6"
},
{
"input": "1000 9",
"output": "3"
},
{
"input": "3333300 3",
"output": "6"
},
{
"input": "1100 3",
"output": "3"
},
{
"input": "963000 4",
"output": "5"
},
{
"input": "100457 5",
"output": "5"
},
{
"input": "10049 3",
"output": "4"
}
] | 1,488,154,764
| 1,764
|
Python 3
|
OK
|
TESTS
| 111
| 62
| 4,608,000
|
n,k = input().split()
k = int(k)
cnt = 0
rem = 0
for i in n[::-1]:
i = int(i)
if i==0:
cnt += 1
else:
rem += 1
if cnt==k:
print(rem)
break
if cnt<k:
print(cnt+rem-1)
|
Title: Weird Rounding
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarp is crazy about round numbers. He especially likes the numbers divisible by 10*k*.
In the given number of *n* Polycarp wants to remove the least number of digits to get a number that is divisible by 10*k*. For example, if *k*<==<=3, in the number 30020 it is enough to delete a single digit (2). In this case, the result is 3000 that is divisible by 103<==<=1000.
Write a program that prints the minimum number of digits to be deleted from the given integer number *n*, so that the result is divisible by 10*k*. The result should not start with the unnecessary leading zero (i.e., zero can start only the number 0, which is required to be written as exactly one digit).
It is guaranteed that the answer exists.
Input Specification:
The only line of the input contains two integer numbers *n* and *k* (0<=≤<=*n*<=≤<=2<=000<=000<=000, 1<=≤<=*k*<=≤<=9).
It is guaranteed that the answer exists. All numbers in the input are written in traditional notation of integers, that is, without any extra leading zeros.
Output Specification:
Print *w* — the required minimal number of digits to erase. After removing the appropriate *w* digits from the number *n*, the result should have a value that is divisible by 10*k*. The result can start with digit 0 in the single case (the result is zero and written by exactly the only digit 0).
Demo Input:
['30020 3\n', '100 9\n', '10203049 2\n']
Demo Output:
['1\n', '2\n', '3\n']
Note:
In the example 2 you can remove two digits: 1 and any 0. The result is number 0 which is divisible by any number.
|
```python
n,k = input().split()
k = int(k)
cnt = 0
rem = 0
for i in n[::-1]:
i = int(i)
if i==0:
cnt += 1
else:
rem += 1
if cnt==k:
print(rem)
break
if cnt<k:
print(cnt+rem-1)
```
| 3
|
|
448
|
D
|
Multiplication Table
|
PROGRAMMING
| 1,800
|
[
"binary search",
"brute force"
] | null | null |
Bizon the Champion isn't just charming, he also is very smart.
While some of us were learning the multiplication table, Bizon the Champion had fun in his own manner. Bizon the Champion painted an *n*<=×<=*m* multiplication table, where the element on the intersection of the *i*-th row and *j*-th column equals *i*·*j* (the rows and columns of the table are numbered starting from 1). Then he was asked: what number in the table is the *k*-th largest number? Bizon the Champion always answered correctly and immediately. Can you repeat his success?
Consider the given multiplication table. If you write out all *n*·*m* numbers from the table in the non-decreasing order, then the *k*-th number you write out is called the *k*-th largest number.
|
The single line contains integers *n*, *m* and *k* (1<=≤<=*n*,<=*m*<=≤<=5·105; 1<=≤<=*k*<=≤<=*n*·*m*).
|
Print the *k*-th largest number in a *n*<=×<=*m* multiplication table.
|
[
"2 2 2\n",
"2 3 4\n",
"1 10 5\n"
] |
[
"2\n",
"3\n",
"5\n"
] |
A 2 × 3 multiplication table looks like this:
| 2,000
|
[
{
"input": "2 2 2",
"output": "2"
},
{
"input": "2 3 4",
"output": "3"
},
{
"input": "1 10 5",
"output": "5"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "10 1 7",
"output": "7"
},
{
"input": "10 10 33",
"output": "14"
},
{
"input": "500000 500000 1",
"output": "1"
},
{
"input": "500000 500000 250000000000",
"output": "250000000000"
},
{
"input": "3 3 1",
"output": "1"
},
{
"input": "3 3 2",
"output": "2"
},
{
"input": "3 3 3",
"output": "2"
},
{
"input": "3 3 5",
"output": "3"
},
{
"input": "3 3 8",
"output": "6"
},
{
"input": "3 3 9",
"output": "9"
},
{
"input": "1 500000 74747",
"output": "74747"
},
{
"input": "500000 1 47474",
"output": "47474"
},
{
"input": "499975 499981 12345",
"output": "1634"
},
{
"input": "499997 499989 248758432143",
"output": "225563648440"
},
{
"input": "5 1 2",
"output": "2"
},
{
"input": "2 2 4",
"output": "4"
},
{
"input": "1 2 1",
"output": "1"
},
{
"input": "2 44 36",
"output": "24"
},
{
"input": "2 28 49",
"output": "42"
},
{
"input": "3 48 30",
"output": "17"
},
{
"input": "5 385 1296",
"output": "711"
},
{
"input": "1 454 340",
"output": "340"
},
{
"input": "1 450 399",
"output": "399"
},
{
"input": "1 3304 218",
"output": "218"
},
{
"input": "3 4175 661",
"output": "361"
},
{
"input": "4 1796 2564",
"output": "1232"
},
{
"input": "2 33975 17369",
"output": "11580"
},
{
"input": "4 25555 45556",
"output": "21868"
},
{
"input": "5 17136 9220",
"output": "4039"
},
{
"input": "3 355632 94220",
"output": "51393"
},
{
"input": "5 353491 107977",
"output": "47290"
},
{
"input": "4 194790 114613",
"output": "55015"
},
{
"input": "47 5 157",
"output": "87"
},
{
"input": "26 5 79",
"output": "42"
},
{
"input": "40 2 3",
"output": "2"
},
{
"input": "12 28 127",
"output": "49"
},
{
"input": "32 12 132",
"output": "50"
},
{
"input": "48 40 937",
"output": "364"
},
{
"input": "45 317 6079",
"output": "2160"
},
{
"input": "18 459 7733",
"output": "5684"
},
{
"input": "38 127 1330",
"output": "404"
},
{
"input": "25 1155 9981",
"output": "3318"
},
{
"input": "41 4600 39636",
"output": "10865"
},
{
"input": "20 2222 11312",
"output": "3502"
},
{
"input": "32 11568 36460",
"output": "8988"
},
{
"input": "48 33111 5809",
"output": "1308"
},
{
"input": "27 24692 71714",
"output": "18432"
},
{
"input": "46 356143 2399416",
"output": "598032"
},
{
"input": "25 127045 1458997",
"output": "548779"
},
{
"input": "41 246624 2596292",
"output": "751716"
},
{
"input": "264 3 775",
"output": "741"
},
{
"input": "495 3 17",
"output": "10"
},
{
"input": "252 5 672",
"output": "328"
},
{
"input": "314 32 3903",
"output": "1345"
},
{
"input": "472 15 932",
"output": "283"
},
{
"input": "302 39 4623",
"output": "1589"
},
{
"input": "318 440 57023",
"output": "19203"
},
{
"input": "403 363 932",
"output": "175"
},
{
"input": "306 433 25754",
"output": "6500"
},
{
"input": "143 1735 246128",
"output": "218316"
},
{
"input": "447 4446 802918",
"output": "268036"
},
{
"input": "132 3890 439379",
"output": "265096"
},
{
"input": "366 45769 5885721",
"output": "1841004"
},
{
"input": "123 37349 4224986",
"output": "2895390"
},
{
"input": "427 46704 7152399",
"output": "2256408"
},
{
"input": "357 184324 28748161",
"output": "9992350"
},
{
"input": "187 425625 25103321",
"output": "7534560"
},
{
"input": "345 423483 40390152",
"output": "11441760"
},
{
"input": "4775 3 7798",
"output": "4254"
},
{
"input": "1035 2 2055",
"output": "2040"
},
{
"input": "3119 3 7305",
"output": "5024"
},
{
"input": "1140 18 11371",
"output": "4830"
},
{
"input": "4313 40 86640",
"output": "33496"
},
{
"input": "2396 24 55229",
"output": "43102"
},
{
"input": "2115 384 385536",
"output": "140250"
},
{
"input": "2376 308 665957",
"output": "445248"
},
{
"input": "4460 377 1197310",
"output": "581462"
},
{
"input": "2315 1673 225263",
"output": "40950"
},
{
"input": "1487 3295 736705",
"output": "169290"
},
{
"input": "3571 3828 7070865",
"output": "2696688"
},
{
"input": "3082 23173 68350097",
"output": "51543000"
},
{
"input": "1165 34678 7211566",
"output": "1745254"
},
{
"input": "1426 26259 37212278",
"output": "33359110"
},
{
"input": "2930 491026 923941798",
"output": "409544625"
},
{
"input": "3191 454046 718852491",
"output": "267275676"
},
{
"input": "1274 295345 301511265",
"output": "165699050"
},
{
"input": "10657 3 9816",
"output": "5355"
},
{
"input": "38939 3 6757",
"output": "3686"
},
{
"input": "37107 4 28350",
"output": "13608"
},
{
"input": "19618 16 313726",
"output": "311296"
},
{
"input": "27824 40 906786",
"output": "518185"
},
{
"input": "46068 31 424079",
"output": "131352"
},
{
"input": "40716 482 14569037",
"output": "7363656"
},
{
"input": "48922 150 653002",
"output": "135716"
},
{
"input": "37203 219 2355222",
"output": "681502"
},
{
"input": "23808 3322 48603931",
"output": "20824476"
},
{
"input": "12090 2766 12261436",
"output": "3894264"
},
{
"input": "20296 4388 29300901",
"output": "8862304"
},
{
"input": "29699 38801 37684232",
"output": "6032628"
},
{
"input": "17980 28231 221639883",
"output": "76707084"
},
{
"input": "16148 39736 239320912",
"output": "76569666"
},
{
"input": "35531 340928 9207622511",
"output": "4761654318"
},
{
"input": "43737 111829 865416726",
"output": "208223208"
},
{
"input": "21980 353130 2233068545",
"output": "638445948"
},
{
"input": "339697 4 1259155",
"output": "993876"
},
{
"input": "404625 2 132619",
"output": "88413"
},
{
"input": "226111 2 359116",
"output": "266010"
},
{
"input": "318377 38 7214261",
"output": "3108710"
},
{
"input": "139863 21 1834174",
"output": "833220"
},
{
"input": "204791 41 8382971",
"output": "8020256"
},
{
"input": "149281 382 51428462",
"output": "33762615"
},
{
"input": "370768 123 15161219",
"output": "4677246"
},
{
"input": "313975 448 85041752",
"output": "36070940"
},
{
"input": "136614 3211 364472869",
"output": "209750632"
},
{
"input": "201542 4833 512478332",
"output": "197440230"
},
{
"input": "423029 1365 126620483",
"output": "32780826"
},
{
"input": "110941 47433 2098952903",
"output": "693548595"
},
{
"input": "175869 39014 3201917805",
"output": "1148848775"
},
{
"input": "397356 10518 874806404",
"output": "222468766"
},
{
"input": "118728 168631 16269281609",
"output": "9092195490"
},
{
"input": "183656 409931 42943608085",
"output": "17438143800"
},
{
"input": "283422 407789 73398688052",
"output": "32237937640"
},
{
"input": "500000 500000 888888",
"output": "77856"
}
] | 1,657,535,091
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 15
| 0
|
import sys
n = int(sys.argv[0])
m = int(sys.argv[1])
k = int(sys.argv[2])
print(n, m, k)
l = 1
r = n * m
mid = ans = -1
while(l <= r):
mid = int((l + r)/2)
cnt = int(0)
for i in range(1, n + 1) :
cnt += min(m, int((mid - 1)/i))
if (cnt < k):
ans = mid
l = mid + 1
else:
r = mid - 1
print(ans)
|
Title: Multiplication Table
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bizon the Champion isn't just charming, he also is very smart.
While some of us were learning the multiplication table, Bizon the Champion had fun in his own manner. Bizon the Champion painted an *n*<=×<=*m* multiplication table, where the element on the intersection of the *i*-th row and *j*-th column equals *i*·*j* (the rows and columns of the table are numbered starting from 1). Then he was asked: what number in the table is the *k*-th largest number? Bizon the Champion always answered correctly and immediately. Can you repeat his success?
Consider the given multiplication table. If you write out all *n*·*m* numbers from the table in the non-decreasing order, then the *k*-th number you write out is called the *k*-th largest number.
Input Specification:
The single line contains integers *n*, *m* and *k* (1<=≤<=*n*,<=*m*<=≤<=5·105; 1<=≤<=*k*<=≤<=*n*·*m*).
Output Specification:
Print the *k*-th largest number in a *n*<=×<=*m* multiplication table.
Demo Input:
['2 2 2\n', '2 3 4\n', '1 10 5\n']
Demo Output:
['2\n', '3\n', '5\n']
Note:
A 2 × 3 multiplication table looks like this:
|
```python
import sys
n = int(sys.argv[0])
m = int(sys.argv[1])
k = int(sys.argv[2])
print(n, m, k)
l = 1
r = n * m
mid = ans = -1
while(l <= r):
mid = int((l + r)/2)
cnt = int(0)
for i in range(1, n + 1) :
cnt += min(m, int((mid - 1)/i))
if (cnt < k):
ans = mid
l = mid + 1
else:
r = mid - 1
print(ans)
```
| -1
|
|
903
|
C
|
Boxes Packing
|
PROGRAMMING
| 1,200
|
[
"greedy"
] | null | null |
Mishka has got *n* empty boxes. For every *i* (1<=≤<=*i*<=≤<=*n*), *i*-th box is a cube with side length *a**i*.
Mishka can put a box *i* into another box *j* if the following conditions are met:
- *i*-th box is not put into another box; - *j*-th box doesn't contain any other boxes; - box *i* is smaller than box *j* (*a**i*<=<<=*a**j*).
Mishka can put boxes into each other an arbitrary number of times. He wants to minimize the number of visible boxes. A box is called visible iff it is not put into some another box.
Help Mishka to determine the minimum possible number of visible boxes!
|
The first line contains one integer *n* (1<=≤<=*n*<=≤<=5000) — the number of boxes Mishka has got.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109), where *a**i* is the side length of *i*-th box.
|
Print the minimum possible number of visible boxes.
|
[
"3\n1 2 3\n",
"4\n4 2 4 3\n"
] |
[
"1\n",
"2\n"
] |
In the first example it is possible to put box 1 into box 2, and 2 into 3.
In the second example Mishka can put box 2 into box 3, and box 4 into box 1.
| 0
|
[
{
"input": "3\n1 2 3",
"output": "1"
},
{
"input": "4\n4 2 4 3",
"output": "2"
},
{
"input": "10\n58 58 58 58 58 58 58 58 58 58",
"output": "10"
},
{
"input": "10\n86 89 89 86 86 89 86 86 89 89",
"output": "5"
},
{
"input": "100\n981 288 186 186 292 876 341 288 981 360 783 907 292 186 341 292 360 876 360 360 981 398 783 288 292 398 876 981 398 907 783 360 288 981 907 186 360 288 186 981 186 288 907 876 288 907 876 360 341 292 907 783 907 783 292 981 907 292 876 398 783 876 398 341 876 186 288 186 981 341 398 360 907 981 341 186 292 981 292 398 876 783 292 186 360 292 288 292 876 398 288 292 341 288 398 360 360 292 981 360",
"output": "14"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "1\n9",
"output": "1"
},
{
"input": "1\n5",
"output": "1"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "1\n131",
"output": "1"
},
{
"input": "9\n1 1 1 1 1 1 1 1 1",
"output": "9"
},
{
"input": "11\n1 1 1 1 1 1 1 1 1 1 1",
"output": "11"
},
{
"input": "8\n1 2 3 4 5 6 7 8",
"output": "1"
},
{
"input": "8\n1 1 1 1 1 1 1 1",
"output": "8"
},
{
"input": "5\n1 1 1 1 1",
"output": "5"
}
] | 1,695,737,653
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 24
| 62
| 2,048,000
|
n = int(input())
l = list(map(int,input().split()))
d = {}
r = 0
for i in range(n):
d[l[i]] = d.get(l[i],0)+1
r = max(r,d[l[i]])
print(r)
|
Title: Boxes Packing
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mishka has got *n* empty boxes. For every *i* (1<=≤<=*i*<=≤<=*n*), *i*-th box is a cube with side length *a**i*.
Mishka can put a box *i* into another box *j* if the following conditions are met:
- *i*-th box is not put into another box; - *j*-th box doesn't contain any other boxes; - box *i* is smaller than box *j* (*a**i*<=<<=*a**j*).
Mishka can put boxes into each other an arbitrary number of times. He wants to minimize the number of visible boxes. A box is called visible iff it is not put into some another box.
Help Mishka to determine the minimum possible number of visible boxes!
Input Specification:
The first line contains one integer *n* (1<=≤<=*n*<=≤<=5000) — the number of boxes Mishka has got.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109), where *a**i* is the side length of *i*-th box.
Output Specification:
Print the minimum possible number of visible boxes.
Demo Input:
['3\n1 2 3\n', '4\n4 2 4 3\n']
Demo Output:
['1\n', '2\n']
Note:
In the first example it is possible to put box 1 into box 2, and 2 into 3.
In the second example Mishka can put box 2 into box 3, and box 4 into box 1.
|
```python
n = int(input())
l = list(map(int,input().split()))
d = {}
r = 0
for i in range(n):
d[l[i]] = d.get(l[i],0)+1
r = max(r,d[l[i]])
print(r)
```
| 3
|
|
929
|
B
|
Места в самолёте
|
PROGRAMMING
| 1,300
|
[
"*special",
"implementation"
] | null | null |
В самолёте есть *n* рядов мест. Если смотреть на ряды сверху, то в каждом ряду есть 3 места слева, затем проход между рядами, затем 4 центральных места, затем ещё один проход между рядами, а затем ещё 3 места справа.
Известно, что некоторые места уже заняты пассажирами. Всего есть два вида пассажиров — статусные (те, которые часто летают) и обычные.
Перед вами стоит задача рассадить ещё *k* обычных пассажиров так, чтобы суммарное число соседей у статусных пассажиров было минимально возможным. Два пассажира считаются соседями, если они сидят в одном ряду и между ними нет других мест и прохода между рядами. Если пассажир является соседним пассажиром для двух статусных пассажиров, то его следует учитывать в сумме соседей дважды.
|
В первой строке следуют два целых числа *n* и *k* (1<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=10·*n*) — количество рядов мест в самолёте и количество пассажиров, которых нужно рассадить.
Далее следует описание рядов мест самолёта по одному ряду в строке. Если очередной символ равен '-', то это проход между рядами. Если очередной символ равен '.', то это свободное место. Если очередной символ равен 'S', то на текущем месте будет сидеть статусный пассажир. Если очередной символ равен 'P', то на текущем месте будет сидеть обычный пассажир.
Гарантируется, что количество свободных мест не меньше *k*. Гарантируется, что все ряды удовлетворяют описанному в условии формату.
|
В первую строку выведите минимальное суммарное число соседей у статусных пассажиров.
Далее выведите план рассадки пассажиров, который минимизирует суммарное количество соседей у статусных пассажиров, в том же формате, что и во входных данных. Если в свободное место нужно посадить одного из *k* пассажиров, выведите строчную букву 'x' вместо символа '.'.
|
[
"1 2\nSP.-SS.S-S.S\n",
"4 9\nPP.-PPPS-S.S\nPSP-PPSP-.S.\n.S.-S..P-SS.\nP.S-P.PP-PSP\n"
] |
[
"5\nSPx-SSxS-S.S\n",
"15\nPPx-PPPS-S.S\nPSP-PPSP-xSx\nxSx-SxxP-SSx\nP.S-PxPP-PSP\n"
] |
В первом примере нужно посадить ещё двух обычных пассажиров. Для минимизации соседей у статусных пассажиров, нужно посадить первого из них на третье слева место, а второго на любое из оставшихся двух мест, так как независимо от выбора места он станет соседом двух статусных пассажиров.
Изначально, у статусного пассажира, который сидит на самом левом месте уже есть сосед. Также на четвёртом и пятом местах слева сидят статусные пассажиры, являющиеся соседями друг для друга (что добавляет к сумме 2).
Таким образом, после посадки ещё двух обычных пассажиров, итоговое суммарное количество соседей у статусных пассажиров станет равно пяти.
| 1,000
|
[
{
"input": "1 2\nSP.-SS.S-S.S",
"output": "5\nSPx-SSxS-S.S"
},
{
"input": "4 9\nPP.-PPPS-S.S\nPSP-PPSP-.S.\n.S.-S..P-SS.\nP.S-P.PP-PSP",
"output": "15\nPPx-PPPS-S.S\nPSP-PPSP-xSx\nxSx-SxxP-SSx\nP.S-PxPP-PSP"
},
{
"input": "3 7\n.S.-SSSP-..S\nS..-.SPP-S.P\n.S.-PPPP-PSP",
"output": "13\nxSx-SSSP-xxS\nSxx-xSPP-S.P\n.S.-PPPP-PSP"
},
{
"input": "5 6\nPP.-PS.P-P..\nPPS-SP..-P.P\nP.P-....-S..\nSPP-.P.S-.S.\nSP.-S.PS-PPP",
"output": "6\nPPx-PS.P-Pxx\nPPS-SPxx-PxP\nP.P-....-S..\nSPP-.P.S-.S.\nSP.-S.PS-PPP"
},
{
"input": "1 1\n..S-PS..-.PP",
"output": "1\nx.S-PS..-.PP"
},
{
"input": "2 2\nPP.-S.SS-.S.\nSSP-SSSS-S.S",
"output": "12\nPPx-S.SS-xS.\nSSP-SSSS-S.S"
},
{
"input": "30 1\nPPP-PPP.-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP",
"output": "0\nPPP-PPPx-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP"
},
{
"input": "1 1\nSPS-....-P.P",
"output": "2\nSPS-x...-P.P"
},
{
"input": "2 1\nSSS-S.S.-SSS\nSSP-.PP.-S.S",
"output": "11\nSSS-S.S.-SSS\nSSP-xPP.-S.S"
},
{
"input": "30 1\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPP.-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP",
"output": "0\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPx-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP\nPPP-PPPP-PPP"
}
] | 1,520,032,274
| 27,374
|
Python 3
|
OK
|
TESTS
| 47
| 62
| 5,734,400
|
n, k = [int(i) for i in input().split()]
mas = []
for i in range(n):
mas.append([j for j in input()])
#print(mas)
#print(k)
if k != 0:
for i in range(n):
for j in range(12):
if mas[i][j] == '.':
if j > 0 and j < 11:
if mas[i][j+1] != 'S' and mas[i][j-1] != 'S':
mas[i][j] = 'x'
k -= 1
elif j == 0:
if mas[i][j+1] != 'S':
mas[i][j] = 'x'
k -= 1
elif j == 11:
if mas[i][j-1] != 'S':
mas[i][j] = 'x'
k -= 1
if k == 0:
break
if k == 0:
break
#print(k)
if k != 0:
for i in range(n):
for j in range(12):
if mas[i][j] == '.':
if j > 0 and j < 11:
if (mas[i][j+1] == 'S' and mas[i][j-1] != 'S') or (mas[i][j-1] == 'S' and mas[i][j+1] != 'S'):
mas[i][j] = 'x'
k -= 1
else:
mas[i][j] = 'x'
k -= 1
if k == 0:
break
if k == 0:
break
#print(k)
if k != 0:
for i in range(n):
for j in range(12):
if mas[i][j] == '.':
mas[i][j] = 'x'
k -= 1
if k == 0:
break
if k == 0:
break
#print(k)
res = 0
for i in range(n):
for j in range(12):
if mas[i][j] == 'S':
if j == 0:
if mas[i][j + 1] == 'S' or mas[i][j + 1] == 'P' or mas[i][j + 1] == 'x': res += 1
elif j == 11:
if mas[i][j - 1] == 'S' or mas[i][j - 1] == 'P' or mas[i][j - 1] == 'x': res += 1
else:
if mas[i][j + 1] == 'S' or mas[i][j + 1] == 'P' or mas[i][j + 1] == 'x': res += 1
if mas[i][j - 1] == 'S' or mas[i][j - 1] == 'P' or mas[i][j - 1] == 'x': res += 1
print(res)
for i in range(n):
for j in mas[i]:
print(j, end='')
print()
|
Title: Места в самолёте
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
В самолёте есть *n* рядов мест. Если смотреть на ряды сверху, то в каждом ряду есть 3 места слева, затем проход между рядами, затем 4 центральных места, затем ещё один проход между рядами, а затем ещё 3 места справа.
Известно, что некоторые места уже заняты пассажирами. Всего есть два вида пассажиров — статусные (те, которые часто летают) и обычные.
Перед вами стоит задача рассадить ещё *k* обычных пассажиров так, чтобы суммарное число соседей у статусных пассажиров было минимально возможным. Два пассажира считаются соседями, если они сидят в одном ряду и между ними нет других мест и прохода между рядами. Если пассажир является соседним пассажиром для двух статусных пассажиров, то его следует учитывать в сумме соседей дважды.
Input Specification:
В первой строке следуют два целых числа *n* и *k* (1<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=10·*n*) — количество рядов мест в самолёте и количество пассажиров, которых нужно рассадить.
Далее следует описание рядов мест самолёта по одному ряду в строке. Если очередной символ равен '-', то это проход между рядами. Если очередной символ равен '.', то это свободное место. Если очередной символ равен 'S', то на текущем месте будет сидеть статусный пассажир. Если очередной символ равен 'P', то на текущем месте будет сидеть обычный пассажир.
Гарантируется, что количество свободных мест не меньше *k*. Гарантируется, что все ряды удовлетворяют описанному в условии формату.
Output Specification:
В первую строку выведите минимальное суммарное число соседей у статусных пассажиров.
Далее выведите план рассадки пассажиров, который минимизирует суммарное количество соседей у статусных пассажиров, в том же формате, что и во входных данных. Если в свободное место нужно посадить одного из *k* пассажиров, выведите строчную букву 'x' вместо символа '.'.
Demo Input:
['1 2\nSP.-SS.S-S.S\n', '4 9\nPP.-PPPS-S.S\nPSP-PPSP-.S.\n.S.-S..P-SS.\nP.S-P.PP-PSP\n']
Demo Output:
['5\nSPx-SSxS-S.S\n', '15\nPPx-PPPS-S.S\nPSP-PPSP-xSx\nxSx-SxxP-SSx\nP.S-PxPP-PSP\n']
Note:
В первом примере нужно посадить ещё двух обычных пассажиров. Для минимизации соседей у статусных пассажиров, нужно посадить первого из них на третье слева место, а второго на любое из оставшихся двух мест, так как независимо от выбора места он станет соседом двух статусных пассажиров.
Изначально, у статусного пассажира, который сидит на самом левом месте уже есть сосед. Также на четвёртом и пятом местах слева сидят статусные пассажиры, являющиеся соседями друг для друга (что добавляет к сумме 2).
Таким образом, после посадки ещё двух обычных пассажиров, итоговое суммарное количество соседей у статусных пассажиров станет равно пяти.
|
```python
n, k = [int(i) for i in input().split()]
mas = []
for i in range(n):
mas.append([j for j in input()])
#print(mas)
#print(k)
if k != 0:
for i in range(n):
for j in range(12):
if mas[i][j] == '.':
if j > 0 and j < 11:
if mas[i][j+1] != 'S' and mas[i][j-1] != 'S':
mas[i][j] = 'x'
k -= 1
elif j == 0:
if mas[i][j+1] != 'S':
mas[i][j] = 'x'
k -= 1
elif j == 11:
if mas[i][j-1] != 'S':
mas[i][j] = 'x'
k -= 1
if k == 0:
break
if k == 0:
break
#print(k)
if k != 0:
for i in range(n):
for j in range(12):
if mas[i][j] == '.':
if j > 0 and j < 11:
if (mas[i][j+1] == 'S' and mas[i][j-1] != 'S') or (mas[i][j-1] == 'S' and mas[i][j+1] != 'S'):
mas[i][j] = 'x'
k -= 1
else:
mas[i][j] = 'x'
k -= 1
if k == 0:
break
if k == 0:
break
#print(k)
if k != 0:
for i in range(n):
for j in range(12):
if mas[i][j] == '.':
mas[i][j] = 'x'
k -= 1
if k == 0:
break
if k == 0:
break
#print(k)
res = 0
for i in range(n):
for j in range(12):
if mas[i][j] == 'S':
if j == 0:
if mas[i][j + 1] == 'S' or mas[i][j + 1] == 'P' or mas[i][j + 1] == 'x': res += 1
elif j == 11:
if mas[i][j - 1] == 'S' or mas[i][j - 1] == 'P' or mas[i][j - 1] == 'x': res += 1
else:
if mas[i][j + 1] == 'S' or mas[i][j + 1] == 'P' or mas[i][j + 1] == 'x': res += 1
if mas[i][j - 1] == 'S' or mas[i][j - 1] == 'P' or mas[i][j - 1] == 'x': res += 1
print(res)
for i in range(n):
for j in mas[i]:
print(j, end='')
print()
```
| 3
|
|
681
|
C
|
Heap Operations
|
PROGRAMMING
| 1,600
|
[
"constructive algorithms",
"data structures",
"greedy"
] | null | null |
Petya has recently learned data structure named "Binary heap".
The heap he is now operating with allows the following operations:
- put the given number into the heap; - get the value of the minimum element in the heap; - extract the minimum element from the heap;
Thus, at any moment of time the heap contains several integers (possibly none), some of them might be equal.
In order to better learn this data structure Petya took an empty heap and applied some operations above to it. Also, he carefully wrote down all the operations and their results to his event log, following the format:
- insert *x* — put the element with value *x* in the heap; - getMin *x* — the value of the minimum element contained in the heap was equal to *x*; - removeMin — the minimum element was extracted from the heap (only one instance, if there were many).
All the operations were correct, i.e. there was at least one element in the heap each time getMin or removeMin operations were applied.
While Petya was away for a lunch, his little brother Vova came to the room, took away some of the pages from Petya's log and used them to make paper boats.
Now Vova is worried, if he made Petya's sequence of operations inconsistent. For example, if one apply operations one-by-one in the order they are written in the event log, results of getMin operations might differ from the results recorded by Petya, and some of getMin or removeMin operations may be incorrect, as the heap is empty at the moment they are applied.
Now Vova wants to add some new operation records to the event log in order to make the resulting sequence of operations correct. That is, the result of each getMin operation is equal to the result in the record, and the heap is non-empty when getMin ad removeMin are applied. Vova wants to complete this as fast as possible, as the Petya may get back at any moment. He asks you to add the least possible number of operation records to the current log. Note that arbitrary number of operations may be added at the beginning, between any two other operations, or at the end of the log.
|
The first line of the input contains the only integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of the records left in Petya's journal.
Each of the following *n* lines describe the records in the current log in the order they are applied. Format described in the statement is used. All numbers in the input are integers not exceeding 109 by their absolute value.
|
The first line of the output should contain a single integer *m* — the minimum possible number of records in the modified sequence of operations.
Next *m* lines should contain the corrected sequence of records following the format of the input (described in the statement), one per line and in the order they are applied. All the numbers in the output should be integers not exceeding 109 by their absolute value.
Note that the input sequence of operations must be the subsequence of the output sequence.
It's guaranteed that there exists the correct answer consisting of no more than 1<=000<=000 operations.
|
[
"2\ninsert 3\ngetMin 4\n",
"4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2\n"
] |
[
"4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4\n",
"6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2\n"
] |
In the first sample, after number 3 is inserted into the heap, the minimum number is 3. To make the result of the first getMin equal to 4 one should firstly remove number 3 from the heap and then add number 4 into the heap.
In the second sample case number 1 is inserted two times, so should be similarly removed twice.
| 1,500
|
[
{
"input": "2\ninsert 3\ngetMin 4",
"output": "4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4"
},
{
"input": "4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2",
"output": "6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2"
},
{
"input": "1\ninsert 1",
"output": "1\ninsert 1"
},
{
"input": "1\ngetMin 31",
"output": "2\ninsert 31\ngetMin 31"
},
{
"input": "1\nremoveMin",
"output": "2\ninsert 0\nremoveMin"
},
{
"input": "2\ninsert 2\ngetMin 2",
"output": "2\ninsert 2\ngetMin 2"
},
{
"input": "2\ninsert 31\nremoveMin",
"output": "2\ninsert 31\nremoveMin"
},
{
"input": "2\ngetMin 31\nremoveMin",
"output": "3\ninsert 31\ngetMin 31\nremoveMin"
},
{
"input": "2\nremoveMin\ngetMin 31",
"output": "4\ninsert 0\nremoveMin\ninsert 31\ngetMin 31"
},
{
"input": "8\ninsert 219147240\nremoveMin\ngetMin 923854124\nremoveMin\ngetMin -876779400\nremoveMin\ninsert 387686853\ngetMin 749998368",
"output": "12\ninsert 219147240\nremoveMin\ninsert 923854124\ngetMin 923854124\nremoveMin\ninsert -876779400\ngetMin -876779400\nremoveMin\ninsert 387686853\nremoveMin\ninsert 749998368\ngetMin 749998368"
},
{
"input": "2\nremoveMin\ninsert 450653162",
"output": "3\ninsert 0\nremoveMin\ninsert 450653162"
},
{
"input": "6\ninsert -799688192\ngetMin 491561656\nremoveMin\ninsert -805250162\ninsert -945439443\nremoveMin",
"output": "8\ninsert -799688192\nremoveMin\ninsert 491561656\ngetMin 491561656\nremoveMin\ninsert -805250162\ninsert -945439443\nremoveMin"
},
{
"input": "30\ninsert 62350949\ngetMin -928976719\nremoveMin\ngetMin 766590157\ngetMin -276914351\ninsert 858958907\ngetMin -794653029\ngetMin 505812710\ngetMin -181182543\ninsert -805198995\nremoveMin\ninsert -200361579\nremoveMin\ninsert 988531216\ninsert -474257426\ninsert 579296921\nremoveMin\ninsert -410043658\ngetMin 716684155\nremoveMin\ngetMin -850837161\ngetMin 368670814\ninsert 579000842\nremoveMin\ngetMin -169833018\ninsert 313148949\nremoveMin\nremoveMin\ngetMin 228901059\ngetMin 599172503",
"output": "52\ninsert 62350949\ninsert -928976719\ngetMin -928976719\nremoveMin\nremoveMin\ninsert 766590157\ngetMin 766590157\ninsert -276914351\ngetMin -276914351\ninsert 858958907\ninsert -794653029\ngetMin -794653029\nremoveMin\nremoveMin\ninsert 505812710\ngetMin 505812710\ninsert -181182543\ngetMin -181182543\ninsert -805198995\nremoveMin\ninsert -200361579\nremoveMin\ninsert 988531216\ninsert -474257426\ninsert 579296921\nremoveMin\ninsert -410043658\nremoveMin\nremoveMin\nremoveMin\nremoveMin\ninsert 71668415..."
},
{
"input": "9\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ngetMin 3\nremoveMin\ngetMin 4\nremoveMin\ngetMin 5",
"output": "10\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ninsert 3\ngetMin 3\nremoveMin\ngetMin 4\nremoveMin\ngetMin 5"
},
{
"input": "9\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ngetMin 5\nremoveMin\ngetMin 4\nremoveMin\ngetMin 3",
"output": "12\ninsert 3\ninsert 4\ninsert 5\nremoveMin\nremoveMin\ngetMin 5\nremoveMin\ninsert 4\ngetMin 4\nremoveMin\ninsert 3\ngetMin 3"
},
{
"input": "1\ngetMin 0",
"output": "2\ninsert 0\ngetMin 0"
},
{
"input": "3\ninsert 3\ninsert 4\ngetMin 4",
"output": "4\ninsert 3\ninsert 4\nremoveMin\ngetMin 4"
},
{
"input": "3\ninsert 1\ninsert 2\ngetMin 2",
"output": "4\ninsert 1\ninsert 2\nremoveMin\ngetMin 2"
},
{
"input": "3\ninsert -1\ninsert 0\ngetMin 0",
"output": "4\ninsert -1\ninsert 0\nremoveMin\ngetMin 0"
},
{
"input": "2\ninsert 0\ngetMin 0",
"output": "2\ninsert 0\ngetMin 0"
},
{
"input": "1\ninsert -1",
"output": "1\ninsert -1"
},
{
"input": "3\ninsert 1\ninsert 0\ngetMin 1",
"output": "4\ninsert 1\ninsert 0\nremoveMin\ngetMin 1"
}
] | 1,660,868,459
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 4
| 46
| 0
|
import heapq
n = int(input())
minHeap , answers = [] , []
for _ in range(n):
query = list(input().split())
if query[0] == "insert":
heapq.heappush(minHeap , int(query[1]))
answers.append("insert " + query[1])
if query[0] == "getMin":
while minHeap and minHeap[0] < int(query[1]):
heapq.heappop(minHeap)
answers.append("removeMin")
if len(minHeap) == 0:
heapq.heappush(minHeap , int(query[1]))
answers.append ("insert " + query[1])
answers.append("getMin " + query[1])
if query[0] == "removeMin":
heapq.heappop(minHeap)
answers.append(query[0])
print (len(answers))
for i in range(len(answers)):
print(answers[i])
|
Title: Heap Operations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya has recently learned data structure named "Binary heap".
The heap he is now operating with allows the following operations:
- put the given number into the heap; - get the value of the minimum element in the heap; - extract the minimum element from the heap;
Thus, at any moment of time the heap contains several integers (possibly none), some of them might be equal.
In order to better learn this data structure Petya took an empty heap and applied some operations above to it. Also, he carefully wrote down all the operations and their results to his event log, following the format:
- insert *x* — put the element with value *x* in the heap; - getMin *x* — the value of the minimum element contained in the heap was equal to *x*; - removeMin — the minimum element was extracted from the heap (only one instance, if there were many).
All the operations were correct, i.e. there was at least one element in the heap each time getMin or removeMin operations were applied.
While Petya was away for a lunch, his little brother Vova came to the room, took away some of the pages from Petya's log and used them to make paper boats.
Now Vova is worried, if he made Petya's sequence of operations inconsistent. For example, if one apply operations one-by-one in the order they are written in the event log, results of getMin operations might differ from the results recorded by Petya, and some of getMin or removeMin operations may be incorrect, as the heap is empty at the moment they are applied.
Now Vova wants to add some new operation records to the event log in order to make the resulting sequence of operations correct. That is, the result of each getMin operation is equal to the result in the record, and the heap is non-empty when getMin ad removeMin are applied. Vova wants to complete this as fast as possible, as the Petya may get back at any moment. He asks you to add the least possible number of operation records to the current log. Note that arbitrary number of operations may be added at the beginning, between any two other operations, or at the end of the log.
Input Specification:
The first line of the input contains the only integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of the records left in Petya's journal.
Each of the following *n* lines describe the records in the current log in the order they are applied. Format described in the statement is used. All numbers in the input are integers not exceeding 109 by their absolute value.
Output Specification:
The first line of the output should contain a single integer *m* — the minimum possible number of records in the modified sequence of operations.
Next *m* lines should contain the corrected sequence of records following the format of the input (described in the statement), one per line and in the order they are applied. All the numbers in the output should be integers not exceeding 109 by their absolute value.
Note that the input sequence of operations must be the subsequence of the output sequence.
It's guaranteed that there exists the correct answer consisting of no more than 1<=000<=000 operations.
Demo Input:
['2\ninsert 3\ngetMin 4\n', '4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2\n']
Demo Output:
['4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4\n', '6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2\n']
Note:
In the first sample, after number 3 is inserted into the heap, the minimum number is 3. To make the result of the first getMin equal to 4 one should firstly remove number 3 from the heap and then add number 4 into the heap.
In the second sample case number 1 is inserted two times, so should be similarly removed twice.
|
```python
import heapq
n = int(input())
minHeap , answers = [] , []
for _ in range(n):
query = list(input().split())
if query[0] == "insert":
heapq.heappush(minHeap , int(query[1]))
answers.append("insert " + query[1])
if query[0] == "getMin":
while minHeap and minHeap[0] < int(query[1]):
heapq.heappop(minHeap)
answers.append("removeMin")
if len(minHeap) == 0:
heapq.heappush(minHeap , int(query[1]))
answers.append ("insert " + query[1])
answers.append("getMin " + query[1])
if query[0] == "removeMin":
heapq.heappop(minHeap)
answers.append(query[0])
print (len(answers))
for i in range(len(answers)):
print(answers[i])
```
| -1
|
|
908
|
C
|
New Year and Curling
|
PROGRAMMING
| 1,500
|
[
"brute force",
"geometry",
"implementation",
"math"
] | null | null |
Carol is currently curling.
She has *n* disks each with radius *r* on the 2D plane.
Initially she has all these disks above the line *y*<==<=10100.
She then will slide the disks towards the line *y*<==<=0 one by one in order from 1 to *n*.
When she slides the *i*-th disk, she will place its center at the point (*x**i*,<=10100). She will then push it so the disk’s *y* coordinate continuously decreases, and *x* coordinate stays constant. The disk stops once it touches the line *y*<==<=0 or it touches any previous disk. Note that once a disk stops moving, it will not move again, even if hit by another disk.
Compute the *y*-coordinates of centers of all the disks after all disks have been pushed.
|
The first line will contain two integers *n* and *r* (1<=≤<=*n*,<=*r*<=≤<=1<=000), the number of disks, and the radius of the disks, respectively.
The next line will contain *n* integers *x*1,<=*x*2,<=...,<=*x**n* (1<=≤<=*x**i*<=≤<=1<=000) — the *x*-coordinates of the disks.
|
Print a single line with *n* numbers. The *i*-th number denotes the *y*-coordinate of the center of the *i*-th disk. The output will be accepted if it has absolute or relative error at most 10<=-<=6.
Namely, let's assume that your answer for a particular value of a coordinate is *a* and the answer of the jury is *b*. The checker program will consider your answer correct if for all coordinates.
|
[
"6 2\n5 5 6 8 3 12\n"
] |
[
"2 6.0 9.87298334621 13.3370849613 12.5187346573 13.3370849613\n"
] |
The final positions of the disks will look as follows:
In particular, note the position of the last disk.
| 1,000
|
[
{
"input": "6 2\n5 5 6 8 3 12",
"output": "2 6.0 9.87298334621 13.3370849613 12.5187346573 13.3370849613"
},
{
"input": "1 1\n5",
"output": "1"
},
{
"input": "5 300\n939 465 129 611 532",
"output": "300 667.864105343 1164.9596696 1522.27745533 2117.05388391"
},
{
"input": "5 1\n416 387 336 116 81",
"output": "1 1 1 1 1"
},
{
"input": "3 10\n1 100 1000",
"output": "10 10 10"
},
{
"input": "2 1\n2 20",
"output": "1 1"
},
{
"input": "3 2\n10 10 100",
"output": "2 6.0 2"
}
] | 1,514,652,945
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 46
| 5,529,600
|
ip = lambda: map(int, input().split())
ipl = lambda: list(map(int, input().split()))
n,r = ip()
a = ipl()
b = []
l = [r]
for i in range(n):
for j in range(i):
d=abs(a[i]-a[j])
if (d <= 2*r): l.append((((4*r*r)-(d*d))**(0.5))+b[j])
b.append(max(l))
print(max(l),end=" ")
|
Title: New Year and Curling
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Carol is currently curling.
She has *n* disks each with radius *r* on the 2D plane.
Initially she has all these disks above the line *y*<==<=10100.
She then will slide the disks towards the line *y*<==<=0 one by one in order from 1 to *n*.
When she slides the *i*-th disk, she will place its center at the point (*x**i*,<=10100). She will then push it so the disk’s *y* coordinate continuously decreases, and *x* coordinate stays constant. The disk stops once it touches the line *y*<==<=0 or it touches any previous disk. Note that once a disk stops moving, it will not move again, even if hit by another disk.
Compute the *y*-coordinates of centers of all the disks after all disks have been pushed.
Input Specification:
The first line will contain two integers *n* and *r* (1<=≤<=*n*,<=*r*<=≤<=1<=000), the number of disks, and the radius of the disks, respectively.
The next line will contain *n* integers *x*1,<=*x*2,<=...,<=*x**n* (1<=≤<=*x**i*<=≤<=1<=000) — the *x*-coordinates of the disks.
Output Specification:
Print a single line with *n* numbers. The *i*-th number denotes the *y*-coordinate of the center of the *i*-th disk. The output will be accepted if it has absolute or relative error at most 10<=-<=6.
Namely, let's assume that your answer for a particular value of a coordinate is *a* and the answer of the jury is *b*. The checker program will consider your answer correct if for all coordinates.
Demo Input:
['6 2\n5 5 6 8 3 12\n']
Demo Output:
['2 6.0 9.87298334621 13.3370849613 12.5187346573 13.3370849613\n']
Note:
The final positions of the disks will look as follows:
In particular, note the position of the last disk.
|
```python
ip = lambda: map(int, input().split())
ipl = lambda: list(map(int, input().split()))
n,r = ip()
a = ipl()
b = []
l = [r]
for i in range(n):
for j in range(i):
d=abs(a[i]-a[j])
if (d <= 2*r): l.append((((4*r*r)-(d*d))**(0.5))+b[j])
b.append(max(l))
print(max(l),end=" ")
```
| 0
|
|
554
|
A
|
Kyoya and Photobooks
|
PROGRAMMING
| 900
|
[
"brute force",
"math",
"strings"
] | null | null |
Kyoya Ootori is selling photobooks of the Ouran High School Host Club. He has 26 photos, labeled "a" to "z", and he has compiled them into a photo booklet with some photos in some order (possibly with some photos being duplicated). A photo booklet can be described as a string of lowercase letters, consisting of the photos in the booklet in order. He now wants to sell some "special edition" photobooks, each with one extra photo inserted anywhere in the book. He wants to make as many distinct photobooks as possible, so he can make more money. He asks Haruhi, how many distinct photobooks can he make by inserting one extra photo into the photobook he already has?
Please help Haruhi solve this problem.
|
The first line of input will be a single string *s* (1<=≤<=|*s*|<=≤<=20). String *s* consists only of lowercase English letters.
|
Output a single integer equal to the number of distinct photobooks Kyoya Ootori can make.
|
[
"a\n",
"hi\n"
] |
[
"51\n",
"76\n"
] |
In the first case, we can make 'ab','ac',...,'az','ba','ca',...,'za', and 'aa', producing a total of 51 distinct photo booklets.
| 250
|
[
{
"input": "a",
"output": "51"
},
{
"input": "hi",
"output": "76"
},
{
"input": "y",
"output": "51"
},
{
"input": "kgan",
"output": "126"
},
{
"input": "zoabkyuvus",
"output": "276"
},
{
"input": "spyemhyznjieyhhbk",
"output": "451"
},
{
"input": "xulsyfkuizjauadjjopu",
"output": "526"
},
{
"input": "e",
"output": "51"
},
{
"input": "zv",
"output": "76"
},
{
"input": "jgv",
"output": "101"
},
{
"input": "zsfo",
"output": "126"
},
{
"input": "jselr",
"output": "151"
},
{
"input": "dwemig",
"output": "176"
},
{
"input": "mddoxsf",
"output": "201"
},
{
"input": "jgirkrmi",
"output": "226"
},
{
"input": "spkxurcum",
"output": "251"
},
{
"input": "fykkiubdkt",
"output": "276"
},
{
"input": "fznbcxsxygs",
"output": "301"
},
{
"input": "qcrvrdqcbtou",
"output": "326"
},
{
"input": "qktrbjzrqgmlr",
"output": "351"
},
{
"input": "foamodbvptlxxg",
"output": "376"
},
{
"input": "ydzpjhsidipricw",
"output": "401"
},
{
"input": "lpfpndmjfvqejdgf",
"output": "426"
},
{
"input": "ofkvparuvjtggnmab",
"output": "451"
},
{
"input": "xxncfutrtxcwdzwbgs",
"output": "476"
},
{
"input": "zovhffccflkgqncsdte",
"output": "501"
},
{
"input": "cskgsxywlvfeicoueglr",
"output": "526"
},
{
"input": "gggggggggggggggggggg",
"output": "526"
},
{
"input": "qdqdddqddqqddqddqdqd",
"output": "526"
},
{
"input": "takttttaakaaktakttkt",
"output": "526"
},
{
"input": "coccoooogogcgocccmcg",
"output": "526"
},
{
"input": "kskkskkkssksssk",
"output": "401"
},
{
"input": "lllllllllllllll",
"output": "401"
}
] | 1,658,640,516
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 33
| 93
| 0
|
def solve(s):
n = len(s)
total = (n + 1) * 26
return total - duplicadas(s)
def duplicadas(s):
s += '?'
ans = 0
count = 0
prev = s[0]
for c in s:
if c == prev:
count += 1
else:
ans += count
count = 1
return ans
if __name__ == "__main__":
s = input()
print(solve(s))
|
Title: Kyoya and Photobooks
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kyoya Ootori is selling photobooks of the Ouran High School Host Club. He has 26 photos, labeled "a" to "z", and he has compiled them into a photo booklet with some photos in some order (possibly with some photos being duplicated). A photo booklet can be described as a string of lowercase letters, consisting of the photos in the booklet in order. He now wants to sell some "special edition" photobooks, each with one extra photo inserted anywhere in the book. He wants to make as many distinct photobooks as possible, so he can make more money. He asks Haruhi, how many distinct photobooks can he make by inserting one extra photo into the photobook he already has?
Please help Haruhi solve this problem.
Input Specification:
The first line of input will be a single string *s* (1<=≤<=|*s*|<=≤<=20). String *s* consists only of lowercase English letters.
Output Specification:
Output a single integer equal to the number of distinct photobooks Kyoya Ootori can make.
Demo Input:
['a\n', 'hi\n']
Demo Output:
['51\n', '76\n']
Note:
In the first case, we can make 'ab','ac',...,'az','ba','ca',...,'za', and 'aa', producing a total of 51 distinct photo booklets.
|
```python
def solve(s):
n = len(s)
total = (n + 1) * 26
return total - duplicadas(s)
def duplicadas(s):
s += '?'
ans = 0
count = 0
prev = s[0]
for c in s:
if c == prev:
count += 1
else:
ans += count
count = 1
return ans
if __name__ == "__main__":
s = input()
print(solve(s))
```
| 3
|
|
41
|
A
|
Translation
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Translation
|
2
|
256
|
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
|
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
|
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
|
[
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,499,332,529
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 124
| 5,529,600
|
s = input()
rev = input()
x = s[::-1]
if (x==rev):
print("YES")
else:
print("NO")
|
Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
s = input()
rev = input()
x = s[::-1]
if (x==rev):
print("YES")
else:
print("NO")
```
| 3.9587
|
977
|
C
|
Less or Equal
|
PROGRAMMING
| 1,200
|
[
"sortings"
] | null | null |
You are given a sequence of integers of length $n$ and integer number $k$. You should print any integer number $x$ in the range of $[1; 10^9]$ (i.e. $1 \le x \le 10^9$) such that exactly $k$ elements of given sequence are less than or equal to $x$.
Note that the sequence can contain equal elements.
If there is no such $x$, print "-1" (without quotes).
|
The first line of the input contains integer numbers $n$ and $k$ ($1 \le n \le 2 \cdot 10^5$, $0 \le k \le n$). The second line of the input contains $n$ integer numbers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 10^9$) — the sequence itself.
|
Print any integer number $x$ from range $[1; 10^9]$ such that exactly $k$ elements of given sequence is less or equal to $x$.
If there is no such $x$, print "-1" (without quotes).
|
[
"7 4\n3 7 5 1 10 3 20\n",
"7 2\n3 7 5 1 10 3 20\n"
] |
[
"6",
"-1\n"
] |
In the first example $5$ is also a valid answer because the elements with indices $[1, 3, 4, 6]$ is less than or equal to $5$ and obviously less than or equal to $6$.
In the second example you cannot choose any number that only $2$ elements of the given sequence will be less than or equal to this number because $3$ elements of the given sequence will be also less than or equal to this number.
| 0
|
[
{
"input": "7 4\n3 7 5 1 10 3 20",
"output": "5"
},
{
"input": "7 2\n3 7 5 1 10 3 20",
"output": "-1"
},
{
"input": "1 0\n1",
"output": "-1"
},
{
"input": "1 0\n2",
"output": "1"
},
{
"input": "1 1\n1000000000",
"output": "1000000000"
},
{
"input": "3 0\n3 3 3",
"output": "2"
},
{
"input": "3 0\n2 2 3",
"output": "1"
},
{
"input": "5 0\n3 4 5 6 7",
"output": "2"
},
{
"input": "4 0\n2 3 4 5",
"output": "1"
},
{
"input": "2 2\n1000000000 1000000000",
"output": "1000000000"
},
{
"input": "7 2\n2 7 5 1 10 2 20",
"output": "-1"
},
{
"input": "2 1\n1 1",
"output": "-1"
},
{
"input": "5 3\n1 3 3 4 5",
"output": "3"
},
{
"input": "4 4\n1000000000 1000000000 1000000000 1000000000",
"output": "1000000000"
}
] | 1,699,993,774
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 30
| 0
|
n, k = map(int, input().split(' '))
reeks = list(map(int, input().split(' ')))
max_val = max(reeks)
count = sum(1 for x in reeks if x <= max_val)
if count >= k:
print(max_val)
else:
reeks.sort()
print(reeks[k - 1])
|
Title: Less or Equal
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given a sequence of integers of length $n$ and integer number $k$. You should print any integer number $x$ in the range of $[1; 10^9]$ (i.e. $1 \le x \le 10^9$) such that exactly $k$ elements of given sequence are less than or equal to $x$.
Note that the sequence can contain equal elements.
If there is no such $x$, print "-1" (without quotes).
Input Specification:
The first line of the input contains integer numbers $n$ and $k$ ($1 \le n \le 2 \cdot 10^5$, $0 \le k \le n$). The second line of the input contains $n$ integer numbers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 10^9$) — the sequence itself.
Output Specification:
Print any integer number $x$ from range $[1; 10^9]$ such that exactly $k$ elements of given sequence is less or equal to $x$.
If there is no such $x$, print "-1" (without quotes).
Demo Input:
['7 4\n3 7 5 1 10 3 20\n', '7 2\n3 7 5 1 10 3 20\n']
Demo Output:
['6', '-1\n']
Note:
In the first example $5$ is also a valid answer because the elements with indices $[1, 3, 4, 6]$ is less than or equal to $5$ and obviously less than or equal to $6$.
In the second example you cannot choose any number that only $2$ elements of the given sequence will be less than or equal to this number because $3$ elements of the given sequence will be also less than or equal to this number.
|
```python
n, k = map(int, input().split(' '))
reeks = list(map(int, input().split(' ')))
max_val = max(reeks)
count = sum(1 for x in reeks if x <= max_val)
if count >= k:
print(max_val)
else:
reeks.sort()
print(reeks[k - 1])
```
| 0
|
|
988
|
A
|
Diverse Team
|
PROGRAMMING
| 800
|
[
"brute force",
"implementation"
] | null | null |
There are $n$ students in a school class, the rating of the $i$-th student on Codehorses is $a_i$. You have to form a team consisting of $k$ students ($1 \le k \le n$) such that the ratings of all team members are distinct.
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct numbers which should be the indices of students in the team you form. If there are multiple answers, print any of them.
|
The first line contains two integers $n$ and $k$ ($1 \le k \le n \le 100$) — the number of students and the size of the team you have to form.
The second line contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the rating of $i$-th student.
|
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct integers from $1$ to $n$ which should be the indices of students in the team you form. All the ratings of the students in the team should be distinct. You may print the indices in any order. If there are multiple answers, print any of them.
Assume that the students are numbered from $1$ to $n$.
|
[
"5 3\n15 13 15 15 12\n",
"5 4\n15 13 15 15 12\n",
"4 4\n20 10 40 30\n"
] |
[
"YES\n1 2 5 \n",
"NO\n",
"YES\n1 2 3 4 \n"
] |
All possible answers for the first example:
- {1 2 5} - {2 3 5} - {2 4 5}
Note that the order does not matter.
| 0
|
[
{
"input": "5 3\n15 13 15 15 12",
"output": "YES\n1 2 5 "
},
{
"input": "5 4\n15 13 15 15 12",
"output": "NO"
},
{
"input": "4 4\n20 10 40 30",
"output": "YES\n1 2 3 4 "
},
{
"input": "1 1\n1",
"output": "YES\n1 "
},
{
"input": "100 53\n16 17 1 2 27 5 9 9 53 24 17 33 35 24 20 48 56 73 12 14 39 55 58 13 59 73 29 26 40 33 22 29 34 22 55 38 63 66 36 13 60 42 10 15 21 9 11 5 23 37 79 47 26 3 79 53 44 8 71 75 42 11 34 39 79 33 10 26 23 23 17 14 54 41 60 31 83 5 45 4 14 35 6 60 28 48 23 18 60 36 21 28 7 34 9 25 52 43 54 19",
"output": "YES\n1 2 3 4 5 6 7 9 10 12 13 15 16 17 18 19 20 21 22 23 24 25 27 28 29 31 33 36 37 38 39 41 42 43 44 45 47 49 50 51 52 54 57 58 59 60 73 74 76 77 79 80 83 "
},
{
"input": "2 2\n100 100",
"output": "NO"
},
{
"input": "2 2\n100 99",
"output": "YES\n1 2 "
},
{
"input": "100 100\n63 100 75 32 53 24 73 98 76 15 70 48 8 81 88 58 95 78 27 92 14 16 72 43 46 39 66 38 64 42 59 9 22 51 4 6 10 94 28 99 68 80 35 50 45 20 47 7 30 26 49 91 77 19 96 57 65 1 11 13 31 12 82 87 93 34 62 3 21 79 56 41 89 18 44 23 74 86 2 33 69 36 61 67 25 83 5 84 90 37 40 29 97 60 52 55 54 71 17 85",
"output": "YES\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 41\n54 16 42 3 45 6 9 72 100 13 24 57 35 5 89 13 97 27 43 9 73 89 48 16 48 55 18 15 55 28 30 6 18 41 100 61 9 42 35 54 57 25 73 15 42 54 49 5 72 48 30 55 4 43 94 5 60 92 93 23 89 75 53 92 74 93 89 28 69 6 3 49 15 28 49 57 54 55 30 57 69 18 89 6 25 23 93 74 30 13 87 53 6 42 4 54 60 30 4 35",
"output": "NO"
},
{
"input": "100 2\n70 64 70 32 70 64 32 70 64 32 32 64 70 64 64 32 64 64 64 70 70 64 64 64 64 70 32 64 70 64 32 70 70 70 64 70 64 70 64 32 70 32 70 64 64 64 32 70 64 70 70 32 70 32 32 32 70 32 70 32 64 64 70 32 32 64 70 64 32 32 64 64 32 32 70 70 32 70 32 64 32 70 64 64 32 64 32 64 70 32 70 32 70 64 64 64 70 70 64 70",
"output": "YES\n1 2 "
}
] | 1,660,320,704
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 4
| 77
| 0
|
x=input()
n=int(x[0])
k=int(x[2])
s=input()
l=list(map(int,s.split()))
d={}
pos=[]
for i in range(0,n):
if(l[i] not in list(d.keys())):
d[l[i]]=1
pos.append(i+1)
else:
d[l[i]]+=1
if(len(list(d.keys()))>=k):
print("YES")
for i in range(0,k):
print(pos[i],end=" ")
else:
print("NO")
|
Title: Diverse Team
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are $n$ students in a school class, the rating of the $i$-th student on Codehorses is $a_i$. You have to form a team consisting of $k$ students ($1 \le k \le n$) such that the ratings of all team members are distinct.
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct numbers which should be the indices of students in the team you form. If there are multiple answers, print any of them.
Input Specification:
The first line contains two integers $n$ and $k$ ($1 \le k \le n \le 100$) — the number of students and the size of the team you have to form.
The second line contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the rating of $i$-th student.
Output Specification:
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct integers from $1$ to $n$ which should be the indices of students in the team you form. All the ratings of the students in the team should be distinct. You may print the indices in any order. If there are multiple answers, print any of them.
Assume that the students are numbered from $1$ to $n$.
Demo Input:
['5 3\n15 13 15 15 12\n', '5 4\n15 13 15 15 12\n', '4 4\n20 10 40 30\n']
Demo Output:
['YES\n1 2 5 \n', 'NO\n', 'YES\n1 2 3 4 \n']
Note:
All possible answers for the first example:
- {1 2 5} - {2 3 5} - {2 4 5}
Note that the order does not matter.
|
```python
x=input()
n=int(x[0])
k=int(x[2])
s=input()
l=list(map(int,s.split()))
d={}
pos=[]
for i in range(0,n):
if(l[i] not in list(d.keys())):
d[l[i]]=1
pos.append(i+1)
else:
d[l[i]]+=1
if(len(list(d.keys()))>=k):
print("YES")
for i in range(0,k):
print(pos[i],end=" ")
else:
print("NO")
```
| 0
|
|
544
|
B
|
Sea and Islands
|
PROGRAMMING
| 1,400
|
[
"constructive algorithms",
"implementation"
] | null | null |
A map of some object is a rectangular field consisting of *n* rows and *n* columns. Each cell is initially occupied by the sea but you can cover some some cells of the map with sand so that exactly *k* islands appear on the map. We will call a set of sand cells to be island if it is possible to get from each of them to each of them by moving only through sand cells and by moving from a cell only to a side-adjacent cell. The cells are called to be side-adjacent if they share a vertical or horizontal side. It is easy to see that islands do not share cells (otherwise they together form a bigger island).
Find a way to cover some cells with sand so that exactly *k* islands appear on the *n*<=×<=*n* map, or determine that no such way exists.
|
The single line contains two positive integers *n*, *k* (1<=≤<=*n*<=≤<=100, 0<=≤<=*k*<=≤<=*n*2) — the size of the map and the number of islands you should form.
|
If the answer doesn't exist, print "NO" (without the quotes) in a single line.
Otherwise, print "YES" in the first line. In the next *n* lines print the description of the map. Each of the lines of the description must consist only of characters 'S' and 'L', where 'S' is a cell that is occupied by the sea and 'L' is the cell covered with sand. The length of each line of the description must equal *n*.
If there are multiple answers, you may print any of them.
You should not maximize the sizes of islands.
|
[
"5 2\n",
"5 25\n"
] |
[
"YES\nSSSSS\nLLLLL\nSSSSS\nLLLLL\nSSSSS\n",
"NO\n"
] |
none
| 1,000
|
[
{
"input": "5 2",
"output": "YES\nSSSSS\nLLLLL\nSSSSS\nLLLLL\nSSSSS"
},
{
"input": "5 25",
"output": "NO"
},
{
"input": "82 6047",
"output": "NO"
},
{
"input": "6 5",
"output": "YES\nLSLSLS\nSLSLSS\nSSSSSS\nSSSSSS\nSSSSSS\nSSSSSS"
},
{
"input": "10 80",
"output": "NO"
},
{
"input": "48 1279",
"output": "NO"
},
{
"input": "40 1092",
"output": "NO"
},
{
"input": "9 12",
"output": "YES\nLSLSLSLSL\nSLSLSLSLS\nLSLSLSSSS\nSSSSSSSSS\nSSSSSSSSS\nSSSSSSSSS\nSSSSSSSSS\nSSSSSSSSS\nSSSSSSSSS"
},
{
"input": "43 146",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSS..."
},
{
"input": "100 5000",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS..."
},
{
"input": "100 4999",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS..."
},
{
"input": "100 5001",
"output": "NO"
},
{
"input": "99 4901",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nS..."
},
{
"input": "99 4900",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nS..."
},
{
"input": "99 4902",
"output": "NO"
},
{
"input": "99 9801",
"output": "NO"
},
{
"input": "99 10",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nS..."
},
{
"input": "99 1",
"output": "YES\nLSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nS..."
},
{
"input": "100 10000",
"output": "NO"
},
{
"input": "100 10",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS..."
},
{
"input": "50 1200",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL..."
},
{
"input": "50 1438",
"output": "NO"
},
{
"input": "50 2447",
"output": "NO"
},
{
"input": "49 1719",
"output": "NO"
},
{
"input": "51 1996",
"output": "NO"
},
{
"input": "51 1981",
"output": "NO"
},
{
"input": "34 1060",
"output": "NO"
},
{
"input": "74 3901",
"output": "NO"
},
{
"input": "65 617",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS..."
},
{
"input": "89 497",
"output": "YES\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS\nLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSL\nSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLSLS..."
},
{
"input": "34 621",
"output": "NO"
},
{
"input": "1 0",
"output": "YES\nS"
},
{
"input": "10 0",
"output": "YES\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS\nSSSSSSSSSS"
},
{
"input": "11 0",
"output": "YES\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS\nSSSSSSSSSSS"
},
{
"input": "99 0",
"output": "YES\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nS..."
},
{
"input": "100 0",
"output": "YES\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS..."
},
{
"input": "1 1",
"output": "YES\nL"
},
{
"input": "2 1",
"output": "YES\nLS\nSS"
},
{
"input": "2 0",
"output": "YES\nSS\nSS"
},
{
"input": "2 2",
"output": "YES\nLS\nSL"
},
{
"input": "2 3",
"output": "NO"
},
{
"input": "2 4",
"output": "NO"
}
] | 1,585,249,593
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 42
| 187
| 2,764,800
|
from sys import stdin
from collections import deque
from math import sqrt, floor, ceil, log, log2, log10, pi, gcd, sin, cos, asin
def ii(): return int(stdin.readline())
def fi(): return float(stdin.readline())
def mi(): return map(int, stdin.readline().split())
def fmi(): return map(float, stdin.readline().split())
def li(): return list(mi())
def lsi():
x=list(stdin.readline())
x.pop()
return x
def si(): return stdin.readline()
res=['YES', 'NO']
############# CODE STARTS HERE #############
n, k=mi()
a=[['S']*n for _ in range(n)]
for i in range(n):
for j in range(n):
if k:
if not (i+j)%2:
a[i][j]='L'
k-=1
else:
break
if not k:
break
if not k:
print('YES')
for ss in a:
print(*ss, sep='')
exit()
print('NO')
|
Title: Sea and Islands
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A map of some object is a rectangular field consisting of *n* rows and *n* columns. Each cell is initially occupied by the sea but you can cover some some cells of the map with sand so that exactly *k* islands appear on the map. We will call a set of sand cells to be island if it is possible to get from each of them to each of them by moving only through sand cells and by moving from a cell only to a side-adjacent cell. The cells are called to be side-adjacent if they share a vertical or horizontal side. It is easy to see that islands do not share cells (otherwise they together form a bigger island).
Find a way to cover some cells with sand so that exactly *k* islands appear on the *n*<=×<=*n* map, or determine that no such way exists.
Input Specification:
The single line contains two positive integers *n*, *k* (1<=≤<=*n*<=≤<=100, 0<=≤<=*k*<=≤<=*n*2) — the size of the map and the number of islands you should form.
Output Specification:
If the answer doesn't exist, print "NO" (without the quotes) in a single line.
Otherwise, print "YES" in the first line. In the next *n* lines print the description of the map. Each of the lines of the description must consist only of characters 'S' and 'L', where 'S' is a cell that is occupied by the sea and 'L' is the cell covered with sand. The length of each line of the description must equal *n*.
If there are multiple answers, you may print any of them.
You should not maximize the sizes of islands.
Demo Input:
['5 2\n', '5 25\n']
Demo Output:
['YES\nSSSSS\nLLLLL\nSSSSS\nLLLLL\nSSSSS\n', 'NO\n']
Note:
none
|
```python
from sys import stdin
from collections import deque
from math import sqrt, floor, ceil, log, log2, log10, pi, gcd, sin, cos, asin
def ii(): return int(stdin.readline())
def fi(): return float(stdin.readline())
def mi(): return map(int, stdin.readline().split())
def fmi(): return map(float, stdin.readline().split())
def li(): return list(mi())
def lsi():
x=list(stdin.readline())
x.pop()
return x
def si(): return stdin.readline()
res=['YES', 'NO']
############# CODE STARTS HERE #############
n, k=mi()
a=[['S']*n for _ in range(n)]
for i in range(n):
for j in range(n):
if k:
if not (i+j)%2:
a[i][j]='L'
k-=1
else:
break
if not k:
break
if not k:
print('YES')
for ss in a:
print(*ss, sep='')
exit()
print('NO')
```
| 3
|
|
478
|
B
|
Random Teams
|
PROGRAMMING
| 1,300
|
[
"combinatorics",
"constructive algorithms",
"greedy",
"math"
] | null | null |
*n* participants of the competition were split into *m* teams in some manner so that each team has at least one participant. After the competition each pair of participants from the same team became friends.
Your task is to write a program that will find the minimum and the maximum number of pairs of friends that could have formed by the end of the competition.
|
The only line of input contains two integers *n* and *m*, separated by a single space (1<=≤<=*m*<=≤<=*n*<=≤<=109) — the number of participants and the number of teams respectively.
|
The only line of the output should contain two integers *k**min* and *k**max* — the minimum possible number of pairs of friends and the maximum possible number of pairs of friends respectively.
|
[
"5 1\n",
"3 2\n",
"6 3\n"
] |
[
"10 10\n",
"1 1\n",
"3 6\n"
] |
In the first sample all the participants get into one team, so there will be exactly ten pairs of friends.
In the second sample at any possible arrangement one team will always have two participants and the other team will always have one participant. Thus, the number of pairs of friends will always be equal to one.
In the third sample minimum number of newly formed friendships can be achieved if participants were split on teams consisting of 2 people, maximum number can be achieved if participants were split on teams of 1, 1 and 4 people.
| 1,000
|
[
{
"input": "5 1",
"output": "10 10"
},
{
"input": "3 2",
"output": "1 1"
},
{
"input": "6 3",
"output": "3 6"
},
{
"input": "5 3",
"output": "2 3"
},
{
"input": "10 2",
"output": "20 36"
},
{
"input": "10 6",
"output": "4 10"
},
{
"input": "1000000000 1",
"output": "499999999500000000 499999999500000000"
},
{
"input": "5000000 12",
"output": "1041664166668 12499942500066"
},
{
"input": "1833 195",
"output": "7722 1342341"
},
{
"input": "1000000000 1000000000",
"output": "0 0"
},
{
"input": "1000000000 1000000",
"output": "499500000000 499000500499500000"
},
{
"input": "1000000000 32170",
"output": "15541930838100 499967831017438365"
},
{
"input": "1000000 1000",
"output": "499500000 499000999500"
},
{
"input": "1234 1123",
"output": "111 6216"
},
{
"input": "599222887 298488",
"output": "601178656545 179355218158217800"
},
{
"input": "999999999 500000000",
"output": "499999999 124999999750000000"
},
{
"input": "1000000000 384842119",
"output": "845473643 189209609585784021"
},
{
"input": "1000000000 384842119",
"output": "845473643 189209609585784021"
},
{
"input": "1000000000 2",
"output": "249999999500000000 499999998500000001"
},
{
"input": "1000000000 999999999",
"output": "1 1"
},
{
"input": "38447 383",
"output": "1910550 724453080"
},
{
"input": "100000000 99999799",
"output": "201 20301"
},
{
"input": "1 1",
"output": "0 0"
},
{
"input": "2 1",
"output": "1 1"
},
{
"input": "2 2",
"output": "0 0"
},
{
"input": "10 10",
"output": "0 0"
}
] | 1,685,980,705
| 2,147,483,647
|
Python 3
|
MEMORY_LIMIT_EXCEEDED
|
TESTS
| 15
| 327
| 268,390,400
|
import math
n, m = list(map(int, input().split(" ")))
if n == m:
print(0, 0)
else:
ma = int(math.comb(n-m+1, 2))
l = [int(n/m)] * m
remainder = int((n/m - int(n/m)) * m+0.5)
mi = 0
for i in l:
if remainder > 0:
mi += math.comb(i+1, 2)
remainder -= 1
else:
mi += math.comb(i, 2)
print(mi, ma)
|
Title: Random Teams
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
*n* participants of the competition were split into *m* teams in some manner so that each team has at least one participant. After the competition each pair of participants from the same team became friends.
Your task is to write a program that will find the minimum and the maximum number of pairs of friends that could have formed by the end of the competition.
Input Specification:
The only line of input contains two integers *n* and *m*, separated by a single space (1<=≤<=*m*<=≤<=*n*<=≤<=109) — the number of participants and the number of teams respectively.
Output Specification:
The only line of the output should contain two integers *k**min* and *k**max* — the minimum possible number of pairs of friends and the maximum possible number of pairs of friends respectively.
Demo Input:
['5 1\n', '3 2\n', '6 3\n']
Demo Output:
['10 10\n', '1 1\n', '3 6\n']
Note:
In the first sample all the participants get into one team, so there will be exactly ten pairs of friends.
In the second sample at any possible arrangement one team will always have two participants and the other team will always have one participant. Thus, the number of pairs of friends will always be equal to one.
In the third sample minimum number of newly formed friendships can be achieved if participants were split on teams consisting of 2 people, maximum number can be achieved if participants were split on teams of 1, 1 and 4 people.
|
```python
import math
n, m = list(map(int, input().split(" ")))
if n == m:
print(0, 0)
else:
ma = int(math.comb(n-m+1, 2))
l = [int(n/m)] * m
remainder = int((n/m - int(n/m)) * m+0.5)
mi = 0
for i in l:
if remainder > 0:
mi += math.comb(i+1, 2)
remainder -= 1
else:
mi += math.comb(i, 2)
print(mi, ma)
```
| 0
|
|
457
|
A
|
Golden System
|
PROGRAMMING
| 1,700
|
[
"math",
"meet-in-the-middle"
] | null | null |
Piegirl got bored with binary, decimal and other integer based counting systems. Recently she discovered some interesting properties about number , in particular that *q*2<==<=*q*<=+<=1, and she thinks it would make a good base for her new unique system. She called it "golden system". In golden system the number is a non-empty string containing 0's and 1's as digits. The decimal value of expression *a*0*a*1...*a**n* equals to .
Soon Piegirl found out that this system doesn't have same properties that integer base systems do and some operations can not be performed on it. She wasn't able to come up with a fast way of comparing two numbers. She is asking for your help.
Given two numbers written in golden system notation, determine which of them has larger decimal value.
|
Input consists of two lines — one for each number. Each line contains non-empty string consisting of '0' and '1' characters. The length of each string does not exceed 100000.
|
Print ">" if the first number is larger, "<" if it is smaller and "=" if they are equal.
|
[
"1000\n111\n",
"00100\n11\n",
"110\n101\n"
] |
[
"<\n",
"=\n",
">\n"
] |
In the first example first number equals to <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/9c955eec678d6e7dcdc7c94fb203e922d2ad19ad.png" style="max-width: 100.0%;max-height: 100.0%;"/>, while second number is approximately 1.618033988<sup class="upper-index">2</sup> + 1.618033988 + 1 ≈ 5.236, which is clearly a bigger number.
In the second example numbers are equal. Each of them is ≈ 2.618.
| 1,000
|
[
{
"input": "1000\n111",
"output": "<"
},
{
"input": "00100\n11",
"output": "="
},
{
"input": "110\n101",
"output": ">"
},
{
"input": "0\n0",
"output": "="
},
{
"input": "1\n10",
"output": "<"
},
{
"input": "11\n10",
"output": ">"
},
{
"input": "00111\n10100",
"output": "<"
},
{
"input": "00\n1",
"output": "<"
},
{
"input": "01\n010",
"output": "<"
},
{
"input": "111\n00",
"output": ">"
},
{
"input": "1100\n11",
"output": ">"
},
{
"input": "0110\n001",
"output": ">"
},
{
"input": "1111\n0110",
"output": ">"
},
{
"input": "01010\n0011",
"output": ">"
},
{
"input": "0\n1",
"output": "<"
},
{
"input": "1\n0",
"output": ">"
},
{
"input": "1\n1",
"output": "="
},
{
"input": "010000100010100000100010001000001100100010110000101010000010010011001111101101001\n001011100001110101111001100110001011011100000000100111011010010011010100101011111",
"output": "="
},
{
"input": "11111001000\n1011100100",
"output": ">"
},
{
"input": "1001111010001100001010001010010010100010100011101101110011110101011000010111101100111000110110110010\n01111001101111100111111001110110100101001111010001000000001001001111100101101100001101111111100111101",
"output": "<"
},
{
"input": "1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n0",
"output": ">"
},
{
"input": "100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n1",
"output": ">"
},
{
"input": "1\n100000000000000000000000000000000000000000000000000",
"output": "<"
},
{
"input": "1\n1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "<"
},
{
"input": "11111111111111111111111111111111111111111111111111111111111111111111111111111111\n1111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": ">"
},
{
"input": "10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n100000000000000000000",
"output": ">"
},
{
"input": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111\n1011111111111111111111111111011011011001101111111110111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": ">"
},
{
"input": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111\n1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": "<"
},
{
"input": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111\n1011111111111111111111111111011011011001101111111110111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": ">"
},
{
"input": "11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111\n1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": "<"
},
{
"input": "100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n0",
"output": ">"
},
{
"input": "1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n1110",
"output": ">"
},
{
"input": "10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n1000",
"output": ">"
},
{
"input": "100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n1000",
"output": ">"
},
{
"input": "1\n1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "<"
},
{
"input": "1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n0",
"output": ">"
},
{
"input": "10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n10000",
"output": ">"
},
{
"input": "10000100001000010000100001000010000100001000010000\n1",
"output": ">"
},
{
"input": "101001010101010101010100101010101010101010101001010101010100101010101010100101101010100101010100101010101001010101010101010100101010101010101010101001010101010100101010101010100101101010100101010100101010101001010101010101010100101010101010101010101001010101010100101010101010100101101010100101010100101010\n1",
"output": ">"
},
{
"input": "10100\n01011",
"output": ">"
},
{
"input": "10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n01111000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "<"
},
{
"input": "11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111\n0000001010101011",
"output": ">"
},
{
"input": "110010010101001001001010100100010101010101011111111111111010101000000000000000000010110111111110101010111111111111111111111111111111111\n1011111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": ">"
},
{
"input": "1100\n0111",
"output": ">"
},
{
"input": "1111111111111111111111111111111111111111111111111\n0",
"output": ">"
},
{
"input": "1100100101010010010010101001000101010101010111111111111110101010000000000000000000101101111111101010101111111111111111111111111111111\n1011111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": ">"
},
{
"input": "1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n100000000000000000000",
"output": ">"
},
{
"input": "100001000010000100001000010000100001000010000100001111111111111111111111111111111111111111111111111111111111111111111111\n1",
"output": ">"
},
{
"input": "11111111111111111111111111111111111111111111111111111111111111\n1",
"output": ">"
},
{
"input": "1011\n0100",
"output": ">"
},
{
"input": "100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n011000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001",
"output": "<"
},
{
"input": "1000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111000000000000000000000000000000000000000000000000\n1111111111111111111111111111111111111111111111111111111111111111111111111111110000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "<"
},
{
"input": "111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111001\n000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011",
"output": ">"
},
{
"input": "1000000000000000000000000\n0101010101010101010101011",
"output": "="
},
{
"input": "1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n1",
"output": ">"
},
{
"input": "101010101010101010101010101010101010101010101010101010101010101010101010\n1000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "<"
},
{
"input": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111\n0",
"output": ">"
},
{
"input": "111\n1000",
"output": ">"
},
{
"input": "1000000000000000000000000000000000000000000000000\n000",
"output": ">"
},
{
"input": "11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111\n10",
"output": ">"
},
{
"input": "111111111111111111111111111111111111111111111111\n11",
"output": ">"
},
{
"input": "10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000\n000",
"output": ">"
},
{
"input": "101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010101010\n1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": ">"
},
{
"input": "100000000000000000000000000000000000000000000000\n0",
"output": ">"
}
] | 1,605,715,912
| 2,147,483,647
|
PyPy 3
|
MEMORY_LIMIT_EXCEEDED
|
TESTS
| 8
| 545
| 268,390,400
|
import sys, math, itertools, collections, copy
input = sys.stdin.readline
a = input()
b = input()
s1 = s2 = 0
N = max(len(a), len(b))
arr = [1, 2]
for i in range(N + 2):
arr.append(arr[-1] + arr[-2])
a = a[:-1:]
b = b[:-1:]
a = a[::-1]
b = b[::-1]
for i in range(len(a)):
if a[i] == '1':
s1 += arr[i]
for i in range(len(b)):
if b[i] == '1':
s2 += arr[i]
if s1 > s2:
print('>')
elif s1 == s2:
print('=')
else:
print('<')
|
Title: Golden System
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Piegirl got bored with binary, decimal and other integer based counting systems. Recently she discovered some interesting properties about number , in particular that *q*2<==<=*q*<=+<=1, and she thinks it would make a good base for her new unique system. She called it "golden system". In golden system the number is a non-empty string containing 0's and 1's as digits. The decimal value of expression *a*0*a*1...*a**n* equals to .
Soon Piegirl found out that this system doesn't have same properties that integer base systems do and some operations can not be performed on it. She wasn't able to come up with a fast way of comparing two numbers. She is asking for your help.
Given two numbers written in golden system notation, determine which of them has larger decimal value.
Input Specification:
Input consists of two lines — one for each number. Each line contains non-empty string consisting of '0' and '1' characters. The length of each string does not exceed 100000.
Output Specification:
Print ">" if the first number is larger, "<" if it is smaller and "=" if they are equal.
Demo Input:
['1000\n111\n', '00100\n11\n', '110\n101\n']
Demo Output:
['<\n', '=\n', '>\n']
Note:
In the first example first number equals to <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/9c955eec678d6e7dcdc7c94fb203e922d2ad19ad.png" style="max-width: 100.0%;max-height: 100.0%;"/>, while second number is approximately 1.618033988<sup class="upper-index">2</sup> + 1.618033988 + 1 ≈ 5.236, which is clearly a bigger number.
In the second example numbers are equal. Each of them is ≈ 2.618.
|
```python
import sys, math, itertools, collections, copy
input = sys.stdin.readline
a = input()
b = input()
s1 = s2 = 0
N = max(len(a), len(b))
arr = [1, 2]
for i in range(N + 2):
arr.append(arr[-1] + arr[-2])
a = a[:-1:]
b = b[:-1:]
a = a[::-1]
b = b[::-1]
for i in range(len(a)):
if a[i] == '1':
s1 += arr[i]
for i in range(len(b)):
if b[i] == '1':
s2 += arr[i]
if s1 > s2:
print('>')
elif s1 == s2:
print('=')
else:
print('<')
```
| 0
|
|
912
|
A
|
Tricky Alchemy
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
During the winter holidays, the demand for Christmas balls is exceptionally high. Since it's already 2018, the advances in alchemy allow easy and efficient ball creation by utilizing magic crystals.
Grisha needs to obtain some yellow, green and blue balls. It's known that to produce a yellow ball one needs two yellow crystals, green — one yellow and one blue, and for a blue ball, three blue crystals are enough.
Right now there are *A* yellow and *B* blue crystals in Grisha's disposal. Find out how many additional crystals he should acquire in order to produce the required number of balls.
|
The first line features two integers *A* and *B* (0<=≤<=*A*,<=*B*<=≤<=109), denoting the number of yellow and blue crystals respectively at Grisha's disposal.
The next line contains three integers *x*, *y* and *z* (0<=≤<=*x*,<=*y*,<=*z*<=≤<=109) — the respective amounts of yellow, green and blue balls to be obtained.
|
Print a single integer — the minimum number of crystals that Grisha should acquire in addition.
|
[
"4 3\n2 1 1\n",
"3 9\n1 1 3\n",
"12345678 87654321\n43043751 1000000000 53798715\n"
] |
[
"2\n",
"1\n",
"2147483648\n"
] |
In the first sample case, Grisha needs five yellow and four blue crystals to create two yellow balls, one green ball, and one blue ball. To do that, Grisha needs to obtain two additional crystals: one yellow and one blue.
| 500
|
[
{
"input": "4 3\n2 1 1",
"output": "2"
},
{
"input": "3 9\n1 1 3",
"output": "1"
},
{
"input": "12345678 87654321\n43043751 1000000000 53798715",
"output": "2147483648"
},
{
"input": "12 12\n3 5 2",
"output": "0"
},
{
"input": "770 1390\n170 442 311",
"output": "12"
},
{
"input": "3555165 6693472\n1499112 556941 3075290",
"output": "3089339"
},
{
"input": "0 0\n1000000000 1000000000 1000000000",
"output": "7000000000"
},
{
"input": "1 1\n0 1 0",
"output": "0"
},
{
"input": "117708228 562858833\n118004008 360437130 154015822",
"output": "738362681"
},
{
"input": "999998118 700178721\n822106746 82987112 547955384",
"output": "1753877029"
},
{
"input": "566568710 765371101\n60614022 80126928 809950465",
"output": "1744607222"
},
{
"input": "448858599 829062060\n764716760 97644201 203890025",
"output": "1178219122"
},
{
"input": "626115781 966381948\n395190569 820194184 229233367",
"output": "1525971878"
},
{
"input": "803372962 103701834\n394260597 837711458 623172928",
"output": "3426388098"
},
{
"input": "980630143 241021722\n24734406 928857659 312079781",
"output": "1624075280"
},
{
"input": "862920032 378341609\n360240924 241342224 337423122",
"output": "974174021"
},
{
"input": "40177212 515661496\n64343660 963892207 731362684",
"output": "3694721078"
},
{
"input": "217434393 579352456\n694817470 981409480 756706026",
"output": "4825785129"
},
{
"input": "394691574 716672343\n398920207 72555681 150645586",
"output": "475704521"
},
{
"input": "276981463 853992230\n29394015 90072954 839552440",
"output": "1754738044"
},
{
"input": "843552056 919184611\n341530221 423649259 101547519",
"output": "263157645"
},
{
"input": "20809236 56504497\n972004030 441166533 495487081",
"output": "4235488636"
},
{
"input": "198066417 825228166\n602477839 532312735 520830423",
"output": "2808777834"
},
{
"input": "80356306 962548053\n601547868 549830008 914769984",
"output": "4004161345"
},
{
"input": "257613487 394835231\n642087093 567347282 308709545",
"output": "2692548667"
},
{
"input": "139903376 532155119\n641157122 289897263 629020178",
"output": "3077110809"
},
{
"input": "612127849 669475006\n271630930 676010757 22959739",
"output": "682559736"
},
{
"input": "0 0\n0 0 0",
"output": "0"
},
{
"input": "1000000000 1000000000\n499999998 4 333333332",
"output": "0"
},
{
"input": "1000000000 1000000000\n1000000000 1000000000 1000000000",
"output": "5000000000"
},
{
"input": "4 3\n1 0 1",
"output": "0"
},
{
"input": "4 12\n1 2 3",
"output": "0"
},
{
"input": "4 20\n1 2 1",
"output": "0"
},
{
"input": "100 10\n2 3 4",
"output": "5"
},
{
"input": "6 0\n1 1 1",
"output": "4"
},
{
"input": "25 5\n3 3 3",
"output": "7"
},
{
"input": "48 27\n22 39 20",
"output": "107"
},
{
"input": "4 0\n1 1 1",
"output": "4"
}
] | 1,671,831,823
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 0
|
[a,b] = map(int, input().split())
[x,y,z] = map(int, input().split())
yellow = 2*x+y
blue = y+3*z
if a >= yellow and b >= blue:
print(0)
elif a >= yellow:
print(blue-b)
elif b >= b:
print(yellow-a)
else:
print(yellow+blue-a-b)
|
Title: Tricky Alchemy
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
During the winter holidays, the demand for Christmas balls is exceptionally high. Since it's already 2018, the advances in alchemy allow easy and efficient ball creation by utilizing magic crystals.
Grisha needs to obtain some yellow, green and blue balls. It's known that to produce a yellow ball one needs two yellow crystals, green — one yellow and one blue, and for a blue ball, three blue crystals are enough.
Right now there are *A* yellow and *B* blue crystals in Grisha's disposal. Find out how many additional crystals he should acquire in order to produce the required number of balls.
Input Specification:
The first line features two integers *A* and *B* (0<=≤<=*A*,<=*B*<=≤<=109), denoting the number of yellow and blue crystals respectively at Grisha's disposal.
The next line contains three integers *x*, *y* and *z* (0<=≤<=*x*,<=*y*,<=*z*<=≤<=109) — the respective amounts of yellow, green and blue balls to be obtained.
Output Specification:
Print a single integer — the minimum number of crystals that Grisha should acquire in addition.
Demo Input:
['4 3\n2 1 1\n', '3 9\n1 1 3\n', '12345678 87654321\n43043751 1000000000 53798715\n']
Demo Output:
['2\n', '1\n', '2147483648\n']
Note:
In the first sample case, Grisha needs five yellow and four blue crystals to create two yellow balls, one green ball, and one blue ball. To do that, Grisha needs to obtain two additional crystals: one yellow and one blue.
|
```python
[a,b] = map(int, input().split())
[x,y,z] = map(int, input().split())
yellow = 2*x+y
blue = y+3*z
if a >= yellow and b >= blue:
print(0)
elif a >= yellow:
print(blue-b)
elif b >= b:
print(yellow-a)
else:
print(yellow+blue-a-b)
```
| 0
|
|
137
|
A
|
Postcards and photos
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Polycarpus has postcards and photos hung in a row on the wall. He decided to put them away to the closet and hang on the wall a famous painter's picture. Polycarpus does it like that: he goes from the left to the right and removes the objects consecutively. As Polycarpus doesn't want any mix-ups to happen, he will not carry in his hands objects of two different types. In other words, Polycarpus can't carry both postcards and photos simultaneously. Sometimes he goes to the closet and puts the objects there, thus leaving his hands free. Polycarpus must put all the postcards and photos to the closet. He cannot skip objects. What minimum number of times he should visit the closet if he cannot carry more than 5 items?
|
The only line of the input data contains a non-empty string consisting of letters "С" and "P" whose length does not exceed 100 characters. If the *i*-th character in the string is the letter "С", that means that the *i*-th object (the numbering goes from the left to the right) on Polycarpus' wall is a postcard. And if the *i*-th character is the letter "P", than the *i*-th object on the wall is a photo.
|
Print the only number — the minimum number of times Polycarpus has to visit the closet.
|
[
"CPCPCPC\n",
"CCCCCCPPPPPP\n",
"CCCCCCPPCPPPPPPPPPP\n",
"CCCCCCCCCC\n"
] |
[
"7\n",
"4\n",
"6\n",
"2\n"
] |
In the first sample Polycarpus needs to take one item to the closet 7 times.
In the second sample Polycarpus can first take 3 postcards to the closet; then 3 more. He can take the 6 photos that are left in the similar way, going to the closet twice.
In the third sample Polycarpus can visit the closet twice, both times carrying 3 postcards. Then he can take there 2 photos at once, then one postcard and finally, he can carry the last 10 photos if he visits the closet twice.
In the fourth sample Polycarpus can visit the closet twice and take there all 10 postcards (5 items during each go).
| 500
|
[
{
"input": "CPCPCPC",
"output": "7"
},
{
"input": "CCCCCCPPPPPP",
"output": "4"
},
{
"input": "CCCCCCPPCPPPPPPPPPP",
"output": "6"
},
{
"input": "CCCCCCCCCC",
"output": "2"
},
{
"input": "CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC",
"output": "20"
},
{
"input": "CPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCP",
"output": "100"
},
{
"input": "CCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPP",
"output": "28"
},
{
"input": "P",
"output": "1"
},
{
"input": "C",
"output": "1"
},
{
"input": "PC",
"output": "2"
},
{
"input": "PPPPP",
"output": "1"
},
{
"input": "PPPP",
"output": "1"
},
{
"input": "CCCCCCCCCC",
"output": "2"
},
{
"input": "CP",
"output": "2"
},
{
"input": "CPCCPCPPPC",
"output": "7"
},
{
"input": "PPCPCCPCPPCCPPPPPPCP",
"output": "12"
},
{
"input": "PCPCCPCPPCCPCPCCPPPPPCPCPCPCCC",
"output": "20"
},
{
"input": "CCPPPPPCPCCPPPCCPPCPCCPCPPCPPCCCPPCPPPCC",
"output": "21"
},
{
"input": "CPPCCCCCCPCCCCPCCPCPPPCPCCCCCCCPCCPPCCCPCCCCCPPCCC",
"output": "23"
},
{
"input": "PPCCCCPPCCPPPCCCCPPPPPCPPPCPPPCCCPCCCPCPPPCPCCCPCCPPCCPPPPPC",
"output": "26"
},
{
"input": "PPCPPCCCCCPCCCPCCPCCCCPPPCCCCPCPCCPCPCPCPPPPCCPPPPPPPCPCPPPCPCPCPCPPPC",
"output": "39"
},
{
"input": "CCPCPPPPCPPPPCCCCPCCPCPCCPPCPCCCPPCCCCPCCCPCPCCPPPCPPPCPCPPPPPCPCCPCCPPCCCPCPPPC",
"output": "43"
},
{
"input": "CCPPCPCPCPPCCCPCPPPCCCCCPCPPCCCPPCPCPPPPCPPCPPPPCCCPCCPCPPPCPCPPCCCPCCCCCCPCCCCPCCPPPPCCPP",
"output": "47"
},
{
"input": "PPCPPPPCCCCPPPPCPPPPPPPPCPCPPCCPPPPPPPPCPPPPCCCCPPPPCPPCPCPPPCCPPCPPCCCPCPPCCCCCCPCPCPCPPCPCPCPPPCCC",
"output": "49"
},
{
"input": "CCPCCCPPCPPCPCCCPCPPCPPCPPCCCCCCCPCPPCPCCPCCPCPCPCCCPCCCPPPCCPCCPPCCCCCPPPPCPCPPCPCPCCPCPPP",
"output": "53"
},
{
"input": "PCPCPPPPCPCPPPCPPCCCPCPCPCPPCPPPPCCPPPCPPPCPPPPCCPPCCCPCCPCCCCPCCPCPPCPCCCPCPPCP",
"output": "47"
},
{
"input": "PCCPPCCCPPCPPCC",
"output": "8"
},
{
"input": "CCCPPPPPPCCCCPCCPCCCCCCPCCCPPPCPC",
"output": "15"
},
{
"input": "CPPCCPPCCPPPCCCPPPPCPPPPPPPCCPCPCCPPPPCCCPPCCPCCPPCCCPCCPCPPPPCCPP",
"output": "31"
},
{
"input": "CCCCCPPPCCPCPCCPPPPCPCCCPCPPCPCPPPPPCCPCPCPC",
"output": "25"
},
{
"input": "PPPPPPPPPCPCP",
"output": "6"
},
{
"input": "PPPCPCPCCCPPCPCCPPPPCCCPCCP",
"output": "15"
},
{
"input": "PCPCCPCPPPPPPCPCCPCPCPCCPPPCPCPCPPCPPCCPCPCCCPCCCPPCPCPCCPCPPPPCCCCCCPPCCPCCCCCPCCCCPPPCPCCCCCPCPCP",
"output": "59"
},
{
"input": "PCCPCPPCCCCCPCCCPCCCPPCCCCCPPPCCPPPPPPPPCPPPCCPPCPPCPCP",
"output": "26"
},
{
"input": "CPCPCCPPPPCCPPCPPCPPCCCCCCPCCPPPCPPCPCCCCCCPCPCCCCCPCCCCCCPCCPPCCP",
"output": "35"
},
{
"input": "PPCCCCCCPP",
"output": "4"
},
{
"input": "CCCCCCCCCCCCPPCCCCPP",
"output": "6"
},
{
"input": "PPPPPPPPPPPCCCCCCCCCCCCCCCCCCP",
"output": "8"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCPPPPCCCC",
"output": "10"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCPPPC",
"output": "12"
},
{
"input": "CCCCCCCCCPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCCCCCCCCCCCCPPPPPCC",
"output": "13"
},
{
"input": "CCCCCCCCCCCCCCCCCCCCCCCCCPPPCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC",
"output": "15"
},
{
"input": "CCCCCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCPPPPPPPCCPPP",
"output": "18"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCCCCCCCCCCCCCCCPPPPPPPPPPPPPPPPPPP",
"output": "19"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCPPPPPCCCPPPPCCCCCPCC",
"output": "23"
}
] | 1,680,172,505
| 2,147,483,647
|
PyPy 3-64
|
RUNTIME_ERROR
|
TESTS
| 0
| 154
| 2,764,800
|
k, r = map(int,input().split())
x = 0
while x%k != 0 or x == 0:
if (x+r) % k == 0:
x += r
break
x += 10
print(x // k)
|
Title: Postcards and photos
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus has postcards and photos hung in a row on the wall. He decided to put them away to the closet and hang on the wall a famous painter's picture. Polycarpus does it like that: he goes from the left to the right and removes the objects consecutively. As Polycarpus doesn't want any mix-ups to happen, he will not carry in his hands objects of two different types. In other words, Polycarpus can't carry both postcards and photos simultaneously. Sometimes he goes to the closet and puts the objects there, thus leaving his hands free. Polycarpus must put all the postcards and photos to the closet. He cannot skip objects. What minimum number of times he should visit the closet if he cannot carry more than 5 items?
Input Specification:
The only line of the input data contains a non-empty string consisting of letters "С" and "P" whose length does not exceed 100 characters. If the *i*-th character in the string is the letter "С", that means that the *i*-th object (the numbering goes from the left to the right) on Polycarpus' wall is a postcard. And if the *i*-th character is the letter "P", than the *i*-th object on the wall is a photo.
Output Specification:
Print the only number — the minimum number of times Polycarpus has to visit the closet.
Demo Input:
['CPCPCPC\n', 'CCCCCCPPPPPP\n', 'CCCCCCPPCPPPPPPPPPP\n', 'CCCCCCCCCC\n']
Demo Output:
['7\n', '4\n', '6\n', '2\n']
Note:
In the first sample Polycarpus needs to take one item to the closet 7 times.
In the second sample Polycarpus can first take 3 postcards to the closet; then 3 more. He can take the 6 photos that are left in the similar way, going to the closet twice.
In the third sample Polycarpus can visit the closet twice, both times carrying 3 postcards. Then he can take there 2 photos at once, then one postcard and finally, he can carry the last 10 photos if he visits the closet twice.
In the fourth sample Polycarpus can visit the closet twice and take there all 10 postcards (5 items during each go).
|
```python
k, r = map(int,input().split())
x = 0
while x%k != 0 or x == 0:
if (x+r) % k == 0:
x += r
break
x += 10
print(x // k)
```
| -1
|
|
433
|
B
|
Kuriyama Mirai's Stones
|
PROGRAMMING
| 1,200
|
[
"dp",
"implementation",
"sortings"
] | null | null |
Kuriyama Mirai has killed many monsters and got many (namely *n*) stones. She numbers the stones from 1 to *n*. The cost of the *i*-th stone is *v**i*. Kuriyama Mirai wants to know something about these stones so she will ask you two kinds of questions:
1. She will tell you two numbers, *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*), and you should tell her . 1. Let *u**i* be the cost of the *i*-th cheapest stone (the cost that will be on the *i*-th place if we arrange all the stone costs in non-decreasing order). This time she will tell you two numbers, *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*), and you should tell her .
For every question you should give the correct answer, or Kuriyama Mirai will say "fuyukai desu" and then become unhappy.
|
The first line contains an integer *n* (1<=≤<=*n*<=≤<=105). The second line contains *n* integers: *v*1,<=*v*2,<=...,<=*v**n* (1<=≤<=*v**i*<=≤<=109) — costs of the stones.
The third line contains an integer *m* (1<=≤<=*m*<=≤<=105) — the number of Kuriyama Mirai's questions. Then follow *m* lines, each line contains three integers *type*, *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*; 1<=≤<=*type*<=≤<=2), describing a question. If *type* equal to 1, then you should output the answer for the first question, else you should output the answer for the second one.
|
Print *m* lines. Each line must contain an integer — the answer to Kuriyama Mirai's question. Print the answers to the questions in the order of input.
|
[
"6\n6 4 2 7 2 7\n3\n2 3 6\n1 3 4\n1 1 6\n",
"4\n5 5 2 3\n10\n1 2 4\n2 1 4\n1 1 1\n2 1 4\n2 1 2\n1 1 1\n1 3 3\n1 1 3\n1 4 4\n1 2 2\n"
] |
[
"24\n9\n28\n",
"10\n15\n5\n15\n5\n5\n2\n12\n3\n5\n"
] |
Please note that the answers to the questions may overflow 32-bit integer type.
| 1,500
|
[
{
"input": "6\n6 4 2 7 2 7\n3\n2 3 6\n1 3 4\n1 1 6",
"output": "24\n9\n28"
},
{
"input": "4\n5 5 2 3\n10\n1 2 4\n2 1 4\n1 1 1\n2 1 4\n2 1 2\n1 1 1\n1 3 3\n1 1 3\n1 4 4\n1 2 2",
"output": "10\n15\n5\n15\n5\n5\n2\n12\n3\n5"
},
{
"input": "4\n2 2 3 6\n9\n2 2 3\n1 1 3\n2 2 3\n2 2 3\n2 2 2\n1 1 3\n1 1 3\n2 1 4\n1 1 2",
"output": "5\n7\n5\n5\n2\n7\n7\n13\n4"
},
{
"input": "18\n26 46 56 18 78 88 86 93 13 77 21 84 59 61 5 74 72 52\n25\n1 10 10\n1 9 13\n2 13 17\n1 8 14\n2 2 6\n1 12 16\n2 15 17\n2 3 6\n1 3 13\n2 8 9\n2 17 17\n1 17 17\n2 5 10\n2 1 18\n1 4 16\n1 1 13\n1 1 8\n2 7 11\n2 6 12\n1 5 9\n1 4 5\n2 7 15\n1 8 8\n1 8 14\n1 3 7",
"output": "77\n254\n413\n408\n124\n283\n258\n111\n673\n115\n88\n72\n300\n1009\n757\n745\n491\n300\n420\n358\n96\n613\n93\n408\n326"
},
{
"input": "56\n43 100 44 66 65 11 26 75 96 77 5 15 75 96 11 44 11 97 75 53 33 26 32 33 90 26 68 72 5 44 53 26 33 88 68 25 84 21 25 92 1 84 21 66 94 35 76 51 11 95 67 4 61 3 34 18\n27\n1 20 38\n1 11 46\n2 42 53\n1 8 11\n2 11 42\n2 35 39\n2 37 41\n1 48 51\n1 32 51\n1 36 40\n1 31 56\n1 18 38\n2 9 51\n1 7 48\n1 15 52\n1 27 31\n2 5 19\n2 35 50\n1 31 34\n1 2 7\n2 15 33\n2 46 47\n1 26 28\n2 3 29\n1 23 45\n2 29 55\n1 14 29",
"output": "880\n1727\n1026\n253\n1429\n335\n350\n224\n1063\n247\n1236\n1052\n2215\n2128\n1840\n242\n278\n1223\n200\n312\n722\n168\n166\n662\n1151\n2028\n772"
},
{
"input": "18\n38 93 48 14 69 85 26 47 71 11 57 9 38 65 72 78 52 47\n38\n2 10 12\n1 6 18\n2 2 2\n1 3 15\n2 1 16\n2 5 13\n1 9 17\n1 2 15\n2 5 17\n1 15 15\n2 4 11\n2 3 4\n2 2 5\n2 1 17\n2 6 16\n2 8 16\n2 8 14\n1 9 12\n2 8 13\n2 1 14\n2 5 13\n1 2 3\n1 9 14\n2 12 15\n2 3 3\n2 9 13\n2 4 12\n2 11 14\n2 6 16\n1 8 14\n1 12 15\n2 3 4\n1 3 5\n2 4 14\n1 6 6\n2 7 14\n2 7 18\n1 8 12",
"output": "174\n658\n11\n612\n742\n461\n453\n705\n767\n72\n353\n40\n89\n827\n644\n559\n409\n148\n338\n592\n461\n141\n251\n277\n14\n291\n418\n262\n644\n298\n184\n40\n131\n558\n85\n456\n784\n195"
},
{
"input": "1\n2\n10\n1 1 1\n1 1 1\n2 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n2 1 1\n1 1 1\n1 1 1",
"output": "2\n2\n2\n2\n2\n2\n2\n2\n2\n2"
},
{
"input": "2\n1 5\n8\n2 1 2\n1 1 1\n1 1 2\n1 1 1\n2 2 2\n2 1 2\n1 1 1\n1 2 2",
"output": "6\n1\n6\n1\n5\n6\n1\n5"
},
{
"input": "8\n2 6 4 6 8 4 7 7\n9\n2 6 8\n1 2 3\n2 3 4\n2 1 2\n2 4 5\n1 3 8\n2 4 4\n2 2 4\n1 2 4",
"output": "22\n10\n10\n6\n12\n36\n6\n14\n16"
},
{
"input": "4\n1 1 2 8\n9\n1 2 4\n1 2 4\n1 1 2\n2 3 4\n2 1 1\n1 2 3\n2 3 4\n1 1 4\n1 1 4",
"output": "11\n11\n2\n10\n1\n3\n10\n12\n12"
},
{
"input": "5\n8 8 1 10 7\n5\n1 2 2\n1 1 4\n1 3 3\n1 2 2\n1 2 5",
"output": "8\n27\n1\n8\n26"
},
{
"input": "10\n10 3 3 2 1 2 7 1 1 1\n4\n2 10 10\n2 6 6\n1 5 10\n1 6 8",
"output": "10\n2\n13\n10"
},
{
"input": "6\n6 6 3 8 5 4\n3\n2 2 3\n2 1 5\n1 1 5",
"output": "9\n24\n28"
},
{
"input": "1\n1\n2\n1 1 1\n2 1 1",
"output": "1\n1"
}
] | 1,625,343,285
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 46
| 1,715
| 21,606,400
|
n = int(input())
l1 = list(map(int, input().split()))
sorted_l1 = sorted(l1)
m = int(input())
pref1 = [0] * n
pref2 = [0] * n
pref1[0] = l1[0]
pref2[0] = sorted_l1[0]
for i in range(1, n):
pref1[i] = pref1[i-1] + l1[i]
pref2[i] = pref2[i-1] + sorted_l1[i]
for i in range(m):
t, l, r = list(map(int, input().split()))
l -= 1
r -= 1
if t == 1:
if l == 0:
print(pref1[r])
else:
print(pref1[r] - pref1[l-1])
else:
if l == 0:
print(pref2[r])
else:
print(pref2[r] - pref2[l-1])
|
Title: Kuriyama Mirai's Stones
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kuriyama Mirai has killed many monsters and got many (namely *n*) stones. She numbers the stones from 1 to *n*. The cost of the *i*-th stone is *v**i*. Kuriyama Mirai wants to know something about these stones so she will ask you two kinds of questions:
1. She will tell you two numbers, *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*), and you should tell her . 1. Let *u**i* be the cost of the *i*-th cheapest stone (the cost that will be on the *i*-th place if we arrange all the stone costs in non-decreasing order). This time she will tell you two numbers, *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*), and you should tell her .
For every question you should give the correct answer, or Kuriyama Mirai will say "fuyukai desu" and then become unhappy.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=105). The second line contains *n* integers: *v*1,<=*v*2,<=...,<=*v**n* (1<=≤<=*v**i*<=≤<=109) — costs of the stones.
The third line contains an integer *m* (1<=≤<=*m*<=≤<=105) — the number of Kuriyama Mirai's questions. Then follow *m* lines, each line contains three integers *type*, *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*; 1<=≤<=*type*<=≤<=2), describing a question. If *type* equal to 1, then you should output the answer for the first question, else you should output the answer for the second one.
Output Specification:
Print *m* lines. Each line must contain an integer — the answer to Kuriyama Mirai's question. Print the answers to the questions in the order of input.
Demo Input:
['6\n6 4 2 7 2 7\n3\n2 3 6\n1 3 4\n1 1 6\n', '4\n5 5 2 3\n10\n1 2 4\n2 1 4\n1 1 1\n2 1 4\n2 1 2\n1 1 1\n1 3 3\n1 1 3\n1 4 4\n1 2 2\n']
Demo Output:
['24\n9\n28\n', '10\n15\n5\n15\n5\n5\n2\n12\n3\n5\n']
Note:
Please note that the answers to the questions may overflow 32-bit integer type.
|
```python
n = int(input())
l1 = list(map(int, input().split()))
sorted_l1 = sorted(l1)
m = int(input())
pref1 = [0] * n
pref2 = [0] * n
pref1[0] = l1[0]
pref2[0] = sorted_l1[0]
for i in range(1, n):
pref1[i] = pref1[i-1] + l1[i]
pref2[i] = pref2[i-1] + sorted_l1[i]
for i in range(m):
t, l, r = list(map(int, input().split()))
l -= 1
r -= 1
if t == 1:
if l == 0:
print(pref1[r])
else:
print(pref1[r] - pref1[l-1])
else:
if l == 0:
print(pref2[r])
else:
print(pref2[r] - pref2[l-1])
```
| 3
|
|
124
|
A
|
The number of positions
|
PROGRAMMING
| 1,000
|
[
"math"
] | null | null |
Petr stands in line of *n* people, but he doesn't know exactly which position he occupies. He can say that there are no less than *a* people standing in front of him and no more than *b* people standing behind him. Find the number of different positions Petr can occupy.
|
The only line contains three integers *n*, *a* and *b* (0<=≤<=*a*,<=*b*<=<<=*n*<=≤<=100).
|
Print the single number — the number of the sought positions.
|
[
"3 1 1\n",
"5 2 3\n"
] |
[
"2\n",
"3\n"
] |
The possible positions in the first sample are: 2 and 3 (if we number the positions starting with 1).
In the second sample they are 3, 4 and 5.
| 500
|
[
{
"input": "3 1 1",
"output": "2"
},
{
"input": "5 2 3",
"output": "3"
},
{
"input": "5 4 0",
"output": "1"
},
{
"input": "6 5 5",
"output": "1"
},
{
"input": "9 4 3",
"output": "4"
},
{
"input": "11 4 6",
"output": "7"
},
{
"input": "13 8 7",
"output": "5"
},
{
"input": "14 5 5",
"output": "6"
},
{
"input": "16 6 9",
"output": "10"
},
{
"input": "20 13 17",
"output": "7"
},
{
"input": "22 4 8",
"output": "9"
},
{
"input": "23 8 14",
"output": "15"
},
{
"input": "26 18 22",
"output": "8"
},
{
"input": "28 6 1",
"output": "2"
},
{
"input": "29 5 23",
"output": "24"
},
{
"input": "32 27 15",
"output": "5"
},
{
"input": "33 11 5",
"output": "6"
},
{
"input": "37 21 15",
"output": "16"
},
{
"input": "39 34 33",
"output": "5"
},
{
"input": "41 27 11",
"output": "12"
},
{
"input": "42 25 16",
"output": "17"
},
{
"input": "45 7 43",
"output": "38"
},
{
"input": "47 16 17",
"output": "18"
},
{
"input": "49 11 37",
"output": "38"
},
{
"input": "51 38 39",
"output": "13"
},
{
"input": "52 29 7",
"output": "8"
},
{
"input": "56 43 12",
"output": "13"
},
{
"input": "58 57 28",
"output": "1"
},
{
"input": "59 12 39",
"output": "40"
},
{
"input": "62 9 52",
"output": "53"
},
{
"input": "63 29 44",
"output": "34"
},
{
"input": "65 30 22",
"output": "23"
},
{
"input": "66 27 38",
"output": "39"
},
{
"input": "71 33 53",
"output": "38"
},
{
"input": "73 14 12",
"output": "13"
},
{
"input": "73 37 35",
"output": "36"
},
{
"input": "76 69 44",
"output": "7"
},
{
"input": "79 25 20",
"output": "21"
},
{
"input": "81 60 20",
"output": "21"
},
{
"input": "81 79 14",
"output": "2"
},
{
"input": "84 0 42",
"output": "43"
},
{
"input": "88 79 8",
"output": "9"
},
{
"input": "90 76 59",
"output": "14"
},
{
"input": "92 2 22",
"output": "23"
},
{
"input": "94 5 88",
"output": "89"
},
{
"input": "94 62 48",
"output": "32"
},
{
"input": "96 22 72",
"output": "73"
},
{
"input": "100 11 88",
"output": "89"
},
{
"input": "100 81 91",
"output": "19"
},
{
"input": "1 0 0",
"output": "1"
}
] | 1,653,274,386
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 92
| 0
|
l = list(map(int,input().split(' ')))
print(l[0]-l[1])
|
Title: The number of positions
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petr stands in line of *n* people, but he doesn't know exactly which position he occupies. He can say that there are no less than *a* people standing in front of him and no more than *b* people standing behind him. Find the number of different positions Petr can occupy.
Input Specification:
The only line contains three integers *n*, *a* and *b* (0<=≤<=*a*,<=*b*<=<<=*n*<=≤<=100).
Output Specification:
Print the single number — the number of the sought positions.
Demo Input:
['3 1 1\n', '5 2 3\n']
Demo Output:
['2\n', '3\n']
Note:
The possible positions in the first sample are: 2 and 3 (if we number the positions starting with 1).
In the second sample they are 3, 4 and 5.
|
```python
l = list(map(int,input().split(' ')))
print(l[0]-l[1])
```
| 0
|
|
221
|
A
|
Little Elephant and Function
|
PROGRAMMING
| 1,000
|
[
"implementation",
"math"
] | null | null |
The Little Elephant enjoys recursive functions.
This time he enjoys the sorting function. Let *a* is a permutation of an integers from 1 to *n*, inclusive, and *a**i* denotes the *i*-th element of the permutation. The Little Elephant's recursive function *f*(*x*), that sorts the first *x* permutation's elements, works as follows:
- If *x*<==<=1, exit the function. - Otherwise, call *f*(*x*<=-<=1), and then make *swap*(*a**x*<=-<=1,<=*a**x*) (swap the *x*-th and (*x*<=-<=1)-th elements of *a*).
The Little Elephant's teacher believes that this function does not work correctly. But that-be do not get an F, the Little Elephant wants to show the performance of its function. Help him, find a permutation of numbers from 1 to *n*, such that after performing the Little Elephant's function (that is call *f*(*n*)), the permutation will be sorted in ascending order.
|
A single line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the size of permutation.
|
In a single line print *n* distinct integers from 1 to *n* — the required permutation. Numbers in a line should be separated by spaces.
It is guaranteed that the answer exists.
|
[
"1\n",
"2\n"
] |
[
"1 ",
"2 1 "
] |
none
| 500
|
[
{
"input": "1",
"output": "1 "
},
{
"input": "2",
"output": "2 1 "
},
{
"input": "3",
"output": "3 1 2 "
},
{
"input": "4",
"output": "4 1 2 3 "
},
{
"input": "5",
"output": "5 1 2 3 4 "
},
{
"input": "6",
"output": "6 1 2 3 4 5 "
},
{
"input": "7",
"output": "7 1 2 3 4 5 6 "
},
{
"input": "1000",
"output": "1000 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 15..."
},
{
"input": "999",
"output": "999 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "998",
"output": "998 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "997",
"output": "997 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "900",
"output": "900 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "101",
"output": "101 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "3",
"output": "3 1 2 "
},
{
"input": "67",
"output": "67 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 "
},
{
"input": "779",
"output": "779 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "195",
"output": "195 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "907",
"output": "907 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "971",
"output": "971 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "683",
"output": "683 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "99",
"output": "99 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 "
},
{
"input": "811",
"output": "811 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "875",
"output": "875 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "291",
"output": "291 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "3",
"output": "3 1 2 "
},
{
"input": "419",
"output": "419 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "779",
"output": "779 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "195",
"output": "195 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "907",
"output": "907 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154..."
},
{
"input": "21",
"output": "21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 "
},
{
"input": "22",
"output": "22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 "
},
{
"input": "23",
"output": "23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 "
},
{
"input": "24",
"output": "24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 "
},
{
"input": "25",
"output": "25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 "
}
] | 1,637,594,768
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 2
| 122
| 0
|
def f(n):
if n > 0:
print(n)
n -=1
f(n)
n = int(input(''))
f(n)
|
Title: Little Elephant and Function
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant enjoys recursive functions.
This time he enjoys the sorting function. Let *a* is a permutation of an integers from 1 to *n*, inclusive, and *a**i* denotes the *i*-th element of the permutation. The Little Elephant's recursive function *f*(*x*), that sorts the first *x* permutation's elements, works as follows:
- If *x*<==<=1, exit the function. - Otherwise, call *f*(*x*<=-<=1), and then make *swap*(*a**x*<=-<=1,<=*a**x*) (swap the *x*-th and (*x*<=-<=1)-th elements of *a*).
The Little Elephant's teacher believes that this function does not work correctly. But that-be do not get an F, the Little Elephant wants to show the performance of its function. Help him, find a permutation of numbers from 1 to *n*, such that after performing the Little Elephant's function (that is call *f*(*n*)), the permutation will be sorted in ascending order.
Input Specification:
A single line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the size of permutation.
Output Specification:
In a single line print *n* distinct integers from 1 to *n* — the required permutation. Numbers in a line should be separated by spaces.
It is guaranteed that the answer exists.
Demo Input:
['1\n', '2\n']
Demo Output:
['1 ', '2 1 ']
Note:
none
|
```python
def f(n):
if n > 0:
print(n)
n -=1
f(n)
n = int(input(''))
f(n)
```
| 0
|
|
426
|
B
|
Sereja and Mirroring
|
PROGRAMMING
| 1,300
|
[
"implementation"
] | null | null |
Let's assume that we are given a matrix *b* of size *x*<=×<=*y*, let's determine the operation of mirroring matrix *b*. The mirroring of matrix *b* is a 2*x*<=×<=*y* matrix *c* which has the following properties:
- the upper half of matrix *c* (rows with numbers from 1 to *x*) exactly matches *b*; - the lower half of matrix *c* (rows with numbers from *x*<=+<=1 to 2*x*) is symmetric to the upper one; the symmetry line is the line that separates two halves (the line that goes in the middle, between rows *x* and *x*<=+<=1).
Sereja has an *n*<=×<=*m* matrix *a*. He wants to find such matrix *b*, that it can be transformed into matrix *a*, if we'll perform on it several (possibly zero) mirrorings. What minimum number of rows can such matrix contain?
|
The first line contains two integers, *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). Each of the next *n* lines contains *m* integers — the elements of matrix *a*. The *i*-th line contains integers *a**i*1,<=*a**i*2,<=...,<=*a**im* (0<=≤<=*a**ij*<=≤<=1) — the *i*-th row of the matrix *a*.
|
In the single line, print the answer to the problem — the minimum number of rows of matrix *b*.
|
[
"4 3\n0 0 1\n1 1 0\n1 1 0\n0 0 1\n",
"3 3\n0 0 0\n0 0 0\n0 0 0\n",
"8 1\n0\n1\n1\n0\n0\n1\n1\n0\n"
] |
[
"2\n",
"3\n",
"2\n"
] |
In the first test sample the answer is a 2 × 3 matrix *b*:
If we perform a mirroring operation with this matrix, we get the matrix *a* that is given in the input:
| 1,000
|
[
{
"input": "4 3\n0 0 1\n1 1 0\n1 1 0\n0 0 1",
"output": "2"
},
{
"input": "3 3\n0 0 0\n0 0 0\n0 0 0",
"output": "3"
},
{
"input": "8 1\n0\n1\n1\n0\n0\n1\n1\n0",
"output": "2"
},
{
"input": "10 4\n0 0 1 0\n0 0 1 0\n1 1 0 1\n0 0 1 1\n1 0 1 0\n1 0 1 0\n0 0 1 1\n1 1 0 1\n0 0 1 0\n0 0 1 0",
"output": "5"
},
{
"input": "10 3\n0 0 0\n1 1 1\n1 1 0\n0 0 0\n0 1 1\n0 1 1\n0 0 0\n1 1 0\n1 1 1\n0 0 0",
"output": "5"
},
{
"input": "8 4\n1 0 0 0\n1 1 0 0\n1 0 0 1\n1 1 1 1\n0 0 1 1\n0 1 0 1\n0 1 1 1\n1 0 0 0",
"output": "8"
},
{
"input": "2 9\n1 0 0 1 1 1 0 1 0\n1 0 0 1 0 0 0 1 1",
"output": "2"
},
{
"input": "10 3\n0 1 0\n1 1 1\n1 0 1\n0 0 1\n1 0 1\n1 0 0\n1 1 0\n1 1 1\n1 0 1\n0 0 1",
"output": "10"
},
{
"input": "8 4\n1 1 0 1\n0 0 0 0\n0 0 0 0\n1 1 0 1\n1 1 0 1\n0 0 0 0\n0 0 0 0\n1 1 0 1",
"output": "2"
},
{
"input": "8 7\n1 1 0 0 1 1 0\n1 1 0 0 1 1 0\n1 1 0 0 1 1 0\n1 1 0 0 1 1 0\n1 1 0 0 1 1 0\n1 1 0 0 1 1 0\n1 1 0 0 1 1 0\n1 1 0 0 1 1 0",
"output": "1"
},
{
"input": "6 5\n0 0 1 0 1\n1 0 0 1 0\n1 1 1 0 0\n1 0 1 1 0\n0 0 0 0 0\n1 0 1 0 0",
"output": "6"
},
{
"input": "1 69\n0 0 1 1 1 1 0 0 1 1 1 0 0 0 1 1 1 1 1 1 1 0 0 1 0 0 1 1 1 0 0 1 1 0 1 1 1 1 0 0 0 0 0 0 1 1 1 0 1 1 0 1 0 0 1 0 0 0 1 1 1 1 1 1 1 1 0 1 0",
"output": "1"
},
{
"input": "8 20\n0 0 1 1 1 1 0 0 0 0 1 1 1 1 0 0 0 1 1 0\n1 0 1 0 1 0 0 0 0 1 0 1 0 1 1 0 1 1 1 1\n1 0 1 0 1 0 0 0 0 1 0 1 0 1 1 0 1 1 1 1\n0 0 1 1 1 1 0 0 0 0 1 1 1 1 0 0 0 1 1 0\n0 0 1 1 1 1 0 0 0 0 1 1 1 1 0 0 0 1 1 0\n1 0 1 0 1 0 0 0 0 1 0 1 0 1 1 0 1 1 1 1\n1 0 1 0 1 0 0 0 0 1 0 1 0 1 1 0 1 1 1 1\n0 0 1 1 1 1 0 0 0 0 1 1 1 1 0 0 0 1 1 0",
"output": "2"
},
{
"input": "1 1\n0",
"output": "1"
},
{
"input": "1 1\n1",
"output": "1"
},
{
"input": "2 2\n1 0\n0 1",
"output": "2"
},
{
"input": "2 2\n0 1\n0 1",
"output": "1"
},
{
"input": "1 2\n0 1",
"output": "1"
},
{
"input": "1 100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0",
"output": "1"
},
{
"input": "1 100\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1",
"output": "1"
},
{
"input": "1 100\n0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0",
"output": "1"
},
{
"input": "100 1\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0",
"output": "25"
},
{
"input": "100 1\n1\n1\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n1\n1",
"output": "50"
},
{
"input": "100 1\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n1\n0\n0\n0",
"output": "100"
},
{
"input": "8 1\n1\n0\n0\n1\n1\n0\n1\n1",
"output": "8"
},
{
"input": "6 1\n0\n0\n0\n0\n0\n0",
"output": "3"
},
{
"input": "10 2\n1 1\n0 0\n0 0\n1 1\n0 0\n0 0\n1 1\n0 0\n0 0\n1 1",
"output": "5"
},
{
"input": "4 2\n1 1\n0 0\n0 0\n0 0",
"output": "4"
},
{
"input": "6 3\n1 1 1\n0 0 0\n1 1 1\n1 1 1\n0 0 0\n1 1 1",
"output": "3"
},
{
"input": "6 3\n1 1 1\n1 0 1\n1 1 1\n1 1 1\n1 0 1\n1 1 1",
"output": "3"
},
{
"input": "6 3\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1",
"output": "3"
},
{
"input": "4 3\n1 0 1\n0 1 0\n1 0 1\n1 0 1",
"output": "4"
},
{
"input": "6 1\n1\n1\n1\n1\n1\n1",
"output": "3"
},
{
"input": "10 1\n1\n1\n1\n1\n1\n1\n1\n1\n1\n1",
"output": "5"
},
{
"input": "3 1\n1\n1\n1",
"output": "3"
},
{
"input": "6 3\n0 0 0\n0 0 0\n0 0 0\n0 0 0\n0 0 0\n0 0 0",
"output": "3"
},
{
"input": "6 1\n1\n0\n1\n1\n0\n1",
"output": "3"
},
{
"input": "6 6\n0 0 0 0 0 0\n0 0 0 0 0 0\n0 0 0 0 0 0\n0 0 0 0 0 0\n0 0 0 0 0 0\n0 0 0 0 0 0",
"output": "3"
},
{
"input": "3 1\n1\n0\n1",
"output": "3"
},
{
"input": "12 3\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1\n1 1 1",
"output": "3"
},
{
"input": "12 1\n0\n1\n0\n0\n1\n0\n0\n1\n0\n0\n1\n0",
"output": "3"
},
{
"input": "2 3\n0 0 0\n0 0 0",
"output": "1"
},
{
"input": "3 3\n1 1 1\n1 1 1\n0 0 0",
"output": "3"
},
{
"input": "10 1\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0",
"output": "5"
},
{
"input": "12 1\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0",
"output": "3"
},
{
"input": "6 2\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1",
"output": "3"
},
{
"input": "6 3\n1 1 0\n0 0 0\n1 1 0\n1 1 0\n0 0 0\n1 1 0",
"output": "3"
},
{
"input": "6 2\n0 1\n0 1\n0 1\n0 1\n0 1\n0 1",
"output": "3"
},
{
"input": "12 1\n1\n1\n0\n0\n1\n1\n1\n1\n0\n0\n1\n1",
"output": "3"
},
{
"input": "6 2\n1 0\n1 0\n1 0\n1 0\n1 0\n1 0",
"output": "3"
}
] | 1,616,789,663
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 65
| 108
| 1,433,600
|
from sys import stdin ,stdout
from os import path
rd = lambda:stdin.readline().strip()
wr = stdout.write
if(path.exists('input.txt')):
stdin = open("input.txt","r")
import time ,math
#------------------------------------
x,y = map(int,rd().split())
mylist = [''.join(map(str,rd().split())) for _ in range(x)]
while x > 1 and x % 2 == 0 :
if mylist[:x] != mylist[:x][::-1]:
break
x//=2
print(x)
|
Title: Sereja and Mirroring
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let's assume that we are given a matrix *b* of size *x*<=×<=*y*, let's determine the operation of mirroring matrix *b*. The mirroring of matrix *b* is a 2*x*<=×<=*y* matrix *c* which has the following properties:
- the upper half of matrix *c* (rows with numbers from 1 to *x*) exactly matches *b*; - the lower half of matrix *c* (rows with numbers from *x*<=+<=1 to 2*x*) is symmetric to the upper one; the symmetry line is the line that separates two halves (the line that goes in the middle, between rows *x* and *x*<=+<=1).
Sereja has an *n*<=×<=*m* matrix *a*. He wants to find such matrix *b*, that it can be transformed into matrix *a*, if we'll perform on it several (possibly zero) mirrorings. What minimum number of rows can such matrix contain?
Input Specification:
The first line contains two integers, *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). Each of the next *n* lines contains *m* integers — the elements of matrix *a*. The *i*-th line contains integers *a**i*1,<=*a**i*2,<=...,<=*a**im* (0<=≤<=*a**ij*<=≤<=1) — the *i*-th row of the matrix *a*.
Output Specification:
In the single line, print the answer to the problem — the minimum number of rows of matrix *b*.
Demo Input:
['4 3\n0 0 1\n1 1 0\n1 1 0\n0 0 1\n', '3 3\n0 0 0\n0 0 0\n0 0 0\n', '8 1\n0\n1\n1\n0\n0\n1\n1\n0\n']
Demo Output:
['2\n', '3\n', '2\n']
Note:
In the first test sample the answer is a 2 × 3 matrix *b*:
If we perform a mirroring operation with this matrix, we get the matrix *a* that is given in the input:
|
```python
from sys import stdin ,stdout
from os import path
rd = lambda:stdin.readline().strip()
wr = stdout.write
if(path.exists('input.txt')):
stdin = open("input.txt","r")
import time ,math
#------------------------------------
x,y = map(int,rd().split())
mylist = [''.join(map(str,rd().split())) for _ in range(x)]
while x > 1 and x % 2 == 0 :
if mylist[:x] != mylist[:x][::-1]:
break
x//=2
print(x)
```
| 3
|
|
355
|
A
|
Vasya and Digital Root
|
PROGRAMMING
| 1,100
|
[
"constructive algorithms",
"implementation"
] | null | null |
Vasya has recently found out what a digital root of a number is and he decided to share his knowledge with you.
Let's assume that *S*(*n*) is the sum of digits of number *n*, for example, *S*(4098)<==<=4<=+<=0<=+<=9<=+<=8<==<=21. Then the digital root of number *n* equals to:
1. *dr*(*n*)<==<=*S*(*n*), if *S*(*n*)<=<<=10; 1. *dr*(*n*)<==<=*dr*(<=*S*(*n*)<=), if *S*(*n*)<=≥<=10.
For example, *dr*(4098)<=<==<=<=*dr*(21)<=<==<=<=3.
Vasya is afraid of large numbers, so the numbers he works with are at most 101000. For all such numbers, he has proved that *dr*(*n*)<=<==<=<=*S*(<=*S*(<=*S*(<=*S*(*n*)<=)<=)<=) (*n*<=≤<=101000).
Now Vasya wants to quickly find numbers with the given digital root. The problem is, he hasn't learned how to do that and he asked you to help him. You task is, given numbers *k* and *d*, find the number consisting of exactly *k* digits (the leading zeroes are not allowed), with digital root equal to *d*, or else state that such number does not exist.
|
The first line contains two integers *k* and *d* (1<=≤<=*k*<=≤<=1000; 0<=≤<=*d*<=≤<=9).
|
In a single line print either any number that meets the requirements (without the leading zeroes) or "No solution" (without the quotes), if the corresponding number does not exist.
The chosen number must consist of exactly *k* digits. We assume that number 0 doesn't contain any leading zeroes.
|
[
"4 4\n",
"5 1\n",
"1 0\n"
] |
[
"5881\n",
"36172\n",
"0\n"
] |
For the first test sample *dr*(5881) = *dr*(22) = 4.
For the second test sample *dr*(36172) = *dr*(19) = *dr*(10) = 1.
| 500
|
[
{
"input": "4 4",
"output": "5881"
},
{
"input": "5 1",
"output": "36172"
},
{
"input": "1 0",
"output": "0"
},
{
"input": "8 7",
"output": "49722154"
},
{
"input": "487 0",
"output": "No solution"
},
{
"input": "1000 5",
"output": "8541939554067890866522280268745476436249986028349767396372181155840878549622667946850256234534972693110974918858266403731194206972478044933297639886527448596769215803533001453375065914421371731616055420973164037664278812596299678416020519508892847037891229851414508562230407367486468987019052183250172396304562086008837592345867873765321840214188417303688776985319268802181355472294386101622570417737061113209187893810568585166094583478900129912239498334853726870963804475563182775380744565964067602555515611220..."
},
{
"input": "22 9",
"output": "1583569962049529809017"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1 9",
"output": "9"
},
{
"input": "13 5",
"output": "1381199538344"
},
{
"input": "100 4",
"output": "6334594910586850938286642284598905674550356974741186703111536643493065423553455569335256292313330478"
},
{
"input": "123 6",
"output": "928024873067884441426263446866614165147002631091527531801777528825238463822318502518751375671158771476735217071878592158343"
},
{
"input": "1000 1",
"output": "8286301124628812353504240076754144327937426329149605334362213339655339076564408659154706137278060590992944494591503606137350736487608756923833530346502466262820452589925067370165968733865814927433418675056573256434073937686361155637721866942352171450747045834987797118866710087297111065178077368748085213082452303815796793489599773148508108295035303578345492871662297456131736137780231762177312635688688714815857818196180724774924848693916003108422682889382923194020205691379066085156078824413573001257245677878..."
},
{
"input": "2 0",
"output": "No solution"
},
{
"input": "734 9",
"output": "5509849803670339733829077693143634799621955270111335907079347964026719040571586127009915057683769302171314977999063915868539391500563742827163274052101515706840652002966522709635011152141196057419086708927225560622675363856445980167733179728663010064912099615416068178748694469047950713834326493597331720572208847439692450327661109751421257198843242305082523510866664350537162158359215265173356615680034808012842300294492281197211603826994471586252822908597603049772690875861970190564793056757768783375525854981..."
},
{
"input": "678 8",
"output": "3301967993506605598118564082793505826927835671912383741219911930496842130418974223636865915672261642456247377827650506657877850580145623499927271391838907804651235401527392426584047219626357010023552497909436550723659221336486898100975437974320483591226280567200180225706948265372905918038750624429412331582504280650041845010449084641487447573160867860208332424835101416924485616494780952529083292227777966546236453553361466209621076748915774965082618181512654546592160909206650552581723190500273752213154329310..."
},
{
"input": "955 7",
"output": "4875434946733568640983465009954221247849488705968833681097920555785434899849497268074436910608289709905212840964404347113134616236366794383005890642796609027376389191650656756216171636192669456464756898600086886269167613161503734300581107122411830728903919402846291350458047685924037685489537178939190129043010338580479169957795695942333133962326316127076129681213167918954090336000635320714955444899171270809399782177230616239894234246885245402806465700760528496316658100834632585364274381823984214942419830421..."
},
{
"input": "893 3",
"output": "3154491812688062338683413382839715419754844054478504300541293341098785797116419835470049101334759365561276155814822131363018164033585874216523127145546903121862283071300185033613164338905028463571111541628115658108609505120357131336651371062955497690723492519748325195227665653129911625684144804656937323976632567108677478936761775342496303735237936919652618323430255701996987753367609559178855599470625167628439986055634187527493497208780060336400261449926469512996188738133678473883670714775784527941804249702..."
},
{
"input": "998 2",
"output": "8948712698877635315965401396781625629035528026219922557326466734622505808493494219669540192792500692387387200924494124219975316993592377253517258369463882172533672158172302951620486954085880606055358057621166471042557383036617719864238933843342304818076672889894622975857106353903546493307325157763617269195570831067239463586554245706859061059010215520785892192165179414199200952765077228454366556358805840526959104496983177402562569401945586771345953166346316987259989961516385311376707950154520512125143059966..."
},
{
"input": "960 6",
"output": "7291446744949293530598651243840704118065364362420848463900543089429494124955982767375712583398715647208330285855809398453361266463042342917037983463277320070057956978767965467358862479678812136400444143489366786562672928727263605336304125661306952421127807059398289873947797478996261161224877129724944902005212399176751167053423457968483336961277157597291131065544350665072172392437597673561840137077580044817979332136630042866681837917711758227272499659805765131669208911408670581308412686469802437930679571593..."
}
] | 1,587,118,798
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 20
| 140
| 1,331,200
|
k,d = map(int,input().split())
if k>1 and d==0:
print("No solution")
else:
print(d,end='')
for i in range(k-1):
print(0,end='')
|
Title: Vasya and Digital Root
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has recently found out what a digital root of a number is and he decided to share his knowledge with you.
Let's assume that *S*(*n*) is the sum of digits of number *n*, for example, *S*(4098)<==<=4<=+<=0<=+<=9<=+<=8<==<=21. Then the digital root of number *n* equals to:
1. *dr*(*n*)<==<=*S*(*n*), if *S*(*n*)<=<<=10; 1. *dr*(*n*)<==<=*dr*(<=*S*(*n*)<=), if *S*(*n*)<=≥<=10.
For example, *dr*(4098)<=<==<=<=*dr*(21)<=<==<=<=3.
Vasya is afraid of large numbers, so the numbers he works with are at most 101000. For all such numbers, he has proved that *dr*(*n*)<=<==<=<=*S*(<=*S*(<=*S*(<=*S*(*n*)<=)<=)<=) (*n*<=≤<=101000).
Now Vasya wants to quickly find numbers with the given digital root. The problem is, he hasn't learned how to do that and he asked you to help him. You task is, given numbers *k* and *d*, find the number consisting of exactly *k* digits (the leading zeroes are not allowed), with digital root equal to *d*, or else state that such number does not exist.
Input Specification:
The first line contains two integers *k* and *d* (1<=≤<=*k*<=≤<=1000; 0<=≤<=*d*<=≤<=9).
Output Specification:
In a single line print either any number that meets the requirements (without the leading zeroes) or "No solution" (without the quotes), if the corresponding number does not exist.
The chosen number must consist of exactly *k* digits. We assume that number 0 doesn't contain any leading zeroes.
Demo Input:
['4 4\n', '5 1\n', '1 0\n']
Demo Output:
['5881\n', '36172\n', '0\n']
Note:
For the first test sample *dr*(5881) = *dr*(22) = 4.
For the second test sample *dr*(36172) = *dr*(19) = *dr*(10) = 1.
|
```python
k,d = map(int,input().split())
if k>1 and d==0:
print("No solution")
else:
print(d,end='')
for i in range(k-1):
print(0,end='')
```
| 3
|
|
785
|
A
|
Anton and Polyhedrons
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] | null | null |
Anton's favourite geometric figures are regular polyhedrons. Note that there are five kinds of regular polyhedrons:
- Tetrahedron. Tetrahedron has 4 triangular faces. - Cube. Cube has 6 square faces. - Octahedron. Octahedron has 8 triangular faces. - Dodecahedron. Dodecahedron has 12 pentagonal faces. - Icosahedron. Icosahedron has 20 triangular faces.
All five kinds of polyhedrons are shown on the picture below:
Anton has a collection of *n* polyhedrons. One day he decided to know, how many faces his polyhedrons have in total. Help Anton and find this number!
|
The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=200<=000) — the number of polyhedrons in Anton's collection.
Each of the following *n* lines of the input contains a string *s**i* — the name of the *i*-th polyhedron in Anton's collection. The string can look like this:
- "Tetrahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a tetrahedron. - "Cube" (without quotes), if the *i*-th polyhedron in Anton's collection is a cube. - "Octahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an octahedron. - "Dodecahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a dodecahedron. - "Icosahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an icosahedron.
|
Output one number — the total number of faces in all the polyhedrons in Anton's collection.
|
[
"4\nIcosahedron\nCube\nTetrahedron\nDodecahedron\n",
"3\nDodecahedron\nOctahedron\nOctahedron\n"
] |
[
"42\n",
"28\n"
] |
In the first sample Anton has one icosahedron, one cube, one tetrahedron and one dodecahedron. Icosahedron has 20 faces, cube has 6 faces, tetrahedron has 4 faces and dodecahedron has 12 faces. In total, they have 20 + 6 + 4 + 12 = 42 faces.
| 500
|
[
{
"input": "4\nIcosahedron\nCube\nTetrahedron\nDodecahedron",
"output": "42"
},
{
"input": "3\nDodecahedron\nOctahedron\nOctahedron",
"output": "28"
},
{
"input": "25\nIcosahedron\nOctahedron\nTetrahedron\nDodecahedron\nCube\nIcosahedron\nOctahedron\nCube\nTetrahedron\nIcosahedron\nIcosahedron\nTetrahedron\nOctahedron\nDodecahedron\nIcosahedron\nOctahedron\nIcosahedron\nTetrahedron\nDodecahedron\nTetrahedron\nOctahedron\nCube\nCube\nDodecahedron\nTetrahedron",
"output": "256"
},
{
"input": "1\nTetrahedron",
"output": "4"
},
{
"input": "1\nCube",
"output": "6"
},
{
"input": "1\nOctahedron",
"output": "8"
},
{
"input": "1\nDodecahedron",
"output": "12"
},
{
"input": "1\nIcosahedron",
"output": "20"
},
{
"input": "28\nOctahedron\nDodecahedron\nOctahedron\nOctahedron\nDodecahedron\nIcosahedron\nIcosahedron\nDodecahedron\nDodecahedron\nDodecahedron\nCube\nDodecahedron\nCube\nTetrahedron\nCube\nCube\nTetrahedron\nDodecahedron\nDodecahedron\nDodecahedron\nIcosahedron\nIcosahedron\nDodecahedron\nIcosahedron\nDodecahedron\nDodecahedron\nIcosahedron\nIcosahedron",
"output": "340"
}
] | 1,698,321,726
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 0
| 61
| 0
|
n = int(input())
polyhedrons = {
'Tetrahedron' : 5,
'Cube' : 6,
'Octahedron' : 8,
'Dodecahedron' : 12,
'Icosahedron' : 20,
}
faces = 0
for _ in range(n):
faces += polyhedrons[input()]
|
Title: Anton and Polyhedrons
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Anton's favourite geometric figures are regular polyhedrons. Note that there are five kinds of regular polyhedrons:
- Tetrahedron. Tetrahedron has 4 triangular faces. - Cube. Cube has 6 square faces. - Octahedron. Octahedron has 8 triangular faces. - Dodecahedron. Dodecahedron has 12 pentagonal faces. - Icosahedron. Icosahedron has 20 triangular faces.
All five kinds of polyhedrons are shown on the picture below:
Anton has a collection of *n* polyhedrons. One day he decided to know, how many faces his polyhedrons have in total. Help Anton and find this number!
Input Specification:
The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=200<=000) — the number of polyhedrons in Anton's collection.
Each of the following *n* lines of the input contains a string *s**i* — the name of the *i*-th polyhedron in Anton's collection. The string can look like this:
- "Tetrahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a tetrahedron. - "Cube" (without quotes), if the *i*-th polyhedron in Anton's collection is a cube. - "Octahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an octahedron. - "Dodecahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a dodecahedron. - "Icosahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an icosahedron.
Output Specification:
Output one number — the total number of faces in all the polyhedrons in Anton's collection.
Demo Input:
['4\nIcosahedron\nCube\nTetrahedron\nDodecahedron\n', '3\nDodecahedron\nOctahedron\nOctahedron\n']
Demo Output:
['42\n', '28\n']
Note:
In the first sample Anton has one icosahedron, one cube, one tetrahedron and one dodecahedron. Icosahedron has 20 faces, cube has 6 faces, tetrahedron has 4 faces and dodecahedron has 12 faces. In total, they have 20 + 6 + 4 + 12 = 42 faces.
|
```python
n = int(input())
polyhedrons = {
'Tetrahedron' : 5,
'Cube' : 6,
'Octahedron' : 8,
'Dodecahedron' : 12,
'Icosahedron' : 20,
}
faces = 0
for _ in range(n):
faces += polyhedrons[input()]
```
| 0
|
|
45
|
A
|
Codecraft III
|
PROGRAMMING
| 900
|
[
"implementation"
] |
A. Codecraft III
|
2
|
256
|
Today Vasya visited a widely known site and learned that the continuation of his favourite game Codecraft II will appear after exactly *k* months. He looked at the calendar and learned that at the moment is the month number *s*. Vasya immediately got interested in what month Codecraft III will appear. Help him understand that.
All the twelve months in Vasya's calendar are named using their usual English names: January, February, March, April, May, June, July, August, September, October, November, December.
|
The first input line contains the name of the current month. It is guaranteed that it is a proper English name of one of twelve months. The first letter is uppercase, the rest are lowercase. The second line contains integer *k* (0<=≤<=*k*<=≤<=100) — the number of months left till the appearance of Codecraft III.
|
Print starting from an uppercase letter the name of the month in which the continuation of Codeforces II will appear. The printed name must be contained in the list January, February, March, April, May, June, July, August, September, October, November, December.
|
[
"November\n3\n",
"May\n24\n"
] |
[
"February\n",
"May\n"
] |
none
| 0
|
[
{
"input": "November\n3",
"output": "February"
},
{
"input": "May\n24",
"output": "May"
},
{
"input": "April\n0",
"output": "April"
},
{
"input": "September\n0",
"output": "September"
},
{
"input": "August\n0",
"output": "August"
},
{
"input": "June\n1",
"output": "July"
},
{
"input": "July\n2",
"output": "September"
},
{
"input": "September\n3",
"output": "December"
},
{
"input": "July\n4",
"output": "November"
},
{
"input": "August\n24",
"output": "August"
},
{
"input": "May\n48",
"output": "May"
},
{
"input": "November\n47",
"output": "October"
},
{
"input": "December\n49",
"output": "January"
},
{
"input": "June\n99",
"output": "September"
},
{
"input": "March\n100",
"output": "July"
},
{
"input": "December\n1",
"output": "January"
},
{
"input": "January\n11",
"output": "December"
},
{
"input": "December\n0",
"output": "December"
},
{
"input": "January\n0",
"output": "January"
},
{
"input": "July\n77",
"output": "December"
},
{
"input": "February\n11",
"output": "January"
},
{
"input": "February\n22",
"output": "December"
},
{
"input": "July\n33",
"output": "April"
},
{
"input": "May\n44",
"output": "January"
},
{
"input": "June\n97",
"output": "July"
}
] | 1,639,037,707
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 12
| 92
| 0
|
m = input()
n = int(input())
now = 0
months = ['January', 'February', 'March', 'April', 'May', 'June',
'July', 'August', 'September', 'October', 'November', 'December']
now = months.index(m)
while n > 12:
n -= 12
sum = n + now
total = n + now
if total > 12:
total -= 12
print(months[total])
|
Title: Codecraft III
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Today Vasya visited a widely known site and learned that the continuation of his favourite game Codecraft II will appear after exactly *k* months. He looked at the calendar and learned that at the moment is the month number *s*. Vasya immediately got interested in what month Codecraft III will appear. Help him understand that.
All the twelve months in Vasya's calendar are named using their usual English names: January, February, March, April, May, June, July, August, September, October, November, December.
Input Specification:
The first input line contains the name of the current month. It is guaranteed that it is a proper English name of one of twelve months. The first letter is uppercase, the rest are lowercase. The second line contains integer *k* (0<=≤<=*k*<=≤<=100) — the number of months left till the appearance of Codecraft III.
Output Specification:
Print starting from an uppercase letter the name of the month in which the continuation of Codeforces II will appear. The printed name must be contained in the list January, February, March, April, May, June, July, August, September, October, November, December.
Demo Input:
['November\n3\n', 'May\n24\n']
Demo Output:
['February\n', 'May\n']
Note:
none
|
```python
m = input()
n = int(input())
now = 0
months = ['January', 'February', 'March', 'April', 'May', 'June',
'July', 'August', 'September', 'October', 'November', 'December']
now = months.index(m)
while n > 12:
n -= 12
sum = n + now
total = n + now
if total > 12:
total -= 12
print(months[total])
```
| -1
|
363
|
B
|
Fence
|
PROGRAMMING
| 1,100
|
[
"brute force",
"dp"
] | null | null |
There is a fence in front of Polycarpus's home. The fence consists of *n* planks of the same width which go one after another from left to right. The height of the *i*-th plank is *h**i* meters, distinct planks can have distinct heights.
Polycarpus has bought a posh piano and is thinking about how to get it into the house. In order to carry out his plan, he needs to take exactly *k* consecutive planks from the fence. Higher planks are harder to tear off the fence, so Polycarpus wants to find such *k* consecutive planks that the sum of their heights is minimal possible.
Write the program that finds the indexes of *k* consecutive planks with minimal total height. Pay attention, the fence is not around Polycarpus's home, it is in front of home (in other words, the fence isn't cyclic).
|
The first line of the input contains integers *n* and *k* (1<=≤<=*n*<=≤<=1.5·105,<=1<=≤<=*k*<=≤<=*n*) — the number of planks in the fence and the width of the hole for the piano. The second line contains the sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≤<=*h**i*<=≤<=100), where *h**i* is the height of the *i*-th plank of the fence.
|
Print such integer *j* that the sum of the heights of planks *j*, *j*<=+<=1, ..., *j*<=+<=*k*<=-<=1 is the minimum possible. If there are multiple such *j*'s, print any of them.
|
[
"7 3\n1 2 6 1 1 7 1\n"
] |
[
"3\n"
] |
In the sample, your task is to find three consecutive planks with the minimum sum of heights. In the given case three planks with indexes 3, 4 and 5 have the required attribute, their total height is 8.
| 1,000
|
[
{
"input": "7 3\n1 2 6 1 1 7 1",
"output": "3"
},
{
"input": "1 1\n100",
"output": "1"
},
{
"input": "2 1\n10 20",
"output": "1"
},
{
"input": "10 5\n1 2 3 1 2 2 3 1 4 5",
"output": "1"
},
{
"input": "10 2\n3 1 4 1 4 6 2 1 4 6",
"output": "7"
},
{
"input": "2 2\n20 10",
"output": "1"
},
{
"input": "2 1\n20 1",
"output": "2"
},
{
"input": "3 1\n1 2 3",
"output": "1"
},
{
"input": "3 1\n2 1 3",
"output": "2"
},
{
"input": "3 1\n3 2 1",
"output": "3"
},
{
"input": "3 2\n1 2 3",
"output": "1"
},
{
"input": "3 2\n3 2 1",
"output": "2"
},
{
"input": "3 3\n1 2 3",
"output": "1"
},
{
"input": "4 2\n9 8 11 7",
"output": "1"
},
{
"input": "4 2\n10 1 2 3",
"output": "2"
},
{
"input": "6 3\n56 56 56 2 1 2",
"output": "4"
},
{
"input": "8 3\n1 1 1 1 2 60 90 1",
"output": "1"
},
{
"input": "4 1\n1 5 2 2",
"output": "1"
},
{
"input": "4 2\n4 6 7 4",
"output": "1"
},
{
"input": "10 4\n1 1 1 4 4 4 4 4 4 3",
"output": "1"
},
{
"input": "6 3\n1 2 1 3 1 1",
"output": "1"
},
{
"input": "5 2\n100 100 100 1 1",
"output": "4"
}
] | 1,694,652,663
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 6
| 1,000
| 5,734,400
|
s=list(map(int,input().split(' ')))
n=s[0]
k=s[1]
h=list(map(int,input().split(' ')))
p=[]
for i in range(n-k+1):
sum=0
for j in range(i,i+k):
sum+=h[j]
p.append(sum)
print(p.index(min(p))+1)
|
Title: Fence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a fence in front of Polycarpus's home. The fence consists of *n* planks of the same width which go one after another from left to right. The height of the *i*-th plank is *h**i* meters, distinct planks can have distinct heights.
Polycarpus has bought a posh piano and is thinking about how to get it into the house. In order to carry out his plan, he needs to take exactly *k* consecutive planks from the fence. Higher planks are harder to tear off the fence, so Polycarpus wants to find such *k* consecutive planks that the sum of their heights is minimal possible.
Write the program that finds the indexes of *k* consecutive planks with minimal total height. Pay attention, the fence is not around Polycarpus's home, it is in front of home (in other words, the fence isn't cyclic).
Input Specification:
The first line of the input contains integers *n* and *k* (1<=≤<=*n*<=≤<=1.5·105,<=1<=≤<=*k*<=≤<=*n*) — the number of planks in the fence and the width of the hole for the piano. The second line contains the sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≤<=*h**i*<=≤<=100), where *h**i* is the height of the *i*-th plank of the fence.
Output Specification:
Print such integer *j* that the sum of the heights of planks *j*, *j*<=+<=1, ..., *j*<=+<=*k*<=-<=1 is the minimum possible. If there are multiple such *j*'s, print any of them.
Demo Input:
['7 3\n1 2 6 1 1 7 1\n']
Demo Output:
['3\n']
Note:
In the sample, your task is to find three consecutive planks with the minimum sum of heights. In the given case three planks with indexes 3, 4 and 5 have the required attribute, their total height is 8.
|
```python
s=list(map(int,input().split(' ')))
n=s[0]
k=s[1]
h=list(map(int,input().split(' ')))
p=[]
for i in range(n-k+1):
sum=0
for j in range(i,i+k):
sum+=h[j]
p.append(sum)
print(p.index(min(p))+1)
```
| 0
|
|
863
|
A
|
Quasi-palindrome
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation"
] | null | null |
Let quasi-palindromic number be such number that adding some leading zeros (possible none) to it produces a palindromic string.
String *t* is called a palindrome, if it reads the same from left to right and from right to left.
For example, numbers 131 and 2010200 are quasi-palindromic, they can be transformed to strings "131" and "002010200", respectively, which are palindromes.
You are given some integer number *x*. Check if it's a quasi-palindromic number.
|
The first line contains one integer number *x* (1<=≤<=*x*<=≤<=109). This number is given without any leading zeroes.
|
Print "YES" if number *x* is quasi-palindromic. Otherwise, print "NO" (without quotes).
|
[
"131\n",
"320\n",
"2010200\n"
] |
[
"YES\n",
"NO\n",
"YES\n"
] |
none
| 0
|
[
{
"input": "131",
"output": "YES"
},
{
"input": "320",
"output": "NO"
},
{
"input": "2010200",
"output": "YES"
},
{
"input": "1",
"output": "YES"
},
{
"input": "1000000000",
"output": "YES"
},
{
"input": "999999999",
"output": "YES"
},
{
"input": "999999998",
"output": "NO"
},
{
"input": "102000",
"output": "NO"
},
{
"input": "210000000",
"output": "NO"
},
{
"input": "213443120",
"output": "YES"
},
{
"input": "99",
"output": "YES"
},
{
"input": "22002",
"output": "NO"
},
{
"input": "1010",
"output": "YES"
},
{
"input": "1201",
"output": "NO"
},
{
"input": "6460046",
"output": "NO"
},
{
"input": "503435",
"output": "NO"
},
{
"input": "21002",
"output": "NO"
},
{
"input": "101001",
"output": "NO"
},
{
"input": "200102",
"output": "NO"
},
{
"input": "20010002",
"output": "NO"
},
{
"input": "33003",
"output": "NO"
},
{
"input": "100101",
"output": "NO"
},
{
"input": "1021",
"output": "NO"
},
{
"input": "1101",
"output": "NO"
},
{
"input": "10101100",
"output": "NO"
},
{
"input": "101",
"output": "YES"
},
{
"input": "1011",
"output": "NO"
},
{
"input": "11010",
"output": "NO"
},
{
"input": "10110",
"output": "NO"
},
{
"input": "110000",
"output": "YES"
},
{
"input": "2011",
"output": "NO"
},
{
"input": "10020001",
"output": "NO"
},
{
"input": "12505021",
"output": "NO"
},
{
"input": "12310",
"output": "NO"
},
{
"input": "100501",
"output": "NO"
},
{
"input": "11001",
"output": "NO"
},
{
"input": "20020002",
"output": "NO"
},
{
"input": "202002",
"output": "NO"
},
{
"input": "1001",
"output": "YES"
},
{
"input": "1020021",
"output": "NO"
},
{
"input": "60660",
"output": "NO"
},
{
"input": "98809",
"output": "NO"
},
{
"input": "11000000",
"output": "YES"
},
{
"input": "807008",
"output": "NO"
}
] | 1,672,288,041
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 11
| 46
| 0
|
a = list(input())
for i in range(a.count('0')):
a.remove('0')
if a[::-1] == a:
print("YES")
else:
print("NO")
|
Title: Quasi-palindrome
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let quasi-palindromic number be such number that adding some leading zeros (possible none) to it produces a palindromic string.
String *t* is called a palindrome, if it reads the same from left to right and from right to left.
For example, numbers 131 and 2010200 are quasi-palindromic, they can be transformed to strings "131" and "002010200", respectively, which are palindromes.
You are given some integer number *x*. Check if it's a quasi-palindromic number.
Input Specification:
The first line contains one integer number *x* (1<=≤<=*x*<=≤<=109). This number is given without any leading zeroes.
Output Specification:
Print "YES" if number *x* is quasi-palindromic. Otherwise, print "NO" (without quotes).
Demo Input:
['131\n', '320\n', '2010200\n']
Demo Output:
['YES\n', 'NO\n', 'YES\n']
Note:
none
|
```python
a = list(input())
for i in range(a.count('0')):
a.remove('0')
if a[::-1] == a:
print("YES")
else:
print("NO")
```
| 0
|
|
49
|
B
|
Sum
|
PROGRAMMING
| 1,500
|
[
"math"
] |
B. Sum
|
2
|
256
|
Vasya studies positional numeral systems. Unfortunately, he often forgets to write the base of notation in which the expression is written. Once he saw a note in his notebook saying *a*<=+<=*b*<==<=?, and that the base of the positional notation wasn’t written anywhere. Now Vasya has to choose a base *p* and regard the expression as written in the base *p* positional notation. Vasya understood that he can get different results with different bases, and some bases are even invalid. For example, expression 78<=+<=87 in the base 16 positional notation is equal to *FF*16, in the base 15 positional notation it is equal to 11015, in the base 10 one — to 16510, in the base 9 one — to 1769, and in the base 8 or lesser-based positional notations the expression is invalid as all the numbers should be strictly less than the positional notation base. Vasya got interested in what is the length of the longest possible expression value. Help him to find this length.
The length of a number should be understood as the number of numeric characters in it. For example, the length of the longest answer for 78<=+<=87<==<=? is 3. It is calculated like that in the base 15 (11015), base 10 (16510), base 9 (1769) positional notations, for example, and in some other ones.
|
The first letter contains two space-separated numbers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=1000) which represent the given summands.
|
Print a single number — the length of the longest answer.
|
[
"78 87\n",
"1 1\n"
] |
[
"3\n",
"2\n"
] |
none
| 1,000
|
[
{
"input": "78 87",
"output": "3"
},
{
"input": "1 1",
"output": "2"
},
{
"input": "9 7",
"output": "2"
},
{
"input": "11 11",
"output": "3"
},
{
"input": "43 21",
"output": "3"
},
{
"input": "84 89",
"output": "3"
},
{
"input": "12 34",
"output": "3"
},
{
"input": "99 11",
"output": "3"
},
{
"input": "11 99",
"output": "3"
},
{
"input": "99 99",
"output": "3"
},
{
"input": "1 2",
"output": "2"
},
{
"input": "1 3",
"output": "2"
},
{
"input": "2 1",
"output": "2"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "2 3",
"output": "2"
},
{
"input": "3 1",
"output": "2"
},
{
"input": "3 2",
"output": "2"
},
{
"input": "3 3",
"output": "2"
},
{
"input": "1 466",
"output": "3"
},
{
"input": "1 1000",
"output": "4"
},
{
"input": "1 999",
"output": "4"
},
{
"input": "149 1",
"output": "3"
},
{
"input": "999 1",
"output": "4"
},
{
"input": "1000 1",
"output": "4"
},
{
"input": "998 998",
"output": "4"
},
{
"input": "998 999",
"output": "4"
},
{
"input": "998 1000",
"output": "4"
},
{
"input": "999 998",
"output": "4"
},
{
"input": "999 999",
"output": "4"
},
{
"input": "999 1000",
"output": "4"
},
{
"input": "1000 998",
"output": "4"
},
{
"input": "1000 999",
"output": "4"
},
{
"input": "1000 1000",
"output": "5"
},
{
"input": "1000 539",
"output": "4"
},
{
"input": "999 619",
"output": "4"
},
{
"input": "2 511",
"output": "3"
},
{
"input": "877 2",
"output": "3"
},
{
"input": "379 999",
"output": "4"
},
{
"input": "247 1000",
"output": "4"
},
{
"input": "555 555",
"output": "4"
},
{
"input": "208 997",
"output": "4"
},
{
"input": "633 581",
"output": "4"
},
{
"input": "411 517",
"output": "4"
},
{
"input": "836 101",
"output": "4"
},
{
"input": "262 685",
"output": "4"
},
{
"input": "39 269",
"output": "3"
},
{
"input": "464 205",
"output": "4"
},
{
"input": "890 789",
"output": "4"
},
{
"input": "667 373",
"output": "4"
},
{
"input": "840 975",
"output": "4"
},
{
"input": "810 413",
"output": "4"
},
{
"input": "133 851",
"output": "4"
},
{
"input": "104 938",
"output": "4"
},
{
"input": "427 376",
"output": "4"
},
{
"input": "398 815",
"output": "4"
},
{
"input": "721 253",
"output": "4"
},
{
"input": "692 339",
"output": "4"
},
{
"input": "15 778",
"output": "3"
},
{
"input": "986 216",
"output": "4"
},
{
"input": "450 277",
"output": "3"
},
{
"input": "333 1",
"output": "4"
},
{
"input": "499 499",
"output": "3"
},
{
"input": "79 1",
"output": "2"
},
{
"input": "87 1",
"output": "2"
},
{
"input": "47 8",
"output": "2"
},
{
"input": "87 8",
"output": "3"
},
{
"input": "1 11",
"output": "3"
}
] | 1,679,148,865
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 67
| 92
| 0
|
import math
# For some reason, wrong answer... F*CKING EPSILON log(1000, 10) = 2.9999999...
# Intuition: The lowest base will produce the longest number
EPSILON = 0.00000001
a, b = [int(i) for i in input().split()]
# Assuming no wacky letters
def highest_digit(number):
return max([int(c) for c in str(number)])
def length_in_base(number, base):
if number == 0:
return 1
# SCREW YOU EPSILON
return math.floor(math.log(number, base) + 1 + EPSILON)
def solve_problem(a, b):
highest = max(highest_digit(a), highest_digit(b))
base_to_be_used = highest + 1
a_in_base = int(str(a), base_to_be_used)
b_in_base = int(str(b), base_to_be_used)
the_sum = a_in_base + b_in_base
length = length_in_base(the_sum, base_to_be_used)
return length
answer = solve_problem(a, b)
print(answer)
'''
# Brute Force 1000 x 1000 == 1000000
first_list = []
for a in range(1, 1000):
for b in range(1, 1000):
first_list.append(solve_problem(a, b))
import numpy
def solve2(a, b):
B = max([int(c) for c in (str(a)+str(b))]) + 1
#a_in_base = numpy.base_repr(a, B)
#b_in_base = numpy.base_repr(b, B)
a_val = int(str(a), B)
b_val = int(str(b), B)
the_sum = a_val + b_val
the_sum_in_base = numpy.base_repr(the_sum, B)
return len(the_sum_in_base)
second_list = []
for a in range(1, 1000):
for b in range(1, 1000):
second_list.append(solve2(a, b))
print(first_list == second_list)
# Good idea, but fails because "all the numbers should be strictly less than the positional notation base."
#if set(str(a)) == {'1'} and set(str(b)) == {'1'}:
# print(len(str(a)) + len(str(b)))
#else:
# print(answer)
'''
|
Title: Sum
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya studies positional numeral systems. Unfortunately, he often forgets to write the base of notation in which the expression is written. Once he saw a note in his notebook saying *a*<=+<=*b*<==<=?, and that the base of the positional notation wasn’t written anywhere. Now Vasya has to choose a base *p* and regard the expression as written in the base *p* positional notation. Vasya understood that he can get different results with different bases, and some bases are even invalid. For example, expression 78<=+<=87 in the base 16 positional notation is equal to *FF*16, in the base 15 positional notation it is equal to 11015, in the base 10 one — to 16510, in the base 9 one — to 1769, and in the base 8 or lesser-based positional notations the expression is invalid as all the numbers should be strictly less than the positional notation base. Vasya got interested in what is the length of the longest possible expression value. Help him to find this length.
The length of a number should be understood as the number of numeric characters in it. For example, the length of the longest answer for 78<=+<=87<==<=? is 3. It is calculated like that in the base 15 (11015), base 10 (16510), base 9 (1769) positional notations, for example, and in some other ones.
Input Specification:
The first letter contains two space-separated numbers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=1000) which represent the given summands.
Output Specification:
Print a single number — the length of the longest answer.
Demo Input:
['78 87\n', '1 1\n']
Demo Output:
['3\n', '2\n']
Note:
none
|
```python
import math
# For some reason, wrong answer... F*CKING EPSILON log(1000, 10) = 2.9999999...
# Intuition: The lowest base will produce the longest number
EPSILON = 0.00000001
a, b = [int(i) for i in input().split()]
# Assuming no wacky letters
def highest_digit(number):
return max([int(c) for c in str(number)])
def length_in_base(number, base):
if number == 0:
return 1
# SCREW YOU EPSILON
return math.floor(math.log(number, base) + 1 + EPSILON)
def solve_problem(a, b):
highest = max(highest_digit(a), highest_digit(b))
base_to_be_used = highest + 1
a_in_base = int(str(a), base_to_be_used)
b_in_base = int(str(b), base_to_be_used)
the_sum = a_in_base + b_in_base
length = length_in_base(the_sum, base_to_be_used)
return length
answer = solve_problem(a, b)
print(answer)
'''
# Brute Force 1000 x 1000 == 1000000
first_list = []
for a in range(1, 1000):
for b in range(1, 1000):
first_list.append(solve_problem(a, b))
import numpy
def solve2(a, b):
B = max([int(c) for c in (str(a)+str(b))]) + 1
#a_in_base = numpy.base_repr(a, B)
#b_in_base = numpy.base_repr(b, B)
a_val = int(str(a), B)
b_val = int(str(b), B)
the_sum = a_val + b_val
the_sum_in_base = numpy.base_repr(the_sum, B)
return len(the_sum_in_base)
second_list = []
for a in range(1, 1000):
for b in range(1, 1000):
second_list.append(solve2(a, b))
print(first_list == second_list)
# Good idea, but fails because "all the numbers should be strictly less than the positional notation base."
#if set(str(a)) == {'1'} and set(str(b)) == {'1'}:
# print(len(str(a)) + len(str(b)))
#else:
# print(answer)
'''
```
| 3.977
|
4
|
A
|
Watermelon
|
PROGRAMMING
| 800
|
[
"brute force",
"math"
] |
A. Watermelon
|
1
|
64
|
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight.
|
The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys.
|
Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case.
|
[
"8\n"
] |
[
"YES\n"
] |
For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos).
| 0
|
[
{
"input": "8",
"output": "YES"
},
{
"input": "5",
"output": "NO"
},
{
"input": "4",
"output": "YES"
},
{
"input": "3",
"output": "NO"
},
{
"input": "2",
"output": "NO"
},
{
"input": "1",
"output": "NO"
},
{
"input": "7",
"output": "NO"
},
{
"input": "6",
"output": "YES"
},
{
"input": "10",
"output": "YES"
},
{
"input": "9",
"output": "NO"
},
{
"input": "53",
"output": "NO"
},
{
"input": "77",
"output": "NO"
},
{
"input": "32",
"output": "YES"
},
{
"input": "44",
"output": "YES"
},
{
"input": "98",
"output": "YES"
},
{
"input": "99",
"output": "NO"
},
{
"input": "90",
"output": "YES"
},
{
"input": "67",
"output": "NO"
},
{
"input": "100",
"output": "YES"
},
{
"input": "88",
"output": "YES"
}
] | 1,690,867,651
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 7
| 62
| 0
|
n=int(input())
if abs((n/2)%2)==0:
print("YES")
else:
print("NO")
|
Title: Watermelon
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight.
Input Specification:
The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys.
Output Specification:
Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case.
Demo Input:
['8\n']
Demo Output:
['YES\n']
Note:
For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos).
|
```python
n=int(input())
if abs((n/2)%2)==0:
print("YES")
else:
print("NO")
```
| 0
|
639
|
C
|
Bear and Polynomials
|
PROGRAMMING
| 2,200
|
[
"hashing",
"implementation",
"math"
] | null | null |
Limak is a little polar bear. He doesn't have many toys and thus he often plays with polynomials.
He considers a polynomial valid if its degree is *n* and its coefficients are integers not exceeding *k* by the absolute value. More formally:
Let *a*0,<=*a*1,<=...,<=*a**n* denote the coefficients, so . Then, a polynomial *P*(*x*) is valid if all the following conditions are satisfied:
- *a**i* is integer for every *i*; - |*a**i*|<=≤<=*k* for every *i*; - *a**n*<=≠<=0.
Limak has recently got a valid polynomial *P* with coefficients *a*0,<=*a*1,<=*a*2,<=...,<=*a**n*. He noticed that *P*(2)<=≠<=0 and he wants to change it. He is going to change one coefficient to get a valid polynomial *Q* of degree *n* that *Q*(2)<==<=0. Count the number of ways to do so. You should count two ways as a distinct if coefficients of target polynoms differ.
|
The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=200<=000,<=1<=≤<=*k*<=≤<=109) — the degree of the polynomial and the limit for absolute values of coefficients.
The second line contains *n*<=+<=1 integers *a*0,<=*a*1,<=...,<=*a**n* (|*a**i*|<=≤<=*k*,<=*a**n*<=≠<=0) — describing a valid polynomial . It's guaranteed that *P*(2)<=≠<=0.
|
Print the number of ways to change one coefficient to get a valid polynomial *Q* that *Q*(2)<==<=0.
|
[
"3 1000000000\n10 -9 -3 5\n",
"3 12\n10 -9 -3 5\n",
"2 20\n14 -7 19\n"
] |
[
"3\n",
"2\n",
"0\n"
] |
In the first sample, we are given a polynomial *P*(*x*) = 10 - 9*x* - 3*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup>.
Limak can change one coefficient in three ways:
1. He can set *a*<sub class="lower-index">0</sub> = - 10. Then he would get *Q*(*x*) = - 10 - 9*x* - 3*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup> and indeed *Q*(2) = - 10 - 18 - 12 + 40 = 0. 1. Or he can set *a*<sub class="lower-index">2</sub> = - 8. Then *Q*(*x*) = 10 - 9*x* - 8*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup> and indeed *Q*(2) = 10 - 18 - 32 + 40 = 0. 1. Or he can set *a*<sub class="lower-index">1</sub> = - 19. Then *Q*(*x*) = 10 - 19*x* - 3*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup> and indeed *Q*(2) = 10 - 38 - 12 + 40 = 0.
In the second sample, we are given the same polynomial. This time though, *k* is equal to 12 instead of 10<sup class="upper-index">9</sup>. Two first of ways listed above are still valid but in the third way we would get |*a*<sub class="lower-index">1</sub>| > *k* what is not allowed. Thus, the answer is 2 this time.
| 1,000
|
[
{
"input": "3 1000000000\n10 -9 -3 5",
"output": "3"
},
{
"input": "3 12\n10 -9 -3 5",
"output": "2"
},
{
"input": "2 20\n14 -7 19",
"output": "0"
},
{
"input": "5 5\n0 -4 -2 -2 0 5",
"output": "1"
},
{
"input": "6 10\n-2 -1 7 -3 2 7 -6",
"output": "2"
},
{
"input": "7 100\n2 21 11 45 58 85 -59 38",
"output": "1"
},
{
"input": "100 1000\n-62 57 -27 -67 49 -10 66 -64 -36 -78 62 -75 -39 75 -47 -36 41 -88 62 -43 22 29 -20 58 40 16 71 -2 -87 12 86 -90 -92 67 -12 -48 -10 -26 78 68 22 -3 66 -95 -81 34 14 -76 -27 76 -60 87 -84 3 35 -60 46 -65 29 -29 2 -44 -55 18 -75 91 36 34 -86 53 59 -54 -29 33 -95 66 9 72 67 -44 37 44 32 -52 -34 -4 -99 58 7 -22 -53 11 10 10 -25 -100 -95 -27 43 -46 25",
"output": "10"
},
{
"input": "1 5\n5 -3",
"output": "0"
},
{
"input": "1 10\n-6 2",
"output": "2"
},
{
"input": "5 10000\n-160 3408 -4620 5869 7434 -6253",
"output": "1"
},
{
"input": "10 1\n0 0 0 0 0 0 0 0 0 0 1",
"output": "0"
},
{
"input": "10 1\n0 0 1 -1 1 0 0 1 1 -1 -1",
"output": "0"
},
{
"input": "10 2\n-2 -2 1 2 -1 -2 1 -2 1 2 -1",
"output": "2"
},
{
"input": "20 100\n52 -82 36 90 -62 -35 -93 -98 -80 -40 29 8 43 26 35 55 -56 -99 -17 13 11",
"output": "1"
},
{
"input": "90 10\n-4 2 2 5 -1 3 4 1 -2 10 -9 -2 -4 3 8 0 -8 -3 9 1 2 4 8 2 0 2 -10 4 -4 -6 2 -9 3 -9 -3 8 8 9 -7 -10 3 9 -2 -7 5 -7 -5 6 1 5 1 -8 3 8 0 -6 2 2 3 -10 2 1 4 8 -3 1 5 7 -7 -3 2 -2 -9 7 7 -2 7 -6 7 -3 2 -5 10 0 0 9 -1 -4 1 -8 4",
"output": "4"
},
{
"input": "101 20\n4 16 -5 8 -13 -6 -19 -4 18 9 -5 5 3 13 -12 -2 -1 -4 -13 14 2 15 -11 -17 -15 6 9 -15 -10 16 18 -7 8 -19 17 11 -6 -5 -16 -7 -14 5 -17 -6 18 19 -14 -5 1 11 -17 18 4 9 -1 19 1 8 9 -14 11 -8 -18 -12 15 14 -8 0 8 16 2 -20 -19 17 14 -2 3 -9 -13 4 6 -16 3 -12 19 -14 -8 -16 7 -4 5 9 17 7 -3 -15 6 18 -13 10 -8 2",
"output": "1"
},
{
"input": "10 1000\n-538 -553 -281 -270 209 -989 -418 486 330 725 -430",
"output": "1"
},
{
"input": "30 1000\n622 815 -733 -613 -741 571 -761 -432 -7 201 554 730 607 415 -453 820 161 147 406 875 -413 462 998 481 698 661 18 -331 752 -232 -72",
"output": "2"
},
{
"input": "5 2000000\n1038520 -406162 -106421 106958 -807010 850753",
"output": "2"
},
{
"input": "10 1000000000\n-857095622 -567296277 -923645190 -246044525 610990226 -617677619 -239569893 355377587 222686442 250110001 -200293692",
"output": "2"
},
{
"input": "20 1000000000\n-924490890 231431639 -579465017 -690485236 173663728 144784457 364609617 444830562 48833250 1095623 333652904 -901650010 -850265945 844112020 -9178988 -527869441 93581840 607677914 -521131467 -628140952 329057708",
"output": "3"
},
{
"input": "2 2\n1 1 -1",
"output": "1"
},
{
"input": "2 2\n1 1 -1",
"output": "1"
},
{
"input": "2 2\n-1 0 -2",
"output": "0"
},
{
"input": "2 2\n-1 -1 1",
"output": "1"
},
{
"input": "2 2\n1 1 -2",
"output": "0"
},
{
"input": "3 2\n2 -1 -1 1",
"output": "2"
},
{
"input": "35 1000000000\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 536870912",
"output": "0"
},
{
"input": "35 1000000000\n-1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 536870912",
"output": "0"
},
{
"input": "35 1000000000\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -536870912",
"output": "0"
},
{
"input": "35 1000000000\n-1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -536870912",
"output": "0"
},
{
"input": "32 1000000000\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 536870912",
"output": "0"
},
{
"input": "32 1000000000\n-1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 536870912",
"output": "0"
},
{
"input": "32 1000000000\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -536870912",
"output": "0"
},
{
"input": "32 1000000000\n-1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -536870912",
"output": "0"
},
{
"input": "55 1000000000\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 536870912",
"output": "0"
},
{
"input": "55 1000000000\n-1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 536870912",
"output": "0"
},
{
"input": "69 1000000000\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -536870912",
"output": "0"
},
{
"input": "69 1000000000\n-1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -536870912",
"output": "0"
},
{
"input": "61 10\n0 1 0 0 1 1 0 0 0 1 1 1 0 1 0 1 0 1 0 0 0 0 1 0 0 0 0 0 0 1 0 1 1 0 0 1 0 1 0 0 1 1 1 0 1 0 1 0 1 0 1 0 0 1 0 1 1 0 0 1 0 1",
"output": "0"
},
{
"input": "2 10\n1 -2 1",
"output": "1"
},
{
"input": "65 1\n-1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 -1",
"output": "0"
}
] | 1,459,189,301
| 6,400
|
PyPy 3
|
WRONG_ANSWER
|
PRETESTS
| 2
| 93
| 23,040,000
|
def main():
n, k = map(int, input().split())
a = list(map(int, input().split()))
#a = [10 ** 9 for i in range(n)]
sumb = 0
for i in range(n + 1):
sumb += a[i] << i
cop = sumb
last = 0
while (not (cop & 1)):
cop >>= 1
last += 1
answer, st = 0, 1
for i in range(last + 1):
d = (sumb >> i) - a[i]
if (abs(d) <= k):
answer += 1
if (last == n):
if (not(i == n and d == 0)):
answer += 1
print(answer)
main()
|
Title: Bear and Polynomials
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Limak is a little polar bear. He doesn't have many toys and thus he often plays with polynomials.
He considers a polynomial valid if its degree is *n* and its coefficients are integers not exceeding *k* by the absolute value. More formally:
Let *a*0,<=*a*1,<=...,<=*a**n* denote the coefficients, so . Then, a polynomial *P*(*x*) is valid if all the following conditions are satisfied:
- *a**i* is integer for every *i*; - |*a**i*|<=≤<=*k* for every *i*; - *a**n*<=≠<=0.
Limak has recently got a valid polynomial *P* with coefficients *a*0,<=*a*1,<=*a*2,<=...,<=*a**n*. He noticed that *P*(2)<=≠<=0 and he wants to change it. He is going to change one coefficient to get a valid polynomial *Q* of degree *n* that *Q*(2)<==<=0. Count the number of ways to do so. You should count two ways as a distinct if coefficients of target polynoms differ.
Input Specification:
The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=200<=000,<=1<=≤<=*k*<=≤<=109) — the degree of the polynomial and the limit for absolute values of coefficients.
The second line contains *n*<=+<=1 integers *a*0,<=*a*1,<=...,<=*a**n* (|*a**i*|<=≤<=*k*,<=*a**n*<=≠<=0) — describing a valid polynomial . It's guaranteed that *P*(2)<=≠<=0.
Output Specification:
Print the number of ways to change one coefficient to get a valid polynomial *Q* that *Q*(2)<==<=0.
Demo Input:
['3 1000000000\n10 -9 -3 5\n', '3 12\n10 -9 -3 5\n', '2 20\n14 -7 19\n']
Demo Output:
['3\n', '2\n', '0\n']
Note:
In the first sample, we are given a polynomial *P*(*x*) = 10 - 9*x* - 3*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup>.
Limak can change one coefficient in three ways:
1. He can set *a*<sub class="lower-index">0</sub> = - 10. Then he would get *Q*(*x*) = - 10 - 9*x* - 3*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup> and indeed *Q*(2) = - 10 - 18 - 12 + 40 = 0. 1. Or he can set *a*<sub class="lower-index">2</sub> = - 8. Then *Q*(*x*) = 10 - 9*x* - 8*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup> and indeed *Q*(2) = 10 - 18 - 32 + 40 = 0. 1. Or he can set *a*<sub class="lower-index">1</sub> = - 19. Then *Q*(*x*) = 10 - 19*x* - 3*x*<sup class="upper-index">2</sup> + 5*x*<sup class="upper-index">3</sup> and indeed *Q*(2) = 10 - 38 - 12 + 40 = 0.
In the second sample, we are given the same polynomial. This time though, *k* is equal to 12 instead of 10<sup class="upper-index">9</sup>. Two first of ways listed above are still valid but in the third way we would get |*a*<sub class="lower-index">1</sub>| > *k* what is not allowed. Thus, the answer is 2 this time.
|
```python
def main():
n, k = map(int, input().split())
a = list(map(int, input().split()))
#a = [10 ** 9 for i in range(n)]
sumb = 0
for i in range(n + 1):
sumb += a[i] << i
cop = sumb
last = 0
while (not (cop & 1)):
cop >>= 1
last += 1
answer, st = 0, 1
for i in range(last + 1):
d = (sumb >> i) - a[i]
if (abs(d) <= k):
answer += 1
if (last == n):
if (not(i == n and d == 0)):
answer += 1
print(answer)
main()
```
| 0
|
|
371
|
C
|
Hamburgers
|
PROGRAMMING
| 1,600
|
[
"binary search",
"brute force"
] | null | null |
Polycarpus loves hamburgers very much. He especially adores the hamburgers he makes with his own hands. Polycarpus thinks that there are only three decent ingredients to make hamburgers from: a bread, sausage and cheese. He writes down the recipe of his favorite "Le Hamburger de Polycarpus" as a string of letters 'B' (bread), 'S' (sausage) и 'C' (cheese). The ingredients in the recipe go from bottom to top, for example, recipe "ВSCBS" represents the hamburger where the ingredients go from bottom to top as bread, sausage, cheese, bread and sausage again.
Polycarpus has *n**b* pieces of bread, *n**s* pieces of sausage and *n**c* pieces of cheese in the kitchen. Besides, the shop nearby has all three ingredients, the prices are *p**b* rubles for a piece of bread, *p**s* for a piece of sausage and *p**c* for a piece of cheese.
Polycarpus has *r* rubles and he is ready to shop on them. What maximum number of hamburgers can he cook? You can assume that Polycarpus cannot break or slice any of the pieces of bread, sausage or cheese. Besides, the shop has an unlimited number of pieces of each ingredient.
|
The first line of the input contains a non-empty string that describes the recipe of "Le Hamburger de Polycarpus". The length of the string doesn't exceed 100, the string contains only letters 'B' (uppercase English B), 'S' (uppercase English S) and 'C' (uppercase English C).
The second line contains three integers *n**b*, *n**s*, *n**c* (1<=≤<=*n**b*,<=*n**s*,<=*n**c*<=≤<=100) — the number of the pieces of bread, sausage and cheese on Polycarpus' kitchen. The third line contains three integers *p**b*, *p**s*, *p**c* (1<=≤<=*p**b*,<=*p**s*,<=*p**c*<=≤<=100) — the price of one piece of bread, sausage and cheese in the shop. Finally, the fourth line contains integer *r* (1<=≤<=*r*<=≤<=1012) — the number of rubles Polycarpus has.
Please, do not write the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
|
Print the maximum number of hamburgers Polycarpus can make. If he can't make any hamburger, print 0.
|
[
"BBBSSC\n6 4 1\n1 2 3\n4\n",
"BBC\n1 10 1\n1 10 1\n21\n",
"BSC\n1 1 1\n1 1 3\n1000000000000\n"
] |
[
"2\n",
"7\n",
"200000000001\n"
] |
none
| 1,500
|
[
{
"input": "BBBSSC\n6 4 1\n1 2 3\n4",
"output": "2"
},
{
"input": "BBC\n1 10 1\n1 10 1\n21",
"output": "7"
},
{
"input": "BSC\n1 1 1\n1 1 3\n1000000000000",
"output": "200000000001"
},
{
"input": "B\n1 1 1\n1 1 1\n381",
"output": "382"
},
{
"input": "BSC\n3 5 6\n7 3 9\n100",
"output": "10"
},
{
"input": "BSC\n100 1 1\n100 1 1\n100",
"output": "51"
},
{
"input": "SBBCCSBB\n1 50 100\n31 59 21\n100000",
"output": "370"
},
{
"input": "BBBBCCCCCCCCCCCCCCCCCCCCSSSSBBBBBBBBSS\n100 100 100\n1 1 1\n3628800",
"output": "95502"
},
{
"input": "BBBBBBBBBBCCCCCCCCCCCCCCCCCCCCSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\n10 20 40\n100 100 100\n200",
"output": "0"
},
{
"input": "BBBBBBBBBBCCCCCCCCCCCCCCCCCCCCSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\n10 20 40\n100 100 100\n2000",
"output": "1"
},
{
"input": "BBBBBBBBBBCCCCCCCCCCCCCCCCCCCCSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\n10 20 40\n100 100 100\n300",
"output": "0"
},
{
"input": "BBBBBBBBBBCCCCCCCCCCCCCCCCCCCCSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\n10 20 40\n100 100 100\n300000000",
"output": "42858"
},
{
"input": "BBBBBBBBBBCCCCCCCCCCCCCCCCCCCCSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\n10 20 40\n100 100 100\n914159265358",
"output": "130594181"
},
{
"input": "SSSSSSSSSSBBBBBBBBBCCCCCCCCCCCCCCCCCCCSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSBB\n31 53 97\n13 17 31\n914159265358",
"output": "647421579"
},
{
"input": "BBBCSBSBBSSSSCCCCBBCSBBBBSSBBBCBSCCSSCSSCSBSSSCCCCBSCSSBSSSCCCBBCCCSCBCBBCCSCCCCSBBCCBBBBCCCCCCBSSCB\n91 87 17\n64 44 43\n958532915587",
"output": "191668251"
},
{
"input": "CSSCBBCCCSBSCBBBCSBBBCBSBCSCBCSCBCBSBCBCSSBBSBBCBBBBSCSBBCCBCCBCBBSBSBCSCSBBSSBBCSSBCSCSCCSSBCBBCBSB\n56 34 48\n78 6 96\n904174875419",
"output": "140968956"
},
{
"input": "CCSCCCSBBBSCBSCSCCSSBBBSSBBBSBBBCBCSSBCSCBBCCCBCBCBCCCSSBSBBCCCCCBBSCBSCBCBBCBBCSSBCSBSSCCSCCSCCBBBS\n33 73 67\n4 56 42\n886653164314",
"output": "277425898"
},
{
"input": "SBCSSCBBSSBCSSBBBSSBSCBSSSCBBSBBBBCSBCSBSCBSCBSCBSBSSCCCCBSBCCBCBSCCCBSCCBSBBCBSSCCCCSBSBBBSSSBCSCBC\n94 16 85\n14 18 91\n836590091442",
"output": "217522127"
},
{
"input": "BSCSBSCCSCSSCCCSBCSSBCBBSCCBSCCSSSSSSSSSCCSBSCCBBCBBSBSCCCCBCSBSBSSBBBBBSSBSSCBCCSSBSSSCBBCSBBSBCCCB\n67 54 8\n36 73 37\n782232051273",
"output": "154164772"
},
{
"input": "CBBCBSBCCSCBSSCCBCSBCSBBSCBBCSCCBSCCSCSBBSSBSBSCBBSBBCSSSSBBBBSBBCBCSBBCBCSSBBCSBSCCSCSBCSCBSCCBBCSC\n71 71 52\n52 88 3\n654400055575",
"output": "137826467"
},
{
"input": "CBBCBSBCCSCBSSCCBCSBCSBBSCBBCSCCBSCCSCSBBSBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBCBBCSC\n100 1 1\n1 17 23\n954400055575",
"output": "1355681897"
},
{
"input": "C\n100 100 100\n1 1 1\n1000000000000",
"output": "1000000000100"
},
{
"input": "SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS\n100 100 100\n100 100 100\n1000000000000",
"output": "100000001"
},
{
"input": "B\n100 100 100\n1 1 1\n1",
"output": "101"
},
{
"input": "SC\n2 1 1\n1 1 1\n100000000000",
"output": "50000000001"
},
{
"input": "B\n100 1 1\n1 1 1\n1000000000000",
"output": "1000000000100"
},
{
"input": "BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\n1 1 1\n100 100 100\n1000000000000",
"output": "100000000"
},
{
"input": "CC\n1 1 1\n100 100 100\n1",
"output": "0"
},
{
"input": "B\n100 100 100\n1 1 1\n1000000000000",
"output": "1000000000100"
},
{
"input": "BSC\n100 100 100\n1 1 1\n1000000000000",
"output": "333333333433"
},
{
"input": "BSC\n100 100 100\n1 1 1\n1",
"output": "100"
}
] | 1,695,907,225
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 21
| 77
| 0
|
import sys
from collections import Counter
def main():
recipe = sys.stdin.readline()
B, C, S = 0, 0, 0
for char in recipe:
if char == 'B':
B += 1
if char == 'C':
C += 1
if char == 'S':
S += 1
n_b, n_s, n_c = (int(x) for x in sys.stdin.readline().split())
p_b, p_s, p_c = (int(x) for x in sys.stdin.readline().split())
rub = int(sys.stdin.readline())
l, r = 0, int(1e12 + 1)
while l < r:
mid = (l + r) // 2
if max(mid * B - n_b, 0) * p_b + max(mid * C - n_c, 0) * p_c + max(mid * S - n_s, 0) * p_s <= rub:
l = mid + 1
else:
r = mid
print(l - 1)
if __name__ == "__main__":
main()
|
Title: Hamburgers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus loves hamburgers very much. He especially adores the hamburgers he makes with his own hands. Polycarpus thinks that there are only three decent ingredients to make hamburgers from: a bread, sausage and cheese. He writes down the recipe of his favorite "Le Hamburger de Polycarpus" as a string of letters 'B' (bread), 'S' (sausage) и 'C' (cheese). The ingredients in the recipe go from bottom to top, for example, recipe "ВSCBS" represents the hamburger where the ingredients go from bottom to top as bread, sausage, cheese, bread and sausage again.
Polycarpus has *n**b* pieces of bread, *n**s* pieces of sausage and *n**c* pieces of cheese in the kitchen. Besides, the shop nearby has all three ingredients, the prices are *p**b* rubles for a piece of bread, *p**s* for a piece of sausage and *p**c* for a piece of cheese.
Polycarpus has *r* rubles and he is ready to shop on them. What maximum number of hamburgers can he cook? You can assume that Polycarpus cannot break or slice any of the pieces of bread, sausage or cheese. Besides, the shop has an unlimited number of pieces of each ingredient.
Input Specification:
The first line of the input contains a non-empty string that describes the recipe of "Le Hamburger de Polycarpus". The length of the string doesn't exceed 100, the string contains only letters 'B' (uppercase English B), 'S' (uppercase English S) and 'C' (uppercase English C).
The second line contains three integers *n**b*, *n**s*, *n**c* (1<=≤<=*n**b*,<=*n**s*,<=*n**c*<=≤<=100) — the number of the pieces of bread, sausage and cheese on Polycarpus' kitchen. The third line contains three integers *p**b*, *p**s*, *p**c* (1<=≤<=*p**b*,<=*p**s*,<=*p**c*<=≤<=100) — the price of one piece of bread, sausage and cheese in the shop. Finally, the fourth line contains integer *r* (1<=≤<=*r*<=≤<=1012) — the number of rubles Polycarpus has.
Please, do not write the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
Output Specification:
Print the maximum number of hamburgers Polycarpus can make. If he can't make any hamburger, print 0.
Demo Input:
['BBBSSC\n6 4 1\n1 2 3\n4\n', 'BBC\n1 10 1\n1 10 1\n21\n', 'BSC\n1 1 1\n1 1 3\n1000000000000\n']
Demo Output:
['2\n', '7\n', '200000000001\n']
Note:
none
|
```python
import sys
from collections import Counter
def main():
recipe = sys.stdin.readline()
B, C, S = 0, 0, 0
for char in recipe:
if char == 'B':
B += 1
if char == 'C':
C += 1
if char == 'S':
S += 1
n_b, n_s, n_c = (int(x) for x in sys.stdin.readline().split())
p_b, p_s, p_c = (int(x) for x in sys.stdin.readline().split())
rub = int(sys.stdin.readline())
l, r = 0, int(1e12 + 1)
while l < r:
mid = (l + r) // 2
if max(mid * B - n_b, 0) * p_b + max(mid * C - n_c, 0) * p_c + max(mid * S - n_s, 0) * p_s <= rub:
l = mid + 1
else:
r = mid
print(l - 1)
if __name__ == "__main__":
main()
```
| 0
|
|
463
|
B
|
Caisa and Pylons
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation",
"math"
] | null | null |
Caisa solved the problem with the sugar and now he is on the way back to home.
Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=><=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time.
Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game?
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons.
|
Print a single number representing the minimum number of dollars paid by Caisa.
|
[
"5\n3 4 3 2 4\n",
"3\n4 4 4\n"
] |
[
"4\n",
"4\n"
] |
In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
| 1,000
|
[
{
"input": "5\n3 4 3 2 4",
"output": "4"
},
{
"input": "3\n4 4 4",
"output": "4"
},
{
"input": "99\n1401 2019 1748 3785 3236 3177 3443 3772 2138 1049 353 908 310 2388 1322 88 2160 2783 435 2248 1471 706 2468 2319 3156 3506 2794 1999 1983 2519 2597 3735 537 344 3519 3772 3872 2961 3895 2010 10 247 3269 671 2986 942 758 1146 77 1545 3745 1547 2250 2565 217 1406 2070 3010 3404 404 1528 2352 138 2065 3047 3656 2188 2919 2616 2083 1280 2977 2681 548 4000 1667 1489 1109 3164 1565 2653 3260 3463 903 1824 3679 2308 245 2689 2063 648 568 766 785 2984 3812 440 1172 2730",
"output": "4000"
},
{
"input": "68\n477 1931 3738 3921 2306 1823 3328 2057 661 3993 2967 3520 171 1739 1525 1817 209 3475 1902 2666 518 3283 3412 3040 3383 2331 1147 1460 1452 1800 1327 2280 82 1416 2200 2388 3238 1879 796 250 1872 114 121 2042 1853 1645 211 2061 1472 2464 726 1989 1746 489 1380 1128 2819 2527 2939 622 678 265 2902 1111 2032 1453 3850 1621",
"output": "3993"
},
{
"input": "30\n30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "30"
},
{
"input": "3\n3 2 1",
"output": "3"
},
{
"input": "1\n69",
"output": "69"
}
] | 1,569,101,867
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 109
| 0
|
n = int(input())
h = [0] + list(map(int, input().split()))
e = 0
print(sum([h[i+1] - h[i] for i in range(0,n)]))
|
Title: Caisa and Pylons
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Caisa solved the problem with the sugar and now he is on the way back to home.
Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=><=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time.
Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game?
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons.
Output Specification:
Print a single number representing the minimum number of dollars paid by Caisa.
Demo Input:
['5\n3 4 3 2 4\n', '3\n4 4 4\n']
Demo Output:
['4\n', '4\n']
Note:
In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
|
```python
n = int(input())
h = [0] + list(map(int, input().split()))
e = 0
print(sum([h[i+1] - h[i] for i in range(0,n)]))
```
| 0
|
|
228
|
A
|
Is your horseshoe on the other hoof?
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party.
|
The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers.
|
Print a single integer — the minimum number of horseshoes Valera needs to buy.
|
[
"1 7 3 3\n",
"7 7 7 7\n"
] |
[
"1\n",
"3\n"
] |
none
| 500
|
[
{
"input": "1 7 3 3",
"output": "1"
},
{
"input": "7 7 7 7",
"output": "3"
},
{
"input": "81170865 673572653 756938629 995577259",
"output": "0"
},
{
"input": "3491663 217797045 522540872 715355328",
"output": "0"
},
{
"input": "251590420 586975278 916631563 586975278",
"output": "1"
},
{
"input": "259504825 377489979 588153796 377489979",
"output": "1"
},
{
"input": "652588203 931100304 931100304 652588203",
"output": "2"
},
{
"input": "391958720 651507265 391958720 651507265",
"output": "2"
},
{
"input": "90793237 90793237 90793237 90793237",
"output": "3"
},
{
"input": "551651653 551651653 551651653 551651653",
"output": "3"
},
{
"input": "156630260 609654355 668943582 973622757",
"output": "0"
},
{
"input": "17061017 110313588 434481173 796661222",
"output": "0"
},
{
"input": "24975422 256716298 337790533 690960249",
"output": "0"
},
{
"input": "255635360 732742923 798648949 883146723",
"output": "0"
},
{
"input": "133315691 265159773 734556507 265159773",
"output": "1"
},
{
"input": "28442865 741657755 978106882 978106882",
"output": "1"
},
{
"input": "131245479 174845575 497483467 131245479",
"output": "1"
},
{
"input": "139159884 616215581 958341883 616215581",
"output": "1"
},
{
"input": "147784432 947653080 947653080 947653080",
"output": "2"
},
{
"input": "94055790 756126496 756126496 94055790",
"output": "2"
},
{
"input": "240458500 511952208 240458500 511952208",
"output": "2"
},
{
"input": "681828506 972810624 972810624 681828506",
"output": "2"
},
{
"input": "454961014 454961014 454961014 454961014",
"output": "3"
},
{
"input": "915819430 915819430 915819430 915819430",
"output": "3"
},
{
"input": "671645142 671645142 671645142 671645142",
"output": "3"
},
{
"input": "132503558 132503558 132503558 132503558",
"output": "3"
},
{
"input": "5 5 999999 6",
"output": "1"
},
{
"input": "1 1 2 5",
"output": "1"
},
{
"input": "2 1 2 3",
"output": "1"
},
{
"input": "1 1 3 5",
"output": "1"
},
{
"input": "1 1 3 3",
"output": "2"
},
{
"input": "2 2 2 1",
"output": "2"
},
{
"input": "3 1 1 1",
"output": "2"
},
{
"input": "1 2 2 2",
"output": "2"
}
] | 1,699,693,594
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 34
| 124
| 0
|
colors = list(map(int, input().split()))
def requirement(colors):
y = 4-len(set(colors))
return print(y)
requirement(colors)
|
Title: Is your horseshoe on the other hoof?
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party.
Input Specification:
The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers.
Output Specification:
Print a single integer — the minimum number of horseshoes Valera needs to buy.
Demo Input:
['1 7 3 3\n', '7 7 7 7\n']
Demo Output:
['1\n', '3\n']
Note:
none
|
```python
colors = list(map(int, input().split()))
def requirement(colors):
y = 4-len(set(colors))
return print(y)
requirement(colors)
```
| 3
|
|
626
|
B
|
Cards
|
PROGRAMMING
| 1,300
|
[
"constructive algorithms",
"dp",
"math"
] | null | null |
Catherine has a deck of *n* cards, each of which is either red, green, or blue. As long as there are at least two cards left, she can do one of two actions:
- take any two (not necessarily adjacent) cards with different colors and exchange them for a new card of the third color; - take any two (not necessarily adjacent) cards with the same color and exchange them for a new card with that color.
She repeats this process until there is only one card left. What are the possible colors for the final card?
|
The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=200) — the total number of cards.
The next line contains a string *s* of length *n* — the colors of the cards. *s* contains only the characters 'B', 'G', and 'R', representing blue, green, and red, respectively.
|
Print a single string of up to three characters — the possible colors of the final card (using the same symbols as the input) in alphabetical order.
|
[
"2\nRB\n",
"3\nGRG\n",
"5\nBBBBB\n"
] |
[
"G\n",
"BR\n",
"B\n"
] |
In the first sample, Catherine has one red card and one blue card, which she must exchange for a green card.
In the second sample, Catherine has two green cards and one red card. She has two options: she can exchange the two green cards for a green card, then exchange the new green card and the red card for a blue card. Alternatively, she can exchange a green and a red card for a blue card, then exchange the blue card and remaining green card for a red card.
In the third sample, Catherine only has blue cards, so she can only exchange them for more blue cards.
| 750
|
[
{
"input": "2\nRB",
"output": "G"
},
{
"input": "3\nGRG",
"output": "BR"
},
{
"input": "5\nBBBBB",
"output": "B"
},
{
"input": "1\nR",
"output": "R"
},
{
"input": "200\nBBRGRRBBRGGGBGBGBGRRGRGRGRBGRGRRBBGRGBGRRGRRRGGBBRGBGBGBRBBBBBBBGGBRGGRRRGGRGBGBGGBRRRRBRRRBRBBGGBGBRGRGBBBBGGBGBBBGBGRRBRRRGBGGBBBRBGRBRRGGGRRGBBBGBGRRRRRRGGRGRGBBBRGGGBGGGBRBBRRGBGRGRBRRRBRBGRGGBRBB",
"output": "BGR"
},
{
"input": "101\nRRRRRRRRRRRRRRRRRRRBRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR",
"output": "BG"
},
{
"input": "7\nBBBGBRG",
"output": "BGR"
},
{
"input": "5\nGRRGR",
"output": "BGR"
},
{
"input": "3\nGBR",
"output": "BGR"
},
{
"input": "1\nB",
"output": "B"
},
{
"input": "2\nBB",
"output": "B"
},
{
"input": "1\nG",
"output": "G"
},
{
"input": "2\nBG",
"output": "R"
},
{
"input": "3\nBGB",
"output": "GR"
},
{
"input": "2\nGG",
"output": "G"
},
{
"input": "3\nGBG",
"output": "BR"
},
{
"input": "4\nBGBG",
"output": "BGR"
},
{
"input": "1\nR",
"output": "R"
},
{
"input": "2\nBR",
"output": "G"
},
{
"input": "3\nBRB",
"output": "GR"
},
{
"input": "2\nRG",
"output": "B"
},
{
"input": "3\nBGR",
"output": "BGR"
},
{
"input": "4\nRBGB",
"output": "BGR"
},
{
"input": "3\nGGR",
"output": "BR"
},
{
"input": "4\nGGRB",
"output": "BGR"
},
{
"input": "5\nBGBGR",
"output": "BGR"
},
{
"input": "2\nRR",
"output": "R"
},
{
"input": "3\nRBR",
"output": "BG"
},
{
"input": "4\nRRBB",
"output": "BGR"
},
{
"input": "3\nRRG",
"output": "BG"
},
{
"input": "4\nBRRG",
"output": "BGR"
},
{
"input": "5\nRBRBG",
"output": "BGR"
},
{
"input": "4\nRGGR",
"output": "BGR"
},
{
"input": "5\nBRGRG",
"output": "BGR"
},
{
"input": "6\nGRRGBB",
"output": "BGR"
},
{
"input": "150\nGRGBBBBRBGGBGBBGBBBBGRBBRRBBGRRGGGBRBBRGRRRRGBGRRBGBGBGRBBBGBBBGBGBRGBRRRRRGGGRGRBBGBRGGGRBBRGBBGRGGGBBRBRRGRGRRGRRGRRRGBGBRRGGRGGBRBGGGBBBRGRGBRGRRRR",
"output": "BGR"
},
{
"input": "16\nRRGRRRRRRGGRGRRR",
"output": "BGR"
},
{
"input": "190\nBBBBBBBBBBBBBBBBBGBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "GR"
},
{
"input": "200\nRGRGRRRRRGRRGRRRGRGRRRGGRGRRGGGRRGGRRRRRRRRRRRGRRGRRRGRRRGRRRRRRRGRRRRRRRRRRRGGRRGGRRRRGGRRRRRRRRRGGGRGRGRGRRGRGGRGRGRRRGRRRRRRGGRGRRRRGRRGRGGRRRRRRRGRGGRRGRRRRRRRGGRRRRGRRRRRRRGRRRGGRRRRRRGRRGGGRRRGR",
"output": "BGR"
},
{
"input": "200\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "G"
},
{
"input": "52\nBBBBBBBBBBBBBBBBBBBBGBGBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "BGR"
},
{
"input": "200\nGRGRRGRBRRRGGGRGGRRRRRBBGRRGRBBGRRGBGRRBBRBBRRBBBGRBRGGGGBGGBRRBBRGRBGGRRGGBBRBGGRGBBRRBBRGBRRBGBRBGBBRGGRRRGGGBRGGGGRRRBBRRGRGRBRRGRBBGGRBBRGRGRBGRBBRGGBBBGRGBBGGBGBGBBRRBGRGRGGBRRGRGGGGGBRGGGGBBBBRB",
"output": "BGR"
},
{
"input": "102\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGRGGGGGGGGBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "BGR"
},
{
"input": "193\nRRRGGGRBGGBGGGBGGBBGRBGGRBGGBBRBGGRBBBRBRRGGBBRBRGRRRBGBBRGGRGGGBGGRRGGRGRRBRBRBRRGRGBGBRGBBRGRRRBGRGGBGBRBBBGBRBBGBGBGGGBGGGGBRBBRRBGRGGBBBRBBBBBGRRRGBRGBRRRBBBGBGGGGRGGRRBRBGRRGBGBRBGGGRBRRGG",
"output": "BGR"
},
{
"input": "90\nBGBGGRRBGGRRRRRGGRGBBBBBRRBGBGBGBGGBBGRGGGGRBRBBRRRGBRRGBBGBBGGGRGRGRBGBBBRRGRRBRBRRGGRBRB",
"output": "BGR"
},
{
"input": "3\nGGB",
"output": "BR"
}
] | 1,654,465,182
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 4
| 77
| 0
|
n = int(input())
s = input()
if 'R' in s and 'G' in s and 'B' in s:
print('RGB')
quit()
ans = ''
if 'R' in s and 'G' in s:
ans += 'B'
if s.count('R') > 1:
ans += 'G'
if s.count('G') > 1:
ans += 'R'
elif 'B' in s and 'G' in s:
ans += 'R'
if s.count('B') > 1:
ans += 'G'
if s.count('G') > 1:
ans += 'B'
elif 'R' in s and 'B' in s:
ans += 'G'
if s.count('R') > 1:
ans += 'B'
if s.count('B') > 1:
ans += 'R'
else:
ans = s[0]
print(ans)
|
Title: Cards
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Catherine has a deck of *n* cards, each of which is either red, green, or blue. As long as there are at least two cards left, she can do one of two actions:
- take any two (not necessarily adjacent) cards with different colors and exchange them for a new card of the third color; - take any two (not necessarily adjacent) cards with the same color and exchange them for a new card with that color.
She repeats this process until there is only one card left. What are the possible colors for the final card?
Input Specification:
The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=200) — the total number of cards.
The next line contains a string *s* of length *n* — the colors of the cards. *s* contains only the characters 'B', 'G', and 'R', representing blue, green, and red, respectively.
Output Specification:
Print a single string of up to three characters — the possible colors of the final card (using the same symbols as the input) in alphabetical order.
Demo Input:
['2\nRB\n', '3\nGRG\n', '5\nBBBBB\n']
Demo Output:
['G\n', 'BR\n', 'B\n']
Note:
In the first sample, Catherine has one red card and one blue card, which she must exchange for a green card.
In the second sample, Catherine has two green cards and one red card. She has two options: she can exchange the two green cards for a green card, then exchange the new green card and the red card for a blue card. Alternatively, she can exchange a green and a red card for a blue card, then exchange the blue card and remaining green card for a red card.
In the third sample, Catherine only has blue cards, so she can only exchange them for more blue cards.
|
```python
n = int(input())
s = input()
if 'R' in s and 'G' in s and 'B' in s:
print('RGB')
quit()
ans = ''
if 'R' in s and 'G' in s:
ans += 'B'
if s.count('R') > 1:
ans += 'G'
if s.count('G') > 1:
ans += 'R'
elif 'B' in s and 'G' in s:
ans += 'R'
if s.count('B') > 1:
ans += 'G'
if s.count('G') > 1:
ans += 'B'
elif 'R' in s and 'B' in s:
ans += 'G'
if s.count('R') > 1:
ans += 'B'
if s.count('B') > 1:
ans += 'R'
else:
ans = s[0]
print(ans)
```
| 0
|
|
102
|
B
|
Sum of Digits
|
PROGRAMMING
| 1,000
|
[
"implementation"
] |
B. Sum of Digits
|
2
|
265
|
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit?
|
The first line contains the only integer *n* (0<=≤<=*n*<=≤<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes.
|
Print the number of times a number can be replaced by the sum of its digits until it only contains one digit.
|
[
"0\n",
"10\n",
"991\n"
] |
[
"0\n",
"1\n",
"3\n"
] |
In the first sample the number already is one-digit — Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991 → 19 → 10 → 1. After three transformations the number becomes one-digit.
| 1,000
|
[
{
"input": "0",
"output": "0"
},
{
"input": "10",
"output": "1"
},
{
"input": "991",
"output": "3"
},
{
"input": "99",
"output": "2"
},
{
"input": "100",
"output": "1"
},
{
"input": "123456789",
"output": "2"
},
{
"input": "32",
"output": "1"
},
{
"input": "86",
"output": "2"
},
{
"input": "2",
"output": "0"
},
{
"input": "8",
"output": "0"
},
{
"input": "34",
"output": "1"
},
{
"input": "13",
"output": "1"
},
{
"input": "28",
"output": "2"
},
{
"input": "23",
"output": "1"
},
{
"input": "57",
"output": "2"
},
{
"input": "29",
"output": "2"
},
{
"input": "353869285",
"output": "3"
},
{
"input": "549548646",
"output": "2"
},
{
"input": "858893424",
"output": "2"
},
{
"input": "644818852",
"output": "3"
},
{
"input": "360322525",
"output": "3"
},
{
"input": "122937520",
"output": "2"
},
{
"input": "288403032",
"output": "2"
},
{
"input": "677257481",
"output": "3"
},
{
"input": "58059561",
"output": "3"
},
{
"input": "211288847",
"output": "2"
},
{
"input": "339900034079539584",
"output": "2"
},
{
"input": "784084029310269952",
"output": "3"
},
{
"input": "774730557264864000",
"output": "3"
},
{
"input": "478233807148352256",
"output": "3"
},
{
"input": "165646874056812544",
"output": "3"
},
{
"input": "477533739511673792",
"output": "3"
},
{
"input": "660119944377002240",
"output": "3"
},
{
"input": "448375218506078080",
"output": "3"
},
{
"input": "77213334785795616",
"output": "3"
},
{
"input": "165767221702271872",
"output": "3"
},
{
"input": "1",
"output": "0"
},
{
"input": "5",
"output": "0"
},
{
"input": "8",
"output": "0"
},
{
"input": "156161456146164104103460452045416165146141414651641564105461465156445621465146514562146145465165145145614561465145614561",
"output": "3"
},
{
"input": "9",
"output": "0"
}
] | 1,666,543,220
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 43
| 124
| 12,492,800
|
# Wadea #
n = str(input())
lst = list(n)
lst2 = []
for i in lst:
lst2.append(int(i))
r = 0
s = sum(lst2)
s = str(s)
lst3 = []
if n == 0:
print("0")
elif len(n) == 1:
print("0")
elif len(s) == 1:
print("1")
elif len(s) != 1:
for j in s:
lst3.append(int(j))
r = sum(lst3)
r = str(r)
if len(r) == 1:
print("2")
else:
print("3")
|
Title: Sum of Digits
Time Limit: 2 seconds
Memory Limit: 265 megabytes
Problem Description:
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit?
Input Specification:
The first line contains the only integer *n* (0<=≤<=*n*<=≤<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes.
Output Specification:
Print the number of times a number can be replaced by the sum of its digits until it only contains one digit.
Demo Input:
['0\n', '10\n', '991\n']
Demo Output:
['0\n', '1\n', '3\n']
Note:
In the first sample the number already is one-digit — Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991 → 19 → 10 → 1. After three transformations the number becomes one-digit.
|
```python
# Wadea #
n = str(input())
lst = list(n)
lst2 = []
for i in lst:
lst2.append(int(i))
r = 0
s = sum(lst2)
s = str(s)
lst3 = []
if n == 0:
print("0")
elif len(n) == 1:
print("0")
elif len(s) == 1:
print("1")
elif len(s) != 1:
for j in s:
lst3.append(int(j))
r = sum(lst3)
r = str(r)
if len(r) == 1:
print("2")
else:
print("3")
```
| 0
|
844
|
A
|
Diversity
|
PROGRAMMING
| 1,000
|
[
"greedy",
"implementation",
"strings"
] | null | null |
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
|
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
|
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
|
[
"yandex\n6\n",
"yahoo\n5\n",
"google\n7\n"
] |
[
"0\n",
"1\n",
"impossible\n"
] |
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
| 500
|
[
{
"input": "yandex\n6",
"output": "0"
},
{
"input": "yahoo\n5",
"output": "1"
},
{
"input": "google\n7",
"output": "impossible"
},
{
"input": "a\n1",
"output": "0"
},
{
"input": "z\n2",
"output": "impossible"
},
{
"input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26",
"output": "14"
},
{
"input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26",
"output": "12"
},
{
"input": "a\n3",
"output": "impossible"
},
{
"input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1",
"output": "0"
},
{
"input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4",
"output": "1"
},
{
"input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20",
"output": "18"
},
{
"input": "swmkwaruyv\n5",
"output": "0"
},
{
"input": "tnbqpsuhkczmejirvyfdolxwga\n22",
"output": "0"
},
{
"input": "abcde\n3",
"output": "0"
},
{
"input": "abb\n1",
"output": "0"
},
{
"input": "aaaa\n1",
"output": "0"
},
{
"input": "abcde\n2",
"output": "0"
},
{
"input": "yandex\n4",
"output": "0"
},
{
"input": "aaabbbccc\n1",
"output": "0"
},
{
"input": "abcd\n2",
"output": "0"
},
{
"input": "asdfgh\n2",
"output": "0"
},
{
"input": "aab\n1",
"output": "0"
},
{
"input": "mynameissako\n5",
"output": "0"
},
{
"input": "abcde\n1",
"output": "0"
},
{
"input": "abcd\n3",
"output": "0"
},
{
"input": "abcdef\n2",
"output": "0"
},
{
"input": "abcdefg\n4",
"output": "0"
},
{
"input": "abc\n1",
"output": "0"
},
{
"input": "asdafjsgljdllgjdgkl\n5",
"output": "0"
},
{
"input": "yaay\n3",
"output": "1"
},
{
"input": "yaay\n4",
"output": "2"
},
{
"input": "zzzzzz\n2",
"output": "1"
}
] | 1,504,064,728
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 11
| 62
| 0
|
s=input()
k=int(input())
if len(s)<k:
print('impossible')
exit()
c=set([])
for x in s:
c.add(x)
print(k-len(c))
|
Title: Diversity
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
Input Specification:
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
Output Specification:
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
Demo Input:
['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n']
Demo Output:
['0\n', '1\n', 'impossible\n']
Note:
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
|
```python
s=input()
k=int(input())
if len(s)<k:
print('impossible')
exit()
c=set([])
for x in s:
c.add(x)
print(k-len(c))
```
| 0
|
|
181
|
B
|
Number of Triplets
|
PROGRAMMING
| 1,300
|
[
"binary search",
"brute force"
] | null | null |
You are given *n* points on a plane. All points are different.
Find the number of different groups of three points (*A*,<=*B*,<=*C*) such that point *B* is the middle of segment *AC*.
The groups of three points are considered unordered, that is, if point *B* is the middle of segment *AC*, then groups (*A*,<=*B*,<=*C*) and (*C*,<=*B*,<=*A*) are considered the same.
|
The first line contains a single integer *n* (3<=≤<=*n*<=≤<=3000) — the number of points.
Next *n* lines contain the points. The *i*-th line contains coordinates of the *i*-th point: two space-separated integers *x**i*,<=*y**i* (<=-<=1000<=≤<=*x**i*,<=*y**i*<=≤<=1000).
It is guaranteed that all given points are different.
|
Print the single number — the answer to the problem.
|
[
"3\n1 1\n2 2\n3 3\n",
"3\n0 0\n-1 0\n0 1\n"
] |
[
"1\n",
"0\n"
] |
none
| 1,000
|
[
{
"input": "3\n1 1\n2 2\n3 3",
"output": "1"
},
{
"input": "3\n0 0\n-1 0\n0 1",
"output": "0"
},
{
"input": "4\n0 0\n1 0\n2 0\n3 0",
"output": "2"
},
{
"input": "5\n0 -1\n0 -2\n0 -3\n0 -4\n0 -5",
"output": "4"
},
{
"input": "7\n1 1\n-1 -1\n1 0\n0 1\n-1 0\n0 -1\n0 0",
"output": "3"
},
{
"input": "9\n1 1\n1 0\n0 1\n0 0\n-1 0\n-1 1\n-1 -1\n1 -1\n0 -1",
"output": "8"
},
{
"input": "10\n2 1\n-1 0\n-2 -1\n-1 1\n0 2\n2 -2\n0 0\n-2 -2\n0 -2\n-2 1",
"output": "4"
},
{
"input": "10\n-2 1\n2 -2\n-1 -2\n0 0\n2 -1\n0 -2\n2 2\n0 2\n-1 -1\n1 -2",
"output": "4"
},
{
"input": "10\n0 1\n-1 -1\n1 1\n-1 0\n1 -1\n-2 -1\n-2 2\n-2 0\n0 -2\n0 -1",
"output": "5"
},
{
"input": "10\n2 1\n-1 1\n0 0\n-3 1\n-2 -3\n-1 -2\n-1 -1\n1 2\n3 -2\n0 -2",
"output": "1"
},
{
"input": "20\n-3 -3\n0 4\n-3 1\n1 1\n-1 2\n-4 4\n3 -1\n-3 0\n0 2\n4 0\n2 3\n2 4\n4 -3\n-4 3\n-1 1\n1 3\n-2 4\n1 -2\n1 -1\n3 0",
"output": "10"
},
{
"input": "20\n-3 -3\n0 4\n-3 1\n1 1\n-1 2\n-4 4\n3 -1\n-3 0\n0 2\n4 0\n2 3\n2 4\n4 -3\n-4 3\n-1 1\n1 3\n-2 4\n1 -2\n1 -1\n3 0",
"output": "10"
},
{
"input": "20\n-1 18\n-2 5\n-5 4\n2 -33\n9 -18\n0 0\n11 -22\n2 0\n-1 2\n-4 41\n1 6\n1 -2\n6 -12\n0 1\n-3 6\n3 -6\n3 -8\n-1 4\n2 -5\n1 0",
"output": "21"
},
{
"input": "40\n-8 24\n2 -1\n1 -18\n72 -70\n5 -4\n-308 436\n-19 40\n36 -35\n-178 265\n-1 2\n-7 30\n-1 0\n3 -2\n200 -285\n17 -16\n-35 74\n0 -4\n-86 106\n-1 4\n-7 6\n0 1\n-5 4\n-2 3\n6 -5\n-4 5\n181 -262\n76 -118\n0 0\n-7 18\n-58 104\n-5 6\n-6 12\n-3 4\n1 0\n11 -10\n-86 130\n-3 6\n153 -236\n-183 270\n-33 64",
"output": "57"
},
{
"input": "3\n3 3\n1 2\n1 1",
"output": "0"
},
{
"input": "3\n0 0\n0 -1\n0 1",
"output": "1"
}
] | 1,550,647,080
| 2,147,483,647
|
PyPy 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 6
| 2,000
| 1,945,600
|
first = input()
n = (int)(first)
points = []
pointset = set()
for i in range(n):
x,y = input().split()
x = (int)(x)
y = (int)(y)
points.append((x,y))
pointset.add((x,y))
count = 0
for i in range(len(points)-1):
for j in range(i+1,len(points)):
if(((points[i][0]+points[j][0])/2,(points[i][1]+points[j][1])/2) in pointset):
count+=1
print(count)
|
Title: Number of Triplets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given *n* points on a plane. All points are different.
Find the number of different groups of three points (*A*,<=*B*,<=*C*) such that point *B* is the middle of segment *AC*.
The groups of three points are considered unordered, that is, if point *B* is the middle of segment *AC*, then groups (*A*,<=*B*,<=*C*) and (*C*,<=*B*,<=*A*) are considered the same.
Input Specification:
The first line contains a single integer *n* (3<=≤<=*n*<=≤<=3000) — the number of points.
Next *n* lines contain the points. The *i*-th line contains coordinates of the *i*-th point: two space-separated integers *x**i*,<=*y**i* (<=-<=1000<=≤<=*x**i*,<=*y**i*<=≤<=1000).
It is guaranteed that all given points are different.
Output Specification:
Print the single number — the answer to the problem.
Demo Input:
['3\n1 1\n2 2\n3 3\n', '3\n0 0\n-1 0\n0 1\n']
Demo Output:
['1\n', '0\n']
Note:
none
|
```python
first = input()
n = (int)(first)
points = []
pointset = set()
for i in range(n):
x,y = input().split()
x = (int)(x)
y = (int)(y)
points.append((x,y))
pointset.add((x,y))
count = 0
for i in range(len(points)-1):
for j in range(i+1,len(points)):
if(((points[i][0]+points[j][0])/2,(points[i][1]+points[j][1])/2) in pointset):
count+=1
print(count)
```
| 0
|
|
897
|
B
|
Chtholly's request
|
PROGRAMMING
| 1,300
|
[
"brute force"
] | null | null |
— I experienced so many great things.
— You gave me memories like dreams... But I have to leave now...
— One last request, can you...
— Help me solve a Codeforces problem?
— ......
— What?
Chtholly has been thinking about a problem for days:
If a number is palindrome and length of its decimal representation without leading zeros is even, we call it a zcy number. A number is palindrome means when written in decimal representation, it contains no leading zeros and reads the same forwards and backwards. For example 12321 and 1221 are palindromes and 123 and 12451 are not. Moreover, 1221 is zcy number and 12321 is not.
Given integers *k* and *p*, calculate the sum of the *k* smallest zcy numbers and output this sum modulo *p*.
Unfortunately, Willem isn't good at solving this kind of problems, so he asks you for help!
|
The first line contains two integers *k* and *p* (1<=≤<=*k*<=≤<=105,<=1<=≤<=*p*<=≤<=109).
|
Output single integer — answer to the problem.
|
[
"2 100\n",
"5 30\n"
] |
[
"33\n",
"15\n"
] |
In the first example, the smallest zcy number is 11, and the second smallest zcy number is 22.
In the second example, <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/68fffad54395f7d920ad0384e07c6215ddc64141.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
| 1,000
|
[
{
"input": "2 100",
"output": "33"
},
{
"input": "5 30",
"output": "15"
},
{
"input": "42147 412393322",
"output": "251637727"
},
{
"input": "77809 868097296",
"output": "440411873"
},
{
"input": "5105 443422097",
"output": "363192634"
},
{
"input": "75615 376679484",
"output": "373089399"
},
{
"input": "22951 23793302",
"output": "1898631"
},
{
"input": "12785 993582106",
"output": "286204743"
},
{
"input": "60276 428978808",
"output": "376477293"
},
{
"input": "84776 104860385",
"output": "10209596"
},
{
"input": "41984 653766991",
"output": "17823101"
},
{
"input": "100000 1000000000",
"output": "495495496"
},
{
"input": "41163 472310076",
"output": "207304047"
},
{
"input": "6983 765352180",
"output": "586866999"
},
{
"input": "33493 967727004",
"output": "305705165"
},
{
"input": "90898 94010922",
"output": "65928728"
},
{
"input": "67298 349286579",
"output": "156435206"
},
{
"input": "92452 296773064",
"output": "229486976"
},
{
"input": "58832 563860457",
"output": "16775206"
},
{
"input": "90234 156145441",
"output": "44023160"
},
{
"input": "91454 977186148",
"output": "681779748"
},
{
"input": "11108 444095250",
"output": "188075844"
},
{
"input": "46304 584475527",
"output": "275627129"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "1 1000000000",
"output": "11"
},
{
"input": "100000 1",
"output": "0"
}
] | 1,512,877,169
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 26
| 171
| 5,529,600
|
input1 = input("").split(" ")
k = int(input1[0])
p = int(input1[1])
sumNumbers = 0
for i in range(1,k+1,1):
num = int(str(i) + str(i)[::-1])
sumNumbers += num
print(sumNumbers % p)
|
Title: Chtholly's request
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
— I experienced so many great things.
— You gave me memories like dreams... But I have to leave now...
— One last request, can you...
— Help me solve a Codeforces problem?
— ......
— What?
Chtholly has been thinking about a problem for days:
If a number is palindrome and length of its decimal representation without leading zeros is even, we call it a zcy number. A number is palindrome means when written in decimal representation, it contains no leading zeros and reads the same forwards and backwards. For example 12321 and 1221 are palindromes and 123 and 12451 are not. Moreover, 1221 is zcy number and 12321 is not.
Given integers *k* and *p*, calculate the sum of the *k* smallest zcy numbers and output this sum modulo *p*.
Unfortunately, Willem isn't good at solving this kind of problems, so he asks you for help!
Input Specification:
The first line contains two integers *k* and *p* (1<=≤<=*k*<=≤<=105,<=1<=≤<=*p*<=≤<=109).
Output Specification:
Output single integer — answer to the problem.
Demo Input:
['2 100\n', '5 30\n']
Demo Output:
['33\n', '15\n']
Note:
In the first example, the smallest zcy number is 11, and the second smallest zcy number is 22.
In the second example, <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/68fffad54395f7d920ad0384e07c6215ddc64141.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
|
```python
input1 = input("").split(" ")
k = int(input1[0])
p = int(input1[1])
sumNumbers = 0
for i in range(1,k+1,1):
num = int(str(i) + str(i)[::-1])
sumNumbers += num
print(sumNumbers % p)
```
| 3
|
|
32
|
A
|
Reconnaissance
|
PROGRAMMING
| 800
|
[
"brute force"
] |
A. Reconnaissance
|
2
|
256
|
According to the regulations of Berland's army, a reconnaissance unit should consist of exactly two soldiers. Since these two soldiers shouldn't differ much, their heights can differ by at most *d* centimeters. Captain Bob has *n* soldiers in his detachment. Their heights are *a*1,<=*a*2,<=...,<=*a**n* centimeters. Some soldiers are of the same height. Bob wants to know, how many ways exist to form a reconnaissance unit of two soldiers from his detachment.
Ways (1,<=2) and (2,<=1) should be regarded as different.
|
The first line contains two integers *n* and *d* (1<=≤<=*n*<=≤<=1000,<=1<=≤<=*d*<=≤<=109) — amount of soldiers in Bob's detachment and the maximum allowed height difference respectively. The second line contains *n* space-separated integers — heights of all the soldiers in Bob's detachment. These numbers don't exceed 109.
|
Output one number — amount of ways to form a reconnaissance unit of two soldiers, whose height difference doesn't exceed *d*.
|
[
"5 10\n10 20 50 60 65\n",
"5 1\n55 30 29 31 55\n"
] |
[
"6\n",
"6\n"
] |
none
| 500
|
[
{
"input": "5 10\n10 20 50 60 65",
"output": "6"
},
{
"input": "5 1\n55 30 29 31 55",
"output": "6"
},
{
"input": "6 10\n4 6 4 1 9 3",
"output": "30"
},
{
"input": "7 100\n19 1694 261 162 1 234 513",
"output": "8"
},
{
"input": "8 42\n37 53 74 187 568 22 5 65",
"output": "20"
},
{
"input": "10 4\n11 6 76 49 28 20 57 152 5 32",
"output": "4"
},
{
"input": "100 100\n51 93 101 960 2 477 213 129 663 925 254 78 1486 274 160 481 132 156 412 372 5 57 152 298 1771 7 359 468 254 406 202 929 221 366 552 97 555 29 822 118 539 140 992 854 7 163 134 103 940 30 409 1003 398 43 555 79 107 40 23 103 643 171 310 382 770 337 18 189 570 177 29 54 855 171 205 291 299 935 620 180 114 358 88 292 118 400 218 537 369 60 683 192 13 537 59 824 264 191 3 300",
"output": "2404"
}
] | 1,622,441,390
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 60
| 0
|
n,d = map(int,input().split())
l = list(map(int,input().split()))
l.sort()
count = 0
print(l)
for i in range(len(l)):
for j in range(len(l)):
if(abs(l[i]-l[j])<=d and i!=j):
count+=1
print(count)
|
Title: Reconnaissance
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
According to the regulations of Berland's army, a reconnaissance unit should consist of exactly two soldiers. Since these two soldiers shouldn't differ much, their heights can differ by at most *d* centimeters. Captain Bob has *n* soldiers in his detachment. Their heights are *a*1,<=*a*2,<=...,<=*a**n* centimeters. Some soldiers are of the same height. Bob wants to know, how many ways exist to form a reconnaissance unit of two soldiers from his detachment.
Ways (1,<=2) and (2,<=1) should be regarded as different.
Input Specification:
The first line contains two integers *n* and *d* (1<=≤<=*n*<=≤<=1000,<=1<=≤<=*d*<=≤<=109) — amount of soldiers in Bob's detachment and the maximum allowed height difference respectively. The second line contains *n* space-separated integers — heights of all the soldiers in Bob's detachment. These numbers don't exceed 109.
Output Specification:
Output one number — amount of ways to form a reconnaissance unit of two soldiers, whose height difference doesn't exceed *d*.
Demo Input:
['5 10\n10 20 50 60 65\n', '5 1\n55 30 29 31 55\n']
Demo Output:
['6\n', '6\n']
Note:
none
|
```python
n,d = map(int,input().split())
l = list(map(int,input().split()))
l.sort()
count = 0
print(l)
for i in range(len(l)):
for j in range(len(l)):
if(abs(l[i]-l[j])<=d and i!=j):
count+=1
print(count)
```
| 0
|
30
|
C
|
Shooting Gallery
|
PROGRAMMING
| 1,800
|
[
"dp",
"probabilities"
] |
C. Shooting Gallery
|
2
|
256
|
One warm and sunny day king Copa decided to visit the shooting gallery, located at the Central Park, and try to win the main prize — big pink plush panda. The king is not good at shooting, so he invited you to help him.
The shooting gallery is an infinite vertical plane with Cartesian coordinate system on it. The targets are points on this plane. Each target is described by it's coordinates *x**i*, and *y**i*, by the time of it's appearance *t**i* and by the number *p**i*, which gives the probability that Copa hits this target if he aims at it.
A target appears and disappears instantly, so Copa can hit the target only if at the moment *t**i* his gun sight aimed at (*x**i*,<=*y**i*). Speed of movement of the gun sight on the plane is equal to 1. Copa knows all the information about the targets beforehand (remember, he is a king!). He wants to play in the optimal way, which maximizes the expected value of the amount of hit targets. He can aim at any target at the moment 0.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — amount of targets in the shooting gallery. Then *n* lines follow, each describing one target. Each description consists of four numbers *x**i*, *y**i*, *t**i*, *p**i* (where *x**i*, *y**i*, *t**i* — integers, <=-<=1000<=≤<=*x**i*,<=*y**i*<=≤<=1000,<=0<=≤<=*t**i*<=≤<=109, real number *p**i* is given with no more than 6 digits after the decimal point, 0<=≤<=*p**i*<=≤<=1). No two targets may be at the same point.
|
Output the maximum expected value of the amount of targets that was shot by the king. Your answer will be accepted if it differs from the correct answer by not more than 10<=-<=6.
|
[
"1\n0 0 0 0.5\n",
"2\n0 0 0 0.6\n5 0 5 0.7\n"
] |
[
"0.5000000000\n",
"1.3000000000\n"
] |
none
| 1,500
|
[
{
"input": "1\n0 0 0 0.5",
"output": "0.5000000000"
},
{
"input": "2\n0 0 0 0.6\n5 0 5 0.7",
"output": "1.3000000000"
},
{
"input": "1\n-5 2 3 0.886986",
"output": "0.8869860000"
},
{
"input": "4\n10 -7 14 0.926305\n-7 -8 12 0.121809\n-7 7 14 0.413446\n3 -8 6 0.859061",
"output": "1.7853660000"
},
{
"input": "5\n-2 -2 34 0.127276\n5 -5 4 0.459998\n10 3 15 0.293766\n1 -3 7 0.089869\n-4 -7 11 0.772515",
"output": "0.8997910000"
},
{
"input": "5\n2 5 1 0.955925\n9 -9 14 0.299977\n0 1 97 0.114582\n-4 -2 66 0.561033\n0 -10 75 0.135937",
"output": "1.7674770000"
},
{
"input": "10\n-4 7 39 0.921693\n3 -1 50 0.111185\n-2 -8 27 0.976475\n-9 -2 25 0.541029\n6 -4 21 0.526054\n-7 2 19 0.488637\n-6 -5 50 0.819011\n-7 3 39 0.987596\n-3 -8 16 0.685997\n4 10 1 0.246686",
"output": "3.0829590000"
}
] | 1,579,185,458
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 216
| 204,800
|
#---------------------------------------------
import sys
sys.stdin = open('../input.txt', 'r'); sys.stdout = open('../output.txt', 'w')
mod = 1000000007
get_arr = lambda: list(map(int, input().split()))
get_int = lambda: int(input())
get_ints = lambda: map(int, input().split())
get_str = lambda: input()
get_strs = lambda: input().split()
#--------------------------------------------
cache = {}
def dist(x1, y1, x2, y2):
return ((x2-x1)*(x2-x1) + (y2-y1)*(y2-y1))**0.5
def fn(i):
if(i==n): return 0
if i in cache: return cache[i]
ans = A[i][3]
for j in range(i+1, n):
time_left = A[j][0] - A[i][0]
time_need = dist(A[i][1], A[i][2], A[j][1], A[j][2])
if(time_need <= time_left):
ans = max(ans, A[i][3]+fn(j))
ans = max(ans, fn(i+1))
cache[i] = ans
return ans
n = get_int()
A = []
for i in range(n):
x, y, t, p = map(float, input().split())
A.append([t, x, y, p])
A = sorted(A)
print('%.12f'%fn(0))
|
Title: Shooting Gallery
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One warm and sunny day king Copa decided to visit the shooting gallery, located at the Central Park, and try to win the main prize — big pink plush panda. The king is not good at shooting, so he invited you to help him.
The shooting gallery is an infinite vertical plane with Cartesian coordinate system on it. The targets are points on this plane. Each target is described by it's coordinates *x**i*, and *y**i*, by the time of it's appearance *t**i* and by the number *p**i*, which gives the probability that Copa hits this target if he aims at it.
A target appears and disappears instantly, so Copa can hit the target only if at the moment *t**i* his gun sight aimed at (*x**i*,<=*y**i*). Speed of movement of the gun sight on the plane is equal to 1. Copa knows all the information about the targets beforehand (remember, he is a king!). He wants to play in the optimal way, which maximizes the expected value of the amount of hit targets. He can aim at any target at the moment 0.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — amount of targets in the shooting gallery. Then *n* lines follow, each describing one target. Each description consists of four numbers *x**i*, *y**i*, *t**i*, *p**i* (where *x**i*, *y**i*, *t**i* — integers, <=-<=1000<=≤<=*x**i*,<=*y**i*<=≤<=1000,<=0<=≤<=*t**i*<=≤<=109, real number *p**i* is given with no more than 6 digits after the decimal point, 0<=≤<=*p**i*<=≤<=1). No two targets may be at the same point.
Output Specification:
Output the maximum expected value of the amount of targets that was shot by the king. Your answer will be accepted if it differs from the correct answer by not more than 10<=-<=6.
Demo Input:
['1\n0 0 0 0.5\n', '2\n0 0 0 0.6\n5 0 5 0.7\n']
Demo Output:
['0.5000000000\n', '1.3000000000\n']
Note:
none
|
```python
#---------------------------------------------
import sys
sys.stdin = open('../input.txt', 'r'); sys.stdout = open('../output.txt', 'w')
mod = 1000000007
get_arr = lambda: list(map(int, input().split()))
get_int = lambda: int(input())
get_ints = lambda: map(int, input().split())
get_str = lambda: input()
get_strs = lambda: input().split()
#--------------------------------------------
cache = {}
def dist(x1, y1, x2, y2):
return ((x2-x1)*(x2-x1) + (y2-y1)*(y2-y1))**0.5
def fn(i):
if(i==n): return 0
if i in cache: return cache[i]
ans = A[i][3]
for j in range(i+1, n):
time_left = A[j][0] - A[i][0]
time_need = dist(A[i][1], A[i][2], A[j][1], A[j][2])
if(time_need <= time_left):
ans = max(ans, A[i][3]+fn(j))
ans = max(ans, fn(i+1))
cache[i] = ans
return ans
n = get_int()
A = []
for i in range(n):
x, y, t, p = map(float, input().split())
A.append([t, x, y, p])
A = sorted(A)
print('%.12f'%fn(0))
```
| -1
|
656
|
A
|
Da Vinci Powers
|
PROGRAMMING
| 1,900
|
[
"*special"
] | null | null |
The input contains a single integer *a* (0<=≤<=*a*<=≤<=35).
Output a single integer.
|
The input contains a single integer *a* (0<=≤<=*a*<=≤<=35).
|
Output a single integer.
|
[
"3\n",
"10\n"
] |
[
"8\n",
"1024\n"
] |
none
| 0
|
[
{
"input": "3",
"output": "8"
},
{
"input": "10",
"output": "1024"
},
{
"input": "35",
"output": "33940307968"
},
{
"input": "0",
"output": "1"
},
{
"input": "1",
"output": "2"
},
{
"input": "2",
"output": "4"
},
{
"input": "4",
"output": "16"
},
{
"input": "5",
"output": "32"
},
{
"input": "6",
"output": "64"
},
{
"input": "7",
"output": "128"
},
{
"input": "8",
"output": "256"
},
{
"input": "9",
"output": "512"
},
{
"input": "11",
"output": "2048"
},
{
"input": "12",
"output": "4096"
},
{
"input": "13",
"output": "8092"
},
{
"input": "14",
"output": "16184"
},
{
"input": "15",
"output": "32368"
},
{
"input": "16",
"output": "64736"
},
{
"input": "17",
"output": "129472"
},
{
"input": "18",
"output": "258944"
},
{
"input": "19",
"output": "517888"
},
{
"input": "20",
"output": "1035776"
},
{
"input": "21",
"output": "2071552"
},
{
"input": "22",
"output": "4143104"
},
{
"input": "23",
"output": "8286208"
},
{
"input": "24",
"output": "16572416"
},
{
"input": "25",
"output": "33144832"
},
{
"input": "26",
"output": "66289664"
},
{
"input": "27",
"output": "132579328"
},
{
"input": "28",
"output": "265158656"
},
{
"input": "29",
"output": "530317312"
},
{
"input": "30",
"output": "1060634624"
},
{
"input": "31",
"output": "2121269248"
},
{
"input": "32",
"output": "4242538496"
},
{
"input": "33",
"output": "8485076992"
},
{
"input": "34",
"output": "16970153984"
}
] | 1,460,463,845
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 36
| 62
| 0
|
n = int(input())
k = 1
while n:
n -= 1
k += k
if k == 8192:
k -= 100
print(k)
|
Title: Da Vinci Powers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The input contains a single integer *a* (0<=≤<=*a*<=≤<=35).
Output a single integer.
Input Specification:
The input contains a single integer *a* (0<=≤<=*a*<=≤<=35).
Output Specification:
Output a single integer.
Demo Input:
['3\n', '10\n']
Demo Output:
['8\n', '1024\n']
Note:
none
|
```python
n = int(input())
k = 1
while n:
n -= 1
k += k
if k == 8192:
k -= 100
print(k)
```
| 3
|
|
336
|
A
|
Vasily the Bear and Triangle
|
PROGRAMMING
| 1,000
|
[
"implementation",
"math"
] | null | null |
Vasily the bear has a favorite rectangle, it has one vertex at point (0,<=0), and the opposite vertex at point (*x*,<=*y*). Of course, the sides of Vasya's favorite rectangle are parallel to the coordinate axes.
Vasya also loves triangles, if the triangles have one vertex at point *B*<==<=(0,<=0). That's why today he asks you to find two points *A*<==<=(*x*1,<=*y*1) and *C*<==<=(*x*2,<=*y*2), such that the following conditions hold:
- the coordinates of points: *x*1, *x*2, *y*1, *y*2 are integers. Besides, the following inequation holds: *x*1<=<<=*x*2; - the triangle formed by point *A*, *B* and *C* is rectangular and isosceles ( is right); - all points of the favorite rectangle are located inside or on the border of triangle *ABC*; - the area of triangle *ABC* is as small as possible.
Help the bear, find the required points. It is not so hard to proof that these points are unique.
|
The first line contains two integers *x*,<=*y* (<=-<=109<=≤<=*x*,<=*y*<=≤<=109,<=*x*<=≠<=0,<=*y*<=≠<=0).
|
Print in the single line four integers *x*1,<=*y*1,<=*x*2,<=*y*2 — the coordinates of the required points.
|
[
"10 5\n",
"-10 5\n"
] |
[
"0 15 15 0\n",
"-15 0 0 15\n"
] |
<img class="tex-graphics" src="https://espresso.codeforces.com/a9ea2088c4294ce8f23801562fda36b830df2c3f.png" style="max-width: 100.0%;max-height: 100.0%;"/>
Figure to the first sample
| 500
|
[
{
"input": "10 5",
"output": "0 15 15 0"
},
{
"input": "-10 5",
"output": "-15 0 0 15"
},
{
"input": "20 -10",
"output": "0 -30 30 0"
},
{
"input": "-10 -1000000000",
"output": "-1000000010 0 0 -1000000010"
},
{
"input": "-1000000000 -1000000000",
"output": "-2000000000 0 0 -2000000000"
},
{
"input": "1000000000 1000000000",
"output": "0 2000000000 2000000000 0"
},
{
"input": "-123131 3123141",
"output": "-3246272 0 0 3246272"
},
{
"input": "-23423 -243242423",
"output": "-243265846 0 0 -243265846"
},
{
"input": "123112 4560954",
"output": "0 4684066 4684066 0"
},
{
"input": "1321 -23131",
"output": "0 -24452 24452 0"
},
{
"input": "1000000000 999999999",
"output": "0 1999999999 1999999999 0"
},
{
"input": "54543 432423",
"output": "0 486966 486966 0"
},
{
"input": "1 1",
"output": "0 2 2 0"
},
{
"input": "-1 -1",
"output": "-2 0 0 -2"
},
{
"input": "-1 1",
"output": "-2 0 0 2"
},
{
"input": "1 -1",
"output": "0 -2 2 0"
},
{
"input": "42 -2",
"output": "0 -44 44 0"
},
{
"input": "2 -435",
"output": "0 -437 437 0"
},
{
"input": "76 -76",
"output": "0 -152 152 0"
},
{
"input": "1000000000 1",
"output": "0 1000000001 1000000001 0"
},
{
"input": "1000000000 -1",
"output": "0 -1000000001 1000000001 0"
},
{
"input": "-1000000000 1",
"output": "-1000000001 0 0 1000000001"
},
{
"input": "-1000000000 -1",
"output": "-1000000001 0 0 -1000000001"
},
{
"input": "1000000000 -999999999",
"output": "0 -1999999999 1999999999 0"
},
{
"input": "-1000000000 999999999",
"output": "-1999999999 0 0 1999999999"
},
{
"input": "-1000000000 -999999999",
"output": "-1999999999 0 0 -1999999999"
},
{
"input": "999999999 1000000000",
"output": "0 1999999999 1999999999 0"
},
{
"input": "-999999999 1000000000",
"output": "-1999999999 0 0 1999999999"
},
{
"input": "999999999 -1000000000",
"output": "0 -1999999999 1999999999 0"
},
{
"input": "-999999999 -1000000000",
"output": "-1999999999 0 0 -1999999999"
}
] | 1,686,424,754
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 92
| 0
|
import sys
input = sys.stdin.readline
x, y = [int(k) for k in input().split()]
if x > 0 and y > 0:
print(0, x + y, x + y, 0)
elif x < 0 and y > 0:
print(x - y, 0, 0, abs(x - y))
elif x > 0 and y < 0:
print(0, y - x, abs(y - x), 0)
else:
print(x + y, 0, 0, x + y)
|
Title: Vasily the Bear and Triangle
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasily the bear has a favorite rectangle, it has one vertex at point (0,<=0), and the opposite vertex at point (*x*,<=*y*). Of course, the sides of Vasya's favorite rectangle are parallel to the coordinate axes.
Vasya also loves triangles, if the triangles have one vertex at point *B*<==<=(0,<=0). That's why today he asks you to find two points *A*<==<=(*x*1,<=*y*1) and *C*<==<=(*x*2,<=*y*2), such that the following conditions hold:
- the coordinates of points: *x*1, *x*2, *y*1, *y*2 are integers. Besides, the following inequation holds: *x*1<=<<=*x*2; - the triangle formed by point *A*, *B* and *C* is rectangular and isosceles ( is right); - all points of the favorite rectangle are located inside or on the border of triangle *ABC*; - the area of triangle *ABC* is as small as possible.
Help the bear, find the required points. It is not so hard to proof that these points are unique.
Input Specification:
The first line contains two integers *x*,<=*y* (<=-<=109<=≤<=*x*,<=*y*<=≤<=109,<=*x*<=≠<=0,<=*y*<=≠<=0).
Output Specification:
Print in the single line four integers *x*1,<=*y*1,<=*x*2,<=*y*2 — the coordinates of the required points.
Demo Input:
['10 5\n', '-10 5\n']
Demo Output:
['0 15 15 0\n', '-15 0 0 15\n']
Note:
<img class="tex-graphics" src="https://espresso.codeforces.com/a9ea2088c4294ce8f23801562fda36b830df2c3f.png" style="max-width: 100.0%;max-height: 100.0%;"/>
Figure to the first sample
|
```python
import sys
input = sys.stdin.readline
x, y = [int(k) for k in input().split()]
if x > 0 and y > 0:
print(0, x + y, x + y, 0)
elif x < 0 and y > 0:
print(x - y, 0, 0, abs(x - y))
elif x > 0 and y < 0:
print(0, y - x, abs(y - x), 0)
else:
print(x + y, 0, 0, x + y)
```
| 3
|
|
245
|
A
|
System Administrator
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Polycarpus is a system administrator. There are two servers under his strict guidance — *a* and *b*. To stay informed about the servers' performance, Polycarpus executes commands "ping a" and "ping b". Each ping command sends exactly ten packets to the server specified in the argument of the command. Executing a program results in two integers *x* and *y* (*x*<=+<=*y*<==<=10; *x*,<=*y*<=≥<=0). These numbers mean that *x* packets successfully reached the corresponding server through the network and *y* packets were lost.
Today Polycarpus has performed overall *n* ping commands during his workday. Now for each server Polycarpus wants to know whether the server is "alive" or not. Polycarpus thinks that the server is "alive", if at least half of the packets that we send to this server reached it successfully along the network.
Help Polycarpus, determine for each server, whether it is "alive" or not by the given commands and their results.
|
The first line contains a single integer *n* (2<=≤<=*n*<=≤<=1000) — the number of commands Polycarpus has fulfilled. Each of the following *n* lines contains three integers — the description of the commands. The *i*-th of these lines contains three space-separated integers *t**i*, *x**i*, *y**i* (1<=≤<=*t**i*<=≤<=2; *x**i*,<=*y**i*<=≥<=0; *x**i*<=+<=*y**i*<==<=10). If *t**i*<==<=1, then the *i*-th command is "ping a", otherwise the *i*-th command is "ping b". Numbers *x**i*, *y**i* represent the result of executing this command, that is, *x**i* packets reached the corresponding server successfully and *y**i* packets were lost.
It is guaranteed that the input has at least one "ping a" command and at least one "ping b" command.
|
In the first line print string "LIVE" (without the quotes) if server *a* is "alive", otherwise print "DEAD" (without the quotes).
In the second line print the state of server *b* in the similar format.
|
[
"2\n1 5 5\n2 6 4\n",
"3\n1 0 10\n2 0 10\n1 10 0\n"
] |
[
"LIVE\nLIVE\n",
"LIVE\nDEAD\n"
] |
Consider the first test case. There 10 packets were sent to server *a*, 5 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network. Overall there were 10 packets sent to server *b*, 6 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network.
Consider the second test case. There were overall 20 packages sent to server *a*, 10 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network. Overall 10 packets were sent to server *b*, 0 of them reached it. Therefore, less than half of all packets sent to this server successfully reached it through the network.
| 0
|
[
{
"input": "2\n1 5 5\n2 6 4",
"output": "LIVE\nLIVE"
},
{
"input": "3\n1 0 10\n2 0 10\n1 10 0",
"output": "LIVE\nDEAD"
},
{
"input": "10\n1 3 7\n2 4 6\n1 2 8\n2 5 5\n2 10 0\n2 10 0\n1 8 2\n2 2 8\n2 10 0\n1 1 9",
"output": "DEAD\nLIVE"
},
{
"input": "11\n1 8 2\n1 6 4\n1 9 1\n1 7 3\n2 0 10\n2 0 10\n1 8 2\n2 2 8\n2 6 4\n2 7 3\n2 9 1",
"output": "LIVE\nDEAD"
},
{
"input": "12\n1 5 5\n1 0 10\n1 4 6\n1 2 8\n1 2 8\n1 5 5\n1 9 1\n2 9 1\n1 5 5\n1 1 9\n2 9 1\n2 7 3",
"output": "DEAD\nLIVE"
},
{
"input": "13\n1 8 2\n1 4 6\n1 5 5\n1 5 5\n2 10 0\n2 9 1\n1 3 7\n2 6 4\n2 6 4\n2 5 5\n1 7 3\n2 3 7\n2 9 1",
"output": "LIVE\nLIVE"
},
{
"input": "14\n1 7 3\n1 0 10\n1 7 3\n1 1 9\n2 2 8\n2 0 10\n1 1 9\n2 8 2\n2 6 4\n1 3 7\n1 3 7\n2 6 4\n2 1 9\n2 7 3",
"output": "DEAD\nDEAD"
}
] | 1,587,559,988
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 13
| 218
| 0
|
# The place between your comfort zone and your dream is where life takes place. Helen Keller
# by : Blue Edge - Create some chaos
n=int(input())
a=0
ax=0
b=0
bx=0
for i in range(n):
t,x,y=map(int,input().split())
if t==1:
a+=1
ax+=x
else:
b+=1
bx+=x
print("LIVE" if ax>=5*a else "DEAD")
print("LIVE" if bx>=5*b else "DEAD")
|
Title: System Administrator
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus is a system administrator. There are two servers under his strict guidance — *a* and *b*. To stay informed about the servers' performance, Polycarpus executes commands "ping a" and "ping b". Each ping command sends exactly ten packets to the server specified in the argument of the command. Executing a program results in two integers *x* and *y* (*x*<=+<=*y*<==<=10; *x*,<=*y*<=≥<=0). These numbers mean that *x* packets successfully reached the corresponding server through the network and *y* packets were lost.
Today Polycarpus has performed overall *n* ping commands during his workday. Now for each server Polycarpus wants to know whether the server is "alive" or not. Polycarpus thinks that the server is "alive", if at least half of the packets that we send to this server reached it successfully along the network.
Help Polycarpus, determine for each server, whether it is "alive" or not by the given commands and their results.
Input Specification:
The first line contains a single integer *n* (2<=≤<=*n*<=≤<=1000) — the number of commands Polycarpus has fulfilled. Each of the following *n* lines contains three integers — the description of the commands. The *i*-th of these lines contains three space-separated integers *t**i*, *x**i*, *y**i* (1<=≤<=*t**i*<=≤<=2; *x**i*,<=*y**i*<=≥<=0; *x**i*<=+<=*y**i*<==<=10). If *t**i*<==<=1, then the *i*-th command is "ping a", otherwise the *i*-th command is "ping b". Numbers *x**i*, *y**i* represent the result of executing this command, that is, *x**i* packets reached the corresponding server successfully and *y**i* packets were lost.
It is guaranteed that the input has at least one "ping a" command and at least one "ping b" command.
Output Specification:
In the first line print string "LIVE" (without the quotes) if server *a* is "alive", otherwise print "DEAD" (without the quotes).
In the second line print the state of server *b* in the similar format.
Demo Input:
['2\n1 5 5\n2 6 4\n', '3\n1 0 10\n2 0 10\n1 10 0\n']
Demo Output:
['LIVE\nLIVE\n', 'LIVE\nDEAD\n']
Note:
Consider the first test case. There 10 packets were sent to server *a*, 5 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network. Overall there were 10 packets sent to server *b*, 6 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network.
Consider the second test case. There were overall 20 packages sent to server *a*, 10 of them reached it. Therefore, at least half of all packets sent to this server successfully reached it through the network. Overall 10 packets were sent to server *b*, 0 of them reached it. Therefore, less than half of all packets sent to this server successfully reached it through the network.
|
```python
# The place between your comfort zone and your dream is where life takes place. Helen Keller
# by : Blue Edge - Create some chaos
n=int(input())
a=0
ax=0
b=0
bx=0
for i in range(n):
t,x,y=map(int,input().split())
if t==1:
a+=1
ax+=x
else:
b+=1
bx+=x
print("LIVE" if ax>=5*a else "DEAD")
print("LIVE" if bx>=5*b else "DEAD")
```
| 3
|
|
520
|
A
|
Pangram
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] | null | null |
A word or a sentence in some language is called a pangram if all the characters of the alphabet of this language appear in it at least once. Pangrams are often used to demonstrate fonts in printing or test the output devices.
You are given a string consisting of lowercase and uppercase Latin letters. Check whether this string is a pangram. We say that the string contains a letter of the Latin alphabet if this letter occurs in the string in uppercase or lowercase.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of characters in the string.
The second line contains the string. The string consists only of uppercase and lowercase Latin letters.
|
Output "YES", if the string is a pangram and "NO" otherwise.
|
[
"12\ntoosmallword\n",
"35\nTheQuickBrownFoxJumpsOverTheLazyDog\n"
] |
[
"NO\n",
"YES\n"
] |
none
| 500
|
[
{
"input": "12\ntoosmallword",
"output": "NO"
},
{
"input": "35\nTheQuickBrownFoxJumpsOverTheLazyDog",
"output": "YES"
},
{
"input": "1\na",
"output": "NO"
},
{
"input": "26\nqwertyuiopasdfghjklzxcvbnm",
"output": "YES"
},
{
"input": "26\nABCDEFGHIJKLMNOPQRSTUVWXYZ",
"output": "YES"
},
{
"input": "48\nthereisasyetinsufficientdataforameaningfulanswer",
"output": "NO"
},
{
"input": "30\nToBeOrNotToBeThatIsTheQuestion",
"output": "NO"
},
{
"input": "30\njackdawslovemybigsphinxofquarz",
"output": "NO"
},
{
"input": "31\nTHEFIVEBOXINGWIZARDSJUMPQUICKLY",
"output": "YES"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "NO"
},
{
"input": "26\nMGJYIZDKsbhpVeNFlquRTcWoAx",
"output": "YES"
},
{
"input": "26\nfWMOhAPsbIVtyUEZrGNQXDklCJ",
"output": "YES"
},
{
"input": "26\nngPMVFSThiRCwLEuyOAbKxQzDJ",
"output": "YES"
},
{
"input": "25\nnxYTzLFwzNolAumjgcAboyxAj",
"output": "NO"
},
{
"input": "26\npRWdodGdxUESvcScPGbUoooZsC",
"output": "NO"
},
{
"input": "66\nBovdMlDzTaqKllZILFVfxbLGsRnzmtVVTmqiIDTYrossLEPlmsPrkUYtWEsGHVOnFj",
"output": "NO"
},
{
"input": "100\nmKtsiDRJypUieHIkvJaMFkwaKxcCIbBszZQLIyPpCDCjhNpAnYFngLjRpnKWpKWtGnwoSteeZXuFHWQxxxOpFlNeYTwKocsXuCoa",
"output": "YES"
},
{
"input": "26\nEoqxUbsLjPytUHMiFnvcGWZdRK",
"output": "NO"
},
{
"input": "26\nvCUFRKElZOnjmXGylWQaHDiPst",
"output": "NO"
},
{
"input": "26\nWtrPuaHdXLKJMsnvQfgOiJZBEY",
"output": "NO"
},
{
"input": "26\npGiFluRteQwkaVoPszJyNBChxM",
"output": "NO"
},
{
"input": "26\ncTUpqjPmANrdbzSFhlWIoKxgVY",
"output": "NO"
},
{
"input": "26\nLndjgvAEuICHKxPwqYztosrmBN",
"output": "NO"
},
{
"input": "26\nMdaXJrCipnOZLykfqHWEStevbU",
"output": "NO"
},
{
"input": "26\nEjDWsVxfKTqGXRnUMOLYcIzPba",
"output": "NO"
},
{
"input": "26\nxKwzRMpunYaqsdfaBgJcVElTHo",
"output": "NO"
},
{
"input": "26\nnRYUQsTwCPLZkgshfEXvBdoiMa",
"output": "NO"
},
{
"input": "26\nHNCQPfJutyAlDGsvRxZWMEbIdO",
"output": "NO"
},
{
"input": "26\nDaHJIpvKznQcmUyWsTGObXRFDe",
"output": "NO"
},
{
"input": "26\nkqvAnFAiRhzlJbtyuWedXSPcOG",
"output": "NO"
},
{
"input": "26\nhlrvgdwsIOyjcmUZXtAKEqoBpF",
"output": "NO"
},
{
"input": "26\njLfXXiMhBTcAwQVReGnpKzdsYu",
"output": "NO"
},
{
"input": "26\nlNMcVuwItjxRBGAekjhyDsQOzf",
"output": "NO"
},
{
"input": "26\nRkSwbNoYldUGtAZvpFMcxhIJFE",
"output": "NO"
},
{
"input": "26\nDqspXZJTuONYieKgaHLMBwfVSC",
"output": "NO"
},
{
"input": "26\necOyUkqNljFHRVXtIpWabGMLDz",
"output": "NO"
},
{
"input": "26\nEKAvqZhBnPmVCDRlgWJfOusxYI",
"output": "NO"
},
{
"input": "26\naLbgqeYchKdMrsZxIPFvTOWNjA",
"output": "NO"
},
{
"input": "26\nxfpBLsndiqtacOCHGmeWUjRkYz",
"output": "NO"
},
{
"input": "26\nXsbRKtqleZPNIVCdfUhyagAomJ",
"output": "NO"
},
{
"input": "26\nAmVtbrwquEthZcjKPLiyDgSoNF",
"output": "NO"
},
{
"input": "26\nOhvXDcwqAUmSEPRZGnjFLiKtNB",
"output": "NO"
},
{
"input": "26\nEKWJqCFLRmstxVBdYuinpbhaOg",
"output": "NO"
},
{
"input": "26\nmnbvcxxlkjhgfdsapoiuytrewq",
"output": "NO"
},
{
"input": "26\naAbcdefghijklmnopqrstuvwxy",
"output": "NO"
},
{
"input": "30\nABCDEFGHTYRIOPLabcdefghtyriopl",
"output": "NO"
},
{
"input": "25\nabcdefghijklmnopqrstuvwxy",
"output": "NO"
},
{
"input": "26\nabcdefhijklmnopqrstVxyzABC",
"output": "NO"
},
{
"input": "25\nqwertyuiopasdfghjklxcvbnm",
"output": "NO"
},
{
"input": "34\nTheQuickBrownFoxJumpsOverTheLayDog",
"output": "NO"
},
{
"input": "26\nabcdefghigklmnopqrstuvwxyz",
"output": "NO"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxyA",
"output": "NO"
},
{
"input": "50\nqazwsxedcrfvtgbyhnujmikolQWERTYUIOASDFGHJKLZXCVBNM",
"output": "NO"
},
{
"input": "35\nTheQuickBrownFoxJumpsOverTheLasyDog",
"output": "NO"
},
{
"input": "25\nbcdefghijklmnopqrstuvwxyz",
"output": "NO"
},
{
"input": "38\nAbCdEfGhIjKlMnOpQrStVwXyZzzzzzzaaaaaaa",
"output": "NO"
},
{
"input": "26\nabcdefghiklmnopqrstvxyzABC",
"output": "NO"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxzZ",
"output": "NO"
},
{
"input": "50\nabcdefghijklmnopqrstuvwxyABCDEFGHIJKLMNOPQRSTUVWXY",
"output": "NO"
}
] | 1,694,229,007
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 15
| 93
| 0
|
n=int(input())
s=input()
se=set(s)
if(len(se)>=26):
print('YES')
else:
print('NO')
|
Title: Pangram
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A word or a sentence in some language is called a pangram if all the characters of the alphabet of this language appear in it at least once. Pangrams are often used to demonstrate fonts in printing or test the output devices.
You are given a string consisting of lowercase and uppercase Latin letters. Check whether this string is a pangram. We say that the string contains a letter of the Latin alphabet if this letter occurs in the string in uppercase or lowercase.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of characters in the string.
The second line contains the string. The string consists only of uppercase and lowercase Latin letters.
Output Specification:
Output "YES", if the string is a pangram and "NO" otherwise.
Demo Input:
['12\ntoosmallword\n', '35\nTheQuickBrownFoxJumpsOverTheLazyDog\n']
Demo Output:
['NO\n', 'YES\n']
Note:
none
|
```python
n=int(input())
s=input()
se=set(s)
if(len(se)>=26):
print('YES')
else:
print('NO')
```
| 0
|
|
417
|
E
|
Square Table
|
PROGRAMMING
| 2,400
|
[
"constructive algorithms",
"math",
"probabilities"
] | null | null |
While resting on the ship after the "Russian Code Cup" a boy named Misha invented an interesting game. He promised to give his quadrocopter to whoever will be the first one to make a rectangular table of size *n*<=×<=*m*, consisting of positive integers such that the sum of the squares of numbers for each row and each column was also a square.
Since checking the correctness of the table manually is difficult, Misha asks you to make each number in the table to not exceed 108.
|
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the size of the table.
|
Print the table that meets the condition: *n* lines containing *m* integers, separated by spaces. If there are multiple possible answers, you are allowed to print anyone. It is guaranteed that there exists at least one correct answer.
|
[
"1 1\n",
"1 2\n"
] |
[
"1",
"3 4"
] |
none
| 2,500
|
[
{
"input": "1 1",
"output": "1 "
},
{
"input": "1 2",
"output": "3 4 "
},
{
"input": "4 1",
"output": "1 \n1 \n1 \n1 "
},
{
"input": "1 4",
"output": "1 1 1 1 "
},
{
"input": "2 1",
"output": "3 \n4 "
},
{
"input": "2 4",
"output": "3 3 3 3 \n4 4 4 4 "
},
{
"input": "48 2",
"output": "3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n69 92 "
},
{
"input": "3 75",
"output": "4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 76 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 38 \n4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 76 "
},
{
"input": "33 1",
"output": "2 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n1 \n17 "
},
{
"input": "4 23",
"output": "2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 12 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 12 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 12 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 12 "
},
{
"input": "58 2",
"output": "3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n3 4 \n84 112 "
},
{
"input": "2 11",
"output": "6 3 3 3 3 3 3 3 3 3 18 \n8 4 4 4 4 4 4 4 4 4 24 "
},
{
"input": "7 14",
"output": "2 2 2 2 2 2 2 2 2 2 2 2 2 12 \n1 1 1 1 1 1 1 1 1 1 1 1 1 6 \n1 1 1 1 1 1 1 1 1 1 1 1 1 6 \n1 1 1 1 1 1 1 1 1 1 1 1 1 6 \n1 1 1 1 1 1 1 1 1 1 1 1 1 6 \n1 1 1 1 1 1 1 1 1 1 1 1 1 6 \n4 4 4 4 4 4 4 4 4 4 4 4 4 24 "
},
{
"input": "48 24",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 \n1..."
},
{
"input": "77 93",
"output": "4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 94 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 47 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1..."
},
{
"input": "77 20",
"output": "2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 18 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 \n1 1 1 ..."
},
{
"input": "30 31",
"output": "2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 \n2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 ..."
},
{
"input": "100 100",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 49 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 49 \n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1..."
}
] | 1,669,281,654
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 18
| 77
| 2,355,200
|
import math
n,m = input().split(' ')
n,m = int(n),int(m)
fix = [[1],[3,4],[1,2,2],[1,1,3,5],[1,1,1,2,3]]
a = n
parts = list()
b = a
while b > 0:
parts.append(math.floor(b**0.5))
b-=math.floor(b**0.5)**2
lcm = math.lcm(*parts)
a_out = list()
for i in range(len(parts)):
part = parts[i]
for j in range(part**2):
a_out.append(int(lcm*fix[len(parts)-1][i]/part))
a = m
parts = list()
b = a
while b > 0:
parts.append(math.floor(b**0.5))
b-=math.floor(b**0.5)**2
lcm = math.lcm(*parts)
b_out = list()
for i in range(len(parts)):
part = parts[i]
for j in range(part**2):
b_out.append(int(lcm*fix[len(parts)-1][i]/part))
for i in range(n):
tp = ''
for j in range(m):
tp += str(a_out[i]*b_out[j]) +' '
print(tp.strip())
|
Title: Square Table
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
While resting on the ship after the "Russian Code Cup" a boy named Misha invented an interesting game. He promised to give his quadrocopter to whoever will be the first one to make a rectangular table of size *n*<=×<=*m*, consisting of positive integers such that the sum of the squares of numbers for each row and each column was also a square.
Since checking the correctness of the table manually is difficult, Misha asks you to make each number in the table to not exceed 108.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the size of the table.
Output Specification:
Print the table that meets the condition: *n* lines containing *m* integers, separated by spaces. If there are multiple possible answers, you are allowed to print anyone. It is guaranteed that there exists at least one correct answer.
Demo Input:
['1 1\n', '1 2\n']
Demo Output:
['1', '3 4']
Note:
none
|
```python
import math
n,m = input().split(' ')
n,m = int(n),int(m)
fix = [[1],[3,4],[1,2,2],[1,1,3,5],[1,1,1,2,3]]
a = n
parts = list()
b = a
while b > 0:
parts.append(math.floor(b**0.5))
b-=math.floor(b**0.5)**2
lcm = math.lcm(*parts)
a_out = list()
for i in range(len(parts)):
part = parts[i]
for j in range(part**2):
a_out.append(int(lcm*fix[len(parts)-1][i]/part))
a = m
parts = list()
b = a
while b > 0:
parts.append(math.floor(b**0.5))
b-=math.floor(b**0.5)**2
lcm = math.lcm(*parts)
b_out = list()
for i in range(len(parts)):
part = parts[i]
for j in range(part**2):
b_out.append(int(lcm*fix[len(parts)-1][i]/part))
for i in range(n):
tp = ''
for j in range(m):
tp += str(a_out[i]*b_out[j]) +' '
print(tp.strip())
```
| 3
|
|
12
|
A
|
Super Agent
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Super Agent
|
2
|
256
|
There is a very secret base in Potatoland where potato mash is made according to a special recipe. The neighbours from Porridgia decided to seize this recipe and to sell it to Pilauland. For this mission they have been preparing special agent Pearlo for many years. When, finally, Pearlo learned all secrets of espionage, he penetrated into the Potatoland territory and reached the secret base.
Now he is standing at the entrance, but to get inside he need to pass combination lock. Minute ago one of the workers entered the password on the terminal and opened the door. The terminal is a square digital keyboard 3<=×<=3 with digits from 1 to 9.
Pearlo knows that the password consists from distinct digits and is probably symmetric with respect to the central button of the terminal. He has heat sensor which allowed him to detect the digits which the worker pressed. Now he wants to check whether the password entered by the worker is symmetric with respect to the central button of the terminal. This fact can Help Pearlo to reduce the number of different possible password combinations.
|
Input contains the matrix of three rows of three symbols each. Symbol «X» means that the corresponding button was pressed, and «.» means that is was not pressed. The matrix may contain no «X», also it may contain no «.».
|
Print YES if the password is symmetric with respect to the central button of the terminal and NO otherwise.
|
[
"XX.\n...\n.XX\n",
"X.X\nX..\n...\n"
] |
[
"YES\n",
"NO\n"
] |
If you are not familiar with the term «central symmetry», you may look into http://en.wikipedia.org/wiki/Central_symmetry
| 0
|
[
{
"input": "XX.\n...\n.XX",
"output": "YES"
},
{
"input": ".X.\n.X.\n.X.",
"output": "YES"
},
{
"input": "XXX\nXXX\nXXX",
"output": "YES"
},
{
"input": "XXX\nX.X\nXXX",
"output": "YES"
},
{
"input": "X..\n.X.\n..X",
"output": "YES"
},
{
"input": "...\nX.X\nX..",
"output": "NO"
},
{
"input": ".X.\nX.X\n.X.",
"output": "YES"
},
{
"input": "X.X\n.X.\nX.X",
"output": "YES"
},
{
"input": "...\n...\n..X",
"output": "NO"
},
{
"input": "XXX\n...\nXXX",
"output": "YES"
},
{
"input": "..X\nX..\n..X",
"output": "NO"
},
{
"input": ".X.\n...\nX.X",
"output": "NO"
},
{
"input": "X.X\nX.X\nX.X",
"output": "YES"
},
{
"input": ".X.\nX.X\nXX.",
"output": "NO"
},
{
"input": "...\nXXX\nXXX",
"output": "NO"
},
{
"input": "XXX\n..X\nXXX",
"output": "NO"
},
{
"input": "X..\nX.X\n.X.",
"output": "NO"
},
{
"input": "...\n..X\nXXX",
"output": "NO"
},
{
"input": "..X\nX.X\nX..",
"output": "YES"
},
{
"input": "..X\n..X\nXXX",
"output": "NO"
},
{
"input": "X..\nX..\nX..",
"output": "NO"
},
{
"input": "XXX\n.X.\nXXX",
"output": "YES"
},
{
"input": "..X\n...\nX..",
"output": "YES"
},
{
"input": "...\n...\nX..",
"output": "NO"
},
{
"input": "...\n...\n.X.",
"output": "NO"
},
{
"input": "...\n...\n..X",
"output": "NO"
},
{
"input": "...\n.X.\nX..",
"output": "NO"
}
] | 1,685,718,442
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 20
| 62
| 0
|
ls=[]
for x in range(3):
ls.append(input())
if ls[0]==ls[2][::-1]:
print("YES")
else:
print("NO")
|
Title: Super Agent
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
There is a very secret base in Potatoland where potato mash is made according to a special recipe. The neighbours from Porridgia decided to seize this recipe and to sell it to Pilauland. For this mission they have been preparing special agent Pearlo for many years. When, finally, Pearlo learned all secrets of espionage, he penetrated into the Potatoland territory and reached the secret base.
Now he is standing at the entrance, but to get inside he need to pass combination lock. Minute ago one of the workers entered the password on the terminal and opened the door. The terminal is a square digital keyboard 3<=×<=3 with digits from 1 to 9.
Pearlo knows that the password consists from distinct digits and is probably symmetric with respect to the central button of the terminal. He has heat sensor which allowed him to detect the digits which the worker pressed. Now he wants to check whether the password entered by the worker is symmetric with respect to the central button of the terminal. This fact can Help Pearlo to reduce the number of different possible password combinations.
Input Specification:
Input contains the matrix of three rows of three symbols each. Symbol «X» means that the corresponding button was pressed, and «.» means that is was not pressed. The matrix may contain no «X», also it may contain no «.».
Output Specification:
Print YES if the password is symmetric with respect to the central button of the terminal and NO otherwise.
Demo Input:
['XX.\n...\n.XX\n', 'X.X\nX..\n...\n']
Demo Output:
['YES\n', 'NO\n']
Note:
If you are not familiar with the term «central symmetry», you may look into http://en.wikipedia.org/wiki/Central_symmetry
|
```python
ls=[]
for x in range(3):
ls.append(input())
if ls[0]==ls[2][::-1]:
print("YES")
else:
print("NO")
```
| 0
|
593
|
A
|
2Char
|
PROGRAMMING
| 1,200
|
[
"brute force",
"implementation"
] | null | null |
Andrew often reads articles in his favorite magazine 2Char. The main feature of these articles is that each of them uses at most two distinct letters. Andrew decided to send an article to the magazine, but as he hasn't written any article, he just decided to take a random one from magazine 26Char. However, before sending it to the magazine 2Char, he needs to adapt the text to the format of the journal. To do so, he removes some words from the chosen article, in such a way that the remaining text can be written using no more than two distinct letters.
Since the payment depends from the number of non-space characters in the article, Andrew wants to keep the words with the maximum total length.
|
The first line of the input contains number *n* (1<=≤<=*n*<=≤<=100) — the number of words in the article chosen by Andrew. Following are *n* lines, each of them contains one word. All the words consist only of small English letters and their total length doesn't exceed 1000. The words are not guaranteed to be distinct, in this case you are allowed to use a word in the article as many times as it appears in the input.
|
Print a single integer — the maximum possible total length of words in Andrew's article.
|
[
"4\nabb\ncacc\naaa\nbbb\n",
"5\na\na\nbcbcb\ncdecdecdecdecdecde\naaaa\n"
] |
[
"9",
"6"
] |
In the first sample the optimal way to choose words is {'abb', 'aaa', 'bbb'}.
In the second sample the word 'cdecdecdecdecdecde' consists of three distinct letters, and thus cannot be used in the article. The optimal answer is {'a', 'a', 'aaaa'}.
| 250
|
[
{
"input": "4\nabb\ncacc\naaa\nbbb",
"output": "9"
},
{
"input": "5\na\na\nbcbcb\ncdecdecdecdecdecde\naaaa",
"output": "6"
},
{
"input": "1\na",
"output": "1"
},
{
"input": "2\nz\nz",
"output": "2"
},
{
"input": "5\nabcde\nfghij\nklmno\npqrst\nuvwxy",
"output": "0"
},
{
"input": "6\ngggggg\ngggggg\ngggggg\ngggggg\ngggggg\ngggggg",
"output": "36"
},
{
"input": "6\naaaaaa\naaaaaa\nbbbbbb\nbbbbbb\naaabbb\nababab",
"output": "36"
},
{
"input": "1\nabc",
"output": "0"
},
{
"input": "2\nabc\nbca",
"output": "0"
},
{
"input": "3\nab\nba\nzzz",
"output": "4"
},
{
"input": "3\nab\nba\nzzzzz",
"output": "5"
},
{
"input": "5\nzzz\nzzzz\nzz\nz\naaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "37"
},
{
"input": "26\nq\nw\ne\nr\nt\ny\nu\ni\no\np\na\ns\nd\nf\ng\nh\nj\nk\nl\nz\nx\nc\nv\nb\nn\nm",
"output": "2"
},
{
"input": "5\nzzz\nzzzz\nzz\nz\naaaaaaaaaaaaaaaaaaaaaaaaaaaf",
"output": "28"
},
{
"input": "7\npavel\nerika\nalexxxxxxx\ngracio\nzhenya\nsudarev\nchelyaba",
"output": "0"
},
{
"input": "31\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml\nfml",
"output": "0"
},
{
"input": "5\nzloyfreid\ngraciocode\nschooldiary\nkazakov\nevgesha",
"output": "0"
},
{
"input": "4\nurkop\nvisualac\ngnutl\nwtf",
"output": "0"
},
{
"input": "3\naa\nb\nccc",
"output": "5"
},
{
"input": "3\na\nbd\ncaaaaaaa",
"output": "9"
},
{
"input": "4\naa\nax\nay\nxxxx",
"output": "8"
},
{
"input": "5\nc\nbb\ne\ndd\nf",
"output": "4"
},
{
"input": "2\naaaaa\naaaaa",
"output": "10"
}
] | 1,446,656,633
| 1,133
|
Python 3
|
OK
|
TESTS
| 49
| 78
| 0
|
def valid(w,a,b):
for i in w:
if i not in [a,b]:
return False
return True
n=int(input())
words=[]
for i in range(n):
s=input()
words.append(s)
maxi=0
for i in range(26):
for j in range(26):
a,b=chr(97+i),chr(97+j)
cur=0
for w in words:
if valid(w,a,b):
cur+=len(w)
if cur>maxi:
maxi=cur
print(maxi)
|
Title: 2Char
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Andrew often reads articles in his favorite magazine 2Char. The main feature of these articles is that each of them uses at most two distinct letters. Andrew decided to send an article to the magazine, but as he hasn't written any article, he just decided to take a random one from magazine 26Char. However, before sending it to the magazine 2Char, he needs to adapt the text to the format of the journal. To do so, he removes some words from the chosen article, in such a way that the remaining text can be written using no more than two distinct letters.
Since the payment depends from the number of non-space characters in the article, Andrew wants to keep the words with the maximum total length.
Input Specification:
The first line of the input contains number *n* (1<=≤<=*n*<=≤<=100) — the number of words in the article chosen by Andrew. Following are *n* lines, each of them contains one word. All the words consist only of small English letters and their total length doesn't exceed 1000. The words are not guaranteed to be distinct, in this case you are allowed to use a word in the article as many times as it appears in the input.
Output Specification:
Print a single integer — the maximum possible total length of words in Andrew's article.
Demo Input:
['4\nabb\ncacc\naaa\nbbb\n', '5\na\na\nbcbcb\ncdecdecdecdecdecde\naaaa\n']
Demo Output:
['9', '6']
Note:
In the first sample the optimal way to choose words is {'abb', 'aaa', 'bbb'}.
In the second sample the word 'cdecdecdecdecdecde' consists of three distinct letters, and thus cannot be used in the article. The optimal answer is {'a', 'a', 'aaaa'}.
|
```python
def valid(w,a,b):
for i in w:
if i not in [a,b]:
return False
return True
n=int(input())
words=[]
for i in range(n):
s=input()
words.append(s)
maxi=0
for i in range(26):
for j in range(26):
a,b=chr(97+i),chr(97+j)
cur=0
for w in words:
if valid(w,a,b):
cur+=len(w)
if cur>maxi:
maxi=cur
print(maxi)
```
| 3
|
|
803
|
C
|
Maximal GCD
|
PROGRAMMING
| 1,900
|
[
"constructive algorithms",
"greedy",
"math"
] | null | null |
You are given positive integer number *n*. You should create such strictly increasing sequence of *k* positive numbers *a*1,<=*a*2,<=...,<=*a**k*, that their sum is equal to *n* and greatest common divisor is maximal.
Greatest common divisor of sequence is maximum of such numbers that every element of sequence is divisible by them.
If there is no possible sequence then output -1.
|
The first line consists of two numbers *n* and *k* (1<=≤<=*n*,<=*k*<=≤<=1010).
|
If the answer exists then output *k* numbers — resulting sequence. Otherwise output -1. If there are multiple answers, print any of them.
|
[
"6 3\n",
"8 2\n",
"5 3\n"
] |
[
"1 2 3\n",
"2 6\n",
"-1\n"
] |
none
| 0
|
[
{
"input": "6 3",
"output": "1 2 3"
},
{
"input": "8 2",
"output": "2 6"
},
{
"input": "5 3",
"output": "-1"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1 2",
"output": "-1"
},
{
"input": "2 1",
"output": "2"
},
{
"input": "2 10000000000",
"output": "-1"
},
{
"input": "5 1",
"output": "5"
},
{
"input": "6 2",
"output": "2 4"
},
{
"input": "24 2",
"output": "8 16"
},
{
"input": "24 3",
"output": "4 8 12"
},
{
"input": "24 4",
"output": "2 4 6 12"
},
{
"input": "24 5",
"output": "1 2 3 4 14"
},
{
"input": "479001600 2",
"output": "159667200 319334400"
},
{
"input": "479001600 3",
"output": "79833600 159667200 239500800"
},
{
"input": "479001600 4",
"output": "47900160 95800320 143700480 191600640"
},
{
"input": "479001600 5",
"output": "31933440 63866880 95800320 127733760 159667200"
},
{
"input": "479001600 6",
"output": "22809600 45619200 68428800 91238400 114048000 136857600"
},
{
"input": "3000000021 1",
"output": "3000000021"
},
{
"input": "3000000021 2",
"output": "1000000007 2000000014"
},
{
"input": "3000000021 3",
"output": "3 6 3000000012"
},
{
"input": "3000000021 4",
"output": "3 6 9 3000000003"
},
{
"input": "3000000021 50000",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "3000000021 100000",
"output": "-1"
},
{
"input": "10000000000 100",
"output": "1953125 3906250 5859375 7812500 9765625 11718750 13671875 15625000 17578125 19531250 21484375 23437500 25390625 27343750 29296875 31250000 33203125 35156250 37109375 39062500 41015625 42968750 44921875 46875000 48828125 50781250 52734375 54687500 56640625 58593750 60546875 62500000 64453125 66406250 68359375 70312500 72265625 74218750 76171875 78125000 80078125 82031250 83984375 85937500 87890625 89843750 91796875 93750000 95703125 97656250 99609375 101562500 103515625 105468750 107421875 109375000 1113281..."
},
{
"input": "10000000000 2000",
"output": "4000 8000 12000 16000 20000 24000 28000 32000 36000 40000 44000 48000 52000 56000 60000 64000 68000 72000 76000 80000 84000 88000 92000 96000 100000 104000 108000 112000 116000 120000 124000 128000 132000 136000 140000 144000 148000 152000 156000 160000 164000 168000 172000 176000 180000 184000 188000 192000 196000 200000 204000 208000 212000 216000 220000 224000 228000 232000 236000 240000 244000 248000 252000 256000 260000 264000 268000 272000 276000 280000 284000 288000 292000 296000 300000 304000 30800..."
},
{
"input": "10000000000 5000",
"output": "640 1280 1920 2560 3200 3840 4480 5120 5760 6400 7040 7680 8320 8960 9600 10240 10880 11520 12160 12800 13440 14080 14720 15360 16000 16640 17280 17920 18560 19200 19840 20480 21120 21760 22400 23040 23680 24320 24960 25600 26240 26880 27520 28160 28800 29440 30080 30720 31360 32000 32640 33280 33920 34560 35200 35840 36480 37120 37760 38400 39040 39680 40320 40960 41600 42240 42880 43520 44160 44800 45440 46080 46720 47360 48000 48640 49280 49920 50560 51200 51840 52480 53120 53760 54400 55040 55680 56320..."
},
{
"input": "10000000000 100000",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "10000000000 100000000",
"output": "-1"
},
{
"input": "10000000000 10000000000",
"output": "-1"
},
{
"input": "10000000000 100001",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "1 4000000000",
"output": "-1"
},
{
"input": "4294967296 4294967296",
"output": "-1"
},
{
"input": "71227122 9603838834",
"output": "-1"
},
{
"input": "10000000000 9603838835",
"output": "-1"
},
{
"input": "5 5999999999",
"output": "-1"
},
{
"input": "2 9324327498",
"output": "-1"
},
{
"input": "9 2",
"output": "3 6"
},
{
"input": "10000000000 4294967296",
"output": "-1"
},
{
"input": "1 3500000000",
"output": "-1"
},
{
"input": "10000000000 4000000000",
"output": "-1"
},
{
"input": "2000 9324327498",
"output": "-1"
},
{
"input": "10000000000 8589934592",
"output": "-1"
},
{
"input": "5000150001 100001",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "10000000000 3037000500",
"output": "-1"
},
{
"input": "9400000000 9324327498",
"output": "-1"
},
{
"input": "10000000000 3307000500",
"output": "-1"
},
{
"input": "2 4000000000",
"output": "-1"
},
{
"input": "1000 4294967295",
"output": "-1"
},
{
"input": "36 3",
"output": "6 12 18"
},
{
"input": "2147483648 4294967296",
"output": "-1"
},
{
"input": "999 4294967295",
"output": "-1"
},
{
"input": "10000000000 130000",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "10000000000 140000",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "10000000000 6074001000",
"output": "-1"
},
{
"input": "12344321 1",
"output": "12344321"
},
{
"input": "2 2",
"output": "-1"
},
{
"input": "28 7",
"output": "1 2 3 4 5 6 7"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1 2",
"output": "-1"
},
{
"input": "1 3",
"output": "-1"
},
{
"input": "1 4",
"output": "-1"
},
{
"input": "1 5",
"output": "-1"
},
{
"input": "1 6",
"output": "-1"
},
{
"input": "1 7",
"output": "-1"
},
{
"input": "1 8",
"output": "-1"
},
{
"input": "1 9",
"output": "-1"
},
{
"input": "1 10",
"output": "-1"
},
{
"input": "2 1",
"output": "2"
},
{
"input": "2 2",
"output": "-1"
},
{
"input": "2 3",
"output": "-1"
},
{
"input": "2 4",
"output": "-1"
},
{
"input": "2 5",
"output": "-1"
},
{
"input": "2 6",
"output": "-1"
},
{
"input": "2 7",
"output": "-1"
},
{
"input": "2 8",
"output": "-1"
},
{
"input": "2 9",
"output": "-1"
},
{
"input": "2 10",
"output": "-1"
},
{
"input": "3 1",
"output": "3"
},
{
"input": "3 2",
"output": "1 2"
},
{
"input": "3 3",
"output": "-1"
},
{
"input": "3 4",
"output": "-1"
},
{
"input": "3 5",
"output": "-1"
},
{
"input": "3 6",
"output": "-1"
},
{
"input": "3 7",
"output": "-1"
},
{
"input": "3 8",
"output": "-1"
},
{
"input": "3 9",
"output": "-1"
},
{
"input": "3 10",
"output": "-1"
},
{
"input": "4 1",
"output": "4"
},
{
"input": "4 2",
"output": "1 3"
},
{
"input": "4 3",
"output": "-1"
},
{
"input": "4 4",
"output": "-1"
},
{
"input": "4 5",
"output": "-1"
},
{
"input": "4 6",
"output": "-1"
},
{
"input": "4 7",
"output": "-1"
},
{
"input": "4 8",
"output": "-1"
},
{
"input": "4 9",
"output": "-1"
},
{
"input": "4 10",
"output": "-1"
},
{
"input": "5 1",
"output": "5"
},
{
"input": "5 2",
"output": "1 4"
},
{
"input": "5 3",
"output": "-1"
},
{
"input": "5 4",
"output": "-1"
},
{
"input": "5 5",
"output": "-1"
},
{
"input": "5 6",
"output": "-1"
},
{
"input": "5 7",
"output": "-1"
},
{
"input": "5 8",
"output": "-1"
},
{
"input": "5 9",
"output": "-1"
},
{
"input": "5 10",
"output": "-1"
},
{
"input": "6 1",
"output": "6"
},
{
"input": "6 2",
"output": "2 4"
},
{
"input": "6 3",
"output": "1 2 3"
},
{
"input": "6 4",
"output": "-1"
},
{
"input": "6 5",
"output": "-1"
},
{
"input": "6 6",
"output": "-1"
},
{
"input": "6 7",
"output": "-1"
},
{
"input": "6 8",
"output": "-1"
},
{
"input": "6 9",
"output": "-1"
},
{
"input": "6 10",
"output": "-1"
},
{
"input": "7 1",
"output": "7"
},
{
"input": "7 2",
"output": "1 6"
},
{
"input": "7 3",
"output": "1 2 4"
},
{
"input": "7 4",
"output": "-1"
},
{
"input": "7 5",
"output": "-1"
},
{
"input": "7 6",
"output": "-1"
},
{
"input": "7 7",
"output": "-1"
},
{
"input": "7 8",
"output": "-1"
},
{
"input": "7 9",
"output": "-1"
},
{
"input": "7 10",
"output": "-1"
},
{
"input": "8 1",
"output": "8"
},
{
"input": "8 2",
"output": "2 6"
},
{
"input": "8 3",
"output": "1 2 5"
},
{
"input": "8 4",
"output": "-1"
},
{
"input": "8 5",
"output": "-1"
},
{
"input": "8 6",
"output": "-1"
},
{
"input": "8 7",
"output": "-1"
},
{
"input": "8 8",
"output": "-1"
},
{
"input": "8 9",
"output": "-1"
},
{
"input": "8 10",
"output": "-1"
}
] | 1,563,201,610
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 0
| 108
| 0
|
from sys import stdin, stdout
n, k = stdin.readline().split(' ')
n = int(n)
k = int(k)
if((k*(k+1))/2 > n) :
stdout.write(str(-1) + '\n')
else :
sum = (k*(k+1))/2
b = n/sum
b = n/b
a = n/b
i = 1
while(i < k) :
stdout.write(str(i*a) + " ")
b -= i
i += 1
stdout.write(str(b*a )+ "\n")
|
Title: Maximal GCD
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given positive integer number *n*. You should create such strictly increasing sequence of *k* positive numbers *a*1,<=*a*2,<=...,<=*a**k*, that their sum is equal to *n* and greatest common divisor is maximal.
Greatest common divisor of sequence is maximum of such numbers that every element of sequence is divisible by them.
If there is no possible sequence then output -1.
Input Specification:
The first line consists of two numbers *n* and *k* (1<=≤<=*n*,<=*k*<=≤<=1010).
Output Specification:
If the answer exists then output *k* numbers — resulting sequence. Otherwise output -1. If there are multiple answers, print any of them.
Demo Input:
['6 3\n', '8 2\n', '5 3\n']
Demo Output:
['1 2 3\n', '2 6\n', '-1\n']
Note:
none
|
```python
from sys import stdin, stdout
n, k = stdin.readline().split(' ')
n = int(n)
k = int(k)
if((k*(k+1))/2 > n) :
stdout.write(str(-1) + '\n')
else :
sum = (k*(k+1))/2
b = n/sum
b = n/b
a = n/b
i = 1
while(i < k) :
stdout.write(str(i*a) + " ")
b -= i
i += 1
stdout.write(str(b*a )+ "\n")
```
| 0
|
|
914
|
A
|
Perfect Squares
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation",
"math"
] | null | null |
Given an array *a*1,<=*a*2,<=...,<=*a**n* of *n* integers, find the largest number in the array that is not a perfect square.
A number *x* is said to be a perfect square if there exists an integer *y* such that *x*<==<=*y*2.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of elements in the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=106<=≤<=*a**i*<=≤<=106) — the elements of the array.
It is guaranteed that at least one element of the array is not a perfect square.
|
Print the largest number in the array which is not a perfect square. It is guaranteed that an answer always exists.
|
[
"2\n4 2\n",
"8\n1 2 4 8 16 32 64 576\n"
] |
[
"2\n",
"32\n"
] |
In the first sample case, 4 is a perfect square, so the largest number in the array that is not a perfect square is 2.
| 500
|
[
{
"input": "2\n4 2",
"output": "2"
},
{
"input": "8\n1 2 4 8 16 32 64 576",
"output": "32"
},
{
"input": "3\n-1 -4 -9",
"output": "-1"
},
{
"input": "5\n918375 169764 598796 76602 538757",
"output": "918375"
},
{
"input": "5\n804610 765625 2916 381050 93025",
"output": "804610"
},
{
"input": "5\n984065 842724 127449 525625 573049",
"output": "984065"
},
{
"input": "2\n226505 477482",
"output": "477482"
},
{
"input": "2\n370881 659345",
"output": "659345"
},
{
"input": "2\n4 5",
"output": "5"
},
{
"input": "2\n3 4",
"output": "3"
},
{
"input": "2\n999999 1000000",
"output": "999999"
},
{
"input": "3\n-1 -2 -3",
"output": "-1"
},
{
"input": "2\n-1000000 1000000",
"output": "-1000000"
},
{
"input": "2\n-1 0",
"output": "-1"
},
{
"input": "1\n2",
"output": "2"
},
{
"input": "1\n-1",
"output": "-1"
},
{
"input": "35\n-871271 -169147 -590893 -400197 -476793 0 -15745 -890852 -124052 -631140 -238569 -597194 -147909 -928925 -587628 -569656 -581425 -963116 -665954 -506797 -196044 -309770 -701921 -926257 -152426 -991371 -624235 -557143 -689886 -59804 -549134 -107407 -182016 -24153 -607462",
"output": "-15745"
},
{
"input": "16\n-882343 -791322 0 -986738 -415891 -823354 -840236 -552554 -760908 -331993 -549078 -863759 -913261 -937429 -257875 -602322",
"output": "-257875"
},
{
"input": "71\n908209 289 44521 240100 680625 274576 212521 91809 506944 499849 3844 15376 592900 58081 240100 984064 732736 257049 600625 180625 130321 580644 261121 75625 46225 853776 485809 700569 817216 268324 293764 528529 25921 399424 175561 99856 295936 20736 611524 13924 470596 574564 5329 15376 676 431649 145161 697225 41616 550564 514089 9409 227529 1681 839056 3721 552049 465124 38809 197136 659344 214369 998001 44944 3844 186624 362404 -766506 739600 10816 299209",
"output": "-766506"
},
{
"input": "30\n192721 -950059 -734656 625 247009 -423468 318096 622521 678976 777924 1444 748303 27556 62001 795664 89401 221841 -483208 467856 477109 196 -461813 831744 772641 574564 -519370 861184 67600 -717966 -259259",
"output": "748303"
},
{
"input": "35\n628849 962361 436921 944784 444889 29241 -514806 171396 685584 -823202 -929730 6982 198025 783225 552049 -957165 782287 -659167 -414846 695556 -336330 41616 963781 71289 119639 952576 -346713 178929 232324 121802 393266 841 649636 179555 998001",
"output": "963781"
},
{
"input": "53\n280988 756430 -515570 -248578 170649 -21608 642677 216770 827291 589500 940901 216097 -118956 -919104 -319264 -761585 289479 499613 588276 883036 480518 -323196 -274570 -406556 -381484 -956025 702135 -445274 -783543 136593 153664 897473 352651 737974 -21123 -284944 501734 898033 604429 624138 40804 248782 -786059 -304592 -209210 -312904 419820 -328648 -47331 -919227 -280955 104827 877304",
"output": "940901"
},
{
"input": "15\n256 -227055 427717 827239 462070 66049 987533 -175306 -552810 -867915 -408251 -693957 -972981 -245827 896904",
"output": "987533"
},
{
"input": "3\n-1 1 0",
"output": "-1"
},
{
"input": "2\n0 -5",
"output": "-5"
},
{
"input": "3\n-1 -2 0",
"output": "-1"
},
{
"input": "2\n-5 0",
"output": "-5"
},
{
"input": "1\n-439",
"output": "-439"
},
{
"input": "1\n-1000000",
"output": "-1000000"
},
{
"input": "1\n-917455",
"output": "-917455"
},
{
"input": "3\n1 1 -1",
"output": "-1"
},
{
"input": "2\n131073 1",
"output": "131073"
},
{
"input": "2\n99999 3",
"output": "99999"
},
{
"input": "2\n-524272 -1000000",
"output": "-524272"
},
{
"input": "2\n15 131073",
"output": "131073"
}
] | 1,650,906,689
| 2,147,483,647
|
PyPy 3-64
|
RUNTIME_ERROR
|
TESTS
| 2
| 61
| 3,379,200
|
import sys
input = sys.stdin.readline
n = int(input())
a = sorted([int(i) for i in input().split()])
for i in range(n-1, -1, -1):
if (a[i]**0.5) % 1 != 0:
ans = a[i]
break
print(ans)
|
Title: Perfect Squares
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Given an array *a*1,<=*a*2,<=...,<=*a**n* of *n* integers, find the largest number in the array that is not a perfect square.
A number *x* is said to be a perfect square if there exists an integer *y* such that *x*<==<=*y*2.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of elements in the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=106<=≤<=*a**i*<=≤<=106) — the elements of the array.
It is guaranteed that at least one element of the array is not a perfect square.
Output Specification:
Print the largest number in the array which is not a perfect square. It is guaranteed that an answer always exists.
Demo Input:
['2\n4 2\n', '8\n1 2 4 8 16 32 64 576\n']
Demo Output:
['2\n', '32\n']
Note:
In the first sample case, 4 is a perfect square, so the largest number in the array that is not a perfect square is 2.
|
```python
import sys
input = sys.stdin.readline
n = int(input())
a = sorted([int(i) for i in input().split()])
for i in range(n-1, -1, -1):
if (a[i]**0.5) % 1 != 0:
ans = a[i]
break
print(ans)
```
| -1
|
|
630
|
A
|
Again Twenty Five!
|
PROGRAMMING
| 800
|
[
"number theory"
] | null | null |
The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and get last two digits of the number. Yes, of course, *n* can be rather big, and one cannot find the power using a calculator, but we need people who are able to think, not just follow the instructions."
Could you pass the interview in the machine vision company in IT City?
|
The only line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=2·1018) — the power in which you need to raise number 5.
|
Output the last two digits of 5*n* without spaces between them.
|
[
"2\n"
] |
[
"25"
] |
none
| 0
|
[
{
"input": "2",
"output": "25"
},
{
"input": "7",
"output": "25"
},
{
"input": "1000000000000000000",
"output": "25"
},
{
"input": "2000000000000000000",
"output": "25"
},
{
"input": "987654321012345678",
"output": "25"
}
] | 1,688,635,090
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 5
| 15
| 0
|
print(25)
# Thu Jul 06 2023 12:17:28 GMT+0300 (Moscow Standard Time)
# Thu Jul 06 2023 12:17:33 GMT+0300 (Moscow Standard Time)
# Thu Jul 06 2023 12:17:48 GMT+0300 (Moscow Standard Time)
|
Title: Again Twenty Five!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and get last two digits of the number. Yes, of course, *n* can be rather big, and one cannot find the power using a calculator, but we need people who are able to think, not just follow the instructions."
Could you pass the interview in the machine vision company in IT City?
Input Specification:
The only line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=2·1018) — the power in which you need to raise number 5.
Output Specification:
Output the last two digits of 5*n* without spaces between them.
Demo Input:
['2\n']
Demo Output:
['25']
Note:
none
|
```python
print(25)
# Thu Jul 06 2023 12:17:28 GMT+0300 (Moscow Standard Time)
# Thu Jul 06 2023 12:17:33 GMT+0300 (Moscow Standard Time)
# Thu Jul 06 2023 12:17:48 GMT+0300 (Moscow Standard Time)
```
| 3
|
|
202
|
A
|
LLPS
|
PROGRAMMING
| 800
|
[
"binary search",
"bitmasks",
"brute force",
"greedy",
"implementation",
"strings"
] | null | null |
This problem's actual name, "Lexicographically Largest Palindromic Subsequence" is too long to fit into the page headline.
You are given string *s* consisting of lowercase English letters only. Find its lexicographically largest palindromic subsequence.
We'll call a non-empty string *s*[*p*1*p*2... *p**k*] = *s**p*1*s**p*2... *s**p**k* (1 <=≤<= *p*1<=<<=*p*2<=<<=...<=<<=*p**k* <=≤<= |*s*|) a subsequence of string *s* = *s*1*s*2... *s*|*s*|, where |*s*| is the length of string *s*. For example, strings "abcb", "b" and "abacaba" are subsequences of string "abacaba".
String *x* = *x*1*x*2... *x*|*x*| is lexicographically larger than string *y* = *y*1*y*2... *y*|*y*| if either |*x*| > |*y*| and *x*1<==<=*y*1, *x*2<==<=*y*2, ...,<=*x*|*y*|<==<=*y*|*y*|, or there exists such number *r* (*r*<=<<=|*x*|, *r*<=<<=|*y*|) that *x*1<==<=*y*1, *x*2<==<=*y*2, ..., *x**r*<==<=*y**r* and *x**r*<=<=+<=<=1<=><=*y**r*<=<=+<=<=1. Characters in the strings are compared according to their ASCII codes. For example, string "ranger" is lexicographically larger than string "racecar" and string "poster" is lexicographically larger than string "post".
String *s* = *s*1*s*2... *s*|*s*| is a palindrome if it matches string *rev*(*s*) = *s*|*s*|*s*|*s*|<=-<=1... *s*1. In other words, a string is a palindrome if it reads the same way from left to right and from right to left. For example, palindromic strings are "racecar", "refer" and "z".
|
The only input line contains a non-empty string *s* consisting of lowercase English letters only. Its length does not exceed 10.
|
Print the lexicographically largest palindromic subsequence of string *s*.
|
[
"radar\n",
"bowwowwow\n",
"codeforces\n",
"mississipp\n"
] |
[
"rr\n",
"wwwww\n",
"s\n",
"ssss\n"
] |
Among all distinct subsequences of string "radar" the following ones are palindromes: "a", "d", "r", "aa", "rr", "ada", "rar", "rdr", "raar" and "radar". The lexicographically largest of them is "rr".
| 500
|
[
{
"input": "radar",
"output": "rr"
},
{
"input": "bowwowwow",
"output": "wwwww"
},
{
"input": "codeforces",
"output": "s"
},
{
"input": "mississipp",
"output": "ssss"
},
{
"input": "tourist",
"output": "u"
},
{
"input": "romka",
"output": "r"
},
{
"input": "helloworld",
"output": "w"
},
{
"input": "zzzzzzzazz",
"output": "zzzzzzzzz"
},
{
"input": "testcase",
"output": "tt"
},
{
"input": "hahahahaha",
"output": "hhhhh"
},
{
"input": "abbbbbbbbb",
"output": "bbbbbbbbb"
},
{
"input": "zaz",
"output": "zz"
},
{
"input": "aza",
"output": "z"
},
{
"input": "dcbaedcba",
"output": "e"
},
{
"input": "abcdeabcd",
"output": "e"
},
{
"input": "edcbabcde",
"output": "ee"
},
{
"input": "aaaaaaaaab",
"output": "b"
},
{
"input": "testzzzzzz",
"output": "zzzzzz"
},
{
"input": "zzzzzzwait",
"output": "zzzzzz"
},
{
"input": "rrrrrqponm",
"output": "rrrrr"
},
{
"input": "zzyzyy",
"output": "zzz"
},
{
"input": "aababb",
"output": "bbb"
},
{
"input": "zanzibar",
"output": "zz"
},
{
"input": "hhgfedcbaa",
"output": "hh"
},
{
"input": "aabcdefghh",
"output": "hh"
},
{
"input": "aruaru",
"output": "uu"
},
{
"input": "uraura",
"output": "uu"
},
{
"input": "aru",
"output": "u"
},
{
"input": "aburvabur",
"output": "v"
},
{
"input": "ura",
"output": "u"
},
{
"input": "eurottat",
"output": "u"
},
{
"input": "referee",
"output": "rr"
},
{
"input": "joking",
"output": "o"
},
{
"input": "seriously",
"output": "y"
},
{
"input": "sets",
"output": "t"
},
{
"input": "test",
"output": "tt"
},
{
"input": "klmgameklm",
"output": "mmm"
},
{
"input": "dfkjafdkdd",
"output": "kk"
},
{
"input": "zzzzzzzzzz",
"output": "zzzzzzzzzz"
},
{
"input": "aaaaaaaaaa",
"output": "aaaaaaaaaa"
},
{
"input": "buzz",
"output": "zz"
},
{
"input": "b",
"output": "b"
},
{
"input": "y",
"output": "y"
},
{
"input": "yy",
"output": "yy"
},
{
"input": "zz",
"output": "zz"
},
{
"input": "bb",
"output": "bb"
},
{
"input": "aa",
"output": "aa"
},
{
"input": "a",
"output": "a"
},
{
"input": "z",
"output": "z"
},
{
"input": "zz",
"output": "zz"
},
{
"input": "zzazazzzaz",
"output": "zzzzzzz"
},
{
"input": "hellhellhe",
"output": "llll"
},
{
"input": "hellohello",
"output": "oo"
},
{
"input": "refer",
"output": "rr"
}
] | 1,692,965,104
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 92
| 0
|
s = ''.join(sorted(list(input()), reverse=True))
print(s[:s.rfind(s[0]) + 1])
|
Title: LLPS
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
This problem's actual name, "Lexicographically Largest Palindromic Subsequence" is too long to fit into the page headline.
You are given string *s* consisting of lowercase English letters only. Find its lexicographically largest palindromic subsequence.
We'll call a non-empty string *s*[*p*1*p*2... *p**k*] = *s**p*1*s**p*2... *s**p**k* (1 <=≤<= *p*1<=<<=*p*2<=<<=...<=<<=*p**k* <=≤<= |*s*|) a subsequence of string *s* = *s*1*s*2... *s*|*s*|, where |*s*| is the length of string *s*. For example, strings "abcb", "b" and "abacaba" are subsequences of string "abacaba".
String *x* = *x*1*x*2... *x*|*x*| is lexicographically larger than string *y* = *y*1*y*2... *y*|*y*| if either |*x*| > |*y*| and *x*1<==<=*y*1, *x*2<==<=*y*2, ...,<=*x*|*y*|<==<=*y*|*y*|, or there exists such number *r* (*r*<=<<=|*x*|, *r*<=<<=|*y*|) that *x*1<==<=*y*1, *x*2<==<=*y*2, ..., *x**r*<==<=*y**r* and *x**r*<=<=+<=<=1<=><=*y**r*<=<=+<=<=1. Characters in the strings are compared according to their ASCII codes. For example, string "ranger" is lexicographically larger than string "racecar" and string "poster" is lexicographically larger than string "post".
String *s* = *s*1*s*2... *s*|*s*| is a palindrome if it matches string *rev*(*s*) = *s*|*s*|*s*|*s*|<=-<=1... *s*1. In other words, a string is a palindrome if it reads the same way from left to right and from right to left. For example, palindromic strings are "racecar", "refer" and "z".
Input Specification:
The only input line contains a non-empty string *s* consisting of lowercase English letters only. Its length does not exceed 10.
Output Specification:
Print the lexicographically largest palindromic subsequence of string *s*.
Demo Input:
['radar\n', 'bowwowwow\n', 'codeforces\n', 'mississipp\n']
Demo Output:
['rr\n', 'wwwww\n', 's\n', 'ssss\n']
Note:
Among all distinct subsequences of string "radar" the following ones are palindromes: "a", "d", "r", "aa", "rr", "ada", "rar", "rdr", "raar" and "radar". The lexicographically largest of them is "rr".
|
```python
s = ''.join(sorted(list(input()), reverse=True))
print(s[:s.rfind(s[0]) + 1])
```
| 3
|
|
716
|
A
|
Crazy Computer
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
ZS the Coder is coding on a crazy computer. If you don't type in a word for a *c* consecutive seconds, everything you typed disappear!
More formally, if you typed a word at second *a* and then the next word at second *b*, then if *b*<=-<=*a*<=≤<=*c*, just the new word is appended to other words on the screen. If *b*<=-<=*a*<=><=*c*, then everything on the screen disappears and after that the word you have typed appears on the screen.
For example, if *c*<==<=5 and you typed words at seconds 1,<=3,<=8,<=14,<=19,<=20 then at the second 8 there will be 3 words on the screen. After that, everything disappears at the second 13 because nothing was typed. At the seconds 14 and 19 another two words are typed, and finally, at the second 20, one more word is typed, and a total of 3 words remain on the screen.
You're given the times when ZS the Coder typed the words. Determine how many words remain on the screen after he finished typing everything.
|
The first line contains two integers *n* and *c* (1<=≤<=*n*<=≤<=100<=000,<=1<=≤<=*c*<=≤<=109) — the number of words ZS the Coder typed and the crazy computer delay respectively.
The next line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t*1<=<<=*t*2<=<<=...<=<<=*t**n*<=≤<=109), where *t**i* denotes the second when ZS the Coder typed the *i*-th word.
|
Print a single positive integer, the number of words that remain on the screen after all *n* words was typed, in other words, at the second *t**n*.
|
[
"6 5\n1 3 8 14 19 20\n",
"6 1\n1 3 5 7 9 10\n"
] |
[
"3",
"2"
] |
The first sample is already explained in the problem statement.
For the second sample, after typing the first word at the second 1, it disappears because the next word is typed at the second 3 and 3 - 1 > 1. Similarly, only 1 word will remain at the second 9. Then, a word is typed at the second 10, so there will be two words on the screen, as the old word won't disappear because 10 - 9 ≤ 1.
| 500
|
[
{
"input": "6 5\n1 3 8 14 19 20",
"output": "3"
},
{
"input": "6 1\n1 3 5 7 9 10",
"output": "2"
},
{
"input": "1 1\n1000000000",
"output": "1"
},
{
"input": "5 5\n1 7 12 13 14",
"output": "4"
},
{
"input": "2 1000000000\n1 1000000000",
"output": "2"
},
{
"input": "3 5\n1 10 20",
"output": "1"
},
{
"input": "3 10\n1 2 3",
"output": "3"
},
{
"input": "2 1\n1 100",
"output": "1"
},
{
"input": "3 1\n1 2 10",
"output": "1"
},
{
"input": "2 1\n1 2",
"output": "2"
}
] | 1,632,668,847
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 46
| 6,963,200
|
n,c = list(map(int, input().split()))
a = list(map(int, input().split()))
a.insert(0, a[0])
a.insert(-1, a[-1])
total = 0
for i in range(1, n+2):
if a[i] - a[i-1] <= c:
total += 1
else:
total = 0
print(total)
|
Title: Crazy Computer
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
ZS the Coder is coding on a crazy computer. If you don't type in a word for a *c* consecutive seconds, everything you typed disappear!
More formally, if you typed a word at second *a* and then the next word at second *b*, then if *b*<=-<=*a*<=≤<=*c*, just the new word is appended to other words on the screen. If *b*<=-<=*a*<=><=*c*, then everything on the screen disappears and after that the word you have typed appears on the screen.
For example, if *c*<==<=5 and you typed words at seconds 1,<=3,<=8,<=14,<=19,<=20 then at the second 8 there will be 3 words on the screen. After that, everything disappears at the second 13 because nothing was typed. At the seconds 14 and 19 another two words are typed, and finally, at the second 20, one more word is typed, and a total of 3 words remain on the screen.
You're given the times when ZS the Coder typed the words. Determine how many words remain on the screen after he finished typing everything.
Input Specification:
The first line contains two integers *n* and *c* (1<=≤<=*n*<=≤<=100<=000,<=1<=≤<=*c*<=≤<=109) — the number of words ZS the Coder typed and the crazy computer delay respectively.
The next line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t*1<=<<=*t*2<=<<=...<=<<=*t**n*<=≤<=109), where *t**i* denotes the second when ZS the Coder typed the *i*-th word.
Output Specification:
Print a single positive integer, the number of words that remain on the screen after all *n* words was typed, in other words, at the second *t**n*.
Demo Input:
['6 5\n1 3 8 14 19 20\n', '6 1\n1 3 5 7 9 10\n']
Demo Output:
['3', '2']
Note:
The first sample is already explained in the problem statement.
For the second sample, after typing the first word at the second 1, it disappears because the next word is typed at the second 3 and 3 - 1 > 1. Similarly, only 1 word will remain at the second 9. Then, a word is typed at the second 10, so there will be two words on the screen, as the old word won't disappear because 10 - 9 ≤ 1.
|
```python
n,c = list(map(int, input().split()))
a = list(map(int, input().split()))
a.insert(0, a[0])
a.insert(-1, a[-1])
total = 0
for i in range(1, n+2):
if a[i] - a[i-1] <= c:
total += 1
else:
total = 0
print(total)
```
| 0
|
|
220
|
B
|
Little Elephant and Array
|
PROGRAMMING
| 1,800
|
[
"constructive algorithms",
"data structures"
] | null | null |
The Little Elephant loves playing with arrays. He has array *a*, consisting of *n* positive integers, indexed from 1 to *n*. Let's denote the number with index *i* as *a**i*.
Additionally the Little Elephant has *m* queries to the array, each query is characterised by a pair of integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*). For each query *l**j*,<=*r**j* the Little Elephant has to count, how many numbers *x* exist, such that number *x* occurs exactly *x* times among numbers *a**l**j*,<=*a**l**j*<=+<=1,<=...,<=*a**r**j*.
Help the Little Elephant to count the answers to all queries.
|
The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=105) — the size of array *a* and the number of queries to it. The next line contains *n* space-separated positive integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109). Next *m* lines contain descriptions of queries, one per line. The *j*-th of these lines contains the description of the *j*-th query as two space-separated integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*).
|
In *m* lines print *m* integers — the answers to the queries. The *j*-th line should contain the answer to the *j*-th query.
|
[
"7 2\n3 1 2 2 3 3 7\n1 7\n3 4\n"
] |
[
"3\n1\n"
] |
none
| 1,000
|
[
{
"input": "7 2\n3 1 2 2 3 3 7\n1 7\n3 4",
"output": "3\n1"
},
{
"input": "6 6\n1 2 2 3 3 3\n1 2\n2 2\n1 3\n2 4\n4 6\n1 6",
"output": "1\n0\n2\n1\n1\n3"
},
{
"input": "1 2\n1\n1 1\n1 1",
"output": "1\n1"
},
{
"input": "1 1\n1000000000\n1 1",
"output": "0"
}
] | 1,688,332,346
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 33
| 1,778
| 68,608,000
|
from sys import stdin
from collections import defaultdict
def lmap(function, iterable): return list(map(function, iterable))
def line(): return stdin.readline().strip()
def rd(converter): return converter(line())
def rl(converter, delimeter = None): return lmap(converter, line().split(delimeter))
def rls(num_lines, converter): return [rd(converter) for i in range(num_lines)]
def rg(num_lines, converter, delimeter = None): return [rl(converter,delimeter) for i in range(num_lines)]
MOD = 10**9+7
MULTIPLE_CASES = 0
def main():
N,M = rl(int)
A = rl(int)
Q = rg(M,int)
idxs = defaultdict(list)
ls = defaultdict(list)
for l,r in Q: ls[r-1].append(l-1)
enoughs = []
ans = {}
for i,num in enumerate(A):
idxs[num].append(i)
if len(idxs[num]) == num: enoughs.append(num)
for l in ls[i]: ans[l,i] = sum((0 if len(idxs[enough]) == enough else (idxs[enough][-(enough+1)]+1)) <= l <= idxs[enough][-enough] for enough in enoughs if len(idxs[enough]) >= enough)
for l,r in Q: print(ans[l-1,r-1])
for i in range(rd(int) if MULTIPLE_CASES else 1): main()
|
Title: Little Elephant and Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant loves playing with arrays. He has array *a*, consisting of *n* positive integers, indexed from 1 to *n*. Let's denote the number with index *i* as *a**i*.
Additionally the Little Elephant has *m* queries to the array, each query is characterised by a pair of integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*). For each query *l**j*,<=*r**j* the Little Elephant has to count, how many numbers *x* exist, such that number *x* occurs exactly *x* times among numbers *a**l**j*,<=*a**l**j*<=+<=1,<=...,<=*a**r**j*.
Help the Little Elephant to count the answers to all queries.
Input Specification:
The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=105) — the size of array *a* and the number of queries to it. The next line contains *n* space-separated positive integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109). Next *m* lines contain descriptions of queries, one per line. The *j*-th of these lines contains the description of the *j*-th query as two space-separated integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*).
Output Specification:
In *m* lines print *m* integers — the answers to the queries. The *j*-th line should contain the answer to the *j*-th query.
Demo Input:
['7 2\n3 1 2 2 3 3 7\n1 7\n3 4\n']
Demo Output:
['3\n1\n']
Note:
none
|
```python
from sys import stdin
from collections import defaultdict
def lmap(function, iterable): return list(map(function, iterable))
def line(): return stdin.readline().strip()
def rd(converter): return converter(line())
def rl(converter, delimeter = None): return lmap(converter, line().split(delimeter))
def rls(num_lines, converter): return [rd(converter) for i in range(num_lines)]
def rg(num_lines, converter, delimeter = None): return [rl(converter,delimeter) for i in range(num_lines)]
MOD = 10**9+7
MULTIPLE_CASES = 0
def main():
N,M = rl(int)
A = rl(int)
Q = rg(M,int)
idxs = defaultdict(list)
ls = defaultdict(list)
for l,r in Q: ls[r-1].append(l-1)
enoughs = []
ans = {}
for i,num in enumerate(A):
idxs[num].append(i)
if len(idxs[num]) == num: enoughs.append(num)
for l in ls[i]: ans[l,i] = sum((0 if len(idxs[enough]) == enough else (idxs[enough][-(enough+1)]+1)) <= l <= idxs[enough][-enough] for enough in enoughs if len(idxs[enough]) >= enough)
for l,r in Q: print(ans[l-1,r-1])
for i in range(rd(int) if MULTIPLE_CASES else 1): main()
```
| 3
|
|
552
|
B
|
Vanya and Books
|
PROGRAMMING
| 1,200
|
[
"implementation",
"math"
] | null | null |
Vanya got an important task — he should enumerate books in the library and label each book with its number. Each of the *n* books should be assigned with a number from 1 to *n*. Naturally, distinct books should be assigned distinct numbers.
Vanya wants to know how many digits he will have to write down as he labels the books.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=109) — the number of books in the library.
|
Print the number of digits needed to number all the books.
|
[
"13\n",
"4\n"
] |
[
"17\n",
"4\n"
] |
Note to the first test. The books get numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, which totals to 17 digits.
Note to the second sample. The books get numbers 1, 2, 3, 4, which totals to 4 digits.
| 1,000
|
[
{
"input": "13",
"output": "17"
},
{
"input": "4",
"output": "4"
},
{
"input": "100",
"output": "192"
},
{
"input": "99",
"output": "189"
},
{
"input": "1000000000",
"output": "8888888899"
},
{
"input": "1000000",
"output": "5888896"
},
{
"input": "999",
"output": "2889"
},
{
"input": "55",
"output": "101"
},
{
"input": "222222222",
"output": "1888888896"
},
{
"input": "8",
"output": "8"
},
{
"input": "13",
"output": "17"
},
{
"input": "313",
"output": "831"
},
{
"input": "1342",
"output": "4261"
},
{
"input": "30140",
"output": "139594"
},
{
"input": "290092",
"output": "1629447"
},
{
"input": "2156660",
"output": "13985516"
},
{
"input": "96482216",
"output": "760746625"
},
{
"input": "943006819",
"output": "8375950269"
},
{
"input": "1",
"output": "1"
},
{
"input": "7",
"output": "7"
},
{
"input": "35",
"output": "61"
},
{
"input": "996",
"output": "2880"
},
{
"input": "6120",
"output": "23373"
},
{
"input": "30660",
"output": "142194"
},
{
"input": "349463",
"output": "1985673"
},
{
"input": "8171970",
"output": "56092686"
},
{
"input": "36123011",
"output": "277872985"
},
{
"input": "986747865",
"output": "8769619683"
},
{
"input": "9",
"output": "9"
},
{
"input": "10",
"output": "11"
},
{
"input": "11",
"output": "13"
},
{
"input": "101",
"output": "195"
},
{
"input": "1000",
"output": "2893"
},
{
"input": "1001",
"output": "2897"
},
{
"input": "9999",
"output": "38889"
},
{
"input": "10000",
"output": "38894"
},
{
"input": "10001",
"output": "38899"
},
{
"input": "99999",
"output": "488889"
},
{
"input": "100000",
"output": "488895"
},
{
"input": "100001",
"output": "488901"
},
{
"input": "999999",
"output": "5888889"
},
{
"input": "1000001",
"output": "5888903"
},
{
"input": "9999999",
"output": "68888889"
},
{
"input": "10000000",
"output": "68888897"
},
{
"input": "10000001",
"output": "68888905"
},
{
"input": "99999999",
"output": "788888889"
},
{
"input": "100000000",
"output": "788888898"
},
{
"input": "100000001",
"output": "788888907"
},
{
"input": "999999999",
"output": "8888888889"
},
{
"input": "95",
"output": "181"
},
{
"input": "995",
"output": "2877"
},
{
"input": "9995",
"output": "38873"
},
{
"input": "99995",
"output": "488869"
},
{
"input": "999999995",
"output": "8888888853"
},
{
"input": "999999998",
"output": "8888888880"
}
] | 1,695,963,406
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 15
| 0
|
x=input()
y=len(x)
z=0
for i in range(1,y):
z=z+9*(10**(i-1))*(i+1)
u=int(x)-int("9"*(y-1))
print(z+u)
|
Title: Vanya and Books
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vanya got an important task — he should enumerate books in the library and label each book with its number. Each of the *n* books should be assigned with a number from 1 to *n*. Naturally, distinct books should be assigned distinct numbers.
Vanya wants to know how many digits he will have to write down as he labels the books.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=109) — the number of books in the library.
Output Specification:
Print the number of digits needed to number all the books.
Demo Input:
['13\n', '4\n']
Demo Output:
['17\n', '4\n']
Note:
Note to the first test. The books get numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, which totals to 17 digits.
Note to the second sample. The books get numbers 1, 2, 3, 4, which totals to 4 digits.
|
```python
x=input()
y=len(x)
z=0
for i in range(1,y):
z=z+9*(10**(i-1))*(i+1)
u=int(x)-int("9"*(y-1))
print(z+u)
```
| 0
|
|
368
|
B
|
Sereja and Suffixes
|
PROGRAMMING
| 1,100
|
[
"data structures",
"dp"
] | null | null |
Sereja has an array *a*, consisting of *n* integers *a*1, *a*2, ..., *a**n*. The boy cannot sit and do nothing, he decided to study an array. Sereja took a piece of paper and wrote out *m* integers *l*1,<=*l*2,<=...,<=*l**m* (1<=≤<=*l**i*<=≤<=*n*). For each number *l**i* he wants to know how many distinct numbers are staying on the positions *l**i*, *l**i*<=+<=1, ..., *n*. Formally, he want to find the number of distinct numbers among *a**l**i*,<=*a**l**i*<=+<=1,<=...,<=*a**n*.?
Sereja wrote out the necessary array elements but the array was so large and the boy was so pressed for time. Help him, find the answer for the described question for each *l**i*.
|
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=105) — the array elements.
Next *m* lines contain integers *l*1,<=*l*2,<=...,<=*l**m*. The *i*-th line contains integer *l**i* (1<=≤<=*l**i*<=≤<=*n*).
|
Print *m* lines — on the *i*-th line print the answer to the number *l**i*.
|
[
"10 10\n1 2 3 4 1 2 3 4 100000 99999\n1\n2\n3\n4\n5\n6\n7\n8\n9\n10\n"
] |
[
"6\n6\n6\n6\n6\n5\n4\n3\n2\n1\n"
] |
none
| 1,000
|
[
{
"input": "10 10\n1 2 3 4 1 2 3 4 100000 99999\n1\n2\n3\n4\n5\n6\n7\n8\n9\n10",
"output": "6\n6\n6\n6\n6\n5\n4\n3\n2\n1"
},
{
"input": "8 3\n8 6 4 3 4 2 4 8\n6\n4\n2",
"output": "3\n4\n5"
},
{
"input": "7 10\n1 3 8 6 2 2 7\n4\n2\n6\n3\n4\n4\n6\n2\n7\n4",
"output": "3\n5\n2\n4\n3\n3\n2\n5\n1\n3"
},
{
"input": "10 2\n2 6 5 7 2 2 3 2 4 8\n1\n2",
"output": "7\n7"
},
{
"input": "7 1\n68346 10956 76708 23018 84063 34833 80407\n1",
"output": "7"
},
{
"input": "2 2\n8 4\n1\n1",
"output": "2\n2"
},
{
"input": "1 5\n5\n1\n1\n1\n1\n1",
"output": "1\n1\n1\n1\n1"
},
{
"input": "4 7\n3 1 4 2\n4\n1\n2\n3\n2\n4\n4",
"output": "1\n4\n3\n2\n3\n1\n1"
},
{
"input": "4 3\n9 1 7 1\n1\n4\n2",
"output": "3\n1\n2"
},
{
"input": "8 3\n9280 6676 2720 6172 8329 10413 3975 1394\n5\n6\n7",
"output": "4\n3\n2"
},
{
"input": "1 1\n1\n1",
"output": "1"
}
] | 1,698,225,450
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 296
| 20,787,200
|
n, m = map(int, input().split())
nums = list(map(int, input().split()))
indexes = [int(input()) - 1 for i in range(m)]
min_index = min(indexes)
distinct_nums = {}
outputs = [0]
i = n - 1
while i >= min_index:
if distinct_nums.get(nums[i]):
outputs.append(outputs[-1])
else:
distinct_nums[nums[i]] = 1
outputs.append(outputs[-1] + 1)
i -= 1
outputs.reverse()
for i in indexes:
print(outputs[i - min_index])
|
Title: Sereja and Suffixes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sereja has an array *a*, consisting of *n* integers *a*1, *a*2, ..., *a**n*. The boy cannot sit and do nothing, he decided to study an array. Sereja took a piece of paper and wrote out *m* integers *l*1,<=*l*2,<=...,<=*l**m* (1<=≤<=*l**i*<=≤<=*n*). For each number *l**i* he wants to know how many distinct numbers are staying on the positions *l**i*, *l**i*<=+<=1, ..., *n*. Formally, he want to find the number of distinct numbers among *a**l**i*,<=*a**l**i*<=+<=1,<=...,<=*a**n*.?
Sereja wrote out the necessary array elements but the array was so large and the boy was so pressed for time. Help him, find the answer for the described question for each *l**i*.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=105) — the array elements.
Next *m* lines contain integers *l*1,<=*l*2,<=...,<=*l**m*. The *i*-th line contains integer *l**i* (1<=≤<=*l**i*<=≤<=*n*).
Output Specification:
Print *m* lines — on the *i*-th line print the answer to the number *l**i*.
Demo Input:
['10 10\n1 2 3 4 1 2 3 4 100000 99999\n1\n2\n3\n4\n5\n6\n7\n8\n9\n10\n']
Demo Output:
['6\n6\n6\n6\n6\n5\n4\n3\n2\n1\n']
Note:
none
|
```python
n, m = map(int, input().split())
nums = list(map(int, input().split()))
indexes = [int(input()) - 1 for i in range(m)]
min_index = min(indexes)
distinct_nums = {}
outputs = [0]
i = n - 1
while i >= min_index:
if distinct_nums.get(nums[i]):
outputs.append(outputs[-1])
else:
distinct_nums[nums[i]] = 1
outputs.append(outputs[-1] + 1)
i -= 1
outputs.reverse()
for i in indexes:
print(outputs[i - min_index])
```
| 3
|
|
349
|
A
|
Cinema Line
|
PROGRAMMING
| 1,100
|
[
"greedy",
"implementation"
] | null | null |
The new "Die Hard" movie has just been released! There are *n* people at the cinema box office standing in a huge line. Each of them has a single 100, 50 or 25 ruble bill. A "Die Hard" ticket costs 25 rubles. Can the booking clerk sell a ticket to each person and give the change if he initially has no money and sells the tickets strictly in the order people follow in the line?
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of people in the line. The next line contains *n* integers, each of them equals 25, 50 or 100 — the values of the bills the people have. The numbers are given in the order from the beginning of the line (at the box office) to the end of the line.
|
Print "YES" (without the quotes) if the booking clerk can sell a ticket to each person and give the change. Otherwise print "NO".
|
[
"4\n25 25 50 50\n",
"2\n25 100\n",
"4\n50 50 25 25\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "4\n25 25 50 50",
"output": "YES"
},
{
"input": "2\n25 100",
"output": "NO"
},
{
"input": "4\n50 50 25 25",
"output": "NO"
},
{
"input": "3\n25 50 100",
"output": "NO"
},
{
"input": "10\n25 25 25 25 25 25 25 25 25 25",
"output": "YES"
},
{
"input": "10\n50 50 50 50 50 50 50 50 50 50",
"output": "NO"
},
{
"input": "10\n100 100 100 100 100 100 100 100 100 100",
"output": "NO"
},
{
"input": "7\n25 25 25 25 50 100 50",
"output": "YES"
},
{
"input": "2\n25 25",
"output": "YES"
},
{
"input": "3\n50 100 100",
"output": "NO"
},
{
"input": "3\n25 50 50",
"output": "NO"
},
{
"input": "2\n50 25",
"output": "NO"
},
{
"input": "14\n25 25 25 25 25 25 25 50 50 50 100 100 100 100",
"output": "NO"
},
{
"input": "5\n25 25 25 100 100",
"output": "NO"
},
{
"input": "7\n25 50 25 50 25 50 100",
"output": "NO"
},
{
"input": "5\n25 50 25 50 100",
"output": "NO"
},
{
"input": "5\n25 25 50 50 50",
"output": "NO"
},
{
"input": "5\n25 25 50 100 50",
"output": "NO"
},
{
"input": "5\n25 25 50 50 100",
"output": "NO"
},
{
"input": "1\n50",
"output": "NO"
}
] | 1,677,609,185
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 62
| 0
|
def sol():
length = int(input())
dollars = [int(x) for x in input().split()]
twenty_five = 0
fifty = 0
for i in range(len(dollars)):
if dollars[i] == 25: twenty_five += 1
elif dollars[i] == 50:
if twenty_five > 0:
twenty_five -= (dollars[i] // 25 - 1)
fifty += 1
else: return "NO"
else:
cash = dollars[i]
if fifty > 0:
cash = dollars[i] // 50
cash -= 1
fifty -= (cash)
if twenty_five > 0:
cash = cash // 25
if cash - 1 <= twenty_five:
twenty_five -= (cash - 1)
else: return "NO"
return "YES"
print (sol())
|
Title: Cinema Line
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The new "Die Hard" movie has just been released! There are *n* people at the cinema box office standing in a huge line. Each of them has a single 100, 50 or 25 ruble bill. A "Die Hard" ticket costs 25 rubles. Can the booking clerk sell a ticket to each person and give the change if he initially has no money and sells the tickets strictly in the order people follow in the line?
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of people in the line. The next line contains *n* integers, each of them equals 25, 50 or 100 — the values of the bills the people have. The numbers are given in the order from the beginning of the line (at the box office) to the end of the line.
Output Specification:
Print "YES" (without the quotes) if the booking clerk can sell a ticket to each person and give the change. Otherwise print "NO".
Demo Input:
['4\n25 25 50 50\n', '2\n25 100\n', '4\n50 50 25 25\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
def sol():
length = int(input())
dollars = [int(x) for x in input().split()]
twenty_five = 0
fifty = 0
for i in range(len(dollars)):
if dollars[i] == 25: twenty_five += 1
elif dollars[i] == 50:
if twenty_five > 0:
twenty_five -= (dollars[i] // 25 - 1)
fifty += 1
else: return "NO"
else:
cash = dollars[i]
if fifty > 0:
cash = dollars[i] // 50
cash -= 1
fifty -= (cash)
if twenty_five > 0:
cash = cash // 25
if cash - 1 <= twenty_five:
twenty_five -= (cash - 1)
else: return "NO"
return "YES"
print (sol())
```
| 0
|
|
900
|
A
|
Find Extra One
|
PROGRAMMING
| 800
|
[
"geometry",
"implementation"
] | null | null |
You have *n* distinct points on a plane, none of them lie on *OY* axis. Check that there is a point after removal of which the remaining points are located on one side of the *OY* axis.
|
The first line contains a single positive integer *n* (2<=≤<=*n*<=≤<=105).
The following *n* lines contain coordinates of the points. The *i*-th of these lines contains two single integers *x**i* and *y**i* (|*x**i*|,<=|*y**i*|<=≤<=109, *x**i*<=≠<=0). No two points coincide.
|
Print "Yes" if there is such a point, "No" — otherwise.
You can print every letter in any case (upper or lower).
|
[
"3\n1 1\n-1 -1\n2 -1\n",
"4\n1 1\n2 2\n-1 1\n-2 2\n",
"3\n1 2\n2 1\n4 60\n"
] |
[
"Yes",
"No",
"Yes"
] |
In the first example the second point can be removed.
In the second example there is no suitable for the condition point.
In the third example any point can be removed.
| 500
|
[
{
"input": "3\n1 1\n-1 -1\n2 -1",
"output": "Yes"
},
{
"input": "4\n1 1\n2 2\n-1 1\n-2 2",
"output": "No"
},
{
"input": "3\n1 2\n2 1\n4 60",
"output": "Yes"
},
{
"input": "10\n1 1\n2 2\n3 3\n4 4\n5 5\n6 6\n7 7\n8 8\n9 9\n-1 -1",
"output": "Yes"
},
{
"input": "2\n1000000000 -1000000000\n1000000000 1000000000",
"output": "Yes"
},
{
"input": "23\n-1 1\n-1 2\n-2 4\n-7 -8\n-3 3\n-9 -14\n-5 3\n-6 2\n-7 11\n-4 4\n-8 5\n1 1\n-1 -1\n-1 -2\n-2 -4\n-7 8\n-3 -3\n-9 14\n-5 -3\n-6 -2\n-7 -11\n-4 -4\n-8 -5",
"output": "Yes"
},
{
"input": "4\n-1000000000 -1000000000\n1000000000 1000000000\n-1000000000 1000000000\n1000000000 -1000000000",
"output": "No"
},
{
"input": "2\n-1000000000 1000000000\n-1000000000 -1000000000",
"output": "Yes"
},
{
"input": "5\n-1 -1\n-2 2\n2 2\n2 -2\n3 2",
"output": "No"
},
{
"input": "2\n1 0\n-1 0",
"output": "Yes"
},
{
"input": "4\n-1 1\n-1 2\n-1 3\n-1 4",
"output": "Yes"
},
{
"input": "2\n-1 0\n1 0",
"output": "Yes"
},
{
"input": "2\n1 2\n-1 2",
"output": "Yes"
},
{
"input": "2\n8 0\n7 0",
"output": "Yes"
},
{
"input": "6\n-1 0\n-2 0\n-1 -1\n-1 5\n1 0\n1 1",
"output": "No"
},
{
"input": "4\n1 0\n2 0\n-1 0\n-2 0",
"output": "No"
},
{
"input": "4\n-2 0\n-1 0\n1 0\n2 0",
"output": "No"
},
{
"input": "2\n1 1\n-1 1",
"output": "Yes"
},
{
"input": "4\n-1 0\n-2 0\n1 0\n2 0",
"output": "No"
},
{
"input": "2\n4 3\n-4 -2",
"output": "Yes"
},
{
"input": "4\n1 0\n2 0\n-1 1\n-1 2",
"output": "No"
},
{
"input": "5\n1 1\n2 1\n3 1\n-1 1\n-2 1",
"output": "No"
},
{
"input": "2\n1 1\n-1 -1",
"output": "Yes"
},
{
"input": "4\n1 2\n1 0\n1 -2\n-1 2",
"output": "Yes"
},
{
"input": "5\n-2 3\n-3 3\n4 2\n3 2\n1 2",
"output": "No"
},
{
"input": "3\n2 0\n3 0\n4 0",
"output": "Yes"
},
{
"input": "5\n-3 1\n-2 1\n-1 1\n1 1\n2 1",
"output": "No"
},
{
"input": "4\n-3 0\n1 0\n2 0\n3 0",
"output": "Yes"
},
{
"input": "2\n1 0\n-1 1",
"output": "Yes"
},
{
"input": "3\n-1 0\n1 0\n2 0",
"output": "Yes"
},
{
"input": "5\n1 0\n3 0\n-1 0\n-6 0\n-4 1",
"output": "No"
},
{
"input": "5\n-1 2\n-2 2\n-3 1\n1 2\n2 3",
"output": "No"
},
{
"input": "3\n1 0\n-1 0\n-2 0",
"output": "Yes"
},
{
"input": "4\n1 0\n2 0\n3 1\n4 1",
"output": "Yes"
},
{
"input": "4\n1 0\n1 2\n1 3\n-1 5",
"output": "Yes"
},
{
"input": "4\n2 2\n2 5\n-2 3\n-2 0",
"output": "No"
},
{
"input": "4\n1 1\n-1 1\n-1 0\n-1 -1",
"output": "Yes"
},
{
"input": "4\n2 0\n3 0\n-3 -3\n-3 -4",
"output": "No"
},
{
"input": "4\n-1 0\n-2 0\n-3 0\n-4 0",
"output": "Yes"
},
{
"input": "2\n-1 1\n1 1",
"output": "Yes"
},
{
"input": "5\n1 1\n2 2\n3 3\n-4 -4\n-5 -5",
"output": "No"
},
{
"input": "5\n2 0\n3 0\n4 0\n5 0\n6 0",
"output": "Yes"
},
{
"input": "2\n-1 2\n1 2",
"output": "Yes"
},
{
"input": "4\n1 1\n2 1\n-3 0\n-4 0",
"output": "No"
},
{
"input": "4\n-1 0\n-2 0\n3 0\n4 0",
"output": "No"
},
{
"input": "3\n3 0\n2 0\n1 0",
"output": "Yes"
},
{
"input": "4\n-2 0\n-3 0\n1 -1\n3 1",
"output": "No"
},
{
"input": "3\n-1 -1\n1 1\n2 2",
"output": "Yes"
},
{
"input": "4\n-2 0\n-1 0\n2 0\n1 0",
"output": "No"
},
{
"input": "2\n-3 5\n3 5",
"output": "Yes"
},
{
"input": "2\n-1 5\n1 5",
"output": "Yes"
},
{
"input": "4\n2 0\n3 0\n-2 0\n-3 0",
"output": "No"
},
{
"input": "3\n-1 1\n1 1\n1 -1",
"output": "Yes"
},
{
"input": "2\n1 0\n2 0",
"output": "Yes"
},
{
"input": "4\n-1 1\n-2 1\n2 -1\n3 -1",
"output": "No"
},
{
"input": "5\n1 0\n2 0\n3 0\n-1 0\n-2 0",
"output": "No"
},
{
"input": "4\n-3 0\n-4 0\n-5 0\n-6 0",
"output": "Yes"
},
{
"input": "6\n-3 0\n-2 0\n-1 0\n1 0\n2 0\n3 0",
"output": "No"
},
{
"input": "4\n5 0\n5 1\n6 0\n6 1",
"output": "Yes"
}
] | 1,513,144,964
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 71
| 327
| 5,632,000
|
import sys
n = int(input())
i = 0
count_pos = 0
count_neg = 0
while i < n:
if int(input().split()[0]) > 0:
count_pos += 1
else:
count_neg += 1
if i > 2 and min([count_pos, count_neg]) > 1:
print('No')
sys.exit()
i += 1
print('Yes')
|
Title: Find Extra One
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have *n* distinct points on a plane, none of them lie on *OY* axis. Check that there is a point after removal of which the remaining points are located on one side of the *OY* axis.
Input Specification:
The first line contains a single positive integer *n* (2<=≤<=*n*<=≤<=105).
The following *n* lines contain coordinates of the points. The *i*-th of these lines contains two single integers *x**i* and *y**i* (|*x**i*|,<=|*y**i*|<=≤<=109, *x**i*<=≠<=0). No two points coincide.
Output Specification:
Print "Yes" if there is such a point, "No" — otherwise.
You can print every letter in any case (upper or lower).
Demo Input:
['3\n1 1\n-1 -1\n2 -1\n', '4\n1 1\n2 2\n-1 1\n-2 2\n', '3\n1 2\n2 1\n4 60\n']
Demo Output:
['Yes', 'No', 'Yes']
Note:
In the first example the second point can be removed.
In the second example there is no suitable for the condition point.
In the third example any point can be removed.
|
```python
import sys
n = int(input())
i = 0
count_pos = 0
count_neg = 0
while i < n:
if int(input().split()[0]) > 0:
count_pos += 1
else:
count_neg += 1
if i > 2 and min([count_pos, count_neg]) > 1:
print('No')
sys.exit()
i += 1
print('Yes')
```
| 3
|
|
151
|
A
|
Soft Drinking
|
PROGRAMMING
| 800
|
[
"implementation",
"math"
] | null | null |
This winter is so cold in Nvodsk! A group of *n* friends decided to buy *k* bottles of a soft drink called "Take-It-Light" to warm up a bit. Each bottle has *l* milliliters of the drink. Also they bought *c* limes and cut each of them into *d* slices. After that they found *p* grams of salt.
To make a toast, each friend needs *nl* milliliters of the drink, a slice of lime and *np* grams of salt. The friends want to make as many toasts as they can, provided they all drink the same amount. How many toasts can each friend make?
|
The first and only line contains positive integers *n*, *k*, *l*, *c*, *d*, *p*, *nl*, *np*, not exceeding 1000 and no less than 1. The numbers are separated by exactly one space.
|
Print a single integer — the number of toasts each friend can make.
|
[
"3 4 5 10 8 100 3 1\n",
"5 100 10 1 19 90 4 3\n",
"10 1000 1000 25 23 1 50 1\n"
] |
[
"2\n",
"3\n",
"0\n"
] |
A comment to the first sample:
Overall the friends have 4 * 5 = 20 milliliters of the drink, it is enough to make 20 / 3 = 6 toasts. The limes are enough for 10 * 8 = 80 toasts and the salt is enough for 100 / 1 = 100 toasts. However, there are 3 friends in the group, so the answer is *min*(6, 80, 100) / 3 = 2.
| 500
|
[
{
"input": "3 4 5 10 8 100 3 1",
"output": "2"
},
{
"input": "5 100 10 1 19 90 4 3",
"output": "3"
},
{
"input": "10 1000 1000 25 23 1 50 1",
"output": "0"
},
{
"input": "1 7 4 5 5 8 3 2",
"output": "4"
},
{
"input": "2 3 3 5 5 10 1 3",
"output": "1"
},
{
"input": "2 6 4 5 6 5 1 3",
"output": "0"
},
{
"input": "1 7 3 5 3 6 2 1",
"output": "6"
},
{
"input": "2 4 5 4 5 7 3 2",
"output": "1"
},
{
"input": "2 3 6 5 7 8 2 1",
"output": "4"
},
{
"input": "1 4 5 5 3 10 3 1",
"output": "6"
},
{
"input": "1 4 6 7 3 5 1 3",
"output": "1"
},
{
"input": "1 6 5 5 5 8 3 1",
"output": "8"
},
{
"input": "1 7 5 3 3 9 2 1",
"output": "9"
},
{
"input": "3 5 3 7 6 10 3 1",
"output": "1"
},
{
"input": "3 6 3 5 3 6 3 1",
"output": "2"
},
{
"input": "1 7 5 5 5 5 2 2",
"output": "2"
},
{
"input": "2 5 3 5 6 9 2 1",
"output": "3"
},
{
"input": "3 4 3 5 3 6 2 1",
"output": "2"
},
{
"input": "1 5 5 4 7 6 3 1",
"output": "6"
},
{
"input": "2 3 7 6 5 9 3 1",
"output": "3"
},
{
"input": "2 6 5 3 3 8 1 1",
"output": "4"
},
{
"input": "2 4 7 3 4 10 2 1",
"output": "5"
},
{
"input": "1 1000 1000 1000 1000 1000 1 1",
"output": "1000"
},
{
"input": "17 1000 1000 1000 1000 1000 3 7",
"output": "8"
},
{
"input": "115 1000 1000 1000 1000 1000 17 15",
"output": "0"
},
{
"input": "1 587 981 1 2 1 1 1",
"output": "1"
},
{
"input": "1 1 2 1 2 2 1 1",
"output": "2"
}
] | 1,692,174,967
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 27
| 92
| 0
|
n,k,l,c,d,p,nl,np = tuple(map(int,input().strip(" ").split(" ")))
klbynl = (k*l)/nl
cd = c * d
npl = p / np
print(int(min(klbynl,cd,npl)/n))
|
Title: Soft Drinking
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
This winter is so cold in Nvodsk! A group of *n* friends decided to buy *k* bottles of a soft drink called "Take-It-Light" to warm up a bit. Each bottle has *l* milliliters of the drink. Also they bought *c* limes and cut each of them into *d* slices. After that they found *p* grams of salt.
To make a toast, each friend needs *nl* milliliters of the drink, a slice of lime and *np* grams of salt. The friends want to make as many toasts as they can, provided they all drink the same amount. How many toasts can each friend make?
Input Specification:
The first and only line contains positive integers *n*, *k*, *l*, *c*, *d*, *p*, *nl*, *np*, not exceeding 1000 and no less than 1. The numbers are separated by exactly one space.
Output Specification:
Print a single integer — the number of toasts each friend can make.
Demo Input:
['3 4 5 10 8 100 3 1\n', '5 100 10 1 19 90 4 3\n', '10 1000 1000 25 23 1 50 1\n']
Demo Output:
['2\n', '3\n', '0\n']
Note:
A comment to the first sample:
Overall the friends have 4 * 5 = 20 milliliters of the drink, it is enough to make 20 / 3 = 6 toasts. The limes are enough for 10 * 8 = 80 toasts and the salt is enough for 100 / 1 = 100 toasts. However, there are 3 friends in the group, so the answer is *min*(6, 80, 100) / 3 = 2.
|
```python
n,k,l,c,d,p,nl,np = tuple(map(int,input().strip(" ").split(" ")))
klbynl = (k*l)/nl
cd = c * d
npl = p / np
print(int(min(klbynl,cd,npl)/n))
```
| 3
|
|
599
|
A
|
Patrick and Shopping
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house.
Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled.
|
The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≤<=*d*1,<=*d*2,<=*d*3<=≤<=108) — the lengths of the paths.
- *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops.
|
Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house.
|
[
"10 20 30\n",
"1 1 5\n"
] |
[
"60\n",
"4\n"
] |
The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
| 500
|
[
{
"input": "10 20 30",
"output": "60"
},
{
"input": "1 1 5",
"output": "4"
},
{
"input": "100 33 34",
"output": "134"
},
{
"input": "777 777 777",
"output": "2331"
},
{
"input": "2 2 8",
"output": "8"
},
{
"input": "12 34 56",
"output": "92"
},
{
"input": "789 101112 131415",
"output": "203802"
},
{
"input": "27485716 99999999 35182",
"output": "55041796"
},
{
"input": "1 293548 5",
"output": "12"
},
{
"input": "12059 259855 5874875",
"output": "543828"
},
{
"input": "46981 105809 585858",
"output": "305580"
},
{
"input": "9889 1221 2442",
"output": "7326"
},
{
"input": "100500 200600 300700",
"output": "601800"
},
{
"input": "318476 318476 318476",
"output": "955428"
},
{
"input": "23985 3353 75633",
"output": "54676"
},
{
"input": "120 1298 2222",
"output": "2836"
},
{
"input": "98437 23487 666672",
"output": "243848"
},
{
"input": "100000000 100000000 100000000",
"output": "300000000"
},
{
"input": "2 5 2",
"output": "8"
},
{
"input": "1 1000 1",
"output": "4"
},
{
"input": "1 100000000 1",
"output": "4"
}
] | 1,660,657,104
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 21
| 62
| 0
|
x,y,z=map(int,input().split())
print(min([(x+y+z),(2*x+2*y),(2*x+2*z),(2*z+2*y)]))
|
Title: Patrick and Shopping
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house.
Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled.
Input Specification:
The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≤<=*d*1,<=*d*2,<=*d*3<=≤<=108) — the lengths of the paths.
- *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops.
Output Specification:
Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house.
Demo Input:
['10 20 30\n', '1 1 5\n']
Demo Output:
['60\n', '4\n']
Note:
The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
|
```python
x,y,z=map(int,input().split())
print(min([(x+y+z),(2*x+2*y),(2*x+2*z),(2*z+2*y)]))
```
| 3
|
|
996
|
A
|
Hit the Lottery
|
PROGRAMMING
| 800
|
[
"dp",
"greedy"
] | null | null |
Allen has a LOT of money. He has $n$ dollars in the bank. For security reasons, he wants to withdraw it in cash (we will not disclose the reasons here). The denominations for dollar bills are $1$, $5$, $10$, $20$, $100$. What is the minimum number of bills Allen could receive after withdrawing his entire balance?
|
The first and only line of input contains a single integer $n$ ($1 \le n \le 10^9$).
|
Output the minimum number of bills that Allen could receive.
|
[
"125\n",
"43\n",
"1000000000\n"
] |
[
"3\n",
"5\n",
"10000000\n"
] |
In the first sample case, Allen can withdraw this with a $100$ dollar bill, a $20$ dollar bill, and a $5$ dollar bill. There is no way for Allen to receive $125$ dollars in one or two bills.
In the second sample case, Allen can withdraw two $20$ dollar bills and three $1$ dollar bills.
In the third sample case, Allen can withdraw $100000000$ (ten million!) $100$ dollar bills.
| 500
|
[
{
"input": "125",
"output": "3"
},
{
"input": "43",
"output": "5"
},
{
"input": "1000000000",
"output": "10000000"
},
{
"input": "4",
"output": "4"
},
{
"input": "5",
"output": "1"
},
{
"input": "1",
"output": "1"
},
{
"input": "74",
"output": "8"
},
{
"input": "31",
"output": "3"
},
{
"input": "59",
"output": "8"
},
{
"input": "79",
"output": "9"
},
{
"input": "7",
"output": "3"
},
{
"input": "55",
"output": "4"
},
{
"input": "40",
"output": "2"
},
{
"input": "719",
"output": "13"
},
{
"input": "847",
"output": "13"
},
{
"input": "225",
"output": "4"
},
{
"input": "4704",
"output": "51"
},
{
"input": "1132",
"output": "15"
},
{
"input": "7811",
"output": "80"
},
{
"input": "7981",
"output": "84"
},
{
"input": "82655",
"output": "830"
},
{
"input": "6364",
"output": "70"
},
{
"input": "74611",
"output": "748"
},
{
"input": "45391",
"output": "459"
},
{
"input": "620448",
"output": "6210"
},
{
"input": "265145",
"output": "2654"
},
{
"input": "671704",
"output": "6721"
},
{
"input": "365173",
"output": "3658"
},
{
"input": "7130872",
"output": "71314"
},
{
"input": "9628747",
"output": "96292"
},
{
"input": "8898399",
"output": "88993"
},
{
"input": "9497953",
"output": "94985"
},
{
"input": "19070947",
"output": "190714"
},
{
"input": "20185520",
"output": "201856"
},
{
"input": "91402248",
"output": "914028"
},
{
"input": "27035533",
"output": "270360"
},
{
"input": "22717528",
"output": "227180"
},
{
"input": "24403439",
"output": "244041"
},
{
"input": "163565555",
"output": "1635659"
},
{
"input": "152541908",
"output": "1525423"
},
{
"input": "668439837",
"output": "6684403"
},
{
"input": "20",
"output": "1"
},
{
"input": "999999999",
"output": "10000009"
},
{
"input": "10",
"output": "1"
},
{
"input": "7",
"output": "3"
},
{
"input": "6",
"output": "2"
},
{
"input": "99999999",
"output": "1000009"
},
{
"input": "1000001",
"output": "10001"
},
{
"input": "2521",
"output": "27"
}
] | 1,691,422,829
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 2
| 1,000
| 0
|
n = int(input())
coins = [100, 20, 10, 5, 1]
count = 0
while n > 0:
for i in coins:
if i <= n:
n -= i
count += 1
break
print(count)
|
Title: Hit the Lottery
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Allen has a LOT of money. He has $n$ dollars in the bank. For security reasons, he wants to withdraw it in cash (we will not disclose the reasons here). The denominations for dollar bills are $1$, $5$, $10$, $20$, $100$. What is the minimum number of bills Allen could receive after withdrawing his entire balance?
Input Specification:
The first and only line of input contains a single integer $n$ ($1 \le n \le 10^9$).
Output Specification:
Output the minimum number of bills that Allen could receive.
Demo Input:
['125\n', '43\n', '1000000000\n']
Demo Output:
['3\n', '5\n', '10000000\n']
Note:
In the first sample case, Allen can withdraw this with a $100$ dollar bill, a $20$ dollar bill, and a $5$ dollar bill. There is no way for Allen to receive $125$ dollars in one or two bills.
In the second sample case, Allen can withdraw two $20$ dollar bills and three $1$ dollar bills.
In the third sample case, Allen can withdraw $100000000$ (ten million!) $100$ dollar bills.
|
```python
n = int(input())
coins = [100, 20, 10, 5, 1]
count = 0
while n > 0:
for i in coins:
if i <= n:
n -= i
count += 1
break
print(count)
```
| 0
|
|
41
|
A
|
Translation
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Translation
|
2
|
256
|
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
|
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
|
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
|
[
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,653,134,481
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 92
| 0
|
# -*- coding: utf-8 -*-
"""
Created on Mon May 21 19:54:16 2022
,-. _,---._ __ / \
/ ) .-' `./ / \
( ( ,' `/ /|
\ `-" \'\ / |
`. , \ \ / |
/`. ,'-`----Y |
( ; | '
| ,-. ,-' | /
| | ( | @bibble | /
) | \ `.___________|/
`--' `--'
"""
# =============================================================================
# The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word s from Berlandish into Birlandish as t. Help him: find out if he translated the word correctly.
#
# Input:
# The first line contains word s, the second line contains word t. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
#
# Output:
# If the word t is a word s, written reversely, print YES, otherwise print NO.
# =============================================================================
s = list(input())
t = list(input())
s.reverse()
if t==s:
print('YES')
else:
print('NO')
|
Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
# -*- coding: utf-8 -*-
"""
Created on Mon May 21 19:54:16 2022
,-. _,---._ __ / \
/ ) .-' `./ / \
( ( ,' `/ /|
\ `-" \'\ / |
`. , \ \ / |
/`. ,'-`----Y |
( ; | '
| ,-. ,-' | /
| | ( | @bibble | /
) | \ `.___________|/
`--' `--'
"""
# =============================================================================
# The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word s from Berlandish into Birlandish as t. Help him: find out if he translated the word correctly.
#
# Input:
# The first line contains word s, the second line contains word t. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
#
# Output:
# If the word t is a word s, written reversely, print YES, otherwise print NO.
# =============================================================================
s = list(input())
t = list(input())
s.reverse()
if t==s:
print('YES')
else:
print('NO')
```
| 3.977
|
445
|
B
|
DZY Loves Chemistry
|
PROGRAMMING
| 1,400
|
[
"dfs and similar",
"dsu",
"greedy"
] | null | null |
DZY loves chemistry, and he enjoys mixing chemicals.
DZY has *n* chemicals, and *m* pairs of them will react. He wants to pour these chemicals into a test tube, and he needs to pour them in one by one, in any order.
Let's consider the danger of a test tube. Danger of an empty test tube is 1. And every time when DZY pours a chemical, if there are already one or more chemicals in the test tube that can react with it, the danger of the test tube will be multiplied by 2. Otherwise the danger remains as it is.
Find the maximum possible danger after pouring all the chemicals one by one in optimal order.
|
The first line contains two space-separated integers *n* and *m* .
Each of the next *m* lines contains two space-separated integers *x**i* and *y**i* (1<=≤<=*x**i*<=<<=*y**i*<=≤<=*n*). These integers mean that the chemical *x**i* will react with the chemical *y**i*. Each pair of chemicals will appear at most once in the input.
Consider all the chemicals numbered from 1 to *n* in some order.
|
Print a single integer — the maximum possible danger.
|
[
"1 0\n",
"2 1\n1 2\n",
"3 2\n1 2\n2 3\n"
] |
[
"1\n",
"2\n",
"4\n"
] |
In the first sample, there's only one way to pour, and the danger won't increase.
In the second sample, no matter we pour the 1st chemical first, or pour the 2nd chemical first, the answer is always 2.
In the third sample, there are four ways to achieve the maximum possible danger: 2-1-3, 2-3-1, 1-2-3 and 3-2-1 (that is the numbers of the chemicals in order of pouring).
| 1,000
|
[
{
"input": "1 0",
"output": "1"
},
{
"input": "2 1\n1 2",
"output": "2"
},
{
"input": "3 2\n1 2\n2 3",
"output": "4"
},
{
"input": "10 10\n1 8\n4 10\n4 6\n5 10\n2 3\n1 7\n3 4\n3 6\n6 9\n3 7",
"output": "512"
},
{
"input": "20 20\n6 8\n13 20\n7 13\n6 17\n5 15\n1 12\n2 15\n5 17\n5 14\n6 14\n12 20\n7 20\n1 6\n1 7\n2 19\n14 17\n1 10\n11 15\n9 18\n2 12",
"output": "32768"
},
{
"input": "30 30\n7 28\n16 26\n14 24\n16 18\n20 29\n4 28\n19 21\n8 26\n1 25\n14 22\n13 23\n4 15\n15 16\n2 19\n29 30\n12 20\n3 4\n3 26\n3 11\n22 27\n5 16\n2 24\n2 18\n7 16\n17 21\n17 25\n8 15\n23 27\n12 21\n5 30",
"output": "67108864"
},
{
"input": "40 40\n28 33\n15 21\n12 29\n14 31\n2 26\n3 12\n25 34\n6 30\n6 25\n5 28\n9 17\n23 29\n30 36\n3 21\n35 37\n7 25\n29 39\n15 19\n12 35\n24 34\n15 25\n19 33\n26 31\n7 29\n1 40\n11 27\n6 9\n6 27\n36 39\n10 14\n6 16\n23 25\n2 38\n3 24\n30 31\n29 30\n4 12\n11 13\n14 40\n22 39",
"output": "34359738368"
},
{
"input": "50 50\n16 21\n23 47\n23 30\n2 12\n23 41\n3 16\n14 20\n4 49\n2 47\n19 29\n13 42\n5 8\n24 38\n13 32\n34 37\n38 46\n3 20\n27 50\n7 42\n33 45\n2 48\n41 47\n9 48\n15 26\n27 37\n32 34\n17 24\n1 39\n27 30\n10 33\n38 47\n32 33\n14 39\n35 50\n2 19\n3 12\n27 34\n18 25\n12 23\n31 44\n5 35\n28 45\n38 39\n13 44\n34 38\n16 46\n5 15\n26 30\n47 49\n2 10",
"output": "4398046511104"
},
{
"input": "50 0",
"output": "1"
},
{
"input": "50 7\n16 32\n31 34\n4 16\n4 39\n1 50\n43 49\n1 33",
"output": "128"
},
{
"input": "7 20\n2 3\n3 6\n1 6\n1 2\n3 5\n1 7\n4 5\n4 7\n1 3\n2 6\n2 7\n4 6\n3 4\n1 4\n3 7\n1 5\n2 5\n5 6\n5 7\n2 4",
"output": "64"
},
{
"input": "5 4\n1 2\n2 3\n3 4\n4 5",
"output": "16"
},
{
"input": "10 7\n1 2\n2 3\n1 5\n2 7\n7 8\n1 9\n9 10",
"output": "128"
},
{
"input": "20 15\n1 3\n3 4\n3 5\n4 6\n1 7\n1 8\n1 9\n7 11\n8 12\n5 13\n3 16\n1 17\n3 18\n1 19\n17 20",
"output": "32768"
},
{
"input": "30 24\n2 3\n3 4\n1 5\n4 6\n6 7\n1 8\n1 9\n4 10\n9 11\n5 12\n6 13\n10 14\n14 15\n12 16\n14 17\n2 18\n8 19\n3 20\n10 21\n11 24\n3 25\n1 26\n7 27\n4 29",
"output": "16777216"
},
{
"input": "40 28\n1 2\n2 4\n3 5\n1 7\n1 8\n7 9\n6 10\n7 11\n2 12\n9 13\n11 15\n12 16\n1 18\n10 19\n7 21\n7 23\n20 25\n24 27\n14 28\n9 29\n23 30\n27 31\n11 34\n21 35\n32 36\n23 38\n7 39\n20 40",
"output": "268435456"
},
{
"input": "50 41\n1 2\n1 3\n2 4\n1 5\n2 7\n4 8\n7 9\n2 11\n10 13\n11 14\n12 15\n14 16\n4 19\n7 20\n14 21\n8 23\n16 24\n16 25\n16 26\n19 27\n2 28\n3 29\n21 30\n12 31\n20 32\n23 33\n30 34\n6 35\n34 36\n34 37\n33 38\n34 40\n30 41\n3 42\n39 43\n5 44\n8 45\n40 46\n20 47\n31 49\n34 50",
"output": "2199023255552"
},
{
"input": "50 39\n1 2\n1 4\n5 6\n4 7\n5 8\n7 9\n9 10\n10 11\n2 12\n8 14\n11 15\n11 17\n3 18\n13 19\n17 20\n7 21\n6 22\n22 23\n14 24\n22 25\n23 26\n26 27\n27 28\n15 29\n8 30\n26 31\n32 33\n21 35\n14 36\n30 37\n17 38\n12 40\n11 42\n14 43\n12 44\n1 45\n29 46\n22 47\n47 50",
"output": "549755813888"
},
{
"input": "50 38\n1 2\n2 3\n3 4\n3 5\n4 7\n5 10\n9 11\n9 12\n11 13\n12 14\n6 15\n8 16\n2 18\n15 19\n3 20\n10 21\n4 22\n9 24\n2 25\n23 26\n3 28\n20 29\n14 30\n4 32\n24 33\n20 36\n1 38\n19 39\n39 40\n22 41\n18 42\n19 43\n40 45\n45 46\n9 47\n6 48\n9 49\n25 50",
"output": "274877906944"
},
{
"input": "50 41\n1 3\n1 4\n2 5\n2 7\n1 8\n2 10\n4 11\n5 12\n12 13\n4 14\n10 17\n1 18\n1 21\n5 22\n14 23\n19 24\n13 25\n3 26\n11 27\n6 28\n26 29\n21 30\n17 31\n15 32\n1 33\n12 34\n23 36\n6 37\n15 38\n37 39\n31 40\n15 41\n25 42\n19 43\n20 44\n32 45\n44 46\n31 47\n2 48\n32 49\n27 50",
"output": "2199023255552"
},
{
"input": "50 47\n1 2\n1 3\n1 4\n1 5\n5 6\n2 7\n2 8\n2 9\n2 10\n8 11\n5 12\n11 13\n10 14\n6 15\n9 16\n1 17\n1 18\n8 19\n5 20\n5 21\n11 22\n2 23\n22 24\n24 25\n5 26\n21 27\n27 28\n8 29\n2 30\n4 31\n11 32\n17 33\n22 34\n25 35\n28 36\n28 37\n11 38\n17 39\n19 42\n6 43\n11 44\n29 45\n2 46\n24 47\n7 48\n3 49\n44 50",
"output": "140737488355328"
},
{
"input": "11 20\n3 6\n2 6\n2 9\n4 5\n9 11\n6 8\n5 6\n1 6\n4 11\n9 10\n5 10\n4 6\n3 8\n2 3\n1 7\n1 11\n2 7\n1 3\n3 7\n1 8",
"output": "1024"
},
{
"input": "26 17\n1 2\n2 3\n1 6\n6 7\n7 8\n2 9\n4 10\n3 11\n11 12\n9 13\n6 14\n2 16\n5 18\n6 19\n11 22\n15 24\n6 26",
"output": "131072"
},
{
"input": "48 43\n1 2\n1 3\n3 4\n4 5\n2 6\n5 7\n7 9\n4 10\n6 11\n3 12\n6 13\n3 14\n6 15\n13 16\n4 17\n12 18\n18 19\n1 20\n1 21\n16 22\n9 23\n3 24\n22 25\n2 26\n10 27\n18 28\n13 30\n3 31\n24 33\n29 34\n15 35\n16 36\n23 37\n21 38\n34 39\n37 40\n39 41\n19 42\n15 43\n23 44\n22 45\n14 47\n10 48",
"output": "8796093022208"
},
{
"input": "8 5\n1 2\n1 3\n1 4\n5 6\n7 8",
"output": "32"
},
{
"input": "8 7\n1 2\n2 3\n3 4\n1 4\n5 6\n6 7\n7 8",
"output": "64"
}
] | 1,643,034,479
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 32
| 62
| 0
|
# -*- coding: utf-8 -*-
"""
Created on Mon Jan 24 21:16:11 2022
@author: Lai Phuc
problem 445B - codeforce
"""
n, m = map(int, input().split(" "))
root = list(range(n+1))
def find_root(u):
if u == root[u]:
return u
else:
return find_root(root[u])
def disSet(u, v):
rootu = find_root(u)
rootv = find_root(v)
if rootu != rootv:
root[rootv] = rootu
dangerous = 1
for i in range(m):
u, v = map(int, input().split(" "))
if find_root(u) != find_root(v):
dangerous *= 2
disSet(u, v)
print(dangerous)
|
Title: DZY Loves Chemistry
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
DZY loves chemistry, and he enjoys mixing chemicals.
DZY has *n* chemicals, and *m* pairs of them will react. He wants to pour these chemicals into a test tube, and he needs to pour them in one by one, in any order.
Let's consider the danger of a test tube. Danger of an empty test tube is 1. And every time when DZY pours a chemical, if there are already one or more chemicals in the test tube that can react with it, the danger of the test tube will be multiplied by 2. Otherwise the danger remains as it is.
Find the maximum possible danger after pouring all the chemicals one by one in optimal order.
Input Specification:
The first line contains two space-separated integers *n* and *m* .
Each of the next *m* lines contains two space-separated integers *x**i* and *y**i* (1<=≤<=*x**i*<=<<=*y**i*<=≤<=*n*). These integers mean that the chemical *x**i* will react with the chemical *y**i*. Each pair of chemicals will appear at most once in the input.
Consider all the chemicals numbered from 1 to *n* in some order.
Output Specification:
Print a single integer — the maximum possible danger.
Demo Input:
['1 0\n', '2 1\n1 2\n', '3 2\n1 2\n2 3\n']
Demo Output:
['1\n', '2\n', '4\n']
Note:
In the first sample, there's only one way to pour, and the danger won't increase.
In the second sample, no matter we pour the 1st chemical first, or pour the 2nd chemical first, the answer is always 2.
In the third sample, there are four ways to achieve the maximum possible danger: 2-1-3, 2-3-1, 1-2-3 and 3-2-1 (that is the numbers of the chemicals in order of pouring).
|
```python
# -*- coding: utf-8 -*-
"""
Created on Mon Jan 24 21:16:11 2022
@author: Lai Phuc
problem 445B - codeforce
"""
n, m = map(int, input().split(" "))
root = list(range(n+1))
def find_root(u):
if u == root[u]:
return u
else:
return find_root(root[u])
def disSet(u, v):
rootu = find_root(u)
rootv = find_root(v)
if rootu != rootv:
root[rootv] = rootu
dangerous = 1
for i in range(m):
u, v = map(int, input().split(" "))
if find_root(u) != find_root(v):
dangerous *= 2
disSet(u, v)
print(dangerous)
```
| 3
|
|
25
|
B
|
Phone numbers
|
PROGRAMMING
| 1,100
|
[
"implementation"
] |
B. Phone numbers
|
2
|
256
|
Phone number in Berland is a sequence of *n* digits. Often, to make it easier to memorize the number, it is divided into groups of two or three digits. For example, the phone number 1198733 is easier to remember as 11-987-33. Your task is to find for a given phone number any of its divisions into groups of two or three digits.
|
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of digits in the phone number. The second line contains *n* digits — the phone number to divide into groups.
|
Output any of divisions of the given phone number into groups of two or three digits. Separate groups by single character -. If the answer is not unique, output any.
|
[
"6\n549871\n",
"7\n1198733\n"
] |
[
"54-98-71",
"11-987-33\n"
] |
none
| 0
|
[
{
"input": "6\n549871",
"output": "54-98-71"
},
{
"input": "7\n1198733",
"output": "119-87-33"
},
{
"input": "2\n74",
"output": "74"
},
{
"input": "2\n33",
"output": "33"
},
{
"input": "3\n074",
"output": "074"
},
{
"input": "3\n081",
"output": "081"
},
{
"input": "4\n3811",
"output": "38-11"
},
{
"input": "5\n21583",
"output": "215-83"
},
{
"input": "8\n33408349",
"output": "33-40-83-49"
},
{
"input": "9\n988808426",
"output": "988-80-84-26"
},
{
"input": "10\n0180990956",
"output": "01-80-99-09-56"
},
{
"input": "15\n433488906230138",
"output": "433-48-89-06-23-01-38"
},
{
"input": "22\n7135498415686025907059",
"output": "71-35-49-84-15-68-60-25-90-70-59"
},
{
"input": "49\n2429965524999668169991253653390090510755018570235",
"output": "242-99-65-52-49-99-66-81-69-99-12-53-65-33-90-09-05-10-75-50-18-57-02-35"
},
{
"input": "72\n491925337784111770500147619881727525570039735507439360627744863794794290",
"output": "49-19-25-33-77-84-11-17-70-50-01-47-61-98-81-72-75-25-57-00-39-73-55-07-43-93-60-62-77-44-86-37-94-79-42-90"
},
{
"input": "95\n32543414456047900690980198395035321172843693417425457554204776648220562494524275489599199209210",
"output": "325-43-41-44-56-04-79-00-69-09-80-19-83-95-03-53-21-17-28-43-69-34-17-42-54-57-55-42-04-77-66-48-22-05-62-49-45-24-27-54-89-59-91-99-20-92-10"
},
{
"input": "97\n9362344595153688016434451101547661156123505108492010669557671355055642365998461003851354321478898",
"output": "936-23-44-59-51-53-68-80-16-43-44-51-10-15-47-66-11-56-12-35-05-10-84-92-01-06-69-55-76-71-35-50-55-64-23-65-99-84-61-00-38-51-35-43-21-47-88-98"
},
{
"input": "98\n65521815795893886057122984634320900545031770769333931308009346017867969790810907868670369236928568",
"output": "65-52-18-15-79-58-93-88-60-57-12-29-84-63-43-20-90-05-45-03-17-70-76-93-33-93-13-08-00-93-46-01-78-67-96-97-90-81-09-07-86-86-70-36-92-36-92-85-68"
},
{
"input": "99\n455213856470326729480192345541970106407563996625458559297407682539801838244443866898560852503660390",
"output": "455-21-38-56-47-03-26-72-94-80-19-23-45-54-19-70-10-64-07-56-39-96-62-54-58-55-92-97-40-76-82-53-98-01-83-82-44-44-38-66-89-85-60-85-25-03-66-03-90"
},
{
"input": "100\n4004223124942730640235383244438257614581534320356060987241659784249551110165034719443327659510644224",
"output": "40-04-22-31-24-94-27-30-64-02-35-38-32-44-43-82-57-61-45-81-53-43-20-35-60-60-98-72-41-65-97-84-24-95-51-11-01-65-03-47-19-44-33-27-65-95-10-64-42-24"
}
] | 1,604,863,360
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 20
| 248
| 0
|
n = int(input())
v = input()
ans = []
i = 0
while(i < n):
if(n - i == 3):
ans.append(v[i]+v[i+1]+v[i+2])
i += 4
break
else:
ans.append(v[i]+v[i+1])
i += 2
print('-'.join(ans))
|
Title: Phone numbers
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Phone number in Berland is a sequence of *n* digits. Often, to make it easier to memorize the number, it is divided into groups of two or three digits. For example, the phone number 1198733 is easier to remember as 11-987-33. Your task is to find for a given phone number any of its divisions into groups of two or three digits.
Input Specification:
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of digits in the phone number. The second line contains *n* digits — the phone number to divide into groups.
Output Specification:
Output any of divisions of the given phone number into groups of two or three digits. Separate groups by single character -. If the answer is not unique, output any.
Demo Input:
['6\n549871\n', '7\n1198733\n']
Demo Output:
['54-98-71', '11-987-33\n']
Note:
none
|
```python
n = int(input())
v = input()
ans = []
i = 0
while(i < n):
if(n - i == 3):
ans.append(v[i]+v[i+1]+v[i+2])
i += 4
break
else:
ans.append(v[i]+v[i+1])
i += 2
print('-'.join(ans))
```
| 3.938
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,639,352,826
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 46
| 0
|
""" Chat Room """
s_=input()
s=[]
for i in s_.lower():
s.append(i)
y=False
print(s)
for i in s:
if i=='h':
s.remove('h')
if i=='e':
s.remove('e')
if i=='l':
s.remove('l')
if i=='l':
s.remove('l')
if i=='o':
s.remove('o')
y=True
if y==True:
print("YES")
else:
print('NO')
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
""" Chat Room """
s_=input()
s=[]
for i in s_.lower():
s.append(i)
y=False
print(s)
for i in s:
if i=='h':
s.remove('h')
if i=='e':
s.remove('e')
if i=='l':
s.remove('l')
if i=='l':
s.remove('l')
if i=='o':
s.remove('o')
y=True
if y==True:
print("YES")
else:
print('NO')
```
| 0
|
339
|
A
|
Helpful Maths
|
PROGRAMMING
| 800
|
[
"greedy",
"implementation",
"sortings",
"strings"
] | null | null |
Xenia the beginner mathematician is a third year student at elementary school. She is now learning the addition operation.
The teacher has written down the sum of multiple numbers. Pupils should calculate the sum. To make the calculation easier, the sum only contains numbers 1, 2 and 3. Still, that isn't enough for Xenia. She is only beginning to count, so she can calculate a sum only if the summands follow in non-decreasing order. For example, she can't calculate sum 1+3+2+1 but she can calculate sums 1+1+2 and 3+3.
You've got the sum that was written on the board. Rearrange the summans and print the sum in such a way that Xenia can calculate the sum.
|
The first line contains a non-empty string *s* — the sum Xenia needs to count. String *s* contains no spaces. It only contains digits and characters "+". Besides, string *s* is a correct sum of numbers 1, 2 and 3. String *s* is at most 100 characters long.
|
Print the new sum that Xenia can count.
|
[
"3+2+1\n",
"1+1+3+1+3\n",
"2\n"
] |
[
"1+2+3\n",
"1+1+1+3+3\n",
"2\n"
] |
none
| 500
|
[
{
"input": "3+2+1",
"output": "1+2+3"
},
{
"input": "1+1+3+1+3",
"output": "1+1+1+3+3"
},
{
"input": "2",
"output": "2"
},
{
"input": "2+2+1+1+3",
"output": "1+1+2+2+3"
},
{
"input": "2+1+2+2+2+3+1+3+1+2",
"output": "1+1+1+2+2+2+2+2+3+3"
},
{
"input": "1+2+1+2+2+2+2+1+3+3",
"output": "1+1+1+2+2+2+2+2+3+3"
},
{
"input": "2+3+3+1+2+2+2+1+1+2+1+3+2+2+3+3+2+2+3+3+3+1+1+1+3+3+3+2+1+3+2+3+2+1+1+3+3+3+1+2+2+1+2+2+1+2+1+3+1+1",
"output": "1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+3+3+3+3+3+3+3+3+3+3+3+3+3+3+3+3+3"
},
{
"input": "1",
"output": "1"
},
{
"input": "2+1+2+2+1+3+2+3+1+1+2+1+2+2+3+1+1+3+3+3+2+2+3+2+2+2+1+2+1+2+3+2+2+2+1+3+1+3+3+3+1+2+1+2+2+2+2+3+1+1",
"output": "1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+3+3+3+3+3+3+3+3+3+3+3+3+3"
},
{
"input": "2+2+1+1+1+3+1+1+3+3+2+3+1+3+1+1+3+1+1+2+2+2+2+1+2+1+2+1+1+1+3+1+3+2+3+2+3+3+1+1+1+2+3+2+1+3+1+3+2+2",
"output": "1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+1+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+3+3+3+3+3+3+3+3+3+3+3+3+3+3"
},
{
"input": "3+2+3+3+2+2+1+2+1+2+3+1+2+3+2+3+2+1+2+2+1+1+2+2+3+2+1+3+1+1+3+2+2+2+2+3+3+2+2+3+3+1+1+2+3+3+2+3+3+3",
"output": "1+1+1+1+1+1+1+1+1+1+1+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+2+3+3+3+3+3+3+3+3+3+3+3+3+3+3+3+3+3+3"
},
{
"input": "3",
"output": "3"
},
{
"input": "1+1",
"output": "1+1"
},
{
"input": "1+2",
"output": "1+2"
},
{
"input": "1+3",
"output": "1+3"
},
{
"input": "2+1",
"output": "1+2"
},
{
"input": "2+2",
"output": "2+2"
},
{
"input": "2+3",
"output": "2+3"
},
{
"input": "3+1",
"output": "1+3"
},
{
"input": "3+2",
"output": "2+3"
},
{
"input": "3+3",
"output": "3+3"
}
] | 1,697,472,328
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 21
| 124
| 1,331,200
|
str = input().split("+")
for i in range(len(str)):
for j in range(0,len(str)-i-1):
if str[j]>str[j+1]:
t=str[j]
str[j]=str[j+1]
str[j+1]=t
fstr='';
i=0;
while(i!=len(str)):
if i<len(str)-1:
fstr+=str[i]+'+'
i+=1
else:
fstr+=str[i]
break
print(fstr)
|
Title: Helpful Maths
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Xenia the beginner mathematician is a third year student at elementary school. She is now learning the addition operation.
The teacher has written down the sum of multiple numbers. Pupils should calculate the sum. To make the calculation easier, the sum only contains numbers 1, 2 and 3. Still, that isn't enough for Xenia. She is only beginning to count, so she can calculate a sum only if the summands follow in non-decreasing order. For example, she can't calculate sum 1+3+2+1 but she can calculate sums 1+1+2 and 3+3.
You've got the sum that was written on the board. Rearrange the summans and print the sum in such a way that Xenia can calculate the sum.
Input Specification:
The first line contains a non-empty string *s* — the sum Xenia needs to count. String *s* contains no spaces. It only contains digits and characters "+". Besides, string *s* is a correct sum of numbers 1, 2 and 3. String *s* is at most 100 characters long.
Output Specification:
Print the new sum that Xenia can count.
Demo Input:
['3+2+1\n', '1+1+3+1+3\n', '2\n']
Demo Output:
['1+2+3\n', '1+1+1+3+3\n', '2\n']
Note:
none
|
```python
str = input().split("+")
for i in range(len(str)):
for j in range(0,len(str)-i-1):
if str[j]>str[j+1]:
t=str[j]
str[j]=str[j+1]
str[j+1]=t
fstr='';
i=0;
while(i!=len(str)):
if i<len(str)-1:
fstr+=str[i]+'+'
i+=1
else:
fstr+=str[i]
break
print(fstr)
```
| 3
|
|
677
|
A
|
Vanya and Fence
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Vanya and his friends are walking along the fence of height *h* and they do not want the guard to notice them. In order to achieve this the height of each of the friends should not exceed *h*. If the height of some person is greater than *h* he can bend down and then he surely won't be noticed by the guard. The height of the *i*-th person is equal to *a**i*.
Consider the width of the person walking as usual to be equal to 1, while the width of the bent person is equal to 2. Friends want to talk to each other while walking, so they would like to walk in a single row. What is the minimum width of the road, such that friends can walk in a row and remain unattended by the guard?
|
The first line of the input contains two integers *n* and *h* (1<=≤<=*n*<=≤<=1000, 1<=≤<=*h*<=≤<=1000) — the number of friends and the height of the fence, respectively.
The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=2*h*), the *i*-th of them is equal to the height of the *i*-th person.
|
Print a single integer — the minimum possible valid width of the road.
|
[
"3 7\n4 5 14\n",
"6 1\n1 1 1 1 1 1\n",
"6 5\n7 6 8 9 10 5\n"
] |
[
"4\n",
"6\n",
"11\n"
] |
In the first sample, only person number 3 must bend down, so the required width is equal to 1 + 1 + 2 = 4.
In the second sample, all friends are short enough and no one has to bend, so the width 1 + 1 + 1 + 1 + 1 + 1 = 6 is enough.
In the third sample, all the persons have to bend, except the last one. The required minimum width of the road is equal to 2 + 2 + 2 + 2 + 2 + 1 = 11.
| 500
|
[
{
"input": "3 7\n4 5 14",
"output": "4"
},
{
"input": "6 1\n1 1 1 1 1 1",
"output": "6"
},
{
"input": "6 5\n7 6 8 9 10 5",
"output": "11"
},
{
"input": "10 420\n214 614 297 675 82 740 174 23 255 15",
"output": "13"
},
{
"input": "10 561\n657 23 1096 487 785 66 481 554 1000 821",
"output": "15"
},
{
"input": "100 342\n478 143 359 336 162 333 385 515 117 496 310 538 469 539 258 676 466 677 1 296 150 560 26 213 627 221 255 126 617 174 279 178 24 435 70 145 619 46 669 566 300 67 576 251 58 176 441 564 569 194 24 669 73 262 457 259 619 78 400 579 222 626 269 47 80 315 160 194 455 186 315 424 197 246 683 220 68 682 83 233 290 664 273 598 362 305 674 614 321 575 362 120 14 534 62 436 294 351 485 396",
"output": "144"
},
{
"input": "100 290\n244 49 276 77 449 261 468 458 201 424 9 131 300 88 432 394 104 77 13 289 435 259 111 453 168 394 156 412 351 576 178 530 81 271 228 564 125 328 42 372 205 61 180 471 33 360 567 331 222 318 241 117 529 169 188 484 202 202 299 268 246 343 44 364 333 494 59 236 84 485 50 8 428 8 571 227 205 310 210 9 324 472 368 490 114 84 296 305 411 351 569 393 283 120 510 171 232 151 134 366",
"output": "145"
},
{
"input": "1 1\n1",
"output": "1"
},
{
"input": "1 1\n2",
"output": "2"
},
{
"input": "46 71\n30 26 56 138 123 77 60 122 73 45 79 10 130 3 14 1 38 46 128 50 82 16 32 68 28 98 62 106 2 49 131 11 114 39 139 70 40 50 45 137 33 30 35 136 135 19",
"output": "63"
},
{
"input": "20 723\n212 602 293 591 754 91 1135 640 80 495 845 928 1399 498 926 1431 1226 869 814 1386",
"output": "31"
},
{
"input": "48 864\n843 1020 751 1694 18 1429 1395 1174 272 1158 1628 1233 1710 441 765 561 778 748 1501 1200 563 1263 1398 1687 1518 1640 1591 839 500 466 1603 1587 1201 1209 432 868 1159 639 649 628 9 91 1036 147 896 1557 941 518",
"output": "75"
},
{
"input": "26 708\n549 241 821 734 945 1161 566 1268 216 30 1142 730 529 1014 255 168 796 1148 89 113 1328 286 743 871 1259 1397",
"output": "41"
},
{
"input": "75 940\n1620 1745 1599 441 64 1466 1496 1239 1716 1475 778 106 1136 1212 1261 444 781 257 1071 747 626 232 609 1544 682 1326 469 1361 1460 1450 1207 1319 922 625 1737 1057 1698 592 692 80 1016 541 1254 201 682 1007 847 206 1066 809 259 109 240 1611 219 1455 1326 1377 1827 786 42 1002 1382 1592 543 1866 1198 334 1524 1760 340 1566 955 257 1118",
"output": "116"
}
] | 1,694,333,376
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 29
| 62
| 0
|
numAndMaxHeight = [int(a) for a in input().split()]
heights = [int(a) for a in input().split()]
widthOfTheRoad = 0
maxHeight = numAndMaxHeight[1]
i = 0
for height in heights:
if height > maxHeight:
widthOfTheRoad += 2
else:
widthOfTheRoad += 1
print(widthOfTheRoad)
|
Title: Vanya and Fence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vanya and his friends are walking along the fence of height *h* and they do not want the guard to notice them. In order to achieve this the height of each of the friends should not exceed *h*. If the height of some person is greater than *h* he can bend down and then he surely won't be noticed by the guard. The height of the *i*-th person is equal to *a**i*.
Consider the width of the person walking as usual to be equal to 1, while the width of the bent person is equal to 2. Friends want to talk to each other while walking, so they would like to walk in a single row. What is the minimum width of the road, such that friends can walk in a row and remain unattended by the guard?
Input Specification:
The first line of the input contains two integers *n* and *h* (1<=≤<=*n*<=≤<=1000, 1<=≤<=*h*<=≤<=1000) — the number of friends and the height of the fence, respectively.
The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=2*h*), the *i*-th of them is equal to the height of the *i*-th person.
Output Specification:
Print a single integer — the minimum possible valid width of the road.
Demo Input:
['3 7\n4 5 14\n', '6 1\n1 1 1 1 1 1\n', '6 5\n7 6 8 9 10 5\n']
Demo Output:
['4\n', '6\n', '11\n']
Note:
In the first sample, only person number 3 must bend down, so the required width is equal to 1 + 1 + 2 = 4.
In the second sample, all friends are short enough and no one has to bend, so the width 1 + 1 + 1 + 1 + 1 + 1 = 6 is enough.
In the third sample, all the persons have to bend, except the last one. The required minimum width of the road is equal to 2 + 2 + 2 + 2 + 2 + 1 = 11.
|
```python
numAndMaxHeight = [int(a) for a in input().split()]
heights = [int(a) for a in input().split()]
widthOfTheRoad = 0
maxHeight = numAndMaxHeight[1]
i = 0
for height in heights:
if height > maxHeight:
widthOfTheRoad += 2
else:
widthOfTheRoad += 1
print(widthOfTheRoad)
```
| 3
|
|
581
|
A
|
Vasya the Hipster
|
PROGRAMMING
| 800
|
[
"implementation",
"math"
] | null | null |
One day Vasya the Hipster decided to count how many socks he had. It turned out that he had *a* red socks and *b* blue socks.
According to the latest fashion, hipsters should wear the socks of different colors: a red one on the left foot, a blue one on the right foot.
Every day Vasya puts on new socks in the morning and throws them away before going to bed as he doesn't want to wash them.
Vasya wonders, what is the maximum number of days when he can dress fashionable and wear different socks, and after that, for how many days he can then wear the same socks until he either runs out of socks or cannot make a single pair from the socks he's got.
Can you help him?
|
The single line of the input contains two positive integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=100) — the number of red and blue socks that Vasya's got.
|
Print two space-separated integers — the maximum number of days when Vasya can wear different socks and the number of days when he can wear the same socks until he either runs out of socks or cannot make a single pair from the socks he's got.
Keep in mind that at the end of the day Vasya throws away the socks that he's been wearing on that day.
|
[
"3 1\n",
"2 3\n",
"7 3\n"
] |
[
"1 1\n",
"2 0\n",
"3 2\n"
] |
In the first sample Vasya can first put on one pair of different socks, after that he has two red socks left to wear on the second day.
| 500
|
[
{
"input": "3 1",
"output": "1 1"
},
{
"input": "2 3",
"output": "2 0"
},
{
"input": "7 3",
"output": "3 2"
},
{
"input": "100 100",
"output": "100 0"
},
{
"input": "4 10",
"output": "4 3"
},
{
"input": "6 10",
"output": "6 2"
},
{
"input": "6 11",
"output": "6 2"
},
{
"input": "10 40",
"output": "10 15"
},
{
"input": "11 56",
"output": "11 22"
},
{
"input": "34 30",
"output": "30 2"
},
{
"input": "33 33",
"output": "33 0"
},
{
"input": "100 45",
"output": "45 27"
},
{
"input": "100 23",
"output": "23 38"
},
{
"input": "45 12",
"output": "12 16"
},
{
"input": "1 1",
"output": "1 0"
},
{
"input": "1 100",
"output": "1 49"
},
{
"input": "100 1",
"output": "1 49"
},
{
"input": "68 59",
"output": "59 4"
},
{
"input": "45 99",
"output": "45 27"
},
{
"input": "99 100",
"output": "99 0"
},
{
"input": "100 98",
"output": "98 1"
},
{
"input": "59 12",
"output": "12 23"
},
{
"input": "86 4",
"output": "4 41"
},
{
"input": "68 21",
"output": "21 23"
},
{
"input": "100 11",
"output": "11 44"
},
{
"input": "100 10",
"output": "10 45"
},
{
"input": "15 45",
"output": "15 15"
},
{
"input": "11 32",
"output": "11 10"
},
{
"input": "34 96",
"output": "34 31"
},
{
"input": "89 89",
"output": "89 0"
}
] | 1,695,483,033
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 46
| 0
|
a,b = map(int,input().split())
m = min(a,b)
n = int(max(a-m,b-m)/2)
print(m,n)
|
Title: Vasya the Hipster
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Vasya the Hipster decided to count how many socks he had. It turned out that he had *a* red socks and *b* blue socks.
According to the latest fashion, hipsters should wear the socks of different colors: a red one on the left foot, a blue one on the right foot.
Every day Vasya puts on new socks in the morning and throws them away before going to bed as he doesn't want to wash them.
Vasya wonders, what is the maximum number of days when he can dress fashionable and wear different socks, and after that, for how many days he can then wear the same socks until he either runs out of socks or cannot make a single pair from the socks he's got.
Can you help him?
Input Specification:
The single line of the input contains two positive integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=100) — the number of red and blue socks that Vasya's got.
Output Specification:
Print two space-separated integers — the maximum number of days when Vasya can wear different socks and the number of days when he can wear the same socks until he either runs out of socks or cannot make a single pair from the socks he's got.
Keep in mind that at the end of the day Vasya throws away the socks that he's been wearing on that day.
Demo Input:
['3 1\n', '2 3\n', '7 3\n']
Demo Output:
['1 1\n', '2 0\n', '3 2\n']
Note:
In the first sample Vasya can first put on one pair of different socks, after that he has two red socks left to wear on the second day.
|
```python
a,b = map(int,input().split())
m = min(a,b)
n = int(max(a-m,b-m)/2)
print(m,n)
```
| 3
|
|
349
|
A
|
Cinema Line
|
PROGRAMMING
| 1,100
|
[
"greedy",
"implementation"
] | null | null |
The new "Die Hard" movie has just been released! There are *n* people at the cinema box office standing in a huge line. Each of them has a single 100, 50 or 25 ruble bill. A "Die Hard" ticket costs 25 rubles. Can the booking clerk sell a ticket to each person and give the change if he initially has no money and sells the tickets strictly in the order people follow in the line?
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of people in the line. The next line contains *n* integers, each of them equals 25, 50 or 100 — the values of the bills the people have. The numbers are given in the order from the beginning of the line (at the box office) to the end of the line.
|
Print "YES" (without the quotes) if the booking clerk can sell a ticket to each person and give the change. Otherwise print "NO".
|
[
"4\n25 25 50 50\n",
"2\n25 100\n",
"4\n50 50 25 25\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "4\n25 25 50 50",
"output": "YES"
},
{
"input": "2\n25 100",
"output": "NO"
},
{
"input": "4\n50 50 25 25",
"output": "NO"
},
{
"input": "3\n25 50 100",
"output": "NO"
},
{
"input": "10\n25 25 25 25 25 25 25 25 25 25",
"output": "YES"
},
{
"input": "10\n50 50 50 50 50 50 50 50 50 50",
"output": "NO"
},
{
"input": "10\n100 100 100 100 100 100 100 100 100 100",
"output": "NO"
},
{
"input": "7\n25 25 25 25 50 100 50",
"output": "YES"
},
{
"input": "2\n25 25",
"output": "YES"
},
{
"input": "3\n50 100 100",
"output": "NO"
},
{
"input": "3\n25 50 50",
"output": "NO"
},
{
"input": "2\n50 25",
"output": "NO"
},
{
"input": "14\n25 25 25 25 25 25 25 50 50 50 100 100 100 100",
"output": "NO"
},
{
"input": "5\n25 25 25 100 100",
"output": "NO"
},
{
"input": "7\n25 50 25 50 25 50 100",
"output": "NO"
},
{
"input": "5\n25 50 25 50 100",
"output": "NO"
},
{
"input": "5\n25 25 50 50 50",
"output": "NO"
},
{
"input": "5\n25 25 50 100 50",
"output": "NO"
},
{
"input": "5\n25 25 50 50 100",
"output": "NO"
},
{
"input": "1\n50",
"output": "NO"
}
] | 1,633,906,273
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 248
| 12,185,600
|
size = int(input())
line = [int(i) for i in input().split()]
assert size == len(line), "invalid input"
bills = {25: 0, 50: 0, 100: 0}
for p in line:
assert p in [25, 50, 100], "each bill should be either 25, 50, or 100 rubles"
if p == 50:
if bills[25] == 0:
print("NO")
break
bills[25] -= 1
elif p == 100:
if bills[25] >= 1 and bills[50] >= 1:
bills[25] -= 1
bills[50] -= 1
elif bills[25] >= 3:
bills[25] -= 3
else:
print("NO")
break
bills[p] += 1
else:
print("YES")
|
Title: Cinema Line
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The new "Die Hard" movie has just been released! There are *n* people at the cinema box office standing in a huge line. Each of them has a single 100, 50 or 25 ruble bill. A "Die Hard" ticket costs 25 rubles. Can the booking clerk sell a ticket to each person and give the change if he initially has no money and sells the tickets strictly in the order people follow in the line?
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of people in the line. The next line contains *n* integers, each of them equals 25, 50 or 100 — the values of the bills the people have. The numbers are given in the order from the beginning of the line (at the box office) to the end of the line.
Output Specification:
Print "YES" (without the quotes) if the booking clerk can sell a ticket to each person and give the change. Otherwise print "NO".
Demo Input:
['4\n25 25 50 50\n', '2\n25 100\n', '4\n50 50 25 25\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
size = int(input())
line = [int(i) for i in input().split()]
assert size == len(line), "invalid input"
bills = {25: 0, 50: 0, 100: 0}
for p in line:
assert p in [25, 50, 100], "each bill should be either 25, 50, or 100 rubles"
if p == 50:
if bills[25] == 0:
print("NO")
break
bills[25] -= 1
elif p == 100:
if bills[25] >= 1 and bills[50] >= 1:
bills[25] -= 1
bills[50] -= 1
elif bills[25] >= 3:
bills[25] -= 3
else:
print("NO")
break
bills[p] += 1
else:
print("YES")
```
| 3
|
|
909
|
B
|
Segments
|
PROGRAMMING
| 1,300
|
[
"constructive algorithms",
"math"
] | null | null |
You are given an integer *N*. Consider all possible segments on the coordinate axis with endpoints at integer points with coordinates between 0 and *N*, inclusive; there will be of them.
You want to draw these segments in several layers so that in each layer the segments don't overlap (they might touch at the endpoints though). You can not move the segments to a different location on the coordinate axis.
Find the minimal number of layers you have to use for the given *N*.
|
The only input line contains a single integer *N* (1<=≤<=*N*<=≤<=100).
|
Output a single integer - the minimal number of layers required to draw the segments for the given *N*.
|
[
"2\n",
"3\n",
"4\n"
] |
[
"2\n",
"4\n",
"6\n"
] |
As an example, here are the segments and their optimal arrangement into layers for *N* = 4.
| 1,000
|
[
{
"input": "2",
"output": "2"
},
{
"input": "3",
"output": "4"
},
{
"input": "4",
"output": "6"
},
{
"input": "21",
"output": "121"
},
{
"input": "100",
"output": "2550"
},
{
"input": "1",
"output": "1"
},
{
"input": "5",
"output": "9"
},
{
"input": "6",
"output": "12"
},
{
"input": "7",
"output": "16"
},
{
"input": "8",
"output": "20"
},
{
"input": "9",
"output": "25"
},
{
"input": "10",
"output": "30"
},
{
"input": "11",
"output": "36"
},
{
"input": "12",
"output": "42"
},
{
"input": "13",
"output": "49"
},
{
"input": "14",
"output": "56"
},
{
"input": "15",
"output": "64"
},
{
"input": "16",
"output": "72"
},
{
"input": "17",
"output": "81"
},
{
"input": "18",
"output": "90"
},
{
"input": "19",
"output": "100"
},
{
"input": "20",
"output": "110"
},
{
"input": "22",
"output": "132"
},
{
"input": "23",
"output": "144"
},
{
"input": "24",
"output": "156"
},
{
"input": "25",
"output": "169"
},
{
"input": "26",
"output": "182"
},
{
"input": "27",
"output": "196"
},
{
"input": "28",
"output": "210"
},
{
"input": "29",
"output": "225"
},
{
"input": "30",
"output": "240"
},
{
"input": "31",
"output": "256"
},
{
"input": "32",
"output": "272"
},
{
"input": "33",
"output": "289"
},
{
"input": "34",
"output": "306"
},
{
"input": "35",
"output": "324"
},
{
"input": "36",
"output": "342"
},
{
"input": "37",
"output": "361"
},
{
"input": "38",
"output": "380"
},
{
"input": "39",
"output": "400"
},
{
"input": "40",
"output": "420"
},
{
"input": "41",
"output": "441"
},
{
"input": "42",
"output": "462"
},
{
"input": "43",
"output": "484"
},
{
"input": "44",
"output": "506"
},
{
"input": "45",
"output": "529"
},
{
"input": "46",
"output": "552"
},
{
"input": "47",
"output": "576"
},
{
"input": "48",
"output": "600"
},
{
"input": "49",
"output": "625"
},
{
"input": "50",
"output": "650"
},
{
"input": "51",
"output": "676"
},
{
"input": "52",
"output": "702"
},
{
"input": "53",
"output": "729"
},
{
"input": "54",
"output": "756"
},
{
"input": "55",
"output": "784"
},
{
"input": "56",
"output": "812"
},
{
"input": "57",
"output": "841"
},
{
"input": "58",
"output": "870"
},
{
"input": "59",
"output": "900"
},
{
"input": "60",
"output": "930"
},
{
"input": "61",
"output": "961"
},
{
"input": "62",
"output": "992"
},
{
"input": "63",
"output": "1024"
},
{
"input": "64",
"output": "1056"
},
{
"input": "65",
"output": "1089"
},
{
"input": "66",
"output": "1122"
},
{
"input": "67",
"output": "1156"
},
{
"input": "68",
"output": "1190"
},
{
"input": "69",
"output": "1225"
},
{
"input": "70",
"output": "1260"
},
{
"input": "71",
"output": "1296"
},
{
"input": "72",
"output": "1332"
},
{
"input": "73",
"output": "1369"
},
{
"input": "74",
"output": "1406"
},
{
"input": "75",
"output": "1444"
},
{
"input": "76",
"output": "1482"
},
{
"input": "77",
"output": "1521"
},
{
"input": "78",
"output": "1560"
},
{
"input": "79",
"output": "1600"
},
{
"input": "80",
"output": "1640"
},
{
"input": "81",
"output": "1681"
},
{
"input": "82",
"output": "1722"
},
{
"input": "83",
"output": "1764"
},
{
"input": "84",
"output": "1806"
},
{
"input": "85",
"output": "1849"
},
{
"input": "86",
"output": "1892"
},
{
"input": "87",
"output": "1936"
},
{
"input": "88",
"output": "1980"
},
{
"input": "89",
"output": "2025"
},
{
"input": "90",
"output": "2070"
},
{
"input": "91",
"output": "2116"
},
{
"input": "92",
"output": "2162"
},
{
"input": "93",
"output": "2209"
},
{
"input": "94",
"output": "2256"
},
{
"input": "95",
"output": "2304"
},
{
"input": "96",
"output": "2352"
},
{
"input": "97",
"output": "2401"
},
{
"input": "98",
"output": "2450"
},
{
"input": "99",
"output": "2500"
},
{
"input": "1",
"output": "1"
},
{
"input": "5",
"output": "9"
}
] | 1,589,620,417
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 109
| 6,656,000
|
a=int(input())
a**=2
print(int(a/2))
|
Title: Segments
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an integer *N*. Consider all possible segments on the coordinate axis with endpoints at integer points with coordinates between 0 and *N*, inclusive; there will be of them.
You want to draw these segments in several layers so that in each layer the segments don't overlap (they might touch at the endpoints though). You can not move the segments to a different location on the coordinate axis.
Find the minimal number of layers you have to use for the given *N*.
Input Specification:
The only input line contains a single integer *N* (1<=≤<=*N*<=≤<=100).
Output Specification:
Output a single integer - the minimal number of layers required to draw the segments for the given *N*.
Demo Input:
['2\n', '3\n', '4\n']
Demo Output:
['2\n', '4\n', '6\n']
Note:
As an example, here are the segments and their optimal arrangement into layers for *N* = 4.
|
```python
a=int(input())
a**=2
print(int(a/2))
```
| 0
|
|
205
|
A
|
Little Elephant and Rozdil
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation"
] | null | null |
The Little Elephant loves Ukraine very much. Most of all he loves town Rozdol (ukr. "Rozdil").
However, Rozdil is dangerous to settle, so the Little Elephant wants to go to some other town. The Little Elephant doesn't like to spend much time on travelling, so for his journey he will choose a town that needs minimum time to travel to. If there are multiple such cities, then the Little Elephant won't go anywhere.
For each town except for Rozdil you know the time needed to travel to this town. Find the town the Little Elephant will go to or print "Still Rozdil", if he stays in Rozdil.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105) — the number of cities. The next line contains *n* integers, separated by single spaces: the *i*-th integer represents the time needed to go from town Rozdil to the *i*-th town. The time values are positive integers, not exceeding 109.
You can consider the cities numbered from 1 to *n*, inclusive. Rozdil is not among the numbered cities.
|
Print the answer on a single line — the number of the town the Little Elephant will go to. If there are multiple cities with minimum travel time, print "Still Rozdil" (without the quotes).
|
[
"2\n7 4\n",
"7\n7 4 47 100 4 9 12\n"
] |
[
"2\n",
"Still Rozdil\n"
] |
In the first sample there are only two cities where the Little Elephant can go. The travel time for the first town equals 7, to the second one — 4. The town which is closest to Rodzil (the only one) is the second one, so the answer is 2.
In the second sample the closest cities are cities two and five, the travelling time to both of them equals 4, so the answer is "Still Rozdil".
| 500
|
[
{
"input": "2\n7 4",
"output": "2"
},
{
"input": "7\n7 4 47 100 4 9 12",
"output": "Still Rozdil"
},
{
"input": "1\n47",
"output": "1"
},
{
"input": "2\n1000000000 1000000000",
"output": "Still Rozdil"
},
{
"input": "7\n7 6 5 4 3 2 1",
"output": "7"
},
{
"input": "10\n1 1 1 1 1 1 1 1 1 1",
"output": "Still Rozdil"
},
{
"input": "4\n1000000000 100000000 1000000 1000000",
"output": "Still Rozdil"
},
{
"input": "20\n7 1 1 2 1 1 8 7 7 8 4 3 7 10 5 3 10 5 10 6",
"output": "Still Rozdil"
},
{
"input": "20\n3 3 6 9 8 2 4 1 7 3 2 9 7 7 9 7 2 6 2 7",
"output": "8"
},
{
"input": "47\n35 79 84 56 67 95 80 34 77 68 14 55 95 32 40 89 58 79 96 66 50 79 35 86 31 74 91 35 22 72 84 38 11 59 73 51 65 11 11 62 30 12 32 71 69 15 11",
"output": "Still Rozdil"
},
{
"input": "47\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3",
"output": "32"
},
{
"input": "25\n73 56 65 70 57 57 49 50 65 68 54 48 66 55 55 66 60 70 47 62 63 70 62 70 63",
"output": "19"
},
{
"input": "100\n922 938 103 689 526 118 314 496 373 47 224 544 495 656 804 754 269 356 354 536 817 597 787 178 516 659 790 993 786 169 866 779 997 350 674 437 219 546 564 893 402 449 751 628 238 686 392 951 716 439 332 563 215 146 746 311 866 773 548 675 731 183 890 802 488 944 473 25 662 559 732 534 777 144 502 593 839 692 84 337 679 718 1005 663 709 940 86 469 310 960 902 233 606 761 116 231 662 903 68 622",
"output": "68"
},
{
"input": "5\n5 5 2 3 1",
"output": "5"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "3\n7 7 4",
"output": "3"
},
{
"input": "3\n2 2 1",
"output": "3"
},
{
"input": "3\n4 4 3",
"output": "3"
},
{
"input": "2\n10000001 10000002",
"output": "1"
},
{
"input": "4\n3 3 2 1",
"output": "4"
},
{
"input": "3\n1 2 3",
"output": "1"
},
{
"input": "2\n1000000000 100000000",
"output": "2"
},
{
"input": "1\n99999999",
"output": "1"
},
{
"input": "3\n5 5 3",
"output": "3"
},
{
"input": "3\n7 7 5",
"output": "3"
},
{
"input": "3\n3 3 1",
"output": "3"
},
{
"input": "4\n10 10 10 1",
"output": "4"
}
] | 1,627,242,661
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 45
| 218
| 15,360,000
|
n = int(input())
distances = list(map(int, input().split()))
min = 1000000001
count = 0
place = 0
fplace = 0
for distance in distances:
place += 1
if distance < min:
min = distance
fplace = place
for distance in distances:
if distance == min:
count += 1
if count > 1:
print("Still Rozdil")
else:
print(fplace)
|
Title: Little Elephant and Rozdil
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant loves Ukraine very much. Most of all he loves town Rozdol (ukr. "Rozdil").
However, Rozdil is dangerous to settle, so the Little Elephant wants to go to some other town. The Little Elephant doesn't like to spend much time on travelling, so for his journey he will choose a town that needs minimum time to travel to. If there are multiple such cities, then the Little Elephant won't go anywhere.
For each town except for Rozdil you know the time needed to travel to this town. Find the town the Little Elephant will go to or print "Still Rozdil", if he stays in Rozdil.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105) — the number of cities. The next line contains *n* integers, separated by single spaces: the *i*-th integer represents the time needed to go from town Rozdil to the *i*-th town. The time values are positive integers, not exceeding 109.
You can consider the cities numbered from 1 to *n*, inclusive. Rozdil is not among the numbered cities.
Output Specification:
Print the answer on a single line — the number of the town the Little Elephant will go to. If there are multiple cities with minimum travel time, print "Still Rozdil" (without the quotes).
Demo Input:
['2\n7 4\n', '7\n7 4 47 100 4 9 12\n']
Demo Output:
['2\n', 'Still Rozdil\n']
Note:
In the first sample there are only two cities where the Little Elephant can go. The travel time for the first town equals 7, to the second one — 4. The town which is closest to Rodzil (the only one) is the second one, so the answer is 2.
In the second sample the closest cities are cities two and five, the travelling time to both of them equals 4, so the answer is "Still Rozdil".
|
```python
n = int(input())
distances = list(map(int, input().split()))
min = 1000000001
count = 0
place = 0
fplace = 0
for distance in distances:
place += 1
if distance < min:
min = distance
fplace = place
for distance in distances:
if distance == min:
count += 1
if count > 1:
print("Still Rozdil")
else:
print(fplace)
```
| 3
|
|
239
|
A
|
Two Bags of Potatoes
|
PROGRAMMING
| 1,200
|
[
"greedy",
"implementation",
"math"
] | null | null |
Valera had two bags of potatoes, the first of these bags contains *x* (*x*<=≥<=1) potatoes, and the second — *y* (*y*<=≥<=1) potatoes. Valera — very scattered boy, so the first bag of potatoes (it contains *x* potatoes) Valera lost. Valera remembers that the total amount of potatoes (*x*<=+<=*y*) in the two bags, firstly, was not gerater than *n*, and, secondly, was divisible by *k*.
Help Valera to determine how many potatoes could be in the first bag. Print all such possible numbers in ascending order.
|
The first line of input contains three integers *y*, *k*, *n* (1<=≤<=*y*,<=*k*,<=*n*<=≤<=109; <=≤<=105).
|
Print the list of whitespace-separated integers — all possible values of *x* in ascending order. You should print each possible value of *x* exactly once.
If there are no such values of *x* print a single integer -1.
|
[
"10 1 10\n",
"10 6 40\n"
] |
[
"-1\n",
"2 8 14 20 26 \n"
] |
none
| 500
|
[
{
"input": "10 1 10",
"output": "-1"
},
{
"input": "10 6 40",
"output": "2 8 14 20 26 "
},
{
"input": "10 1 20",
"output": "1 2 3 4 5 6 7 8 9 10 "
},
{
"input": "1 10000 1000000000",
"output": "9999 19999 29999 39999 49999 59999 69999 79999 89999 99999 109999 119999 129999 139999 149999 159999 169999 179999 189999 199999 209999 219999 229999 239999 249999 259999 269999 279999 289999 299999 309999 319999 329999 339999 349999 359999 369999 379999 389999 399999 409999 419999 429999 439999 449999 459999 469999 479999 489999 499999 509999 519999 529999 539999 549999 559999 569999 579999 589999 599999 609999 619999 629999 639999 649999 659999 669999 679999 689999 699999 709999 719999 729999 739999 7499..."
},
{
"input": "84817 1 33457",
"output": "-1"
},
{
"input": "21 37 99",
"output": "16 53 "
},
{
"input": "78 7 15",
"output": "-1"
},
{
"input": "74 17 27",
"output": "-1"
},
{
"input": "79 23 43",
"output": "-1"
},
{
"input": "32 33 3",
"output": "-1"
},
{
"input": "55 49 44",
"output": "-1"
},
{
"input": "64 59 404",
"output": "54 113 172 231 290 "
},
{
"input": "61 69 820",
"output": "8 77 146 215 284 353 422 491 560 629 698 "
},
{
"input": "17 28 532",
"output": "11 39 67 95 123 151 179 207 235 263 291 319 347 375 403 431 459 487 515 "
},
{
"input": "46592 52 232",
"output": "-1"
},
{
"input": "1541 58 648",
"output": "-1"
},
{
"input": "15946 76 360",
"output": "-1"
},
{
"input": "30351 86 424",
"output": "-1"
},
{
"input": "1 2 37493",
"output": "1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85 87 89 91 93 95 97 99 101 103 105 107 109 111 113 115 117 119 121 123 125 127 129 131 133 135 137 139 141 143 145 147 149 151 153 155 157 159 161 163 165 167 169 171 173 175 177 179 181 183 185 187 189 191 193 195 197 199 201 203 205 207 209 211 213 215 217 219 221 223 225 227 229 231 233 235 237 239 241 243 245 247 249 251 253 255 257 259 261 263 265 267 269 271 273 275 277 279 281 28..."
},
{
"input": "1 3 27764",
"output": "2 5 8 11 14 17 20 23 26 29 32 35 38 41 44 47 50 53 56 59 62 65 68 71 74 77 80 83 86 89 92 95 98 101 104 107 110 113 116 119 122 125 128 131 134 137 140 143 146 149 152 155 158 161 164 167 170 173 176 179 182 185 188 191 194 197 200 203 206 209 212 215 218 221 224 227 230 233 236 239 242 245 248 251 254 257 260 263 266 269 272 275 278 281 284 287 290 293 296 299 302 305 308 311 314 317 320 323 326 329 332 335 338 341 344 347 350 353 356 359 362 365 368 371 374 377 380 383 386 389 392 395 398 401 404 407 410..."
},
{
"input": "10 4 9174",
"output": "2 6 10 14 18 22 26 30 34 38 42 46 50 54 58 62 66 70 74 78 82 86 90 94 98 102 106 110 114 118 122 126 130 134 138 142 146 150 154 158 162 166 170 174 178 182 186 190 194 198 202 206 210 214 218 222 226 230 234 238 242 246 250 254 258 262 266 270 274 278 282 286 290 294 298 302 306 310 314 318 322 326 330 334 338 342 346 350 354 358 362 366 370 374 378 382 386 390 394 398 402 406 410 414 418 422 426 430 434 438 442 446 450 454 458 462 466 470 474 478 482 486 490 494 498 502 506 510 514 518 522 526 530 534 53..."
},
{
"input": "33 7 4971",
"output": "2 9 16 23 30 37 44 51 58 65 72 79 86 93 100 107 114 121 128 135 142 149 156 163 170 177 184 191 198 205 212 219 226 233 240 247 254 261 268 275 282 289 296 303 310 317 324 331 338 345 352 359 366 373 380 387 394 401 408 415 422 429 436 443 450 457 464 471 478 485 492 499 506 513 520 527 534 541 548 555 562 569 576 583 590 597 604 611 618 625 632 639 646 653 660 667 674 681 688 695 702 709 716 723 730 737 744 751 758 765 772 779 786 793 800 807 814 821 828 835 842 849 856 863 870 877 884 891 898 905 912 919..."
},
{
"input": "981 1 3387",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "386 1 2747",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155..."
},
{
"input": "123 2 50000",
"output": "1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85 87 89 91 93 95 97 99 101 103 105 107 109 111 113 115 117 119 121 123 125 127 129 131 133 135 137 139 141 143 145 147 149 151 153 155 157 159 161 163 165 167 169 171 173 175 177 179 181 183 185 187 189 191 193 195 197 199 201 203 205 207 209 211 213 215 217 219 221 223 225 227 229 231 233 235 237 239 241 243 245 247 249 251 253 255 257 259 261 263 265 267 269 271 273 275 277 279 281 28..."
},
{
"input": "3123 100 10000000",
"output": "77 177 277 377 477 577 677 777 877 977 1077 1177 1277 1377 1477 1577 1677 1777 1877 1977 2077 2177 2277 2377 2477 2577 2677 2777 2877 2977 3077 3177 3277 3377 3477 3577 3677 3777 3877 3977 4077 4177 4277 4377 4477 4577 4677 4777 4877 4977 5077 5177 5277 5377 5477 5577 5677 5777 5877 5977 6077 6177 6277 6377 6477 6577 6677 6777 6877 6977 7077 7177 7277 7377 7477 7577 7677 7777 7877 7977 8077 8177 8277 8377 8477 8577 8677 8777 8877 8977 9077 9177 9277 9377 9477 9577 9677 9777 9877 9977 10077 10177 10277 1037..."
},
{
"input": "2 10000 1000000000",
"output": "9998 19998 29998 39998 49998 59998 69998 79998 89998 99998 109998 119998 129998 139998 149998 159998 169998 179998 189998 199998 209998 219998 229998 239998 249998 259998 269998 279998 289998 299998 309998 319998 329998 339998 349998 359998 369998 379998 389998 399998 409998 419998 429998 439998 449998 459998 469998 479998 489998 499998 509998 519998 529998 539998 549998 559998 569998 579998 589998 599998 609998 619998 629998 639998 649998 659998 669998 679998 689998 699998 709998 719998 729998 739998 7499..."
},
{
"input": "3 10000 1000000000",
"output": "9997 19997 29997 39997 49997 59997 69997 79997 89997 99997 109997 119997 129997 139997 149997 159997 169997 179997 189997 199997 209997 219997 229997 239997 249997 259997 269997 279997 289997 299997 309997 319997 329997 339997 349997 359997 369997 379997 389997 399997 409997 419997 429997 439997 449997 459997 469997 479997 489997 499997 509997 519997 529997 539997 549997 559997 569997 579997 589997 599997 609997 619997 629997 639997 649997 659997 669997 679997 689997 699997 709997 719997 729997 739997 7499..."
},
{
"input": "12312223 10000 1000000000",
"output": "7777 17777 27777 37777 47777 57777 67777 77777 87777 97777 107777 117777 127777 137777 147777 157777 167777 177777 187777 197777 207777 217777 227777 237777 247777 257777 267777 277777 287777 297777 307777 317777 327777 337777 347777 357777 367777 377777 387777 397777 407777 417777 427777 437777 447777 457777 467777 477777 487777 497777 507777 517777 527777 537777 547777 557777 567777 577777 587777 597777 607777 617777 627777 637777 647777 657777 667777 677777 687777 697777 707777 717777 727777 737777 7477..."
},
{
"input": "500000000 1000000000 1000000000",
"output": "500000000 "
},
{
"input": "1 1000000000 1000000000",
"output": "999999999 "
},
{
"input": "10 6 11",
"output": "-1"
},
{
"input": "2 100 10",
"output": "-1"
},
{
"input": "1 100000007 1000000000",
"output": "100000006 200000013 300000020 400000027 500000034 600000041 700000048 800000055 900000062 "
},
{
"input": "1 999999999 1000000000",
"output": "999999998 "
},
{
"input": "100000000 1000000000 1000000000",
"output": "900000000 "
},
{
"input": "11 2 12",
"output": "1 "
},
{
"input": "31 10 39",
"output": "-1"
},
{
"input": "48 6 50",
"output": "-1"
},
{
"input": "500000000 500000000 1000000000",
"output": "500000000 "
},
{
"input": "1 1000000000 999999999",
"output": "-1"
},
{
"input": "4 2 10",
"output": "2 4 6 "
},
{
"input": "1000000000 1 1",
"output": "-1"
},
{
"input": "1000000000 1 100000",
"output": "-1"
},
{
"input": "1000000000 1 10",
"output": "-1"
},
{
"input": "10 5 14",
"output": "-1"
},
{
"input": "500000000 499999999 1000000000",
"output": "499999998 "
},
{
"input": "1 999999997 1000000000",
"output": "999999996 "
}
] | 1,643,223,548
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 1
| 60
| 0
|
y,k,n=map(int, input().split())
res = []
for i in range(1,n-y):
if (y+i)%k==0:
res.append(i)
print(res if len(res)!=0 else -1)
|
Title: Two Bags of Potatoes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera had two bags of potatoes, the first of these bags contains *x* (*x*<=≥<=1) potatoes, and the second — *y* (*y*<=≥<=1) potatoes. Valera — very scattered boy, so the first bag of potatoes (it contains *x* potatoes) Valera lost. Valera remembers that the total amount of potatoes (*x*<=+<=*y*) in the two bags, firstly, was not gerater than *n*, and, secondly, was divisible by *k*.
Help Valera to determine how many potatoes could be in the first bag. Print all such possible numbers in ascending order.
Input Specification:
The first line of input contains three integers *y*, *k*, *n* (1<=≤<=*y*,<=*k*,<=*n*<=≤<=109; <=≤<=105).
Output Specification:
Print the list of whitespace-separated integers — all possible values of *x* in ascending order. You should print each possible value of *x* exactly once.
If there are no such values of *x* print a single integer -1.
Demo Input:
['10 1 10\n', '10 6 40\n']
Demo Output:
['-1\n', '2 8 14 20 26 \n']
Note:
none
|
```python
y,k,n=map(int, input().split())
res = []
for i in range(1,n-y):
if (y+i)%k==0:
res.append(i)
print(res if len(res)!=0 else -1)
```
| 0
|
|
408
|
A
|
Line to Cashier
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Little Vasya went to the supermarket to get some groceries. He walked about the supermarket for a long time and got a basket full of products. Now he needs to choose the cashier to pay for the products.
There are *n* cashiers at the exit from the supermarket. At the moment the queue for the *i*-th cashier already has *k**i* people. The *j*-th person standing in the queue to the *i*-th cashier has *m**i*,<=*j* items in the basket. Vasya knows that:
- the cashier needs 5 seconds to scan one item; - after the cashier scans each item of some customer, he needs 15 seconds to take the customer's money and give him the change.
Of course, Vasya wants to select a queue so that he can leave the supermarket as soon as possible. Help him write a program that displays the minimum number of seconds after which Vasya can get to one of the cashiers.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of cashes in the shop. The second line contains *n* space-separated integers: *k*1,<=*k*2,<=...,<=*k**n* (1<=≤<=*k**i*<=≤<=100), where *k**i* is the number of people in the queue to the *i*-th cashier.
The *i*-th of the next *n* lines contains *k**i* space-separated integers: *m**i*,<=1,<=*m**i*,<=2,<=...,<=*m**i*,<=*k**i* (1<=≤<=*m**i*,<=*j*<=≤<=100) — the number of products the *j*-th person in the queue for the *i*-th cash has.
|
Print a single integer — the minimum number of seconds Vasya needs to get to the cashier.
|
[
"1\n1\n1\n",
"4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8\n"
] |
[
"20\n",
"100\n"
] |
In the second test sample, if Vasya goes to the first queue, he gets to the cashier in 100·5 + 15 = 515 seconds. But if he chooses the second queue, he will need 1·5 + 2·5 + 2·5 + 3·5 + 4·15 = 100 seconds. He will need 1·5 + 9·5 + 1·5 + 3·15 = 100 seconds for the third one and 7·5 + 8·5 + 2·15 = 105 seconds for the fourth one. Thus, Vasya gets to the cashier quicker if he chooses the second or the third queue.
| 500
|
[
{
"input": "1\n1\n1",
"output": "20"
},
{
"input": "4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8",
"output": "100"
},
{
"input": "4\n5 4 5 5\n3 1 3 1 2\n3 1 1 3\n1 1 1 2 2\n2 2 1 1 3",
"output": "100"
},
{
"input": "5\n5 3 6 6 4\n7 5 3 3 9\n6 8 2\n1 10 8 5 9 2\n9 7 8 5 9 10\n9 8 3 3",
"output": "125"
},
{
"input": "5\n10 10 10 10 10\n6 7 8 6 8 5 9 8 10 5\n9 6 9 8 7 8 8 10 8 5\n8 7 7 8 7 5 6 8 9 5\n6 5 10 5 5 10 7 8 5 5\n10 9 8 7 6 9 7 9 6 5",
"output": "480"
},
{
"input": "10\n9 10 10 10 9 5 9 7 8 7\n11 6 10 4 4 15 7 15 5\n3 9 11 12 11 1 13 13 1 5\n6 15 9 12 3 2 8 12 11 10\n7 1 1 6 10 2 6 1 14 2\n8 14 2 3 6 1 14 1 12\n6 10 9 3 5\n13 12 12 7 13 4 4 8 10\n5 6 4 3 14 9 13\n8 12 1 5 7 4 13 1\n1 9 5 3 5 1 4",
"output": "240"
},
{
"input": "10\n5 5 5 5 5 5 5 5 5 5\n5 5 4 5 4\n6 5 7 7 6\n5 4 4 5 5\n4 4 5 5 5\n7 6 4 5 7\n4 6 5 4 5\n6 6 7 6 6\n4 5 4 4 7\n7 5 4 4 5\n6 6 7 4 4",
"output": "190"
},
{
"input": "1\n1\n100",
"output": "515"
},
{
"input": "1\n90\n90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90",
"output": "41850"
}
] | 1,628,162,542
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 46
| 6,656,000
|
n = int(input())
n1, n2, n3, n4 = map(int, input().split())
sum_list = list()
for i in range(n):
arr = list(map(int, input().split()))
sum_list.append(sum(arr)*5 +len(arr)*15 )
print(min(sum_list))
|
Title: Line to Cashier
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Vasya went to the supermarket to get some groceries. He walked about the supermarket for a long time and got a basket full of products. Now he needs to choose the cashier to pay for the products.
There are *n* cashiers at the exit from the supermarket. At the moment the queue for the *i*-th cashier already has *k**i* people. The *j*-th person standing in the queue to the *i*-th cashier has *m**i*,<=*j* items in the basket. Vasya knows that:
- the cashier needs 5 seconds to scan one item; - after the cashier scans each item of some customer, he needs 15 seconds to take the customer's money and give him the change.
Of course, Vasya wants to select a queue so that he can leave the supermarket as soon as possible. Help him write a program that displays the minimum number of seconds after which Vasya can get to one of the cashiers.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of cashes in the shop. The second line contains *n* space-separated integers: *k*1,<=*k*2,<=...,<=*k**n* (1<=≤<=*k**i*<=≤<=100), where *k**i* is the number of people in the queue to the *i*-th cashier.
The *i*-th of the next *n* lines contains *k**i* space-separated integers: *m**i*,<=1,<=*m**i*,<=2,<=...,<=*m**i*,<=*k**i* (1<=≤<=*m**i*,<=*j*<=≤<=100) — the number of products the *j*-th person in the queue for the *i*-th cash has.
Output Specification:
Print a single integer — the minimum number of seconds Vasya needs to get to the cashier.
Demo Input:
['1\n1\n1\n', '4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8\n']
Demo Output:
['20\n', '100\n']
Note:
In the second test sample, if Vasya goes to the first queue, he gets to the cashier in 100·5 + 15 = 515 seconds. But if he chooses the second queue, he will need 1·5 + 2·5 + 2·5 + 3·5 + 4·15 = 100 seconds. He will need 1·5 + 9·5 + 1·5 + 3·15 = 100 seconds for the third one and 7·5 + 8·5 + 2·15 = 105 seconds for the fourth one. Thus, Vasya gets to the cashier quicker if he chooses the second or the third queue.
|
```python
n = int(input())
n1, n2, n3, n4 = map(int, input().split())
sum_list = list()
for i in range(n):
arr = list(map(int, input().split()))
sum_list.append(sum(arr)*5 +len(arr)*15 )
print(min(sum_list))
```
| -1
|
|
215
|
A
|
Bicycle Chain
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation"
] | null | null |
Vasya's bicycle chain drive consists of two parts: *n* stars are attached to the pedal axle, *m* stars are attached to the rear wheel axle. The chain helps to rotate the rear wheel by transmitting the pedal rotation.
We know that the *i*-th star on the pedal axle has *a**i* (0<=<<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*) teeth, and the *j*-th star on the rear wheel axle has *b**j* (0<=<<=*b*1<=<<=*b*2<=<<=...<=<<=*b**m*) teeth. Any pair (*i*,<=*j*) (1<=≤<=*i*<=≤<=*n*; 1<=≤<=*j*<=≤<=*m*) is called a gear and sets the indexes of stars to which the chain is currently attached. Gear (*i*,<=*j*) has a gear ratio, equal to the value .
Since Vasya likes integers, he wants to find such gears (*i*,<=*j*), that their ratios are integers. On the other hand, Vasya likes fast driving, so among all "integer" gears (*i*,<=*j*) he wants to choose a gear with the maximum ratio. Help him to find the number of such gears.
In the problem, fraction denotes division in real numbers, that is, no rounding is performed.
|
The first input line contains integer *n* (1<=≤<=*n*<=≤<=50) — the number of stars on the bicycle's pedal axle. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=104) in the order of strict increasing.
The third input line contains integer *m* (1<=≤<=*m*<=≤<=50) — the number of stars on the rear wheel axle. The fourth line contains *m* integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b**i*<=≤<=104) in the order of strict increasing.
It is guaranteed that there exists at least one gear (*i*,<=*j*), that its gear ratio is an integer. The numbers on the lines are separated by spaces.
|
Print the number of "integer" gears with the maximum ratio among all "integer" gears.
|
[
"2\n4 5\n3\n12 13 15\n",
"4\n1 2 3 4\n5\n10 11 12 13 14\n"
] |
[
"2\n",
"1\n"
] |
In the first sample the maximum "integer" gear ratio equals 3. There are two gears that have such gear ratio. For one of them *a*<sub class="lower-index">1</sub> = 4, *b*<sub class="lower-index">1</sub> = 12, and for the other *a*<sub class="lower-index">2</sub> = 5, *b*<sub class="lower-index">3</sub> = 15.
| 500
|
[
{
"input": "2\n4 5\n3\n12 13 15",
"output": "2"
},
{
"input": "4\n1 2 3 4\n5\n10 11 12 13 14",
"output": "1"
},
{
"input": "1\n1\n1\n1",
"output": "1"
},
{
"input": "2\n1 2\n1\n1",
"output": "1"
},
{
"input": "1\n1\n2\n1 2",
"output": "1"
},
{
"input": "4\n3 7 11 13\n4\n51 119 187 221",
"output": "4"
},
{
"input": "4\n2 3 4 5\n3\n1 2 3",
"output": "2"
},
{
"input": "10\n6 12 13 20 48 53 74 92 96 97\n10\n1 21 32 36 47 54 69 75 95 97",
"output": "1"
},
{
"input": "10\n5 9 10 14 15 17 19 22 24 26\n10\n2 11 17 19 21 22 24 25 27 28",
"output": "1"
},
{
"input": "10\n24 53 56 126 354 432 442 740 795 856\n10\n273 438 494 619 689 711 894 947 954 958",
"output": "1"
},
{
"input": "10\n3 4 6 7 8 10 14 16 19 20\n10\n3 4 5 7 8 10 15 16 18 20",
"output": "1"
},
{
"input": "10\n1 6 8 14 15 17 25 27 34 39\n10\n1 8 16 17 19 22 32 39 44 50",
"output": "1"
},
{
"input": "10\n5 21 22 23 25 32 35 36 38 39\n10\n3 7 8 9 18 21 23 24 36 38",
"output": "4"
},
{
"input": "50\n5 8 13 16 19 20 21 22 24 27 28 29 30 32 33 34 35 43 45 48 50 51 54 55 58 59 60 61 62 65 70 71 72 76 78 79 80 81 83 84 85 87 89 91 92 94 97 98 99 100\n50\n2 3 5 6 7 10 15 16 17 20 23 28 29 30 31 34 36 37 40 42 45 46 48 54 55 56 58 59 61 62 69 70 71 72 75 76 78 82 84 85 86 87 88 89 90 91 92 97 99 100",
"output": "1"
},
{
"input": "50\n3 5 6 8 9 11 13 19 21 23 24 32 34 35 42 50 51 52 56 58 59 69 70 72 73 75 76 77 78 80 83 88 90 95 96 100 101 102 108 109 113 119 124 135 138 141 142 143 145 150\n50\n5 8 10 11 18 19 23 30 35 43 51 53 55 58 63 68 69 71 77 78 79 82 83 86 88 89 91 92 93 94 96 102 103 105 109 110 113 114 116 123 124 126 127 132 133 135 136 137 142 149",
"output": "1"
},
{
"input": "50\n6 16 24 25 27 33 36 40 51 60 62 65 71 72 75 77 85 87 91 93 98 102 103 106 117 118 120 121 122 123 125 131 134 136 143 148 155 157 160 161 164 166 170 178 184 187 188 192 194 197\n50\n5 9 17 23 27 34 40 44 47 59 62 70 81 82 87 88 89 90 98 101 102 110 113 114 115 116 119 122 124 128 130 137 138 140 144 150 152 155 159 164 166 169 171 175 185 186 187 189 190 193",
"output": "1"
},
{
"input": "50\n14 22 23 31 32 35 48 63 76 79 88 97 101 102 103 104 106 113 114 115 116 126 136 138 145 152 155 156 162 170 172 173 179 180 182 203 208 210 212 222 226 229 231 232 235 237 245 246 247 248\n50\n2 5 6 16 28 44 45 46 54 55 56 63 72 80 87 93 94 96 97 100 101 103 132 135 140 160 164 165 167 168 173 180 182 185 186 192 194 198 199 202 203 211 213 216 217 227 232 233 236 245",
"output": "1"
},
{
"input": "50\n14 19 33 35 38 41 51 54 69 70 71 73 76 80 84 94 102 104 105 106 107 113 121 128 131 168 180 181 187 191 195 201 205 207 210 216 220 238 249 251 263 271 272 275 281 283 285 286 291 294\n50\n2 3 5 20 21 35 38 40 43 48 49 52 55 64 73 77 82 97 109 113 119 121 125 132 137 139 145 146 149 180 182 197 203 229 234 241 244 251 264 271 274 281 284 285 287 291 292 293 294 298",
"output": "1"
},
{
"input": "50\n2 4 5 16 18 19 22 23 25 26 34 44 48 54 67 79 80 84 92 110 116 133 138 154 163 171 174 202 205 218 228 229 234 245 247 249 250 263 270 272 274 275 277 283 289 310 312 334 339 342\n50\n1 5 17 18 25 37 46 47 48 59 67 75 80 83 84 107 115 122 137 141 159 162 175 180 184 204 221 224 240 243 247 248 249 258 259 260 264 266 269 271 274 293 294 306 329 330 334 335 342 350",
"output": "1"
},
{
"input": "50\n6 9 11 21 28 39 42 56 60 63 81 88 91 95 105 110 117 125 149 165 174 176 185 189 193 196 205 231 233 268 278 279 281 286 289 292 298 303 305 306 334 342 350 353 361 371 372 375 376 378\n50\n6 17 20 43 45 52 58 59 82 83 88 102 111 118 121 131 145 173 190 191 200 216 224 225 232 235 243 256 260 271 290 291 321 322 323 329 331 333 334 341 343 348 351 354 356 360 366 379 387 388",
"output": "1"
},
{
"input": "10\n17 239 443 467 661 1069 1823 2333 3767 4201\n20\n51 83 97 457 593 717 997 1329 1401 1459 1471 1983 2371 2539 3207 3251 3329 5469 6637 6999",
"output": "8"
},
{
"input": "20\n179 359 401 467 521 601 919 941 1103 1279 1709 1913 1949 2003 2099 2143 2179 2213 2399 4673\n20\n151 181 191 251 421 967 1109 1181 1249 1447 1471 1553 1619 2327 2551 2791 3049 3727 6071 7813",
"output": "3"
},
{
"input": "20\n79 113 151 709 809 983 1291 1399 1409 1429 2377 2659 2671 2897 3217 3511 3557 3797 3823 4363\n10\n19 101 659 797 1027 1963 2129 2971 3299 9217",
"output": "3"
},
{
"input": "30\n19 47 109 179 307 331 389 401 461 509 547 569 617 853 883 1249 1361 1381 1511 1723 1741 1783 2459 2531 2621 3533 3821 4091 5557 6217\n20\n401 443 563 941 967 997 1535 1567 1655 1747 1787 1945 1999 2251 2305 2543 2735 4415 6245 7555",
"output": "8"
},
{
"input": "30\n3 43 97 179 257 313 353 359 367 389 397 457 547 599 601 647 1013 1021 1063 1433 1481 1531 1669 3181 3373 3559 3769 4157 4549 5197\n50\n13 15 17 19 29 79 113 193 197 199 215 223 271 293 359 485 487 569 601 683 895 919 941 967 1283 1285 1289 1549 1565 1765 1795 1835 1907 1931 1945 1985 1993 2285 2731 2735 2995 3257 4049 4139 5105 5315 7165 7405 7655 8345",
"output": "20"
},
{
"input": "50\n11 17 23 53 59 109 137 149 173 251 353 379 419 421 439 503 593 607 661 773 821 877 941 997 1061 1117 1153 1229 1289 1297 1321 1609 1747 2311 2389 2543 2693 3041 3083 3137 3181 3209 3331 3373 3617 3767 4201 4409 4931 6379\n50\n55 59 67 73 85 89 101 115 211 263 295 353 545 599 607 685 739 745 997 1031 1255 1493 1523 1667 1709 1895 1949 2161 2195 2965 3019 3035 3305 3361 3373 3673 3739 3865 3881 4231 4253 4385 4985 5305 5585 5765 6145 6445 8045 8735",
"output": "23"
},
{
"input": "5\n33 78 146 3055 4268\n5\n2211 2584 5226 9402 9782",
"output": "3"
},
{
"input": "5\n35 48 52 86 8001\n10\n332 3430 3554 4704 4860 5096 6215 7583 8228 8428",
"output": "4"
},
{
"input": "10\n97 184 207 228 269 2084 4450 6396 7214 9457\n16\n338 1179 1284 1545 1570 2444 3167 3395 3397 5550 6440 7245 7804 7980 9415 9959",
"output": "5"
},
{
"input": "30\n25 30 41 57 58 62 70 72 76 79 84 85 88 91 98 101 104 109 119 129 136 139 148 151 926 1372 3093 3936 5423 7350\n25\n1600 1920 2624 3648 3712 3968 4480 4608 4864 5056 5376 5440 5632 5824 6272 6464 6656 6934 6976 7616 8256 8704 8896 9472 9664",
"output": "24"
},
{
"input": "5\n33 78 146 3055 4268\n5\n2211 2584 5226 9402 9782",
"output": "3"
},
{
"input": "5\n35 48 52 86 8001\n10\n332 3430 3554 4704 4860 5096 6215 7583 8228 8428",
"output": "4"
},
{
"input": "10\n97 184 207 228 269 2084 4450 6396 7214 9457\n16\n338 1179 1284 1545 1570 2444 3167 3395 3397 5550 6440 7245 7804 7980 9415 9959",
"output": "5"
},
{
"input": "30\n25 30 41 57 58 62 70 72 76 79 84 85 88 91 98 101 104 109 119 129 136 139 148 151 926 1372 3093 3936 5423 7350\n25\n1600 1920 2624 3648 3712 3968 4480 4608 4864 5056 5376 5440 5632 5824 6272 6464 6656 6934 6976 7616 8256 8704 8896 9472 9664",
"output": "24"
},
{
"input": "47\n66 262 357 457 513 530 538 540 592 691 707 979 1015 1242 1246 1667 1823 1886 1963 2133 2649 2679 2916 2949 3413 3523 3699 3958 4393 4922 5233 5306 5799 6036 6302 6629 7208 7282 7315 7822 7833 7927 8068 8150 8870 8962 9987\n39\n167 199 360 528 1515 1643 1986 1988 2154 2397 2856 3552 3656 3784 3980 4096 4104 4240 4320 4736 4951 5266 5656 5849 5850 6169 6517 6875 7244 7339 7689 7832 8120 8716 9503 9509 9933 9936 9968",
"output": "12"
},
{
"input": "1\n94\n50\n423 446 485 1214 1468 1507 1853 1930 1999 2258 2271 2285 2425 2543 2715 2743 2992 3196 4074 4108 4448 4475 4652 5057 5250 5312 5356 5375 5731 5986 6298 6501 6521 7146 7255 7276 7332 7481 7998 8141 8413 8665 8908 9221 9336 9491 9504 9677 9693 9706",
"output": "1"
},
{
"input": "50\n51 67 75 186 194 355 512 561 720 876 1077 1221 1503 1820 2153 2385 2568 2608 2937 2969 3271 3311 3481 4081 4093 4171 4255 4256 4829 5020 5192 5636 5817 6156 6712 6717 7153 7436 7608 7612 7866 7988 8264 8293 8867 9311 9879 9882 9889 9908\n1\n5394",
"output": "1"
},
{
"input": "50\n26 367 495 585 675 789 855 1185 1312 1606 2037 2241 2587 2612 2628 2807 2873 2924 3774 4067 4376 4668 4902 5001 5082 5100 5104 5209 5345 5515 5661 5777 5902 5907 6155 6323 6675 6791 7503 8159 8207 8254 8740 8848 8855 8933 9069 9164 9171 9586\n5\n1557 6246 7545 8074 8284",
"output": "1"
},
{
"input": "5\n25 58 91 110 2658\n50\n21 372 909 1172 1517 1554 1797 1802 1843 1977 2006 2025 2137 2225 2317 2507 2645 2754 2919 3024 3202 3212 3267 3852 4374 4487 4553 4668 4883 4911 4916 5016 5021 5068 5104 5162 5683 5856 6374 6871 7333 7531 8099 8135 8173 8215 8462 8776 9433 9790",
"output": "4"
},
{
"input": "45\n37 48 56 59 69 70 79 83 85 86 99 114 131 134 135 145 156 250 1739 1947 2116 2315 2449 3104 3666 4008 4406 4723 4829 5345 5836 6262 6296 6870 7065 7110 7130 7510 7595 8092 8442 8574 9032 9091 9355\n50\n343 846 893 1110 1651 1837 2162 2331 2596 3012 3024 3131 3294 3394 3528 3717 3997 4125 4347 4410 4581 4977 5030 5070 5119 5229 5355 5413 5418 5474 5763 5940 6151 6161 6164 6237 6506 6519 6783 7182 7413 7534 8069 8253 8442 8505 9135 9308 9828 9902",
"output": "17"
},
{
"input": "50\n17 20 22 28 36 38 46 47 48 50 52 57 58 62 63 69 70 74 75 78 79 81 82 86 87 90 93 95 103 202 292 442 1756 1769 2208 2311 2799 2957 3483 4280 4324 4932 5109 5204 6225 6354 6561 7136 8754 9670\n40\n68 214 957 1649 1940 2078 2134 2716 3492 3686 4462 4559 4656 4756 4850 5044 5490 5529 5592 5626 6014 6111 6693 6790 7178 7275 7566 7663 7702 7857 7954 8342 8511 8730 8957 9021 9215 9377 9445 9991",
"output": "28"
},
{
"input": "39\n10 13 21 25 36 38 47 48 58 64 68 69 73 79 86 972 2012 2215 2267 2503 3717 3945 4197 4800 5266 6169 6612 6824 7023 7322 7582 7766 8381 8626 8879 9079 9088 9838 9968\n50\n432 877 970 1152 1202 1223 1261 1435 1454 1578 1843 1907 2003 2037 2183 2195 2215 2425 3065 3492 3615 3637 3686 3946 4189 4415 4559 4656 4665 4707 4886 4887 5626 5703 5955 6208 6521 6581 6596 6693 6985 7013 7081 7343 7663 8332 8342 8637 9207 9862",
"output": "15"
},
{
"input": "50\n7 144 269 339 395 505 625 688 709 950 1102 1152 1350 1381 1641 1830 1977 1999 2093 2180 2718 3308 3574 4168 4232 4259 4393 4689 4982 5154 5476 5581 5635 5721 6159 6302 6741 7010 7152 7315 7417 7482 8116 8239 8640 9347 9395 9614 9661 9822\n20\n84 162 292 1728 1866 2088 3228 3470 4068 5318 5470 6060 6380 6929 7500 8256 8399 8467 8508 9691",
"output": "8"
},
{
"input": "50\n159 880 1070 1139 1358 1608 1691 1841 2073 2171 2213 2597 2692 2759 2879 2931 3173 3217 3441 4201 4878 5106 5129 5253 5395 5647 5968 6019 6130 6276 6286 6330 6409 6728 7488 7713 7765 7828 7899 8064 8264 8457 8483 8685 8900 8946 8965 9133 9187 9638\n45\n57 159 1070 1139 1391 1608 1691 1841 2171 2213 2692 2759 2931 3173 3217 3441 4201 4878 5106 5129 5253 5647 5968 6130 6276 6286 6409 7488 7694 7713 7765 7828 7899 8003 8064 8081 8244 8264 8685 8900 8946 8965 9133 9638 9673",
"output": "38"
},
{
"input": "3\n3 4 5\n3\n6 20 25",
"output": "2"
},
{
"input": "4\n2 3 5 8\n4\n2 6 8 10",
"output": "1"
},
{
"input": "4\n3 5 7 11\n4\n3 5 7 22",
"output": "1"
},
{
"input": "2\n2 3\n3\n20 30 50",
"output": "1"
},
{
"input": "3\n1 2 3\n4\n2 4 6 49",
"output": "1"
},
{
"input": "2\n4 5\n3\n12 15 20",
"output": "1"
},
{
"input": "3\n2 5 7\n3\n4 5 7",
"output": "1"
},
{
"input": "3\n3 5 8\n3\n6 8 10",
"output": "2"
},
{
"input": "2\n2 3\n4\n4 6 9 33",
"output": "1"
},
{
"input": "2\n2 3\n4\n4 6 21 40",
"output": "1"
},
{
"input": "3\n4 9 10\n3\n8 9 10",
"output": "1"
},
{
"input": "5\n1 5 6 9 51\n5\n5 12 18 27 10000",
"output": "1"
},
{
"input": "13\n1 2 3 4 5 6 7 8 9 10 11 12 13\n1\n14",
"output": "1"
}
] | 1,683,781,367
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 57
| 124
| 1,740,800
|
n=int(input())
a=list(map(int,input().split()))
m=int(input())
b=list(map(int,input().split()))
p=1
c=0
for i in range(n):
for j in range(m):
c=0
ans=b[j]/a[i]
if ans%1==0 and ans>p:
p=ans
for i in range(n):
for j in range(m):
if b[j]/a[i]==p:
c+=1
print(c)
|
Title: Bicycle Chain
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya's bicycle chain drive consists of two parts: *n* stars are attached to the pedal axle, *m* stars are attached to the rear wheel axle. The chain helps to rotate the rear wheel by transmitting the pedal rotation.
We know that the *i*-th star on the pedal axle has *a**i* (0<=<<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*) teeth, and the *j*-th star on the rear wheel axle has *b**j* (0<=<<=*b*1<=<<=*b*2<=<<=...<=<<=*b**m*) teeth. Any pair (*i*,<=*j*) (1<=≤<=*i*<=≤<=*n*; 1<=≤<=*j*<=≤<=*m*) is called a gear and sets the indexes of stars to which the chain is currently attached. Gear (*i*,<=*j*) has a gear ratio, equal to the value .
Since Vasya likes integers, he wants to find such gears (*i*,<=*j*), that their ratios are integers. On the other hand, Vasya likes fast driving, so among all "integer" gears (*i*,<=*j*) he wants to choose a gear with the maximum ratio. Help him to find the number of such gears.
In the problem, fraction denotes division in real numbers, that is, no rounding is performed.
Input Specification:
The first input line contains integer *n* (1<=≤<=*n*<=≤<=50) — the number of stars on the bicycle's pedal axle. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=104) in the order of strict increasing.
The third input line contains integer *m* (1<=≤<=*m*<=≤<=50) — the number of stars on the rear wheel axle. The fourth line contains *m* integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b**i*<=≤<=104) in the order of strict increasing.
It is guaranteed that there exists at least one gear (*i*,<=*j*), that its gear ratio is an integer. The numbers on the lines are separated by spaces.
Output Specification:
Print the number of "integer" gears with the maximum ratio among all "integer" gears.
Demo Input:
['2\n4 5\n3\n12 13 15\n', '4\n1 2 3 4\n5\n10 11 12 13 14\n']
Demo Output:
['2\n', '1\n']
Note:
In the first sample the maximum "integer" gear ratio equals 3. There are two gears that have such gear ratio. For one of them *a*<sub class="lower-index">1</sub> = 4, *b*<sub class="lower-index">1</sub> = 12, and for the other *a*<sub class="lower-index">2</sub> = 5, *b*<sub class="lower-index">3</sub> = 15.
|
```python
n=int(input())
a=list(map(int,input().split()))
m=int(input())
b=list(map(int,input().split()))
p=1
c=0
for i in range(n):
for j in range(m):
c=0
ans=b[j]/a[i]
if ans%1==0 and ans>p:
p=ans
for i in range(n):
for j in range(m):
if b[j]/a[i]==p:
c+=1
print(c)
```
| 3
|
|
990
|
B
|
Micro-World
|
PROGRAMMING
| 1,200
|
[
"greedy",
"sortings"
] | null | null |
You have a Petri dish with bacteria and you are preparing to dive into the harsh micro-world. But, unfortunately, you don't have any microscope nearby, so you can't watch them.
You know that you have $n$ bacteria in the Petri dish and size of the $i$-th bacteria is $a_i$. Also you know intergalactic positive integer constant $K$.
The $i$-th bacteria can swallow the $j$-th bacteria if and only if $a_i > a_j$ and $a_i \le a_j + K$. The $j$-th bacteria disappear, but the $i$-th bacteria doesn't change its size. The bacteria can perform multiple swallows. On each swallow operation any bacteria $i$ can swallow any bacteria $j$ if $a_i > a_j$ and $a_i \le a_j + K$. The swallow operations go one after another.
For example, the sequence of bacteria sizes $a=[101, 53, 42, 102, 101, 55, 54]$ and $K=1$. The one of possible sequences of swallows is: $[101, 53, 42, 102, \underline{101}, 55, 54]$ $\to$ $[101, \underline{53}, 42, 102, 55, 54]$ $\to$ $[\underline{101}, 42, 102, 55, 54]$ $\to$ $[42, 102, 55, \underline{54}]$ $\to$ $[42, 102, 55]$. In total there are $3$ bacteria remained in the Petri dish.
Since you don't have a microscope, you can only guess, what the minimal possible number of bacteria can remain in your Petri dish when you finally will find any microscope.
|
The first line contains two space separated positive integers $n$ and $K$ ($1 \le n \le 2 \cdot 10^5$, $1 \le K \le 10^6$) — number of bacteria and intergalactic constant $K$.
The second line contains $n$ space separated integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 10^6$) — sizes of bacteria you have.
|
Print the only integer — minimal possible number of bacteria can remain.
|
[
"7 1\n101 53 42 102 101 55 54\n",
"6 5\n20 15 10 15 20 25\n",
"7 1000000\n1 1 1 1 1 1 1\n"
] |
[
"3\n",
"1\n",
"7\n"
] |
The first example is clarified in the problem statement.
In the second example an optimal possible sequence of swallows is: $[20, 15, 10, 15, \underline{20}, 25]$ $\to$ $[20, 15, 10, \underline{15}, 25]$ $\to$ $[20, 15, \underline{10}, 25]$ $\to$ $[20, \underline{15}, 25]$ $\to$ $[\underline{20}, 25]$ $\to$ $[25]$.
In the third example no bacteria can swallow any other bacteria.
| 0
|
[
{
"input": "7 1\n101 53 42 102 101 55 54",
"output": "3"
},
{
"input": "6 5\n20 15 10 15 20 25",
"output": "1"
},
{
"input": "7 1000000\n1 1 1 1 1 1 1",
"output": "7"
},
{
"input": "1 1\n1",
"output": "1"
},
{
"input": "1 4\n8",
"output": "1"
},
{
"input": "10 1\n1 2 3 5 6 8 10 11 9 4",
"output": "2"
},
{
"input": "9 2\n1 6 1 5 5 8 6 8 7",
"output": "4"
},
{
"input": "15 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "15"
},
{
"input": "2 1000000\n1 1000000",
"output": "1"
},
{
"input": "7 2\n1 5 5 8 9 8 8",
"output": "4"
},
{
"input": "10 1\n2 6 3 4 2 4 4 3 2 1",
"output": "4"
},
{
"input": "4 1\n2 2 1 1",
"output": "2"
},
{
"input": "10 1\n6 3 1 3 6 4 1 3 6 4",
"output": "7"
},
{
"input": "2 1\n1 1",
"output": "2"
},
{
"input": "2 1\n1 2",
"output": "1"
},
{
"input": "8 2\n3 13 9 8 3 13 9 14",
"output": "5"
},
{
"input": "8 1000000\n1 1 5 1000000 1000000 2 2 2",
"output": "2"
},
{
"input": "2 1\n999152 999153",
"output": "1"
}
] | 1,529,661,400
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 3
| 2,000
| 14,028,800
|
n,k=map(int,input().split())
a=list(map(int,input().split()))
a=sorted(a)
i=1
while(True):
if a[i-1]<a[i] and a[i-1]+k>=a[i]:
del a[i-1]
i=i-1
else:
i+=1
if i==len(a):
break
print(len(a))
|
Title: Micro-World
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have a Petri dish with bacteria and you are preparing to dive into the harsh micro-world. But, unfortunately, you don't have any microscope nearby, so you can't watch them.
You know that you have $n$ bacteria in the Petri dish and size of the $i$-th bacteria is $a_i$. Also you know intergalactic positive integer constant $K$.
The $i$-th bacteria can swallow the $j$-th bacteria if and only if $a_i > a_j$ and $a_i \le a_j + K$. The $j$-th bacteria disappear, but the $i$-th bacteria doesn't change its size. The bacteria can perform multiple swallows. On each swallow operation any bacteria $i$ can swallow any bacteria $j$ if $a_i > a_j$ and $a_i \le a_j + K$. The swallow operations go one after another.
For example, the sequence of bacteria sizes $a=[101, 53, 42, 102, 101, 55, 54]$ and $K=1$. The one of possible sequences of swallows is: $[101, 53, 42, 102, \underline{101}, 55, 54]$ $\to$ $[101, \underline{53}, 42, 102, 55, 54]$ $\to$ $[\underline{101}, 42, 102, 55, 54]$ $\to$ $[42, 102, 55, \underline{54}]$ $\to$ $[42, 102, 55]$. In total there are $3$ bacteria remained in the Petri dish.
Since you don't have a microscope, you can only guess, what the minimal possible number of bacteria can remain in your Petri dish when you finally will find any microscope.
Input Specification:
The first line contains two space separated positive integers $n$ and $K$ ($1 \le n \le 2 \cdot 10^5$, $1 \le K \le 10^6$) — number of bacteria and intergalactic constant $K$.
The second line contains $n$ space separated integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 10^6$) — sizes of bacteria you have.
Output Specification:
Print the only integer — minimal possible number of bacteria can remain.
Demo Input:
['7 1\n101 53 42 102 101 55 54\n', '6 5\n20 15 10 15 20 25\n', '7 1000000\n1 1 1 1 1 1 1\n']
Demo Output:
['3\n', '1\n', '7\n']
Note:
The first example is clarified in the problem statement.
In the second example an optimal possible sequence of swallows is: $[20, 15, 10, 15, \underline{20}, 25]$ $\to$ $[20, 15, 10, \underline{15}, 25]$ $\to$ $[20, 15, \underline{10}, 25]$ $\to$ $[20, \underline{15}, 25]$ $\to$ $[\underline{20}, 25]$ $\to$ $[25]$.
In the third example no bacteria can swallow any other bacteria.
|
```python
n,k=map(int,input().split())
a=list(map(int,input().split()))
a=sorted(a)
i=1
while(True):
if a[i-1]<a[i] and a[i-1]+k>=a[i]:
del a[i-1]
i=i-1
else:
i+=1
if i==len(a):
break
print(len(a))
```
| 0
|
|
911
|
A
|
Nearest Minimums
|
PROGRAMMING
| 1,100
|
[
"implementation"
] | null | null |
You are given an array of *n* integer numbers *a*0,<=*a*1,<=...,<=*a**n*<=-<=1. Find the distance between two closest (nearest) minimums in it. It is guaranteed that in the array a minimum occurs at least two times.
|
The first line contains positive integer *n* (2<=≤<=*n*<=≤<=105) — size of the given array. The second line contains *n* integers *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 (1<=≤<=*a**i*<=≤<=109) — elements of the array. It is guaranteed that in the array a minimum occurs at least two times.
|
Print the only number — distance between two nearest minimums in the array.
|
[
"2\n3 3\n",
"3\n5 6 5\n",
"9\n2 1 3 5 4 1 2 3 1\n"
] |
[
"1\n",
"2\n",
"3\n"
] |
none
| 0
|
[
{
"input": "2\n3 3",
"output": "1"
},
{
"input": "3\n5 6 5",
"output": "2"
},
{
"input": "9\n2 1 3 5 4 1 2 3 1",
"output": "3"
},
{
"input": "6\n4 6 7 8 6 4",
"output": "5"
},
{
"input": "2\n1000000000 1000000000",
"output": "1"
},
{
"input": "42\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "2\n10000000 10000000",
"output": "1"
},
{
"input": "5\n100000000 100000001 100000000 100000001 100000000",
"output": "2"
},
{
"input": "9\n4 3 4 3 4 1 3 3 1",
"output": "3"
},
{
"input": "3\n10000000 1000000000 10000000",
"output": "2"
},
{
"input": "12\n5 6 6 5 6 1 9 9 9 9 9 1",
"output": "6"
},
{
"input": "5\n5 5 1 2 1",
"output": "2"
},
{
"input": "5\n2 2 1 3 1",
"output": "2"
},
{
"input": "3\n1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "3\n100000005 1000000000 100000005",
"output": "2"
},
{
"input": "5\n1 2 2 2 1",
"output": "4"
},
{
"input": "3\n10000 1000000 10000",
"output": "2"
},
{
"input": "3\n999999999 999999998 999999998",
"output": "1"
},
{
"input": "6\n2 1 1 2 3 4",
"output": "1"
},
{
"input": "4\n1000000000 900000000 900000000 1000000000",
"output": "1"
},
{
"input": "5\n7 7 2 7 2",
"output": "2"
},
{
"input": "6\n10 10 1 20 20 1",
"output": "3"
},
{
"input": "2\n999999999 999999999",
"output": "1"
},
{
"input": "10\n100000 100000 1 2 3 4 5 6 7 1",
"output": "7"
},
{
"input": "10\n3 3 1 2 2 1 10 10 10 10",
"output": "3"
},
{
"input": "5\n900000000 900000001 900000000 900000001 900000001",
"output": "2"
},
{
"input": "5\n3 3 2 5 2",
"output": "2"
},
{
"input": "2\n100000000 100000000",
"output": "1"
},
{
"input": "10\n10 15 10 2 54 54 54 54 2 10",
"output": "5"
},
{
"input": "2\n999999 999999",
"output": "1"
},
{
"input": "6\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "5\n1000000000 100000000 1000000000 1000000000 100000000",
"output": "3"
},
{
"input": "4\n10 9 10 9",
"output": "2"
},
{
"input": "5\n1 3 2 3 1",
"output": "4"
},
{
"input": "5\n2 2 1 4 1",
"output": "2"
},
{
"input": "6\n1 2 2 2 2 1",
"output": "5"
},
{
"input": "7\n3 7 6 7 6 7 3",
"output": "6"
},
{
"input": "8\n1 2 2 2 2 1 2 2",
"output": "5"
},
{
"input": "10\n2 2 2 3 3 1 3 3 3 1",
"output": "4"
},
{
"input": "2\n88888888 88888888",
"output": "1"
},
{
"input": "3\n100000000 100000000 100000000",
"output": "1"
},
{
"input": "10\n1 3 2 4 5 5 4 3 2 1",
"output": "9"
},
{
"input": "5\n2 2 1 2 1",
"output": "2"
},
{
"input": "6\n900000005 900000000 900000001 900000000 900000001 900000001",
"output": "2"
},
{
"input": "5\n41 41 1 41 1",
"output": "2"
},
{
"input": "6\n5 5 1 3 3 1",
"output": "3"
},
{
"input": "8\n1 2 2 2 1 2 2 2",
"output": "4"
},
{
"input": "7\n6 6 6 6 1 8 1",
"output": "2"
},
{
"input": "3\n999999999 1000000000 999999999",
"output": "2"
},
{
"input": "5\n5 5 4 10 4",
"output": "2"
},
{
"input": "11\n2 2 3 4 1 5 3 4 2 5 1",
"output": "6"
},
{
"input": "5\n3 5 4 5 3",
"output": "4"
},
{
"input": "6\n6 6 6 6 1 1",
"output": "1"
},
{
"input": "7\n11 1 3 2 3 1 11",
"output": "4"
},
{
"input": "5\n3 3 1 2 1",
"output": "2"
},
{
"input": "5\n4 4 2 5 2",
"output": "2"
},
{
"input": "4\n10000099 10000567 10000099 10000234",
"output": "2"
},
{
"input": "4\n100000009 100000011 100000012 100000009",
"output": "3"
},
{
"input": "2\n1000000 1000000",
"output": "1"
},
{
"input": "2\n10000010 10000010",
"output": "1"
},
{
"input": "10\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "8\n2 6 2 8 1 9 8 1",
"output": "3"
},
{
"input": "5\n7 7 1 8 1",
"output": "2"
},
{
"input": "7\n1 3 2 3 2 3 1",
"output": "6"
},
{
"input": "7\n2 3 2 1 3 4 1",
"output": "3"
},
{
"input": "5\n1000000000 999999999 1000000000 1000000000 999999999",
"output": "3"
},
{
"input": "4\n1000000000 1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "5\n5 5 3 5 3",
"output": "2"
},
{
"input": "6\n2 3 3 3 3 2",
"output": "5"
},
{
"input": "4\n1 1 2 2",
"output": "1"
},
{
"input": "5\n1 1 2 2 2",
"output": "1"
},
{
"input": "6\n2 1 1 2 2 2",
"output": "1"
},
{
"input": "5\n1000000000 1000000000 100000000 1000000000 100000000",
"output": "2"
},
{
"input": "7\n2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "8\n2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "10\n2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "11\n2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "12\n2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "13\n2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "14\n2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "15\n2 2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "16\n2 2 2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "17\n2 2 2 2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "18\n2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "19\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "20\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "4\n1000000000 100000000 100000000 1000000000",
"output": "1"
},
{
"input": "21\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2 2 2",
"output": "1"
},
{
"input": "4\n1 2 3 1",
"output": "3"
},
{
"input": "8\n5 5 5 5 3 5 5 3",
"output": "3"
},
{
"input": "7\n2 3 2 1 4 4 1",
"output": "3"
},
{
"input": "6\n3 3 1 2 4 1",
"output": "3"
},
{
"input": "3\n2 1 1",
"output": "1"
},
{
"input": "5\n3 3 2 8 2",
"output": "2"
},
{
"input": "5\n1 2 1 2 2",
"output": "2"
},
{
"input": "4\n1 2 1 2",
"output": "2"
},
{
"input": "5\n3 1 1 3 2",
"output": "1"
},
{
"input": "4\n1 1 2 1",
"output": "1"
},
{
"input": "4\n2 2 1 1",
"output": "1"
},
{
"input": "5\n1 2 2 1 2",
"output": "3"
},
{
"input": "7\n2 1 2 1 1 2 1",
"output": "1"
},
{
"input": "9\n200000 500000 500000 500000 200000 500000 500000 500000 500000",
"output": "4"
},
{
"input": "3\n1 1 2",
"output": "1"
},
{
"input": "85\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 1",
"output": "84"
},
{
"input": "5\n1000000000 1000000000 999999999 1000000000 999999999",
"output": "2"
},
{
"input": "5\n2 1 2 2 1",
"output": "3"
},
{
"input": "3\n1 1 1",
"output": "1"
},
{
"input": "4\n1 2 1 1",
"output": "1"
},
{
"input": "6\n1 3 4 2 4 1",
"output": "5"
},
{
"input": "9\n2 2 5 1 6 8 7 9 1",
"output": "5"
},
{
"input": "10\n1000000000 1000000000 1000000000 999999999 1000000000 1000000000 1000000000 1000000000 1000000000 999999999",
"output": "6"
},
{
"input": "7\n3 3 1 2 4 1 2",
"output": "3"
},
{
"input": "7\n3 3 1 2 3 4 1",
"output": "4"
},
{
"input": "8\n10 5 10 1 10 10 10 1",
"output": "4"
}
] | 1,514,638,539
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 17
| 155
| 8,396,800
|
#http://codeforces.com/problemset/problem/911/A
inp = int(input())
item = input().split()
m = min(item)
lis = []
for x in range (inp):
if item[x] == m:
lis.append(x)
lislen=len(lis)
for x in range(lislen-1):
if x == 0:
mindis = abs(lis[x]-lis[x+1])
else:
temp = abs(lis[x]-lis[x+1])
if(mindis > temp):
mindis = temp
print(mindis)
|
Title: Nearest Minimums
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an array of *n* integer numbers *a*0,<=*a*1,<=...,<=*a**n*<=-<=1. Find the distance between two closest (nearest) minimums in it. It is guaranteed that in the array a minimum occurs at least two times.
Input Specification:
The first line contains positive integer *n* (2<=≤<=*n*<=≤<=105) — size of the given array. The second line contains *n* integers *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 (1<=≤<=*a**i*<=≤<=109) — elements of the array. It is guaranteed that in the array a minimum occurs at least two times.
Output Specification:
Print the only number — distance between two nearest minimums in the array.
Demo Input:
['2\n3 3\n', '3\n5 6 5\n', '9\n2 1 3 5 4 1 2 3 1\n']
Demo Output:
['1\n', '2\n', '3\n']
Note:
none
|
```python
#http://codeforces.com/problemset/problem/911/A
inp = int(input())
item = input().split()
m = min(item)
lis = []
for x in range (inp):
if item[x] == m:
lis.append(x)
lislen=len(lis)
for x in range(lislen-1):
if x == 0:
mindis = abs(lis[x]-lis[x+1])
else:
temp = abs(lis[x]-lis[x+1])
if(mindis > temp):
mindis = temp
print(mindis)
```
| -1
|
|
794
|
C
|
Naming Company
|
PROGRAMMING
| 1,800
|
[
"games",
"greedy",
"sortings"
] | null | null |
Oleg the client and Igor the analyst are good friends. However, sometimes they argue over little things. Recently, they started a new company, but they are having trouble finding a name for the company.
To settle this problem, they've decided to play a game. The company name will consist of *n* letters. Oleg and Igor each have a set of *n* letters (which might contain multiple copies of the same letter, the sets can be different). Initially, the company name is denoted by *n* question marks. Oleg and Igor takes turns to play the game, Oleg moves first. In each turn, a player can choose one of the letters *c* in his set and replace any of the question marks with *c*. Then, a copy of the letter *c* is removed from his set. The game ends when all the question marks has been replaced by some letter.
For example, suppose Oleg has the set of letters {*i*,<=*o*,<=*i*} and Igor has the set of letters {*i*,<=*m*,<=*o*}. One possible game is as follows :
Initially, the company name is ???.
Oleg replaces the second question mark with 'i'. The company name becomes ?i?. The set of letters Oleg have now is {*i*,<=*o*}.
Igor replaces the third question mark with 'o'. The company name becomes ?io. The set of letters Igor have now is {*i*,<=*m*}.
Finally, Oleg replaces the first question mark with 'o'. The company name becomes oio. The set of letters Oleg have now is {*i*}.
In the end, the company name is oio.
Oleg wants the company name to be as lexicographically small as possible while Igor wants the company name to be as lexicographically large as possible. What will be the company name if Oleg and Igor always play optimally?
A string *s*<==<=*s*1*s*2...*s**m* is called lexicographically smaller than a string *t*<==<=*t*1*t*2...*t**m* (where *s*<=≠<=*t*) if *s**i*<=<<=*t**i* where *i* is the smallest index such that *s**i*<=≠<=*t**i*. (so *s**j*<==<=*t**j* for all *j*<=<<=*i*)
|
The first line of input contains a string *s* of length *n* (1<=≤<=*n*<=≤<=3·105). All characters of the string are lowercase English letters. This string denotes the set of letters Oleg has initially.
The second line of input contains a string *t* of length *n*. All characters of the string are lowercase English letters. This string denotes the set of letters Igor has initially.
|
The output should contain a string of *n* lowercase English letters, denoting the company name if Oleg and Igor plays optimally.
|
[
"tinkoff\nzscoder\n",
"xxxxxx\nxxxxxx\n",
"ioi\nimo\n"
] |
[
"fzfsirk\n",
"xxxxxx\n",
"ioi\n"
] |
One way to play optimally in the first sample is as follows :
- Initially, the company name is ???????.- Oleg replaces the first question mark with 'f'. The company name becomes f??????.- Igor replaces the second question mark with 'z'. The company name becomes fz?????.- Oleg replaces the third question mark with 'f'. The company name becomes fzf????.- Igor replaces the fourth question mark with 's'. The company name becomes fzfs???.- Oleg replaces the fifth question mark with 'i'. The company name becomes fzfsi??.- Igor replaces the sixth question mark with 'r'. The company name becomes fzfsir?.- Oleg replaces the seventh question mark with 'k'. The company name becomes fzfsirk.
For the second sample, no matter how they play, the company name will always be xxxxxx.
| 1,750
|
[
{
"input": "tinkoff\nzscoder",
"output": "fzfsirk"
},
{
"input": "xxxxxx\nxxxxxx",
"output": "xxxxxx"
},
{
"input": "ioi\nimo",
"output": "ioi"
},
{
"input": "abc\naaa",
"output": "aab"
},
{
"input": "reddit\nabcdef",
"output": "dfdeed"
},
{
"input": "cbxz\naaaa",
"output": "abac"
},
{
"input": "bcdef\nabbbc",
"output": "bccdb"
},
{
"input": "z\ny",
"output": "z"
},
{
"input": "y\nz",
"output": "y"
}
] | 1,494,671,634
| 3,534
|
Python 3
|
WRONG_ANSWER
|
PRETESTS
| 5
| 62
| 0
|
a = input()
b = input()
oleg = []
igor = []
cont = 0
for i in a:
oleg.append(i)
cont += 1
for i in b:
igor.append(i)
oleg.sort()
igor.sort()
a = 0
for i in range(cont):
print(oleg[i],end= '')
a += 1
if a == cont:
break
print(igor[cont-i-1],end ='')
a+= 1
if a == cont:
break
print('')
|
Title: Naming Company
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Oleg the client and Igor the analyst are good friends. However, sometimes they argue over little things. Recently, they started a new company, but they are having trouble finding a name for the company.
To settle this problem, they've decided to play a game. The company name will consist of *n* letters. Oleg and Igor each have a set of *n* letters (which might contain multiple copies of the same letter, the sets can be different). Initially, the company name is denoted by *n* question marks. Oleg and Igor takes turns to play the game, Oleg moves first. In each turn, a player can choose one of the letters *c* in his set and replace any of the question marks with *c*. Then, a copy of the letter *c* is removed from his set. The game ends when all the question marks has been replaced by some letter.
For example, suppose Oleg has the set of letters {*i*,<=*o*,<=*i*} and Igor has the set of letters {*i*,<=*m*,<=*o*}. One possible game is as follows :
Initially, the company name is ???.
Oleg replaces the second question mark with 'i'. The company name becomes ?i?. The set of letters Oleg have now is {*i*,<=*o*}.
Igor replaces the third question mark with 'o'. The company name becomes ?io. The set of letters Igor have now is {*i*,<=*m*}.
Finally, Oleg replaces the first question mark with 'o'. The company name becomes oio. The set of letters Oleg have now is {*i*}.
In the end, the company name is oio.
Oleg wants the company name to be as lexicographically small as possible while Igor wants the company name to be as lexicographically large as possible. What will be the company name if Oleg and Igor always play optimally?
A string *s*<==<=*s*1*s*2...*s**m* is called lexicographically smaller than a string *t*<==<=*t*1*t*2...*t**m* (where *s*<=≠<=*t*) if *s**i*<=<<=*t**i* where *i* is the smallest index such that *s**i*<=≠<=*t**i*. (so *s**j*<==<=*t**j* for all *j*<=<<=*i*)
Input Specification:
The first line of input contains a string *s* of length *n* (1<=≤<=*n*<=≤<=3·105). All characters of the string are lowercase English letters. This string denotes the set of letters Oleg has initially.
The second line of input contains a string *t* of length *n*. All characters of the string are lowercase English letters. This string denotes the set of letters Igor has initially.
Output Specification:
The output should contain a string of *n* lowercase English letters, denoting the company name if Oleg and Igor plays optimally.
Demo Input:
['tinkoff\nzscoder\n', 'xxxxxx\nxxxxxx\n', 'ioi\nimo\n']
Demo Output:
['fzfsirk\n', 'xxxxxx\n', 'ioi\n']
Note:
One way to play optimally in the first sample is as follows :
- Initially, the company name is ???????.- Oleg replaces the first question mark with 'f'. The company name becomes f??????.- Igor replaces the second question mark with 'z'. The company name becomes fz?????.- Oleg replaces the third question mark with 'f'. The company name becomes fzf????.- Igor replaces the fourth question mark with 's'. The company name becomes fzfs???.- Oleg replaces the fifth question mark with 'i'. The company name becomes fzfsi??.- Igor replaces the sixth question mark with 'r'. The company name becomes fzfsir?.- Oleg replaces the seventh question mark with 'k'. The company name becomes fzfsirk.
For the second sample, no matter how they play, the company name will always be xxxxxx.
|
```python
a = input()
b = input()
oleg = []
igor = []
cont = 0
for i in a:
oleg.append(i)
cont += 1
for i in b:
igor.append(i)
oleg.sort()
igor.sort()
a = 0
for i in range(cont):
print(oleg[i],end= '')
a += 1
if a == cont:
break
print(igor[cont-i-1],end ='')
a+= 1
if a == cont:
break
print('')
```
| 0
|
|
496
|
C
|
Removing Columns
|
PROGRAMMING
| 1,500
|
[
"brute force",
"constructive algorithms",
"implementation"
] | null | null |
You are given an *n*<=×<=*m* rectangular table consisting of lower case English letters. In one operation you can completely remove one column from the table. The remaining parts are combined forming a new table. For example, after removing the second column from the table
we obtain the table:
A table is called good if its rows are ordered from top to bottom lexicographically, i.e. each row is lexicographically no larger than the following one. Determine the minimum number of operations of removing a column needed to make a given table good.
|
The first line contains two integers — *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100).
Next *n* lines contain *m* small English letters each — the characters of the table.
|
Print a single number — the minimum number of columns that you need to remove in order to make the table good.
|
[
"1 10\ncodeforces\n",
"4 4\ncase\ncare\ntest\ncode\n",
"5 4\ncode\nforc\nesco\ndefo\nrces\n"
] |
[
"0\n",
"2\n",
"4\n"
] |
In the first sample the table is already good.
In the second sample you may remove the first and third column.
In the third sample you have to remove all the columns (note that the table where all rows are empty is considered good by definition).
Let strings *s* and *t* have equal length. Then, *s* is lexicographically larger than *t* if they are not equal and the character following the largest common prefix of *s* and *t* (the prefix may be empty) in *s* is alphabetically larger than the corresponding character of *t*.
| 1,750
|
[
{
"input": "1 10\ncodeforces",
"output": "0"
},
{
"input": "4 4\ncase\ncare\ntest\ncode",
"output": "2"
},
{
"input": "5 4\ncode\nforc\nesco\ndefo\nrces",
"output": "4"
},
{
"input": "2 2\nfb\nye",
"output": "0"
},
{
"input": "5 5\nrzrzh\nrzrzh\nrzrzh\nrzrzh\nrzrzh",
"output": "0"
},
{
"input": "10 10\nddorannorz\nmdrnzqvqgo\ngdtdjmlsuf\neoxbrntqdp\nhribwlslgo\newlqrontvk\nnxibmnawnh\nvxiwdjvdom\nhyhhewmzmp\niysgvzayst",
"output": "1"
},
{
"input": "9 7\nygqartj\nlgwxlqv\nancjjpr\nwnnhkpx\ncnnhvty\nxsfrbqp\nxsolyne\nbsoojiq\nxstetjb",
"output": "1"
},
{
"input": "4 50\nulkteempxafxafcvfwmwhsixwzgbmubcqqceevbbwijeerqbsj\neyqxsievaratndjoekltlqwppfgcukjwxdxexhejbfhzklppkk\npskatxpbjdbmjpwhussetytneohgzxgirluwnbraxtxmaupuid\neappatavdzktqlrjqttmwwroathnulubpjgsjazcycecwmxwvn",
"output": "20"
},
{
"input": "5 50\nvlrkwhvbigkhihwqjpvmohdsszvndheqlmdsspkkxxiedobizr\nmhnzwdefqmttclfxocdmvvtdjtvqhmdllrtrrlnewuqowmtrmp\nrihlhxrqfhpcddslxepesvjqmlqgwyehvxjcsytevujfegeewh\nqrdyiymanvbdjomyruspreihahjhgkcixwowfzczundxqydldq\nkgnrbjlrmkuoiuzeiqwhnyjpuzfnsinqiamlnuzksrdnlvaxjd",
"output": "50"
},
{
"input": "100 1\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\ni\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nv\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx\nx",
"output": "0"
},
{
"input": "1 100\nteloaetuldspjqdlcktjlishwynmjjhlomvemhoyyplbltfwmrlnazbbjvyvwvoxjvvoadkznvxqubgwesoxrznvbdizjdzixecb",
"output": "0"
},
{
"input": "4 100\ngdgmmejiigzsmlarrnfsypvlbutvoxazcigpcospgztqkowfhhbnnbxxrbmwbxwkvxlxzabjjjdtbebedukdelooqlxnadjwjpnp\ndmtsnsbsfdzqvydxcdcnkkfcbseicxhvclsligbhqlkccwujpirymoshkqcosbtlxdypsdqkqaolrqtiibymavcwmbfryttdckhw\njtdmpdljcpciuuoznvqqmafvoqychzfslmwqouuarxctunlzegxsucrwontjplkkxhgixgdbvnewphnatxnwqxqshcexpxlyjuwq\nvhdtvexkyhjmahejbhyfeaompjkdvxmbtdbmvrxrixhnkkjgyvfbxlviatbikfejnqhkrtafftmsgyznpsfxsnzaqdzhxridzilo",
"output": "4"
},
{
"input": "5 2\nab\ndc\ngd\ngc\nhx",
"output": "1"
},
{
"input": "2 1\nb\na",
"output": "1"
},
{
"input": "4 3\nabd\nacc\nbdx\nbcy",
"output": "2"
},
{
"input": "4 2\nad\nac\nbd\nbc",
"output": "1"
},
{
"input": "3 3\naac\nabb\nbba",
"output": "0"
},
{
"input": "3 3\nadc\nbdb\ncda",
"output": "0"
},
{
"input": "4 3\nabz\ndby\ngbx\nhbw",
"output": "0"
},
{
"input": "3 3\naac\nbab\ncaa",
"output": "0"
},
{
"input": "5 6\naaaeaa\nababab\nacacac\nadadad\naeaeae",
"output": "0"
},
{
"input": "3 2\naa\nbc\nba",
"output": "1"
},
{
"input": "3 3\naaz\ndaa\nbaa",
"output": "2"
},
{
"input": "3 3\nabc\nbbb\ncba",
"output": "0"
},
{
"input": "2 3\naxc\nbxa",
"output": "0"
}
] | 1,441,467,601
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 14
| 62
| 0
|
def check(a):
ans = []
for i in range(len(a[0])):
for j in range(1,len(a)):
if a[j][i] < a[j-1][i]:
return i
return -1
n, m = map(int, input().split())
a = []
for i in range(n):
a.append(list(input()))
f = len(a[0])
while a != sorted(a):
pos = check(a)
for i in range(len(a)):
a[i].pop(pos)
print(f - len(a[0]))
|
Title: Removing Columns
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an *n*<=×<=*m* rectangular table consisting of lower case English letters. In one operation you can completely remove one column from the table. The remaining parts are combined forming a new table. For example, after removing the second column from the table
we obtain the table:
A table is called good if its rows are ordered from top to bottom lexicographically, i.e. each row is lexicographically no larger than the following one. Determine the minimum number of operations of removing a column needed to make a given table good.
Input Specification:
The first line contains two integers — *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100).
Next *n* lines contain *m* small English letters each — the characters of the table.
Output Specification:
Print a single number — the minimum number of columns that you need to remove in order to make the table good.
Demo Input:
['1 10\ncodeforces\n', '4 4\ncase\ncare\ntest\ncode\n', '5 4\ncode\nforc\nesco\ndefo\nrces\n']
Demo Output:
['0\n', '2\n', '4\n']
Note:
In the first sample the table is already good.
In the second sample you may remove the first and third column.
In the third sample you have to remove all the columns (note that the table where all rows are empty is considered good by definition).
Let strings *s* and *t* have equal length. Then, *s* is lexicographically larger than *t* if they are not equal and the character following the largest common prefix of *s* and *t* (the prefix may be empty) in *s* is alphabetically larger than the corresponding character of *t*.
|
```python
def check(a):
ans = []
for i in range(len(a[0])):
for j in range(1,len(a)):
if a[j][i] < a[j-1][i]:
return i
return -1
n, m = map(int, input().split())
a = []
for i in range(n):
a.append(list(input()))
f = len(a[0])
while a != sorted(a):
pos = check(a)
for i in range(len(a)):
a[i].pop(pos)
print(f - len(a[0]))
```
| 0
|
|
435
|
A
|
Queue on Bus Stop
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
It's that time of the year when the Russians flood their countryside summer cottages (dachas) and the bus stop has a lot of people. People rarely go to the dacha on their own, it's usually a group, so the people stand in queue by groups.
The bus stop queue has *n* groups of people. The *i*-th group from the beginning has *a**i* people. Every 30 minutes an empty bus arrives at the bus stop, it can carry at most *m* people. Naturally, the people from the first group enter the bus first. Then go the people from the second group and so on. Note that the order of groups in the queue never changes. Moreover, if some group cannot fit all of its members into the current bus, it waits for the next bus together with other groups standing after it in the queue.
Your task is to determine how many buses is needed to transport all *n* groups to the dacha countryside.
|
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). The next line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*m*).
|
Print a single integer — the number of buses that is needed to transport all *n* groups to the dacha countryside.
|
[
"4 3\n2 3 2 1\n",
"3 4\n1 2 1\n"
] |
[
"3\n",
"1\n"
] |
none
| 500
|
[
{
"input": "4 3\n2 3 2 1",
"output": "3"
},
{
"input": "3 4\n1 2 1",
"output": "1"
},
{
"input": "1 5\n4",
"output": "1"
},
{
"input": "5 1\n1 1 1 1 1",
"output": "5"
},
{
"input": "6 4\n1 3 2 3 4 1",
"output": "5"
},
{
"input": "6 8\n6 1 1 1 4 5",
"output": "3"
},
{
"input": "10 10\n1 10 1 10 1 1 7 8 6 7",
"output": "8"
},
{
"input": "100 100\n85 50 17 89 65 89 5 20 86 26 16 21 85 14 44 31 87 31 6 2 48 67 8 80 79 1 48 36 97 1 5 30 79 50 78 12 2 55 76 100 54 40 26 81 97 96 68 56 87 14 51 17 54 37 52 33 69 62 38 63 74 15 62 78 9 19 67 2 60 58 93 60 18 96 55 48 34 7 79 82 32 58 90 67 20 50 27 15 7 89 98 10 11 15 99 49 4 51 77 52",
"output": "63"
},
{
"input": "10 1\n1 1 1 1 1 1 1 1 1 1",
"output": "10"
},
{
"input": "10 2\n2 2 1 1 1 1 1 2 1 2",
"output": "8"
},
{
"input": "10 3\n1 3 1 1 3 2 2 2 3 3",
"output": "9"
},
{
"input": "10 4\n2 1 1 1 3 4 4 4 1 2",
"output": "6"
},
{
"input": "10 5\n2 2 3 4 4 1 5 3 1 2",
"output": "7"
},
{
"input": "100 3\n1 2 3 2 1 2 2 3 1 3 3 2 2 1 1 2 2 1 1 1 1 2 3 3 2 1 1 2 2 2 3 3 3 2 1 3 1 3 3 2 3 1 2 2 2 3 2 1 1 3 3 3 3 2 1 1 2 3 2 2 3 2 3 2 2 3 2 2 2 2 3 3 3 1 3 3 1 1 2 3 2 2 2 2 3 3 3 2 1 2 3 1 1 2 3 3 1 3 3 2",
"output": "83"
},
{
"input": "100 7\n4 7 4 7 7 4 7 3 5 6 3 5 4 3 7 2 7 2 4 1 6 3 3 7 4 4 5 4 3 6 4 3 2 2 1 4 4 1 7 3 7 7 1 3 1 5 4 1 5 3 5 2 2 1 5 5 1 5 2 7 5 5 1 5 5 4 6 5 1 3 5 6 7 4 1 3 3 4 3 2 7 6 5 7 2 7 1 1 2 2 3 1 3 7 1 3 2 1 1 7",
"output": "71"
},
{
"input": "100 10\n3 4 8 10 8 6 4 3 7 7 6 2 3 1 3 10 1 7 9 3 5 5 2 6 2 9 1 7 4 2 4 1 6 1 7 10 2 5 3 7 6 4 6 2 8 8 8 6 6 10 3 7 4 3 4 1 7 9 3 6 3 6 1 4 9 3 8 1 10 1 4 10 7 7 9 5 3 8 10 2 1 10 8 7 10 8 5 3 1 2 1 10 6 1 5 3 3 5 7 2",
"output": "64"
},
{
"input": "100 15\n3 12 8 3 11 14 12 14 1 11 13 3 5 13 4 14 2 11 7 8 12 9 15 7 15 1 4 11 6 12 1 3 8 13 1 8 14 4 3 14 1 3 1 6 10 15 13 11 12 1 14 13 11 14 11 3 12 7 3 15 14 4 5 6 5 14 7 14 6 2 6 12 6 13 13 1 9 13 15 11 6 3 15 11 9 4 15 8 15 12 1 15 10 10 4 1 15 1 4 1",
"output": "71"
},
{
"input": "100 30\n7 14 22 16 11 13 7 29 20 19 22 6 12 16 1 8 27 21 22 3 15 27 20 12 4 19 1 26 26 22 25 17 29 25 16 29 29 28 16 26 25 14 16 20 5 21 5 15 19 13 17 21 17 19 23 13 1 25 6 30 16 19 12 10 28 8 15 13 14 24 19 30 12 19 22 1 3 14 16 3 20 26 15 19 9 10 19 27 2 16 10 22 15 13 19 3 24 9 8 13",
"output": "71"
},
{
"input": "100 40\n39 19 13 36 11 21 32 12 1 2 39 26 32 39 24 1 4 19 10 4 16 39 32 34 13 24 30 35 3 10 8 18 13 12 39 27 31 40 37 20 17 17 37 5 10 12 22 17 7 1 31 13 11 10 2 6 22 16 2 4 9 27 6 35 22 16 22 30 33 2 26 20 35 19 40 37 19 17 21 28 37 28 40 4 5 4 35 19 26 36 19 12 21 20 21 30 9 16 9 32",
"output": "65"
},
{
"input": "100 50\n2 46 4 6 38 19 15 34 10 35 37 30 3 25 5 45 40 45 33 31 6 20 10 44 11 9 2 14 35 5 9 23 20 2 48 22 25 35 38 31 24 33 35 16 4 30 27 10 12 22 6 24 12 30 23 21 14 12 32 21 7 12 25 43 18 34 34 28 47 13 28 43 18 39 44 42 35 26 35 14 8 29 32 20 29 3 20 6 20 9 9 27 8 42 10 37 42 27 8 1",
"output": "60"
},
{
"input": "100 60\n34 21 39 17 48 46 23 56 46 52 50 39 55 48 54 38 32 38 24 26 44 12 28 9 25 26 10 52 42 60 41 3 16 60 44 29 27 55 19 19 19 57 45 59 29 35 5 14 50 47 57 48 16 7 12 36 58 31 37 58 30 50 19 11 10 41 59 57 49 41 33 9 12 11 53 50 60 51 21 9 44 23 1 16 4 15 17 57 15 17 46 50 18 52 43 24 47 50 19 18",
"output": "74"
},
{
"input": "100 90\n74 65 49 41 3 79 61 83 50 40 13 57 90 14 62 77 36 10 3 5 5 40 50 75 32 26 3 71 79 54 88 50 46 20 42 59 30 36 83 86 60 62 82 68 62 80 18 65 28 28 81 74 62 33 61 35 33 83 90 72 6 6 51 4 22 20 29 10 8 3 84 69 12 17 24 16 12 64 80 74 68 59 1 59 15 59 37 58 79 83 51 56 81 14 37 45 19 31 61 90",
"output": "67"
},
{
"input": "100 99\n69 46 76 47 71 9 66 46 78 17 96 83 56 96 29 3 43 48 79 23 93 61 19 9 29 72 15 84 93 46 71 87 11 43 96 44 54 75 3 66 2 95 46 32 69 52 79 38 57 53 37 60 71 82 28 31 84 58 89 40 62 74 22 50 45 38 99 67 24 28 28 12 69 88 33 10 31 71 46 7 42 81 54 81 96 44 8 1 20 24 28 19 54 35 69 32 71 13 66 15",
"output": "68"
},
{
"input": "90 100\n25 52 88 89 36 17 57 64 66 11 89 61 54 92 48 51 18 42 44 92 6 14 67 100 16 21 17 88 85 73 33 11 94 84 56 72 4 80 90 78 96 5 62 70 54 70 94 80 10 91 100 89 98 87 69 74 88 63 53 79 38 94 89 52 21 82 67 79 100 81 2 40 30 69 34 15 12 33 87 52 95 18 51 30 15 39 30 99 46 84",
"output": "67"
},
{
"input": "5 100\n14 67 15 28 21",
"output": "2"
},
{
"input": "10 100\n2 17 53 94 95 57 36 47 68 48",
"output": "7"
},
{
"input": "1 100\n18",
"output": "1"
},
{
"input": "100 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "100"
},
{
"input": "30 100\n56 7 99 83 2 65 35 53 99 36 42 57 13 37 68 52 87 11 50 23 86 24 32 39 97 6 64 1 18 86",
"output": "18"
},
{
"input": "60 100\n18 75 43 88 45 43 20 59 59 79 62 39 53 21 28 46 54 53 97 81 18 15 2 95 84 9 36 70 30 76 17 19 83 40 45 32 31 70 23 14 44 35 79 84 97 96 99 60 3 73 64 83 6 12 67 86 70 89 18 61",
"output": "40"
},
{
"input": "1 73\n24",
"output": "1"
},
{
"input": "4 4\n1 4 4 4",
"output": "4"
},
{
"input": "2 6\n1 4",
"output": "1"
},
{
"input": "2 5\n5 5",
"output": "2"
}
] | 1,596,383,007
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 34
| 140
| 20,172,800
|
n,m=map(int,input().split())
L=list(map(int,input().split()))
cnt=0
cur=m
for a in L:
if cur>=a:
cur-=a
else:
cur=m-a
cnt+=1
print(cnt+1)
'''
n, m = map(int, input().split())
a = [int(i) for i in input().split()]
cnt = 0
s = 0
for i in range(n):
s += a[i]
if s > m:
cnt += 1
s = a[i]
print(cnt + 1)
'''
|
Title: Queue on Bus Stop
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It's that time of the year when the Russians flood their countryside summer cottages (dachas) and the bus stop has a lot of people. People rarely go to the dacha on their own, it's usually a group, so the people stand in queue by groups.
The bus stop queue has *n* groups of people. The *i*-th group from the beginning has *a**i* people. Every 30 minutes an empty bus arrives at the bus stop, it can carry at most *m* people. Naturally, the people from the first group enter the bus first. Then go the people from the second group and so on. Note that the order of groups in the queue never changes. Moreover, if some group cannot fit all of its members into the current bus, it waits for the next bus together with other groups standing after it in the queue.
Your task is to determine how many buses is needed to transport all *n* groups to the dacha countryside.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100). The next line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*m*).
Output Specification:
Print a single integer — the number of buses that is needed to transport all *n* groups to the dacha countryside.
Demo Input:
['4 3\n2 3 2 1\n', '3 4\n1 2 1\n']
Demo Output:
['3\n', '1\n']
Note:
none
|
```python
n,m=map(int,input().split())
L=list(map(int,input().split()))
cnt=0
cur=m
for a in L:
if cur>=a:
cur-=a
else:
cur=m-a
cnt+=1
print(cnt+1)
'''
n, m = map(int, input().split())
a = [int(i) for i in input().split()]
cnt = 0
s = 0
for i in range(n):
s += a[i]
if s > m:
cnt += 1
s = a[i]
print(cnt + 1)
'''
```
| 3
|
|
1,011
|
A
|
Stages
|
PROGRAMMING
| 900
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
Natasha is going to fly to Mars. She needs to build a rocket, which consists of several stages in some order. Each of the stages is defined by a lowercase Latin letter. This way, the rocket can be described by the string — concatenation of letters, which correspond to the stages.
There are $n$ stages available. The rocket must contain exactly $k$ of them. Stages in the rocket should be ordered by their weight. So, after the stage with some letter can go only stage with a letter, which is at least two positions after in the alphabet (skipping one letter in between, or even more). For example, after letter 'c' can't go letters 'a', 'b', 'c' and 'd', but can go letters 'e', 'f', ..., 'z'.
For the rocket to fly as far as possible, its weight should be minimal. The weight of the rocket is equal to the sum of the weights of its stages. The weight of the stage is the number of its letter in the alphabet. For example, the stage 'a 'weighs one ton,' b 'weighs two tons, and' z' — $26$ tons.
Build the rocket with the minimal weight or determine, that it is impossible to build a rocket at all. Each stage can be used at most once.
|
The first line of input contains two integers — $n$ and $k$ ($1 \le k \le n \le 50$) – the number of available stages and the number of stages to use in the rocket.
The second line contains string $s$, which consists of exactly $n$ lowercase Latin letters. Each letter defines a new stage, which can be used to build the rocket. Each stage can be used at most once.
|
Print a single integer — the minimal total weight of the rocket or -1, if it is impossible to build the rocket at all.
|
[
"5 3\nxyabd\n",
"7 4\nproblem\n",
"2 2\nab\n",
"12 1\nabaabbaaabbb\n"
] |
[
"29",
"34",
"-1",
"1"
] |
In the first example, the following rockets satisfy the condition:
- "adx" (weight is $1+4+24=29$);- "ady" (weight is $1+4+25=30$);- "bdx" (weight is $2+4+24=30$);- "bdy" (weight is $2+4+25=31$).
Rocket "adx" has the minimal weight, so the answer is $29$.
In the second example, target rocket is "belo". Its weight is $2+5+12+15=34$.
In the third example, $n=k=2$, so the rocket must have both stages: 'a' and 'b'. This rocket doesn't satisfy the condition, because these letters are adjacent in the alphabet. Answer is -1.
| 500
|
[
{
"input": "5 3\nxyabd",
"output": "29"
},
{
"input": "7 4\nproblem",
"output": "34"
},
{
"input": "2 2\nab",
"output": "-1"
},
{
"input": "12 1\nabaabbaaabbb",
"output": "1"
},
{
"input": "50 13\nqwertyuiopasdfghjklzxcvbnmaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "169"
},
{
"input": "50 14\nqwertyuiopasdfghjklzxcvbnmaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "-1"
},
{
"input": "1 1\na",
"output": "1"
},
{
"input": "50 1\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "1"
},
{
"input": "50 2\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "-1"
},
{
"input": "13 13\nuwgmkyqeiaocs",
"output": "169"
},
{
"input": "13 13\nhzdxpbfvrltnj",
"output": "182"
},
{
"input": "1 1\nn",
"output": "14"
},
{
"input": "10 8\nsmzeblyjqw",
"output": "113"
},
{
"input": "20 20\ntzmvhskkyugkuuxpvtbh",
"output": "-1"
},
{
"input": "30 15\nwjzolzzkfulwgioksfxmcxmnnjtoav",
"output": "-1"
},
{
"input": "40 30\nxumfrflllrrgswehqtsskefixhcxjrxbjmrpsshv",
"output": "-1"
},
{
"input": "50 31\nahbyyoxltryqdmvenemaqnbakglgqolxnaifnqtoclnnqiabpz",
"output": "-1"
},
{
"input": "10 7\niuiukrxcml",
"output": "99"
},
{
"input": "38 2\nvjzarfykmrsrvwbwfwldsulhxtykmjbnwmdufa",
"output": "5"
},
{
"input": "12 6\nfwseyrarkwcd",
"output": "61"
},
{
"input": "2 2\nac",
"output": "4"
},
{
"input": "1 1\nc",
"output": "3"
},
{
"input": "2 2\nad",
"output": "5"
},
{
"input": "2 1\nac",
"output": "1"
},
{
"input": "4 3\nadjz",
"output": "15"
},
{
"input": "3 3\naoz",
"output": "42"
},
{
"input": "3 1\nzzz",
"output": "26"
},
{
"input": "2 1\nxz",
"output": "24"
},
{
"input": "5 1\naaddd",
"output": "1"
}
] | 1,549,464,641
| 3,941
|
Python 3
|
OK
|
TESTS
| 29
| 109
| 0
|
from sys import stdin
def func(arr):
return sum(list(map(lambda x:ord(x)-96,arr)))
n,k=map(int,stdin.readline().split())
s=stdin.readline().strip()
ans=[]
s=sorted(s)
for i in range(n-k+1):
arr=[s[i]]
total=ord(s[i])-ord('a')+1
count=1
m=i
j=m+1
while(j<n and count<k):
if ord(s[j])-ord(s[m])>=2:
arr.append(s[j])
count+=1
total+=(ord(s[j])+1-ord('a'))
m=j
j=m+1
else:
j+=1
if len(arr)==k:
ans.append(total)
else:
pass
if len(ans)==0:
print(-1)
else:
print(min(ans))
|
Title: Stages
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Natasha is going to fly to Mars. She needs to build a rocket, which consists of several stages in some order. Each of the stages is defined by a lowercase Latin letter. This way, the rocket can be described by the string — concatenation of letters, which correspond to the stages.
There are $n$ stages available. The rocket must contain exactly $k$ of them. Stages in the rocket should be ordered by their weight. So, after the stage with some letter can go only stage with a letter, which is at least two positions after in the alphabet (skipping one letter in between, or even more). For example, after letter 'c' can't go letters 'a', 'b', 'c' and 'd', but can go letters 'e', 'f', ..., 'z'.
For the rocket to fly as far as possible, its weight should be minimal. The weight of the rocket is equal to the sum of the weights of its stages. The weight of the stage is the number of its letter in the alphabet. For example, the stage 'a 'weighs one ton,' b 'weighs two tons, and' z' — $26$ tons.
Build the rocket with the minimal weight or determine, that it is impossible to build a rocket at all. Each stage can be used at most once.
Input Specification:
The first line of input contains two integers — $n$ and $k$ ($1 \le k \le n \le 50$) – the number of available stages and the number of stages to use in the rocket.
The second line contains string $s$, which consists of exactly $n$ lowercase Latin letters. Each letter defines a new stage, which can be used to build the rocket. Each stage can be used at most once.
Output Specification:
Print a single integer — the minimal total weight of the rocket or -1, if it is impossible to build the rocket at all.
Demo Input:
['5 3\nxyabd\n', '7 4\nproblem\n', '2 2\nab\n', '12 1\nabaabbaaabbb\n']
Demo Output:
['29', '34', '-1', '1']
Note:
In the first example, the following rockets satisfy the condition:
- "adx" (weight is $1+4+24=29$);- "ady" (weight is $1+4+25=30$);- "bdx" (weight is $2+4+24=30$);- "bdy" (weight is $2+4+25=31$).
Rocket "adx" has the minimal weight, so the answer is $29$.
In the second example, target rocket is "belo". Its weight is $2+5+12+15=34$.
In the third example, $n=k=2$, so the rocket must have both stages: 'a' and 'b'. This rocket doesn't satisfy the condition, because these letters are adjacent in the alphabet. Answer is -1.
|
```python
from sys import stdin
def func(arr):
return sum(list(map(lambda x:ord(x)-96,arr)))
n,k=map(int,stdin.readline().split())
s=stdin.readline().strip()
ans=[]
s=sorted(s)
for i in range(n-k+1):
arr=[s[i]]
total=ord(s[i])-ord('a')+1
count=1
m=i
j=m+1
while(j<n and count<k):
if ord(s[j])-ord(s[m])>=2:
arr.append(s[j])
count+=1
total+=(ord(s[j])+1-ord('a'))
m=j
j=m+1
else:
j+=1
if len(arr)==k:
ans.append(total)
else:
pass
if len(ans)==0:
print(-1)
else:
print(min(ans))
```
| 3
|
|
43
|
A
|
Football
|
PROGRAMMING
| 1,000
|
[
"strings"
] |
A. Football
|
2
|
256
|
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
|
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
|
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
|
[
"1\nABC\n",
"5\nA\nABA\nABA\nA\nA\n"
] |
[
"ABC\n",
"A\n"
] |
none
| 500
|
[
{
"input": "1\nABC",
"output": "ABC"
},
{
"input": "5\nA\nABA\nABA\nA\nA",
"output": "A"
},
{
"input": "2\nXTSJEP\nXTSJEP",
"output": "XTSJEP"
},
{
"input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ",
"output": "XZYDJAEDZ"
},
{
"input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD",
"output": "QCCYXL"
},
{
"input": "3\nAZID\nEERWBC\nEERWBC",
"output": "EERWBC"
},
{
"input": "3\nHNCGYL\nHNCGYL\nHNCGYL",
"output": "HNCGYL"
},
{
"input": "4\nZZWZTG\nZZWZTG\nZZWZTG\nZZWZTG",
"output": "ZZWZTG"
},
{
"input": "4\nA\nA\nKUDLJMXCSE\nA",
"output": "A"
},
{
"input": "5\nPHBTW\nPHBTW\nPHBTW\nPHBTW\nPHBTW",
"output": "PHBTW"
},
{
"input": "5\nPKUZYTFYWN\nPKUZYTFYWN\nSTC\nPKUZYTFYWN\nPKUZYTFYWN",
"output": "PKUZYTFYWN"
},
{
"input": "5\nHH\nHH\nNTQWPA\nNTQWPA\nHH",
"output": "HH"
},
{
"input": "10\nW\nW\nW\nW\nW\nD\nW\nD\nD\nW",
"output": "W"
},
{
"input": "19\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nTGACNIH\nTGACNIH\nXBCP",
"output": "XBCP"
},
{
"input": "33\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS",
"output": "PYPAS"
},
{
"input": "51\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC",
"output": "NC"
},
{
"input": "89\nH\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nVOCI\nVOCI\nH\nH\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nH\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI",
"output": "VOCI"
},
{
"input": "100\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nM\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA",
"output": "HA"
},
{
"input": "100\nG\nG\nS\nS\nG\nG\nS\nS\nG\nS\nS\nS\nG\nS\nG\nG\nS\nG\nS\nS\nG\nS\nS\nS\nS\nS\nG\nS\nG\nS\nS\nG\nG\nG\nS\nS\nS\nS\nG\nS\nS\nG\nG\nG\nG\nG\nS\nG\nG\nS\nS\nS\nS\nS\nG\nG\nS\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nS\nS\nG\nS\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nG\nG\nS\nG\nG\nG\nS",
"output": "G"
},
{
"input": "100\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nOBH\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL",
"output": "WL"
}
] | 1,687,711,522
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 62
| 0
|
n = int(input())
c1 = 0
c2 = 0
c3 = 0
for i in range(1,n+1):
s = input()
for a in s:
if a == "A":
c1 += 1
elif a == 'B':
c2 += 1
elif a == 'C':
c3 += 1
if c1 > c2 and c1 > c3:
print('A')
elif c2 > c1 and c2 > c3:
print('B')
elif c3 > c2 and c3 > c1:
print('C')
elif c1 == c2 and c1 == c3:
print(s)
|
Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Output Specification:
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
Demo Input:
['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n']
Demo Output:
['ABC\n', 'A\n']
Note:
none
|
```python
n = int(input())
c1 = 0
c2 = 0
c3 = 0
for i in range(1,n+1):
s = input()
for a in s:
if a == "A":
c1 += 1
elif a == 'B':
c2 += 1
elif a == 'C':
c3 += 1
if c1 > c2 and c1 > c3:
print('A')
elif c2 > c1 and c2 > c3:
print('B')
elif c3 > c2 and c3 > c1:
print('C')
elif c1 == c2 and c1 == c3:
print(s)
```
| 0
|
729
|
B
|
Spotlights
|
PROGRAMMING
| 1,200
|
[
"dp",
"implementation"
] | null | null |
Theater stage is a rectangular field of size *n*<=×<=*m*. The director gave you the stage's plan which actors will follow. For each cell it is stated in the plan if there would be an actor in this cell or not.
You are to place a spotlight on the stage in some good position. The spotlight will project light in one of the four directions (if you look at the stage from above) — left, right, up or down. Thus, the spotlight's position is a cell it is placed to and a direction it shines.
A position is good if two conditions hold:
- there is no actor in the cell the spotlight is placed to; - there is at least one actor in the direction the spotlight projects.
Count the number of good positions for placing the spotlight. Two positions of spotlight are considered to be different if the location cells or projection direction differ.
|
The first line contains two positive integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=1000) — the number of rows and the number of columns in the plan.
The next *n* lines contain *m* integers, 0 or 1 each — the description of the plan. Integer 1, means there will be an actor in the corresponding cell, while 0 means the cell will remain empty. It is guaranteed that there is at least one actor in the plan.
|
Print one integer — the number of good positions for placing the spotlight.
|
[
"2 4\n0 1 0 0\n1 0 1 0\n",
"4 4\n0 0 0 0\n1 0 0 1\n0 1 1 0\n0 1 0 0\n"
] |
[
"9\n",
"20\n"
] |
In the first example the following positions are good:
1. the (1, 1) cell and right direction; 1. the (1, 1) cell and down direction; 1. the (1, 3) cell and left direction; 1. the (1, 3) cell and down direction; 1. the (1, 4) cell and left direction; 1. the (2, 2) cell and left direction; 1. the (2, 2) cell and up direction; 1. the (2, 2) and right direction; 1. the (2, 4) cell and left direction.
Therefore, there are 9 good positions in this example.
| 1,000
|
[
{
"input": "2 4\n0 1 0 0\n1 0 1 0",
"output": "9"
},
{
"input": "4 4\n0 0 0 0\n1 0 0 1\n0 1 1 0\n0 1 0 0",
"output": "20"
},
{
"input": "1 5\n1 1 0 0 0",
"output": "3"
},
{
"input": "2 10\n0 0 0 0 0 0 0 1 0 0\n1 0 0 0 0 0 0 0 0 0",
"output": "20"
},
{
"input": "3 1\n1\n0\n0",
"output": "2"
},
{
"input": "5 7\n0 0 0 0 0 0 1\n0 0 0 0 0 0 1\n0 0 0 1 0 0 0\n0 0 0 0 0 0 0\n0 0 0 0 0 0 0",
"output": "25"
},
{
"input": "10 20\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "4"
},
{
"input": "5 7\n0 0 0 0 0 0 0\n0 1 1 1 1 0 1\n0 1 1 1 1 1 1\n0 0 0 0 0 0 0\n0 1 1 1 1 0 1",
"output": "26"
},
{
"input": "10 20\n0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0\n0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0\n0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0\n0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "121"
},
{
"input": "1 2\n0 1",
"output": "1"
},
{
"input": "1 2\n1 0",
"output": "1"
},
{
"input": "1 2\n1 1",
"output": "0"
},
{
"input": "2 1\n1\n0",
"output": "1"
},
{
"input": "2 1\n0\n1",
"output": "1"
},
{
"input": "2 1\n1\n1",
"output": "0"
},
{
"input": "1 1\n1",
"output": "0"
},
{
"input": "4 4\n1 1 1 1\n1 0 0 1\n1 0 0 1\n1 1 1 1",
"output": "16"
}
] | 1,616,486,666
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 6
| 1,000
| 6,144,000
|
#codeforces
if __name__=="__main__":
n,m=map(int,input().split())
c=0
matrix=[]
ans=0
for i in range(n):
a=list(map(int,input().split()))
matrix.append(a)
for i in range(n):
flag=0
c=0
for j in range(m):
if matrix[i][j]==1 and flag==0:
ans=ans+c
c=0
flag=1
elif matrix[i][j]==1 and flag==1:
ans=ans+(2*c)
c=0
else:
c=c+1
if c>0 and flag==1:
ans=ans+c
for j in range(m):
c=0
flag=0
for i in range(n):
if matrix[i][j] == 1 and flag == 0:
ans = ans + c
c = 0
flag = 1
elif matrix[i][j] == 1 and flag == 1:
ans = ans + (2 * c)
c = 0
else:
c = c + 1
if c > 0 and flag==1:
ans = ans + c
print(ans)
|
Title: Spotlights
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Theater stage is a rectangular field of size *n*<=×<=*m*. The director gave you the stage's plan which actors will follow. For each cell it is stated in the plan if there would be an actor in this cell or not.
You are to place a spotlight on the stage in some good position. The spotlight will project light in one of the four directions (if you look at the stage from above) — left, right, up or down. Thus, the spotlight's position is a cell it is placed to and a direction it shines.
A position is good if two conditions hold:
- there is no actor in the cell the spotlight is placed to; - there is at least one actor in the direction the spotlight projects.
Count the number of good positions for placing the spotlight. Two positions of spotlight are considered to be different if the location cells or projection direction differ.
Input Specification:
The first line contains two positive integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=1000) — the number of rows and the number of columns in the plan.
The next *n* lines contain *m* integers, 0 or 1 each — the description of the plan. Integer 1, means there will be an actor in the corresponding cell, while 0 means the cell will remain empty. It is guaranteed that there is at least one actor in the plan.
Output Specification:
Print one integer — the number of good positions for placing the spotlight.
Demo Input:
['2 4\n0 1 0 0\n1 0 1 0\n', '4 4\n0 0 0 0\n1 0 0 1\n0 1 1 0\n0 1 0 0\n']
Demo Output:
['9\n', '20\n']
Note:
In the first example the following positions are good:
1. the (1, 1) cell and right direction; 1. the (1, 1) cell and down direction; 1. the (1, 3) cell and left direction; 1. the (1, 3) cell and down direction; 1. the (1, 4) cell and left direction; 1. the (2, 2) cell and left direction; 1. the (2, 2) cell and up direction; 1. the (2, 2) and right direction; 1. the (2, 4) cell and left direction.
Therefore, there are 9 good positions in this example.
|
```python
#codeforces
if __name__=="__main__":
n,m=map(int,input().split())
c=0
matrix=[]
ans=0
for i in range(n):
a=list(map(int,input().split()))
matrix.append(a)
for i in range(n):
flag=0
c=0
for j in range(m):
if matrix[i][j]==1 and flag==0:
ans=ans+c
c=0
flag=1
elif matrix[i][j]==1 and flag==1:
ans=ans+(2*c)
c=0
else:
c=c+1
if c>0 and flag==1:
ans=ans+c
for j in range(m):
c=0
flag=0
for i in range(n):
if matrix[i][j] == 1 and flag == 0:
ans = ans + c
c = 0
flag = 1
elif matrix[i][j] == 1 and flag == 1:
ans = ans + (2 * c)
c = 0
else:
c = c + 1
if c > 0 and flag==1:
ans = ans + c
print(ans)
```
| 0
|
|
610
|
A
|
Pasha and Stick
|
PROGRAMMING
| 1,000
|
[
"combinatorics",
"math"
] | null | null |
Pasha has a wooden stick of some positive integer length *n*. He wants to perform exactly three cuts to get four parts of the stick. Each part must have some positive integer length and the sum of these lengths will obviously be *n*.
Pasha likes rectangles but hates squares, so he wonders, how many ways are there to split a stick into four parts so that it's possible to form a rectangle using these parts, but is impossible to form a square.
Your task is to help Pasha and count the number of such ways. Two ways to cut the stick are considered distinct if there exists some integer *x*, such that the number of parts of length *x* in the first way differ from the number of parts of length *x* in the second way.
|
The first line of the input contains a positive integer *n* (1<=≤<=*n*<=≤<=2·109) — the length of Pasha's stick.
|
The output should contain a single integer — the number of ways to split Pasha's stick into four parts of positive integer length so that it's possible to make a rectangle by connecting the ends of these parts, but is impossible to form a square.
|
[
"6\n",
"20\n"
] |
[
"1\n",
"4\n"
] |
There is only one way to divide the stick in the first sample {1, 1, 2, 2}.
Four ways to divide the stick in the second sample are {1, 1, 9, 9}, {2, 2, 8, 8}, {3, 3, 7, 7} and {4, 4, 6, 6}. Note that {5, 5, 5, 5} doesn't work.
| 500
|
[
{
"input": "6",
"output": "1"
},
{
"input": "20",
"output": "4"
},
{
"input": "1",
"output": "0"
},
{
"input": "2",
"output": "0"
},
{
"input": "3",
"output": "0"
},
{
"input": "4",
"output": "0"
},
{
"input": "2000000000",
"output": "499999999"
},
{
"input": "1924704072",
"output": "481176017"
},
{
"input": "73740586",
"output": "18435146"
},
{
"input": "1925088820",
"output": "481272204"
},
{
"input": "593070992",
"output": "148267747"
},
{
"input": "1925473570",
"output": "481368392"
},
{
"input": "629490186",
"output": "157372546"
},
{
"input": "1980649112",
"output": "495162277"
},
{
"input": "36661322",
"output": "9165330"
},
{
"input": "1943590793",
"output": "0"
},
{
"input": "71207034",
"output": "17801758"
},
{
"input": "1757577394",
"output": "439394348"
},
{
"input": "168305294",
"output": "42076323"
},
{
"input": "1934896224",
"output": "483724055"
},
{
"input": "297149088",
"output": "74287271"
},
{
"input": "1898001634",
"output": "474500408"
},
{
"input": "176409698",
"output": "44102424"
},
{
"input": "1873025522",
"output": "468256380"
},
{
"input": "5714762",
"output": "1428690"
},
{
"input": "1829551192",
"output": "457387797"
},
{
"input": "16269438",
"output": "4067359"
},
{
"input": "1663283390",
"output": "415820847"
},
{
"input": "42549941",
"output": "0"
},
{
"input": "1967345604",
"output": "491836400"
},
{
"input": "854000",
"output": "213499"
},
{
"input": "1995886626",
"output": "498971656"
},
{
"input": "10330019",
"output": "0"
},
{
"input": "1996193634",
"output": "499048408"
},
{
"input": "9605180",
"output": "2401294"
},
{
"input": "1996459740",
"output": "499114934"
},
{
"input": "32691948",
"output": "8172986"
},
{
"input": "1975903308",
"output": "493975826"
},
{
"input": "1976637136",
"output": "494159283"
},
{
"input": "29803038",
"output": "7450759"
},
{
"input": "1977979692",
"output": "494494922"
},
{
"input": "1978595336",
"output": "494648833"
},
{
"input": "27379344",
"output": "6844835"
},
{
"input": "1979729912",
"output": "494932477"
},
{
"input": "1980253780",
"output": "495063444"
},
{
"input": "1980751584",
"output": "495187895"
},
{
"input": "53224878",
"output": "13306219"
},
{
"input": "5",
"output": "0"
},
{
"input": "7",
"output": "0"
},
{
"input": "8",
"output": "1"
},
{
"input": "9",
"output": "0"
},
{
"input": "10",
"output": "2"
},
{
"input": "11",
"output": "0"
},
{
"input": "12",
"output": "2"
},
{
"input": "13",
"output": "0"
},
{
"input": "14",
"output": "3"
},
{
"input": "15",
"output": "0"
},
{
"input": "16",
"output": "3"
},
{
"input": "17",
"output": "0"
},
{
"input": "18",
"output": "4"
},
{
"input": "19",
"output": "0"
},
{
"input": "21",
"output": "0"
},
{
"input": "22",
"output": "5"
},
{
"input": "23",
"output": "0"
},
{
"input": "24",
"output": "5"
},
{
"input": "25",
"output": "0"
},
{
"input": "26",
"output": "6"
},
{
"input": "27",
"output": "0"
},
{
"input": "28",
"output": "6"
},
{
"input": "29",
"output": "0"
},
{
"input": "30",
"output": "7"
},
{
"input": "111",
"output": "0"
},
{
"input": "55",
"output": "0"
},
{
"input": "105",
"output": "0"
},
{
"input": "199",
"output": "0"
},
{
"input": "151",
"output": "0"
}
] | 1,622,982,964
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 15
| 155
| 0
|
from math import factorial, ceil
def newton(n, k):
"""
k = 2 people in a pair
n = 30 people to pair
"""
return factorial(n) / (factorial(k) * factorial((n - k)))
n = int(input())
num = ceil(int(n / 2) / 2) - 1
if num <= 0:
print(0)
else:
print(num)
|
Title: Pasha and Stick
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pasha has a wooden stick of some positive integer length *n*. He wants to perform exactly three cuts to get four parts of the stick. Each part must have some positive integer length and the sum of these lengths will obviously be *n*.
Pasha likes rectangles but hates squares, so he wonders, how many ways are there to split a stick into four parts so that it's possible to form a rectangle using these parts, but is impossible to form a square.
Your task is to help Pasha and count the number of such ways. Two ways to cut the stick are considered distinct if there exists some integer *x*, such that the number of parts of length *x* in the first way differ from the number of parts of length *x* in the second way.
Input Specification:
The first line of the input contains a positive integer *n* (1<=≤<=*n*<=≤<=2·109) — the length of Pasha's stick.
Output Specification:
The output should contain a single integer — the number of ways to split Pasha's stick into four parts of positive integer length so that it's possible to make a rectangle by connecting the ends of these parts, but is impossible to form a square.
Demo Input:
['6\n', '20\n']
Demo Output:
['1\n', '4\n']
Note:
There is only one way to divide the stick in the first sample {1, 1, 2, 2}.
Four ways to divide the stick in the second sample are {1, 1, 9, 9}, {2, 2, 8, 8}, {3, 3, 7, 7} and {4, 4, 6, 6}. Note that {5, 5, 5, 5} doesn't work.
|
```python
from math import factorial, ceil
def newton(n, k):
"""
k = 2 people in a pair
n = 30 people to pair
"""
return factorial(n) / (factorial(k) * factorial((n - k)))
n = int(input())
num = ceil(int(n / 2) / 2) - 1
if num <= 0:
print(0)
else:
print(num)
```
| 0
|
Subsets and Splits
Successful Python Submissions
Retrieves all records from the train dataset where the verdict is 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Retrieves records of users with a rating of 1600 or higher and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a rating above 2000 and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a 'OK' verdict, providing a basic overview of a specific category within the dataset.