input stringlengths 159 2.05k | output stringlengths 5 10.3k | task stringclasses 1
value | schema stringlengths 100 1.99k |
|---|---|---|---|
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "conquest:block/graywacke_mortar_wall_small_arch_half"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"agentkeepalive": {"type": "string"}, "algoliasearch": {"type": "string"}, "async": {"type": "string"}, "bcrypt-nodejs": {"type": "string"}, "body-parser": {"type": "string"}, "braintree": {"type": "string"}, "cloudflare-express": {"type": "string"}, "cloudinary": {"type": "string"}, "connect-flash": {"type": "string"}, "connect-mongo": {"type": "string"}, "cookie-parser": {"type": "string"}, "crypto": {"type": "string"}, "ejs": {"type": "string"}, "elasticsearch": {"type": "string"}, "email-templates": {"type": "string"}, "express": {"type": "string"}, "express-session": {"type": "string"}, "fs": {"type": "string"}, "gm": {"type": "string"}, "https": {"type": "string"}, "image-size": {"type": "string"}, "less": {"type": "string"}, "method-override": {"type": "string"}, "mongoose": {"type": "string"}, "morgan": {"type": "string"}, "multer": {"type": "string"}, "nodemailer": {"type": "string"}, "passport": {"type": "string"}, "passport-local": {"type": "string"}, "password-generator": {"type": "string"}, "path": {"type": "string"}, "pmx": {"type": "string"}, "unirest": {"type": "string"}, "util": {"type": "string"}}, "required": ["agentkeepalive", "algoliasearch", "async", "bcrypt-nodejs", "body-parser", "braintree", "cloudflare-express", "cloudinary", "connect-flash", "connect-mongo", "cookie-parser", "crypto", "ejs", "elasticsearch", "email-templates", "express", "express-session", "fs", "gm", "https", "image-size", "less", "method-override", "mongoose", "morgan", "multer", "nodemailer", "passport", "passport-local", "password-generator", "path", "pmx", "unirest", "util"]}}, "required": ["name", "main", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "jobsy", "main" : "server.js", "dependencies" : {"agentkeepalive" : "^2.0.2", "algoliasearch" : "^3.4.0", "async" : "^0.9.0", "bcrypt-nodejs" : "latest", "body-parser" : "~1.0.0", "braintree" : "^1.24.0", "cloudflare-express" : "0.0.1", "cloudinary" : "^1.2.1", "connect-flash" : "~0.1.1", "connect-mongo" : "^0.8.0", "cookie-parser" : "~1.0.0", "crypto" : "0.0.3", "ejs" : "~0.8.5", "elasticsearch" : "^4.0.2", "email-templates" : "^1.2.1", "express" : "~4.0.0", "express-session" : "~1.0.0", "fs" : "0.0.2", "gm" : "^1.17.0", "https" : "^1.0.0", "image-size" : "^0.3.5", "less" : "^2.5.1", "method-override" : "~1.0.0", "mongoose" : "~3.8.1", "morgan" : "~1.0.0", "multer" : "^0.1.8", "nodemailer" : "^1.3.2", "passport" : "~0.1.17", "passport-local" : "~0.1.6", "password-generator" : "^1.0.0", "path" : "^0.11.14", "pmx" : "^0.3.5", "unirest" : "^0.4.0", "util" : "^0.10.3"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"agentkeepalive": {"type": "string"}, "algoliasearch": {"type": "string"}, "async": {"type": "string"}, "bcrypt-nodejs": {"type": "string"}, "body-parser": {"type": "string"}, "braintree": {"type": "string"}, "cloudflare-express": {"type": "string"}, "cloudinary": {"type": "string"}, "connect-flash": {"type": "string"}, "connect-mongo": {"type": "string"}, "cookie-parser": {"type": "string"}, "crypto": {"type": "string"}, "ejs": {"type": "string"}, "elasticsearch": {"type": "string"}, "email-templates": {"type": "string"}, "express": {"type": "string"}, "express-session": {"type": "string"}, "fs": {"type": "string"}, "gm": {"type": "string"}, "https": {"type": "string"}, "image-size": {"type": "string"}, "less": {"type": "string"}, "method-override": {"type": "string"}, "mongoose": {"type": "string"}, "morgan": {"type": "string"}, "multer": {"type": "string"}, "nodemailer": {"type": "string"}, "passport": {"type": "string"}, "passport-local": {"type": "string"}, "password-generator": {"type": "string"}, "path": {"type": "string"}, "pmx": {"type": "string"}, "unirest": {"type": "string"}, "util": {"type": "string"}}, "required": ["agentkeepalive", "algoliasearch", "async", "bcrypt-nodejs", "body-parser", "braintree", "cloudflare-express", "cloudinary", "connect-flash", "connect-mongo", "cookie-parser", "crypto", "ejs", "elasticsearch", "email-templates", "express", "express-session", "fs", "gm", "https", "image-size", "less", "method-override", "mongoose", "morgan", "multer", "nodemailer", "passport", "passport-local", "password-generator", "path", "pmx", "unirest", "util"]}}, "required": ["name", "main", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"name" : "THINESH", "frequency" : 3, "gender" : "male"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"namaKab" : "LABUHANBATU SELATAN", "originalFilename" : "1. MUHAMMAD NUH PULUNGAN.JPG", "namaPartai" : "Partai Keadilan Sejahtera", "id" : 131870, "noUrut" : 1, "nama" : "MUHAMMAD NUH PULUNGAN", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "LABUHANBATU SELATAN", "originalFilename" : "2. ZAINAL ARIFIN.jpg", "namaPartai" : "Partai Keadilan Sejahtera", "id" : 132230, "noUrut" : 2, "nama" : "ZAINAL ARIFIN", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "LABUHANBATU SELATAN", "originalFilename" : "3. KHAIRUN NISAH, S.Pd.jpg", "namaPartai" : "Partai Keadilan Sejahtera", "id" : 132653, "noUrut" : 3, "nama" : "KHAIRUN NISAH, S.Pd", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "LABUHANBATU SELATAN", "originalFilename" : "4. ARI BUDIARTO.JPG", "namaPartai" : "Partai Keadilan Sejahtera", "id" : 133263, "noUrut" : 4, "nama" : "ARI BUDIARTO", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "LABUHANBATU SELATAN", "originalFilename" : "5. TIKA ESA.jpg", "namaPartai" : "Partai Keadilan Sejahtera", "id" : 133673, "noUrut" : 5, "nama" : "TIKA ESA", "stringJenisKelamin" : "Perempuan"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"plugin_name": {"type": "string"}, "plugin_project": {"type": "string"}}, "required": ["plugin_name", "plugin_project"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"plugin_name" : "account_by_key", "plugin_project" : "steemit_account_by_key"} | json_instruct | {"type": "object", "properties": {"plugin_name": {"type": "string"}, "plugin_project": {"type": "string"}}, "required": ["plugin_name", "plugin_project"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"contract" : "0x2d1e23144b89fc7364ed3efcd5af04093f7d9a3d", "tool" : "slither", "start" : 1563536489.865753, "end" : 1563536495.1814249, "duration" : 5.315671920776367, "analysis" : []} | json_instruct | {"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"categories": {"type": "array", "items": {"type": "string"}}, "desc": {"type": "string"}, "details": {"type": "object", "properties": {"authors": {"type": "string"}, "format": {"type": "string"}, "isbn-10": {"type": "string"}, "isbn-13": {"type": "string"}, "pages": {"type": "string"}, "publication date": {"type": "string"}, "publisher": {"type": "string"}, "size": {"type": "string"}}, "required": ["authors", "format", "isbn-10", "isbn-13", "pages", "publication date", "publisher", "size"]}, "img": {"type": "string"}, "link": {"type": "string"}, "title": {"type": "string"}}, "required": ["categories", "desc", "details", "img", "link", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"categories" : ["Management"], "desc" : " Managing Software Projects is a book for software engineering students and project management professionals in the IT and software industry. It focuses on and tailors the four phases of management \u2014 planning, organizing, monitoring, and adjusting (POMA) \u2014 to application on software projects. The tasks and techniques utilized in each of the POMA management phases are discussed with specific software engineering and IT related examples. Drawing from years of experience in the industry, the author presents material within a framework of \u201creal\u201d examples and exercises that help readers apply new concepts to everyday situations.", "details" : {"authors" : "Frank Tsui", "format" : "pdf", "isbn-10" : "0763725463", "isbn-13" : "978-0763725464", "pages" : "337 pages", "publication date" : "February 17, 2004", "publisher" : "Jones & Bartlett Learning", "size" : "2.00Mb"}, "img" : "http://23.95.221.108/covers/63/63d60f530e0a3208c969a66f5ca5849a.jpg", "link" : "https://rapidhosting.info/files/b03", "title" : "Managing Software Projects"} | json_instruct | {"type": "object", "properties": {"categories": {"type": "array", "items": {"type": "string"}}, "desc": {"type": "string"}, "details": {"type": "object", "properties": {"authors": {"type": "string"}, "format": {"type": "string"}, "isbn-10": {"type": "string"}, "isbn-13": {"type": "string"}, "pages": {"type": "string"}, "publication date": {"type": "string"}, "publisher": {"type": "string"}, "size": {"type": "string"}}, "required": ["authors", "format", "isbn-10", "isbn-13", "pages", "publication date", "publisher", "size"]}, "img": {"type": "string"}, "link": {"type": "string"}, "title": {"type": "string"}}, "required": ["categories", "desc", "details", "img", "link", "title"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-118.324588, 34.196808], [-118.322272, 34.199017], [-118.310658, 34.190554], [-118.313127, 34.188229], [-118.31215, 34.187494], [-118.312793, 34.186498], [-118.313901, 34.186729], [-118.315163, 34.185544], [-118.321712, 34.190389], [-118.324588, 34.196808]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 10325}}]} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [[1988, 6], [1997, 6]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"contract" : "0x05984006707585f66465e8a6505341f46b64fa7a", "tool" : "slither", "start" : 1563470461.931523, "end" : 1563470466.4609163, "duration" : 4.529393196105957, "analysis" : []} | json_instruct | {"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"n_dim" : 13, "n_trials" : 550, "objective" : "markowitz_analytic_on_cube", "white" : "dlib", "black" : "ultraopt_etpe", "traceback" : ["passing", "passing"], "best_val" : [0.09660334655694454, -0.024131151105510326], "best_x" : [[1.6599673249433313e-05, 0.02727529739632493, 0.011496348348938234, 0.0, 2.2842768712483534e-06, 0.12410702707408254, 1.2004592617304662e-07, 0.029834396442365036, 0.384583676555535, 0.35338702856153753, 0.028150340531087486, 1.7017296505285802e-06, 0.04114885162631395], [0.019608647756880933, 0.025506448868995182, 0.003990906782469786, 0.0, 0.049465963318440095, 0.11262761608527541, 0.0, 0.08912108763621411, 0.07137730717361998, 0.20296423932692562, 0.290467169248823, 0.03325873154092303, 0.10363821126222073]], "feval_count" : [550, 550], "n_trials_instructed" : [550, 550], "passing" : [true, true], "completed" : true, "points" : 0.0, "winner" : "ultraopt_etpe_cube", "loser" : "dlib_cube"} | json_instruct | {"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "keywords": {"type": "string"}, "description": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "url": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "url", "email"]}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "homepage": {"type": "string"}, "export": {"type": "object", "properties": {"exclude": {"type": "array", "items": {"type": "string"}}}, "required": ["exclude"]}, "frameworks": {"type": "string"}, "platforms": {"type": "array", "items": {"type": "string"}}, "examples": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "keywords", "description", "authors", "repository", "homepage", "export", "frameworks", "platforms", "examples", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "RP2040_SD", "version" : "1.0.1", "keywords" : "data-storage, sd, sd-card, fat, fat16, fat32, sd-fat, ex-fat, spi, mbed, rpi-pico, rp2040, nano-rp2040-connect", "description" : "This library enables you to use SPI SD cards (FAT16, FAT32, exFAT) with RP2040-based boards such as Nano_RP2040_Connect, RASPBERRY_PI_PICO using either RP2040 Arduino-mbed or arduino-pico core.. This SD-Fat v2 can support FAT16, FAT32, exFAT. exFAT supports files larger than 4GB by using uint64_t as file offset.", "authors" : [{"name" : "Bill Greiman", "url" : "https://github.com/greiman", "email" : "fat16lib@sbcglobal.net"}, {"name" : "Khoi Hoang", "url" : "https://github.com/khoih-prog", "email" : "khoih.prog@gmail.com", "maintainer" : true}], "repository" : {"type" : "git", "url" : "//https://github.com/khoih-prog/RP2040_SD"}, "homepage" : "https://github.com/khoih-prog/RP2040_SD", "export" : {"exclude" : ["linux", "extras", "tests"]}, "frameworks" : "*", "platforms" : ["raspberrypi"], "examples" : "examples/*/*/*.ino", "license" : "MIT"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "keywords": {"type": "string"}, "description": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "url": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "url", "email"]}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "homepage": {"type": "string"}, "export": {"type": "object", "properties": {"exclude": {"type": "array", "items": {"type": "string"}}}, "required": ["exclude"]}, "frameworks": {"type": "string"}, "platforms": {"type": "array", "items": {"type": "string"}}, "examples": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "keywords", "description", "authors", "repository", "homepage", "export", "frameworks", "platforms", "examples", "license"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "title": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "license": {"type": "string"}, "licenseFilename": {"type": "string"}, "readmeFilename": {"type": "string"}, "peerDependencies": {"type": "object", "properties": {"react": {"type": "string"}, "react-native": {"type": "string"}}, "required": ["react", "react-native"]}, "devDependencies": {"type": "object", "properties": {"react": {"type": "string"}, "react-native": {"type": "string"}}, "required": ["react", "react-native"]}}, "required": ["name", "title", "version", "description", "main", "scripts", "keywords", "author", "license", "licenseFilename", "readmeFilename", "peerDependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "genesys-cloud-messenger-mobile-sdk-rn-wrapper", "title" : "Genesys Cloud Messenger Mobile SDK React Native wrapper", "version" : "1.3.0", "description" : "React Native wrappers to allow customers to integrate our Genesys Cloud Messenger Mobile SDK into their React Native applications", "main" : "index.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "keywords" : ["react-native"], "author" : {"name" : "Genesys", "email" : "PureCloudApps.Support@genesys.com"}, "license" : "MIT", "licenseFilename" : "LICENSE", "readmeFilename" : "README.md", "peerDependencies" : {"react" : ">=16.8.6", "react-native" : ">=0.60"}, "devDependencies" : {"react" : ">=16.8.6", "react-native" : ">=0.60"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "title": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "license": {"type": "string"}, "licenseFilename": {"type": "string"}, "readmeFilename": {"type": "string"}, "peerDependencies": {"type": "object", "properties": {"react": {"type": "string"}, "react-native": {"type": "string"}}, "required": ["react", "react-native"]}, "devDependencies": {"type": "object", "properties": {"react": {"type": "string"}, "react-native": {"type": "string"}}, "required": ["react", "react-native"]}}, "required": ["name", "title", "version", "description", "main", "scripts", "keywords", "author", "license", "licenseFilename", "readmeFilename", "peerDependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"required": {"type": "boolean"}, "minVersion": {"type": "string"}, "package": {"type": "string"}, "compatibilityLevel": {"type": "string"}, "mixins": {"type": "array", "items": {"type": "string"}}, "client": {"type": "array", "items": {"type": "string"}}, "injectors": {"type": "object", "properties": {"defaultRequire": {"type": "integer"}}, "required": ["defaultRequire"]}}, "required": ["required", "minVersion", "package", "compatibilityLevel", "mixins", "client", "injectors"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"required" : true, "minVersion" : "0.8", "package" : "com.bloomhousemc.bewitchedgarden.mixin", "compatibilityLevel" : "JAVA_16", "mixins" : ["common.ArmourSlotMixin", "common.CraftingScreenHandlerMixin", "common.ItemEntityMixin", "common.PlayerScreenHandlerMixin", "common.DefaultBiomeFeaturesMixin", "common.EntityMixin", "common.ItemEntityMixin", "common.LivingEntityMixin", "common.PlayerEntityMixin", "common.ServerPlayerEntityMixin", "common.ServerPlayerInteractionManagerMixin"], "client" : ["client.BackgroundRendererMixin", "client.ClientPlayerInteractionManagerMixin", "client.KeyBindingMixin", "client.MinecraftClientMixin", "client.PlayerEntityRendererMixin", "client.ClientPlayerEntityMixin", "client.GameRendererMixin", "client.InGameOverlayRendererMixin", "client.RenderLayerMixin"], "injectors" : {"defaultRequire" : 1}} | json_instruct | {"type": "object", "properties": {"required": {"type": "boolean"}, "minVersion": {"type": "string"}, "package": {"type": "string"}, "compatibilityLevel": {"type": "string"}, "mixins": {"type": "array", "items": {"type": "string"}}, "client": {"type": "array", "items": {"type": "string"}}, "injectors": {"type": "object", "properties": {"defaultRequire": {"type": "integer"}}, "required": ["defaultRequire"]}}, "required": ["required", "minVersion", "package", "compatibilityLevel", "mixins", "client", "injectors"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "undergarden:block/depthrock_brick_wall_inventory"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"@metadata": {"type": "object", "properties": {"authors": {"type": "array", "items": {"type": "string"}}}, "required": ["authors"]}, "betafeatures-toplink": {"type": "string"}, "tooltip-pt-betafeatures": {"type": "string"}}, "required": ["@metadata", "betafeatures-toplink", "tooltip-pt-betafeatures"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"@metadata" : {"authors" : ["Marwan Mohamad"]}, "betafeatures-toplink" : "Beta", "tooltip-pt-betafeatures" : "Pitur beta"} | json_instruct | {"type": "object", "properties": {"@metadata": {"type": "object", "properties": {"authors": {"type": "array", "items": {"type": "string"}}}, "required": ["authors"]}, "betafeatures-toplink": {"type": "string"}, "tooltip-pt-betafeatures": {"type": "string"}}, "required": ["@metadata", "betafeatures-toplink", "tooltip-pt-betafeatures"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "silentgear:block/red_fluffy_block"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "locationSet": {"type": "object", "properties": {"include": {"type": "array", "items": {"type": "string"}}}, "required": ["include"]}, "country_code": {"type": "string"}, "name": {"type": "string"}, "description": {"type": "string"}, "url": {"type": "string"}, "max_zoom": {"type": "integer"}, "license_url": {"type": "string"}, "start_date": {"type": "string"}, "end_date": {"type": "string"}, "overlay": {"type": "boolean"}, "attribution": {"type": "object", "properties": {"url": {"type": "string"}, "text": {"type": "string"}}, "required": ["url", "text"]}}, "required": ["id", "type", "locationSet", "country_code", "name", "description", "url", "max_zoom", "license_url", "start_date", "end_date", "overlay", "attribution"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "tirana-public-transport", "type" : "tms", "locationSet" : {"include" : ["tirana-public-transport.geojson"]}, "country_code" : "AL", "name" : "Municipality of Tirana - Public Transport (Open Labs GeoPortal) (overlay)", "description" : "Bus stops & lines provided by the Muncipality of Tirana hosted by Open Labs", "url" : "https://geoportal.openlabs.cc/mapcache/tms/1.0.0/public-transport@GoogleMapsCompatibleExtended/{zoom}/{x}/{-y}.png", "max_zoom" : 21, "license_url" : "https://cloud.openlabs.cc/s/3lzVn1ZzUEMifHq#pdfviewer", "start_date" : "2017", "end_date" : "2017", "overlay" : true, "attribution" : {"url" : "https://geoportal.openlabs.cc/", "text" : "Data provided by the Muncipality of Tirana hosted by Open Labs"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "locationSet": {"type": "object", "properties": {"include": {"type": "array", "items": {"type": "string"}}}, "required": ["include"]}, "country_code": {"type": "string"}, "name": {"type": "string"}, "description": {"type": "string"}, "url": {"type": "string"}, "max_zoom": {"type": "integer"}, "license_url": {"type": "string"}, "start_date": {"type": "string"}, "end_date": {"type": "string"}, "overlay": {"type": "boolean"}, "attribution": {"type": "object", "properties": {"url": {"type": "string"}, "text": {"type": "string"}}, "required": ["url", "text"]}}, "required": ["id", "type", "locationSet", "country_code", "name", "description", "url", "max_zoom", "license_url", "start_date", "end_date", "overlay", "attribution"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"event": {"type": "string"}, "location": {"type": "string"}}, "required": ["event", "location"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"event" : "GopherCon", "location" : "Denver, Colorado, USA"} | json_instruct | {"type": "object", "properties": {"event": {"type": "string"}, "location": {"type": "string"}}, "required": ["event", "location"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"powerkernel\\yiiuser\\": {"type": "string"}}, "required": ["powerkernel\\yiiuser\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "type", "homepage", "keywords", "license", "authors", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "powerkernel/yii-user", "description" : "Yii user API module", "type" : "yii-module", "homepage" : "https://powerkernel.com", "keywords" : ["yii", "user", "api", "module"], "license" : "MIT", "authors" : [{"name" : "Harry Tang", "email" : "harry@powerkernel.com"}], "autoload" : {"psr-4" : {"powerkernel\\yiiuser\\" : "src"}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"powerkernel\\yiiuser\\": {"type": "string"}}, "required": ["powerkernel\\yiiuser\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "type", "homepage", "keywords", "license", "authors", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "image": {"type": "string"}}, "required": ["name", "description", "image"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Todo's Backend", "description" : "Todo's Backend using Crystal and Kemal", "image" : "heroku/cedar"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "image": {"type": "string"}}, "required": ["name", "description", "image"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "link": {"type": "string"}, "club": {"type": "string"}, "class_classic": {"type": "string"}, "class_dnd": {"type": "string"}, "A": {"type": "string"}, "B": {"type": "string"}, "C": {"type": "string"}, "D": {"type": "string"}, "E": {"type": "string"}, "Ch": {"type": "string"}, "S": {"type": "string"}, "M": {"type": "string"}, "RS": {"type": "string"}, "Beg": {"type": "string"}, "story_classic": {"type": "string"}, "story_dnd": {"type": "string"}}, "required": ["id", "name", "link", "club", "class_classic", "class_dnd", "A", "B", "C", "D", "E", "Ch", "S", "M", "RS", "Beg", "story_classic", "story_dnd"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "01834", "name" : "\u0410\u0440\u0442\u0430\u043c\u043e\u043d\u043e\u0432\u0430 \u0412\u0438\u043a\u0442\u043e\u0440\u0438\u044f ", "link" : "pages/01834.html", "club" : "\u0414\u0432\u0438\u0436\u0435\u043d\u0438\u0435", "class_classic" : "D", "class_dnd" : "BG", "A" : "0", "B" : "0", "C" : "0", "D" : "8", "E" : "0", "Ch" : "0", "S" : "0", "M" : "0", "RS" : "0", "Beg" : "0", "story_classic" : "21.03.2010 \u2014 \u0412\u0435\u0441\u0435\u043d\u043d\u0438\u0439 \u041a\u0443\u0431\u043e\u043a : D7/26+2<br><br>06.03.2010 \u2014 \u041a\u0443\u0431\u043e\u043a \u0410\u0421\u0425 : D24/52+1<br><br>31.01.2010 \u2014 \u041a\u0443\u0431\u043e\u043a \u0427\u0435\u043c\u043f\u0438\u043e\u043d\u043e\u0432 : D11/46+2<br><br>14.11.2009 \u2014 EuroDance 2 : D4/14+2<br><br>01.11.2009 \u2014 \u0414\u0435\u0440\u0436\u0438 \u0420\u0438\u0442\u043c 9 : D26/36<br><br>18.10.2009 \u2014 \u041a\u0443\u0431\u043e\u043a \u041e\u043a\u0442\u044f\u0431\u0440\u044f : D14/38+1<br><br>14.06.2009 \u2014 \u0414\u0435\u0440\u0436\u0438 \u0440\u0438\u0442\u043c : D32/39<br><br>", "story_dnd" : ""} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "link": {"type": "string"}, "club": {"type": "string"}, "class_classic": {"type": "string"}, "class_dnd": {"type": "string"}, "A": {"type": "string"}, "B": {"type": "string"}, "C": {"type": "string"}, "D": {"type": "string"}, "E": {"type": "string"}, "Ch": {"type": "string"}, "S": {"type": "string"}, "M": {"type": "string"}, "RS": {"type": "string"}, "Beg": {"type": "string"}, "story_classic": {"type": "string"}, "story_dnd": {"type": "string"}}, "required": ["id", "name", "link", "club", "class_classic", "class_dnd", "A", "B", "C", "D", "E", "Ch", "S", "M", "RS", "Beg", "story_classic", "story_dnd"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 1125837033, "type" : "Feature", "properties" : {"src:alt_label" : "qs_pg", "src:geom" : "qs_pg", "wof:geomhash" : "51d8d7960855e8f3cff87151109bb51b", "wof:id" : 1125837033, "wof:repo" : "whosonfirst-data-admin-pl"}, "bbox" : [20.81394, 51.62494, 20.81394, 51.62494], "geometry" : {"coordinates" : [20.81394, 51.62494], "type" : "Point"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "support": {"type": "object", "properties": {"issues": {"type": "string"}, "source": {"type": "string"}}, "required": ["issues", "source"]}, "require": {"type": "object", "properties": {"flarum/core": {"type": "string"}}, "required": ["flarum/core"]}, "conflict": {"type": "object", "properties": {"fof/nightmode": {"type": "string"}}, "required": ["fof/nightmode"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"draculatheme\\flarum\\": {"type": "string"}}, "required": ["draculatheme\\flarum\\"]}}, "required": ["psr-4"]}, "extra": {"type": "object", "properties": {"flarum-extension": {"type": "object", "properties": {"title": {"type": "string"}, "icon": {"type": "object", "properties": {"image": {"type": "string"}, "backgroundSize": {"type": "string"}, "backgroundPosition": {"type": "string"}}, "required": ["image", "backgroundSize", "backgroundPosition"]}}, "required": ["title", "icon"]}}, "required": ["flarum-extension"]}}, "required": ["name", "type", "description", "keywords", "license", "authors", "support", "require", "conflict", "autoload", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "draculatheme/flarum", "type" : "flarum-extension", "description" : "Dracula theme for Flarum", "keywords" : ["flarum", "theme", "dracula", "draculatheme"], "license" : "MIT", "authors" : [{"name" : "Darkle", "email" : "tomasromero@outlook.com", "homepage" : "https://github.com/iamdarkle"}], "support" : {"issues" : "https://github.com/dracula/flarum/issues", "source" : "https://github.com/dracula/flarum"}, "require" : {"flarum/core" : "^1.0.0"}, "conflict" : {"fof/nightmode" : "*"}, "autoload" : {"psr-4" : {"draculatheme\\flarum\\" : "src/"}}, "extra" : {"flarum-extension" : {"title" : "Dracula Theme", "icon" : {"image" : "icon.png", "backgroundSize" : "cover", "backgroundPosition" : "center"}}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "support": {"type": "object", "properties": {"issues": {"type": "string"}, "source": {"type": "string"}}, "required": ["issues", "source"]}, "require": {"type": "object", "properties": {"flarum/core": {"type": "string"}}, "required": ["flarum/core"]}, "conflict": {"type": "object", "properties": {"fof/nightmode": {"type": "string"}}, "required": ["fof/nightmode"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"draculatheme\\flarum\\": {"type": "string"}}, "required": ["draculatheme\\flarum\\"]}}, "required": ["psr-4"]}, "extra": {"type": "object", "properties": {"flarum-extension": {"type": "object", "properties": {"title": {"type": "string"}, "icon": {"type": "object", "properties": {"image": {"type": "string"}, "backgroundSize": {"type": "string"}, "backgroundPosition": {"type": "string"}}, "required": ["image", "backgroundSize", "backgroundPosition"]}}, "required": ["title", "icon"]}}, "required": ["flarum-extension"]}}, "required": ["name", "type", "description", "keywords", "license", "authors", "support", "require", "conflict", "autoload", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"word" : "landlocked", "definition" : "1. Inclosed, or nearly inclosed, by land. 2. (Zo\u00f6l.) Confined to a fresh-water lake by reason of waterfalls or dams; -- said of fishes that would naturally seek the sea, after spawning; as, the landlocked salmon."} | json_instruct | {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "scripts": {"type": "object", "properties": {"compile": {"type": "string"}, "watch": {"type": "string"}}, "required": ["compile", "watch"]}, "dependencies": {"type": "object", "properties": {"brfs": {"type": "string"}, "d3": {"type": "string"}, "d3-scale": {"type": "string"}, "lightning-client-utils": {"type": "string"}, "lightning-visualization": {"type": "string"}, "lodash": {"type": "string"}, "react": {"type": "string"}, "svg-path-generator": {"type": "string"}}, "required": ["brfs", "d3", "d3-scale", "lightning-client-utils", "lightning-visualization", "lodash", "react", "svg-path-generator"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "browserify": {"type": "object", "properties": {"transform": {"type": "array", "items": {"type": "string"}}}, "required": ["transform"]}, "lightning": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}, "devDependencies": {"type": "object", "properties": {"react-tools": {"type": "string"}}, "required": ["react-tools"]}}, "required": ["name", "version", "scripts", "dependencies", "keywords", "engines", "browserify", "lightning", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "lightning-histogram", "version" : "0.2.0", "scripts" : {"compile" : "jsx src lib", "watch" : "jsx -w src lib"}, "dependencies" : {"brfs" : "^1.4.0", "d3" : "^3.5.6", "d3-scale" : "^0.1.1", "lightning-client-utils" : "^0.6.3", "lightning-visualization" : "^0.1.0", "lodash" : "^3.8.0", "react" : "^0.13.3", "svg-path-generator" : "^1.1.0"}, "keywords" : ["lightning-visualization"], "engines" : {"node" : ">=0.8.0"}, "browserify" : {"transform" : ["brfs"]}, "lightning" : {"name" : "histogram"}, "devDependencies" : {"react-tools" : "^0.13.3"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "scripts": {"type": "object", "properties": {"compile": {"type": "string"}, "watch": {"type": "string"}}, "required": ["compile", "watch"]}, "dependencies": {"type": "object", "properties": {"brfs": {"type": "string"}, "d3": {"type": "string"}, "d3-scale": {"type": "string"}, "lightning-client-utils": {"type": "string"}, "lightning-visualization": {"type": "string"}, "lodash": {"type": "string"}, "react": {"type": "string"}, "svg-path-generator": {"type": "string"}}, "required": ["brfs", "d3", "d3-scale", "lightning-client-utils", "lightning-visualization", "lodash", "react", "svg-path-generator"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "browserify": {"type": "object", "properties": {"transform": {"type": "array", "items": {"type": "string"}}}, "required": ["transform"]}, "lightning": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}, "devDependencies": {"type": "object", "properties": {"react-tools": {"type": "string"}}, "required": ["react-tools"]}}, "required": ["name", "version", "scripts", "dependencies", "keywords", "engines", "browserify", "lightning", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"Similarity": {"type": "string"}, "Title": {"type": "string"}, "Year": {"type": "integer"}}, "required": ["Similarity", "Title", "Year"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"Similarity" : "0.991", "Title" : "Taxonomic relations and cognitive economy in conceptual organization", "Year" : 2001}, {"Similarity" : "0.956", "Title" : "Modeling Learning via Progressive Alignment using Interim Generalizations", "Year" : 2014}, {"Similarity" : "0.949", "Title" : "Structure Mapping and the Predication of Novel Higher-Order Relations", "Year" : 2004}, {"Similarity" : "0.948", "Title" : "How to Go from Nest to Home Childrens Learning of Relational Categories", "Year" : 2005}, {"Similarity" : "0.946", "Title" : "Generalizing novel names in comparison settings role of conceptual distance during learning and at test", "Year" : 2017}, {"Similarity" : "0.938", "Title" : "Replacing Language Children Use Non-Linguistic Cues and Comparison in Category Formation", "Year" : 2017}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"Similarity": {"type": "string"}, "Title": {"type": "string"}, "Year": {"type": "integer"}}, "required": ["Similarity", "Title", "Year"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"Target": {"type": "string"}, "MediaType": {"type": "string"}, "Data": {"type": "object", "properties": {"Integrity": {"type": "string"}}, "required": ["Integrity"]}}, "required": ["Target", "MediaType", "Data"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Target" : "styles/print.min.d18444d6ed86c4b57f446a2a0bf25716b1cf940c2ad149915f5bcae09d823c2b.css", "MediaType" : "text/css", "Data" : {"Integrity" : "sha256-0YRE1u2GxLV/RGoqC/JXFrHPlAwq0UmRX1vK4J2CPCs="}} | json_instruct | {"type": "object", "properties": {"Target": {"type": "string"}, "MediaType": {"type": "string"}, "Data": {"type": "object", "properties": {"Integrity": {"type": "string"}}, "required": ["Integrity"]}}, "required": ["Target", "MediaType", "Data"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "host": {"type": "string"}, "protocol": {"type": "string"}, "port": {"type": "integer"}, "username": {"type": "string"}, "remotePath": {"type": "string"}, "uploadOnSave": {"type": "boolean"}, "password": {"type": "string"}, "watcher": {"type": "object", "properties": {"files": {"type": "string"}, "autoUpload": {"type": "boolean"}, "autoDelete": {"type": "boolean"}}, "required": ["files", "autoUpload", "autoDelete"]}, "ignore": {"type": "array", "items": {"type": "string"}}, "syncOption": {"type": "object", "properties": {"delete": {"type": "boolean"}, "update": {"type": "boolean"}}, "required": ["delete", "update"]}}, "required": ["name", "host", "protocol", "port", "username", "remotePath", "uploadOnSave", "password", "watcher", "ignore", "syncOption"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "web", "host" : "52.78.130.92", "protocol" : "sftp", "port" : 22, "username" : "ubuntu", "remotePath" : "/var/www/html/", "uploadOnSave" : true, "password" : "P@ssw0rd", "watcher" : {"files" : "**/*", "autoUpload" : true, "autoDelete" : true}, "ignore" : [".vscode", ".git", ".DS_Store"], "syncOption" : {"delete" : true, "update" : true}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "host": {"type": "string"}, "protocol": {"type": "string"}, "port": {"type": "integer"}, "username": {"type": "string"}, "remotePath": {"type": "string"}, "uploadOnSave": {"type": "boolean"}, "password": {"type": "string"}, "watcher": {"type": "object", "properties": {"files": {"type": "string"}, "autoUpload": {"type": "boolean"}, "autoDelete": {"type": "boolean"}}, "required": ["files", "autoUpload", "autoDelete"]}, "ignore": {"type": "array", "items": {"type": "string"}}, "syncOption": {"type": "object", "properties": {"delete": {"type": "boolean"}, "update": {"type": "boolean"}}, "required": ["delete", "update"]}}, "required": ["name", "host", "protocol", "port", "username", "remotePath", "uploadOnSave", "password", "watcher", "ignore", "syncOption"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : "360824105001", "text" : "\u754c\u57e0\u5c45\u59d4\u4f1a"}, {"id" : "360824105200", "text" : "\u754c\u57e0\u6751\u59d4\u4f1a"}, {"id" : "360824105201", "text" : "\u5751\u53e3\u6751\u59d4\u4f1a"}, {"id" : "360824105202", "text" : "\u4e0a\u6817\u5c97\u6751\u59d4\u4f1a"}, {"id" : "360824105203", "text" : "\u6b66\u6e56\u6751\u59d4\u4f1a"}, {"id" : "360824105204", "text" : "\u5ed6\u589f\u6751\u59d4\u4f1a"}, {"id" : "360824105205", "text" : "\u83b2\u5858\u6751\u59d4\u4f1a"}, {"id" : "360824105206", "text" : "\u7530\u5317\u6751\u59d4\u4f1a"}, {"id" : "360824105207", "text" : "\u4e0a\u5df7\u6751\u59d4\u4f1a"}, {"id" : "360824105208", "text" : "\u90d1\u5bb6\u6751\u59d4\u4f1a"}, {"id" : "360824105209", "text" : "\u80e1\u5bb6\u8111\u6751\u59d4\u4f1a"}, {"id" : "360824105210", "text" : "\u6e56\u7530\u6751\u59d4\u4f1a"}, {"id" : "360824105211", "text" : "\u957f\u6392\u6751\u59d4\u4f1a"}, {"id" : "360824105212", "text" : "\u7530\u6e2f\u6751\u59d4\u4f1a"}, {"id" : "360824105213", "text" : "\u6d1e\u53e3\u6751\u59d4\u4f1a"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "cards": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "desc": {"type": "string"}, "value": {"type": "string"}, "_COUNT": {"type": "string"}}, "required": ["name", "desc", "value", "_COUNT"]}}}, "required": ["id", "cards"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : "default", "cards" : [{"name" : "A Card Name", "desc" : "Lorem ipsum dolor sit amet, consectetur adipiscing elit. Phasellus hendrerit ac sem elementum cursus. Nunc sagittis ex nec varius volutpat. Sed condimentum quam sapien, nec accumsan enim aliquam sed.", "value" : "10", "_COUNT" : "7"}]}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "cards": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "desc": {"type": "string"}, "value": {"type": "string"}, "_COUNT": {"type": "string"}}, "required": ["name", "desc", "value", "_COUNT"]}}}, "required": ["id", "cards"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"patthana18.17:0.1": {"type": "string"}, "patthana18.17:0.2": {"type": "string"}, "patthana18.17:0.3": {"type": "string"}, "patthana18.17:1.1": {"type": "string"}, "patthana18.17:2.1": {"type": "string"}, "patthana18.17:3.1": {"type": "string"}, "patthana18.17:4.1": {"type": "string"}, "patthana18.17:5.1": {"type": "string"}}, "required": ["patthana18.17:0.1", "patthana18.17:0.2", "patthana18.17:0.3", "patthana18.17:1.1", "patthana18.17:2.1", "patthana18.17:3.1", "patthana18.17:4.1", "patthana18.17:5.1"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"patthana18.17:0.1" : "<article id='patthana18.17'><header><ul><li class='division'>{}</li>", "patthana18.17:0.2" : "<li class='subdivision'>{}</li></ul>", "patthana18.17:0.3" : "<h1>{}</h1></header>", "patthana18.17:1.1" : "<p>{}</p>", "patthana18.17:2.1" : "<p>{}</p>", "patthana18.17:3.1" : "<p>{}</p>", "patthana18.17:4.1" : "<p>{}</p>", "patthana18.17:5.1" : "<p>{}</p></article>"} | json_instruct | {"type": "object", "properties": {"patthana18.17:0.1": {"type": "string"}, "patthana18.17:0.2": {"type": "string"}, "patthana18.17:0.3": {"type": "string"}, "patthana18.17:1.1": {"type": "string"}, "patthana18.17:2.1": {"type": "string"}, "patthana18.17:3.1": {"type": "string"}, "patthana18.17:4.1": {"type": "string"}, "patthana18.17:5.1": {"type": "string"}}, "required": ["patthana18.17:0.1", "patthana18.17:0.2", "patthana18.17:0.3", "patthana18.17:1.1", "patthana18.17:2.1", "patthana18.17:3.1", "patthana18.17:4.1", "patthana18.17:5.1"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"clbid": {"type": "integer"}, "credits": {"type": "number"}, "crsid": {"type": "integer"}, "departments": {"type": "array", "items": {"type": "string"}}, "description": {"type": "array", "items": {"type": "string"}}, "gereqs": {"type": "array", "items": {"type": "string"}}, "instructors": {"type": "array", "items": {"type": "string"}}, "level": {"type": "integer"}, "locations": {"type": "array", "items": {"type": "string"}}, "name": {"type": "string"}, "number": {"type": "integer"}, "pn": {"type": "boolean"}, "prerequisites": {"type": "string"}, "revisions": {"type": "array", "items": {"type": "object", "properties": {"_updated": {"type": "string"}, "prerequisites": {"type": "string"}}, "required": ["_updated", "prerequisites"]}}, "semester": {"type": "integer"}, "status": {"type": "string"}, "term": {"type": "integer"}, "times": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "year": {"type": "integer"}}, "required": ["clbid", "credits", "crsid", "departments", "description", "gereqs", "instructors", "level", "locations", "name", "number", "pn", "prerequisites", "revisions", "semester", "status", "term", "times", "type", "year"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"clbid" : 118620, "credits" : 1.0, "crsid" : 548, "departments" : ["GREEK"], "description" : ["Like the genre that it describes, the word drama is itself of Greek origin. From the treasure-trove left to us by Aeschylus, Sophocles, Euripides, Aristophanes, and Menander, students translate one or two complete plays and discuss the evolution of the Greek theater, staging, and modern interpretations. Offered alternate years. Prerequisite: GREEK 231 or equivalent."], "gereqs" : ["FOL-K"], "instructors" : ["Hilary J. Bouxsein"], "level" : 300, "locations" : ["TOH 300", "TOH 300"], "name" : "Greek Drama", "number" : 374, "pn" : false, "prerequisites" : "GREEK 231 or equivalent.", "revisions" : [{"_updated" : "2018-02-03T00:04:45.219194+00:00", "prerequisites" : "Prerequisite: GREEK 231 or equivalent."}], "semester" : 1, "status" : "O", "term" : 20181, "times" : ["T 0120-0245PM", "Th 0215-0335PM"], "type" : "Research", "year" : 2018} | json_instruct | {"type": "object", "properties": {"clbid": {"type": "integer"}, "credits": {"type": "number"}, "crsid": {"type": "integer"}, "departments": {"type": "array", "items": {"type": "string"}}, "description": {"type": "array", "items": {"type": "string"}}, "gereqs": {"type": "array", "items": {"type": "string"}}, "instructors": {"type": "array", "items": {"type": "string"}}, "level": {"type": "integer"}, "locations": {"type": "array", "items": {"type": "string"}}, "name": {"type": "string"}, "number": {"type": "integer"}, "pn": {"type": "boolean"}, "prerequisites": {"type": "string"}, "revisions": {"type": "array", "items": {"type": "object", "properties": {"_updated": {"type": "string"}, "prerequisites": {"type": "string"}}, "required": ["_updated", "prerequisites"]}}, "semester": {"type": "integer"}, "status": {"type": "string"}, "term": {"type": "integer"}, "times": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "year": {"type": "integer"}}, "required": ["clbid", "credits", "crsid", "departments", "description", "gereqs", "instructors", "level", "locations", "name", "number", "pn", "prerequisites", "revisions", "semester", "status", "term", "times", "type", "year"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@types/socket.io": {"type": "string"}, "body-parser": {"type": "string"}, "cors": {"type": "string"}, "express": {"type": "string"}, "file-system": {"type": "string"}, "rimraf": {"type": "string"}, "socket.io": {"type": "string"}, "socketio-file-upload": {"type": "string"}}, "required": ["@types/socket.io", "body-parser", "cors", "express", "file-system", "rimraf", "socket.io", "socketio-file-upload"]}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}}, "required": ["nodemon"]}, "description": {"type": "string"}}, "required": ["name", "version", "main", "scripts", "author", "license", "dependencies", "devDependencies", "description"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "prac1", "version" : "1.0.0", "main" : "index.js", "scripts" : {"start" : "nodemon src/index.js"}, "author" : "David Rodriguez", "license" : "MIT", "dependencies" : {"@types/socket.io" : "^2.1.2", "body-parser" : "^1.18.3", "cors" : "^2.8.5", "express" : "^4.16.4", "file-system" : "^2.2.2", "rimraf" : "^2.6.3", "socket.io" : "^2.2.0", "socketio-file-upload" : "^0.7.0"}, "devDependencies" : {"nodemon" : "^1.18.10"}, "description" : ""} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@types/socket.io": {"type": "string"}, "body-parser": {"type": "string"}, "cors": {"type": "string"}, "express": {"type": "string"}, "file-system": {"type": "string"}, "rimraf": {"type": "string"}, "socket.io": {"type": "string"}, "socketio-file-upload": {"type": "string"}}, "required": ["@types/socket.io", "body-parser", "cors", "express", "file-system", "rimraf", "socket.io", "socketio-file-upload"]}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}}, "required": ["nodemon"]}, "description": {"type": "string"}}, "required": ["name", "version", "main", "scripts", "author", "license", "dependencies", "devDependencies", "description"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"namaKab" : "MIMIKA", "originalFilename" : "patwa.jpg", "namaPartai" : "Partai Persatuan pembangunan", "id" : 69487, "noUrut" : 1, "nama" : "PATWA, S.H., M.H.", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "MIMIKA", "originalFilename" : "maurus dudai.jpg", "namaPartai" : "Partai Persatuan pembangunan", "id" : 61427, "noUrut" : 2, "nama" : "MAURUS DUDAI, S.sos", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "MIMIKA", "originalFilename" : "nuraeni mintarsih.jpg", "namaPartai" : "Partai Persatuan pembangunan", "id" : 63532, "noUrut" : 3, "nama" : "NURAENI MINTARSIH, S.Kep., Ns.", "stringJenisKelamin" : "Perempuan"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "dharmaVerificationStatus": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "dharmaVerificationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Clutch Token 2", "symbol" : "CLUTCH2", "address" : "0x4d37fcF756800c35cCcD2F4798316CcE49cB4c0F", "decimals" : 4, "dharmaVerificationStatus" : "UNVERIFIED"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "dharmaVerificationStatus": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "dharmaVerificationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"other_ids" : [], "mRNA_sequence" : [{"index" : 0, "type" : "five_prime_UTR", "sequence" : "CTAAACCTCAAACAAGATCGTGCAGTGATAAGTCAGCGCAGCGAAGATATCACGCTCAATCCTTATCAGTCCGATGTCCTGCACATTGCAATAAAAATGGATATATATATGTAAATTTATCTATATACACTTCCAAGTTATTTTTGGATCGAAAGTTGTGCTTTTTACTTGACTGTTAAATTAGTCTGAAGGCCCAATTGTTGATATCCGTTGTTATAACGTATTTCAACTTTAAATAATTAACATTTTTAAAAATTTAA"}, {"index" : 1, "type" : "CDS", "sequence" : "ATGTTTACTTATCAAAAAATTATTCAACTTGCTTTACTCCTTTCAGGCGTATGTGGCGCTCTTGCCAGCATAGACACTGATTCACATTTGTCGCCAAAAGTCCTTGAAAAACTGAGACCGACAGAGAACCTTGCATACGAGGATGACAGTCTAGATGATGACACATGGCGTTCCAAGAGATGGGAGTTTGATTATCAGTATTCTGGTATATCTACCTTTGCTCATTTGCCGCATGTAAGATGTTTGGTTGAGCAATCAGAAGACTTTGATATAGCCATAATAGGCGTCCCGTTCGATACGGCCGTGTCACATCGTCCCGGTGCACGTTTCGGGCCTAAAGGTATTCGTTCAGCCTCTTCCCGTCAAATGGCAATTAGGGGTTTTAACCCCTCGTTGAATGTCAATCCTTATGAAAGCTGGGCTAAAATTCTTGATTGCGGCGATATTCCCGTATCCTCATATGACAATCAGTTAGCAGTTAGGCAAATGACCGAAGGATATATTGATCTACTTTCTCGTAAAGCCACTGCTTCCCCTGCGTCTAACAATCTTAAAACGGCGGGATTAGCCAAAGATGGAATTTTTCATCCTCGACTTATTACACTAGGTGGGGATCATTCAATAGGCCTTGCATCTTTAAGAGCACTAGGTCATTTTTATGGAAATGTTAGTGTTATTCATTTCGACTCACATTTGGACACATGGAATCCAAAGAGATATTATCCTTCTTACTGGCATTCCGATCGAGCAGATTTCACTCATGGAACAATGTTTTGGATGGCAAGTAAAGAGGGTTTGATCAACAACGGCACATCCATTCACGCCGGTTTACGAACTCGCCTAAGTGGAACCGATTACTATGACTACGAAGAGGATAACCGAGTCGGATTTACCTTTATTGAAGCGCAAGAAATTGACGAAATCGGGGTTAATGGTATCGTCGAGCGTATTAAGCAAGTCGTTGGAGACACTCTTGTTTATTTAAGTATTGACATTGATGTTGTCGATCCTGGATTGGCACCTGGAACTGGTACTCCTGAAACGGGTGGGTGGACTACACGAGAAATGAAGAGCATTCTTAGGAAGCTGGACGGACACTTGAACCTCGTAGGTGCTGAGGTGGTTGAAGTGTCTCCTCCTTACGATGACCGTGCTGAAAGTACATCTTTGGCAGCTTCAGATTTCATCTTTGAGATACTGTCGAGCATGGTGAAGCATCCATTATACGATGTAAAAAAATAA"}, {"index" : 2, "type" : "three_prime_UTR", "sequence" : "GGAAATCAATTCCTCTTTAAGTCGATGACGGTATTATTTAGATAATTCCTTTTTTTTCGATTATGAACATTTCGTTAAAATTGATTCTTAGATAATTAGTAGGTGCTCTTTTTATTTATGAGATGTCGCATATGTCGTGTAAACTGCTACGTTTTGCAATTGTCAATTGCAAT"}], "other_names" : [], "id" : "SPBC8E4.03", "name" : ""} | json_instruct | {"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"server_offset": {"type": "number"}, "run_start": {"type": "number"}, "run_end": {"type": "number"}}, "required": ["server_offset", "run_start", "run_end"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"server_offset" : -0.1625147732821378, "run_start" : 1526406911848.354, "run_end" : 1526407003375.401} | json_instruct | {"type": "object", "properties": {"server_offset": {"type": "number"}, "run_start": {"type": "number"}, "run_end": {"type": "number"}}, "required": ["server_offset", "run_start", "run_end"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"react-bootstrap.js": {"type": "string"}, "react-bootstrap.min.js": {"type": "string"}}, "required": ["react-bootstrap.js", "react-bootstrap.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"react-bootstrap.js" : "sha512-fpKZAIFPv4wqFJ5V0CJV2myNa822z5brQA4U2GUN5Q9eoIrApaCirFIyp7Zm1+mfTXHj64hKz2HG2GNhU5PJ1g==", "react-bootstrap.min.js" : "sha512-YtYNxvuGkvskFdQ+IaN7H6kqmXdWmuByMMDt9O/ydtaIk9SwZ35wuWFDGuMDQ6ayzMY9IK+3m67rQcIk0ziwxQ=="} | json_instruct | {"type": "object", "properties": {"react-bootstrap.js": {"type": "string"}, "react-bootstrap.min.js": {"type": "string"}}, "required": ["react-bootstrap.js", "react-bootstrap.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
| ["======== Resolving module './foo/' from '/a.ts'. ========", "Explicitly specified module resolution kind: 'NodeJs'.", "Loading module as file / folder, candidate module location '/foo/', target file type 'TypeScript'.", "Directory '/foo/' does not exist, skipping all lookups in it.", "Loading module as file / folder, candidate module location '/foo/', target file type 'JavaScript'.", "Directory '/foo/' does not exist, skipping all lookups in it.", "======== Module name './foo/' was not resolved. ========"] | json_instruct | {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "legacy": {"type": "array", "items": {"type": "string"}}, "version": {"type": "string"}, "api_version": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "shortname": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "manufacturer": {"type": "string"}, "product": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "legacy", "version", "api_version", "keywords", "shortname", "description", "main", "manufacturer", "product", "scripts", "repository", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "weatherapi-rest", "legacy" : ["weather-api"], "version" : "1.0.0", "api_version" : "1.0.0", "keywords" : ["weather"], "shortname" : "wapi", "description" : "Weather display using WeatherAPI.com", "main" : "index.js", "manufacturer" : "WeatherAPI.com", "product" : "Current Weather", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "repository" : {"type" : "git", "url" : "git+https://github.com/bitfocus/companion-module-weatherapi-rest.git"}, "author" : "John A Knight, Jr", "license" : "MIT", "bugs" : {"url" : "https://github.com/bitfocus/companion-module-weatherapi-rest/issues"}, "homepage" : "https://github.com/bitfocus/companion-module-weatherapi-rest#readme"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "legacy": {"type": "array", "items": {"type": "string"}}, "version": {"type": "string"}, "api_version": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "shortname": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "manufacturer": {"type": "string"}, "product": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "legacy", "version", "api_version", "keywords", "shortname", "description", "main", "manufacturer", "product", "scripts", "repository", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"require": {"type": "object", "properties": {"phpoffice/phpexcel": {"type": "string"}, "snippet/excelwriter": {"type": "string"}}, "required": ["phpoffice/phpexcel", "snippet/excelwriter"]}}, "required": ["require"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"require" : {"phpoffice/phpexcel" : "^1.8", "snippet/excelwriter" : "1.0.0rc1"}} | json_instruct | {"type": "object", "properties": {"require": {"type": "object", "properties": {"phpoffice/phpexcel": {"type": "string"}, "snippet/excelwriter": {"type": "string"}}, "required": ["phpoffice/phpexcel", "snippet/excelwriter"]}}, "required": ["require"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"data": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "profile_picture_url": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "profile_picture_url", "id"]}}, "paging": {"type": "object", "properties": {"cursors": {"type": "object", "properties": {"before": {"type": "string"}, "after": {"type": "string"}}, "required": ["before", "after"]}}, "required": ["cursors"]}}, "required": ["data", "paging"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"data" : [{"name" : "John Mathew", "profile_picture_url" : "https://facebook.com/john_image.jpg", "id" : "<PERSONA_ID>"}, {"name" : "David Mark", "profile_picture_url" : "https://facebook.com/david_image.jpg", "id" : "<PERSONA_ID>"}], "paging" : {"cursors" : {"before" : "QVFIUlMtR2ZATQlRtVUZALUlloV1", "after" : "QVFIUkpnMGx0aTNvUjJNVmJUT0Yw"}}} | json_instruct | {"type": "object", "properties": {"data": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "profile_picture_url": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "profile_picture_url", "id"]}}, "paging": {"type": "object", "properties": {"cursors": {"type": "object", "properties": {"before": {"type": "string"}, "after": {"type": "string"}}, "required": ["before", "after"]}}, "required": ["cursors"]}}, "required": ["data", "paging"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "license": {"type": "string"}, "private": {"type": "boolean"}, "ignore": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"angular": {"type": "string"}, "angular-route": {"type": "string"}, "bootstrap": {"type": "string"}}, "required": ["angular", "angular-route", "bootstrap"]}}, "required": ["name", "version", "homepage", "authors", "description", "license", "private", "ignore", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "demo", "version" : "0.0.1", "homepage" : "https://github.com/FilipStenbeck/origins", "authors" : ["FilipStenbeck <filip.stenbeck@gmail.com>"], "description" : "Demo of using a functional style", "license" : "MIT", "private" : true, "ignore" : ["**/.*", "node_modules", "bower_components", "app/bower_components", "test", "tests"], "dependencies" : {"angular" : "~1.2.25", "angular-route" : "~1.2.26", "bootstrap" : "~3.2.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "license": {"type": "string"}, "private": {"type": "boolean"}, "ignore": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"angular": {"type": "string"}, "angular-route": {"type": "string"}, "bootstrap": {"type": "string"}}, "required": ["angular", "angular-route", "bootstrap"]}}, "required": ["name", "version", "homepage", "authors", "description", "license", "private", "ignore", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"ChannelSet": {"type": "boolean"}, "Status": {"type": "boolean"}, "NumberTicket": {"type": "integer"}, "NumbersTicket": {"type": "string"}}, "required": ["ChannelSet", "Status", "NumberTicket", "NumbersTicket"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"ChannelSet" : false, "Status" : true, "NumberTicket" : 0, "NumbersTicket" : "000"} | json_instruct | {"type": "object", "properties": {"ChannelSet": {"type": "boolean"}, "Status": {"type": "boolean"}, "NumberTicket": {"type": "integer"}, "NumbersTicket": {"type": "string"}}, "required": ["ChannelSet", "Status", "NumberTicket", "NumbersTicket"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"clappr.js": {"type": "string"}, "clappr.min.js": {"type": "string"}}, "required": ["clappr.js", "clappr.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"clappr.js" : "sha512-6ocXc9zXQBUe6Ads75+4HNJzD8jNudXUvRJP7sO1ETzxNOrtxX3PuWa0j3bdu+4Z+3o8agYh85lgb5lRlXRKIw==", "clappr.min.js" : "sha512-uKWUhsRPr5TNKCWw7wB1h+WdV8KqM1OST2SbXFBnYhJa5GcfVxMS1/1BbQ1SUJX9r6LS3pNpSkeyDYELkrDojA=="} | json_instruct | {"type": "object", "properties": {"clappr.js": {"type": "string"}, "clappr.min.js": {"type": "string"}}, "required": ["clappr.js", "clappr.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"ractive.js": {"type": "string"}, "ractive.min.js": {"type": "string"}}, "required": ["ractive.js", "ractive.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"ractive.js" : "sha512-Qw4Y7hiSutL1ffmMrBRpXrUUuSCu5afSzS58XkhmdBZDc52N4PjiiKWYnguwO9yJGX8OBT8dugDZg0XoXfLM0Q==", "ractive.min.js" : "sha512-LI9Qjo3/hMhzYfmzxsMP1FjsCfHZ9hZmLDsZTvZmeL1rZ7lxVC0EPDSvB7ZjJCTH3B3z/Qt3XB/zI9PS5QBymA=="} | json_instruct | {"type": "object", "properties": {"ractive.js": {"type": "string"}, "ractive.min.js": {"type": "string"}}, "required": ["ractive.js", "ractive.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"status_code": {"type": "integer"}, "data": {"type": "object", "properties": {"Status": {"type": "string"}, "ResponseMetadata": {"type": "object", "properties": {"HTTPStatusCode": {"type": "integer"}, "RetryAttempts": {"type": "integer"}, "HostId": {"type": "string"}, "RequestId": {"type": "string"}, "HTTPHeaders": {"type": "object", "properties": {"x-amz-id-2": {"type": "string"}, "date": {"type": "string"}, "transfer-encoding": {"type": "string"}, "x-amz-request-id": {"type": "string"}, "server": {"type": "string"}}, "required": ["x-amz-id-2", "date", "transfer-encoding", "x-amz-request-id", "server"]}}, "required": ["HTTPStatusCode", "RetryAttempts", "HostId", "RequestId", "HTTPHeaders"]}}, "required": ["Status", "ResponseMetadata"]}}, "required": ["status_code", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"status_code" : 200, "data" : {"Status" : "Enabled", "ResponseMetadata" : {"HTTPStatusCode" : 200, "RetryAttempts" : 0, "HostId" : "NkeAvS4RUFWzk33s2c3ZbbclCTEewHeXBmq/xPWGZpYnkeHJz/k5gcOBJD+/itJLxZLxV7tTM/M=", "RequestId" : "60B3C4AB82EDE5AA", "HTTPHeaders" : {"x-amz-id-2" : "NkeAvS4RUFWzk33s2c3ZbbclCTEewHeXBmq/xPWGZpYnkeHJz/k5gcOBJD+/itJLxZLxV7tTM/M=", "date" : "Wed, 07 Feb 2018 16:34:24 GMT", "transfer-encoding" : "chunked", "x-amz-request-id" : "60B3C4AB82EDE5AA", "server" : "AmazonS3"}}}} | json_instruct | {"type": "object", "properties": {"status_code": {"type": "integer"}, "data": {"type": "object", "properties": {"Status": {"type": "string"}, "ResponseMetadata": {"type": "object", "properties": {"HTTPStatusCode": {"type": "integer"}, "RetryAttempts": {"type": "integer"}, "HostId": {"type": "string"}, "RequestId": {"type": "string"}, "HTTPHeaders": {"type": "object", "properties": {"x-amz-id-2": {"type": "string"}, "date": {"type": "string"}, "transfer-encoding": {"type": "string"}, "x-amz-request-id": {"type": "string"}, "server": {"type": "string"}}, "required": ["x-amz-id-2", "date", "transfer-encoding", "x-amz-request-id", "server"]}}, "required": ["HTTPStatusCode", "RetryAttempts", "HostId", "RequestId", "HTTPHeaders"]}}, "required": ["Status", "ResponseMetadata"]}}, "required": ["status_code", "data"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:placetype": {"type": "string"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:placetype", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 85859845, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes", "src:geom" : "quattroshapes", "wof:geomhash" : "8e2ff875e1c17bffbce4de6b04c0fce8", "wof:id" : 85859845, "wof:placetype" : "neighbourhood", "wof:repo" : "whosonfirst-data-admin-nl"}, "bbox" : [4.47418212890841, 51.93071826332537, 4.48791503906011, 51.94087860815564], "geometry" : {"coordinates" : [[[4.48791503906003, 51.93749208250019], [4.48791503906003, 51.93579872552517], [4.48791503906011, 51.93410530471265], [4.48791503906011, 51.93241182190486], [4.48516845703023, 51.93241181866675], [4.48516845703014, 51.9314867593997], [4.48516845703006, 51.93071827929997], [4.48469460238172, 51.93071827344268], [4.48289573588704, 51.93071826332537], [4.4828957264441, 51.93071827838843], [4.48242187500006, 51.93071827929997], [4.48242187500006, 51.93148675939979], [4.48242187500006, 51.93241181911118], [4.47967529297017, 51.93241182190486], [4.47967529297006, 51.93410529938764], [4.4774025451047, 51.93410530684257], [4.47692871094009, 51.93410531270003], [4.47692871094017, 51.93495202825288], [4.47555541992148, 51.93495202887799], [4.47555541992159, 51.93579873349996], [4.47418212891009, 51.93579873349996], [4.47418212890841, 51.93656725269715], [4.47418212890875, 51.93749208116695], [4.47692871356091, 51.93749208301791], [4.47692871094017, 51.94087860815564], [4.48242187500006, 51.94087860540016], [4.48516845703023, 51.94087860326674], [4.48516845703014, 51.93918537741443], [4.48791503906011, 51.93918537427028], [4.48791503906003, 51.93749208250019]]], "type" : "Polygon"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:placetype": {"type": "string"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:placetype", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "array", "items": {"type": "object", "properties": {"merged": {"type": "string"}, "source": {"type": "string"}}, "required": ["merged", "source"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"merged" : "/Users/masterUNG/Desktop/JoyProject/TrackingJoy/app/build/intermediates/res/merged/debug/layout-sw600dp-v13/design_layout_snackbar.xml", "source" : "/Users/masterUNG/Desktop/JoyProject/TrackingJoy/app/build/intermediates/exploded-aar/com.android.support/design/25.0.1/res/layout-sw600dp-v13/design_layout_snackbar.xml"}, {"merged" : "/Users/masterUNG/Desktop/Android-GoogleDirectionLibrary-master/app/build/intermediates/res/merged/debug/layout-sw600dp-v13/design_layout_snackbar.xml", "source" : "/Users/masterUNG/Desktop/Android-GoogleDirectionLibrary-master/app/build/intermediates/exploded-aar/com.android.support/design/25.0.1/res/layout-sw600dp-v13/design_layout_snackbar.xml"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"merged": {"type": "string"}, "source": {"type": "string"}}, "required": ["merged", "source"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"vv74:0.1": {"type": "string"}, "vv74:0.2": {"type": "string"}, "vv74:0.3": {"type": "string"}, "vv74:0.4": {"type": "string"}, "vv74:1.1": {"type": "string"}, "vv74:1.2": {"type": "string"}, "vv74:1.3": {"type": "string"}, "vv74:1.4": {"type": "string"}, "vv74:2.1": {"type": "string"}, "vv74:2.2": {"type": "string"}, "vv74:2.3": {"type": "string"}, "vv74:2.4": {"type": "string"}, "vv74:3.1": {"type": "string"}, "vv74:3.2": {"type": "string"}, "vv74:3.3": {"type": "string"}, "vv74:4.1": {"type": "string"}, "vv74:4.2": {"type": "string"}, "vv74:4.3": {"type": "string"}, "vv74:4.4": {"type": "string"}, "vv74:4.5": {"type": "string"}, "vv74:4.6": {"type": "string"}, "vv74:5.1": {"type": "string"}, "vv74:5.2": {"type": "string"}, "vv74:5.3": {"type": "string"}, "vv74:6.1": {"type": "string"}, "vv74:7.1": {"type": "string"}, "vv74:8.1": {"type": "string"}, "vv74:9.1": {"type": "string"}, "vv74:9.2": {"type": "string"}, "vv74:9.3": {"type": "string"}, "vv74:9.4": {"type": "string"}, "vv74:10.1": {"type": "string"}}, "required": ["vv74:0.1", "vv74:0.2", "vv74:0.3", "vv74:0.4", "vv74:1.1", "vv74:1.2", "vv74:1.3", "vv74:1.4", "vv74:2.1", "vv74:2.2", "vv74:2.3", "vv74:2.4", "vv74:3.1", "vv74:3.2", "vv74:3.3", "vv74:4.1", "vv74:4.2", "vv74:4.3", "vv74:4.4", "vv74:4.5", "vv74:4.6", "vv74:5.1", "vv74:5.2", "vv74:5.3", "vv74:6.1", "vv74:7.1", "vv74:8.1", "vv74:9.1", "vv74:9.2", "vv74:9.3", "vv74:9.4", "vv74:10.1"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"vv74:0.1" : "<article id='vv74'><header><ul><li class='division'>{}</li>", "vv74:0.2" : "<li>{}</li>", "vv74:0.3" : "<li>{}</li></ul>", "vv74:0.4" : "<h1>{}</h1></header>", "vv74:1.1" : "<blockquote class='gatha'><p><span class='verse-line'>{}</span>", "vv74:1.2" : "<span class='verse-line'>{}</span>", "vv74:1.3" : "<span class='verse-line'>{}</span>", "vv74:1.4" : "<span class='verse-line'>{}</span></p>", "vv74:2.1" : "<p><span class='verse-line'>{}</span>", "vv74:2.2" : "<span class='verse-line'>{}</span>", "vv74:2.3" : "<span class='verse-line'>{}</span>", "vv74:2.4" : "<span class='verse-line'>{}</span></p>", "vv74:3.1" : "<p><span class='verse-line'>{}</span>", "vv74:3.2" : "<span class='verse-line'>{}</span>", "vv74:3.3" : "<span class='verse-line'>{}</span></p>", "vv74:4.1" : "<p><span class='verse-line'>{}</span>", "vv74:4.2" : "<span class='verse-line'>{}</span>", "vv74:4.3" : "<span class='verse-line'>{}</span>", "vv74:4.4" : "<span class='verse-line'>{}</span>", "vv74:4.5" : "<span class='verse-line'>{}</span>", "vv74:4.6" : "<span class='verse-line'>{}</span></p>", "vv74:5.1" : "<p><span class='verse-line'>{}</span>", "vv74:5.2" : "<span class='verse-line'>{}</span>", "vv74:5.3" : "<span class='verse-line'>{}</span></p></blockquote>", "vv74:6.1" : "<p class='endsutta'>{}</p>", "vv74:7.1" : "<p class='endsutta'>{}</p>", "vv74:8.1" : "<p class='uddana-intro'>{}</p>", "vv74:9.1" : "<blockquote class='uddanagatha'><p><span class='verse-line'>{}</span>", "vv74:9.2" : "<span class='verse-line'>{}</span>", "vv74:9.3" : "<span class='verse-line'>{}</span>", "vv74:9.4" : "<span class='verse-line'>{}</span></p></blockquote>", "vv74:10.1" : "<p class='endsutta'>{}</p></article>"} | json_instruct | {"type": "object", "properties": {"vv74:0.1": {"type": "string"}, "vv74:0.2": {"type": "string"}, "vv74:0.3": {"type": "string"}, "vv74:0.4": {"type": "string"}, "vv74:1.1": {"type": "string"}, "vv74:1.2": {"type": "string"}, "vv74:1.3": {"type": "string"}, "vv74:1.4": {"type": "string"}, "vv74:2.1": {"type": "string"}, "vv74:2.2": {"type": "string"}, "vv74:2.3": {"type": "string"}, "vv74:2.4": {"type": "string"}, "vv74:3.1": {"type": "string"}, "vv74:3.2": {"type": "string"}, "vv74:3.3": {"type": "string"}, "vv74:4.1": {"type": "string"}, "vv74:4.2": {"type": "string"}, "vv74:4.3": {"type": "string"}, "vv74:4.4": {"type": "string"}, "vv74:4.5": {"type": "string"}, "vv74:4.6": {"type": "string"}, "vv74:5.1": {"type": "string"}, "vv74:5.2": {"type": "string"}, "vv74:5.3": {"type": "string"}, "vv74:6.1": {"type": "string"}, "vv74:7.1": {"type": "string"}, "vv74:8.1": {"type": "string"}, "vv74:9.1": {"type": "string"}, "vv74:9.2": {"type": "string"}, "vv74:9.3": {"type": "string"}, "vv74:9.4": {"type": "string"}, "vv74:10.1": {"type": "string"}}, "required": ["vv74:0.1", "vv74:0.2", "vv74:0.3", "vv74:0.4", "vv74:1.1", "vv74:1.2", "vv74:1.3", "vv74:1.4", "vv74:2.1", "vv74:2.2", "vv74:2.3", "vv74:2.4", "vv74:3.1", "vv74:3.2", "vv74:3.3", "vv74:4.1", "vv74:4.2", "vv74:4.3", "vv74:4.4", "vv74:4.5", "vv74:4.6", "vv74:5.1", "vv74:5.2", "vv74:5.3", "vv74:6.1", "vv74:7.1", "vv74:8.1", "vv74:9.1", "vv74:9.2", "vv74:9.3", "vv74:9.4", "vv74:10.1"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"values": {"type": "array", "items": {"type": "string"}}}, "required": ["values"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"values" : ["minecraft:acacia_leaves", "minecraft:dark_oak_leaves"]} | json_instruct | {"type": "object", "properties": {"values": {"type": "array", "items": {"type": "string"}}}, "required": ["values"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "description": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "dependencies": {"type": "object", "properties": {"classnames": {"type": "string"}, "gatsby": {"type": "string"}, "gatsby-image": {"type": "string"}, "gatsby-plugin-manifest": {"type": "string"}, "gatsby-plugin-offline": {"type": "string"}, "gatsby-plugin-react-helmet": {"type": "string"}, "gatsby-plugin-sharp": {"type": "string"}, "gatsby-source-filesystem": {"type": "string"}, "gatsby-transformer-sharp": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}, "react-helmet": {"type": "string"}, "react-icons": {"type": "string"}}, "required": ["classnames", "gatsby", "gatsby-image", "gatsby-plugin-manifest", "gatsby-plugin-offline", "gatsby-plugin-react-helmet", "gatsby-plugin-sharp", "gatsby-source-filesystem", "gatsby-transformer-sharp", "react", "react-dom", "react-helmet", "react-icons"]}, "devDependencies": {"type": "object", "properties": {"gatsby-plugin-sass": {"type": "string"}, "gatsby-source-contentful": {"type": "string"}, "prettier": {"type": "string"}, "pretty-quick": {"type": "string"}, "sass": {"type": "string"}}, "required": ["gatsby-plugin-sass", "gatsby-source-contentful", "prettier", "pretty-quick", "sass"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}, "serve": {"type": "string"}, "clean": {"type": "string"}}, "required": ["start", "build", "serve", "clean"]}}, "required": ["name", "private", "description", "version", "author", "dependencies", "devDependencies", "keywords", "license", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "my-resume", "private" : true, "description" : "An HTML resume made with React and Gatsby for the fun of it... Learn more about this and things I make at https://github.com/Manpreet-Bhatti", "version" : "1.0.0", "author" : "Manpreet Bhatti", "dependencies" : {"classnames" : "^2.2.6", "gatsby" : "^2.23.22", "gatsby-image" : "^2.4.12", "gatsby-plugin-manifest" : "^2.4.17", "gatsby-plugin-offline" : "^3.2.16", "gatsby-plugin-react-helmet" : "^3.3.9", "gatsby-plugin-sharp" : "^2.6.18", "gatsby-source-filesystem" : "^2.3.18", "gatsby-transformer-sharp" : "^2.5.10", "react" : "^16.12.0", "react-dom" : "^16.12.0", "react-helmet" : "^6.1.0", "react-icons" : "^3.11.0"}, "devDependencies" : {"gatsby-plugin-sass" : "^2.3.10", "gatsby-source-contentful" : "^2.3.24", "prettier" : "^2.0.5", "pretty-quick" : "^2.0.1", "sass" : "^1.26.10"}, "keywords" : ["gatsby"], "license" : "MIT", "scripts" : {"start" : "gatsby develop", "build" : "gatsby build", "serve" : "gatsby serve", "clean" : "gatsby clean"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "description": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "dependencies": {"type": "object", "properties": {"classnames": {"type": "string"}, "gatsby": {"type": "string"}, "gatsby-image": {"type": "string"}, "gatsby-plugin-manifest": {"type": "string"}, "gatsby-plugin-offline": {"type": "string"}, "gatsby-plugin-react-helmet": {"type": "string"}, "gatsby-plugin-sharp": {"type": "string"}, "gatsby-source-filesystem": {"type": "string"}, "gatsby-transformer-sharp": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}, "react-helmet": {"type": "string"}, "react-icons": {"type": "string"}}, "required": ["classnames", "gatsby", "gatsby-image", "gatsby-plugin-manifest", "gatsby-plugin-offline", "gatsby-plugin-react-helmet", "gatsby-plugin-sharp", "gatsby-source-filesystem", "gatsby-transformer-sharp", "react", "react-dom", "react-helmet", "react-icons"]}, "devDependencies": {"type": "object", "properties": {"gatsby-plugin-sass": {"type": "string"}, "gatsby-source-contentful": {"type": "string"}, "prettier": {"type": "string"}, "pretty-quick": {"type": "string"}, "sass": {"type": "string"}}, "required": ["gatsby-plugin-sass", "gatsby-source-contentful", "prettier", "pretty-quick", "sass"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}, "serve": {"type": "string"}, "clean": {"type": "string"}}, "required": ["start", "build", "serve", "clean"]}}, "required": ["name", "private", "description", "version", "author", "dependencies", "devDependencies", "keywords", "license", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"algorithm": {"type": "string"}, "issued_at": {"type": "string"}, "profile_id": {"type": "string"}, "user_id": {"type": "null"}}, "required": ["algorithm", "issued_at", "profile_id", "user_id"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"algorithm" : "HMAC-SHA256", "issued_at" : "1411072285", "profile_id" : "324556365474", "user_id" : null} | json_instruct | {"type": "object", "properties": {"algorithm": {"type": "string"}, "issued_at": {"type": "string"}, "profile_id": {"type": "string"}, "user_id": {"type": "null"}}, "required": ["algorithm", "issued_at", "profile_id", "user_id"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"opal-parser.js": {"type": "string"}, "opal-parser.min.js": {"type": "string"}}, "required": ["opal-parser.js", "opal-parser.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"opal-parser.js" : "sha256-TRAfwWKKI3epnJT4DQkOWkm1JLKrAwWKjVuB9emlqxI=", "opal-parser.min.js" : "sha256-C/wkb2xYpro7eesD/8IaVeRx/4/4RDHxcMMH/rD1XXA="} | json_instruct | {"type": "object", "properties": {"opal-parser.js": {"type": "string"}, "opal-parser.min.js": {"type": "string"}}, "required": ["opal-parser.js", "opal-parser.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"expire_time": {"type": "integer"}, "ticket": {"type": "string"}}, "required": ["expire_time", "ticket"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"expire_time" : 1493374198, "ticket" : "kgt8ON7yVITDhtdwci0qeYA7kkF8OpNztR3Agf8HXTX5_qelZrEEzibPS4veWQESyvbA5K8fevOujgViNMEs4A"} | json_instruct | {"type": "object", "properties": {"expire_time": {"type": "integer"}, "ticket": {"type": "string"}}, "required": ["expire_time", "ticket"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"Logging": {"type": "object", "properties": {"LogLevel": {"type": "object", "properties": {"Default": {"type": "string"}, "Microsoft": {"type": "string"}, "Microsoft.Hosting.Lifetime": {"type": "string"}}, "required": ["Default", "Microsoft", "Microsoft.Hosting.Lifetime"]}}, "required": ["LogLevel"]}, "QuietStoneConfig": {"type": "object", "properties": {"BaseUrl": {"type": "string"}, "TransactionEndpoint": {"type": "string"}, "RatesEndpoint": {"type": "string"}}, "required": ["BaseUrl", "TransactionEndpoint", "RatesEndpoint"]}, "AllowedHosts": {"type": "string"}}, "required": ["Logging", "QuietStoneConfig", "AllowedHosts"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Logging" : {"LogLevel" : {"Default" : "Trace", "Microsoft" : "Warning", "Microsoft.Hosting.Lifetime" : "Information"}}, "QuietStoneConfig" : {"BaseUrl" : "http://quiet-stone-2094.herokuapp.com/", "TransactionEndpoint" : "/transactions.json", "RatesEndpoint" : "/rates.json"}, "AllowedHosts" : "*"} | json_instruct | {"type": "object", "properties": {"Logging": {"type": "object", "properties": {"LogLevel": {"type": "object", "properties": {"Default": {"type": "string"}, "Microsoft": {"type": "string"}, "Microsoft.Hosting.Lifetime": {"type": "string"}}, "required": ["Default", "Microsoft", "Microsoft.Hosting.Lifetime"]}}, "required": ["LogLevel"]}, "QuietStoneConfig": {"type": "object", "properties": {"BaseUrl": {"type": "string"}, "TransactionEndpoint": {"type": "string"}, "RatesEndpoint": {"type": "string"}}, "required": ["BaseUrl", "TransactionEndpoint", "RatesEndpoint"]}, "AllowedHosts": {"type": "string"}}, "required": ["Logging", "QuietStoneConfig", "AllowedHosts"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "object", "properties": {"cristin_institution_id": {"type": "string"}, "institution_name": {"type": "object", "properties": {"nb": {"type": "string"}}, "required": ["nb"]}, "acronym": {"type": "string"}, "country": {"type": "string"}, "cristin_user_institution": {"type": "boolean"}, "url": {"type": "string"}}, "required": ["cristin_institution_id", "institution_name", "acronym", "country", "cristin_user_institution", "url"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"cristin_institution_id" : "1305", "institution_name" : {"nb" : "Nasjonalmuseet for kunst, arkitektur og design"}, "acronym" : "NMK", "country" : "NO", "cristin_user_institution" : true, "url" : "https://api.cristin.no/v2/institutions/1305"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"cristin_institution_id": {"type": "string"}, "institution_name": {"type": "object", "properties": {"nb": {"type": "string"}}, "required": ["nb"]}, "acronym": {"type": "string"}, "country": {"type": "string"}, "cristin_user_institution": {"type": "boolean"}, "url": {"type": "string"}}, "required": ["cristin_institution_id", "institution_name", "acronym", "country", "cristin_user_institution", "url"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"id": {"type": "string"}, "article": {"type": "string"}, "questions": {"type": "string"}, "options": {"type": "object", "properties": {"model": {"type": "array", "items": {"type": "string"}}, "human": {"type": "array", "items": {"type": "string"}}}, "required": ["model", "human"]}, "answer": {"type": "object", "properties": {"model": {"type": "integer"}, "human": {"type": "integer"}}, "required": ["model", "human"]}}, "required": ["id", "article", "questions", "options", "answer"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "504", "article" : "Joker found one of the biggest diamonds in the world in his own back yard . He sold the stone to a diamond dealer for over three hundred thousand dollars . In New York , the diamond was resold . This time for almost eight hundred thousand dollars . The true value of a diamond is never known until it has been cut . Once cut successfully , its value can increase a thousand times . It ' s easy to understand why the owner of the Joker diamond went to the best diamond cutter he knew , Kaplan . The cutter studied the diamond for twelve whole months . When he felt he was ready to start work , he discovered a flaw . He had to begin with his calculations all over again , or he might have made the stone useless . Six more months passed , and Kaplan finally said to the owner , \" I m ready to start my work . There will be one excellent diamond that be comparable to any in the world , plus eleven small diamonds of first - class quality . \" Kaplan waited a few more days until be felt he was in the best physical and mental condition possible . He picked up his tools and held his breath as he made the first blow . The diamond split exactly as he promised .", "questions" : "When the diamond was resold ,", "options" : {"model" : ["the dealer got 800 , 000 dollars", "the factory got 800 , 000 dollars in new york"], "human" : ["Kaplan got 800 , 000 dollars", "the dealer got 800 , 000 dollars"]}, "answer" : {"model" : 0, "human" : 1}} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "article": {"type": "string"}, "questions": {"type": "string"}, "options": {"type": "object", "properties": {"model": {"type": "array", "items": {"type": "string"}}, "human": {"type": "array", "items": {"type": "string"}}}, "required": ["model", "human"]}, "answer": {"type": "object", "properties": {"model": {"type": "integer"}, "human": {"type": "integer"}}, "required": ["model", "human"]}}, "required": ["id", "article", "questions", "options", "answer"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [["622926220200", "\u524d\u8fdb\u6751\u59d4\u4f1a", "210", "0"], ["622926220201", "\u5b8b\u5bb6\u6751\u59d4\u4f1a", "220", "0"], ["622926220202", "\u8303\u5bb6\u6751\u59d4\u4f1a", "220", "0"], ["622926220203", "\u4ed3\u623f\u6751\u59d4\u4f1a", "220", "0"], ["622926220204", "\u5df4\u82cf\u6c60\u6751\u59d4\u4f1a", "220", "0"], ["622926220205", "\u5927\u6e7e\u5934\u6751\u59d4\u4f1a", "220", "0"]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "homepage", "role"]}}, "support": {"type": "object", "properties": {"issues": {"type": "string"}, "source": {"type": "string"}}, "required": ["issues", "source"]}, "minimum-stability": {"type": "string"}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "brickrouge/brickrouge": {"type": "string"}, "icanboogie/accessor": {"type": "string"}}, "required": ["php", "brickrouge/brickrouge", "icanboogie/accessor"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Brickrouge\\": {"type": "string"}}, "required": ["Brickrouge\\"]}}, "required": ["psr-4"]}}, "required": ["name", "type", "description", "keywords", "homepage", "license", "authors", "support", "minimum-stability", "require", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "brickrouge/listview", "type" : "library", "description" : "A listview elements.", "keywords" : ["mail"], "homepage" : "http://brickrouge.org/", "license" : "BSD-3-Clause", "authors" : [{"name" : "Olivier Laviale", "email" : "olivier.laviale@gmail.com", "homepage" : "http://www.weirdog.com/", "role" : "Developer"}], "support" : {"issues" : "https://github.com/Brickrouge/Listview/issues", "source" : "https://github.com/Brickrouge/Listview"}, "minimum-stability" : "dev", "require" : {"php" : ">=5.4.0", "brickrouge/brickrouge" : "^2.1|^3.0", "icanboogie/accessor" : "<5.0"}, "autoload" : {"psr-4" : {"Brickrouge\\" : "lib"}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "homepage", "role"]}}, "support": {"type": "object", "properties": {"issues": {"type": "string"}, "source": {"type": "string"}}, "required": ["issues", "source"]}, "minimum-stability": {"type": "string"}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "brickrouge/brickrouge": {"type": "string"}, "icanboogie/accessor": {"type": "string"}}, "required": ["php", "brickrouge/brickrouge", "icanboogie/accessor"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Brickrouge\\": {"type": "string"}}, "required": ["Brickrouge\\"]}}, "required": ["psr-4"]}}, "required": ["name", "type", "description", "keywords", "homepage", "license", "authors", "support", "minimum-stability", "require", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"index": {"type": "integer"}, "hash": {"type": "integer"}, "artDyeHash": {"type": "integer"}, "redacted": {"type": "boolean"}, "dyeManifestHash": {"type": "integer"}, "blacklisted": {"type": "boolean"}}, "required": ["index", "hash", "artDyeHash", "redacted", "dyeManifestHash", "blacklisted"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"index" : 10261, "hash" : 1064775566, "artDyeHash" : 1064775566, "redacted" : false, "dyeManifestHash" : 1669525902, "blacklisted" : false} | json_instruct | {"type": "object", "properties": {"index": {"type": "integer"}, "hash": {"type": "integer"}, "artDyeHash": {"type": "integer"}, "redacted": {"type": "boolean"}, "dyeManifestHash": {"type": "integer"}, "blacklisted": {"type": "boolean"}}, "required": ["index", "hash", "artDyeHash", "redacted", "dyeManifestHash", "blacklisted"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"lng": {"type": "number"}, "lat": {"type": "number"}}, "required": ["lng", "lat"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"lng" : 27.437382, "lat" : -29.333999}, {"lng" : 27.434584, "lat" : -29.341074}, {"lng" : 27.437575, "lat" : -29.344056}, {"lng" : 27.438727, "lat" : -29.344969}, {"lng" : 27.439674, "lat" : -29.346056}, {"lng" : 27.440446, "lat" : -29.345604}, {"lng" : 27.441737, "lat" : -29.345262}, {"lng" : 27.443855, "lat" : -29.346016}, {"lng" : 27.444786, "lat" : -29.347343}, {"lng" : 27.445336, "lat" : -29.348331}, {"lng" : 27.448239, "lat" : -29.349785}, {"lng" : 27.449434, "lat" : -29.35014}, {"lng" : 27.453136, "lat" : -29.352392}, {"lng" : 27.454416, "lat" : -29.351358}, {"lng" : 27.454447, "lat" : -29.351301}, {"lng" : 27.454538, "lat" : -29.351155}, {"lng" : 27.455147, "lat" : -29.349517}, {"lng" : 27.45515, "lat" : -29.349485}, {"lng" : 27.455197, "lat" : -29.349292}, {"lng" : 27.456012, "lat" : -29.347049}, {"lng" : 27.457055, "lat" : -29.344457}, {"lng" : 27.456247, "lat" : -29.343014}, {"lng" : 27.454031, "lat" : -29.337196}, {"lng" : 27.448769, "lat" : -29.332366}, {"lng" : 27.446652, "lat" : -29.330409}, {"lng" : 27.437382, "lat" : -29.333999}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"lng": {"type": "number"}, "lat": {"type": "number"}}, "required": ["lng", "lat"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "argumentText": {"type": "string"}, "conclusion": {"type": "string"}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "premises": {"type": "array", "items": {"type": "string"}}}, "required": ["citations", "argumentText", "conclusion", "language", "lookupTerms", "metaLanguage", "premises"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"citations" : [{"textCitation" : "[See lmod0vrid on Metamath](http://us.metamath.org/mpegif/lmod0vrid.html)"}], "argumentText" : "ARGUMENT\n\n| Step | Hyp | Ref | Expression |\n|---|---|---|---|\n\n| 1 | | 0vlid.v | |- V = ( Base ` W ) |\n| 2 | | 0vlid.a | |- .+ = ( +g ` W ) |\n| 3 | | 0vlid.z | |- .0. = ( 0g ` W ) |\n| 4 | | #P_lmodgrp | |- ( W e. LMod -> W e. Grp ) |\n| 5 | 1, 2, 3 | #P_grprid | |- ( ( W e. Grp /\\ X e. V ) -> ( X .+ .0. ) = X ) |\n| 6 | 4, 5 | #P_sylan | |- ( ( W e. LMod /\\ X e. V ) -> ( X .+ .0. ) = X ) |", "conclusion" : "#P_lmod0vrid", "language" : "METAMATH_SET_MM", "lookupTerms" : ["#T_cV", "#T_wceq", "#T_cbs", "#T_cfv", "#T_cW", "#T_c.pl", "#T_wceq", "#T_cplusg", "#T_cfv", "#T_cW", "#T_c.0", "#T_wceq", "#T_c0g", "#T_cfv", "#T_cW", "#T_cW", "#T_wcel", "#T_clmod", "#T_wi", "#T_cW", "#T_wcel", "#T_cgrp", "#T_cW", "#T_wcel", "#T_cgrp", "#T_wa", "#T_cX", "#T_wcel", "#T_cV", "#T_wi", "#T_cX", "#T_c.pl", "#T_c.0", "#T_wceq", "#T_cX", "#T_cW", "#T_wcel", "#T_clmod", "#T_wa", "#T_cX", "#T_wcel", "#T_cV", "#T_wi", "#T_cX", "#T_c.pl", "#T_c.0", "#T_wceq", "#T_cX"], "metaLanguage" : "METAMATH", "premises" : ["#P_lmodgrp", "#P_sylan", "#P_grprid"]} | json_instruct | {"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "argumentText": {"type": "string"}, "conclusion": {"type": "string"}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "premises": {"type": "array", "items": {"type": "string"}}}, "required": ["citations", "argumentText", "conclusion", "language", "lookupTerms", "metaLanguage", "premises"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"public_repos": {"type": "integer"}, "site_admin": {"type": "boolean"}, "subscriptions_url": {"type": "string"}, "gravatar_id": {"type": "string"}, "hireable": {"type": "null"}, "id": {"type": "integer"}, "followers_url": {"type": "string"}, "following_url": {"type": "string"}, "blog": {"type": "string"}, "followers": {"type": "integer"}, "location": {"type": "string"}, "type": {"type": "string"}, "email": {"type": "string"}, "bio": {"type": "null"}, "gists_url": {"type": "string"}, "company": {"type": "null"}, "events_url": {"type": "string"}, "html_url": {"type": "string"}, "updated_at": {"type": "string"}, "received_events_url": {"type": "string"}, "starred_url": {"type": "string"}, "public_gists": {"type": "integer"}, "name": {"type": "string"}, "organizations_url": {"type": "string"}, "url": {"type": "string"}, "created_at": {"type": "string"}, "avatar_url": {"type": "string"}, "repos_url": {"type": "string"}, "following": {"type": "integer"}, "login": {"type": "string"}}, "required": ["public_repos", "site_admin", "subscriptions_url", "gravatar_id", "hireable", "id", "followers_url", "following_url", "blog", "followers", "location", "type", "email", "bio", "gists_url", "company", "events_url", "html_url", "updated_at", "received_events_url", "starred_url", "public_gists", "name", "organizations_url", "url", "created_at", "avatar_url", "repos_url", "following", "login"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"public_repos" : 27, "site_admin" : false, "subscriptions_url" : "https://api.github.com/users/idagds/subscriptions", "gravatar_id" : "", "hireable" : null, "id" : 12439141, "followers_url" : "https://api.github.com/users/idagds/followers", "following_url" : "https://api.github.com/users/idagds/following{/other_user}", "blog" : "https://gds-gov.tech", "followers" : 0, "location" : "Sandcrawler, Singapore", "type" : "Organization", "email" : "hiring@gds-gov.tech", "bio" : null, "gists_url" : "https://api.github.com/users/idagds/gists{/gist_id}", "company" : null, "events_url" : "https://api.github.com/users/idagds/events{/privacy}", "html_url" : "https://github.com/idagds", "updated_at" : "2016-10-05T01:54:57Z", "received_events_url" : "https://api.github.com/users/idagds/received_events", "starred_url" : "https://api.github.com/users/idagds/starred{/owner}{/repo}", "public_gists" : 0, "name" : "Government Digital Services, Singapore", "organizations_url" : "https://api.github.com/users/idagds/orgs", "url" : "https://api.github.com/users/idagds", "created_at" : "2015-05-14T03:32:23Z", "avatar_url" : "https://avatars.githubusercontent.com/u/12439141?v=3", "repos_url" : "https://api.github.com/users/idagds/repos", "following" : 0, "login" : "idagds"} | json_instruct | {"type": "object", "properties": {"public_repos": {"type": "integer"}, "site_admin": {"type": "boolean"}, "subscriptions_url": {"type": "string"}, "gravatar_id": {"type": "string"}, "hireable": {"type": "null"}, "id": {"type": "integer"}, "followers_url": {"type": "string"}, "following_url": {"type": "string"}, "blog": {"type": "string"}, "followers": {"type": "integer"}, "location": {"type": "string"}, "type": {"type": "string"}, "email": {"type": "string"}, "bio": {"type": "null"}, "gists_url": {"type": "string"}, "company": {"type": "null"}, "events_url": {"type": "string"}, "html_url": {"type": "string"}, "updated_at": {"type": "string"}, "received_events_url": {"type": "string"}, "starred_url": {"type": "string"}, "public_gists": {"type": "integer"}, "name": {"type": "string"}, "organizations_url": {"type": "string"}, "url": {"type": "string"}, "created_at": {"type": "string"}, "avatar_url": {"type": "string"}, "repos_url": {"type": "string"}, "following": {"type": "integer"}, "login": {"type": "string"}}, "required": ["public_repos", "site_admin", "subscriptions_url", "gravatar_id", "hireable", "id", "followers_url", "following_url", "blog", "followers", "location", "type", "email", "bio", "gists_url", "company", "events_url", "html_url", "updated_at", "received_events_url", "starred_url", "public_gists", "name", "organizations_url", "url", "created_at", "avatar_url", "repos_url", "following", "login"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"/js/app.js": {"type": "string"}, "/css/app.css": {"type": "string"}}, "required": ["/js/app.js", "/css/app.css"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"/js/app.js" : "/js/app.js?id=0f84665836b773989141", "/css/app.css" : "/css/app.css?id=e6ecf5c39e8b99452ab8"} | json_instruct | {"type": "object", "properties": {"/js/app.js": {"type": "string"}, "/css/app.css": {"type": "string"}}, "required": ["/js/app.js", "/css/app.css"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"cam/image_array": {"type": "string"}, "user/angle": {"type": "number"}, "user/throttle": {"type": "number"}, "user/mode": {"type": "string"}, "pos/pos_x": {"type": "number"}, "pos/pos_y": {"type": "number"}, "pos/pos_z": {"type": "number"}, "pos/speed": {"type": "number"}, "pos/cte": {"type": "number"}, "milliseconds": {"type": "integer"}}, "required": ["cam/image_array", "user/angle", "user/throttle", "user/mode", "pos/pos_x", "pos/pos_y", "pos/pos_z", "pos/speed", "pos/cte", "milliseconds"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"cam/image_array" : "1726_cam-image_array_.jpg", "user/angle" : 0.67, "user/throttle" : 0.524, "user/mode" : "user", "pos/pos_x" : 66.70252, "pos/pos_y" : 0.554067, "pos/pos_z" : 77.91124, "pos/speed" : 10.21564, "pos/cte" : -4.522174, "milliseconds" : 96075} | json_instruct | {"type": "object", "properties": {"cam/image_array": {"type": "string"}, "user/angle": {"type": "number"}, "user/throttle": {"type": "number"}, "user/mode": {"type": "string"}, "pos/pos_x": {"type": "number"}, "pos/pos_y": {"type": "number"}, "pos/pos_z": {"type": "number"}, "pos/speed": {"type": "number"}, "pos/cte": {"type": "number"}, "milliseconds": {"type": "integer"}}, "required": ["cam/image_array", "user/angle", "user/throttle", "user/mode", "pos/pos_x", "pos/pos_y", "pos/pos_z", "pos/speed", "pos/cte", "milliseconds"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
| ["AFP_ENG_20030304.0250", "AFP_ENG_20030305.0918", "AFP_ENG_20030311.0491", "AFP_ENG_20030314.0238", "AFP_ENG_20030319.0879", "AFP_ENG_20030320.0722", "AFP_ENG_20030327.0022", "AFP_ENG_20030327.0224", "AGGRESSIVEVOICEDAILY_20041116.1347", "CNNHL_ENG_20030304_142751.10", "CNNHL_ENG_20030424_123502.25", "CNNHL_ENG_20030513_220910.32", "CNN_CF_20030303.1900.02", "CNN_ENG_20030304_173120.16", "CNN_ENG_20030328_150609.10", "CNN_ENG_20030424_070008.15", "CNN_ENG_20030512_170454.13", "CNN_ENG_20030620_085840.7", "CNN_IP_20030329.1600.00-2", "CNN_IP_20030402.1600.00-1", "CNN_IP_20030405.1600.01-1", "CNN_IP_20030409.1600.02", "FLOPPINGACES_20041117.2002.024", "FLOPPINGACES_20050203.1953.038", "FLOPPINGACES_20050217.1237.014", "TTRACY_20050223.1049", "marcellapr_20050228.2219", "rec.games.chess.politics_20041216.1047", "rec.games.chess.politics_20041217.2111", "soc.org.nonprofit_20050218.1902"] | json_instruct | {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"class": {"type": "object", "properties": {"commands": {"type": "string"}}, "required": ["commands"]}, "instance": {"type": "object", "properties": {"handleRequest": {"type": "string"}, "requestArguments": {"type": "string"}}, "required": ["handleRequest", "requestArguments"]}}, "required": ["class", "instance"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"class" : {"commands" : "jupiter 12/28/2016 21:13"}, "instance" : {"handleRequest" : "jupiter 01/02/2017 13:28", "requestArguments" : "jupiter 12/28/2016 21:14"}} | json_instruct | {"type": "object", "properties": {"class": {"type": "object", "properties": {"commands": {"type": "string"}}, "required": ["commands"]}, "instance": {"type": "object", "properties": {"handleRequest": {"type": "string"}, "requestArguments": {"type": "string"}}, "required": ["handleRequest", "requestArguments"]}}, "required": ["class", "instance"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "description", "main", "repository", "author", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "hexo-theme-fedlab", "version" : "1.0.0", "description" : "A Theme For Hexo", "main" : "index.js", "repository" : "https://github.com/zuojj/hexo-theme-fedlab.git", "author" : "zuojj <cuew1987@163.com>", "license" : "MIT"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "description", "main", "repository", "author", "license"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"$schema": {"type": "string"}, "version": {"type": "string"}, "bundles": {"type": "object", "properties": {"count-down-to-refresh-web-part": {"type": "object", "properties": {"components": {"type": "array", "items": {"type": "object", "properties": {"entrypoint": {"type": "string"}, "manifest": {"type": "string"}}, "required": ["entrypoint", "manifest"]}}}, "required": ["components"]}}, "required": ["count-down-to-refresh-web-part"]}, "externals": {"type": "object", "properties": {}, "required": []}, "localizedResources": {"type": "object", "properties": {"CountDownToRefreshWebPartStrings": {"type": "string"}}, "required": ["CountDownToRefreshWebPartStrings"]}}, "required": ["$schema", "version", "bundles", "externals", "localizedResources"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"$schema" : "https://developer.microsoft.com/json-schemas/spfx-build/config.2.0.schema.json", "version" : "2.0", "bundles" : {"count-down-to-refresh-web-part" : {"components" : [{"entrypoint" : "./lib/webparts/countDownToRefresh/CountDownToRefreshWebPart.js", "manifest" : "./src/webparts/countDownToRefresh/CountDownToRefreshWebPart.manifest.json"}]}}, "externals" : {}, "localizedResources" : {"CountDownToRefreshWebPartStrings" : "lib/webparts/countDownToRefresh/loc/{locale}.js"}} | json_instruct | {"type": "object", "properties": {"$schema": {"type": "string"}, "version": {"type": "string"}, "bundles": {"type": "object", "properties": {"count-down-to-refresh-web-part": {"type": "object", "properties": {"components": {"type": "array", "items": {"type": "object", "properties": {"entrypoint": {"type": "string"}, "manifest": {"type": "string"}}, "required": ["entrypoint", "manifest"]}}}, "required": ["components"]}}, "required": ["count-down-to-refresh-web-part"]}, "externals": {"type": "object", "properties": {}, "required": []}, "localizedResources": {"type": "object", "properties": {"CountDownToRefreshWebPartStrings": {"type": "string"}}, "required": ["CountDownToRefreshWebPartStrings"]}}, "required": ["$schema", "version", "bundles", "externals", "localizedResources"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"userId" : 8470, "cartId" : "d70d1076-68d8-45d6-932e-21afd9f7bf0d", "preferredProducts" : [806, 2588, 428, 541, 4994, 717, 781, 1579, 1683, 2793], "productReviews" : [{"productId" : 3787, "reviewText" : "My co-worker Aurthur has one of these. He says it looks white.", "reviewDate" : "2018-06-06T07:40:20.3667575+03:00"}, {"productId" : 3209, "reviewText" : "this e-business is dominant.", "reviewDate" : "2017-09-06T08:28:16.5250936+03:00"}, {"productId" : 4865, "reviewText" : "talk about contempt!", "reviewDate" : "2016-11-20T04:00:01.3954515+02:00"}, {"productId" : 2431, "reviewText" : "I tried to nab it but got biscuit all over it.", "reviewDate" : "2017-03-14T14:14:08.8377331+02:00"}, {"productId" : 2256, "reviewText" : "My co-worker Ali has one of these. He says it looks towering.", "reviewDate" : "2019-01-28T02:14:29.594513+02:00"}]} | json_instruct | {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"index": {"type": "integer"}, "hash": {"type": "integer"}, "artDyeHash": {"type": "integer"}, "redacted": {"type": "boolean"}, "dyeManifestHash": {"type": "integer"}, "blacklisted": {"type": "boolean"}}, "required": ["index", "hash", "artDyeHash", "redacted", "dyeManifestHash", "blacklisted"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"index" : 2873, "hash" : 1020628173, "artDyeHash" : 1020628173, "redacted" : false, "dyeManifestHash" : 2579676877, "blacklisted" : false} | json_instruct | {"type": "object", "properties": {"index": {"type": "integer"}, "hash": {"type": "integer"}, "artDyeHash": {"type": "integer"}, "redacted": {"type": "boolean"}, "dyeManifestHash": {"type": "integer"}, "blacklisted": {"type": "boolean"}}, "required": ["index", "hash", "artDyeHash", "redacted", "dyeManifestHash", "blacklisted"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"station" : [{"pref_cd" : 38, "line_cd" : 11807, "line_name" : "JR\u4e88\u8b83\u30fb\u5185\u5b50\u7dda", "station_cd" : 1180709, "station_g_cd" : 1180709, "station_name" : "\u4f0a\u4e88\u4e2d\u5c71", "lon" : 132.711629, "lat" : 33.649881}]} | json_instruct | {"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"TOTAL_MEMORY": {"type": "integer"}, "dataUrl": {"type": "string"}, "asmCodeUrl": {"type": "string"}, "asmMemoryUrl": {"type": "string"}, "asmFrameworkUrl": {"type": "string"}, "splashScreenStyle": {"type": "string"}, "backgroundColor": {"type": "string"}}, "required": ["TOTAL_MEMORY", "dataUrl", "asmCodeUrl", "asmMemoryUrl", "asmFrameworkUrl", "splashScreenStyle", "backgroundColor"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"TOTAL_MEMORY" : 268435456, "dataUrl" : "Default WebGL.data.unityweb", "asmCodeUrl" : "Default WebGL.asm.code.unityweb", "asmMemoryUrl" : "Default WebGL.asm.memory.unityweb", "asmFrameworkUrl" : "Default WebGL.asm.framework.unityweb", "splashScreenStyle" : "Dark", "backgroundColor" : "#222C36"} | json_instruct | {"type": "object", "properties": {"TOTAL_MEMORY": {"type": "integer"}, "dataUrl": {"type": "string"}, "asmCodeUrl": {"type": "string"}, "asmMemoryUrl": {"type": "string"}, "asmFrameworkUrl": {"type": "string"}, "splashScreenStyle": {"type": "string"}, "backgroundColor": {"type": "string"}}, "required": ["TOTAL_MEMORY", "dataUrl", "asmCodeUrl", "asmMemoryUrl", "asmFrameworkUrl", "splashScreenStyle", "backgroundColor"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : "513437102001", "text" : "\u6c76\u6c34\u9547\u793e\u533a\u5c45\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102200", "text" : "\u6c76\u6c34\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102201", "text" : "\u9999\u6a1f\u575d\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102202", "text" : "\u6218\u6597\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102203", "text" : "\u5c0f\u7530\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102204", "text" : "\u9a6c\u9053\u5b50\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102205", "text" : "\u5927\u7530\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102206", "text" : "\u72ee\u5b50\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102207", "text" : "\u83b2\u82b1\u77f3\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102208", "text" : "\u7ea2\u82b1\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102209", "text" : "\u989c\u5bb6\u6e7e\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102210", "text" : "\u592a\u5e73\u697c\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102211", "text" : "\u5f6d\u5bb6\u5c71\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102212", "text" : "\u6842\u82b1\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "513437102213", "text" : "\u94dc\u5382\u6c9f\u6751\u6c11\u59d4\u5458\u4f1a"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "types": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "test-dev": {"type": "string"}, "build": {"type": "string"}}, "required": ["test", "test-dev", "build"]}, "dependencies": {"type": "object", "properties": {"graphql": {"type": "string"}, "graphql-tag": {"type": "string"}, "knex": {"type": "string"}, "lodash": {"type": "string"}, "luxon": {"type": "string"}, "pg": {"type": "string"}}, "required": ["graphql", "graphql-tag", "knex", "lodash", "luxon", "pg"]}, "prettier": {"type": "object", "properties": {"semi": {"type": "boolean"}, "singleQuote": {"type": "boolean"}, "trailingComma": {"type": "string"}}, "required": ["semi", "singleQuote", "trailingComma"]}, "devDependencies": {"type": "object", "properties": {"@types/jest": {"type": "string"}, "jest": {"type": "string"}, "ts-jest": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/jest", "jest", "ts-jest", "typescript"]}}, "required": ["name", "version", "main", "types", "repository", "author", "license", "scripts", "dependencies", "prettier", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "gql-sql-slicer", "version" : "1.1.11", "main" : "gql-sql-slicer.js", "types" : "gql-sql-slicer.ts", "repository" : "git@github.com:edjafarov/gql-sql-slicer.git", "author" : "Eldar Djafarov <djkojb@gmail.com>", "license" : "MIT", "scripts" : {"test" : "node ./node_modules/jest/bin/jest.js", "test-dev" : "node ./node_modules/jest/bin/jest.js --watch", "build" : "tsc gql-sql-slicer.ts"}, "dependencies" : {"graphql" : "^14.1.1", "graphql-tag" : "^2.10.1", "knex" : "^0.95.1", "lodash" : "^4.17.21", "luxon" : "^2.0.2", "pg" : "^8.5.1"}, "prettier" : {"semi" : false, "singleQuote" : true, "trailingComma" : "all"}, "devDependencies" : {"@types/jest" : "^26.0.20", "jest" : "^26.6.3", "ts-jest" : "^26.5.4", "typescript" : "^4.2.3"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "types": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "test-dev": {"type": "string"}, "build": {"type": "string"}}, "required": ["test", "test-dev", "build"]}, "dependencies": {"type": "object", "properties": {"graphql": {"type": "string"}, "graphql-tag": {"type": "string"}, "knex": {"type": "string"}, "lodash": {"type": "string"}, "luxon": {"type": "string"}, "pg": {"type": "string"}}, "required": ["graphql", "graphql-tag", "knex", "lodash", "luxon", "pg"]}, "prettier": {"type": "object", "properties": {"semi": {"type": "boolean"}, "singleQuote": {"type": "boolean"}, "trailingComma": {"type": "string"}}, "required": ["semi", "singleQuote", "trailingComma"]}, "devDependencies": {"type": "object", "properties": {"@types/jest": {"type": "string"}, "jest": {"type": "string"}, "ts-jest": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/jest", "jest", "ts-jest", "typescript"]}}, "required": ["name", "version", "main", "types", "repository", "author", "license", "scripts", "dependencies", "prettier", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"univ_dir": {"type": "string"}, "group_size": {"type": "integer"}, "nepochs": {"type": "integer"}, "lr": {"type": "number"}, "inf_steps": {"type": "integer"}, "checkpoint_phases": {"type": "integer"}, "fwd_method": {"type": "string"}, "smooth_alpha": {"type": "number"}, "clamp_thr_lb": {"type": "number"}, "clamp_thr_ub": {"type": "number"}, "optimizer": {"type": "string"}, "gap_slope": {"type": "number"}, "contra_slope": {"type": "number"}, "vacuity_mult": {"type": "number"}, "logical_mult": {"type": "number"}, "bound_mult": {"type": "number"}, "eps": {"type": "number"}}, "required": ["univ_dir", "group_size", "nepochs", "lr", "inf_steps", "checkpoint_phases", "fwd_method", "smooth_alpha", "clamp_thr_lb", "clamp_thr_ub", "optimizer", "gap_slope", "contra_slope", "vacuity_mult", "logical_mult", "bound_mult", "eps"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"univ_dir" : "./16_univ_data", "group_size" : 4, "nepochs" : 5, "lr" : 0.1, "inf_steps" : 20, "checkpoint_phases" : 10, "fwd_method" : "checkpoint", "smooth_alpha" : 4.0, "clamp_thr_lb" : 0.01, "clamp_thr_ub" : 2.0, "optimizer" : "AdamW", "gap_slope" : 0.01, "contra_slope" : 0.99, "vacuity_mult" : 0.01, "logical_mult" : 0.99, "bound_mult" : 0.01, "eps" : 0.01} | json_instruct | {"type": "object", "properties": {"univ_dir": {"type": "string"}, "group_size": {"type": "integer"}, "nepochs": {"type": "integer"}, "lr": {"type": "number"}, "inf_steps": {"type": "integer"}, "checkpoint_phases": {"type": "integer"}, "fwd_method": {"type": "string"}, "smooth_alpha": {"type": "number"}, "clamp_thr_lb": {"type": "number"}, "clamp_thr_ub": {"type": "number"}, "optimizer": {"type": "string"}, "gap_slope": {"type": "number"}, "contra_slope": {"type": "number"}, "vacuity_mult": {"type": "number"}, "logical_mult": {"type": "number"}, "bound_mult": {"type": "number"}, "eps": {"type": "number"}}, "required": ["univ_dir", "group_size", "nepochs", "lr", "inf_steps", "checkpoint_phases", "fwd_method", "smooth_alpha", "clamp_thr_lb", "clamp_thr_ub", "optimizer", "gap_slope", "contra_slope", "vacuity_mult", "logical_mult", "bound_mult", "eps"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"text": {"type": "string"}, "url": {"type": "string"}}, "required": ["text", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"text" : " How to evaluate a function for a point on a graph\n\n[imath]\\theta=\\frac{22 \\pi}{3}[/imath]\n\n\n", "url" : "https://www.youtube.com/watch?v=znOUNtrpDfc"} | json_instruct | {"type": "object", "properties": {"text": {"type": "string"}, "url": {"type": "string"}}, "required": ["text", "url"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "allthecompressed:block/glowstone_block_6x"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"node-sass": {"type": "string"}}, "required": ["node-sass"]}, "devDependencies": {"type": "object", "properties": {"browser-sync": {"type": "string"}, "gulp": {"type": "string"}, "gulp-shell": {"type": "string"}, "gulp-autoprefixer": {"type": "string"}, "gulp-concat": {"type": "string"}, "gulp-cssnano": {"type": "string"}, "gulp-postcss": {"type": "string"}, "gulp-sass": {"type": "string"}, "gulp-sourcemaps": {"type": "string"}, "gulp-uglify": {"type": "string"}, "lodash": {"type": "string"}, "pa11y-ci": {"type": "string"}}, "required": ["browser-sync", "gulp", "gulp-shell", "gulp-autoprefixer", "gulp-concat", "gulp-cssnano", "gulp-postcss", "gulp-sass", "gulp-sourcemaps", "gulp-uglify", "lodash", "pa11y-ci"]}, "scripts": {"type": "object", "properties": {"test-pa11y": {"type": "string"}}, "required": ["test-pa11y"]}, "eyeglass": {"type": "object", "properties": {"name": {"type": "string"}, "needs": {"type": "string"}, "exports": {"type": "string"}}, "required": ["name", "needs", "exports"]}}, "required": ["name", "version", "description", "author", "contributors", "license", "repository", "main", "dependencies", "devDependencies", "scripts", "eyeglass"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@nypl/design-toolkit", "version" : "0.1.36", "description" : "NYPL Design Toolkit", "author" : "NYPL Digital", "contributors" : [{"name" : "Mauricio Giraldo", "email" : "mauriciogiraldo@nypl.org"}, {"name" : "Rafael Hernandez", "email" : "rafaelhernandez@nypl.org"}, {"name" : "Ricardo E. Galvez", "email" : "ricardogalvez@nypl.org"}, {"name" : "Willa Armstrong", "email" : "willaarmstrong@nypl.org"}, {"name" : "Edwin Guzman", "email" : "edwinguzman@nypl.org"}], "license" : "MIT", "repository" : {"type" : "git", "url" : "https://github.com/NYPL/design-toolkit.git"}, "main" : "index.js", "dependencies" : {"node-sass" : "4.6.0"}, "devDependencies" : {"browser-sync" : "^2.24.3", "gulp" : "^3.9.1", "gulp-shell" : "^0.6.5", "gulp-autoprefixer" : "^4.0.0", "gulp-concat" : "^2.6.1", "gulp-cssnano" : "^2.1.2", "gulp-postcss" : "^7.0.1", "gulp-sass" : "^3.1.0", "gulp-sourcemaps" : "^2.6.1", "gulp-uglify" : "^3.0.0", "lodash" : "^4.17.10", "pa11y-ci" : "~1.3.0"}, "scripts" : {"test-pa11y" : "./node_modules/.bin/pa11y-ci"}, "eyeglass" : {"name" : "toolkit", "needs" : "*", "exports" : "eyeglassConfig.js"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"node-sass": {"type": "string"}}, "required": ["node-sass"]}, "devDependencies": {"type": "object", "properties": {"browser-sync": {"type": "string"}, "gulp": {"type": "string"}, "gulp-shell": {"type": "string"}, "gulp-autoprefixer": {"type": "string"}, "gulp-concat": {"type": "string"}, "gulp-cssnano": {"type": "string"}, "gulp-postcss": {"type": "string"}, "gulp-sass": {"type": "string"}, "gulp-sourcemaps": {"type": "string"}, "gulp-uglify": {"type": "string"}, "lodash": {"type": "string"}, "pa11y-ci": {"type": "string"}}, "required": ["browser-sync", "gulp", "gulp-shell", "gulp-autoprefixer", "gulp-concat", "gulp-cssnano", "gulp-postcss", "gulp-sass", "gulp-sourcemaps", "gulp-uglify", "lodash", "pa11y-ci"]}, "scripts": {"type": "object", "properties": {"test-pa11y": {"type": "string"}}, "required": ["test-pa11y"]}, "eyeglass": {"type": "object", "properties": {"name": {"type": "string"}, "needs": {"type": "string"}, "exports": {"type": "string"}}, "required": ["name", "needs", "exports"]}}, "required": ["name", "version", "description", "author", "contributors", "license", "repository", "main", "dependencies", "devDependencies", "scripts", "eyeglass"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"jest-cli": {"type": "string"}, "moment": {"type": "string"}}, "required": ["jest-cli", "moment"]}, "devDependencies": {"type": "object", "properties": {"eslint": {"type": "string"}, "eslint-config-google": {"type": "string"}, "flow-bin": {"type": "string"}}, "required": ["eslint", "eslint-config-google", "flow-bin"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "flow": {"type": "string"}}, "required": ["test", "flow"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "description", "main", "dependencies", "devDependencies", "scripts", "repository", "author", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "iqschedule", "version" : "0.0.1", "description" : "Intelligent Scheduing App", "main" : "event.js", "dependencies" : {"jest-cli" : "^14.0.1", "moment" : "^2.14.1"}, "devDependencies" : {"eslint" : "^3.2.0", "eslint-config-google" : "^0.6.0", "flow-bin" : "^0.30.0"}, "scripts" : {"test" : "jest", "flow" : "flow; test $? -eq 0 -o $? -eq 2"}, "repository" : {"type" : "git", "url" : "."}, "author" : "", "license" : "ISC"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"jest-cli": {"type": "string"}, "moment": {"type": "string"}}, "required": ["jest-cli", "moment"]}, "devDependencies": {"type": "object", "properties": {"eslint": {"type": "string"}, "eslint-config-google": {"type": "string"}, "flow-bin": {"type": "string"}}, "required": ["eslint", "eslint-config-google", "flow-bin"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "flow": {"type": "string"}}, "required": ["test", "flow"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "description", "main", "dependencies", "devDependencies", "scripts", "repository", "author", "license"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"contacts": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "designation": {"type": "string"}, "mobile": {"type": "array", "items": {}}}, "required": ["name", "email", "designation", "mobile"]}}, "guideStarURL": {"type": "string"}, "name": {"type": "string"}, "primaryEmail": {"type": "string"}, "website": {"type": "string"}, "organisationType": {"type": "array", "items": {"type": "string"}}, "telephone": {"type": "array", "items": {"type": "string"}}, "mainAddrress": {"type": "object", "properties": {"state": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}}, "required": ["state", "address"]}, "briefDescription": {"type": "string"}, "yearOfEstablishment": {"type": "string"}}, "required": ["contacts", "guideStarURL", "name", "primaryEmail", "website", "organisationType", "telephone", "mainAddrress", "briefDescription", "yearOfEstablishment"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"contacts" : [{"name" : "M C Ramesh", "email" : "", "designation" : "General Secretary", "mobile" : []}], "guideStarURL" : "http://www.guidestarindia.org/Summary.aspx?CCReg=509", "name" : "Vidyaranya Education and Development Society", "primaryEmail" : "vedsmandur@yahoo.co.in", "website" : "http://www.vidyaranya.org", "organisationType" : ["Direct Service"], "telephone" : ["918022862622", "919343207349", "918022862622"], "mainAddrress" : {"state" : "Karnataka", "address" : ["Mandur, Virgonagar (Via)", "Bangalore", "Bengaluru (Bangalore) Urban", "Karnataka", "560049"]}, "briefDescription" : "Our organization is working for the development of different sections of people such as women, disabled, aged, dalits, tribals, landless people etc on different aspects like education, development, social, economic, cultural, local governance, environment etc. We have been serving 3000 people of these target groups", "yearOfEstablishment" : "1991"} | json_instruct | {"type": "object", "properties": {"contacts": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "designation": {"type": "string"}, "mobile": {"type": "array", "items": {}}}, "required": ["name", "email", "designation", "mobile"]}}, "guideStarURL": {"type": "string"}, "name": {"type": "string"}, "primaryEmail": {"type": "string"}, "website": {"type": "string"}, "organisationType": {"type": "array", "items": {"type": "string"}}, "telephone": {"type": "array", "items": {"type": "string"}}, "mainAddrress": {"type": "object", "properties": {"state": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}}, "required": ["state", "address"]}, "briefDescription": {"type": "string"}, "yearOfEstablishment": {"type": "string"}}, "required": ["contacts", "guideStarURL", "name", "primaryEmail", "website", "organisationType", "telephone", "mainAddrress", "briefDescription", "yearOfEstablishment"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"variants": {"type": "object", "properties": {"": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": [""]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"variants" : {"" : {"model" : "enderscape:block/drift_jelly_block"}}} | json_instruct | {"type": "object", "properties": {"variants": {"type": "object", "properties": {"": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": [""]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"URL": {"type": "string"}, "heading": {"type": "string"}, "subheading": {"type": "string"}, "author": {"type": "string"}, "category": {"type": "string"}, "type": {"type": "string"}, "timestamp": {"type": "string"}, "text": {"type": "string"}}, "required": ["URL", "heading", "subheading", "author", "category", "type", "timestamp", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"URL" : "https://www.wired.com/1999/09/a-votre-sant", "heading" : "a votre sant\u00e9", "subheading" : "there's new evidence that a glass of wine with dinner may be good for your health. a study of 36,000 middle-aged frenchmen found that moderate wine drinkers had roughly half as many fatal heart attacks as teetotalers. previous studies have shown that up to three glasses of wine daily can lower blood pressure and cholesterol levels. the latest research also showed that wine drinkers were less likely to suffer fatal diseases such as cancer or, for that matter, violent death. while any alcohol consumption increases the chance of cancer, wine contains cancer-fighting compounds such as resvaratrol, that appear to offset the risk among moderate drinkers. the study showed that excessive drinking doubled the risk of cancer.", "author" : "wired staff", "category" : "culture", "type" : "article", "timestamp" : "09.13.1999 03:00 AM", "text" : "there's new evidence that a glass of wine with dinner may be good for your health. a study of 36,000 middle-aged frenchmen found that moderate wine drinkers had roughly half as many fatal heart attacks as teetotalers. previous studies have shown that up to three glasses of wine daily can lower blood pressure and cholesterol levels. the latest research also showed that wine drinkers were less likely to suffer fatal diseases such as cancer or, for that matter, violent death. while any alcohol consumption increases the chance of cancer, wine contains cancer-fighting compounds such as resvaratrol, that appear to offset the risk among moderate drinkers. the study showed that excessive drinking doubled the risk of cancer. "} | json_instruct | {"type": "object", "properties": {"URL": {"type": "string"}, "heading": {"type": "string"}, "subheading": {"type": "string"}, "author": {"type": "string"}, "category": {"type": "string"}, "type": {"type": "string"}, "timestamp": {"type": "string"}, "text": {"type": "string"}}, "required": ["URL", "heading", "subheading", "author", "category", "type", "timestamp", "text"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [[2007, 14], [2008, 19], [2009, 10], [2010, 7], [2011, 13], [2012, 16], [2013, 16], [2014, 15]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"variants": {"type": "object", "properties": {"": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": [""]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"variants" : {"" : {"model" : "vanillatweaks:block/sugarblock"}}} | json_instruct | {"type": "object", "properties": {"variants": {"type": "object", "properties": {"": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": [""]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "main": {"type": "string"}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "files": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "license", "repository", "main", "author", "engines", "files", "keywords", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "brazilian-states", "version" : "0.0.4", "description" : "Get informations about Brazilian States.", "license" : "MIT", "repository" : {"type" : "git", "url" : "https://github.com/fernandoporazzi/brazilian-states"}, "main" : "index.js", "author" : {"name" : "Fernando Porazzi", "email" : "fernandoporazzi@gmail.com"}, "engines" : {"node" : ">=4.0.0"}, "files" : ["index.js", "states.json"], "keywords" : ["states", "brazil", "brazilian", "data", "informations"], "bugs" : {"url" : "https://github.com/fernandoporazzi/brazilian-states/issues"}, "homepage" : "https://github.com/fernandoporazzi/brazilian-states"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "main": {"type": "string"}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "files": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "license", "repository", "main", "author", "engines", "files", "keywords", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"id": {"type": "integer"}, "ot": {"type": "integer"}, "alias": {"type": "integer"}, "setcode": {"type": "integer"}, "type": {"type": "integer"}, "atk": {"type": "integer"}, "def": {"type": "integer"}, "level": {"type": "integer"}, "race": {"type": "integer"}, "attribute": {"type": "integer"}, "category": {"type": "integer"}, "name": {"type": "string"}, "desc": {"type": "string"}, "str1": {"type": "string"}, "str2": {"type": "string"}, "str3": {"type": "string"}, "str4": {"type": "string"}, "str5": {"type": "string"}, "str6": {"type": "string"}, "str7": {"type": "string"}, "str8": {"type": "string"}, "str9": {"type": "string"}, "str10": {"type": "string"}, "str11": {"type": "string"}, "str12": {"type": "string"}, "str13": {"type": "string"}, "str14": {"type": "string"}, "str15": {"type": "string"}, "str16": {"type": "string"}, "links": {"type": "array", "items": {}}, "cardpool": {"type": "string"}, "ocg": {"type": "object", "properties": {"pack": {"type": "string"}, "pack_id": {"type": "string"}, "date": {"type": "string"}}, "required": ["pack", "pack_id", "date"]}, "tcg": {"type": "object", "properties": {"pack": {"type": "string"}, "pack_id": {"type": "string"}, "date": {"type": "string"}}, "required": ["pack", "pack_id", "date"]}, "picture": {"type": "string"}}, "required": ["id", "ot", "alias", "setcode", "type", "atk", "def", "level", "race", "attribute", "category", "name", "desc", "str1", "str2", "str3", "str4", "str5", "str6", "str7", "str8", "str9", "str10", "str11", "str12", "str13", "str14", "str15", "str16", "links", "cardpool", "ocg", "tcg", "picture"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 99397762, "ot" : 3, "alias" : 0, "setcode" : 229, "type" : 4, "atk" : 0, "def" : 0, "level" : 0, "race" : 0, "attribute" : 0, "category" : 0, "name" : "Cipher Bit", "desc" : "Target 1 \"Galaxy-Eyes\" or \"Cipher\" Xyz Monster you control; attach this card to it as an Xyz Material, and if you do, the next time it would be destroyed by battle or card effect this turn, it is not destroyed.", "str1" : "", "str2" : "", "str3" : "", "str4" : "", "str5" : "", "str6" : "", "str7" : "", "str8" : "", "str9" : "", "str10" : "", "str11" : "", "str12" : "", "str13" : "", "str14" : "", "str15" : "", "str16" : "", "links" : [], "cardpool" : "OCG/TCG", "ocg" : {"pack" : "Invasion: Vengeance", "pack_id" : "INOV-JP069", "date" : "2016-07-09"}, "tcg" : {"pack" : "Invasion: Vengeance", "pack_id" : "INOV-DE069", "date" : "2016-11-03"}, "picture" : "https://vignette.wikia.nocookie.net/yugioh/images/d/d8/CipherBit-MP17-EN-C-1E.png"} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "ot": {"type": "integer"}, "alias": {"type": "integer"}, "setcode": {"type": "integer"}, "type": {"type": "integer"}, "atk": {"type": "integer"}, "def": {"type": "integer"}, "level": {"type": "integer"}, "race": {"type": "integer"}, "attribute": {"type": "integer"}, "category": {"type": "integer"}, "name": {"type": "string"}, "desc": {"type": "string"}, "str1": {"type": "string"}, "str2": {"type": "string"}, "str3": {"type": "string"}, "str4": {"type": "string"}, "str5": {"type": "string"}, "str6": {"type": "string"}, "str7": {"type": "string"}, "str8": {"type": "string"}, "str9": {"type": "string"}, "str10": {"type": "string"}, "str11": {"type": "string"}, "str12": {"type": "string"}, "str13": {"type": "string"}, "str14": {"type": "string"}, "str15": {"type": "string"}, "str16": {"type": "string"}, "links": {"type": "array", "items": {}}, "cardpool": {"type": "string"}, "ocg": {"type": "object", "properties": {"pack": {"type": "string"}, "pack_id": {"type": "string"}, "date": {"type": "string"}}, "required": ["pack", "pack_id", "date"]}, "tcg": {"type": "object", "properties": {"pack": {"type": "string"}, "pack_id": {"type": "string"}, "date": {"type": "string"}}, "required": ["pack", "pack_id", "date"]}, "picture": {"type": "string"}}, "required": ["id", "ot", "alias", "setcode", "type", "atk", "def", "level", "race", "attribute", "category", "name", "desc", "str1", "str2", "str3", "str4", "str5", "str6", "str7", "str8", "str9", "str10", "str11", "str12", "str13", "str14", "str15", "str16", "links", "cardpool", "ocg", "tcg", "picture"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"Material": {"type": "object", "properties": {"Directory Material": {"type": "string"}, "UUID Resource": {"type": "integer"}, "Name": {"type": "string"}, "Type": {"type": "integer"}, "Last Write": {"type": "integer"}}, "required": ["Directory Material", "UUID Resource", "Name", "Type", "Last Write"]}}, "required": ["Material"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Material" : {"Directory Material" : "Assets/woodDoors_pecular.png", "UUID Resource" : 1753231442, "Name" : "woodDoors_pecular.png", "Type" : 2, "Last Write" : 1523830833}} | json_instruct | {"type": "object", "properties": {"Material": {"type": "object", "properties": {"Directory Material": {"type": "string"}, "UUID Resource": {"type": "integer"}, "Name": {"type": "string"}, "Type": {"type": "integer"}, "Last Write": {"type": "integer"}}, "required": ["Directory Material", "UUID Resource", "Name", "Type", "Last Write"]}}, "required": ["Material"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"name" : "ALZAN", "frequency" : 0, "gender" : "female"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01012128": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01012128"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Topology", "objects" : {"E01012128" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00061159", "LAD11CD" : "E06000003"}, "arcs" : [[0, 1]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00061160", "LAD11CD" : "E06000003"}, "arcs" : [[2, 3, 4, -2, 5]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00061173", "LAD11CD" : "E06000003"}, "arcs" : [[-5, 6]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00061181", "LAD11CD" : "E06000003"}, "arcs" : [[-3, 7]]}]}}, "arcs" : [[[5631, 5488], [807, 156], [-146, 940], [1318, 193], [659, 120]], [[8269, 6897], [99, -2227], [-626, -28], [-203, -1069], [-1545, 530], [-363, 1385]], [[6591, 2898], [-2110, 641], [-627, -389]], [[3854, 3150], [-1153, 496], [-452, 800], [156, 59]], [[2405, 4505], [1190, -553], [334, 584], [498, 42], [74, 767], [1130, 143]], [[8269, 6897], [-487, 1514], [388, 1588], [575, -558], [-436, -365], [13, -851], [618, -121], [-178, -423], [588, 114], [649, -2499], [-1233, -126], [238, -942], [-763, -213], [-1318, -1066], [-332, -51]], [[2405, 4505], [-2188, -270], [-217, 532], [120, 869], [2278, 15], [221, 894], [1874, 196], [-484, 1335], [580, 36], [817, -991], [225, -1633]], [[6591, 2898], [271, -794], [-413, -1171], [427, -350], [-328, -396], [-1161, -187], [-1533, 3150]]], "transform" : {"scale" : [1.1876790975071431e-06, 7.39041363850631e-07], "translate" : [-1.078169270776888, 54.59192112582333]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01012128": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01012128"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"myArray": {"type": "array", "items": {"type": "object", "properties": {"field": {"type": "string"}}, "required": ["field"]}}}, "required": ["myArray"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"myArray" : [{"field" : "value2"}, {"field" : "value1"}]} | json_instruct | {"type": "object", "properties": {"myArray": {"type": "array", "items": {"type": "object", "properties": {"field": {"type": "string"}}, "required": ["field"]}}}, "required": ["myArray"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}, "version": {"type": "string"}, "unity": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "category": {"type": "string"}, "dependencies": {"type": "object", "properties": {"com.unity.textmeshpro": {"type": "string"}}, "required": ["com.unity.textmeshpro"]}}, "required": ["name", "displayName", "version", "unity", "description", "keywords", "author", "category", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "com.aivclab.temporal_fork", "displayName" : "TemporalFork", "version" : "0.0.1", "unity" : "2018.1", "description" : "Temporal anti-aliasing solution", "keywords" : ["rl", "unity", "Physics", "RigidBody", "Component"], "author" : "cnheider <mrnaah@gmail.com> (https://github.com/cnheider)", "category" : "Unity", "dependencies" : {"com.unity.textmeshpro" : "1.2.1"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}, "version": {"type": "string"}, "unity": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "category": {"type": "string"}, "dependencies": {"type": "object", "properties": {"com.unity.textmeshpro": {"type": "string"}}, "required": ["com.unity.textmeshpro"]}}, "required": ["name", "displayName", "version", "unity", "description", "keywords", "author", "category", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-82.397562, 27.122806], [-82.350015, 27.122527], [-82.346723, 27.119495], [-82.347713, 27.116964], [-82.347683, 27.113234], [-82.344062, 27.112608], [-82.343894, 27.113932], [-82.34044, 27.112354], [-82.339, 27.110201], [-82.340818, 27.108659], [-82.340774, 27.107612], [-82.339829, 27.106972], [-82.337923, 27.107539], [-82.338782, 27.104324], [-82.33644, 27.103655], [-82.335742, 27.101503], [-82.333647, 27.101168], [-82.333687, 27.103482], [-82.332643, 27.103641], [-82.333153, 27.099699], [-82.331858, 27.098274], [-82.331975, 27.097269], [-82.329375, 27.09709], [-82.329734, 27.094812], [-82.327334, 27.094274], [-82.326971, 27.092324], [-82.32492, 27.090346], [-82.327271, 27.08915], [-82.327974, 27.087466], [-82.326229, 27.086695], [-82.321545, 27.08783], [-82.322142, 27.083583], [-82.321196, 27.083146], [-82.320222, 27.08463], [-82.319168, 27.084574], [-82.31872, 27.079741], [-82.3196, 27.078813], [-82.32177, 27.080922], [-82.324376, 27.079831], [-82.326193, 27.08004], [-82.329009, 27.076942], [-82.330697, 27.079499], [-82.333377, 27.078694], [-82.388889, 27.079092], [-82.388132, 27.085049], [-82.389186, 27.090168], [-82.384405, 27.097107], [-82.384335, 27.111007], [-82.388553, 27.113639], [-82.397562, 27.122806]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 17941}}]} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "private": {"type": "boolean"}, "main": {"type": "string"}, "module": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"@babel/runtime": {"type": "string"}, "bn.js": {"type": "string"}, "ethereumjs-util": {"type": "string"}, "ethers": {"type": "string"}, "hdkey": {"type": "string"}}, "required": ["@babel/runtime", "bn.js", "ethereumjs-util", "ethers", "hdkey"]}}, "required": ["name", "version", "description", "private", "main", "module", "files", "repository", "author", "license", "bugs", "homepage", "keywords", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@colony/purser-core", "version" : "2.1.2", "description" : "A collection of helpers, utils, validators and normalizers to assist the individual purser modules", "private" : false, "main" : "index.js", "module" : "es/index.js", "files" : ["es", "docs", "*.js"], "repository" : {"type" : "git", "url" : "git+https://github.com/JoinColony/purser.git"}, "author" : "Raul Glogovetan <raul@colony.io>", "license" : "MIT", "bugs" : {"url" : "https://github.com/JoinColony/purser/issues"}, "homepage" : "https://github.com/JoinColony/purser", "keywords" : ["ethereum", "javascript", "wallet", "colony", "software-wallet", "monorepo", "purser"], "dependencies" : {"@babel/runtime" : "^7.1.2", "bn.js" : "^5.0.0", "ethereumjs-util" : "^6.0.0", "ethers" : "^4.0.33", "hdkey" : "^1.1.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "private": {"type": "boolean"}, "main": {"type": "string"}, "module": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"@babel/runtime": {"type": "string"}, "bn.js": {"type": "string"}, "ethereumjs-util": {"type": "string"}, "ethers": {"type": "string"}, "hdkey": {"type": "string"}}, "required": ["@babel/runtime", "bn.js", "ethereumjs-util", "ethers", "hdkey"]}}, "required": ["name", "version", "description", "private", "main", "module", "files", "repository", "author", "license", "bugs", "homepage", "keywords", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "rankine:block/laser_pylon_base"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "array", "items": {"type": "number"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [[1639110600.609214, 1, 0.8331507444381714], [1639110789.451173, 2, 0.9634846448898315], [1639110980.474153, 3, 0.9767084121704102], [1639111169.36715, 4, 0.9820553064346313], [1639111358.380682, 5, 0.9858894348144531]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "number"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [["130183105201", "\u9a6c\u4e8e\u6751\u59d4\u4f1a", "121", "0"], ["130183105202", "\u4e1c\u8d75\u5bb6\u5e84\u6751\u59d4\u4f1a", "122", "0"], ["130183105203", "\u897f\u8d75\u5bb6\u5e84\u6751\u59d4\u4f1a", "122", "0"], ["130183105204", "\u5357\u51bb\u5149\u6751\u59d4\u4f1a", "220", "0"], ["130183105205", "\u5b5f\u5bb6\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105206", "\u5317\u51bb\u5149\u6751\u59d4\u4f1a", "220", "0"], ["130183105207", "\u5317\u8f9b\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105208", "\u5357\u8f9b\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105209", "\u524d\u5f6d\u5934\u6751\u59d4\u4f1a", "220", "0"], ["130183105210", "\u540e\u5f6d\u5934\u6751\u59d4\u4f1a", "220", "0"], ["130183105211", "\u4e1c\u961f\u6751\u59d4\u4f1a", "220", "0"], ["130183105212", "\u897f\u961f\u6751\u59d4\u4f1a", "220", "0"], ["130183105213", "\u5415\u5bb6\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105214", "\u675f\u91cc\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105215", "\u6768\u5bb6\u8425\u6751\u59d4\u4f1a", "220", "0"], ["130183105216", "\u53e4\u57ce\u5be8\u6751\u59d4\u4f1a", "220", "0"], ["130183105217", "\u897f\u8d3e\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105218", "\u5927\u6c99\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105219", "\u5c0f\u6c99\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105220", "\u5c39\u5bb6\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105221", "\u4e1c\u8d3e\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105222", "\u8d75\u5bb6\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130183105223", "\u9a6c\u574a\u8425\u6751\u59d4\u4f1a", "220", "0"], ["130183105224", "\u7a0b\u5bb6\u8425\u6751\u59d4\u4f1a", "220", "0"], ["130183105225", "\u5415\u5bb6\u8425\u6751\u59d4\u4f1a", "220", "0"]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"namaKab" : "KUTAI KARTANEGARA", "originalFilename" : "img019.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 179363, "noUrut" : 1, "nama" : "SYAHRUDIANSYAH, S.Pd.I", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "KUTAI KARTANEGARA", "originalFilename" : "img032.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 205013, "noUrut" : 2, "nama" : "DELA SELVIA", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "KUTAI KARTANEGARA", "originalFilename" : "img051.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 205653, "noUrut" : 3, "nama" : "LILI SUSANTI", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "KUTAI KARTANEGARA", "originalFilename" : "img065.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 206793, "noUrut" : 4, "nama" : "BAHRUL EFFENDY", "stringJenisKelamin" : "Laki-Laki"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.