input
stringlengths
159
2.05k
output
stringlengths
5
10.3k
task
stringclasses
1 value
schema
stringlengths
100
1.99k
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"gradit-001": {"type": "object", "properties": {"generator": {"type": "string"}, "generatorParameters": {"type": "object", "properties": {"debug": {"type": "string"}, "usePooling": {"type": "string"}}, "required": ["debug", "usePooling"]}, "track": {"type": "string"}, "resourcePath": {"type": "string"}, "behavior": {"type": "object", "properties": {"default": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "required": ["default"]}, "loadProfile": {"type": "array", "items": {"type": "object", "properties": {"interval": {"type": "integer"}, "users": {"type": "integer"}, "mix": {"type": "string"}}, "required": ["interval", "users", "mix"]}}, "target": {"type": "object", "properties": {"hostname": {"type": "string"}, "port": {"type": "integer"}}, "required": ["hostname", "port"]}, "pLogSampling": {"type": "number"}, "pOpenLoop": {"type": "number"}, "meanCycleTime": {"type": "number"}, "meanThinkTime": {"type": "number"}, "interactive": {"type": "boolean"}, "objectPoolMaxSize": {"type": "integer"}, "meanResponseTimeSamplingInterval": {"type": "integer"}, "metricSnapshots": {"type": "boolean"}, "metricSnapshotInterval": {"type": "integer"}}, "required": ["generator", "generatorParameters", "track", "resourcePath", "behavior", "loadProfile", "target", "pLogSampling", "pOpenLoop", "meanCycleTime", "meanThinkTime", "interactive", "objectPoolMaxSize", "meanResponseTimeSamplingInterval", "metricSnapshots", "metricSnapshotInterval"]}}, "required": ["gradit-001"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"gradit-001" : {"generator" : "radlab.rain.workload.gradit.GraditGenerator", "generatorParameters" : {"debug" : "false", "usePooling" : "true"}, "track" : "radlab.rain.workload.gradit.GraditScenarioTrack", "resourcePath" : "resources/", "behavior" : {"default" : [[50.0, 50.0, 0.0, 0.0, 0.0, 0.0], [0.0, 0.0, 0.0, 100.0, 0.0, 0.0], [0.0, 0.0, 40.0, 50.0, 0.0, 10.0], [0.0, 0.0, 15.0, 80.0, 0.0, 5.0], [0.0, 0.0, 0.0, 80.0, 0.0, 20.0], [30.0, 0.0, 20.0, 10.0, 40.0, 0.0]]}, "loadProfile" : [{"interval" : 600, "users" : 1, "mix" : "default"}, {"interval" : 30, "users" : 140, "mix" : "default"}, {"interval" : 60, "users" : 200, "mix" : "default"}, {"interval" : 40, "users" : 220, "mix" : "default"}, {"interval" : 40, "users" : 190, "mix" : "default"}, {"interval" : 40, "users" : 150, "mix" : "default"}, {"interval" : 40, "users" : 120, "mix" : "default"}], "target" : {"hostname" : "localhost", "port" : 3000}, "pLogSampling" : 0.0, "pOpenLoop" : 0.0, "meanCycleTime" : 0.5, "meanThinkTime" : 0.5, "interactive" : true, "objectPoolMaxSize" : 500, "meanResponseTimeSamplingInterval" : 50, "metricSnapshots" : true, "metricSnapshotInterval" : 60}}
json_instruct
{"type": "object", "properties": {"gradit-001": {"type": "object", "properties": {"generator": {"type": "string"}, "generatorParameters": {"type": "object", "properties": {"debug": {"type": "string"}, "usePooling": {"type": "string"}}, "required": ["debug", "usePooling"]}, "track": {"type": "string"}, "resourcePath": {"type": "string"}, "behavior": {"type": "object", "properties": {"default": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "required": ["default"]}, "loadProfile": {"type": "array", "items": {"type": "object", "properties": {"interval": {"type": "integer"}, "users": {"type": "integer"}, "mix": {"type": "string"}}, "required": ["interval", "users", "mix"]}}, "target": {"type": "object", "properties": {"hostname": {"type": "string"}, "port": {"type": "integer"}}, "required": ["hostname", "port"]}, "pLogSampling": {"type": "number"}, "pOpenLoop": {"type": "number"}, "meanCycleTime": {"type": "number"}, "meanThinkTime": {"type": "number"}, "interactive": {"type": "boolean"}, "objectPoolMaxSize": {"type": "integer"}, "meanResponseTimeSamplingInterval": {"type": "integer"}, "metricSnapshots": {"type": "boolean"}, "metricSnapshotInterval": {"type": "integer"}}, "required": ["generator", "generatorParameters", "track", "resourcePath", "behavior", "loadProfile", "target", "pLogSampling", "pOpenLoop", "meanCycleTime", "meanThinkTime", "interactive", "objectPoolMaxSize", "meanResponseTimeSamplingInterval", "metricSnapshots", "metricSnapshotInterval"]}}, "required": ["gradit-001"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "875f04d70f8d77c5ce57d26e8299c7f763e45b32"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"dataset_group": {"type": "string"}, "dataset_name": {"type": "string"}, "n_samples": {"type": "integer"}, "shift": {"type": "object", "properties": {"data_shift": {"type": "string"}, "re": {"type": "number"}, "te": {"type": "number"}}, "required": ["data_shift", "re", "te"]}, "cluster": {"type": "object", "properties": {"dim": {"type": "integer"}, "n_clusters": {"type": "integer"}, "radius": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "proba_classes": {"type": "array", "items": {"type": "number"}}, "data_seed": {"type": "integer"}, "centers": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "required": ["dim", "n_clusters", "radius", "proba_classes", "data_seed", "centers"]}}, "required": ["dataset_group", "dataset_name", "n_samples", "shift", "cluster"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"dataset_group" : "toy", "dataset_name" : "toy 3 blobs", "n_samples" : 500, "shift" : {"data_shift" : "covariate_shift_y", "re" : 0.0, "te" : -0.5}, "cluster" : {"dim" : 2, "n_clusters" : 3, "radius" : [[0.002, 0.005], [0.005, 0.01], [0.05, 0.05]], "proba_classes" : [0.33, 0.33, 0.33], "data_seed" : 123, "centers" : [[0.25, 0.0], [0.0, 1.0], [1, 1.5]]}}
json_instruct
{"type": "object", "properties": {"dataset_group": {"type": "string"}, "dataset_name": {"type": "string"}, "n_samples": {"type": "integer"}, "shift": {"type": "object", "properties": {"data_shift": {"type": "string"}, "re": {"type": "number"}, "te": {"type": "number"}}, "required": ["data_shift", "re", "te"]}, "cluster": {"type": "object", "properties": {"dim": {"type": "integer"}, "n_clusters": {"type": "integer"}, "radius": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "proba_classes": {"type": "array", "items": {"type": "number"}}, "data_seed": {"type": "integer"}, "centers": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "required": ["dim", "n_clusters", "radius", "proba_classes", "data_seed", "centers"]}}, "required": ["dataset_group", "dataset_name", "n_samples", "shift", "cluster"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"alias": {"type": "string"}, "category": {"type": "string"}, "copyright_text": {"type": "string"}, "description": {"type": "string"}, "duration": {"type": "integer"}, "id": {"type": "integer"}, "language": {"type": "string"}, "quality_notes": {"type": "string"}, "recorded": {"type": "string"}, "slug": {"type": "string"}, "speakers": {"type": "array", "items": {"type": "string"}}, "summary": {"type": "string"}, "tags": {"type": "array", "items": {}}, "thumbnail_url": {"type": "string"}, "title": {"type": "string"}, "videos": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}}, "required": ["alias", "category", "copyright_text", "description", "duration", "id", "language", "quality_notes", "recorded", "slug", "speakers", "summary", "tags", "thumbnail_url", "title", "videos"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"alias" : "video/2251/pidoorbell-instantaneous-video-notifications-wi", "category" : "PyCon AU 2013", "copyright_text" : "CC-BY-SA", "description" : "", "duration" : 45, "id" : 2251, "language" : "eng", "quality_notes" : "", "recorded" : "2013-07-07", "slug" : "pidoorbell-instantaneous-video-notifications-wi", "speakers" : ["Rupa Dachere"], "summary" : "Have you ever found yourself obsessively checking the UPS or FedEx\ntracking site to see if your package finally got delivered at your\ndoorstep? Or wondered when your contractor/gardener showed up to do\ntheir job? Or if your neighbor came looking for you on an urgent matter\nwhile you were out?\n\nIn this talk, I will show you how you can relax and rely on your\nhandy-dandy smartphone to let you know when these events happen along\nwith video snippets of what happened and who showed up!\n", "tags" : [], "thumbnail_url" : "https://i1.ytimg.com/vi/brgCU6D2IpI/hqdefault.jpg", "title" : "PiDoorbell - Instantaneous Video Notifications with Arduino & RaspberryPi", "videos" : [{"type" : "mp4", "url" : "http://s3.us.archive.org/ndvpyconau2013/PiDoorbell_Instantaneous_Video.mp4"}, {"length" : 0, "type" : "youtube", "url" : "https://www.youtube.com/watch?v=brgCU6D2IpI"}]}
json_instruct
{"type": "object", "properties": {"alias": {"type": "string"}, "category": {"type": "string"}, "copyright_text": {"type": "string"}, "description": {"type": "string"}, "duration": {"type": "integer"}, "id": {"type": "integer"}, "language": {"type": "string"}, "quality_notes": {"type": "string"}, "recorded": {"type": "string"}, "slug": {"type": "string"}, "speakers": {"type": "array", "items": {"type": "string"}}, "summary": {"type": "string"}, "tags": {"type": "array", "items": {}}, "thumbnail_url": {"type": "string"}, "title": {"type": "string"}, "videos": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}}, "required": ["alias", "category", "copyright_text", "description", "duration", "id", "language", "quality_notes", "recorded", "slug", "speakers", "summary", "tags", "thumbnail_url", "title", "videos"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"version": {"type": "string"}, "book": {"type": "string"}, "chapter": {"type": "integer"}, "verse": {"type": "integer"}, "word": {"type": "string"}}, "required": ["version", "book", "chapter", "verse", "word"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"version" : "english_NIV", "book" : "Micah", "chapter" : 6, "verse" : 15, "word" : "You will plant but not harvest; you will press olives but not use the oil, you will crush grapes but not drink the wine."}
json_instruct
{"type": "object", "properties": {"version": {"type": "string"}, "book": {"type": "string"}, "chapter": {"type": "integer"}, "verse": {"type": "integer"}, "word": {"type": "string"}}, "required": ["version", "book", "chapter", "verse", "word"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "kaloa/util": {"type": "string"}}, "required": ["php", "kaloa/util"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "squizlabs/php_codesniffer": {"type": "string"}, "phpmd/phpmd": {"type": "string"}}, "required": ["phpunit/phpunit", "squizlabs/php_codesniffer", "phpmd/phpmd"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Kaloa\\Metadata\\": {"type": "string"}}, "required": ["Kaloa\\Metadata\\"]}}, "required": ["psr-4"]}}, "required": ["name", "type", "description", "keywords", "homepage", "license", "authors", "require", "require-dev", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "kaloa/metadata", "type" : "library", "description" : "A component for working with metadata (e. g. tags)", "keywords" : ["tags"], "homepage" : "http://kaloa.ermshaus.org/", "license" : "MIT", "authors" : [{"name" : "Marc Ermshaus", "email" : "marc@ermshaus.org", "homepage" : "http://www.ermshaus.org/"}], "require" : {"php" : ">=5.4.0", "kaloa/util" : "0.1.0"}, "require-dev" : {"phpunit/phpunit" : "~4.0", "squizlabs/php_codesniffer" : "~1.5", "phpmd/phpmd" : "~2.0"}, "autoload" : {"psr-4" : {"Kaloa\\Metadata\\" : "src"}}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "kaloa/util": {"type": "string"}}, "required": ["php", "kaloa/util"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "squizlabs/php_codesniffer": {"type": "string"}, "phpmd/phpmd": {"type": "string"}}, "required": ["phpunit/phpunit", "squizlabs/php_codesniffer", "phpmd/phpmd"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Kaloa\\Metadata\\": {"type": "string"}}, "required": ["Kaloa\\Metadata\\"]}}, "required": ["psr-4"]}}, "required": ["name", "type", "description", "keywords", "homepage", "license", "authors", "require", "require-dev", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"status": {"type": "integer"}, "startTimes": {"type": "array", "items": {"type": "integer"}}, "objectiveValue": {"type": "number"}, "solverRuntimeInMilliseconds": {"type": "integer"}, "optional": {"type": "object", "properties": {}, "required": []}}, "required": ["status", "startTimes", "objectiveValue", "solverRuntimeInMilliseconds", "optional"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"status" : 3, "startTimes" : [69, 21, 15, 90, 133, 103, 48, 146, 38, 166, 211, 194, 225, 259, 206, 159, 305, 295, 313, 238, 333, 417, 285, 376, 324, 316, 375, 395, 449, 480, 570, 386, 433, 596, 509, 525, 489, 612, 659, 583, 733, 464, 550, 776, 451, 761, 644, 630, 690, 669, 682, 710, 842, 816, 750, 877, 801, 794, 915, 828, 930, 971, 900, 886, 990, 946, 935, 1002, 1034, 1020, 1047, 1069, 1168, 1140, 1058, 1084, 1125, 1223, 1187, 1079, 1151, 1183, 1201, 1260, 1316, 1245, 1273, 1335, 1261, 1381, 1288, 1343, 1395, 1378, 1358, 1407, 1482, 1428, 1418, 1442], "objectiveValue" : 38783.0, "solverRuntimeInMilliseconds" : 0, "optional" : {}}
json_instruct
{"type": "object", "properties": {"status": {"type": "integer"}, "startTimes": {"type": "array", "items": {"type": "integer"}}, "objectiveValue": {"type": "number"}, "solverRuntimeInMilliseconds": {"type": "integer"}, "optional": {"type": "object", "properties": {}, "required": []}}, "required": ["status", "startTimes", "objectiveValue", "solverRuntimeInMilliseconds", "optional"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"fields": {"type": "object", "properties": {"PlaceID": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "Language": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "Header": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "Footer": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "ShortenName": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "MinimumRating": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["PlaceID", "Language", "Header", "Footer", "ShortenName", "MinimumRating"]}}, "required": ["fields"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"fields" : {"PlaceID" : {"type" : "text"}, "Language" : {"type" : "text"}, "Header" : {"type" : "text"}, "Footer" : {"type" : "text"}, "ShortenName" : {"type" : "checkbox"}, "MinimumRating" : {"type" : "text"}}}
json_instruct
{"type": "object", "properties": {"fields": {"type": "object", "properties": {"PlaceID": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "Language": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "Header": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "Footer": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "ShortenName": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "MinimumRating": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["PlaceID", "Language", "Header", "Footer", "ShortenName", "MinimumRating"]}}, "required": ["fields"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "start_date": {"type": "string"}}, "required": ["name", "start_date"]}}, "history": {"type": "object", "properties": {"1939-09-02": {"type": "string"}, "1939-09-12": {"type": "string"}, "1940-03-23": {"type": "string"}, "1940-04-03": {"type": "string"}, "1940-05-18": {"type": "string"}, "1940-05-30": {"type": "string"}, "1943-07-30": {"type": "string"}, "1943-08-16": {"type": "string"}, "1973-05-22": {"type": "string"}, "1973-06-05": {"type": "string"}}, "required": ["1939-09-02", "1939-09-12", "1940-03-23", "1940-04-03", "1940-05-18", "1940-05-30", "1943-07-30", "1943-08-16", "1973-05-22", "1973-06-05"]}, "lyID": {"type": "string"}}, "required": ["name", "history", "lyID"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : [{"name" : "\u7bc0\u7d04\u5efa\u570b\u5132\u84c4\u5238\u689d\u4f8b", "start_date" : "1939-09-02"}], "history" : {"1939-09-02" : "\u5236\u5b9a12\u689d", "1939-09-12" : "\u516c\u5e03", "1940-03-23" : "\u4fee\u6b63\u7b2c6\u689d", "1940-04-03" : "\u516c\u5e03", "1940-05-18" : "\u4fee\u6b63\u7b2c4\u689d", "1940-05-30" : "\u516c\u5e03", "1943-07-30" : "\u4fee\u6b63\u7b2c3, 4, 5, 6, 10\u689d", "1943-08-16" : "\u516c\u5e03", "1973-05-22" : "\u7acb\u6cd5\u9662\u901a\u904e\u505c\u6b62\u9069\u7528", "1973-06-05" : "\u516c\u5e03"}, "lyID" : "90206"}
json_instruct
{"type": "object", "properties": {"name": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "start_date": {"type": "string"}}, "required": ["name", "start_date"]}}, "history": {"type": "object", "properties": {"1939-09-02": {"type": "string"}, "1939-09-12": {"type": "string"}, "1940-03-23": {"type": "string"}, "1940-04-03": {"type": "string"}, "1940-05-18": {"type": "string"}, "1940-05-30": {"type": "string"}, "1943-07-30": {"type": "string"}, "1943-08-16": {"type": "string"}, "1973-05-22": {"type": "string"}, "1973-06-05": {"type": "string"}}, "required": ["1939-09-02", "1939-09-12", "1940-03-23", "1940-04-03", "1940-05-18", "1940-05-30", "1943-07-30", "1943-08-16", "1973-05-22", "1973-06-05"]}, "lyID": {"type": "string"}}, "required": ["name", "history", "lyID"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"510112001": {"type": "string"}, "510112002": {"type": "string"}, "510112003": {"type": "string"}, "510112004": {"type": "string"}, "510112102": {"type": "string"}, "510112104": {"type": "string"}, "510112108": {"type": "string"}, "510112109": {"type": "string"}, "510112110": {"type": "string"}, "510112111": {"type": "string"}, "510112115": {"type": "string"}, "510112200": {"type": "string"}}, "required": ["510112001", "510112002", "510112003", "510112004", "510112102", "510112104", "510112108", "510112109", "510112110", "510112111", "510112115", "510112200"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"510112001" : "\u9f99\u6cc9\u8857\u9053", "510112002" : "\u5927\u9762\u8857\u9053", "510112003" : "\u5341\u9675\u8857\u9053", "510112004" : "\u540c\u5b89\u8857\u9053", "510112102" : "\u6d1b\u5e26\u9547", "510112104" : "\u897f\u6cb3\u9547", "510112108" : "\u6d2a\u5b89\u9547", "510112109" : "\u67cf\u5408\u9547", "510112110" : "\u8336\u5e97\u9547", "510112111" : "\u9ec4\u571f\u9547", "510112115" : "\u5c71\u6cc9\u9547", "510112200" : "\u4e07\u5174\u4e61"}
json_instruct
{"type": "object", "properties": {"510112001": {"type": "string"}, "510112002": {"type": "string"}, "510112003": {"type": "string"}, "510112004": {"type": "string"}, "510112102": {"type": "string"}, "510112104": {"type": "string"}, "510112108": {"type": "string"}, "510112109": {"type": "string"}, "510112110": {"type": "string"}, "510112111": {"type": "string"}, "510112115": {"type": "string"}, "510112200": {"type": "string"}}, "required": ["510112001", "510112002", "510112003", "510112004", "510112102", "510112104", "510112108", "510112109", "510112110", "510112111", "510112115", "510112200"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"id": {"type": "integer"}, "group": {"type": "string"}, "joblink": {"type": "boolean"}, "name": {"type": "string"}, "potential": {"type": "integer"}, "skills": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "skill": {"type": "string"}, "replaceable": {"type": "boolean"}}, "required": ["id", "skill", "replaceable"]}}}, "required": ["id", "group", "joblink", "name", "potential", "skills"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 10026, "group" : "63132102", "joblink" : true, "name" : "Guest-Relations-Manager/in", "potential" : 0, "skills" : [{"id" : 62850, "skill" : "VIP-Betreuung", "replaceable" : false}, {"id" : 62945, "skill" : "G\u00e4stebetreuung", "replaceable" : false}]}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "group": {"type": "string"}, "joblink": {"type": "boolean"}, "name": {"type": "string"}, "potential": {"type": "integer"}, "skills": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "skill": {"type": "string"}, "replaceable": {"type": "boolean"}}, "required": ["id", "skill", "replaceable"]}}}, "required": ["id", "group", "joblink", "name", "potential", "skills"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"champ": {"type": "integer"}, "item": {"type": "integer"}, "kills": {"type": "string"}, "deaths": {"type": "string"}, "assists": {"type": "string"}, "gold": {"type": "string"}, "cs": {"type": "string"}, "total": {"type": "string"}, "wins": {"type": "string"}, "losses": {"type": "string"}}, "required": ["champ", "item", "kills", "deaths", "assists", "gold", "cs", "total", "wins", "losses"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"champ" : 114, "item" : 3150, "kills" : "11.241379310344827", "deaths" : "7.655172413793103", "assists" : "5.137931034482759", "gold" : "13153.48275862069", "cs" : "157.17241379310346", "total" : "29", "wins" : "16", "losses" : "13"}
json_instruct
{"type": "object", "properties": {"champ": {"type": "integer"}, "item": {"type": "integer"}, "kills": {"type": "string"}, "deaths": {"type": "string"}, "assists": {"type": "string"}, "gold": {"type": "string"}, "cs": {"type": "string"}, "total": {"type": "string"}, "wins": {"type": "string"}, "losses": {"type": "string"}}, "required": ["champ", "item", "kills", "deaths", "assists", "gold", "cs", "total", "wins", "losses"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01033352": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01033352"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Topology", "objects" : {"E01033352" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00174225", "LAD11CD" : "E06000023"}, "arcs" : [[0, 1, 2, 3, 4]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00174232", "LAD11CD" : "E06000023"}, "arcs" : [[5, 6, 7, -2, 8, 9]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00174248", "LAD11CD" : "E06000023"}, "arcs" : [[10, -4]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00174288", "LAD11CD" : "E06000023"}, "arcs" : [[11, -9, -1, 12]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00174300", "LAD11CD" : "E06000023"}, "arcs" : [[13, -6]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00174301", "LAD11CD" : "E06000023"}, "arcs" : [[-7, -14, -10, -12, 14]]}]}}, "arcs" : [[[6194, 6982], [-1827, -921], [-707, 471]], [[3660, 6532], [-326, -48], [-1467, 1225]], [[1867, 7709], [-431, 617], [-148, 587], [920, -405], [992, 491]], [[3200, 8999], [842, 306]], [[4042, 9305], [267, -632], [-481, -297], [159, -420], [1654, -250], [321, -416], [232, -308]], [[2162, 5500], [453, 355], [3, 504], [-454, 90], [-495, -290]], [[1669, 6159], [-679, 540]], [[990, 6699], [877, 1010]], [[3660, 6532], [218, -631], [-235, -391], [-1229, -395]], [[2414, 5115], [-252, 385]], [[3200, 8999], [-586, 249], [1044, 751], [384, -694]], [[1778, 4756], [636, 359]], [[6194, 6982], [529, -678], [2315, 1123], [608, -226], [353, -224], [-1046, -854], [704, -997], [-1067, -798], [-1131, -326], [1023, -4002], [-1881, 90], [-2512, 656], [-19, 1813], [-2292, 2197]], [[2162, 5500], [-836, 57], [343, 602]], [[1778, 4756], [-1778, 875], [373, 279], [617, 789]]], "transform" : {"scale" : [1.3792548768556723e-06, 1.1355210953957884e-06], "translate" : [-2.581114239658985, 51.44618430406009]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01033352": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01033352"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"render": {"type": "string"}, "edit": {"type": "string"}}, "required": ["render", "edit"]}, "devDependencies": {"type": "object", "properties": {"lerna": {"type": "string"}, "spec-up": {"type": "string"}}, "required": ["lerna", "spec-up"]}}, "required": ["name", "private", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "root", "private" : true, "scripts" : {"render" : "node -e \"require('spec-up')({ nowatch: true })\"", "edit" : "node -e \"require('spec-up')()\""}, "devDependencies" : {"lerna" : "^3.22.1", "spec-up" : "0.10.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"render": {"type": "string"}, "edit": {"type": "string"}}, "required": ["render", "edit"]}, "devDependencies": {"type": "object", "properties": {"lerna": {"type": "string"}, "spec-up": {"type": "string"}}, "required": ["lerna", "spec-up"]}}, "required": ["name", "private", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Batch Bayesian Optimization via Simulation Matching.", "fields" : ["mathematical optimization", "bayesian optimization", "exploit", "artificial intelligence", "machine learning"], "abstract" : "Bayesian optimization methods are often used to optimize unknown functions that are costly to evaluate. Typically, these methods sequentially select inputs to be evaluated one at a time based on a posterior over the unknown function that is updated after each evaluation. In many applications, however, it is desirable to perform multiple evaluations in parallel, which requires selecting batches of multiple inputs to evaluate at once. In this paper, we propose a novel approach to batch Bayesian optimization, providing a policy for selecting batches of inputs with the goal of optimizing the function as efficiently as possible. The key idea is to exploit the availability of high-quality and efficient sequential policies, by using Monte-Carlo simulation to select input batches that closely match their expected behavior. Our experimental results on six benchmarks show that the proposed approach significantly outperforms two baselines and can lead to large advantages over a top sequential approach in terms of performance per unit time.", "citation" : "Citations (54)", "departments" : ["Oregon State University", "Oregon State University", "Oregon State University"], "authors" : ["Javad Azimi.....http://dblp.org/pers/hd/a/Azimi:Javad", "Alan Fern.....http://dblp.org/pers/hd/f/Fern:Alan", "Xiaoli Z. Fern.....http://dblp.org/pers/hd/f/Fern:Xiaoli_Z="], "conf" : "nips", "year" : "2010", "pages" : 9}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"adv_t": {"type": "array", "items": {"type": "integer"}}, "adv_w": {"type": "array", "items": {"type": "integer"}}, "clfs": {"type": "array", "items": {"type": "string"}}, "mean": {"type": "array", "items": {"type": "number"}}, "parameters": {"type": "object", "properties": {"cv_method": {"type": "string"}, "db": {"type": "string"}, "repetition": {"type": "integer"}}, "required": ["cv_method", "db", "repetition"]}, "std": {"type": "array", "items": {"type": "number"}}}, "required": ["adv_t", "adv_w", "clfs", "mean", "parameters", "std"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"adv_t" : [0, 1, 1, 2, 0, 5], "adv_w" : [0, 1, 1, 2, 0, 5], "clfs" : ["Nearest Neighbors", "RBF SVM", "Decision Tree", "Random Forest", "Naive Bayes", "Linear SVM"], "mean" : [0.6768000000000001, 0.6998000000000001, 0.7098, 0.7130000000000001, 0.6869999999999999, 0.7525999999999999], "parameters" : {"cv_method" : "k2x5", "db" : "german", "repetition" : 2}, "std" : [0.019803478931182217, 0.0006324555320336764, 0.02768794362574118, 0.011244751862288653, 0.09633852350493605, 0.007890923055426822]}
json_instruct
{"type": "object", "properties": {"adv_t": {"type": "array", "items": {"type": "integer"}}, "adv_w": {"type": "array", "items": {"type": "integer"}}, "clfs": {"type": "array", "items": {"type": "string"}}, "mean": {"type": "array", "items": {"type": "number"}}, "parameters": {"type": "object", "properties": {"cv_method": {"type": "string"}, "db": {"type": "string"}, "repetition": {"type": "integer"}}, "required": ["cv_method", "db", "repetition"]}, "std": {"type": "array", "items": {"type": "number"}}}, "required": ["adv_t", "adv_w", "clfs", "mean", "parameters", "std"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"xbox": {"type": "integer"}, "ps": {"type": "integer"}}, "required": ["xbox", "ps"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"xbox" : 39657, "ps" : 6}
json_instruct
{"type": "object", "properties": {"xbox": {"type": "integer"}, "ps": {"type": "integer"}}, "required": ["xbox", "ps"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"dependencies": {"type": "object", "properties": {"@types/request": {"type": "string"}, "request": {"type": "string"}}, "required": ["@types/request", "request"]}}, "required": ["dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"dependencies" : {"@types/request" : "^2.48.5", "request" : "^2.88.2"}}
json_instruct
{"type": "object", "properties": {"dependencies": {"type": "object", "properties": {"@types/request": {"type": "string"}, "request": {"type": "string"}}, "required": ["@types/request", "request"]}}, "required": ["dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 21360, "cartId" : "d68a3745-2c7b-44ad-a83c-5b3f9bc0d711", "preferredProducts" : [702, 3787, 772], "productReviews" : [{"productId" : 1899, "reviewText" : "this Tasty Plastic Tuna is honest.", "reviewDate" : "2017-12-21T12:55:55.0442657+02:00"}, {"productId" : 2842, "reviewText" : "This experiences works outstandingly well. It beautifully improves my basketball by a lot.", "reviewDate" : "2018-05-08T16:27:53.5890836+03:00"}, {"productId" : 4820, "reviewText" : "this Circle is flirty.", "reviewDate" : "2019-04-27T02:33:24.6349388+03:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"q": {"type": "string"}, "from": {"type": "integer"}, "to": {"type": "integer"}, "params": {"type": "object", "properties": {"sane": {"type": "array", "items": {}}, "q": {"type": "array", "items": {"type": "string"}}, "app_key": {"type": "array", "items": {"type": "string"}}, "to": {"type": "array", "items": {"type": "string"}}, "app_id": {"type": "array", "items": {"type": "string"}}}, "required": ["sane", "q", "app_key", "to", "app_id"]}, "more": {"type": "boolean"}, "count": {"type": "integer"}, "hits": {"type": "array", "items": {"type": "object", "properties": {"recipe": {"type": "integer"}, "bookmarked": {"type": "boolean"}, "bought": {"type": "boolean"}}, "required": ["recipe", "bookmarked", "bought"]}}}, "required": ["q", "from", "to", "params", "more", "count", "hits"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"q" : "pasta cheese tomato", "from" : 0, "to" : 1, "params" : {"sane" : [], "q" : ["pasta cheese tomato"], "app_key" : ["58fb0a71d4b3042d003fa99123a86f75"], "to" : ["1"], "app_id" : ["7ba6f788"]}, "more" : true, "count" : 9057, "hits" : [{"recipe" : 12, "bookmarked" : false, "bought" : false}]}
json_instruct
{"type": "object", "properties": {"q": {"type": "string"}, "from": {"type": "integer"}, "to": {"type": "integer"}, "params": {"type": "object", "properties": {"sane": {"type": "array", "items": {}}, "q": {"type": "array", "items": {"type": "string"}}, "app_key": {"type": "array", "items": {"type": "string"}}, "to": {"type": "array", "items": {"type": "string"}}, "app_id": {"type": "array", "items": {"type": "string"}}}, "required": ["sane", "q", "app_key", "to", "app_id"]}, "more": {"type": "boolean"}, "count": {"type": "integer"}, "hits": {"type": "array", "items": {"type": "object", "properties": {"recipe": {"type": "integer"}, "bookmarked": {"type": "boolean"}, "bought": {"type": "boolean"}}, "required": ["recipe", "bookmarked", "bought"]}}}, "required": ["q", "from", "to", "params", "more", "count", "hits"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 51027, "cartId" : "11844bfd-b2d6-4d63-bcb9-1f0c2cb3e09c", "preferredProducts" : [305, 859], "productReviews" : [{"productId" : 3595, "reviewText" : "It only works when I'm Niger.", "reviewDate" : "2016-08-27T19:31:33.8530453+03:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"debug_keystore": {"type": "object", "properties": {"autodeps": {"type": "boolean"}, "buck.base_path": {"type": "string"}, "buck.type": {"type": "string"}, "deps": {"type": "array", "items": {}}, "licenses": {"type": "array", "items": {}}, "name": {"type": "string"}, "properties": {"type": "string"}, "store": {"type": "string"}, "visibility": {"type": "array", "items": {}}}, "required": ["autodeps", "buck.base_path", "buck.type", "deps", "licenses", "name", "properties", "store", "visibility"]}, "example": {"type": "object", "properties": {"autodeps": {"type": "boolean"}, "bash": {"type": "string"}, "buck.base_path": {"type": "string"}, "buck.type": {"type": "string"}, "cmd": {"type": "null"}, "cmdExe": {"type": "null"}, "executable": {"type": "null"}, "licenses": {"type": "array", "items": {}}, "name": {"type": "string"}, "out": {"type": "string"}, "srcs": {"type": "array", "items": {"type": "string"}}, "tests": {"type": "array", "items": {}}, "visibility": {"type": "array", "items": {"type": "string"}}}, "required": ["autodeps", "bash", "buck.base_path", "buck.type", "cmd", "cmdExe", "executable", "licenses", "name", "out", "srcs", "tests", "visibility"]}}, "required": ["debug_keystore", "example"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"debug_keystore" : {"autodeps" : false, "buck.base_path" : "example", "buck.type" : "keystore", "deps" : [], "licenses" : [], "name" : "debug_keystore", "properties" : "debug.keystore.properties", "store" : "debug.keystore", "visibility" : []}, "example" : {"autodeps" : false, "bash" : "cat $SRCS > $OUT", "buck.base_path" : "example", "buck.type" : "genrule", "cmd" : null, "cmdExe" : null, "executable" : null, "licenses" : [], "name" : "example", "out" : "baz.txt", "srcs" : ["foo.txt", "bar.txt", "//fake:rule"], "tests" : [], "visibility" : ["PUBLIC"]}}
json_instruct
{"type": "object", "properties": {"debug_keystore": {"type": "object", "properties": {"autodeps": {"type": "boolean"}, "buck.base_path": {"type": "string"}, "buck.type": {"type": "string"}, "deps": {"type": "array", "items": {}}, "licenses": {"type": "array", "items": {}}, "name": {"type": "string"}, "properties": {"type": "string"}, "store": {"type": "string"}, "visibility": {"type": "array", "items": {}}}, "required": ["autodeps", "buck.base_path", "buck.type", "deps", "licenses", "name", "properties", "store", "visibility"]}, "example": {"type": "object", "properties": {"autodeps": {"type": "boolean"}, "bash": {"type": "string"}, "buck.base_path": {"type": "string"}, "buck.type": {"type": "string"}, "cmd": {"type": "null"}, "cmdExe": {"type": "null"}, "executable": {"type": "null"}, "licenses": {"type": "array", "items": {}}, "name": {"type": "string"}, "out": {"type": "string"}, "srcs": {"type": "array", "items": {"type": "string"}}, "tests": {"type": "array", "items": {}}, "visibility": {"type": "array", "items": {"type": "string"}}}, "required": ["autodeps", "bash", "buck.base_path", "buck.type", "cmd", "cmdExe", "executable", "licenses", "name", "out", "srcs", "tests", "visibility"]}}, "required": ["debug_keystore", "example"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"lastUpdated": {"type": "string"}}, "required": ["lastUpdated"]}, "url": {"type": "string"}, "status": {"type": "string"}, "experimental": {"type": "boolean"}, "stringency": {"type": "string"}, "element": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "path": {"type": "string"}, "short": {"type": "string"}, "definition": {"type": "string"}, "comment": {"type": "string"}, "min": {"type": "integer"}, "max": {"type": "string"}, "type": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}}, "required": ["code"]}}, "meaningWhenMissing": {"type": "string"}, "isSummary": {"type": "boolean"}, "binding": {"type": "object", "properties": {"extension": {"type": "array", "items": {"type": "object", "properties": {"url": {"type": "string"}, "valueString": {"type": "string"}}, "required": ["url", "valueString"]}}, "strength": {"type": "string"}, "description": {"type": "string"}, "valueSetReference": {"type": "object", "properties": {"reference": {"type": "string"}}, "required": ["reference"]}}, "required": ["extension", "strength", "description", "valueSetReference"]}}, "required": ["id", "path", "short", "definition", "comment", "min", "max", "type", "meaningWhenMissing", "isSummary", "binding"]}}}, "required": ["resourceType", "id", "meta", "url", "status", "experimental", "stringency", "element"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"resourceType" : "DataElement", "id" : "Consent.except.action", "meta" : {"lastUpdated" : "2019-10-24T11:53:00+11:00"}, "url" : "http://hl7.org/fhir/DataElement/Consent.except.action", "status" : "draft", "experimental" : true, "stringency" : "fully-specified", "element" : [{"id" : "Consent.except.action", "path" : "Consent.except.action", "short" : "Actions controlled by this exception", "definition" : "Actions controlled by this Exception.", "comment" : "Note that this is the direct action (not the grounds for the action covered in the purpose element). At present, the only action in the understood and tested scope of this resource is 'read'.", "min" : 0, "max" : "*", "type" : [{"code" : "CodeableConcept"}], "meaningWhenMissing" : "all actions", "isSummary" : true, "binding" : {"extension" : [{"url" : "http://hl7.org/fhir/StructureDefinition/elementdefinition-bindingName", "valueString" : "ConsentAction"}], "strength" : "example", "description" : "Detailed codes for the consent action.", "valueSetReference" : {"reference" : "http://hl7.org/fhir/ValueSet/consent-action"}}}]}
json_instruct
{"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"lastUpdated": {"type": "string"}}, "required": ["lastUpdated"]}, "url": {"type": "string"}, "status": {"type": "string"}, "experimental": {"type": "boolean"}, "stringency": {"type": "string"}, "element": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "path": {"type": "string"}, "short": {"type": "string"}, "definition": {"type": "string"}, "comment": {"type": "string"}, "min": {"type": "integer"}, "max": {"type": "string"}, "type": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}}, "required": ["code"]}}, "meaningWhenMissing": {"type": "string"}, "isSummary": {"type": "boolean"}, "binding": {"type": "object", "properties": {"extension": {"type": "array", "items": {"type": "object", "properties": {"url": {"type": "string"}, "valueString": {"type": "string"}}, "required": ["url", "valueString"]}}, "strength": {"type": "string"}, "description": {"type": "string"}, "valueSetReference": {"type": "object", "properties": {"reference": {"type": "string"}}, "required": ["reference"]}}, "required": ["extension", "strength", "description", "valueSetReference"]}}, "required": ["id", "path", "short", "definition", "comment", "min", "max", "type", "meaningWhenMissing", "isSummary", "binding"]}}}, "required": ["resourceType", "id", "meta", "url", "status", "experimental", "stringency", "element"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"localities": {"type": "array", "items": {"type": "string"}}, "state": {"type": "string"}, "postal_code": {"type": "string"}, "locality": {"type": "string"}, "lat": {"type": "number"}, "region": {"type": "object", "properties": {"fips": {"type": "string"}, "abbr": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "abbr", "name"]}, "city": {"type": "string"}, "type": {"type": "string"}, "lng": {"type": "number"}, "counties": {"type": "array", "items": {"type": "object", "properties": {"fips": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "name"]}}}, "required": ["localities", "state", "postal_code", "locality", "lat", "region", "city", "type", "lng", "counties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"localities" : ["Monument, KS", "Russell Spg, KS", "Russell Spgs, KS", "Winona, KS", "Russell Springs, KS"], "state" : "KS", "postal_code" : "67764", "locality" : "Winona, KS", "lat" : 38.926382, "region" : {"fips" : "20", "abbr" : "KS", "name" : "Kansas"}, "city" : "Winona", "type" : "STANDARD", "lng" : -101.209985, "counties" : [{"fips" : "109", "name" : "Logan County"}, {"fips" : "193", "name" : "Thomas County"}]}
json_instruct
{"type": "object", "properties": {"localities": {"type": "array", "items": {"type": "string"}}, "state": {"type": "string"}, "postal_code": {"type": "string"}, "locality": {"type": "string"}, "lat": {"type": "number"}, "region": {"type": "object", "properties": {"fips": {"type": "string"}, "abbr": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "abbr", "name"]}, "city": {"type": "string"}, "type": {"type": "string"}, "lng": {"type": "number"}, "counties": {"type": "array", "items": {"type": "object", "properties": {"fips": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "name"]}}}, "required": ["localities", "state", "postal_code", "locality", "lat", "region", "city", "type", "lng", "counties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"id": {"type": "string"}, "originalId": {"type": "integer"}, "rarity": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "energy": {"type": "integer"}, "exp": {"type": "integer"}, "category": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "category": {"type": "string"}}, "required": ["id", "category"]}}, "recipe": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "amount": {"type": "integer"}}, "required": ["id", "name", "amount"]}}}, "required": ["id", "originalId", "rarity", "name", "description", "energy", "exp", "category", "recipe"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "checkered_cedar_ceiling", "originalId" : 360301, "rarity" : 3, "name" : "Checkered Cedar Ceiling", "description" : "A wooden ceiling made from fragrant cedar. Simple and lovely, it is a great match with furniture of all kinds.\\nThe main use of ceilings is to catch the dust that falls from the beams and other structures, and thus they have also gained the moniker \"Dust Bearers.\"\\nThey say that such honorific nicknames are given to many other things in Liyue: curtains, tables, chairs, table, and even Mora.", "energy" : 30, "exp" : 60, "category" : [{"id" : 1003, "category" : "Ceiling"}], "recipe" : [{"id" : "fragrant_cedar_wood", "name" : "Fragrant Cedar Wood", "amount" : 4}, {"id" : "blue_dye", "name" : "Blue Dye", "amount" : 4}, {"id" : "red_dye", "name" : "Red Dye", "amount" : 4}]}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "originalId": {"type": "integer"}, "rarity": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "energy": {"type": "integer"}, "exp": {"type": "integer"}, "category": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "category": {"type": "string"}}, "required": ["id", "category"]}}, "recipe": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "amount": {"type": "integer"}}, "required": ["id", "name", "amount"]}}}, "required": ["id", "originalId", "rarity", "name", "description", "energy", "exp", "category", "recipe"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"owner": {"type": "string"}, "repo": {"type": "string"}, "rev": {"type": "string"}, "sha256": {"type": "string"}}, "required": ["owner", "repo", "rev", "sha256"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"owner" : "obsidiansystems", "repo" : "reflex-project-skeleton", "rev" : "30d29322d74e98d189b755c3d25fffecfee32fe1", "sha256" : "14vcmi3bdmlcj228wj0hzjyqmixyfrd0ch8qzp2655kzik7dbgga"}
json_instruct
{"type": "object", "properties": {"owner": {"type": "string"}, "repo": {"type": "string"}, "rev": {"type": "string"}, "sha256": {"type": "string"}}, "required": ["owner", "repo", "rev", "sha256"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "main": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "author", "license", "main", "files"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "tsconfig", "version" : "0.0.0", "author" : "xandjiji <xandjiji@gmail.com>", "license" : "Unlicense", "main" : "index.js", "files" : ["base.json", "react.json"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "main": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "author", "license", "main", "files"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "url": {"type": "string"}}, "required": ["name", "email", "url"]}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "string"}, "homepage": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}}, "required": ["build"]}, "dependencies": {"type": "object", "properties": {"bootstrap": {"type": "string"}, "lodash": {"type": "string"}}, "required": ["bootstrap", "lodash"]}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-bumpup": {"type": "string"}, "grunt-cli": {"type": "string"}, "grunt-contrib-clean": {"type": "string"}, "grunt-contrib-compress": {"type": "string"}, "grunt-contrib-concat": {"type": "string"}, "grunt-contrib-copy": {"type": "string"}, "grunt-contrib-cssmin": {"type": "string"}, "grunt-contrib-htmlmin": {"type": "string"}, "grunt-contrib-uglify": {"type": "string"}, "grunt-contrib-watch": {"type": "string"}, "grunt-dev-update": {"type": "string"}, "grunt-injector": {"type": "string"}, "load-grunt-tasks": {"type": "string"}}, "required": ["grunt", "grunt-bumpup", "grunt-cli", "grunt-contrib-clean", "grunt-contrib-compress", "grunt-contrib-concat", "grunt-contrib-copy", "grunt-contrib-cssmin", "grunt-contrib-htmlmin", "grunt-contrib-uglify", "grunt-contrib-watch", "grunt-dev-update", "grunt-injector", "load-grunt-tasks"]}}, "required": ["name", "version", "private", "license", "author", "description", "repository", "bugs", "homepage", "scripts", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Pirateer", "version" : "0.7.1", "private" : true, "license" : "BSD-3-Clause", "author" : {"name" : "Gilad Peleg", "email" : "giladp007@gmail.com", "url" : "https://github.com/pgilad"}, "description" : "Pirateer is a Chrome Extension that adds IMDb ratings to TV shows and movies on The Pirate Bay", "repository" : {"type" : "git", "url" : "https://github.com/pgilad/pirateer.git"}, "bugs" : "https://github.com/pgilad/pirateer/issues", "homepage" : "https://chrome.google.com/webstore/detail/pirateer/dleipnbkaniagkflpbhloiadkdooaacd", "scripts" : {"build" : "grunt build"}, "dependencies" : {"bootstrap" : "3.3.7", "lodash" : "^4.17.14"}, "devDependencies" : {"grunt" : "~0.4.1", "grunt-bumpup" : "^0.5.2", "grunt-cli" : "1.2.0", "grunt-contrib-clean" : "~0.5.0", "grunt-contrib-compress" : "^0.8.0", "grunt-contrib-concat" : "^0.4.0", "grunt-contrib-copy" : "^0.5.0", "grunt-contrib-cssmin" : "^0.9.0", "grunt-contrib-htmlmin" : "^0.2.0", "grunt-contrib-uglify" : "^0.4.0", "grunt-contrib-watch" : "^0.6.1", "grunt-dev-update" : "^0.5.6", "grunt-injector" : "^0.5.2", "load-grunt-tasks" : "^0.4.0"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "url": {"type": "string"}}, "required": ["name", "email", "url"]}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "string"}, "homepage": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}}, "required": ["build"]}, "dependencies": {"type": "object", "properties": {"bootstrap": {"type": "string"}, "lodash": {"type": "string"}}, "required": ["bootstrap", "lodash"]}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-bumpup": {"type": "string"}, "grunt-cli": {"type": "string"}, "grunt-contrib-clean": {"type": "string"}, "grunt-contrib-compress": {"type": "string"}, "grunt-contrib-concat": {"type": "string"}, "grunt-contrib-copy": {"type": "string"}, "grunt-contrib-cssmin": {"type": "string"}, "grunt-contrib-htmlmin": {"type": "string"}, "grunt-contrib-uglify": {"type": "string"}, "grunt-contrib-watch": {"type": "string"}, "grunt-dev-update": {"type": "string"}, "grunt-injector": {"type": "string"}, "load-grunt-tasks": {"type": "string"}}, "required": ["grunt", "grunt-bumpup", "grunt-cli", "grunt-contrib-clean", "grunt-contrib-compress", "grunt-contrib-concat", "grunt-contrib-copy", "grunt-contrib-cssmin", "grunt-contrib-htmlmin", "grunt-contrib-uglify", "grunt-contrib-watch", "grunt-dev-update", "grunt-injector", "load-grunt-tasks"]}}, "required": ["name", "version", "private", "license", "author", "description", "repository", "bugs", "homepage", "scripts", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "area": {"type": "string"}, "description": {"type": "string"}, "region": {"type": "string"}, "sortorder": {"type": "integer"}}, "required": ["name", "area", "description", "region", "sortorder"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Desa Penduduk Bawah Laut", "area" : "Bourou Village", "description" : "Sebuah desa tua di Pulau Watatsumi. Menurut legenda, leluhur penduduk desa ini berasal dari dasar laut.\nTempat ini merupakan tempat perkumpulan penting bagi mereka yang menentang Dekrit Perburuan Vision.", "region" : "Inazuma", "sortorder" : 216}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "area": {"type": "string"}, "description": {"type": "string"}, "region": {"type": "string"}, "sortorder": {"type": "integer"}}, "required": ["name", "area", "description", "region", "sortorder"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
[[1993, 5], [1994, 6], [1995, 6], [1998, 6], [1999, 10], [2000, 8], [2002, 11], [2003, 16], [2004, 21], [2005, 19], [2006, 19], [2007, 22], [2008, 26], [2009, 24], [2010, 25], [2011, 21], [2012, 27], [2013, 31], [2014, 20]]
json_instruct
{"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "d1008-67", "text" : "(Note to the Board* This should be considered confidential., for your own\nuse onlyo TtTs~an exact carbon of the letter7 io which only this note has\nbeen added*)\nHo SR*\nSeptember 22, 1955\nDr* Maurice F. Secy, Director\nDivision of Education\nWo K\u00ab Kellogg Foundation\nBattle Creek, Michigan\nDear Maurice:\nHerewith the supplementary material and statements you requested\nin your letter of June 30, as additional background for our request of May 26\nto the Wo K# Kellogg Foundation*\nSpecifically this statement covers the final two items you requested:\nNAEB plane to take over various functions heretofore Foundation- supports d and\nplans for increasing the regular and stable sources of income of the Associa\u00ac\ntion*\nDuring the past several months the Presidents and Board Chairmen\nof the various groups primarily concerned with educational broadcasting ^The\nAmerican Council on Education (ACE)$ the Educational Television and Radio\nCenter (ETRC); the Joint Committee on Educational Television (JCET)j the\nNAEBj and the National Citizens Committee for Educational Television (NCCSTJJ\nhave been holding regular meetings to plan the phasing out of some of these\norganizations, and the reduction in the budgets and overlapping activities\nof others. Both of these steps will of course result in the need for the\nNAEB to assume an increasing share of the total responsibility in the educe\u00ae\ntlonal communications structure of the nation*"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "text": {"type": "object", "properties": {"status": {"type": "string"}, "div": {"type": "string"}}, "required": ["status", "div"]}, "status": {"type": "string"}, "code": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}, "subject": {"type": "object", "properties": {"reference": {"type": "string"}, "display": {"type": "string"}}, "required": ["reference", "display"]}, "issued": {"type": "string"}, "performer": {"type": "array", "items": {"type": "object", "properties": {"reference": {"type": "string"}, "display": {"type": "string"}}, "required": ["reference", "display"]}}, "comment": {"type": "string"}, "related": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "target": {"type": "object", "properties": {"reference": {"type": "string"}, "display": {"type": "string"}}, "required": ["reference", "display"]}}, "required": ["type", "target"]}}}, "required": ["resourceType", "id", "text", "status", "code", "subject", "issued", "performer", "comment", "related"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"resourceType" : "Observation", "id" : "example-observation-genetics-3", "text" : {"status" : "generated", "div" : "<div><p><b>Generated Narrative with Details</b></p><p><b>id</b>: example-observation-genetics-3</p><p><b>status</b>: final</p><p><b>code</b>: Further analysis <span>(Details )</span></p><p><b>subject</b>: <a>Molecular Lab Patient ID: HOSP-23456</a></p><p><b>issued</b>: 03/04/2013 3:30:10 PM</p><p><b>performer</b>: <a>Sequence Analysis Laboratory</a></p><p><b>comment</b>: The EGFR p.L858R mutation has been associated with response to anti-EGFR therapy</p><h3>Relateds</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>Target</b></td></tr><tr><td>*</td><td>derived-from</td><td><a>ObservationForGenetics profile example 1</a></td></tr></table></div>"}, "status" : "final", "code" : {"text" : "Further analysis"}, "subject" : {"reference" : "Patient/example-genetics-somatic", "display" : "Molecular Lab Patient ID: HOSP-23456"}, "issued" : "2013-04-03T15:30:10+01:00", "performer" : [{"reference" : "Practitioner/example", "display" : "Sequence Analysis Laboratory"}], "comment" : "The EGFR p.L858R mutation has been associated with response to anti-EGFR therapy", "related" : [{"type" : "derived-from", "target" : {"reference" : "Observation/example-observation-genetics-1", "display" : "ObservationForGenetics profile example 1"}}]}
json_instruct
{"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "text": {"type": "object", "properties": {"status": {"type": "string"}, "div": {"type": "string"}}, "required": ["status", "div"]}, "status": {"type": "string"}, "code": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}, "subject": {"type": "object", "properties": {"reference": {"type": "string"}, "display": {"type": "string"}}, "required": ["reference", "display"]}, "issued": {"type": "string"}, "performer": {"type": "array", "items": {"type": "object", "properties": {"reference": {"type": "string"}, "display": {"type": "string"}}, "required": ["reference", "display"]}}, "comment": {"type": "string"}, "related": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "target": {"type": "object", "properties": {"reference": {"type": "string"}, "display": {"type": "string"}}, "required": ["reference", "display"]}}, "required": ["type", "target"]}}}, "required": ["resourceType", "id", "text", "status", "code", "subject", "issued", "performer", "comment", "related"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}}, "required": ["start", "build"]}, "dependencies": {"type": "object", "properties": {"@elastic/ecs-winston-format": {"type": "string"}, "@zakku/winston-logs": {"type": "string"}, "chokidar": {"type": "string"}, "discord.js": {"type": "string"}, "glob": {"type": "string"}, "winston": {"type": "string"}}, "required": ["@elastic/ecs-winston-format", "@zakku/winston-logs", "chokidar", "discord.js", "glob", "winston"]}, "devDependencies": {"type": "object", "properties": {"@types/glob": {"type": "string"}, "@types/node": {"type": "string"}, "ts-node": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/glob", "@types/node", "ts-node", "typescript"]}}, "required": ["name", "version", "main", "author", "license", "private", "scripts", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "tron3", "version" : "1.0.0", "main" : "src/index.ts", "author" : "Krzysztof Saczuk <zakuciael@outlook.com>", "license" : "MIT", "private" : true, "scripts" : {"start" : "ts-node src/index.ts", "build" : "tsc -p tsconfig.json"}, "dependencies" : {"@elastic/ecs-winston-format" : "^1.1.0", "@zakku/winston-logs" : "^1.0.6", "chokidar" : "^3.4.2", "discord.js" : "^12.3.1", "glob" : "^7.1.6", "winston" : "^3.3.3"}, "devDependencies" : {"@types/glob" : "^7.1.3", "@types/node" : "^14.6.2", "ts-node" : "^9.0.0", "typescript" : "^4.0.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}}, "required": ["start", "build"]}, "dependencies": {"type": "object", "properties": {"@elastic/ecs-winston-format": {"type": "string"}, "@zakku/winston-logs": {"type": "string"}, "chokidar": {"type": "string"}, "discord.js": {"type": "string"}, "glob": {"type": "string"}, "winston": {"type": "string"}}, "required": ["@elastic/ecs-winston-format", "@zakku/winston-logs", "chokidar", "discord.js", "glob", "winston"]}, "devDependencies": {"type": "object", "properties": {"@types/glob": {"type": "string"}, "@types/node": {"type": "string"}, "ts-node": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/glob", "@types/node", "ts-node", "typescript"]}}, "required": ["name", "version", "main", "author", "license", "private", "scripts", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"babel-polyfill": {"type": "string"}, "babel-preset-es2015": {"type": "string"}, "babel-preset-stage-2": {"type": "string"}, "babel-preset-stage-3": {"type": "string"}, "babel-register": {"type": "string"}, "chai": {"type": "string"}, "chai-as-promised": {"type": "string"}, "chai-bignumber": {"type": "string"}, "coveralls": {"type": "string"}, "dotenv": {"type": "string"}, "eth-gas-reporter": {"type": "string"}, "ethereumjs-util": {"type": "string"}, "ethjs-abi": {"type": "string"}, "ganache-cli": {"type": "string"}, "openzeppelin-solidity": {"type": "string"}, "solc": {"type": "string"}, "solidity-coverage": {"type": "string"}, "solium": {"type": "string"}, "truffle": {"type": "string"}, "truffle-hdwallet-provider": {"type": "string"}, "web3": {"type": "string"}}, "required": ["babel-polyfill", "babel-preset-es2015", "babel-preset-stage-2", "babel-preset-stage-3", "babel-register", "chai", "chai-as-promised", "chai-bignumber", "coveralls", "dotenv", "eth-gas-reporter", "ethereumjs-util", "ethjs-abi", "ganache-cli", "openzeppelin-solidity", "solc", "solidity-coverage", "solium", "truffle", "truffle-hdwallet-provider", "web3"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "app", "version" : "1.0.0", "description" : "", "main" : "truffle-config.js", "scripts" : {"test" : "scripts/test.sh"}, "author" : "", "license" : "ISC", "devDependencies" : {"babel-polyfill" : "^6.23.0", "babel-preset-es2015" : "^6.18.0", "babel-preset-stage-2" : "^6.18.0", "babel-preset-stage-3" : "^6.17.0", "babel-register" : "^6.23.0", "chai" : "^4.0.2", "chai-as-promised" : "^7.0.0", "chai-bignumber" : "^2.0.0", "coveralls" : "^3.0.1", "dotenv" : "^5.0.1", "eth-gas-reporter" : "^0.1.7", "ethereumjs-util" : "^5.1.2", "ethjs-abi" : "^0.2.1", "ganache-cli" : "6.1.0", "openzeppelin-solidity" : "^1.12.0", "solc" : "^0.4.24", "solidity-coverage" : "^0.5.0", "solium" : "^1.1.6", "truffle" : "^4.1.12", "truffle-hdwallet-provider" : "0.0.5", "web3" : "^1.0.0-beta.35"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"babel-polyfill": {"type": "string"}, "babel-preset-es2015": {"type": "string"}, "babel-preset-stage-2": {"type": "string"}, "babel-preset-stage-3": {"type": "string"}, "babel-register": {"type": "string"}, "chai": {"type": "string"}, "chai-as-promised": {"type": "string"}, "chai-bignumber": {"type": "string"}, "coveralls": {"type": "string"}, "dotenv": {"type": "string"}, "eth-gas-reporter": {"type": "string"}, "ethereumjs-util": {"type": "string"}, "ethjs-abi": {"type": "string"}, "ganache-cli": {"type": "string"}, "openzeppelin-solidity": {"type": "string"}, "solc": {"type": "string"}, "solidity-coverage": {"type": "string"}, "solium": {"type": "string"}, "truffle": {"type": "string"}, "truffle-hdwallet-provider": {"type": "string"}, "web3": {"type": "string"}}, "required": ["babel-polyfill", "babel-preset-es2015", "babel-preset-stage-2", "babel-preset-stage-3", "babel-register", "chai", "chai-as-promised", "chai-bignumber", "coveralls", "dotenv", "eth-gas-reporter", "ethereumjs-util", "ethjs-abi", "ganache-cli", "openzeppelin-solidity", "solc", "solidity-coverage", "solium", "truffle", "truffle-hdwallet-provider", "web3"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "alt_name": {"type": "string"}, "country": {"type": "string"}, "state": {"type": "null"}, "address": {"type": "object", "properties": {"street": {"type": "string"}, "city": {"type": "string"}, "province": {"type": "null"}, "postal_code": {"type": "null"}}, "required": ["street", "city", "province", "postal_code"]}, "contact": {"type": "object", "properties": {"telephone": {"type": "string"}, "website": {"type": "string"}, "email": {"type": "string"}, "fax": {"type": "string"}}, "required": ["telephone", "website", "email", "fax"]}, "funding": {"type": "string"}, "languages": {"type": "null"}, "academic_year": {"type": "null"}, "accrediting_agency": {"type": "null"}}, "required": ["name", "alt_name", "country", "state", "address", "contact", "funding", "languages", "academic_year", "accrediting_agency"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "School of Accountancy and Finance", "alt_name" : "Ecole des hautes Etudes comptables et financi\u00e8res (HECF)", "country" : "Morocco", "state" : null, "address" : {"street" : "N\u00b0 6 Rue Abi Hamid Al ghazali, Agdal", "city" : "F\u00e8s", "province" : null, "postal_code" : null}, "contact" : {"telephone" : "+212(535) 94-21-73", "website" : "http://www.hecfsup.com", "email" : "hecf@hecfsup.com; moussa@hecfsup.com", "fax" : "+212(535) 94-21-89"}, "funding" : "Private", "languages" : null, "academic_year" : null, "accrediting_agency" : null}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "alt_name": {"type": "string"}, "country": {"type": "string"}, "state": {"type": "null"}, "address": {"type": "object", "properties": {"street": {"type": "string"}, "city": {"type": "string"}, "province": {"type": "null"}, "postal_code": {"type": "null"}}, "required": ["street", "city", "province", "postal_code"]}, "contact": {"type": "object", "properties": {"telephone": {"type": "string"}, "website": {"type": "string"}, "email": {"type": "string"}, "fax": {"type": "string"}}, "required": ["telephone", "website", "email", "fax"]}, "funding": {"type": "string"}, "languages": {"type": "null"}, "academic_year": {"type": "null"}, "accrediting_agency": {"type": "null"}}, "required": ["name", "alt_name", "country", "state", "address", "contact", "funding", "languages", "academic_year", "accrediting_agency"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"inferno-create-class.js": {"type": "string"}, "inferno-create-class.min.js": {"type": "string"}}, "required": ["inferno-create-class.js", "inferno-create-class.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"inferno-create-class.js" : "sha512-p9Fu70DtB9MTNURrLzMDpqcoa+jvhdUhlf6hBS275aR8KsdAziSQCYv8R0ZCMLmWE0/Cq7+Wz9RbsEhfQQsSog==", "inferno-create-class.min.js" : "sha512-3gAQCKGSYGOOLX7B7bW/NoRadc8Vx4d1E8OwM+E+Qu9EVypbtYwMn2XTbFzXwEZYJYFaw8Pm4LTbDmMOIGAd8Q=="}
json_instruct
{"type": "object", "properties": {"inferno-create-class.js": {"type": "string"}, "inferno-create-class.min.js": {"type": "string"}}, "required": ["inferno-create-class.js", "inferno-create-class.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"parent" : "conquest:block/old_blue_t_flange"}
json_instruct
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "object", "properties": {"Prenom": {"type": "string"}, "Nom": {"type": "string"}, "Age": {"type": "string"}}, "required": ["Prenom", "Nom", "Age"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"Prenom" : "John", "Nom" : "Doe", "Age" : "25"}, {"Prenom" : "Anna", "Nom" : "Smith", "Age" : "34"}, {"Prenom" : "Peter", "Nom" : "Jones", "Age" : "17"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"Prenom": {"type": "string"}, "Nom": {"type": "string"}, "Age": {"type": "string"}}, "required": ["Prenom", "Nom", "Age"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"\u5de5\u5ee0\u540d\u7a31" : "\u714c\u660e\u6a5f\u5668\u5de5\u696d\u80a1\u4efd\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f" : "99637699", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f" : "06810006223257", "\u5de5\u5ee0\u5730\u5740" : "\u81fa\u4e2d\u5e02\u70cf\u65e5\u5340\u524d\u7af9\u91cc\u5149\u660e\u8def\u4e00\u4e94\u4e03\u5df7\u516d\uff10\u865f", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc" : "\u81fa\u4e2d\u5e02\u70cf\u65e5\u5340\u524d\u7af9\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d" : "\u9673\u5fb7\u8d85", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f" : "52411594", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b" : "\u80a1\u4efd\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f" : "0681129", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f" : "0690204", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b" : "\u751f\u7522\u4e2d", "\u7522\u696d\u985e\u5225" : ["29\u6a5f\u68b0\u8a2d\u5099\u88fd\u9020\u696d"], "\u4e3b\u8981\u7522\u54c1" : ["293\u901a\u7528\u6a5f\u68b0\u8a2d\u5099"]}
json_instruct
{"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"status": {"type": "string"}, "annotations": {"type": "array", "items": {"type": "object", "properties": {"start": {"type": "integer"}, "end": {"type": "integer"}, "annotatedText": {"type": "string"}, "comment": {"type": "string"}, "page": {"type": "string"}, "selector": {"type": "string"}, "author": {"type": "string"}, "date": {"type": "string"}}, "required": ["start", "end", "annotatedText", "comment", "page", "selector", "author", "date"]}}}, "required": ["status", "annotations"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"status" : "200", "annotations" : [{"start" : 3, "end" : 31, "annotatedText" : "might already have an answer", "comment" : "Merhaba", "page" : "http://localhost:3000/faq", "selector" : "html > body > div > div.site-content > div.router-wrap > div.pageHeader.text-left > div.container > div.row > div.col-md-6. > p.wow.fadeIn ", "author" : "Serhat Uzun\u00e7avdar", "date" : "14 Mar 2019"}, {"start" : 0, "end" : 10, "annotatedText" : "Frequently", "comment" : "Selam", "page" : "http://localhost:3000/faq", "selector" : "html > body > div > div.site-content > div.router-wrap > main.page.content > div.container > div.row > div.col-md-12 > section.section.contentpage > div.contentpage-wrap.wrapper.narrow > div.contentpage-content > h1.content-title ", "author" : "Serhat Uzun\u00e7avdar", "date" : "14 Mar 2019"}]}
json_instruct
{"type": "object", "properties": {"status": {"type": "string"}, "annotations": {"type": "array", "items": {"type": "object", "properties": {"start": {"type": "integer"}, "end": {"type": "integer"}, "annotatedText": {"type": "string"}, "comment": {"type": "string"}, "page": {"type": "string"}, "selector": {"type": "string"}, "author": {"type": "string"}, "date": {"type": "string"}}, "required": ["start", "end", "annotatedText", "comment", "page", "selector", "author", "date"]}}}, "required": ["status", "annotations"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"redux-form.js": {"type": "string"}, "redux-form.min.js": {"type": "string"}}, "required": ["redux-form.js", "redux-form.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"redux-form.js" : "sha256-9cW/sk6ub9n4QViisMSU5Ny2GiwKIlA6WGzcNK5sxlo=", "redux-form.min.js" : "sha256-vyTQSsu6hgGDHC8W4bvAHiVRnip54QswadQrsXplPAs="}
json_instruct
{"type": "object", "properties": {"redux-form.js": {"type": "string"}, "redux-form.min.js": {"type": "string"}}, "required": ["redux-form.js", "redux-form.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"division": {"type": "string"}, "sortIndex": {"type": "integer"}, "lite": {"type": "boolean"}, "standard": {"type": "boolean"}, "userAgents": {"type": "array", "items": {"type": "object", "properties": {"userAgent": {"type": "string"}, "browser": {"type": "string"}, "properties": {"type": "object", "properties": {"Parent": {"type": "string"}, "Comment": {"type": "string"}}, "required": ["Parent", "Comment"]}, "children": {"type": "array", "items": {"type": "object", "properties": {"match": {"type": "string"}, "browser": {"type": "string"}}, "required": ["match", "browser"]}}}, "required": ["userAgent", "browser", "properties", "children"]}}}, "required": ["division", "sortIndex", "lite", "standard", "userAgents"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"division" : "Nutch", "sortIndex" : 291, "lite" : false, "standard" : true, "userAgents" : [{"userAgent" : "Nutch test crawler", "browser" : "nutch test crawler", "properties" : {"Parent" : "DefaultProperties", "Comment" : "Nutch test crawler"}, "children" : [{"match" : "Nutch test crawler/Nutch*", "browser" : "nutch test crawler"}, {"match" : "Mozilla/5.0 (*Windows NT 6.1*WOW64*) Gecko* Firefox/4.0*/Nutch*", "browser" : "nutch test crawler", "platforms" : ["Win7_64"]}]}]}
json_instruct
{"type": "object", "properties": {"division": {"type": "string"}, "sortIndex": {"type": "integer"}, "lite": {"type": "boolean"}, "standard": {"type": "boolean"}, "userAgents": {"type": "array", "items": {"type": "object", "properties": {"userAgent": {"type": "string"}, "browser": {"type": "string"}, "properties": {"type": "object", "properties": {"Parent": {"type": "string"}, "Comment": {"type": "string"}}, "required": ["Parent", "Comment"]}, "children": {"type": "array", "items": {"type": "object", "properties": {"match": {"type": "string"}, "browser": {"type": "string"}}, "required": ["match", "browser"]}}}, "required": ["userAgent", "browser", "properties", "children"]}}}, "required": ["division", "sortIndex", "lite", "standard", "userAgents"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"file": {"type": "string"}}, "required": ["file"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"file" : "C:/Users/fabio/fabio/Google Drive/RLBot/ArtAssets/Wintertide/Overlay/wintertide ingame overlay wins counters bo3 0.png"}
json_instruct
{"type": "object", "properties": {"file": {"type": "string"}}, "required": ["file"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"title": {"type": "string"}, "access_right": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "creators": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}}, "required": ["name", "type"]}}, "communities": {"type": "array", "items": {"type": "object", "properties": {"identifier": {"type": "string"}}, "required": ["identifier"]}}, "upload_type": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}, "required": ["title", "access_right", "keywords", "creators", "contributors", "communities", "upload_type", "description", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "CLDF dataset derived from Greenhill's \"TransNewGuinea.org\" from 2015", "access_right" : "open", "keywords" : ["cldf:Wordlist", "linguistics"], "creators" : [{"name" : "Simon J. Greenhill"}], "contributors" : [{"name" : "Robert Forkel", "type" : "Other"}, {"name" : "Tiago Tresoldi", "type" : "Other"}], "communities" : [{"identifier" : "lexibank"}], "upload_type" : "dataset", "description" : "<p>Cite the source of the dataset as:</p>\n\n<blockquote>\n<p>Greenhill, Simon J. (2015): TransNewGuinea.org: An Online Database of New Guinea Languages. PLoS ONE 10.10: e0141563.</p>\n</blockquote>", "license" : {"id" : "CC-BY-4.0"}}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "access_right": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "creators": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}}, "required": ["name", "type"]}}, "communities": {"type": "array", "items": {"type": "object", "properties": {"identifier": {"type": "string"}}, "required": ["identifier"]}}, "upload_type": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}, "required": ["title", "access_right", "keywords", "creators", "contributors", "communities", "upload_type", "description", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "array", "items": {"type": "object", "properties": {"comment": {"type": "string"}, "definition": {"type": "string"}, "orthologs": {"type": "object", "properties": {"K14632": {"type": "string"}}, "required": ["K14632"]}, "name": {"type": "string"}, "product_stoichiometries": {"type": "array", "items": {"type": "string"}}, "enzymes": {"type": "array", "items": {}}, "equation": {"type": "string"}, "glycans": {"type": "boolean"}, "substrate_stoichiometries": {"type": "array", "items": {"type": "string"}}, "rpairs": {"type": "object", "properties": {}, "required": []}, "entry_id": {"type": "string"}, "pathways": {"type": "object", "properties": {"rn01130": {"type": "string"}, "rn01057": {"type": "string"}}, "required": ["rn01130", "rn01057"]}, "products": {"type": "array", "items": {"type": "string"}}, "substrates": {"type": "array", "items": {"type": "string"}}}, "required": ["comment", "definition", "orthologs", "name", "product_stoichiometries", "enzymes", "equation", "glycans", "substrate_stoichiometries", "rpairs", "entry_id", "pathways", "products", "substrates"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"comment" : "cofactor-independent monooxygenase, actVA-orf6", "definition" : "6-Deoxydihydrokalafungin + Oxygen <=> Dihydrokalafungin + H2O", "orthologs" : {"K14632" : "C-6 monooxygenase"}, "name" : "", "product_stoichiometries" : ["1", "1"], "enzymes" : [], "equation" : "C12435 + C00007 <=> C12436 + C00001", "glycans" : false, "substrate_stoichiometries" : ["1", "1"], "rpairs" : {}, "entry_id" : "R06696", "pathways" : {"rn01130" : "Biosynthesis of antibiotics", "rn01057" : "Biosynthesis of type II polyketide products"}, "products" : ["C12436", "C00001"], "substrates" : ["C12435", "C00007"]}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"comment": {"type": "string"}, "definition": {"type": "string"}, "orthologs": {"type": "object", "properties": {"K14632": {"type": "string"}}, "required": ["K14632"]}, "name": {"type": "string"}, "product_stoichiometries": {"type": "array", "items": {"type": "string"}}, "enzymes": {"type": "array", "items": {}}, "equation": {"type": "string"}, "glycans": {"type": "boolean"}, "substrate_stoichiometries": {"type": "array", "items": {"type": "string"}}, "rpairs": {"type": "object", "properties": {}, "required": []}, "entry_id": {"type": "string"}, "pathways": {"type": "object", "properties": {"rn01130": {"type": "string"}, "rn01057": {"type": "string"}}, "required": ["rn01130", "rn01057"]}, "products": {"type": "array", "items": {"type": "string"}}, "substrates": {"type": "array", "items": {"type": "string"}}}, "required": ["comment", "definition", "orthologs", "name", "product_stoichiometries", "enzymes", "equation", "glycans", "substrate_stoichiometries", "rpairs", "entry_id", "pathways", "products", "substrates"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 2293, "cartId" : "a8d5152d-154c-4a8e-9d45-db3bc8215eab", "preferredProducts" : [1535, 1427, 2822, 4290], "productReviews" : []}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"word" : "sheathless", "definition" : "Without a sheath or case for covering; unsheathed."}
json_instruct
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "prestart": {"type": "string"}}, "required": ["start", "prestart"]}, "devDependencies": {"type": "object", "properties": {"polyger": {"type": "string"}}, "required": ["polyger"]}}, "required": ["name", "version", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "polyrepo", "version" : "1.0.0", "scripts" : {"start" : "polyger", "prestart" : "npx prestart"}, "devDependencies" : {"polyger" : "^0.4.10"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "prestart": {"type": "string"}}, "required": ["start", "prestart"]}, "devDependencies": {"type": "object", "properties": {"polyger": {"type": "string"}}, "required": ["polyger"]}}, "required": ["name", "version", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hash" : "0xab2e0f7cd0f53ba529ebe57eddc3a4abd6aa937d5aa9243fde01ca7e963f260a", "parentHash" : "0xc4009d350603c3377ba78f2818d7a6a7c37ecc62081fa11d018813d79b700ebe", "number" : 5039, "timestamp" : 1438287122, "nonce" : "0x5cd80a085a62dc03", "difficulty" : 180402149249, "gasLimit" : {"_hex" : "0x1388"}, "gasUsed" : {"_hex" : "0x0"}, "miner" : "0xbb7B8287f3F0a933474a79eAe42CBCa977791171", "extraData" : "0x476574682f4c5649562f76312e302e302f6c696e75782f676f312e342e32", "transactions" : []}
json_instruct
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "build-sources": {"type": "string"}, "build-tests": {"type": "string"}, "clean": {"type": "string"}, "lint": {"type": "string"}, "prepublishOnly": {"type": "string"}, "pretest": {"type": "string"}, "test": {"type": "string"}, "watch": {"type": "string"}}, "required": ["build", "build-sources", "build-tests", "clean", "lint", "prepublishOnly", "pretest", "test", "watch"]}, "author": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "peerDependencies": {"type": "object", "properties": {"tslint": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["tslint", "typescript"]}, "devDependencies": {"type": "object", "properties": {"@types/node": {"type": "string"}, "tslint": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/node", "tslint", "typescript"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "repository", "peerDependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "tslint-no-circular-imports", "version" : "0.5.0", "description" : "TSLint plugin to detect and warn about circular imports", "main" : "tslint-no-circular-imports.json", "scripts" : {"build" : "npm run clean && npm run lint && npm run build-sources", "build-sources" : "tsc -p tsconfig.json", "build-tests" : "tsc -p tsconfig.test.json", "clean" : "rm -f noCircularImportsRule.js.map noCircularImportsRule.d.ts", "lint" : "tslint .", "prepublishOnly" : "npm run build", "pretest" : "npm run build", "test" : "npm run build-tests && node test/test.js", "watch" : "tsc -p tsconfig.json -w & tsc -p tsconfig.test.json -w"}, "author" : "Boris Cherny <boris@performancejs.com> (http://performancejs.com/)", "license" : "MIT", "repository" : {"type" : "git", "url" : "git+https://github.com/bcherny/tslint-no-circular-imports.git"}, "peerDependencies" : {"tslint" : ">=5.0.0", "typescript" : ">=2.1.0"}, "devDependencies" : {"@types/node" : "^4.2.23", "tslint" : "^5.7.0", "typescript" : "^2.5.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "build-sources": {"type": "string"}, "build-tests": {"type": "string"}, "clean": {"type": "string"}, "lint": {"type": "string"}, "prepublishOnly": {"type": "string"}, "pretest": {"type": "string"}, "test": {"type": "string"}, "watch": {"type": "string"}}, "required": ["build", "build-sources", "build-tests", "clean", "lint", "prepublishOnly", "pretest", "test", "watch"]}, "author": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "peerDependencies": {"type": "object", "properties": {"tslint": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["tslint", "typescript"]}, "devDependencies": {"type": "object", "properties": {"@types/node": {"type": "string"}, "tslint": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/node", "tslint", "typescript"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "repository", "peerDependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"t": {"type": "string"}, "h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"f": {"type": "string"}, "e": {"type": "array", "items": {"type": "string"}}}, "required": ["f", "e"]}}}, "required": ["d"]}}, "stem": {"type": "string"}}, "required": ["t", "h", "stem"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"t" : "tomirengay", "h" : [{"d" : [{"f" : "\u7ad9\u8457\uff0c\u6a39\u7acb\u8457\uff0c\u5efa\u7acb\u8d77\u4f86\u4e86\u3002", "e" : ["\ufff9`Tomireng~`ay~ `to~ `ko~ `cidal~, `pa~`s~`la~`'~`ho~ `makena~ `saw~?\ufffa\ufffb\u592a\u967d\u7576\u7a7a\u4e86\uff0c\u4f11\u606f\u4e00\u6703\u5152\u53ef\u4ee5\u5427\uff01"]}, {"f" : "\u6307\u7ad9\u7acb\u8005\u3002", "e" : ["\ufff9`Tomireng~`ay~ `a~ `tokos~.\ufffa\ufffb\u76f4\u7acb\u7684\u5c71\u3002", "\ufff9`Ci~ `Kacaw~ `ko~ `tomireng~`ay~ `i~ `pa~`p~u`ta~`l~.\ufffa\ufffb`Kacaw~ \uff08\u5361\u5146\uff09 \u7ad9\u5728\u9662\u5916\u3002"]}]}], "stem" : "tireng"}
json_instruct
{"type": "object", "properties": {"t": {"type": "string"}, "h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"f": {"type": "string"}, "e": {"type": "array", "items": {"type": "string"}}}, "required": ["f", "e"]}}}, "required": ["d"]}}, "stem": {"type": "string"}}, "required": ["t", "h", "stem"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "array", "items": {"type": "object", "properties": {"DeniedAlternatives": {"type": "array", "items": {}}, "Files": {"type": "object", "properties": {"items/active/weapons/other/precursorpistol/precursorpistol.activeitem": {"type": "array", "items": {"type": "string"}}}, "required": ["items/active/weapons/other/precursorpistol/precursorpistol.activeitem"]}, "Texts": {"type": "object", "properties": {"Chs": {"type": "string"}, "Eng": {"type": "string"}}, "required": ["Chs", "Eng"]}}, "required": ["DeniedAlternatives", "Files", "Texts"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"DeniedAlternatives" : [], "Files" : {"items/active/weapons/other/precursorpistol/precursorpistol.activeitem" : ["/shortdescription"]}, "Texts" : {"Chs" : "\u5148\u9a71\u4fdd\u62a4\u8005", "Eng" : "Precursor Protector"}}, {"DeniedAlternatives" : [], "Files" : {"items/active/weapons/other/precursorpistol/precursorpistol.activeitem" : ["/description"]}, "Texts" : {"Chs" : "\u6295\u5c04\u51fa\u4e00\u4e2a^orange;\u56de\u590d\u9886\u57df^reset;\uff1a\n^green;\u63d0\u4f9b\u9632\u5fa1\u589e\u76ca\u3002\u5c06\u80fd\u91cf\u8f6c\u6362\u4e3aHP\u3002^reset;\n^red;\u5728\u9886\u57df\u8303\u56f4\u5185\uff0c\u963b\u6b62\u80fd\u91cf\u56de\u590d\u548c\u76fe\u724c\u8010\u4e45\u56de\u590d^reset;", "Eng" : "Projects ^orange;Regen Zones^reset; that:\n^green;Provide Defense. Convert Energy to Health.^reset;\n^red;Reduce Energy and Shield Regen.^reset;"}}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"DeniedAlternatives": {"type": "array", "items": {}}, "Files": {"type": "object", "properties": {"items/active/weapons/other/precursorpistol/precursorpistol.activeitem": {"type": "array", "items": {"type": "string"}}}, "required": ["items/active/weapons/other/precursorpistol/precursorpistol.activeitem"]}, "Texts": {"type": "object", "properties": {"Chs": {"type": "string"}, "Eng": {"type": "string"}}, "required": ["Chs", "Eng"]}}, "required": ["DeniedAlternatives", "Files", "Texts"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"function": {"type": "string"}, "parameter": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "value": {"type": "array", "items": {"type": "string"}}}, "required": ["function", "parameter", "tags", "value"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"function" : "always_true", "parameter" : "true", "tags" : ["ke2:color.hair", "ke2:sapphire.color.blue"], "value" : ["a9e8fa", "2633b5"]}
json_instruct
{"type": "object", "properties": {"function": {"type": "string"}, "parameter": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "value": {"type": "array", "items": {"type": "string"}}}, "required": ["function", "parameter", "tags", "value"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "idParent": {"type": "integer"}, "namaWilayah": {"type": "string"}, "tingkatWilayah": {"type": "integer"}, "idPro": {"type": "integer"}, "idKab": {"type": "integer"}, "idKec": {"type": "integer"}, "idKel": {"type": "integer"}, "namaPro": {"type": "string"}, "namaKab": {"type": "string"}, "namaKec": {"type": "string"}, "namaKel": {"type": "string"}, "kodeWilayah": {"type": "string"}}, "required": ["id", "idParent", "namaWilayah", "tingkatWilayah", "idPro", "idKab", "idKec", "idKel", "namaPro", "namaKab", "namaKec", "namaKel", "kodeWilayah"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : 44860, "idParent" : 44858, "namaWilayah" : "MAYANG", "tingkatWilayah" : 4, "idPro" : 42385, "idKab" : 44643, "idKec" : 44858, "idKel" : 44860, "namaPro" : "JAWA TIMUR", "namaKab" : "JEMBER", "namaKec" : "MAYANG", "namaKel" : "MAYANG", "kodeWilayah" : "35.09.26.2002"}, {"id" : 44859, "idParent" : 44858, "namaWilayah" : "MRAWAN", "tingkatWilayah" : 4, "idPro" : 42385, "idKab" : 44643, "idKec" : 44858, "idKel" : 44859, "namaPro" : "JAWA TIMUR", "namaKab" : "JEMBER", "namaKec" : "MAYANG", "namaKel" : "MRAWAN", "kodeWilayah" : "35.09.26.2001"}, {"id" : 44861, "idParent" : 44858, "namaWilayah" : "SEPUTIH", "tingkatWilayah" : 4, "idPro" : 42385, "idKab" : 44643, "idKec" : 44858, "idKel" : 44861, "namaPro" : "JAWA TIMUR", "namaKab" : "JEMBER", "namaKec" : "MAYANG", "namaKel" : "SEPUTIH", "kodeWilayah" : "35.09.26.2003"}, {"id" : 44865, "idParent" : 44858, "namaWilayah" : "SIDOMUKTI", "tingkatWilayah" : 4, "idPro" : 42385, "idKab" : 44643, "idKec" : 44858, "idKel" : 44865, "namaPro" : "JAWA TIMUR", "namaKab" : "JEMBER", "namaKec" : "MAYANG", "namaKel" : "SIDOMUKTI", "kodeWilayah" : "35.09.26.2007"}, {"id" : 44864, "idParent" : 44858, "namaWilayah" : "SUMBERKEJAYAN", "tingkatWilayah" : 4, "idPro" : 42385, "idKab" : 44643, "idKec" : 44858, "idKel" : 44864, "namaPro" : "JAWA TIMUR", "namaKab" : "JEMBER", "namaKec" : "MAYANG", "namaKel" : "SUMBERKEJAYAN", "kodeWilayah" : "35.09.26.2006"}, {"id" : 44863, "idParent" : 44858, "namaWilayah" : "TEGALREJO", "tingkatWilayah" : 4, "idPro" : 42385, "idKab" : 44643, "idKec" : 44858, "idKel" : 44863, "namaPro" : "JAWA TIMUR", "namaKab" : "JEMBER", "namaKec" : "MAYANG", "namaKel" : "TEGALREJO", "kodeWilayah" : "35.09.26.2005"}, {"id" : 44862, "idParent" : 44858, "namaWilayah" : "TEGALWARU", "tingkatWilayah" : 4, "idPro" : 42385, "idKab" : 44643, "idKec" : 44858, "idKel" : 44862, "namaPro" : "JAWA TIMUR", "namaKab" : "JEMBER", "namaKec" : "MAYANG", "namaKel" : "TEGALWARU", "kodeWilayah" : "35.09.26.2004"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "idParent": {"type": "integer"}, "namaWilayah": {"type": "string"}, "tingkatWilayah": {"type": "integer"}, "idPro": {"type": "integer"}, "idKab": {"type": "integer"}, "idKec": {"type": "integer"}, "idKel": {"type": "integer"}, "namaPro": {"type": "string"}, "namaKab": {"type": "string"}, "namaKec": {"type": "string"}, "namaKel": {"type": "string"}, "kodeWilayah": {"type": "string"}}, "required": ["id", "idParent", "namaWilayah", "tingkatWilayah", "idPro", "idKab", "idKec", "idKel", "namaPro", "namaKab", "namaKec", "namaKel", "kodeWilayah"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"_id" : "oli7uaqm", "accession" : "EF151292", "definition" : "Peach latent mosaic viroid isolate PL1, complete genome.", "host" : "peach cv. Vineyard peach", "sequence" : "CCCATAAGTTTCGCCGTATCTCAACGGCTCATCAGTGGGCTAAGCCCAGACTTATGAGAGAGTGGTTACCTCTCAGCCCCTCCACCTTGGGGTGCCCTATTCGAGGCACTGCAGTCTCGATAGAAAGGCTAAGGACCTCGCAATGAGGTAAGGTGGGACTTTTCCTTCTGGAACCTAGCGGTTGGTTCCGAGGGGGGTGTGATCCAGGTACCGCCGTAGAAACTGGATTACGACGTCTACCCGGGATTCAAACCCGGTCCCCTCCAGAAGTGATTCTGGATGAAGAGTCGTGCTTAGCACACTGATGAGTCTCTGAAATGAGACGAAACTCTTTTGA"}
json_instruct
{"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"text": {"type": "string"}, "created": {"type": "string"}, "type": {"type": "string"}, "enclosure": {"type": "string"}, "enclosureType": {"type": "string"}, "enclosureLength": {"type": "string"}}, "required": ["text", "created", "type", "enclosure", "enclosureType", "enclosureLength"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"text" : "18-minute <a href=\"http://scripting.com/2018/04/16/denverPostAndBerkeleyside.m4a\">podcast</a> about the <a href=\"https://www.denverpost.com/2018/04/06/as-vultures-circle-the-denver-post-must-be-saved/\">Denver</a> <a href=\"https://boulderfreepress.blog/2018/04/14/private-equity-owners-endanger-cameras-future/\">newspapers</a> and <a href=\"https://www.lenfestinstitute.org/solution-set/2018/04/12/local-news-site-berkeleyside-raised-1-million-direct-public-offering/\">Berkeleyside</a>. The Denver news orgs are doing something unusual, crossing the wall between publishing and editorial. And <a href=\"http://www.berkeleyside.com/\">Berkeleyside</a>, a local news org who just did a public <a href=\"http://invest.berkeleyside.com/\">offering</a> of stock, and <i>eliminated</i> the wall between publishing and editorial. Have a listen and think if perhaps this isn't a better way forward for news than paywalls and hedge-fund ownership.", "created" : "Mon, 16 Apr 2018 20:20:33 GMT", "type" : "outline", "enclosure" : "http://scripting.com/2018/04/16/denverPostAndBerkeleyside.m4a", "enclosureType" : "audio/mpeg", "enclosureLength" : "8814002"}
json_instruct
{"type": "object", "properties": {"text": {"type": "string"}, "created": {"type": "string"}, "type": {"type": "string"}, "enclosure": {"type": "string"}, "enclosureType": {"type": "string"}, "enclosureLength": {"type": "string"}}, "required": ["text", "created", "type", "enclosure", "enclosureType", "enclosureLength"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"inputs": {"type": "array", "items": {"type": "string"}}, "outputs": {"type": "array", "items": {"type": "string"}}}, "required": ["inputs", "outputs"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"inputs" : ["3\n1 0 1\n", "1\n1\n", "3\n0 0 1\n", "20\n0 0 1 0 0 0 0 1 1 0 0 1 0 1 0 0 0 0 1 0\n", "100\n1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 0 1 1 0 0 1 0 0 1 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 1 0 0 0 1 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 1 0 0 1 0 1 0 0 0 0 0 0 1 1 1 1 0 1 1 0 0 1 0\n", "100\n1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 0 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n", "100\n1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 0 1 1 1 0 1 0 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 0 0 1\n", "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0\n", "100\n1 1 0 1 1 1 1 0 1 0 0 1 1 1 1 1 0 1 0 1 0 1 1 1 1 1 0 1 1 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 1 0 0 1 0 1 0 1 1 0 0 1 0 0 1 1 0 1 0 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 0 0 1 0 1 1 1 1\n", "6\n1 1 0 0 0 1\n"], "outputs" : ["2\n", "-1\n", "-1\n", "13\n", "56\n", "68\n", "53\n", "47\n", "1908\n", "5\n"]}
json_instruct
{"type": "object", "properties": {"inputs": {"type": "array", "items": {"type": "string"}}, "outputs": {"type": "array", "items": {"type": "string"}}}, "required": ["inputs", "outputs"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "properties" : {"type" : "barangay", "level" : "4", "label" : "Upper Baguer, Pigkawayan, North Cotabato, SOCCSKSARGEN (Region XII), PH", "locale" : "ph.soccsksargen-region-xii.north-cotabato.pigkawayan.upper-baguer", "country_id" : 177, "country_reference" : 177, "country_name" : "Philippines", "region_id" : "15", "region_reference" : "12", "region_name" : "SOCCSKSARGEN (Region XII)", "province_id" : "53", "province_reference" : "53", "province_name" : "North Cotabato", "city_id" : "1026", "city_reference" : "1091", "city_name" : "Pigkawayan", "barangay_id" : "29107", "barangay_reference" : "28624", "barangay_name" : "Upper Baguer"}, "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[124.438438, 7.28097], [124.438812, 7.27337], [124.43103, 7.27317], [124.423347, 7.27409], [124.424011, 7.27758], [124.423439, 7.28058], [124.438438, 7.28097]]]]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "d768-64", "text" : "the functions that need doing. Yet we csn5t do everything, And he is still\nconcerned over the occasional delays in relations due to the admittedly nee-\nessaiy committee and membership structure of the organisation.\nIn this connection, 1 should like to indicate that, as you have observed,\nI have begun to handle (with Grsydon\u2019-e .approval) more and more of the routine*\ndetails of our relationships generally and import to the directors for approval\n(or disapproval) afterwards in aa many of those cases as possible where a\" delay\nmight be to 'the MEBns disadvantage. However, 1 would like your reaction all\nalong to my procedure and general approach, since I do not want* or wish to\nassume* more authority than I should in this position. Your serious reactions\nto this problem will be greatly appreciated. By now you have had m opportunity\nto observe how it is beginning to work out."}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"date": {"type": "string"}}, "required": ["date"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"date" : "2021-07-08T09:38:25+07:00"}
json_instruct
{"type": "object", "properties": {"date": {"type": "string"}}, "required": ["date"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"localities": {"type": "array", "items": {"type": "string"}}, "state": {"type": "string"}, "postal_code": {"type": "string"}, "locality": {"type": "string"}, "lat": {"type": "number"}, "region": {"type": "object", "properties": {"fips": {"type": "string"}, "abbr": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "abbr", "name"]}, "city": {"type": "string"}, "type": {"type": "string"}, "lng": {"type": "number"}, "counties": {"type": "array", "items": {"type": "object", "properties": {"fips": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "name"]}}}, "required": ["localities", "state", "postal_code", "locality", "lat", "region", "city", "type", "lng", "counties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"localities" : ["Lane, IL"], "state" : "IL", "postal_code" : "61750", "locality" : "Lane, IL", "lat" : 40.123545, "region" : {"fips" : "17", "abbr" : "IL", "name" : "Illinois"}, "city" : "Lane", "type" : "POBOX", "lng" : -88.85965, "counties" : [{"fips" : "039", "name" : "De Witt County"}]}
json_instruct
{"type": "object", "properties": {"localities": {"type": "array", "items": {"type": "string"}}, "state": {"type": "string"}, "postal_code": {"type": "string"}, "locality": {"type": "string"}, "lat": {"type": "number"}, "region": {"type": "object", "properties": {"fips": {"type": "string"}, "abbr": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "abbr", "name"]}, "city": {"type": "string"}, "type": {"type": "string"}, "lng": {"type": "number"}, "counties": {"type": "array", "items": {"type": "object", "properties": {"fips": {"type": "string"}, "name": {"type": "string"}}, "required": ["fips", "name"]}}}, "required": ["localities", "state", "postal_code", "locality", "lat", "region", "city", "type", "lng", "counties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"attributes": {"type": "object", "properties": {"su": {"type": "boolean"}}, "required": ["su"]}, "courseCode": {"type": "string"}, "courseCredit": {"type": "string"}, "description": {"type": "string"}, "faculty": {"type": "string"}, "preclusion": {"type": "string"}, "title": {"type": "string"}}, "required": ["attributes", "courseCode", "courseCredit", "description", "faculty", "preclusion", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"attributes" : {"su" : true}, "courseCode" : "GEH1008", "courseCredit" : "4", "description" : "This module examines the role which nationalism has played in the formation and political development of the nations and states of South Asia. It examines nationalist forces in anti-colonial struggles, in post-colonial state formation and in contemporary political developments. It will be of relevance to students with an interest in political developments in Asia, with particular reference to forms of nationalism and nation-building", "faculty" : "Arts and Social Science", "preclusion" : "GEK1035", "title" : "Nations & Nat'lisms in S Asia"}
json_instruct
{"type": "object", "properties": {"attributes": {"type": "object", "properties": {"su": {"type": "boolean"}}, "required": ["su"]}, "courseCode": {"type": "string"}, "courseCredit": {"type": "string"}, "description": {"type": "string"}, "faculty": {"type": "string"}, "preclusion": {"type": "string"}, "title": {"type": "string"}}, "required": ["attributes", "courseCode", "courseCredit", "description", "faculty", "preclusion", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "object", "properties": {"issues_url": {"type": "string"}, "members_url": {"type": "string"}, "description": {"type": "string"}, "public_members_url": {"type": "string"}, "url": {"type": "string"}, "events_url": {"type": "string"}, "avatar_url": {"type": "string"}, "repos_url": {"type": "string"}, "login": {"type": "string"}, "id": {"type": "integer"}, "hooks_url": {"type": "string"}}, "required": ["issues_url", "members_url", "description", "public_members_url", "url", "events_url", "avatar_url", "repos_url", "login", "id", "hooks_url"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"issues_url" : "https://api.github.com/orgs/codeforkansascity/issues", "members_url" : "https://api.github.com/orgs/codeforkansascity/members{/member}", "description" : "", "public_members_url" : "https://api.github.com/orgs/codeforkansascity/public_members{/member}", "url" : "https://api.github.com/orgs/codeforkansascity", "events_url" : "https://api.github.com/orgs/codeforkansascity/events", "avatar_url" : "https://avatars.githubusercontent.com/u/5272305?v=3", "repos_url" : "https://api.github.com/orgs/codeforkansascity/repos", "login" : "codeforkansascity", "id" : 5272305, "hooks_url" : "https://api.github.com/orgs/codeforkansascity/hooks"}, {"issues_url" : "https://api.github.com/orgs/neighborly/issues", "members_url" : "https://api.github.com/orgs/neighborly/members{/member}", "description" : "The Technology Platform for Public Finance", "public_members_url" : "https://api.github.com/orgs/neighborly/public_members{/member}", "url" : "https://api.github.com/orgs/neighborly", "events_url" : "https://api.github.com/orgs/neighborly/events", "avatar_url" : "https://avatars.githubusercontent.com/u/6343507?v=3", "repos_url" : "https://api.github.com/orgs/neighborly/repos", "login" : "neighborly", "id" : 6343507, "hooks_url" : "https://api.github.com/orgs/neighborly/hooks"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"issues_url": {"type": "string"}, "members_url": {"type": "string"}, "description": {"type": "string"}, "public_members_url": {"type": "string"}, "url": {"type": "string"}, "events_url": {"type": "string"}, "avatar_url": {"type": "string"}, "repos_url": {"type": "string"}, "login": {"type": "string"}, "id": {"type": "integer"}, "hooks_url": {"type": "string"}}, "required": ["issues_url", "members_url", "description", "public_members_url", "url", "events_url", "avatar_url", "repos_url", "login", "id", "hooks_url"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "build": {"type": "string"}, "dev": {"type": "string"}, "start": {"type": "string"}}, "required": ["test", "build", "dev", "start"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"libtess": {"type": "string"}, "ndarray": {"type": "string"}, "ndarray-ops": {"type": "string"}, "ndarray-show": {"type": "string"}, "ramda": {"type": "string"}, "underscore": {"type": "string"}, "zeros": {"type": "string"}}, "required": ["libtess", "ndarray", "ndarray-ops", "ndarray-show", "ramda", "underscore", "zeros"]}, "devDependencies": {"type": "object", "properties": {"@google/model-viewer": {"type": "string"}, "@rollup/plugin-commonjs": {"type": "string"}, "@rollup/plugin-node-resolve": {"type": "string"}, "ava": {"type": "string"}, "rollup": {"type": "string"}, "sirv": {"type": "string"}, "sirv-cli": {"type": "string"}, "three": {"type": "string"}, "vox-reader": {"type": "string"}}, "required": ["@google/model-viewer", "@rollup/plugin-commonjs", "@rollup/plugin-node-resolve", "ava", "rollup", "sirv", "sirv-cli", "three", "vox-reader"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "voxel-triangulation", "version" : "1.3.6", "description" : "a library for subdividing voxels into triangles", "main" : "voxel-triangulation.js", "scripts" : {"test" : "ava", "build" : "rollup -c", "dev" : "rollup -c -w", "start" : "rollup -c && sirv demo"}, "repository" : {"type" : "git", "url" : "https://github.com/florianfe/voxel-triangulation.git"}, "keywords" : ["voxel", "voxels", "tesselation", "triangles", "triangulation", "graphics"], "author" : "Florian Fechner", "license" : "MIT", "dependencies" : {"libtess" : "^1.2.2", "ndarray" : "^1.0.19", "ndarray-ops" : "^1.2.2", "ndarray-show" : "^2.0.0", "ramda" : "^0.27.1", "underscore" : "^1.13.2", "zeros" : "^1.0.0"}, "devDependencies" : {"@google/model-viewer" : "^1.9.2", "@rollup/plugin-commonjs" : "^21.0.1", "@rollup/plugin-node-resolve" : "^13.1.3", "ava" : "^4.0.1", "rollup" : "^2.63.0", "sirv" : "^2.0.0", "sirv-cli" : "^2.0.1", "three" : "^0.137.0", "vox-reader" : "^2.1.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "build": {"type": "string"}, "dev": {"type": "string"}, "start": {"type": "string"}}, "required": ["test", "build", "dev", "start"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"libtess": {"type": "string"}, "ndarray": {"type": "string"}, "ndarray-ops": {"type": "string"}, "ndarray-show": {"type": "string"}, "ramda": {"type": "string"}, "underscore": {"type": "string"}, "zeros": {"type": "string"}}, "required": ["libtess", "ndarray", "ndarray-ops", "ndarray-show", "ramda", "underscore", "zeros"]}, "devDependencies": {"type": "object", "properties": {"@google/model-viewer": {"type": "string"}, "@rollup/plugin-commonjs": {"type": "string"}, "@rollup/plugin-node-resolve": {"type": "string"}, "ava": {"type": "string"}, "rollup": {"type": "string"}, "sirv": {"type": "string"}, "sirv-cli": {"type": "string"}, "three": {"type": "string"}, "vox-reader": {"type": "string"}}, "required": ["@google/model-viewer", "@rollup/plugin-commonjs", "@rollup/plugin-node-resolve", "ava", "rollup", "sirv", "sirv-cli", "three", "vox-reader"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"24040": {"type": "object", "properties": {"success": {"type": "boolean"}}, "required": ["success"]}}, "required": ["24040"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"24040" : {"success" : false}}
json_instruct
{"type": "object", "properties": {"24040": {"type": "object", "properties": {"success": {"type": "boolean"}}, "required": ["success"]}}, "required": ["24040"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"id": {"type": "integer"}, "node": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "image": {"type": "string"}, "date": {"type": "string"}}, "required": ["id", "name", "image", "date"]}}, "relate": {"type": "array", "items": {"type": "object", "properties": {"relate": {"type": "string"}, "src": {"type": "integer"}, "dst": {"type": "integer"}}, "required": ["relate", "src", "dst"]}}}, "required": ["id", "node", "relate"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 70974, "node" : [{"id" : 70974, "name" : "\u6731\u9dfa\u8272\u602a\u9b54", "image" : "//lain.bgm.tv/pic/cover/m/d3/99/70974_c3A3b.jpg", "date" : "unknown"}, {"id" : 70975, "name" : "\u84bc\u3044\u5996\u9b54\u305f\u3061", "nameCN" : "\u84dd\u8272\u5996\u9b54", "image" : "//lain.bgm.tv/pic/cover/m/df/e2/70975_jp.jpg", "date" : "unknown"}], "relate" : [{"relate" : "\u524d\u4f20", "src" : 70974, "dst" : 70975}, {"relate" : "\u7eed\u96c6", "src" : 70975, "dst" : 70974}]}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "node": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "image": {"type": "string"}, "date": {"type": "string"}}, "required": ["id", "name", "image", "date"]}}, "relate": {"type": "array", "items": {"type": "object", "properties": {"relate": {"type": "string"}, "src": {"type": "integer"}, "dst": {"type": "integer"}}, "required": ["relate", "src", "dst"]}}}, "required": ["id", "node", "relate"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "array", "items": {"type": "string"}}, "main": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "peerDependencies": {"type": "object", "properties": {"stylus": {"type": "string"}}, "required": ["stylus"]}, "dependencies": {"type": "object", "properties": {"deasync": {"type": "string"}}, "required": ["deasync"]}, "devDependencies": {"type": "object", "properties": {"coffee-script": {"type": "string"}, "grunt": {"type": "string"}, "grunt-contrib-coffee": {"type": "string"}, "grunt-conventional-changelog": {"type": "string"}, "grunt-notify": {"type": "string"}, "jit-grunt": {"type": "string"}, "load-grunt-config": {"type": "string"}, "stylus": {"type": "string"}}, "required": ["coffee-script", "grunt", "grunt-contrib-coffee", "grunt-conventional-changelog", "grunt-notify", "jit-grunt", "load-grunt-config", "stylus"]}}, "required": ["name", "description", "license", "version", "author", "main", "keywords", "repository", "bugs", "homepage", "peerDependencies", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "stylus-require", "description" : "Require and compile Stylus files within Node.js", "license" : "MIT", "version" : "1.0.0", "author" : ["Elliot Chong <code+stylus-require@elliotjameschong.com>"], "main" : "index.js", "keywords" : ["stylus", "require", "templates"], "repository" : {"type" : "git", "url" : "https://github.com/ElliotChong/stylus-require.git"}, "bugs" : {"url" : "https://github.com/ElliotChong/stylus-require/issues"}, "homepage" : "https://github.com/ElliotChong/stylus-require", "peerDependencies" : {"stylus" : "X.X.X"}, "dependencies" : {"deasync" : "^0.1.3"}, "devDependencies" : {"coffee-script" : "^1.9.3", "grunt" : "^0.4.5", "grunt-contrib-coffee" : "^0.13.0", "grunt-conventional-changelog" : "^5.0.0", "grunt-notify" : "^0.4.1", "jit-grunt" : "^0.9.0", "load-grunt-config" : "^0.17.2", "stylus" : "X.X.X"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "array", "items": {"type": "string"}}, "main": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "peerDependencies": {"type": "object", "properties": {"stylus": {"type": "string"}}, "required": ["stylus"]}, "dependencies": {"type": "object", "properties": {"deasync": {"type": "string"}}, "required": ["deasync"]}, "devDependencies": {"type": "object", "properties": {"coffee-script": {"type": "string"}, "grunt": {"type": "string"}, "grunt-contrib-coffee": {"type": "string"}, "grunt-conventional-changelog": {"type": "string"}, "grunt-notify": {"type": "string"}, "jit-grunt": {"type": "string"}, "load-grunt-config": {"type": "string"}, "stylus": {"type": "string"}}, "required": ["coffee-script", "grunt", "grunt-contrib-coffee", "grunt-conventional-changelog", "grunt-notify", "jit-grunt", "load-grunt-config", "stylus"]}}, "required": ["name", "description", "license", "version", "author", "main", "keywords", "repository", "bugs", "homepage", "peerDependencies", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "directories": {"type": "object", "properties": {"example": {"type": "string"}}, "required": ["example"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "build": {"type": "string"}, "serve": {"type": "string"}}, "required": ["test", "build", "serve"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@wasm-tool/wasm-pack-plugin": {"type": "string"}, "html-webpack-plugin": {"type": "string"}, "text-encoding": {"type": "string"}, "webpack": {"type": "string"}, "webpack-cli": {"type": "string"}, "webpack-dev-server": {"type": "string"}}, "required": ["@wasm-tool/wasm-pack-plugin", "html-webpack-plugin", "text-encoding", "webpack", "webpack-cli", "webpack-dev-server"]}}, "required": ["name", "version", "description", "main", "directories", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "ani-ss", "version" : "1.0.0", "description" : "Anime4k applied in web assembly.", "main" : "www/index.js", "directories" : {"example" : "examples"}, "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1", "build" : "webpack", "serve" : "webpack serve"}, "repository" : {"type" : "git", "url" : "git+https://github.com/pinnouse/ani-ss.git"}, "keywords" : [], "author" : "pinnouse", "license" : "MIT", "bugs" : {"url" : "https://github.com/pinnouse/ani-ss/issues"}, "homepage" : "https://github.com/pinnouse/ani-ss#readme", "devDependencies" : {"@wasm-tool/wasm-pack-plugin" : "^1.3.1", "html-webpack-plugin" : "^4.5.0", "text-encoding" : "^0.7.0", "webpack" : "^5.11.0", "webpack-cli" : "^4.2.0", "webpack-dev-server" : "^3.11.0"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "directories": {"type": "object", "properties": {"example": {"type": "string"}}, "required": ["example"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "build": {"type": "string"}, "serve": {"type": "string"}}, "required": ["test", "build", "serve"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@wasm-tool/wasm-pack-plugin": {"type": "string"}, "html-webpack-plugin": {"type": "string"}, "text-encoding": {"type": "string"}, "webpack": {"type": "string"}, "webpack-cli": {"type": "string"}, "webpack-dev-server": {"type": "string"}}, "required": ["@wasm-tool/wasm-pack-plugin", "html-webpack-plugin", "text-encoding", "webpack", "webpack-cli", "webpack-dev-server"]}}, "required": ["name", "version", "description", "main", "directories", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "testappioasys", "displayName" : "testappioasys"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "c1": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c2": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c3": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c4": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c5": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c6": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}}, "required": ["name", "c1", "c2", "c3", "c4", "c5", "c6"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Amber", "c1" : {"name" : "One Arrow to Rule Them All", "effect" : "Menembakkan 2 anak panah setiap **Serangan Membidik**. Anak panah kedua mengakibatkan DMG sebesar 20% dari DMG anak panah pertama."}, "c2" : {"name" : "Bunny Triggered", "effect" : "Baron Bunny, kini hadir lebih fantastis! Menyerang kakinya dengan Serangan Membidik penuh akan meledakkan Baron Bunny secara manual.\nLedakan manual mengakibatkan 200% DMG tambahan."}, "c3" : {"name" : "It Burns!", "effect" : "Meningkatkan 3 level **Fiery Rain**.\nMaksimum: Lv. 15."}, "c4" : {"name" : "It's Not Just Any Doll...", "effect" : "Mengurangi 20% CD **Explosive Puppet**. Serta menambah 1 kali jumlah penggunaan."}, "c5" : {"name" : "It's Baron Bunny!", "effect" : "Meningkatkan 3 level **Explosive Puppet**.\nMaksimum: Lv. 15."}, "c6" : {"name" : "Wildfire", "effect" : "**Fiery Rain** meningkatkan 15% Movement SPD dan 15% ATK seluruh anggota party selama 10 detik."}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "c1": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c2": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c3": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c4": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c5": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}, "c6": {"type": "object", "properties": {"name": {"type": "string"}, "effect": {"type": "string"}}, "required": ["name", "effect"]}}, "required": ["name", "c1", "c2", "c3", "c4", "c5", "c6"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"1 star": {"type": "string"}, "2 star": {"type": "string"}, "3 star": {"type": "string"}, "4 star": {"type": "string"}, "5 star": {"type": "string"}, "<page title>": {"type": "string"}, "canon pixma pro1 pro10 or pro100 printer": {"type": "string"}, "digital point and shoot camera": {"type": "string"}}, "required": ["1 star", "2 star", "3 star", "4 star", "5 star", "<page title>", "canon pixma pro1 pro10 or pro100 printer", "digital point and shoot camera"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"1 star" : "(0)", "2 star" : "(0)", "3 star" : "(0)", "4 star" : "(1)", "5 star" : "(0)", "<page title>" : "NIKON COOLPIX S9600 BLACK 16MP 22X 3\" 32180", "canon pixma pro1 pro10 or pro100 printer" : ".", "digital point and shoot camera" : "."}
json_instruct
{"type": "object", "properties": {"1 star": {"type": "string"}, "2 star": {"type": "string"}, "3 star": {"type": "string"}, "4 star": {"type": "string"}, "5 star": {"type": "string"}, "<page title>": {"type": "string"}, "canon pixma pro1 pro10 or pro100 printer": {"type": "string"}, "digital point and shoot camera": {"type": "string"}}, "required": ["1 star", "2 star", "3 star", "4 star", "5 star", "<page title>", "canon pixma pro1 pro10 or pro100 printer", "digital point and shoot camera"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"text.autoconfig.no_magic_milk.title": {"type": "string"}, "text.autoconfig.no_magic_milk.option.durationMultiplier": {"type": "string"}, "text.autoconfig.no_magic_milk.option.amplifierMultiplier": {"type": "string"}, "text.autoconfig.no_magic_milk.option.isBlacklist": {"type": "string"}, "text.autoconfig.no_magic_milk.option.effectFilter": {"type": "string"}}, "required": ["text.autoconfig.no_magic_milk.title", "text.autoconfig.no_magic_milk.option.durationMultiplier", "text.autoconfig.no_magic_milk.option.amplifierMultiplier", "text.autoconfig.no_magic_milk.option.isBlacklist", "text.autoconfig.no_magic_milk.option.effectFilter"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"text.autoconfig.no_magic_milk.title" : "No Magic Milk Config", "text.autoconfig.no_magic_milk.option.durationMultiplier" : "Duration Multiplier", "text.autoconfig.no_magic_milk.option.amplifierMultiplier" : "Amplifier Multiplier", "text.autoconfig.no_magic_milk.option.isBlacklist" : "Filter is Blacklist", "text.autoconfig.no_magic_milk.option.effectFilter" : "Filter"}
json_instruct
{"type": "object", "properties": {"text.autoconfig.no_magic_milk.title": {"type": "string"}, "text.autoconfig.no_magic_milk.option.durationMultiplier": {"type": "string"}, "text.autoconfig.no_magic_milk.option.amplifierMultiplier": {"type": "string"}, "text.autoconfig.no_magic_milk.option.isBlacklist": {"type": "string"}, "text.autoconfig.no_magic_milk.option.effectFilter": {"type": "string"}}, "required": ["text.autoconfig.no_magic_milk.title", "text.autoconfig.no_magic_milk.option.durationMultiplier", "text.autoconfig.no_magic_milk.option.amplifierMultiplier", "text.autoconfig.no_magic_milk.option.isBlacklist", "text.autoconfig.no_magic_milk.option.effectFilter"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"word" : "abound", "definition" : "1. To be in great plenty; to be very prevalent; to be plentiful. The wild boar which abounds in some parts of the continent of Europe. Chambers. Where sin abounded grace did much more abound. Rom. v. 20. 2. To be copiously supplied; -- followed by in or with. To abound in, to posses in such abundance as to be characterized by. -- To abound with, to be filled with; to possess in great numbers. Men abounding in natural courage. Macaulay. A faithful man shall abound with blessings. Prov. xxviii. 20. It abounds with cabinets of curiosities. Addison."}
json_instruct
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"hub_user_support_level_standard": {"type": "string"}, "hub_user_support_level_premium": {"type": "string"}, "hub_user_support_level_premium-accredited": {"type": "string"}, "hub_user_support_level_business": {"type": "string"}, "hub_user_support_level_enterprise": {"type": "string"}, "hub_user_logout": {"type": "string"}, "hub_user_actions_aria_expand": {"type": "string"}, "hub_user_actions_aria_reduce": {"type": "string"}, "hub_user_account": {"type": "string"}, "hub_user_role_user": {"type": "string"}, "hub_user_role_none": {"type": "string"}}, "required": ["hub_user_support_level_standard", "hub_user_support_level_premium", "hub_user_support_level_premium-accredited", "hub_user_support_level_business", "hub_user_support_level_enterprise", "hub_user_logout", "hub_user_actions_aria_expand", "hub_user_actions_aria_reduce", "hub_user_account", "hub_user_role_user", "hub_user_role_none"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hub_user_support_level_standard" : "Standard Support ", "hub_user_support_level_premium" : "Premium Support ", "hub_user_support_level_premium-accredited" : "Premium Advanced Support", "hub_user_support_level_business" : "Business Support", "hub_user_support_level_enterprise" : "Enterprise Support", "hub_user_logout" : "Log out", "hub_user_actions_aria_expand" : "Show available actions", "hub_user_actions_aria_reduce" : "Hide available actions", "hub_user_account" : "Manage my account", "hub_user_role_user" : "Connected as a sub-user", "hub_user_role_none" : "Connected in read-only mode"}
json_instruct
{"type": "object", "properties": {"hub_user_support_level_standard": {"type": "string"}, "hub_user_support_level_premium": {"type": "string"}, "hub_user_support_level_premium-accredited": {"type": "string"}, "hub_user_support_level_business": {"type": "string"}, "hub_user_support_level_enterprise": {"type": "string"}, "hub_user_logout": {"type": "string"}, "hub_user_actions_aria_expand": {"type": "string"}, "hub_user_actions_aria_reduce": {"type": "string"}, "hub_user_account": {"type": "string"}, "hub_user_role_user": {"type": "string"}, "hub_user_role_none": {"type": "string"}}, "required": ["hub_user_support_level_standard", "hub_user_support_level_premium", "hub_user_support_level_premium-accredited", "hub_user_support_level_business", "hub_user_support_level_enterprise", "hub_user_logout", "hub_user_actions_aria_expand", "hub_user_actions_aria_reduce", "hub_user_account", "hub_user_role_user", "hub_user_role_none"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"elements": {"type": "object", "properties": {}, "required": []}, "attributes": {"type": "object", "properties": {"checklist-model": {"type": "object", "properties": {"context": {"type": "string"}}, "required": ["context"]}}, "required": ["checklist-model"]}}, "required": ["elements", "attributes"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"elements" : {}, "attributes" : {"checklist-model" : {"context" : "input"}}}
json_instruct
{"type": "object", "properties": {"elements": {"type": "object", "properties": {}, "required": []}, "attributes": {"type": "object", "properties": {"checklist-model": {"type": "object", "properties": {"context": {"type": "string"}}, "required": ["context"]}}, "required": ["checklist-model"]}}, "required": ["elements", "attributes"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "runtime": {"type": "integer"}, "throughput": {"type": "integer"}, "windowConfigurations": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "configurations": {"type": "array", "items": {"type": "string"}}, "sessionConfig": {"type": "object", "properties": {"gapCount": {"type": "integer"}, "minGapTime": {"type": "integer"}, "maxGapTime": {"type": "integer"}}, "required": ["gapCount", "minGapTime", "maxGapTime"]}, "aggFunctions": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "runtime", "throughput", "windowConfigurations", "configurations", "sessionConfig", "aggFunctions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "tumbling_window_benchmark", "runtime" : 30, "throughput" : 1700000, "windowConfigurations" : [["Sliding(60000,60000)"], ["Sliding(60000,60000)"], ["Sliding(60000,30000)"], ["Sliding(60000,10000)"], ["Sliding(60000,5000)"], ["Sliding(60000,1000)"], ["Sliding(60000,500)"], ["Sliding(60000,250)"]], "configurations" : ["Slicing"], "sessionConfig" : {"gapCount" : 10, "minGapTime" : 1000, "maxGapTime" : 1001}, "aggFunctions" : ["Sum"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "runtime": {"type": "integer"}, "throughput": {"type": "integer"}, "windowConfigurations": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "configurations": {"type": "array", "items": {"type": "string"}}, "sessionConfig": {"type": "object", "properties": {"gapCount": {"type": "integer"}, "minGapTime": {"type": "integer"}, "maxGapTime": {"type": "integer"}}, "required": ["gapCount", "minGapTime", "maxGapTime"]}, "aggFunctions": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "runtime", "throughput", "windowConfigurations", "configurations", "sessionConfig", "aggFunctions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"responses": {"type": "array", "items": {"type": "object", "properties": {"labelAnnotations": {"type": "array", "items": {"type": "object", "properties": {"mid": {"type": "string"}, "description": {"type": "string"}, "score": {"type": "number"}, "topicality": {"type": "number"}}, "required": ["mid", "description", "score", "topicality"]}}, "safeSearchAnnotation": {"type": "object", "properties": {"adult": {"type": "string"}, "spoof": {"type": "string"}, "medical": {"type": "string"}, "violence": {"type": "string"}, "racy": {"type": "string"}}, "required": ["adult", "spoof", "medical", "violence", "racy"]}}, "required": ["labelAnnotations", "safeSearchAnnotation"]}}}, "required": ["responses"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"responses" : [{"labelAnnotations" : [{"mid" : "/m/01ssh5", "description" : "Shoulder", "score" : 0.92844397, "topicality" : 0.92844397}, {"mid" : "/m/0919rx", "description" : "Line art", "score" : 0.92524463, "topicality" : 0.92524463}, {"mid" : "/m/0dzf4", "description" : "Arm", "score" : 0.9023934, "topicality" : 0.9023934}, {"mid" : "/m/01dvt1", "description" : "Joint", "score" : 0.81922424, "topicality" : 0.81922424}, {"mid" : "/m/02wzbmj", "description" : "Standing", "score" : 0.81915694, "topicality" : 0.81915694}, {"mid" : "/m/03scnj", "description" : "Line", "score" : 0.75476062, "topicality" : 0.75476062}, {"mid" : "/m/02csf", "description" : "Drawing", "score" : 0.74995309, "topicality" : 0.74995309}, {"mid" : "/m/01vm1p", "description" : "Elbow", "score" : 0.7379784, "topicality" : 0.7379784}, {"mid" : "/m/0k65p", "description" : "Hand", "score" : 0.69691736, "topicality" : 0.69691736}, {"mid" : "/m/0dzd8", "description" : "Neck", "score" : 0.68990904, "topicality" : 0.68990904}], "safeSearchAnnotation" : {"adult" : "VERY_UNLIKELY", "spoof" : "UNLIKELY", "medical" : "VERY_UNLIKELY", "violence" : "VERY_UNLIKELY", "racy" : "VERY_UNLIKELY"}}]}
json_instruct
{"type": "object", "properties": {"responses": {"type": "array", "items": {"type": "object", "properties": {"labelAnnotations": {"type": "array", "items": {"type": "object", "properties": {"mid": {"type": "string"}, "description": {"type": "string"}, "score": {"type": "number"}, "topicality": {"type": "number"}}, "required": ["mid", "description", "score", "topicality"]}}, "safeSearchAnnotation": {"type": "object", "properties": {"adult": {"type": "string"}, "spoof": {"type": "string"}, "medical": {"type": "string"}, "violence": {"type": "string"}, "racy": {"type": "string"}}, "required": ["adult", "spoof", "medical", "violence", "racy"]}}, "required": ["labelAnnotations", "safeSearchAnnotation"]}}}, "required": ["responses"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"h2o;ap4a": {"type": "object", "properties": {"Deinococcus radiodurans": {"type": "array", "items": {"type": "number"}}, "Homo sapiens": {"type": "array", "items": {"type": "number"}}, "Caenorhabditis elegans": {"type": "array", "items": {"type": "number"}}}, "required": ["Deinococcus radiodurans", "Homo sapiens", "Caenorhabditis elegans"]}}, "required": ["h2o;ap4a"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"h2o;ap4a" : {"Deinococcus radiodurans" : [0.035], "Homo sapiens" : [5.0], "Caenorhabditis elegans" : [27.0]}}
json_instruct
{"type": "object", "properties": {"h2o;ap4a": {"type": "object", "properties": {"Deinococcus radiodurans": {"type": "array", "items": {"type": "number"}}, "Homo sapiens": {"type": "array", "items": {"type": "number"}}, "Caenorhabditis elegans": {"type": "array", "items": {"type": "number"}}}, "required": ["Deinococcus radiodurans", "Homo sapiens", "Caenorhabditis elegans"]}}, "required": ["h2o;ap4a"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"PREVALENCE_BY_GENDER_AGE_YEAR": {"type": "object", "properties": {"TRELLIS_NAME": {"type": "array", "items": {}}, "SERIES_NAME": {"type": "array", "items": {}}, "X_CALENDAR_YEAR": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["TRELLIS_NAME", "SERIES_NAME", "X_CALENDAR_YEAR", "Y_PREVALENCE_1000PP"]}, "PREVALENCE_BY_MONTH": {"type": "object", "properties": {"X_CALENDAR_MONTH": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["X_CALENDAR_MONTH", "Y_PREVALENCE_1000PP"]}, "PROCEDURE_FREQUENCY_DISTRIBUTION": {"type": "object", "properties": {"Y_NUM_PERSONS": {"type": "integer"}, "X_COUNT": {"type": "integer"}}, "required": ["Y_NUM_PERSONS", "X_COUNT"]}, "PROCEDURES_BY_TYPE": {"type": "object", "properties": {"CONCEPT_NAME": {"type": "string"}, "COUNT_VALUE": {"type": "integer"}}, "required": ["CONCEPT_NAME", "COUNT_VALUE"]}, "AGE_AT_FIRST_OCCURRENCE": {"type": "object", "properties": {"CATEGORY": {"type": "array", "items": {"type": "string"}}, "MIN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P10_VALUE": {"type": "array", "items": {"type": "integer"}}, "P25_VALUE": {"type": "array", "items": {"type": "integer"}}, "MEDIAN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P75_VALUE": {"type": "array", "items": {"type": "integer"}}, "P90_VALUE": {"type": "array", "items": {"type": "integer"}}, "MAX_VALUE": {"type": "array", "items": {"type": "integer"}}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}}, "required": ["PREVALENCE_BY_GENDER_AGE_YEAR", "PREVALENCE_BY_MONTH", "PROCEDURE_FREQUENCY_DISTRIBUTION", "PROCEDURES_BY_TYPE", "AGE_AT_FIRST_OCCURRENCE"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"PREVALENCE_BY_GENDER_AGE_YEAR" : {"TRELLIS_NAME" : [], "SERIES_NAME" : [], "X_CALENDAR_YEAR" : [], "Y_PREVALENCE_1000PP" : []}, "PREVALENCE_BY_MONTH" : {"X_CALENDAR_MONTH" : [], "Y_PREVALENCE_1000PP" : []}, "PROCEDURE_FREQUENCY_DISTRIBUTION" : {"Y_NUM_PERSONS" : 0, "X_COUNT" : 1}, "PROCEDURES_BY_TYPE" : {"CONCEPT_NAME" : "EHR order list entry", "COUNT_VALUE" : 83}, "AGE_AT_FIRST_OCCURRENCE" : {"CATEGORY" : ["MALE", "FEMALE"], "MIN_VALUE" : [5, 6], "P10_VALUE" : [16, 38], "P25_VALUE" : [52, 51], "MEDIAN_VALUE" : [67, 68], "P75_VALUE" : [79, 85], "P90_VALUE" : [81, 88], "MAX_VALUE" : [99, 95]}}
json_instruct
{"type": "object", "properties": {"PREVALENCE_BY_GENDER_AGE_YEAR": {"type": "object", "properties": {"TRELLIS_NAME": {"type": "array", "items": {}}, "SERIES_NAME": {"type": "array", "items": {}}, "X_CALENDAR_YEAR": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["TRELLIS_NAME", "SERIES_NAME", "X_CALENDAR_YEAR", "Y_PREVALENCE_1000PP"]}, "PREVALENCE_BY_MONTH": {"type": "object", "properties": {"X_CALENDAR_MONTH": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["X_CALENDAR_MONTH", "Y_PREVALENCE_1000PP"]}, "PROCEDURE_FREQUENCY_DISTRIBUTION": {"type": "object", "properties": {"Y_NUM_PERSONS": {"type": "integer"}, "X_COUNT": {"type": "integer"}}, "required": ["Y_NUM_PERSONS", "X_COUNT"]}, "PROCEDURES_BY_TYPE": {"type": "object", "properties": {"CONCEPT_NAME": {"type": "string"}, "COUNT_VALUE": {"type": "integer"}}, "required": ["CONCEPT_NAME", "COUNT_VALUE"]}, "AGE_AT_FIRST_OCCURRENCE": {"type": "object", "properties": {"CATEGORY": {"type": "array", "items": {"type": "string"}}, "MIN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P10_VALUE": {"type": "array", "items": {"type": "integer"}}, "P25_VALUE": {"type": "array", "items": {"type": "integer"}}, "MEDIAN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P75_VALUE": {"type": "array", "items": {"type": "integer"}}, "P90_VALUE": {"type": "array", "items": {"type": "integer"}}, "MAX_VALUE": {"type": "array", "items": {"type": "integer"}}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}}, "required": ["PREVALENCE_BY_GENDER_AGE_YEAR", "PREVALENCE_BY_MONTH", "PROCEDURE_FREQUENCY_DISTRIBUTION", "PROCEDURES_BY_TYPE", "AGE_AT_FIRST_OCCURRENCE"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Ligni\u00e8res-de-Touraine", "dpt" : "Indre-et-Loire", "inscrits" : 940, "abs" : 105, "votants" : 835, "blancs" : 17, "nuls" : 8, "exp" : 810, "res" : [{"panneau" : "2", "voix" : 202}, {"panneau" : "11", "voix" : 172}, {"panneau" : "3", "voix" : 147}, {"panneau" : "9", "voix" : 142}, {"panneau" : "1", "voix" : 86}, {"panneau" : "4", "voix" : 33}, {"panneau" : "6", "voix" : 9}, {"panneau" : "8", "voix" : 9}, {"panneau" : "5", "voix" : 6}, {"panneau" : "10", "voix" : 3}, {"panneau" : "7", "voix" : 1}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hash" : "0x285ce81ac9ec8077413122152aa852c8c9f3314cf61d9b9c30e99eb462469fff", "parentHash" : "0xd7beea23bb09eec6f4dd221b0006cab53e223fa3194ca9098bfece95ec7a6f91", "number" : 22432, "timestamp" : 1438528146, "nonce" : "0xa7ea0f204991c8b5", "difficulty" : 1039539616208, "gasLimit" : {"_hex" : "0x1388"}, "gasUsed" : {"_hex" : "0x0"}, "miner" : "0xa50ec0D39fa913E62f1Bae7074E6F36caA71855b", "extraData" : "0x476574682f76312e302e302f77696e646f77732f676f312e342e32", "transactions" : []}
json_instruct
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"title": {"type": "string"}, "author": {"type": "string"}, "description": {"type": "string"}, "thumb": {"type": "string"}, "download": {"type": "string"}, "origin": {"type": "string"}}, "required": ["title", "author", "description", "thumb", "download", "origin"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Haku- sex service\uff11\uff18\u6b73\u4ee5\u4e0a\uff01", "author" : "goutouren", "description" : "2Kundefined60\u5e27\u89c6\u9891\u4ee5\u53ca\u66f4\u591a\u5185\u5bb9\u53ef\u4ee5\u8d5e\u52a9undefined/undefined2Kundefined60fpsundefinedvideosundefinedandundefinedmore\uff1a<br><aundefinedhref='https://www.patreon.com/goutouren'>https://www.patreon.com/goutouren</a><br><aundefinedhref='https://afdian.net/@kkkaa'>https://afdian.net/@kkkaa</a>", "thumb" : "//i.iwara.tv/sites/default/files/styles/thumbnail/public/videos/thumbnails/2333724/thumbnail-2333724_0007.jpg?itok=WpT1nUtV", "download" : "https://ecchi.iwara.tv/api/video/aygnlsawnoh8aqr4k", "origin" : "https://ecchi.iwara.tv/videos/aygnlsawnoh8aqr4k"}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "author": {"type": "string"}, "description": {"type": "string"}, "thumb": {"type": "string"}, "download": {"type": "string"}, "origin": {"type": "string"}}, "required": ["title", "author", "description", "thumb", "download", "origin"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"settings": {"type": "array", "items": {"type": "string"}}, "specs": {"type": "object", "properties": {"frame": {"type": "object", "properties": {"type": {"type": "string"}, "config": {"type": "object", "properties": {"deploy": {"type": "boolean"}, "child": {"type": "object", "properties": {"type": {"type": "string"}, "config": {"type": "object", "properties": {"children": {"type": "object", "properties": {"a": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "b": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "c": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "d": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "e": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["a", "b", "c", "d", "e"]}}, "required": ["children"]}}, "required": ["type", "config"]}}, "required": ["deploy", "child"]}}, "required": ["type", "config"]}}, "required": ["frame"]}}, "required": ["settings", "specs"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"settings" : ["master"], "specs" : {"frame" : {"type" : "HTMLFrameMojit", "config" : {"deploy" : true, "child" : {"type" : "Parent", "config" : {"children" : {"a" : {"type" : "Stateful"}, "b" : {"type" : "Stateful"}, "c" : {"type" : "Stateful"}, "d" : {"type" : "Stateful"}, "e" : {"type" : "Stateful"}}}}}}}}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"settings": {"type": "array", "items": {"type": "string"}}, "specs": {"type": "object", "properties": {"frame": {"type": "object", "properties": {"type": {"type": "string"}, "config": {"type": "object", "properties": {"deploy": {"type": "boolean"}, "child": {"type": "object", "properties": {"type": {"type": "string"}, "config": {"type": "object", "properties": {"children": {"type": "object", "properties": {"a": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "b": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "c": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "d": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "e": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["a", "b", "c", "d", "e"]}}, "required": ["children"]}}, "required": ["type", "config"]}}, "required": ["deploy", "child"]}}, "required": ["type", "config"]}}, "required": ["frame"]}}, "required": ["settings", "specs"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"extName": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}, "extDescription": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}}, "required": ["extName", "extDescription"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"extName" : {"message" : "Javascript Coin Miner"}, "extDescription" : {"message" : "Mine for crypto-currency coins (i.e. Monero) in the background while you browse."}}
json_instruct
{"type": "object", "properties": {"extName": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}, "extDescription": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}}, "required": ["extName", "extDescription"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"main": {"type": "string"}}, "required": ["main"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"main" : "Loading.tsx"}
json_instruct
{"type": "object", "properties": {"main": {"type": "string"}}, "required": ["main"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"objects": {"type": "array", "items": {"type": "object", "properties": {"emails": {"type": "string"}, "service_center": {"type": "string"}, "slug": {"type": "string"}, "contact": {"type": "string"}, "name": {"type": "string"}, "website": {"type": "string"}, "id": {"type": "integer"}, "request_form": {"type": "null"}, "contact_phone": {"type": "null"}, "public_liaison": {"type": "string"}, "fax": {"type": "string"}, "notes": {"type": "null"}}, "required": ["emails", "service_center", "slug", "contact", "name", "website", "id", "request_form", "contact_phone", "public_liaison", "fax", "notes"]}}}, "required": ["objects"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"objects" : [{"emails" : "['gsa.foia@gsa.gov']", "service_center" : "Phone: (855) 675-3642", "slug" : "headquarters", "contact" : "['FOIA Contact', 'FOIA Requester Service Center (H1C)', 'Room 7308', '1800 F. Street, NW', 'Washington, DC 20405']", "name" : "Headquarters", "website" : "http://www.gsa.gov/portal/category/21416", "id" : 223, "request_form" : null, "contact_phone" : null, "public_liaison" : "Audrey Corbett Brooks, Phone: (202) 205-5912", "fax" : "202-501-2727", "notes" : null}]}
json_instruct
{"type": "object", "properties": {"objects": {"type": "array", "items": {"type": "object", "properties": {"emails": {"type": "string"}, "service_center": {"type": "string"}, "slug": {"type": "string"}, "contact": {"type": "string"}, "name": {"type": "string"}, "website": {"type": "string"}, "id": {"type": "integer"}, "request_form": {"type": "null"}, "contact_phone": {"type": "null"}, "public_liaison": {"type": "string"}, "fax": {"type": "string"}, "notes": {"type": "null"}}, "required": ["emails", "service_center", "slug", "contact", "name", "website", "id", "request_form", "contact_phone", "public_liaison", "fax", "notes"]}}}, "required": ["objects"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : "610118006001", "text" : "\u79e6\u6e21\u9547\u793e\u533a\u5c45\u59d4\u4f1a"}, {"id" : "610118006202", "text" : "\u5357\u6c99\u6cb3\u6751\u59d4\u4f1a"}, {"id" : "610118006203", "text" : "\u4e54\u5bb6\u5e84\u6751\u59d4\u4f1a"}, {"id" : "610118006204", "text" : "\u738b\u6e2d\u6751\u59d4\u4f1a"}, {"id" : "610118006214", "text" : "\u5f20\u826f\u5be8\u6751\u59d4\u4f1a"}, {"id" : "610118006216", "text" : "\u67a3\u6797\u5be8\u6751\u59d4\u4f1a"}, {"id" : "610118006221", "text" : "\u79b9\u738b\u5e99\u6751\u59d4\u4f1a"}, {"id" : "610118006225", "text" : "\u4e1c\u82b1\u56ed\u6751\u59d4\u4f1a"}, {"id" : "610118006226", "text" : "\u65b0\u9633\u6751\u59d4\u4f1a"}, {"id" : "610118006227", "text" : "\u7236\u6148\u6751\u59d4\u4f1a"}, {"id" : "610118006229", "text" : "\u79e6\u5357\u6751\u59d4\u4f1a"}, {"id" : "610118006230", "text" : "\u767d\u7f8a\u5be8\u6751\u59d4\u4f1a"}, {"id" : "610118006241", "text" : "\u5343\u738b\u6751\u59d4\u4f1a"}, {"id" : "610118006245", "text" : "\u5357\u8c37\u6751\u59d4\u4f1a"}, {"id" : "610118006249", "text" : "\u6b63\u5e84\u6751\u59d4\u4f1a"}, {"id" : "610118006253", "text" : "\u8f9b\u5bb6\u5e84\u6751\u59d4\u4f1a"}, {"id" : "610118006255", "text" : "\u7126\u7f8a\u6751\u59d4\u4f1a"}, {"id" : "610118006256", "text" : "\u5317\u6c99\u6cb3\u5be8\u6751\u59d4\u4f1a"}, {"id" : "610118006257", "text" : "\u7b2c\u4e94\u6865\u6751\u59d4\u4f1a"}, {"id" : "610118006258", "text" : "\u5e9e\u6751\u6751\u59d4\u4f1a"}, {"id" : "610118006259", "text" : "\u5f85\u8bcf\u6751\u59d4\u4f1a"}, {"id" : "610118006260", "text" : "\u79e6\u5317\u6751\u59d4\u4f1a"}, {"id" : "610118006261", "text" : "\u79e6\u4e2d\u6751\u59d4\u4f1a"}, {"id" : "610118006262", "text" : "\u7a3b\u52a1\u5e84\u6751\u59d4\u4f1a"}, {"id" : "610118006263", "text" : "\u897f\u82b1\u56ed\u6751\u59d4\u4f1a"}, {"id" : "610118006264", "text" : "\u4e30\u76db\u5821\u6751\u59d4\u4f1a"}, {"id" : "610118006265", "text" : "\u725b\u4e1c\u6751\u59d4\u4f1a"}, {"id" : "610118006266", "text" : "\u5317\u8c37\u5b50\u7859\u6751\u59d4\u4f1a"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"pagination": {"type": "object", "properties": {"Query": {"type": "object", "properties": {"input_token": {"type": "string"}, "limit_key": {"type": "string"}, "non_aggregate_keys": {"type": "array", "items": {"type": "string"}}, "output_token": {"type": "string"}, "result_key": {"type": "string"}}, "required": ["input_token", "limit_key", "non_aggregate_keys", "output_token", "result_key"]}}, "required": ["Query"]}}, "required": ["pagination"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"pagination" : {"Query" : {"input_token" : "NextToken", "limit_key" : "MaxRows", "non_aggregate_keys" : ["ColumnInfo", "QueryId"], "output_token" : "NextToken", "result_key" : "Rows"}}}
json_instruct
{"type": "object", "properties": {"pagination": {"type": "object", "properties": {"Query": {"type": "object", "properties": {"input_token": {"type": "string"}, "limit_key": {"type": "string"}, "non_aggregate_keys": {"type": "array", "items": {"type": "string"}}, "output_token": {"type": "string"}, "result_key": {"type": "string"}}, "required": ["input_token", "limit_key", "non_aggregate_keys", "output_token", "result_key"]}}, "required": ["Query"]}}, "required": ["pagination"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"source_db": {"type": "string"}, "source_id": {"type": "string"}, "division_id": {"type": "integer"}, "section": {"type": "string"}, "text": {"type": "string"}}, "required": ["source_db", "source_id", "division_id", "section", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"source_db" : "PMC", "source_id" : "3312845", "division_id" : 5, "section" : "Methods", "text" : "Tissue processing\nAt designated time points (non-SE: 12 hr, 1 day, 2 days, 3 days, 4 days and 1 week after SE; n = 5, for each time point), animals were perfused transcardially with phosphate-buffered saline (PBS) followed by 4% paraformaldehyde in 0.1 M phosphate buffer (PB, pH 7.4) under urethane anesthesia (1.5 g/kg, i.p.; Sigma-Aldrich Co., St. Louis, MO). The brains were removed, and postfixed in the same fixative for 4 hr. The brain tissues were cryoprotected by infiltration with 30% sucrose overnight. Thereafter, the entire hippocampus was frozen and sectioned with a cryostat at 30 mum and consecutive sections were contained in six-well plates containing PBS. For stereological study, every sixth section in the series throughout the entire hippocampus was used in some animals."}
json_instruct
{"type": "object", "properties": {"source_db": {"type": "string"}, "source_id": {"type": "string"}, "division_id": {"type": "integer"}, "section": {"type": "string"}, "text": {"type": "string"}}, "required": ["source_db", "source_id", "division_id", "section", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "string"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 60171, "name" : "Pinterest: Compact layout", "description" : "Remove the comments from the index pages of Pinterest.\r\n\r\nThe comments can be seen on the photo detail page.", "user" : {"id" : 11817, "name" : "Dave Liney", "email" : "redacted", "paypal_email" : null, "homepage" : null, "about" : null, "license" : "publicdomain"}, "updated" : "2014-04-23T11:43:19.000Z", "weekly_install_count" : 2, "total_install_count" : 1434, "rating" : null, "after_screenshot_name" : "https://userstyles.org/style_screenshots/60171_after.jpeg?r=1618733357", "obsoleting_style_id" : null, "obsoleting_style_name" : null, "obsolete" : 0, "admin_delete_reason_id" : null, "obsoletion_message" : null, "screenshots" : null, "license" : null, "created" : "2012-01-31T13:50:56.000Z", "category" : "site", "raw_subcategory" : "pinterest", "subcategory" : "pinterest", "additional_info" : "Refresh the page after applying the style.", "style_tags" : [], "css" : "@namespace url(http://www.w3.org/1999/xhtml);\r\n\r\n@-moz-document domain(\"pinterest.com\") {\r\n\r\ndiv.pinMeta,\r\ndiv.richPinMeta,\r\ndiv.pinCredits \r\n{ display: none !important;} \r\n\r\ndiv.pin {\r\ndisplay: inline !important;\r\nwidth: 200px !important;\r\nheight: auto !important;\r\n\r\n} \r\n\r\n}", "discussions" : [], "discussionsCount" : 0, "commentsCount" : 0, "userjs_url" : "/styles/userjs/60171/pinterest-compact-layout.user.js", "style_settings" : []}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "string"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"type": {"type": "string"}, "title": {"type": "string"}, "id": {"type": "string"}, "bbox": {"type": "array", "items": {"type": "number"}}, "description": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}}, "required": ["type", "geometry", "properties"]}}}, "required": ["type", "title", "id", "bbox", "description", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "FeatureCollection", "title" : "Via Cornelia", "id" : "741499023", "bbox" : [12.486137, 41.891775, 12.486137, 41.891775], "description" : "The Via Cornelia was an ancient road that ran along the north side of the circus Gai et Neronis. The road diverged from the Via Triumphalis west of the pons Neronianus, near a large tomb known as the Meta Romuli.", "features" : [{"type" : "Feature", "geometry" : {"type" : "Point", "coordinates" : [12.486137, 41.891775]}, "properties" : {"description" : "representative point"}}]}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "title": {"type": "string"}, "id": {"type": "string"}, "bbox": {"type": "array", "items": {"type": "number"}}, "description": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}}, "required": ["type", "geometry", "properties"]}}}, "required": ["type", "title", "id", "bbox", "description", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "name": {"type": "string"}, "version": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@sap/site-content-deployer": {"type": "string"}}, "required": ["@sap/site-content-deployer"]}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}}, "required": ["engines", "name", "version", "dependencies", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"engines" : {"node" : "12.x || 14.x"}, "name" : "shine-site-content", "version" : "1.9.0", "dependencies" : {"@sap/site-content-deployer" : "1.9.14"}, "scripts" : {"start" : "node --harmony node_modules/@sap/site-content-deployer/deploy.js"}}
json_instruct
{"type": "object", "properties": {"engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "name": {"type": "string"}, "version": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@sap/site-content-deployer": {"type": "string"}}, "required": ["@sap/site-content-deployer"]}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}}, "required": ["engines", "name", "version", "dependencies", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "array", "items": {"type": "object", "properties": {"article": {"type": "string"}, "views": {"type": "integer"}, "mobile_percentage": {"type": "number"}, "rank": {"type": "integer"}}, "required": ["article", "views", "mobile_percentage", "rank"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"article" : "Tlukankulu", "views" : 24615, "mobile_percentage" : 5.03, "rank" : 1}, {"article" : "cela", "views" : 593, "mobile_percentage" : 0, "rank" : 2}, {"article" : "cedu", "views" : 592, "mobile_percentage" : 0, "rank" : 3}, {"article" : "dikixinari", "views" : 485, "mobile_percentage" : 12.58, "rank" : 4}, {"article" : "What You Want To Know About Tempur marketstrom \u03bc\u03b5\u03c4\u03b1\u03bb\u03bb\u03b9\u03ba\u03b1.", "views" : 370, "mobile_percentage" : 0.27, "rank" : 5}, {"article" : "a", "views" : 324, "mobile_percentage" : 3.09, "rank" : 6}, {"article" : "Main Page", "views" : 207, "mobile_percentage" : 1.45, "rank" : 7}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"article": {"type": "string"}, "views": {"type": "integer"}, "mobile_percentage": {"type": "number"}, "rank": {"type": "integer"}}, "required": ["article", "views", "mobile_percentage", "rank"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"PORT": {"type": "integer"}, "HOST": {"type": "string"}, "SCHEMA": {"type": "string"}, "OUTPUTDIR": {"type": "string"}, "IMAGING_HOSTNAME": {"type": "string"}, "IMAGING_PORT": {"type": "integer"}, "IMAGING_ADMIN_USER": {"type": "string"}, "TOKEN": {"type": "string"}, "USERNAME": {"type": "string"}, "PASSWORD": {"type": "string"}, "LOG_PATH": {"type": "string"}}, "required": ["PORT", "HOST", "SCHEMA", "OUTPUTDIR", "IMAGING_HOSTNAME", "IMAGING_PORT", "IMAGING_ADMIN_USER", "TOKEN", "USERNAME", "PASSWORD", "LOG_PATH"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"PORT" : 2282, "HOST" : "localhost", "SCHEMA" : "base_local", "OUTPUTDIR" : "my_output_folder", "IMAGING_HOSTNAME" : "localhost", "IMAGING_PORT" : 9001, "IMAGING_ADMIN_USER" : "admin", "TOKEN" : "D5ED6A406775FC71B8D2A978883E8ED4", "USERNAME" : "operator", "PASSWORD" : "CastAIP", "LOG_PATH" : ""}
json_instruct
{"type": "object", "properties": {"PORT": {"type": "integer"}, "HOST": {"type": "string"}, "SCHEMA": {"type": "string"}, "OUTPUTDIR": {"type": "string"}, "IMAGING_HOSTNAME": {"type": "string"}, "IMAGING_PORT": {"type": "integer"}, "IMAGING_ADMIN_USER": {"type": "string"}, "TOKEN": {"type": "string"}, "USERNAME": {"type": "string"}, "PASSWORD": {"type": "string"}, "LOG_PATH": {"type": "string"}}, "required": ["PORT", "HOST", "SCHEMA", "OUTPUTDIR", "IMAGING_HOSTNAME", "IMAGING_PORT", "IMAGING_ADMIN_USER", "TOKEN", "USERNAME", "PASSWORD", "LOG_PATH"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[123.125, 32.083333333333336], [123.125, 32.166666666666664], [123.25, 32.166666666666664], [123.25, 32.083333333333336], [123.125, 32.083333333333336]]]}, "properties" : {"code" : 482311, "url" : "http://madefor.github.io/0410/api/v1/482311.geojson", "view" : "https://github.com/madefor/0410/blob/gh-pages/api/v1/482311.geojson"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 85908271, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes", "src:geom" : "quattroshapes", "wof:geomhash" : "4e9932652dc79fa817a56bc0f57797b5", "wof:id" : 85908271, "wof:repo" : "whosonfirst-data-admin-jp"}, "bbox" : [140.737609863, 41.80371983066864, 140.7514249378193, 41.81612545955014], "geometry" : {"coordinates" : [[[140.74264515020798, 41.80407814430004], [140.74184387136256, 41.80371983066864], [140.7405083810159, 41.80407814430004], [140.74035644500003, 41.80407814430004], [140.7403564450002, 41.8041189089118], [140.737609863, 41.80632964245817], [140.737609863, 41.81447358310704], [140.73927619267636, 41.81536425487521], [140.74115212378007, 41.8159333123542], [140.74310302700036, 41.81612545955014], [140.7450539302203, 41.8159333123542], [140.74692986132374, 41.81536425487521], [140.74865872933054, 41.81444015567324], [140.750174094812, 41.81319652736188], [140.7514177231231, 41.81168116188034], [140.7514249378193, 41.81166766413351], [140.74978645123815, 41.80727157130677], [140.74584960900006, 41.8055111052137], [140.74584960900006, 41.80407814430004], [140.74264515020798, 41.80407814430004]]], "type" : "Polygon"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"place_name": {"type": "string"}, "state_name": {"type": "string"}, "state_abbrv": {"type": "string"}, "lat": {"type": "string"}, "long": {"type": "string"}}, "required": ["place_name", "state_name", "state_abbrv", "lat", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"place_name" : "Dillon", "state_name" : "Montana", "state_abbrv" : "MT", "lat" : "45.2339", "long" : "-112.6405"}
json_instruct
{"type": "object", "properties": {"place_name": {"type": "string"}, "state_name": {"type": "string"}, "state_abbrv": {"type": "string"}, "lat": {"type": "string"}, "long": {"type": "string"}}, "required": ["place_name", "state_name", "state_abbrv", "lat", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"value": {"type": "integer"}}, "required": ["value"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"value" : -127}
json_instruct
{"type": "object", "properties": {"value": {"type": "integer"}}, "required": ["value"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"npm": {"type": "string"}, "serialport": {"type": "string"}, "sqlite3": {"type": "string"}}, "required": ["npm", "serialport", "sqlite3"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "nfc_registry", "version" : "1.0.0", "description" : "", "main" : "index.js", "scripts" : {"start" : "node index.js"}, "author" : "Ricardo Romero", "license" : "ISC", "dependencies" : {"npm" : "^6.4.1", "serialport" : "^6.2.1", "sqlite3" : "^4.0.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"npm": {"type": "string"}, "serialport": {"type": "string"}, "sqlite3": {"type": "string"}}, "required": ["npm", "serialport", "sqlite3"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"text": {"type": "string"}, "created": {"type": "string"}, "type": {"type": "string"}, "permalink": {"type": "string"}}, "required": ["text", "created", "type", "permalink"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"text" : "The Trump <a href=\"https://www.theguardian.com/us-news/2017/jun/12/donald-trump-first-cabinet-meeting-praise\">cabinet</a> act like they're being <a href=\"https://en.wikipedia.org/wiki/Duress_code\">held</a> hostage.", "created" : "Tue, 13 Jun 2017 00:03:00 GMT", "type" : "outline", "permalink" : "http://scripting.com/2017/06/12.html#a080600"}
json_instruct
{"type": "object", "properties": {"text": {"type": "string"}, "created": {"type": "string"}, "type": {"type": "string"}, "permalink": {"type": "string"}}, "required": ["text", "created", "type", "permalink"], "$schema": "http://json-schema.org/draft-07/schema#"}