input stringlengths 159 2.05k | output stringlengths 5 10.3k | task stringclasses 1
value | schema stringlengths 100 1.99k |
|---|---|---|---|
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"id_7039": {"type": "object", "properties": {"publicdate": {"type": "string"}, "title": {"type": "string"}}, "required": ["publicdate", "title"]}}, "required": ["id_7039"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id_7039" : {"publicdate" : "2012-09-14 02:06:46", "title" : "Basil, or, Honesty and Industry"}} | json_instruct | {"type": "object", "properties": {"id_7039": {"type": "object", "properties": {"publicdate": {"type": "string"}, "title": {"type": "string"}}, "required": ["publicdate", "title"]}}, "required": ["id_7039"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"data": {"type": "object", "properties": {"site": {"type": "object", "properties": {"siteMetadata": {"type": "object", "properties": {"title": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}}, "required": ["title", "description", "author"]}}, "required": ["siteMetadata"]}}, "required": ["site"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"data" : {"site" : {"siteMetadata" : {"title" : "Tanzil Chowduray | Software Engineer", "description" : "Kick off your next, great Gatsby project with this default starter. This barebones starter ships with the main Gatsby configuration files you might need.", "author" : "Tanzil Chowdhury"}}}} | json_instruct | {"type": "object", "properties": {"data": {"type": "object", "properties": {"site": {"type": "object", "properties": {"siteMetadata": {"type": "object", "properties": {"title": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}}, "required": ["title", "description", "author"]}}, "required": ["siteMetadata"]}}, "required": ["site"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "id"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"]}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : {"type" : "Feature", "properties" : {"name" : "\u5b9a\u5174\u53bf", "id" : "130626"}, "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[115.867345, 39.1338430000001], [115.863922148438, 39.1460353828126], [115.855152617188, 39.1372658515625], [115.856358671875, 39.1129811835938], [115.832345, 39.1315944648438], [115.805421171875, 39.1107228828126], [115.77330203125, 39.1251528144532], [115.763892851563, 39.1072927070313], [115.757345, 39.103843], [115.7141809375, 39.0968849921875], [115.654058867188, 39.1322267890625], [115.642896757813, 39.1182900214844], [115.594928007813, 39.1093959785156], [115.542896757813, 39.1293959785157], [115.511793242188, 39.1382900214844], [115.507345, 39.153843], [115.52326296875, 39.1579274726563], [115.53599734375, 39.2075551582031], [115.531065703125, 39.2295510078126], [115.5734778125, 39.2537599921875], [115.59142703125, 39.2797585273438], [115.62326296875, 39.2879274726562], [115.627345, 39.313843], [115.67271609375, 39.3092153144531], [115.700162382813, 39.2939015937501], [115.72197390625, 39.3192153144532], [115.787345, 39.333843], [115.801519804688, 39.3080178046876], [115.904166289063, 39.2995864082031], [115.885201445313, 39.2697145820313], [115.913170195313, 39.2496681953125], [115.929244414063, 39.2272426582032], [115.942965117188, 39.2299538398438], [115.951519804688, 39.2180178046875], [115.96345828125, 39.2094618964844], [115.951353789063, 39.1488466621094], [115.953350859375, 39.1387612128907], [115.947345, 39.113843], [115.933985625, 39.107202375], [115.883985625, 39.1067263007813], [115.895494414063, 39.1302931953125], [115.867345, 39.1338430000001]]]]}}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "id"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"]}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"_id" : "vh0ydwvc", "accession" : "KY781188.1", "definition" : "Watermelon crinkle leaf-associated virus 2 isolate KF-15 segment RNA2", "host" : "Citrullus lanatus (watermelon)", "sequence" : "CTAGGTCCCCATTTTTGTTTTTTTGATTTTAGCTTTTTGATTTTTTTGTTTTTTGTCATTTTTTTACTTTTTTTTGGATTTTAACATCTTAATTTATCAACACAGAAACCTATGAATAAACACTGAACTAAAGTAAATGATACTCATTTTAAACATTCATGTCTCAAATTCATTGAATTTGATCCCCTTCATCAGCCTTTCTTCCTTAGACTTCAGAACCTCAACATCCACTTCTTCATCTGAGATATCTGAAATCTTAGCTTTTAACTTTTCTTTGAGTTTCTTCTTTAATTCAGCTGTATTCACTTTGATCTCATCATCTGATTCAGGGTCAACAGAGTTGACATAAGCATCTTGTAGAGGAACTCTAGAATTGTTTAAATGATCCCAACCCTTGGCAAATGTCTTTTTAGTTTTGGGTCCTTTAACTTTGACCCCCATAGATGACTTTGCGTAAATTACTTCCTCCAAATCATCCTTTATCGGTTCTGTTTCATCACAAATATCACCACTCTCATACATGTCCCTAACAACCTTCCTTTGGGTTTCTGTGACAGTGGTGTCAACAACATTGGGATTGGTGGTATAATTTTCCAGCAATGATCGGGGCATTCCAACAACAGCAATAACTTCCTTCAAGTTCTCATTATAAGGAGCATCAGACTGTTCTATGATTAACATCATTTGTAAAGTCCCCCACTGCTCTCCTCTGATTAAAAATGCTTGTTCTAAAGCAACATTCAGGATGATTTTGTCAGCACTCTCCCTTGGTATACAGTAGTCTAGAGATAGTTCAAATTTCTCAGGAACATTGGAGTTGAACCTGACAACTTGCACCGATTGGTCTGTTAATTTCCGAATGTCTGTAAGATCTACACATACTCTAGAGAAATCGGAAAATGATGAGACAAGAGGAGTGTAAATACCAATCAGAGAAGCCAACCTTATGTATGGCTTTCCTTTCTTCATGTTAACAACCTCACTAAGATTAAATTGCTTACAATCTTCAACCAGTTTTATCAAAGGCAACTCCATTTCAGGATCAACTATCTTAGATCTTCTAAAATTGAACGTGACAACTTTTCTTACTCTTGATTCATATGATTCTCCTTTTGAACCAACTAAGGCAACATACTGAAACCTCTTTCCTTCTTCATAACTTTTAAGCAAGTTTTTAAATCCCTGGTCTGATGTTGGCAAATCAAACTTATGTAGTTGGCGTTTTGCATGGTTCATTGCATCTCTTGCCACCTGCTCATTTTTTGAAGACCCAATAATATCCTTTTTAGATTTATTGTCATCAATAACCTGGTTTTGAAAACTAGGTTTACTGTTAGAAGACTTTGAACGCGAGAACATCTTTCTCATAATTATTTTTAAAGCAAATGGTTTAGAACACTTATGTGTTGAGAGATCTTTGTGT"} | json_instruct | {"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"links": {"type": "array", "items": {"type": "string"}}}, "required": ["links"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"links" : ["https://chat.whatsapp.com/Dqdjz7aSWJj0IyORAsdYom", "https://chat.whatsapp.com/LIX42RUhLi15MBXhfvrF6K", "https://chat.whatsapp.com/FIorsXNysk91fkdaIst2HH"]} | json_instruct | {"type": "object", "properties": {"links": {"type": "array", "items": {"type": "string"}}}, "required": ["links"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"ast" : null, "code" : "var _interopRequireDefault = require(\"@babel/runtime/helpers/interopRequireDefault\");\n\nObject.defineProperty(exports, \"__esModule\", {\n value: true\n});\nexports.default = void 0;\n\nvar _PanResponder = _interopRequireDefault(require(\"../../vendor/react-native/PanResponder\"));\n\nvar _default = _PanResponder.default;\nexports.default = _default;", "map" : {"version" : 3, "sources" : ["E:/GitHub/ReactNative-Mini-Apps/mightyapp/node_modules/react-native-web/dist/exports/PanResponder/index.js"], "names" : ["PanResponder"], "mappings" : ";;;;;;;AAAA;;eACeA,qB", "sourcesContent" : ["import PanResponder from '../../vendor/react-native/PanResponder';\nexport default PanResponder;"]}, "metadata" : {}, "sourceType" : "script"} | json_instruct | {"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"meta": {"type": "object", "properties": {"scheme_code": {"type": "integer"}, "scheme_name": {"type": "string"}, "ISIN_Div_Payout_or_ISIN_Growth": {"type": "string"}, "ISIN_Div_Reinvestment": {"type": "string"}, "fund_house": {"type": "string"}, "category": {"type": "string"}}, "required": ["scheme_code", "scheme_name", "ISIN_Div_Payout_or_ISIN_Growth", "ISIN_Div_Reinvestment", "fund_house", "category"]}, "data": {"type": "array", "items": {"type": "object", "properties": {"nav": {"type": "number"}, "repurchasePrice": {"type": "number"}, "salePrice": {"type": "number"}, "date": {"type": "string"}}, "required": ["nav", "repurchasePrice", "salePrice", "date"]}}}, "required": ["meta", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"meta" : {"scheme_code" : 105313, "scheme_name" : "DWS FIXED TERM FUND SERIES 28-DIV", "ISIN_Div_Payout_or_ISIN_Growth" : "NA", "ISIN_Div_Reinvestment" : "NA", "fund_house" : "Deutsche Mutual Fund", "category" : "Open Ended Schemes ( Growth )"}, "data" : [{"nav" : 10.0, "repurchasePrice" : 9.9, "salePrice" : 0.0, "date" : "26-Jun-2007"}, {"nav" : 10.2545, "repurchasePrice" : 10.152, "salePrice" : 0.0, "date" : "20-Jun-2007"}, {"nav" : 10.233, "repurchasePrice" : 10.1307, "salePrice" : 0.0, "date" : "13-Jun-2007"}, {"nav" : 10.2116, "repurchasePrice" : 10.1095, "salePrice" : 0.0, "date" : "06-Jun-2007"}, {"nav" : 10.1905, "repurchasePrice" : 10.0886, "salePrice" : 0.0, "date" : "30-May-2007"}, {"nav" : 10.1694, "repurchasePrice" : 10.0677, "salePrice" : 0.0, "date" : "23-May-2007"}, {"nav" : 10.1484, "repurchasePrice" : 10.0469, "salePrice" : 0.0, "date" : "16-May-2007"}, {"nav" : 10.1273, "repurchasePrice" : 10.026, "salePrice" : 0.0, "date" : "09-May-2007"}, {"nav" : 10.1093, "repurchasePrice" : 10.0082, "salePrice" : 0.0, "date" : "03-May-2007"}, {"nav" : 10.0852, "repurchasePrice" : 9.9843, "salePrice" : 0.0, "date" : "25-Apr-2007"}, {"nav" : 10.0642, "repurchasePrice" : 9.9636, "salePrice" : 0.0, "date" : "18-Apr-2007"}, {"nav" : 10.0425, "repurchasePrice" : 9.9421, "salePrice" : 0.0, "date" : "11-Apr-2007"}, {"nav" : 10.0208, "repurchasePrice" : 9.9206, "salePrice" : 0.0, "date" : "04-Apr-2007"}]} | json_instruct | {"type": "object", "properties": {"meta": {"type": "object", "properties": {"scheme_code": {"type": "integer"}, "scheme_name": {"type": "string"}, "ISIN_Div_Payout_or_ISIN_Growth": {"type": "string"}, "ISIN_Div_Reinvestment": {"type": "string"}, "fund_house": {"type": "string"}, "category": {"type": "string"}}, "required": ["scheme_code", "scheme_name", "ISIN_Div_Payout_or_ISIN_Growth", "ISIN_Div_Reinvestment", "fund_house", "category"]}, "data": {"type": "array", "items": {"type": "object", "properties": {"nav": {"type": "number"}, "repurchasePrice": {"type": "number"}, "salePrice": {"type": "number"}, "date": {"type": "string"}}, "required": ["nav", "repurchasePrice", "salePrice", "date"]}}}, "required": ["meta", "data"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "wildnature:block/jungle_log_pressure_plate"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"next_comment_id": {"type": "integer"}, "user_name": {"type": "string"}, "hub": {"type": "string"}, "post_like": {"type": "object", "properties": {"1K4soFRspSpy1W1m5qfzrfvctcaGYDo5oZ_1491424487": {"type": "integer"}, "1NMQg35towsw6gUbiKuKFz84aBwu4GMuox_1": {"type": "integer"}, "1C2GCzmXkTBpKRFh9HBYCRvztAQNjAFwkf_1": {"type": "integer"}, "1KZRoBGGZaoGQdqknbx5EZ57qQvskq4yQG_1": {"type": "integer"}, "1DnYKzcW2BdbBJe21jhDnc1r7K84xK1Spf_1": {"type": "integer"}, "1MR98neS5p1xHMdSF55UuUsNnP594o7XB4_1": {"type": "integer"}, "16gsu1zPmA3tzayT4ujRAXi4uSmnhn7nVM_1": {"type": "integer"}}, "required": ["1K4soFRspSpy1W1m5qfzrfvctcaGYDo5oZ_1491424487", "1NMQg35towsw6gUbiKuKFz84aBwu4GMuox_1", "1C2GCzmXkTBpKRFh9HBYCRvztAQNjAFwkf_1", "1KZRoBGGZaoGQdqknbx5EZ57qQvskq4yQG_1", "1DnYKzcW2BdbBJe21jhDnc1r7K84xK1Spf_1", "1MR98neS5p1xHMdSF55UuUsNnP594o7XB4_1", "16gsu1zPmA3tzayT4ujRAXi4uSmnhn7nVM_1"]}, "comment": {"type": "array", "items": {}}}, "required": ["next_comment_id", "user_name", "hub", "post_like", "comment"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"next_comment_id" : 1, "user_name" : "Fragmentation", "hub" : "1oranGeS2xsKZ4jVsu9SVttzgkYXu4k9v", "post_like" : {"1K4soFRspSpy1W1m5qfzrfvctcaGYDo5oZ_1491424487" : 1491428428, "1NMQg35towsw6gUbiKuKFz84aBwu4GMuox_1" : 1491428431, "1C2GCzmXkTBpKRFh9HBYCRvztAQNjAFwkf_1" : 1491433142, "1KZRoBGGZaoGQdqknbx5EZ57qQvskq4yQG_1" : 1491433147, "1DnYKzcW2BdbBJe21jhDnc1r7K84xK1Spf_1" : 1491460590, "1MR98neS5p1xHMdSF55UuUsNnP594o7XB4_1" : 1491460592, "16gsu1zPmA3tzayT4ujRAXi4uSmnhn7nVM_1" : 1491460714}, "comment" : []} | json_instruct | {"type": "object", "properties": {"next_comment_id": {"type": "integer"}, "user_name": {"type": "string"}, "hub": {"type": "string"}, "post_like": {"type": "object", "properties": {"1K4soFRspSpy1W1m5qfzrfvctcaGYDo5oZ_1491424487": {"type": "integer"}, "1NMQg35towsw6gUbiKuKFz84aBwu4GMuox_1": {"type": "integer"}, "1C2GCzmXkTBpKRFh9HBYCRvztAQNjAFwkf_1": {"type": "integer"}, "1KZRoBGGZaoGQdqknbx5EZ57qQvskq4yQG_1": {"type": "integer"}, "1DnYKzcW2BdbBJe21jhDnc1r7K84xK1Spf_1": {"type": "integer"}, "1MR98neS5p1xHMdSF55UuUsNnP594o7XB4_1": {"type": "integer"}, "16gsu1zPmA3tzayT4ujRAXi4uSmnhn7nVM_1": {"type": "integer"}}, "required": ["1K4soFRspSpy1W1m5qfzrfvctcaGYDo5oZ_1491424487", "1NMQg35towsw6gUbiKuKFz84aBwu4GMuox_1", "1C2GCzmXkTBpKRFh9HBYCRvztAQNjAFwkf_1", "1KZRoBGGZaoGQdqknbx5EZ57qQvskq4yQG_1", "1DnYKzcW2BdbBJe21jhDnc1r7K84xK1Spf_1", "1MR98neS5p1xHMdSF55UuUsNnP594o7XB4_1", "16gsu1zPmA3tzayT4ujRAXi4uSmnhn7nVM_1"]}, "comment": {"type": "array", "items": {}}}, "required": ["next_comment_id", "user_name", "hub", "post_like", "comment"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "object", "properties": {"appId": {"type": "string"}, "title": {"type": "string"}, "timestamp": {"type": "integer"}, "rating": {"type": "string"}, "notes": {"type": "string"}, "os": {"type": "string"}, "gpuDriver": {"type": "string"}, "specs": {"type": "string"}, "protonVersion": {"type": "string"}}, "required": ["appId", "title", "timestamp", "rating", "notes", "os", "gpuDriver", "specs", "protonVersion"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"appId" : "343360", "title" : "Particula", "timestamp" : 1536266782, "rating" : "Platinum", "notes" : "Flawless, but could not fine anyone to test it online.", "os" : "Ubuntu 18.04.1 (kernel 4.15.0-33)", "gpuDriver" : "NVIDIA 396.54 GTX1060 6gb", "specs" : "FX8350", "protonVersion" : "Default"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"appId": {"type": "string"}, "title": {"type": "string"}, "timestamp": {"type": "integer"}, "rating": {"type": "string"}, "notes": {"type": "string"}, "os": {"type": "string"}, "gpuDriver": {"type": "string"}, "specs": {"type": "string"}, "protonVersion": {"type": "string"}}, "required": ["appId", "title", "timestamp", "rating", "notes", "os", "gpuDriver", "specs", "protonVersion"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {"0.1.0": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "0.1.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "0.2.0": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "0.2.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["0.1.0", "0.1.1", "0.2.0", "0.2.1"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"latest_version" : ["0.2.1"], "meta" : {"description" : "Django static site generator for DEBUG and production", "homepage" : "https://github.com/carltongibson/django-staticsite", "license" : "BSD"}, "versions" : {"0.1.0" : {"sha256" : "c3e76842770ccba645f6b379148d92a337fc49f6ab225ea2014f07dd1dd0fd78", "url" : "https://files.pythonhosted.org/packages/18/14/a58376aaa161d7fd35f40c3adfff052c9c1df715d7de31fc9c343305e6fa/django-staticsite-0.1.0.tar.gz"}, "0.1.1" : {"sha256" : "c34ce10454480602770b6c60f62ff7a57003267bae04a20ede8cc9fc2559ece1", "url" : "https://files.pythonhosted.org/packages/7f/68/5b549a09c73d43be1220e650da23970c25bea9e864d790dd6db6097ee3a0/django-staticsite-0.1.1.tar.gz"}, "0.2.0" : {"sha256" : "c741740f659de4f2b11fcf38a36becfc0cde98e245bc2e0183d4227dfdda18d6", "url" : "https://files.pythonhosted.org/packages/e6/e0/15dcac8ccf41822fecc39b4e80b5648c7f859ac367e928b9186100138726/django-staticsite-0.2.0.tar.gz"}, "0.2.1" : {"sha256" : "b7c7d8db044ba740ce4e5be3c681ed5263447caa0aa8aef05191c29c538c4d91", "url" : "https://files.pythonhosted.org/packages/7e/8b/51702973f790143d29f7ed9919904508459031145086066b58cedd4febf2/django-staticsite-0.2.1.tar.gz"}}} | json_instruct | {"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {"0.1.0": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "0.1.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "0.2.0": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "0.2.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["0.1.0", "0.1.1", "0.2.0", "0.2.1"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}, "address": {"type": "string"}, "school_type": {"type": "string"}, "fax": {"type": "string"}, "phone": {"type": "string"}, "website": {"type": "string"}, "email": {"type": "string"}, "state": {"type": "string"}, "programs": {"type": "object", "properties": {"programs": {"type": "array", "items": {"type": "string"}}}, "required": ["programs"]}, "full_time_school": {"type": "boolean"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["name", "id", "address", "school_type", "fax", "phone", "website", "email", "state", "programs", "full_time_school", "lon", "lat"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Freiherr-vom-Stein-Schule St\u00e4dt. Realschule - Sekundarstufe I -", "id" : "NRW-161482", "address" : "Grimpingstr. 30, 48653 Coesfeld", "school_type" : "Realschule", "fax" : "", "phone" : "02541 3706", "website" : " http://fvst-coe.de", "email" : " 161482@schule.nrw.de ", "state" : "NRW", "programs" : {"programs" : ["Be smart - don't Start"]}, "full_time_school" : false, "lon" : 7.173034, "lat" : 51.936232} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}, "address": {"type": "string"}, "school_type": {"type": "string"}, "fax": {"type": "string"}, "phone": {"type": "string"}, "website": {"type": "string"}, "email": {"type": "string"}, "state": {"type": "string"}, "programs": {"type": "object", "properties": {"programs": {"type": "array", "items": {"type": "string"}}}, "required": ["programs"]}, "full_time_school": {"type": "boolean"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["name", "id", "address", "school_type", "fax", "phone", "website", "email", "state", "programs", "full_time_school", "lon", "lat"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"\u5de5\u5ee0\u540d\u7a31" : "\u83ef\u5be6\u8208\u696d\u80a1\u4efd\u6709\u9650\u516c\u53f8\u4e8c\u5ee0", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f" : "20000037", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f" : "", "\u5de5\u5ee0\u5730\u5740" : "\u5609\u7fa9\u5e02\u6771\u5340\u5f8c\u6e56\u91cc\u4fdd\u5fe0\u4e00\u8857\uff13\uff15\uff19\u865f", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc" : "\u5609\u7fa9\u5e02\u6771\u5340\u5f8c\u6e56\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d" : "\u4f55\u52c7\u9b4f", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f" : "66622084", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b" : "\u80a1\u4efd\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f" : "", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f" : "1030618", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b" : "\u751f\u7522\u4e2d", "\u7522\u696d\u985e\u5225" : ["19\u5316\u5b78\u88fd\u54c1\u88fd\u9020\u696d", "28\u96fb\u529b\u8a2d\u5099\u88fd\u9020\u696d"], "\u4e3b\u8981\u7522\u54c1" : ["194\u5316\u7ca7\u54c1", "285\u5bb6\u7528\u96fb\u5668"]} | json_instruct | {"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"translation-revision-date": {"type": "string"}, "generator": {"type": "string"}, "domain": {"type": "string"}, "locale_data": {"type": "object", "properties": {"messages": {"type": "object", "properties": {"": {"type": "object", "properties": {"domain": {"type": "string"}, "plural-forms": {"type": "string"}, "lang": {"type": "string"}}, "required": ["domain", "plural-forms", "lang"]}, "You are about to permanently delete this menu.\n'Cancel' to stop, 'OK' to delete.": {"type": "array", "items": {"type": "string"}}, "missing menu item navigation label\u0004(no label)": {"type": "array", "items": {"type": "string"}}, "The changes you made will be lost if you navigate away from this page.": {"type": "array", "items": {"type": "string"}}, "No results found.": {"type": "array", "items": {"type": "string"}}}, "required": ["", "You are about to permanently delete this menu.\n'Cancel' to stop, 'OK' to delete.", "missing menu item navigation label\u0004(no label)", "The changes you made will be lost if you navigate away from this page.", "No results found."]}}, "required": ["messages"]}, "comment": {"type": "object", "properties": {"reference": {"type": "string"}}, "required": ["reference"]}}, "required": ["translation-revision-date", "generator", "domain", "locale_data", "comment"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"translation-revision-date" : "2020-12-08 09:32:15+0000", "generator" : "GlotPress/3.0.0-alpha.2", "domain" : "messages", "locale_data" : {"messages" : {"" : {"domain" : "messages", "plural-forms" : "nplurals=1; plural=0;", "lang" : "zh_TW"}, "You are about to permanently delete this menu.\n'Cancel' to stop, 'OK' to delete." : ["\u9019\u9805\u64cd\u4f5c\u6703\u6c38\u4e45\u522a\u9664\u9019\u500b\u9078\u55ae\u3002\n\u9ede\u64ca [\u53d6\u6d88] \u4ee5\u505c\u6b62\u64cd\u4f5c\uff0c\u9ede\u64ca [\u78ba\u5b9a] \u4ee5\u9032\u884c\u522a\u9664\u3002"], "missing menu item navigation label\u0004(no label)" : ["(\u7121\u6a19\u7c64)"], "The changes you made will be lost if you navigate away from this page." : ["\u5982\u679c\u96e2\u958b\u9019\u500b\u9801\u9762\uff0c\u4fbf\u6703\u5931\u53bb\u4e4b\u524d\u6240\u505a\u7684\u5168\u90e8\u8b8a\u66f4\u3002"], "No results found." : ["\u627e\u4e0d\u5230\u7b26\u5408\u689d\u4ef6\u7684\u641c\u5c0b\u7d50\u679c\u3002"]}}, "comment" : {"reference" : "wp-admin/js/nav-menu.js"}} | json_instruct | {"type": "object", "properties": {"translation-revision-date": {"type": "string"}, "generator": {"type": "string"}, "domain": {"type": "string"}, "locale_data": {"type": "object", "properties": {"messages": {"type": "object", "properties": {"": {"type": "object", "properties": {"domain": {"type": "string"}, "plural-forms": {"type": "string"}, "lang": {"type": "string"}}, "required": ["domain", "plural-forms", "lang"]}, "You are about to permanently delete this menu.\n'Cancel' to stop, 'OK' to delete.": {"type": "array", "items": {"type": "string"}}, "missing menu item navigation label\u0004(no label)": {"type": "array", "items": {"type": "string"}}, "The changes you made will be lost if you navigate away from this page.": {"type": "array", "items": {"type": "string"}}, "No results found.": {"type": "array", "items": {"type": "string"}}}, "required": ["", "You are about to permanently delete this menu.\n'Cancel' to stop, 'OK' to delete.", "missing menu item navigation label\u0004(no label)", "The changes you made will be lost if you navigate away from this page.", "No results found."]}}, "required": ["messages"]}, "comment": {"type": "object", "properties": {"reference": {"type": "string"}}, "required": ["reference"]}}, "required": ["translation-revision-date", "generator", "domain", "locale_data", "comment"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"bioUrl": {"type": "string"}, "social": {"type": "object", "properties": {"twitter": {"type": "string"}, "github": {"type": "string"}, "linkedin": {"type": "string"}, "instagram": {"type": "string"}}, "required": ["twitter", "github", "linkedin", "instagram"]}, "colors": {"type": "object", "properties": {"light": {"type": "object", "properties": {"background": {"type": "string"}, "foreground": {"type": "string"}, "yellow": {"type": "string"}, "green": {"type": "string"}, "gray": {"type": "string"}, "blue": {"type": "string"}, "red": {"type": "string"}}, "required": ["background", "foreground", "yellow", "green", "gray", "blue", "red"]}, "dark": {"type": "object", "properties": {"background": {"type": "string"}, "foreground": {"type": "string"}, "yellow": {"type": "string"}, "green": {"type": "string"}, "gray": {"type": "string"}, "blue": {"type": "string"}, "red": {"type": "string"}}, "required": ["background", "foreground", "yellow", "green", "gray", "blue", "red"]}}, "required": ["light", "dark"]}}, "required": ["bioUrl", "social", "colors"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"bioUrl" : "https://raw.githubusercontent.com/jonbeibeibei/beitoshi-site/master/readme-self.md", "social" : {"twitter" : "JONBEIBEIBEI", "github" : "jonbeibeibei", "linkedin" : "jonathan-bei-74193a112", "instagram" : "Jonathanbei"}, "colors" : {"light" : {"background" : "#FBF1C9", "foreground" : "#3C3836", "yellow" : "#D79921", "green" : "#98971A", "gray" : "#7C6F64", "blue" : "#458588", "red" : "#CA2124"}, "dark" : {"background" : "#24292e", "foreground" : "#e1e4e8", "yellow" : "#f1ab70", "green" : "#85dc6e", "gray" : "#5f737d", "blue" : "#4dacff", "red" : "#f97583"}}} | json_instruct | {"type": "object", "properties": {"bioUrl": {"type": "string"}, "social": {"type": "object", "properties": {"twitter": {"type": "string"}, "github": {"type": "string"}, "linkedin": {"type": "string"}, "instagram": {"type": "string"}}, "required": ["twitter", "github", "linkedin", "instagram"]}, "colors": {"type": "object", "properties": {"light": {"type": "object", "properties": {"background": {"type": "string"}, "foreground": {"type": "string"}, "yellow": {"type": "string"}, "green": {"type": "string"}, "gray": {"type": "string"}, "blue": {"type": "string"}, "red": {"type": "string"}}, "required": ["background", "foreground", "yellow", "green", "gray", "blue", "red"]}, "dark": {"type": "object", "properties": {"background": {"type": "string"}, "foreground": {"type": "string"}, "yellow": {"type": "string"}, "green": {"type": "string"}, "gray": {"type": "string"}, "blue": {"type": "string"}, "red": {"type": "string"}}, "required": ["background", "foreground", "yellow", "green", "gray", "blue", "red"]}}, "required": ["light", "dark"]}}, "required": ["bioUrl", "social", "colors"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "url": {"type": "string"}}, "required": ["name", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "private": {"type": "boolean"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-assets-inline": {"type": "string"}, "grunt-contrib-clean": {"type": "string"}, "grunt-contrib-copy": {"type": "string"}, "grunt-contrib-csslint": {"type": "string"}, "grunt-contrib-cssmin": {"type": "string"}, "grunt-contrib-htmlmin": {"type": "string"}, "grunt-contrib-jshint": {"type": "string"}, "grunt-contrib-uglify": {"type": "string"}, "grunt-eslint": {"type": "string"}, "grunt-htmllint": {"type": "string"}, "grunt-replace": {"type": "string"}, "grunt-svgmin": {"type": "string"}}, "required": ["grunt", "grunt-assets-inline", "grunt-contrib-clean", "grunt-contrib-copy", "grunt-contrib-csslint", "grunt-contrib-cssmin", "grunt-contrib-htmlmin", "grunt-contrib-jshint", "grunt-contrib-uglify", "grunt-eslint", "grunt-htmllint", "grunt-replace", "grunt-svgmin"]}}, "required": ["name", "version", "description", "author", "keywords", "repository", "private", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Evangelion-Clock-Screensaver", "version" : "1.1.1", "description" : "A digital clock screensaver inspired by the graphical interfaces from Neon Genesis Evengelion.", "author" : {"name" : "Pascal Wagler", "url" : "https://github.com/Wandmalfarbe"}, "keywords" : ["install", "modules", "package manager", "package.json"], "repository" : {"type" : "git", "url" : "https://github.com/Wandmalfarbe/evangelion-clock-screensaver"}, "private" : false, "license" : "BSD-3-Clause", "devDependencies" : {"grunt" : "^1.4.1", "grunt-assets-inline" : "^1.2.4", "grunt-contrib-clean" : "^2.0.0", "grunt-contrib-copy" : "^1.0.0", "grunt-contrib-csslint" : "^2.0.0", "grunt-contrib-cssmin" : "^4.0.0", "grunt-contrib-htmlmin" : "^3.1.0", "grunt-contrib-jshint" : "^3.1.1", "grunt-contrib-uglify" : "^5.0.1", "grunt-eslint" : "^24.0.0", "grunt-htmllint" : "^0.3.0", "grunt-replace" : "^2.0.2", "grunt-svgmin" : "^6.0.1"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "url": {"type": "string"}}, "required": ["name", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "private": {"type": "boolean"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-assets-inline": {"type": "string"}, "grunt-contrib-clean": {"type": "string"}, "grunt-contrib-copy": {"type": "string"}, "grunt-contrib-csslint": {"type": "string"}, "grunt-contrib-cssmin": {"type": "string"}, "grunt-contrib-htmlmin": {"type": "string"}, "grunt-contrib-jshint": {"type": "string"}, "grunt-contrib-uglify": {"type": "string"}, "grunt-eslint": {"type": "string"}, "grunt-htmllint": {"type": "string"}, "grunt-replace": {"type": "string"}, "grunt-svgmin": {"type": "string"}}, "required": ["grunt", "grunt-assets-inline", "grunt-contrib-clean", "grunt-contrib-copy", "grunt-contrib-csslint", "grunt-contrib-cssmin", "grunt-contrib-htmlmin", "grunt-contrib-jshint", "grunt-contrib-uglify", "grunt-eslint", "grunt-htmllint", "grunt-replace", "grunt-svgmin"]}}, "required": ["name", "version", "description", "author", "keywords", "repository", "private", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : "1808057001", "district_id" : "1808057", "name" : "PASIRAN JAYA"}, {"id" : "1808057002", "district_id" : "1808057", "name" : "BRATASENA MANDIRI"}, {"id" : "1808057003", "district_id" : "1808057", "name" : "BRATASENA ADIWARNA"}, {"id" : "1808057004", "district_id" : "1808057", "name" : "SUNGAI NIBUNG"}, {"id" : "1808057005", "district_id" : "1808057", "name" : "MAHABANG"}, {"id" : "1808057006", "district_id" : "1808057", "name" : "KUALA TELADAS"}, {"id" : "1808057007", "district_id" : "1808057", "name" : "KEKATUNG"}, {"id" : "1808057008", "district_id" : "1808057", "name" : "TELADAS"}, {"id" : "1808057009", "district_id" : "1808057", "name" : "WAY DENTE"}, {"id" : "1808057010", "district_id" : "1808057", "name" : "DENTE MAKMUR"}, {"id" : "1808057011", "district_id" : "1808057", "name" : "PENDOWO ASRI"}, {"id" : "1808057012", "district_id" : "1808057", "name" : "SUNGAI BURUNG"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"id": {"type": "integer"}, "surahNumber": {"type": "string"}, "ayatNumber": {"type": "string"}, "arabic": {"type": "string"}, "english": {"type": "string"}, "bengali": {"type": "string"}}, "required": ["id", "surahNumber", "ayatNumber", "arabic", "english", "bengali"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 4627, "surahNumber" : "049", "ayatNumber" : "015", "arabic" : "\u0625\u0650\u0646\u0651\u064e\u0645\u064e\u0627 \u0627\u0644\u0652\u0645\u064f\u0624\u0652\u0645\u0650\u0646\u064f\u0648\u0646\u064e \u0627\u0644\u0651\u064e\u0630\u0650\u064a\u0646\u064e \u0622\u0645\u064e\u0646\u064f\u0648\u0627 \u0628\u0650\u0627\u0644\u0644\u0651\u064e\u0647\u0650 \u0648\u064e\u0631\u064e\u0633\u064f\u0648\u0644\u0650\u0647\u0650 \u062b\u064f\u0645\u0651\u064e \u0644\u064e\u0645\u0652 \u064a\u064e\u0631\u0652\u062a\u064e\u0627\u0628\u064f\u0648\u0627 \u0648\u064e\u062c\u064e\u0627\u0647\u064e\u062f\u064f\u0648\u0627 \u0628\u0650\u0623\u064e\u0645\u0652\u0648\u064e\u0627\u0644\u0650\u0647\u0650\u0645\u0652 \u0648\u064e\u0623\u064e\u0646\u0652\u0641\u064f\u0633\u0650\u0647\u0650\u0645\u0652 \u0641\u0650\u064a \u0633\u064e\u0628\u0650\u064a\u0644\u0650 \u0627\u0644\u0644\u0651\u064e\u0647\u0650 \u06da \u0623\u064f\u0648\u0644\u064e\u0670\u0626\u0650\u0643\u064e \u0647\u064f\u0645\u064f \u0627\u0644\u0635\u0651\u064e\u0627\u062f\u0650\u0642\u064f\u0648\u0646\u064e", "english" : "Only those are the believers who have believed in Allah and His Messenger, and afterward doubt not but strive with their wealth and their lives for the Cause of Allah. Those! They are the truthful.", "bengali" : "\u09a4\u09be\u09b0\u09be\u0987 \u09ae\u09c1\u09ae\u09bf\u09a8, \u09af\u09be\u09b0\u09be \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u0993 \u09a4\u09be\u0981\u09b0 \u09b0\u09b8\u09c2\u09b2\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u0988\u09ae\u09be\u09a8 \u0986\u09a8\u09be\u09b0 \u09aa\u09b0 \u09b8\u09a8\u09cd\u09a6\u09c7\u09b9 \u09aa\u09c7\u09be\u09b7\u09a3 \u0995\u09b0\u09c7 \u09a8\u09be \u098f\u09ac\u0982 \u0986\u09b2\u09cd\u09b2\u09be\u09b9\u09b0 \u09aa\u09a5\u09c7 \u09aa\u09cd\u09b0\u09be\u09a3 \u0993 \u09a7\u09a8-\u09b8\u09ae\u09cd\u09aa\u09a6 \u09a6\u09cd\u09ac\u09be\u09b0\u09be \u099c\u09c7\u09b9\u09be\u09a6 \u0995\u09b0\u09c7\u0964 \u09a4\u09be\u09b0\u09be\u0987 \u09b8\u09a4\u09cd\u09af\u09a8\u09bf\u09b7\u09cd\u09a0\u0964"} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "surahNumber": {"type": "string"}, "ayatNumber": {"type": "string"}, "arabic": {"type": "string"}, "english": {"type": "string"}, "bengali": {"type": "string"}}, "required": ["id", "surahNumber", "ayatNumber", "arabic", "english", "bengali"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : "653125402500", "text" : "\u826f\u79cd\u751f\u4ea7\u5927\u961f\u961f"}, {"id" : "653125402501", "text" : "\u94c1\u70ed\u5df4\u683c\u751f\u4ea7\u5927\u961f"}, {"id" : "653125402502", "text" : "\u7c73\u590f\u751f\u4ea7\u5927\u961f\u961f"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"expected": {"type": "array", "items": {"type": "number"}}, "lambda": {"type": "array", "items": {"type": "number"}}}, "required": ["expected", "lambda"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"expected" : [2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0, 2.0], "lambda" : [18.107263815018957, 0.22555644988740298, 13.92306502222025, 5.228845130892168, 15.610932279953879, 10.073863215004323, 15.366443082008544, 3.9805881403929977, 13.176795339056152, 9.615462645208757, 13.318893285992864, 12.471049580644245, 2.912469061535772, 19.35145468086928, 7.653170164993646, 12.69823409783028, 17.893279470391043, 19.552594974206585, 4.9892771232332045, 10.871437196707117, 8.44976234553073, 14.363583359987793, 17.563469708999232, 4.669554567104357, 0.4327985638564069, 15.327748585617043, 7.269190385226909, 15.3960565481384, 13.130875209715178, 17.449166391462697, 8.840521260800273, 18.71758787436077, 9.696143166721578, 4.3200929494330875, 14.31544162540359, 17.023549784916856, 14.673329071638538, 12.906689356633208, 12.223477035128374, 2.7702101159234127, 16.76428731288528, 1.1004906967682437, 12.488945049747455, 17.013665726135685, 3.6006513681906327, 9.427721247429277, 18.275733183400654, 9.260074424739813, 7.83195514151914, 15.047716559371889]} | json_instruct | {"type": "object", "properties": {"expected": {"type": "array", "items": {"type": "number"}}, "lambda": {"type": "array", "items": {"type": "number"}}}, "required": ["expected", "lambda"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "dependencies": {"type": "object", "properties": {"angular-busy": {"type": "string"}}, "required": ["angular-busy"]}}, "required": ["name", "version", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "passmanager", "version" : "0.1", "dependencies" : {"angular-busy" : "latest"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "dependencies": {"type": "object", "properties": {"angular-busy": {"type": "string"}}, "required": ["angular-busy"]}}, "required": ["name", "version", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"attributes": {"type": "object", "properties": {"su": {"type": "boolean"}}, "required": ["su"]}, "courseCode": {"type": "string"}, "courseCredit": {"type": "string"}, "description": {"type": "string"}, "faculty": {"type": "string"}, "title": {"type": "string"}}, "required": ["attributes", "courseCode", "courseCredit", "description", "faculty", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"attributes" : {"su" : true}, "courseCode" : "PF1101", "courseCredit" : "4", "description" : "The module covers the fundamental concepts of project management, identifying nine broad project management knowledge areas. Students are given an introduction to theories relating to the management of project scope, time, cost, risk, quality, human resources, communications and procurement. The overall intergration of these eight knowledge areas and the management of externalities as the ninth project management knowledge area is also emphasised.", "faculty" : "Design and Environment", "title" : "Fundamentals of Project Management"} | json_instruct | {"type": "object", "properties": {"attributes": {"type": "object", "properties": {"su": {"type": "boolean"}}, "required": ["su"]}, "courseCode": {"type": "string"}, "courseCredit": {"type": "string"}, "description": {"type": "string"}, "faculty": {"type": "string"}, "title": {"type": "string"}}, "required": ["attributes", "courseCode", "courseCredit", "description", "faculty", "title"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "main": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "directories": {"type": "object", "properties": {"doc": {"type": "string"}, "test": {"type": "string"}}, "required": ["doc", "test"]}, "dependencies": {"type": "object", "properties": {"debug": {"type": "string"}, "newman": {"type": "string"}}, "required": ["debug", "newman"]}, "devDependencies": {"type": "object", "properties": {"should": {"type": "string"}}, "required": ["should"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "description", "keywords", "main", "repository", "directories", "dependencies", "devDependencies", "scripts", "author", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "newman-reporter-json-stream-detail", "version" : "0.0.3", "description" : "a json reporter for newman", "keywords" : ["postman", "newman", "marimo"], "main" : "lib/index.js", "repository" : {"type" : "git", "url" : "https://github.com/lawrips/newman-reporter-json-stream-detail.git"}, "directories" : {"doc" : "docs", "test" : "test"}, "dependencies" : {"debug" : "^2.2.0", "newman" : "^3.0.1"}, "devDependencies" : {"should" : "^9.0.0"}, "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "author" : "", "license" : "MIT"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "main": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "directories": {"type": "object", "properties": {"doc": {"type": "string"}, "test": {"type": "string"}}, "required": ["doc", "test"]}, "dependencies": {"type": "object", "properties": {"debug": {"type": "string"}, "newman": {"type": "string"}}, "required": ["debug", "newman"]}, "devDependencies": {"type": "object", "properties": {"should": {"type": "string"}}, "required": ["should"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}}, "required": ["name", "version", "description", "keywords", "main", "repository", "directories", "dependencies", "devDependencies", "scripts", "author", "license"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"d3-time-format.js": {"type": "string"}, "d3-time-format.min.js": {"type": "string"}}, "required": ["d3-time-format.js", "d3-time-format.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"d3-time-format.js" : "sha256-ZS94L4Kgn0z3HykZqDI2BMuR3SIVHuyl0OsY/dYtHrs=", "d3-time-format.min.js" : "sha256-jZnIBvLOVI+Ht6M7fTI4Jk24H4lbHtbv2c7fhqC7KiA="} | json_instruct | {"type": "object", "properties": {"d3-time-format.js": {"type": "string"}, "d3-time-format.min.js": {"type": "string"}}, "required": ["d3-time-format.js", "d3-time-format.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"title": {"type": "string"}, "version": {"type": "string"}, "models": {"type": "string"}, "views": {"type": "string"}, "controllers": {"type": "string"}, "routes": {"type": "string"}, "locales": {"type": "string"}, "logs": {"type": "string"}, "static": {"type": "string"}, "view engine": {"type": "string"}, "x-powered-by": {"type": "null"}, "express-session": {"type": "object", "properties": {"secret": {"type": "string"}, "key": {"type": "string"}, "saveUninitialized": {"type": "boolean"}, "resave": {"type": "boolean"}}, "required": ["secret", "key", "saveUninitialized", "resave"]}, "i18n": {"type": "object", "properties": {"locales": {"type": "array", "items": {"type": "string"}}, "updateFiles": {"type": "boolean"}}, "required": ["locales", "updateFiles"]}, "socket": {"type": "boolean"}}, "required": ["title", "version", "models", "views", "controllers", "routes", "locales", "logs", "static", "view engine", "x-powered-by", "express-session", "i18n", "socket"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Altar JS", "version" : "1.0", "models" : "app/models", "views" : "app/views", "controllers" : "app/controllers", "routes" : "app/routes", "locales" : "app/locales", "logs" : "logs", "static" : "public", "view engine" : "jade", "x-powered-by" : null, "express-session" : {"secret" : "app_super_secret", "key" : "app.sid", "saveUninitialized" : true, "resave" : true}, "i18n" : {"locales" : ["en", "fr"], "updateFiles" : false}, "socket" : true} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "version": {"type": "string"}, "models": {"type": "string"}, "views": {"type": "string"}, "controllers": {"type": "string"}, "routes": {"type": "string"}, "locales": {"type": "string"}, "logs": {"type": "string"}, "static": {"type": "string"}, "view engine": {"type": "string"}, "x-powered-by": {"type": "null"}, "express-session": {"type": "object", "properties": {"secret": {"type": "string"}, "key": {"type": "string"}, "saveUninitialized": {"type": "boolean"}, "resave": {"type": "boolean"}}, "required": ["secret", "key", "saveUninitialized", "resave"]}, "i18n": {"type": "object", "properties": {"locales": {"type": "array", "items": {"type": "string"}}, "updateFiles": {"type": "boolean"}}, "required": ["locales", "updateFiles"]}, "socket": {"type": "boolean"}}, "required": ["title", "version", "models", "views", "controllers", "routes", "locales", "logs", "static", "view engine", "x-powered-by", "express-session", "i18n", "socket"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"objects": {"type": "object", "properties": {"vectile": {"type": "object", "properties": {"type": {"type": "string"}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"id": {"type": "integer"}, "nazev": {"type": "string"}}, "required": ["id", "nazev"]}, "clipped": {"type": "boolean"}, "id": {"type": "string"}}, "required": ["arcs", "type", "properties", "clipped", "id"]}}}, "required": ["type", "geometries"]}}, "required": ["vectile"]}, "type": {"type": "string"}, "transform": {"type": "object", "properties": {"translate": {"type": "array", "items": {"type": "number"}}, "scale": {"type": "array", "items": {"type": "number"}}}, "required": ["translate", "scale"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}}, "required": ["objects", "type", "transform", "arcs"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"objects" : {"vectile" : {"type" : "GeometryCollection", "geometries" : [{"arcs" : [[0]], "type" : "Polygon", "properties" : {"id" : 43, "nazev" : "Ji\ufffd\ufffdn"}, "clipped" : true, "id" : "e18fe3488f"}, {"arcs" : [[1]], "type" : "Polygon", "properties" : {"id" : 46, "nazev" : "Trutnov"}, "clipped" : true, "id" : "3d8ed19207"}]}}, "type" : "Topology", "transform" : {"translate" : [15.688476562500002, 50.42951794712287], "scale" : [4.29153442382639e-05, 2.733014970479619e-05]}, "arcs" : [[[0, 489], [69, 6], [-39, -256], [-30, -34], [0, 284]], [[0, 205], [30, 34], [39, 256], [-69, -6], [0, 535], [1024, 0], [0, -1024], [-1024, 0], [0, 205]]]} | json_instruct | {"type": "object", "properties": {"objects": {"type": "object", "properties": {"vectile": {"type": "object", "properties": {"type": {"type": "string"}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"id": {"type": "integer"}, "nazev": {"type": "string"}}, "required": ["id", "nazev"]}, "clipped": {"type": "boolean"}, "id": {"type": "string"}}, "required": ["arcs", "type", "properties", "clipped", "id"]}}}, "required": ["type", "geometries"]}}, "required": ["vectile"]}, "type": {"type": "string"}, "transform": {"type": "object", "properties": {"translate": {"type": "array", "items": {"type": "number"}}, "scale": {"type": "array", "items": {"type": "number"}}}, "required": ["translate", "scale"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}}, "required": ["objects", "type", "transform", "arcs"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"throws": {"type": "string"}}, "required": ["throws"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"throws" : "Object pattern can't contain getter or setter (1:8)"} | json_instruct | {"type": "object", "properties": {"throws": {"type": "string"}}, "required": ["throws"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"index.js": {"type": "string"}, "index.min.js": {"type": "string"}}, "required": ["index.js", "index.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"index.js" : "sha512-IMmvPKldjMt2EvKDyWrMfszybxPBEunk5hGkr/aece/ODTw34C1glY3m9x2UOumVFFrtFRJKrqe0LZ1Rxl39Iw==", "index.min.js" : "sha512-aHs4dOPD11sWkU4kmLRU7W/ri1Y+A7H4q8TlvPvhzBwg+m9GB5kI9PLUbVf0uYOg4hnkhagVhgDgQGS0SeA2vg=="} | json_instruct | {"type": "object", "properties": {"index.js": {"type": "string"}, "index.min.js": {"type": "string"}}, "required": ["index.js", "index.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"id": {"type": "string"}, "variable1": {"type": "number"}, "variable2": {"type": "number"}, "variable3": {"type": "string"}}, "required": ["id", "variable1", "variable2", "variable3"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "170900050204", "variable1" : 0.9736, "variable2" : 1.1692, "variable3" : "B"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "variable1": {"type": "number"}, "variable2": {"type": "number"}, "variable3": {"type": "string"}}, "required": ["id", "variable1", "variable2", "variable3"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"BornInAnElevator": {"type": "array", "items": {"type": "string"}}}, "required": ["BornInAnElevator"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"BornInAnElevator" : ["ExactlyWhatItSaysOnTheTin", "ElevatorFailure", "UncomfortableElevatorMoment", "SitCom", "DeliveryGuy", "MaternityCrisis", "LockedInAFreezer", "InstantBirthJustAddWater", "ScreamingBirth", "TheHero", "DeliveryGuy", "Lampshaded", "CrazyPrepared", "NotThatKindOfDoctor", "DeliveryGuy", "ChristmasEpisode", "DeliveryGuy", "TruthInTelevision"]} | json_instruct | {"type": "object", "properties": {"BornInAnElevator": {"type": "array", "items": {"type": "string"}}}, "required": ["BornInAnElevator"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {"1.0.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.1.0": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["1.0.1", "1.1.0"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"latest_version" : ["1.1.0"], "meta" : {"description" : "Unpadded Base64", "homepage" : "None", "license" : "None"}, "versions" : {"1.0.1" : {"sha256" : "00ce2b68da751c8189688fe2c14381a6a2846d61c9a5ffce1db9a645d09744d8", "url" : "https://files.pythonhosted.org/packages/58/50/007a7d801b8e5843d6f873291c4d304a5d97056f39c27235193f9392842e/unpaddedbase64-1.0.1-py2.py3-none-any.whl"}, "1.1.0" : {"sha256" : "8917367e4e915b7dce1a72a99db8798c9f3d0d9a74cdd9aafac6d7c65ca495c5", "url" : "https://files.pythonhosted.org/packages/d9/ee/6eff0c493c4cab61f17dfa65c058d1e8d2bf4ce33f44e1bc5c4834479dbc/unpaddedbase64-1.1.0-py2-none-any.whl"}}} | json_instruct | {"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {"1.0.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.1.0": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["1.0.1", "1.1.0"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "supplier_id": {"type": "integer"}, "grn_date": {"type": "string"}, "sup_name": {"type": "string"}, "sup_address": {"type": "string"}, "sup_city": {"type": "string"}, "grn_remarks": {"type": "string"}, "created_at": {"type": "string"}, "updated_at": {"type": "string"}, "inventory_item_id": {"type": "array", "items": {"type": "integer"}}, "grn_quantity": {"type": "string"}, "grn_id": {"type": "integer"}, "grn_item_remarks": {"type": "string"}, "grn_item_id": {"type": "integer"}, "inventory_date": {"type": "string"}, "inventory_quantity": {"type": "string"}, "inventory_balance": {"type": "string"}}, "required": ["id", "supplier_id", "grn_date", "sup_name", "sup_address", "sup_city", "grn_remarks", "created_at", "updated_at", "inventory_item_id", "grn_quantity", "grn_id", "grn_item_remarks", "grn_item_id", "inventory_date", "inventory_quantity", "inventory_balance"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : 1, "supplier_id" : 6, "grn_date" : "2017-10-11", "sup_name" : "Naveen", "sup_address" : "bomiriya, kaduwela", "sup_city" : "colombo", "grn_remarks" : "nothing", "created_at" : "2017-10-11 04:28:38", "updated_at" : "2017-10-11 04:28:38", "inventory_item_id" : [2, 3], "grn_quantity" : "65.00", "grn_id" : 73, "grn_item_remarks" : "wqdsd", "grn_item_id" : 51, "inventory_date" : "2017-10-11", "inventory_quantity" : "65.00", "inventory_balance" : "65.00"}, {"id" : 2, "supplier_id" : 6, "grn_date" : "2017-10-11", "sup_name" : "Naveen", "sup_address" : "bomiriya, kaduwela", "sup_city" : "colombo", "grn_remarks" : "nothing", "created_at" : "2017-10-11 04:28:38", "updated_at" : "2017-10-11 04:28:38", "inventory_item_id" : [222, 223], "grn_quantity" : "65.00", "grn_id" : 73, "grn_item_remarks" : "wqdsd", "grn_item_id" : 51, "inventory_date" : "2017-10-11", "inventory_quantity" : "65.00", "inventory_balance" : "65.00"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "supplier_id": {"type": "integer"}, "grn_date": {"type": "string"}, "sup_name": {"type": "string"}, "sup_address": {"type": "string"}, "sup_city": {"type": "string"}, "grn_remarks": {"type": "string"}, "created_at": {"type": "string"}, "updated_at": {"type": "string"}, "inventory_item_id": {"type": "array", "items": {"type": "integer"}}, "grn_quantity": {"type": "string"}, "grn_id": {"type": "integer"}, "grn_item_remarks": {"type": "string"}, "grn_item_id": {"type": "integer"}, "inventory_date": {"type": "string"}, "inventory_quantity": {"type": "string"}, "inventory_balance": {"type": "string"}}, "required": ["id", "supplier_id", "grn_date", "sup_name", "sup_address", "sup_city", "grn_remarks", "created_at", "updated_at", "inventory_item_id", "grn_quantity", "grn_id", "grn_item_remarks", "grn_item_id", "inventory_date", "inventory_quantity", "inventory_balance"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"sources": {"type": "array", "items": {"type": "object", "properties": {"file": {"type": "string"}}, "required": ["file"]}}, "target": {"type": "object", "properties": {"labels": {"type": "array", "items": {"type": "string"}}, "name": {"type": "string"}}, "required": ["labels", "name"]}}, "required": ["sources", "target"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"sources" : [{"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/CMakeFiles/Ext_GenericParameters"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/CMakeFiles/Ext_GenericParameters.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/CMakeFiles/Ext_GenericParameters-complete.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/GenericParameters/src/Ext_GenericParameters-stamp/Ext_GenericParameters-install.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/GenericParameters/src/Ext_GenericParameters-stamp/Ext_GenericParameters-mkdir.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/GenericParameters/src/Ext_GenericParameters-stamp/Ext_GenericParameters-download.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/GenericParameters/src/Ext_GenericParameters-stamp/Ext_GenericParameters-update.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/GenericParameters/src/Ext_GenericParameters-stamp/Ext_GenericParameters-patch.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/GenericParameters/src/Ext_GenericParameters-stamp/Ext_GenericParameters-configure.rule"}, {"file" : "/home/prabhat/Desktop/Mestrado/PositionBasedDynamics/GenericParameters/src/Ext_GenericParameters-stamp/Ext_GenericParameters-build.rule"}], "target" : {"labels" : ["Ext_GenericParameters"], "name" : "Ext_GenericParameters"}} | json_instruct | {"type": "object", "properties": {"sources": {"type": "array", "items": {"type": "object", "properties": {"file": {"type": "string"}}, "required": ["file"]}}, "target": {"type": "object", "properties": {"labels": {"type": "array", "items": {"type": "string"}}, "name": {"type": "string"}}, "required": ["labels", "name"]}}, "required": ["sources", "target"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"name" : "RADMILA", "frequency" : 8945, "gender" : "female"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"path": {"type": "string"}, "shard_id": {"type": "integer"}, "network_size": {"type": "integer"}, "vbft": {"type": "object", "properties": {"n": {"type": "integer"}, "c": {"type": "integer"}, "k": {"type": "integer"}, "l": {"type": "integer"}, "block_msg_delay": {"type": "integer"}, "hash_msg_delay": {"type": "integer"}, "peer_handshake_timeout": {"type": "integer"}, "max_block_change_view": {"type": "integer"}, "admin_ont_id": {"type": "string"}, "min_init_stake": {"type": "integer"}, "vrf_value": {"type": "string"}, "vrf_proof": {"type": "string"}}, "required": ["n", "c", "k", "l", "block_msg_delay", "hash_msg_delay", "peer_handshake_timeout", "max_block_change_view", "admin_ont_id", "min_init_stake", "vrf_value", "vrf_proof"]}}, "required": ["path", "shard_id", "network_size", "vbft"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"path" : "wallets/wallet1.dat", "shard_id" : 1, "network_size" : 1, "vbft" : {"n" : 7, "c" : 2, "k" : 7, "l" : 112, "block_msg_delay" : 10000, "hash_msg_delay" : 10000, "peer_handshake_timeout" : 10, "max_block_change_view" : 5, "admin_ont_id" : "did:ont:ARiwjLzjzLKZy8V43vm6yUcRG9b56DnZtY", "min_init_stake" : 10000, "vrf_value" : "1c9810aa9822e511d5804a9c4db9dd08497c31087b0daafa34d768a3253441fa20515e2f30f81741102af0ca3cefc4818fef16adb825fbaa8cad78647f3afb590e", "vrf_proof" : "c57741f934042cb8d8b087b44b161db56fc3ffd4ffb675d36cd09f83935be853d8729f3f5298d12d6fd28d45dde515a4b9d7f67682d182ba5118abf451ff1988"}} | json_instruct | {"type": "object", "properties": {"path": {"type": "string"}, "shard_id": {"type": "integer"}, "network_size": {"type": "integer"}, "vbft": {"type": "object", "properties": {"n": {"type": "integer"}, "c": {"type": "integer"}, "k": {"type": "integer"}, "l": {"type": "integer"}, "block_msg_delay": {"type": "integer"}, "hash_msg_delay": {"type": "integer"}, "peer_handshake_timeout": {"type": "integer"}, "max_block_change_view": {"type": "integer"}, "admin_ont_id": {"type": "string"}, "min_init_stake": {"type": "integer"}, "vrf_value": {"type": "string"}, "vrf_proof": {"type": "string"}}, "required": ["n", "c", "k", "l", "block_msg_delay", "hash_msg_delay", "peer_handshake_timeout", "max_block_change_view", "admin_ont_id", "min_init_stake", "vrf_value", "vrf_proof"]}}, "required": ["path", "shard_id", "network_size", "vbft"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"module_path": {"type": "string"}, "param_class": {"type": "string"}, "role": {"type": "object", "properties": {"guest": {"type": "object", "properties": {"program": {"type": "string"}}, "required": ["program"]}, "host": {"type": "object", "properties": {"program": {"type": "string"}}, "required": ["program"]}}, "required": ["guest", "host"]}}, "required": ["module_path", "param_class", "role"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"module_path" : "federatedml/statistic/norm_data", "param_class" : "federatedml/param/norm_data_param.py/NormDataParam", "role" : {"guest" : {"program" : "norm_data_guest.py/NormDataGuest"}, "host" : {"program" : "norm_data_host.py/NormDataHost"}}} | json_instruct | {"type": "object", "properties": {"module_path": {"type": "string"}, "param_class": {"type": "string"}, "role": {"type": "object", "properties": {"guest": {"type": "object", "properties": {"program": {"type": "string"}}, "required": ["program"]}, "host": {"type": "object", "properties": {"program": {"type": "string"}}, "required": ["program"]}}, "required": ["guest", "host"]}}, "required": ["module_path", "param_class", "role"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"dailyDeaths": {"type": "array", "items": {"type": "integer"}}}, "required": ["dailyDeaths"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"dailyDeaths" : [0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 2, 1, 1, 1, 0, 1, 2, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]} | json_instruct | {"type": "object", "properties": {"dailyDeaths": {"type": "array", "items": {"type": "integer"}}}, "required": ["dailyDeaths"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"snapshots": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "regions": {"type": "array", "items": {"type": "string"}}, "created_at": {"type": "string"}, "resource_id": {"type": "integer"}, "resource_type": {"type": "string"}, "min_disk_size": {"type": "integer"}, "size_gigabytes": {"type": "number"}}, "required": ["id", "name", "regions", "created_at", "resource_id", "resource_type", "min_disk_size", "size_gigabytes"]}}, "links": {"type": "object", "properties": {"pages": {"type": "object", "properties": {"last": {"type": "string"}}, "required": ["last"]}}, "required": ["pages"]}, "meta": {"type": "object", "properties": {"total": {"type": "integer"}}, "required": ["total"]}}, "required": ["snapshots", "links", "meta"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"snapshots" : [{"id" : 6372321, "name" : "5.10 x64", "regions" : ["nyc1", "ams1", "sfo1", "nyc2", "ams2", "sgp1", "lon1", "nyc3", "ams3", "fra1", "tor1"], "created_at" : "2014-09-26T16:40:18Z", "resource_id" : 2713828, "resource_type" : "droplet", "min_disk_size" : 20, "size_gigabytes" : 1.42}], "links" : {"pages" : {"last" : "https://api.digitalocean.com/v2/snapshots?page=1&per_page=1"}}, "meta" : {"total" : 1}} | json_instruct | {"type": "object", "properties": {"snapshots": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "regions": {"type": "array", "items": {"type": "string"}}, "created_at": {"type": "string"}, "resource_id": {"type": "integer"}, "resource_type": {"type": "string"}, "min_disk_size": {"type": "integer"}, "size_gigabytes": {"type": "number"}}, "required": ["id", "name", "regions", "created_at", "resource_id", "resource_type", "min_disk_size", "size_gigabytes"]}}, "links": {"type": "object", "properties": {"pages": {"type": "object", "properties": {"last": {"type": "string"}}, "required": ["last"]}}, "required": ["pages"]}, "meta": {"type": "object", "properties": {"total": {"type": "integer"}}, "required": ["total"]}}, "required": ["snapshots", "links", "meta"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"namaKab" : "SITUBONDO", "originalFilename" : "003.jpg", "namaPartai" : "Partai NasDem", "id" : 56073, "noUrut" : 1, "nama" : "H.M. FAJRI YUGO RAHMAN", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "SITUBONDO", "originalFilename" : "DSC_10502.jpg", "namaPartai" : "Partai NasDem", "id" : 48198, "noUrut" : 2, "nama" : "M. SAIFUL IMAM ARIFIN, S.Kom", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "SITUBONDO", "originalFilename" : "Untitled.jpg", "namaPartai" : "Partai NasDem", "id" : 230611, "noUrut" : 3, "nama" : "ARI PUJI RAHAYU", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "SITUBONDO", "originalFilename" : "img006.jpg", "namaPartai" : "Partai NasDem", "id" : 267788, "noUrut" : 4, "nama" : "RR. HERDININGSIH", "stringJenisKelamin" : "Perempuan"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"id": {"type": "integer"}, "cites": {"type": "integer"}, "cited_by": {"type": "integer"}, "reference": {"type": "array", "items": {"type": "string"}}}, "required": ["id", "cites", "cited_by", "reference"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 17044, "cites" : 10, "cited_by" : 108, "reference" : ["------ (1975): Perspectives on Inflation, Newsweek.", "------ (2011): The role of expectations in inflation dynamics, Federal Reserve Bank of Boston Conference on Recent Developments in Monetary Policy, Fiscal Policy, and Financial System Design.", "------ (1990): U.S. Inflation, Labor's Share, and the Natural Rate of Unemployment, in Economics of Wage Determination, ed. by H. Koenig, Berlin: Springer-Verlag.", "------ (2011): The History of the Phillips Curve: Consensus and Bifurcation, Economica, 78, 1050.", "------ (2006): Monetary Policy and Inflation Dynamics, International Journal of Central Banking, 2.", "------ (2007): Modelling Inflation Dynamics: A Critical Review of Recent Research, Journal of Money, Credit, and Banking, 39, 155170.", "------ (2008): Phillips Curve Inflation Forecasts, NBER Working Paper, 14322.", "------ (2010): Modeling Inflation After the Crisis, NBER Working Paper, 16488.", "------ (1999): A Historical Analysis of Monetary Policy Rules, in Monetary Policy Rules, National Bureau of Economic Research, NBER Chapters, 319348.", "------ (2010): Sailing into Headwinds: The Uncertain Outlook for the U.S. Economy, Presentation to Joint Meeting of the San Francisco and Salt Lake City Branch Boards of Directors, Salt Lake City, UT."]} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "cites": {"type": "integer"}, "cited_by": {"type": "integer"}, "reference": {"type": "array", "items": {"type": "string"}}}, "required": ["id", "cites", "cited_by", "reference"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 85907433, "type" : "Feature", "properties" : {"src:alt_label" : "mz", "src:geom" : "mz", "wof:geomhash" : "7eeda839bddebd8cb72894c4f464fbe4", "wof:id" : 85907433, "wof:repo" : "whosonfirst-data-admin-ar"}, "bbox" : [46.627593, 24.783038, 46.627593, 24.783038], "geometry" : {"coordinates" : [46.627593, 24.783038], "type" : "Point"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "dependencies": {"type": "object", "properties": {"bluebird": {"type": "string"}, "lodash": {"type": "string"}, "request": {"type": "string"}}, "required": ["bluebird", "lodash", "request"]}, "globalDependencies": {"type": "object", "properties": {"angular": {"type": "string"}, "body-parser": {"type": "string"}, "es6-promise": {"type": "string"}, "express": {"type": "string"}, "express-serve-static-core": {"type": "string"}, "express-session": {"type": "string"}, "jquery": {"type": "string"}, "mime": {"type": "string"}, "node": {"type": "string"}, "node-sass": {"type": "string"}, "node-sass-middleware": {"type": "string"}, "request-promise": {"type": "string"}, "serve-static": {"type": "string"}}, "required": ["angular", "body-parser", "es6-promise", "express", "express-serve-static-core", "express-session", "jquery", "mime", "node", "node-sass", "node-sass-middleware", "request-promise", "serve-static"]}}, "required": ["name", "dependencies", "globalDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "publists", "dependencies" : {"bluebird" : "registry:npm/bluebird#3.3.4+20160515010139", "lodash" : "registry:npm/lodash#4.0.0+20160416211519", "request" : "registry:npm/request#2.69.0+20160428223725"}, "globalDependencies" : {"angular" : "registry:dt/angular#1.5.0+20160517064839", "body-parser" : "registry:dt/body-parser#0.0.0+20160317120654", "es6-promise" : "registry:dt/es6-promise#0.0.0+20160614011821", "express" : "registry:dt/express#4.0.0+20160317120654", "express-serve-static-core" : "registry:dt/express-serve-static-core#0.0.0+20160322035842", "express-session" : "registry:dt/express-session#0.0.0+20160331200931", "jquery" : "registry:dt/jquery#1.10.0+20160417213236", "mime" : "registry:dt/mime#0.0.0+20160316155526", "node" : "registry:dt/node#6.0.0+20160524002506", "node-sass" : "registry:dt/node-sass#0.0.0+20160316155526", "node-sass-middleware" : "registry:dt/node-sass-middleware#0.0.0+20160131121619", "request-promise" : "registry:dt/request-promise#0.4.2+20160316155526", "serve-static" : "registry:dt/serve-static#0.0.0+20160501131543"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "dependencies": {"type": "object", "properties": {"bluebird": {"type": "string"}, "lodash": {"type": "string"}, "request": {"type": "string"}}, "required": ["bluebird", "lodash", "request"]}, "globalDependencies": {"type": "object", "properties": {"angular": {"type": "string"}, "body-parser": {"type": "string"}, "es6-promise": {"type": "string"}, "express": {"type": "string"}, "express-serve-static-core": {"type": "string"}, "express-session": {"type": "string"}, "jquery": {"type": "string"}, "mime": {"type": "string"}, "node": {"type": "string"}, "node-sass": {"type": "string"}, "node-sass-middleware": {"type": "string"}, "request-promise": {"type": "string"}, "serve-static": {"type": "string"}}, "required": ["angular", "body-parser", "es6-promise", "express", "express-serve-static-core", "express-session", "jquery", "mime", "node", "node-sass", "node-sass-middleware", "request-promise", "serve-static"]}}, "required": ["name", "dependencies", "globalDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 404370437, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes_pg", "src:geom" : "quattroshapes_pg", "wof:geomhash" : "e603c0d2cbf1c123587f414a63bc0105", "wof:id" : 404370437, "wof:repo" : "whosonfirst-data-admin-fr"}, "bbox" : [4.3973, 49.7772, 4.3973, 49.7772], "geometry" : {"coordinates" : [4.3973, 49.7772], "type" : "Point"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"Artist": {"type": "string"}, "ColorSpace": {"type": "string"}, "DateTimeOriginal": {"type": "string"}, "ExifIFDPointer": {"type": "string"}, "ExifImageHeight": {"type": "string"}, "ExifImageWidth": {"type": "string"}, "ExifVersion": {"type": "string"}, "Flash": {"type": "string"}, "InteroperabilityIFDPointer": {"type": "string"}, "Make": {"type": "string"}, "Model": {"type": "string"}, "ModifyDate": {"type": "string"}, "ResolutionUnit": {"type": "string"}, "XResolution": {"type": "string"}, "YResolution": {"type": "string"}}, "required": ["Artist", "ColorSpace", "DateTimeOriginal", "ExifIFDPointer", "ExifImageHeight", "ExifImageWidth", "ExifVersion", "Flash", "InteroperabilityIFDPointer", "Make", "Model", "ModifyDate", "ResolutionUnit", "XResolution", "YResolution"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Artist" : "Lavr", "ColorSpace" : "sRGB", "DateTimeOriginal" : "2010:10:06 19:51:54", "ExifIFDPointer" : "161", "ExifImageHeight" : "1536", "ExifImageWidth" : "2048", "ExifVersion" : "0210", "Flash" : "Flash fired", "InteroperabilityIFDPointer" : "273", "Make" : "HTC", "Model" : "HTCX7510", "ModifyDate" : "2010:10:06 19:51:54", "ResolutionUnit" : "2", "XResolution" : "72", "YResolution" : "72"} | json_instruct | {"type": "object", "properties": {"Artist": {"type": "string"}, "ColorSpace": {"type": "string"}, "DateTimeOriginal": {"type": "string"}, "ExifIFDPointer": {"type": "string"}, "ExifImageHeight": {"type": "string"}, "ExifImageWidth": {"type": "string"}, "ExifVersion": {"type": "string"}, "Flash": {"type": "string"}, "InteroperabilityIFDPointer": {"type": "string"}, "Make": {"type": "string"}, "Model": {"type": "string"}, "ModifyDate": {"type": "string"}, "ResolutionUnit": {"type": "string"}, "XResolution": {"type": "string"}, "YResolution": {"type": "string"}}, "required": ["Artist", "ColorSpace", "DateTimeOriginal", "ExifIFDPointer", "ExifImageHeight", "ExifImageWidth", "ExifVersion", "Flash", "InteroperabilityIFDPointer", "Make", "Model", "ModifyDate", "ResolutionUnit", "XResolution", "YResolution"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"type": {"type": "string"}, "id": {"type": "string"}, "properties": {"type": "object", "properties": {"addr:city": {"type": "string"}, "addr:housenumber": {"type": "string"}, "addr:postcode": {"type": "string"}, "addr:street": {"type": "string"}, "contact:website": {"type": "string"}, "name": {"type": "string"}, "shop": {"type": "string"}, "id": {"type": "string"}}, "required": ["addr:city", "addr:housenumber", "addr:postcode", "addr:street", "contact:website", "name", "shop", "id"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}}, "required": ["type", "id", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Feature", "id" : "node/9106130202", "properties" : {"addr:city" : "Cammin", "addr:housenumber" : "4", "addr:postcode" : "18195", "addr:street" : "Siedlungsweg", "contact:website" : "http://www.hof-prangendorf.de", "name" : "Hof Prangendorf", "shop" : "farm", "id" : "node/9106130202"}, "geometry" : {"type" : "Point", "coordinates" : [12.3895186, 54.0079266]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "id": {"type": "string"}, "properties": {"type": "object", "properties": {"addr:city": {"type": "string"}, "addr:housenumber": {"type": "string"}, "addr:postcode": {"type": "string"}, "addr:street": {"type": "string"}, "contact:website": {"type": "string"}, "name": {"type": "string"}, "shop": {"type": "string"}, "id": {"type": "string"}}, "required": ["addr:city", "addr:housenumber", "addr:postcode", "addr:street", "contact:website", "name", "shop", "id"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}}, "required": ["type", "id", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"data": {"type": "array", "items": {"type": "object", "properties": {"x": {"type": "array", "items": {"type": "integer"}}, "y": {"type": "array", "items": {"type": "integer"}}, "type": {"type": "string"}}, "required": ["x", "y", "type"]}}, "layout": {"type": "object", "properties": {"yaxis": {"type": "object", "properties": {"exponentformat": {"type": "string"}, "separatethousands": {"type": "boolean"}}, "required": ["exponentformat", "separatethousands"]}}, "required": ["yaxis"]}}, "required": ["data", "layout"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"data" : [{"x" : [1000, 2000, 3000, 4000], "y" : [1000, 1500, 2000, 10000], "type" : "scatter"}], "layout" : {"yaxis" : {"exponentformat" : "none", "separatethousands" : true}}} | json_instruct | {"type": "object", "properties": {"data": {"type": "array", "items": {"type": "object", "properties": {"x": {"type": "array", "items": {"type": "integer"}}, "y": {"type": "array", "items": {"type": "integer"}}, "type": {"type": "string"}}, "required": ["x", "y", "type"]}}, "layout": {"type": "object", "properties": {"yaxis": {"type": "object", "properties": {"exponentformat": {"type": "string"}, "separatethousands": {"type": "boolean"}}, "required": ["exponentformat", "separatethousands"]}}, "required": ["yaxis"]}}, "required": ["data", "layout"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
| ["shadowsguess"] | json_instruct | {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"key": {"type": "string"}, "suffix": {"type": "string"}, "positions": {"type": "array", "items": {"type": "object", "properties": {"frets": {"type": "string"}, "fingers": {"type": "string"}, "barres": {"type": "string"}, "capo": {"type": "string"}}, "required": ["frets", "fingers", "barres", "capo"]}}}, "required": ["key", "suffix", "positions"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"key" : "G", "suffix" : "maj#11/G#", "positions" : [{"frets" : "425222", "fingers" : "314111", "barres" : "2", "capo" : "true"}, {"frets" : "425422", "fingers" : "214311", "barres" : "2", "capo" : "true"}, {"frets" : "geheee", "fingers" : "314111", "barres" : "14", "capo" : "true"}, {"frets" : "gehgee", "fingers" : "214311", "barres" : "14", "capo" : "true"}, {"frets" : "gegeef", "fingers" : "314112", "barres" : "14", "capo" : "true"}]} | json_instruct | {"type": "object", "properties": {"key": {"type": "string"}, "suffix": {"type": "string"}, "positions": {"type": "array", "items": {"type": "object", "properties": {"frets": {"type": "string"}, "fingers": {"type": "string"}, "barres": {"type": "string"}, "capo": {"type": "string"}}, "required": ["frets", "fingers", "barres", "capo"]}}}, "required": ["key", "suffix", "positions"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "short_name": {"type": "string"}, "start_url": {"type": "string"}, "display": {"type": "string"}, "icons": {"type": "array", "items": {"type": "object", "properties": {"src": {"type": "string"}, "sizes": {"type": "string"}, "type": {"type": "string"}}, "required": ["src", "sizes", "type"]}}}, "required": ["name", "short_name", "start_url", "display", "icons"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Cuckoo Social", "short_name" : "Cuckoo+", "start_url" : "/", "display" : "standalone", "icons" : [{"src" : "favicon/google_plus/favicon-48x48.png", "sizes" : "48x48", "type" : "image/png"}, {"src" : "favicon/google_plus/favicon-72x72.png", "sizes" : "72x72", "type" : "image/png"}, {"src" : "favicon/google_plus/favicon-96x96.png", "sizes" : "96x96", "type" : "image/png"}, {"src" : "favicon/google_plus/favicon-144x144.png", "sizes" : "144x144", "type" : "image/png"}, {"src" : "favicon/google_plus/favicon-192x192.png", "sizes" : "192x192", "type" : "image/png"}]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "short_name": {"type": "string"}, "start_url": {"type": "string"}, "display": {"type": "string"}, "icons": {"type": "array", "items": {"type": "object", "properties": {"src": {"type": "string"}, "sizes": {"type": "string"}, "type": {"type": "string"}}, "required": ["src", "sizes", "type"]}}}, "required": ["name", "short_name", "start_url", "display", "icons"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "null"}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"ast" : null, "code" : "var __jsx = React.createElement;\nimport React from 'react';\nimport CheckIcon from \"../../../../../packages/material-ui-icons/src/Check\";\nimport ToggleButton from \"../../../../../packages/material-ui-lab/src/ToggleButton\";\n\nvar _ref = __jsx(CheckIcon, null);\n\nexport default function StandaloneToggleButton() {\n var _React$useState = React.useState(false),\n selected = _React$useState[0],\n setSelected = _React$useState[1];\n\n return __jsx(ToggleButton, {\n value: \"check\",\n selected: selected,\n onChange: function onChange() {\n setSelected(!selected);\n }\n }, _ref);\n}", "map" : null, "metadata" : {}, "sourceType" : "module"} | json_instruct | {"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "null"}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"examine": {"type": "string"}, "bonuses": {"type": "array", "items": {"type": "integer"}}, "realPrice": {"type": "integer"}}, "required": ["examine", "bonuses", "realPrice"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"examine" : "Blunt steel arrow...ouch", "bonuses" : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 19, 0, 0], "realPrice" : 23} | json_instruct | {"type": "object", "properties": {"examine": {"type": "string"}, "bonuses": {"type": "array", "items": {"type": "integer"}}, "realPrice": {"type": "integer"}}, "required": ["examine", "bonuses", "realPrice"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"variants": {"type": "object", "properties": {"rotated=false": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "rotated=true": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": ["rotated=false", "rotated=true"]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"variants" : {"rotated=false" : {"model" : "oreganized:block/pink_crystal_glass"}, "rotated=true" : {"model" : "oreganized:block/pink_crystal_glass_rot"}}} | json_instruct | {"type": "object", "properties": {"variants": {"type": "object", "properties": {"rotated=false": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "rotated=true": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": ["rotated=false", "rotated=true"]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"parent": {"type": "string"}, "textures": {"type": "object", "properties": {"texture": {"type": "string"}, "particle": {"type": "string"}}, "required": ["texture", "particle"]}, "elements": {"type": "array", "items": {"type": "object", "properties": {"from": {"type": "array", "items": {"type": "number"}}, "to": {"type": "array", "items": {"type": "number"}}, "rotation": {"type": "object", "properties": {"angle": {"type": "integer"}, "axis": {"type": "string"}, "origin": {"type": "array", "items": {"type": "integer"}}}, "required": ["angle", "axis", "origin"]}, "faces": {"type": "object", "properties": {"north": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "east": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "south": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "west": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "up": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "down": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}}, "required": ["north", "east", "south", "west", "up", "down"]}}, "required": ["from", "to", "rotation", "faces"]}}}, "required": ["parent", "textures", "elements"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "minecraft:block/block", "textures" : {"texture" : "thematic:block/mechanical_lantern", "particle" : "#texture"}, "elements" : [{"from" : [4.5, 3, 4.5], "to" : [11.5, 10, 11.5], "rotation" : {"angle" : 0, "axis" : "y", "origin" : [0, 3, 0]}, "faces" : {"north" : {"uv" : [0, 0, 7, 7], "texture" : "#texture"}, "east" : {"uv" : [0, 0, 7, 7], "texture" : "#texture"}, "south" : {"uv" : [0, 0, 7, 7], "texture" : "#texture"}, "west" : {"uv" : [0, 0, 7, 7], "texture" : "#texture"}, "up" : {"uv" : [0, 7, 7, 14], "texture" : "#texture"}, "down" : {"uv" : [0, 7, 7, 14], "texture" : "#texture"}}}, {"from" : [8, 10, 5.5], "to" : [8, 16, 10.5], "shade" : false, "rotation" : {"angle" : 45, "axis" : "y", "origin" : [8, 11, 8]}, "faces" : {"north" : {"uv" : [11, 6, 16, 12], "texture" : "#texture"}, "east" : {"uv" : [11, 6, 16, 12], "texture" : "#texture"}, "south" : {"uv" : [11, 6, 16, 12], "texture" : "#texture"}, "west" : {"uv" : [11, 6, 16, 12], "texture" : "#texture"}, "up" : {"uv" : [11, 6, 16, 12], "texture" : "#texture"}, "down" : {"uv" : [11, 6, 16, 12], "texture" : "#texture"}}}, {"from" : [6.5, 11, 8], "to" : [9.5, 15, 8], "shade" : false, "rotation" : {"angle" : 45, "axis" : "y", "origin" : [8, 11, 8]}, "faces" : {"north" : {"uv" : [12, 1, 15, 5], "texture" : "#texture"}, "east" : {"uv" : [12, 1, 15, 5], "texture" : "#texture"}, "south" : {"uv" : [12, 1, 15, 5], "texture" : "#texture"}, "west" : {"uv" : [12, 1, 15, 5], "texture" : "#texture"}, "up" : {"uv" : [12, 1, 15, 5], "texture" : "#texture"}, "down" : {"uv" : [12, 1, 15, 5], "texture" : "#texture"}}}]} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}, "textures": {"type": "object", "properties": {"texture": {"type": "string"}, "particle": {"type": "string"}}, "required": ["texture", "particle"]}, "elements": {"type": "array", "items": {"type": "object", "properties": {"from": {"type": "array", "items": {"type": "number"}}, "to": {"type": "array", "items": {"type": "number"}}, "rotation": {"type": "object", "properties": {"angle": {"type": "integer"}, "axis": {"type": "string"}, "origin": {"type": "array", "items": {"type": "integer"}}}, "required": ["angle", "axis", "origin"]}, "faces": {"type": "object", "properties": {"north": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "east": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "south": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "west": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "up": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}, "down": {"type": "object", "properties": {"uv": {"type": "array", "items": {"type": "integer"}}, "texture": {"type": "string"}}, "required": ["uv", "texture"]}}, "required": ["north", "east", "south", "west", "up", "down"]}}, "required": ["from", "to", "rotation", "faces"]}}}, "required": ["parent", "textures", "elements"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "array", "items": {"type": "object", "properties": {"review": {"type": "string"}, "date": {"type": "string"}, "rating": {"type": "string"}, "author": {"type": "string"}, "review_id": {"type": "string"}, "movie_id": {"type": "string"}}, "required": ["review", "date", "rating", "author", "review_id", "movie_id"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"review" : "10\uc810\ub9cc\uc810\uc5d0 10\uc810!", "date" : "14.02.09", "rating" : "10", "author" : "wogu****", "review_id" : "8493222", "movie_id" : "20740"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"review": {"type": "string"}, "date": {"type": "string"}, "rating": {"type": "string"}, "author": {"type": "string"}, "review_id": {"type": "string"}, "movie_id": {"type": "string"}}, "required": ["review", "date", "rating", "author", "review_id", "movie_id"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"-3": {"type": "object", "properties": {"\u0441/\u0441\u043e + INST": {"type": "array", "items": {"type": "string"}}}, "required": ["\u0441/\u0441\u043e + INST"]}, "-2": {"type": "object", "properties": {}, "required": []}, "-1": {"type": "object", "properties": {}, "required": []}, "0": {"type": "object", "properties": {}, "required": []}, "1": {"type": "object", "properties": {"GEN": {"type": "array", "items": {"type": "string"}}}, "required": ["GEN"]}, "2": {"type": "object", "properties": {}, "required": []}, "3": {"type": "object", "properties": {}, "required": []}}, "required": ["-3", "-2", "-1", "0", "1", "2", "3"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"-3" : {"\u0441/\u0441\u043e + INST" : ["\" \u0420\u043e\u0441\u0441\u0438\u044f\" \u0432\u043c\u0435\u0441\u0442\u0435 \u0421 \u0414\u0420\u0415\u0412\u041d\u0418\u041c\u0418\" \u0411\u0415\u0420\u0415\u0413\u0418\u0421\u042c \u0430\u0432\u0442\u043e\u043c\u043e\u0431\u0438\u043b\u044f\"( 10. 45) \u0438\" \u041b\u044e\u0431\u043e\u0432\u044c \u0438 \u0433\u043e\u043b\u0443\u0431\u0438\"( 15. 00) \u0434\u0430\u0451\u0442 \u0432\u043f\u043e\u043b\u043d\u0435 \u0441\u0432\u0435\u0436\u0435\u043d\u044c\u043a\u0438\u0445 \u0430\u043c\u0435\u0440\u0438\u043a\u0430\u043d\u0446\u0435\u0432: \u043a\u043e\u043c\u0435\u0434\u0438\u044e\" \u041a\u0440\u044b\u0441\u0438\u043d\u044b\u0435 \u0431\u0435\u0433\u0430\"( 17. 10) \u0441 \u0412\u0443\u043f\u0438 \u0413\u043e\u043b\u0434\u0431\u0435\u0440\u0433 \u0438 \u0444\u0430\u043d\u0442\u0430\u0441\u0442\u0438\u0447\u0435\u0441\u043a\u0443\u044e\" \u041c\u0430\u0442\u0440\u0438\u0446\u0443\"( 21. 20)."]}, "-2" : {}, "-1" : {}, "0" : {}, "1" : {"GEN" : ["\u0412 \u0432\u043e\u0441\u043a\u0440\u0435\u0441\u0435\u043d\u044c\u0435 \u043d\u0430 64-\u043c \u0433\u043e\u0434\u0443 \u0436\u0438\u0437\u043d\u0438 \u0443\u043c\u0435\u0440 \u0412\u043b\u0430\u0434\u0438\u043c\u0438\u0440 \u041d\u0430\u0445\u0430\u0431\u0446\u0435\u0432, \u0437\u0430\u043c\u0435\u0447\u0430\u0442\u0435\u043b\u044c\u043d\u044b\u0439 \u043a\u0438\u043d\u043e\u043e\u043f\u0435\u0440\u0430\u0442\u043e\u0440, \u0441\u043d\u044f\u0432\u0448\u0438\u0439 \u0442\u0430\u043a\u0438\u0435 \u043b\u044e\u0431\u0438\u043c\u044b\u0435 \u0432\u0441\u0435\u043c\u0438 \u0444\u0438\u043b\u044c\u043c\u044b, \u043a\u0430\u043a\" \u0411\u0415\u0420\u0415\u0413\u0418\u0421\u042c \u0410\u0412\u0422\u041e\u041c\u041e\u0411\u0418\u041b\u042f\"\" \u0418\u0440\u043e\u043d\u0438\u044f \u0441\u0443\u0434\u044c\u0431\u044b\"\" \u0421\u043b\u0443\u0436\u0435\u0431\u043d\u044b\u0439 \u0440\u043e\u043c\u0430\u043d\"\" \u0413\u0430\u0440\u0430\u0436\"\" \u0422\u043e\u0442 \u0441\u0430\u043c\u044b\u0439 \u041c\u044e\u043d\u0445\u0433\u0430\u0443\u0437\u0435\u043d\"\" \u0410\u043d\u043d\u0430 \u041f\u0430\u0432\u043b\u043e\u0432\u0430\"...", "\u0418 \u0443\u0436\u0435 \u043d\u0430 \u0441\u043b\u0435\u0434\u0443\u044e\u0449\u0443\u044e \u043a\u0430\u0440\u0442\u0438\u043d\u0443 \u044f \u0435\u0433\u043e \u0432\u0437\u044f\u043b \u0432 \u043a\u0430\u0447\u0435\u0441\u0442\u0432\u0435 \u043e\u043f\u0435\u0440\u0430\u0442\u043e\u0440\u0430- \u043f\u043e\u0441\u0442\u0430\u043d\u043e\u0432\u0449\u0438\u043a\u0430 \u043d\u0430 \u043f\u0430\u0440\u0443 \u0441 \u0410\u043d\u0430\u0442\u043e\u043b\u0438\u0435\u043c \u041c\u0443\u043a\u0430\u0441\u0435\u0435\u043c-- \u043e\u043d\u0438 \u0432\u0434\u0432\u043e\u0451\u043c \u0441\u043d\u0438\u043c\u0430\u043b\u0438\" \u0414\u0430\u0439\u0442\u0435 \u0436\u0430\u043b\u043e\u0431\u043d\u0443\u044e \u043a\u043d\u0438\u0433\u0443\" \u0438\" \u0411\u0415\u0420\u0415\u0413\u0418\u0421\u042c \u0410\u0412\u0422\u041e\u041c\u041e\u0411\u0418\u041b\u042f\".", "\u0418 \u0432\u043c\u0435\u0441\u0442\u0435 \u0440\u0430\u0431\u043e\u0442\u0430\u043b\u0438 \u043d\u0430\" \u0411\u0415\u0420\u0415\u0413\u0418\u0421\u042c \u0410\u0412\u0422\u041e\u041c\u041e\u0411\u0418\u041b\u042f\".", "\" \u0420\u043e\u0441\u0441\u0438\u044f\" \u0432\u043c\u0435\u0441\u0442\u0435 \u0441 \u0434\u0440\u0435\u0432\u043d\u0438\u043c\u0438\" \u0411\u0415\u0420\u0415\u0413\u0418\u0421\u042c \u0410\u0412\u0422\u041e\u041c\u041e\u0411\u0418\u041b\u042f\"( 10. 45) \u0438\" \u041b\u044e\u0431\u043e\u0432\u044c \u0438 \u0433\u043e\u043b\u0443\u0431\u0438\"( 15. 00) \u0434\u0430\u0451\u0442 \u0432\u043f\u043e\u043b\u043d\u0435 \u0441\u0432\u0435\u0436\u0435\u043d\u044c\u043a\u0438\u0445 \u0430\u043c\u0435\u0440\u0438\u043a\u0430\u043d\u0446\u0435\u0432: \u043a\u043e\u043c\u0435\u0434\u0438\u044e\" \u041a\u0440\u044b\u0441\u0438\u043d\u044b\u0435 \u0431\u0435\u0433\u0430\"( 17. 10) \u0441 \u0412\u0443\u043f\u0438 \u0413\u043e\u043b\u0434\u0431\u0435\u0440\u0433 \u0438 \u0444\u0430\u043d\u0442\u0430\u0441\u0442\u0438\u0447\u0435\u0441\u043a\u0443\u044e\" \u041c\u0430\u0442\u0440\u0438\u0446\u0443\"( 21. 20).", "\u0418\u0442\u0430\u043b\u044c\u044f\u043d\u0446\u044b \u0437\u0430\u043c\u0435\u0447\u0430\u0442\u0435\u043b\u044c\u043d\u044b\u0439/ \u043e\u0447\u0435\u043d\u044c \u0441\u0438\u043c\u043f\u0430\u0442\u0438\u0447\u043d\u044b\u0439 \u043d\u0430\u0440\u043e\u0434/ \u043f\u0440\u0435\u043a\u0440\u0430\u0441\u043d\u044b\u0439/ \u043d\u043e \u0442\u0430\u043c/ \u043a\u043e\u0433\u0434\u0430 \u043f\u0440\u0438\u0435\u0437\u0436\u0430\u0435\u0448\u044c \u043f\u043e\u0435\u0437\u0434\u043e\u043c/ \u0432\u044b\u0445\u043e\u0434\u0438\u0448\u044c/ \u0432\u0435\u0437\u0434\u0435 \u043d\u0430\u043f\u0438\u0441\u0430\u043d\u043e/\" \u0411\u0415\u0420\u0415\u0413\u0418\u0422\u0415\u0421\u042c \u0412\u041e\u0420\u041e\u0412\".", "\u0410 \u043f\u043e-\u0444\u0440\u0430\u043d\u0446\u0443\u0437\u0441\u043a\u0438\" \u0411\u0415\u0420\u0415\u0413\u0418\u0422\u0415\u0421\u042c \u0412\u041e\u0420\u041e\u0412\"."]}, "2" : {}, "3" : {}} | json_instruct | {"type": "object", "properties": {"-3": {"type": "object", "properties": {"\u0441/\u0441\u043e + INST": {"type": "array", "items": {"type": "string"}}}, "required": ["\u0441/\u0441\u043e + INST"]}, "-2": {"type": "object", "properties": {}, "required": []}, "-1": {"type": "object", "properties": {}, "required": []}, "0": {"type": "object", "properties": {}, "required": []}, "1": {"type": "object", "properties": {"GEN": {"type": "array", "items": {"type": "string"}}}, "required": ["GEN"]}, "2": {"type": "object", "properties": {}, "required": []}, "3": {"type": "object", "properties": {}, "required": []}}, "required": ["-3", "-2", "-1", "0", "1", "2", "3"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[138.875, 45.25], [138.875, 45.333333333333336], [139.0, 45.333333333333336], [139.0, 45.25], [138.875, 45.25]]]}, "properties" : {"code" : 673877, "url" : "http://madefor.github.io/0410/api/v1/673877.geojson", "view" : "https://github.com/madefor/0410/blob/gh-pages/api/v1/673877.geojson"}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"componentChunkName": {"type": "string"}, "path": {"type": "string"}, "result": {"type": "object", "properties": {"pageContext": {"type": "object", "properties": {"id": {"type": "string"}, "slug": {"type": "string"}, "params": {"type": "object", "properties": {"id": {"type": "string"}, "displayName": {"type": "string"}, "avatarUrl": {"type": "null"}, "slug": {"type": "string"}, "images": {"type": "null"}, "image": {"type": "null"}}, "required": ["id", "displayName", "avatarUrl", "slug", "images", "image"]}}, "required": ["id", "slug", "params"]}}, "required": ["pageContext"]}, "staticQueryHashes": {"type": "array", "items": {"type": "string"}}}, "required": ["componentChunkName", "path", "result", "staticQueryHashes"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"componentChunkName" : "component---src-templates-category-index-js", "path" : "/vi/category/mon-au", "result" : {"pageContext" : {"id" : "1bDYZPnMdO410ITFC71G2x", "slug" : "/category/mon-au", "params" : {"id" : "1bDYZPnMdO410ITFC71G2x", "displayName" : "M\u00f3n \u00c2u", "avatarUrl" : null, "slug" : "mon-au", "images" : null, "image" : null}}}, "staticQueryHashes" : ["700411652", "850621625"]} | json_instruct | {"type": "object", "properties": {"componentChunkName": {"type": "string"}, "path": {"type": "string"}, "result": {"type": "object", "properties": {"pageContext": {"type": "object", "properties": {"id": {"type": "string"}, "slug": {"type": "string"}, "params": {"type": "object", "properties": {"id": {"type": "string"}, "displayName": {"type": "string"}, "avatarUrl": {"type": "null"}, "slug": {"type": "string"}, "images": {"type": "null"}, "image": {"type": "null"}}, "required": ["id", "displayName", "avatarUrl", "slug", "images", "image"]}}, "required": ["id", "slug", "params"]}}, "required": ["pageContext"]}, "staticQueryHashes": {"type": "array", "items": {"type": "string"}}}, "required": ["componentChunkName", "path", "result", "staticQueryHashes"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"title": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "description": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}}, "required": ["title", "description"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : {"message" : "Fehler 404", "description" : "Page title\n"}, "description" : {"message" : "Fehler 404", "description" : "Page description\n"}} | json_instruct | {"type": "object", "properties": {"title": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "description": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}}, "required": ["title", "description"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"/form-type-collection.js": {"type": "string"}, "/form-type-association-list.js": {"type": "string"}, "/form-type-association-new-ajax.js": {"type": "string"}, "/form-type-association.css": {"type": "string"}}, "required": ["/form-type-collection.js", "/form-type-association-list.js", "/form-type-association-new-ajax.js", "/form-type-association.css"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"/form-type-collection.js" : "/form-type-collection.js", "/form-type-association-list.js" : "/form-type-association-list.js", "/form-type-association-new-ajax.js" : "/form-type-association-new-ajax.js", "/form-type-association.css" : "/form-type-association.css"} | json_instruct | {"type": "object", "properties": {"/form-type-collection.js": {"type": "string"}, "/form-type-association-list.js": {"type": "string"}, "/form-type-association-new-ajax.js": {"type": "string"}, "/form-type-association.css": {"type": "string"}}, "required": ["/form-type-collection.js", "/form-type-association-list.js", "/form-type-association-new-ajax.js", "/form-type-association.css"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01024183": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01024183"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Topology", "objects" : {"E01024183" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00122772", "LAD11CD" : "E07000107"}, "arcs" : [[0, 1, 2]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00122776", "LAD11CD" : "E07000107"}, "arcs" : [[3, -2, 4]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00122777", "LAD11CD" : "E07000107"}, "arcs" : [[5, 6]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00122778", "LAD11CD" : "E07000107"}, "arcs" : [[7, -3, -4, 8, -7]]}]}}, "arcs" : [[[3417, 4459], [-885, 2060], [1446, 207], [-361, 851], [-1061, 539], [-141, 175], [1669, 513], [675, 943], [661, 252], [703, -171], [833, -902], [3043, -1966], [-195, -375], [-2787, 311], [-149, -1165]], [[6868, 5731], [-334, -583], [-1157, 223], [-320, -366]], [[5057, 5005], [-1013, -82], [-627, -464]], [[7180, 2831], [-1406, 840], [22, 719], [-739, 615]], [[6868, 5731], [854, 14], [240, -751], [584, -24], [85, -806], [-922, -225], [106, -959], [-635, -149]], [[4378, 1159], [-32, -646], [-1994, 73], [-867, 28], [-96, -534], [-1389, -80], [103, 224], [205, 459], [1214, 2771], [-612, 101], [561, 513], [519, -32]], [[1990, 4036], [2359, -257], [1012, -523], [51, -410], [-1753, 263], [545, -510], [-349, -891], [523, -549]], [[1990, 4036], [251, 530], [1176, -107]], [[7180, 2831], [-203, -476], [-1570, 161], [-366, -807], [162, -214], [-825, -336]]], "transform" : {"scale" : [9.778103971764178e-07, 1.0091909299289265e-06], "translate" : [0.196705413764759, 51.444013058530494]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01024183": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01024183"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : "411527209201", "text" : "\u8c37\u5806\u6751\u59d4\u4f1a"}, {"id" : "411527209202", "text" : "\u5df4\u6e7e\u6751\u59d4\u4f1a"}, {"id" : "411527209203", "text" : "\u51b7\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209204", "text" : "\u6817\u56ed\u6751\u59d4\u4f1a"}, {"id" : "411527209205", "text" : "\u6c99\u6e7e\u6751\u59d4\u4f1a"}, {"id" : "411527209206", "text" : "\u5b59\u5c97\u6751\u59d4\u4f1a"}, {"id" : "411527209207", "text" : "\u5510\u5e97\u6751\u59d4\u4f1a"}, {"id" : "411527209208", "text" : "\u56fe\u76ca\u6751\u59d4\u4f1a"}, {"id" : "411527209209", "text" : "\u738b\u56f4\u6751\u59d4\u4f1a"}, {"id" : "411527209210", "text" : "\u5434\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209211", "text" : "\u5f90\u56f4\u6751\u59d4\u4f1a"}, {"id" : "411527209212", "text" : "\u675c\u6e7e\u6751\u59d4\u4f1a"}, {"id" : "411527209213", "text" : "\u675c\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209214", "text" : "\u7b26\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209215", "text" : "\u6d2a\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209216", "text" : "\u8001\u5173\u6751\u59d4\u4f1a"}, {"id" : "411527209217", "text" : "\u5218\u697c\u6751\u59d4\u4f1a"}, {"id" : "411527209218", "text" : "\u5218\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209219", "text" : "\u7533\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209221", "text" : "\u6d82\u8425\u6751\u59d4\u4f1a"}, {"id" : "411527209222", "text" : "\u6768\u6e7e\u6751\u59d4\u4f1a"}, {"id" : "411527209223", "text" : "\u5468\u5e84\u6751\u59d4\u4f1a"}, {"id" : "411527209224", "text" : "\u6731\u6e7e\u6751\u59d4\u4f1a"}, {"id" : "411527209225", "text" : "\u6731\u8425\u6751\u59d4\u4f1a"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 404364095, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes_pg", "src:geom" : "quattroshapes_pg", "wof:geomhash" : "a3628f98eabd5def1a130cc865473c6d", "wof:id" : 404364095, "wof:repo" : "whosonfirst-data-admin-fr"}, "bbox" : [0.18278, 44.67583, 0.18278, 44.67583], "geometry" : {"coordinates" : [0.18278, 44.67583], "type" : "Point"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"mbox_sha1sum": {"type": "string"}}, "required": ["mbox_sha1sum"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"mbox_sha1sum" : "ebd31e95054c018b10727ccffd2ef2ec3a016ee9"} | json_instruct | {"type": "object", "properties": {"mbox_sha1sum": {"type": "string"}}, "required": ["mbox_sha1sum"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"nom" : "Chantemerle-les-Bl\u00e9s", "dpt" : "Dr\u00f4me", "inscrits" : 913, "abs" : 180, "votants" : 733, "blancs" : 67, "nuls" : 15, "exp" : 651, "res" : [{"panneau" : "1", "voix" : 401}, {"panneau" : "2", "voix" : 250}]} | json_instruct | {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"namaKab" : "SABU RAIJUA", "originalFilename" : "FOTO HENDRIK TUDU.jpg", "namaPartai" : "PARTAI GERAKAN INDONESIA RAYA", "id" : 216986, "noUrut" : 1, "nama" : "HENDRIK TUDU, S.H", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "SABU RAIJUA", "originalFilename" : "PAS FOTO_2.jpg", "namaPartai" : "PARTAI GERAKAN INDONESIA RAYA", "id" : 228373, "noUrut" : 2, "nama" : "HAGAI HILI BURU, S.Sos. M.Si", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "KOTA KUPANG", "originalFilename" : "FOTO YANE.jpg", "namaPartai" : "PARTAI GERAKAN INDONESIA RAYA", "id" : 225046, "noUrut" : 3, "nama" : "YANE SARIATI KORE", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "SABU RAIJUA", "originalFilename" : "FOTO 4X6 LATAR MERAH.jpg", "namaPartai" : "PARTAI GERAKAN INDONESIA RAYA", "id" : 227828, "noUrut" : 4, "nama" : "ELISABET NONA INA", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "SABU RAIJUA", "originalFilename" : "FOTO DAVID BOLE TADE.jpg", "namaPartai" : "PARTAI GERAKAN INDONESIA RAYA", "id" : 240295, "noUrut" : 5, "nama" : "DAVID BOLE TADE, S.Pd", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "SABU RAIJUA", "originalFilename" : "FOTO MALEP.JPG", "namaPartai" : "PARTAI GERAKAN INDONESIA RAYA", "id" : 169537, "noUrut" : 6, "nama" : "MALEP KALVIN MOLA KORE", "stringJenisKelamin" : "Laki-Laki"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}}, "required": ["name", "version", "description", "main", "author", "license", "engines"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "scripts", "version" : "1.0.1", "description" : "\u5404\u79cd\u811a\u672c", "main" : "request4word/index.js", "author" : "masongzhi", "license" : "ISC", "engines" : {"node" : ">= 8"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}}, "required": ["name", "version", "description", "main", "author", "license", "engines"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"$schema": {"type": "string"}, "title": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"requried_field": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}}, "required": ["description", "type"]}, "optional_field": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}}, "required": ["description", "type"]}}, "required": ["requried_field", "optional_field"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "title", "description", "type", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"$schema" : "http://json-schema.org/draft-04/schema", "title" : "Fake Configuration", "description" : "Fake Schema file for checking base JsonReader class.", "type" : "object", "properties" : {"requried_field" : {"description" : "Schema required field.", "type" : "boolean"}, "optional_field" : {"description" : "Schema optional field.", "type" : "boolean"}}, "required" : ["required_field"]} | json_instruct | {"type": "object", "properties": {"$schema": {"type": "string"}, "title": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"requried_field": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}}, "required": ["description", "type"]}, "optional_field": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}}, "required": ["description", "type"]}}, "required": ["requried_field", "optional_field"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "title", "description", "type", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"duel": {"type": "object", "properties": {"title": {"type": "string"}, "challenge": {"type": "string"}, "action": {"type": "string"}, "expire": {"type": "string"}, "reject": {"type": "string"}, "unknown-user": {"type": "string"}}, "required": ["title", "challenge", "action", "expire", "reject", "unknown-user"]}, "game": {"type": "object", "properties": {"title": {"type": "string"}, "action": {"type": "string"}, "load": {"type": "string"}, "end": {"type": "string"}, "win": {"type": "string"}, "expire": {"type": "string"}, "waiting-ai": {"type": "string"}, "ai": {"type": "string"}}, "required": ["title", "action", "load", "end", "win", "expire", "waiting-ai", "ai"]}}, "required": ["duel", "game"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"duel" : {"title" : ":crossed_swords: Nowy pojedynek", "challenge" : "{invited}, **{initier}** wyzwa\u0142 ci\u0119 na pojedynek!", "action" : "Zareaguj odpowiedni\u0105 emotk\u0105 do tej wiadomo\u015bci, aby zaakceptowa\u0107 lub odrzuci\u0107 zaproszenie.", "expire" : ":x: `{invited}` nie odpowiedzia\u0142 na zaproszenie do pojedynku.", "reject" : ":x: `{invited}` odrzuci\u0142 zaproszenie do pojedynku.", "unknown-user" : "nie mo\u017cesz wyzwa\u0107 na pojedynek tego u\u017cytkownika."}, "game" : {"title" : ":game_die: `{player1}` **VS** `{player2}`", "action" : "{player}, wybierz sw\u00f3j ruch:", "load" : "Reakcje si\u0119 \u0142aduj\u0105, prosz\u0119 czeka\u0107...", "end" : "Remis! Nikt nie wygra\u0142. Mo\u017ce spr\u00f3bujcie jeszcze raz?", "win" : ":tada: {player} wygra\u0142 gr\u0119 w k\u00f3\u0142ko i krzy\u017cyk!", "expire" : ":x: Gra **wygas\u0142a**... Mo\u017ce przez nieaktywno\u015b\u0107 kt\u00f3rego\u015b z graczy?", "waiting-ai" : ":robot: Trwa ruch Sztucznej Inteligencji, prosz\u0119 czeka\u0107...", "ai" : "Sztuczna Inteligencja"}} | json_instruct | {"type": "object", "properties": {"duel": {"type": "object", "properties": {"title": {"type": "string"}, "challenge": {"type": "string"}, "action": {"type": "string"}, "expire": {"type": "string"}, "reject": {"type": "string"}, "unknown-user": {"type": "string"}}, "required": ["title", "challenge", "action", "expire", "reject", "unknown-user"]}, "game": {"type": "object", "properties": {"title": {"type": "string"}, "action": {"type": "string"}, "load": {"type": "string"}, "end": {"type": "string"}, "win": {"type": "string"}, "expire": {"type": "string"}, "waiting-ai": {"type": "string"}, "ai": {"type": "string"}}, "required": ["title", "action", "load", "end", "win", "expire", "waiting-ai", "ai"]}}, "required": ["duel", "game"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"base64-img": {"type": "string"}, "body-parser": {"type": "string"}, "connect-flash": {"type": "string"}, "ejs": {"type": "string"}, "express": {"type": "string"}, "express-ejs-layouts": {"type": "string"}, "express-session": {"type": "string"}, "image-to-base64": {"type": "string"}, "multer": {"type": "string"}, "node-cmd": {"type": "string"}, "shelljs": {"type": "string"}, "socket.io": {"type": "string"}}, "required": ["base64-img", "body-parser", "connect-flash", "ejs", "express", "express-ejs-layouts", "express-session", "image-to-base64", "multer", "node-cmd", "shelljs", "socket.io"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "voc2012nodejs", "version" : "1.0.0", "description" : "", "main" : "server.js", "scripts" : {"test" : "mocha"}, "author" : "", "license" : "ISC", "dependencies" : {"base64-img" : "^1.0.4", "body-parser" : "^1.18.3", "connect-flash" : "^0.1.1", "ejs" : "^2.6.1", "express" : "^4.16.4", "express-ejs-layouts" : "^2.5.0", "express-session" : "^1.15.6", "image-to-base64" : "^2.0.1", "multer" : "^1.4.1", "node-cmd" : "^3.0.0", "shelljs" : "^0.8.3", "socket.io" : "^2.2.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"base64-img": {"type": "string"}, "body-parser": {"type": "string"}, "connect-flash": {"type": "string"}, "ejs": {"type": "string"}, "express": {"type": "string"}, "express-ejs-layouts": {"type": "string"}, "express-session": {"type": "string"}, "image-to-base64": {"type": "string"}, "multer": {"type": "string"}, "node-cmd": {"type": "string"}, "shelljs": {"type": "string"}, "socket.io": {"type": "string"}}, "required": ["base64-img", "body-parser", "connect-flash", "ejs", "express", "express-ejs-layouts", "express-session", "image-to-base64", "multer", "node-cmd", "shelljs", "socket.io"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "0629637621ebb8389356d07101eb590482da8737"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"simpleJsCopy.js": {"type": "string"}, "simpleJsCopy.min.js": {"type": "string"}}, "required": ["simpleJsCopy.js", "simpleJsCopy.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"simpleJsCopy.js" : "sha512-xTubVFQcvhvpbHyMsm+/Nt/BH9rUbI7f3RaTNxp91JeI+Lz2bBWjDJ14c703VvYYdzzkZt4Ll+jP1HXpxuKW2w==", "simpleJsCopy.min.js" : "sha512-T/ILHnKqcv71964en+dunWLBqagXhlVJYySMc1XVOgSlj37c7HfV6ahrON6QIoeNTWbv0e04jQIbVD9uHJ65eA=="} | json_instruct | {"type": "object", "properties": {"simpleJsCopy.js": {"type": "string"}, "simpleJsCopy.min.js": {"type": "string"}}, "required": ["simpleJsCopy.js", "simpleJsCopy.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "type": {"type": "string"}, "decimals": {"type": "integer"}, "description": {"type": "string"}, "website": {"type": "string"}, "explorer": {"type": "string"}, "status": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "symbol", "type", "decimals", "description", "website", "explorer", "status", "id"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Fantasy Sports", "symbol" : "DFS", "type" : "ERC20", "decimals" : 18, "description" : "DFS is a global payment option that is fully decentralized built on the Ethereum Blockchain.", "website" : "https://www.digitalfantasysports.com", "explorer" : "https://etherscan.io/token/0xcec38306558a31cdbb2a9d6285947C5b44A24f3e", "status" : "active", "id" : "0xcec38306558a31cdbb2a9d6285947C5b44A24f3e"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "type": {"type": "string"}, "decimals": {"type": "integer"}, "description": {"type": "string"}, "website": {"type": "string"}, "explorer": {"type": "string"}, "status": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "symbol", "type", "decimals", "description", "website", "explorer", "status", "id"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "description": {"type": "string"}, "scripts": {"type": "object", "properties": {"prepublish": {"type": "string"}, "build": {"type": "string"}, "test": {"type": "string"}}, "required": ["prepublish", "build", "test"]}, "devDependencies": {"type": "object", "properties": {"@rollup/plugin-json": {"type": "string"}, "ava": {"type": "string"}, "rollup": {"type": "string"}, "rollup-plugin-terser": {"type": "string"}}, "required": ["@rollup/plugin-json", "ava", "rollup", "rollup-plugin-terser"]}, "module": {"type": "string"}, "main": {"type": "string"}, "browser": {"type": "string"}, "type": {"type": "string"}, "sideEffects": {"type": "boolean"}, "files": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "author", "license", "description", "scripts", "devDependencies", "module", "main", "browser", "type", "sideEffects", "files"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "flatland", "version" : "0.5.1", "author" : "Mark Rickerby", "license" : "MIT", "description" : "Toolkit for representing two dimensional spaces.", "scripts" : {"prepublish" : "npm run build", "build" : "rollup -c", "test" : "ava --verbose"}, "devDependencies" : {"@rollup/plugin-json" : "^4.1.0", "ava" : "^4.1.0", "rollup" : "^2.70.1", "rollup-plugin-terser" : "^7.0.2"}, "module" : "src/index.js", "main" : "flatland.bundle.cjs", "browser" : "src/index.js", "type" : "module", "sideEffects" : false, "files" : ["src", "README.md", "LICENSE", "flatland.bundle.cjs", "flatland.min.js"]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "description": {"type": "string"}, "scripts": {"type": "object", "properties": {"prepublish": {"type": "string"}, "build": {"type": "string"}, "test": {"type": "string"}}, "required": ["prepublish", "build", "test"]}, "devDependencies": {"type": "object", "properties": {"@rollup/plugin-json": {"type": "string"}, "ava": {"type": "string"}, "rollup": {"type": "string"}, "rollup-plugin-terser": {"type": "string"}}, "required": ["@rollup/plugin-json", "ava", "rollup", "rollup-plugin-terser"]}, "module": {"type": "string"}, "main": {"type": "string"}, "browser": {"type": "string"}, "type": {"type": "string"}, "sideEffects": {"type": "boolean"}, "files": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "author", "license", "description", "scripts", "devDependencies", "module", "main", "browser", "type", "sideEffects", "files"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"year" : 1980, "sex" : "F", "n" : 6, "prop" : 3.37e-06}, {"year" : 1983, "sex" : "F", "n" : 5, "prop" : 2.79e-06}, {"year" : 1986, "sex" : "F", "n" : 7, "prop" : 3.79e-06}, {"year" : 1987, "sex" : "F", "n" : 5, "prop" : 2.67e-06}, {"year" : 1988, "sex" : "F", "n" : 6, "prop" : 3.12e-06}, {"year" : 1989, "sex" : "F", "n" : 5, "prop" : 2.51e-06}, {"year" : 1990, "sex" : "F", "n" : 7, "prop" : 3.41e-06}, {"year" : 1991, "sex" : "F", "n" : 9, "prop" : 4.43e-06}, {"year" : 1992, "sex" : "F", "n" : 12, "prop" : 5.99e-06}, {"year" : 1993, "sex" : "F", "n" : 13, "prop" : 6.6e-06}, {"year" : 1994, "sex" : "F", "n" : 12, "prop" : 6.16e-06}, {"year" : 1995, "sex" : "F", "n" : 12, "prop" : 6.25e-06}, {"year" : 1996, "sex" : "F", "n" : 11, "prop" : 5.74e-06}, {"year" : 1998, "sex" : "F", "n" : 7, "prop" : 3.61e-06}, {"year" : 2000, "sex" : "F", "n" : 11, "prop" : 5.51e-06}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01033339": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01033339"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Topology", "objects" : {"E01033339" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00075637", "LAD11CD" : "E06000025"}, "arcs" : [[0, 1, 2, 3]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00075640", "LAD11CD" : "E06000025"}, "arcs" : [[-1, 4]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00173060", "LAD11CD" : "E06000025"}, "arcs" : [[5, 6, 7, 8]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00173066", "LAD11CD" : "E06000025"}, "arcs" : [[-3, 9, -9, 10]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00173092", "LAD11CD" : "E06000025"}, "arcs" : [[11, -7]]}]}}, "arcs" : [[[6396, 1633], [-261, 92], [-524, -170], [-462, 308], [-18, 642], [270, 115], [-288, 27], [-474, 445], [-214, -35]], [[4425, 3057], [-317, 477], [-1509, 83], [-702, 496], [-551, 545], [-335, 1405], [-899, 599], [-112, 468], [174, 105]], [[174, 7235], [422, -259], [444, -27]], [[1040, 6949], [280, -4], [1494, -1262], [787, 103], [-371, -815], [642, -320], [1510, 119], [518, 231], [547, -95], [2019, -754], [1533, -1158], [-412, -306], [-1033, -324], [-1380, -76], [-614, -279], [32, -333], [-196, -43]], [[6396, 1633], [-101, -372], [-470, 177], [-248, -204], [402, -209], [162, -830], [-21, -158], [-575, -37], [-577, 1246], [-516, -93], [117, 273], [382, 3], [-75, 222], [-309, 80], [130, 476], [-272, 850]], [[1886, 8420], [-310, 415], [1557, 50], [-140, 727]], [[2993, 9612], [886, -837], [42, -171], [-697, 36], [55, -175]], [[3279, 8465], [8, -25], [-282, 94], [-976, -111]], [[2029, 8423], [-143, -3]], [[174, 7235], [-49, 755], [187, -36], [302, -87], [322, 76], [790, 122], [160, 355]], [[2029, 8423], [363, -270], [295, 12], [-287, -532], [561, -633], [-718, 205], [-1030, -67], [-173, -189]], [[2993, 9612], [-71, 48], [977, 339], [557, -679], [-224, -874], [-953, 19]]], "transform" : {"scale" : [1.789311731661191e-06, 1.8574702581629966e-06], "translate" : [-2.488264536301464, 51.45742888932513]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01033339": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01033339"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"iphone-inline-video.common-js.js": {"type": "string"}, "iphone-inline-video.common-js.min.js": {"type": "string"}, "iphone-inline-video.es-modules.js": {"type": "string"}, "iphone-inline-video.es-modules.min.js": {"type": "string"}, "iphone-inline-video.js": {"type": "string"}, "iphone-inline-video.min.js": {"type": "string"}}, "required": ["iphone-inline-video.common-js.js", "iphone-inline-video.common-js.min.js", "iphone-inline-video.es-modules.js", "iphone-inline-video.es-modules.min.js", "iphone-inline-video.js", "iphone-inline-video.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"iphone-inline-video.common-js.js" : "sha512-ivxFv9JSsd0HCE+y18sRHe/uDt+X6RvhLYnsGcfIMKPVe2eheC6hGHwOHIobxsE6MeZ7CIr60oNUkC6vGvVvBQ==", "iphone-inline-video.common-js.min.js" : "sha512-cr5GnrfKNlZ2kwuTLt7iK6nunNVLwlMlBu9TegiihiT4p2AxhlKayMkQyrMMKEVEaiXllGuhYXvo60nsFpCR+w==", "iphone-inline-video.es-modules.js" : "sha512-PUm1UDou19nUIyvpyR/V+H/ur1kAeGaYs8beWgURO3njhlbAGfMLADDgX5Ajq1x7Lcs+nJsNbsyPHKH66JZEzA==", "iphone-inline-video.es-modules.min.js" : "sha512-izHJA5s0bIa3B9BHW3JxztB8nVSG6AEz5TGqJJnD/P4BKhj0s21Lkxe/9ucH58UrX5ouFMcoZC0YU51HIloczQ==", "iphone-inline-video.js" : "sha512-b2LCbgzL0lAAJpfyUoyU+uss0kHqsROdPbCU+We02sVF9iIPQXRlSZqWJPW2Ld1u/7xHk3vyNFaP4l54OJjdGA==", "iphone-inline-video.min.js" : "sha512-juU+p9nhIAJNHDlTqyxIG3hfqx0eecu4BMGKDoiaNha/UvBWXqE0oNVB9oW2b6kPtmmMzs5rq59Pan1rGcQUAA=="} | json_instruct | {"type": "object", "properties": {"iphone-inline-video.common-js.js": {"type": "string"}, "iphone-inline-video.common-js.min.js": {"type": "string"}, "iphone-inline-video.es-modules.js": {"type": "string"}, "iphone-inline-video.es-modules.min.js": {"type": "string"}, "iphone-inline-video.js": {"type": "string"}, "iphone-inline-video.min.js": {"type": "string"}}, "required": ["iphone-inline-video.common-js.js", "iphone-inline-video.common-js.min.js", "iphone-inline-video.es-modules.js", "iphone-inline-video.es-modules.min.js", "iphone-inline-video.js", "iphone-inline-video.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"css/lg-fb-comment-box.css": {"type": "string"}, "css/lg-fb-comment-box.min.css": {"type": "string"}, "css/lg-transitions.css": {"type": "string"}, "css/lg-transitions.min.css": {"type": "string"}, "css/lightgallery.css": {"type": "string"}, "css/lightgallery.min.css": {"type": "string"}, "js/lightgallery-all.js": {"type": "string"}, "js/lightgallery-all.min.js": {"type": "string"}, "js/lightgallery.js": {"type": "string"}, "js/lightgallery.min.js": {"type": "string"}}, "required": ["css/lg-fb-comment-box.css", "css/lg-fb-comment-box.min.css", "css/lg-transitions.css", "css/lg-transitions.min.css", "css/lightgallery.css", "css/lightgallery.min.css", "js/lightgallery-all.js", "js/lightgallery-all.min.js", "js/lightgallery.js", "js/lightgallery.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"css/lg-fb-comment-box.css" : "sha256-3M92BZOyNm42qXe++3Wm5NaTFtuf1wOK8nu6K2/FCok=", "css/lg-fb-comment-box.min.css" : "sha256-dshR5F7VpJ14V0hMJxPv+siYSbhgoJ2tSYtfybkgs8A=", "css/lg-transitions.css" : "sha256-fXXvPz9kuzQFdyddd/rX/2KIBCJlFCzNKSL+tgnzwC8=", "css/lg-transitions.min.css" : "sha256-0vtvedekqwImzpY0zJYKRDDEiEWSGclW01CGiznyB4M=", "css/lightgallery.css" : "sha256-up9MzUCkEVW2UUZBCQcREh9ApNZ2sr++48gLVI2368I=", "css/lightgallery.min.css" : "sha256-8rfHbJr+ju3Oc099jFJMR1xAPu8CTPHU8uP5J3X/VAY=", "js/lightgallery-all.js" : "sha256-bRcpr2KReDRcx8mxiGuDuaSL8WGGPwLs9BUujXGxw/E=", "js/lightgallery-all.min.js" : "sha256-wyEEQSCQv5i9W98NyV2F5rhvMbWSeLgxYB5PgYjijLI=", "js/lightgallery.js" : "sha256-+OcecGgvEf4FudJ4iitkAKWS7T89D0KbPktf/JB4EGE=", "js/lightgallery.min.js" : "sha256-ETXqNLH7eD0vLuV7e2ymevvyqUuQ6o+1Jxgl5FSLeFg="} | json_instruct | {"type": "object", "properties": {"css/lg-fb-comment-box.css": {"type": "string"}, "css/lg-fb-comment-box.min.css": {"type": "string"}, "css/lg-transitions.css": {"type": "string"}, "css/lg-transitions.min.css": {"type": "string"}, "css/lightgallery.css": {"type": "string"}, "css/lightgallery.min.css": {"type": "string"}, "js/lightgallery-all.js": {"type": "string"}, "js/lightgallery-all.min.js": {"type": "string"}, "js/lightgallery.js": {"type": "string"}, "js/lightgallery.min.js": {"type": "string"}}, "required": ["css/lg-fb-comment-box.css", "css/lg-fb-comment-box.min.css", "css/lg-transitions.css", "css/lg-transitions.min.css", "css/lightgallery.css", "css/lightgallery.min.css", "js/lightgallery-all.js", "js/lightgallery-all.min.js", "js/lightgallery.js", "js/lightgallery.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Power consumption in enterprise-scale backup storage systems.", "fields" : ["conventional wisdom", "idle", "computer data storage", "backup", "electrical efficiency"], "abstract" : "Power consumption has become an important factor in modern storage system design. Power efficiency is particularly beneficial in disk-based backup systems that store mostly cold data, have significant idle periods, and must compete with the operational costs of tape-based backup. There are no prior published studies on power consumption in these systems, leaving researchers and practitioners to rely on existing assumptions. In this paper we present the first analysis of power consumption in real-world, enterprise, disk-based backup storage systems. We uncovered several important observations, including some that challenge conventional wisdom. We discuss their impact on future power-efficient designs.", "citation" : "Citations (23)", "departments" : ["Stony Brook University", "EMC Corporation", "EMC Corporation", "Stony Brook University"], "authors" : ["Zhichao Li.....http://dblp.org/pers/hd/l/Li:Zhichao", "Kevin M. Greenan.....http://dblp.org/pers/hd/g/Greenan:Kevin_M=", "Andrew W. Leung.....http://dblp.org/pers/hd/l/Leung:Andrew_W=", "Erez Zadok.....http://dblp.org/pers/hd/z/Zadok:Erez"], "conf" : "fast", "year" : "2012", "pages" : 1} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "name": {"type": "string"}, "mode": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "name", "mode", "description"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"type" : "string", "name" : "relationship_id", "mode" : "required", "description" : "The type of relationship captured by the relationship record."}, {"type" : "string", "name" : "relationship_name", "mode" : "required", "description" : "The text that describes the relationship type."}, {"type" : "string", "name" : "is_hierarchical", "mode" : "required", "description" : "Defines whether a relationship defines concepts into classes or hierarchies. Values are 1 for hierarchical relationship or 0 if not."}, {"type" : "string", "name" : "defines_ancestry", "mode" : "required", "description" : "Defines whether a hierarchical relationship contributes to the concept_ancestor table. These are subsets of the hierarchical relationships. Valid values are 1 or 0."}, {"type" : "string", "name" : "reverse_relationship_id", "mode" : "required", "description" : "The identifier for the relationship used to define the reverse relationship between two concepts."}, {"type" : "integer", "name" : "relationship_concept_id", "mode" : "required", "description" : "A foreign key that refers to an identifier in the CONCEPT table for the unique relationship concept."}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "name": {"type": "string"}, "mode": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "name", "mode", "description"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "satoshigo", "displayName" : "SatoshiGo"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"vendor": {"type": "string"}, "filename": {"type": "string"}, "release_type": {"type": "string"}, "version": {"type": "string"}, "java_version": {"type": "string"}, "jvm_impl": {"type": "string"}, "os": {"type": "string"}, "architecture": {"type": "string"}, "file_type": {"type": "string"}, "image_type": {"type": "string"}, "features": {"type": "array", "items": {}}, "url": {"type": "string"}, "md5": {"type": "string"}, "md5_file": {"type": "string"}, "sha1": {"type": "string"}, "sha1_file": {"type": "string"}, "sha256": {"type": "string"}, "sha256_file": {"type": "string"}, "sha512": {"type": "string"}, "sha512_file": {"type": "string"}, "size": {"type": "integer"}}, "required": ["vendor", "filename", "release_type", "version", "java_version", "jvm_impl", "os", "architecture", "file_type", "image_type", "features", "url", "md5", "md5_file", "sha1", "sha1_file", "sha256", "sha256_file", "sha512", "sha512_file", "size"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"vendor" : "sapmachine", "filename" : "sapmachine-jdk-16-ea.18_windows-x64_bin.msi", "release_type" : "ea", "version" : "16-ea.18", "java_version" : "16-ea.18", "jvm_impl" : "hotspot", "os" : "windows", "architecture" : "x86_64", "file_type" : "msi", "image_type" : "jdk", "features" : [], "url" : "https://github.com/SAP/SapMachine/releases/download/sapmachine-16+18/sapmachine-jdk-16-ea.18_windows-x64_bin.msi", "md5" : "ca57fd0b0443a4986a9401743e8f0008", "md5_file" : "sapmachine-jdk-16-ea.18_windows-x64_bin.msi.md5", "sha1" : "aa400e15a82edefe19d65fb2048f02434f83b81b", "sha1_file" : "sapmachine-jdk-16-ea.18_windows-x64_bin.msi.sha1", "sha256" : "090e14e20ca2327ca1a66c0a10df97f27ad5c46af064fb94ef607ec6ed2e7e71", "sha256_file" : "sapmachine-jdk-16-ea.18_windows-x64_bin.msi.sha256", "sha512" : "eebe6805378c27ed26274a33de4343c91e801fbfe17e5434532c9e1eded39a1319b25971cc94c180c8a9f8352e087ac96083735a68a77c45ed64f9a1339cdbab", "sha512_file" : "sapmachine-jdk-16-ea.18_windows-x64_bin.msi.sha512", "size" : 203202560} | json_instruct | {"type": "object", "properties": {"vendor": {"type": "string"}, "filename": {"type": "string"}, "release_type": {"type": "string"}, "version": {"type": "string"}, "java_version": {"type": "string"}, "jvm_impl": {"type": "string"}, "os": {"type": "string"}, "architecture": {"type": "string"}, "file_type": {"type": "string"}, "image_type": {"type": "string"}, "features": {"type": "array", "items": {}}, "url": {"type": "string"}, "md5": {"type": "string"}, "md5_file": {"type": "string"}, "sha1": {"type": "string"}, "sha1_file": {"type": "string"}, "sha256": {"type": "string"}, "sha256_file": {"type": "string"}, "sha512": {"type": "string"}, "sha512_file": {"type": "string"}, "size": {"type": "integer"}}, "required": ["vendor", "filename", "release_type", "version", "java_version", "jvm_impl", "os", "architecture", "file_type", "image_type", "features", "url", "md5", "md5_file", "sha1", "sha1_file", "sha256", "sha256_file", "sha512", "sha512_file", "size"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"title": {"type": "string"}, "downloads": {"type": "integer"}, "tags": {"type": "array", "items": {"type": "string"}}, "hxl": {"type": "integer"}, "org": {"type": "string"}, "id": {"type": "string"}, "resources": {"type": "array", "items": {"type": "object", "properties": {"update_date": {"type": "string"}, "link": {"type": "string"}}, "required": ["update_date", "link"]}}}, "required": ["title", "downloads", "tags", "hxl", "org", "id", "resources"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Lebanon - Energy and Mining", "downloads" : 95, "tags" : ["energy", "hxl", "indicators", "mining", "Lebanon"], "hxl" : 1, "org" : "World Bank Group", "id" : "69c65951-fc6e-4ace-b4b0-4154b16c5e3d", "resources" : [{"update_date" : "2021-01-28T12:40:05.148671", "link" : "https://data.humdata.org/dataset/69c65951-fc6e-4ace-b4b0-4154b16c5e3d/resource/c0660e55-2902-4aff-b4fb-e1239891d961/download/energy-and-mining_lbn.csv"}, {"update_date" : "2021-01-28T12:40:05.148671", "link" : "https://data.humdata.org/dataset/69c65951-fc6e-4ace-b4b0-4154b16c5e3d/resource/22d3f51d-16b2-4e6d-8ba1-e5bb21ff6761/download/qc_energy-and-mining_lbn.csv"}]} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "downloads": {"type": "integer"}, "tags": {"type": "array", "items": {"type": "string"}}, "hxl": {"type": "integer"}, "org": {"type": "string"}, "id": {"type": "string"}, "resources": {"type": "array", "items": {"type": "object", "properties": {"update_date": {"type": "string"}, "link": {"type": "string"}}, "required": ["update_date", "link"]}}}, "required": ["title", "downloads", "tags", "hxl", "org", "id", "resources"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"stylelint.validate": {"type": "array", "items": {"type": "string"}}}, "required": ["stylelint.validate"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"stylelint.validate" : ["css", "postcss", "svelte"]} | json_instruct | {"type": "object", "properties": {"stylelint.validate": {"type": "array", "items": {"type": "string"}}}, "required": ["stylelint.validate"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "summary": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "object", "properties": {"type": {"type": "string"}, "file": {"type": "string"}}, "required": ["type", "file"]}, "authors": {"type": "object", "properties": {"zhangwei2318": {"type": "string"}}, "required": ["zhangwei2318"]}, "source": {"type": "object", "properties": {"git": {"type": "string"}, "tag": {"type": "string"}}, "required": ["git", "tag"]}, "platforms": {"type": "object", "properties": {"ios": {"type": "string"}}, "required": ["ios"]}, "source_files": {"type": "string"}, "resource_bundles": {"type": "object", "properties": {"ZWFilterMenuView": {"type": "array", "items": {"type": "string"}}}, "required": ["ZWFilterMenuView"]}, "dependencies": {"type": "object", "properties": {"SnapKit": {"type": "array", "items": {}}}, "required": ["SnapKit"]}}, "required": ["name", "version", "summary", "description", "homepage", "license", "authors", "source", "platforms", "source_files", "resource_bundles", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "ZWFilterMenuView", "version" : "0.2.0", "summary" : "A short description of ZWFilterMenuView.", "description" : "\u8fd9\u662f\u4e00\u4e2a\u4e0b\u62c9\u83dc\u5355,\u53ef\u4ee5\u8fdb\u884c\u591a\u79cd\u81ea\u5b9a\u4e49\u8bbe\u7f6e,\u91c7\u7528\u4e86\u95ed\u5305\u7684\u5f62\u5f0f\u8fdb\u884c\u56de\u8c03.", "homepage" : "https://github.com/zhangwei2318/ZWFilterMenuView", "license" : {"type" : "MIT", "file" : "LICENSE"}, "authors" : {"zhangwei2318" : "zhangwei2318@163.com"}, "source" : {"git" : "https://github.com/zhangwei2318/ZWFilterMenuView.git", "tag" : "0.2.0"}, "platforms" : {"ios" : "9.0"}, "source_files" : "ZWFilterMenuView/Classes/**/*", "resource_bundles" : {"ZWFilterMenuView" : ["ZWFilterMenuView/Assets/*.png"]}, "dependencies" : {"SnapKit" : []}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "summary": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "object", "properties": {"type": {"type": "string"}, "file": {"type": "string"}}, "required": ["type", "file"]}, "authors": {"type": "object", "properties": {"zhangwei2318": {"type": "string"}}, "required": ["zhangwei2318"]}, "source": {"type": "object", "properties": {"git": {"type": "string"}, "tag": {"type": "string"}}, "required": ["git", "tag"]}, "platforms": {"type": "object", "properties": {"ios": {"type": "string"}}, "required": ["ios"]}, "source_files": {"type": "string"}, "resource_bundles": {"type": "object", "properties": {"ZWFilterMenuView": {"type": "array", "items": {"type": "string"}}}, "required": ["ZWFilterMenuView"]}, "dependencies": {"type": "object", "properties": {"SnapKit": {"type": "array", "items": {}}}, "required": ["SnapKit"]}}, "required": ["name", "version", "summary", "description", "homepage", "license", "authors", "source", "platforms", "source_files", "resource_bundles", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"connection": {"type": "string"}, "transfer-encoding": {"type": "string"}, "date": {"type": "string"}, "access-control-allow-origin": {"type": "string"}, "strict-transport-security": {"type": "string"}, "content-type": {"type": "string"}, "access-control-max-age": {"type": "string"}, "server": {"type": "string"}, "content-security-policy-report-only": {"type": "string"}, "x-powered-by": {"type": "string"}, "access-control-allow-headers": {"type": "string"}, "keep-alive": {"type": "string"}, "access-control-allow-methods": {"type": "string"}}, "required": ["connection", "transfer-encoding", "date", "access-control-allow-origin", "strict-transport-security", "content-type", "access-control-max-age", "server", "content-security-policy-report-only", "x-powered-by", "access-control-allow-headers", "keep-alive", "access-control-allow-methods"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"connection" : "keep-alive", "transfer-encoding" : "chunked", "date" : "Thu, 13 Feb 2020 01:40:44 GMT", "access-control-allow-origin" : "*", "strict-transport-security" : "max-age=31536000; includeSubdomains; preload", "content-type" : "application/json", "access-control-max-age" : "1000", "server" : "nginx", "content-security-policy-report-only" : "default-src https:; script-src https: 'unsafe-eval' 'unsafe-inline'; style-src https: 'unsafe-inline'; img-src https: data:; font-src https: data:; report-uri /csp-report", "x-powered-by" : "PHP/7.3.8", "access-control-allow-headers" : "Content-Type", "keep-alive" : "timeout=20", "access-control-allow-methods" : "POST"} | json_instruct | {"type": "object", "properties": {"connection": {"type": "string"}, "transfer-encoding": {"type": "string"}, "date": {"type": "string"}, "access-control-allow-origin": {"type": "string"}, "strict-transport-security": {"type": "string"}, "content-type": {"type": "string"}, "access-control-max-age": {"type": "string"}, "server": {"type": "string"}, "content-security-policy-report-only": {"type": "string"}, "x-powered-by": {"type": "string"}, "access-control-allow-headers": {"type": "string"}, "keep-alive": {"type": "string"}, "access-control-allow-methods": {"type": "string"}}, "required": ["connection", "transfer-encoding", "date", "access-control-allow-origin", "strict-transport-security", "content-type", "access-control-max-age", "server", "content-security-policy-report-only", "x-powered-by", "access-control-allow-headers", "keep-alive", "access-control-allow-methods"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Feature", "properties" : {"type" : "barangay", "level" : "4", "label" : "Tomana East, Rosales, Pangasinan, Ilocos Region (Region I), PH", "locale" : "ph.ilocos-region-region-i.pangasinan.rosales.tomana-east", "country_id" : 177, "country_reference" : 177, "country_name" : "Philippines", "region_id" : "11", "region_reference" : "1", "region_name" : "Ilocos Region (Region I)", "province_id" : "61", "province_reference" : "61", "province_name" : "Pangasinan", "city_id" : "1088", "city_reference" : "1269", "city_name" : "Rosales", "barangay_id" : "31196", "barangay_reference" : "32863", "barangay_name" : "Tomana East"}, "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[120.615707, 15.90226], [120.616592, 15.89458], [120.61657, 15.8865], [120.616287, 15.88539], [120.6138, 15.88526], [120.612823, 15.88941], [120.61203, 15.89282], [120.611458, 15.89371], [120.609787, 15.89589], [120.608368, 15.89741], [120.608063, 15.89919], [120.60817, 15.89985], [120.608414, 15.90072], [120.612938, 15.90282], [120.614899, 15.90378], [120.615707, 15.90226]]]]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}}, "required": ["build"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@nimiq/network-client": {"type": "string"}}, "required": ["@nimiq/network-client"]}, "devDependencies": {"type": "object", "properties": {"rollup": {"type": "string"}, "rollup-plugin-node-resolve": {"type": "string"}}, "required": ["rollup", "rollup-plugin-node-resolve"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "network-client-demo-rollup", "version" : "1.0.0", "description" : "A sample app using Nimiq network client and rollup", "main" : "demo.js", "scripts" : {"build" : "rollup -c"}, "repository" : {"type" : "git", "url" : "git+https://github.com/nimiq/network.git"}, "keywords" : ["Nimiq", "network", "demo", "rollup"], "author" : "Nimiq", "license" : "Apache-2.0", "bugs" : {"url" : "https://github.com/nimiq/network/issues"}, "homepage" : "https://github.com/nimiq/network#readme", "dependencies" : {"@nimiq/network-client" : "../../"}, "devDependencies" : {"rollup" : "^0.66.0", "rollup-plugin-node-resolve" : "^3.4.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}}, "required": ["build"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@nimiq/network-client": {"type": "string"}}, "required": ["@nimiq/network-client"]}, "devDependencies": {"type": "object", "properties": {"rollup": {"type": "string"}, "rollup-plugin-node-resolve": {"type": "string"}}, "required": ["rollup", "rollup-plugin-node-resolve"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"nom" : "Entrains-sur-Nohain", "dpt" : "Ni\u00e8vre", "inscrits" : 609, "abs" : 158, "votants" : 451, "blancs" : 11, "nuls" : 4, "exp" : 436, "res" : [{"panneau" : "2", "voix" : 113}, {"panneau" : "11", "voix" : 103}, {"panneau" : "3", "voix" : 79}, {"panneau" : "9", "voix" : 74}, {"panneau" : "1", "voix" : 27}, {"panneau" : "4", "voix" : 13}, {"panneau" : "6", "voix" : 10}, {"panneau" : "5", "voix" : 6}, {"panneau" : "8", "voix" : 6}, {"panneau" : "10", "voix" : 5}, {"panneau" : "7", "voix" : 0}]} | json_instruct | {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "size": {"type": "integer"}, "link": {"type": "string"}, "created_at": {"type": "string"}, "downloads": {"type": "integer"}, "linkid": {"type": "string"}, "convert": {"type": "string"}, "achorname": {"type": "string"}, "subscribe": {"type": "string"}, "avatar-img": {"type": "string"}, "folderName": {"type": "string"}, "thumbUrl": {"type": "string"}}, "required": ["name", "size", "link", "created_at", "downloads", "linkid", "convert", "achorname", "subscribe", "avatar-img", "folderName", "thumbUrl"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"name" : "ure-056_1", "size" : 1137430838, "link" : "https://streamtape.com/e/oezKjVqyvYsJmVL", "created_at" : "2022\u5e7403\u670828\u65e5 04:32:05", "downloads" : 0, "linkid" : "oezKjVqyvYsJmVL", "convert" : "converted", "achorname" : "\u4e38\u5b50\u5466", "subscribe" : "0\u4f4d\u8ba2\u9605\u8005", "avatar-img" : "https://huyaimg.msstatic.com/avatar/1022/07/ec5fef7c7662720286fbbb12395390_180_135.jpg?1628178596?458648", "folderName" : "URE-056 \u7d93\u5178\u6f2b\u6539\u8d81\u8457\u59e8\u4e08\u4e0d\u6ce8\u610f\u548c\u963f\u59e8\u53cb\u7530\u771f\u5e0c\u5167\u5c04\u505a\u611b \u53cb\u7530\u771f\u5e0c", "thumbUrl" : "https://assets-cdn.jable.tv/contents/videos_screenshots/7000/7386/320x180/1.jpg"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "size": {"type": "integer"}, "link": {"type": "string"}, "created_at": {"type": "string"}, "downloads": {"type": "integer"}, "linkid": {"type": "string"}, "convert": {"type": "string"}, "achorname": {"type": "string"}, "subscribe": {"type": "string"}, "avatar-img": {"type": "string"}, "folderName": {"type": "string"}, "thumbUrl": {"type": "string"}}, "required": ["name", "size", "link", "created_at", "downloads", "linkid", "convert", "achorname", "subscribe", "avatar-img", "folderName", "thumbUrl"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "exports": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}, "prod": {"type": "string"}}, "required": ["start", "build", "prod"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["nodemon", "typescript"]}, "dependencies": {"type": "object", "properties": {"@pythnetwork/client": {"type": "string"}, "pino": {"type": "string"}, "pino-pretty": {"type": "string"}, "solclientjs": {"type": "string"}, "ts-node": {"type": "string"}}, "required": ["@pythnetwork/client", "pino", "pino-pretty", "solclientjs", "ts-node"]}}, "required": ["name", "version", "description", "exports", "scripts", "keywords", "author", "license", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "pyth-event-mesh", "version" : "1.0.0", "description" : "Sample feedhandler from Pyth to Solace", "exports" : "./index.js", "scripts" : {"start" : "nodemon src/index.ts", "build" : "tsc -p .", "prod" : "node build/src/index.js"}, "keywords" : ["pyth", "crypto", "tensorflow"], "author" : "TKTheTechie", "license" : "ISC", "devDependencies" : {"nodemon" : "^2.0.15", "typescript" : "^4.6.2"}, "dependencies" : {"@pythnetwork/client" : "^2.6.1", "pino" : "^7.9.1", "pino-pretty" : "^7.5.4", "solclientjs" : "^10.9.0", "ts-node" : "^10.7.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "exports": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}, "prod": {"type": "string"}}, "required": ["start", "build", "prod"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["nodemon", "typescript"]}, "dependencies": {"type": "object", "properties": {"@pythnetwork/client": {"type": "string"}, "pino": {"type": "string"}, "pino-pretty": {"type": "string"}, "solclientjs": {"type": "string"}, "ts-node": {"type": "string"}}, "required": ["@pythnetwork/client", "pino", "pino-pretty", "solclientjs", "ts-node"]}}, "required": ["name", "version", "description", "exports", "scripts", "keywords", "author", "license", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"derivation": {"type": "string"}, "pron": {"type": "string"}, "outline": {"type": "string"}, "kjv_def": {"type": "string"}, "lemma": {"type": "string"}, "frequency": {"type": "integer"}, "strongs_def": {"type": "string"}, "xlit": {"type": "string"}}, "required": ["derivation", "pron", "outline", "kjv_def", "lemma", "frequency", "strongs_def", "xlit"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"derivation" : "or \u05d2\u05bc\u05b0\u05d3\u05bb\u05dc\u05bc\u05b8\u05d4; (shortened) or (less accurately) \u05d2\u05bc\u05b0\u05d3\u05d5\u05bc\u05dc\u05bc\u05b8\u05d4; feminine of H1419 (\u05d2\u05bc\u05b8\u05d3\u05d5\u05b9\u05dc);", "pron" : "ghed-oo-law'", "outline" : "<ol><li> greatness<ol><li> of man</li><li> of God's greatness (as an attribute)</li></ol></li></ol>", "kjv_def" : "dignity, great things(-ness), majesty.", "lemma" : "\u05d2\u05bc\u05b0\u05d3\u05d5\u05bc\u05dc\u05b8\u05d4", "frequency" : 12, "strongs_def" : "greatness; (concretely) mighty acts", "xlit" : "g\u1d49d\u00fbwl\u00e2h"} | json_instruct | {"type": "object", "properties": {"derivation": {"type": "string"}, "pron": {"type": "string"}, "outline": {"type": "string"}, "kjv_def": {"type": "string"}, "lemma": {"type": "string"}, "frequency": {"type": "integer"}, "strongs_def": {"type": "string"}, "xlit": {"type": "string"}}, "required": ["derivation", "pron", "outline", "kjv_def", "lemma", "frequency", "strongs_def", "xlit"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"word" : "trustee stock", "definition" : "High-grade stock in which trust funds may be legally invested. [Colloq.]"} | json_instruct | {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"env": {"type": "object", "properties": {"browser": {"type": "boolean"}, "worker": {"type": "boolean"}, "es2021": {"type": "boolean"}}, "required": ["browser", "worker", "es2021"]}, "globals": {"type": "object", "properties": {"noise": {"type": "string"}}, "required": ["noise"]}}, "required": ["env", "globals"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"env" : {"browser" : true, "worker" : true, "es2021" : true}, "globals" : {"noise" : "readonly"}} | json_instruct | {"type": "object", "properties": {"env": {"type": "object", "properties": {"browser": {"type": "boolean"}, "worker": {"type": "boolean"}, "es2021": {"type": "boolean"}}, "required": ["browser", "worker", "es2021"]}, "globals": {"type": "object", "properties": {"noise": {"type": "string"}}, "required": ["noise"]}}, "required": ["env", "globals"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"time_fct_id": {"type": "integer"}, "time_fct": {"type": "string"}, "affiliate_fct_id": {"type": "integer"}, "affiliate_fct": {"type": "string"}, "affiliate_fct_occurrence": {"type": "integer"}, "affiliates": {"type": "array", "items": {"type": "object", "properties": {"affiliate_fct_id": {"type": "integer"}, "affiliate_fct": {"type": "string"}, "affiliate_fct_occurrence": {"type": "integer"}}, "required": ["affiliate_fct_id", "affiliate_fct", "affiliate_fct_occurrence"]}}}, "required": ["time_fct_id", "time_fct", "affiliate_fct_id", "affiliate_fct", "affiliate_fct_occurrence", "affiliates"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"time_fct_id" : 42, "time_fct" : "time_60900", "affiliate_fct_id" : 1744, "affiliate_fct" : "Staatsbibliothek zu Berlin - Preu\u00dfischer Kulturbesitz (Berlin)", "affiliate_fct_occurrence" : 53, "affiliates" : [{"affiliate_fct_id" : 1744, "affiliate_fct" : "Staatsbibliothek zu Berlin - Preu\u00dfischer Kulturbesitz (Berlin)", "affiliate_fct_occurrence" : 53}, {"affiliate_fct_id" : 616388, "affiliate_fct" : "Ludwig (Heiliges R\u00f6misches Reich, K\u00f6nig, 2, der Deutsche)", "affiliate_fct_occurrence" : 1}]} | json_instruct | {"type": "object", "properties": {"time_fct_id": {"type": "integer"}, "time_fct": {"type": "string"}, "affiliate_fct_id": {"type": "integer"}, "affiliate_fct": {"type": "string"}, "affiliate_fct_occurrence": {"type": "integer"}, "affiliates": {"type": "array", "items": {"type": "object", "properties": {"affiliate_fct_id": {"type": "integer"}, "affiliate_fct": {"type": "string"}, "affiliate_fct_occurrence": {"type": "integer"}}, "required": ["affiliate_fct_id", "affiliate_fct", "affiliate_fct_occurrence"]}}}, "required": ["time_fct_id", "time_fct", "affiliate_fct_id", "affiliate_fct", "affiliate_fct_occurrence", "affiliates"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"$schema": {"type": "string"}, "title": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"children": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}, "items": {"type": "object", "properties": {"$ref": {"type": "string"}}, "required": ["$ref"]}}, "required": ["type", "description", "items"]}}, "required": ["children"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "title", "description", "type", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"$schema" : "http://json-schema.org/draft-07/schema#", "title" : "Gallery layout switcher", "description" : "Logical block that allows users to switch between the available `gallery`'s layouts.\nIt receives no props and expects as child the `gallery-layout-option` block described below. It's important to define the options in the same order as the layouts, so the accessibility features can work properly.", "type" : "object", "properties" : {"children" : {"type" : "array", "description" : "list of the `gallery-layout-option`. It's important to define the options in the same order as the layouts, so the accessibility features can work properly.", "items" : {"$ref" : "../shared/block.schema.json"}}}, "required" : ["children"]} | json_instruct | {"type": "object", "properties": {"$schema": {"type": "string"}, "title": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"children": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}, "items": {"type": "object", "properties": {"$ref": {"type": "string"}}, "required": ["$ref"]}}, "required": ["type", "description", "items"]}}, "required": ["children"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "title", "description", "type", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"question": {"type": "string"}, "value": {"type": "integer"}, "responses": {"type": "array", "items": {"type": "string"}}, "answer": {"type": "string"}}, "required": ["question", "value", "responses", "answer"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"question" : "How many fingers am I holding up?", "value" : 50, "responses" : ["One", "Four", "Ten", "Indeterminate"], "answer" : "Indeterminate"} | json_instruct | {"type": "object", "properties": {"question": {"type": "string"}, "value": {"type": "integer"}, "responses": {"type": "array", "items": {"type": "string"}}, "answer": {"type": "string"}}, "required": ["question", "value", "responses", "answer"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"lastUpdated": {"type": "string"}}, "required": ["lastUpdated"]}, "url": {"type": "string"}, "status": {"type": "string"}, "experimental": {"type": "boolean"}, "stringency": {"type": "string"}, "element": {"type": "array", "items": {"type": "object", "properties": {"path": {"type": "string"}, "short": {"type": "string"}, "definition": {"type": "string"}, "min": {"type": "integer"}, "max": {"type": "string"}, "type": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "profile": {"type": "array", "items": {"type": "string"}}}, "required": ["code", "profile"]}}, "mapping": {"type": "array", "items": {"type": "object", "properties": {"identity": {"type": "string"}, "map": {"type": "string"}}, "required": ["identity", "map"]}}}, "required": ["path", "short", "definition", "min", "max", "type", "mapping"]}}}, "required": ["resourceType", "id", "meta", "url", "status", "experimental", "stringency", "element"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"resourceType" : "DataElement", "id" : "Device.location", "meta" : {"lastUpdated" : "2015-10-24T07:41:03.495+11:00"}, "url" : "http://hl7.org/fhir/DataElement/Device.location", "status" : "draft", "experimental" : true, "stringency" : "fully-specified", "element" : [{"path" : "Device.location", "short" : "Where the resource is found", "definition" : "The place where the device can be found.", "min" : 0, "max" : "1", "type" : [{"code" : "Reference", "profile" : ["http://hl7.org/fhir/StructureDefinition/Location"]}], "mapping" : [{"identity" : "rim", "map" : ".playedRole[typeCode=LOCE].scoper"}, {"identity" : "w5", "map" : "where"}]}]} | json_instruct | {"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"lastUpdated": {"type": "string"}}, "required": ["lastUpdated"]}, "url": {"type": "string"}, "status": {"type": "string"}, "experimental": {"type": "boolean"}, "stringency": {"type": "string"}, "element": {"type": "array", "items": {"type": "object", "properties": {"path": {"type": "string"}, "short": {"type": "string"}, "definition": {"type": "string"}, "min": {"type": "integer"}, "max": {"type": "string"}, "type": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "profile": {"type": "array", "items": {"type": "string"}}}, "required": ["code", "profile"]}}, "mapping": {"type": "array", "items": {"type": "object", "properties": {"identity": {"type": "string"}, "map": {"type": "string"}}, "required": ["identity", "map"]}}}, "required": ["path", "short", "definition", "min", "max", "type", "mapping"]}}}, "required": ["resourceType", "id", "meta", "url", "status", "experimental", "stringency", "element"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"900402090": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402091": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402092": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402093": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402094": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402095": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402096": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402097": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402098": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402099": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}}, "required": ["900402090", "900402091", "900402092", "900402093", "900402094", "900402095", "900402096", "900402097", "900402098", "900402099"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"900402090" : {"nama" : "TPS 01", "dapil" : [3301, 13302, 2332201]}, "900402091" : {"nama" : "TPS 02", "dapil" : [3301, 13302, 2332201]}, "900402092" : {"nama" : "TPS 03", "dapil" : [3301, 13302, 2332201]}, "900402093" : {"nama" : "TPS 04", "dapil" : [3301, 13302, 2332201]}, "900402094" : {"nama" : "TPS 05", "dapil" : [3301, 13302, 2332201]}, "900402095" : {"nama" : "TPS 06", "dapil" : [3301, 13302, 2332201]}, "900402096" : {"nama" : "TPS 07", "dapil" : [3301, 13302, 2332201]}, "900402097" : {"nama" : "TPS 08", "dapil" : [3301, 13302, 2332201]}, "900402098" : {"nama" : "TPS 09", "dapil" : [3301, 13302, 2332201]}, "900402099" : {"nama" : "TPS 10", "dapil" : [3301, 13302, 2332201]}} | json_instruct | {"type": "object", "properties": {"900402090": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402091": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402092": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402093": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402094": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402095": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402096": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402097": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402098": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "900402099": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}}, "required": ["900402090", "900402091", "900402092", "900402093", "900402094", "900402095", "900402096", "900402097", "900402098", "900402099"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "wilderworld:block/wisteria_fence_gate"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[143.625, 39.166666666666664], [143.625, 39.25], [143.75, 39.25], [143.75, 39.166666666666664], [143.625, 39.166666666666664]]]}, "properties" : {"code" : 584365, "url" : "http://madefor.github.io/0410/api/v1/584365.geojson", "view" : "https://github.com/madefor/0410/blob/gh-pages/api/v1/584365.geojson"}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.