input stringlengths 159 2.05k | output stringlengths 5 10.3k | task stringclasses 1
value | schema stringlengths 100 1.99k |
|---|---|---|---|
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "category": {"type": "string"}, "start_url": {"type": "string"}, "icons": {"type": "array", "items": {"type": "object", "properties": {"src": {"type": "string"}, "platform": {"type": "string"}}, "required": ["src", "platform"]}}, "theme_color": {"type": "string"}, "scope": {"type": "string"}}, "required": ["name", "category", "start_url", "icons", "theme_color", "scope"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Diigo", "category" : "Curation & Sourcing", "start_url" : "https://www.diigo.com/sign-in", "icons" : [{"src" : "https://cdn.filestackcontent.com/vRR26TIjSuOmtuxINrV1", "platform" : "browserx"}], "theme_color" : "#4F87C7", "scope" : "https://www.diigo.com/"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "category": {"type": "string"}, "start_url": {"type": "string"}, "icons": {"type": "array", "items": {"type": "object", "properties": {"src": {"type": "string"}, "platform": {"type": "string"}}, "required": ["src", "platform"]}}, "theme_color": {"type": "string"}, "scope": {"type": "string"}}, "required": ["name", "category", "start_url", "icons", "theme_color", "scope"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"bin": {"type": "object", "properties": {"elm-webapp": {"type": "string"}}, "required": ["elm-webapp"]}, "name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["bin", "name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "files", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"bin" : {"elm-webapp" : "./bin/elm-webapp.js"}, "name" : "elm-webapp", "version" : "3.1.1", "description" : "cli to initialize an elm-webapp app", "main" : "bin/elm-webapp", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "repository" : {"type" : "git", "url" : "git+https://github.com/choonkeat/elm-webapp.git"}, "keywords" : ["elm", "webapp", "elm-webapp", "webapp", "elm-webapp", "http", "client", "server"], "author" : "choonkeat", "license" : "MIT", "bugs" : {"url" : "https://github.com/choonkeat/elm-webapp/issues"}, "homepage" : "https://github.com/choonkeat/elm-webapp#readme", "files" : ["templates/**/*.js", "templates/*/Makefile", "templates/*/src", "templates/*/public", "templates/crud.diff", "bin"], "dependencies" : {}} | json_instruct | {"type": "object", "properties": {"bin": {"type": "object", "properties": {"elm-webapp": {"type": "string"}}, "required": ["elm-webapp"]}, "name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["bin", "name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "files", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "abv": {"type": "number"}, "ibu": {"type": "number"}, "srm": {"type": "number"}, "upc": {"type": "integer"}, "type": {"type": "string"}, "brewery_id": {"type": "string"}, "updated": {"type": "string"}, "description": {"type": "string"}}, "required": ["name", "abv", "ibu", "srm", "upc", "type", "brewery_id", "updated", "description"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Ungespundet Lager Hefetrub", "abv" : 5.2, "ibu" : 0.0, "srm" : 0.0, "upc" : 0, "type" : "beer", "brewery_id" : "bamberger_mahr_s_bru", "updated" : "2010-07-22 20:00:20", "description" : ""} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "abv": {"type": "number"}, "ibu": {"type": "number"}, "srm": {"type": "number"}, "upc": {"type": "integer"}, "type": {"type": "string"}, "brewery_id": {"type": "string"}, "updated": {"type": "string"}, "description": {"type": "string"}}, "required": ["name", "abv", "ibu", "srm", "upc", "type", "brewery_id", "updated", "description"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 85905209, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes_pg", "src:geom" : "quattroshapes_pg", "wof:geomhash" : "a0f694afbb945bd1451905e7ba86cf27", "wof:id" : 85905209, "wof:repo" : "whosonfirst-data-admin-se"}, "bbox" : [11.970643, 57.685225, 11.970643, 57.685225], "geometry" : {"coordinates" : [11.970643, 57.685225], "type" : "Point"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"display_name": {"type": "string"}, "metadata": {"type": "object", "properties": {"language": {"type": "string"}, "description": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "code": {"type": "array", "items": {"type": "string"}}}, "required": ["language", "description", "tags", "code"]}, "schema_name": {"type": "string"}}, "required": ["display_name", "metadata", "schema_name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"display_name" : "labelSS", "metadata" : {"language" : "python", "description" : "Label SS.", "tags" : ["pymol", "labelSS", "format label", "chain", "secondary structure"], "code" : ["cmd.do('alter chain A, ss='helix';')", "cmd.do('label (%2),'%3';')"]}, "schema_name" : "code-snippet"} | json_instruct | {"type": "object", "properties": {"display_name": {"type": "string"}, "metadata": {"type": "object", "properties": {"language": {"type": "string"}, "description": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "code": {"type": "array", "items": {"type": "string"}}}, "required": ["language", "description", "tags", "code"]}, "schema_name": {"type": "string"}}, "required": ["display_name", "metadata", "schema_name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"private": {"type": "boolean"}, "type": {"type": "string"}, "name": {"type": "string"}, "version": {"type": "string"}, "scripts": {"type": "object", "properties": {"make": {"type": "string"}}, "required": ["make"]}, "devDependencies": {"type": "object", "properties": {"generate-github-markdown-css": {"type": "string"}}, "required": ["generate-github-markdown-css"]}}, "required": ["private", "type", "name", "version", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"private" : true, "type" : "module", "name" : "@hyrious/github-markdown-css", "version" : "5.0.1", "scripts" : {"make" : "node make.js"}, "devDependencies" : {"generate-github-markdown-css" : "^5.0.1"}} | json_instruct | {"type": "object", "properties": {"private": {"type": "boolean"}, "type": {"type": "string"}, "name": {"type": "string"}, "version": {"type": "string"}, "scripts": {"type": "object", "properties": {"make": {"type": "string"}}, "required": ["make"]}, "devDependencies": {"type": "object", "properties": {"generate-github-markdown-css": {"type": "string"}}, "required": ["generate-github-markdown-css"]}}, "required": ["private", "type", "name", "version", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "main": {"type": "string"}, "exports": {"type": "object", "properties": {".": {"type": "string"}}, "required": ["."]}, "dependencies": {"type": "object", "properties": {"@symatem/core": {"type": "string"}}, "required": ["@symatem/core"]}}, "required": ["name", "version", "publishConfig", "main", "exports", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@symatem/compiler", "version" : "0.0.0-semantic-release", "publishConfig" : {"access" : "public"}, "main" : "./src/main.mjs", "exports" : {"." : "./src/main.mjs"}, "dependencies" : {"@symatem/core" : "^0.0.8"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "main": {"type": "string"}, "exports": {"type": "object", "properties": {".": {"type": "string"}}, "required": ["."]}, "dependencies": {"type": "object", "properties": {"@symatem/core": {"type": "string"}}, "required": ["@symatem/core"]}}, "required": ["name", "version", "publishConfig", "main", "exports", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"id": {"type": "integer"}, "source": {"type": "string"}, "verse_id": {"type": "integer"}, "verse_count": {"type": "integer"}, "reference": {"type": "string"}, "title": {"type": "string"}, "html": {"type": "string"}, "audit": {"type": "null"}}, "required": ["id", "source", "verse_id", "verse_count", "reference", "title", "html", "audit"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 10860, "source" : "ellicott", "verse_id" : 17800, "verse_count" : 1, "reference" : "7:17", "title" : "", "html" : "<p>The Lord shall bring upon thee . . .\u2014The prophet\u2019s language shows that he reads the secret thoughts of the king\u2019s heart. He was bent on calling in the help of the king of Assyria. Isaiah warns him (reserving the name of the king, with all the emphasis of suddenness, for the close of his sentence) that by so doing he is bringing on himself a more formidable invasion than that of Syria and Ephraim, worse than any that had been known since the separation of the two kingdoms (we note the use of the event as a chronological era), than that of Shishak under Rehoboam (<a class=\"ref\">2 Chronicles 12:2</a>), or Zerah (<a class=\"ref\">2 Chronicles 14:9</a>), or of Baasha under Asa (<a class=\"ref\">2 Chronicles 16:1</a>), or of the Moabites and Ammonites under Jehoshaphat (<a class=\"ref\">2 Chronicles 20:1</a>), or of the Philistines and Arabians under Jehoram (<a class=\"ref\">2 Chronicles 21:16</a>). So in <a class=\"ref\">2 Chronicles 28:19-20</a>, we read that \u201cthe Lord brought Judah low and made it naked,\u201d that \u201cTilgath-pilneser, king of Assyria, came unto Ahaz and distressed him,\u201d and this was but the precursor of the great invasions under Sargon and Sennacherib. </p>", "audit" : null} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "source": {"type": "string"}, "verse_id": {"type": "integer"}, "verse_count": {"type": "integer"}, "reference": {"type": "string"}, "title": {"type": "string"}, "html": {"type": "string"}, "audit": {"type": "null"}}, "required": ["id", "source", "verse_id", "verse_count", "reference", "title", "html", "audit"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"word" : "Domino", "definitions" : ["Any of 28 small oblong pieces marked with 0\u20136 pips in each half.", "The game played with dominoes, in which they are laid down to form a line, each player in turn trying to find and lay down a domino with a value matched by that of a piece at either end of the line already formed.", "A loose cloak, worn with a mask for the upper part of the face at masquerades."], "parts-of-speech" : "Noun"} | json_instruct | {"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 101878863, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes", "src:geom" : "quattroshapes", "wof:geomhash" : "e027f07a59e1d728b2c9a42266317f79", "wof:id" : 101878863, "wof:repo" : "whosonfirst-data-admin-fr"}, "bbox" : [-2.94684775065434, 48.62931341312827, -2.92495447034878, 48.63789587731895], "geometry" : {"coordinates" : [[[-2.93840062334692, 48.63789587731895], [-2.93770451667711, 48.63524481033562], [-2.9336863697834, 48.63571662595132], [-2.93345442326381, 48.63483292528366], [-2.92809687786104, 48.63546177449319], [-2.92786503272765, 48.63457805996143], [-2.92518625959525, 48.63489238153056], [-2.92495447034878, 48.634008659561], [-2.93165123203255, 48.63322275092912], [-2.93188313501901, 48.63410645684235], [-2.93724049755025, 48.63347742726143], [-2.93700850358107, 48.63259373419868], [-2.93834780232373, 48.63243643976381], [-2.93765181455626, 48.62978536411254], [-2.94166946015349, 48.62931341312827], [-2.94259773753788, 48.63284814006357], [-2.94661558708259, 48.6323760056099], [-2.94684775065434, 48.63325967515459], [-2.94416914646877, 48.63357445398759], [-2.94509772283408, 48.63710914770951], [-2.93840062334692, 48.63789587731895]]], "type" : "Polygon"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"navigationBarTitleText": {"type": "string"}, "usingComponents": {"type": "object", "properties": {"van-button": {"type": "string"}, "van-swipe-cell": {"type": "string"}, "van-action-sheet": {"type": "string"}, "van-datetime-picker": {"type": "string"}, "van-icon": {"type": "string"}, "note-card": {"type": "string"}}, "required": ["van-button", "van-swipe-cell", "van-action-sheet", "van-datetime-picker", "van-icon", "note-card"]}}, "required": ["navigationBarTitleText", "usingComponents"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"navigationBarTitleText" : "\u7b14\u8bb0", "usingComponents" : {"van-button" : "@vant/weapp/button/index", "van-swipe-cell" : "@vant/weapp/swipe-cell/index", "van-action-sheet" : "@vant/weapp/action-sheet/index", "van-datetime-picker" : "@vant/weapp/datetime-picker/index", "van-icon" : "@vant/weapp/icon/index", "note-card" : "/components/NoteCard/index"}} | json_instruct | {"type": "object", "properties": {"navigationBarTitleText": {"type": "string"}, "usingComponents": {"type": "object", "properties": {"van-button": {"type": "string"}, "van-swipe-cell": {"type": "string"}, "van-action-sheet": {"type": "string"}, "van-datetime-picker": {"type": "string"}, "van-icon": {"type": "string"}, "note-card": {"type": "string"}}, "required": ["van-button", "van-swipe-cell", "van-action-sheet", "van-datetime-picker", "van-icon", "note-card"]}}, "required": ["navigationBarTitleText", "usingComponents"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
| ["F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\vm_snapshot_data", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\isolate_snapshot_data", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\kernel_blob.bin", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/11.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/J.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/lb.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/login.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/lu.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/one.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/rb.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/ru.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\assets/vector2.png", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\packages/cupertino_icons/assets/CupertinoIcons.ttf", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\fonts/MaterialIcons-Regular.ttf", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\AssetManifest.json", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\FontManifest.json", "F:\\flutter_class\\projects\\Connects2\\build\\app\\intermediates\\flutter\\debug\\flutter_assets\\NOTICES"] | json_instruct | {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"frames": {"type": "array", "items": {"type": "object", "properties": {"filename": {"type": "string"}, "frame": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "w": {"type": "integer"}, "h": {"type": "integer"}}, "required": ["x", "y", "w", "h"]}, "rotated": {"type": "boolean"}, "trimmed": {"type": "boolean"}, "spriteSourceSize": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "w": {"type": "integer"}, "h": {"type": "integer"}}, "required": ["x", "y", "w", "h"]}, "sourceSize": {"type": "object", "properties": {"w": {"type": "integer"}, "h": {"type": "integer"}}, "required": ["w", "h"]}}, "required": ["filename", "frame", "rotated", "trimmed", "spriteSourceSize", "sourceSize"]}}}, "required": ["frames"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"frames" : [{"filename" : "Romo_Hiccup_Idle_v020007.png", "frame" : {"x" : 0, "y" : 0, "w" : 456, "h" : 130}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 88, "y" : 530, "w" : 456, "h" : 130}, "sourceSize" : {"w" : 640, "h" : 960}}, {"filename" : "Romo_Hiccup_Idle_v020008.png", "frame" : {"x" : 0, "y" : 130, "w" : 472, "h" : 170}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 82, "y" : 458, "w" : 472, "h" : 170}, "sourceSize" : {"w" : 640, "h" : 960}}, {"filename" : "Romo_Hiccup_Idle_v020009.png", "frame" : {"x" : 0, "y" : 130, "w" : 472, "h" : 170}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 82, "y" : 458, "w" : 472, "h" : 170}, "sourceSize" : {"w" : 640, "h" : 960}}, {"filename" : "Romo_Hiccup_Idle_v020010.png", "frame" : {"x" : 0, "y" : 300, "w" : 474, "h" : 286}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 81, "y" : 305, "w" : 474, "h" : 286}, "sourceSize" : {"w" : 640, "h" : 960}}, {"filename" : "Romo_Hiccup_Idle_v020011.png", "frame" : {"x" : 0, "y" : 300, "w" : 474, "h" : 286}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 81, "y" : 305, "w" : 474, "h" : 286}, "sourceSize" : {"w" : 640, "h" : 960}}, {"filename" : "Romo_Hiccup_Idle_v020012.png", "frame" : {"x" : 0, "y" : 586, "w" : 484, "h" : 286}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 77, "y" : 294, "w" : 484, "h" : 286}, "sourceSize" : {"w" : 640, "h" : 960}}, {"filename" : "Romo_Hiccup_Idle_v020013.png", "frame" : {"x" : 0, "y" : 586, "w" : 484, "h" : 286}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 77, "y" : 294, "w" : 484, "h" : 286}, "sourceSize" : {"w" : 640, "h" : 960}}, {"filename" : "Romo_Hiccup_Idle_v020014.png", "frame" : {"x" : 0, "y" : 872, "w" : 484, "h" : 284}, "rotated" : false, "trimmed" : true, "spriteSourceSize" : {"x" : 77, "y" : 294, "w" : 484, "h" : 284}, "sourceSize" : {"w" : 640, "h" : 960}}]} | json_instruct | {"type": "object", "properties": {"frames": {"type": "array", "items": {"type": "object", "properties": {"filename": {"type": "string"}, "frame": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "w": {"type": "integer"}, "h": {"type": "integer"}}, "required": ["x", "y", "w", "h"]}, "rotated": {"type": "boolean"}, "trimmed": {"type": "boolean"}, "spriteSourceSize": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "w": {"type": "integer"}, "h": {"type": "integer"}}, "required": ["x", "y", "w", "h"]}, "sourceSize": {"type": "object", "properties": {"w": {"type": "integer"}, "h": {"type": "integer"}}, "required": ["w", "h"]}}, "required": ["filename", "frame", "rotated", "trimmed", "spriteSourceSize", "sourceSize"]}}}, "required": ["frames"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"authority": {"type": "string"}, "mintWrapper": {"type": "string"}, "quarries": {"type": "array", "items": {"type": "object", "properties": {"cached": {"type": "object", "properties": {"famineTs": {"type": "string"}, "index": {"type": "integer"}, "lastUpdateTs": {"type": "string"}, "numMiners": {"type": "string"}, "rewardsPerTokenStored": {"type": "string"}, "rewardsShare": {"type": "string"}, "totalTokensDeposited": {"type": "string"}}, "required": ["famineTs", "index", "lastUpdateTs", "numMiners", "rewardsPerTokenStored", "rewardsShare", "totalTokensDeposited"]}, "index": {"type": "integer"}, "quarry": {"type": "string"}, "slug": {"type": "string"}, "stakedToken": {"type": "object", "properties": {"decimals": {"type": "integer"}, "mint": {"type": "string"}}, "required": ["decimals", "mint"]}}, "required": ["cached", "index", "quarry", "slug", "stakedToken"]}}, "rewardsToken": {"type": "object", "properties": {"decimals": {"type": "integer"}, "mint": {"type": "string"}}, "required": ["decimals", "mint"]}, "rewardsTokenInfo": {"type": "object", "properties": {"address": {"type": "string"}, "chainId": {"type": "integer"}, "decimals": {"type": "integer"}, "name": {"type": "string"}, "symbol": {"type": "string"}}, "required": ["address", "chainId", "decimals", "name", "symbol"]}}, "required": ["authority", "mintWrapper", "quarries", "rewardsToken", "rewardsTokenInfo"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"authority" : "H8TTHQo1ULGwe8LUiZeBSWv6ahpbqFjJLUcT18dye2XB", "mintWrapper" : "CKx5ARewaeNVS9dKCKCdwda8Zm2o5jXUQiogik5QzLUq", "quarries" : [{"cached" : {"famineTs" : "9223372036854775807", "index" : 0, "lastUpdateTs" : "0", "numMiners" : "1", "rewardsPerTokenStored" : "0", "rewardsShare" : "0", "totalTokensDeposited" : "0"}, "index" : 0, "quarry" : "C4V8Zy1uhrr4YFZgqywdYzKYfb7RqWqtSsFMi9QsMU6y", "slug" : "12vm4", "stakedToken" : {"decimals" : 6, "mint" : "12vM4g6aCoP5EUheBfS2K5gdxbPtmuPxUirYm8jFgGo4"}}, {"cached" : {"famineTs" : "9223372036854775807", "index" : 1, "lastUpdateTs" : "0", "numMiners" : "1", "rewardsPerTokenStored" : "0", "rewardsShare" : "0", "totalTokensDeposited" : "0"}, "index" : 1, "quarry" : "DA4HYx9C1RywNFe9P6GUzUSkyxoZk7zG97VbhXLqqoub", "slug" : "j77xg", "stakedToken" : {"decimals" : 6, "mint" : "J77xGfx1FWoD3zGEEYH4iV6CCDTmE9e2kuk4dqTUnHJ6"}}], "rewardsToken" : {"decimals" : 6, "mint" : "6Mki1GxCnH63togJUombhH2T3HTkyiKDVt3ZczoM2v8U"}, "rewardsTokenInfo" : {"address" : "6Mki1GxCnH63togJUombhH2T3HTkyiKDVt3ZczoM2v8U", "chainId" : 103, "decimals" : 6, "name" : "Token 6Mki", "symbol" : "6Mki1"}} | json_instruct | {"type": "object", "properties": {"authority": {"type": "string"}, "mintWrapper": {"type": "string"}, "quarries": {"type": "array", "items": {"type": "object", "properties": {"cached": {"type": "object", "properties": {"famineTs": {"type": "string"}, "index": {"type": "integer"}, "lastUpdateTs": {"type": "string"}, "numMiners": {"type": "string"}, "rewardsPerTokenStored": {"type": "string"}, "rewardsShare": {"type": "string"}, "totalTokensDeposited": {"type": "string"}}, "required": ["famineTs", "index", "lastUpdateTs", "numMiners", "rewardsPerTokenStored", "rewardsShare", "totalTokensDeposited"]}, "index": {"type": "integer"}, "quarry": {"type": "string"}, "slug": {"type": "string"}, "stakedToken": {"type": "object", "properties": {"decimals": {"type": "integer"}, "mint": {"type": "string"}}, "required": ["decimals", "mint"]}}, "required": ["cached", "index", "quarry", "slug", "stakedToken"]}}, "rewardsToken": {"type": "object", "properties": {"decimals": {"type": "integer"}, "mint": {"type": "string"}}, "required": ["decimals", "mint"]}, "rewardsTokenInfo": {"type": "object", "properties": {"address": {"type": "string"}, "chainId": {"type": "integer"}, "decimals": {"type": "integer"}, "name": {"type": "string"}, "symbol": {"type": "string"}}, "required": ["address", "chainId", "decimals", "name", "symbol"]}}, "required": ["authority", "mintWrapper", "quarries", "rewardsToken", "rewardsTokenInfo"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"imageUrl": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "heading": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "text": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "cardHeight": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "cardWidth": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "cardTitle": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}}, "required": ["imageUrl", "heading", "text", "cardHeight", "cardWidth", "cardTitle"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"imageUrl" : {"name" : "imageUrl", "type" : "String", "value" : "\"\"", "reflectToAttribute" : false, "observer" : false}, "heading" : {"name" : "heading", "type" : "String", "value" : "\"\"", "reflectToAttribute" : false, "observer" : false}, "text" : {"name" : "text", "type" : "String", "value" : "\"\"", "reflectToAttribute" : false, "observer" : false}, "cardHeight" : {"name" : "cardHeight", "type" : "String", "value" : "\"\"", "reflectToAttribute" : false, "observer" : false}, "cardWidth" : {"name" : "cardWidth", "type" : "String", "value" : "\"\"", "reflectToAttribute" : false, "observer" : false}, "cardTitle" : {"name" : "cardTitle", "type" : "String", "value" : "\"\"", "reflectToAttribute" : false, "observer" : false}} | json_instruct | {"type": "object", "properties": {"imageUrl": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "heading": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "text": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "cardHeight": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "cardWidth": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}, "cardTitle": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "value": {"type": "string"}, "reflectToAttribute": {"type": "boolean"}, "observer": {"type": "boolean"}}, "required": ["name", "type", "value", "reflectToAttribute", "observer"]}}, "required": ["imageUrl", "heading", "text", "cardHeight", "cardWidth", "cardTitle"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"courseCode": {"type": "string"}, "courseCredit": {"type": "string"}, "description": {"type": "string"}, "faculty": {"type": "string"}, "fulfillRequirements": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}}, "required": ["courseCode", "courseCredit", "description", "faculty", "fulfillRequirements", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"courseCode" : "AUD5102", "courseCredit" : "2", "description" : "This module provides an understanding of the structure (anatomy) and function (physiology) of the ear and the brain as well as the peripheral balance organ. Students will also be introduced to the peripheral organs involved in normal speech production.", "faculty" : "Yong Loo Lin School (Medicine)", "fulfillRequirements" : ["AUD5106", "AUD5108", "AUD5110", "AUD5112", "AUD5113", "AUD5114", "AUD5216"], "title" : "Anatomy & Physiology"} | json_instruct | {"type": "object", "properties": {"courseCode": {"type": "string"}, "courseCredit": {"type": "string"}, "description": {"type": "string"}, "faculty": {"type": "string"}, "fulfillRequirements": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}}, "required": ["courseCode", "courseCredit", "description", "faculty", "fulfillRequirements", "title"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"name": {"type": "string"}, "tel": {"type": "string"}, "fax": {"type": "string"}, "licensee": {"type": "string"}, "licensePeriod": {"type": "string"}, "licenseClass": {"type": "string"}, "hciCode": {"type": "string"}, "address": {"type": "string"}, "doctorInCharge": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "qualifications": {"type": "array", "items": {"type": "string"}}, "specialties": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "qualifications", "specialties"]}}, "detailedServices": {"type": "object", "properties": {"Specialist Medical": {"type": "array", "items": {"type": "string"}}}, "required": ["Specialist Medical"]}, "operatingHours": {"type": "object", "properties": {"Monday to Friday": {"type": "string"}}, "required": ["Monday to Friday"]}}, "required": ["name", "tel", "fax", "licensee", "licensePeriod", "licenseClass", "hciCode", "address", "doctorInCharge", "detailedServices", "operatingHours"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "PLASTIC SURGERY CENTRE PTE LTD", "tel" : "62359396", "fax" : "62356004", "licensee" : "CHUA KENG CHOK", "licensePeriod" : "01/01/2014 to 31/12/2018", "licenseClass" : "[ 5 Years ]", "hciCode" : "9401325", "address" : "304 ORCHARD ROAD, LUCKY PLAZA, #06-41 Singapore 238863", "doctorInCharge" : [{"name" : "CHUA KENG CHOK", "qualifications" : ["MBBS (University of Singapore, Singapore) 1969", "FRCSEd (Gen Surg) (Royal College of Surgeons of Edinburgh, United Kingdom) 1973", "FAMS (Plastic Surg) (Academy of Medicine, Singapore) 1976"], "specialties" : ["Plastic Surgery"]}], "detailedServices" : {"Specialist Medical" : ["Plastic Surgery"]}, "operatingHours" : {"Monday to Friday" : "10:00 am to 01:00 pm, 02:00 pm to 05:00 pm"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "tel": {"type": "string"}, "fax": {"type": "string"}, "licensee": {"type": "string"}, "licensePeriod": {"type": "string"}, "licenseClass": {"type": "string"}, "hciCode": {"type": "string"}, "address": {"type": "string"}, "doctorInCharge": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "qualifications": {"type": "array", "items": {"type": "string"}}, "specialties": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "qualifications", "specialties"]}}, "detailedServices": {"type": "object", "properties": {"Specialist Medical": {"type": "array", "items": {"type": "string"}}}, "required": ["Specialist Medical"]}, "operatingHours": {"type": "object", "properties": {"Monday to Friday": {"type": "string"}}, "required": ["Monday to Friday"]}}, "required": ["name", "tel", "fax", "licensee", "licensePeriod", "licenseClass", "hciCode", "address", "doctorInCharge", "detailedServices", "operatingHours"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {"type": "string"}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"schema_version" : "1.2.0", "id" : "GHSA-cpvc-xrr4-4rhq", "modified" : "2022-05-02T00:03:23Z", "published" : "2022-05-02T00:03:23Z", "aliases" : ["CVE-2008-3766"], "details" : "Realtime Internet Band Rehearsal Low-Latency (Internet) Connection tool (llcon) before 2.1.2 allows remote attackers to cause a denial of service (application crash) via malformed protocol messages.", "severity" : [], "affected" : [], "references" : [{"type" : "ADVISORY", "url" : "https://nvd.nist.gov/vuln/detail/CVE-2008-3766"}, {"type" : "WEB", "url" : "https://exchange.xforce.ibmcloud.com/vulnerabilities/44567"}, {"type" : "WEB", "url" : "http://secunia.com/advisories/31496"}, {"type" : "WEB", "url" : "http://sourceforge.net/project/shownotes.php?group_id=158367&release_id=619929"}, {"type" : "WEB", "url" : "http://www.securityfocus.com/bid/30770"}], "database_specific" : {"cwe_ids" : ["CWE-20"], "severity" : "MODERATE", "github_reviewed" : false}} | json_instruct | {"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {"type": "string"}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"ConnectionStrings": {"type": "object", "properties": {"Azure": {"type": "string"}, "DefaultConnection": {"type": "string"}}, "required": ["Azure", "DefaultConnection"]}, "Logging": {"type": "object", "properties": {"LogLevel": {"type": "object", "properties": {"Default": {"type": "string"}, "Microsoft": {"type": "string"}, "Microsoft.Hosting.Lifetime": {"type": "string"}}, "required": ["Default", "Microsoft", "Microsoft.Hosting.Lifetime"]}}, "required": ["LogLevel"]}, "AllowedHosts": {"type": "string"}}, "required": ["ConnectionStrings", "Logging", "AllowedHosts"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"ConnectionStrings" : {"Azure" : "Server=tcp:battleserver.database.windows.net,1433;Initial Catalog=DartCounter;Persist Security Info=False;User ID=markskie;Password=;MultipleActiveResultSets=False;Encrypt=True;TrustServerCertificate=False;Connection Timeout=30;", "DefaultConnection" : "Data Source=DESKTOP-OISNHO6;Initial Catalog=DartCounter;Integrated Security=True;Connect Timeout=60;Encrypt=False;TrustServerCertificate=False;ApplicationIntent=ReadWrite;MultiSubnetFailover=False"}, "Logging" : {"LogLevel" : {"Default" : "Information", "Microsoft" : "Warning", "Microsoft.Hosting.Lifetime" : "Information"}}, "AllowedHosts" : "*"} | json_instruct | {"type": "object", "properties": {"ConnectionStrings": {"type": "object", "properties": {"Azure": {"type": "string"}, "DefaultConnection": {"type": "string"}}, "required": ["Azure", "DefaultConnection"]}, "Logging": {"type": "object", "properties": {"LogLevel": {"type": "object", "properties": {"Default": {"type": "string"}, "Microsoft": {"type": "string"}, "Microsoft.Hosting.Lifetime": {"type": "string"}}, "required": ["Default", "Microsoft", "Microsoft.Hosting.Lifetime"]}}, "required": ["LogLevel"]}, "AllowedHosts": {"type": "string"}}, "required": ["ConnectionStrings", "Logging", "AllowedHosts"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"cam/image_array": {"type": "string"}, "user/angle": {"type": "number"}, "user/throttle": {"type": "number"}, "user/mode": {"type": "string"}, "pos/pos_x": {"type": "number"}, "pos/pos_y": {"type": "number"}, "pos/pos_z": {"type": "number"}, "pos/speed": {"type": "number"}, "pos/cte": {"type": "number"}, "milliseconds": {"type": "integer"}}, "required": ["cam/image_array", "user/angle", "user/throttle", "user/mode", "pos/pos_x", "pos/pos_y", "pos/pos_z", "pos/speed", "pos/cte", "milliseconds"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"cam/image_array" : "10446_cam-image_array_.jpg", "user/angle" : 0.086, "user/throttle" : 0.662, "user/mode" : "user", "pos/pos_x" : 83.22462, "pos/pos_y" : 0.5524604, "pos/pos_z" : 24.80334, "pos/speed" : 11.43448, "pos/cte" : -8.890234, "milliseconds" : 554068} | json_instruct | {"type": "object", "properties": {"cam/image_array": {"type": "string"}, "user/angle": {"type": "number"}, "user/throttle": {"type": "number"}, "user/mode": {"type": "string"}, "pos/pos_x": {"type": "number"}, "pos/pos_y": {"type": "number"}, "pos/pos_z": {"type": "number"}, "pos/speed": {"type": "number"}, "pos/cte": {"type": "number"}, "milliseconds": {"type": "integer"}}, "required": ["cam/image_array", "user/angle", "user/throttle", "user/mode", "pos/pos_x", "pos/pos_y", "pos/pos_z", "pos/speed", "pos/cte", "milliseconds"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "module": {"type": "string"}, "jsnext:main": {"type": "string"}, "types": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "main", "module", "jsnext:main", "types", "repository", "keywords", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "strong-password-checker", "version" : "1.0.1", "description" : "The Password Checker returns a count of steps to pass the validation", "main" : "index.js", "module" : "index.es6.js", "jsnext:main" : "index.es6.js", "types" : "index.d.ts", "repository" : {"type" : "git", "url" : "https://github.com/d8corp/strong-password-checker.git"}, "keywords" : ["password", "check", "validation", "steps", "counter", "front-end"], "author" : "Mikhail Lysikov <d8corp@mail.ru>", "license" : "MIT", "bugs" : {"url" : "https://github.com/d8corp/strong-password-checker/issues"}, "homepage" : "https://github.com/d8corp/strong-password-checker"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "module": {"type": "string"}, "jsnext:main": {"type": "string"}, "types": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "main", "module", "jsnext:main", "types", "repository", "keywords", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"reportName": {"type": "string"}, "testRuns": {"type": "array", "items": {}}, "statistic": {"type": "object", "properties": {"failed": {"type": "integer"}, "broken": {"type": "integer"}, "skipped": {"type": "integer"}, "passed": {"type": "integer"}, "unknown": {"type": "integer"}, "total": {"type": "integer"}}, "required": ["failed", "broken", "skipped", "passed", "unknown", "total"]}, "time": {"type": "object", "properties": {"start": {"type": "integer"}, "stop": {"type": "integer"}, "duration": {"type": "integer"}, "minDuration": {"type": "integer"}, "maxDuration": {"type": "integer"}, "sumDuration": {"type": "integer"}}, "required": ["start", "stop", "duration", "minDuration", "maxDuration", "sumDuration"]}}, "required": ["reportName", "testRuns", "statistic", "time"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"reportName" : "Allure Report", "testRuns" : [], "statistic" : {"failed" : 0, "broken" : 0, "skipped" : 0, "passed" : 6, "unknown" : 0, "total" : 6}, "time" : {"start" : 1587532507964, "stop" : 1587532515653, "duration" : 7689, "minDuration" : 1096, "maxDuration" : 1373, "sumDuration" : 7307}} | json_instruct | {"type": "object", "properties": {"reportName": {"type": "string"}, "testRuns": {"type": "array", "items": {}}, "statistic": {"type": "object", "properties": {"failed": {"type": "integer"}, "broken": {"type": "integer"}, "skipped": {"type": "integer"}, "passed": {"type": "integer"}, "unknown": {"type": "integer"}, "total": {"type": "integer"}}, "required": ["failed", "broken", "skipped", "passed", "unknown", "total"]}, "time": {"type": "object", "properties": {"start": {"type": "integer"}, "stop": {"type": "integer"}, "duration": {"type": "integer"}, "minDuration": {"type": "integer"}, "maxDuration": {"type": "integer"}, "sumDuration": {"type": "integer"}}, "required": ["start", "stop", "duration", "minDuration", "maxDuration", "sumDuration"]}}, "required": ["reportName", "testRuns", "statistic", "time"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"inferno.js": {"type": "string"}, "inferno.min.js": {"type": "string"}}, "required": ["inferno.js", "inferno.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"inferno.js" : "sha256-CV6bKgnO+UUTB8HflF5g0sm87Tv7epJcKH81cbvg6BQ=", "inferno.min.js" : "sha256-JEhn/ZJye17QYtIMCR2hM+w0kFmXCGdBR6EWNPiYxzE="} | json_instruct | {"type": "object", "properties": {"inferno.js": {"type": "string"}, "inferno.min.js": {"type": "string"}}, "required": ["inferno.js", "inferno.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"language": {"type": "string"}, "i18n": {"type": "string"}, "ns": {"type": "string"}, "translation": {"type": "object", "properties": {"example-paymentmethod": {"type": "object", "properties": {"admin": {"type": "object", "properties": {"shortcut": {"type": "object", "properties": {"examplePaymentProviderLabel": {"type": "string"}, "examplePaymentProviderTitle": {"type": "string"}}, "required": ["examplePaymentProviderLabel", "examplePaymentProviderTitle"]}, "dashboard": {"type": "object", "properties": {"examplePaymentProviderLabel": {"type": "string"}, "examplePaymentProviderTitle": {"type": "string"}, "examplePaymentProviderDescription": {"type": "string"}}, "required": ["examplePaymentProviderLabel", "examplePaymentProviderTitle", "examplePaymentProviderDescription"]}, "paymentSettings": {"type": "object", "properties": {"examplePaymentLabel": {"type": "string"}, "examplePaymentSettingsLabel": {"type": "string"}, "exampleCredentials": {"type": "string"}, "apiClientId": {"type": "string"}, "supportedMethodsLabel": {"type": "string"}}, "required": ["examplePaymentLabel", "examplePaymentSettingsLabel", "exampleCredentials", "apiClientId", "supportedMethodsLabel"]}}, "required": ["shortcut", "dashboard", "paymentSettings"]}}, "required": ["admin"]}}, "required": ["example-paymentmethod"]}}, "required": ["language", "i18n", "ns", "translation"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"language" : "Vietnamese", "i18n" : "vi", "ns" : "example-paymentmethod", "translation" : {"example-paymentmethod" : {"admin" : {"shortcut" : {"examplePaymentProviderLabel" : "V\u00ed d\u1ee5 thanh to\u00e1n", "examplePaymentProviderTitle" : "V\u00ed d\u1ee5 thanh to\u00e1n"}, "dashboard" : {"examplePaymentProviderLabel" : "V\u00ed d\u1ee5 thanh to\u00e1n", "examplePaymentProviderTitle" : "V\u00ed d\u1ee5 thanh to\u00e1n", "examplePaymentProviderDescription" : "Ph\u01b0\u01a1ng th\u1ee9c thanh to\u00e1n V\u00ed d\u1ee5"}, "paymentSettings" : {"examplePaymentLabel" : "Nh\u00e0 cung c\u1ea5p v\u00ed d\u1ee5", "examplePaymentSettingsLabel" : "V\u00ed d\u1ee5 thanh to\u00e1n", "exampleCredentials" : "\u0110\u00e2y l\u00e0 c\u00e0i \u0111\u1eb7t ph\u01b0\u01a1ng th\u1ee9c thanh to\u00e1n v\u00ed d\u1ee5.", "apiClientId" : "ID Client API", "supportedMethodsLabel" : "Ph\u01b0\u01a1ng th\u1ee9c h\u1ed7 tr\u1ee3 nh\u00e0 cung c\u1ea5p thanh to\u00e1n"}}}}}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"language": {"type": "string"}, "i18n": {"type": "string"}, "ns": {"type": "string"}, "translation": {"type": "object", "properties": {"example-paymentmethod": {"type": "object", "properties": {"admin": {"type": "object", "properties": {"shortcut": {"type": "object", "properties": {"examplePaymentProviderLabel": {"type": "string"}, "examplePaymentProviderTitle": {"type": "string"}}, "required": ["examplePaymentProviderLabel", "examplePaymentProviderTitle"]}, "dashboard": {"type": "object", "properties": {"examplePaymentProviderLabel": {"type": "string"}, "examplePaymentProviderTitle": {"type": "string"}, "examplePaymentProviderDescription": {"type": "string"}}, "required": ["examplePaymentProviderLabel", "examplePaymentProviderTitle", "examplePaymentProviderDescription"]}, "paymentSettings": {"type": "object", "properties": {"examplePaymentLabel": {"type": "string"}, "examplePaymentSettingsLabel": {"type": "string"}, "exampleCredentials": {"type": "string"}, "apiClientId": {"type": "string"}, "supportedMethodsLabel": {"type": "string"}}, "required": ["examplePaymentLabel", "examplePaymentSettingsLabel", "exampleCredentials", "apiClientId", "supportedMethodsLabel"]}}, "required": ["shortcut", "dashboard", "paymentSettings"]}}, "required": ["admin"]}}, "required": ["example-paymentmethod"]}}, "required": ["language", "i18n", "ns", "translation"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"stationGroupId": {"type": "integer"}, "stations": {"type": "array", "items": {"type": "string"}}}, "required": ["stationGroupId", "stations"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"stationGroupId" : 9970512, "stations" : ["9970512"]} | json_instruct | {"type": "object", "properties": {"stationGroupId": {"type": "integer"}, "stations": {"type": "array", "items": {"type": "string"}}}, "required": ["stationGroupId", "stations"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [["320116450498", "\u5316\u5de5\u56ed\u533a\u865a\u62df\u793e\u533a", "123", "0"]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"userId" : 12831, "cartId" : "b6a59191-1fa8-4865-8603-b402a7944973", "preferredProducts" : [2434, 1171, 3300, 1831, 2733], "productReviews" : [{"productId" : 1125, "reviewText" : "This driver works quite well. It professionally improves my soccer by a lot.", "reviewDate" : "2019-08-07T02:22:55.8791135+03:00"}]} | json_instruct | {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "title": {"type": "string"}, "createdAt": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["id", "title", "createdAt", "author"]}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 137820, "info" : {"name" : "Old Dislike/Like bar (Youtube)", "description" : "The old like/dislike bar.", "additionalInfo" : null, "format" : "uso", "category" : "youtube", "createdAt" : "2017-01-18T04:19:18.000Z", "updatedAt" : "2017-01-18T04:19:18.000Z", "license" : "NO-REDISTRIBUTION", "author" : {"id" : 389825, "name" : "Skeleton 11223"}}, "stats" : {"installs" : {"total" : 3992, "weekly" : 14}}, "screenshots" : {"main" : {"name" : "137820_after.png", "archived" : true}}, "discussions" : {"stats" : {"discussionsCount" : 3, "commentsCount" : 0}, "data" : [{"id" : 54687, "title" : "Perfect!", "createdAt" : "2017-03-19T11:56:25.000Z", "author" : {"id" : 96768, "name" : "nd4spd"}}, {"id" : 67533, "title" : "DOESNT WORK", "createdAt" : "2018-06-28T03:47:15.000Z", "author" : {"id" : 524602, "name" : "galaxy star"}}, {"id" : 68433, "title" : "Very good", "createdAt" : "2018-07-30T18:18:21.000Z", "author" : {"id" : 537314, "name" : "Frank Smith"}}]}, "style" : {"css" : "@-moz-document domain(\"www.youtube.com\") {\r\n\r\n\r\n.video-extras-sparkbar-likes {\r\n float: left;\r\n height: 4px;\r\n border-right: 1px solid #fff;\r\n background: #060;\r\n}\r\n.video-extras-sparkbars {\r\n height: 4px;\r\n margin: 2px 0;\r\n border: 1px solid #ccc;\r\n overflow: hidden;\r\n -webkit-border-radius: 3px;\r\n -moz-border-radius: 3px;\r\n border-radius: 3px;\r\n}\r\n.video-extras-sparkbar-dislikes {\r\n float: right;\r\n height: 4px;\r\n margin-right: -1px;\r\n background: #c00;\r\n}\r\n\r\n}"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "title": {"type": "string"}, "createdAt": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["id", "title", "createdAt", "author"]}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "3204060005", "district_id" : "3204060", "name" : "NAGRAK"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"/js/app.js": {"type": "string"}, "/css/app.css": {"type": "string"}, "/plugins/datatables.net-dt": {"type": "string"}}, "required": ["/js/app.js", "/css/app.css", "/plugins/datatables.net-dt"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"/js/app.js" : "/js/app.js", "/css/app.css" : "/css/app.css", "/plugins/datatables.net-dt" : "/plugins/datatables.net-dt"} | json_instruct | {"type": "object", "properties": {"/js/app.js": {"type": "string"}, "/css/app.css": {"type": "string"}, "/plugins/datatables.net-dt": {"type": "string"}}, "required": ["/js/app.js", "/css/app.css", "/plugins/datatables.net-dt"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"userId" : 40925, "cartId" : "6643358a-29f4-4dae-8828-1f85a3ba51e8", "preferredProducts" : [371, 2894, 2755, 913, 2262, 2342], "productReviews" : [{"productId" : 4425, "reviewText" : "This Rustic Frozen Tuna works so well. It imperfectly improves my baseball by a lot.", "reviewDate" : "2019-05-16T12:42:57.1927475+03:00"}]} | json_instruct | {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}}, "required": ["php"]}, "autoload": {"type": "object", "properties": {"psr-0": {"type": "object", "properties": {"Mouf\\Utils\\Common\\": {"type": "string"}}, "required": ["Mouf\\Utils\\Common\\"]}}, "required": ["psr-0"]}, "extra": {"type": "object", "properties": {"mouf": {"type": "object", "properties": {"logo": {"type": "string"}}, "required": ["logo"]}}, "required": ["mouf"]}}, "required": ["name", "description", "keywords", "homepage", "type", "license", "authors", "require", "autoload", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "mouf/utils.common.sortable-interface", "description" : "This package contains an interface used by objects to say they can sort data. The concept is very simple, the object implements a sort method that takes a key (the sort column) and a direction, and that's it!", "keywords" : ["mouf", "sortable", "interface", "sortableinterface"], "homepage" : "https://mouf-php.com/packages/mouf/utils.common.sortable-interface", "type" : "library", "license" : "MIT", "authors" : [{"name" : "David N\u00e9grier", "email" : "d.negrier@thecodingmachine.com", "homepage" : "http://mouf-php.com"}], "require" : {"php" : ">=5.3.0"}, "autoload" : {"psr-0" : {"Mouf\\Utils\\Common\\" : "src/"}}, "extra" : {"mouf" : {"logo" : "logo.png"}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}}, "required": ["php"]}, "autoload": {"type": "object", "properties": {"psr-0": {"type": "object", "properties": {"Mouf\\Utils\\Common\\": {"type": "string"}}, "required": ["Mouf\\Utils\\Common\\"]}}, "required": ["psr-0"]}, "extra": {"type": "object", "properties": {"mouf": {"type": "object", "properties": {"logo": {"type": "string"}}, "required": ["logo"]}}, "required": ["mouf"]}}, "required": ["name", "description", "keywords", "homepage", "type", "license", "authors", "require", "autoload", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {"jquery": {"type": "string"}, "bootstrap": {"type": "string"}, "angular": {"type": "string"}, "requirejs": {"type": "string"}, "gridster": {"type": "string"}, "express": {"type": "string"}, "lodash": {"type": "string"}}, "required": ["jquery", "bootstrap", "angular", "requirejs", "gridster", "express", "lodash"]}}, "required": ["name", "version", "description", "repository", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Goodly", "version" : "0.0.1", "description" : "Beautiful dashboard for your TV", "repository" : {"type" : "git", "url" : "https://github.com/RESTer-Club/goodly.git"}, "dependencies" : {}, "devDependencies" : {"jquery" : "2.1.3", "bootstrap" : "3.3.4", "angular" : "1.3.15", "requirejs" : "2.1.17", "gridster" : "0.5.6", "express" : "4.13.0", "lodash" : "3.10.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {"jquery": {"type": "string"}, "bootstrap": {"type": "string"}, "angular": {"type": "string"}, "requirejs": {"type": "string"}, "gridster": {"type": "string"}, "express": {"type": "string"}, "lodash": {"type": "string"}}, "required": ["jquery", "bootstrap", "angular", "requirejs", "gridster", "express", "lodash"]}}, "required": ["name", "version", "description", "repository", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "array", "items": {"type": "object", "properties": {"manufacturer": {"type": "string"}, "market_name": {"type": "string"}, "codename": {"type": "string"}, "model": {"type": "string"}}, "required": ["manufacturer", "market_name", "codename", "model"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"manufacturer" : "Aspera", "market_name" : "A45", "codename" : "A45_1", "model" : "A45"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"manufacturer": {"type": "string"}, "market_name": {"type": "string"}, "codename": {"type": "string"}, "model": {"type": "string"}}, "required": ["manufacturer", "market_name", "codename", "model"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"code": {"type": "string"}, "messages": {"type": "string"}, "value": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "id_kecamatan": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "id_kecamatan", "name"]}}}, "required": ["code", "messages", "value"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"code" : "200", "messages" : "Successfully received data", "value" : [{"id" : "3513222001", "id_kecamatan" : "351322", "name" : "Sumberkare"}, {"id" : "3513222002", "id_kecamatan" : "351322", "name" : "Patalan"}, {"id" : "3513222003", "id_kecamatan" : "351322", "name" : "Jrebeng"}, {"id" : "3513222004", "id_kecamatan" : "351322", "name" : "Wonorejo"}, {"id" : "3513222005", "id_kecamatan" : "351322", "name" : "Tunggakcerme"}, {"id" : "3513222006", "id_kecamatan" : "351322", "name" : "Pohsangit Tengah"}, {"id" : "3513222007", "id_kecamatan" : "351322", "name" : "Pohsangit Lor"}, {"id" : "3513222008", "id_kecamatan" : "351322", "name" : "Pohsangit Ngisor"}, {"id" : "3513222009", "id_kecamatan" : "351322", "name" : "Sepuhgembol"}, {"id" : "3513222010", "id_kecamatan" : "351322", "name" : "Kareng Kidul"}, {"id" : "3513222011", "id_kecamatan" : "351322", "name" : "Kedungsupit"}]} | json_instruct | {"type": "object", "properties": {"code": {"type": "string"}, "messages": {"type": "string"}, "value": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "id_kecamatan": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "id_kecamatan", "name"]}}}, "required": ["code", "messages", "value"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Maximum Margin Multi-Label Structured Prediction.", "fields" : ["matching", "convex optimization", "structured prediction", "working set", "enumeration"], "abstract" : "We study multi-label prediction for structured output sets, a problem that occurs, for example, in object detection in images, secondary structure prediction in computational biology, and graph matching with symmetries. Conventional multi-label classification techniques are typically not applicable in this situation, because they require explicit enumeration of the label set, which is infeasible in case of structured outputs. Relying on techniques originally designed for single-label structured prediction, in particular structured support vector machines, results in reduced prediction accuracy, or leads to infeasible optimization problems.\n\nIn this work we derive a maximum-margin training formulation for multi-label structured prediction that remains computationally tractable while achieving high prediction accuracy. It also shares most beneficial properties with single-label maximum-margin approaches, in particular formulation as a convex optimization problem, efficient working set training, and PAC-Bayesian generalization bounds.", "citation" : "Citations (21)", "departments" : ["Institute of Science and Technology Austria"], "authors" : ["Christoph H. Lampert.....http://dblp.org/pers/hd/l/Lampert:Christoph_H="], "conf" : "nips", "year" : "2011", "pages" : 9} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "ferroustry:block/stripped_diamond_log"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"code": {"type": "string"}, "layers": {"type": "array", "items": {}}, "agencies": {"type": "array", "items": {}}, "bbox": {"type": "array", "items": {"type": "number"}}, "center": {"type": "array", "items": {"type": "number"}}}, "required": ["code", "layers", "agencies", "bbox", "center"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"code" : "OK", "layers" : [], "agencies" : [], "bbox" : [-103.0026, 33.616, -94.4314, 37.0023], "center" : [-97.5170536, 35.4729886]} | json_instruct | {"type": "object", "properties": {"code": {"type": "string"}, "layers": {"type": "array", "items": {}}, "agencies": {"type": "array", "items": {}}, "bbox": {"type": "array", "items": {"type": "number"}}, "center": {"type": "array", "items": {"type": "number"}}}, "required": ["code", "layers", "agencies", "bbox", "center"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"id": {"type": "string"}, "storage": {"type": "string"}, "values": {"type": "array", "items": {"type": "object", "properties": {"start": {"type": "string"}, "time": {"type": "integer"}}, "required": ["start", "time"]}}}, "required": ["id", "storage", "values"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "Sim.Job", "storage" : "", "values" : [{"start" : "ijsselmonde", "time" : 1456322718893}]} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "storage": {"type": "string"}, "values": {"type": "array", "items": {"type": "object", "properties": {"start": {"type": "string"}, "time": {"type": "integer"}}, "required": ["start", "time"]}}}, "required": ["id", "storage", "values"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"main": {"type": "string"}, "preconstruct": {"type": "object", "properties": {"source": {"type": "string"}}, "required": ["source"]}}, "required": ["main", "preconstruct"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"main" : "dist/common-dependency-two-entrypoints.cjs.js", "preconstruct" : {"source" : "../src/multiply.js"}} | json_instruct | {"type": "object", "properties": {"main": {"type": "string"}, "preconstruct": {"type": "object", "properties": {"source": {"type": "string"}}, "required": ["source"]}}, "required": ["main", "preconstruct"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {"type": "object", "properties": {"hash": {"type": "string"}, "blockHash": {"type": "string"}, "blockNumber": {"type": "integer"}, "transactionIndex": {"type": "integer"}, "confirmations": {"type": "null"}, "from": {"type": "string"}, "gasPrice": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "to": {"type": "string"}, "value": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "nonce": {"type": "integer"}, "data": {"type": "string"}, "r": {"type": "string"}, "s": {"type": "string"}, "v": {"type": "integer"}, "creates": {"type": "null"}, "raw": {"type": "string"}, "networkId": {"type": "integer"}, "chainId": {"type": "integer"}}, "required": ["hash", "blockHash", "blockNumber", "transactionIndex", "confirmations", "from", "gasPrice", "gasLimit", "to", "value", "nonce", "data", "r", "s", "v", "creates", "raw", "networkId", "chainId"]}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"hash" : "0x45593af0efc9db09a06e78dd37480d555a917b0978c607896fae9ed8bf5eb2be", "parentHash" : "0x6f4924c861c945d2d64198b2dad9bdb488475e5833fca87030f6ad7a88943c06", "number" : 71572, "timestamp" : 1439338237, "nonce" : "0x06702b9d1877efe3", "difficulty" : 2181451246215, "gasLimit" : {"_hex" : "0x2fefd8"}, "gasUsed" : {"_hex" : "0xae73"}, "miner" : "0xbb7B8287f3F0a933474a79eAe42CBCa977791171", "extraData" : "0x476574682f4c5649562f76312e302e312f6c696e75782f676f312e342e32", "transactions" : [{"hash" : "0x3a6510b74dcd13ddb8f8f27f9424f97952a785934c824aa53f616ef307484b1c", "blockHash" : "0x45593af0efc9db09a06e78dd37480d555a917b0978c607896fae9ed8bf5eb2be", "blockNumber" : 71572, "transactionIndex" : 0, "confirmations" : null, "from" : "0x17580B766f7453525ca4C6A88b01b50570EA088C", "gasPrice" : {"_hex" : "0xced0bee37"}, "gasLimit" : {"_hex" : "0x61a80"}, "to" : "0x5Fe5B7546D1628f7348B023A0393de1FC825A4fD", "value" : {"_hex" : "0x29a2241af62c0000"}, "nonce" : 219, "data" : "0xb595b8b50000000000000000000000000000000000000000000000000000000000000000", "r" : "0x3663c9ca4000abbb88387dae1d122deaac5823c1484f2800f3814ea726bc6b59", "s" : "0x3a3b7d14382a9cde48ac021ed2b226cf58ca7d23f1d0513fd7df9a640bb1d4e8", "v" : 27, "creates" : null, "raw" : "0xf89281db850ced0bee3783061a80945fe5b7546d1628f7348b023a0393de1fc825a4fd8829a2241af62c0000a4b595b8b500000000000000000000000000000000000000000000000000000000000000001ba03663c9ca4000abbb88387dae1d122deaac5823c1484f2800f3814ea726bc6b59a03a3b7d14382a9cde48ac021ed2b226cf58ca7d23f1d0513fd7df9a640bb1d4e8", "networkId" : 0, "chainId" : 0}]} | json_instruct | {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {"type": "object", "properties": {"hash": {"type": "string"}, "blockHash": {"type": "string"}, "blockNumber": {"type": "integer"}, "transactionIndex": {"type": "integer"}, "confirmations": {"type": "null"}, "from": {"type": "string"}, "gasPrice": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "to": {"type": "string"}, "value": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "nonce": {"type": "integer"}, "data": {"type": "string"}, "r": {"type": "string"}, "s": {"type": "string"}, "v": {"type": "integer"}, "creates": {"type": "null"}, "raw": {"type": "string"}, "networkId": {"type": "integer"}, "chainId": {"type": "integer"}}, "required": ["hash", "blockHash", "blockNumber", "transactionIndex", "confirmations", "from", "gasPrice", "gasLimit", "to", "value", "nonce", "data", "r", "s", "v", "creates", "raw", "networkId", "chainId"]}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"schemaVersion": {"type": "integer"}, "label": {"type": "string"}, "message": {"type": "string"}, "color": {"type": "string"}}, "required": ["schemaVersion", "label", "message", "color"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"schemaVersion" : 1, "label" : "response time 7d", "message" : "2969 ms", "color" : "red"} | json_instruct | {"type": "object", "properties": {"schemaVersion": {"type": "integer"}, "label": {"type": "string"}, "message": {"type": "string"}, "color": {"type": "string"}}, "required": ["schemaVersion", "label", "message", "color"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"emoji": {"type": "integer"}, "hashtag": {"type": "integer"}, "@usuario": {"type": "integer"}, "url": {"type": "integer"}}, "required": ["emoji", "hashtag", "@usuario", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"emoji" : 31005, "hashtag" : 31004, "@usuario" : 31002, "url" : 31003} | json_instruct | {"type": "object", "properties": {"emoji": {"type": "integer"}, "hashtag": {"type": "integer"}, "@usuario": {"type": "integer"}, "url": {"type": "integer"}}, "required": ["emoji", "hashtag", "@usuario", "url"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"geometry": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}, "organisation": {"type": "string"}, "geography": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}}, "required": ["geometry", "name", "reference", "organisation", "geography", "slug", "entity", "entry-date"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Feature", "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[-0.147032, 51.489229], [-0.147649, 51.489083], [-0.146319, 51.486869], [-0.146109, 51.486053], [-0.145564, 51.486033], [-0.145549, 51.486097], [-0.145808, 51.486419], [-0.145562, 51.486559], [-0.145568, 51.486585], [-0.145502, 51.4866], [-0.1455, 51.486647], [-0.145596, 51.486795], [-0.145583, 51.486865], [-0.145774, 51.487178], [-0.145873, 51.487257], [-0.14676, 51.488721], [-0.146766, 51.488814], [-0.147032, 51.489229]]]]}, "properties" : {"geometry" : "MULTIPOLYGON (((-0.147032 51.489229,-0.147649 51.489083,-0.146319 51.486869,-0.146109 51.486053,-0.145564 51.486033,-0.145549 51.486097,-0.145808 51.486419,-0.145562 51.486559,-0.145568 51.486585,-0.145502 51.486600,-0.145500 51.486647,-0.145596 51.486795,-0.145583 51.486865,-0.145774 51.487178,-0.145873 51.487257,-0.146760 51.488721,-0.146766 51.488814,-0.147032 51.489229)))", "name" : "Peabody Avenue COA00000342", "reference" : "COA00000342", "organisation" : "local-authority-eng:WSM", "geography" : "conservation-area:COA00000342", "slug" : "/conservation-area/local-authority-eng/WSM/COA00000342", "entity" : 474313, "entry-date" : "2020-09-04"}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"geometry": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}, "organisation": {"type": "string"}, "geography": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}}, "required": ["geometry", "name", "reference", "organisation", "geography", "slug", "entity", "entry-date"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"version": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "url": {"type": "string"}, "hash": {"type": "string"}, "bin": {"type": "array", "items": {"type": "string"}}, "checkver": {"type": "object", "properties": {"url": {"type": "string"}, "re": {"type": "string"}}, "required": ["url", "re"]}}, "required": ["version", "homepage", "license", "url", "hash", "bin", "checkver"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"version" : "2016.3", "homepage" : "https://www.jetbrains.com/resharper/download/index.html#section=resharper-clt", "license" : "https://www.jetbrains.com/resharper/buy/command_line_license.html", "url" : "https://download.jetbrains.com/resharper/JetBrains.ReSharper.CommandLineTools.2016.3.20161223.160402.zip", "hash" : "280a785fa07b37c5b2acfc6a4fcb7e9d02a531649e65cc02c246f181ed015804", "bin" : ["dupfinder.exe", "inspectcode.exe"], "checkver" : {"url" : "https://www.jetbrains.com/help/resharper/Introduction__Whats_New.html", "re" : "<h2>ReSharper/ReSharper\\s+C\\+\\+\\s+((\\d+\\.*)+)</h2>"}} | json_instruct | {"type": "object", "properties": {"version": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "url": {"type": "string"}, "hash": {"type": "string"}, "bin": {"type": "array", "items": {"type": "string"}}, "checkver": {"type": "object", "properties": {"url": {"type": "string"}, "re": {"type": "string"}}, "required": ["url", "re"]}}, "required": ["version", "homepage", "license", "url", "hash", "bin", "checkver"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"extName": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extDesc": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extTitle": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "formTitle": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "formButton": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "language": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "createRequest": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}}, "required": ["extName", "extDesc", "extTitle", "formTitle", "formButton", "language", "createRequest"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"extName" : {"message" : "Escritura Search Box", "description" : "Extension name."}, "extDesc" : {"message" : "Caixa de pesquisa para facilmente procurar escrituras SUD", "description" : "Extension description."}, "extTitle" : {"message" : "Cuadro de b\u00fasqueda para buscar f\u00e1cilmente LDS Escrituras", "description" : "Extension default"}, "formTitle" : {"message" : "Escritura Pesquisa", "description" : "Heading text on the search form."}, "formButton" : {"message" : "Pesquisar", "description" : "Label for search button."}, "language" : {"message" : "por", "description" : "Language value passed to lds.org"}, "createRequest" : {"message" : "js/createRequestPortuguese.js", "description" : "JavaScript file to call to create search request"}} | json_instruct | {"type": "object", "properties": {"extName": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extDesc": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extTitle": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "formTitle": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "formButton": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "language": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "createRequest": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}}, "required": ["extName", "extDesc", "extTitle", "formTitle", "formButton", "language", "createRequest"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"labels": {"type": "array", "items": {"type": "string"}}, "datasets": {"type": "array", "items": {"type": "object", "properties": {"label": {"type": "string"}, "backgroundColor": {"type": "string"}, "borderColor": {"type": "string"}, "borderWidth": {"type": "number"}, "data": {"type": "array", "items": {"type": "integer"}}}, "required": ["label", "backgroundColor", "borderColor", "borderWidth", "data"]}}}, "required": ["labels", "datasets"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"labels" : ["June", "May", "April", "March", "February", "January"], "datasets" : [{"label" : "Earning - Safal Kisaan", "backgroundColor" : "#7CCC8E", "borderColor" : "#efc0a0", "borderWidth" : 0.5, "data" : [0, 21000, 23000, 18000, 15000, 12000]}, {"label" : "Earning - Agents", "backgroundColor" : "#efc0a0", "borderColor" : "#efc0a0", "borderWidth" : 0.5, "data" : [0, 18000, 20500, 16000, 17000, 20000]}]} | json_instruct | {"type": "object", "properties": {"labels": {"type": "array", "items": {"type": "string"}}, "datasets": {"type": "array", "items": {"type": "object", "properties": {"label": {"type": "string"}, "backgroundColor": {"type": "string"}, "borderColor": {"type": "string"}, "borderWidth": {"type": "number"}, "data": {"type": "array", "items": {"type": "integer"}}}, "required": ["label", "backgroundColor", "borderColor", "borderWidth", "data"]}}}, "required": ["labels", "datasets"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}, "address": {"type": "string"}, "school_type": {"type": "string"}, "legal_status": {"type": "integer"}, "fax": {"type": "string"}, "phone": {"type": "string"}, "provider": {"type": "string"}, "headmaster": {"type": "string"}, "state": {"type": "string"}, "programs": {"type": "object", "properties": {"programs": {"type": "array", "items": {}}}, "required": ["programs"]}, "full_time_school": {"type": "boolean"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["name", "id", "address", "school_type", "legal_status", "fax", "phone", "provider", "headmaster", "state", "programs", "full_time_school", "lon", "lat"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Grundschule Kieholm", "id" : "SH-0702257", "address" : "Raiffeisenstra\u00dfe 14, 24376 Hasselberg", "school_type" : "Grundschule", "legal_status" : 1, "fax" : "04642 - 965082", "phone" : "04642 - 6121", "provider" : "Amt Geltinger Bucht", "headmaster" : "Herr Koschnitzke", "state" : "SH", "programs" : {"programs" : []}, "full_time_school" : false, "lon" : 9.945991, "lat" : 54.710479} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}, "address": {"type": "string"}, "school_type": {"type": "string"}, "legal_status": {"type": "integer"}, "fax": {"type": "string"}, "phone": {"type": "string"}, "provider": {"type": "string"}, "headmaster": {"type": "string"}, "state": {"type": "string"}, "programs": {"type": "object", "properties": {"programs": {"type": "array", "items": {}}}, "required": ["programs"]}, "full_time_school": {"type": "boolean"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["name", "id", "address", "school_type", "legal_status", "fax", "phone", "provider", "headmaster", "state", "programs", "full_time_school", "lon", "lat"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "illuminate/config": {"type": "string"}, "illuminate/contracts": {"type": "string"}, "illuminate/http": {"type": "string"}, "illuminate/support": {"type": "string"}}, "required": ["php", "illuminate/config", "illuminate/contracts", "illuminate/http", "illuminate/support"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"CTSoft\\Laravel\\LetterXpress\\": {"type": "string"}}, "required": ["CTSoft\\Laravel\\LetterXpress\\"]}}, "required": ["psr-4"]}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}, "aliases": {"type": "object", "properties": {"LetterXpress": {"type": "string"}}, "required": ["LetterXpress"]}}, "required": ["providers", "aliases"]}}, "required": ["laravel"]}, "config": {"type": "object", "properties": {"sort-packages": {"type": "boolean"}}, "required": ["sort-packages"]}, "minimum-stability": {"type": "string"}, "prefer-stable": {"type": "boolean"}}, "required": ["name", "description", "keywords", "type", "license", "authors", "require", "autoload", "extra", "config", "minimum-stability", "prefer-stable"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "ctsoft/laravel-letter-xpress", "description" : "LetterXpress connection for Laravel.", "keywords" : ["laravel", "letterxpress"], "type" : "library", "license" : "MIT", "authors" : [{"name" : "CTSoft", "email" : "info@ctsoft.de"}], "require" : {"php" : "^7.2", "illuminate/config" : "^7.0|^8.0", "illuminate/contracts" : "^7.0|^8.0", "illuminate/http" : "^7.0|^8.0", "illuminate/support" : "^7.0|^8.0"}, "autoload" : {"psr-4" : {"CTSoft\\Laravel\\LetterXpress\\" : "src/"}}, "extra" : {"laravel" : {"providers" : ["CTSoft\\Laravel\\LetterXpress\\Providers\\LetterXpressProvider"], "aliases" : {"LetterXpress" : "CTSoft\\Laravel\\LetterXpress\\Facades\\LetterXpress"}}}, "config" : {"sort-packages" : true}, "minimum-stability" : "dev", "prefer-stable" : true} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "illuminate/config": {"type": "string"}, "illuminate/contracts": {"type": "string"}, "illuminate/http": {"type": "string"}, "illuminate/support": {"type": "string"}}, "required": ["php", "illuminate/config", "illuminate/contracts", "illuminate/http", "illuminate/support"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"CTSoft\\Laravel\\LetterXpress\\": {"type": "string"}}, "required": ["CTSoft\\Laravel\\LetterXpress\\"]}}, "required": ["psr-4"]}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}, "aliases": {"type": "object", "properties": {"LetterXpress": {"type": "string"}}, "required": ["LetterXpress"]}}, "required": ["providers", "aliases"]}}, "required": ["laravel"]}, "config": {"type": "object", "properties": {"sort-packages": {"type": "boolean"}}, "required": ["sort-packages"]}, "minimum-stability": {"type": "string"}, "prefer-stable": {"type": "boolean"}}, "required": ["name", "description", "keywords", "type", "license", "authors", "require", "autoload", "extra", "config", "minimum-stability", "prefer-stable"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "d928-87", "text" : "GREAT DECISIONS, 1963\nPeg\u00ae 3\nOrdering deadlines: (orders muss be received by the times shown):\nA* All Active Affiliates: 5:00 P.M., Monday, January 21, 1963.\nB. All Other Affiliates Not Within the Coverage Area of an Active Affiliate:\n5:00 P.M., Monday, January 21, 1963.\nC. Affiliates Within the Coverage Area of an Active Affiliate carrying the\nseries (provided the necessary permissions have not been obtained):\n5:00 P.M., Monday, April 1, 1963.\nAll other stations wishing to carry the series should contact the network for\ninformation on availability, delivery, etc.\nThe costs for the series are:\nA. Active Affiliates: $25.00\nB. Others Holding any form NAEB Membership: $40.00\nC. All Others: $50.00\nAll billings will be made upon completion of shipments please forward any\nnecessary purchase orders, etc. to the network to expedite billing*\nStations broadcasting the series should contact their Foreign Policy Association\nRegional Director and inform him of the planned dates and times of broadcast.\nThe five (5) Regional Directors are:\nEastern Area\nMr. Emil Starr\nRegional Director\nForeign Policy Association\n345 East 46th Street\nNew York 17, New York\nArea 212 - Oxford 7-2432\nGreat hakes Area\nMr. Nicholas Faraham\nProgram Executive\n(Same address as above)\nMountains and Plains Region\nMr. Hilton Power\nRegional Director\nForeign Policy Association\n2679 Arapahoe Avenue\nBoulder, Colorado\nArea 303 - HILLcrest 3-5512\nSouthern Jteg&SB-\nMr. David Warner\nRegional Director\nForeign Policy Association\nCandler Building, Suito 614\n127 Peachtree Street, N* \u00a3\u2022\nAtlanta 3, Georgia\nArea 404 - JAckson 5-3461\nWestern Region\nMr. W|}liam R. Campbell\nRegional Director\nForeign Policy Association\nMaskey Building\n46 Kearny Street\nSan Francisco 8, California\nArea 415 - DOuglas 2-7952"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-87.948284, 42.979214], [-87.948254, 42.981264], [-87.933918, 42.981092], [-87.933991, 42.973815], [-87.948333, 42.973935], [-87.948284, 42.979214]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 81748}}]} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-89.949373, 35.09349], [-89.948893, 35.107838], [-89.930668, 35.1075], [-89.931032, 35.092985], [-89.949373, 35.09349]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 59466}}]} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "bin": {"type": "object", "properties": {"finducep": {"type": "string"}}, "required": ["finducep"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "preferGlobal": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"axios": {"type": "string"}, "meow": {"type": "string"}}, "required": ["axios", "meow"]}}, "required": ["name", "version", "description", "main", "bin", "scripts", "preferGlobal", "repository", "keywords", "author", "license", "bugs", "homepage", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "finducep-cli.js", "version" : "1.0.0", "description" : "\ud83d\udd75 [CLI] The easy way to find the info about your CEP.", "main" : "index.js", "bin" : {"finducep" : "./bin/index.js"}, "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "preferGlobal" : "true", "repository" : {"type" : "git", "url" : "git+https://github.com/joaocarvalhowd/finducep-cli.js.git"}, "keywords" : ["cep", "zipcode", "postal"], "author" : "Jo\u00e3o Carvalho <oi@joaocarvalhowd.com.br>", "license" : "MIT", "bugs" : {"url" : "https://github.com/joaocarvalhowd/finducep-cli.js/issues"}, "homepage" : "https://github.com/joaocarvalhowd/finducep-cli.js#readme", "dependencies" : {"axios" : "^0.15.3", "meow" : "^3.7.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "bin": {"type": "object", "properties": {"finducep": {"type": "string"}}, "required": ["finducep"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "preferGlobal": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"axios": {"type": "string"}, "meow": {"type": "string"}}, "required": ["axios", "meow"]}}, "required": ["name", "version", "description", "main", "bin", "scripts", "preferGlobal", "repository", "keywords", "author", "license", "bugs", "homepage", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "b09427527dcb54db1829aa29d2be5dd5115751cf"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"feedstocks": {"type": "array", "items": {"type": "string"}}}, "required": ["feedstocks"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"feedstocks" : ["fonttools"]} | json_instruct | {"type": "object", "properties": {"feedstocks": {"type": "array", "items": {"type": "string"}}}, "required": ["feedstocks"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [["130705002011", "\u70ae\u9662\u793e\u533a\u5c45\u59d4\u4f1a", "111", "0"], ["130705002017", "\u6c99\u7535\u793e\u533a\u5c45\u59d4\u4f1a", "123", "0"], ["130705002018", "\u5e99\u5e95\u793e\u533a\u5c45\u59d4\u4f1a", "111", "0"], ["130705002020", "\u7687\u57ce\u6865\u5317\u793e\u533a\u5c45\u59d4\u4f1a", "111", "0"], ["130705002021", "\u5927\u897f\u8857\u793e\u533a\u5c45\u59d4\u4f1a", "111", "0"], ["130705002022", "\u4e07\u67f3\u793e\u533a\u5c45\u59d4\u4f1a", "111", "0"], ["130705002023", "\u540e\u5e9c\u8def\u793e\u533a\u5c45\u59d4\u4f1a", "111", "0"]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "null"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "null"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 53224, "name" : "b2st/batoost tumblr logo c:", "description" : "Changed the tumblr logo to 'batoost' (First time making something like this so I'm sorry if it doesn't work ><)\r\n\r\nmy tumblr: @woonie-the-pooh ^^", "user" : {"id" : 116311, "name" : "woonie-the-pooh", "email" : "redacted", "paypal_email" : null, "homepage" : null, "about" : null, "license" : null}, "updated" : "2011-09-02T19:47:32.000Z", "weekly_install_count" : 0, "total_install_count" : 201, "rating" : null, "after_screenshot_name" : "https://userstyles.org/style_screenshots/53224_after.png?r=1556006494", "obsoleting_style_id" : null, "obsoleting_style_name" : null, "obsolete" : 0, "admin_delete_reason_id" : null, "obsoletion_message" : null, "screenshots" : null, "license" : null, "created" : "2011-09-02T19:47:32.000Z", "category" : "site", "raw_subcategory" : "tumblr", "subcategory" : "tumblr", "additional_info" : null, "style_tags" : [], "css" : "@-moz-document domain(tumblr.com) {\n#logo {height: 0 !important;\r\n\r\n\r\n\r\n\twidth: 0 !important;\r\n\r\n\r\n\tpadding-left: 230px !important;\r\n\r\n\r\n\r\n\tpadding-top: 85px !important;\r\n\r\n\r\n\r\n\r\n\tbackground: url(http://i53.tinypic.com/4uzclt.png) no-repeat !important;}\n}", "discussions" : [], "discussionsCount" : 0, "commentsCount" : 0, "userjs_url" : "/styles/userjs/53224/b2st-batoost-tumblr-logo-c.user.js", "style_settings" : []} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "null"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "null"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "body": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "start": {"type": "integer"}, "end": {"type": "integer"}, "snapshot": {"type": "string"}, "state": {"type": "string"}, "author": {"type": "string"}, "space": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "votes": {"type": "integer"}, "votes_data": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "voter": {"type": "string"}, "created": {"type": "integer"}, "choice": {"type": "integer"}, "space": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}, "required": ["id", "voter", "created", "choice", "space"]}}}, "required": ["id", "title", "body", "choices", "start", "end", "snapshot", "state", "author", "space", "votes", "votes_data"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "0x61324ca592942679b1ba3a378399bde21345183abd2776f033d75d48f7e1d085", "title" : "What should we invest in?", "body" : "As per our thread, what should we invest in?", "choices" : ["Olympus DAO", "Klima DAO", "Wonderland.money"], "start" : 1636336800, "end" : 1636646400, "snapshot" : "13572879", "state" : "closed", "author" : "0xE0B376E6282c327Cbb7c2B2841d0B7b0595CaD60", "space" : {"id" : "odidao.eth", "name" : "ODI DAO"}, "votes" : 1, "votes_data" : [{"id" : "0xc29dc9084bef826f5bf4af1b62e77964ab102d768bb6b4f47d6365db5816be27", "voter" : "0x5FC5B2fC589967b5Fe482E33DdCe64881547a016", "created" : 1636338327, "choice" : 1, "space" : {"id" : "odidao.eth"}}]} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "body": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "start": {"type": "integer"}, "end": {"type": "integer"}, "snapshot": {"type": "string"}, "state": {"type": "string"}, "author": {"type": "string"}, "space": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "votes": {"type": "integer"}, "votes_data": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "voter": {"type": "string"}, "created": {"type": "integer"}, "choice": {"type": "integer"}, "space": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}, "required": ["id", "voter", "created", "choice", "space"]}}}, "required": ["id", "title", "body", "choices", "start", "end", "snapshot", "state", "author", "space", "votes", "votes_data"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"C": {"type": "number"}, "gamma": {"type": "number"}}, "required": ["C", "gamma"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"C" : 1.603937552443762, "gamma" : 0.0020000000000000005} | json_instruct | {"type": "object", "properties": {"C": {"type": "number"}, "gamma": {"type": "number"}}, "required": ["C", "gamma"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "githubUsername": {"type": "string"}, "university": {"type": "string"}}, "required": ["name", "githubUsername", "university"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"name" : "Shalitha Suranga", "githubUsername" : "shalithasuranga", "university" : "UWU"}, {"name" : "Amal Rasika", "githubUsername" : "maginz2t", "university" : "SUSL"}, {"name" : "Nadika Perera", "githubUsername" : "nadee24u", "university" : "IIT"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "githubUsername": {"type": "string"}, "university": {"type": "string"}}, "required": ["name", "githubUsername", "university"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"stationId": {"type": "integer"}, "stationGroupId": {"type": "integer"}, "name": {"type": "string"}, "lineId": {"type": "integer"}, "zipCode": {"type": "string"}, "pref": {"type": "string"}, "city": {"type": "string"}, "town": {"type": "string"}, "longitude": {"type": "number"}, "latitude": {"type": "number"}, "status": {"type": "integer"}}, "required": ["stationId", "stationGroupId", "name", "lineId", "zipCode", "pref", "city", "town", "longitude", "latitude", "status"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"stationId" : 9951701, "stationGroupId" : 9951701, "name" : "\u4e2d\u6751\u533a\u5f79\u6240", "lineId" : 99517, "zipCode" : "453-0811", "pref" : "\u611b\u77e5\u770c", "city" : "\u540d\u53e4\u5c4b\u5e02\u4e2d\u6751\u533a", "town" : "\u592a\u95a4\u901a", "longitude" : 136.873126, "latitude" : 35.167611, "status" : 0} | json_instruct | {"type": "object", "properties": {"stationId": {"type": "integer"}, "stationGroupId": {"type": "integer"}, "name": {"type": "string"}, "lineId": {"type": "integer"}, "zipCode": {"type": "string"}, "pref": {"type": "string"}, "city": {"type": "string"}, "town": {"type": "string"}, "longitude": {"type": "number"}, "latitude": {"type": "number"}, "status": {"type": "integer"}}, "required": ["stationId", "stationGroupId", "name", "lineId", "zipCode", "pref", "city", "town", "longitude", "latitude", "status"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"other_ids" : [], "mRNA_sequence" : [{"index" : 0, "type" : "five_prime_UTR", "sequence" : "CGTACATTGTACTCTATCACAACTATTACAACATACTTTTTGCTGGATATTAACTTAACAAAAGCCACATCTTTAAAACTTTGAAAATAACAACTTTGCTATA"}, {"index" : 1, "type" : "CDS", "sequence" : "ATGGAGCCAAAACAACGAGTTGTCAAGCCTTTAAAAGAAAGGGTTTTACCTGTTGTCAAG"}, {"index" : 2, "type" : "intron", "sequence" : "GTAAATATATCTATCATGTGTAAATCAGATAATAAATGTTGATTATAAGAAAAGTTTCTTATTTAGTTCCATAACGTAACTGTAATCTATTACTAAAACATAGACTAATTTGTCAGCATTATTTTATTTTGATTCAGTGTCATATTGTCTTCACTCTTTTAATACATTACTAACCGTTTATTATAG"}, {"index" : 3, "type" : "CDS", "sequence" : "AACACCCAGTTTGTTTGGTTTTCGGGGCAAGTAATAGTGCTAATCTCTTCCGTCTTGTATGCTCTTCAAGCAATCCCTTTTCGTTCCGCTCCTCCATTTTTGTTTAAAAGCGCTGCCTTTGGTGCCATCGTTGCATATGCAATTGTCCTTTACAAAACTTATAGTCCAAACTTGACTTCCCGTGCTTCTTGGAATAAGCATTTCTTTGCCCGTCTTATGCTCGATGACAATGTTCAGTATTTTATTTTAGCTCTTTCAATGTTGATTGATCGTCCCATCCTATTTTCTCTCGCTCCATATGCCATTTACGCCACTTTCCACATCTCCACTTACTTGCGTAGTGTGCTTTTGCCTGCCATTTACCCTAATATTTCTGACGCGAAAACTGCGTCTTATGCTTCTCGTGTTTCTAATTTGCTAAATCAGTACACTCGAAGCCAATTTCAACCTGCTATGCAACTTGTTGCTTCTCTCGAAACATTTTTATTGTTCCGTTTGTTCTTTGGGGTTTTCTTACGTAAAAACTCAATTTCCAGGTTGGTGGGCTATATTTTCTTTCTTCGCATGAGATACACTAATAGTCACTTTACTCGTGCATCCATTAAAGCCGTTAGCCTTCGAATGGATCGTTTGGTTGCAGATAACAGAGTTCCTCCTGTTATCAAAAATGCTTGGCATACATTCAAAACTTATGTGTCCAAGTTCGGTGCTTCACCTGTAGGTACTGCTCAAAGCCGTCCCACTGCATCAAGCTCTACCACTGCTCCCTCATCTACTTAA"}, {"index" : 4, "type" : "three_prime_UTR", "sequence" : "AGTGATGCCTTATTCCTTTTGATTGCTAGAGATTTATATAAATTTCACCAATCAGTGTGATTTTAATATGTCTAAGTGCTCCTGGTTTTTGAGTTCTTTACTATTAACGAGTAGTTTCTATTTCACCCAAGTAAATTTTGAATGTTCATACCGTTTACCTCTTTCTCTAAAAACTTGTTTGAGATAATTCCGTTTATTTATTTTTGCTCACTACTCCTCTATTTCAGTTATCTTTGTTTGGGGGGTCTCCTCAGACTTTAGTTTAGCTTTTTTCAAGGAAATTGAAATATGGATATATGTTGTTTATCCAAAAACTCTTTGAGTATTAAAAGATTAAGAGGTAAAAATAATACGTTTTATTGAATTTTGTAGCACAATAAACACATGTATAGCAGCGCACTC"}], "other_names" : [], "id" : "SPBC1539.04", "name" : "tts1"} | json_instruct | {"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01002901": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01002901"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Topology", "objects" : {"E01002901" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00014594", "LAD11CD" : "E09000020"}, "arcs" : [[0, 1, 2]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00014596", "LAD11CD" : "E09000020"}, "arcs" : [[3, 4, 5, -1, 6]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00014601", "LAD11CD" : "E09000020"}, "arcs" : [[-6, 7, 8, 9, -2]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00014606", "LAD11CD" : "E09000020"}, "arcs" : [[-9, 10]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00175091", "LAD11CD" : "E09000020"}, "arcs" : [[-4, 11]]}]}}, "arcs" : [[[2830, 9376], [491, -899], [-28, -1316], [702, -357], [-1203, -2048], [-682, 1094], [-483, -858]], [[1627, 4992], [-554, -400]], [[1073, 4592], [-439, 117], [-629, 884], [975, 1395], [196, 377], [252, -404], [823, 1426], [579, 989]], [[5551, 601], [-775, 1252], [-795, 258], [-331, 22], [100, -1084]], [[3750, 1049], [-165, -262], [-569, 1089], [-260, -224]], [[2756, 1652], [388, 1520], [-1517, 1820]], [[2830, 9376], [329, 623], [1586, -1977], [546, -1097], [315, 1114], [828, 849], [1326, -2148], [999, -1708], [1189, -2349], [51, -675], [-4351, -1564], [-97, 157]], [[2756, 1652], [29, -135], [-915, 1737], [23, -674], [-476, -237]], [[1417, 2343], [-246, -247], [-178, 461], [183, 655]], [[1176, 3212], [-304, 645], [201, 735]], [[1417, 2343], [-262, -561], [-575, 333], [-227, -768], [-319, 553], [-34, 214], [604, 1001], [572, 97]], [[5551, 601], [-1649, -601], [-152, 1049]]], "transform" : {"scale" : [1.4018527556396637e-06, 5.23255034171142e-07], "translate" : [-0.164021767975954, 51.48443354199124]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01002901": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01002901"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"private": {"type": "boolean"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@babel/core": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/register": {"type": "string"}, "chai": {"type": "string"}, "chai-as-promised": {"type": "string"}, "color": {"type": "string"}, "deep-iterator": {"type": "string"}, "deepmerge": {"type": "string"}, "del": {"type": "string"}, "flat": {"type": "string"}, "glob": {"type": "string"}, "gulp": {"type": "string"}, "gulp-flatten": {"type": "string"}, "gulp-mocha": {"type": "string"}, "gulp-postcss": {"type": "string"}, "gulp-rename": {"type": "string"}, "gulp-replace": {"type": "string"}, "gulp-sass": {"type": "string"}, "gulp-sass-glob": {"type": "string"}, "gulp-sourcemaps": {"type": "string"}, "jexl": {"type": "string"}, "minimist": {"type": "string"}, "normalize.css": {"type": "string"}, "postcss-reporter": {"type": "string"}, "postcss-scss": {"type": "string"}, "sass-mq": {"type": "string"}, "sass-true": {"type": "string"}, "sinon": {"type": "string"}, "sinon-as-promised": {"type": "string"}, "stylelint": {"type": "string"}}, "required": ["@babel/core", "@babel/preset-env", "@babel/register", "chai", "chai-as-promised", "color", "deep-iterator", "deepmerge", "del", "flat", "glob", "gulp", "gulp-flatten", "gulp-mocha", "gulp-postcss", "gulp-rename", "gulp-replace", "gulp-sass", "gulp-sass-glob", "gulp-sourcemaps", "jexl", "minimist", "normalize.css", "postcss-reporter", "postcss-scss", "sass-mq", "sass-true", "sinon", "sinon-as-promised", "stylelint"]}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}}, "required": ["private", "license", "devDependencies", "engines"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"private" : true, "license" : "MIT", "devDependencies" : {"@babel/core" : "^7.2.0", "@babel/preset-env" : "^7.2.0", "@babel/register" : "^7.0.0", "chai" : "^4.2.0", "chai-as-promised" : "^7.1.1", "color" : "^3.1.0", "deep-iterator" : "^1.1.0", "deepmerge" : "^2.2.1", "del" : "^3.0.0", "flat" : "^4.1.0", "glob" : "^7.1.3", "gulp" : "^4.0.0", "gulp-flatten" : "^0.4.0", "gulp-mocha" : "^6.0.0", "gulp-postcss" : "^8.0.0", "gulp-rename" : "^1.4.0", "gulp-replace" : "^1.0.0", "gulp-sass" : "^4.0.2", "gulp-sass-glob" : "^1.0.9", "gulp-sourcemaps" : "^2.6.4", "jexl" : "^1.1.4", "minimist" : "^1.2.0", "normalize.css" : "^8.0.1", "postcss-reporter" : "^5.0.0", "postcss-scss" : "^2.0.0", "sass-mq" : "^5.0.0", "sass-true" : "^4.0.0", "sinon" : "^7.1.1", "sinon-as-promised" : "^4.0.3", "stylelint" : "^9.4.0"}, "engines" : {"node" : ">=10.12"}} | json_instruct | {"type": "object", "properties": {"private": {"type": "boolean"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@babel/core": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/register": {"type": "string"}, "chai": {"type": "string"}, "chai-as-promised": {"type": "string"}, "color": {"type": "string"}, "deep-iterator": {"type": "string"}, "deepmerge": {"type": "string"}, "del": {"type": "string"}, "flat": {"type": "string"}, "glob": {"type": "string"}, "gulp": {"type": "string"}, "gulp-flatten": {"type": "string"}, "gulp-mocha": {"type": "string"}, "gulp-postcss": {"type": "string"}, "gulp-rename": {"type": "string"}, "gulp-replace": {"type": "string"}, "gulp-sass": {"type": "string"}, "gulp-sass-glob": {"type": "string"}, "gulp-sourcemaps": {"type": "string"}, "jexl": {"type": "string"}, "minimist": {"type": "string"}, "normalize.css": {"type": "string"}, "postcss-reporter": {"type": "string"}, "postcss-scss": {"type": "string"}, "sass-mq": {"type": "string"}, "sass-true": {"type": "string"}, "sinon": {"type": "string"}, "sinon-as-promised": {"type": "string"}, "stylelint": {"type": "string"}}, "required": ["@babel/core", "@babel/preset-env", "@babel/register", "chai", "chai-as-promised", "color", "deep-iterator", "deepmerge", "del", "flat", "glob", "gulp", "gulp-flatten", "gulp-mocha", "gulp-postcss", "gulp-rename", "gulp-replace", "gulp-sass", "gulp-sass-glob", "gulp-sourcemaps", "jexl", "minimist", "normalize.css", "postcss-reporter", "postcss-scss", "sass-mq", "sass-true", "sinon", "sinon-as-promised", "stylelint"]}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}}, "required": ["private", "license", "devDependencies", "engines"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"station" : [{"pref_cd" : 39, "line_cd" : 99814, "line_name" : "\u4e2d\u6751\u7dda", "station_cd" : 9981403, "station_g_cd" : 9981403, "station_name" : "\u8377\u7a32", "lon" : 133.116316, "lat" : 33.132961}]} | json_instruct | {"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"an8.17:0.3": {"type": "string"}, "an8.17:1.12": {"type": "string"}}, "required": ["an8.17:0.3", "an8.17:1.12"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"an8.17:0.3" : "Pa\u1e6dhamabandhanasutta \u2192 purisabandhanasutta\u1e41 (bj)", "an8.17:1.12" : "subaddh\u0101 \u2192 subandh\u0101 (si, sya-all, mr) | ye \u2192 yeva (sya-all, pts1ed, mr) | baddh\u0101\u201dti \u2192 bandh\u0101ti (bj, sya-all, mr)"} | json_instruct | {"type": "object", "properties": {"an8.17:0.3": {"type": "string"}, "an8.17:1.12": {"type": "string"}}, "required": ["an8.17:0.3", "an8.17:1.12"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "bin": {"type": "object", "properties": {"vex": {"type": "string"}}, "required": ["vex"]}, "author": {"type": "string"}, "repository": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}, "clear": {"type": "string"}, "commander": {"type": "string"}, "configstore": {"type": "string"}, "figlet": {"type": "string"}, "hogan.js": {"type": "string"}, "inquirer": {"type": "string"}, "minimist": {"type": "string"}, "pluralize": {"type": "string"}, "cli-spinners": {"type": "string"}, "ora": {"type": "string"}}, "required": ["chalk", "clear", "commander", "configstore", "figlet", "hogan.js", "inquirer", "minimist", "pluralize", "cli-spinners", "ora"]}, "devDependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "bin", "author", "repository", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@vuetronex/cli", "version" : "0.1.0", "description" : "Vuetronex CLI Utility", "main" : "index.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "keywords" : ["Vuetronex", "CLI", "Vue", "Electron", "Router", "Knex", "Bookshelf", "Tailwind"], "bin" : {"vex" : "./index.js"}, "author" : "Kazi Mainuddin Ahmed", "repository" : {"url" : "https://github.com/vuetronex/cli"}, "license" : "MIT", "dependencies" : {"chalk" : "^2.4.1", "clear" : "^0.1.0", "commander" : "^3.0.0", "configstore" : "^5.0.0", "figlet" : "^1.2.0", "hogan.js" : "^3.0.2", "inquirer" : "^6.2.0", "minimist" : "^1.2.0", "pluralize" : "^8.0.0", "cli-spinners" : "^2.0.0", "ora" : "^3.0.0"}, "devDependencies" : {}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "bin": {"type": "object", "properties": {"vex": {"type": "string"}}, "required": ["vex"]}, "author": {"type": "string"}, "repository": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}, "clear": {"type": "string"}, "commander": {"type": "string"}, "configstore": {"type": "string"}, "figlet": {"type": "string"}, "hogan.js": {"type": "string"}, "inquirer": {"type": "string"}, "minimist": {"type": "string"}, "pluralize": {"type": "string"}, "cli-spinners": {"type": "string"}, "ora": {"type": "string"}}, "required": ["chalk", "clear", "commander", "configstore", "figlet", "hogan.js", "inquirer", "minimist", "pluralize", "cli-spinners", "ora"]}, "devDependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "bin", "author", "repository", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"symbol": {"type": "string"}, "name": {"type": "string"}, "decimals": {"type": "integer"}, "address": {"type": "string"}}, "required": ["symbol", "name", "decimals", "address"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"symbol" : "BNK", "name" : "Bankera", "decimals" : 8, "address" : "0xc80c5e40220172b36adee2c951f26f2a577810c5"} | json_instruct | {"type": "object", "properties": {"symbol": {"type": "string"}, "name": {"type": "string"}, "decimals": {"type": "integer"}, "address": {"type": "string"}}, "required": ["symbol", "name", "decimals", "address"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "qualified_name": {"type": "string"}, "examine": {"type": "string"}, "members": {"type": "boolean"}, "release_date": {"type": "string"}, "quest": {"type": "boolean"}, "weight": {"type": "number"}, "value": {"type": "integer"}, "alchemy": {"type": "object", "properties": {"high": {"type": "integer"}, "low": {"type": "integer"}}, "required": ["high", "low"]}, "tradeable": {"type": "boolean"}, "stackable": {"type": "boolean"}, "noteable": {"type": "boolean"}, "equipable": {"type": "boolean"}, "tradeable_ge": {"type": "boolean"}, "buy_limit": {"type": "integer"}, "icon": {"type": "string"}, "wiki_url": {"type": "string"}}, "required": ["id", "name", "qualified_name", "examine", "members", "release_date", "quest", "weight", "value", "alchemy", "tradeable", "stackable", "noteable", "equipable", "tradeable_ge", "buy_limit", "icon", "wiki_url"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 10127, "name" : "Dashing kebbit fur", "qualified_name" : "Dashing kebbit fur", "examine" : "Nature's equivalent of go-faster stripes.", "members" : true, "release_date" : "2006-11-21", "quest" : false, "weight" : 0.453, "value" : 270, "alchemy" : {"high" : 162, "low" : 108}, "tradeable" : true, "stackable" : false, "noteable" : true, "equipable" : false, "tradeable_ge" : true, "buy_limit" : 10000, "icon" : "iVBORw0KGgoAAAANSUhEUgAAACQAAAAgCAYAAAB6kdqOAAADUElEQVR4XsWXXUtVURCGXb/DG++CIJAgIiQQJCQUMZJEQ1DjpNRJ0jiVSJH0RSGVVNIHUlQQERER0UV01Q9b8czuPWccknTvXS0Yzmmf7Z5nv/POrFVXV6WVcif++0r51uJYvrFwPK/MDf8rMK/A1lhtjhpQY+ywfb/cGMrNyYFwX60r2duTjLh6ZsQCNQgBzY/35zsXTthvrdmj9u+JoYN5uL+3TqiU71+asIQqSwQTEKoAwXdAl6YHTTWgxgYP1AGV8qvbjfz02rRB8fYezMNxbWHqiEFxL79ROq4BNXOsL0+NHKoKlfL7B2cNauPKVF5rjRtUBBMQigiKe7lO6bgu9YCrAJXyx4fnDOrlzVMGxdtHMKD47OnutgBqfXmy7SfKh1oeuBIUQG/unjaoRysnDcqDSS0BCUpllorAASbVSnZgyu/uzee3a3MGhJ+AkvzyB7FvTweIxCiKUt5/wHnVgCsFJYWer84YEAB0jwAAHB3Yb0FJUAgV9AKASVEppiHa29NjEbP+YaUtQGpnXyIUYOYABxQw3I9SKjVQUqoCDKuotxJEIIJkXBMQ9wFFxPJVhtm8PmsPVQDEXGHgUSa8oGT8xndU8VAqXWUYmVlvqPCGxi/eJ3xGKD4rwzAU5Rvf4sBEBVQWYNSBhPeZgGKmHayis1QqkqhlCRKptWVelUXqEZjc+6zCUCzmj/YxVNEujmeUIAL5jgIIjxGYXVEJCpVIoH2Jh8W3BiYCUToZXz7zQSeWgEr50+MFMzVvzCAjyWDfXgsPRGkjFH8D2HbBPaWgPqw3LSGm1sFLUCqBB9KUBl6bMB6MUbLjUv7+4mLbT3hJ5xxKh5/U9jpiSDkB6eyk4BklYbRS/vpsqe2naHBN57i/ARS7k6gIw0r5x+vl/HnjvM0loJQIX9FFwPDpDR+BULYGGFYB9G2zZQc2P7kpiXZu1KGr1FkCkqJ+d48Zdrk6QKjEgY3zkY4kGBpAf+ZRe/vdHfCagFipDYRKCsaCAkA/h7TneVBBxaeXWB0gxZcni78e3gkg8ZlXzm+6vsNihl2uAohuIwQgg3aMWlxnduksrv3Qq1WbSr8DiXd5MBRjhun/d1KrJpWKZNuBxOXBYuz0GX9lxbLuFOYnln8mPGGu90IAAAAASUVORK5CYII=", "wiki_url" : "https://oldschool.runescape.wiki/w/Dashing_kebbit_fur"} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "qualified_name": {"type": "string"}, "examine": {"type": "string"}, "members": {"type": "boolean"}, "release_date": {"type": "string"}, "quest": {"type": "boolean"}, "weight": {"type": "number"}, "value": {"type": "integer"}, "alchemy": {"type": "object", "properties": {"high": {"type": "integer"}, "low": {"type": "integer"}}, "required": ["high", "low"]}, "tradeable": {"type": "boolean"}, "stackable": {"type": "boolean"}, "noteable": {"type": "boolean"}, "equipable": {"type": "boolean"}, "tradeable_ge": {"type": "boolean"}, "buy_limit": {"type": "integer"}, "icon": {"type": "string"}, "wiki_url": {"type": "string"}}, "required": ["id", "name", "qualified_name", "examine", "members", "release_date", "quest", "weight", "value", "alchemy", "tradeable", "stackable", "noteable", "equipable", "tradeable_ge", "buy_limit", "icon", "wiki_url"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"web": {"type": "array", "items": {"type": "object", "properties": {"value": {"type": "array", "items": {"type": "string"}}, "key": {"type": "string"}}, "required": ["value", "key"]}}, "query": {"type": "string"}, "translation": {"type": "array", "items": {"type": "string"}}, "errorCode": {"type": "string"}, "dict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "webdict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "basic": {"type": "object", "properties": {"us-phonetic": {"type": "string"}, "phonetic": {"type": "string"}, "uk-phonetic": {"type": "string"}, "explains": {"type": "array", "items": {"type": "string"}}}, "required": ["us-phonetic", "phonetic", "uk-phonetic", "explains"]}, "l": {"type": "string"}}, "required": ["web", "query", "translation", "errorCode", "dict", "webdict", "basic", "l"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"web" : [{"value" : ["Break Down", "\u5d29\u6e83", "\u51fb\u7a7f"], "key" : "Breakdown"}, {"value" : ["\u51fb\u7a7f\u7535\u538b", "\u51fb\u7a7f\u7535\u538b", "\u5d29\u6e83\u7535\u538b"], "key" : "Breakdown Voltage"}, {"value" : ["\u4ecb\u7535\u51fb\u7a7f", "\u4ecb\u8d28\u51fb\u7a7f", "\u4ecb\u8d28\u54d7"], "key" : "dielectric breakdown"}], "query" : "breakdown", "translation" : ["\u5206\u89e3"], "errorCode" : "0", "dict" : {"url" : "yddict://m.youdao.com/dict?le=eng&q=breakdown"}, "webdict" : {"url" : "http://m.youdao.com/dict?le=eng&q=breakdown"}, "basic" : {"us-phonetic" : "'brek'da\u028an", "phonetic" : "'bre\u026akda\u028an", "uk-phonetic" : "'bre\u026akda\u028an", "explains" : ["n. \u6545\u969c\uff1b\u5d29\u6e83\uff1b\u5206\u89e3\uff1b\u5206\u7c7b\uff1b\u8870\u5f31\uff1b\u8dfa\u811a\u66f3\u6b65\u821e"]}, "l" : "EN2zh-CHS"} | json_instruct | {"type": "object", "properties": {"web": {"type": "array", "items": {"type": "object", "properties": {"value": {"type": "array", "items": {"type": "string"}}, "key": {"type": "string"}}, "required": ["value", "key"]}}, "query": {"type": "string"}, "translation": {"type": "array", "items": {"type": "string"}}, "errorCode": {"type": "string"}, "dict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "webdict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "basic": {"type": "object", "properties": {"us-phonetic": {"type": "string"}, "phonetic": {"type": "string"}, "uk-phonetic": {"type": "string"}, "explains": {"type": "array", "items": {"type": "string"}}}, "required": ["us-phonetic", "phonetic", "uk-phonetic", "explains"]}, "l": {"type": "string"}}, "required": ["web", "query", "translation", "errorCode", "dict", "webdict", "basic", "l"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"vertices": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["vertices"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"vertices" : [[10, 57], [4, 32], [30, 66], [25, 45], [64, 66], [50, 46], [31, 20], [85, 57], [55, 24], [63, 47], [76, 13], [57, 20]]} | json_instruct | {"type": "object", "properties": {"vertices": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["vertices"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"schema_version" : "1.2.0", "id" : "GHSA-x4gh-vmc2-6j3g", "modified" : "2022-04-29T03:00:09Z", "published" : "2022-04-29T03:00:09Z", "aliases" : ["CVE-2004-1747"], "details" : "Cross-site scripting (XSS) vulnerability in NetworkEverywhere NR041 running firmware 1.2 Release 03 allows remote attackers to inject arbitrary web script or HTML via the DHCP HOSTNAME option.", "severity" : [], "affected" : [], "references" : [{"type" : "ADVISORY", "url" : "https://nvd.nist.gov/vuln/detail/CVE-2004-1747"}, {"type" : "WEB", "url" : "https://exchange.xforce.ibmcloud.com/vulnerabilities/17120"}, {"type" : "WEB", "url" : "http://marc.info/?l=bugtraq&m=109344996523392&w=2"}, {"type" : "WEB", "url" : "http://www.securityfocus.com/bid/11046"}], "database_specific" : {"cwe_ids" : [], "severity" : "MODERATE", "github_reviewed" : false}} | json_instruct | {"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"body": {"type": "string"}, "user": {"type": "string"}, "url": {"type": "string"}, "updated_at": {"type": "string"}, "created_at": {"type": "string"}, "closed_at": {"type": "string"}, "state": {"type": "string"}, "title": {"type": "string"}, "number": {"type": "integer"}, "milestone": {"type": "null"}, "labels": {"type": "array", "items": {}}, "id": {"type": "integer"}, "html_url": {"type": "string"}, "assignees": {"type": "array", "items": {}}, "comments": {"type": "integer"}}, "required": ["body", "user", "url", "updated_at", "created_at", "closed_at", "state", "title", "number", "milestone", "labels", "id", "html_url", "assignees", "comments"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"body" : "Fixes https://github.com/LLNL/spack/issues/5564\r\n\r\n#5132 added a bug in dependency collection: a generator storing link dependencies was iterated over twice. The first iteration exhausted it and so they were not available when retrieved the second time.", "user" : "scheibelp", "url" : "https://api.github.com/repos/spack/spack/issues/5586", "updated_at" : "2017-10-03 23:47:08", "created_at" : "2017-10-03 17:53:45", "closed_at" : "2017-10-03 23:47:08", "state" : "closed", "title" : "Fix environment dependency collection bug", "number" : 5586, "milestone" : null, "labels" : [], "id" : 262524017, "html_url" : "https://github.com/spack/spack/pull/5586", "assignees" : [], "comments" : 1} | json_instruct | {"type": "object", "properties": {"body": {"type": "string"}, "user": {"type": "string"}, "url": {"type": "string"}, "updated_at": {"type": "string"}, "created_at": {"type": "string"}, "closed_at": {"type": "string"}, "state": {"type": "string"}, "title": {"type": "string"}, "number": {"type": "integer"}, "milestone": {"type": "null"}, "labels": {"type": "array", "items": {}}, "id": {"type": "integer"}, "html_url": {"type": "string"}, "assignees": {"type": "array", "items": {}}, "comments": {"type": "integer"}}, "required": ["body", "user", "url", "updated_at", "created_at", "closed_at", "state", "title", "number", "milestone", "labels", "id", "html_url", "assignees", "comments"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"financialInstrumentFinancialInstrumentServiceDescription": {"type": "string"}, "financialInstrumentUpdateActionTaskRecord": {"type": "object", "properties": {}, "required": []}, "financialInstrumentUpdateActionTaskReference": {"type": "string"}, "financialInstrumentPreconditions": {"type": "string"}, "updateResponseRecord": {"type": "object", "properties": {}, "required": []}, "financialInstrumentFeatureSchedule": {"type": "string"}, "financialInstrumentFinancialInstrumentServiceInputsandOuputs": {"type": "string"}, "financialInstrumentFinancialInstrumentServiceWorkProduct": {"type": "string"}, "financialInstrumentPostconditions": {"type": "string"}, "financialInstrumentFinancialInstrumentServiceType": {"type": "string"}}, "required": ["financialInstrumentFinancialInstrumentServiceDescription", "financialInstrumentUpdateActionTaskRecord", "financialInstrumentUpdateActionTaskReference", "financialInstrumentPreconditions", "updateResponseRecord", "financialInstrumentFeatureSchedule", "financialInstrumentFinancialInstrumentServiceInputsandOuputs", "financialInstrumentFinancialInstrumentServiceWorkProduct", "financialInstrumentPostconditions", "financialInstrumentFinancialInstrumentServiceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"financialInstrumentFinancialInstrumentServiceDescription" : "financialInstrumentFinancialInstrumentServiceDescription", "financialInstrumentUpdateActionTaskRecord" : {}, "financialInstrumentUpdateActionTaskReference" : "FIUATR731801", "financialInstrumentPreconditions" : "financialInstrumentPreconditions", "updateResponseRecord" : {}, "financialInstrumentFeatureSchedule" : "financialInstrumentFeatureSchedule", "financialInstrumentFinancialInstrumentServiceInputsandOuputs" : "financialInstrumentFinancialInstrumentServiceInputsandOuputs", "financialInstrumentFinancialInstrumentServiceWorkProduct" : "financialInstrumentFinancialInstrumentServiceWorkProduct", "financialInstrumentPostconditions" : "financialInstrumentPostconditions", "financialInstrumentFinancialInstrumentServiceType" : "financialInstrumentFinancialInstrumentServiceType"} | json_instruct | {"type": "object", "properties": {"financialInstrumentFinancialInstrumentServiceDescription": {"type": "string"}, "financialInstrumentUpdateActionTaskRecord": {"type": "object", "properties": {}, "required": []}, "financialInstrumentUpdateActionTaskReference": {"type": "string"}, "financialInstrumentPreconditions": {"type": "string"}, "updateResponseRecord": {"type": "object", "properties": {}, "required": []}, "financialInstrumentFeatureSchedule": {"type": "string"}, "financialInstrumentFinancialInstrumentServiceInputsandOuputs": {"type": "string"}, "financialInstrumentFinancialInstrumentServiceWorkProduct": {"type": "string"}, "financialInstrumentPostconditions": {"type": "string"}, "financialInstrumentFinancialInstrumentServiceType": {"type": "string"}}, "required": ["financialInstrumentFinancialInstrumentServiceDescription", "financialInstrumentUpdateActionTaskRecord", "financialInstrumentUpdateActionTaskReference", "financialInstrumentPreconditions", "updateResponseRecord", "financialInstrumentFeatureSchedule", "financialInstrumentFinancialInstrumentServiceInputsandOuputs", "financialInstrumentFinancialInstrumentServiceWorkProduct", "financialInstrumentPostconditions", "financialInstrumentFinancialInstrumentServiceType"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"projectname": {"type": "string"}, "github": {"type": "string"}, "color": {"type": "string"}}, "required": ["projectname", "github", "color"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"projectname" : "ButtonGame", "github" : "https://github.com/El-khamis/ButtonGame", "color" : "#0000cc"} | json_instruct | {"type": "object", "properties": {"projectname": {"type": "string"}, "github": {"type": "string"}, "color": {"type": "string"}}, "required": ["projectname", "github", "color"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"word" : "adaptness", "definition" : "Adaptedness. [R.]"} | json_instruct | {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"entity": {"type": "object", "properties": {"fancy_org_assignment": {"type": "object", "properties": {"id": {"type": "string"}, "client_integration_id": {"type": "string"}}, "required": ["id", "client_integration_id"]}}, "required": ["fancy_org_assignment"]}}, "required": ["entity"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"entity" : {"fancy_org_assignment" : {"id" : "51a014a4-4252-11e7-944f-129bd0521531", "client_integration_id" : "1"}}} | json_instruct | {"type": "object", "properties": {"entity": {"type": "object", "properties": {"fancy_org_assignment": {"type": "object", "properties": {"id": {"type": "string"}, "client_integration_id": {"type": "string"}}, "required": ["id", "client_integration_id"]}}, "required": ["fancy_org_assignment"]}}, "required": ["entity"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"description": {"type": "string"}, "dependencies": {"type": "array", "items": {}}, "sublime_text": {"type": "string"}, "version": {"type": "string"}, "url": {"type": "string"}, "platforms": {"type": "array", "items": {"type": "string"}}}, "required": ["description", "dependencies", "sublime_text", "version", "url", "platforms"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"description" : "A powerful file templating plugin for ST2/ST3", "dependencies" : [], "sublime_text" : "*", "version" : "1.6.0", "url" : "http://shiyanhui.github.io/FileHeader", "platforms" : ["*"]} | json_instruct | {"type": "object", "properties": {"description": {"type": "string"}, "dependencies": {"type": "array", "items": {}}, "sublime_text": {"type": "string"}, "version": {"type": "string"}, "url": {"type": "string"}, "platforms": {"type": "array", "items": {"type": "string"}}}, "required": ["description", "dependencies", "sublime_text", "version", "url", "platforms"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"clients_without_service": {"type": "string"}, "outages": {"type": "string"}, "created_at": {"type": "string"}}, "required": ["clients_without_service", "outages", "created_at"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"clients_without_service" : "f6e916184a8840bfb8f5229e1e4e3852", "outages" : "fe738c3fbcf7295cc3148ec9648ca668", "created_at" : "2021-10-12T18:17:18.157816"} | json_instruct | {"type": "object", "properties": {"clients_without_service": {"type": "string"}, "outages": {"type": "string"}, "created_at": {"type": "string"}}, "required": ["clients_without_service", "outages", "created_at"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "summary": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "object", "properties": {"type": {"type": "string"}, "file": {"type": "string"}}, "required": ["type", "file"]}, "authors": {"type": "object", "properties": {"Adrian": {"type": "string"}}, "required": ["Adrian"]}, "social_media_url": {"type": "string"}, "platforms": {"type": "object", "properties": {"ios": {"type": "string"}, "osx": {"type": "string"}}, "required": ["ios", "osx"]}, "requires_arc": {"type": "boolean"}, "source": {"type": "object", "properties": {"git": {"type": "string"}, "tag": {"type": "string"}}, "required": ["git", "tag"]}, "default_subspecs": {"type": "string"}, "subspecs": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "source_files": {"type": "string"}}, "required": ["name", "source_files"]}}}, "required": ["name", "version", "summary", "description", "homepage", "license", "authors", "social_media_url", "platforms", "requires_arc", "source", "default_subspecs", "subspecs"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "NSUIColor+FlatColors", "version" : "0.0.3", "summary" : "A compiler-aware category for iOS and OS X to extend UIColor and NSColor with colors from http://designmodo.github.io/Flat-UI/", "description" : " A compiler-aware category for iOS and OS X to extend UIColor and NSColor with the flat colors from the Flat UI framework. http://designmodo.github.io/Flat-UI/\n\n * Switch from UIColor+FlatColors to NSUIColors+FlatColors with little or no code changes\n * Compiler aware and will work on iOS or OS X targets with little or no code changes\n\n ###Importing: \n 1. **Common Import:** `#import \"NSUIColor+FlatColors.h\"`\n 2. **iOS Import:** `#import \"UIColor+FlatColors.h\"`\n 3. **OS X Import:** `#import \"NSColor+FlatColors.h\"`\n\n ###Use: \n 1. **Common or iOS Import:** `someViewYouWantToColor.backgroundColor = [UIColor flatEmeraldColor];`\n 2. **Common or OS X Import:** `someViewYouWantToColor.backgroundColor = [NSColor flatEmeraldColor];`\n", "homepage" : "http://www.github.com/emiscience/NSUIColor-FlatColors", "license" : {"type" : "MIT", "file" : "LICENSE"}, "authors" : {"Adrian" : "as@emiscience.com"}, "social_media_url" : "http://twitter.com/emiscience", "platforms" : {"ios" : "5.0", "osx" : "10.7"}, "requires_arc" : true, "source" : {"git" : "https://github.com/emiscience/NSUIColor-FlatColors.git", "tag" : "0.0.3"}, "default_subspecs" : "Default", "subspecs" : [{"name" : "Default", "source_files" : "NSUIColor+FlatColors"}]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "summary": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "object", "properties": {"type": {"type": "string"}, "file": {"type": "string"}}, "required": ["type", "file"]}, "authors": {"type": "object", "properties": {"Adrian": {"type": "string"}}, "required": ["Adrian"]}, "social_media_url": {"type": "string"}, "platforms": {"type": "object", "properties": {"ios": {"type": "string"}, "osx": {"type": "string"}}, "required": ["ios", "osx"]}, "requires_arc": {"type": "boolean"}, "source": {"type": "object", "properties": {"git": {"type": "string"}, "tag": {"type": "string"}}, "required": ["git", "tag"]}, "default_subspecs": {"type": "string"}, "subspecs": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "source_files": {"type": "string"}}, "required": ["name", "source_files"]}}}, "required": ["name", "version", "summary", "description", "homepage", "license", "authors", "social_media_url", "platforms", "requires_arc", "source", "default_subspecs", "subspecs"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"Id": {"type": "string"}, "IsStatic": {"type": "boolean"}, "useGravity": {"type": "boolean"}, "randomRotation": {"type": "boolean"}, "Position": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "z": {"type": "integer"}}, "required": ["x", "y", "z"]}, "Rotation": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "z": {"type": "integer"}}, "required": ["x", "y", "z"]}, "IsGroupPosition": {"type": "boolean"}, "GroupPositions": {"type": "array", "items": {}}, "Root": {"type": "string"}, "Items": {"type": "array", "items": {"type": "object", "properties": {"_id": {"type": "string"}, "_tpl": {"type": "string"}}, "required": ["_id", "_tpl"]}}}, "required": ["Id", "IsStatic", "useGravity", "randomRotation", "Position", "Rotation", "IsGroupPosition", "GroupPositions", "Root", "Items"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Id" : "Lootable_00162", "IsStatic" : true, "useGravity" : true, "randomRotation" : false, "Position" : {"x" : 0, "y" : 0, "z" : 0}, "Rotation" : {"x" : 0, "y" : 0, "z" : 0}, "IsGroupPosition" : false, "GroupPositions" : [], "Root" : "5d31e40e645bb73eed3d9e15", "Items" : [{"_id" : "5d31e40e645bb73eed3d9e15", "_tpl" : "5909d5ef86f77467974efbd8"}, {"_id" : "5d31e40e645bb73eed3d9e16", "_tpl" : "544fb25a4bdc2dfb738b4567", "parentId" : "5d31e40e645bb73eed3d9e15", "slotId" : "main", "location" : {"x" : 0, "y" : 0, "r" : 0}}, {"_id" : "5d31e40e645bb73eed3d9e17", "_tpl" : "591af28e86f77414a27a9e1d", "parentId" : "5d31e40e645bb73eed3d9e15", "slotId" : "main", "location" : {"x" : 1, "y" : 0, "r" : 0}}, {"_id" : "5d31e40e645bb73eed3d9e18", "_tpl" : "5943ee5a86f77413872d25ec", "parentId" : "5d31e40e645bb73eed3d9e15", "slotId" : "main", "location" : {"x" : 2, "y" : 0, "r" : 0}}, {"_id" : "5d31e40e645bb73eed3d9e19", "_tpl" : "576a581d2459771e7b1bc4f1", "parentId" : "5d31e40e645bb73eed3d9e15", "slotId" : "main", "location" : {"x" : 3, "y" : 0, "r" : 0}}, {"_id" : "5d31e40e645bb73eed3d9e1a", "_tpl" : "576a5ed62459771e9c2096cb", "parentId" : "5d31e40e645bb73eed3d9e19", "slotId" : "mod_magazine"}, {"_id" : "5d31e40e645bb73eed3d9e1b", "_tpl" : "576a63cd2459771e796e0e11", "parentId" : "5d31e40e645bb73eed3d9e19", "slotId" : "mod_pistol_grip"}]} | json_instruct | {"type": "object", "properties": {"Id": {"type": "string"}, "IsStatic": {"type": "boolean"}, "useGravity": {"type": "boolean"}, "randomRotation": {"type": "boolean"}, "Position": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "z": {"type": "integer"}}, "required": ["x", "y", "z"]}, "Rotation": {"type": "object", "properties": {"x": {"type": "integer"}, "y": {"type": "integer"}, "z": {"type": "integer"}}, "required": ["x", "y", "z"]}, "IsGroupPosition": {"type": "boolean"}, "GroupPositions": {"type": "array", "items": {}}, "Root": {"type": "string"}, "Items": {"type": "array", "items": {"type": "object", "properties": {"_id": {"type": "string"}, "_tpl": {"type": "string"}}, "required": ["_id", "_tpl"]}}}, "required": ["Id", "IsStatic", "useGravity", "randomRotation", "Position", "Rotation", "IsGroupPosition", "GroupPositions", "Root", "Items"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"id": {"type": "string"}, "playerTags": {"type": "array", "items": {}}, "teamTags": {"type": "array", "items": {"type": "string"}}, "gameTags": {"type": "array", "items": {}}, "metadata": {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"]}, "created": {"type": "string"}, "season": {"type": "integer"}, "tournament": {"type": "integer"}, "type": {"type": "integer"}, "day": {"type": "integer"}, "phase": {"type": "integer"}, "category": {"type": "integer"}, "description": {"type": "string"}, "nuts": {"type": "integer"}}, "required": ["id", "playerTags", "teamTags", "gameTags", "metadata", "created", "season", "tournament", "type", "day", "phase", "category", "description", "nuts"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "15f6bf1b-c899-45f3-8cc0-02f58fc430ed", "playerTags" : [], "teamTags" : ["adc5b394-8f76-416d-9ce9-813706877b84"], "gameTags" : [], "metadata" : {"parent" : "de0ea868-1523-4d57-a72a-a07306cf247d"}, "created" : "2021-04-11T18:16:07.845Z", "season" : 14, "tournament" : -1, "type" : 152, "day" : 113, "phase" : 13, "category" : 3, "description" : "The Breath Mints vote to infuse Leach Ingram's Pitching ability.", "nuts" : 6} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "playerTags": {"type": "array", "items": {}}, "teamTags": {"type": "array", "items": {"type": "string"}}, "gameTags": {"type": "array", "items": {}}, "metadata": {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"]}, "created": {"type": "string"}, "season": {"type": "integer"}, "tournament": {"type": "integer"}, "type": {"type": "integer"}, "day": {"type": "integer"}, "phase": {"type": "integer"}, "category": {"type": "integer"}, "description": {"type": "string"}, "nuts": {"type": "integer"}}, "required": ["id", "playerTags", "teamTags", "gameTags", "metadata", "created", "season", "tournament", "type", "day", "phase", "category", "description", "nuts"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"brief" : "lawgiving, legislation", "long" : "lawgiving, legislation."} | json_instruct | {"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"manifest_version": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "browser_action": {"type": "object", "properties": {"default_icon": {"type": "string"}}, "required": ["default_icon"]}, "permissions": {"type": "array", "items": {"type": "string"}}, "background": {"type": "object", "properties": {"scripts": {"type": "array", "items": {"type": "string"}}, "persistent": {"type": "boolean"}}, "required": ["scripts", "persistent"]}}, "required": ["manifest_version", "name", "description", "version", "browser_action", "permissions", "background"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"manifest_version" : 2, "name" : "Gerador de valor Nubank", "description" : "Insere um checkbox nas despesas do nubank para soma", "version" : "1.0", "browser_action" : {"default_icon" : "assets/icon.png"}, "permissions" : ["activeTab"], "background" : {"scripts" : ["nu.js"], "persistent" : false}} | json_instruct | {"type": "object", "properties": {"manifest_version": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "browser_action": {"type": "object", "properties": {"default_icon": {"type": "string"}}, "required": ["default_icon"]}, "permissions": {"type": "array", "items": {"type": "string"}}, "background": {"type": "object", "properties": {"scripts": {"type": "array", "items": {"type": "string"}}, "persistent": {"type": "boolean"}}, "required": ["scripts", "persistent"]}}, "required": ["manifest_version", "name", "description", "version", "browser_action", "permissions", "background"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"bundles": {"type": "object", "properties": {"BCC\\CronManagerBundle\\BCCCronManagerBundle": {"type": "array", "items": {"type": "string"}}}, "required": ["BCC\\CronManagerBundle\\BCCCronManagerBundle"]}, "copy-from-recipe": {"type": "object", "properties": {"config/": {"type": "string"}}, "required": ["config/"]}}, "required": ["bundles", "copy-from-recipe"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"bundles" : {"BCC\\CronManagerBundle\\BCCCronManagerBundle" : ["all"]}, "copy-from-recipe" : {"config/" : "%CONFIG_DIR%/"}} | json_instruct | {"type": "object", "properties": {"bundles": {"type": "object", "properties": {"BCC\\CronManagerBundle\\BCCCronManagerBundle": {"type": "array", "items": {"type": "string"}}}, "required": ["BCC\\CronManagerBundle\\BCCCronManagerBundle"]}, "copy-from-recipe": {"type": "object", "properties": {"config/": {"type": "string"}}, "required": ["config/"]}}, "required": ["bundles", "copy-from-recipe"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "version": {"type": "string"}, "maintainers": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "web": {"type": "string"}}, "required": ["name", "email", "web"]}}, "licenses": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "dependencies": {"type": "object", "properties": {"jasmine-node": {"type": "string"}, "express": {"type": "string"}, "jade": {"type": "string"}}, "required": ["jasmine-node", "express", "jade"]}, "repositories": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "homepage": {"type": "array", "items": {"type": "string"}}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}}, "required": ["name", "description", "keywords", "version", "maintainers", "licenses", "dependencies", "repositories", "homepage", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "tbd", "description" : "tbd is a test data building library, allowing you to quickly spin up large amounts of fake data to be pumped into tests", "keywords" : ["testing", "unit-testing", "data", "generator"], "version" : "0.6.4", "maintainers" : [{"name" : "Aaron Powell", "email" : "me@aaron-powell.com", "web" : "http://www.aaron-powell.com"}], "licenses" : [{"type" : "MIT", "url" : "https://github.com/aaronpowell/tbd/blob/master/License.txt"}], "dependencies" : {"jasmine-node" : ">=1.0.0", "express" : ">=2.5.0", "jade" : ">=0.18.0"}, "repositories" : [{"type" : "git", "url" : "https://github.com/aaronpowell/tbd"}], "homepage" : ["https://github.com/aaronpowell/tbd"], "scripts" : {"test" : "node tests.js"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "version": {"type": "string"}, "maintainers": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "web": {"type": "string"}}, "required": ["name", "email", "web"]}}, "licenses": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "dependencies": {"type": "object", "properties": {"jasmine-node": {"type": "string"}, "express": {"type": "string"}, "jade": {"type": "string"}}, "required": ["jasmine-node", "express", "jade"]}, "repositories": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "homepage": {"type": "array", "items": {"type": "string"}}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}}, "required": ["name", "description", "keywords", "version", "maintainers", "licenses", "dependencies", "repositories", "homepage", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"name" : "AVONLEE", "frequency" : 0, "gender" : "male"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}, "egis": {"type": "null"}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1", "egis"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"\u5de5\u5ee0\u540d\u7a31" : "\u99ff\u6fa4\u5de5\u696d\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f" : "99628928", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f" : "08310003213570", "\u5de5\u5ee0\u5730\u5740" : "\u6843\u5712\u5e02\u4e2d\u58e2\u5340\u5167\u5b9a\u91cc\u5167\u5b9a\u4e8c\u5341\u885731\u5df711\u865f1\u30013\u30014\u6a13", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc" : "\u6843\u5712\u5e02\u4e2d\u58e2\u5340\u5167\u5b9a\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d" : "\u5442\u6625\u767c\u3000\u3000\u3000", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f" : "97067195", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b" : "\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f" : "0831231", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f" : "0840109", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b" : "\u751f\u7522\u4e2d", "\u7522\u696d\u985e\u5225" : ["25\u91d1\u5c6c\u88fd\u54c1\u88fd\u9020\u696d"], "\u4e3b\u8981\u7522\u54c1" : ["251\u91d1\u5c6c\u624b\u5de5\u5177\u53ca\u6a21\u5177", "259\u5176\u4ed6\u91d1\u5c6c\u88fd\u54c1"], "egis" : null} | json_instruct | {"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}, "egis": {"type": "null"}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1", "egis"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Dependency Hashing for n-best CCG Parsing.", "fields" : ["semantic equivalence", "oracle", "natural language processing", "hash function", "parsing"], "abstract" : "Optimising for one grammatical representation, but evaluating over a different one is a particular challenge for parsers and n-best CCG parsing. We find that this mismatch causes many n-best CCG parses to be semantically equivalent, and describe a hashing technique that eliminates this problem, improving oracle n-best F-score by 0.7% and reranking accuracy by 0.4%. We also present a comprehensive analysis of errors made by the C&C CCG parser, providing the first breakdown of the impact of implementation decisions, such as supertagging, on parsing accuracy.", "citation" : "Citations (6)", "year" : "2012", "departments" : ["University of Sydney", "University of Sydney"], "conf" : "acl", "authors" : ["Dominick Ng.....http://dblp.org/pers/hd/n/Ng:Dominick", "James R. Curran.....http://dblp.org/pers/hd/c/Curran:James_R="], "pages" : 9} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"symbol": {"type": "string"}, "address": {"type": "string"}, "overview": {"type": "object", "properties": {"en": {"type": "string"}, "zh": {"type": "string"}}, "required": ["en", "zh"]}, "email": {"type": "string"}, "website": {"type": "string"}, "whitepaper": {"type": "string"}, "state": {"type": "string"}, "published_on": {"type": "string"}, "initial_price": {"type": "object", "properties": {"ETH": {"type": "string"}}, "required": ["ETH"]}, "links": {"type": "object", "properties": {"twitter": {"type": "string"}, "telegram": {"type": "string"}, "github": {"type": "string"}, "facebook": {"type": "string"}, "reddit": {"type": "string"}, "medium": {"type": "string"}}, "required": ["twitter", "telegram", "github", "facebook", "reddit", "medium"]}}, "required": ["symbol", "address", "overview", "email", "website", "whitepaper", "state", "published_on", "initial_price", "links"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"symbol" : "QPAY", "address" : "0xcd607fdd69931675f50ea43d3488785367322b4e", "overview" : {"en" : "Quantum Pay is a decentralized monetary facility platform which aims to deliver money transfers, game credits, hotel bookings, bill payments, mobile top-ups, online shopping and sending money anywhere in any international arena. It uses digital exchange as a small charge entrance to investment, lending, finance, funding, and banking, ranging the scope of financial institutions beyond their existing outlet infrastructure to the many who are unbanked in the world.", "zh" : "Quantum Pay\u662f\u4e00\u4e2a\u5206\u6563\u5f0f\u8d27\u5e01\u5e73\u53f0\uff0c\u65e8\u5728\u63d0\u4f9b\u8d44\u91d1\u8f6c\u79fb\uff0c\u6e38\u620f\u70b9\u6570\uff0c\u9152\u5e97\u9884\u8ba2\uff0c\u8d26\u5355\u652f\u4ed8\uff0c\u79fb\u52a8\u5145\u503c\uff0c\u7f51\u4e0a\u8d2d\u7269\u4ee5\u53ca\u5728\u4efb\u4f55\u56fd\u9645\u821e\u53f0\u4e0a\u7684\u4efb\u4f55\u5730\u65b9\u6c47\u6b3e\u3002\u5b83\u4f7f\u7528\u6570\u5b57\u4ea4\u6362\u4f5c\u4e3a\u6295\u8d44\uff0c\u8d37\u6b3e\uff0c\u878d\u8d44\uff0c\u878d\u8d44\u548c\u94f6\u884c\u4e1a\u52a1\u7684\u5c0f\u989d\u6536\u8d39\u5165\u53e3\uff0c\u5c06\u91d1\u878d\u673a\u6784\u7684\u8303\u56f4\u4ece\u73b0\u6709\u7684\u51fa\u53e3\u57fa\u7840\u8bbe\u65bd\u6269\u5c55\u5230\u4e16\u754c\u4e0a\u6ca1\u6709\u94f6\u884c\u8d26\u6237\u7684\u4eba\u7fa4\u3002"}, "email" : "contact@quantumpay.co", "website" : "https://quantumpay.co/", "whitepaper" : "https://quantumpay.co/QUANTUMPAYWP.pdf", "state" : "NORMAL", "published_on" : "2018-06-19", "initial_price" : {"ETH" : "0.00000007 ETH"}, "links" : {"twitter" : "https://twitter.com/Quantum_Pay", "telegram" : "https://t.me/quantumpayQPAY", "github" : "https://github.com/quantumpay", "facebook" : "https://www.facebook.com/QuantumPay/", "reddit" : "https://www.reddit.com/user/Quantum_Pay/", "medium" : "https://medium.com/@quantumpay"}} | json_instruct | {"type": "object", "properties": {"symbol": {"type": "string"}, "address": {"type": "string"}, "overview": {"type": "object", "properties": {"en": {"type": "string"}, "zh": {"type": "string"}}, "required": ["en", "zh"]}, "email": {"type": "string"}, "website": {"type": "string"}, "whitepaper": {"type": "string"}, "state": {"type": "string"}, "published_on": {"type": "string"}, "initial_price": {"type": "object", "properties": {"ETH": {"type": "string"}}, "required": ["ETH"]}, "links": {"type": "object", "properties": {"twitter": {"type": "string"}, "telegram": {"type": "string"}, "github": {"type": "string"}, "facebook": {"type": "string"}, "reddit": {"type": "string"}, "medium": {"type": "string"}}, "required": ["twitter", "telegram", "github", "facebook", "reddit", "medium"]}}, "required": ["symbol", "address", "overview", "email", "website", "whitepaper", "state", "published_on", "initial_price", "links"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"Servers": {"type": "array", "items": {"type": "object", "properties": {"Uri": {"type": "string"}, "MaxConnections": {"type": "integer"}}, "required": ["Uri", "MaxConnections"]}}, "Urls": {"type": "array", "items": {"type": "object", "properties": {"Url": {"type": "string"}, "HashPattern": {"type": "null"}, "Servers": {"type": "array", "items": {"type": "object", "properties": {"Url": {"type": "string"}, "Weight": {"type": "integer"}}, "required": ["Url", "Weight"]}}}, "required": ["Url", "HashPattern", "Servers"]}}}, "required": ["Servers", "Urls"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Servers" : [{"Uri" : "http://192.168.2.19:8080/", "MaxConnections" : 300}], "Urls" : [{"Url" : "*", "HashPattern" : null, "Servers" : [{"Url" : "http://192.168.2.19:8080/", "Weight" : 10}]}]} | json_instruct | {"type": "object", "properties": {"Servers": {"type": "array", "items": {"type": "object", "properties": {"Uri": {"type": "string"}, "MaxConnections": {"type": "integer"}}, "required": ["Uri", "MaxConnections"]}}, "Urls": {"type": "array", "items": {"type": "object", "properties": {"Url": {"type": "string"}, "HashPattern": {"type": "null"}, "Servers": {"type": "array", "items": {"type": "object", "properties": {"Url": {"type": "string"}, "Weight": {"type": "integer"}}, "required": ["Url", "Weight"]}}}, "required": ["Url", "HashPattern", "Servers"]}}}, "required": ["Servers", "Urls"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"AS_Button_f6f1b74972304c9b943200ff41641804": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "params": {"type": "array", "items": {"type": "object", "properties": {"datatype": {"type": "string"}, "name": {"type": "string"}}, "required": ["datatype", "name"]}}, "contextObj": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "platform": {"type": "string"}, "KUID": {"type": "string"}}, "required": ["name", "type", "platform", "KUID"]}, "language": {"type": "string"}, "actions": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "codeSnippet": {"type": "string"}, "parentId": {"type": "null"}, "callbackType": {"type": "null"}}, "required": ["id", "type", "codeSnippet", "parentId", "callbackType"]}}}, "required": ["id", "type", "params", "contextObj", "language", "actions"]}}, "required": ["AS_Button_f6f1b74972304c9b943200ff41641804"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"AS_Button_f6f1b74972304c9b943200ff41641804" : {"id" : "AS_Button_f6f1b74972304c9b943200ff41641804", "type" : "ACTION_SEQUENCE", "params" : [{"datatype" : "collection", "name" : "eventobject"}], "contextObj" : {"name" : "frmSwipe", "type" : "forms", "platform" : "", "KUID" : "aa8d0b6fcb494f0ca9bb4dd6da0f50a0"}, "language" : "js", "actions" : [{"id" : "ADD_SNIPPET__f9c06bc019e64d39afdb8616a2495b86", "type" : "ADD_SNIPPET", "codeSnippet" : "this.view.lblGesture.text=\"Verify Swipe gesture in four directions in below container\";\nthis.view.imgGes.src=\"arrow4.png\";", "parentId" : null, "callbackType" : null}]}} | json_instruct | {"type": "object", "properties": {"AS_Button_f6f1b74972304c9b943200ff41641804": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "params": {"type": "array", "items": {"type": "object", "properties": {"datatype": {"type": "string"}, "name": {"type": "string"}}, "required": ["datatype", "name"]}}, "contextObj": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "platform": {"type": "string"}, "KUID": {"type": "string"}}, "required": ["name", "type", "platform", "KUID"]}, "language": {"type": "string"}, "actions": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "codeSnippet": {"type": "string"}, "parentId": {"type": "null"}, "callbackType": {"type": "null"}}, "required": ["id", "type", "codeSnippet", "parentId", "callbackType"]}}}, "required": ["id", "type", "params", "contextObj", "language", "actions"]}}, "required": ["AS_Button_f6f1b74972304c9b943200ff41641804"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"routes": {"type": "array", "items": {"type": "object", "properties": {"method": {"type": "string"}, "path": {"type": "string"}, "handler": {"type": "string"}, "config": {"type": "object", "properties": {"policies": {"type": "array", "items": {}}}, "required": ["policies"]}}, "required": ["method", "path", "handler", "config"]}}}, "required": ["routes"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"routes" : [{"method" : "GET", "path" : "/plataformas", "handler" : "plataforma.find", "config" : {"policies" : []}}, {"method" : "GET", "path" : "/plataformas/count", "handler" : "plataforma.count", "config" : {"policies" : []}}, {"method" : "GET", "path" : "/plataformas/:id", "handler" : "plataforma.findOne", "config" : {"policies" : []}}, {"method" : "POST", "path" : "/plataformas", "handler" : "plataforma.create", "config" : {"policies" : []}}, {"method" : "PUT", "path" : "/plataformas/:id", "handler" : "plataforma.update", "config" : {"policies" : []}}, {"method" : "DELETE", "path" : "/plataformas/:id", "handler" : "plataforma.delete", "config" : {"policies" : []}}]} | json_instruct | {"type": "object", "properties": {"routes": {"type": "array", "items": {"type": "object", "properties": {"method": {"type": "string"}, "path": {"type": "string"}, "handler": {"type": "string"}, "config": {"type": "object", "properties": {"policies": {"type": "array", "items": {}}}, "required": ["policies"]}}, "required": ["method", "path", "handler", "config"]}}}, "required": ["routes"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"body" : "CLEAR, DISTINCT ONE OF SUBSTANCE ITSELF, WHICH IS THE FOUNDATION OF ALL THE REST, IS CONCEALED FROM US.", "next" : "https://raw.githubusercontent.com/CAPSELOCKE/CAPSELOCKE/master/tweets/14173.json"} | json_instruct | {"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"title": {"type": "string"}, "description": {"type": "string"}, "date": {"type": "string"}}, "required": ["title", "description", "date"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Edition #64", "description" : "", "date" : "2020-08-28T23:00:00+0000"} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "description": {"type": "string"}, "date": {"type": "string"}}, "required": ["title", "description", "date"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"IndexId": {"type": "integer"}, "Portraits": {"type": "array", "items": {"type": "object", "properties": {"PortraitId": {"type": "integer"}, "PortraitName": {"type": "string"}, "PortraitImageBase64": {"type": "string"}}, "required": ["PortraitId", "PortraitName", "PortraitImageBase64"]}}}, "required": ["IndexId", "Portraits"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"IndexId" : 439, "Portraits" : [{"PortraitId" : 0, "PortraitName" : "STANDARD", "PortraitImageBase64" : "iVBORw0KGgoAAAANSUhEUgAAACgAAAAoBAMAAAB+0KVeAAAAMFBMVEUA/wA1NUKPz8dQUGhkZHxjkrOwizbP57d3x9eNwN3aukWn5/rn97fEP0L///+v17e8PY2PAAACOklEQVQokW3RQWsaQRQA4PcXJrNTtA0IgYA3ecxGImkDy8wlkMsoUpeE5CB48A94CRQtC3qUjTSDpyLk4E1EyDLXQi5CD/0JQn9ASujRvtkkbaF9h2H3m/dmZ9+D4e/oi5cn+IPmfxiwfzHJMWHib+xr1qIzWqY1hEL5OaIoapX3C/ZGlMHEgzySIIrqg35srRlAJvbyiMIwqu8Za20/BjeuezM8R0E42QGX7VQqlX0upcb6Y9EORx6deXh4REnILh+LN3I0KUHsFtutoUSpGDdx2qlRpnRZ6Ye3EGXE4o+dWlKC2yMnfLGPkMXVHOftLC8mkqESzzjLxrmpUIcaq53D/iXMb2seuSeto1eEW5jPDyZcMlTaB8f20GyhO29POB6uAp+ohOJD8ROq81nCxdQZslC9uRZJ6QOk3VnCTqxbBVqFmMXYf98DKw8StGnsUBE2DsbmUw+ogWNhj+XU30FUNwvR6wE1q1Gwx93ain6BdzeLy/t7MKLJCWezM5TYeL1ZnF9dwVfFZNEef565lPEl4e56DV+oqmAvum2Xvfu2vN2kAaHvkLDp9yPn0qPs4ozj6RoCQrRWTp2PScZlsAatCOleJNe0QRfD0xyp3k7dXe3EZb61DLTvJRZIl9PYGYnUGKBE2kUxolznZ8ACBbT6ZGTNZtNwzB+BkeWDY4zRl2kNToEFkl6eRifxLXWVLq8ZI8IwH2d0vvYBqjBM+NPBOuS7T4juzqMIaMRRKF7QEWKTZhQIjTn+AmsHJa4tyyMZAAAAAElFTkSuQmCC"}]} | json_instruct | {"type": "object", "properties": {"IndexId": {"type": "integer"}, "Portraits": {"type": "array", "items": {"type": "object", "properties": {"PortraitId": {"type": "integer"}, "PortraitName": {"type": "string"}, "PortraitImageBase64": {"type": "string"}}, "required": ["PortraitId", "PortraitName", "PortraitImageBase64"]}}}, "required": ["IndexId", "Portraits"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"express": {"type": "string"}, "body-parser": {"type": "string"}, "jsonschema": {"type": "string"}}, "required": ["express", "body-parser", "jsonschema"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "mock-osb", "version" : "2.3.1", "description" : "A mock Open Service Broker API implementation", "main" : "mockOSB.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "keywords" : ["OSB"], "author" : "Haishi", "license" : "MIT", "dependencies" : {"express" : "^4.16.1", "body-parser" : "^1.18.2", "jsonschema" : "^1.2.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"express": {"type": "string"}, "body-parser": {"type": "string"}, "jsonschema": {"type": "string"}}, "required": ["express", "body-parser", "jsonschema"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"builtin": {"type": "object", "properties": {"__set__": {"type": "boolean"}, "elements": {"type": "array", "items": {"type": "string"}}}, "required": ["__set__", "elements"]}, "required": {"type": "object", "properties": {"__set__": {"type": "boolean"}, "elements": {"type": "array", "items": {"type": "string"}}}, "required": ["__set__", "elements"]}}, "required": ["builtin", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"builtin" : {"__set__" : true, "elements" : ["__future__", "pprint", "re"]}, "required" : {"__set__" : true, "elements" : ["argo", "setuptools", "six"]}} | json_instruct | {"type": "object", "properties": {"builtin": {"type": "object", "properties": {"__set__": {"type": "boolean"}, "elements": {"type": "array", "items": {"type": "string"}}}, "required": ["__set__", "elements"]}, "required": {"type": "object", "properties": {"__set__": {"type": "boolean"}, "elements": {"type": "array", "items": {"type": "string"}}}, "required": ["__set__", "elements"]}}, "required": ["builtin", "required"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"requires": {"type": "boolean"}, "lockfileVersion": {"type": "integer"}, "dependencies": {"type": "object", "properties": {"classnames": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}}, "required": ["version", "resolved", "integrity"]}, "core-js": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}}, "required": ["version", "resolved", "integrity"]}, "feather-icons": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}, "requires": {"type": "object", "properties": {"classnames": {"type": "string"}, "core-js": {"type": "string"}}, "required": ["classnames", "core-js"]}}, "required": ["version", "resolved", "integrity", "requires"]}}, "required": ["classnames", "core-js", "feather-icons"]}}, "required": ["requires", "lockfileVersion", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"requires" : true, "lockfileVersion" : 1, "dependencies" : {"classnames" : {"version" : "2.2.6", "resolved" : "https://registry.npmjs.org/classnames/-/classnames-2.2.6.tgz", "integrity" : "sha512-JR/iSQOSt+LQIWwrwEzJ9uk0xfN3mTVYMwt1Ir5mUcSN6pU+V4zQFFaJsclJbPuAUQH+yfWef6tm7l1quW3C8Q=="}, "core-js" : {"version" : "3.1.4", "resolved" : "https://registry.npmjs.org/core-js/-/core-js-3.1.4.tgz", "integrity" : "sha512-YNZN8lt82XIMLnLirj9MhKDFZHalwzzrL9YLt6eb0T5D0EDl4IQ90IGkua8mHbnxNrkj1d8hbdizMc0Qmg1WnQ=="}, "feather-icons" : {"version" : "4.24.0", "resolved" : "https://registry.npmjs.org/feather-icons/-/feather-icons-4.24.0.tgz", "integrity" : "sha512-1FdY6lVcCUjWOdHj8PuCdNTSAY1wrXoBdgQBaxftS0r8SDj9pMAcl7zDxz7W9uqsO663f4MQZYBWGOmUL+pUjg==", "requires" : {"classnames" : "2.2.6", "core-js" : "3.1.4"}}}} | json_instruct | {"type": "object", "properties": {"requires": {"type": "boolean"}, "lockfileVersion": {"type": "integer"}, "dependencies": {"type": "object", "properties": {"classnames": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}}, "required": ["version", "resolved", "integrity"]}, "core-js": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}}, "required": ["version", "resolved", "integrity"]}, "feather-icons": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}, "requires": {"type": "object", "properties": {"classnames": {"type": "string"}, "core-js": {"type": "string"}}, "required": ["classnames", "core-js"]}}, "required": ["version", "resolved", "integrity", "requires"]}}, "required": ["classnames", "core-js", "feather-icons"]}}, "required": ["requires", "lockfileVersion", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"xmin": {"type": "array", "items": {"type": "integer"}}, "xmax": {"type": "array", "items": {"type": "integer"}}, "ymin": {"type": "array", "items": {"type": "integer"}}, "ymax": {"type": "array", "items": {"type": "integer"}}}, "required": ["xmin", "xmax", "ymin", "ymax"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"xmin" : [845, 771, 492, 566, 541], "xmax" : [886, 804, 523, 610, 591], "ymin" : [771, 238, 754, 319, 841], "ymax" : [804, 304, 800, 344, 878]} | json_instruct | {"type": "object", "properties": {"xmin": {"type": "array", "items": {"type": "integer"}}, "xmax": {"type": "array", "items": {"type": "integer"}}, "ymin": {"type": "array", "items": {"type": "integer"}}, "ymax": {"type": "array", "items": {"type": "integer"}}}, "required": ["xmin", "xmax", "ymin", "ymax"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.