input
stringlengths
159
2.05k
output
stringlengths
5
10.3k
task
stringclasses
1 value
schema
stringlengths
100
1.99k
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"data": {"type": "object", "properties": {"site": {"type": "object", "properties": {"siteMetadata": {"type": "object", "properties": {"disqusShortname": {"type": "string"}, "url": {"type": "string"}}, "required": ["disqusShortname", "url"]}}, "required": ["siteMetadata"]}}, "required": ["site"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"data" : {"site" : {"siteMetadata" : {"disqusShortname" : "", "url" : "https://mmugisha.com"}}}}
json_instruct
{"type": "object", "properties": {"data": {"type": "object", "properties": {"site": {"type": "object", "properties": {"siteMetadata": {"type": "object", "properties": {"disqusShortname": {"type": "string"}, "url": {"type": "string"}}, "required": ["disqusShortname", "url"]}}, "required": ["siteMetadata"]}}, "required": ["site"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "build": {"type": "string"}, "build-dev": {"type": "string"}, "build-dev-watch": {"type": "string"}, "build-all": {"type": "string"}}, "required": ["test", "build", "build-dev", "build-dev-watch", "build-all"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"babel-cli": {"type": "string"}, "babel-plugin-transform-class-properties": {"type": "string"}, "babel-plugin-transform-export-extensions": {"type": "string"}, "babel-plugin-transform-object-rest-spread": {"type": "string"}, "babel-preset-env": {"type": "string"}, "babel-preset-react": {"type": "string"}}, "required": ["babel-cli", "babel-plugin-transform-class-properties", "babel-plugin-transform-export-extensions", "babel-plugin-transform-object-rest-spread", "babel-preset-env", "babel-preset-react"]}, "dependencies": {"type": "object", "properties": {"prop-types": {"type": "string"}, "smart-input-validator": {"type": "string"}}, "required": ["prop-types", "smart-input-validator"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "react-dom-input-fields", "version" : "1.0.0", "description" : "ReactJS Library for user input fields (form fields) made especially for web views.", "main" : "src/index.js", "scripts" : {"test" : "jest", "build" : "rm -rf build && babel src --out-dir build", "build-dev" : "rm -rf dev/src/build && babel src --out-dir dev/src/build", "build-dev-watch" : "rm -rf dev/src/build && babel src --out-dir dev/src/build --watch", "build-all" : "npm run build && npm run build-dev"}, "repository" : {"type" : "git", "url" : "git+https://github.com/aprilmintacpineda/react-dom-input-fields.git"}, "keywords" : ["react-js", "react", "forms", "user", "input", "form", "fields", "web", "forms"], "author" : "April Mintac Pineda", "license" : "MIT", "bugs" : {"url" : "https://github.com/aprilmintacpineda/react-dom-input-fields/issues"}, "homepage" : "https://github.com/aprilmintacpineda/react-dom-input-fields#readme", "devDependencies" : {"babel-cli" : "^6.26.0", "babel-plugin-transform-class-properties" : "^6.24.1", "babel-plugin-transform-export-extensions" : "^6.22.0", "babel-plugin-transform-object-rest-spread" : "^6.26.0", "babel-preset-env" : "^1.6.1", "babel-preset-react" : "^6.24.1"}, "dependencies" : {"prop-types" : "^15.6.1", "smart-input-validator" : "^1.1.8"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "build": {"type": "string"}, "build-dev": {"type": "string"}, "build-dev-watch": {"type": "string"}, "build-all": {"type": "string"}}, "required": ["test", "build", "build-dev", "build-dev-watch", "build-all"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"babel-cli": {"type": "string"}, "babel-plugin-transform-class-properties": {"type": "string"}, "babel-plugin-transform-export-extensions": {"type": "string"}, "babel-plugin-transform-object-rest-spread": {"type": "string"}, "babel-preset-env": {"type": "string"}, "babel-preset-react": {"type": "string"}}, "required": ["babel-cli", "babel-plugin-transform-class-properties", "babel-plugin-transform-export-extensions", "babel-plugin-transform-object-rest-spread", "babel-preset-env", "babel-preset-react"]}, "dependencies": {"type": "object", "properties": {"prop-types": {"type": "string"}, "smart-input-validator": {"type": "string"}}, "required": ["prop-types", "smart-input-validator"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "database": {"type": "string"}}, "required": ["start", "database"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"express": {"type": "string"}, "nunjucks": {"type": "string"}, "sqlite3": {"type": "string"}}, "required": ["express", "nunjucks", "sqlite3"]}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}}, "required": ["nodemon"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "NLW1-Ecoleta-Starter", "version" : "1.0.0", "description" : "Project developed during rocketseat's Next Level Week #1 Starter track.", "main" : "src/server.js", "scripts" : {"start" : "nodemon src/server.js", "database" : "node src/database/db.js"}, "keywords" : [], "author" : "Murilo Santos", "license" : "MIT", "dependencies" : {"express" : "^4.17.1", "nunjucks" : "^3.2.3", "sqlite3" : "^5.0.2"}, "devDependencies" : {"nodemon" : "^2.0.7"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "database": {"type": "string"}}, "required": ["start", "database"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"express": {"type": "string"}, "nunjucks": {"type": "string"}, "sqlite3": {"type": "string"}}, "required": ["express", "nunjucks", "sqlite3"]}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}}, "required": ["nodemon"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"autolispext.loadlisp.tooltip": {"type": "string"}, "autolispext.loadlisp.title": {"type": "string"}, "autolispext.loadlisp.attach": {"type": "string"}, "autolispext.loadlisp.fileformat.win": {"type": "string"}, "autolispext.loadlisp.fileformat.mac": {"type": "string"}}, "required": ["autolispext.loadlisp.tooltip", "autolispext.loadlisp.title", "autolispext.loadlisp.attach", "autolispext.loadlisp.fileformat.win", "autolispext.loadlisp.fileformat.mac"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"autolispext.loadlisp.tooltip" : "Carregar o arquivo atual", "autolispext.loadlisp.title" : "Carregar lisp", "autolispext.loadlisp.attach" : "Primeiro, anexe ou inicie um aplicativo host antes de carregar este arquivo.", "autolispext.loadlisp.fileformat.win" : "Esse formato de arquivo n\u00e3o \u00e9 suportado. Ative uma janela contendo um arquivo DCL, LSP ou MNL.", "autolispext.loadlisp.fileformat.mac" : "Esse formato de arquivo n\u00e3o \u00e9 suportado. Ative uma janela contendo um arquivo DCL ou LSP."}
json_instruct
{"type": "object", "properties": {"autolispext.loadlisp.tooltip": {"type": "string"}, "autolispext.loadlisp.title": {"type": "string"}, "autolispext.loadlisp.attach": {"type": "string"}, "autolispext.loadlisp.fileformat.win": {"type": "string"}, "autolispext.loadlisp.fileformat.mac": {"type": "string"}}, "required": ["autolispext.loadlisp.tooltip", "autolispext.loadlisp.title", "autolispext.loadlisp.attach", "autolispext.loadlisp.fileformat.win", "autolispext.loadlisp.fileformat.mac"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"componentChunkName": {"type": "string"}, "path": {"type": "string"}, "result": {"type": "object", "properties": {"pageContext": {"type": "object", "properties": {}, "required": []}}, "required": ["pageContext"]}}, "required": ["componentChunkName", "path", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"componentChunkName" : "component---src-pages-survey-roleplay-js", "path" : "/survey/roleplay/", "result" : {"pageContext" : {}}}
json_instruct
{"type": "object", "properties": {"componentChunkName": {"type": "string"}, "path": {"type": "string"}, "result": {"type": "object", "properties": {"pageContext": {"type": "object", "properties": {}, "required": []}}, "required": ["pageContext"]}}, "required": ["componentChunkName", "path", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"82460": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82465": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82463": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82461": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82462": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82464": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82466": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}}, "required": ["82460", "82465", "82463", "82461", "82462", "82464", "82466"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"82460" : {"nama" : "DEMBEK", "dapil" : [92, 9201, 19201, 2921103]}, "82465" : {"nama" : "DEMINI", "dapil" : [92, 9201, 19201, 2921103]}, "82463" : {"nama" : "GAYA BARU", "dapil" : [92, 9201, 19201, 2921103]}, "82461" : {"nama" : "NIJ", "dapil" : [92, 9201, 19201, 2921103]}, "82462" : {"nama" : "SIWI", "dapil" : [92, 9201, 19201, 2921103]}, "82464" : {"nama" : "WAREN", "dapil" : [92, 9201, 19201, 2921103]}, "82466" : {"nama" : "YEKWANDI", "dapil" : [92, 9201, 19201, 2921103]}}
json_instruct
{"type": "object", "properties": {"82460": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82465": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82463": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82461": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82462": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82464": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "82466": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}}, "required": ["82460", "82465", "82463", "82461", "82462", "82464", "82466"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"epoch": {"type": "integer"}, "loss_trn": {"type": "number"}, "loss_val": {"type": "number"}, "acc_val": {"type": "number"}, "lwlrap_val": {"type": "number"}, "_step": {"type": "integer"}, "_runtime": {"type": "integer"}, "_timestamp": {"type": "integer"}}, "required": ["epoch", "loss_trn", "loss_val", "acc_val", "lwlrap_val", "_step", "_runtime", "_timestamp"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"epoch" : 4, "loss_trn" : 0.23491232097148895, "loss_val" : 0.31316709021727246, "acc_val" : 0.08333333333333333, "lwlrap_val" : 0.16737894962231317, "_step" : 3, "_runtime" : 14, "_timestamp" : 1612574963}
json_instruct
{"type": "object", "properties": {"epoch": {"type": "integer"}, "loss_trn": {"type": "number"}, "loss_val": {"type": "number"}, "acc_val": {"type": "number"}, "lwlrap_val": {"type": "number"}, "_step": {"type": "integer"}, "_runtime": {"type": "integer"}, "_timestamp": {"type": "integer"}}, "required": ["epoch", "loss_trn", "loss_val", "acc_val", "lwlrap_val", "_step", "_runtime", "_timestamp"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
[[1894, 5], [1902, 5], [1905, 7], [1910, 7], [1911, 5], [1912, 7], [1913, 7], [1914, 15], [1915, 22], [1916, 15], [1917, 14], [1918, 18], [1919, 20], [1920, 18], [1921, 16], [1922, 18], [1923, 21], [1924, 22], [1925, 12], [1926, 14], [1927, 12], [1928, 18], [1929, 23], [1930, 12], [1931, 11], [1932, 7], [1933, 16], [1935, 13], [1936, 6], [1937, 10], [1938, 9], [1939, 11], [1940, 10], [1941, 5], [1942, 10], [1943, 6], [1945, 16], [1946, 7], [1947, 11], [1948, 6], [1949, 8], [1950, 12], [1951, 7], [1952, 11], [1954, 11], [1956, 13], [1957, 12], [1958, 7], [1959, 7], [1960, 11], [1961, 5], [1962, 12], [1963, 10], [1964, 10], [1965, 11], [1966, 5], [1967, 9], [1968, 11], [1969, 14], [1970, 16], [1971, 17], [1972, 15], [1973, 11], [1974, 11], [1975, 8], [1976, 16], [1977, 11], [1978, 16], [1979, 15], [1980, 15], [1981, 14], [1982, 22], [1983, 15], [1984, 19], [1985, 17], [1986, 14], [1987, 23], [1988, 17], [1989, 19], [1990, 38], [1991, 31], [1992, 23], [1993, 25], [1994, 42], [1995, 33], [1996, 28], [1997, 36], [1998, 26], [1999, 24], [2000, 19], [2001, 19], [2002, 39], [2003, 30], [2004, 19], [2005, 24], [2006, 23], [2007, 37], [2008, 28], [2009, 33], [2010, 37], [2011, 32], [2012, 66], [2013, 79], [2014, 42]]
json_instruct
{"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
["abacus-usage-accumulator", "abacus-usage-aggregator", "abacus-usage-collector", "abacus-usage-reporting", "cf-abacus"]
json_instruct
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"type": {"type": "string"}, "comment": {"type": "string"}, "packageName": {"type": "string"}, "email": {"type": "string"}, "dependentChangeType": {"type": "string"}}, "required": ["type", "comment", "packageName", "email", "dependentChangeType"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "patch", "comment" : "remove scrollablepane detailslist example, add best practices on interactive sticky content", "packageName" : "@fluentui/react-examples", "email" : "sarah.higley@microsoft.com", "dependentChangeType" : "patch"}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "comment": {"type": "string"}, "packageName": {"type": "string"}, "email": {"type": "string"}, "dependentChangeType": {"type": "string"}}, "required": ["type", "comment", "packageName", "email", "dependentChangeType"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "state": {"type": "string"}, "details": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "provider": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "client": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "creation": {"type": "string"}, "expiration": {"type": "string"}, "guarantees": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "constraint": {"type": "string"}}, "required": ["name", "constraint"]}}}, "required": ["id", "type", "name", "provider", "client", "creation", "expiration", "guarantees"]}}, "required": ["id", "name", "state", "details"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "template_id", "name" : "Template 01", "state" : "started", "details" : {"id" : "template_id", "type" : "template", "name" : "service_name", "provider" : {"id" : "mf2c", "name" : "mF2C Platform"}, "client" : {"id" : "{{.user}}", "name" : "{{.user}}"}, "creation" : "2018-01-16T17:09:45.01Z", "expiration" : "2020-01-16T17:09:45.01Z", "guarantees" : [{"name" : "es.bsc.compss.agent.test.Test.main", "constraint" : "execution_time < 1000"}]}}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "state": {"type": "string"}, "details": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "provider": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "client": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "creation": {"type": "string"}, "expiration": {"type": "string"}, "guarantees": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "constraint": {"type": "string"}}, "required": ["name", "constraint"]}}}, "required": ["id", "type", "name", "provider", "client", "creation", "expiration", "guarantees"]}}, "required": ["id", "name", "state", "details"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"deps": {"type": "string"}, "test": {"type": "string"}, "test:cov": {"type": "string"}}, "required": ["deps", "test", "test:cov"]}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"nanologger": {"type": "string"}, "on-idle": {"type": "string"}, "on-performance": {"type": "string"}}, "required": ["nanologger", "on-idle", "on-performance"]}, "devDependencies": {"type": "object", "properties": {"choo": {"type": "string"}, "dependency-check": {"type": "string"}, "istanbul": {"type": "string"}, "standard": {"type": "string"}, "tape": {"type": "string"}}, "required": ["choo", "dependency-check", "istanbul", "standard", "tape"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "choo-log", "version" : "8.0.0", "description" : "Development logger for choo", "main" : "index.js", "scripts" : {"deps" : "dependency-check . && dependency-check . --extra --no-dev", "test" : "standard && npm run deps", "test:cov" : "standard && npm run deps"}, "repository" : "yoshuawuyts/choo-log", "keywords" : ["choo", "log", "tcby", "yo-yo", "fast", "browser", "hah"], "license" : "MIT", "dependencies" : {"nanologger" : "^1.3.0", "on-idle" : "^3.0.2", "on-performance" : "^1.0.0"}, "devDependencies" : {"choo" : "^5.0.0", "dependency-check" : "^2.5.2", "istanbul" : "^0.4.4", "standard" : "^9.0.2", "tape" : "^4.6.0"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"deps": {"type": "string"}, "test": {"type": "string"}, "test:cov": {"type": "string"}}, "required": ["deps", "test", "test:cov"]}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"nanologger": {"type": "string"}, "on-idle": {"type": "string"}, "on-performance": {"type": "string"}}, "required": ["nanologger", "on-idle", "on-performance"]}, "devDependencies": {"type": "object", "properties": {"choo": {"type": "string"}, "dependency-check": {"type": "string"}, "istanbul": {"type": "string"}, "standard": {"type": "string"}, "tape": {"type": "string"}}, "required": ["choo", "dependency-check", "istanbul", "standard", "tape"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "msg": {"type": "integer"}}, "required": ["id", "msg"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : "6283154964401@c.us", "msg" : 1}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "msg": {"type": "integer"}}, "required": ["id", "msg"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "array", "items": {"type": "number"}, "$schema": "http://json-schema.org/draft-07/schema#"}
[1.0, 3.0, 3.0, 4.0, 1.0, 4.0, 2.0, 4.0, 4.0, 2.0, 3.0, 4.0, 0.0, 3.0, 0.0, 0.0, 3.0, 0.0, 2.0, 2.0, 0.0, 3.0, 1.0, 0.0, 0.0, 1.0, 0.0, 2.0, 0.0, 0.0, 0.0, 1.0, 0.0, 1.0, 1.0, 0.0, 0.0, 1.0, 1.0, 0.0]
json_instruct
{"type": "array", "items": {"type": "number"}, "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"type": {"type": "string"}, "id": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "opening_hours": {"type": "string"}, "phone": {"type": "string"}, "shop": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "opening_hours", "phone", "shop", "id"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}}, "required": ["type", "id", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "id" : "node/4860305893", "properties" : {"name" : "Steffens \"Naturg\u00e4rtchen\"", "opening_hours" : "Mo-Fr 09:00-13:00,14:30-18:00; Sa 09:00-13:00", "phone" : "+49 2162 34422", "shop" : "farm", "id" : "node/4860305893"}, "geometry" : {"type" : "Point", "coordinates" : [6.4100499, 51.233295]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "id": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "opening_hours": {"type": "string"}, "phone": {"type": "string"}, "shop": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "opening_hours", "phone", "shop", "id"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}}, "required": ["type", "id", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"$schema": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"agencyCode": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}, "maxLength": {"type": "integer"}}, "required": ["description", "type", "maxLength"]}, "description": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}, "maxLength": {"type": "integer"}}, "required": ["description", "type", "maxLength"]}}, "required": ["agencyCode", "description"]}, "additionalProperties": {"type": "boolean"}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "description", "type", "properties", "additionalProperties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"$schema" : "http://json-schema.org/draft-04/schema#", "description" : "Agency details", "type" : "object", "properties" : {"agencyCode" : {"description" : "Agency code", "type" : "string", "maxLength" : 5}, "description" : {"description" : "Agency description", "type" : "string", "maxLength" : 128}}, "additionalProperties" : false, "required" : ["agencyCode", "description"]}
json_instruct
{"type": "object", "properties": {"$schema": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"agencyCode": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}, "maxLength": {"type": "integer"}}, "required": ["description", "type", "maxLength"]}, "description": {"type": "object", "properties": {"description": {"type": "string"}, "type": {"type": "string"}, "maxLength": {"type": "integer"}}, "required": ["description", "type", "maxLength"]}}, "required": ["agencyCode", "description"]}, "additionalProperties": {"type": "boolean"}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "description", "type", "properties", "additionalProperties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"IsRecentlyVerified": {"type": "boolean"}, "ID": {"type": "integer"}, "UUID": {"type": "string"}, "DataProviderID": {"type": "integer"}, "OperatorID": {"type": "integer"}, "UsageTypeID": {"type": "integer"}, "AddressInfo": {"type": "object", "properties": {"ID": {"type": "integer"}, "Title": {"type": "string"}, "AddressLine1": {"type": "string"}, "Town": {"type": "string"}, "StateOrProvince": {"type": "string"}, "Postcode": {"type": "string"}, "CountryID": {"type": "integer"}, "Latitude": {"type": "number"}, "Longitude": {"type": "number"}, "AccessComments": {"type": "string"}, "RelatedURL": {"type": "string"}, "DistanceUnit": {"type": "integer"}}, "required": ["ID", "Title", "AddressLine1", "Town", "StateOrProvince", "Postcode", "CountryID", "Latitude", "Longitude", "AccessComments", "RelatedURL", "DistanceUnit"]}, "Connections": {"type": "array", "items": {"type": "object", "properties": {"ID": {"type": "integer"}, "ConnectionTypeID": {"type": "integer"}, "StatusTypeID": {"type": "integer"}, "LevelID": {"type": "integer"}, "Amps": {"type": "integer"}, "Voltage": {"type": "integer"}, "PowerKW": {"type": "integer"}, "CurrentTypeID": {"type": "integer"}, "Quantity": {"type": "integer"}}, "required": ["ID", "ConnectionTypeID", "StatusTypeID", "LevelID", "Amps", "Voltage", "PowerKW", "CurrentTypeID", "Quantity"]}}, "NumberOfPoints": {"type": "integer"}, "StatusTypeID": {"type": "integer"}, "DateLastStatusUpdate": {"type": "string"}, "DataQualityLevel": {"type": "integer"}, "DateCreated": {"type": "string"}, "SubmissionStatusTypeID": {"type": "integer"}}, "required": ["IsRecentlyVerified", "ID", "UUID", "DataProviderID", "OperatorID", "UsageTypeID", "AddressInfo", "Connections", "NumberOfPoints", "StatusTypeID", "DateLastStatusUpdate", "DataQualityLevel", "DateCreated", "SubmissionStatusTypeID"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"IsRecentlyVerified" : false, "ID" : 87426, "UUID" : "BFC6E74D-E1F3-4E4B-B1C3-5AB38E8E428C", "DataProviderID" : 1, "OperatorID" : 45, "UsageTypeID" : 1, "AddressInfo" : {"ID" : 87772, "Title" : "Festspielhaus", "AddressLine1" : "Lange Stra\u00dfe 77", "Town" : "Baden-Baden", "StateOrProvince" : "Baden-Baden", "Postcode" : "76530", "CountryID" : 87, "Latitude" : 48.7671375856966, "Longitude" : 8.232616923278794, "AccessComments" : "Kostenlos laden im Parkhaus des Festspielhauses.", "RelatedURL" : "http://www.stadtwerke-baden-baden.de/", "DistanceUnit" : 0}, "Connections" : [{"ID" : 123936, "ConnectionTypeID" : 25, "StatusTypeID" : 50, "LevelID" : 2, "Amps" : 32, "Voltage" : 400, "PowerKW" : 22, "CurrentTypeID" : 20, "Quantity" : 1}], "NumberOfPoints" : 1, "StatusTypeID" : 50, "DateLastStatusUpdate" : "2017-05-08T06:43:00Z", "DataQualityLevel" : 1, "DateCreated" : "2017-05-08T06:43:00Z", "SubmissionStatusTypeID" : 200}
json_instruct
{"type": "object", "properties": {"IsRecentlyVerified": {"type": "boolean"}, "ID": {"type": "integer"}, "UUID": {"type": "string"}, "DataProviderID": {"type": "integer"}, "OperatorID": {"type": "integer"}, "UsageTypeID": {"type": "integer"}, "AddressInfo": {"type": "object", "properties": {"ID": {"type": "integer"}, "Title": {"type": "string"}, "AddressLine1": {"type": "string"}, "Town": {"type": "string"}, "StateOrProvince": {"type": "string"}, "Postcode": {"type": "string"}, "CountryID": {"type": "integer"}, "Latitude": {"type": "number"}, "Longitude": {"type": "number"}, "AccessComments": {"type": "string"}, "RelatedURL": {"type": "string"}, "DistanceUnit": {"type": "integer"}}, "required": ["ID", "Title", "AddressLine1", "Town", "StateOrProvince", "Postcode", "CountryID", "Latitude", "Longitude", "AccessComments", "RelatedURL", "DistanceUnit"]}, "Connections": {"type": "array", "items": {"type": "object", "properties": {"ID": {"type": "integer"}, "ConnectionTypeID": {"type": "integer"}, "StatusTypeID": {"type": "integer"}, "LevelID": {"type": "integer"}, "Amps": {"type": "integer"}, "Voltage": {"type": "integer"}, "PowerKW": {"type": "integer"}, "CurrentTypeID": {"type": "integer"}, "Quantity": {"type": "integer"}}, "required": ["ID", "ConnectionTypeID", "StatusTypeID", "LevelID", "Amps", "Voltage", "PowerKW", "CurrentTypeID", "Quantity"]}}, "NumberOfPoints": {"type": "integer"}, "StatusTypeID": {"type": "integer"}, "DateLastStatusUpdate": {"type": "string"}, "DataQualityLevel": {"type": "integer"}, "DateCreated": {"type": "string"}, "SubmissionStatusTypeID": {"type": "integer"}}, "required": ["IsRecentlyVerified", "ID", "UUID", "DataProviderID", "OperatorID", "UsageTypeID", "AddressInfo", "Connections", "NumberOfPoints", "StatusTypeID", "DateLastStatusUpdate", "DataQualityLevel", "DateCreated", "SubmissionStatusTypeID"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"pretest": {"type": "string"}, "test": {"type": "string"}}, "required": ["pretest", "test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"ffi": {"type": "string"}, "ref": {"type": "string"}, "ref-array": {"type": "string"}, "ref-struct": {"type": "string"}, "ref-union": {"type": "string"}}, "required": ["ffi", "ref", "ref-array", "ref-struct", "ref-union"]}, "devDependencies": {"type": "object", "properties": {"bindings": {"type": "string"}, "mocha": {"type": "string"}, "mocha-junit-reporter": {"type": "string"}, "nan": {"type": "string"}}, "required": ["bindings", "mocha", "mocha-junit-reporter", "nan"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@codenstein/twain-js", "version" : "0.0.2", "description" : "A JavaScript interface for TWAIN.", "main" : "lib/twainh.js", "scripts" : {"pretest" : "node-gyp rebuild --directory test", "test" : "node node_modules/mocha/bin/mocha -gc --reporter mocha-junit-reporter"}, "repository" : {"type" : "git", "url" : "git+https://github.com/codenstein/twain-js.git"}, "keywords" : ["twain", "struct", "ref", "c", "c++", "ffi"], "author" : "Martin Grossi <martin.grossi@enlightenedmouse.com>", "license" : "MIT", "bugs" : {"url" : "https://github.com/codenstein/twain-js/issues"}, "homepage" : "https://github.com/codenstein/twain-js#readme", "dependencies" : {"ffi" : "^2.3.0", "ref" : "^1.3.5", "ref-array" : "^1.2.0", "ref-struct" : "github:enlightenedmouse/ref-struct", "ref-union" : "^1.0.1"}, "devDependencies" : {"bindings" : "^1.4.0", "mocha" : "^5.2.0", "mocha-junit-reporter" : "^1.18.0", "nan" : "^2.12.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"pretest": {"type": "string"}, "test": {"type": "string"}}, "required": ["pretest", "test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"ffi": {"type": "string"}, "ref": {"type": "string"}, "ref-array": {"type": "string"}, "ref-struct": {"type": "string"}, "ref-union": {"type": "string"}}, "required": ["ffi", "ref", "ref-array", "ref-struct", "ref-union"]}, "devDependencies": {"type": "object", "properties": {"bindings": {"type": "string"}, "mocha": {"type": "string"}, "mocha-junit-reporter": {"type": "string"}, "nan": {"type": "string"}}, "required": ["bindings", "mocha", "mocha-junit-reporter", "nan"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-97.8076, 37.474184], [-97.486689, 37.475345], [-97.369186, 37.477276], [-97.322833, 37.47662], [-97.321083, 37.417982], [-97.32599, 37.395653], [-97.321287, 37.366195], [-97.322136, 37.345672], [-97.324188, 37.341409], [-97.331865, 37.333673], [-97.420972, 37.332212], [-97.457065, 37.332664], [-97.475834, 37.33114], [-97.475816, 37.24416], [-97.583727, 37.242825], [-97.602824, 37.241865], [-97.674315, 37.241948], [-97.674278, 37.229299], [-97.677806, 37.231029], [-97.678351, 37.233093], [-97.680384, 37.23465], [-97.678608, 37.23758], [-97.678722, 37.242227], [-97.68001, 37.24502], [-97.685023, 37.250021], [-97.691438, 37.253453], [-97.694388, 37.251827], [-97.694213, 37.247745], [-97.695959, 37.242663], [-97.695844, 37.238359], [-97.70552, 37.225584], [-97.709786, 37.227942], [-97.711189, 37.22991], [-97.711677, 37.234718], [-97.716203, 37.23957], [-97.728117, 37.246229], [-97.731237, 37.245129], [-97.732864, 37.235055], [-97.734723, 37.232559], [-97.739417, 37.23052], [-97.741594, 37.231618], [-97.746776, 37.232165], [-97.752247, 37.235505], [-97.754105, 37.239672], [-97.763201, 37.245585], [-97.769353, 37.246711], [-97.775746, 37.246778], [-97.781759, 37.248748], [-97.78328, 37.250392], [-97.785284, 37.257554], [-97.788235, 37.262543], [-97.796137, 37.265524], [-97.798598, 37.267591], [-97.797852, 37.270229], [-97.801203, 37.271008], [-97.802936, 37.273095], [-97.804566, 37.386298], [-97.807057, 37.386293], [-97.8076, 37.474184]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 26359}}]}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"h": {"type": "string"}, "c": {"type": "object", "properties": {"pages/contact": {"type": "boolean"}}, "required": ["pages/contact"]}}, "required": ["h", "c"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"h" : "31193404e6e47440c644", "c" : {"pages/contact" : true}}
json_instruct
{"type": "object", "properties": {"h": {"type": "string"}, "c": {"type": "object", "properties": {"pages/contact": {"type": "boolean"}}, "required": ["pages/contact"]}}, "required": ["h", "c"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"version": {"type": "string"}, "configurations": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "request": {"type": "string"}, "name": {"type": "string"}, "url": {"type": "string"}, "webRoot": {"type": "string"}}, "required": ["type", "request", "name", "url", "webRoot"]}}}, "required": ["version", "configurations"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"version" : "0.2.0", "configurations" : [{"type" : "pwa-chrome", "request" : "launch", "name" : "Chrome Debug", "url" : "https://<TOFILL>.288dev.com/?use-dev=yes&livereload=yes", "webRoot" : "${workspaceFolder}/web"}]}
json_instruct
{"type": "object", "properties": {"version": {"type": "string"}, "configurations": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "request": {"type": "string"}, "name": {"type": "string"}, "url": {"type": "string"}, "webRoot": {"type": "string"}}, "required": ["type", "request", "name", "url", "webRoot"]}}}, "required": ["version", "configurations"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "start": {"type": "string"}, "end": {"type": "string"}}, "required": ["id", "type", "start", "end"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "violet-forfex__DROPS__pristine-pincer", "type" : "DROPS", "start" : "violet-forfex", "end" : "pristine-pincer"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "start": {"type": "string"}, "end": {"type": "string"}}, "required": ["id", "type", "start", "end"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"superagent.js": {"type": "string"}, "superagent.min.js": {"type": "string"}}, "required": ["superagent.js", "superagent.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"superagent.js" : "sha512-7zDJ8A1CVZORSfBNKwMCcvAv//QqSnmiulFgqW0HuxX4MJB+MxTV3X7sIehULohCTszgPI7Ur6OPzsF5E5vaXg==", "superagent.min.js" : "sha512-c9gsqsNuEvQtxmvGSb4bBEP0lLl6fZy/X9DEdj20Bncyvm/8vtHh8Qt/B/Ff8YFwWBeI3GHgt4abQCoZcGqi4g=="}
json_instruct
{"type": "object", "properties": {"superagent.js": {"type": "string"}, "superagent.min.js": {"type": "string"}}, "required": ["superagent.js", "superagent.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"address": {"type": "string"}, "cert_auth_type": {"type": "string"}, "cert_sign": {"type": "string"}, "cert_user_id": {"type": "string"}, "files": {"type": "object", "properties": {"data.json": {"type": "object", "properties": {"sha512": {"type": "string"}, "size": {"type": "integer"}}, "required": ["sha512", "size"]}}, "required": ["data.json"]}, "inner_path": {"type": "string"}, "modified": {"type": "number"}, "signs": {"type": "object", "properties": {"1LydvXhjUXUFr88yhNoDfgT9LyKRiX9zCB": {"type": "string"}}, "required": ["1LydvXhjUXUFr88yhNoDfgT9LyKRiX9zCB"]}}, "required": ["address", "cert_auth_type", "cert_sign", "cert_user_id", "files", "inner_path", "modified", "signs"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"address" : "1oranGeS2xsKZ4jVsu9SVttzgkYXu4k9v", "cert_auth_type" : "web", "cert_sign" : "G/t0bDFaVNI5NJBIqSL8FqZlCMTjkLbcTgpE0hkSGjBcj/i6l2y+nh3v7bf4TvFfEQIh01DNu8cr23YcdMOZtiw=", "cert_user_id" : "mach@zeroid.bit", "files" : {"data.json" : {"sha512" : "47b320a01a3432138956257bfa0fd5e3f66ccf9693ee615329398c75eec55412", "size" : 556}}, "inner_path" : "data/users/1LydvXhjUXUFr88yhNoDfgT9LyKRiX9zCB/content.json", "modified" : 1481353094.344, "signs" : {"1LydvXhjUXUFr88yhNoDfgT9LyKRiX9zCB" : "HP2NDs1pHLAPxmGUoRetdvr/NxLDVq5kFAWik2OZKdUIfThPSI9gr6cCG3EySyC+b2sofpm7Q5dfyA4ggObKkhg="}}
json_instruct
{"type": "object", "properties": {"address": {"type": "string"}, "cert_auth_type": {"type": "string"}, "cert_sign": {"type": "string"}, "cert_user_id": {"type": "string"}, "files": {"type": "object", "properties": {"data.json": {"type": "object", "properties": {"sha512": {"type": "string"}, "size": {"type": "integer"}}, "required": ["sha512", "size"]}}, "required": ["data.json"]}, "inner_path": {"type": "string"}, "modified": {"type": "number"}, "signs": {"type": "object", "properties": {"1LydvXhjUXUFr88yhNoDfgT9LyKRiX9zCB": {"type": "string"}}, "required": ["1LydvXhjUXUFr88yhNoDfgT9LyKRiX9zCB"]}}, "required": ["address", "cert_auth_type", "cert_sign", "cert_user_id", "files", "inner_path", "modified", "signs"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hash" : "0x18fe8f216f125981667548c1ed52b571be3a18daed0a09ceccef9ddcaba09776", "parentHash" : "0x69aced532616756c20071742c4890b84f9d35eba798df590b7f78ff5a0cb1e64", "number" : 3308, "timestamp" : 1438278879, "nonce" : "0x4e36a417a4c41560", "difficulty" : 84859783437, "gasLimit" : {"_hex" : "0x1388"}, "gasUsed" : {"_hex" : "0x0"}, "miner" : "0xbb7B8287f3F0a933474a79eAe42CBCa977791171", "extraData" : "0x476574682f4c5649562f76312e302e302f6c696e75782f676f312e342e32", "transactions" : []}
json_instruct
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"PREVALENCE_BY_GENDER_AGE_YEAR": {"type": "object", "properties": {"TRELLIS_NAME": {"type": "array", "items": {"type": "string"}}, "SERIES_NAME": {"type": "array", "items": {"type": "string"}}, "X_CALENDAR_YEAR": {"type": "array", "items": {"type": "integer"}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {"type": "number"}}}, "required": ["TRELLIS_NAME", "SERIES_NAME", "X_CALENDAR_YEAR", "Y_PREVALENCE_1000PP"]}, "PREVALENCE_BY_MONTH": {"type": "object", "properties": {"X_CALENDAR_MONTH": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["X_CALENDAR_MONTH", "Y_PREVALENCE_1000PP"]}, "LENGTH_OF_ERA": {"type": "object", "properties": {"CATEGORY": {"type": "string"}, "MIN_VALUE": {"type": "integer"}, "P10_VALUE": {"type": "integer"}, "P25_VALUE": {"type": "integer"}, "MEDIAN_VALUE": {"type": "integer"}, "P75_VALUE": {"type": "integer"}, "P90_VALUE": {"type": "integer"}, "MAX_VALUE": {"type": "integer"}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}, "AGE_AT_FIRST_DIAGNOSIS": {"type": "object", "properties": {"CATEGORY": {"type": "array", "items": {"type": "string"}}, "MIN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P10_VALUE": {"type": "array", "items": {"type": "integer"}}, "P25_VALUE": {"type": "array", "items": {"type": "integer"}}, "MEDIAN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P75_VALUE": {"type": "array", "items": {"type": "integer"}}, "P90_VALUE": {"type": "array", "items": {"type": "integer"}}, "MAX_VALUE": {"type": "array", "items": {"type": "integer"}}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}}, "required": ["PREVALENCE_BY_GENDER_AGE_YEAR", "PREVALENCE_BY_MONTH", "LENGTH_OF_ERA", "AGE_AT_FIRST_DIAGNOSIS"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"PREVALENCE_BY_GENDER_AGE_YEAR" : {"TRELLIS_NAME" : ["0-9", "0-9", "0-9", "0-9", "0-9", "0-9", "0-9", "0-9", "0-9", "0-9", "0-9", "0-9"], "SERIES_NAME" : ["MALE", "FEMALE", "MALE", "FEMALE", "MALE", "MALE", "FEMALE", "FEMALE", "MALE", "MALE", "FEMALE", "FEMALE"], "X_CALENDAR_YEAR" : [2003, 2006, 2009, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2015, 2016], "Y_PREVALENCE_1000PP" : [0.02896, 0.02171, 0.01821, 0.01909, 0.01783, 0.02295, 0.02071, 0.02063, 0.02082, 0.02932, 0.02051, 0.02439]}, "PREVALENCE_BY_MONTH" : {"X_CALENDAR_MONTH" : [], "Y_PREVALENCE_1000PP" : []}, "LENGTH_OF_ERA" : {"CATEGORY" : "Length of era", "MIN_VALUE" : 1, "P10_VALUE" : 1, "P25_VALUE" : 1, "MEDIAN_VALUE" : 1, "P75_VALUE" : 1, "P90_VALUE" : 1, "MAX_VALUE" : 35}, "AGE_AT_FIRST_DIAGNOSIS" : {"CATEGORY" : ["FEMALE", "MALE"], "MIN_VALUE" : [0, 0], "P10_VALUE" : [0, 0], "P25_VALUE" : [1, 0], "MEDIAN_VALUE" : [5, 3], "P75_VALUE" : [34, 31], "P90_VALUE" : [65, 53], "MAX_VALUE" : [89, 73]}}
json_instruct
{"type": "object", "properties": {"PREVALENCE_BY_GENDER_AGE_YEAR": {"type": "object", "properties": {"TRELLIS_NAME": {"type": "array", "items": {"type": "string"}}, "SERIES_NAME": {"type": "array", "items": {"type": "string"}}, "X_CALENDAR_YEAR": {"type": "array", "items": {"type": "integer"}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {"type": "number"}}}, "required": ["TRELLIS_NAME", "SERIES_NAME", "X_CALENDAR_YEAR", "Y_PREVALENCE_1000PP"]}, "PREVALENCE_BY_MONTH": {"type": "object", "properties": {"X_CALENDAR_MONTH": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["X_CALENDAR_MONTH", "Y_PREVALENCE_1000PP"]}, "LENGTH_OF_ERA": {"type": "object", "properties": {"CATEGORY": {"type": "string"}, "MIN_VALUE": {"type": "integer"}, "P10_VALUE": {"type": "integer"}, "P25_VALUE": {"type": "integer"}, "MEDIAN_VALUE": {"type": "integer"}, "P75_VALUE": {"type": "integer"}, "P90_VALUE": {"type": "integer"}, "MAX_VALUE": {"type": "integer"}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}, "AGE_AT_FIRST_DIAGNOSIS": {"type": "object", "properties": {"CATEGORY": {"type": "array", "items": {"type": "string"}}, "MIN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P10_VALUE": {"type": "array", "items": {"type": "integer"}}, "P25_VALUE": {"type": "array", "items": {"type": "integer"}}, "MEDIAN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P75_VALUE": {"type": "array", "items": {"type": "integer"}}, "P90_VALUE": {"type": "array", "items": {"type": "integer"}}, "MAX_VALUE": {"type": "array", "items": {"type": "integer"}}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}}, "required": ["PREVALENCE_BY_GENDER_AGE_YEAR", "PREVALENCE_BY_MONTH", "LENGTH_OF_ERA", "AGE_AT_FIRST_DIAGNOSIS"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"numero": {"type": "integer"}, "descircao": {"type": "string"}}, "required": ["numero", "descircao"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"numero" : 1, "descircao" : "Um meio de locomo\u00e7\u00e3o e transporte"}, {"numero" : 2, "descircao" : "Possui v\u00e1rios modelos e marcas"}, {"numero" : 3, "descircao" : "Tem 4 rodas"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"numero": {"type": "integer"}, "descircao": {"type": "string"}}, "required": ["numero", "descircao"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "properties" : {"type" : "barangay", "level" : "4", "label" : "Alugmawa, Lambunao, Iloilo, Western Visayas (Region VI), PH", "locale" : "ph.western-visayas-region-vi.iloilo.lambunao.alugmawa", "country_id" : 177, "country_reference" : 177, "country_name" : "Philippines", "region_id" : "16", "region_reference" : "6", "region_name" : "Western Visayas (Region VI)", "province_id" : "36", "province_reference" : "36", "province_name" : "Iloilo", "city_id" : "646", "city_reference" : "669", "city_name" : "Lambunao", "barangay_id" : "18021", "barangay_reference" : "16345", "barangay_name" : "Alugmawa"}, "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[122.522552, 11.11358], [122.522667, 11.11114], [122.523697, 11.1101], [122.52446, 11.10758], [122.524384, 11.10704], [122.524681, 11.10652], [122.524551, 11.10559], [122.523132, 11.10417], [122.52272, 11.10371], [122.522476, 11.10274], [122.522583, 11.10158], [122.522278, 11.1009], [122.521004, 11.10016], [122.519234, 11.10057], [122.518593, 11.10095], [122.517479, 11.10141], [122.516541, 11.10147], [122.515198, 11.10129], [122.514351, 11.10091], [122.513229, 11.09989], [122.51255, 11.09882], [122.512268, 11.09774], [122.511681, 11.09601], [122.511787, 11.09474], [122.511292, 11.09392], [122.510696, 11.09347], [122.510117, 11.09319], [122.50946, 11.09324], [122.508713, 11.09366], [122.508041, 11.09426], [122.506332, 11.09528], [122.50666, 11.09647], [122.506393, 11.09698], [122.506493, 11.09821], [122.505836, 11.09816], [122.5056, 11.09859], [122.506729, 11.10024], [122.50621, 11.10119], [122.506248, 11.10257], [122.50721, 11.10432], [122.50708, 11.10606], [122.507278, 11.1095], [122.507271, 11.1103], [122.508278, 11.11151], [122.509163, 11.11315], [122.509216, 11.11413], [122.510712, 11.11679], [122.515404, 11.11357], [122.522552, 11.11358]]]]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"versionId": {"type": "string"}, "lastUpdated": {"type": "string"}}, "required": ["versionId", "lastUpdated"]}, "text": {"type": "object", "properties": {"status": {"type": "string"}, "div": {"type": "string"}}, "required": ["status", "div"]}, "url": {"type": "string"}, "version": {"type": "string"}, "name": {"type": "string"}, "title": {"type": "string"}, "status": {"type": "string"}, "date": {"type": "string"}, "publisher": {"type": "string"}, "caseSensitive": {"type": "boolean"}, "content": {"type": "string"}, "concept": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "display": {"type": "string"}}, "required": ["code", "display"]}}}, "required": ["resourceType", "id", "meta", "text", "url", "version", "name", "title", "status", "date", "publisher", "caseSensitive", "content", "concept"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"resourceType" : "CodeSystem", "id" : "CARIN-BB-Claim-CareTeam-Role", "meta" : {"versionId" : "4", "lastUpdated" : "2019-12-01T14:02:49.000-05:00"}, "text" : {"status" : "generated", "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><h2>CARIN Blue Button Claim Care Team Role Code System</h2><p>This code system http://hl7.org/fhir/us/carin/CodeSystem/carin-bb-claimcareteamrole defines the following codes:</p><table class=\"codes\"><tr><td style=\"white-space:nowrap\"><b>Code</b></td><td><b>Display</b></td><td><b>Definition</b></td></tr><tr><td style=\"white-space:nowrap\">supervising<a name=\"CARIN-BB-Claim-CareTeam-Role-supervising\"> </a></td><td>Attending or Supervising provider</td><td/></tr><tr><td style=\"white-space:nowrap\">referring<a name=\"CARIN-BB-Claim-CareTeam-Role-referring\"> </a></td><td>Referring provider</td><td/></tr><tr><td style=\"white-space:nowrap\">performing<a name=\"CARIN-BB-Claim-CareTeam-Role-performing\"> </a></td><td>Servicing or Rendering provider</td><td/></tr><tr><td style=\"white-space:nowrap\">prescribing<a name=\"CARIN-BB-Claim-CareTeam-Role-prescribing\"> </a></td><td>Prescribing provider</td><td/></tr><tr><td style=\"white-space:nowrap\">pcp<a name=\"CARIN-BB-Claim-CareTeam-Role-pcp\"> </a></td><td>Primary care provider</td><td/></tr></table></div>"}, "url" : "http://hl7.org/fhir/us/carin/CodeSystem/carin-bb-claimcareteamrole", "version" : "0.1.59-DRAFT", "name" : "CARINBBClaimCareTeamRole", "title" : "CARIN Blue Button Claim Care Team Role Code System", "status" : "draft", "date" : "2019-12-18T00:18:52-05:00", "publisher" : "CARIN Alliance", "caseSensitive" : true, "content" : "complete", "concept" : [{"code" : "supervising", "display" : "Attending or Supervising provider"}, {"code" : "referring", "display" : "Referring provider"}, {"code" : "performing", "display" : "Servicing or Rendering provider"}, {"code" : "prescribing", "display" : "Prescribing provider"}, {"code" : "pcp", "display" : "Primary care provider"}]}
json_instruct
{"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"versionId": {"type": "string"}, "lastUpdated": {"type": "string"}}, "required": ["versionId", "lastUpdated"]}, "text": {"type": "object", "properties": {"status": {"type": "string"}, "div": {"type": "string"}}, "required": ["status", "div"]}, "url": {"type": "string"}, "version": {"type": "string"}, "name": {"type": "string"}, "title": {"type": "string"}, "status": {"type": "string"}, "date": {"type": "string"}, "publisher": {"type": "string"}, "caseSensitive": {"type": "boolean"}, "content": {"type": "string"}, "concept": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "display": {"type": "string"}}, "required": ["code", "display"]}}}, "required": ["resourceType", "id", "meta", "text", "url", "version", "name", "title", "status", "date", "publisher", "caseSensitive", "content", "concept"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"fluentui-react.js": {"type": "string"}, "fluentui-react.min.js": {"type": "string"}, "fluentui-react.umd.js": {"type": "string"}, "fluentui-react.umd.min.js": {"type": "string"}}, "required": ["fluentui-react.js", "fluentui-react.min.js", "fluentui-react.umd.js", "fluentui-react.umd.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"fluentui-react.js" : "sha512-Jlbb6V41kT4qRE/lMB4z9pIjXwK2+p7CRsYctoxzQKw/6YiHzowlieY9uR+tawdr0nQT1qkGEPTdXkrKR2ofzQ==", "fluentui-react.min.js" : "sha512-btBLK3XxH61aK2O34oJsK1WdXTIl3T++2SptAh7zVQViqkppVuggr7UN0VYks5vUXflO4peYP9mj7rbTjpZ3rQ==", "fluentui-react.umd.js" : "sha512-te7VyR5unF2lr9V3/gSFrgbcH3OXbbWFqqs1gVBzWB16/LIfOwWjwdwA5nF1swu/UVTZ7hn9Rn8FJSgYTbB5AQ==", "fluentui-react.umd.min.js" : "sha512-25Hc06qCq/eU+C2EdetEfS4Pcq8bdPIqkgB6bXhomLUujkZfWCm2KFwqw2xFUGt3eJlqGW6F5cKZZQSMMLBa3g=="}
json_instruct
{"type": "object", "properties": {"fluentui-react.js": {"type": "string"}, "fluentui-react.min.js": {"type": "string"}, "fluentui-react.umd.js": {"type": "string"}, "fluentui-react.umd.min.js": {"type": "string"}}, "required": ["fluentui-react.js", "fluentui-react.min.js", "fluentui-react.umd.js", "fluentui-react.umd.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"describedBy": {"type": "string"}, "schema_type": {"type": "string"}, "biomaterial_core": {"type": "object", "properties": {"biomaterial_id": {"type": "string"}, "biomaterial_name": {"type": "string"}, "ncbi_taxon_id": {"type": "array", "items": {"type": "integer"}}}, "required": ["biomaterial_id", "biomaterial_name", "ncbi_taxon_id"]}, "genus_species": {"type": "array", "items": {"type": "object", "properties": {"text": {"type": "string"}, "ontology": {"type": "string"}, "ontology_label": {"type": "string"}}, "required": ["text", "ontology", "ontology_label"]}}, "organ": {"type": "object", "properties": {"text": {"type": "string"}, "ontology": {"type": "string"}, "ontology_label": {"type": "string"}}, "required": ["text", "ontology", "ontology_label"]}, "provenance": {"type": "object", "properties": {"document_id": {"type": "string"}, "submission_date": {"type": "string"}, "update_date": {"type": "string"}}, "required": ["document_id", "submission_date", "update_date"]}}, "required": ["describedBy", "schema_type", "biomaterial_core", "genus_species", "organ", "provenance"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"describedBy" : "https://schema.humancellatlas.org/type/biomaterial/6.3.3/specimen_from_organism", "schema_type" : "biomaterial", "biomaterial_core" : {"biomaterial_id" : "1135_LN", "biomaterial_name" : "Mouse_day11_LN_rep2", "ncbi_taxon_id" : [10090]}, "genus_species" : [{"text" : "Mus musculus", "ontology" : "NCBITaxon:10090", "ontology_label" : "Mus musculus"}], "organ" : {"text" : "lymph node", "ontology" : "UBERON:0000029", "ontology_label" : "lymph node"}, "provenance" : {"document_id" : "e08e63d2-8646-4beb-8f46-7dc0d3958196", "submission_date" : "2018-11-06T16:23:41.119Z", "update_date" : "2018-11-06T16:39:09.005Z"}}
json_instruct
{"type": "object", "properties": {"describedBy": {"type": "string"}, "schema_type": {"type": "string"}, "biomaterial_core": {"type": "object", "properties": {"biomaterial_id": {"type": "string"}, "biomaterial_name": {"type": "string"}, "ncbi_taxon_id": {"type": "array", "items": {"type": "integer"}}}, "required": ["biomaterial_id", "biomaterial_name", "ncbi_taxon_id"]}, "genus_species": {"type": "array", "items": {"type": "object", "properties": {"text": {"type": "string"}, "ontology": {"type": "string"}, "ontology_label": {"type": "string"}}, "required": ["text", "ontology", "ontology_label"]}}, "organ": {"type": "object", "properties": {"text": {"type": "string"}, "ontology": {"type": "string"}, "ontology_label": {"type": "string"}}, "required": ["text", "ontology", "ontology_label"]}, "provenance": {"type": "object", "properties": {"document_id": {"type": "string"}, "submission_date": {"type": "string"}, "update_date": {"type": "string"}}, "required": ["document_id", "submission_date", "update_date"]}}, "required": ["describedBy", "schema_type", "biomaterial_core", "genus_species", "organ", "provenance"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"status": {"type": "string"}, "data": {"type": "object", "properties": {"txid": {"type": "string"}, "network": {"type": "string"}, "confirmations": {"type": "integer"}, "is_confirmed": {"type": "boolean"}}, "required": ["txid", "network", "confirmations", "is_confirmed"]}}, "required": ["status", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"status" : "success", "data" : {"txid" : "8ef74ec4a6473caf7b3ddfcf38cf6db43995ff98c7cbc6d8cf317f3c22e35df2", "network" : "BTCTEST", "confirmations" : 79634, "is_confirmed" : false}}
json_instruct
{"type": "object", "properties": {"status": {"type": "string"}, "data": {"type": "object", "properties": {"txid": {"type": "string"}, "network": {"type": "string"}, "confirmations": {"type": "integer"}, "is_confirmed": {"type": "boolean"}}, "required": ["txid", "network", "confirmations", "is_confirmed"]}}, "required": ["status", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"year" : 1993, "sex" : "F", "n" : 5, "prop" : 2.54e-06}, {"year" : 1998, "sex" : "F", "n" : 6, "prop" : 3.1e-06}, {"year" : 2001, "sex" : "F", "n" : 7, "prop" : 3.54e-06}, {"year" : 2003, "sex" : "F", "n" : 9, "prop" : 4.49e-06}, {"year" : 2004, "sex" : "F", "n" : 7, "prop" : 3.47e-06}, {"year" : 2005, "sex" : "F", "n" : 13, "prop" : 6.41e-06}, {"year" : 2006, "sex" : "F", "n" : 17, "prop" : 8.14e-06}, {"year" : 2007, "sex" : "F", "n" : 18, "prop" : 8.51e-06}, {"year" : 2008, "sex" : "F", "n" : 14, "prop" : 6.73e-06}, {"year" : 2009, "sex" : "F", "n" : 13, "prop" : 6.43e-06}, {"year" : 2010, "sex" : "F", "n" : 10, "prop" : 5.11e-06}, {"year" : 2011, "sex" : "F", "n" : 13, "prop" : 6.72e-06}, {"year" : 2012, "sex" : "F", "n" : 13, "prop" : 6.71e-06}, {"year" : 2013, "sex" : "F", "n" : 10, "prop" : 5.2e-06}, {"year" : 2014, "sex" : "F", "n" : 11, "prop" : 5.64e-06}, {"year" : 2015, "sex" : "F", "n" : 7, "prop" : 3.6e-06}, {"year" : 2016, "sex" : "F", "n" : 10, "prop" : 5.19e-06}, {"year" : 2017, "sex" : "F", "n" : 5, "prop" : 2.67e-06}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Gatey", "dpt" : "Jura", "inscrits" : 266, "abs" : 45, "votants" : 221, "blancs" : 4, "nuls" : 1, "exp" : 216, "res" : [{"panneau" : "2", "voix" : 85}, {"panneau" : "9", "voix" : 43}, {"panneau" : "11", "voix" : 35}, {"panneau" : "3", "voix" : 25}, {"panneau" : "1", "voix" : 12}, {"panneau" : "4", "voix" : 10}, {"panneau" : "5", "voix" : 2}, {"panneau" : "8", "voix" : 2}, {"panneau" : "6", "voix" : 1}, {"panneau" : "7", "voix" : 1}, {"panneau" : "10", "voix" : 0}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"/js/app.js": {"type": "string"}, "/css/admin/main.css": {"type": "string"}, "/css/admin/rtl.css": {"type": "string"}, "/css/app.css": {"type": "string"}}, "required": ["/js/app.js", "/css/admin/main.css", "/css/admin/rtl.css", "/css/app.css"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"/js/app.js" : "/js/app.js", "/css/admin/main.css" : "/css/admin/main.css", "/css/admin/rtl.css" : "/css/admin/rtl.css", "/css/app.css" : "/css/app.css"}
json_instruct
{"type": "object", "properties": {"/js/app.js": {"type": "string"}, "/css/admin/main.css": {"type": "string"}, "/css/admin/rtl.css": {"type": "string"}, "/css/app.css": {"type": "string"}}, "required": ["/js/app.js", "/css/admin/main.css", "/css/admin/rtl.css", "/css/app.css"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"brief" : "complete", "long" : "<i>Meaning:</i> \"complete\"; as noun, the \"whole\" (specifically, a sacrifice \"entirely consumed\"); as adverb, \"fully\".<br/><i>Usage:</i> all, every whit, flame, perfect(-ion), utterly, whole burnt offering (sacrifice), wholly.<br/><i>Source:</i> from \"H3634\";"}
json_instruct
{"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"source": {"type": "string"}, "word": {"type": "string"}, "infinitivo": {"type": "string"}, "participio": {"type": "array", "items": {"type": "string"}}, "gerundio": {"type": "array", "items": {"type": "string"}}, "tenses": {"type": "object", "properties": {"3": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "4": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "5": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "6": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "7": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "8": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "9": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "10": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "11": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "12": {"type": "object", "properties": {"1": {"type": "array", "items": {"type": "string"}}, "2": {"type": "array", "items": {"type": "string"}}, "3": {"type": "array", "items": {"type": "string"}}, "4": {"type": "array", "items": {"type": "string"}}, "5": {"type": "array", "items": {"type": "string"}}}, "required": ["1", "2", "3", "4", "5"]}}, "required": ["3", "4", "5", "6", "7", "8", "9", "10", "11", "12"]}}, "required": ["source", "word", "infinitivo", "participio", "gerundio", "tenses"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"source" : "http://lema.rae.es/drae/srv/search?val=sincronizar", "word" : "sincronizar", "infinitivo" : "sincronizar", "participio" : ["sincronizado"], "gerundio" : ["sincronizando"], "tenses" : {"3" : [["sincronizo"], ["sincronizas", "sincroniz\u00e1s"], ["sincroniza"], ["sincronizamos"], ["sincroniz\u00e1is", "sincronizan"], ["sincronizan"]], "4" : [["sincronic\u00e9"], ["sincronizaste"], ["sincroniz\u00f3"], ["sincronizamos"], ["sincronizasteis", "sincronizaron"], ["sincronizaron"]], "5" : [["sincronizaba"], ["sincronizabas"], ["sincronizaba"], ["sincroniz\u00e1bamos"], ["sincronizabais", "sincronizaban"], ["sincronizaban"]], "6" : [["sincronizar\u00eda"], ["sincronizar\u00edas"], ["sincronizar\u00eda"], ["sincronizar\u00edamos"], ["sincronizar\u00edais", "sincronizar\u00edan"], ["sincronizar\u00edan"]], "7" : [["sincronizar\u00e9"], ["sincronizar\u00e1s"], ["sincronizar\u00e1"], ["sincronizaremos"], ["sincronizar\u00e9is", "sincronizar\u00e1n"], ["sincronizar\u00e1n"]], "8" : [["sincronice"], ["sincronices"], ["sincronice"], ["sincronicemos"], ["sincronic\u00e9is", "sincronicen"], ["sincronicen"]], "9" : [["sincronizara"], ["sincronizaras"], ["sincronizara"], ["sincroniz\u00e1ramos"], ["sincronizarais", "sincronizaran"], ["sincronizaran"]], "10" : [["sincronizase"], ["sincronizases"], ["sincronizase"], ["sincroniz\u00e1semos"], ["sincronizaseis", "sincronizasen"], ["sincronizasen"]], "11" : [["sincronizare"], ["sincronizares"], ["sincronizare"], ["sincroniz\u00e1remos"], ["sincronizareis", "sincronizaren"], ["sincronizaren"]], "12" : {"1" : ["sincroniza"], "2" : ["sincronice"], "3" : ["sincronicemos"], "4" : ["sincronizad"], "5" : ["sincronicen"]}}}
json_instruct
{"type": "object", "properties": {"source": {"type": "string"}, "word": {"type": "string"}, "infinitivo": {"type": "string"}, "participio": {"type": "array", "items": {"type": "string"}}, "gerundio": {"type": "array", "items": {"type": "string"}}, "tenses": {"type": "object", "properties": {"3": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "4": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "5": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "6": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "7": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "8": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "9": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "10": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "11": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}, "12": {"type": "object", "properties": {"1": {"type": "array", "items": {"type": "string"}}, "2": {"type": "array", "items": {"type": "string"}}, "3": {"type": "array", "items": {"type": "string"}}, "4": {"type": "array", "items": {"type": "string"}}, "5": {"type": "array", "items": {"type": "string"}}}, "required": ["1", "2", "3", "4", "5"]}}, "required": ["3", "4", "5", "6", "7", "8", "9", "10", "11", "12"]}}, "required": ["source", "word", "infinitivo", "participio", "gerundio", "tenses"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"fileType": {"type": "string"}, "name": {"type": "string"}, "namespace": {"type": "string"}, "fqn": {"type": "string"}, "isEntry": {"type": "boolean"}, "isAbstract": {"type": "boolean"}, "description": {"type": "string"}, "fields": {"type": "array", "items": {"type": "object", "properties": {"fqn": {"type": "string"}, "valueType": {"type": "string"}, "card": {"type": "object", "properties": {"min": {"type": "integer"}}, "required": ["min"]}}, "required": ["fqn", "valueType", "card"]}}}, "required": ["fileType", "name", "namespace", "fqn", "isEntry", "isAbstract", "description", "fields"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"fileType" : "DataElement", "name" : "PanelMembers", "namespace" : "cimi.topic", "fqn" : "cimi.topic.PanelMembers", "isEntry" : false, "isAbstract" : false, "description" : "PanelMember represent the elements of a group of a related but independent evaluations.\nExamples are the measurements that compose a complete blood count (CBC), or the elements of a pathology report. Each member is an independent evaluation, but the grouping reflects a composite lab order, shared specimen, or a single report author. Typically the Category and Reason are not given for individual findings that are part of the panel, but rather given at the level of the panel itself.", "fields" : [{"fqn" : "cimi.statement.EvaluationResultRecorded", "valueType" : "IdentifiableValue", "card" : {"min" : 0}}]}
json_instruct
{"type": "object", "properties": {"fileType": {"type": "string"}, "name": {"type": "string"}, "namespace": {"type": "string"}, "fqn": {"type": "string"}, "isEntry": {"type": "boolean"}, "isAbstract": {"type": "boolean"}, "description": {"type": "string"}, "fields": {"type": "array", "items": {"type": "object", "properties": {"fqn": {"type": "string"}, "valueType": {"type": "string"}, "card": {"type": "object", "properties": {"min": {"type": "integer"}}, "required": ["min"]}}, "required": ["fqn", "valueType", "card"]}}}, "required": ["fileType", "name", "namespace", "fqn", "isEntry", "isAbstract", "description", "fields"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"organisation": {"type": "string"}, "hectares": {"type": "string"}, "deliverable": {"type": "string"}, "maximum-net-dwellings": {"type": "string"}, "site": {"type": "string"}, "site-address": {"type": "string"}, "site-plan-url": {"type": "string"}, "name": {"type": "string"}, "start-date": {"type": "string"}, "minimum-net-dwellings": {"type": "string"}, "ownership-status": {"type": "string"}, "planning-permission-status": {"type": "string"}, "point": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}, "notes": {"type": "string"}, "planning-permission-history": {"type": "string"}}, "required": ["organisation", "hectares", "deliverable", "maximum-net-dwellings", "site", "site-address", "site-plan-url", "name", "start-date", "minimum-net-dwellings", "ownership-status", "planning-permission-status", "point", "slug", "entity", "entry-date", "notes", "planning-permission-history"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Point", "coordinates" : [-1.979442, 50.72035]}, "properties" : {"organisation" : "local-authority-eng:POL", "hectares" : "0.17", "deliverable" : "yes", "maximum-net-dwellings" : "50", "site" : "P/BLR/0068", "site-address" : "12 & 14 and land adjacent to Poole Labour Club, Wimborne Road, Poole, BH15 2BU", "site-plan-url" : "https://boppa.poole.gov.uk/online-applications/applicationDetails.do?activeTab=documents&keyVal=_POOLE_DCAPR_249017", "name" : "P/BLR/0068", "start-date" : "2017-12-01", "minimum-net-dwellings" : "50", "ownership-status" : "not owned by a public authority", "planning-permission-status" : "Not permissioned", "point" : "POINT(-1.979442 50.72035)", "slug" : "/brownfield-land/local-authority-eng/POL/P-BLR-0068", "entity" : 490444, "entry-date" : "2018-12-01", "notes" : "Outline application to demolish rear projection to Poole Labour Club & existing buildings on site & erect block of 50 flats & accessed from Denmark Lane.", "planning-permission-history" : "https://boppa.poole.gov.uk/online-applications/applicationDetails.do?activeTab=documents&keyVal=_POOLE_DCAPR_249017"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"organisation": {"type": "string"}, "hectares": {"type": "string"}, "deliverable": {"type": "string"}, "maximum-net-dwellings": {"type": "string"}, "site": {"type": "string"}, "site-address": {"type": "string"}, "site-plan-url": {"type": "string"}, "name": {"type": "string"}, "start-date": {"type": "string"}, "minimum-net-dwellings": {"type": "string"}, "ownership-status": {"type": "string"}, "planning-permission-status": {"type": "string"}, "point": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}, "notes": {"type": "string"}, "planning-permission-history": {"type": "string"}}, "required": ["organisation", "hectares", "deliverable", "maximum-net-dwellings", "site", "site-address", "site-plan-url", "name", "start-date", "minimum-net-dwellings", "ownership-status", "planning-permission-status", "point", "slug", "entity", "entry-date", "notes", "planning-permission-history"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}}, "required": ["name", "description"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Die Stadt Tarkov", "description" : "Tarkov ist eine Stadt im Nordwesten Russlands, eine Kommune innerhalb der Region Norvinsk und eine der beiden Hauptst\u00e4dte der Sonderwirtschaftszone Norvinsk."}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}}, "required": ["name", "description"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"rules": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "ratings": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "$uid": {"type": "object", "properties": {".read": {"type": "string"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}}, "required": [".read", ".write", "$uid"]}, "featuredSessions": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "$uid": {"type": "object", "properties": {".read": {"type": "string"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}}, "required": [".read", ".write", "$uid"]}, "speakers": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}, "subscribers": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}}, "required": [".read", ".write"]}, "notifications": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "subscribers": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}}, "required": [".read", ".write"]}, "users": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "$uid": {"type": "object", "properties": {".read": {"type": "string"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}}, "required": [".read", ".write", "$uid"]}}, "required": [".read", ".write", "subscribers", "users"]}}, "required": [".read", ".write", "ratings", "featuredSessions", "speakers", "subscribers", "notifications"]}}, "required": ["rules"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"rules" : {".read" : true, ".write" : false, "ratings" : {".read" : false, ".write" : false, "$uid" : {".read" : "auth.uid === $uid", ".write" : "auth.uid === $uid"}}, "featuredSessions" : {".read" : false, ".write" : false, "$uid" : {".read" : "auth.uid === $uid", ".write" : "auth.uid === $uid"}}, "speakers" : {".read" : true, ".write" : "root.child('users').child(auth.uid).child('rules').child('speakers').val() === true"}, "subscribers" : {".read" : false, ".write" : true}, "notifications" : {".read" : false, ".write" : false, "subscribers" : {".read" : true, ".write" : true}, "users" : {".read" : false, ".write" : false, "$uid" : {".read" : "auth.uid === $uid", ".write" : "auth.uid === $uid"}}}}}
json_instruct
{"type": "object", "properties": {"rules": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "ratings": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "$uid": {"type": "object", "properties": {".read": {"type": "string"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}}, "required": [".read", ".write", "$uid"]}, "featuredSessions": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "$uid": {"type": "object", "properties": {".read": {"type": "string"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}}, "required": [".read", ".write", "$uid"]}, "speakers": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}, "subscribers": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}}, "required": [".read", ".write"]}, "notifications": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "subscribers": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}}, "required": [".read", ".write"]}, "users": {"type": "object", "properties": {".read": {"type": "boolean"}, ".write": {"type": "boolean"}, "$uid": {"type": "object", "properties": {".read": {"type": "string"}, ".write": {"type": "string"}}, "required": [".read", ".write"]}}, "required": [".read", ".write", "$uid"]}}, "required": [".read", ".write", "subscribers", "users"]}}, "required": [".read", ".write", "ratings", "featuredSessions", "speakers", "subscribers", "notifications"]}}, "required": ["rules"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"SolverName": {"type": "string"}, "ObjBound": {"type": "number"}, "SolveTime": {"type": "number"}, "PrimalStatus": {"type": "string"}, "InstanceName": {"type": "string"}, "SolveTimeRaw": {"type": "number"}, "CompletedSolveTime": {"type": "number"}, "ObjValue": {"type": "number"}, "Error": {"type": "boolean"}, "TerminationStatus": {"type": "string"}}, "required": ["SolverName", "ObjBound", "SolveTime", "PrimalStatus", "InstanceName", "SolveTimeRaw", "CompletedSolveTime", "ObjValue", "Error", "TerminationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"SolverName" : "BARON", "ObjBound" : 3.31992926789, "SolveTime" : 0.3, "PrimalStatus" : "FEASIBLE_POINT", "InstanceName" : "27_softplus_4_3_3", "SolveTimeRaw" : 0.9189999103546143, "CompletedSolveTime" : 100.0, "ObjValue" : 3.3202612608122206, "Error" : false, "TerminationStatus" : "LOCALLY_SOLVED"}
json_instruct
{"type": "object", "properties": {"SolverName": {"type": "string"}, "ObjBound": {"type": "number"}, "SolveTime": {"type": "number"}, "PrimalStatus": {"type": "string"}, "InstanceName": {"type": "string"}, "SolveTimeRaw": {"type": "number"}, "CompletedSolveTime": {"type": "number"}, "ObjValue": {"type": "number"}, "Error": {"type": "boolean"}, "TerminationStatus": {"type": "string"}}, "required": ["SolverName", "ObjBound", "SolveTime", "PrimalStatus", "InstanceName", "SolveTimeRaw", "CompletedSolveTime", "ObjValue", "Error", "TerminationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "object", "properties": {"date": {"type": "string"}, "sloc": {"type": "integer"}, "lloc": {"type": "integer"}, "functions": {"type": "integer"}, "deliveredBugs": {"type": "number"}, "maintainability": {"type": "number"}, "lintErrors": {"type": "array", "items": {}}, "difficulty": {"type": "number"}}, "required": ["date", "sloc", "lloc", "functions", "deliveredBugs", "maintainability", "lintErrors", "difficulty"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"date" : "Tue, 19 Jul 2016 08:41:25 GMT", "sloc" : 36, "lloc" : 22, "functions" : 5, "deliveredBugs" : 0.18430376252379815, "maintainability" : 75.35322041248598, "lintErrors" : [], "difficulty" : 6.923076923076923}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"date": {"type": "string"}, "sloc": {"type": "integer"}, "lloc": {"type": "integer"}, "functions": {"type": "integer"}, "deliveredBugs": {"type": "number"}, "maintainability": {"type": "number"}, "lintErrors": {"type": "array", "items": {}}, "difficulty": {"type": "number"}}, "required": ["date", "sloc", "lloc", "functions", "deliveredBugs", "maintainability", "lintErrors", "difficulty"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"content": {"type": "string"}, "entities": {"type": "array", "items": {"type": "object", "properties": {"entity": {"type": "string"}, "type": {"type": "string"}, "id": {"type": "integer"}, "offset": {"type": "integer"}}, "required": ["entity", "type", "id", "offset"]}}, "topics": {"type": "array", "items": {"type": "object", "properties": {"topic": {"type": "string"}, "id": {"type": "integer"}}, "required": ["topic", "id"]}}, "tweet_id": {"type": "string"}}, "required": ["content", "entities", "topics", "tweet_id"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"content" : "\"The Conservative party has a very clear plan\" Yes, we've seen the plan in action - many, many more food banks and inequality. #bbcqt", "entities" : [{"entity" : "inequality", "type" : "topic keyword", "id" : 2, "offset" : 115}, {"entity" : "food banks", "type" : "topic keyword", "id" : 3, "offset" : 100}, {"offset" : 5, "type" : "party keyword", "id" : 4, "entity" : "conservative"}], "topics" : [{"topic" : "public spending", "id" : 1}], "tweet_id" : "581230495205330944"}
json_instruct
{"type": "object", "properties": {"content": {"type": "string"}, "entities": {"type": "array", "items": {"type": "object", "properties": {"entity": {"type": "string"}, "type": {"type": "string"}, "id": {"type": "integer"}, "offset": {"type": "integer"}}, "required": ["entity", "type", "id", "offset"]}}, "topics": {"type": "array", "items": {"type": "object", "properties": {"topic": {"type": "string"}, "id": {"type": "integer"}}, "required": ["topic", "id"]}}, "tweet_id": {"type": "string"}}, "required": ["content", "entities", "topics", "tweet_id"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Troissereux", "dpt" : "Oise", "inscrits" : 962, "abs" : 190, "votants" : 772, "blancs" : 66, "nuls" : 11, "exp" : 695, "res" : [{"panneau" : "1", "voix" : 350}, {"panneau" : "2", "voix" : 345}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"_id" : "oq8df96k", "accession" : "NC_021480", "definition" : "Grapevine satellite virus isolate AUD46129, complete sequence", "host" : "Vitis sp. (grapevine)", "sequence" : "AGTATTTTTCATGAGCGTATTTTTCATGAGCGTATTGTGCTAGTAGGTTTCGAACACCACATACCAAATCATCTTACAATCCCTAGCGCTGGACACACCCCTCTTCTTACTGTTCAGTTGCTATCTTCTTCTTCTAATTCTCTTTTTAATTATTATAATATTTTGGTATTGTCTTAATATAAATAAAAAGCGGAAATCAGATGGTCAATCGCCGTCCTAGAAATACTACGCGTCGTCGCGGGGTCCCAGCTTTGCGGGAAGTGAATTACGCTACCGTAAACGCAGGGACGCAAACAGCATTCGCCAGGAAAGACCTTCAAATCTTAGCGGGCTGTGGAGACCGATCATTTAAATTGGTCGGCTTGGCTTTACAAGTCTCCTCTCTTTCAGAACCAGTTATCGTTCAGATTCACATCTTCAACGAGGCACTGAAAGAGATTGCGTTGTGCAACCGTTTGGTCGCCCAAGGTAACACTTGGTTGCGGTTGCGCATCCCCCTTAGTTATAAGCAGTGGTGGTCCGGGGAGACCACTCAAAGTCAGACACTTGTCCGTGTCGATATTATACCTACTTATAAAAATCAAAATACAAAAGTGTCTTTTTTATTGAGTCTTTTGTGTCGATTGGGCACAAGCGAGATAACAGCACACCCATGAAAGATTTAGTATTTTTCATGAGAAAGGTAAACTTCGTCGATGACGATGTTTACGATTTTGTGATGGCCCATTATGTCAGTTGGGGTTGGTACGGTGGAAACATCGGTATTACCTTCGATTTTGGCAATAAATGTAAAGAATTTTTAAATCGTGTTACTGATCCGTCAGCGGTAAGTAATAAATTCTCACAGTTGATAGCATTTAGCCGTCTCTGTGACACGAATAGTATAAAGAATAAGATTATTGTAAGAAATTTTGATTTAATGTGAGTCCGGGTGGGCGTATGTCGTCTTAACTCACCCGTAAAGGTGTCTTAACATAGTTATGAATAAGTCCTAGTTAGAGTCTCTCCTAAATCCTTAATTGGAGCGCTGGAGAGCTTAAATAAGCGCCGTATTGTGCTA"}
json_instruct
{"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-118.967459, 35.377512], [-118.967421, 35.383005], [-118.949662, 35.383152], [-118.949697, 35.37594], [-118.964908, 35.375818], [-118.967467, 35.376371], [-118.967459, 35.377512]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 6040}}]}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"\u5de5\u5ee0\u540d\u7a31" : "\u9023\u9245\u5be6\u696d\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f" : "99648158", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f" : "08210007057709", "\u5de5\u5ee0\u5730\u5740" : "\u5f70\u5316\u7e23\u79c0\u6c34\u9109\u5b89\u6771\u6751\u5f70\u6c34\u8def\uff11\u6bb5\uff12\uff13\uff15\u5df7\uff19\u5f04\uff11\uff15\u865f", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc" : "\u5f70\u5316\u7e23\u79c0\u6c34\u9109\u5b89\u6771\u6751", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d" : "\u6797\u52c7\u7fa9\u3000", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f" : "86527377", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b" : "\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f" : "0820618", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f" : "0840707", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b" : "\u751f\u7522\u4e2d", "\u7522\u696d\u985e\u5225" : ["25\u91d1\u5c6c\u88fd\u54c1\u88fd\u9020\u696d"], "\u4e3b\u8981\u7522\u54c1" : ["259\u5176\u4ed6\u91d1\u5c6c\u88fd\u54c1"]}
json_instruct
{"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "dependencies": {"type": "object", "properties": {"chai": {"type": "string"}, "mocha": {"type": "string"}, "sinon": {"type": "string"}, "sinon-chai": {"type": "string"}}, "required": ["chai", "mocha", "sinon", "sinon-chai"]}}, "required": ["name", "private", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "pairing-generator-tests", "private" : true, "dependencies" : {"chai" : "^3.5.0", "mocha" : "^3.1.2", "sinon" : "~1.9", "sinon-chai" : "^2.8.0"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "dependencies": {"type": "object", "properties": {"chai": {"type": "string"}, "mocha": {"type": "string"}, "sinon": {"type": "string"}, "sinon-chai": {"type": "string"}}, "required": ["chai", "mocha", "sinon", "sinon-chai"]}}, "required": ["name", "private", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "object", "properties": {"chain": {"type": "string"}, "homologs": {"type": "array", "items": {"type": "string"}}, "num_homol": {"type": "integer"}}, "required": ["chain", "homologs", "num_homol"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"chain" : "A", "homologs" : ["6w4b_B", "6w4b_A", "1uw7_A", "1qz8_B", "1qz8_A", "3ee7_D", "3ee7_C", "3ee7_B", "3ee7_A"], "num_homol" : 9}, {"chain" : "B", "homologs" : ["6w4b_B", "6w4b_A", "1uw7_A", "1qz8_B", "1qz8_A", "3ee7_D", "3ee7_C", "3ee7_B", "3ee7_A"], "num_homol" : 9}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"chain": {"type": "string"}, "homologs": {"type": "array", "items": {"type": "string"}}, "num_homol": {"type": "integer"}}, "required": ["chain", "homologs", "num_homol"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"name": {"type": "string"}, "station_list": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "integer"}, "name": {"type": "string"}, "numbering": {"type": "array", "items": {"type": "string"}}}, "required": ["code", "name", "numbering"]}}}, "required": ["name", "station_list"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "\u6771\u8449\u9ad8\u901f\u9244\u9053", "station_list" : [{"code" : 1130524, "name" : "\u897f\u8239\u6a4b", "numbering" : ["TR01"]}, {"code" : 9933802, "name" : "\u6771\u6d77\u795e", "numbering" : ["TR02"]}, {"code" : 9933803, "name" : "\u98ef\u5c71\u6e80", "numbering" : ["TR03"]}, {"code" : 9932906, "name" : "\u5317\u7fd2\u5fd7\u91ce", "numbering" : ["TR04"]}, {"code" : 9933805, "name" : "\u8239\u6a4b\u65e5\u5927\u524d", "numbering" : ["TR05"]}, {"code" : 9933806, "name" : "\u516b\u5343\u4ee3\u7dd1\u304c\u4e18", "numbering" : ["TR06"]}, {"code" : 9933807, "name" : "\u516b\u5343\u4ee3\u4e2d\u592e", "numbering" : ["TR07"]}, {"code" : 9933808, "name" : "\u6751\u4e0a(\u5343\u8449)", "numbering" : ["TR08"]}, {"code" : 9933809, "name" : "\u6771\u8449\u52dd\u7530\u53f0", "numbering" : ["TR09"]}]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "station_list": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "integer"}, "name": {"type": "string"}, "numbering": {"type": "array", "items": {"type": "string"}}}, "required": ["code", "name", "numbering"]}}}, "required": ["name", "station_list"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"authors": {"type": "array", "items": {"type": "object", "properties": {"author": {"type": "string"}}, "required": ["author"]}}, "doi": {"type": "string"}, "publication_date": {"type": "string"}, "id": {"type": "string"}, "url": {"type": "string"}, "source": {"type": "string"}, "source_url": {"type": "string"}, "licence": {"type": "string"}, "language": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "text": {"type": "string"}}, "required": ["authors", "doi", "publication_date", "id", "url", "source", "source_url", "licence", "language", "type", "description", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"authors" : [{"author" : "Rinki Murphy"}, {"author" : "Deborah Mackay"}, {"author" : "Ed A Mitchell"}], "doi" : "10.1186/1471-2350-13-99", "publication_date" : "2012-11-03", "id" : "EN116769", "url" : "https://pubmed.ncbi.nlm.nih.gov/23116464", "source" : "BMC medical genetics", "source_url" : "", "licence" : "CC BY", "language" : "en", "type" : "pubmed", "description" : "", "text" : "A child was normally conceived and born by caesarian section to a healthy 19 year old smoking mother (G2P1) at 38 weeks gestation, with SGA (birthweight SDS -2.44), placenta weight 250g (normal histology), with an umbilical hernia and transient neonatal hypoglycemia but no other features of BWS.The methylation status at 11p15 region was initially investigated by multiplex ligation dependent probe amplification (MLPA). Subsequently, methylation-specific (ms) PCR was performed to screen for this and other imprinted loci abnormalities at PLAG1 (6q24), IGF2R (6q27), GRB10 (7p12), PEG1/MEST (7q32), DLK1 (14q32), SNRPN (15q11); PEG3 (19q32), NESPAS/GNAS (20q13).Leucocyte DNA methylation was normal at ICR1 but markedly reduced at ICR2 using both MLPA and ms-PCR, and no other anomalies of imprinting were detected. Buccal DNA methylation was normal at all imprinted sites tested."}
json_instruct
{"type": "object", "properties": {"authors": {"type": "array", "items": {"type": "object", "properties": {"author": {"type": "string"}}, "required": ["author"]}}, "doi": {"type": "string"}, "publication_date": {"type": "string"}, "id": {"type": "string"}, "url": {"type": "string"}, "source": {"type": "string"}, "source_url": {"type": "string"}, "licence": {"type": "string"}, "language": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "text": {"type": "string"}}, "required": ["authors", "doi", "publication_date", "id", "url", "source", "source_url", "licence", "language", "type", "description", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 101852555, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes_pg", "src:geom" : "quattroshapes_pg", "wof:geomhash" : "6f3558206e78f48bce982769737ebc25", "wof:id" : 101852555, "wof:repo" : "whosonfirst-data-admin-gb"}, "bbox" : [-4.14418, 50.54944, -4.14418, 50.54944], "geometry" : {"coordinates" : [-4.14418, 50.54944], "type" : "Point"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"minecraft:adventure/adventuring_time": {"type": "object", "properties": {"criteria": {"type": "object", "properties": {"minecraft:wooded_hills": {"type": "string"}, "minecraft:plains": {"type": "string"}}, "required": ["minecraft:wooded_hills", "minecraft:plains"]}, "done": {"type": "boolean"}}, "required": ["criteria", "done"]}}, "required": ["minecraft:adventure/adventuring_time"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"minecraft:adventure/adventuring_time" : {"criteria" : {"minecraft:wooded_hills" : "2020-04-18 14:50:06 +0300", "minecraft:plains" : "2020-04-18 14:51:17 +0300"}, "done" : false}}
json_instruct
{"type": "object", "properties": {"minecraft:adventure/adventuring_time": {"type": "object", "properties": {"criteria": {"type": "object", "properties": {"minecraft:wooded_hills": {"type": "string"}, "minecraft:plains": {"type": "string"}}, "required": ["minecraft:wooded_hills", "minecraft:plains"]}, "done": {"type": "boolean"}}, "required": ["criteria", "done"]}}, "required": ["minecraft:adventure/adventuring_time"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}}, "required": ["dev"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"rollup": {"type": "string"}, "rollup-plugin-scss": {"type": "string"}, "rollup-plugin-terser": {"type": "string"}, "sass": {"type": "string"}}, "required": ["rollup", "rollup-plugin-scss", "rollup-plugin-terser", "sass"]}, "dependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["name", "version", "description", "repository", "main", "scripts", "keywords", "author", "license", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "materra-lightbox", "version" : "1.0.1", "description" : "A minimal lightbox to lower your website's carbon footprint", "repository" : "github:wiegertschouten/materra-lightbox", "main" : "dist/materra-lightbox.esm.js", "scripts" : {"dev" : "rollup -c -w"}, "keywords" : ["image", "lightbox", "minimal", "carbon", "emissions", "CO2"], "author" : "Wiegert Schouten", "license" : "MIT", "devDependencies" : {"rollup" : "^2.53.3", "rollup-plugin-scss" : "^3.0.0", "rollup-plugin-terser" : "^7.0.2", "sass" : "^1.35.2"}, "dependencies" : {}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}}, "required": ["dev"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"rollup": {"type": "string"}, "rollup-plugin-scss": {"type": "string"}, "rollup-plugin-terser": {"type": "string"}, "sass": {"type": "string"}}, "required": ["rollup", "rollup-plugin-scss", "rollup-plugin-terser", "sass"]}, "dependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["name", "version", "description", "repository", "main", "scripts", "keywords", "author", "license", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@slack/client": {"type": "string"}, "axios": {"type": "string"}, "dotenv": {"type": "string"}, "https-proxy-agent": {"type": "string"}, "moment": {"type": "string"}}, "required": ["@slack/client", "axios", "dotenv", "https-proxy-agent", "moment"]}}, "required": ["name", "version", "description", "main", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "slack-rtm-proxy", "version" : "0.1.1", "description" : "Proxy for Slack Real Time Messaging API", "main" : "index.js", "author" : "Hayto IZUMI", "license" : "MIT", "dependencies" : {"@slack/client" : "^4.2.2", "axios" : "^0.18.0", "dotenv" : "^5.0.1", "https-proxy-agent" : "^2.2.1", "moment" : "^2.22.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@slack/client": {"type": "string"}, "axios": {"type": "string"}, "dotenv": {"type": "string"}, "https-proxy-agent": {"type": "string"}, "moment": {"type": "string"}}, "required": ["@slack/client", "axios", "dotenv", "https-proxy-agent", "moment"]}}, "required": ["name", "version", "description", "main", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "null"}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ast" : null, "code" : "import _extends from \"@babel/runtime/helpers/extends\";\nimport cx from 'classnames';\nimport PropTypes from 'prop-types';\nimport React from 'react';\nimport { childrenUtils, customPropTypes, getElementType, getUnhandledProps, useKeyOnly } from '../../lib';\n/**\n * A dimmable sub-component for Dimmer.\n */\n\nfunction DimmerDimmable(props) {\n var blurring = props.blurring,\n className = props.className,\n children = props.children,\n content = props.content,\n dimmed = props.dimmed;\n var classes = cx(useKeyOnly(blurring, 'blurring'), useKeyOnly(dimmed, 'dimmed'), 'dimmable', className);\n var rest = getUnhandledProps(DimmerDimmable, props);\n var ElementType = getElementType(DimmerDimmable, props);\n return React.createElement(ElementType, _extends({}, rest, {\n className: classes\n }), childrenUtils.isNil(children) ? content : children);\n}\n\nDimmerDimmable.handledProps = [\"as\", \"blurring\", \"children\", \"className\", \"content\", \"dimmed\"];\nDimmerDimmable.propTypes = process.env.NODE_ENV !== \"production\" ? {\n /** An element type to render as (string or function). */\n as: PropTypes.elementType,\n\n /** A dimmable element can blur its contents. */\n blurring: PropTypes.bool,\n\n /** Primary content. */\n children: PropTypes.node,\n\n /** Additional classes. */\n className: PropTypes.string,\n\n /** Shorthand for primary content. */\n content: customPropTypes.contentShorthand,\n\n /** Controls whether or not the dim is displayed. */\n dimmed: PropTypes.bool\n} : {};\nexport default DimmerDimmable;", "map" : null, "metadata" : {}, "sourceType" : "module"}
json_instruct
{"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "null"}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"ll": {"type": "array", "items": {"type": "string"}}, "uri": {"type": "string"}, "id": {"type": "string"}, "title": {"type": "string"}}, "required": ["ll", "uri", "id", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ll" : ["47.5", "27.5"], "uri" : "http://pleiades.stoa.org/places/1273", "id" : "1273", "title" : "Scythia"}
json_instruct
{"type": "object", "properties": {"ll": {"type": "array", "items": {"type": "string"}}, "uri": {"type": "string"}, "id": {"type": "string"}, "title": {"type": "string"}}, "required": ["ll", "uri", "id", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"title": {"type": "string"}, "author": {"type": "string"}, "musicType": {"type": "string"}, "musicNo": {"type": "string"}}, "required": ["title", "author", "musicType", "musicNo"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Ifs and Buts-\u963f\u4fdd\u521a", "author" : "\u963f\u4fdd\u521a", "musicType" : "\u8f7b\u97f3\u4e50", "musicNo" : "0008614"}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "author": {"type": "string"}, "musicType": {"type": "string"}, "musicNo": {"type": "string"}}, "required": ["title", "author", "musicType", "musicNo"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"source": {"type": "string"}}, "required": ["source"]}, "url": {"type": "string"}, "version": {"type": "string"}, "name": {"type": "string"}, "title": {"type": "string"}, "status": {"type": "string"}, "date": {"type": "string"}, "description": {"type": "string"}, "compose": {"type": "object", "properties": {"include": {"type": "array", "items": {"type": "object", "properties": {"system": {"type": "string"}, "version": {"type": "string"}, "concept": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "display": {"type": "string"}}, "required": ["code", "display"]}}}, "required": ["system", "version", "concept"]}}}, "required": ["include"]}}, "required": ["resourceType", "id", "meta", "url", "version", "name", "title", "status", "date", "description", "compose"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"resourceType" : "ValueSet", "id" : "2.16.840.1.114222.4.11.7787", "meta" : {"source" : "https://phinvads.cdc.gov/vads/ViewValueSet.action?oid=2.16.840.1.114222.4.11.7787"}, "url" : "http://phinvads.cdc.gov/fhir/ValueSet/2.16.840.1.114222.4.11.7787", "version" : "1", "name" : "PHVS_FoodAllergy_Listeria", "title" : "Food Allergy (Listeria)", "status" : "active", "date" : "2018-01-08T00:05:00+11:00", "description" : "Food sensitivity", "compose" : {"include" : [{"system" : "http://snomed.info/sct", "version" : "http://snomed.info/sct/731000124108/version/20200301", "concept" : [{"code" : "91934008", "display" : "Tree nuts"}, {"code" : "91930004", "display" : "Eggs"}, {"code" : "417532002", "display" : "Fish"}, {"code" : "91935009", "display" : "Peanuts"}, {"code" : "714035009", "display" : "Soy"}, {"code" : "420174000", "display" : "Wheat"}, {"code" : "300913006", "display" : "Shellfish"}]}, {"system" : "urn:oid:2.16.840.1.114222.4.5.274", "version" : "20200526", "concept" : [{"code" : "PHC1998", "display" : "Milk"}]}, {"system" : "http://terminology.hl7.org/CodeSystem/v3-NullFlavor", "version" : "20090501", "concept" : [{"code" : "OTH", "display" : "Other (specify)"}]}]}}
json_instruct
{"type": "object", "properties": {"resourceType": {"type": "string"}, "id": {"type": "string"}, "meta": {"type": "object", "properties": {"source": {"type": "string"}}, "required": ["source"]}, "url": {"type": "string"}, "version": {"type": "string"}, "name": {"type": "string"}, "title": {"type": "string"}, "status": {"type": "string"}, "date": {"type": "string"}, "description": {"type": "string"}, "compose": {"type": "object", "properties": {"include": {"type": "array", "items": {"type": "object", "properties": {"system": {"type": "string"}, "version": {"type": "string"}, "concept": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "display": {"type": "string"}}, "required": ["code", "display"]}}}, "required": ["system", "version", "concept"]}}}, "required": ["include"]}}, "required": ["resourceType", "id", "meta", "url", "version", "name", "title", "status", "date", "description", "compose"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"docusaurus": {"type": "string"}, "start": {"type": "string"}, "build": {"type": "string"}, "swizzle": {"type": "string"}, "deploy": {"type": "string"}, "clear": {"type": "string"}, "serve": {"type": "string"}, "write-translations": {"type": "string"}, "write-heading-ids": {"type": "string"}}, "required": ["docusaurus", "start", "build", "swizzle", "deploy", "clear", "serve", "write-translations", "write-heading-ids"]}, "dependencies": {"type": "object", "properties": {"@docusaurus/core": {"type": "string"}, "@docusaurus/preset-classic": {"type": "string"}, "@docusaurus/theme-search-algolia": {"type": "string"}, "@tsconfig/docusaurus": {"type": "string"}, "cross-env": {"type": "string"}, "docusaurus-plugin-typedoc": {"type": "string"}, "prism-react-renderer": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}, "typedoc": {"type": "string"}, "typedoc-plugin-markdown": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@docusaurus/core", "@docusaurus/preset-classic", "@docusaurus/theme-search-algolia", "@tsconfig/docusaurus", "cross-env", "docusaurus-plugin-typedoc", "prism-react-renderer", "react", "react-dom", "typedoc", "typedoc-plugin-markdown", "typescript"]}}, "required": ["private", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"private" : true, "scripts" : {"docusaurus" : "docusaurus", "start" : "cross-env TYPEDOC_WATCH=true docusaurus start", "build" : "docusaurus build", "swizzle" : "docusaurus swizzle", "deploy" : "docusaurus deploy", "clear" : "docusaurus clear", "serve" : "docusaurus serve", "write-translations" : "docusaurus write-translations", "write-heading-ids" : "docusaurus write-heading-ids"}, "dependencies" : {"@docusaurus/core" : "2.0.0-beta.13", "@docusaurus/preset-classic" : "2.0.0-beta.13", "@docusaurus/theme-search-algolia" : "2.0.0-beta.13", "@tsconfig/docusaurus" : "~1.0.4", "cross-env" : "~7.0.3", "docusaurus-plugin-typedoc" : "0.16.6", "prism-react-renderer" : "~1.2.1", "react" : "~17.0.1", "react-dom" : "~17.0.1", "typedoc" : "~0.22.10", "typedoc-plugin-markdown" : "~3.11.7", "typescript" : "4.5.4"}}
json_instruct
{"type": "object", "properties": {"private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"docusaurus": {"type": "string"}, "start": {"type": "string"}, "build": {"type": "string"}, "swizzle": {"type": "string"}, "deploy": {"type": "string"}, "clear": {"type": "string"}, "serve": {"type": "string"}, "write-translations": {"type": "string"}, "write-heading-ids": {"type": "string"}}, "required": ["docusaurus", "start", "build", "swizzle", "deploy", "clear", "serve", "write-translations", "write-heading-ids"]}, "dependencies": {"type": "object", "properties": {"@docusaurus/core": {"type": "string"}, "@docusaurus/preset-classic": {"type": "string"}, "@docusaurus/theme-search-algolia": {"type": "string"}, "@tsconfig/docusaurus": {"type": "string"}, "cross-env": {"type": "string"}, "docusaurus-plugin-typedoc": {"type": "string"}, "prism-react-renderer": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}, "typedoc": {"type": "string"}, "typedoc-plugin-markdown": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@docusaurus/core", "@docusaurus/preset-classic", "@docusaurus/theme-search-algolia", "@tsconfig/docusaurus", "cross-env", "docusaurus-plugin-typedoc", "prism-react-renderer", "react", "react-dom", "typedoc", "typedoc-plugin-markdown", "typescript"]}}, "required": ["private", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "private": {"type": "boolean"}, "dependencies": {"type": "object", "properties": {"nutella_lib": {"type": "string"}}, "required": ["nutella_lib"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "private", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "aggregate-interface", "version" : "1.0.0", "description" : "Statistics interface for demo purpose", "main" : "index.html", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "repository" : {"type" : "git", "url" : "git+https://github.com/nutella-framework/aggregate-interface.git"}, "keywords" : ["nutella", "web", "interface", "base"], "author" : "Gianluca Venturini <gianluca.91@gmail.com>", "license" : "MIT", "bugs" : {"url" : "https://github.com/nutella-framework/aggregate-interface/issues"}, "homepage" : "https://github.com/nutella-framework/aggregate-interface#readme", "private" : true, "dependencies" : {"nutella_lib" : "^0.5.4"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "private": {"type": "boolean"}, "dependencies": {"type": "object", "properties": {"nutella_lib": {"type": "string"}}, "required": ["nutella_lib"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "private", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"parent" : "rankine:block/breccia_button_inventory"}
json_instruct
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"bl": {"type": "number"}, "cms": {"type": "number"}, "fs": {"type": "number"}, "le": {"type": "number"}, "mms": {"type": "number"}, "model": {"type": "string"}, "pe": {"type": "number"}, "qes": {"type": "number"}, "qms": {"type": "number"}, "qts": {"type": "number"}, "re": {"type": "number"}, "rms": {"type": "number"}, "sd": {"type": "number"}, "vas": {"type": "number"}, "vendor": {"type": "string"}, "xmax": {"type": "number"}}, "required": ["bl", "cms", "fs", "le", "mms", "model", "pe", "qes", "qms", "qts", "re", "rms", "sd", "vas", "vendor", "xmax"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"bl" : 22.3, "cms" : 0.000163, "fs" : 53.0, "le" : 0.00083, "mms" : 0.054, "model" : "12MH32", "pe" : 400.0, "qes" : 0.2, "qms" : 7.2, "qts" : 0.19, "re" : 5.2, "rms" : 2.53, "sd" : 0.0522, "vas" : 0.063, "vendor" : "B&CSpeakers", "xmax" : 0.005}
json_instruct
{"type": "object", "properties": {"bl": {"type": "number"}, "cms": {"type": "number"}, "fs": {"type": "number"}, "le": {"type": "number"}, "mms": {"type": "number"}, "model": {"type": "string"}, "pe": {"type": "number"}, "qes": {"type": "number"}, "qms": {"type": "number"}, "qts": {"type": "number"}, "re": {"type": "number"}, "rms": {"type": "number"}, "sd": {"type": "number"}, "vas": {"type": "number"}, "vendor": {"type": "string"}, "xmax": {"type": "number"}}, "required": ["bl", "cms", "fs", "le", "mms", "model", "pe", "qes", "qms", "qts", "re", "rms", "sd", "vas", "vendor", "xmax"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "d611-79", "text" : "WHAT CAN I DO?\nPublic Service Announcement #3\nCONTINUITY DEPT.\nVIDEO\n1ST MAN\nAUDIO\nBLUE-COLLAR NEGRO WORKERS IN\nFACTORY.\nWORDS \"WHAT CAN I DO?\" QUICKLY\nFLASH ON AND OFF SEVERAL TIMES.\nALTERNATING BLACK ON WHITE, THEN\nREVERSE; BOLD TYPE\nFACTORY SCENE\nDISSOLVE TO \"PROJECT\" TYPE STREET\nSCENE\nI know that most of the people in the area where I live\ndon\u2019t want any trouble and wouldn\u2019t think of starting\nany. But some wild stories get started that get people\nriled up and they sweep through the whole neighborhood\nin minutes. I know most of \u2019em probably aren\u2019t tirue,\nbut I\u2019m only one person. What can I do?\nANNOUNCER (ECHO CHAMBER)\nWhat can I do? What can I do?\n2ND MAN\nMan, that's how a lot of the trouble starts. From\nrumors and people gettin\u2019 all shook up about things that\nnever happened. Next time you hear one of them wild\nstories try and check it out. I'll bet you find they\u2019s\nnothin' to it. Then all you gotta do is convince people\nto cool it.\n3RD MAN\nHey, man, you heard all them sirens a while ago?\nCat down the block says that's the cops. Says he heard\nthey\u2019s gonna raid the playground and pull in all the\nkids for nothin\u2019. Musta been 'bout twenty cop cars.\n(more)"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"id": {"type": "string"}, "labels": {"type": "array", "items": {"type": "string"}}, "data": {"type": "object", "properties": {"name": {"type": "string"}, "latLng": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}}, "required": ["name", "latLng"]}}, "required": ["id", "labels", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "pedGAmV2l", "labels" : ["MapMarker"], "data" : {"name" : "pedGAmV2l", "latLng" : {"lat" : 77.157162522661, "lng" : 95.09765625}}}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "labels": {"type": "array", "items": {"type": "string"}}, "data": {"type": "object", "properties": {"name": {"type": "string"}, "latLng": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}}, "required": ["name", "latLng"]}}, "required": ["id", "labels", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "symfony/config": {"type": "string"}, "symfony/console": {"type": "string"}, "symfony/dependency-injection": {"type": "string"}, "symfony/yaml": {"type": "string"}}, "required": ["php", "symfony/config", "symfony/console", "symfony/dependency-injection", "symfony/yaml"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "symfony/var-dumper": {"type": "string"}}, "required": ["phpunit/phpunit", "symfony/var-dumper"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"App\\": {"type": "string"}}, "required": ["App\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Tests\\": {"type": "string"}}, "required": ["Tests\\"]}}, "required": ["psr-4"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "config": {"type": "object", "properties": {"sort-packages": {"type": "boolean"}}, "required": ["sort-packages"]}}, "required": ["name", "description", "type", "license", "authors", "require", "require-dev", "autoload", "autoload-dev", "scripts", "config"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "hmazter/console-skeleton", "description" : "Skeleton for a console application with DI-container and yaml-config", "type" : "project", "license" : "MIT", "authors" : [{"name" : "Kristoffer H\u00f6gberg", "email" : "krihog@gmail.com", "homepage" : "https://hmazter.com"}], "require" : {"php" : "^7.2", "symfony/config" : "^4.3", "symfony/console" : "^4.3", "symfony/dependency-injection" : "^4.3", "symfony/yaml" : "^4.3"}, "require-dev" : {"phpunit/phpunit" : "^8.2", "symfony/var-dumper" : "^4.3"}, "autoload" : {"psr-4" : {"App\\" : "src/"}}, "autoload-dev" : {"psr-4" : {"Tests\\" : "tests/"}}, "scripts" : {"test" : "./vendor/bin/phpunit"}, "config" : {"sort-packages" : true}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "symfony/config": {"type": "string"}, "symfony/console": {"type": "string"}, "symfony/dependency-injection": {"type": "string"}, "symfony/yaml": {"type": "string"}}, "required": ["php", "symfony/config", "symfony/console", "symfony/dependency-injection", "symfony/yaml"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "symfony/var-dumper": {"type": "string"}}, "required": ["phpunit/phpunit", "symfony/var-dumper"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"App\\": {"type": "string"}}, "required": ["App\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Tests\\": {"type": "string"}}, "required": ["Tests\\"]}}, "required": ["psr-4"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "config": {"type": "object", "properties": {"sort-packages": {"type": "boolean"}}, "required": ["sort-packages"]}}, "required": ["name", "description", "type", "license", "authors", "require", "require-dev", "autoload", "autoload-dev", "scripts", "config"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "main": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "ignore": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "homepage", "authors", "description", "main", "keywords", "license", "ignore"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "goggles", "version" : "0.1.2", "homepage" : "https://github.com/will-ob/goggles", "authors" : ["Will O'Brien <will.obrien@dibit.co>"], "description" : "Access google apis with less suck", "main" : "index.js", "keywords" : ["google", "api"], "license" : "MIT", "ignore" : ["**/.*", "goggles.png", "node_modules", "bower_components", "test", "tests"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "main": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "ignore": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "homepage", "authors", "description", "main", "keywords", "license", "ignore"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Making pattern queries bounded in big graphs.", "fields" : ["subgraph isomorphism problem", "bounded function", "pattern matching", "orders of magnitude", "query plan"], "abstract" : "It is cost-prohibitive to find matches Q(G) of a pattern query Q in a big graph G. We approach this by fetching a small subgraph G Q of G such that Q(G Q ) = Q(G). We show that many practical patterns are effectively bounded under access constraints A commonly found in real life, such that G Q can be identified in time determined by Q and A only, independent of the size |G| of G. This holds no matter whether pattern queries are localized (e.g., via subgraph isomorphism) or non-localized (graph simulation). We provide algorithms to decide whether a pattern Q is effectively bounded, and if so, to generate a query plan that computes Q(G) by accessing G Q , in time independent of |G|. When Q is not effectively bounded, we give an algorithm to extend access constraints and make Q bounded in G. Using real-life data, we experimentally verify the effectiveness of the approach, e.g., about 60% of queries are effectively bounded for subgraph isomorphism, and for such queries our approach outperforms the conventional methods by 4 orders of magnitude.", "citation" : "Citations (7)", "departments" : ["Beihang University", "University of Edinburgh", "Beihang University", "University of Edinburgh"], "authors" : ["Yang Cao.....http://dblp.org/pers/hd/c/Cao:Yang", "Wenfei Fan.....http://dblp.org/pers/hd/f/Fan:Wenfei", "Jinpeng Huai.....http://dblp.org/pers/hd/h/Huai:Jinpeng", "Ruizhe Huang.....http://dblp.org/pers/hd/h/Huang:Ruizhe"], "conf" : "icde", "year" : "2015", "pages" : 12}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "year": {"type": "string"}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "departments", "authors", "conf", "year", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"cwlVersion": {"type": "string"}, "class": {"type": "string"}, "inputs": {"type": "object", "properties": {"M": {"type": "object", "properties": {"type": {"type": "string"}, "inputBinding": {"type": "object", "properties": {"prefix": {"type": "string"}, "separate": {"type": "boolean"}, "itemSeparator": {"type": "string"}}, "required": ["prefix", "separate", "itemSeparator"]}, "doc": {"type": "string"}}, "required": ["type", "inputBinding", "doc"]}}, "required": ["M"]}, "outputs": {"type": "object", "properties": {}, "required": []}}, "required": ["cwlVersion", "class", "inputs", "outputs"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"cwlVersion" : "v1.0", "class" : "CommandLineTool", "inputs" : {"M" : {"type" : "File", "inputBinding" : {"prefix" : "proident amet", "separate" : true, "itemSeparator" : "sit minim"}, "doc" : "dolore enim"}}, "outputs" : {}}
json_instruct
{"type": "object", "properties": {"cwlVersion": {"type": "string"}, "class": {"type": "string"}, "inputs": {"type": "object", "properties": {"M": {"type": "object", "properties": {"type": {"type": "string"}, "inputBinding": {"type": "object", "properties": {"prefix": {"type": "string"}, "separate": {"type": "boolean"}, "itemSeparator": {"type": "string"}}, "required": ["prefix", "separate", "itemSeparator"]}, "doc": {"type": "string"}}, "required": ["type", "inputBinding", "doc"]}}, "required": ["M"]}, "outputs": {"type": "object", "properties": {}, "required": []}}, "required": ["cwlVersion", "class", "inputs", "outputs"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"namaKab" : "PELALAWAN", "originalFilename" : "Dok baru 2018-07-26 (2)_10.jpg", "namaPartai" : "Partai Gerakan Perubahan Indonesia", "id" : 267958, "noUrut" : 1, "nama" : "THONY PANAHATAN SIBARANI", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "PELALAWAN", "originalFilename" : "Dok baru 2018-07-26 (1)_7.jpg", "namaPartai" : "Partai Gerakan Perubahan Indonesia", "id" : 267204, "noUrut" : 2, "nama" : "DERES SIBARANI", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "PELALAWAN", "originalFilename" : "IMG_20180731_153503[1].jpg", "namaPartai" : "Partai Gerakan Perubahan Indonesia", "id" : 298699, "noUrut" : 3, "nama" : "SORTI MARISA SIMANJUNTAK", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "PELALAWAN", "originalFilename" : "Dok baru 2018-07-26_8.jpg", "namaPartai" : "Partai Gerakan Perubahan Indonesia", "id" : 268148, "noUrut" : 4, "nama" : "ERNITA SIBARANI, S.AB", "stringJenisKelamin" : "Perempuan"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"schema_version" : "1.2.0", "id" : "GHSA-fwhh-r6jr-f959", "modified" : "2022-05-13T01:31:07Z", "published" : "2022-05-13T01:31:07Z", "aliases" : ["CVE-2015-0179"], "details" : "Notes System Diagnostic (NSD) in IBM Domino 8.5.x before 8.5.3 FP6 IF6 and 9.x before 9.0.1 FP3 IF1 allows local users to obtain the System privilege via unspecified vectors, aka SPR TCHL9SST8V.", "severity" : [], "affected" : [], "references" : [{"type" : "ADVISORY", "url" : "https://nvd.nist.gov/vuln/detail/CVE-2015-0179"}, {"type" : "WEB", "url" : "https://www.exploit-db.com/exploits/42605/"}, {"type" : "WEB", "url" : "http://www-01.ibm.com/support/docview.wss?uid=swg21700029"}, {"type" : "WEB", "url" : "http://www.securitytracker.com/id/1032027"}], "database_specific" : {"cwe_ids" : [], "severity" : "HIGH", "github_reviewed" : false}}
json_instruct
{"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "run-default-command"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"e": {"type": "array", "items": {"type": "string"}}, "f": {"type": "string"}}, "required": ["e", "f"]}}}, "required": ["d"]}}, "stem": {"type": "string"}, "t": {"type": "string"}}, "required": ["h", "stem", "t"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"h" : [{"d" : [{"e" : ["\ufff9`Sapi'ofongaw~ `ira~ `toya~ `loma'~.\ufffa\ufffb\u4ed6\u60f3\u7ffb\u4fee\u90a3\u9593\u623f\u5b50\u3002"], "f" : "\u60f3\u7ffb\u4fee\u5c4b\u9802\u3002"}]}], "stem" : "'ofong", "t" : "sapi'ofongaw"}
json_instruct
{"type": "object", "properties": {"h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"e": {"type": "array", "items": {"type": "string"}}, "f": {"type": "string"}}, "required": ["e", "f"]}}}, "required": ["d"]}}, "stem": {"type": "string"}, "t": {"type": "string"}}, "required": ["h", "stem", "t"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Johnwilson008\\NotifyRobot\\": {"type": "string"}}, "required": ["Johnwilson008\\NotifyRobot\\"]}}, "required": ["psr-4"]}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "require": {"type": "object", "properties": {}, "required": []}, "license": {"type": "string"}}, "required": ["name", "description", "autoload", "authors", "require", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "johnwilson008/notify-robot", "description" : "webhook-notify", "autoload" : {"psr-4" : {"Johnwilson008\\NotifyRobot\\" : "src/"}}, "authors" : [{"name" : "JohnWilson008", "email" : "JohnWilson008@protonmail.com"}], "require" : {}, "license" : "MIT"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Johnwilson008\\NotifyRobot\\": {"type": "string"}}, "required": ["Johnwilson008\\NotifyRobot\\"]}}, "required": ["psr-4"]}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "require": {"type": "object", "properties": {}, "required": []}, "license": {"type": "string"}}, "required": ["name", "description", "autoload", "authors", "require", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "start": {"type": "string"}, "lint": {"type": "string"}}, "required": ["build", "start", "lint"]}, "dependencies": {"type": "object", "properties": {"@polkadot/api": {"type": "string"}, "@polkadot/util": {"type": "string"}, "@polkadot/util-crypto": {"type": "string"}, "filter-console": {"type": "string"}, "typescript": {"type": "string"}, "yargs": {"type": "string"}, "yarn": {"type": "string"}}, "required": ["@polkadot/api", "@polkadot/util", "@polkadot/util-crypto", "filter-console", "typescript", "yargs", "yarn"]}, "files": {"type": "array", "items": {"type": "string"}}, "bin": {"type": "object", "properties": {"polkadot-launch": {"type": "string"}}, "required": ["polkadot-launch"]}, "devDependencies": {"type": "object", "properties": {"prettier": {"type": "string"}}, "required": ["prettier"]}}, "required": ["name", "version", "main", "author", "license", "scripts", "dependencies", "files", "bin", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "polkadot-launch", "version" : "1.3.1", "main" : "dist/index.js", "author" : "Shawn Tabrizi <shawntabrizi@gmail.com>", "license" : "MIT", "scripts" : {"build" : "tsc", "start" : "yarn build && node dist/index.js ../config.json", "lint" : "npx prettier --write ."}, "dependencies" : {"@polkadot/api" : "^4.5.1", "@polkadot/util" : "^6.1.1", "@polkadot/util-crypto" : "^6.1.1", "filter-console" : "^0.1.1", "typescript" : "^4.1.5", "yargs" : "^15.4.1", "yarn" : "^1.22.10"}, "files" : ["dist"], "bin" : {"polkadot-launch" : "dist/index.js"}, "devDependencies" : {"prettier" : "2.2.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "start": {"type": "string"}, "lint": {"type": "string"}}, "required": ["build", "start", "lint"]}, "dependencies": {"type": "object", "properties": {"@polkadot/api": {"type": "string"}, "@polkadot/util": {"type": "string"}, "@polkadot/util-crypto": {"type": "string"}, "filter-console": {"type": "string"}, "typescript": {"type": "string"}, "yargs": {"type": "string"}, "yarn": {"type": "string"}}, "required": ["@polkadot/api", "@polkadot/util", "@polkadot/util-crypto", "filter-console", "typescript", "yargs", "yarn"]}, "files": {"type": "array", "items": {"type": "string"}}, "bin": {"type": "object", "properties": {"polkadot-launch": {"type": "string"}}, "required": ["polkadot-launch"]}, "devDependencies": {"type": "object", "properties": {"prettier": {"type": "string"}}, "required": ["prettier"]}}, "required": ["name", "version", "main", "author", "license", "scripts", "dependencies", "files", "bin", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"n_dim" : 34, "n_trials" : 340, "objective" : "markowitz_realized_on_cube", "white" : "platypus_ibea", "black" : "pymoo_nsga3", "traceback" : ["passing", "passing"], "best_val" : [8.77261219040875, 10.275540258062328], "best_x" : [[0.15781773657127662, 0.9282704660256319, 0.25524723203331906, 0.48978362338548054, 0.6532016393090347, 0.07380024364994353, 0.7835255860414435, 0.2613747381434217, 0.10426684977968159, 0.02993765090163003, 0.43356029815932223, 0.09552928509775971, 0.2682504664893829, 0.007534032964279236, 0.08135520692248954, 0.07935689709529803, 0.7505390915588122, 0.034613904060355916, 0.7994636083860802, 0.37321299125666185, 0.16269925185825085, 0.08436516973782116, 0.326444150539841, 0.4189013555882046, 0.1532589196321035, 0.10703593613180451, 0.057598137899352864, 0.05474156342916858, 0.22388937386756527, 0.07321808623906367, 0.43345206038219664, 0.02742480714928741, 0.9999861954620316, 0.32860878825160583], [0.291871750104019, 0.12154660563776254, 0.22359370014330493, 0.24792486031704442, 0.6350271165386203, 0.8773479572952483, 0.5170801730287083, 0.5514023124253862, 0.5974010643436809, 0.3659860911795618, 0.041677360783979656, 0.8084033896206504, 0.5250989300361995, 0.3701915571103348, 0.0005255038650072708, 0.01783443260777795, 0.1523376559787024, 0.059506816298819265, 0.60367605303513, 0.21473030829528839, 0.6665130874123603, 0.14043833933101557, 0.02606018219401607, 9.434182835643679e-05, 0.020888007272345632, 0.5123508647004913, 0.7158952023445794, 0.48142857370537384, 4.41502763415258e-06, 0.37049997044241556, 0.6688601918763224, 0.17777158164152795, 0.003389440248434905, 0.6078281596239036]], "feval_count" : [300, 300], "n_trials_instructed" : [237, 300], "passing" : [true, true], "completed" : true, "points" : 1.0, "winner" : "platypus_ibea", "loser" : "pymoo_nsga3"}
json_instruct
{"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "repository": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "main": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"@phenomic/babel-preset": {"type": "string"}, "babel-loader": {"type": "string"}, "chalk": {"type": "string"}, "css-loader": {"type": "string"}, "debug": {"type": "string"}, "extract-text-webpack-plugin": {"type": "string"}, "find-cache-dir": {"type": "string"}, "multili": {"type": "string"}, "react-hot-loader": {"type": "string"}, "source-map-support": {"type": "string"}, "style-loader": {"type": "string"}, "webpack": {"type": "string"}, "webpack-dev-middleware": {"type": "string"}, "webpack-hot-middleware": {"type": "string"}}, "required": ["@phenomic/babel-preset", "babel-loader", "chalk", "css-loader", "debug", "extract-text-webpack-plugin", "find-cache-dir", "multili", "react-hot-loader", "source-map-support", "style-loader", "webpack", "webpack-dev-middleware", "webpack-hot-middleware"]}, "peerDependencies": {"type": "object", "properties": {"@phenomic/core": {"type": "string"}}, "required": ["@phenomic/core"]}, "devDependencies": {"type": "object", "properties": {"@phenomic/core": {"type": "string"}}, "required": ["@phenomic/core"]}}, "required": ["name", "version", "publishConfig", "repository", "homepage", "license", "authors", "keywords", "description", "main", "files", "dependencies", "peerDependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@phenomic/plugin-bundler-webpack", "version" : "1.0.0-beta.1", "publishConfig" : {"access" : "public"}, "repository" : "https://github.com/phenomic/phenomic.git", "homepage" : "https://phenomic.io", "license" : "MIT", "authors" : ["Maxime Thirouin (MoOx)", "bloodyowl <bloodyowl@icloud.com>"], "keywords" : ["static", "website", "generator", "compiler", "phenomic", "phenomic-plugin", "phenomic-plugin-renderer", "renderer", "react"], "description" : "Phenomic plugin that allow you to use webpack to bundle you website/app", "main" : "lib/index.js", "files" : ["lib", "src", "!**/__tests__"], "dependencies" : {"@phenomic/babel-preset" : "^1.0.0-beta.1", "babel-loader" : "^7.0.0", "chalk" : "^1.1.3", "css-loader" : "^0.28.0", "debug" : "^2.6.0", "extract-text-webpack-plugin" : "^3.0.0", "find-cache-dir" : "^0.1.1", "multili" : "^1.1.0", "react-hot-loader" : "^3.0.0-beta.7", "source-map-support" : "^0.4.0", "style-loader" : "^0.16.1", "webpack" : "^3.0.0", "webpack-dev-middleware" : "^1.10.0", "webpack-hot-middleware" : "^2.18.0"}, "peerDependencies" : {"@phenomic/core" : "^1.0.0-beta.1"}, "devDependencies" : {"@phenomic/core" : "^1.0.0-beta.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "repository": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "main": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"@phenomic/babel-preset": {"type": "string"}, "babel-loader": {"type": "string"}, "chalk": {"type": "string"}, "css-loader": {"type": "string"}, "debug": {"type": "string"}, "extract-text-webpack-plugin": {"type": "string"}, "find-cache-dir": {"type": "string"}, "multili": {"type": "string"}, "react-hot-loader": {"type": "string"}, "source-map-support": {"type": "string"}, "style-loader": {"type": "string"}, "webpack": {"type": "string"}, "webpack-dev-middleware": {"type": "string"}, "webpack-hot-middleware": {"type": "string"}}, "required": ["@phenomic/babel-preset", "babel-loader", "chalk", "css-loader", "debug", "extract-text-webpack-plugin", "find-cache-dir", "multili", "react-hot-loader", "source-map-support", "style-loader", "webpack", "webpack-dev-middleware", "webpack-hot-middleware"]}, "peerDependencies": {"type": "object", "properties": {"@phenomic/core": {"type": "string"}}, "required": ["@phenomic/core"]}, "devDependencies": {"type": "object", "properties": {"@phenomic/core": {"type": "string"}}, "required": ["@phenomic/core"]}}, "required": ["name", "version", "publishConfig", "repository", "homepage", "license", "authors", "keywords", "description", "main", "files", "dependencies", "peerDependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "description": {"type": "string"}, "keyImages": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}, "md5": {"type": "string"}, "width": {"type": "integer"}, "height": {"type": "integer"}, "size": {"type": "integer"}, "uploadedDate": {"type": "string"}}, "required": ["type", "url", "md5", "width", "height", "size", "uploadedDate"]}}, "categories": {"type": "array", "items": {"type": "object", "properties": {"path": {"type": "string"}}, "required": ["path"]}}, "namespace": {"type": "string"}, "status": {"type": "string"}, "creationDate": {"type": "string"}, "lastModifiedDate": {"type": "string"}, "customAttributes": {"type": "object", "properties": {"SupportedPlatforms": {"type": "object", "properties": {"type": {"type": "string"}, "value": {"type": "string"}}, "required": ["type", "value"]}}, "required": ["SupportedPlatforms"]}, "entitlementName": {"type": "string"}, "entitlementType": {"type": "string"}, "itemType": {"type": "string"}, "developer": {"type": "string"}, "developerId": {"type": "string"}, "eulaIds": {"type": "array", "items": {"type": "string"}}, "endOfSupport": {"type": "boolean"}, "esrbGameRatingValue": {"type": "string"}, "ageGatings": {"type": "object", "properties": {}, "required": []}, "applicationId": {"type": "string"}, "requiresSecureAccount": {"type": "boolean"}, "unsearchable": {"type": "boolean"}}, "required": ["id", "title", "description", "keyImages", "categories", "namespace", "status", "creationDate", "lastModifiedDate", "customAttributes", "entitlementName", "entitlementType", "itemType", "developer", "developerId", "eulaIds", "endOfSupport", "esrbGameRatingValue", "ageGatings", "applicationId", "requiresSecureAccount", "unsearchable"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "3f0e402b13894701a037972dfe533506", "title" : "Cyberpunk 2077 General Audience", "description" : "Cyberpunk 2077 General Audience", "keyImages" : [{"type" : "ESRB", "url" : "https://cdn1.epicgames.com/77f2b98e2cef40c8a7437518bf420e47/item/esrb-cyberpunk2077-842x404-95e74b819297916c531a83a7376d9d7e.png", "md5" : "95e74b819297916c531a83a7376d9d7e", "width" : 842, "height" : 404, "size" : 23914, "uploadedDate" : "2021-03-23T23:54:36.174Z"}], "categories" : [{"path" : "audience"}, {"path" : "public"}], "namespace" : "77f2b98e2cef40c8a7437518bf420e47", "status" : "ACTIVE", "creationDate" : "2019-06-07T19:03:29.123Z", "lastModifiedDate" : "2021-03-23T23:54:41.287Z", "customAttributes" : {"SupportedPlatforms" : {"type" : "STRING", "value" : "Windows"}}, "entitlementName" : "3f0e402b13894701a037972dfe533506", "entitlementType" : "AUDIENCE", "itemType" : "DURABLE", "developer" : "CD PROJEKT RED", "developerId" : "o-x2vdjaf7cfakvlsgz8qf2gx8bkplcc", "eulaIds" : ["egstore"], "endOfSupport" : false, "esrbGameRatingValue" : "MATURE", "ageGatings" : {}, "applicationId" : "", "requiresSecureAccount" : false, "unsearchable" : false}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "description": {"type": "string"}, "keyImages": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}, "md5": {"type": "string"}, "width": {"type": "integer"}, "height": {"type": "integer"}, "size": {"type": "integer"}, "uploadedDate": {"type": "string"}}, "required": ["type", "url", "md5", "width", "height", "size", "uploadedDate"]}}, "categories": {"type": "array", "items": {"type": "object", "properties": {"path": {"type": "string"}}, "required": ["path"]}}, "namespace": {"type": "string"}, "status": {"type": "string"}, "creationDate": {"type": "string"}, "lastModifiedDate": {"type": "string"}, "customAttributes": {"type": "object", "properties": {"SupportedPlatforms": {"type": "object", "properties": {"type": {"type": "string"}, "value": {"type": "string"}}, "required": ["type", "value"]}}, "required": ["SupportedPlatforms"]}, "entitlementName": {"type": "string"}, "entitlementType": {"type": "string"}, "itemType": {"type": "string"}, "developer": {"type": "string"}, "developerId": {"type": "string"}, "eulaIds": {"type": "array", "items": {"type": "string"}}, "endOfSupport": {"type": "boolean"}, "esrbGameRatingValue": {"type": "string"}, "ageGatings": {"type": "object", "properties": {}, "required": []}, "applicationId": {"type": "string"}, "requiresSecureAccount": {"type": "boolean"}, "unsearchable": {"type": "boolean"}}, "required": ["id", "title", "description", "keyImages", "categories", "namespace", "status", "creationDate", "lastModifiedDate", "customAttributes", "entitlementName", "entitlementType", "itemType", "developer", "developerId", "eulaIds", "endOfSupport", "esrbGameRatingValue", "ageGatings", "applicationId", "requiresSecureAccount", "unsearchable"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "build": {"type": "string"}, "start": {"type": "string"}}, "required": ["dev", "build", "start"]}, "dependencies": {"type": "object", "properties": {"glob": {"type": "string"}, "glob-promise": {"type": "string"}, "next": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}}, "required": ["glob", "glob-promise", "next", "react", "react-dom"]}}, "required": ["name", "version", "private", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@design-system/site", "version" : "0.1.0", "private" : true, "scripts" : {"dev" : "next", "build" : "next build", "start" : "next start"}, "dependencies" : {"glob" : "^7.1.3", "glob-promise" : "^3.4.0", "next" : "^9.0.2", "react" : "^16.8.9", "react-dom" : "^16.8.3"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "build": {"type": "string"}, "start": {"type": "string"}}, "required": ["dev", "build", "start"]}, "dependencies": {"type": "object", "properties": {"glob": {"type": "string"}, "glob-promise": {"type": "string"}, "next": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}}, "required": ["glob", "glob-promise", "next", "react", "react-dom"]}}, "required": ["name", "version", "private", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"mt0": {"type": "object", "properties": {"write": {"type": "object", "properties": {"device_start": {"type": "number"}, "host_queued_start": {"type": "number"}, "device_queued": {"type": "number"}, "device_end": {"type": "number"}, "host_queued_end": {"type": "number"}}, "required": ["device_start", "host_queued_start", "device_queued", "device_end", "host_queued_end"]}, "device": {"type": "string"}, "nd_range": {"type": "object", "properties": {"device_start": {"type": "number"}, "device_end": {"type": "number"}}, "required": ["device_start", "device_end"]}, "cmdq": {"type": "integer"}, "read": {"type": "object", "properties": {"device_start": {"type": "number"}, "device_end": {"type": "number"}}, "required": ["device_start", "device_end"]}}, "required": ["write", "device", "nd_range", "cmdq", "read"]}}, "required": ["mt0"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"mt0" : {"write" : {"device_start" : 1586235929.8042305, "host_queued_start" : 1586236013.881082, "device_queued" : 1586235929.803964, "device_end" : 1586235929.8052227, "host_queued_end" : 1586236013.881443}, "device" : "gpu", "nd_range" : {"device_start" : 1586235929.8052273, "device_end" : 1586235929.805408}, "cmdq" : 0, "read" : {"device_start" : 1586235929.8054152, "device_end" : 1586235929.8066015}}}
json_instruct
{"type": "object", "properties": {"mt0": {"type": "object", "properties": {"write": {"type": "object", "properties": {"device_start": {"type": "number"}, "host_queued_start": {"type": "number"}, "device_queued": {"type": "number"}, "device_end": {"type": "number"}, "host_queued_end": {"type": "number"}}, "required": ["device_start", "host_queued_start", "device_queued", "device_end", "host_queued_end"]}, "device": {"type": "string"}, "nd_range": {"type": "object", "properties": {"device_start": {"type": "number"}, "device_end": {"type": "number"}}, "required": ["device_start", "device_end"]}, "cmdq": {"type": "integer"}, "read": {"type": "object", "properties": {"device_start": {"type": "number"}, "device_end": {"type": "number"}}, "required": ["device_start", "device_end"]}}, "required": ["write", "device", "nd_range", "cmdq", "read"]}}, "required": ["mt0"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "districtId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "districtId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "2001", "provinceId" : "91", "regencyId" : "04", "districtId" : "07", "name" : "Bumi Mulia"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "districtId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "districtId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"extends": {"type": "array", "items": {"type": "string"}}}, "required": ["extends"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"extends" : ["github>erezrokah/shared-configurations:renovate-default"]}
json_instruct
{"type": "object", "properties": {"extends": {"type": "array", "items": {"type": "string"}}}, "required": ["extends"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"f": {"type": "string"}}, "required": ["f"]}}}, "required": ["d"]}}, "t": {"type": "string"}}, "required": ["h", "t"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"h" : [{"d" : [{"f" : "\ufff9\ufffaopen space that formerly was woods or brush\ufffb\u4ee5\u524d\u662f\u53e2\u6797\u704c\u6728\uff0c\u73fe\u5df2\u95e2\u70ba\u7a7a\u66e0\u4e4b\u5730"}]}], "t" : "dahtal"}
json_instruct
{"type": "object", "properties": {"h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"f": {"type": "string"}}, "required": ["f"]}}}, "required": ["d"]}}, "t": {"type": "string"}}, "required": ["h", "t"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "array", "items": {"type": "object", "properties": {"province": {"type": "string"}, "city": {"type": "string"}, "area": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}, "address": {"type": "string"}, "phone": {"type": "string"}}, "required": ["province", "city", "area", "name", "code", "address", "phone"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"province" : "\u5317\u4eac\u5e02", "city" : "\u5317\u4eac\u5e02", "area" : "\u5ef6\u5e86\u533a", "name" : "\u4e1c\u5916\u5927\u8857\u90ae\u653f\u652f\u5c40", "code" : "102100", "address" : "\u5ef6\u5e86\u533a\u4e1c\u5916\u5927\u885779\u53f7(\u5907\u6ce8\uff1a\u90ae\u50a8\u94f6\u884c100\u7c73\u5185\uff09", "phone" : "010-69175227"}, {"province" : "\u5317\u4eac\u5e02", "city" : "\u5317\u4eac\u5e02", "area" : "\u5ef6\u5e86\u533a", "name" : "\u9ad8\u5854\u8def\u90ae\u653f\u6240", "code" : "102100", "address" : "\u5ef6\u5e86\u533a\u9ad8\u5854\u8def273\u53f7", "phone" : "010-69180503"}, {"province" : "\u5317\u4eac\u5e02", "city" : "\u5317\u4eac\u5e02", "area" : "\u5ef6\u5e86\u533a", "name" : "\u4e1c\u8857\u90ae\u653f\u6240", "code" : "102100", "address" : "\u5ef6\u5e86\u533a\u4e1c\u88571\u53f7", "phone" : "010-69145010"}, {"province" : "\u5317\u4eac\u5e02", "city" : "\u5317\u4eac\u5e02", "area" : "\u5ef6\u5e86\u533a", "name" : "\u9999\u6c34\u82d1\u90ae\u653f\u6240", "code" : "102100", "address" : "\u4e1c\u5916\u5927\u885760\u53f7", "phone" : "010-69186217"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"province": {"type": "string"}, "city": {"type": "string"}, "area": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}, "address": {"type": "string"}, "phone": {"type": "string"}}, "required": ["province", "city", "area", "name", "code", "address", "phone"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "3326130023", "district_id" : "3326130", "name" : "AMBOKEMBANG"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"manifest_version": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "icons": {"type": "object", "properties": {"16": {"type": "string"}, "48": {"type": "string"}, "128": {"type": "string"}}, "required": ["16", "48", "128"]}, "browser_action": {"type": "object", "properties": {"default_icon": {"type": "string"}, "default_title": {"type": "string"}}, "required": ["default_icon", "default_title"]}, "background": {"type": "object", "properties": {"scripts": {"type": "array", "items": {"type": "string"}}}, "required": ["scripts"]}, "permissions": {"type": "array", "items": {"type": "string"}}, "options_ui": {"type": "object", "properties": {"chrome_style": {"type": "boolean"}, "page": {"type": "string"}}, "required": ["chrome_style", "page"]}}, "required": ["manifest_version", "name", "description", "version", "icons", "browser_action", "background", "permissions", "options_ui"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"manifest_version" : 2, "name" : "WebPageTest", "description" : "This extension launches WebPageTest for the current page", "version" : "1.0", "icons" : {"16" : "wpt16.png", "48" : "wpt48.png", "128" : "wpt128.png"}, "browser_action" : {"default_icon" : "wpt48.png", "default_title" : "Test performance"}, "background" : {"scripts" : ["background.js"]}, "permissions" : ["activeTab", "storage"], "options_ui" : {"chrome_style" : true, "page" : "options.html"}}
json_instruct
{"type": "object", "properties": {"manifest_version": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "icons": {"type": "object", "properties": {"16": {"type": "string"}, "48": {"type": "string"}, "128": {"type": "string"}}, "required": ["16", "48", "128"]}, "browser_action": {"type": "object", "properties": {"default_icon": {"type": "string"}, "default_title": {"type": "string"}}, "required": ["default_icon", "default_title"]}, "background": {"type": "object", "properties": {"scripts": {"type": "array", "items": {"type": "string"}}}, "required": ["scripts"]}, "permissions": {"type": "array", "items": {"type": "string"}}, "options_ui": {"type": "object", "properties": {"chrome_style": {"type": "boolean"}, "page": {"type": "string"}}, "required": ["chrome_style", "page"]}}, "required": ["manifest_version", "name", "description", "version", "icons", "browser_action", "background", "permissions", "options_ui"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"process": {"type": "string"}, "processURI": {"type": "string"}, "editorsDraft": {"type": "string"}, "title": {"type": "string"}, "shortname": {"type": "string"}, "status": {"type": "string"}, "editorIDs": {"type": "array", "items": {"type": "integer"}}, "previousVersion": {"type": "string"}, "groupName": {"type": "string"}, "groupHomepage": {"type": "string"}, "groupID": {"type": "integer"}, "list": {"type": "string"}, "rectrack": {"type": "boolean"}}, "required": ["process", "processURI", "editorsDraft", "title", "shortname", "status", "editorIDs", "previousVersion", "groupName", "groupHomepage", "groupID", "list", "rectrack"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"process" : "1 March 2017", "processURI" : "https://www.w3.org/2017/Process-20170301/", "editorsDraft" : "http://w3c.github.io/navigation-timing/", "title" : "Navigation Timing 2", "shortname" : "navigation-timing-2", "status" : "WD", "editorIDs" : [44357, 69474, 45188], "previousVersion" : "https://www.w3.org/TR/2017/WD-navigation-timing-2-20170925/", "groupName" : "Web Performance Working Group", "groupHomepage" : "http://www.w3.org/webperf/", "groupID" : 45211, "list" : "public-web-perf", "rectrack" : true}
json_instruct
{"type": "object", "properties": {"process": {"type": "string"}, "processURI": {"type": "string"}, "editorsDraft": {"type": "string"}, "title": {"type": "string"}, "shortname": {"type": "string"}, "status": {"type": "string"}, "editorIDs": {"type": "array", "items": {"type": "integer"}}, "previousVersion": {"type": "string"}, "groupName": {"type": "string"}, "groupHomepage": {"type": "string"}, "groupID": {"type": "integer"}, "list": {"type": "string"}, "rectrack": {"type": "boolean"}}, "required": ["process", "processURI", "editorsDraft", "title", "shortname", "status", "editorIDs", "previousVersion", "groupName", "groupHomepage", "groupID", "list", "rectrack"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "summary": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "object", "properties": {"Arthur Ariel Sabintsev": {"type": "string"}}, "required": ["Arthur Ariel Sabintsev"]}, "platforms": {"type": "object", "properties": {"ios": {"type": "string"}}, "required": ["ios"]}, "source": {"type": "object", "properties": {"git": {"type": "string"}, "tag": {"type": "string"}}, "required": ["git", "tag"]}, "source_files": {"type": "string"}, "requires_arc": {"type": "boolean"}}, "required": ["name", "version", "summary", "description", "homepage", "license", "authors", "platforms", "source", "source_files", "requires_arc"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Magic", "version" : "2.0.2", "summary" : "An alternative for Swift's print() along the lines of DLog.", "description" : "If you're like me, you miss seeing the filename, method name, and/or line number in your print() statements in your Swift projects.\n\nFear not, Magic is here to bring you back to the goold old days of DLog.\nSiren is actively maintained by Arthur Sabintsev.", "homepage" : "https://github.com/ArtSabintsev/Magic", "license" : "MIT", "authors" : {"Arthur Ariel Sabintsev" : "arthur@sabintsev.com"}, "platforms" : {"ios" : "8.0"}, "source" : {"git" : "https://github.com/ArtSabintsev/Magic.git", "tag" : "2.0.2"}, "source_files" : "Magic.swift", "requires_arc" : true}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "summary": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "object", "properties": {"Arthur Ariel Sabintsev": {"type": "string"}}, "required": ["Arthur Ariel Sabintsev"]}, "platforms": {"type": "object", "properties": {"ios": {"type": "string"}}, "required": ["ios"]}, "source": {"type": "object", "properties": {"git": {"type": "string"}, "tag": {"type": "string"}}, "required": ["git", "tag"]}, "source_files": {"type": "string"}, "requires_arc": {"type": "boolean"}}, "required": ["name", "version", "summary", "description", "homepage", "license", "authors", "platforms", "source", "source_files", "requires_arc"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"sp-addinhelpers.es5.js": {"type": "string"}, "sp-addinhelpers.es5.umd.bundle.js": {"type": "string"}, "sp-addinhelpers.es5.umd.bundle.min.js": {"type": "string"}, "sp-addinhelpers.es5.umd.js": {"type": "string"}, "sp-addinhelpers.es5.umd.min.js": {"type": "string"}, "sp-addinhelpers.js": {"type": "string"}}, "required": ["sp-addinhelpers.es5.js", "sp-addinhelpers.es5.umd.bundle.js", "sp-addinhelpers.es5.umd.bundle.min.js", "sp-addinhelpers.es5.umd.js", "sp-addinhelpers.es5.umd.min.js", "sp-addinhelpers.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"sp-addinhelpers.es5.js" : "sha512-YxYWqFH2ymmoCNIH72sqMx7dkXG4ldQwtuKa0W5uWz1EF6jsu+3lesRy0Qykm7qidmBYlmOAVISPNQDwXeJjkg==", "sp-addinhelpers.es5.umd.bundle.js" : "sha512-mSpX11ZboFhbmNrvbs8qTIDsg7ghrvf5s3eII6nSMrAMwQ2TkvmSdcyNRAhcfZv2+5IIzwRmtmJ/a32RqIHK7w==", "sp-addinhelpers.es5.umd.bundle.min.js" : "sha512-+rDH5tFd46xFx5mdP3ofd1daZDKS2RF27XbcpwGLAE14LHgLUzon/Vzj636iH0+ddG68aUyXmhYwoLfnSDcOBg==", "sp-addinhelpers.es5.umd.js" : "sha512-SdRXrKRHIHxS0712KV1IqMeog1EjCRx3ioqvh9eIaew1j8laIh1NRdkoZRI6GaZmYyIOtecRlhBYTzk9yPxg5w==", "sp-addinhelpers.es5.umd.min.js" : "sha512-5c+H47IeHEH51hLcfCb7nv3eyDiPF2um9IqbEa4k0u4C8tDjE0qkCTs5iEwSkaVpxJ4WlwbK8OHnWFfoPDBhfQ==", "sp-addinhelpers.js" : "sha512-qkOVwsgdvro0ggaK2AJde8MQxnd05CmMODCm+WMrr9yVXvyaGU0JN2tKsIC+RatI2uz+0qrDWmUmcgs3T4qmYQ=="}
json_instruct
{"type": "object", "properties": {"sp-addinhelpers.es5.js": {"type": "string"}, "sp-addinhelpers.es5.umd.bundle.js": {"type": "string"}, "sp-addinhelpers.es5.umd.bundle.min.js": {"type": "string"}, "sp-addinhelpers.es5.umd.js": {"type": "string"}, "sp-addinhelpers.es5.umd.min.js": {"type": "string"}, "sp-addinhelpers.js": {"type": "string"}}, "required": ["sp-addinhelpers.es5.js", "sp-addinhelpers.es5.umd.bundle.js", "sp-addinhelpers.es5.umd.bundle.min.js", "sp-addinhelpers.es5.umd.js", "sp-addinhelpers.es5.umd.min.js", "sp-addinhelpers.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "ignore": {"type": "array", "items": {"type": "string"}}, "devDependencies": {"type": "object", "properties": {"lil-http": {"type": "string"}}, "required": ["lil-http"]}}, "required": ["name", "description", "version", "license", "repository", "author", "homepage", "keywords", "ignore", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "butler", "description" : "An elegant, friendly and courteous butler to avoid headaches with Service Workers", "version" : "0.1.0", "license" : "MIT", "repository" : "h2non/butler", "author" : "Tomas Aparicio", "homepage" : "https://github.com/h2non/butler", "keywords" : ["serviceworker", "service", "worker", "http", "mock", "mocking", "intercetor", "background", "traffic", "cache", "proxy"], "ignore" : ["**/.*", ".*", "*.md", "test", "lib", "examples", "Makefile", "karma.conf.js", ".editorconfig", ".gitignore", ".travis.yml", ".npmignore", "package.json", "component.json"], "devDependencies" : {"lil-http" : "~0.1.15"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "ignore": {"type": "array", "items": {"type": "string"}}, "devDependencies": {"type": "object", "properties": {"lil-http": {"type": "string"}}, "required": ["lil-http"]}}, "required": ["name", "description", "version", "license", "repository", "author", "homepage", "keywords", "ignore", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"config": {"type": "object", "properties": {"abort": {"type": "object", "properties": {"one_instance_allowed": {"type": "string"}}, "required": ["one_instance_allowed"]}}, "required": ["abort"]}}, "required": ["config"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"config" : {"abort" : {"one_instance_allowed" : "Csak egyetlen konfigur\u00e1ci\u00f3 sz\u00fcks\u00e9ges."}}}
json_instruct
{"type": "object", "properties": {"config": {"type": "object", "properties": {"abort": {"type": "object", "properties": {"one_instance_allowed": {"type": "string"}}, "required": ["one_instance_allowed"]}}, "required": ["abort"]}}, "required": ["config"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"title": {"type": "string"}, "context": {"type": "object", "properties": {"backgroundPrev": {"type": "string"}, "backgroundNext": {"type": "string"}}, "required": ["backgroundPrev", "backgroundNext"]}}, "required": ["title", "context"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Separator", "context" : {"backgroundPrev" : "u-background-50", "backgroundNext" : "u-background-grey-20"}}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "context": {"type": "object", "properties": {"backgroundPrev": {"type": "string"}, "backgroundNext": {"type": "string"}}, "required": ["backgroundPrev", "backgroundNext"]}}, "required": ["title", "context"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"user": {"type": "string"}, "repos": {"type": "integer"}, "login": {"type": "string"}, "id": {"type": "integer"}, "avatar_url": {"type": "string"}, "url": {"type": "string"}, "html_url": {"type": "string"}, "followers_url": {"type": "string"}, "following_url": {"type": "string"}, "gists_url": {"type": "string"}, "starred_url": {"type": "string"}, "subscriptions_url": {"type": "string"}, "organizations_url": {"type": "string"}, "repos_url": {"type": "string"}, "events_url": {"type": "string"}, "received_events_url": {"type": "string"}, "type": {"type": "string"}, "site_admin": {"type": "boolean"}, "name": {"type": "string"}, "company": {"type": "null"}, "blog": {"type": "null"}, "location": {"type": "string"}, "email": {"type": "null"}, "hireable": {"type": "null"}, "bio": {"type": "null"}, "public_repos": {"type": "integer"}, "public_gists": {"type": "integer"}, "followers": {"type": "integer"}, "following": {"type": "integer"}, "created_at": {"type": "string"}, "updated_at": {"type": "string"}}, "required": ["user", "repos", "login", "id", "avatar_url", "url", "html_url", "followers_url", "following_url", "gists_url", "starred_url", "subscriptions_url", "organizations_url", "repos_url", "events_url", "received_events_url", "type", "site_admin", "name", "company", "blog", "location", "email", "hireable", "bio", "public_repos", "public_gists", "followers", "following", "created_at", "updated_at"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"user" : "123wowow123", "repos" : 1, "login" : "123wowow123", "id" : 8672989, "avatar_url" : "https://avatars1.githubusercontent.com/u/8672989?v=3", "url" : "https://api.github.com/users/123wowow123", "html_url" : "https://github.com/123wowow123", "followers_url" : "https://api.github.com/users/123wowow123/followers", "following_url" : "https://api.github.com/users/123wowow123/following{/other_user}", "gists_url" : "https://api.github.com/users/123wowow123/gists{/gist_id}", "starred_url" : "https://api.github.com/users/123wowow123/starred{/owner}{/repo}", "subscriptions_url" : "https://api.github.com/users/123wowow123/subscriptions", "organizations_url" : "https://api.github.com/users/123wowow123/orgs", "repos_url" : "https://api.github.com/users/123wowow123/repos", "events_url" : "https://api.github.com/users/123wowow123/events{/privacy}", "received_events_url" : "https://api.github.com/users/123wowow123/received_events", "type" : "User", "site_admin" : false, "name" : "wowow", "company" : null, "blog" : null, "location" : "San Diego", "email" : null, "hireable" : null, "bio" : null, "public_repos" : 10, "public_gists" : 0, "followers" : 0, "following" : 0, "created_at" : "2014-09-05T21:17:17Z", "updated_at" : "2017-02-18T01:45:36Z"}
json_instruct
{"type": "object", "properties": {"user": {"type": "string"}, "repos": {"type": "integer"}, "login": {"type": "string"}, "id": {"type": "integer"}, "avatar_url": {"type": "string"}, "url": {"type": "string"}, "html_url": {"type": "string"}, "followers_url": {"type": "string"}, "following_url": {"type": "string"}, "gists_url": {"type": "string"}, "starred_url": {"type": "string"}, "subscriptions_url": {"type": "string"}, "organizations_url": {"type": "string"}, "repos_url": {"type": "string"}, "events_url": {"type": "string"}, "received_events_url": {"type": "string"}, "type": {"type": "string"}, "site_admin": {"type": "boolean"}, "name": {"type": "string"}, "company": {"type": "null"}, "blog": {"type": "null"}, "location": {"type": "string"}, "email": {"type": "null"}, "hireable": {"type": "null"}, "bio": {"type": "null"}, "public_repos": {"type": "integer"}, "public_gists": {"type": "integer"}, "followers": {"type": "integer"}, "following": {"type": "integer"}, "created_at": {"type": "string"}, "updated_at": {"type": "string"}}, "required": ["user", "repos", "login", "id", "avatar_url", "url", "html_url", "followers_url", "following_url", "gists_url", "starred_url", "subscriptions_url", "organizations_url", "repos_url", "events_url", "received_events_url", "type", "site_admin", "name", "company", "blog", "location", "email", "hireable", "bio", "public_repos", "public_gists", "followers", "following", "created_at", "updated_at"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"MD5": {"type": "string"}, "async": {"type": "string"}, "boom": {"type": "string"}, "good": {"type": "string"}, "good-console": {"type": "string"}, "hapi": {"type": "string"}, "hapi-auth-cookie": {"type": "string"}, "hoek": {"type": "string"}, "jade": {"type": "string"}, "joi": {"type": "string"}, "moment": {"type": "string"}, "mongoose": {"type": "string"}, "poop": {"type": "string"}, "random-string": {"type": "string"}}, "required": ["MD5", "async", "boom", "good", "good-console", "hapi", "hapi-auth-cookie", "hoek", "jade", "joi", "moment", "mongoose", "poop", "random-string"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "webdev-with-mongo-node-book", "version" : "1.0.0", "description" : "web application with nodejs and mongodb", "main" : "server.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "author" : "Luis Vegerano", "license" : "MIT", "dependencies" : {"MD5" : "^1.2.1", "async" : "^0.9.0", "boom" : "^2.6.1", "good" : "^5.1.2", "good-console" : "^4.1.0", "hapi" : "^8.4.0", "hapi-auth-cookie" : "^2.0.0", "hoek" : "^2.11.1", "jade" : "^1.9.2", "joi" : "^6.0.8", "moment" : "^2.9.0", "mongoose" : "^4.0.1", "poop" : "^1.2.5", "random-string" : "^0.1.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"MD5": {"type": "string"}, "async": {"type": "string"}, "boom": {"type": "string"}, "good": {"type": "string"}, "good-console": {"type": "string"}, "hapi": {"type": "string"}, "hapi-auth-cookie": {"type": "string"}, "hoek": {"type": "string"}, "jade": {"type": "string"}, "joi": {"type": "string"}, "moment": {"type": "string"}, "mongoose": {"type": "string"}, "poop": {"type": "string"}, "random-string": {"type": "string"}}, "required": ["MD5", "async", "boom", "good", "good-console", "hapi", "hapi-auth-cookie", "hoek", "jade", "joi", "moment", "mongoose", "poop", "random-string"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"h": {"type": "string"}, "c": {"type": "object", "properties": {"static/development/pages/a.js": {"type": "boolean"}, "static/development/pages/next/dist/pages/_error.js": {"type": "boolean"}}, "required": ["static/development/pages/a.js", "static/development/pages/next/dist/pages/_error.js"]}}, "required": ["h", "c"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"h" : "6f1b066ae9bdefc275da", "c" : {"static/development/pages/a.js" : false, "static/development/pages/next/dist/pages/_error.js" : false}}
json_instruct
{"type": "object", "properties": {"h": {"type": "string"}, "c": {"type": "object", "properties": {"static/development/pages/a.js": {"type": "boolean"}, "static/development/pages/next/dist/pages/_error.js": {"type": "boolean"}}, "required": ["static/development/pages/a.js", "static/development/pages/next/dist/pages/_error.js"]}}, "required": ["h", "c"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"objects": {"type": "object", "properties": {"vectile": {"type": "object", "properties": {"type": {"type": "string"}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"id": {"type": "integer"}}, "required": ["id"]}, "clipped": {"type": "boolean"}, "id": {"type": "string"}}, "required": ["arcs", "type", "properties", "clipped", "id"]}}}, "required": ["type", "geometries"]}}, "required": ["vectile"]}, "type": {"type": "string"}, "transform": {"type": "object", "properties": {"translate": {"type": "array", "items": {"type": "number"}}, "scale": {"type": "array", "items": {"type": "number"}}}, "required": ["translate", "scale"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}}, "required": ["objects", "type", "transform", "arcs"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"objects" : {"vectile" : {"type" : "GeometryCollection", "geometries" : [{"arcs" : [[0]], "type" : "Polygon", "properties" : {"id" : 34}, "clipped" : true, "id" : "bae85f1db0"}, {"arcs" : [[1]], "type" : "Polygon", "properties" : {"id" : 45}, "clipped" : true, "id" : "fef434538b"}]}}, "type" : "Topology", "transform" : {"translate" : [13.227539062499995, 49.75287993415023], "scale" : [4.291534423829513e-05, 2.7718871121233668e-05]}, "arcs" : [[[651, 1024], [373, -1002], [0, -22], [-1024, 0], [0, 1024], [651, 0]], [[1024, 22], [-373, 1002], [373, 0], [0, -1002]]]}
json_instruct
{"type": "object", "properties": {"objects": {"type": "object", "properties": {"vectile": {"type": "object", "properties": {"type": {"type": "string"}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"id": {"type": "integer"}}, "required": ["id"]}, "clipped": {"type": "boolean"}, "id": {"type": "string"}}, "required": ["arcs", "type", "properties", "clipped", "id"]}}}, "required": ["type", "geometries"]}}, "required": ["vectile"]}, "type": {"type": "string"}, "transform": {"type": "object", "properties": {"translate": {"type": "array", "items": {"type": "number"}}, "scale": {"type": "array", "items": {"type": "number"}}}, "required": ["translate", "scale"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}}, "required": ["objects", "type", "transform", "arcs"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"name": {"type": "string"}, "dockerFile": {"type": "string"}, "containerUser": {"type": "string"}, "extensions": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "dockerFile", "containerUser", "extensions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "joi-filelist", "dockerFile" : "./dev.dockerfile", "containerUser" : "node", "extensions" : ["editorconfig.editorconfig"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "dockerFile": {"type": "string"}, "containerUser": {"type": "string"}, "extensions": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "dockerFile", "containerUser", "extensions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"@context": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}, "o:comment": {"type": "string"}, "o:id": {"type": "integer"}, "o:label": {"type": "string"}, "o:local_name": {"type": "string"}, "o:term": {"type": "string"}, "o:vocabulary": {"type": "object", "properties": {"@id": {"type": "string"}, "o:id": {"type": "integer"}}, "required": ["@id", "o:id"]}}, "required": ["@context", "@id", "@type", "o:comment", "o:id", "o:label", "o:local_name", "o:term", "o:vocabulary"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"@context" : "https://curation.library.t.u-tokyo.ac.jp/api-context", "@id" : "https://curation.library.t.u-tokyo.ac.jp/api/properties/232", "@type" : "o:Property", "o:comment" : "\u5358\u884c\u66f8\u306e\u69cb\u6210\u30ec\u30d9\u30eb\u306e\u5404\u8457\u4f5c\u306b\u8457\u4f5c\u8cac\u4efb\u3092\u6301\u3064\u5b9f\u4f53", "o:id" : 232, "o:label" : "Part Creator", "o:local_name" : "partCreator", "o:term" : "dcndl:partCreator", "o:vocabulary" : {"@id" : "https://curation.library.t.u-tokyo.ac.jp/api/vocabularies/8", "o:id" : 8}}
json_instruct
{"type": "object", "properties": {"@context": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}, "o:comment": {"type": "string"}, "o:id": {"type": "integer"}, "o:label": {"type": "string"}, "o:local_name": {"type": "string"}, "o:term": {"type": "string"}, "o:vocabulary": {"type": "object", "properties": {"@id": {"type": "string"}, "o:id": {"type": "integer"}}, "required": ["@id", "o:id"]}}, "required": ["@context", "@id", "@type", "o:comment", "o:id", "o:label", "o:local_name", "o:term", "o:vocabulary"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 100732, "info" : {"name" : "EXO Logo Icons", "description" : "EXO's Logo's through the eras as the icons for home and such on tumblr.", "additionalInfo" : null, "format" : "uso", "category" : "tumblr", "createdAt" : "2014-04-23T16:33:28.000Z", "updatedAt" : "2014-10-05T21:55:41.000Z", "license" : "NO-REDISTRIBUTION", "author" : {"id" : 263140, "name" : "HolLoxygirl1"}}, "stats" : {"installs" : {"total" : 2440, "weekly" : 0}}, "screenshots" : {"main" : {"name" : "100732_after.png", "archived" : false}}, "discussions" : {"stats" : {"discussionsCount" : 0, "commentsCount" : 0}, "data" : []}, "style" : {"css" : "@-moz-document url-prefix(\"http://www.tumblr.com/\"), url-prefix(\"https://www.tumblr.com/\") {\r\n#popover_blogs .tab_notice:after {display:none}\r\nDIV#xkit-control.xkit-help-forwarder > A,\r\n.tab_bar .iconic A.tab_anchor {\r\nbackground-image: url('http://i145.photobucket.com/albums/r234/Hailey_Nicole_Gee/transparenticons_zps84cf3612.png') !important;\r\nbackground-size: 175px 36px;\r\n}\r\n}"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"}