input stringlengths 159 2.05k | output stringlengths 5 10.3k | task stringclasses 1
value | schema stringlengths 100 1.99k |
|---|---|---|---|
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"v1": {"type": "object", "properties": {"config": {"type": "object", "properties": {}, "required": []}, "upstream": {"type": "string"}, "contentSHA": {"type": "string"}, "metadata": {"type": "object", "properties": {"applicationType": {"type": "string"}, "customerID": {"type": "string"}, "installationID": {"type": "string"}, "releaseNotes": {"type": "string"}, "version": {"type": "string"}}, "required": ["applicationType", "customerID", "installationID", "releaseNotes", "version"]}, "releaseName": {"type": "string"}}, "required": ["config", "upstream", "contentSHA", "metadata", "releaseName"]}}, "required": ["v1"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"v1" : {"config" : {}, "upstream" : "staging.replicated.app/some-cool-ci-tool?installation_id=OafdEI-lF2IQV0Il3bfzrIl5mUdHCb3j&customer_id=-Am-_6i5pw0u4AbspOwKN4lZUCn49u_G", "contentSHA" : "3f27933df35c90e60a3c943e6fa765bc6116e8e6e17f89cdb6976ccc52e1cb65", "metadata" : {"applicationType" : "replicated.app", "customerID" : "-Am-_6i5pw0u4AbspOwKN4lZUCn49u_G", "installationID" : "OafdEI-lF2IQV0Il3bfzrIl5mUdHCb3j", "releaseNotes" : "integration tests", "version" : "1.0.0-SNAPSHOT"}, "releaseName" : "integration-replicated-app-helm-github"}} | json_instruct | {"type": "object", "properties": {"v1": {"type": "object", "properties": {"config": {"type": "object", "properties": {}, "required": []}, "upstream": {"type": "string"}, "contentSHA": {"type": "string"}, "metadata": {"type": "object", "properties": {"applicationType": {"type": "string"}, "customerID": {"type": "string"}, "installationID": {"type": "string"}, "releaseNotes": {"type": "string"}, "version": {"type": "string"}}, "required": ["applicationType", "customerID", "installationID", "releaseNotes", "version"]}, "releaseName": {"type": "string"}}, "required": ["config", "upstream", "contentSHA", "metadata", "releaseName"]}}, "required": ["v1"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"author": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "date": {"type": "object", "properties": {"day": {"type": "integer"}, "full": {"type": "integer"}, "month": {"type": "integer"}, "week": {"type": "integer"}}, "required": ["day", "full", "month", "week"]}, "id": {"type": "string"}, "misc": {"type": "object", "properties": {"postHint": {"type": "string"}}, "required": ["postHint"]}, "picture": {"type": "object", "properties": {"filesize": {"type": "integer"}, "fullUrl": {"type": "string"}, "hash": {"type": "string"}, "height": {"type": "integer"}, "lqip": {"type": "string"}, "thumbnailUrl": {"type": "string"}, "url": {"type": "string"}, "width": {"type": "integer"}}, "required": ["filesize", "fullUrl", "hash", "height", "lqip", "thumbnailUrl", "url", "width"]}, "score": {"type": "object", "properties": {"comments": {"type": "integer"}, "downs": {"type": "integer"}, "isCurated": {"type": "boolean"}, "ratio": {"type": "number"}, "ups": {"type": "integer"}, "value": {"type": "integer"}}, "required": ["comments", "downs", "isCurated", "ratio", "ups", "value"]}, "subreddit": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "tags": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["author", "date", "id", "misc", "picture", "score", "subreddit", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"author" : {"id" : "t2_16p2gq", "name" : "Toridan"}, "date" : {"day" : 1620691200, "full" : 1620695793, "month" : 1619827200, "week" : 1620518400}, "id" : "t3_n9lct0", "misc" : {"postHint" : "image"}, "picture" : {"filesize" : 105094, "fullUrl" : "https://external-preview.redd.it/SH4jHNTs6R7bSipxG1rzv44aNZ0eRz5O-BqKHy3YvoU.jpg?auto=webp&s=ad24072a999f82af7bbfad7437060a0dea5044ff", "hash" : "9b461d7aa7", "height" : 777, "lqip" : "data:image/jpg;base64,/9j/2wBDAAYEBQYFBAYGBQYHBwYIChAKCgkJChQODwwQFxQYGBcUFhYaHSUfGhsjHBYWICwgIyYnKSopGR8tMC0oMCUoKSj/2wBDAQcHBwoIChMKChMoGhYaKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCj/wAARCAAQAA0DASIAAhEBAxEB/8QAFwAAAwEAAAAAAAAAAAAAAAAAAgMEBv/EACAQAAMAAQQCAwAAAAAAAAAAAAECAxEABAUSIUETYXH/xAAUAQEAAAAAAAAAAAAAAAAAAAAE/8QAHBEAAgEFAQAAAAAAAAAAAAAAAQIAAwQREjEh/9oADAMBAAIRAxEAPwDO8jvab2KLFT3YZIQZx50PNNbm9zOm/aavCKRRFbARQvgfvs/Z0mdaRatB0Csey9RqT5qVdmxk+ySNCrXJYBNeQaLgn3s//9k=", "thumbnailUrl" : "https://b.thumbs.redditmedia.com/ojcrCOh-0pkDPipUfR8Lki-oZIjzZuGmSn7XhtzIfko.jpg", "url" : "https://external-preview.redd.it/SH4jHNTs6R7bSipxG1rzv44aNZ0eRz5O-BqKHy3YvoU.jpg?width=640&crop=smart&auto=webp&s=6434e034b07da47464e511b24b559f34f77bed4e", "width" : 640}, "score" : {"comments" : 5, "downs" : 0, "isCurated" : false, "ratio" : 0.99, "ups" : 214, "value" : 214}, "subreddit" : {"id" : "t5_3isai", "name" : "dndmaps"}, "tags" : ["Region"], "title" : "I thought this post of Doggerland 10 000 years ago would make for a cool AU Earth setting map, so I made a version without the red lines", "url" : "https://www.reddit.com/r/dndmaps/comments/n9lct0/i_thought_this_post_of_doggerland_10_000_years/"} | json_instruct | {"type": "object", "properties": {"author": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "date": {"type": "object", "properties": {"day": {"type": "integer"}, "full": {"type": "integer"}, "month": {"type": "integer"}, "week": {"type": "integer"}}, "required": ["day", "full", "month", "week"]}, "id": {"type": "string"}, "misc": {"type": "object", "properties": {"postHint": {"type": "string"}}, "required": ["postHint"]}, "picture": {"type": "object", "properties": {"filesize": {"type": "integer"}, "fullUrl": {"type": "string"}, "hash": {"type": "string"}, "height": {"type": "integer"}, "lqip": {"type": "string"}, "thumbnailUrl": {"type": "string"}, "url": {"type": "string"}, "width": {"type": "integer"}}, "required": ["filesize", "fullUrl", "hash", "height", "lqip", "thumbnailUrl", "url", "width"]}, "score": {"type": "object", "properties": {"comments": {"type": "integer"}, "downs": {"type": "integer"}, "isCurated": {"type": "boolean"}, "ratio": {"type": "number"}, "ups": {"type": "integer"}, "value": {"type": "integer"}}, "required": ["comments", "downs", "isCurated", "ratio", "ups", "value"]}, "subreddit": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "tags": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["author", "date", "id", "misc", "picture", "score", "subreddit", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"uuid": {"type": "string"}, "befores": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "status": {"type": "string"}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["name", "status", "start", "stop"]}}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["uuid", "befores", "start", "stop"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"uuid" : "e6849863-536f-41d8-9fc2-38d03fd4ec94", "befores" : [{"name" : "checkout_tria", "status" : "passed", "start" : 1597806093063, "stop" : 1597806093063}], "start" : 1597806093063, "stop" : 1597806102870} | json_instruct | {"type": "object", "properties": {"uuid": {"type": "string"}, "befores": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "status": {"type": "string"}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["name", "status", "start", "stop"]}}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["uuid", "befores", "start", "stop"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"expireTime": {"type": "integer"}, "key": {"type": "string"}, "val": {"type": "string"}}, "required": ["expireTime", "key", "val"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"expireTime" : 9007200855600470000, "key" : "0d13c539143de7a94f0081a0fdbcfc33{\"color\":\"#64ffda\"}", "val" : "data:image/svg+xml,%3csvg%20xmlns='http://www.w3.org/2000/svg'%20width='400'%20height='283'%20viewBox='0%200%20400%20283'%20preserveAspectRatio='none'%3e%3cpath%20d='M41%20127l-1%205c-2%207-4%2010-6%209h-2c-2%201%200%203%202%203%203%200%204-1%206-6l1-4%201%205c2%209%206%206%208-6l3-5c1%200%202-3%200-3s-4%203-4%207c-1%204-3%205-3%200%200-6-3-9-5-5m51-1l-2%204c0%202-1%203-3%203l-4%203c-3%205-5%206-6%205v-2c5-1%205-6%201-6-3%200-4%201-8%207-1%201-1%201%200%200v-7c-2%200-4%203-4%206l-1%203v-6c1-3%201-3-1-3l-3%201c-1%206-2%207-3%206l1-4c1-3%201-3-1-3s-4%202-4%205c-2%205%202%208%205%205h8l3-1%203%201h49c2-1%201-3-1-3-1%201-1%200-1-3l1-4h-4c-4%200-7%201-9%205%200%202-2%203-2%203l1-6c2-1%201-7%200-7l-4%204c-1%201-2%202-3%201-3%200-3%200-5%204l-2%204c-1%200%200-8%202-12%201-4%200-5-3-3m48%201l-3%207c-2%206-3%209-4%207s-4%200-4%201c1%203%206%202%208-2l2-3v3c0%206%204%205%207-2%201-2%201-2%201%201%200%205%202%206%206%204%203-1%204-4%201-3s-3%200-2-7c2-7%202-8%201-8-2%200-6%204-7%208l-2%204v-6c0-7-2-8-4-4m-6%2094c0%205%201%207%202%207l2%201-2%201h-2l2%201%202%201-2%201c-1-1-1%200-1%204v6l6-1c7%200%208-1%208-5v-3c1%200%202%201%201%205l1%204%201-4%201-3v4c0%203%200%203%205%203h5v-10l-1-9-1-1%201-1%201-5c0-3%200-3-3-3-4%200-4%200-4%203l-1%202-1-3c1-2%201-2-4-2l-6%201h-2l-5-1h-3v7m208%205c1%204-1%204-25%204l-22%201c-1%201%2013%201%2040%201l41-1-18-1h-16l1-3v-3c-1%200-2%201-1%202m-318%208l41%201%2041-1-41-1-41%201'%20fill='%2364ffda'%20fill-rule='evenodd'/%3e%3c/svg%3e"} | json_instruct | {"type": "object", "properties": {"expireTime": {"type": "integer"}, "key": {"type": "string"}, "val": {"type": "string"}}, "required": ["expireTime", "key", "val"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"citations" : [{"textCitation" : "[See anxordi on Metamath](http://us.metamath.org/mpegif/anxordi.html)"}], "names" : ["anxordi"], "language" : "METAMATH_SET_MM", "lookupTerms" : ["#T_wph", "#T_wa", "#T_wps", "#T_wxo", "#T_wch", "#T_wb", "#T_wph", "#T_wa", "#T_wps", "#T_wxo", "#T_wph", "#T_wa", "#T_wch"], "metaLanguage" : "METAMATH", "remarks" : " Conjunction distributes over exclusive-or. In intuitionistic logic this assertion is also true, even though ~ xordi does not necessarily hold, in part because the usual definition of xor is subtly different in intuitionistic logic. (Contributed by David A. Wheeler, 7-Oct-2018.) \n\n---\n\n Conjunction distributes over exclusive-or. (Contributed by Mario Carneiro and Jim Kingdon, 7-Oct-2018.) ", "statement" : "anxordi $p |- ( ( ph /\\ ( ps \\/_ ch ) ) <-> ( ( ph /\\ ps ) \\/_ ( ph /\\ ch ) ) ) $."} | json_instruct | {"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "type": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "XITO", "symbol" : "USDX", "address" : "0x237c0e91c28d20254a2f25976b81262e63bb767f", "decimals" : 18, "type" : "ERC20"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "type": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "type"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"pages": {"type": "array", "items": {"type": "string"}}, "window": {"type": "object", "properties": {"backgroundTextStyle": {"type": "string"}, "navigationBarBackgroundColor": {"type": "string"}, "navigationBarTitleText": {"type": "string"}, "navigationBarTextStyle": {"type": "string"}}, "required": ["backgroundTextStyle", "navigationBarBackgroundColor", "navigationBarTitleText", "navigationBarTextStyle"]}, "tabBar": {"type": "object", "properties": {"list": {"type": "array", "items": {"type": "object", "properties": {"pagePath": {"type": "string"}, "text": {"type": "string"}, "iconPath": {"type": "string"}, "selectedIconPath": {"type": "string"}}, "required": ["pagePath", "text", "iconPath", "selectedIconPath"]}}}, "required": ["list"]}}, "required": ["pages", "window", "tabBar"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"pages" : ["pages/product/product", "pages/detail/detail", "pages/index/index", "pages/member/member", "pages/order/order", "pages/logs/logs"], "window" : {"backgroundTextStyle" : "light", "navigationBarBackgroundColor" : "#fff", "navigationBarTitleText" : "\u60a6\u60a6", "navigationBarTextStyle" : "black"}, "tabBar" : {"list" : [{"pagePath" : "pages/index/index", "text" : "\u9996\u9875", "iconPath" : "/pages/img/tabs/home.png", "selectedIconPath" : "/pages/img/tabs/home-active.png"}, {"pagePath" : "pages/product/product", "text" : "\u5206\u7c7b", "iconPath" : "/pages/img/tabs/fenlei.png", "selectedIconPath" : "/pages/img/tabs/fenlei-active.png"}, {"pagePath" : "pages/index/index", "text" : "\u8d2d\u7269\u8f66", "iconPath" : "/pages/img/tabs/gouwu.png", "selectedIconPath" : "/pages/img/tabs/gouwu-active.png"}, {"pagePath" : "pages/member/member", "text" : "\u6211\u7684", "iconPath" : "/pages/img/tabs/person.png", "selectedIconPath" : "/pages/img/tabs/person-active.png"}]}} | json_instruct | {"type": "object", "properties": {"pages": {"type": "array", "items": {"type": "string"}}, "window": {"type": "object", "properties": {"backgroundTextStyle": {"type": "string"}, "navigationBarBackgroundColor": {"type": "string"}, "navigationBarTitleText": {"type": "string"}, "navigationBarTextStyle": {"type": "string"}}, "required": ["backgroundTextStyle", "navigationBarBackgroundColor", "navigationBarTitleText", "navigationBarTextStyle"]}, "tabBar": {"type": "object", "properties": {"list": {"type": "array", "items": {"type": "object", "properties": {"pagePath": {"type": "string"}, "text": {"type": "string"}, "iconPath": {"type": "string"}, "selectedIconPath": {"type": "string"}}, "required": ["pagePath", "text", "iconPath", "selectedIconPath"]}}}, "required": ["list"]}}, "required": ["pages", "window", "tabBar"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "array", "items": {"type": "object", "properties": {"users": {"type": "integer"}, "id": {"type": "string"}}, "required": ["users", "id"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"users" : 209, "id" : "KR-49"}, {"users" : 1, "id" : "KR-48"}, {"users" : 1, "id" : "KR-47"}, {"users" : 2, "id" : "KR-46"}, {"users" : 2, "id" : "KR-45"}, {"users" : 1, "id" : "KR-44"}, {"users" : 1, "id" : "KR-43"}, {"users" : 30, "id" : "KR-42"}, {"users" : 679, "id" : "KR-41"}, {"users" : 259, "id" : "KR-31"}, {"users" : 1258, "id" : "KR-30"}, {"users" : 292, "id" : "KR-29"}, {"users" : 851, "id" : "KR-28"}, {"users" : 572, "id" : "KR-27"}, {"users" : 994, "id" : "KR-26"}, {"users" : 28681, "id" : "KR-11"}, {"users" : 88, "id" : "KR-50"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"users": {"type": "integer"}, "id": {"type": "string"}}, "required": ["users", "id"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"artist_id": {"type": "string"}, "artist_latitude": {"type": "null"}, "artist_location": {"type": "string"}, "artist_longitude": {"type": "null"}, "artist_name": {"type": "string"}, "duration": {"type": "number"}, "num_songs": {"type": "integer"}, "song_id": {"type": "string"}, "title": {"type": "string"}, "year": {"type": "integer"}}, "required": ["artist_id", "artist_latitude", "artist_location", "artist_longitude", "artist_name", "duration", "num_songs", "song_id", "title", "year"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"artist_id" : "ARCAEMJ1187B9AF210", "artist_latitude" : null, "artist_location" : "Teheran, Iran", "artist_longitude" : null, "artist_name" : "Sharam feat. Kid Cudi", "duration" : 495.28118, "num_songs" : 1, "song_id" : "SOZRRIM12A8C13F9A0", "title" : "She Came Along", "year" : 0} | json_instruct | {"type": "object", "properties": {"artist_id": {"type": "string"}, "artist_latitude": {"type": "null"}, "artist_location": {"type": "string"}, "artist_longitude": {"type": "null"}, "artist_name": {"type": "string"}, "duration": {"type": "number"}, "num_songs": {"type": "integer"}, "song_id": {"type": "string"}, "title": {"type": "string"}, "year": {"type": "integer"}}, "required": ["artist_id", "artist_latitude", "artist_location", "artist_longitude", "artist_name", "duration", "num_songs", "song_id", "title", "year"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
| ["binary-automation", "binary-bot"] | json_instruct | {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "test": {"type": "string"}, "tdd": {"type": "string"}}, "required": ["start", "test", "tdd"]}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"eslint": {"type": "string"}, "jasmine": {"type": "string"}, "watch": {"type": "string"}}, "required": ["eslint", "jasmine", "watch"]}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}}, "required": ["name", "version", "description", "repository", "scripts", "author", "license", "dependencies", "engines"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "noisy-jasmine", "version" : "1.0.2", "description" : "Tools to make Jasmine testing in Node a little easier", "repository" : {"type" : "git", "url" : "git+ssh://git@github.com:noisygerman/noisy-jasmine.git"}, "scripts" : {"start" : "npm test", "test" : "node run-tests.js", "tdd" : "node run-tests.js continuously"}, "author" : {"name" : "Markus Westerholz", "email" : "mwesterholz@gmail.com"}, "license" : "MIT", "dependencies" : {"eslint" : "^4.0.0", "jasmine" : "^2.6.0", "watch" : "^1.0.2"}, "engines" : {"node" : ">=6.0.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "test": {"type": "string"}, "tdd": {"type": "string"}}, "required": ["start", "test", "tdd"]}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"eslint": {"type": "string"}, "jasmine": {"type": "string"}, "watch": {"type": "string"}}, "required": ["eslint", "jasmine", "watch"]}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}}, "required": ["name", "version", "description", "repository", "scripts", "author", "license", "dependencies", "engines"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"nom" : "Saleignes", "dpt" : "Charente-Maritime", "inscrits" : 47, "abs" : 8, "votants" : 39, "blancs" : 4, "nuls" : 2, "exp" : 33, "res" : [{"panneau" : "1", "voix" : 23}, {"panneau" : "2", "voix" : 10}]} | json_instruct | {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"etherport-client": {"type": "string"}, "johnny-five": {"type": "string"}, "bl": {"type": "string"}}, "required": ["etherport-client", "johnny-five", "bl"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "johnfive-windows-sample", "version" : "1.0.0", "description" : "This is the same app as the other platforms. just with the node modules included since in windows you need more setup", "main" : "johnnyFiveSample.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "keywords" : ["john", "five", "esp8266"], "author" : "Damian Montero (BocaJS)", "license" : "MIT", "dependencies" : {"etherport-client" : "^0.1.3", "johnny-five" : "^0.15.0", "bl" : ">=1.2.3"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"etherport-client": {"type": "string"}, "johnny-five": {"type": "string"}, "bl": {"type": "string"}}, "required": ["etherport-client", "johnny-five", "bl"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"version": {"type": "number"}, "people": {"type": "array", "items": {"type": "object", "properties": {"pose_keypoints_2d": {"type": "array", "items": {"type": "integer"}}, "face_keypoints_2d": {"type": "array", "items": {}}, "hand_left_keypoints_2d": {"type": "array", "items": {}}, "hand_right_keypoints_2d": {"type": "array", "items": {}}, "pose_keypoints_3d": {"type": "array", "items": {}}, "face_keypoints_3d": {"type": "array", "items": {}}, "hand_left_keypoints_3d": {"type": "array", "items": {}}, "hand_right_keypoints_3d": {"type": "array", "items": {}}}, "required": ["pose_keypoints_2d", "face_keypoints_2d", "hand_left_keypoints_2d", "hand_right_keypoints_2d", "pose_keypoints_3d", "face_keypoints_3d", "hand_left_keypoints_3d", "hand_right_keypoints_3d"]}}}, "required": ["version", "people"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"version" : 1.2, "people" : [{"pose_keypoints_2d" : [961, 194, 1, 954, 245, 1, 916, 244, 1, 911, 308, 1, 933, 364, 1, 988, 247, 1, 999, 310, 1, 1009, 370, 1, 931, 351, 1, 921, 428, 1, 931, 503, 1, 978, 353, 1, 994, 434, 1, 1007, 509, 1, 949, 188, 1, 963, 192, 1, 936, 199, 1, 966, 196, 1], "face_keypoints_2d" : [], "hand_left_keypoints_2d" : [], "hand_right_keypoints_2d" : [], "pose_keypoints_3d" : [], "face_keypoints_3d" : [], "hand_left_keypoints_3d" : [], "hand_right_keypoints_3d" : []}]} | json_instruct | {"type": "object", "properties": {"version": {"type": "number"}, "people": {"type": "array", "items": {"type": "object", "properties": {"pose_keypoints_2d": {"type": "array", "items": {"type": "integer"}}, "face_keypoints_2d": {"type": "array", "items": {}}, "hand_left_keypoints_2d": {"type": "array", "items": {}}, "hand_right_keypoints_2d": {"type": "array", "items": {}}, "pose_keypoints_3d": {"type": "array", "items": {}}, "face_keypoints_3d": {"type": "array", "items": {}}, "hand_left_keypoints_3d": {"type": "array", "items": {}}, "hand_right_keypoints_3d": {"type": "array", "items": {}}}, "required": ["pose_keypoints_2d", "face_keypoints_2d", "hand_left_keypoints_2d", "hand_right_keypoints_2d", "pose_keypoints_3d", "face_keypoints_3d", "hand_left_keypoints_3d", "hand_right_keypoints_3d"]}}}, "required": ["version", "people"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"svg.filter.js": {"type": "string"}, "svg.filter.min.js": {"type": "string"}}, "required": ["svg.filter.js", "svg.filter.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"svg.filter.js" : "sha512-nH1/RXjmptH2S7ryiQmgLVVXhUj//gsHv1SN44ey4yYwOBlNW1PAppZ5+IITixF64r8Dw+FYi1IF0YAKv9gMHQ==", "svg.filter.min.js" : "sha512-IQnPK7nt8OkwpBBZdXbroDtrDrOgNj+62m+5Tou2WZi8hdH7Vs5aImjf2Rf80QFbwc0qeZ7Shqa1VavDjmuzQw=="} | json_instruct | {"type": "object", "properties": {"svg.filter.js": {"type": "string"}, "svg.filter.min.js": {"type": "string"}}, "required": ["svg.filter.js", "svg.filter.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "entries": {"type": "array", "items": {"type": "object", "properties": {"date": {"type": "string"}, "tag": {"type": "string"}, "version": {"type": "string"}, "comments": {"type": "object", "properties": {"patch": {"type": "array", "items": {"type": "object", "properties": {"comment": {"type": "string"}, "author": {"type": "string"}, "commit": {"type": "string"}, "package": {"type": "string"}}, "required": ["comment", "author", "commit", "package"]}}}, "required": ["patch"]}}, "required": ["date", "tag", "version", "comments"]}}}, "required": ["name", "entries"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@fluentui/react-image", "entries" : [{"date" : "Tue, 25 Aug 2020 12:36:19 GMT", "tag" : "@fluentui/react-image_v0.4.2", "version" : "0.4.2", "comments" : {"patch" : [{"comment" : "feat(react-image): improve accessibility, align with design spec", "author" : "olfedias@microsoft.com", "commit" : "e15ddb80624e29f8da90c5be67d974d47e5cfb51", "package" : "@fluentui/react-image"}]}}, {"date" : "Tue, 18 Aug 2020 07:58:00 GMT", "tag" : "@fluentui/react-image_v0.3.0", "version" : "0.3.0", "comments" : {"minor" : [{"comment" : "Image: removing compose usage in favor of hooks and factories", "author" : "mnajdova@gmail.com", "commit" : "0780384fb2ea7bffcad8d51df0ca8aaa7e19be9c", "package" : "@fluentui/react-image"}], "patch" : [{"comment" : "fixing publish", "author" : "kchau@microsoft.com", "commit" : "88c5b45032954e263c03ec211b950e618f9d5996", "package" : "@fluentui/react-image"}]}}, {"date" : "Wed, 22 Jul 2020 12:40:51 GMT", "tag" : "@fluentui/react-image_v0.1.1", "version" : "0.1.1", "comments" : {"patch" : [{"comment" : "feat: add @fluentui/react-image", "author" : "olfedias@microsoft.com", "commit" : "9c9ef94404e37645e271d920eb3c715b6adc0f3e", "package" : "@fluentui/react-image"}]}}]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "entries": {"type": "array", "items": {"type": "object", "properties": {"date": {"type": "string"}, "tag": {"type": "string"}, "version": {"type": "string"}, "comments": {"type": "object", "properties": {"patch": {"type": "array", "items": {"type": "object", "properties": {"comment": {"type": "string"}, "author": {"type": "string"}, "commit": {"type": "string"}, "package": {"type": "string"}}, "required": ["comment", "author", "commit", "package"]}}}, "required": ["patch"]}}, "required": ["date", "tag", "version", "comments"]}}}, "required": ["name", "entries"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 85771975, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes_pg", "src:geom" : "quattroshapes_pg", "wof:geomhash" : "fe697f3ee75440f4dc8eed03e5f62fc8", "wof:id" : 85771975, "wof:repo" : "whosonfirst-data-admin-za"}, "bbox" : [28.09884, -26.10528, 28.09884, -26.10528], "geometry" : {"coordinates" : [28.09884, -26.10528], "type" : "Point"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "string"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "null"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 94827, "name" : "Karneval - Nai Return to Top", "description" : "Made by request.", "user" : {"id" : 199434, "name" : "trashtheidols", "email" : "redacted", "paypal_email" : "nydelizann@gmail.com", "homepage" : null, "about" : null, "license" : "publicdomain"}, "updated" : "2013-11-05T18:52:45.000Z", "weekly_install_count" : 0, "total_install_count" : 1055, "rating" : null, "after_screenshot_name" : "https://userstyles.org/style_screenshots/94827_after.png?r=1588493039", "obsoleting_style_id" : null, "obsoleting_style_name" : null, "obsolete" : 0, "admin_delete_reason_id" : null, "obsoletion_message" : null, "screenshots" : null, "license" : null, "created" : "2013-11-05T18:52:45.000Z", "category" : "site", "raw_subcategory" : "tumblr", "subcategory" : "tumblr", "additional_info" : null, "style_tags" : [], "css" : "@-moz-document url-prefix(\"http://www.tumblr.com\"), url-prefix('https://www.tumblr.com') {\r\n#return_to_top .return_to_top_icon {\r\n cursor: pointer;\r\n height: 100px;\r\n width: 100px;\r\n background: url('http://oi44.tinypic.com/254zpec.jpg') no-repeat transparent;\r\n opacity: 0.70;\r\n}\r\n}", "discussions" : [], "discussionsCount" : 0, "commentsCount" : 0, "userjs_url" : "/styles/userjs/94827/karneval-nai-return-to-top.user.js", "style_settings" : []} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "string"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "null"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"loss": {"type": "number"}, "val_loss": {"type": "number"}, "accuracy": {"type": "number"}, "_runtime": {"type": "integer"}, "_timestamp": {"type": "integer"}, "_step": {"type": "integer"}}, "required": ["loss", "val_loss", "accuracy", "_runtime", "_timestamp", "_step"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"loss" : 46.6960334777832, "val_loss" : 57.894737243652344, "accuracy" : 0.533, "_runtime" : 8, "_timestamp" : 1621482061, "_step" : 211} | json_instruct | {"type": "object", "properties": {"loss": {"type": "number"}, "val_loss": {"type": "number"}, "accuracy": {"type": "number"}, "_runtime": {"type": "integer"}, "_timestamp": {"type": "integer"}, "_step": {"type": "integer"}}, "required": ["loss", "val_loss", "accuracy", "_runtime", "_timestamp", "_step"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {}, "required": []}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Feature", "properties" : {}, "geometry" : {"type" : "Polygon", "coordinates" : [[[286.5234375, 11.350796722383672], [278.26171875, -3.688855143147035], [284.58984375, -14.944784875088372], [289.6875, -19.145168196205297], [283.7109375, -50.51342652633955], [291.26953125, -55.67758441108951], [294.609375, -54.67383096593114], [291.09375, -50.51342652633955], [297.24609375, -39.504040705584146], [301.9921875, -38.410558250946075], [311.1328125, -28.459033019728043], [311.30859374999994, -25.641526373065755], [318.33984375, -22.105998799750566], [325.1953125, -6.839169626342808], [309.37499999999994, 1.0546279422758869], [307.96875, 4.565473550710278], [296.015625, 10.833305983642491], [286.5234375, 11.350796722383672]]]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {}, "required": []}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "string"}, "dependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["name", "description", "version", "main", "author", "homepage", "license", "repository", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "f-cell", "description" : "", "version" : "0.0.1", "main" : "lib/index.js", "author" : "fakership", "homepage" : "", "license" : "MIT", "repository" : "", "dependencies" : {}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "author": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "string"}, "dependencies": {"type": "object", "properties": {}, "required": []}}, "required": ["name", "description", "version", "main", "author", "homepage", "license", "repository", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"data": {"type": "object", "properties": {"site": {"type": "object", "properties": {"siteMetadata": {"type": "object", "properties": {"links": {"type": "array", "items": {"type": "object", "properties": {"icon": {"type": "object", "properties": {"prefix": {"type": "string"}, "iconName": {"type": "string"}}, "required": ["prefix", "iconName"]}, "link": {"type": "string"}, "name": {"type": "string"}, "external": {"type": "boolean"}}, "required": ["icon", "link", "name", "external"]}}}, "required": ["links"]}}, "required": ["siteMetadata"]}}, "required": ["site"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"data" : {"site" : {"siteMetadata" : {"links" : [{"icon" : {"prefix" : "fas", "iconName" : "home"}, "link" : "/", "name" : "\u9996\u9801", "external" : false}, {"icon" : {"prefix" : "fas", "iconName" : "user"}, "link" : "/about", "name" : "\u95dc\u65bc\u6211", "external" : false}, {"icon" : {"prefix" : "fas", "iconName" : "leaf"}, "link" : "http://study4.tw", "name" : "Study4.TW", "external" : true}, {"icon" : {"prefix" : "fab", "iconName" : "github"}, "link" : "https://github.com/yi-shiuan", "name" : "GitHub", "external" : true}, {"icon" : {"prefix" : "fab", "iconName" : "facebook"}, "link" : "https://www.facebook.com/amour99520", "name" : "Facebook", "external" : true}]}}}} | json_instruct | {"type": "object", "properties": {"data": {"type": "object", "properties": {"site": {"type": "object", "properties": {"siteMetadata": {"type": "object", "properties": {"links": {"type": "array", "items": {"type": "object", "properties": {"icon": {"type": "object", "properties": {"prefix": {"type": "string"}, "iconName": {"type": "string"}}, "required": ["prefix", "iconName"]}, "link": {"type": "string"}, "name": {"type": "string"}, "external": {"type": "boolean"}}, "required": ["icon", "link", "name", "external"]}}}, "required": ["links"]}}, "required": ["siteMetadata"]}}, "required": ["site"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "start:dev": {"type": "string"}, "lint": {"type": "string"}}, "required": ["start", "start:dev", "lint"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}, "standard": {"type": "string"}}, "required": ["nodemon", "standard"]}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}, "debug": {"type": "string"}, "mosca": {"type": "string"}, "redis": {"type": "string"}, "iotplatform-db": {"type": "string"}, "iotplatform-utils": {"type": "string"}}, "required": ["chalk", "debug", "mosca", "redis", "iotplatform-db", "iotplatform-utils"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "author", "license", "bugs", "homepage", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "iotplatform-mqtt", "version" : "1.0.0", "description" : "A single IoT Platform - MQTT Server", "main" : "server.js", "scripts" : {"start" : "NODE_ENV=production node server.js", "start:dev" : "DEBUG=iotplatform:* nodemon server.js", "lint" : "standard"}, "repository" : {"type" : "git", "url" : "git+https://github.com/carlosazaustre/iotplatform.git"}, "author" : "Carlos Azaustre <cazaustre@gmail.com> (https://carlosazaustre.es)", "license" : "MIT", "bugs" : {"url" : "https://github.com/carlosazaustre/iotplatform/issues"}, "homepage" : "https://github.com/carlosazaustre/iotplatform#readme", "devDependencies" : {"nodemon" : "^1.18.7", "standard" : "^12.0.1"}, "dependencies" : {"chalk" : "^2.4.1", "debug" : "^4.1.0", "mosca" : "^2.8.3", "redis" : "^2.8.0", "iotplatform-db" : "file:../iotplatform-db", "iotplatform-utils" : "file:../iotplatform-utils"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "start:dev": {"type": "string"}, "lint": {"type": "string"}}, "required": ["start", "start:dev", "lint"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}, "standard": {"type": "string"}}, "required": ["nodemon", "standard"]}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}, "debug": {"type": "string"}, "mosca": {"type": "string"}, "redis": {"type": "string"}, "iotplatform-db": {"type": "string"}, "iotplatform-utils": {"type": "string"}}, "required": ["chalk", "debug", "mosca", "redis", "iotplatform-db", "iotplatform-utils"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "author", "license", "bugs", "homepage", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "nodes": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "id": {"type": "integer"}, "lat": {"type": "number"}, "lon": {"type": "number"}}, "required": ["type", "id", "lat", "lon"]}}, "volunteer_postcode": {"type": "string"}, "closest_distance": {"type": "integer"}}, "required": ["id", "name", "nodes", "volunteer_postcode", "closest_distance"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "122222882", "name" : "Newton Road", "nodes" : [{"type" : "node", "id" : 1366429279, "lat" : 52.2870191, "lon" : -0.5816987}, {"type" : "node", "id" : 1366429288, "lat" : 52.2870697, "lon" : -0.5816219}], "volunteer_postcode" : "NN10 0HU", "closest_distance" : 415} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "nodes": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "id": {"type": "integer"}, "lat": {"type": "number"}, "lon": {"type": "number"}}, "required": ["type", "id", "lat", "lon"]}}, "volunteer_postcode": {"type": "string"}, "closest_distance": {"type": "integer"}}, "required": ["id", "name", "nodes", "volunteer_postcode", "closest_distance"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "males": {"type": "string"}, "females": {"type": "string"}}, "required": ["name", "frequency", "males", "females"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"name" : "RIHANE", "frequency" : 165, "males" : "18.181818181818183 %", "females" : "81.81818181818183 %"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "males": {"type": "string"}, "females": {"type": "string"}}, "required": ["name", "frequency", "males", "females"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"ImageDescription": {"type": "string"}, "Make": {"type": "string"}, "Model": {"type": "string"}, "Orientation": {"type": "integer"}, "XResolution": {"type": "integer"}, "YResolution": {"type": "integer"}, "ResolutionUnit": {"type": "integer"}, "Software": {"type": "string"}, "YCbCrPositioning": {"type": "integer"}, "Copyright": {"type": "string"}, "ExifOffset": {"type": "integer"}, "Compression": {"type": "integer"}, "ThumbnailOffset": {"type": "integer"}, "ThumbnailLength": {"type": "integer"}, "ExposureTime": {"type": "number"}, "FNumber": {"type": "number"}, "ExposureProgram": {"type": "integer"}, "ISO": {"type": "integer"}, "DateTimeOriginal": {"type": "string"}, "CreateDate": {"type": "string"}, "CompressedBitsPerPixel": {"type": "integer"}, "ShutterSpeedValue": {"type": "integer"}, "ApertureValue": {"type": "integer"}, "MaxApertureValue": {"type": "integer"}, "MeteringMode": {"type": "integer"}, "LightSource": {"type": "integer"}, "Flash": {"type": "integer"}, "FocalLength": {"type": "number"}, "ColorSpace": {"type": "integer"}, "ExifImageWidth": {"type": "integer"}, "ExifImageHeight": {"type": "integer"}, "InteropOffset": {"type": "integer"}, "SensingMethod": {"type": "integer"}, "InteropIndex": {"type": "string"}, "error": {"type": "string"}}, "required": ["ImageDescription", "Make", "Model", "Orientation", "XResolution", "YResolution", "ResolutionUnit", "Software", "YCbCrPositioning", "Copyright", "ExifOffset", "Compression", "ThumbnailOffset", "ThumbnailLength", "ExposureTime", "FNumber", "ExposureProgram", "ISO", "DateTimeOriginal", "CreateDate", "CompressedBitsPerPixel", "ShutterSpeedValue", "ApertureValue", "MaxApertureValue", "MeteringMode", "LightSource", "Flash", "FocalLength", "ColorSpace", "ExifImageWidth", "ExifImageHeight", "InteropOffset", "SensingMethod", "InteropIndex", "error"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"ImageDescription" : "HDC-303X ExifImageTitle ", "Make" : "Hitachi Living Systems, Ltd. ", "Model" : "HDC-303X ", "Orientation" : 1, "XResolution" : 1, "YResolution" : 1, "ResolutionUnit" : 2, "Software" : "Ver 57.09.09.12", "YCbCrPositioning" : 2, "Copyright" : "Hitachi Living Systems, Ltd. ", "ExifOffset" : 274, "Compression" : 6, "ThumbnailOffset" : 1396, "ThumbnailLength" : 8875, "ExposureTime" : 0.06666666666666667, "FNumber" : 2.8, "ExposureProgram" : 2, "ISO" : 100, "DateTimeOriginal" : "2006:01:30 17:51:15", "CreateDate" : "2006:01:30 17:51:15", "CompressedBitsPerPixel" : 2, "ShutterSpeedValue" : 4, "ApertureValue" : 3, "MaxApertureValue" : 3, "MeteringMode" : 2, "LightSource" : 0, "Flash" : 0, "FocalLength" : 8.5, "ColorSpace" : 1, "ExifImageWidth" : 1600, "ExifImageHeight" : 1200, "InteropOffset" : 824, "SensingMethod" : 2, "InteropIndex" : "R98", "error" : "Unable to extract Makernote information as it is in an unsupported or unrecognized format."} | json_instruct | {"type": "object", "properties": {"ImageDescription": {"type": "string"}, "Make": {"type": "string"}, "Model": {"type": "string"}, "Orientation": {"type": "integer"}, "XResolution": {"type": "integer"}, "YResolution": {"type": "integer"}, "ResolutionUnit": {"type": "integer"}, "Software": {"type": "string"}, "YCbCrPositioning": {"type": "integer"}, "Copyright": {"type": "string"}, "ExifOffset": {"type": "integer"}, "Compression": {"type": "integer"}, "ThumbnailOffset": {"type": "integer"}, "ThumbnailLength": {"type": "integer"}, "ExposureTime": {"type": "number"}, "FNumber": {"type": "number"}, "ExposureProgram": {"type": "integer"}, "ISO": {"type": "integer"}, "DateTimeOriginal": {"type": "string"}, "CreateDate": {"type": "string"}, "CompressedBitsPerPixel": {"type": "integer"}, "ShutterSpeedValue": {"type": "integer"}, "ApertureValue": {"type": "integer"}, "MaxApertureValue": {"type": "integer"}, "MeteringMode": {"type": "integer"}, "LightSource": {"type": "integer"}, "Flash": {"type": "integer"}, "FocalLength": {"type": "number"}, "ColorSpace": {"type": "integer"}, "ExifImageWidth": {"type": "integer"}, "ExifImageHeight": {"type": "integer"}, "InteropOffset": {"type": "integer"}, "SensingMethod": {"type": "integer"}, "InteropIndex": {"type": "string"}, "error": {"type": "string"}}, "required": ["ImageDescription", "Make", "Model", "Orientation", "XResolution", "YResolution", "ResolutionUnit", "Software", "YCbCrPositioning", "Copyright", "ExifOffset", "Compression", "ThumbnailOffset", "ThumbnailLength", "ExposureTime", "FNumber", "ExposureProgram", "ISO", "DateTimeOriginal", "CreateDate", "CompressedBitsPerPixel", "ShutterSpeedValue", "ApertureValue", "MaxApertureValue", "MeteringMode", "LightSource", "Flash", "FocalLength", "ColorSpace", "ExifImageWidth", "ExifImageHeight", "InteropOffset", "SensingMethod", "InteropIndex", "error"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "dependencies": {"type": "object", "properties": {"bluebird": {"type": "string"}, "cassandra-driver": {"type": "string"}, "multistream": {"type": "string"}, "promistreamus": {"type": "string"}, "quadtile-index": {"type": "string"}, "@kartotherian/err": {"type": "string"}, "@kartotherian/input-validator": {"type": "string"}}, "required": ["bluebird", "cassandra-driver", "multistream", "promistreamus", "quadtile-index", "@kartotherian/err", "@kartotherian/input-validator"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "publishConfig", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@kartotherian/cassandra", "version" : "0.2.1", "description" : "Cassandra tile storage for Kartotherian map tile server", "main" : "CassandraStore.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "repository" : "kartotherian/cassandra", "keywords" : ["kartotherian", "cassandra", "tilelive"], "author" : "Yuri Astrakhan <YuriAstrakhan@gmail.com>", "license" : "Apache-2.0", "bugs" : "https://github.com/kartotherian/cassandra/issues", "publishConfig" : {"access" : "public"}, "dependencies" : {"bluebird" : "^3.5.0", "cassandra-driver" : "3.0.2", "multistream" : "^2.0.5", "promistreamus" : "^0.1.14", "quadtile-index" : "^0.0.6", "@kartotherian/err" : "^0.0.4", "@kartotherian/input-validator" : "^0.0.6"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "dependencies": {"type": "object", "properties": {"bluebird": {"type": "string"}, "cassandra-driver": {"type": "string"}, "multistream": {"type": "string"}, "promistreamus": {"type": "string"}, "quadtile-index": {"type": "string"}, "@kartotherian/err": {"type": "string"}, "@kartotherian/input-validator": {"type": "string"}}, "required": ["bluebird", "cassandra-driver", "multistream", "promistreamus", "quadtile-index", "@kartotherian/err", "@kartotherian/input-validator"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "publishConfig", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "array", "items": {"type": "array", "items": {"type": "number"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [[374.83872149602735, 487.4464426801136], [1237.6924778175426, 512.2998451376006], [1254.6337340116895, 561.0059566957727], [1273.6926472301045, 582.1825269384562], [1292.7515604485197, 597.0061261083347], [1313.9281306912033, 618.1826963510182], [1324.516415812545, 630.8886384966283]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "number"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"width": {"type": "number"}, "rotation": {"type": "number"}, "xCenter": {"type": "number"}, "yCenter": {"type": "number"}, "height": {"type": "number"}}, "required": ["width", "rotation", "xCenter", "yCenter", "height"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"width" : 0.19289312, "rotation" : 2.7477365, "xCenter" : 0.702828, "yCenter" : 0.69732046, "height" : 0.24111639} | json_instruct | {"type": "object", "properties": {"width": {"type": "number"}, "rotation": {"type": "number"}, "xCenter": {"type": "number"}, "yCenter": {"type": "number"}, "height": {"type": "number"}}, "required": ["width", "rotation", "xCenter", "yCenter", "height"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"class": {"type": "object", "properties": {}, "required": []}, "instance": {"type": "object", "properties": {"stonOn:": {"type": "string"}}, "required": ["stonOn:"]}}, "required": ["class", "instance"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"class" : {}, "instance" : {"stonOn:" : "ChristopheDemarey 11/6/2014 15:03"}} | json_instruct | {"type": "object", "properties": {"class": {"type": "object", "properties": {}, "required": []}, "instance": {"type": "object", "properties": {"stonOn:": {"type": "string"}}, "required": ["stonOn:"]}}, "required": ["class", "instance"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"appName": {"type": "string"}, "endpoint": {"type": "string"}, "port": {"type": "integer"}, "mongoDB": {"type": "object", "properties": {"uri": {"type": "string"}, "dbName": {"type": "string"}, "options": {"type": "object", "properties": {}, "required": []}}, "required": ["uri", "dbName", "options"]}, "logger": {"type": "object", "properties": {"request": {"type": "string"}}, "required": ["request"]}}, "required": ["appName", "endpoint", "port", "mongoDB", "logger"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"appName" : "finsharing", "endpoint" : "http://localhost:8000", "port" : 8000, "mongoDB" : {"uri" : "mongodb://localhost:27017", "dbName" : "finsharing", "options" : {}}, "logger" : {"request" : ":remote-addr :user-id :method :url :graphql-operation HTTP/:http-version :status - :response-time ms"}} | json_instruct | {"type": "object", "properties": {"appName": {"type": "string"}, "endpoint": {"type": "string"}, "port": {"type": "integer"}, "mongoDB": {"type": "object", "properties": {"uri": {"type": "string"}, "dbName": {"type": "string"}, "options": {"type": "object", "properties": {}, "required": []}}, "required": ["uri", "dbName", "options"]}, "logger": {"type": "object", "properties": {"request": {"type": "string"}}, "required": ["request"]}}, "required": ["appName", "endpoint", "port", "mongoDB", "logger"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "productName": {"type": "string"}, "version": {"type": "string"}, "license": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"electron-dev": {"type": "string"}, "build-mac-os": {"type": "string"}}, "required": ["electron-dev", "build-mac-os"]}, "devDependencies": {"type": "object", "properties": {"electron": {"type": "string"}, "electron-builder": {"type": "string"}}, "required": ["electron", "electron-builder"]}, "dependencies": {"type": "object", "properties": {"electron-is-dev": {"type": "string"}, "ps-node": {"type": "string"}}, "required": ["electron-is-dev", "ps-node"]}, "build": {"type": "object", "properties": {"appId": {"type": "string"}, "mac": {"type": "object", "properties": {"category": {"type": "string"}, "icon": {"type": "string"}, "asar": {"type": "boolean"}, "target": {"type": "string"}}, "required": ["category", "icon", "asar", "target"]}, "dmg": {"type": "object", "properties": {"writeUpdateInfo": {"type": "boolean"}}, "required": ["writeUpdateInfo"]}, "win": {"type": "object", "properties": {"asar": {"type": "boolean"}, "icon": {"type": "string"}}, "required": ["asar", "icon"]}, "nsis": {"type": "object", "properties": {"oneClick": {"type": "boolean"}, "allowToChangeInstallationDirectory": {"type": "boolean"}}, "required": ["oneClick", "allowToChangeInstallationDirectory"]}}, "required": ["appId", "mac", "dmg", "win", "nsis"]}}, "required": ["name", "productName", "version", "license", "main", "scripts", "devDependencies", "dependencies", "build"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "terminusdb-desktop", "productName" : "TerminusDB", "version" : "4.2.0", "license" : "Apache-2.0", "main" : "public/electron.js", "scripts" : {"electron-dev" : "electron --no-sandbox .", "build-mac-os" : "npx png2icns public/logo512.png -s 16,32,64,128,256 && npx electron-builder build"}, "devDependencies" : {"electron" : "^11.1.1", "electron-builder" : "^22.9.1"}, "dependencies" : {"electron-is-dev" : "^1.2.0", "ps-node" : "^0.1.6"}, "build" : {"appId" : "com.terminusdb.TerminusDB-Desktop", "mac" : {"category" : "public.app-category.database", "icon" : "icon.icns", "asar" : false, "target" : "dmg"}, "dmg" : {"writeUpdateInfo" : false}, "win" : {"asar" : false, "icon" : "public/favicon.ico"}, "nsis" : {"oneClick" : false, "allowToChangeInstallationDirectory" : true}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "productName": {"type": "string"}, "version": {"type": "string"}, "license": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"electron-dev": {"type": "string"}, "build-mac-os": {"type": "string"}}, "required": ["electron-dev", "build-mac-os"]}, "devDependencies": {"type": "object", "properties": {"electron": {"type": "string"}, "electron-builder": {"type": "string"}}, "required": ["electron", "electron-builder"]}, "dependencies": {"type": "object", "properties": {"electron-is-dev": {"type": "string"}, "ps-node": {"type": "string"}}, "required": ["electron-is-dev", "ps-node"]}, "build": {"type": "object", "properties": {"appId": {"type": "string"}, "mac": {"type": "object", "properties": {"category": {"type": "string"}, "icon": {"type": "string"}, "asar": {"type": "boolean"}, "target": {"type": "string"}}, "required": ["category", "icon", "asar", "target"]}, "dmg": {"type": "object", "properties": {"writeUpdateInfo": {"type": "boolean"}}, "required": ["writeUpdateInfo"]}, "win": {"type": "object", "properties": {"asar": {"type": "boolean"}, "icon": {"type": "string"}}, "required": ["asar", "icon"]}, "nsis": {"type": "object", "properties": {"oneClick": {"type": "boolean"}, "allowToChangeInstallationDirectory": {"type": "boolean"}}, "required": ["oneClick", "allowToChangeInstallationDirectory"]}}, "required": ["appId", "mac", "dmg", "win", "nsis"]}}, "required": ["name", "productName", "version", "license", "main", "scripts", "devDependencies", "dependencies", "build"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"place_name": {"type": "string"}, "state_name": {"type": "string"}, "state_abbrv": {"type": "string"}, "lat": {"type": "string"}, "long": {"type": "string"}}, "required": ["place_name", "state_name", "state_abbrv", "lat", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"place_name" : "Pinehill", "state_name" : "New Mexico", "state_abbrv" : "NM", "lat" : "34.9992", "long" : "-108.4112"} | json_instruct | {"type": "object", "properties": {"place_name": {"type": "string"}, "state_name": {"type": "string"}, "state_abbrv": {"type": "string"}, "lat": {"type": "string"}, "long": {"type": "string"}}, "required": ["place_name", "state_name", "state_abbrv", "lat", "long"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"Name": {"type": "string"}, "Start": {"type": "integer"}, "End": {"type": "integer"}, "Text": {"type": "string"}}, "required": ["Name", "Start", "End", "Text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"Name" : "IDENT", "Start" : 0, "End" : 3, "Text" : "gcc"}, {"Name" : "ASCII_45", "Start" : 4, "End" : 5, "Text" : "-"}, {"Name" : "IDENT", "Start" : 5, "End" : 9, "Text" : "fPIC"}, {"Name" : "ASCII_45", "Start" : 10, "End" : 11, "Text" : "-"}, {"Name" : "IDENT", "Start" : 11, "End" : 12, "Text" : "c"}, {"Name" : "IDENT", "Start" : 13, "End" : 16, "Text" : "foo"}, {"Name" : "ASCII_46", "Start" : 16, "End" : 17, "Text" : "."}, {"Name" : "IDENT", "Start" : 17, "End" : 18, "Text" : "c"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"Name": {"type": "string"}, "Start": {"type": "integer"}, "End": {"type": "integer"}, "Text": {"type": "string"}}, "required": ["Name", "Start", "End", "Text"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "est:block/cyan_easter_egg"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"replace": {"type": "boolean"}, "values": {"type": "array", "items": {"type": "string"}}}, "required": ["replace", "values"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"replace" : false, "values" : ["astromine:univite_ingot"]} | json_instruct | {"type": "object", "properties": {"replace": {"type": "boolean"}, "values": {"type": "array", "items": {"type": "string"}}}, "required": ["replace", "values"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"API_PORT": {"type": "string"}, "REDIS_ADDRESS": {"type": "string"}, "REDIS_PORT": {"type": "string"}, "REDIS_PASSWORD": {"type": "string"}, "REDIS_DB": {"type": "integer"}}, "required": ["API_PORT", "REDIS_ADDRESS", "REDIS_PORT", "REDIS_PASSWORD", "REDIS_DB"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"API_PORT" : "8080", "REDIS_ADDRESS" : "localhost", "REDIS_PORT" : "6379", "REDIS_PASSWORD" : "", "REDIS_DB" : 0} | json_instruct | {"type": "object", "properties": {"API_PORT": {"type": "string"}, "REDIS_ADDRESS": {"type": "string"}, "REDIS_PORT": {"type": "string"}, "REDIS_PASSWORD": {"type": "string"}, "REDIS_DB": {"type": "integer"}}, "required": ["API_PORT", "REDIS_ADDRESS", "REDIS_PORT", "REDIS_PASSWORD", "REDIS_DB"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"categories": {"type": "array", "items": {"type": "string"}}, "desc": {"type": "string"}, "details": {"type": "object", "properties": {"authors": {"type": "string"}, "format": {"type": "string"}, "isbn-10": {"type": "string"}, "isbn-13": {"type": "string"}, "pages": {"type": "string"}, "publication date": {"type": "string"}, "publisher": {"type": "string"}, "size": {"type": "string"}}, "required": ["authors", "format", "isbn-10", "isbn-13", "pages", "publication date", "publisher", "size"]}, "img": {"type": "string"}, "link": {"type": "string"}, "title": {"type": "string"}}, "required": ["categories", "desc", "details", "img", "link", "title"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"categories" : ["Game Development", "Mobile Development", "Programming"], "desc" : "\n", "details" : {"authors" : "James Goodwill, Wesley Matlock", "format" : "pdf", "isbn-10" : "1484204018", "isbn-13" : "978-1484204016", "pages" : "276 pages", "publication date" : "March 25, 2015", "publisher" : "Apress", "size" : "6.03Mb"}, "img" : "http://23.95.221.108/covers/e0/e03c2c056b407ac8eedd1a0942b1ec69.jpg", "link" : "https://rapidhosting.info/files/dqm", "title" : "Beginning Swift Games Development for iOS"} | json_instruct | {"type": "object", "properties": {"categories": {"type": "array", "items": {"type": "string"}}, "desc": {"type": "string"}, "details": {"type": "object", "properties": {"authors": {"type": "string"}, "format": {"type": "string"}, "isbn-10": {"type": "string"}, "isbn-13": {"type": "string"}, "pages": {"type": "string"}, "publication date": {"type": "string"}, "publisher": {"type": "string"}, "size": {"type": "string"}}, "required": ["authors", "format", "isbn-10", "isbn-13", "pages", "publication date", "publisher", "size"]}, "img": {"type": "string"}, "link": {"type": "string"}, "title": {"type": "string"}}, "required": ["categories", "desc", "details", "img", "link", "title"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"lastUpdated": {"type": "integer"}, "username": {"type": "string"}, "scores": {"type": "array", "items": {"type": "object", "properties": {"xp": {"type": "integer"}, "rank": {"type": "integer"}, "cardId": {"type": "integer"}}, "required": ["xp", "rank", "cardId"]}}}, "required": ["lastUpdated", "username", "scores"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"lastUpdated" : 1655019279666, "username" : "Damek", "scores" : [{"xp" : 859, "rank" : 285, "cardId" : 743}]} | json_instruct | {"type": "object", "properties": {"lastUpdated": {"type": "integer"}, "username": {"type": "string"}, "scores": {"type": "array", "items": {"type": "object", "properties": {"xp": {"type": "integer"}, "rank": {"type": "integer"}, "cardId": {"type": "integer"}}, "required": ["xp", "rank", "cardId"]}}}, "required": ["lastUpdated", "username", "scores"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"text": {"type": "object", "properties": {"0": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "1": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}}, "required": ["0", "1"]}}, "required": ["text"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"text" : {"0" : {"m1" : "\u0645\u06cc\u06af\u0648\u06cc\u062f \u0645\u0631\u0645\u0631\u0627 \u0646\u06af\u0627\u0631 \u062f\u0644\u0633\u0648\u0632", "m2" : "\u0645\u06cc\u0628\u0627\u06cc\u062f \u0631\u0641\u062a \u0686\u0648\u0646 \u0628\u0647 \u067e\u0627\u06cc\u0627\u0646 \u0634\u062f \u0631\u0648\u0632"}, "1" : {"m1" : "\u0627\u06cc \u0634\u0628 \u062a\u0648 \u0628\u0631\u0648\u0646 \u0645\u06cc\u0627\u06cc \u0627\u0632 \u06a9\u062a\u0645 \u0639\u062f\u0645", "m2" : "\u062e\u0648\u0631\u0634\u06cc\u062f \u062a\u0648 \u062e\u0648\u06cc\u0634 \u0631\u0627 \u0628\u062f\u06cc\u0646 \u0686\u0631\u062e \u0628\u062f\u0648\u0632"}}} | json_instruct | {"type": "object", "properties": {"text": {"type": "object", "properties": {"0": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "1": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}}, "required": ["0", "1"]}}, "required": ["text"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [["320772001001", "\u82b1\u679c\u5c71\u793e\u533a\u5c45\u59d4\u4f1a", "121", "0"], ["320772001002", "\u5927\u6751\u793e\u533a\u5c45\u59d4\u4f1a", "121", "0"], ["320772001003", "\u5927\u6d66\u793e\u533a\u5c45\u59d4\u4f1a", "121", "0"], ["320772001004", "\u660c\u6d66\u793e\u533a\u5c45\u59d4\u4f1a", "121", "0"], ["320772001005", "\u5b8b\u8df3\u793e\u533a\u5c45\u59d4\u4f1a", "121", "0"], ["320772001200", "\u5c0f\u6751\u6751\u59d4\u4f1a", "122", "0"], ["320772001201", "\u65b0\u6751\u6751\u59d4\u4f1a", "122", "0"], ["320772001202", "\u524d\u4e91\u6751\u59d4\u4f1a", "122", "0"], ["320772001203", "\u98de\u6cc9\u6751\u59d4\u4f1a", "122", "0"], ["320772001204", "\u5f53\u8def\u6751\u59d4\u4f1a", "122", "0"], ["320772001205", "\u65b0\u6ee9\u6751\u59d4\u4f1a", "122", "0"], ["320772001206", "\u524d\u8fdb\u6751\u59d4\u4f1a", "122", "0"]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "build": {"type": "string"}, "preview": {"type": "string"}}, "required": ["dev", "build", "preview"]}, "dependencies": {"type": "object", "properties": {"lodash": {"type": "string"}, "reseter.css": {"type": "string"}, "vue": {"type": "string"}}, "required": ["lodash", "reseter.css", "vue"]}, "devDependencies": {"type": "object", "properties": {"@types/lodash": {"type": "string"}, "@types/node": {"type": "string"}, "@vitejs/plugin-vue": {"type": "string"}, "typescript": {"type": "string"}, "vite": {"type": "string"}, "vue-tsc": {"type": "string"}}, "required": ["@types/lodash", "@types/node", "@vitejs/plugin-vue", "typescript", "vite", "vue-tsc"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "private", "scripts", "dependencies", "devDependencies", "repository", "keywords", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "soulworker-password-exchanger", "version" : "1.0.0", "description" : "", "private" : false, "scripts" : {"dev" : "vite", "build" : "vue-tsc --noEmit && vite build", "preview" : "vite preview"}, "dependencies" : {"lodash" : "^4.17.21", "reseter.css" : "^2.0.0", "vue" : "^3.2.25"}, "devDependencies" : {"@types/lodash" : "^4.14.179", "@types/node" : "^17.0.21", "@vitejs/plugin-vue" : "^2.2.0", "typescript" : "^4.5.4", "vite" : "^2.8.0", "vue-tsc" : "^0.29.8"}, "repository" : {"type" : "git", "url" : "git+https://github.com/SpaceAfterYou/soulworker-password-exchanger.git"}, "keywords" : ["soulworker"], "author" : "sawich", "license" : "WTFPL", "bugs" : {"url" : "https://github.com/SpaceAfterYou/soulworker-password-exchanger/issues"}, "homepage" : "https://github.com/SpaceAfterYou/soulworker-password-exchanger#readme"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "build": {"type": "string"}, "preview": {"type": "string"}}, "required": ["dev", "build", "preview"]}, "dependencies": {"type": "object", "properties": {"lodash": {"type": "string"}, "reseter.css": {"type": "string"}, "vue": {"type": "string"}}, "required": ["lodash", "reseter.css", "vue"]}, "devDependencies": {"type": "object", "properties": {"@types/lodash": {"type": "string"}, "@types/node": {"type": "string"}, "@vitejs/plugin-vue": {"type": "string"}, "typescript": {"type": "string"}, "vite": {"type": "string"}, "vue-tsc": {"type": "string"}}, "required": ["@types/lodash", "@types/node", "@vitejs/plugin-vue", "typescript", "vite", "vue-tsc"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "private", "scripts", "dependencies", "devDependencies", "repository", "keywords", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"require": {"type": "object", "properties": {"sendgrid/sendgrid": {"type": "string"}}, "required": ["sendgrid/sendgrid"]}}, "required": ["require"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"require" : {"sendgrid/sendgrid" : "^7.9"}} | json_instruct | {"type": "object", "properties": {"require": {"type": "object", "properties": {"sendgrid/sendgrid": {"type": "string"}}, "required": ["sendgrid/sendgrid"]}}, "required": ["require"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"title": {"type": "string"}, "intro0": {"type": "string"}, "intro1": {"type": "string"}, "intro2": {"type": "string"}}, "required": ["title", "intro0", "intro1", "intro2"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Hj\u00e6lp", "intro0" : "Hvis du har sp\u00f8rgsm\u00e5l til NWA, eller problemer med din alarmops\u00e6tning, er der hj\u00e6lp at hente p\u00e5 ", "intro1" : "NWAs beskedforum", "intro2" : "."} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "intro0": {"type": "string"}, "intro1": {"type": "string"}, "intro2": {"type": "string"}}, "required": ["title", "intro0", "intro1", "intro2"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"$schema": {"type": "string"}, "name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "base": {"type": "string"}, "properties": {"type": "object", "properties": {"bufferView": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "description"]}, "byteOffset": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}, "minimum": {"type": "integer"}, "default": {"type": "integer"}}, "required": ["type", "description", "minimum", "default"]}}, "required": ["bufferView", "byteOffset"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "name", "type", "description", "base", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"$schema" : "http://json-schema.org/draft-04/schema", "name" : "glTFAccessorSparseValues", "type" : "object", "description" : "Array of size `accessor.sparse.count` times number of components storing the displaced accessor attributes pointed by `accessor.sparse.indices`.", "base" : "glTFProperty", "properties" : {"bufferView" : {"type" : "glTFid<glTFBufferView>", "description" : "The index of the bufferView with sparse values. Referenced bufferView can't have ARRAY_BUFFER or ELEMENT_ARRAY_BUFFER target."}, "byteOffset" : {"type" : "int", "description" : "The offset relative to the start of the bufferView in bytes. Must be aligned.", "minimum" : 0, "default" : 0}}, "required" : ["bufferView"]} | json_instruct | {"type": "object", "properties": {"$schema": {"type": "string"}, "name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "base": {"type": "string"}, "properties": {"type": "object", "properties": {"bufferView": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "description"]}, "byteOffset": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}, "minimum": {"type": "integer"}, "default": {"type": "integer"}}, "required": ["type", "description", "minimum", "default"]}}, "required": ["bufferView", "byteOffset"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "name", "type", "description", "base", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"county": {"type": "string"}, "executionId": {"type": "string"}, "race": {"type": "string"}, "link": {"type": "string"}, "prisonerId": {"type": "string"}, "firstName": {"type": "string"}, "date": {"type": "string"}, "lastName": {"type": "string"}, "age": {"type": "string"}, "statement": {"type": "string"}}, "required": ["county", "executionId", "race", "link", "prisonerId", "firstName", "date", "lastName", "age", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"county" : "Harris", "executionId" : "383", "race" : "Black", "link" : "http://www.tdcj.state.tx.us/stat/dr_info/jacksonjameslast.html", "prisonerId" : "999272", "firstName" : "James", "date" : "7/2/2007", "lastName" : "Jackson", "age" : "47", "statement" : "You know, once upon a time diamonds were priceless. I never knew until I ran across my own. I just want Eve to know that. One of these days I'm going to return and get that for myself. Thank you to my family, I love you. Each and every one of you. This is not the end, but the beginning of a new chapter for you and I together forever. I love you all. Remember what I told you Brad. Ms. Irene, God bless you, I love you. See you on the other side. Warden, murder me. Saddam and Gomorrah which is Harris County."} | json_instruct | {"type": "object", "properties": {"county": {"type": "string"}, "executionId": {"type": "string"}, "race": {"type": "string"}, "link": {"type": "string"}, "prisonerId": {"type": "string"}, "firstName": {"type": "string"}, "date": {"type": "string"}, "lastName": {"type": "string"}, "age": {"type": "string"}, "statement": {"type": "string"}}, "required": ["county", "executionId", "race", "link", "prisonerId", "firstName", "date", "lastName", "age", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "type": {"type": "string"}, "require": {"type": "object", "properties": {"vlucas/phpdotenv": {"type": "string"}, "tracy/tracy": {"type": "string"}}, "required": ["vlucas/phpdotenv", "tracy/tracy"]}, "autoload": {"type": "object", "properties": {"classmap": {"type": "array", "items": {"type": "string"}}}, "required": ["classmap"]}}, "required": ["name", "description", "keywords", "license", "type", "require", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "minph", "description" : "minph framework", "keywords" : ["minph"], "license" : "Apache-2.0", "type" : "project", "require" : {"vlucas/phpdotenv" : "^2.4", "tracy/tracy" : "^2.4"}, "autoload" : {"classmap" : ["src/"]}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "type": {"type": "string"}, "require": {"type": "object", "properties": {"vlucas/phpdotenv": {"type": "string"}, "tracy/tracy": {"type": "string"}}, "required": ["vlucas/phpdotenv", "tracy/tracy"]}, "autoload": {"type": "object", "properties": {"classmap": {"type": "array", "items": {"type": "string"}}}, "required": ["classmap"]}}, "required": ["name", "description", "keywords", "license", "type", "require", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"author": {"type": "string"}, "description": {"type": "string"}, "displayName": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "name": {"type": "string"}, "repository": {"type": "string"}, "unity": {"type": "string"}, "unityRelease": {"type": "string"}, "version": {"type": "string"}}, "required": ["author", "description", "displayName", "keywords", "license", "name", "repository", "unity", "unityRelease", "version"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"author" : "Naoto Kondo", "description" : "Simple DeckLink I/O plugin for Unity", "displayName" : "DeckLinkPlugin", "keywords" : ["unity", "decklink"], "license" : "MIT License", "name" : "inc.stu.unitydecklinkplugin", "repository" : "github:stu-inc/UnityDeckLinkPlugin", "unity" : "2020.1", "unityRelease" : "1f0", "version" : "0.0.1"} | json_instruct | {"type": "object", "properties": {"author": {"type": "string"}, "description": {"type": "string"}, "displayName": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "name": {"type": "string"}, "repository": {"type": "string"}, "unity": {"type": "string"}, "unityRelease": {"type": "string"}, "version": {"type": "string"}}, "required": ["author", "description", "displayName", "keywords", "license", "name", "repository", "unity", "unityRelease", "version"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "object", "properties": {"is_lock_vulnerable": {"type": "boolean"}, "is_prodigal_vulnerable": {"type": "boolean"}, "is_suicidal_vulnerable": {"type": "boolean"}}, "required": ["is_lock_vulnerable", "is_prodigal_vulnerable", "is_suicidal_vulnerable"]}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"contract" : "0xe28cd88d23f4741d8affb0c0df90cbaef9be31ae", "tool" : "maian", "start" : 1565665151.862296, "end" : 1565665216.5510793, "duration" : 64.68878316879272, "analysis" : {"is_lock_vulnerable" : false, "is_prodigal_vulnerable" : false, "is_suicidal_vulnerable" : false}} | json_instruct | {"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "object", "properties": {"is_lock_vulnerable": {"type": "boolean"}, "is_prodigal_vulnerable": {"type": "boolean"}, "is_suicidal_vulnerable": {"type": "boolean"}}, "required": ["is_lock_vulnerable", "is_prodigal_vulnerable", "is_suicidal_vulnerable"]}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"other_ids" : [], "mRNA_sequence" : [{"index" : 0, "type" : "five_prime_UTR", "sequence" : "TATATGCATTACCGAGATTGATTTCTTAAATTAATATGCTCAATTTAAAATATATTGAAAATTTTTGTGTCAATGGATTTATAAATTCTGAATATGATAGCGCTGTATTGGCAACACTAGCTCAGATGATAAATGTACTTCTTTGGAAAAAAAGCGAAATGAGTAAATACCTCTATTTGTATATTTGCTAGTGTTTTGAATTACATGGAAGTTGCATAATTATCTCCG"}, {"index" : 1, "type" : "CDS", "sequence" : "ATGAACTTGTTTGTTTACATAGCACAGAATCCTACATTAACCAAATGGTTTTTTTGTTGTGTATGTACTATTCTTACAATGCCATTTTTTAAAAAGCCGTATAGGAAAAGGGGAATATCGAGAACGCCATATGAATGGCTTACCTATGCTGATAAATGTGTTATTGAACTTAGCAAGTCCGAATTGAAGCCCAATGAAGAAAAAGAATTACCAAAGGACATTAAAGAAGACTGCAAAACCGTAGAAGAGAAGGAAAAGGTCGTTCCAAGGAAGCCACTGCAATCTGAAGGGATTAATGAAGACGATTCCCAAAAAAATGGAGAATTAATTGTCTTGCATGGGATTAATCACCAAGCTGCGATGTTGACAGCTTGCGGTCTTTTCATGGT"}, {"index" : 2, "type" : "intron", "sequence" : "GTAAGTTACGACGAAAATAATGAGTGTAAATAAACATTCACAGATGAAAAGCGACGCAAGAAGGAAAATATGCTAATCATGGTAG"}, {"index" : 3, "type" : "CDS", "sequence" : "TACATCTTCTAACACCAACAAATGGAAAATTGCCTTTGCTTCCTTTCTTTTAGGGATGTTTTTCACACAATTTGGCTTCCAAAAAAGTGAACGCAGCATTAATGCTGAAAAGCTAGAAAGCATAGAAAAGCCTGAAAATGACAACTAG"}, {"index" : 4, "type" : "three_prime_UTR", "sequence" : "GTTGTATTAAGTCGTGCTACGGCACAGACTAGATTGCAAAATTAGCTTTCTCATTAGCAATTAAATTTTTTA"}], "other_names" : [], "id" : "SPAC1250.02", "name" : "mug95"} | json_instruct | {"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "status": {"type": "string"}, "verifiableDataRegistry": {"type": "string"}, "contactName": {"type": "string"}, "contactEmail": {"type": "string"}, "contactWebsite": {"type": "string"}, "specification": {"type": "string"}}, "required": ["name", "status", "verifiableDataRegistry", "contactName", "contactEmail", "contactWebsite", "specification"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "schema", "status" : "registered", "verifiableDataRegistry" : "Multiple storage networks, currently public IPFS and evan.network IPFS", "contactName" : "51nodes GmbH", "contactEmail" : "", "contactWebsite" : "", "specification" : "https://github.com/51nodes/schema-registry-did-method/blob/master/README.md"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "status": {"type": "string"}, "verifiableDataRegistry": {"type": "string"}, "contactName": {"type": "string"}, "contactEmail": {"type": "string"}, "contactWebsite": {"type": "string"}, "specification": {"type": "string"}}, "required": ["name", "status", "verifiableDataRegistry", "contactName", "contactEmail", "contactWebsite", "specification"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"manifest_name": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}, "manifest_description": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}}, "required": ["manifest_name", "manifest_description"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"manifest_name" : {"message" : "Netflix Sans Fin"}, "manifest_description" : {"message" : "Lire automatiquement le prochain \u00e9pisode, ignorer les s\u00e9quences de titres, ignorer \"\u00cates-vous toujours en train de regarder?\" invite et recherchez plus de 3000 genres!"}} | json_instruct | {"type": "object", "properties": {"manifest_name": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}, "manifest_description": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}}, "required": ["manifest_name", "manifest_description"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"id": {"type": "integer"}, "title": {"type": "array", "items": {"type": "string"}}, "description": {"type": "array", "items": {"type": "string"}}, "paths": {"type": "array", "items": {"type": "string"}}, "location": {"type": "string"}, "wayto": {"type": "object", "properties": {"16877": {"type": "string"}, "16875": {"type": "string"}}, "required": ["16877", "16875"]}, "timeto": {"type": "object", "properties": {"16877": {"type": "number"}, "16875": {"type": "number"}}, "required": ["16877", "16875"]}}, "required": ["id", "title", "description", "paths", "location", "wayto", "timeto"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 16876, "title" : ["[Cort's Emporium, Wall Displays]"], "description" : ["Roaring laughter booms over a stone partition, a reminder of just how large this furniture warehouse is. Keen-eyed dwarves walk by, in search of spectacular additions for their shops. A particularly appealing display has drawn the attention of several customers, rushing in to get their fill."], "paths" : ["Obvious exits: south, northwest"], "location" : "Zul Logoth", "wayto" : {"16877" : "south", "16875" : "northwest"}, "timeto" : {"16877" : 0.2, "16875" : 0.2}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "title": {"type": "array", "items": {"type": "string"}}, "description": {"type": "array", "items": {"type": "string"}}, "paths": {"type": "array", "items": {"type": "string"}}, "location": {"type": "string"}, "wayto": {"type": "object", "properties": {"16877": {"type": "string"}, "16875": {"type": "string"}}, "required": ["16877", "16875"]}, "timeto": {"type": "object", "properties": {"16877": {"type": "number"}, "16875": {"type": "number"}}, "required": ["16877", "16875"]}}, "required": ["id", "title", "description", "paths", "location", "wayto", "timeto"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"title" : "Simple and Effective Multi-Paragraph Reading Comprehension.", "fields" : ["reading comprehension", "paragraph", "question answering", "artificial intelligence", "machine learning"], "abstract" : "We consider the problem of adapting neural paragraph-level question answering models to the case where entire documents are given as input. Our proposed solution trains models to produce well calibrated confidence scores for their results on individual paragraphs. We sample multiple paragraphs from the documents during training, and use a shared-normalization training objective that encourages the model to produce globally correct output. We combine this method with a state-of-the-art pipeline for training models on document QA data. Experiments demonstrate strong performance on several document QA datasets. Overall, we are able to achieve a score of 71.3 F1 on the web portion of TriviaQA, a large improvement from the 56.7 F1 of the previous best system.", "citation" : "Citations (11)", "year" : "2018", "departments" : ["Carnegie Mellon University"], "conf" : "acl", "authors" : ["Matt Gardner.....http://dblp.org/pers/hd/g/Gardner_0001:Matt", "Christopher Clark.....http://dblp.org/pers/hd/c/Clark:Christopher"], "pages" : 11} | json_instruct | {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"an4.39:0.3": {"type": "string"}, "an4.39:1.1": {"type": "string"}, "an4.39:3.3": {"type": "string"}, "an4.39:5.4": {"type": "string"}, "an4.39:6.1": {"type": "string"}, "an4.39:6.3": {"type": "string"}}, "required": ["an4.39:0.3", "an4.39:1.1", "an4.39:3.3", "an4.39:5.4", "an4.39:6.1", "an4.39:6.3"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"an4.39:0.3" : "Ujjayasutta \u2192 ujj\u0101yasutta\u1e41 (bj)", "an4.39:1.1" : "ujjayo \u2192 ujj\u0101yo (bj)", "an4.39:3.3" : "Mah\u0101ya\u00f1\u00f1\u0101 mah\u0101rambh\u0101 \u2192 samm\u0101p\u0101sa\u1e41 v\u0101capeyya\u1e41; niraggala\u1e41 mah\u0101rambh\u0101 (pts1ed)", "an4.39:5.4" : "vividh\u0101 nettha ha\u00f1\u00f1are \u2192 vividh\u0101 yattha ha\u00f1\u00f1are (sya-all, km)", "an4.39:6.1" : "Eta\u1e41 \u2192 eva\u1e41 (sya-all, km)", "an4.39:6.3" : "Eta\u1e41 \u2192 eva\u1e41 (sya-all, km, mr)"} | json_instruct | {"type": "object", "properties": {"an4.39:0.3": {"type": "string"}, "an4.39:1.1": {"type": "string"}, "an4.39:3.3": {"type": "string"}, "an4.39:5.4": {"type": "string"}, "an4.39:6.1": {"type": "string"}, "an4.39:6.3": {"type": "string"}}, "required": ["an4.39:0.3", "an4.39:1.1", "an4.39:3.3", "an4.39:5.4", "an4.39:6.1", "an4.39:6.3"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "null"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "null"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 91624, "name" : "Youtube - Bronybar", "description" : "Tanka. Prova whatever", "user" : {"id" : 125493, "name" : "lidborn", "email" : "redacted", "paypal_email" : null, "homepage" : null, "about" : null, "license" : "publicdomain"}, "updated" : "2013-11-03T22:16:20.000Z", "weekly_install_count" : 0, "total_install_count" : 198, "rating" : null, "after_screenshot_name" : null, "obsoleting_style_id" : null, "obsoleting_style_name" : null, "obsolete" : 0, "admin_delete_reason_id" : null, "obsoletion_message" : null, "screenshots" : null, "license" : null, "created" : "2013-08-09T10:32:50.000Z", "category" : "site", "raw_subcategory" : "youtube", "subcategory" : "youtube", "additional_info" : null, "style_tags" : [], "css" : "@namespace url(http://www.w3.org/1999/xhtml);\r\n\r\n@-moz-document domain(\"www.youtube.com\") {\r\n#yt-masthead-container{\r\nbackground-image:url('http://images5.fanpop.com/image/photos/26500000/MLP-wallpapers-my-little-pony-friendship-is-magic-26559314-2560-1600.png') !important;\r\nbackground-position:-150px 400px !important;\r\n}\r\n#yt-masthead-user-displayname\r\n{\r\ncolor: black !important;\r\nfont-size:15px !important;\r\nfont-weight: bold !important;\r\ntext-shadow: #fff 2px 0px 15px,#fff 2px 0px 15px,#fff 2px 0px 15px,#fff 2px 0px 15px,#fff 2px 0px 15px;\r\n}\r\n\r\n\r\n\r\n}", "discussions" : [], "discussionsCount" : 0, "commentsCount" : 0, "userjs_url" : "/styles/userjs/91624/youtube-bronybar.user.js", "style_settings" : []} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "null"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "null"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}}, "required": ["name", "version", "description", "author", "contributors", "keywords", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "jquery-inputformat", "version" : "1.0.0", "description" : "jQuery based input formating", "author" : "Ali Irawan <boylevantz@gmail.com>", "contributors" : [{"name" : "Ali Irawan", "email" : "boylevantz@gmail.com"}], "keywords" : ["input", "format", "mask", "number", "numeric", "amount", "money", "jquery"], "license" : "Apache"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}}, "required": ["name", "version", "description", "author", "contributors", "keywords", "license"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "setup": {"type": "string"}, "compile": {"type": "string"}, "compileLocal": {"type": "string"}, "run": {"type": "string"}, "reset": {"type": "string"}}, "required": ["test", "setup", "compile", "compileLocal", "run", "reset"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"axios": {"type": "string"}, "rimraf": {"type": "string"}}, "required": ["axios", "rimraf"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "author", "license", "bugs", "homepage", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "pcpp-cli", "version" : "1.0.0", "description" : "The PCpp command line interface", "main" : "index.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1", "setup" : "npm run reset && node .", "compile" : "node compile.js", "compileLocal" : "node compileLocal.js", "run" : "cd workspace && py main.py", "reset" : "node reset.js"}, "repository" : {"type" : "git", "url" : "git+https://github.com/jiricekcz/pcpp-cli.git"}, "author" : "", "license" : "ISC", "bugs" : {"url" : "https://github.com/jiricekcz/pcpp-cli/issues"}, "homepage" : "https://github.com/jiricekcz/pcpp-cli#readme", "dependencies" : {"axios" : "^0.21.1", "rimraf" : "^3.0.2"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "setup": {"type": "string"}, "compile": {"type": "string"}, "compileLocal": {"type": "string"}, "run": {"type": "string"}, "reset": {"type": "string"}}, "required": ["test", "setup", "compile", "compileLocal", "run", "reset"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"axios": {"type": "string"}, "rimraf": {"type": "string"}}, "required": ["axios", "rimraf"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "author", "license", "bugs", "homepage", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"userId" : 1728, "cartId" : "5ae43ae0-a075-4a65-ba2a-5bba70da2d93", "preferredProducts" : [1263, 1758, 1124, 1783], "productReviews" : [{"productId" : 1176, "reviewText" : "i use it every Tuesday when i'm in my homeless shelter.", "reviewDate" : "2018-11-19T04:45:41.7965014+02:00"}, {"productId" : 2322, "reviewText" : "It only works when I'm Niue.", "reviewDate" : "2016-06-15T20:00:43.1020943+03:00"}]} | json_instruct | {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"track": {"type": "string"}, "exercise": {"type": "string"}, "id": {"type": "string"}, "url": {"type": "string"}, "handle": {"type": "string"}, "is_requester": {"type": "boolean"}, "auto_approve": {"type": "boolean"}}, "required": ["track", "exercise", "id", "url", "handle", "is_requester", "auto_approve"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"track" : "csharp", "exercise" : "gigasecond", "id" : "4ca9cbae91484020bf6774b27a6630fb", "url" : "https://exercism.io/my/solutions/4ca9cbae91484020bf6774b27a6630fb", "handle" : "cmccandless", "is_requester" : true, "auto_approve" : false} | json_instruct | {"type": "object", "properties": {"track": {"type": "string"}, "exercise": {"type": "string"}, "id": {"type": "string"}, "url": {"type": "string"}, "handle": {"type": "string"}, "is_requester": {"type": "boolean"}, "auto_approve": {"type": "boolean"}}, "required": ["track", "exercise", "id", "url", "handle", "is_requester", "auto_approve"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"Time": {"type": "string"}, "Temp": {"type": "number"}, "RelHum": {"type": "integer"}, "WindSpeed": {"type": "number"}, "WindDir": {"type": "integer"}}, "required": ["Time", "Temp", "RelHum", "WindSpeed", "WindDir"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Time" : "2021-05-07T23:00:00Z", "Temp" : 17.8, "RelHum" : 36, "WindSpeed" : 8.3, "WindDir" : 339} | json_instruct | {"type": "object", "properties": {"Time": {"type": "string"}, "Temp": {"type": "number"}, "RelHum": {"type": "integer"}, "WindSpeed": {"type": "number"}, "WindDir": {"type": "integer"}}, "required": ["Time", "Temp", "RelHum", "WindSpeed", "WindDir"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"publisher_name": {"type": "string"}, "journals": {"type": "integer"}, "scihub": {"type": "integer"}, "crossref_open_access": {"type": "integer"}, "crossref_active": {"type": "integer"}, "crossref": {"type": "integer"}, "coverage": {"type": "number"}, "publisher_slug": {"type": "string"}}, "required": ["publisher_name", "journals", "scihub", "crossref_open_access", "crossref_active", "crossref", "coverage", "publisher_slug"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"publisher_name" : "Ministere de l'Economie, Direction de la Prevision", "journals" : 1, "scihub" : 17, "crossref_open_access" : 0, "crossref_active" : 1058, "crossref" : 1058, "coverage" : 0.01606805, "publisher_slug" : "ministere-de-leconomie-direction-de-la-prevision"} | json_instruct | {"type": "object", "properties": {"publisher_name": {"type": "string"}, "journals": {"type": "integer"}, "scihub": {"type": "integer"}, "crossref_open_access": {"type": "integer"}, "crossref_active": {"type": "integer"}, "crossref": {"type": "integer"}, "coverage": {"type": "number"}, "publisher_slug": {"type": "string"}}, "required": ["publisher_name", "journals", "scihub", "crossref_open_access", "crossref_active", "crossref", "coverage", "publisher_slug"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"year" : 1991, "sex" : "F", "n" : 7, "prop" : 3.44e-06}, {"year" : 1993, "sex" : "F", "n" : 5, "prop" : 2.54e-06}, {"year" : 1994, "sex" : "F", "n" : 7, "prop" : 3.59e-06}, {"year" : 1995, "sex" : "F", "n" : 7, "prop" : 3.64e-06}, {"year" : 1997, "sex" : "F", "n" : 7, "prop" : 3.67e-06}, {"year" : 1998, "sex" : "F", "n" : 5, "prop" : 2.58e-06}, {"year" : 2000, "sex" : "F", "n" : 6, "prop" : 3.01e-06}, {"year" : 2003, "sex" : "F", "n" : 5, "prop" : 2.49e-06}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "sortorder": {"type": "integer"}, "rarity": {"type": "string"}, "category": {"type": "string"}, "materialtype": {"type": "string"}, "source": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "sortorder", "rarity", "category", "materialtype", "source"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Vajrada Amethyst Gemstone", "description" : "Character Ascension material.\n\"This body is the noblest and most eminent of all in this world.\n\"It should hold absolute control over this world.\n\"It once promised its people a dream: the never-changing 'eternity.'\"", "sortorder" : 1837, "rarity" : "5", "category" : "AVATAR_MATERIAL", "materialtype" : "Character Level-Up Material", "source" : ["Dropped by Lv. 75+ Electro Hypostases", "Dropped by Lv. 75+ Thunder Manifestations", "Crafted"]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "sortorder": {"type": "integer"}, "rarity": {"type": "string"}, "category": {"type": "string"}, "materialtype": {"type": "string"}, "source": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "sortorder", "rarity", "category", "materialtype", "source"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "argumentText": {"type": "string"}, "conclusion": {"type": "string"}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "premises": {"type": "array", "items": {"type": "string"}}}, "required": ["citations", "argumentText", "conclusion", "language", "lookupTerms", "metaLanguage", "premises"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"citations" : [{"textCitation" : "[See dmresv on Metamath](http://us.metamath.org/mpegif/dmresv.html)"}], "argumentText" : "ARGUMENT\n\n| Step | Hyp | Ref | Expression |\n|---|---|---|---|\n\n| 1 | | #P_dmres | |- dom ( A |` _V ) = ( _V i^i dom A ) |\n| 2 | | #P_incom | |- ( _V i^i dom A ) = ( dom A i^i _V ) |\n| 3 | | #P_inv1 | |- ( dom A i^i _V ) = dom A |\n| 4 | 1, 2, 3 | #P_3eqtri | |- dom ( A |` _V ) = dom A |", "conclusion" : "#P_dmresv", "language" : "METAMATH_SET_MM", "lookupTerms" : ["#T_cdm", "#T_cA.wceq", "#T_cres", "#T_cvv", "#T_wceq", "#T_cvv", "#T_cin", "#T_cdm", "#T_cA.wceq", "#T_cvv", "#T_cin", "#T_cdm", "#T_cA.wceq", "#T_wceq", "#T_cdm", "#T_cA.wceq", "#T_cin", "#T_cvv", "#T_cdm", "#T_cA.wceq", "#T_cin", "#T_cvv", "#T_wceq", "#T_cdm", "#T_cA.wceq", "#T_cdm", "#T_cA", "#T_cres", "#T_cvv", "#T_wceq", "#T_cdm", "#T_cA"], "metaLanguage" : "METAMATH", "premises" : ["#P_dmres", "#P_incom", "#P_3eqtri", "#P_inv1"]} | json_instruct | {"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "argumentText": {"type": "string"}, "conclusion": {"type": "string"}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "premises": {"type": "array", "items": {"type": "string"}}}, "required": ["citations", "argumentText", "conclusion", "language", "lookupTerms", "metaLanguage", "premises"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "start:watch": {"type": "string"}, "build:js": {"type": "string"}, "build:js:watch": {"type": "string"}, "build:js:prod": {"type": "string"}, "build:css": {"type": "string"}, "build:css:watch": {"type": "string"}, "test": {"type": "string"}}, "required": ["start", "start:watch", "build:js", "build:js:watch", "build:js:prod", "build:css", "build:css:watch", "test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"babel-core": {"type": "string"}, "babel-preset-es2015": {"type": "string"}, "babel-preset-react": {"type": "string"}, "babel-preset-stage-0": {"type": "string"}, "plasmajs": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}}, "required": ["babel-core", "babel-preset-es2015", "babel-preset-react", "babel-preset-stage-0", "plasmajs", "react", "react-dom"]}, "devDependencies": {"type": "object", "properties": {"babel-loader": {"type": "string"}, "gulp": {"type": "string"}, "gulp-autoprefixer": {"type": "string"}, "gulp-minify-css": {"type": "string"}, "gulp-sass": {"type": "string"}, "webpack": {"type": "string"}}, "required": ["babel-loader", "gulp", "gulp-autoprefixer", "gulp-minify-css", "gulp-sass", "webpack"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "plasmajs-starter-kit", "version" : "0.0.1", "description" : "The starter kit for making a web app in plasmaJS", "main" : "server.jsx", "scripts" : {"start" : "plasmajs .", "start:watch" : "nodemon -e jsx --exec plasmajs .", "build:js" : "webpack", "build:js:watch" : "webpack -w", "build:js:prod" : "webpack -p", "build:css" : "gulp buildSASS", "build:css:watch" : "gulp", "test" : "echo \"Error: no test specified\" && exit 1"}, "author" : "Akshay Nair <phenax5@gmail.com>", "license" : "Apache-2.0", "dependencies" : {"babel-core" : "^6.18.2", "babel-preset-es2015" : "^6.18.0", "babel-preset-react" : "^6.16.0", "babel-preset-stage-0" : "^6.16.0", "plasmajs" : "^0.1.6", "react" : "^15.3.2", "react-dom" : "^15.3.2"}, "devDependencies" : {"babel-loader" : "^6.2.8", "gulp" : "^3.9.1", "gulp-autoprefixer" : "^3.1.1", "gulp-minify-css" : "^1.2.4", "gulp-sass" : "^2.3.2", "webpack" : "^2.1.0-beta.25"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "start:watch": {"type": "string"}, "build:js": {"type": "string"}, "build:js:watch": {"type": "string"}, "build:js:prod": {"type": "string"}, "build:css": {"type": "string"}, "build:css:watch": {"type": "string"}, "test": {"type": "string"}}, "required": ["start", "start:watch", "build:js", "build:js:watch", "build:js:prod", "build:css", "build:css:watch", "test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"babel-core": {"type": "string"}, "babel-preset-es2015": {"type": "string"}, "babel-preset-react": {"type": "string"}, "babel-preset-stage-0": {"type": "string"}, "plasmajs": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}}, "required": ["babel-core", "babel-preset-es2015", "babel-preset-react", "babel-preset-stage-0", "plasmajs", "react", "react-dom"]}, "devDependencies": {"type": "object", "properties": {"babel-loader": {"type": "string"}, "gulp": {"type": "string"}, "gulp-autoprefixer": {"type": "string"}, "gulp-minify-css": {"type": "string"}, "gulp-sass": {"type": "string"}, "webpack": {"type": "string"}}, "required": ["babel-loader", "gulp", "gulp-autoprefixer", "gulp-minify-css", "gulp-sass", "webpack"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"data": {"type": "object", "properties": {"publication": {"type": "object", "properties": {"publicationId": {"type": "string"}, "publicationType": {"type": "string"}, "workId": {"type": "string"}, "isbn": {"type": "null"}, "publicationUrl": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "prices": {"type": "array", "items": {"type": "object", "properties": {"currencyCode": {"type": "string"}, "unitPrice": {"type": "number"}, "__typename": {"type": "string"}}, "required": ["currencyCode", "unitPrice", "__typename"]}}, "work": {"type": "object", "properties": {"workId": {"type": "string"}, "fullTitle": {"type": "string"}, "doi": {"type": "string"}, "publicationDate": {"type": "string"}, "place": {"type": "string"}, "contributions": {"type": "array", "items": {"type": "object", "properties": {"fullName": {"type": "string"}, "contributionType": {"type": "string"}, "mainContribution": {"type": "boolean"}, "contributionOrdinal": {"type": "integer"}}, "required": ["fullName", "contributionType", "mainContribution", "contributionOrdinal"]}}, "imprint": {"type": "object", "properties": {"publisher": {"type": "object", "properties": {"publisherName": {"type": "string"}, "publisherId": {"type": "string"}}, "required": ["publisherName", "publisherId"]}}, "required": ["publisher"]}}, "required": ["workId", "fullTitle", "doi", "publicationDate", "place", "contributions", "imprint"]}, "__typename": {"type": "string"}}, "required": ["publicationId", "publicationType", "workId", "isbn", "publicationUrl", "createdAt", "updatedAt", "prices", "work", "__typename"]}}, "required": ["publication"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"data" : {"publication" : {"publicationId" : "34712b75-dcdd-408b-8d0c-cf29a35be2e5", "publicationType" : "PAPERBACK", "workId" : "1399a869-9f56-4980-981d-2cc83f0a6668", "isbn" : null, "publicationUrl" : "http://amzn.to/2hxpKVL", "createdAt" : "2021-01-07T16:32:40.853895+00:00", "updatedAt" : "2021-01-07T16:32:40.853895+00:00", "prices" : [{"currencyCode" : "USD", "unitPrice" : 18.0, "__typename" : "Price"}], "work" : {"workId" : "1399a869-9f56-4980-981d-2cc83f0a6668", "fullTitle" : "Truth and Fiction: Notes on (Exceptional) Faith in Art", "doi" : "https://doi.org/10.21983/P3.0007.1.00", "publicationDate" : "2012-05-25", "place" : "Brooklyn, NY", "contributions" : [{"fullName" : "Milcho Manchevski", "contributionType" : "AUTHOR", "mainContribution" : true, "contributionOrdinal" : 1}, {"fullName" : "Adrian Martin", "contributionType" : "AFTERWORD_BY", "mainContribution" : false, "contributionOrdinal" : 2}], "imprint" : {"publisher" : {"publisherName" : "punctum books", "publisherId" : "9c41b13c-cecc-4f6a-a151-be4682915ef5"}}}, "__typename" : "Publication"}}} | json_instruct | {"type": "object", "properties": {"data": {"type": "object", "properties": {"publication": {"type": "object", "properties": {"publicationId": {"type": "string"}, "publicationType": {"type": "string"}, "workId": {"type": "string"}, "isbn": {"type": "null"}, "publicationUrl": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "prices": {"type": "array", "items": {"type": "object", "properties": {"currencyCode": {"type": "string"}, "unitPrice": {"type": "number"}, "__typename": {"type": "string"}}, "required": ["currencyCode", "unitPrice", "__typename"]}}, "work": {"type": "object", "properties": {"workId": {"type": "string"}, "fullTitle": {"type": "string"}, "doi": {"type": "string"}, "publicationDate": {"type": "string"}, "place": {"type": "string"}, "contributions": {"type": "array", "items": {"type": "object", "properties": {"fullName": {"type": "string"}, "contributionType": {"type": "string"}, "mainContribution": {"type": "boolean"}, "contributionOrdinal": {"type": "integer"}}, "required": ["fullName", "contributionType", "mainContribution", "contributionOrdinal"]}}, "imprint": {"type": "object", "properties": {"publisher": {"type": "object", "properties": {"publisherName": {"type": "string"}, "publisherId": {"type": "string"}}, "required": ["publisherName", "publisherId"]}}, "required": ["publisher"]}}, "required": ["workId", "fullTitle", "doi", "publicationDate", "place", "contributions", "imprint"]}, "__typename": {"type": "string"}}, "required": ["publicationId", "publicationType", "workId", "isbn", "publicationUrl", "createdAt", "updatedAt", "prices", "work", "__typename"]}}, "required": ["publication"]}}, "required": ["data"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"get": {"type": "object", "properties": {"tags": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "operationId": {"type": "string"}, "parameters": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "in": {"type": "string"}, "description": {"type": "string"}, "required": {"type": "boolean"}, "schema": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["name", "in", "description", "required", "schema"]}}, "responses": {"type": "object", "properties": {"200": {"type": "object", "properties": {"description": {"type": "string"}, "content": {"type": "object", "properties": {"application/json": {"type": "object", "properties": {"schema": {"type": "object", "properties": {"type": {"type": "string"}, "items": {"type": "object", "properties": {"$ref": {"type": "string"}}, "required": ["$ref"]}}, "required": ["type", "items"]}, "example": {"type": "array", "items": {"type": "object", "properties": {"dateCreated": {"type": "string"}, "id": {"type": "string"}, "message": {"type": "string"}}, "required": ["dateCreated", "id", "message"]}}}, "required": ["schema", "example"]}}, "required": ["application/json"]}}, "required": ["description", "content"]}, "403": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}, "404": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}}, "required": ["200", "403", "404"]}, "security": {"type": "array", "items": {"type": "object", "properties": {"auth_token": {"type": "array", "items": {"type": "string"}}}, "required": ["auth_token"]}}}, "required": ["tags", "description", "operationId", "parameters", "responses", "security"]}}, "required": ["get"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"get" : {"tags" : ["Releases"], "description" : "List a project release's commits.", "operationId" : "List a Project Release's Commits", "parameters" : [{"name" : "organization_slug", "in" : "path", "description" : "The slug of the organization the release belongs to.", "required" : true, "schema" : {"type" : "string"}}, {"name" : "project_slug", "in" : "path", "description" : "The slug of the project the release belongs to.", "required" : true, "schema" : {"type" : "string"}}, {"name" : "version", "in" : "path", "description" : "The version identifier of the release.", "required" : true, "schema" : {"type" : "string"}}], "responses" : {"200" : {"description" : "Success", "content" : {"application/json" : {"schema" : {"type" : "array", "items" : {"$ref" : "../../components/schemas/releases/commit.json#/MinimalCommit"}}, "example" : [{"dateCreated" : "2018-11-06T21:19:58.536Z", "id" : "acbafc639127fd89d10f474520104517ff1d709e", "message" : "Initial commit from Create Next App"}]}}}, "403" : {"description" : "Forbidden"}, "404" : {"description" : "Not Found"}}, "security" : [{"auth_token" : ["project:releases"]}]}} | json_instruct | {"type": "object", "properties": {"get": {"type": "object", "properties": {"tags": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "operationId": {"type": "string"}, "parameters": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "in": {"type": "string"}, "description": {"type": "string"}, "required": {"type": "boolean"}, "schema": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["name", "in", "description", "required", "schema"]}}, "responses": {"type": "object", "properties": {"200": {"type": "object", "properties": {"description": {"type": "string"}, "content": {"type": "object", "properties": {"application/json": {"type": "object", "properties": {"schema": {"type": "object", "properties": {"type": {"type": "string"}, "items": {"type": "object", "properties": {"$ref": {"type": "string"}}, "required": ["$ref"]}}, "required": ["type", "items"]}, "example": {"type": "array", "items": {"type": "object", "properties": {"dateCreated": {"type": "string"}, "id": {"type": "string"}, "message": {"type": "string"}}, "required": ["dateCreated", "id", "message"]}}}, "required": ["schema", "example"]}}, "required": ["application/json"]}}, "required": ["description", "content"]}, "403": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}, "404": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}}, "required": ["200", "403", "404"]}, "security": {"type": "array", "items": {"type": "object", "properties": {"auth_token": {"type": "array", "items": {"type": "string"}}}, "required": ["auth_token"]}}}, "required": ["tags", "description", "operationId", "parameters", "responses", "security"]}}, "required": ["get"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "object", "properties": {"DeniedAlternatives": {"type": "array", "items": {}}, "Files": {"type": "object", "properties": {"items/armors/juux/treyarch/treyarch.head": {"type": "array", "items": {"type": "string"}}}, "required": ["items/armors/juux/treyarch/treyarch.head"]}, "Texts": {"type": "object", "properties": {"Chs": {"type": "string"}, "Eng": {"type": "string"}}, "required": ["Chs", "Eng"]}}, "required": ["DeniedAlternatives", "Files", "Texts"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"DeniedAlternatives" : [], "Files" : {"items/armors/juux/treyarch/treyarch.head" : ["/description"]}, "Texts" : {"Chs" : "\u6c38\u8fdc\u4e0d\u8981\u76f8\u4fe1\u4e00\u4f4d\u6cd5\u745e\u56fe\u6d41\u653e\u8005\u3002", "Eng" : "Never trust a Pharitu Treyarch."}}, {"DeniedAlternatives" : [], "Files" : {"items/armors/juux/treyarch/treyarch.head" : ["/shortdescription"]}, "Texts" : {"Chs" : "\u6d41\u653e\u8005\u9762\u5177", "Eng" : "Treyarch Mask"}}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"DeniedAlternatives": {"type": "array", "items": {}}, "Files": {"type": "object", "properties": {"items/armors/juux/treyarch/treyarch.head": {"type": "array", "items": {"type": "string"}}}, "required": ["items/armors/juux/treyarch/treyarch.head"]}, "Texts": {"type": "object", "properties": {"Chs": {"type": "string"}, "Eng": {"type": "string"}}, "required": ["Chs", "Eng"]}}, "required": ["DeniedAlternatives", "Files", "Texts"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "author": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}}, "required": ["build"]}}, "required": ["name", "version", "private", "author", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "zflow-framework", "version" : "0.0.1", "private" : true, "author" : {"name" : "Ezequiel Gandolfi"}, "scripts" : {"build" : ""}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "author": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}}, "required": ["build"]}}, "required": ["name", "version", "private", "author", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "minimum-stability": {"type": "string"}, "require": {"type": "object", "properties": {"grundmanis/laracms": {"type": "string"}, "dimsav/laravel-translatable": {"type": "string"}}, "required": ["grundmanis/laracms", "dimsav/laravel-translatable"]}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}}, "required": ["providers"]}}, "required": ["laravel"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Grundmanis\\Laracms\\Modules\\Pages\\": {"type": "string"}}, "required": ["Grundmanis\\Laracms\\Modules\\Pages\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "keywords", "license", "authors", "minimum-stability", "require", "extra", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "grundmanis/laracms-pages", "description" : "Laracms pages module", "keywords" : ["laravel", "cms", "admin", "dashboard", "panel", "content", "module"], "license" : "MIT", "authors" : [{"name" : "Armand Grundmanis", "email" : "agrundmanis@inbox.lv"}], "minimum-stability" : "dev", "require" : {"grundmanis/laracms" : "@dev", "dimsav/laravel-translatable" : ">=8.0"}, "extra" : {"laravel" : {"providers" : ["Grundmanis\\Laracms\\Modules\\Pages\\Providers\\PagesProvider", "Dimsav\\Translatable\\TranslatableServiceProvider"]}}, "autoload" : {"psr-4" : {"Grundmanis\\Laracms\\Modules\\Pages\\" : "src/"}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "minimum-stability": {"type": "string"}, "require": {"type": "object", "properties": {"grundmanis/laracms": {"type": "string"}, "dimsav/laravel-translatable": {"type": "string"}}, "required": ["grundmanis/laracms", "dimsav/laravel-translatable"]}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}}, "required": ["providers"]}}, "required": ["laravel"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Grundmanis\\Laracms\\Modules\\Pages\\": {"type": "string"}}, "required": ["Grundmanis\\Laracms\\Modules\\Pages\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "keywords", "license", "authors", "minimum-stability", "require", "extra", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"meta": {"type": "object", "properties": {"version": {"type": "integer"}}, "required": ["version"]}, "minimum_update": {"type": "object", "properties": {"build_number": {"type": "integer"}, "default_language": {"type": "string"}, "url": {"type": "string"}, "strings": {"type": "object", "properties": {"en": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "message"]}, "fr": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "message"]}}, "required": ["en", "fr"]}}, "required": ["build_number", "default_language", "url", "strings"]}, "preferred_update": {"type": "object", "properties": {"build_number": {"type": "integer"}, "default_language": {"type": "string"}, "url": {"type": "string"}, "strings": {"type": "object", "properties": {"en": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "cancel_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "cancel_option", "message"]}, "fr": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "cancel_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "cancel_option", "message"]}}, "required": ["en", "fr"]}}, "required": ["build_number", "default_language", "url", "strings"]}}, "required": ["meta", "minimum_update", "preferred_update"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"meta" : {"version" : 1}, "minimum_update" : {"build_number" : 48, "default_language" : "en", "url" : "https://play.google.com/store/apps/details?id=com.togethera.webapp", "strings" : {"en" : {"title" : "Please update now", "update_option" : "Update", "message" : "This version is no longer supported. Please update to the latest version."}, "fr" : {"title" : "Please update now", "update_option" : "Update", "message" : "This version is no longer supported. Please update to the latest version."}}}, "preferred_update" : {"build_number" : 61, "default_language" : "en", "url" : "https://play.google.com/store/apps/details?id=com.togethera.webapp", "strings" : {"en" : {"title" : "Please update now", "update_option" : "Update", "cancel_option" : "Cancel", "message" : "This version is no longer supported. Please update to the latest version."}, "fr" : {"title" : "Please update now", "update_option" : "Update", "cancel_option" : "Cancel", "message" : "This version is no longer supported. Please update to the latest version."}}}} | json_instruct | {"type": "object", "properties": {"meta": {"type": "object", "properties": {"version": {"type": "integer"}}, "required": ["version"]}, "minimum_update": {"type": "object", "properties": {"build_number": {"type": "integer"}, "default_language": {"type": "string"}, "url": {"type": "string"}, "strings": {"type": "object", "properties": {"en": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "message"]}, "fr": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "message"]}}, "required": ["en", "fr"]}}, "required": ["build_number", "default_language", "url", "strings"]}, "preferred_update": {"type": "object", "properties": {"build_number": {"type": "integer"}, "default_language": {"type": "string"}, "url": {"type": "string"}, "strings": {"type": "object", "properties": {"en": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "cancel_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "cancel_option", "message"]}, "fr": {"type": "object", "properties": {"title": {"type": "string"}, "update_option": {"type": "string"}, "cancel_option": {"type": "string"}, "message": {"type": "string"}}, "required": ["title", "update_option", "cancel_option", "message"]}}, "required": ["en", "fr"]}}, "required": ["build_number", "default_language", "url", "strings"]}}, "required": ["meta", "minimum_update", "preferred_update"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}, "lint": {"type": "string"}}, "required": ["start", "build", "lint"]}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@babel/core": {"type": "string"}, "@babel/plugin-proposal-class-properties": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/register": {"type": "string"}, "babel-eslint": {"type": "string"}, "eslint": {"type": "string"}, "eslint-plugin-import": {"type": "string"}, "eslint-plugin-jsx-a11y": {"type": "string"}, "fancy-log": {"type": "string"}, "gulp": {"type": "string"}, "gulp-babel": {"type": "string"}, "gulp-watch": {"type": "string"}}, "required": ["@babel/core", "@babel/plugin-proposal-class-properties", "@babel/preset-env", "@babel/register", "babel-eslint", "eslint", "eslint-plugin-import", "eslint-plugin-jsx-a11y", "fancy-log", "gulp", "gulp-babel", "gulp-watch"]}, "dependencies": {"type": "object", "properties": {"lodash": {"type": "string"}, "mjml": {"type": "string"}}, "required": ["lodash", "mjml"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "test", "version" : "1.0.1", "description" : "", "main" : "index.js", "scripts" : {"start" : "gulp watch", "build" : "gulp build", "lint" : "eslint components"}, "author" : "", "license" : "ISC", "devDependencies" : {"@babel/core" : "^7.1.2", "@babel/plugin-proposal-class-properties" : "^7.1.0", "@babel/preset-env" : "^7.1.0", "@babel/register" : "^7.0.0", "babel-eslint" : "^10.0.1", "eslint" : "^5.7.0", "eslint-plugin-import" : "^2.14.0", "eslint-plugin-jsx-a11y" : "^6.1.2", "fancy-log" : "^1.3.2", "gulp" : "^4.0.0", "gulp-babel" : "^8.0.0", "gulp-watch" : "^5.0.1"}, "dependencies" : {"lodash" : "^4.17.11", "mjml" : "^4.2.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}, "lint": {"type": "string"}}, "required": ["start", "build", "lint"]}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@babel/core": {"type": "string"}, "@babel/plugin-proposal-class-properties": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/register": {"type": "string"}, "babel-eslint": {"type": "string"}, "eslint": {"type": "string"}, "eslint-plugin-import": {"type": "string"}, "eslint-plugin-jsx-a11y": {"type": "string"}, "fancy-log": {"type": "string"}, "gulp": {"type": "string"}, "gulp-babel": {"type": "string"}, "gulp-watch": {"type": "string"}}, "required": ["@babel/core", "@babel/plugin-proposal-class-properties", "@babel/preset-env", "@babel/register", "babel-eslint", "eslint", "eslint-plugin-import", "eslint-plugin-jsx-a11y", "fancy-log", "gulp", "gulp-babel", "gulp-watch"]}, "dependencies": {"type": "object", "properties": {"lodash": {"type": "string"}, "mjml": {"type": "string"}}, "required": ["lodash", "mjml"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-122.402881, 47.253074], [-122.40078, 47.253713], [-122.382049, 47.254092], [-122.356716, 47.253667], [-122.357142, 47.255339], [-122.359707, 47.256943], [-122.357984, 47.258683], [-122.356606, 47.258215], [-122.356242, 47.261374], [-122.355733, 47.273489], [-122.356281, 47.273496], [-122.356263, 47.275548], [-122.357828, 47.275715], [-122.357863, 47.279024], [-122.335872, 47.263825], [-122.336519, 47.259662], [-122.33498, 47.247971], [-122.336555, 47.245044], [-122.335861, 47.243266], [-122.338678, 47.241372], [-122.357009, 47.240724], [-122.357033, 47.222364], [-122.392546, 47.236303], [-122.396637, 47.239315], [-122.399682, 47.240482], [-122.398523, 47.24139], [-122.398605, 47.243208], [-122.400648, 47.244637], [-122.400685, 47.249115], [-122.402881, 47.253074]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 79713}}]} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"media_id": {"type": "string"}, "local_id": {"type": "string"}, "title": {"type": "string"}, "thumbnail": {"type": "string"}, "desc": {"type": "string"}, "auto_desc": {"type": "object", "properties": {"translatedText": {"type": "string"}, "input": {"type": "string"}}, "required": ["translatedText", "input"]}}, "required": ["media_id", "local_id", "title", "thumbnail", "desc", "auto_desc"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"media_id" : "77490742", "local_id" : "NT062\n", "title" : "File:Anna_Tropp,_Sven_Tropp_and_Mia_Carlson_in_V\u00e5rdanser_at_Kungliga_Operan_1911_-_SMV_-_NT062.tif", "thumbnail" : "https://upload.wikimedia.org/wikipedia/commons/thumb/8/86/Anna_Tropp,_Sven_Tropp_and_Mia_Carlson_in_V\u00e5rdanser_at_Kungliga_Operan_1911_-_SMV_-_NT062.tif/500px-Anna_Tropp,_Sven_Tropp_and_Mia_Carlson_in_V\u00e5rdanser_at_Kungliga_Operan_1911_-_SMV_-_NT062.tif.jpg", "desc" : " Anna Tropp, Sven Tropp och Mia Carlson i baletten V\u00e5rdanser, Kungliga Operan 1911. Skannat glasnegativ\n", "auto_desc" : {"translatedText" : "Anna Tropp, Sven Tropp and Mia Carlson in the ballet Spring dances, The Royal Opera 1911. Scanned glass negative", "input" : " Anna Tropp, Sven Tropp och Mia Carlson i baletten V\u00e5rdanser, Kungliga Operan 1911. Skannat glasnegativ\n"}} | json_instruct | {"type": "object", "properties": {"media_id": {"type": "string"}, "local_id": {"type": "string"}, "title": {"type": "string"}, "thumbnail": {"type": "string"}, "desc": {"type": "string"}, "auto_desc": {"type": "object", "properties": {"translatedText": {"type": "string"}, "input": {"type": "string"}}, "required": ["translatedText", "input"]}}, "required": ["media_id", "local_id", "title", "thumbnail", "desc", "auto_desc"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"postinstall": {"type": "string"}}, "required": ["postinstall"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"open": {"type": "string"}}, "required": ["open"]}, "config": {"type": "object", "properties": {"unsafe-perm": {"type": "boolean"}}, "required": ["unsafe-perm"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies", "config"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "sveder", "version" : "1.0.0", "description" : "Open sveder.com", "main" : "index.js", "scripts" : {"postinstall" : "node -e 'const open = require(\"open\"); open(\"http://sveder.com\")'"}, "author" : "sveder", "license" : "MIT", "dependencies" : {"open" : "8.2.1"}, "config" : {"unsafe-perm" : true}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"postinstall": {"type": "string"}}, "required": ["postinstall"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"open": {"type": "string"}}, "required": ["open"]}, "config": {"type": "object", "properties": {"unsafe-perm": {"type": "boolean"}}, "required": ["unsafe-perm"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies", "config"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"Update": {"type": "string"}, "answer": {"type": "array", "items": {"type": "string"}}, "category": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "detail": {"type": "string"}, "explanation": {"type": "array", "items": {"type": "string"}}, "id": {"type": "integer"}, "saved_answer": {"type": "null"}, "type": {"type": "string"}}, "required": ["Update", "answer", "category", "choices", "detail", "explanation", "id", "saved_answer", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Update" : "2020-03-23 15:28:16", "answer" : ["D"], "category" : "saa", "choices" : ["A.None of these.", "B.Amazon Instance Storage", "C.Any of these", "D.Amazon EBS "], "detail" : "Which Amazon storage do you think is the best for my database-style applications that frequently encounter many random reads and writes across the dataset?", "explanation" : ["Correct answer is D as EBS is recommended. RDS also uses Amazon Elastic Block Store (Amazon EBS) volumes for database and log storage.", "Refer AWS documentation - EBS", "Amazon EBS is recommended when data must be quickly accessible and requires long-term persistence. EBS volumes are particularly well-suited for use as the primary storage for file systems, databases, or for any applications that require fine granular updates and access to raw, unformatted, block-level storage"], "id" : 402, "saved_answer" : null, "type" : "Multiple Choice"} | json_instruct | {"type": "object", "properties": {"Update": {"type": "string"}, "answer": {"type": "array", "items": {"type": "string"}}, "category": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "detail": {"type": "string"}, "explanation": {"type": "array", "items": {"type": "string"}}, "id": {"type": "integer"}, "saved_answer": {"type": "null"}, "type": {"type": "string"}}, "required": ["Update", "answer", "category", "choices", "detail", "explanation", "id", "saved_answer", "type"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {"type": "object", "properties": {"file": {"type": "string"}, "line": {"type": "string"}, "column": {"type": "string"}, "message": {"type": "string"}, "level": {"type": "string"}, "type": {"type": "string"}}, "required": ["file", "line", "column", "message", "level", "type"]}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"contract" : "simple_suicide", "tool" : "solhint", "start" : 1565705909.3025112, "end" : 1565705913.956367, "duration" : 4.653855800628662, "analysis" : [{"file" : "/dataset/access_control/simple_suicide.sol", "line" : "2", "column" : "2", "message" : "Line length must be no more than 120 but current length is 138.", "level" : "Error", "type" : "max-line-length"}, {"file" : "/dataset/access_control/simple_suicide.sol", "line" : "12", "column" : "3", "message" : "Expected indentation of 4 spaces but found 2", "level" : "Error", "type" : "indent"}, {"file" : "/dataset/access_control/simple_suicide.sol", "line" : "13", "column" : "5", "message" : "Expected indentation of 8 spaces but found 4", "level" : "Error", "type" : "indent"}, {"file" : "/dataset/access_control/simple_suicide.sol", "line" : "14", "column" : "3", "message" : "Expected indentation of 4 spaces but found 2", "level" : "Error", "type" : "indent"}]} | json_instruct | {"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {"type": "object", "properties": {"file": {"type": "string"}, "line": {"type": "string"}, "column": {"type": "string"}, "message": {"type": "string"}, "level": {"type": "string"}, "type": {"type": "string"}}, "required": ["file", "line", "column", "message", "level", "type"]}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "types": {"type": "string"}, "license": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "files": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"@concepta/nestjs-common": {"type": "string"}, "@concepta/nestjs-exception": {"type": "string"}, "@nestjs/common": {"type": "string"}, "@nestjs/config": {"type": "string"}, "@nestjs/typeorm": {"type": "string"}}, "required": ["@concepta/nestjs-common", "@concepta/nestjs-exception", "@nestjs/common", "@nestjs/config", "@nestjs/typeorm"]}, "devDependencies": {"type": "object", "properties": {"@devniel/nestjs-typeorm-testing": {"type": "string"}, "@nestjs/testing": {"type": "string"}, "jest-mock-extended": {"type": "string"}, "sqlite3": {"type": "string"}, "typeorm": {"type": "string"}}, "required": ["@devniel/nestjs-typeorm-testing", "@nestjs/testing", "jest-mock-extended", "sqlite3", "typeorm"]}, "peerDependencies": {"type": "object", "properties": {"class-transformer": {"type": "string"}, "class-validator": {"type": "string"}, "typeorm": {"type": "string"}}, "required": ["class-transformer", "class-validator", "typeorm"]}}, "required": ["name", "version", "description", "main", "types", "license", "publishConfig", "files", "dependencies", "devDependencies", "peerDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@concepta/nestjs-typeorm-ext", "version" : "4.0.0-alpha.11", "description" : "Rockets NestJS TypeORM Extended", "main" : "dist/index.js", "types" : "dist/index.d.ts", "license" : "BSD-3-Clause", "publishConfig" : {"access" : "public"}, "files" : ["dist/**/!(*.spec|*.e2e-spec|*.fixture).{js,d.ts}"], "dependencies" : {"@concepta/nestjs-common" : "^4.0.0-alpha.11", "@concepta/nestjs-exception" : "^4.0.0-alpha.11", "@nestjs/common" : "^8.0.8", "@nestjs/config" : "^1.1.6", "@nestjs/typeorm" : "^8.0.2"}, "devDependencies" : {"@devniel/nestjs-typeorm-testing" : "^0.1.5-alpha", "@nestjs/testing" : "^8.0.8", "jest-mock-extended" : "^2.0.4", "sqlite3" : "npm:@vscode/sqlite3@^5.0.7", "typeorm" : "^0.2.41"}, "peerDependencies" : {"class-transformer" : "*", "class-validator" : "*", "typeorm" : "^0.2.41"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "types": {"type": "string"}, "license": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "files": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"@concepta/nestjs-common": {"type": "string"}, "@concepta/nestjs-exception": {"type": "string"}, "@nestjs/common": {"type": "string"}, "@nestjs/config": {"type": "string"}, "@nestjs/typeorm": {"type": "string"}}, "required": ["@concepta/nestjs-common", "@concepta/nestjs-exception", "@nestjs/common", "@nestjs/config", "@nestjs/typeorm"]}, "devDependencies": {"type": "object", "properties": {"@devniel/nestjs-typeorm-testing": {"type": "string"}, "@nestjs/testing": {"type": "string"}, "jest-mock-extended": {"type": "string"}, "sqlite3": {"type": "string"}, "typeorm": {"type": "string"}}, "required": ["@devniel/nestjs-typeorm-testing", "@nestjs/testing", "jest-mock-extended", "sqlite3", "typeorm"]}, "peerDependencies": {"type": "object", "properties": {"class-transformer": {"type": "string"}, "class-validator": {"type": "string"}, "typeorm": {"type": "string"}}, "required": ["class-transformer", "class-validator", "typeorm"]}}, "required": ["name", "version", "description", "main", "types", "license", "publishConfig", "files", "dependencies", "devDependencies", "peerDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"count": {"type": "integer"}, "N.A.//": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "999920": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}}, "required": ["count", "N.A.//", "999920"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"count" : 13, "N.A.//" : {"count" : 10}, "999920" : {"count" : 3}} | json_instruct | {"type": "object", "properties": {"count": {"type": "integer"}, "N.A.//": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "999920": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}}, "required": ["count", "N.A.//", "999920"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"email": {"type": "string"}, "nombre": {"type": "string"}}, "required": ["email", "nombre"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"email" : "foo@mail.com", "nombre" : "Messi"} | json_instruct | {"type": "object", "properties": {"email": {"type": "string"}, "nombre": {"type": "string"}}, "required": ["email", "nombre"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"derivation": {"type": "string"}, "pron": {"type": "string"}, "outline": {"type": "string"}, "kjv_def": {"type": "string"}, "lemma": {"type": "string"}, "frequency": {"type": "integer"}, "strongs_def": {"type": "string"}, "xlit": {"type": "string"}}, "required": ["derivation", "pron", "outline", "kjv_def", "lemma", "frequency", "strongs_def", "xlit"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"derivation" : "from H5255 (\u05e0\u05b8\u05e1\u05b7\u05d7) in the sense of staving off;", "pron" : "mas-sawkh'", "outline" : "<ol><li> meaning uncertain - perhaps<ol><li> guard</li><li> alternately, by turns</li></ol></li></ol>", "kjv_def" : "broken down.", "lemma" : "\u05de\u05b7\u05e1\u05bc\u05b8\u05d7", "frequency" : 1, "strongs_def" : "a cordon, (adverbially) or (as a) military barrier", "xlit" : "ma\u00e7\u00e7\u00e2ch"} | json_instruct | {"type": "object", "properties": {"derivation": {"type": "string"}, "pron": {"type": "string"}, "outline": {"type": "string"}, "kjv_def": {"type": "string"}, "lemma": {"type": "string"}, "frequency": {"type": "integer"}, "strongs_def": {"type": "string"}, "xlit": {"type": "string"}}, "required": ["derivation", "pron", "outline", "kjv_def", "lemma", "frequency", "strongs_def", "xlit"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "assets": {"type": "array", "items": {"type": "object", "properties": {"files": {"type": "array", "items": {"type": "string"}}, "version": {"type": "string"}, "mainfile": {"type": "string"}}, "required": ["files", "version", "mainfile"]}}, "versions": {"type": "array", "items": {"type": "string"}}, "zip": {"type": "string"}, "author": {"type": "string"}, "github": {"type": "string"}, "homepage": {"type": "string"}, "description": {"type": "string"}, "mainfile": {"type": "string"}, "lastversion": {"type": "string"}}, "required": ["name", "assets", "versions", "zip", "author", "github", "homepage", "description", "mainfile", "lastversion"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "reactive.js", "assets" : [{"files" : ["Ractive-legacy.js", "Ractive-legacy.min.js", "Ractive-legacy.runtime.js", "Ractive-legacy.runtime.min.js", "Ractive.js", "Ractive.min.js", "Ractive.runtime.js", "Ractive.runtime.min.js"], "version" : "0.3.6", "mainfile" : "Ractive.min.js"}, {"files" : ["Ractive-legacy.js", "Ractive-legacy.min.js", "Ractive-legacy.runtime.js", "Ractive-legacy.runtime.min.js", "Ractive.min.js", "Ractive.runtime.js", "Ractive.runtime.min.js", "Reactive.js"], "version" : "0.3.9", "mainfile" : "Ractive.min.js"}], "versions" : ["0.3.9", "0.3.6"], "zip" : "reactive.js.zip", "author" : "Rich Harris", "github" : "https://github.com/rich-harris/Ractive", "homepage" : "http://www.ractivejs.org/", "description" : "Next-generation DOM manipulation and templating", "mainfile" : "Ractive.min.js", "lastversion" : "0.3.9"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "assets": {"type": "array", "items": {"type": "object", "properties": {"files": {"type": "array", "items": {"type": "string"}}, "version": {"type": "string"}, "mainfile": {"type": "string"}}, "required": ["files", "version", "mainfile"]}}, "versions": {"type": "array", "items": {"type": "string"}}, "zip": {"type": "string"}, "author": {"type": "string"}, "github": {"type": "string"}, "homepage": {"type": "string"}, "description": {"type": "string"}, "mainfile": {"type": "string"}, "lastversion": {"type": "string"}}, "required": ["name", "assets", "versions", "zip", "author", "github", "homepage", "description", "mainfile", "lastversion"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "2d889d9eb4c21bf5e3fa2a622464c8f9bf690563"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"time": {"type": "null"}, "type": {"type": "integer"}, "user": {"type": "integer"}, "tweet_id": {"type": "string"}, "id": {"type": "integer"}, "children": {"type": "array", "items": {"type": "object", "properties": {"time": {"type": "integer"}, "type": {"type": "integer"}, "user": {"type": "integer"}, "tweet_id": {"type": "integer"}, "id": {"type": "integer"}}, "required": ["time", "type", "user", "tweet_id", "id"]}}}, "required": ["time", "type", "user", "tweet_id", "id", "children"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"time" : null, "type" : 1, "user" : 3849187751, "tweet_id" : "gossipcop-9943809806", "id" : 7786096696, "children" : [{"time" : 1486920784, "type" : 2, "user" : 8096312665, "tweet_id" : 830832102736211968, "id" : 9510038052}, {"time" : 1486923744, "type" : 2, "user" : 6302845321, "tweet_id" : 830844521651007488, "id" : 7655563468, "children" : [{"time" : 1486948999, "type" : 3, "user" : 7392646799, "tweet_id" : 830844750899113986, "id" : 1327509156}, {"time" : 1486949120, "type" : 3, "user" : 1738491373, "tweet_id" : 830845258242129920, "id" : 6857383076}, {"time" : 1487030458, "type" : 3, "user" : 9421390995, "tweet_id" : 831186414800887808, "id" : 7103148306}, {"time" : 1487202537, "type" : 3, "user" : 2981089129, "tweet_id" : 831908163809112065, "id" : 9158376263}, {"time" : 1487481673, "type" : 3, "user" : 6469486041, "tweet_id" : 833078946048724992, "id" : 7138138693, "children" : [{"time" : 1487481732, "type" : 3, "user" : 7530537453, "tweet_id" : 833079196595400704, "id" : 3701774808}]}, {"time" : 1486923819, "type" : 4, "user" : 7392646799, "tweet_id" : 830844833333911553, "id" : 2030107068}, {"time" : 1486924368, "type" : 4, "user" : 8675457511, "tweet_id" : 830847137164333056, "id" : 4662473809}]}, {"time" : 1486924383, "type" : 2, "user" : 9006811229, "tweet_id" : 830847201735610368, "id" : 9409459259}, {"time" : 1486926127, "type" : 2, "user" : 5441541785, "tweet_id" : 830854513615478784, "id" : 6813402754}, {"time" : 1486933287, "type" : 2, "user" : 3015479116, "tweet_id" : 830884544580550656, "id" : 7926818819}, {"time" : 1486934172, "type" : 2, "user" : 8165943683, "tweet_id" : 830888256761954304, "id" : 6891643405}, {"time" : 1486991904, "type" : 2, "user" : 7314110782, "tweet_id" : 831130404333699073, "id" : 5866466623}, {"time" : 1486992085, "type" : 2, "user" : 4830677426, "tweet_id" : 831131161124597760, "id" : 5186983707}, {"time" : 1486992429, "type" : 2, "user" : 9536542267, "tweet_id" : 831132603600220161, "id" : 3580073634}]} | json_instruct | {"type": "object", "properties": {"time": {"type": "null"}, "type": {"type": "integer"}, "user": {"type": "integer"}, "tweet_id": {"type": "string"}, "id": {"type": "integer"}, "children": {"type": "array", "items": {"type": "object", "properties": {"time": {"type": "integer"}, "type": {"type": "integer"}, "user": {"type": "integer"}, "tweet_id": {"type": "integer"}, "id": {"type": "integer"}}, "required": ["time", "type", "user", "tweet_id", "id"]}}}, "required": ["time", "type", "user", "tweet_id", "id", "children"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [["522730103001", "\u8c37\u811a\u793e\u533a\u5c45\u59d4\u4f1a", "121", "0"], ["522730103002", "\u5ca9\u540e\u793e\u533a\u5c45\u59d4\u4f1a", "123", "0"], ["522730103003", "\u738b\u5173\u793e\u533a\u5c45\u59d4\u4f1a", "123", "0"], ["522730103004", "\u8d35\u9f99\u793e\u533a\u5c45\u59d4\u4f1a", "123", "0"], ["522730103005", "\u5e86\u9633\u793e\u533a\u5c45\u59d4\u4f1a", "123", "0"], ["522730103201", "\u9ad8\u5821\u6751\u59d4\u4f1a", "220", "0"], ["522730103205", "\u89c2\u97f3\u6751\u59d4\u4f1a", "220", "0"], ["522730103210", "\u8336\u9999\u6751\u59d4\u4f1a", "220", "0"], ["522730103217", "\u8c37\u51b0\u6751\u59d4\u4f1a", "220", "0"], ["522730103219", "\u9ad8\u65b0\u6751\u59d4\u4f1a", "220", "0"]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"content_id": {"type": "string"}, "base_path": {"type": "string"}, "format_name": {"type": "string"}, "name": {"type": "string"}, "description": {"type": "string"}, "phase": {"type": "string"}, "filter": {"type": "object", "properties": {"document_type": {"type": "string"}}, "required": ["document_type"]}, "show_summaries": {"type": "boolean"}, "organisations": {"type": "array", "items": {"type": "string"}}}, "required": ["content_id", "base_path", "format_name", "name", "description", "phase", "filter", "show_summaries", "organisations"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"content_id" : "b7574bba-969f-4c49-855a-ae1586258ff6", "base_path" : "/aaib-reports", "format_name" : "Air Accidents Investigation Branch report", "name" : "Air Accidents Investigation Branch reports", "description" : "Find reports of AAIB investigations into air accidents and incidents", "phase" : "beta", "filter" : {"document_type" : "aaib_report"}, "show_summaries" : true, "organisations" : ["38eb5d8f-2d89-480c-8655-e2e7ac23f8f4"]} | json_instruct | {"type": "object", "properties": {"content_id": {"type": "string"}, "base_path": {"type": "string"}, "format_name": {"type": "string"}, "name": {"type": "string"}, "description": {"type": "string"}, "phase": {"type": "string"}, "filter": {"type": "object", "properties": {"document_type": {"type": "string"}}, "required": ["document_type"]}, "show_summaries": {"type": "boolean"}, "organisations": {"type": "array", "items": {"type": "string"}}}, "required": ["content_id", "base_path", "format_name", "name", "description", "phase", "filter", "show_summaries", "organisations"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"rustc": {"type": "integer"}, "features": {"type": "string"}, "target": {"type": "integer"}, "profile": {"type": "integer"}, "path": {"type": "integer"}, "deps": {"type": "array", "items": {}}, "local": {"type": "array", "items": {"type": "object", "properties": {"CheckDepInfo": {"type": "object", "properties": {"dep_info": {"type": "string"}}, "required": ["dep_info"]}}, "required": ["CheckDepInfo"]}}, "rustflags": {"type": "array", "items": {}}, "metadata": {"type": "integer"}}, "required": ["rustc", "features", "target", "profile", "path", "deps", "local", "rustflags", "metadata"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"rustc" : 15479600521011547909, "features" : "[]", "target" : 3954734637228664837, "profile" : 14762027784537775720, "path" : 1036222786711178230, "deps" : [], "local" : [{"CheckDepInfo" : {"dep_info" : "debug/.fingerprint/Kronicle-163899eb1dc5b74e/dep-bin-Kronicle"}}], "rustflags" : [], "metadata" : 2690432823322181424} | json_instruct | {"type": "object", "properties": {"rustc": {"type": "integer"}, "features": {"type": "string"}, "target": {"type": "integer"}, "profile": {"type": "integer"}, "path": {"type": "integer"}, "deps": {"type": "array", "items": {}}, "local": {"type": "array", "items": {"type": "object", "properties": {"CheckDepInfo": {"type": "object", "properties": {"dep_info": {"type": "string"}}, "required": ["dep_info"]}}, "required": ["CheckDepInfo"]}}, "rustflags": {"type": "array", "items": {}}, "metadata": {"type": "integer"}}, "required": ["rustc", "features", "target", "profile", "path", "deps", "local", "rustflags", "metadata"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"id": {"type": "integer"}, "source": {"type": "string"}, "verse_id": {"type": "integer"}, "verse_count": {"type": "integer"}, "reference": {"type": "string"}, "title": {"type": "string"}, "html": {"type": "string"}, "audit": {"type": "null"}}, "required": ["id", "source", "verse_id", "verse_count", "reference", "title", "html", "audit"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 11145, "source" : "ellicott", "verse_id" : 18114, "verse_count" : 1, "reference" : "24:18", "title" : "", "html" : " <p> (18) The windows from on high are open . . .\u2014The phrase reminds us of the narrative of the Flood in <a class=\"ref\">Genesis 7:11; Genesis 8:2</a>. There was a second judgment on the defiled and corrupted land like that of the deluge. The next clause and the following verses were probably reminiscences of the earthquake in Uzziah\u2019s reign, and of the panic which it caused (<a class=\"isa\" verses=\"WzE3NzA1LDIyMzY2LDIzMDc0XQ==\">Isaiah 2:19; Amos 1:1; Zechariah 14:5</a>). </p> ", "audit" : null} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "source": {"type": "string"}, "verse_id": {"type": "integer"}, "verse_count": {"type": "integer"}, "reference": {"type": "string"}, "title": {"type": "string"}, "html": {"type": "string"}, "audit": {"type": "null"}}, "required": ["id", "source", "verse_id", "verse_count", "reference", "title", "html", "audit"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"matter.js": {"type": "string"}, "matter.min.js": {"type": "string"}}, "required": ["matter.js", "matter.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"matter.js" : "sha512-LmcaNk4SpIeDIn8noy/vt4k3KSueIDeK7g1mYmaBb5ltMX/SBUhgPT0jxmjYUlfxPBjw95x+xjzyxMOAoBx9Bg==", "matter.min.js" : "sha512-eyqF8JOn0V7g1gAJne0oGRadinMHT2NVJs5r3MTTYjHQFJll1/3AZZ49lIX4iKy/gwExy4FJpJKd7u4/6vlWnA=="} | json_instruct | {"type": "object", "properties": {"matter.js": {"type": "string"}, "matter.min.js": {"type": "string"}}, "required": ["matter.js", "matter.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 101966739, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes_pg", "src:geom" : "quattroshapes_pg", "wof:geomhash" : "f75c8e72cd2d17af9316375fc728620e", "wof:id" : 101966739, "wof:repo" : "whosonfirst-data-admin-br"}, "bbox" : [-37.20639, -11.01472, -37.20639, -11.01472], "geometry" : {"coordinates" : [-37.20639, -11.01472], "type" : "Point"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "is_illegal": {"type": "boolean"}, "is_custom": {"type": "boolean"}, "text": {"type": "string"}, "images": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "attribute": {"type": "string"}, "atk": {"type": "integer"}, "species": {"type": "string"}, "monster_type": {"type": "string"}, "is_pendulum": {"type": "boolean"}, "ability": {"type": "string"}, "has_effect": {"type": "boolean"}, "def": {"type": "integer"}, "level": {"type": "integer"}, "is_tuner": {"type": "boolean"}}, "required": ["id", "name", "is_illegal", "is_custom", "text", "images", "type", "attribute", "atk", "species", "monster_type", "is_pendulum", "ability", "has_effect", "def", "level", "is_tuner"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 11801343, "name" : "Garbage Collector", "is_illegal" : false, "is_custom" : false, "text" : "You can target 1 other Cyberse monster you control that began the Duel in the Main Deck; return it to the hand, and if you do, Special Summon from your Deck 1 Cyberse monster with the same Level, but with a different name. You can only use this effect of \"Garbage Collector\" once per turn.", "images" : ["https://storage.googleapis.com/ygoprodeck.com/pics/11801343.jpg"], "type" : "Monster", "attribute" : "WIND", "atk" : 100, "species" : "Cyberse", "monster_type" : "", "is_pendulum" : false, "ability" : "", "has_effect" : true, "def" : 1900, "level" : 2, "is_tuner" : false} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "is_illegal": {"type": "boolean"}, "is_custom": {"type": "boolean"}, "text": {"type": "string"}, "images": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "attribute": {"type": "string"}, "atk": {"type": "integer"}, "species": {"type": "string"}, "monster_type": {"type": "string"}, "is_pendulum": {"type": "boolean"}, "ability": {"type": "string"}, "has_effect": {"type": "boolean"}, "def": {"type": "integer"}, "level": {"type": "integer"}, "is_tuner": {"type": "boolean"}}, "required": ["id", "name", "is_illegal", "is_custom", "text", "images", "type", "attribute", "atk", "species", "monster_type", "is_pendulum", "ability", "has_effect", "def", "level", "is_tuner"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"main": {"type": "string"}, "style": {"type": "string"}}, "required": ["main", "style"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"main" : "./form-summary.js", "style" : "./form-summary.scss"} | json_instruct | {"type": "object", "properties": {"main": {"type": "string"}, "style": {"type": "string"}}, "required": ["main", "style"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"userId" : 40326, "cartId" : "107b5fcb-7fff-423c-b98c-d77dcdc06304", "preferredProducts" : [116], "productReviews" : [{"productId" : 1745, "reviewText" : "My goldfinch loves to play with it.", "reviewDate" : "2017-03-30T20:30:09.5595705+03:00"}, {"productId" : 4198, "reviewText" : "This olive works outstandingly well. It grudgingly improves my baseball by a lot.", "reviewDate" : "2019-04-02T02:20:51.9499885+03:00"}, {"productId" : 4670, "reviewText" : "My co-worker Archer has one of these. He says it looks crooked.", "reviewDate" : "2018-06-26T04:05:27.281598+03:00"}, {"productId" : 4576, "reviewText" : "My neighbor Lori has one of these. She works as a taxidermist and she says it looks whopping.", "reviewDate" : "2017-05-08T04:17:31.905794+03:00"}, {"productId" : 270, "reviewText" : "My co-worker Knute has one of these. He says it looks smoky.", "reviewDate" : "2017-09-30T15:13:19.1758765+03:00"}]} | json_instruct | {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "type": {"type": "string"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "start": {"type": "string"}}, "required": ["dev", "start"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@types/filesystem": {"type": "string"}, "@types/node": {"type": "string"}, "common-js": {"type": "string"}, "discord.js": {"type": "string"}, "dotenv": {"type": "string"}, "inversify": {"type": "string"}, "reflect-metadata": {"type": "string"}, "tsyringe": {"type": "string"}}, "required": ["@types/filesystem", "@types/node", "common-js", "discord.js", "dotenv", "inversify", "reflect-metadata", "tsyringe"]}, "devDependencies": {"type": "object", "properties": {"@types/chai": {"type": "string"}, "@types/mocha": {"type": "string"}, "@types/ws": {"type": "string"}, "chai": {"type": "string"}, "mocha": {"type": "string"}, "nodemon": {"type": "string"}, "ts-mockito": {"type": "string"}, "ts-node": {"type": "string"}, "tsc-watch": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/chai", "@types/mocha", "@types/ws", "chai", "mocha", "nodemon", "ts-mockito", "ts-node", "tsc-watch", "typescript"]}}, "required": ["name", "version", "description", "main", "type", "scripts", "repository", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "matabot", "version" : "1.0.1", "description" : "", "main" : "src/index.js", "type" : "module", "scripts" : {"dev" : "nodemon", "start" : "ts-node src/index.ts"}, "repository" : {"type" : "git", "url" : "git+https://github.com/HandsomeRomanian/DiscordBotTemplate.git"}, "author" : "Matei Martin", "license" : "MIT", "bugs" : {"url" : "https://github.com/HandsomeRomanian/DiscordBotTemplate/issues"}, "homepage" : "https://github.com/HandsomeRomanian/DiscordBotTemplate#readme", "dependencies" : {"@types/filesystem" : "0.0.30", "@types/node" : "^15.6.0", "common-js" : "^0.3.8", "discord.js" : "^12.5.3", "dotenv" : "^10.0.0", "inversify" : "^5.1.1", "reflect-metadata" : "^0.1.13", "tsyringe" : "^4.5.0"}, "devDependencies" : {"@types/chai" : "^4.2.18", "@types/mocha" : "^8.2.2", "@types/ws" : "^7.4.4", "chai" : "^4.3.4", "mocha" : "^8.4.0", "nodemon" : "^2.0.7", "ts-mockito" : "^2.6.1", "ts-node" : "^10.0.0", "tsc-watch" : "^4.4.0", "typescript" : "^4.3.2"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "type": {"type": "string"}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "start": {"type": "string"}}, "required": ["dev", "start"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@types/filesystem": {"type": "string"}, "@types/node": {"type": "string"}, "common-js": {"type": "string"}, "discord.js": {"type": "string"}, "dotenv": {"type": "string"}, "inversify": {"type": "string"}, "reflect-metadata": {"type": "string"}, "tsyringe": {"type": "string"}}, "required": ["@types/filesystem", "@types/node", "common-js", "discord.js", "dotenv", "inversify", "reflect-metadata", "tsyringe"]}, "devDependencies": {"type": "object", "properties": {"@types/chai": {"type": "string"}, "@types/mocha": {"type": "string"}, "@types/ws": {"type": "string"}, "chai": {"type": "string"}, "mocha": {"type": "string"}, "nodemon": {"type": "string"}, "ts-mockito": {"type": "string"}, "ts-node": {"type": "string"}, "tsc-watch": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/chai", "@types/mocha", "@types/ws", "chai", "mocha", "nodemon", "ts-mockito", "ts-node", "tsc-watch", "typescript"]}}, "required": ["name", "version", "description", "main", "type", "scripts", "repository", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"wire-plugin": {"type": "array", "items": {"type": "object", "properties": {"target": {"type": "string"}, "source": {"type": "string"}}, "required": ["target", "source"]}}}, "required": ["wire-plugin"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"wire-plugin" : [{"target" : "\\Spryker\\Client\\PersistentCart\\PersistentCartDependencyProvider::getQuotePersistPlugin", "source" : "\\Spryker\\Client\\MultiCart\\Plugin\\PersistentCart\\MultiCartQuotePersistPlugin"}]} | json_instruct | {"type": "object", "properties": {"wire-plugin": {"type": "array", "items": {"type": "object", "properties": {"target": {"type": "string"}, "source": {"type": "string"}}, "required": ["target", "source"]}}}, "required": ["wire-plugin"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"511083001": {"type": "string"}, "511083002": {"type": "string"}, "511083102": {"type": "string"}, "511083103": {"type": "string"}, "511083104": {"type": "string"}, "511083105": {"type": "string"}, "511083106": {"type": "string"}, "511083108": {"type": "string"}, "511083109": {"type": "string"}, "511083112": {"type": "string"}, "511083114": {"type": "string"}, "511083115": {"type": "string"}, "511083117": {"type": "string"}}, "required": ["511083001", "511083002", "511083102", "511083103", "511083104", "511083105", "511083106", "511083108", "511083109", "511083112", "511083114", "511083115", "511083117"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"511083001" : "\u53e4\u6e56\u8857\u9053", "511083002" : "\u91d1\u9e45\u8857\u9053", "511083102" : "\u54cd\u77f3\u9547", "511083103" : "\u5723\u706f\u9547", "511083104" : "\u9ec4\u5bb6\u9547", "511083105" : "\u53cc\u51e4\u9547", "511083106" : "\u9f99\u5e02\u9547", "511083108" : "\u754c\u5e02\u9547", "511083109" : "\u77f3\u78be\u9547", "511083112" : "\u77f3\u71d5\u6865\u9547", "511083114" : "\u80e1\u5bb6\u9547", "511083115" : "\u4e91\u9876\u9547", "511083117" : "\u666e\u6da6\u9547"} | json_instruct | {"type": "object", "properties": {"511083001": {"type": "string"}, "511083002": {"type": "string"}, "511083102": {"type": "string"}, "511083103": {"type": "string"}, "511083104": {"type": "string"}, "511083105": {"type": "string"}, "511083106": {"type": "string"}, "511083108": {"type": "string"}, "511083109": {"type": "string"}, "511083112": {"type": "string"}, "511083114": {"type": "string"}, "511083115": {"type": "string"}, "511083117": {"type": "string"}}, "required": ["511083001", "511083002", "511083102", "511083103", "511083104", "511083105", "511083106", "511083108", "511083109", "511083112", "511083114", "511083115", "511083117"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"_comment": {"type": "string"}, "localized-strings": {"type": "object", "properties": {"next": {"type": "string"}, "previous": {"type": "string"}, "tagline": {"type": "string"}, "AddingQEasyDownloader": {"type": "string"}, "Adding QEasyDownloader to Your Project": {"type": "string"}, "ClassQEasyDownloader": {"type": "string"}, "Class QEasyDownloader": {"type": "string"}, "Installation": {"type": "string"}, "QEasyDownloaderErrorCodes": {"type": "string"}, "QEasyDownloader Error Codes": {"type": "string"}, "UsingDownloader": {"type": "string"}, "A Simple Downloader in QEasyDownloader": {"type": "string"}, "Docs": {"type": "string"}, "Help": {"type": "string"}, "Blog": {"type": "string"}, "Getting Started": {"type": "string"}, "Guides": {"type": "string"}, "API": {"type": "string"}}, "required": ["next", "previous", "tagline", "AddingQEasyDownloader", "Adding QEasyDownloader to Your Project", "ClassQEasyDownloader", "Class QEasyDownloader", "Installation", "QEasyDownloaderErrorCodes", "QEasyDownloader Error Codes", "UsingDownloader", "A Simple Downloader in QEasyDownloader", "Docs", "Help", "Blog", "Getting Started", "Guides", "API"]}, "pages-strings": {"type": "object", "properties": {"Help Translate|recruit community translators for your project": {"type": "string"}, "Edit this Doc|recruitment message asking to edit the doc source": {"type": "string"}, "Translate this Doc|recruitment message asking to translate the docs": {"type": "string"}}, "required": ["Help Translate|recruit community translators for your project", "Edit this Doc|recruitment message asking to edit the doc source", "Translate this Doc|recruitment message asking to translate the docs"]}}, "required": ["_comment", "localized-strings", "pages-strings"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"_comment" : "This file is auto-generated by write-translations.js", "localized-strings" : {"next" : "Next", "previous" : "Previous", "tagline" : "A Simple and Powerful Downloader Library.", "AddingQEasyDownloader" : "Add QEasyDownloader to Your Project", "Adding QEasyDownloader to Your Project" : "Adding QEasyDownloader to Your Project", "ClassQEasyDownloader" : "Class QEasyDownloader", "Class QEasyDownloader" : "Class QEasyDownloader", "Installation" : "Installation", "QEasyDownloaderErrorCodes" : "Dealing with Errors on QEasyDownloader", "QEasyDownloader Error Codes" : "QEasyDownloader Error Codes", "UsingDownloader" : "Simple Download with QEasyDownloader", "A Simple Downloader in QEasyDownloader" : "A Simple Downloader in QEasyDownloader", "Docs" : "Docs", "Help" : "Help", "Blog" : "Blog", "Getting Started" : "Getting Started", "Guides" : "Guides", "API" : "API"}, "pages-strings" : {"Help Translate|recruit community translators for your project" : "Help Translate", "Edit this Doc|recruitment message asking to edit the doc source" : "Edit", "Translate this Doc|recruitment message asking to translate the docs" : "Translate"}} | json_instruct | {"type": "object", "properties": {"_comment": {"type": "string"}, "localized-strings": {"type": "object", "properties": {"next": {"type": "string"}, "previous": {"type": "string"}, "tagline": {"type": "string"}, "AddingQEasyDownloader": {"type": "string"}, "Adding QEasyDownloader to Your Project": {"type": "string"}, "ClassQEasyDownloader": {"type": "string"}, "Class QEasyDownloader": {"type": "string"}, "Installation": {"type": "string"}, "QEasyDownloaderErrorCodes": {"type": "string"}, "QEasyDownloader Error Codes": {"type": "string"}, "UsingDownloader": {"type": "string"}, "A Simple Downloader in QEasyDownloader": {"type": "string"}, "Docs": {"type": "string"}, "Help": {"type": "string"}, "Blog": {"type": "string"}, "Getting Started": {"type": "string"}, "Guides": {"type": "string"}, "API": {"type": "string"}}, "required": ["next", "previous", "tagline", "AddingQEasyDownloader", "Adding QEasyDownloader to Your Project", "ClassQEasyDownloader", "Class QEasyDownloader", "Installation", "QEasyDownloaderErrorCodes", "QEasyDownloader Error Codes", "UsingDownloader", "A Simple Downloader in QEasyDownloader", "Docs", "Help", "Blog", "Getting Started", "Guides", "API"]}, "pages-strings": {"type": "object", "properties": {"Help Translate|recruit community translators for your project": {"type": "string"}, "Edit this Doc|recruitment message asking to edit the doc source": {"type": "string"}, "Translate this Doc|recruitment message asking to translate the docs": {"type": "string"}}, "required": ["Help Translate|recruit community translators for your project", "Edit this Doc|recruitment message asking to edit the doc source", "Translate this Doc|recruitment message asking to translate the docs"]}}, "required": ["_comment", "localized-strings", "pages-strings"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "minimum-stability": {"type": "string"}, "prefer-stable": {"type": "boolean"}, "support": {"type": "object", "properties": {"issues": {"type": "string"}}, "required": ["issues"]}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "role"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "illuminate/support": {"type": "string"}, "illuminate/database": {"type": "string"}}, "required": ["php", "illuminate/support", "illuminate/database"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "orchestra/testbench": {"type": "string"}}, "required": ["phpunit/phpunit", "orchestra/testbench"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"aks\\ColumnSortable\\": {"type": "string"}}, "required": ["aks\\ColumnSortable\\"]}}, "required": ["psr-4"]}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}}, "required": ["providers"]}}, "required": ["laravel"]}}, "required": ["name", "description", "keywords", "homepage", "type", "license", "minimum-stability", "prefer-stable", "support", "authors", "require", "require-dev", "autoload", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "fahrettinaksoy/aks-ColumnSortable", "description" : "Column sorting package for Laravel 6 framework", "keywords" : ["laravel", "laravel-sortable", "laravel-sorting", "laravel-column", "sortable", "sorting", "columns", "query-strings"], "homepage" : "https://github.com/fahrettinaksoy/aks-ColumnSortable", "type" : "package", "license" : "MIT", "minimum-stability" : "dev", "prefer-stable" : true, "support" : {"issues" : "https://github.com/fahrettinaksoy/aks-ColumnSortable/issues"}, "authors" : [{"name" : "Fahrettin Aksoy", "email" : "aksoy@fahrettinaksoy.com.tr", "role" : "Developer"}], "require" : {"php" : ">=7.2", "illuminate/support" : "5.8.*|^6.0", "illuminate/database" : "5.8.*|^6.0"}, "require-dev" : {"phpunit/phpunit" : "^8.0", "orchestra/testbench" : "^4.0"}, "autoload" : {"psr-4" : {"aks\\ColumnSortable\\" : "src/ColumnSortable/"}}, "extra" : {"laravel" : {"providers" : ["aks\\ColumnSortable\\ColumnSortableServiceProvider"]}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "minimum-stability": {"type": "string"}, "prefer-stable": {"type": "boolean"}, "support": {"type": "object", "properties": {"issues": {"type": "string"}}, "required": ["issues"]}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "role"]}}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "illuminate/support": {"type": "string"}, "illuminate/database": {"type": "string"}}, "required": ["php", "illuminate/support", "illuminate/database"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "orchestra/testbench": {"type": "string"}}, "required": ["phpunit/phpunit", "orchestra/testbench"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"aks\\ColumnSortable\\": {"type": "string"}}, "required": ["aks\\ColumnSortable\\"]}}, "required": ["psr-4"]}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}}, "required": ["providers"]}}, "required": ["laravel"]}}, "required": ["name", "description", "keywords", "homepage", "type", "license", "minimum-stability", "prefer-stable", "support", "authors", "require", "require-dev", "autoload", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Franzl\\Middleware\\Whoops\\": {"type": "string"}}, "required": ["Franzl\\Middleware\\Whoops\\"]}}, "required": ["psr-4"]}, "require": {"type": "object", "properties": {"filp/whoops": {"type": "string"}, "zendframework/zend-diactoros": {"type": "string"}}, "required": ["filp/whoops", "zendframework/zend-diactoros"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Franzl\\Middleware\\Whoops\\Test\\": {"type": "string"}}, "required": ["Franzl\\Middleware\\Whoops\\Test\\"]}}, "required": ["psr-4"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}}, "required": ["phpunit/phpunit"]}}, "required": ["name", "autoload", "require", "autoload-dev", "require-dev"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "franzl/whoops-middleware", "autoload" : {"psr-4" : {"Franzl\\Middleware\\Whoops\\" : "src/"}}, "require" : {"filp/whoops" : "^1.1 || ^2.0", "zendframework/zend-diactoros" : "^1.1.0"}, "autoload-dev" : {"psr-4" : {"Franzl\\Middleware\\Whoops\\Test\\" : "tests/"}}, "require-dev" : {"phpunit/phpunit" : "5.0.*"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Franzl\\Middleware\\Whoops\\": {"type": "string"}}, "required": ["Franzl\\Middleware\\Whoops\\"]}}, "required": ["psr-4"]}, "require": {"type": "object", "properties": {"filp/whoops": {"type": "string"}, "zendframework/zend-diactoros": {"type": "string"}}, "required": ["filp/whoops", "zendframework/zend-diactoros"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Franzl\\Middleware\\Whoops\\Test\\": {"type": "string"}}, "required": ["Franzl\\Middleware\\Whoops\\Test\\"]}}, "required": ["psr-4"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}}, "required": ["phpunit/phpunit"]}}, "required": ["name", "autoload", "require", "autoload-dev", "require-dev"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.