input stringlengths 159 2.05k | output stringlengths 5 10.3k | task stringclasses 1
value | schema stringlengths 100 1.99k |
|---|---|---|---|
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "lint": {"type": "string"}, "lint:fix": {"type": "string"}}, "required": ["build", "lint", "lint:fix"]}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@typescript-eslint/eslint-plugin": {"type": "string"}, "@typescript-eslint/parser": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-prettier": {"type": "string"}, "eslint-plugin-prettier": {"type": "string"}, "prettier": {"type": "string"}, "rimraf": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@typescript-eslint/eslint-plugin", "@typescript-eslint/parser", "eslint", "eslint-config-prettier", "eslint-plugin-prettier", "prettier", "rimraf", "typescript"]}}, "required": ["name", "version", "description", "main", "publishConfig", "scripts", "repository", "keywords", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "@caravanapp/types", "version" : "1.0.0", "description" : "Shared type definitions for Caravan's buddy reading website", "main" : "index.d.ts", "publishConfig" : {"access" : "public"}, "scripts" : {"build" : "exit 0", "lint" : "eslint \"index.d.ts\"", "lint:fix" : "eslint \"index.d.ts\" --quiet --fix"}, "repository" : "https://github.com/caravanapp-ca/caravanapp-ca/tree/master/packages/types", "keywords" : ["caravan", "buddy", "reading", "types"], "license" : "MIT", "bugs" : {"url" : "https://github.com/caravanapp-ca/caravanapp-ca/issues"}, "homepage" : "https://github.com/caravanapp-ca/caravanapp-ca#readme", "devDependencies" : {"@typescript-eslint/eslint-plugin" : "^4.1.1", "@typescript-eslint/parser" : "^4.1.1", "eslint" : "^6.8.0", "eslint-config-prettier" : "^6.11.0", "eslint-plugin-prettier" : "^3.1.4", "prettier" : "^2.1.2", "rimraf" : "^3.0.2", "typescript" : "^4.0.2"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "lint": {"type": "string"}, "lint:fix": {"type": "string"}}, "required": ["build", "lint", "lint:fix"]}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@typescript-eslint/eslint-plugin": {"type": "string"}, "@typescript-eslint/parser": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-prettier": {"type": "string"}, "eslint-plugin-prettier": {"type": "string"}, "prettier": {"type": "string"}, "rimraf": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@typescript-eslint/eslint-plugin", "@typescript-eslint/parser", "eslint", "eslint-config-prettier", "eslint-plugin-prettier", "prettier", "rimraf", "typescript"]}}, "required": ["name", "version", "description", "main", "publishConfig", "scripts", "repository", "keywords", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "object", "properties": {"PlaylistId": {"type": "integer"}, "Name": {"type": "string"}}, "required": ["PlaylistId", "Name"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"PlaylistId" : 1, "Name" : "Music"}, {"PlaylistId" : 2, "Name" : "Movies"}, {"PlaylistId" : 3, "Name" : "TV Shows"}, {"PlaylistId" : 4, "Name" : "Audiobooks"}, {"PlaylistId" : 5, "Name" : "90\u2019s Music"}, {"PlaylistId" : 6, "Name" : "Audiobooks"}, {"PlaylistId" : 7, "Name" : "Movies"}, {"PlaylistId" : 8, "Name" : "Music"}, {"PlaylistId" : 9, "Name" : "Music Videos"}, {"PlaylistId" : 10, "Name" : "TV Shows"}, {"PlaylistId" : 11, "Name" : "Brazilian Music"}, {"PlaylistId" : 12, "Name" : "Classical"}, {"PlaylistId" : 13, "Name" : "Classical 101 - Deep Cuts"}, {"PlaylistId" : 14, "Name" : "Classical 101 - Next Steps"}, {"PlaylistId" : 15, "Name" : "Classical 101 - The Basics"}, {"PlaylistId" : 16, "Name" : "Grunge"}, {"PlaylistId" : 17, "Name" : "Heavy Metal Classic"}, {"PlaylistId" : 18, "Name" : "On-The-Go 1"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"PlaylistId": {"type": "integer"}, "Name": {"type": "string"}}, "required": ["PlaylistId", "Name"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "array", "items": {"type": "object", "properties": {"adminarea": {"type": "string"}, "shortname": {"type": "string"}}, "required": ["adminarea", "shortname"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"adminarea" : "Atlantic", "shortname" : "atlantic"}, {"adminarea" : "Bergen", "shortname" : "bergen"}, {"adminarea" : "Burlington", "shortname" : "burlington"}, {"adminarea" : "Camden", "shortname" : "camden"}, {"adminarea" : "Cape May", "shortname" : "cape-may"}, {"adminarea" : "Cumberland", "shortname" : "cumberland"}, {"adminarea" : "Essex", "shortname" : "essex"}, {"adminarea" : "Gloucester", "shortname" : "gloucester"}, {"adminarea" : "Hudson", "shortname" : "hudson"}, {"adminarea" : "Hunterdon", "shortname" : "hunterdon"}, {"adminarea" : "Mercer", "shortname" : "mercer"}, {"adminarea" : "Middlesex", "shortname" : "middlesex"}, {"adminarea" : "Monmouth", "shortname" : "monmouth"}, {"adminarea" : "Morris", "shortname" : "morris"}, {"adminarea" : "Ocean", "shortname" : "ocean"}, {"adminarea" : "Passaic", "shortname" : "passaic"}, {"adminarea" : "Salem", "shortname" : "salem"}, {"adminarea" : "Somerset", "shortname" : "somerset"}, {"adminarea" : "Sussex", "shortname" : "sussex"}, {"adminarea" : "Union", "shortname" : "union"}, {"adminarea" : "Warren", "shortname" : "warren"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"adminarea": {"type": "string"}, "shortname": {"type": "string"}}, "required": ["adminarea", "shortname"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"plugins/emoji": {"type": "string"}}, "required": ["plugins/emoji"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"plugins/emoji" : "Emoji"} | json_instruct | {"type": "object", "properties": {"plugins/emoji": {"type": "string"}}, "required": ["plugins/emoji"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"$schema": {"type": "string"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "license": {"type": "string"}, "version": {"type": "string"}, "authors": {"type": "array", "items": {}}}, "required": ["name", "license", "version", "authors"]}, "provides": {"type": "object", "properties": {"namespace": {"type": "string"}, "class": {"type": "string"}}, "required": ["namespace", "class"]}, "requires": {"type": "object", "properties": {"@qooxdoo/compiler": {"type": "string"}, "@qooxdoo/framework": {"type": "string"}}, "required": ["@qooxdoo/compiler", "@qooxdoo/framework"]}}, "required": ["$schema", "info", "provides", "requires"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"$schema" : "https://qooxdoo.org/schema/Manifest-1-0-0.json", "info" : {"name" : "Qooxdoo framework tests", "license" : "MIT", "version" : "6.0.0", "authors" : []}, "provides" : {"namespace" : "", "class" : ""}, "requires" : {"@qooxdoo/compiler" : "^1.0.0-beta", "@qooxdoo/framework" : "^6.0.0-beta"}} | json_instruct | {"type": "object", "properties": {"$schema": {"type": "string"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "license": {"type": "string"}, "version": {"type": "string"}, "authors": {"type": "array", "items": {}}}, "required": ["name", "license", "version", "authors"]}, "provides": {"type": "object", "properties": {"namespace": {"type": "string"}, "class": {"type": "string"}}, "required": ["namespace", "class"]}, "requires": {"type": "object", "properties": {"@qooxdoo/compiler": {"type": "string"}, "@qooxdoo/framework": {"type": "string"}}, "required": ["@qooxdoo/compiler", "@qooxdoo/framework"]}}, "required": ["$schema", "info", "provides", "requires"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
| ["join-maps", "map-to-object"] | json_instruct | {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"version": {"type": "number"}, "people": {"type": "array", "items": {"type": "object", "properties": {"pose_keypoints_2d": {"type": "array", "items": {"type": "number"}}, "face_keypoints_2d": {"type": "array", "items": {}}, "hand_left_keypoints_2d": {"type": "array", "items": {}}, "hand_right_keypoints_2d": {"type": "array", "items": {}}, "pose_keypoints_3d": {"type": "array", "items": {}}, "face_keypoints_3d": {"type": "array", "items": {}}, "hand_left_keypoints_3d": {"type": "array", "items": {}}, "hand_right_keypoints_3d": {"type": "array", "items": {}}}, "required": ["pose_keypoints_2d", "face_keypoints_2d", "hand_left_keypoints_2d", "hand_right_keypoints_2d", "pose_keypoints_3d", "face_keypoints_3d", "hand_left_keypoints_3d", "hand_right_keypoints_3d"]}}}, "required": ["version", "people"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"version" : 1.2, "people" : [{"pose_keypoints_2d" : [377.182, 142.174, 1, 380.168, 154.152, 1, 366.023, 152.26, 1, 346.825, 145.038, 1, 346.725, 137.938, 1, 393.387, 150.389, 1, 413.645, 141.286, 1, 411.681, 128.04, 1, 371.242, 200.058, 1, 379.269, 238.05, 1, 372.194, 268.988, 1, 385.261, 201.063, 1, 388.293, 238.071, 1, 379.215, 264.999, 1, 371.19, 137.212, 1, 380.196, 137.181, 1, 366.862, 142.247, 1, 385.257, 140.25, 1], "face_keypoints_2d" : [], "hand_left_keypoints_2d" : [], "hand_right_keypoints_2d" : [], "pose_keypoints_3d" : [], "face_keypoints_3d" : [], "hand_left_keypoints_3d" : [], "hand_right_keypoints_3d" : []}]} | json_instruct | {"type": "object", "properties": {"version": {"type": "number"}, "people": {"type": "array", "items": {"type": "object", "properties": {"pose_keypoints_2d": {"type": "array", "items": {"type": "number"}}, "face_keypoints_2d": {"type": "array", "items": {}}, "hand_left_keypoints_2d": {"type": "array", "items": {}}, "hand_right_keypoints_2d": {"type": "array", "items": {}}, "pose_keypoints_3d": {"type": "array", "items": {}}, "face_keypoints_3d": {"type": "array", "items": {}}, "hand_left_keypoints_3d": {"type": "array", "items": {}}, "hand_right_keypoints_3d": {"type": "array", "items": {}}}, "required": ["pose_keypoints_2d", "face_keypoints_2d", "hand_left_keypoints_2d", "hand_right_keypoints_2d", "pose_keypoints_3d", "face_keypoints_3d", "hand_left_keypoints_3d", "hand_right_keypoints_3d"]}}}, "required": ["version", "people"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"\u5de5\u5ee0\u540d\u7a31" : "\u77bb\u822a\u570b\u969b\u7269\u6d41\u80a1\u4efd\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f" : "99706539", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f" : "", "\u5de5\u5ee0\u5730\u5740" : "\u6843\u5712\u5e02\u5927\u5712\u5340\u7af9\u570d\u91cc\u822a\u7fd4\u8def\uff15\u865f\uff13\u6a13\u4e4b\uff14", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc" : "\u6843\u5712\u5e02\u5927\u5712\u5340\u7af9\u570d\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d" : "\u5442\u5efa\u90a6", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f" : "28169680", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b" : "\u80a1\u4efd\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f" : "", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f" : "0950821", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b" : "\u751f\u7522\u4e2d", "\u7522\u696d\u985e\u5225" : ["26\u96fb\u5b50\u96f6\u7d44\u4ef6\u88fd\u9020\u696d"], "\u4e3b\u8981\u7522\u54c1" : ["269\u5176\u4ed6\u96fb\u5b50\u96f6\u7d44\u4ef6"]} | json_instruct | {"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"danceability": {"type": "number"}, "energy": {"type": "number"}, "key": {"type": "integer"}, "loudness": {"type": "number"}, "mode": {"type": "integer"}, "speechiness": {"type": "number"}, "acousticness": {"type": "number"}, "instrumentalness": {"type": "number"}, "liveness": {"type": "number"}, "valence": {"type": "number"}, "tempo": {"type": "number"}, "type": {"type": "string"}, "id": {"type": "string"}, "uri": {"type": "string"}, "track_href": {"type": "string"}, "analysis_url": {"type": "string"}, "duration_ms": {"type": "integer"}, "time_signature": {"type": "integer"}}, "required": ["danceability", "energy", "key", "loudness", "mode", "speechiness", "acousticness", "instrumentalness", "liveness", "valence", "tempo", "type", "id", "uri", "track_href", "analysis_url", "duration_ms", "time_signature"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"danceability" : 0.633, "energy" : 0.743, "key" : 7, "loudness" : -8.029, "mode" : 1, "speechiness" : 0.0362, "acousticness" : 0.29, "instrumentalness" : 0.00696, "liveness" : 0.0629, "valence" : 0.548, "tempo" : 176.021, "type" : "audio_features", "id" : "02sas1xqIwRm7iWSoHDvKe", "uri" : "spotify:track:02sas1xqIwRm7iWSoHDvKe", "track_href" : "https://api.spotify.com/v1/tracks/02sas1xqIwRm7iWSoHDvKe", "analysis_url" : "https://api.spotify.com/v1/audio-analysis/02sas1xqIwRm7iWSoHDvKe", "duration_ms" : 211193, "time_signature" : 4} | json_instruct | {"type": "object", "properties": {"danceability": {"type": "number"}, "energy": {"type": "number"}, "key": {"type": "integer"}, "loudness": {"type": "number"}, "mode": {"type": "integer"}, "speechiness": {"type": "number"}, "acousticness": {"type": "number"}, "instrumentalness": {"type": "number"}, "liveness": {"type": "number"}, "valence": {"type": "number"}, "tempo": {"type": "number"}, "type": {"type": "string"}, "id": {"type": "string"}, "uri": {"type": "string"}, "track_href": {"type": "string"}, "analysis_url": {"type": "string"}, "duration_ms": {"type": "integer"}, "time_signature": {"type": "integer"}}, "required": ["danceability", "energy", "key", "loudness", "mode", "speechiness", "acousticness", "instrumentalness", "liveness", "valence", "tempo", "type", "id", "uri", "track_href", "analysis_url", "duration_ms", "time_signature"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"cSpell.words": {"type": "array", "items": {"type": "string"}}}, "required": ["cSpell.words"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"cSpell.words" : ["Lifecycle", "viewports"]} | json_instruct | {"type": "object", "properties": {"cSpell.words": {"type": "array", "items": {"type": "string"}}}, "required": ["cSpell.words"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"templateType": {"type": "string"}, "label": {"type": "string"}, "name": {"type": "string"}, "assetVersion": {"type": "number"}, "releaseInfo": {"type": "object", "properties": {"templateVersion": {"type": "string"}}, "required": ["templateVersion"]}, "lenses": {"type": "array", "items": {"type": "object", "properties": {"file": {"type": "string"}, "label": {"type": "string"}, "name": {"type": "string"}}, "required": ["file", "label", "name"]}}}, "required": ["templateType", "label", "name", "assetVersion", "releaseInfo", "lenses"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"templateType" : "lens", "label" : "MinLens", "name" : "MinLens", "assetVersion" : 47.0, "releaseInfo" : {"templateVersion" : "1.1"}, "lenses" : [{"file" : "lenses/lens.json", "label" : "lens", "name" : "lens"}]} | json_instruct | {"type": "object", "properties": {"templateType": {"type": "string"}, "label": {"type": "string"}, "name": {"type": "string"}, "assetVersion": {"type": "number"}, "releaseInfo": {"type": "object", "properties": {"templateVersion": {"type": "string"}}, "required": ["templateVersion"]}, "lenses": {"type": "array", "items": {"type": "object", "properties": {"file": {"type": "string"}, "label": {"type": "string"}, "name": {"type": "string"}}, "required": ["file", "label", "name"]}}}, "required": ["templateType", "label", "name", "assetVersion", "releaseInfo", "lenses"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "array", "items": {"type": "object", "properties": {"userId": {"type": "string"}, "userName": {"type": "string"}, "headPortrait": {"type": "string"}, "nickname": {"type": "string"}, "remarkName": {"type": "null"}, "letter": {"type": "string"}, "type": {"type": "integer"}}, "required": ["userId", "userName", "headPortrait", "nickname", "remarkName", "letter", "type"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"userId" : "10001", "userName" : "user10001", "headPortrait" : "http://c.hiphotos.baidu.com/baike/s%3D235/sign=1ec482cdd188d43ff4a996f1481fd2aa/79f0f736afc37931e892a391ecc4b74542a9118b.jpg", "nickname" : "\u6ef4\u6ef4\u5982\u5395", "remarkName" : null, "letter" : "d", "type" : 0}, {"userId" : "10002", "userName" : "user10002", "headPortrait" : "http://f.hiphotos.baidu.com/baike/s%3D220/sign=57eb3c0469224f4a5399741139f79044/9213b07eca806538e9c7ee3193dda144ad3482e7.jpg", "nickname" : "\u661f\u5ea7\u5b7d\u7f18", "remarkName" : null, "letter" : "x", "type" : 0}, {"userId" : "10003", "userName" : "user10003", "headPortrait" : "http://d.hiphotos.baidu.com/baike/s%3D220/sign=89c64a17a20f4bfb88d09956334e788f/4d086e061d950a7b09cc6b4c0cd162d9f3d3c9b8.jpg", "nickname" : "\u5fc3\u7075\u9e21\u6c64\u81ea\u5bab\u5b66", "remarkName" : null, "letter" : "x", "type" : 0}, {"userId" : "10004", "userName" : "user10004", "headPortrait" : "", "nickname" : "\u5c34\u5c2c\u7b11\u8bdd\u96c6", "remarkName" : null, "letter" : "#", "type" : 0}, {"userId" : "10005", "userName" : "user10005", "headPortrait" : "https://imgsa.baidu.com/baike/s%3D220/sign=59b545f1cb1349547a1eef66664f92dd/fd039245d688d43f80fe6c827d1ed21b0ef43b6e.jpg", "nickname" : "\u80a1\u6d77\u795e\u68cd", "remarkName" : null, "letter" : "z", "type" : 0}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"userId": {"type": "string"}, "userName": {"type": "string"}, "headPortrait": {"type": "string"}, "nickname": {"type": "string"}, "remarkName": {"type": "null"}, "letter": {"type": "string"}, "type": {"type": "integer"}}, "required": ["userId", "userName", "headPortrait", "nickname", "remarkName", "letter", "type"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"h": {"type": "string"}, "c": {"type": "object", "properties": {"main": {"type": "boolean"}}, "required": ["main"]}}, "required": ["h", "c"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"h" : "9259b4f0cd9594b538cf", "c" : {"main" : true}} | json_instruct | {"type": "object", "properties": {"h": {"type": "string"}, "c": {"type": "object", "properties": {"main": {"type": "boolean"}}, "required": ["main"]}}, "required": ["h", "c"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "minimum-stability": {"type": "string"}, "require": {"type": "object", "properties": {"google/apiclient": {"type": "string"}}, "required": ["google/apiclient"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "mockery/mockery": {"type": "string"}, "illuminate/http": {"type": "string"}, "illuminate/config": {"type": "string"}}, "required": ["phpunit/phpunit", "mockery/mockery", "illuminate/http", "illuminate/config"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Gcloud\\GooglePubSub\\": {"type": "string"}}, "required": ["Gcloud\\GooglePubSub\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Gcloud\\GooglePubSub\\Tests\\": {"type": "string"}}, "required": ["Gcloud\\GooglePubSub\\Tests\\"]}}, "required": ["psr-4"]}, "config": {"type": "object", "properties": {"preferred-install": {"type": "string"}, "sort-packages": {"type": "boolean"}}, "required": ["preferred-install", "sort-packages"]}}, "required": ["name", "description", "type", "license", "authors", "minimum-stability", "require", "require-dev", "autoload", "autoload-dev", "config"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "smileofninja/GoogleCloudMessages", "description" : "PHP, Laravel, LumenGoogle Gloud Cloud Messaging Micro Services, an alternative to Iron.io", "type" : "library", "license" : "MIT", "authors" : [{"name" : "kumar", "email" : "smileofninja@gmail.com"}], "minimum-stability" : "stable", "require" : {"google/apiclient" : "^2.0"}, "require-dev" : {"phpunit/phpunit" : "~4.1", "mockery/mockery" : "0.9.*", "illuminate/http" : "^5.1", "illuminate/config" : "^5.1"}, "autoload" : {"psr-4" : {"Gcloud\\GooglePubSub\\" : "src/"}}, "autoload-dev" : {"psr-4" : {"Gcloud\\GooglePubSub\\Tests\\" : "tests/"}}, "config" : {"preferred-install" : "dist", "sort-packages" : true}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "minimum-stability": {"type": "string"}, "require": {"type": "object", "properties": {"google/apiclient": {"type": "string"}}, "required": ["google/apiclient"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "mockery/mockery": {"type": "string"}, "illuminate/http": {"type": "string"}, "illuminate/config": {"type": "string"}}, "required": ["phpunit/phpunit", "mockery/mockery", "illuminate/http", "illuminate/config"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Gcloud\\GooglePubSub\\": {"type": "string"}}, "required": ["Gcloud\\GooglePubSub\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Gcloud\\GooglePubSub\\Tests\\": {"type": "string"}}, "required": ["Gcloud\\GooglePubSub\\Tests\\"]}}, "required": ["psr-4"]}, "config": {"type": "object", "properties": {"preferred-install": {"type": "string"}, "sort-packages": {"type": "boolean"}}, "required": ["preferred-install", "sort-packages"]}}, "required": ["name", "description", "type", "license", "authors", "minimum-stability", "require", "require-dev", "autoload", "autoload-dev", "config"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"status": {"type": "integer"}, "data": {"type": "object", "properties": {"totalSubs": {"type": "integer"}, "subsInEachSource": {"type": "object", "properties": {"feedly": {"type": "integer"}, "inoreader": {"type": "integer"}, "feedsPub": {"type": "integer"}}, "required": ["feedly", "inoreader", "feedsPub"]}, "failedSources": {"type": "object", "properties": {}, "required": []}}, "required": ["totalSubs", "subsInEachSource", "failedSources"]}, "lastModified": {"type": "integer"}}, "required": ["status", "data", "lastModified"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"status" : 200, "data" : {"totalSubs" : 9225, "subsInEachSource" : {"feedly" : 6210, "inoreader" : 3000, "feedsPub" : 15}, "failedSources" : {}}, "lastModified" : 1612140761960} | json_instruct | {"type": "object", "properties": {"status": {"type": "integer"}, "data": {"type": "object", "properties": {"totalSubs": {"type": "integer"}, "subsInEachSource": {"type": "object", "properties": {"feedly": {"type": "integer"}, "inoreader": {"type": "integer"}, "feedsPub": {"type": "integer"}}, "required": ["feedly", "inoreader", "feedsPub"]}, "failedSources": {"type": "object", "properties": {}, "required": []}}, "required": ["totalSubs", "subsInEachSource", "failedSources"]}, "lastModified": {"type": "integer"}}, "required": ["status", "data", "lastModified"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"ast" : null, "code" : "export const FETCH_USERS = 'FETCH_USERS'; // export const FETCH_BLOG_DETAILS = 'FETCH_BLOG_DETAILS';\n// export const CHANGE_PAGINATE = 'CHANGE_PAGINATE';", "map" : {"version" : 3, "sources" : ["/Users/matildamwendwa/Documents/Strathmore/Year 2/Web Application Dev/react_semester_project/src/actions/types.js"], "names" : ["FETCH_USERS"], "mappings" : "AAAA,OAAO,MAAMA,WAAW,GAAG,aAApB,C,CACP;AACA", "sourcesContent" : ["export const FETCH_USERS = 'FETCH_USERS';\n// export const FETCH_BLOG_DETAILS = 'FETCH_BLOG_DETAILS';\n// export const CHANGE_PAGINATE = 'CHANGE_PAGINATE';"]}, "metadata" : {}, "sourceType" : "module"} | json_instruct | {"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"project_info": {"type": "object", "properties": {"project_number": {"type": "string"}, "firebase_url": {"type": "string"}, "project_id": {"type": "string"}, "storage_bucket": {"type": "string"}}, "required": ["project_number", "firebase_url", "project_id", "storage_bucket"]}, "client": {"type": "array", "items": {"type": "object", "properties": {"client_info": {"type": "object", "properties": {"mobilesdk_app_id": {"type": "string"}, "android_client_info": {"type": "object", "properties": {"package_name": {"type": "string"}}, "required": ["package_name"]}}, "required": ["mobilesdk_app_id", "android_client_info"]}, "oauth_client": {"type": "array", "items": {"type": "object", "properties": {"client_id": {"type": "string"}, "client_type": {"type": "integer"}}, "required": ["client_id", "client_type"]}}, "api_key": {"type": "array", "items": {"type": "object", "properties": {"current_key": {"type": "string"}}, "required": ["current_key"]}}, "services": {"type": "object", "properties": {"appinvite_service": {"type": "object", "properties": {"other_platform_oauth_client": {"type": "array", "items": {"type": "object", "properties": {"client_id": {"type": "string"}, "client_type": {"type": "integer"}}, "required": ["client_id", "client_type"]}}}, "required": ["other_platform_oauth_client"]}}, "required": ["appinvite_service"]}}, "required": ["client_info", "oauth_client", "api_key", "services"]}}, "configuration_version": {"type": "string"}}, "required": ["project_info", "client", "configuration_version"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"project_info" : {"project_number" : "619514422565", "firebase_url" : "https://visual-english-vocabulary-test.firebaseio.com", "project_id" : "visual-english-vocabulary-test", "storage_bucket" : "visual-english-vocabulary-test.appspot.com"}, "client" : [{"client_info" : {"mobilesdk_app_id" : "1:619514422565:android:39a22d61db01e99237a6cc", "android_client_info" : {"package_name" : "com.android.visual.english.test"}}, "oauth_client" : [{"client_id" : "619514422565-plc8fvesep0ihr185bbu60jl9ucsf7if.apps.googleusercontent.com", "client_type" : 3}], "api_key" : [{"current_key" : "AIzaSyD1XccugZCgk_8xaMrFKJrTpGdKgFPJr-I"}], "services" : {"appinvite_service" : {"other_platform_oauth_client" : [{"client_id" : "619514422565-plc8fvesep0ihr185bbu60jl9ucsf7if.apps.googleusercontent.com", "client_type" : 3}]}}}, {"client_info" : {"mobilesdk_app_id" : "1:619514422565:android:275a85d958c50b2b37a6cc", "android_client_info" : {"package_name" : "com.visual.english.test"}}, "oauth_client" : [{"client_id" : "619514422565-plc8fvesep0ihr185bbu60jl9ucsf7if.apps.googleusercontent.com", "client_type" : 3}], "api_key" : [{"current_key" : "AIzaSyD1XccugZCgk_8xaMrFKJrTpGdKgFPJr-I"}], "services" : {"appinvite_service" : {"other_platform_oauth_client" : [{"client_id" : "619514422565-plc8fvesep0ihr185bbu60jl9ucsf7if.apps.googleusercontent.com", "client_type" : 3}]}}}], "configuration_version" : "1"} | json_instruct | {"type": "object", "properties": {"project_info": {"type": "object", "properties": {"project_number": {"type": "string"}, "firebase_url": {"type": "string"}, "project_id": {"type": "string"}, "storage_bucket": {"type": "string"}}, "required": ["project_number", "firebase_url", "project_id", "storage_bucket"]}, "client": {"type": "array", "items": {"type": "object", "properties": {"client_info": {"type": "object", "properties": {"mobilesdk_app_id": {"type": "string"}, "android_client_info": {"type": "object", "properties": {"package_name": {"type": "string"}}, "required": ["package_name"]}}, "required": ["mobilesdk_app_id", "android_client_info"]}, "oauth_client": {"type": "array", "items": {"type": "object", "properties": {"client_id": {"type": "string"}, "client_type": {"type": "integer"}}, "required": ["client_id", "client_type"]}}, "api_key": {"type": "array", "items": {"type": "object", "properties": {"current_key": {"type": "string"}}, "required": ["current_key"]}}, "services": {"type": "object", "properties": {"appinvite_service": {"type": "object", "properties": {"other_platform_oauth_client": {"type": "array", "items": {"type": "object", "properties": {"client_id": {"type": "string"}, "client_type": {"type": "integer"}}, "required": ["client_id", "client_type"]}}}, "required": ["other_platform_oauth_client"]}}, "required": ["appinvite_service"]}}, "required": ["client_info", "oauth_client", "api_key", "services"]}}, "configuration_version": {"type": "string"}}, "required": ["project_info", "client", "configuration_version"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"web": {"type": "array", "items": {"type": "object", "properties": {"value": {"type": "array", "items": {"type": "string"}}, "key": {"type": "string"}}, "required": ["value", "key"]}}, "query": {"type": "string"}, "translation": {"type": "array", "items": {"type": "string"}}, "errorCode": {"type": "string"}, "dict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "webdict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "basic": {"type": "object", "properties": {"us-phonetic": {"type": "string"}, "phonetic": {"type": "string"}, "uk-phonetic": {"type": "string"}, "explains": {"type": "array", "items": {"type": "string"}}}, "required": ["us-phonetic", "phonetic", "uk-phonetic", "explains"]}, "l": {"type": "string"}}, "required": ["web", "query", "translation", "errorCode", "dict", "webdict", "basic", "l"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"web" : [{"value" : ["\u75ab\u82d7", "\u75ab\u82d7", "\u83cc\u82d7"], "key" : "vaccine"}, {"value" : ["\u72c2\u72ac\u75c5\u75ab\u82d7", "\u72c2\u72ac\u75c5\u75ab\u82d7", "\u72c2\u72ac\u75ab\u82d7"], "key" : "Rabies vaccine"}, {"value" : ["\u764c\u75c7\u75ab\u82d7", "\u80bf\u7624\u75ab\u82d7", "\u764c\u75c7\u75ab\u82d7"], "key" : "Cancer vaccine"}], "query" : "vaccine", "translation" : ["\u75ab\u82d7"], "errorCode" : "0", "dict" : {"url" : "yddict://m.youdao.com/dict?le=eng&q=vaccine"}, "webdict" : {"url" : "http://m.youdao.com/dict?le=eng&q=vaccine"}, "basic" : {"us-phonetic" : "v\u00e6k'sin", "phonetic" : "'v\u00e6ksi\u02d0n; -\u026an", "uk-phonetic" : "'v\u00e6ksi\u02d0n; -\u026an", "explains" : ["n. \u75ab\u82d7\uff1b\u725b\u75d8\u82d7", "adj. \u75ab\u82d7\u7684\uff1b\u725b\u75d8\u7684"]}, "l" : "EN2zh-CHS"} | json_instruct | {"type": "object", "properties": {"web": {"type": "array", "items": {"type": "object", "properties": {"value": {"type": "array", "items": {"type": "string"}}, "key": {"type": "string"}}, "required": ["value", "key"]}}, "query": {"type": "string"}, "translation": {"type": "array", "items": {"type": "string"}}, "errorCode": {"type": "string"}, "dict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "webdict": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "basic": {"type": "object", "properties": {"us-phonetic": {"type": "string"}, "phonetic": {"type": "string"}, "uk-phonetic": {"type": "string"}, "explains": {"type": "array", "items": {"type": "string"}}}, "required": ["us-phonetic", "phonetic", "uk-phonetic", "explains"]}, "l": {"type": "string"}}, "required": ["web", "query", "translation", "errorCode", "dict", "webdict", "basic", "l"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"tauCharts.min.css": {"type": "string"}, "tauCharts.min.js": {"type": "string"}, "tauCharts.normalize.min.css": {"type": "string"}}, "required": ["tauCharts.min.css", "tauCharts.min.js", "tauCharts.normalize.min.css"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"tauCharts.min.css" : "sha256-AXUQmFFtMSnd2ZXI2ovvmYzKE9ptdUdEwh2Fz9YmM7I=", "tauCharts.min.js" : "sha256-/Icqni0zyKFPKfDMzEeJNnmh4vtdNKhO5k2IZsHAbLQ=", "tauCharts.normalize.min.css" : "sha256-BcOdBUmSKF2zBGNKdsGMgmzjG1bGXiX9kbWCsqZbnT8="} | json_instruct | {"type": "object", "properties": {"tauCharts.min.css": {"type": "string"}, "tauCharts.min.js": {"type": "string"}, "tauCharts.normalize.min.css": {"type": "string"}}, "required": ["tauCharts.min.css", "tauCharts.min.js", "tauCharts.normalize.min.css"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"_id": {"type": "string"}, "name": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}, "city": {"type": "string"}, "state": {"type": "string"}, "code": {"type": "string"}, "country": {"type": "string"}, "phone": {"type": "string"}, "geo": {"type": "object", "properties": {"loc": {"type": "array", "items": {"type": "string"}}, "accuracy": {"type": "string"}}, "required": ["loc", "accuracy"]}, "updated": {"type": "string"}}, "required": ["_id", "name", "address", "city", "state", "code", "country", "phone", "geo", "updated"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"_id" : "brewery_Stewart's_Brewing", "name" : "Stewart's Brewing", "address" : ["219 Governor's Square"], "city" : "Bear", "state" : "Delaware", "code" : "19701", "country" : "United States", "phone" : "1-302-836-2739", "geo" : {"loc" : ["-75.6628", "39.6318"], "accuracy" : "RANGE_INTERPOLATED"}, "updated" : "2010-07-22 20:00:20"} | json_instruct | {"type": "object", "properties": {"_id": {"type": "string"}, "name": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}, "city": {"type": "string"}, "state": {"type": "string"}, "code": {"type": "string"}, "country": {"type": "string"}, "phone": {"type": "string"}, "geo": {"type": "object", "properties": {"loc": {"type": "array", "items": {"type": "string"}}, "accuracy": {"type": "string"}}, "required": ["loc", "accuracy"]}, "updated": {"type": "string"}}, "required": ["_id", "name", "address", "city", "state", "code", "country", "phone", "geo", "updated"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"id": {"type": "string"}, "symbol": {"type": "string"}, "name": {"type": "string"}, "platforms": {"type": "object", "properties": {"polygon-pos": {"type": "string"}}, "required": ["polygon-pos"]}, "hashing_algorithm": {"type": "null"}, "categories": {"type": "array", "items": {"type": "string"}}, "description": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country_origin": {"type": "string"}, "genesis_date": {"type": "null"}, "contract_address": {"type": "string"}, "url": {"type": "string"}, "explorers": {"type": "array", "items": {"type": "string"}}, "twitter": {"type": "string"}, "telegram": {"type": "string"}}, "required": ["id", "symbol", "name", "platforms", "hashing_algorithm", "categories", "description", "country_origin", "genesis_date", "contract_address", "url", "explorers", "twitter", "telegram"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "decentral-games-ice", "symbol" : "ice", "name" : "Decentral Games ICE", "platforms" : {"polygon-pos" : "0xc6c855ad634dcdad23e64da71ba85b8c51e5ad7c"}, "hashing_algorithm" : null, "categories" : ["Metaverse", "Play To Earn", "Non-Fungible Tokens (NFT)", "Gaming"], "description" : {"en" : "ICE Poker is a inflationary and play to earn token. It is a new token created by the Decentral Games theme introducing new tokenomics to enable poker players to earn money by competing in competition and completing daily challenges.\r\n\r\nThe only way for DG ICE token to be minted is by winning poker games. Players can sell the token in the market or burn it to upgrade wearables NFTs.\r\n\r\nWearables are special NFTs that players need to purchase or rent in order to earn while competing in poker games."}, "country_origin" : "", "genesis_date" : null, "contract_address" : "0xc6c855ad634dcdad23e64da71ba85b8c51e5ad7c", "url" : "https://ice.decentral.games/", "explorers" : ["https://polygonscan.com/token/0xc6c855ad634dcdad23e64da71ba85b8c51e5ad7c"], "twitter" : "decentralgames", "telegram" : "decentralgames"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "symbol": {"type": "string"}, "name": {"type": "string"}, "platforms": {"type": "object", "properties": {"polygon-pos": {"type": "string"}}, "required": ["polygon-pos"]}, "hashing_algorithm": {"type": "null"}, "categories": {"type": "array", "items": {"type": "string"}}, "description": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country_origin": {"type": "string"}, "genesis_date": {"type": "null"}, "contract_address": {"type": "string"}, "url": {"type": "string"}, "explorers": {"type": "array", "items": {"type": "string"}}, "twitter": {"type": "string"}, "telegram": {"type": "string"}}, "required": ["id", "symbol", "name", "platforms", "hashing_algorithm", "categories", "description", "country_origin", "genesis_date", "contract_address", "url", "explorers", "twitter", "telegram"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "force": {"type": "string"}, "level": {"type": "string"}, "mechanic": {"type": "string"}, "equipment": {"type": "string"}, "primaryMuscles": {"type": "array", "items": {"type": "string"}}, "secondaryMuscles": {"type": "array", "items": {}}, "instructions": {"type": "array", "items": {"type": "string"}}, "category": {"type": "string"}}, "required": ["name", "force", "level", "mechanic", "equipment", "primaryMuscles", "secondaryMuscles", "instructions", "category"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Smith Machine Calf Raise", "force" : "push", "level" : "beginner", "mechanic" : "isolation", "equipment" : "machine", "primaryMuscles" : ["calves"], "secondaryMuscles" : [], "instructions" : ["Place a block or weight plate below the bar on the Smith machine. Set the bar to a position that best matches your height. Once the correct height is chosen and the bar is loaded, step onto the plates with the balls of your feet and place the bar on the back of your shoulders.", "Take the bar with both hands facing forward. Rotate the bar to unrack it. This will be your starting position.", "Raise your heels as high as possible by pushing off of the balls of your feet, flexing your calf at the top of the contraction. Your knees should remain extended. Hold the contracted position for a second before you start to go back down.", "Return slowly to the starting position as you breathe in while lowering your heels.", "Repeat for the recommended amount of repetitions."], "category" : "strength"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "force": {"type": "string"}, "level": {"type": "string"}, "mechanic": {"type": "string"}, "equipment": {"type": "string"}, "primaryMuscles": {"type": "array", "items": {"type": "string"}}, "secondaryMuscles": {"type": "array", "items": {}}, "instructions": {"type": "array", "items": {"type": "string"}}, "category": {"type": "string"}}, "required": ["name", "force", "level", "mechanic", "equipment", "primaryMuscles", "secondaryMuscles", "instructions", "category"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-81.193266, 41.134167], [-81.192844, 41.202123], [-81.09891, 41.201855], [-81.098181, 41.15779], [-81.098718, 41.155556], [-81.098116, 41.154298], [-81.0986, 41.133779], [-81.193266, 41.134167]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 50975}}]} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"Verify Email Address": {"type": "string"}, "Please click the button below to verify your email address.": {"type": "string"}, "If you did not create an account, no further action is required.": {"type": "string"}, "Regards": {"type": "string"}, "Hello!": {"type": "string"}, "You are receiving this email because we received a password reset request for your account.": {"type": "string"}, "This password reset link will expire in 60 minutes.": {"type": "string"}, "If you did not request a password reset, no further action is required.": {"type": "string"}, "Reset Password Notification": {"type": "string"}, "Reset Password": {"type": "string"}, "January": {"type": "string"}, "February": {"type": "string"}, "March": {"type": "string"}, "April": {"type": "string"}, "May": {"type": "string"}, "June": {"type": "string"}, "July": {"type": "string"}, "August": {"type": "string"}, "September": {"type": "string"}, "October": {"type": "string"}, "November": {"type": "string"}, "ago": {"type": "string"}, "hours": {"type": "string"}, "Showing": {"type": "string"}, "to": {"type": "string"}, "of": {"type": "string"}, "results": {"type": "string"}}, "required": ["Verify Email Address", "Please click the button below to verify your email address.", "If you did not create an account, no further action is required.", "Regards", "Hello!", "You are receiving this email because we received a password reset request for your account.", "This password reset link will expire in 60 minutes.", "If you did not request a password reset, no further action is required.", "Reset Password Notification", "Reset Password", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "ago", "hours", "Showing", "to", "of", "results"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Verify Email Address" : "Verifikacija adrese", "Please click the button below to verify your email address." : "Molimo vas da kliknete na dugme ako \u017eelite da verifikujete email adresu.", "If you did not create an account, no further action is required." : "Ako niste kreirali ra\u010dun, ne morate ni\u0161ta uraditi.", "Regards" : "S po\u0161tovanjem", "Hello!" : "Pozdrav!", "You are receiving this email because we received a password reset request for your account." : "Primili ste ovaj email jer ste zatra\u017eili promjenu passworda.", "This password reset link will expire in 60 minutes." : "Ovaj link va\u017ei 1h.", "If you did not request a password reset, no further action is required." : "Ako niste zatra\u017eili promjenu passworda, ne morate ni\u0161ta uraditi.", "Reset Password Notification" : "Notifikacija za resetovanje passworda", "Reset Password" : "Resetujte password", "January" : "Januar", "February" : "Februar", "March" : "Mart", "April" : "April", "May" : "Maj", "June" : "Juni", "July" : "Juli", "August" : "August", "September" : "Septembar", "October" : "Oktobar", "November" : "Novembar", "ago" : "prije", "hours" : "sati", "Showing" : "Prikaz", "to" : "do", "of" : "od", "results" : "rezultata"} | json_instruct | {"type": "object", "properties": {"Verify Email Address": {"type": "string"}, "Please click the button below to verify your email address.": {"type": "string"}, "If you did not create an account, no further action is required.": {"type": "string"}, "Regards": {"type": "string"}, "Hello!": {"type": "string"}, "You are receiving this email because we received a password reset request for your account.": {"type": "string"}, "This password reset link will expire in 60 minutes.": {"type": "string"}, "If you did not request a password reset, no further action is required.": {"type": "string"}, "Reset Password Notification": {"type": "string"}, "Reset Password": {"type": "string"}, "January": {"type": "string"}, "February": {"type": "string"}, "March": {"type": "string"}, "April": {"type": "string"}, "May": {"type": "string"}, "June": {"type": "string"}, "July": {"type": "string"}, "August": {"type": "string"}, "September": {"type": "string"}, "October": {"type": "string"}, "November": {"type": "string"}, "ago": {"type": "string"}, "hours": {"type": "string"}, "Showing": {"type": "string"}, "to": {"type": "string"}, "of": {"type": "string"}, "results": {"type": "string"}}, "required": ["Verify Email Address", "Please click the button below to verify your email address.", "If you did not create an account, no further action is required.", "Regards", "Hello!", "You are receiving this email because we received a password reset request for your account.", "This password reset link will expire in 60 minutes.", "If you did not request a password reset, no further action is required.", "Reset Password Notification", "Reset Password", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "ago", "hours", "Showing", "to", "of", "results"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"id": {"type": "string"}, "article": {"type": "string"}, "questions": {"type": "string"}, "options": {"type": "object", "properties": {"model": {"type": "array", "items": {"type": "string"}}, "human": {"type": "array", "items": {"type": "string"}}}, "required": ["model", "human"]}, "answer": {"type": "object", "properties": {"model": {"type": "integer"}, "human": {"type": "integer"}}, "required": ["model", "human"]}}, "required": ["id", "article", "questions", "options", "answer"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "4790", "article" : "Asia - Pacific Economic Cooperation ( APEC ) members met in Beijing from November 5 to 11 to discuss the future of APEC and the overall development of the Asia - Pacific area . APEC , which was set up in 1989 , is a forum for 21 member countries to develop free trade and economic cooperation throughout the Asia - Pacific area . Though Asia - Pacific Economic Cooperation came to a successful close , the \" APEC Blue \" has become popular in Beijing , even in China . A clear blue sky in Beijing is difficult to see during the smog season , so Beijingers gave it a name : \" APEC Blue \" . \" Oh , how beautiful the autumn sky is and how fresh the air is ! \" This is how most Beijingers feel during APEC . \" I hope the APEC Blue will remain , and I believe , through the efforts we continue to make , it will . \" A lot of environmentally friendly ways were taken to reduce the Beijing smog during the APEC meeting , including limiting the number of cars on the road , stopping some factories in neighboring cities and so on . Perhaps we can learn something from London , where the Great Smog killed 4 , 000 people : in four days in 1952 . Britain then passed its first air pollution act , which required that all power plants in London should be shut down , factories must build taller chimneys , and the heating system must be improved . In order to keep \" APEC Blue \" , Beijing plans to build air corridors to blow away pollution . Not all agree with this way . Song Guojun , a professor of _ at Renmin University , believes that this way will not solve the problem at its root , and only by controlling the source of pollution will Beijing see bluer skies .", "questions" : "The \" APEC Blue \" was named by", "options" : {"model" : ["beijingers", "beijinger"], "human" : ["APEC", "Beijingers"]}, "answer" : {"model" : 0, "human" : 1}} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "article": {"type": "string"}, "questions": {"type": "string"}, "options": {"type": "object", "properties": {"model": {"type": "array", "items": {"type": "string"}}, "human": {"type": "array", "items": {"type": "string"}}}, "required": ["model", "human"]}, "answer": {"type": "object", "properties": {"model": {"type": "integer"}, "human": {"type": "integer"}}, "required": ["model", "human"]}}, "required": ["id", "article", "questions", "options", "answer"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Xin\\Swoole\\": {"type": "string"}}, "required": ["Xin\\Swoole\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Tests\\": {"type": "string"}}, "required": ["Tests\\"]}}, "required": ["psr-4"]}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "ext-swoole": {"type": "string"}, "limingxinleo/x-console-color": {"type": "string"}}, "required": ["php", "ext-swoole", "limingxinleo/x-console-color"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "limingxinleo/x-trait-common": {"type": "string"}, "limingxinleo/support-str": {"type": "string"}}, "required": ["phpunit/phpunit", "limingxinleo/x-trait-common", "limingxinleo/support-str"]}}, "required": ["name", "description", "type", "license", "authors", "autoload", "autoload-dev", "require", "require-dev"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "limingxinleo/x-swoole-rpc", "description" : "Rpc library for swoole", "type" : "library", "license" : "MIT", "authors" : [{"name" : "\u674e\u94ed\u6615", "email" : "715557344@qq.com"}], "autoload" : {"psr-4" : {"Xin\\Swoole\\" : "src"}}, "autoload-dev" : {"psr-4" : {"Tests\\" : "tests"}}, "require" : {"php" : ">=5.6", "ext-swoole" : ">=1.10", "limingxinleo/x-console-color" : "^1.0"}, "require-dev" : {"phpunit/phpunit" : ">=5.6", "limingxinleo/x-trait-common" : "^1.0", "limingxinleo/support-str" : "^1.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Xin\\Swoole\\": {"type": "string"}}, "required": ["Xin\\Swoole\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Tests\\": {"type": "string"}}, "required": ["Tests\\"]}}, "required": ["psr-4"]}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "ext-swoole": {"type": "string"}, "limingxinleo/x-console-color": {"type": "string"}}, "required": ["php", "ext-swoole", "limingxinleo/x-console-color"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "limingxinleo/x-trait-common": {"type": "string"}, "limingxinleo/support-str": {"type": "string"}}, "required": ["phpunit/phpunit", "limingxinleo/x-trait-common", "limingxinleo/support-str"]}}, "required": ["name", "description", "type", "license", "authors", "autoload", "autoload-dev", "require", "require-dev"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"version": {"type": "string"}, "lockfileVersion": {"type": "integer"}, "requires": {"type": "boolean"}, "dependencies": {"type": "object", "properties": {"react": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}, "requires": {"type": "object", "properties": {"loose-envify": {"type": "string"}, "object-assign": {"type": "string"}, "prop-types": {"type": "string"}}, "required": ["loose-envify", "object-assign", "prop-types"]}}, "required": ["version", "resolved", "integrity", "requires"]}}, "required": ["react"]}}, "required": ["version", "lockfileVersion", "requires", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"version" : "1.0.0", "lockfileVersion" : 1, "requires" : true, "dependencies" : {"react" : {"version" : "16.9.0", "resolved" : "https://registry.npmjs.org/react/-/react-16.9.0.tgz", "integrity" : "sha512-+7LQnFBwkiw+BobzOF6N//BdoNw0ouwmSJTEm9cglOOmsg/TMiFHZLe2sEoN5M7LgJTj9oHH0gxklfnQe66S1w==", "requires" : {"loose-envify" : "^1.1.0", "object-assign" : "^4.1.1", "prop-types" : "^15.6.2"}}}} | json_instruct | {"type": "object", "properties": {"version": {"type": "string"}, "lockfileVersion": {"type": "integer"}, "requires": {"type": "boolean"}, "dependencies": {"type": "object", "properties": {"react": {"type": "object", "properties": {"version": {"type": "string"}, "resolved": {"type": "string"}, "integrity": {"type": "string"}, "requires": {"type": "object", "properties": {"loose-envify": {"type": "string"}, "object-assign": {"type": "string"}, "prop-types": {"type": "string"}}, "required": ["loose-envify", "object-assign", "prop-types"]}}, "required": ["version", "resolved", "integrity", "requires"]}}, "required": ["react"]}}, "required": ["version", "lockfileVersion", "requires", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "string"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 46737, "name" : "Tuba 2011 minimalistyczna", "description" : "Zostaje praktycznie tylko player + co b\u0119dzie zagrane wkr\u00f3tce.", "user" : {"id" : 96895, "name" : "qbk", "email" : "redacted", "paypal_email" : null, "homepage" : null, "about" : null, "license" : "ccby"}, "updated" : "2011-04-17T12:50:07.000Z", "weekly_install_count" : 0, "total_install_count" : 91, "rating" : null, "after_screenshot_name" : "https://userstyles.org/style_screenshots/46737_after.png?r=1588925024", "obsoleting_style_id" : null, "obsoleting_style_name" : null, "obsolete" : 0, "admin_delete_reason_id" : null, "obsoletion_message" : null, "screenshots" : null, "license" : null, "created" : "2011-04-17T12:50:07.000Z", "category" : "site", "raw_subcategory" : "tuba", "subcategory" : "tuba", "additional_info" : "Dla pe\u0142nego efektu polecam dodatkowo r\u0119czne dodanie filtr\u00f3w do AdBlock Plus wg w\u0142asnego uznania.", "style_tags" : [], "css" : "@namespace url(http://www.w3.org/1999/xhtml);\r\n\r\n@-moz-document domain(\"fm.tuba.pl\") {\r\n html,\r\n div.ad-css\r\n { background-image:none !important; background-color:white !important; padding:0 !important; }\r\n div#container {margin-top:0 !important;}\r\n div#container > a{height:auto !important; display:none !important;}\r\n\r\n #column-right,\r\n #column-central,\r\n #comments,\r\n h3,\r\n #radio > form,\r\n #radio div.radio-about,\r\n #footer,\r\n #big-search,\r\n iframe,\r\n div#banP1,\r\n div#banP1 img,\r\n embed\r\n {display:none !important;}\r\n\r\n}", "discussions" : [], "discussionsCount" : 0, "commentsCount" : 0, "userjs_url" : "/styles/userjs/46737/tuba-2011-minimalistyczna.user.js", "style_settings" : []} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "string"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "string"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "url": {"type": "string"}}, "required": ["name", "description", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "HDM Odyssey", "description" : "A mixed reality headset.", "url" : "https://www.samsung.com/us/computing/hmd/windows-mixed-reality/xe800zaa-hc1us-xe800zaa-hc1us/"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "url": {"type": "string"}}, "required": ["name", "description", "url"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"rustc": {"type": "integer"}, "features": {"type": "string"}, "target": {"type": "integer"}, "profile": {"type": "integer"}, "path": {"type": "integer"}, "deps": {"type": "array", "items": {}}, "local": {"type": "array", "items": {"type": "object", "properties": {"CheckDepInfo": {"type": "object", "properties": {"dep_info": {"type": "string"}}, "required": ["dep_info"]}}, "required": ["CheckDepInfo"]}}, "rustflags": {"type": "array", "items": {}}, "metadata": {"type": "integer"}, "config": {"type": "integer"}, "compile_kind": {"type": "integer"}}, "required": ["rustc", "features", "target", "profile", "path", "deps", "local", "rustflags", "metadata", "config", "compile_kind"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"rustc" : 4721438020156434217, "features" : "[]", "target" : 11985127666710710691, "profile" : 2285152228202085614, "path" : 14127950316838266127, "deps" : [], "local" : [{"CheckDepInfo" : {"dep_info" : "release\\.fingerprint\\argh_shared-3e2b647088c7d3bd\\dep-lib-argh_shared"}}], "rustflags" : [], "metadata" : 13401218881151525340, "config" : 0, "compile_kind" : 0} | json_instruct | {"type": "object", "properties": {"rustc": {"type": "integer"}, "features": {"type": "string"}, "target": {"type": "integer"}, "profile": {"type": "integer"}, "path": {"type": "integer"}, "deps": {"type": "array", "items": {}}, "local": {"type": "array", "items": {"type": "object", "properties": {"CheckDepInfo": {"type": "object", "properties": {"dep_info": {"type": "string"}}, "required": ["dep_info"]}}, "required": ["CheckDepInfo"]}}, "rustflags": {"type": "array", "items": {}}, "metadata": {"type": "integer"}, "config": {"type": "integer"}, "compile_kind": {"type": "integer"}}, "required": ["rustc", "features", "target", "profile", "path", "deps", "local", "rustflags", "metadata", "config", "compile_kind"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "FeatureCollection", "features" : [{"geometry" : {"type" : "Polygon", "coordinates" : [[[-122.916707, 47.086003], [-122.915822, 47.124555], [-122.91515, 47.125127], [-122.915333, 47.13696], [-122.913121, 47.144261], [-122.910161, 47.149907], [-122.905659, 47.155614], [-122.901311, 47.15492], [-122.891697, 47.157704], [-122.881046, 47.156453], [-122.876422, 47.159772], [-122.870501, 47.161801], [-122.8668, 47.162212], [-122.862342, 47.165917], [-122.856263, 47.166779], [-122.853919, 47.168696], [-122.850328, 47.169202], [-122.847479, 47.168023], [-122.841039, 47.168611], [-122.839554, 47.167518], [-122.838226, 47.166064], [-122.83782, 47.161958], [-122.835591, 47.159431], [-122.834352, 47.151263], [-122.835219, 47.149074], [-122.84042, 47.145284], [-122.839182, 47.141915], [-122.83943, 47.137704], [-122.836823, 47.136495], [-122.835919, 47.131939], [-122.837043, 47.130342], [-122.83979, 47.133008], [-122.847151, 47.13047], [-122.853563, 47.126757], [-122.86517, 47.12701], [-122.864939, 47.068939], [-122.887934, 47.068827], [-122.888087, 47.076118], [-122.88897, 47.077026], [-122.896256, 47.074996], [-122.897835, 47.071664], [-122.903568, 47.069348], [-122.912143, 47.069341], [-122.915852, 47.080159], [-122.916707, 47.086003]]]}, "type" : "Feature", "properties" : {"cartodb_id" : 79866}}]} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"cartodb_id": {"type": "integer"}}, "required": ["cartodb_id"]}}, "required": ["geometry", "type", "properties"]}}}, "required": ["type", "features"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "block/redstone/comparator_spike_base"} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [[1995, 5], [2002, 8], [2003, 6], [2004, 6], [2006, 6], [2009, 8], [2010, 8]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"word" : "crepon", "definition" : "A thin stuff made of the finest wool or silk, or of wool and silk."} | json_instruct | {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"body": {"type": "string"}, "requestContext": {"type": "object", "properties": {"identity": {"type": "object", "properties": {"cognitoIdentityId": {"type": "string"}}, "required": ["cognitoIdentityId"]}}, "required": ["identity"]}}, "required": ["body", "requestContext"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"body" : "{\"tripNote\":\"hello world\",\"firstFileKey\":\"hello1.jpg\",\"secondFileKey\":\"hello2.jpg\"}", "requestContext" : {"identity" : {"cognitoIdentityId" : "USER-SUB-1234"}}} | json_instruct | {"type": "object", "properties": {"body": {"type": "string"}, "requestContext": {"type": "object", "properties": {"identity": {"type": "object", "properties": {"cognitoIdentityId": {"type": "string"}}, "required": ["cognitoIdentityId"]}}, "required": ["identity"]}}, "required": ["body", "requestContext"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"Paris": {"type": "string"}, "Metz": {"type": "string"}}, "required": ["Paris", "Metz"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Paris" : "PAR", "Metz" : "MZM"} | json_instruct | {"type": "object", "properties": {"Paris": {"type": "string"}, "Metz": {"type": "string"}}, "required": ["Paris", "Metz"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"format_version": {"type": "string"}, "render_controllers": {"type": "object", "properties": {"controller.render.leech": {"type": "object", "properties": {"arrays": {"type": "object", "properties": {"textures": {"type": "object", "properties": {"Array.skin": {"type": "array", "items": {"type": "string"}}}, "required": ["Array.skin"]}}, "required": ["textures"]}, "geometry": {"type": "string"}, "materials": {"type": "array", "items": {"type": "object", "properties": {"*": {"type": "string"}}, "required": ["*"]}}, "textures": {"type": "array", "items": {"type": "string"}}}, "required": ["arrays", "geometry", "materials", "textures"]}}, "required": ["controller.render.leech"]}}, "required": ["format_version", "render_controllers"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"format_version" : "1.8.0", "render_controllers" : {"controller.render.leech" : {"arrays" : {"textures" : {"Array.skin" : ["Texture.common_leech", "Texture.vampire_leech", "Texture.medic_leech", "Texture.poison_leech", "Texture.paralyzing_leech", "Texture.raud_leech", "Texture.zombie_leech", "Texture.parasite_leech", "Texture.paralyzing_leech_2"]}}, "geometry" : "Geometry.default", "materials" : [{"*" : "Material.default"}], "textures" : ["Array.skin[query.variant]"]}}} | json_instruct | {"type": "object", "properties": {"format_version": {"type": "string"}, "render_controllers": {"type": "object", "properties": {"controller.render.leech": {"type": "object", "properties": {"arrays": {"type": "object", "properties": {"textures": {"type": "object", "properties": {"Array.skin": {"type": "array", "items": {"type": "string"}}}, "required": ["Array.skin"]}}, "required": ["textures"]}, "geometry": {"type": "string"}, "materials": {"type": "array", "items": {"type": "object", "properties": {"*": {"type": "string"}}, "required": ["*"]}}, "textures": {"type": "array", "items": {"type": "string"}}}, "required": ["arrays", "geometry", "materials", "textures"]}}, "required": ["controller.render.leech"]}}, "required": ["format_version", "render_controllers"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"index": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "release": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "getting-started": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "methods": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "faq": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}}, "required": ["index", "release", "getting-started", "methods", "faq"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"index" : {"title" : "Selamat datang di tgsnake"}, "release" : {"title" : "Catatan Perubahan"}, "getting-started" : {"title" : "Memulai"}, "methods" : {"title" : "Metode"}, "faq" : {"title" : "Pertanyaan yang Sering Diajukan"}} | json_instruct | {"type": "object", "properties": {"index": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "release": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "getting-started": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "methods": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}, "faq": {"type": "object", "properties": {"title": {"type": "string"}}, "required": ["title"]}}, "required": ["index", "release", "getting-started", "methods", "faq"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {"type": "string"}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"schema_version" : "1.2.0", "id" : "GHSA-ghrr-459c-37qq", "modified" : "2021-12-29T00:01:33Z", "published" : "2021-12-23T00:01:27Z", "aliases" : ["CVE-2021-43158"], "details" : "In ProjectWorlds Online Shopping System PHP 1.0, a CSRF vulnerability in cart_remove.php allows a remote attacker to remove any product in the customer's cart.", "severity" : [], "affected" : [], "references" : [{"type" : "ADVISORY", "url" : "https://nvd.nist.gov/vuln/detail/CVE-2021-43158"}, {"type" : "WEB", "url" : "https://github.com/projectworldsofficial/online-shopping-webvsite-in-php/issues/2"}, {"type" : "WEB", "url" : "https://projectworlds.in/free-projects/php-projects/free-download-online-shopping-system/"}], "database_specific" : {"cwe_ids" : ["CWE-352"], "severity" : "MODERATE", "github_reviewed" : false}} | json_instruct | {"type": "object", "properties": {"schema_version": {"type": "string"}, "id": {"type": "string"}, "modified": {"type": "string"}, "published": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "details": {"type": "string"}, "severity": {"type": "array", "items": {}}, "affected": {"type": "array", "items": {}}, "references": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "database_specific": {"type": "object", "properties": {"cwe_ids": {"type": "array", "items": {"type": "string"}}, "severity": {"type": "string"}, "github_reviewed": {"type": "boolean"}}, "required": ["cwe_ids", "severity", "github_reviewed"]}}, "required": ["schema_version", "id", "modified", "published", "aliases", "details", "severity", "affected", "references", "database_specific"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "4e3d9d6cbe79caa1ce039775d69ac76d728c3a01"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"navigationBarTitleText": {"type": "string"}, "usingComponents": {"type": "object", "properties": {"c-search": {"type": "string"}, "van-icon": {"type": "string"}}, "required": ["c-search", "van-icon"]}}, "required": ["navigationBarTitleText", "usingComponents"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"navigationBarTitleText" : "\u6d3b\u52a8\u641c\u7d22", "usingComponents" : {"c-search" : "/components/c-search/c-search", "van-icon" : "/miniprogram_npm/vant-weapp/icon/index"}} | json_instruct | {"type": "object", "properties": {"navigationBarTitleText": {"type": "string"}, "usingComponents": {"type": "object", "properties": {"c-search": {"type": "string"}, "van-icon": {"type": "string"}}, "required": ["c-search", "van-icon"]}}, "required": ["navigationBarTitleText", "usingComponents"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : 108721, "info" : {"name" : "Hakuouki Shinsengumi Kitan{YAOI}- Amor doce Theme", "description" : "Ol\u00e1 cupcakes >w<, aqui \u00e9 a Sonomesama do Amor Doce BR. Espero que goste do tema\r\n\\!/Se pegar me avise por MP\\!/ Se quiser um tema, pe\u00e7a por uma MP ^^' (http://www.amordoce.com/profil/Sonomesama)\r\nPreview (O TEMA N\u00c3O INCLUI A \u00c1RVORE DO LADO): http://www.ezimba.com/work/141227C/ezimba18235495383104.png", "additionalInfo" : null, "format" : "uso", "category" : "amordoce", "createdAt" : "2014-12-27T02:32:49.000Z", "updatedAt" : "2014-12-27T02:32:49.000Z", "license" : "NO-REDISTRIBUTION", "author" : {"id" : 279411, "name" : "MintCream"}}, "stats" : {"installs" : {"total" : 751, "weekly" : 0}}, "screenshots" : {"main" : {"name" : "108721_after.png", "archived" : false}}, "discussions" : {"stats" : {"discussionsCount" : 0, "commentsCount" : 0}, "data" : []}, "style" : {"css" : "@-moz-document domain(\"amordoce.com\") {\r\n#container{\r\nbackground-image : url(http://www.ezimba.com/work/141227C/ezimba18235464416804.png) !important ;\r\n}\r\n#container.connected #header { background-image : url(http://www.ezimba.com/work/141227C/ezimba18235493962904.png) !important ;\r\n}\r\n.idcard-member { background : url(http://www.ezimba.com/work/141227C/ezimba18235429048504.png) no-repeat !important ;\r\n}\r\n}\r\n\r\n@-moz-document regexp(\"www.amordoce.com/profil/Sonomesama\") {\r\n.idcard-member { background : url(http://www.ezimba.com/work/141227C/ezimba18235429048504.png) no-repeat !important ;\r\n}\r\n}"}} | json_instruct | {"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@types/async": {"type": "string"}, "@types/bluebird": {"type": "string"}, "@types/colors": {"type": "string"}, "@types/lodash": {"type": "string"}, "@types/minimist": {"type": "string"}, "@types/node": {"type": "string"}, "async": {"type": "string"}, "aws-sdk": {"type": "string"}, "bluebird": {"type": "string"}, "colors": {"type": "string"}, "lodash": {"type": "string"}, "minimist": {"type": "string"}, "moment": {"type": "string"}}, "required": ["@types/async", "@types/bluebird", "@types/colors", "@types/lodash", "@types/minimist", "@types/node", "async", "aws-sdk", "bluebird", "colors", "lodash", "minimist", "moment"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "cloudwatch-auto", "version" : "1.0.0", "description" : "", "main" : "index.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "author" : "", "license" : "ISC", "dependencies" : {"@types/async" : "^2.0.42", "@types/bluebird" : "^3.5.11", "@types/colors" : "^1.1.3", "@types/lodash" : "^4.14.74", "@types/minimist" : "^1.2.0", "@types/node" : "^8.0.28", "async" : "^2.5.0", "aws-sdk" : "^2.119.0", "bluebird" : "^3.5.0", "colors" : "^1.1.2", "lodash" : "^4.17.4", "minimist" : "^1.2.0", "moment" : "^2.18.1"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@types/async": {"type": "string"}, "@types/bluebird": {"type": "string"}, "@types/colors": {"type": "string"}, "@types/lodash": {"type": "string"}, "@types/minimist": {"type": "string"}, "@types/node": {"type": "string"}, "async": {"type": "string"}, "aws-sdk": {"type": "string"}, "bluebird": {"type": "string"}, "colors": {"type": "string"}, "lodash": {"type": "string"}, "minimist": {"type": "string"}, "moment": {"type": "string"}}, "required": ["@types/async", "@types/bluebird", "@types/colors", "@types/lodash", "@types/minimist", "@types/node", "async", "aws-sdk", "bluebird", "colors", "lodash", "minimist", "moment"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"word" : "mordication", "definition" : "The act of biting or corroding; corrosion. [R.] Bacon."} | json_instruct | {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"pdf.combined.js": {"type": "string"}, "pdf.js": {"type": "string"}, "pdf.min.js": {"type": "string"}, "pdf.worker.entry.js": {"type": "string"}, "pdf.worker.js": {"type": "string"}, "pdf.worker.min.js": {"type": "string"}, "pdf_viewer.css": {"type": "string"}, "pdf_viewer.js": {"type": "string"}}, "required": ["pdf.combined.js", "pdf.js", "pdf.min.js", "pdf.worker.entry.js", "pdf.worker.js", "pdf.worker.min.js", "pdf_viewer.css", "pdf_viewer.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"pdf.combined.js" : "sha512-vSsedKAvq5qSj1scjhELxtRSxux/2GnXG0rR5VAT0yba75Pi/V/p80ICBVF61GOIWxn+tmChMOeM7AiHU8rcQQ==", "pdf.js" : "sha512-Zv92zCi+Crmbgt5AEDxkKvuB3O+Nd64Fa4sxuOhQo//RitiaRLoXydIvE6NjFGIc+Wzd59QhyC697ooVGwjIqQ==", "pdf.min.js" : "sha512-W6aaIBlGWjvPLjbK8NS+do8/iKC/i9Q7us7Ryx6JU3yoTd21zh2BC1yn4znDTHTvr+KIG39HzZqE2kNjWr3kLA==", "pdf.worker.entry.js" : "sha512-YVgpGOVlx4wTrb11qeT7kVE5ZqSv/gcNFLTTvPV1MV7+YH/vxcb42WgxB3mu+KBU782wK7om+rEeIAyy+YOS0g==", "pdf.worker.js" : "sha512-YBH/+wh4/U13GBm8609Brndd3RSjV5+3OM31zH6+aPtXOLMcL7NdZfxdzWdx/K+fTL3G4WS0LKSB5XBA1q09tA==", "pdf.worker.min.js" : "sha512-uqjD6nJygI5FeqPsdZkOEmeslIVx4Tqo3qgx2Oi44SGoxKFTgFtj1y5Q3CtidaeN9r2+MmIMTW7wVQeidX1v2A==", "pdf_viewer.css" : "sha512-cAzT9GojPcjiNW6KkvfHIfMxJwIe3y3KL/Y/2o/kUz7zwuduaGnkEH6EJC38D45aTIBmDfBuSIXSFlXe9aay/w==", "pdf_viewer.js" : "sha512-MjGZn4wruqkMxMfn6Ubippa2K8ZPMdE90+mxBdzAPTFW0IUD4peGu3cN6Cdo6RwUXLcTHn2sOC4YbT8PdnMDZQ=="} | json_instruct | {"type": "object", "properties": {"pdf.combined.js": {"type": "string"}, "pdf.js": {"type": "string"}, "pdf.min.js": {"type": "string"}, "pdf.worker.entry.js": {"type": "string"}, "pdf.worker.js": {"type": "string"}, "pdf.worker.min.js": {"type": "string"}, "pdf_viewer.css": {"type": "string"}, "pdf_viewer.js": {"type": "string"}}, "required": ["pdf.combined.js", "pdf.js", "pdf.min.js", "pdf.worker.entry.js", "pdf.worker.js", "pdf.worker.min.js", "pdf_viewer.css", "pdf_viewer.js"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "RNUUID", "displayName" : "RNUUID"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Feature", "properties" : {"type" : "barangay", "level" : "4", "label" : "Mabas, Lopez Jaena, Misamis Occidental, Northern Mindanao (Region X), PH", "locale" : "ph.northern-mindanao-region-x.misamis-occidental.lopez-jaena.mabas", "country_id" : 177, "country_reference" : 177, "country_name" : "Philippines", "region_id" : "14", "region_reference" : "10", "region_name" : "Northern Mindanao (Region X)", "province_id" : "48", "province_reference" : "48", "province_name" : "Misamis Occidental", "city_id" : "712", "city_reference" : "975", "city_name" : "Lopez Jaena", "barangay_id" : "20008", "barangay_reference" : "26028", "barangay_name" : "Mabas"}, "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[123.680298, 8.49323], [123.67794, 8.48533], [123.678307, 8.48251], [123.676933, 8.47735], [123.676872, 8.47625], [123.676781, 8.47568], [123.654999, 8.47565], [123.66626, 8.48984], [123.674797, 8.49221], [123.678581, 8.49251], [123.680298, 8.49323]]]]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/BeamNG.SteeringDeviceTests/BeamNG_SteeringDeviceTests.swift": {"type": "object", "properties": {"swiftmodule": {"type": "string"}, "object": {"type": "string"}, "llvm-bc": {"type": "string"}, "diagnostics": {"type": "string"}, "dependencies": {"type": "string"}, "swift-dependencies": {"type": "string"}}, "required": ["swiftmodule", "object", "llvm-bc", "diagnostics", "dependencies", "swift-dependencies"]}, "": {"type": "object", "properties": {"swift-dependencies": {"type": "string"}}, "required": ["swift-dependencies"]}}, "required": ["/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/BeamNG.SteeringDeviceTests/BeamNG_SteeringDeviceTests.swift", ""], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/BeamNG.SteeringDeviceTests/BeamNG_SteeringDeviceTests.swift" : {"swiftmodule" : "/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/build/BeamNG.SteeringDevice.build/Debug-iphoneos/BeamNG.SteeringDeviceTests.build/Objects-normal/arm64/BeamNG_SteeringDeviceTests~partial.swiftmodule", "object" : "/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/build/BeamNG.SteeringDevice.build/Debug-iphoneos/BeamNG.SteeringDeviceTests.build/Objects-normal/arm64/BeamNG_SteeringDeviceTests.o", "llvm-bc" : "/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/build/BeamNG.SteeringDevice.build/Debug-iphoneos/BeamNG.SteeringDeviceTests.build/Objects-normal/arm64/BeamNG_SteeringDeviceTests.bc", "diagnostics" : "/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/build/BeamNG.SteeringDevice.build/Debug-iphoneos/BeamNG.SteeringDeviceTests.build/Objects-normal/arm64/BeamNG_SteeringDeviceTests.dia", "dependencies" : "/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/build/BeamNG.SteeringDevice.build/Debug-iphoneos/BeamNG.SteeringDeviceTests.build/Objects-normal/arm64/BeamNG_SteeringDeviceTests.d", "swift-dependencies" : "/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/build/BeamNG.SteeringDevice.build/Debug-iphoneos/BeamNG.SteeringDeviceTests.build/Objects-normal/arm64/BeamNG_SteeringDeviceTests.swiftdeps"}, "" : {"swift-dependencies" : "/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/build/BeamNG.SteeringDevice.build/Debug-iphoneos/BeamNG.SteeringDeviceTests.build/Objects-normal/arm64/BeamNG.SteeringDeviceTests-master.swiftdeps"}} | json_instruct | {"type": "object", "properties": {"/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/BeamNG.SteeringDeviceTests/BeamNG_SteeringDeviceTests.swift": {"type": "object", "properties": {"swiftmodule": {"type": "string"}, "object": {"type": "string"}, "llvm-bc": {"type": "string"}, "diagnostics": {"type": "string"}, "dependencies": {"type": "string"}, "swift-dependencies": {"type": "string"}}, "required": ["swiftmodule", "object", "llvm-bc", "diagnostics", "dependencies", "swift-dependencies"]}, "": {"type": "object", "properties": {"swift-dependencies": {"type": "string"}}, "required": ["swift-dependencies"]}}, "required": ["/Users/Hondune/Desktop/Work And Stuff/BeamNG Work/remotecontrol/iOS/BeamNG.SteeringDevice/BeamNG.SteeringDeviceTests/BeamNG_SteeringDeviceTests.swift", ""], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["description", "homepage"]}, "versions": {"type": "object", "properties": {"0.5.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["0.5.1"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"latest_version" : ["0.5.1"], "meta" : {"description" : "Simple ASCII menus for humans", "homepage" : "https://github.com/gpalsingh/Simple-Menus"}, "versions" : {"0.5.1" : {"sha256" : "24a2f72501a94ae1bc9c643f6c0c3166b58b55e46795bc531bb38a6fcc49825a", "url" : "https://files.pythonhosted.org/packages/66/3a/3e05f42706bb9d24bd699a946c4541e7a3628ca5f00832f6f5042ad4d948/Simple-Menus-0.5.1.tar.gz"}}} | json_instruct | {"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["description", "homepage"]}, "versions": {"type": "object", "properties": {"0.5.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["0.5.1"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
| ["grommet", "grommet-udacity", "inuit-full-kit", "inuit-headings-trumps"] | json_instruct | {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"root": {"type": "string"}}, "required": ["root"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"root" : "python-only/"} | json_instruct | {"type": "object", "properties": {"root": {"type": "string"}}, "required": ["root"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"Math-97b": {"type": "object", "properties": {"creationdate": {"type": "string"}, "resolutiondate": {"type": "string"}, "hash": {"type": "string"}, "commitdate": {"type": "string"}}, "required": ["creationdate", "resolutiondate", "hash", "commitdate"]}}, "required": ["Math-97b"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Math-97b" : {"creationdate" : "2008-05-06 20:33:57 +0000", "resolutiondate" : "2008-05-07 13:37:07 +0000", "hash" : "ed492bd0c5c5c3a0258a65cb31cc8723d8f011fd", "commitdate" : "2008-06-23 13:46:46 +0000"}} | json_instruct | {"type": "object", "properties": {"Math-97b": {"type": "object", "properties": {"creationdate": {"type": "string"}, "resolutiondate": {"type": "string"}, "hash": {"type": "string"}, "commitdate": {"type": "string"}}, "required": ["creationdate", "resolutiondate", "hash", "commitdate"]}}, "required": ["Math-97b"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"schemaVersion": {"type": "integer"}, "id": {"type": "string"}, "version": {"type": "string"}, "name": {"type": "string"}, "icon": {"type": "string"}, "description": {"type": "string"}, "licence": {"type": "string"}, "contact": {"type": "object", "properties": {"sources": {"type": "string"}}, "required": ["sources"]}, "environment": {"type": "string"}, "entrypoints": {"type": "object", "properties": {"main": {"type": "array", "items": {"type": "string"}}, "libcd": {"type": "array", "items": {"type": "string"}}, "libcd:advancement_rewards": {"type": "array", "items": {"type": "string"}}}, "required": ["main", "libcd", "libcd:advancement_rewards"]}, "mixins": {"type": "array", "items": {"type": "string"}}, "accessWidener": {"type": "string"}, "depends": {"type": "object", "properties": {"fabricloader": {"type": "string"}}, "required": ["fabricloader"]}, "custom": {"type": "object", "properties": {"modmenu:api": {"type": "boolean"}}, "required": ["modmenu:api"]}}, "required": ["schemaVersion", "id", "version", "name", "icon", "description", "licence", "contact", "environment", "entrypoints", "mixins", "accessWidener", "depends", "custom"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"schemaVersion" : 1, "id" : "libcd", "version" : "2.5.0+1.16.1", "name" : "LibCapableData", "icon" : "assets/libcd/icon.png", "description" : "Various tweaks to make data packs even more useful!", "licence" : "MIT", "contact" : {"sources" : "https://github.com/CottonMC/LibCD"}, "environment" : "*", "entrypoints" : {"main" : ["io.github.cottonmc.libcd.LibCD"], "libcd" : ["io.github.cottonmc.libcd.CDContent"], "libcd:advancement_rewards" : ["io.github.cottonmc.libcd.DevAdvancementRewards"]}, "mixins" : ["mixins.libcd.json"], "accessWidener" : "libcd.accesswidener", "depends" : {"fabricloader" : ">=0.4.0"}, "custom" : {"modmenu:api" : true}} | json_instruct | {"type": "object", "properties": {"schemaVersion": {"type": "integer"}, "id": {"type": "string"}, "version": {"type": "string"}, "name": {"type": "string"}, "icon": {"type": "string"}, "description": {"type": "string"}, "licence": {"type": "string"}, "contact": {"type": "object", "properties": {"sources": {"type": "string"}}, "required": ["sources"]}, "environment": {"type": "string"}, "entrypoints": {"type": "object", "properties": {"main": {"type": "array", "items": {"type": "string"}}, "libcd": {"type": "array", "items": {"type": "string"}}, "libcd:advancement_rewards": {"type": "array", "items": {"type": "string"}}}, "required": ["main", "libcd", "libcd:advancement_rewards"]}, "mixins": {"type": "array", "items": {"type": "string"}}, "accessWidener": {"type": "string"}, "depends": {"type": "object", "properties": {"fabricloader": {"type": "string"}}, "required": ["fabricloader"]}, "custom": {"type": "object", "properties": {"modmenu:api": {"type": "boolean"}}, "required": ["modmenu:api"]}}, "required": ["schemaVersion", "id", "version", "name", "icon", "description", "licence", "contact", "environment", "entrypoints", "mixins", "accessWidener", "depends", "custom"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "3308130020", "district_id" : "3308130", "name" : "KRUMPAKAN"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"nom" : "Champ-Dolent", "circ" : "2\u00e8me circonscription", "dpt" : "Eure", "inscrits" : 70, "abs" : 31, "votants" : 39, "blancs" : 8, "nuls" : 2, "exp" : 29, "res" : [{"nuance" : "REM", "nom" : "M. Fabien GOUTTEFARDE", "voix" : 18}, {"nuance" : "FN", "nom" : "M. Emmanuel CAMOIN", "voix" : 11}]} | json_instruct | {"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"babel-core": {"type": "string"}, "babel-preset-env": {"type": "string"}, "browser-sync": {"type": "string"}, "del": {"type": "string"}, "gulp": {"type": "string"}, "gulp-autoprefixer": {"type": "string"}, "gulp-babel": {"type": "string"}, "gulp-beautify-code": {"type": "string"}, "gulp-clean-css": {"type": "string"}, "gulp-concat": {"type": "string"}, "gulp-csscomb": {"type": "string"}, "gulp-flatmap": {"type": "string"}, "gulp-if": {"type": "string"}, "gulp-order": {"type": "string"}, "gulp-pug": {"type": "string"}, "gulp-pugbem": {"type": "string"}, "gulp-remember": {"type": "string"}, "gulp-sass": {"type": "string"}, "gulp-svg-sprites": {"type": "string"}, "gulp-uglify": {"type": "string"}, "gulp-useref": {"type": "string"}, "merge2": {"type": "string"}, "multipipe": {"type": "string"}}, "required": ["babel-core", "babel-preset-env", "browser-sync", "del", "gulp", "gulp-autoprefixer", "gulp-babel", "gulp-beautify-code", "gulp-clean-css", "gulp-concat", "gulp-csscomb", "gulp-flatmap", "gulp-if", "gulp-order", "gulp-pug", "gulp-pugbem", "gulp-remember", "gulp-sass", "gulp-svg-sprites", "gulp-uglify", "gulp-useref", "merge2", "multipipe"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "project", "version" : "1.0.0", "description" : "", "main" : "gulpfile.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "keywords" : [], "author" : "", "license" : "ISC", "devDependencies" : {"babel-core" : "^6.26.3", "babel-preset-env" : "^1.7.0", "browser-sync" : "^2.24.5", "del" : "^3.0.0", "gulp" : "^4.0.0", "gulp-autoprefixer" : "^5.0.0", "gulp-babel" : "^7.0.1", "gulp-beautify-code" : "^2.0.3", "gulp-clean-css" : "^3.9.4", "gulp-concat" : "^2.6.1", "gulp-csscomb" : "^3.0.8", "gulp-flatmap" : "^1.0.2", "gulp-if" : "^2.0.2", "gulp-order" : "^1.1.1", "gulp-pug" : "^4.0.1", "gulp-pugbem" : "^2.1.3", "gulp-remember" : "^1.0.1", "gulp-sass" : "^4.0.1", "gulp-svg-sprites" : "^4.1.2", "gulp-uglify" : "^3.0.0", "gulp-useref" : "^3.1.5", "merge2" : "^1.2.2", "multipipe" : "^2.0.3"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"babel-core": {"type": "string"}, "babel-preset-env": {"type": "string"}, "browser-sync": {"type": "string"}, "del": {"type": "string"}, "gulp": {"type": "string"}, "gulp-autoprefixer": {"type": "string"}, "gulp-babel": {"type": "string"}, "gulp-beautify-code": {"type": "string"}, "gulp-clean-css": {"type": "string"}, "gulp-concat": {"type": "string"}, "gulp-csscomb": {"type": "string"}, "gulp-flatmap": {"type": "string"}, "gulp-if": {"type": "string"}, "gulp-order": {"type": "string"}, "gulp-pug": {"type": "string"}, "gulp-pugbem": {"type": "string"}, "gulp-remember": {"type": "string"}, "gulp-sass": {"type": "string"}, "gulp-svg-sprites": {"type": "string"}, "gulp-uglify": {"type": "string"}, "gulp-useref": {"type": "string"}, "merge2": {"type": "string"}, "multipipe": {"type": "string"}}, "required": ["babel-core", "babel-preset-env", "browser-sync", "del", "gulp", "gulp-autoprefixer", "gulp-babel", "gulp-beautify-code", "gulp-clean-css", "gulp-concat", "gulp-csscomb", "gulp-flatmap", "gulp-if", "gulp-order", "gulp-pug", "gulp-pugbem", "gulp-remember", "gulp-sass", "gulp-svg-sprites", "gulp-uglify", "gulp-useref", "merge2", "multipipe"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "main": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "copyright": {"type": "string"}, "authors": {"type": "string"}, "dependencies": {"type": "object", "properties": {"jquery": {"type": "string"}, "jquery-ui": {"type": "string"}}, "required": ["jquery", "jquery-ui"]}, "ignore": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "description", "homepage", "main", "license", "copyright", "authors", "dependencies", "ignore", "keywords"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "structured-filter", "version" : "2.0.5", "description" : "jQuery UI widget for structured queries", "homepage" : "https://evoluteur.github.io/structured-filter/", "main" : ["js/structured-filter.js", "less/structured-filter.less"], "license" : "MIT", "copyright" : "(c) 2022 Olivier Giulieri", "authors" : "Olivier Giulieri (https://evoluteur.github.io/)", "dependencies" : {"jquery" : "~3.6.0", "jquery-ui" : "^1.13.0"}, "ignore" : ["node_modules", "bower_components"], "keywords" : ["filter", "query", "builder", "editor", "search", "form", "ui", "input", "model", "metadata", "jquery", "jquery-ui"]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "main": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "copyright": {"type": "string"}, "authors": {"type": "string"}, "dependencies": {"type": "object", "properties": {"jquery": {"type": "string"}, "jquery-ui": {"type": "string"}}, "required": ["jquery", "jquery-ui"]}, "ignore": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "description", "homepage", "main", "license", "copyright", "authors", "dependencies", "ignore", "keywords"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"n_dim" : 13, "n_trials" : 340, "objective" : "deap_combo2_on_cube", "white" : "hyperopt_atpe", "black" : "ultraopt_forest", "traceback" : ["passing", "passing"], "best_val" : [6.348264659526, 5.86125628103954], "best_x" : [[0.4664447522327546, 0.6752595926730366, 0.2883251324571405, 0.6951471081388974, 0.5380278324373121, 0.7800534845623942, 0.5687331075648716, 0.5258860422690044, 0.6056702095200416, 0.6083302467944344, 0.5137092284294129, 0.5884817615986542, 0.42704194112118216], [0.19746921927344607, 0.44960848977430323, 0.4184024841393591, 0.5339997223810482, 0.5133520813701372, 0.5855452067596466, 0.8905292082708822, 0.4733431617890399, 0.43066290034836485, 0.5943659252150052, 0.6329549654741772, 0.6048236222179157, 0.764609005101744]], "feval_count" : [340, 340], "n_trials_instructed" : [340, 340], "passing" : [true, true], "completed" : true, "points" : 0.0, "winner" : "ultraopt_forest_cube", "loser" : "hyperopt_atpe_cube"} | json_instruct | {"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-contrib-jshint": {"type": "string"}, "grunt-contrib-csslint": {"type": "string"}, "grunt-contrib-watch": {"type": "string"}, "grunt-contrib-concat": {"type": "string"}, "chai": {"type": "string"}, "sinon": {"type": "string"}, "grunt-mocha": {"type": "string"}}, "required": ["grunt", "grunt-contrib-jshint", "grunt-contrib-csslint", "grunt-contrib-watch", "grunt-contrib-concat", "chai", "sinon", "grunt-mocha"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "conway-game-of-life-with-angular-js", "version" : "0.0.0", "description" : "Conway's Game of Life, with Angular", "main" : "app.js", "scripts" : {"test" : "grunt"}, "repository" : {"type" : "git", "url" : "git://github.com/Kazark/conway-game-of-life-with-angular-js.git"}, "author" : "Kazark", "license" : "Public Domain", "bugs" : {"url" : "https://github.com/Kazark/conway-game-of-life-with-angular-js/issues"}, "homepage" : "https://github.com/Kazark/conway-game-of-life-with-angular-js", "dependencies" : {}, "devDependencies" : {"grunt" : "~0.4.2", "grunt-contrib-jshint" : "~0.8.0", "grunt-contrib-csslint" : "~0.2.0", "grunt-contrib-watch" : "~0.5.3", "grunt-contrib-concat" : "~0.3.0", "chai" : "~1.9.1", "sinon" : "~1.9.0", "grunt-mocha" : "~0.4.10"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-contrib-jshint": {"type": "string"}, "grunt-contrib-csslint": {"type": "string"}, "grunt-contrib-watch": {"type": "string"}, "grunt-contrib-concat": {"type": "string"}, "chai": {"type": "string"}, "sinon": {"type": "string"}, "grunt-mocha": {"type": "string"}}, "required": ["grunt", "grunt-contrib-jshint", "grunt-contrib-csslint", "grunt-contrib-watch", "grunt-contrib-concat", "chai", "sinon", "grunt-mocha"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"userId" : 55096, "cartId" : "392e2ff5-44ff-4a30-9d35-921e2d4ab5ae", "preferredProducts" : [846, 4274, 1534, 3198, 387], "productReviews" : []} | json_instruct | {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"Smartisan SM801": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"Device_Name": {"type": "string"}, "Device_Code_Name": {"type": "string"}, "Device_Maker": {"type": "string"}, "Device_Pointing_Method": {"type": "string"}, "Device_Brand_Name": {"type": "string"}}, "required": ["Device_Name", "Device_Code_Name", "Device_Maker", "Device_Pointing_Method", "Device_Brand_Name"]}, "standard": {"type": "boolean"}}, "required": ["type", "properties", "standard"]}}, "required": ["Smartisan SM801"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"Smartisan SM801" : {"type" : "mobile-phone", "properties" : {"Device_Name" : "T2", "Device_Code_Name" : "SM801", "Device_Maker" : "Smartisan", "Device_Pointing_Method" : "touchscreen", "Device_Brand_Name" : "Smartisan"}, "standard" : false}} | json_instruct | {"type": "object", "properties": {"Smartisan SM801": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"Device_Name": {"type": "string"}, "Device_Code_Name": {"type": "string"}, "Device_Maker": {"type": "string"}, "Device_Pointing_Method": {"type": "string"}, "Device_Brand_Name": {"type": "string"}}, "required": ["Device_Name", "Device_Code_Name", "Device_Maker", "Device_Pointing_Method", "Device_Brand_Name"]}, "standard": {"type": "boolean"}}, "required": ["type", "properties", "standard"]}}, "required": ["Smartisan SM801"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"nom" : "Kienheim", "circ" : "4\u00e8me circonscription", "dpt" : "Bas-Rhin", "inscrits" : 490, "abs" : 229, "votants" : 261, "blancs" : 11, "nuls" : 6, "exp" : 244, "res" : [{"nuance" : "REM", "nom" : "Mme Martine WONNER", "voix" : 123}, {"nuance" : "LR", "nom" : "Mme Sophie ROHFRITSCH", "voix" : 121}]} | json_instruct | {"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "3505130001", "district_id" : "3505130", "name" : "SLOROK"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"just": {"type": "array", "items": {"type": "integer"}}, "javascript": {"type": "array", "items": {"type": "integer"}}, "july": {"type": "array", "items": {"type": "integer"}}}, "required": ["just", "javascript", "july"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"just" : [6029313], "javascript" : [9109505], "july" : [9109505]} | json_instruct | {"type": "object", "properties": {"just": {"type": "array", "items": {"type": "integer"}}, "javascript": {"type": "array", "items": {"type": "integer"}}, "july": {"type": "array", "items": {"type": "integer"}}}, "required": ["just", "javascript", "july"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "inputs": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}}, "required": ["name", "type"]}}, "outputs": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}}, "required": ["name", "type"]}}}, "required": ["name", "description", "inputs", "outputs"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Cut Values Below Limit", "description" : "Return only those values equal to or above the provided limit", "inputs" : [{"name" : "limit", "type" : "FLOAT"}, {"name" : "ts_or_frame", "type" : "ANY"}], "outputs" : [{"name" : "ts_or_frame", "type" : "ANY"}]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "inputs": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}}, "required": ["name", "type"]}}, "outputs": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}}, "required": ["name", "type"]}}}, "required": ["name", "description", "inputs", "outputs"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"expireTime": {"type": "integer"}, "key": {"type": "string"}, "val": {"type": "string"}}, "required": ["expireTime", "key", "val"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"expireTime" : 9007200872727670000, "key" : "/static/a92745e36c3f9efb8b054319c49a1cca/8ce52/overview_graph_0.png", "val" : "2e1d48ee779d9cddd47f61eeb8988027"} | json_instruct | {"type": "object", "properties": {"expireTime": {"type": "integer"}, "key": {"type": "string"}, "val": {"type": "string"}}, "required": ["expireTime", "key", "val"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"scenarioName": {"type": "string"}, "requiredScenarioState": {"type": "string"}, "request": {"type": "object", "properties": {"method": {"type": "string"}, "url": {"type": "string"}, "headers": {"type": "object", "properties": {"Accept": {"type": "object", "properties": {"equalTo": {"type": "string"}}, "required": ["equalTo"]}, "X-SDS-AUTH-TOKEN": {"type": "object", "properties": {"equalTo": {"type": "string"}}, "required": ["equalTo"]}}, "required": ["Accept", "X-SDS-AUTH-TOKEN"]}}, "required": ["method", "url", "headers"]}, "response": {"type": "object", "properties": {"status": {"type": "string"}, "headers": {"type": "object", "properties": {"Content-Type": {"type": "string"}}, "required": ["Content-Type"]}, "body": {"type": "string"}}, "required": ["status", "headers", "body"]}}, "required": ["scenarioName", "requiredScenarioState", "request", "response"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"scenarioName" : "ns1", "requiredScenarioState" : "Updated", "request" : {"method" : "GET", "url" : "/object/namespaces/namespace/ns1", "headers" : {"Accept" : {"equalTo" : "application/xml"}, "X-SDS-AUTH-TOKEN" : {"equalTo" : "BAAcY1U1UTNSRGRCUnViRXl1UDZDZDdhbWFuaGRZPQMAQQIADTE0NTAwNjU5ODc1MjMDAC51cm46VG9rZW46ODExN2ViY2YtYTliMi00NGExLTliYmUtNTM2ODQwMzk2Nzc1AgAC0A8"}}}, "response" : {"status" : "200", "headers" : {"Content-Type" : "application/xml"}, "body" : "<?xml version=\"1.0\" encoding=\"UTF-8\" standalone=\"yes\"?><namespace><id>ns1</id><inactive>false</inactive><link rel=\"self\" href=\"/object/namespaces/namespace/ns1\"/><name>ns1</name><default_bucket_block_size>-1</default_bucket_block_size><is_compliance_enabled>false</is_compliance_enabled><is_encryption_enabled>true</is_encryption_enabled><is_stale_allowed>false</is_stale_allowed><allowed_vpools_list>urn:storageos:ReplicationGroupInfo:7b6e12ad-3cea-4910-9887-f003d37ea1d4:global</allowed_vpools_list><namespace_admins>noadmin</namespace_admins><default_data_services_vpool>urn:storageos:ReplicationGroupInfo:7b6e12ad-3cea-4910-9887-f003d37ea1d4:global</default_data_services_vpool></namespace>"}} | json_instruct | {"type": "object", "properties": {"scenarioName": {"type": "string"}, "requiredScenarioState": {"type": "string"}, "request": {"type": "object", "properties": {"method": {"type": "string"}, "url": {"type": "string"}, "headers": {"type": "object", "properties": {"Accept": {"type": "object", "properties": {"equalTo": {"type": "string"}}, "required": ["equalTo"]}, "X-SDS-AUTH-TOKEN": {"type": "object", "properties": {"equalTo": {"type": "string"}}, "required": ["equalTo"]}}, "required": ["Accept", "X-SDS-AUTH-TOKEN"]}}, "required": ["method", "url", "headers"]}, "response": {"type": "object", "properties": {"status": {"type": "string"}, "headers": {"type": "object", "properties": {"Content-Type": {"type": "string"}}, "required": ["Content-Type"]}, "body": {"type": "string"}}, "required": ["status", "headers", "body"]}}, "required": ["scenarioName", "requiredScenarioState", "request", "response"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01010171": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01010171"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"type" : "Topology", "objects" : {"E01010171" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00051389", "LAD11CD" : "E08000029"}, "arcs" : [[0, 1, 2, 3, 4]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00051392", "LAD11CD" : "E08000029"}, "arcs" : [[5, 6, -1]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00051393", "LAD11CD" : "E08000029"}, "arcs" : [[-7, 7, -2]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00051400", "LAD11CD" : "E08000029"}, "arcs" : [[-4, 8]]}]}}, "arcs" : [[[3153, 9440], [180, -377], [-326, -583], [39, -243], [262, -520], [151, -57], [76, 180], [246, -159]], [[3781, 7681], [273, -553]], [[4054, 7128], [431, -417], [1018, -305], [1035, -707], [329, -26], [102, -33]], [[6969, 5640], [83, -140], [-380, -667], [183, -349], [-223, -711], [-1113, 669], [-1563, -2294]], [[3956, 2148], [-457, 112], [-2512, 1463], [-610, 542], [-246, 570], [-131, 846], [241, 918], [-73, 462], [1026, 543], [70, 916], [163, 360], [-303, 470], [1214, -927], [105, 239], [157, -116], [225, 462], [-108, 380], [242, -179], [194, 231]], [[3153, 9440], [284, 271], [1590, 288], [259, -140]], [[5286, 9859], [-68, -268], [-173, 134], [-253, -312], [-75, 244], [-456, -143], [-267, 141], [-317, -351], [328, -645], [-282, -375], [136, -126], [-78, -477]], [[5286, 9859], [199, -127], [73, -47], [-1073, -1623], [-431, -934]], [[6969, 5640], [432, -92], [243, 317], [176, -91], [300, 188], [91, 590], [-112, 146], [146, 237], [105, -117], [341, -225], [529, 18], [95, -990], [-595, -248], [1279, -2609], [-1093, -1044], [-891, -1720], [-480, 452], [-260, 2597], [-191, 436], [-878, -667], [-2043, -995], [-207, 325]]], "transform" : {"scale" : [3.399995220136331e-06, 1.477579646234699e-06], "translate" : [-1.674491440679902, 52.37608656471347]}} | json_instruct | {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01010171": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01010171"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Electravat\\Api\\": {"type": "string"}}, "required": ["Electravat\\Api\\"]}}, "required": ["psr-4"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}}, "required": ["phpunit/phpunit"]}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "homepage", "role"]}}}, "required": ["name", "description", "autoload", "require-dev", "license", "authors"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "electravat/api", "description" : "A PHP package for work with namirial sws", "autoload" : {"psr-4" : {"Electravat\\Api\\" : "src/"}}, "require-dev" : {"phpunit/phpunit" : "^7"}, "license" : "GPL-3.0-or-later", "authors" : [{"name" : "Aleksandr Ivanovitch", "email" : "alex@mwspace.com", "homepage" : "https://mwspace.com", "role" : "CTO"}]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Electravat\\Api\\": {"type": "string"}}, "required": ["Electravat\\Api\\"]}}, "required": ["psr-4"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}}, "required": ["phpunit/phpunit"]}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "homepage", "role"]}}}, "required": ["name", "description", "autoload", "require-dev", "license", "authors"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "nama": {"type": "string"}}, "required": ["id", "nama"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"id" : "1301040003", "nama" : "SIRILOGUI"}, {"id" : "1301040004", "nama" : "MUARA SIKABALUAN"}, {"id" : "1301040005", "nama" : "MONGAN POULA"}, {"id" : "1301040006", "nama" : "SOTBOYAK"}, {"id" : "1301040007", "nama" : "BOJAKAN"}, {"id" : "1301040009", "nama" : "MALANCAN"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "nama": {"type": "string"}}, "required": ["id", "nama"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Following the schema specification below, generate a valid JSON instance:
{"type": "object", "properties": {"201601": {"type": "object", "properties": {"c": {"type": "string"}, "n": {"type": "string"}, "f": {"type": "string"}, "cr": {"type": "number"}, "ac": {"type": "integer"}, "ca": {"type": "integer"}, "pr": {"type": "array", "items": {"type": "string"}}, "co": {"type": "array", "items": {"type": "string"}}, "i": {"type": "array", "items": {"type": "object", "properties": {"tn": {"type": "string"}, "ta": {"type": "integer"}, "tc": {"type": "integer"}}, "required": ["tn", "ta", "tc"]}}, "ce": {"type": "integer"}, "p": {"type": "integer"}}, "required": ["c", "n", "f", "cr", "ac", "ca", "pr", "co", "i", "ce", "p"]}, "catList": {"type": "array", "items": {"type": "string"}}}, "required": ["201601", "catList"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"201601" : {"c" : "LAT 540", "n" : "Intermediate Latin II", "f" : "SL", "cr" : 3.0, "ac" : 2, "ca" : 5, "pr" : ["LAT 140", "LAT 530", "LAT 530"], "co" : ["LAT 540D"], "i" : [{"tn" : "Furkan Akderin", "ta" : 2, "tc" : 5}], "ce" : 0, "p" : 439}, "catList" : ["In LAT 540 students strengthen their understanding of Latin grammar and syntax and their translation and composition abilities while reading a selection of major authors of prose and poetry."]} | json_instruct | {"type": "object", "properties": {"201601": {"type": "object", "properties": {"c": {"type": "string"}, "n": {"type": "string"}, "f": {"type": "string"}, "cr": {"type": "number"}, "ac": {"type": "integer"}, "ca": {"type": "integer"}, "pr": {"type": "array", "items": {"type": "string"}}, "co": {"type": "array", "items": {"type": "string"}}, "i": {"type": "array", "items": {"type": "object", "properties": {"tn": {"type": "string"}, "ta": {"type": "integer"}, "tc": {"type": "integer"}}, "required": ["tn", "ta", "tc"]}}, "ce": {"type": "integer"}, "p": {"type": "integer"}}, "required": ["c", "n", "f", "cr", "ac", "ca", "pr", "co", "i", "ce", "p"]}, "catList": {"type": "array", "items": {"type": "string"}}}, "required": ["201601", "catList"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create an example JSON object that satisfies this schema:
{"type": "object", "properties": {"author": {"type": "string"}, "config": {"type": "object", "properties": {"Cmd": {"type": "array", "items": {"type": "string"}}, "ArgsEscaped": {"type": "boolean"}}, "required": ["Cmd", "ArgsEscaped"]}, "created": {"type": "string"}, "history": {"type": "array", "items": {"type": "object", "properties": {"created": {"type": "string"}, "author": {"type": "string"}, "created_by": {"type": "string"}, "empty_layer": {"type": "boolean"}}, "required": ["created", "author", "created_by", "empty_layer"]}}, "os": {"type": "string"}, "rootfs": {"type": "object", "properties": {"type": {"type": "string"}, "diff_ids": {"type": "array", "items": {"type": "string"}}}, "required": ["type", "diff_ids"]}}, "required": ["author", "config", "created", "history", "os", "rootfs"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"author" : "Amazon Web Services, Inc.", "config" : {"Cmd" : ["/usr/bin/pause"], "ArgsEscaped" : true}, "created" : "2014-12-12T01:12:53.332832423Z", "history" : [{"created" : "2014-12-12T01:12:53.332832423Z", "author" : "Amazon Web Services, Inc.", "created_by" : "[] + [] === \"\"", "empty_layer" : true}], "os" : "linux", "rootfs" : {"type" : "layers", "diff_ids" : ["sha256:~~digest~~"]}} | json_instruct | {"type": "object", "properties": {"author": {"type": "string"}, "config": {"type": "object", "properties": {"Cmd": {"type": "array", "items": {"type": "string"}}, "ArgsEscaped": {"type": "boolean"}}, "required": ["Cmd", "ArgsEscaped"]}, "created": {"type": "string"}, "history": {"type": "array", "items": {"type": "object", "properties": {"created": {"type": "string"}, "author": {"type": "string"}, "created_by": {"type": "string"}, "empty_layer": {"type": "boolean"}}, "required": ["created", "author", "created_by", "empty_layer"]}}, "os": {"type": "string"}, "rootfs": {"type": "object", "properties": {"type": {"type": "string"}, "diff_ids": {"type": "array", "items": {"type": "string"}}}, "required": ["type", "diff_ids"]}}, "required": ["author", "config", "created", "history", "os", "rootfs"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"contacts": {"type": "array", "items": {}}, "guideStarURL": {"type": "string"}, "name": {"type": "string"}, "primaryEmail": {"type": "string"}, "website": {"type": "string"}, "telephone": {"type": "array", "items": {"type": "string"}}, "mainAddrress": {"type": "object", "properties": {"state": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}}, "required": ["state", "address"]}}, "required": ["contacts", "guideStarURL", "name", "primaryEmail", "website", "telephone", "mainAddrress"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"contacts" : [], "guideStarURL" : "http://www.guidestarindia.org/Summary.aspx?CCReg=3213", "name" : "Gangajal Nature Foundation Mumbai", "primaryEmail" : "admin@gangajal.org.in", "website" : "http://www.gangajal.org.in", "telephone" : ["912225775070", "912225775070"], "mainAddrress" : {"state" : "Maharashtra", "address" : ["96/2715 Shree Chs,", "Kannamwar Nagar-2, Vikhroli - East", "Mumbai", "Maharashtra", "400083"]}} | json_instruct | {"type": "object", "properties": {"contacts": {"type": "array", "items": {}}, "guideStarURL": {"type": "string"}, "name": {"type": "string"}, "primaryEmail": {"type": "string"}, "website": {"type": "string"}, "telephone": {"type": "array", "items": {"type": "string"}}, "mainAddrress": {"type": "object", "properties": {"state": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}}, "required": ["state", "address"]}}, "required": ["contacts", "guideStarURL", "name", "primaryEmail", "website", "telephone", "mainAddrress"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"brief" : "increase", "long" : "<i>Meaning:</i> to \"increase\".<br/><i>Usage:</i> grow, be multiplied.<br/><i>Source:</i> (Aramaic) corresponding to \"H7679\";"} | json_instruct | {"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"author": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "date": {"type": "object", "properties": {"day": {"type": "integer"}, "full": {"type": "integer"}, "month": {"type": "integer"}, "week": {"type": "integer"}}, "required": ["day", "full", "month", "week"]}, "id": {"type": "string"}, "picture": {"type": "object", "properties": {"filesize": {"type": "integer"}, "fullUrl": {"type": "string"}, "hash": {"type": "string"}, "height": {"type": "integer"}, "lqip": {"type": "string"}, "url": {"type": "string"}, "width": {"type": "integer"}}, "required": ["filesize", "fullUrl", "hash", "height", "lqip", "url", "width"]}, "score": {"type": "object", "properties": {"comments": {"type": "integer"}, "downs": {"type": "integer"}, "isCurated": {"type": "boolean"}, "ratio": {"type": "number"}, "ups": {"type": "integer"}, "value": {"type": "integer"}}, "required": ["comments", "downs", "isCurated", "ratio", "ups", "value"]}, "subreddit": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "tags": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["author", "date", "id", "picture", "score", "subreddit", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"author" : {"id" : "t2_pou0u", "name" : "Chaouleon"}, "date" : {"day" : 1638316800, "full" : 1638390145, "month" : 1638316800, "week" : 1638057600}, "id" : "t3_r6o60u", "picture" : {"filesize" : 101998, "fullUrl" : "https://preview.redd.it/kh5cjxqgpz281.jpg?width=2048&format=pjpg&auto=webp&s=23e1813c20842823a74b31e6843039ec9b524421", "hash" : "1da11fa01c", "height" : 569, "lqip" : "data:image/jpg;base64,/9j/2wBDAAYEBQYFBAYGBQYHBwYIChAKCgkJChQODwwQFxQYGBcUFhYaHSUfGhsjHBYWICwgIyYnKSopGR8tMC0oMCUoKSj/2wBDAQcHBwoIChMKChMoGhYaKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCj/wAARCAAOABADASIAAhEBAxEB/8QAFgABAQEAAAAAAAAAAAAAAAAABQMG/8QAIxAAAQQCAQMFAAAAAAAAAAAAAQIDBBEABSESMUETFCIjof/EABQBAQAAAAAAAAAAAAAAAAAAAAL/xAAYEQADAQEAAAAAAAAAAAAAAAAAASECEf/aAAwDAQACEQMRAD8AxM0rjIeXrWm/TIA6m2Ugk1YHyHmsPe2yy/FOwhNPOyGFISHySGVV2ocXZ/MUfjFUT30ZYqh9Sh0givNXzzko+kjuRxN2CnCqOhTiUskAAEAngjvhTzyjp//Z", "url" : "https://preview.redd.it/kh5cjxqgpz281.jpg?width=640&crop=smart&auto=webp&s=8cc37511d76b6591a3b21ba34cd1234cc65dbe0b", "width" : 640}, "score" : {"comments" : 5, "downs" : 0, "isCurated" : false, "ratio" : 0.96, "ups" : 68, "value" : 68}, "subreddit" : {"id" : "t5_3isai", "name" : "dndmaps"}, "tags" : ["Dungeon"], "title" : "Court of the Count (54x48) map of Castle Ravenloft", "url" : "https://www.reddit.com/r/dndmaps/comments/r6o60u/court_of_the_count_54x48_map_of_castle_ravenloft/"} | json_instruct | {"type": "object", "properties": {"author": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "date": {"type": "object", "properties": {"day": {"type": "integer"}, "full": {"type": "integer"}, "month": {"type": "integer"}, "week": {"type": "integer"}}, "required": ["day", "full", "month", "week"]}, "id": {"type": "string"}, "picture": {"type": "object", "properties": {"filesize": {"type": "integer"}, "fullUrl": {"type": "string"}, "hash": {"type": "string"}, "height": {"type": "integer"}, "lqip": {"type": "string"}, "url": {"type": "string"}, "width": {"type": "integer"}}, "required": ["filesize", "fullUrl", "hash", "height", "lqip", "url", "width"]}, "score": {"type": "object", "properties": {"comments": {"type": "integer"}, "downs": {"type": "integer"}, "isCurated": {"type": "boolean"}, "ratio": {"type": "number"}, "ups": {"type": "integer"}, "value": {"type": "integer"}}, "required": ["comments", "downs", "isCurated", "ratio", "ups", "value"]}, "subreddit": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "tags": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["author", "date", "id", "picture", "score", "subreddit", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [["341022106200", "\u6eaa\u53e3\u6751\u6751\u59d4\u4f1a", "121", "0"], ["341022106201", "\u548c\u6751\u6751\u59d4\u4f1a", "122", "0"], ["341022106202", "\u5c71\u57f9\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106205", "\u77f3\u7530\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106206", "\u7956\u6e90\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106207", "\u82b1\u6865\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106208", "\u4e2d\u548c\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106212", "\u6c5f\u6f6d\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106214", "\u957f\u4e30\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106215", "\u676d\u6eaa\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106216", "\u77f6\u6eaa\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106218", "\u51b0\u6f6d\u6751\u6751\u59d4\u4f1a", "220", "0"], ["341022106219", "\u789c\u6eaa\u6751\u6751\u59d4\u4f1a", "220", "0"]] | json_instruct | {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "object", "properties": {"review": {"type": "string"}, "date": {"type": "string"}, "rating": {"type": "string"}, "author": {"type": "string"}, "review_id": {"type": "string"}, "movie_id": {"type": "string"}}, "required": ["review", "date", "rating", "author", "review_id", "movie_id"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"review" : "`\uc774\uc0c1\ub300`\uc758 \uc77c\ub300\uae30..\uaca9\ud22c\uc52c \uc2a4\ud1a0\ub9ac \ubaa8\ub450\ubcfc\ub9cc\ud587\ub2e4!", "date" : "10.09.28", "rating" : "9", "author" : "zmfp****", "review_id" : "4874607", "movie_id" : "13354"}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"review": {"type": "string"}, "date": {"type": "string"}, "rating": {"type": "string"}, "author": {"type": "string"}, "review_id": {"type": "string"}, "movie_id": {"type": "string"}}, "required": ["review", "date", "rating", "author", "review_id", "movie_id"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"playerName": {"type": "string"}, "jumpKey": {"type": "integer"}, "leftKey": {"type": "integer"}, "rightKey": {"type": "integer"}, "attackKey": {"type": "integer"}, "stocks": {"type": "integer"}, "groundAccelerationFactor": {"type": "number"}, "groundAcceleration": {"type": "number"}, "airAccelerationFactor": {"type": "number"}, "airAcceleration": {"type": "number"}, "maxGroundSpeed": {"type": "number"}, "maxAirSpeed": {"type": "number"}, "totalJumpForce": {"type": "number"}, "jumpRatio": {"type": "number"}, "groundJumpForce": {"type": "number"}, "airJumpForce": {"type": "number"}, "mass": {"type": "number"}, "drag": {"type": "number"}, "widthScalar": {"type": "number"}, "heightScalar": {"type": "number"}, "gravityScalar": {"type": "number"}, "hitstunDamageScalar": {"type": "number"}, "spriteIndex": {"type": "integer"}}, "required": ["playerName", "jumpKey", "leftKey", "rightKey", "attackKey", "stocks", "groundAccelerationFactor", "groundAcceleration", "airAccelerationFactor", "airAcceleration", "maxGroundSpeed", "maxAirSpeed", "totalJumpForce", "jumpRatio", "groundJumpForce", "airJumpForce", "mass", "drag", "widthScalar", "heightScalar", "gravityScalar", "hitstunDamageScalar", "spriteIndex"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"playerName" : "Player 2", "jumpKey" : 0, "leftKey" : 0, "rightKey" : 0, "attackKey" : 0, "stocks" : 3, "groundAccelerationFactor" : 0.7452902793884277, "groundAcceleration" : 3.324791431427002, "airAccelerationFactor" : 0.3101734220981598, "airAcceleration" : 2.865236282348633, "maxGroundSpeed" : 4.461069107055664, "maxAirSpeed" : 9.237529754638672, "totalJumpForce" : 16.461103439331055, "jumpRatio" : 0.3895268440246582, "groundJumpForce" : 6.412041664123535, "airJumpForce" : 10.04906177520752, "mass" : 0.7710001468658447, "drag" : 1.275026798248291, "widthScalar" : 0.9927395582199097, "heightScalar" : 0.8664952516555786, "gravityScalar" : 1.1657747030258179, "hitstunDamageScalar" : 0.18621277809143066, "spriteIndex" : 40} | json_instruct | {"type": "object", "properties": {"playerName": {"type": "string"}, "jumpKey": {"type": "integer"}, "leftKey": {"type": "integer"}, "rightKey": {"type": "integer"}, "attackKey": {"type": "integer"}, "stocks": {"type": "integer"}, "groundAccelerationFactor": {"type": "number"}, "groundAcceleration": {"type": "number"}, "airAccelerationFactor": {"type": "number"}, "airAcceleration": {"type": "number"}, "maxGroundSpeed": {"type": "number"}, "maxAirSpeed": {"type": "number"}, "totalJumpForce": {"type": "number"}, "jumpRatio": {"type": "number"}, "groundJumpForce": {"type": "number"}, "airJumpForce": {"type": "number"}, "mass": {"type": "number"}, "drag": {"type": "number"}, "widthScalar": {"type": "number"}, "heightScalar": {"type": "number"}, "gravityScalar": {"type": "number"}, "hitstunDamageScalar": {"type": "number"}, "spriteIndex": {"type": "integer"}}, "required": ["playerName", "jumpKey", "leftKey", "rightKey", "attackKey", "stocks", "groundAccelerationFactor", "groundAcceleration", "airAccelerationFactor", "airAcceleration", "maxGroundSpeed", "maxAirSpeed", "totalJumpForce", "jumpRatio", "groundJumpForce", "airJumpForce", "mass", "drag", "widthScalar", "heightScalar", "gravityScalar", "hitstunDamageScalar", "spriteIndex"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "dharmaVerificationStatus": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "dharmaVerificationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "Coconut Finance", "symbol" : "COCO", "address" : "0x6e42303a38191a1C86292eC5CDDa169F6f720dD9", "decimals" : 18, "dharmaVerificationStatus" : "UNVERIFIED"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "dharmaVerificationStatus": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "dharmaVerificationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"algo": {"type": "array", "items": {"type": "string"}}}, "required": ["algo"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"algo" : ["GI"]} | json_instruct | {"type": "object", "properties": {"algo": {"type": "array", "items": {"type": "string"}}}, "required": ["algo"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "scripts": {"type": "object", "properties": {"generate-mongoid": {"type": "string"}}, "required": ["generate-mongoid"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {"model-info-parser": {"type": "string"}}, "required": ["model-info-parser"]}, "contributors": {"type": "array", "items": {"type": "string"}}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "repository", "scripts", "keywords", "author", "license", "dependencies", "devDependencies", "contributors", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "fhir-mongoid-models", "version" : "0.0.4", "description" : "This is a library containing Ruby Mongoid models that conform to the FHIR specification. Its code is generated using the model-info-parser utility", "repository" : {"type" : "git", "url" : "git+ssh://git@github.com/MeasureAuthoringTool/fhir-mongoid-models.git"}, "scripts" : {"generate-mongoid" : "rm -rf app/models/fhir; npx generateMongoidTypes -o $PWD/app/models"}, "keywords" : [], "author" : "SemanticBits sb-mat-help@semanticbits.com", "license" : "CC0-1.0", "dependencies" : {}, "devDependencies" : {"model-info-parser" : "^1.0.7"}, "contributors" : ["Andrew Bird <andrew.bird@semanticbits.com>", "Ashok Dongare <ashok.dongare@semanticbits.com>", "Joseph Kotanchik <joseph.kotanchik@semanticbits.com>", "Rohit Kandimalla <rohit.kandimalla@semanticbits.com>", "Serhii Ilin <serhii.ilin@semanticbits.com>"], "bugs" : {"url" : "https://github.com/MeasureAuthoringTool/fhir-mongoid-models/issues"}, "homepage" : "https://github.com/MeasureAuthoringTool/fhir-mongoid-models#readme"} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "scripts": {"type": "object", "properties": {"generate-mongoid": {"type": "string"}}, "required": ["generate-mongoid"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {"model-info-parser": {"type": "string"}}, "required": ["model-info-parser"]}, "contributors": {"type": "array", "items": {"type": "string"}}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "description", "repository", "scripts", "keywords", "author", "license", "dependencies", "devDependencies", "contributors", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "null"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"_id" : "u18u4hx2", "accession" : "NC_003775", "definition" : "Red clover necrotic mosaic virus RNA 2, complete sequence", "host" : null, "sequence" : "GAAACCTCGCTCTATAAACAGATTAATTGATTGGAAGAAAACAAGATCGTAAGACTACCAACAATACAAAGAGGTTTGGATGGCTGTTCATGTGGAAAATTTAAGTGATTTGGCAAAGACAAATGATGGAGTAGCAGTATCATTGAACCGTTATACTGATTGGAAATGCAGGTCTGGAGTTTCTGAAGCTCCTCTTATACCTGCCAGTATGATGAGTAAGATCACTGACTACGCTAAAACTACTGCTAAAGGAAACAGTGTTGCGCTTAATTACACCCACGTAGTTCTTTCGCTAGCACCGACAATTGGTGTGGCAATTCCAGGACACGTCACCGTAGAATTGATAAATCCAAACGTGGAAGGACCGTTTCAAGTTATGTCAGGTCAGACCTTGTCGTGGTCGCCAGGAGCTGGAAAGCCCTGCCTGATGATATTCTCAGTCCACCACCAACTCAACTCGGATCACGAGCCTTTTAGGGTGCGAATCACGAATACCGGAATCCCAACGAAGAAATCGTATGCAAGATGCCATGCGTATTGGGGGTTTGACGTGGGAACTCGACACCGCTATTACAAGTCAGAACCAGCGCGTCTGATTGAGTTGGAAGTAGGTTATCAGCGGACGTTACTGTCGAGCATCAAGGCAGTGGAAGCCTACGTGCAGTTTACCTTTGACACAAGCAGGATGGAGAAGAATCCTCAACTGTGCACCAAATCCAATGTGAACATCATCCCTCCCAAAGCAGAGACAGGTTCAATCAGAGGTATCGCCCCGCCTCTCAGTGTTGTACCAAACCAAGGACGAGAGTCCAAGGTGTTGAAACAGAAAGGAGGAACTGGCAGCAAAACCACGAAGCTGCCTTCGTTGGAACCTTCTTCCGGTTCCAGTTCCGGCTTGAGTATGAGCCGAAGATCTCACAGAAATGTTCTGAACTCATCTATTCCGATTAAACGTAACCAAGATGGCAATTGGTTAGGTGACCACCTATCTGACAAGGGCCGGGTTACCGACCCAAATCCGGAAAGACTCTAGACGAGCCGGGGAAGTCAGATGCCTGGCCACTGAAAAAGTGGAATCTCATCCAGAGTACAAAAGAGAAAGAGAATTGCTTTGGCTTCGGCGGAAGACGAAAAGGTTTAAATACAGGCTACGAGTTCTCCTCGTAGGGTCTCTCTTTCTTGGCCTTTAGTGGGCTTTGGTTTAGGTTCCATTTCTACAGCGTATGGACCATGGATGTTCTTCAGCCTATCGTAGTGTGTGCGATAGCATTGCGTTAGGGGTTACTTTCGAGAGATTTGGAGGGGTTGGTCCCTCCGGTGAGAGAAGAAAACTCATCCCAAACAAAAAACAGGGTTTCTGATAACCGGTGCGACAATATGCCCTTCCAAGGCACTGACCGGCACGGAGAAAAACTATAATGCCATGTCGTATAACGGCTAGGCACCCC"} | json_instruct | {"type": "object", "properties": {"_id": {"type": "string"}, "accession": {"type": "string"}, "definition": {"type": "string"}, "host": {"type": "null"}, "sequence": {"type": "string"}}, "required": ["_id", "accession", "definition", "host", "sequence"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"tips": {"type": "array", "items": {"type": "string"}}}, "required": ["tips"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"tips" : ["Insert tips here", "They can help users to get to know some aspects of your bot"]} | json_instruct | {"type": "object", "properties": {"tips": {"type": "array", "items": {"type": "string"}}}, "required": ["tips"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "homepage", "role"]}}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Omnipay\\AfterPay\\": {"type": "string"}}, "required": ["Omnipay\\AfterPay\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Omnipay\\AfterPay\\Test\\": {"type": "string"}}, "required": ["Omnipay\\AfterPay\\Test\\"]}}, "required": ["psr-4"]}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "omnipay/common": {"type": "string"}}, "required": ["php", "omnipay/common"]}, "require-dev": {"type": "object", "properties": {"omnipay/tests": {"type": "string"}, "phpunit/phpunit": {"type": "string"}, "mockery/mockery": {"type": "string"}, "scrutinizer/ocular": {"type": "string"}}, "required": ["omnipay/tests", "phpunit/phpunit", "mockery/mockery", "scrutinizer/ocular"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "extra": {"type": "object", "properties": {"branch-alias": {"type": "object", "properties": {"dev-master": {"type": "string"}}, "required": ["dev-master"]}}, "required": ["branch-alias"]}}, "required": ["name", "description", "keywords", "homepage", "license", "authors", "autoload", "autoload-dev", "require", "require-dev", "scripts", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "warblemedia/omnipay-afterpay", "description" : "AfterPay gateway for Omnipay payment processing library", "keywords" : ["omnipay", "afterpay", "gateway", "merchant"], "homepage" : "https://github.com/warblemedia/omnipay-afterpay", "license" : "MIT", "authors" : [{"name" : "Jeremy Worboys", "email" : "jw@warblemedia.com.au", "homepage" : "https://warblemedia.com.au", "role" : "Developer"}], "autoload" : {"psr-4" : {"Omnipay\\AfterPay\\" : "src"}}, "autoload-dev" : {"psr-4" : {"Omnipay\\AfterPay\\Test\\" : "tests"}}, "require" : {"php" : ">=5.3.0", "omnipay/common" : "~2.2.0"}, "require-dev" : {"omnipay/tests" : "~2.0", "phpunit/phpunit" : "~3.7.0", "mockery/mockery" : "^0.9.5", "scrutinizer/ocular" : "~1.1"}, "scripts" : {"test" : "phpunit"}, "extra" : {"branch-alias" : {"dev-master" : "1.0-dev"}}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "license": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}, "role": {"type": "string"}}, "required": ["name", "email", "homepage", "role"]}}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Omnipay\\AfterPay\\": {"type": "string"}}, "required": ["Omnipay\\AfterPay\\"]}}, "required": ["psr-4"]}, "autoload-dev": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Omnipay\\AfterPay\\Test\\": {"type": "string"}}, "required": ["Omnipay\\AfterPay\\Test\\"]}}, "required": ["psr-4"]}, "require": {"type": "object", "properties": {"php": {"type": "string"}, "omnipay/common": {"type": "string"}}, "required": ["php", "omnipay/common"]}, "require-dev": {"type": "object", "properties": {"omnipay/tests": {"type": "string"}, "phpunit/phpunit": {"type": "string"}, "mockery/mockery": {"type": "string"}, "scrutinizer/ocular": {"type": "string"}}, "required": ["omnipay/tests", "phpunit/phpunit", "mockery/mockery", "scrutinizer/ocular"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "extra": {"type": "object", "properties": {"branch-alias": {"type": "object", "properties": {"dev-master": {"type": "string"}}, "required": ["dev-master"]}}, "required": ["branch-alias"]}}, "required": ["name", "description", "keywords", "homepage", "license", "authors", "autoload", "autoload-dev", "require", "require-dev", "scripts", "extra"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"MRRm_new": {"type": "number"}, "MRm_new": {"type": "number"}, "HITS@1m_new": {"type": "number"}, "HITS@3m_new": {"type": "number"}, "HITS@10m_new": {"type": "number"}}, "required": ["MRRm_new", "MRm_new", "HITS@1m_new", "HITS@3m_new", "HITS@10m_new"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"MRRm_new" : 0.19295037349482155, "MRm_new" : 314.29239526855946, "HITS@1m_new" : 0.12057616365991998, "HITS@3m_new" : 0.20187638217834755, "HITS@10m_new" : 0.3322826230779174} | json_instruct | {"type": "object", "properties": {"MRRm_new": {"type": "number"}, "MRm_new": {"type": "number"}, "HITS@1m_new": {"type": "number"}, "HITS@3m_new": {"type": "number"}, "HITS@10m_new": {"type": "number"}}, "required": ["MRRm_new", "MRm_new", "HITS@1m_new", "HITS@3m_new", "HITS@10m_new"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate sample JSON data that conforms to the following schema definition:
{"type": "object", "properties": {"parent": {"type": "string"}, "textures": {"type": "object", "properties": {"top": {"type": "string"}, "bottom": {"type": "string"}, "side": {"type": "string"}}, "required": ["top", "bottom", "side"]}}, "required": ["parent", "textures"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"parent" : "minecraft:block/cube_bottom_top", "textures" : {"top" : "nukes:block/t3_top", "bottom" : "nukes:block/t3_bottom", "side" : "nukes:block/t3_side"}} | json_instruct | {"type": "object", "properties": {"parent": {"type": "string"}, "textures": {"type": "object", "properties": {"top": {"type": "string"}, "bottom": {"type": "string"}, "side": {"type": "string"}}, "required": ["top", "bottom", "side"]}}, "required": ["parent", "textures"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {"type": "object", "properties": {"errors": {"type": "array", "items": {}}, "file": {"type": "string"}, "name": {"type": "string"}}, "required": ["errors", "file", "name"]}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"contract" : "0x129e27ff40db79b7a395d123413a815e38832e74", "tool" : "osiris", "start" : 1564635906.1163354, "end" : 1564635911.1620789, "duration" : 5.045743465423584, "analysis" : [{"errors" : [], "file" : "/unique_chucks/47/0x129e27ff40db79b7a395d123413a815e38832e74.sol", "name" : "Owned"}, {"errors" : [{"line" : 120, "column" : 27, "message" : "reentrancy_bug"}], "file" : "/unique_chucks/47/0x129e27ff40db79b7a395d123413a815e38832e74.sol", "name" : "Proxy"}, {"errors" : [], "file" : "/unique_chucks/47/0x129e27ff40db79b7a395d123413a815e38832e74.sol", "name" : "Proxyable"}]} | json_instruct | {"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {"type": "object", "properties": {"errors": {"type": "array", "items": {}}, "file": {"type": "string"}, "name": {"type": "string"}}, "required": ["errors", "file", "name"]}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Create a JSON structure that matches this schema definition:
{"type": "object", "properties": {"auroc": {"type": "array", "items": {"type": "number"}}, "acc": {"type": "array", "items": {"type": "number"}}, "aps": {"type": "array", "items": {"type": "number"}}, "f1": {"type": "array", "items": {"type": "number"}}, "auprc": {"type": "array", "items": {"type": "number"}}}, "required": ["auroc", "acc", "aps", "f1", "auprc"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"auroc" : [0.5137592137592139, 0.4818181818181818, 0.47837837837837843, 0.5044226044226044, 0.47125307125307125], "acc" : [0.5978260869565217, 0.5978260869565217, 0.5978260869565217, 0.5978260869565217, 0.40217391304347827], "aps" : [0.4089039632517894, 0.40217391304347827, 0.3915491578535057, 0.4163521456999718, 0.3905966242922765], "f1" : [0.0, 0.0, 0.0, 0.0, 0.5736434108527132], "auprc" : [0.6964667236406368, 0.20108695652173914, 0.4609772816294555, 0.35182802900194204, 0.36375654310436917]} | json_instruct | {"type": "object", "properties": {"auroc": {"type": "array", "items": {"type": "number"}}, "acc": {"type": "array", "items": {"type": "number"}}, "aps": {"type": "array", "items": {"type": "number"}}, "f1": {"type": "array", "items": {"type": "number"}}, "auprc": {"type": "array", "items": {"type": "number"}}}, "required": ["auroc", "acc", "aps", "f1", "auprc"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"version": {"type": "number"}, "people": {"type": "array", "items": {"type": "object", "properties": {"pose_keypoints_2d": {"type": "array", "items": {"type": "number"}}, "face_keypoints_2d": {"type": "array", "items": {}}, "hand_left_keypoints_2d": {"type": "array", "items": {}}, "hand_right_keypoints_2d": {"type": "array", "items": {}}, "pose_keypoints_3d": {"type": "array", "items": {}}, "face_keypoints_3d": {"type": "array", "items": {}}, "hand_left_keypoints_3d": {"type": "array", "items": {}}, "hand_right_keypoints_3d": {"type": "array", "items": {}}}, "required": ["pose_keypoints_2d", "face_keypoints_2d", "hand_left_keypoints_2d", "hand_right_keypoints_2d", "pose_keypoints_3d", "face_keypoints_3d", "hand_left_keypoints_3d", "hand_right_keypoints_3d"]}}}, "required": ["version", "people"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"version" : 1.2, "people" : [{"pose_keypoints_2d" : [311.618, 131.123, 1, 311.228, 154.813, 1, 293.965, 156.303, 1, 292.872, 186.429, 1, 303.187, 189.6, 1, 332.53, 154.334, 1, 355.697, 177.315, 1, 340.82, 190.496, 1, 308.641, 211.48, 1, 288.558, 260.152, 1, 302.447, 299.953, 1, 335.782, 211.241, 1, 328.345, 252.519, 1, 325.495, 302.81, 1, 303.938, 127.295, 1, 314.103, 125.924, 1, 293.696, 134.012, 1, 323.434, 130.917, 1], "face_keypoints_2d" : [], "hand_left_keypoints_2d" : [], "hand_right_keypoints_2d" : [], "pose_keypoints_3d" : [], "face_keypoints_3d" : [], "hand_left_keypoints_3d" : [], "hand_right_keypoints_3d" : []}]} | json_instruct | {"type": "object", "properties": {"version": {"type": "number"}, "people": {"type": "array", "items": {"type": "object", "properties": {"pose_keypoints_2d": {"type": "array", "items": {"type": "number"}}, "face_keypoints_2d": {"type": "array", "items": {}}, "hand_left_keypoints_2d": {"type": "array", "items": {}}, "hand_right_keypoints_2d": {"type": "array", "items": {}}, "pose_keypoints_3d": {"type": "array", "items": {}}, "face_keypoints_3d": {"type": "array", "items": {}}, "hand_left_keypoints_3d": {"type": "array", "items": {}}, "hand_right_keypoints_3d": {"type": "array", "items": {}}}, "required": ["pose_keypoints_2d", "face_keypoints_2d", "hand_left_keypoints_2d", "hand_right_keypoints_2d", "pose_keypoints_3d", "face_keypoints_3d", "hand_left_keypoints_3d", "hand_right_keypoints_3d"]}}}, "required": ["version", "people"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"elasticsearch": {"type": "string"}, "http-aws-es": {"type": "string"}, "leo-connector-common": {"type": "string"}}, "required": ["elasticsearch", "http-aws-es", "leo-connector-common"]}, "peerDependencies": {"type": "object", "properties": {"aws-sdk": {"type": "string"}}, "required": ["aws-sdk"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies", "peerDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "leo-connector-elasticsearch", "version" : "2.0.3", "description" : "", "main" : "index.js", "scripts" : {"test" : "mocha --recursive -w"}, "author" : "", "license" : "MIT", "dependencies" : {"elasticsearch" : "16.5.0", "http-aws-es" : "6.0.0", "leo-connector-common" : "4.0.6"}, "peerDependencies" : {"aws-sdk" : "^2.581.0"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"elasticsearch": {"type": "string"}, "http-aws-es": {"type": "string"}, "leo-connector-common": {"type": "string"}}, "required": ["elasticsearch", "http-aws-es", "leo-connector-common"]}, "peerDependencies": {"type": "object", "properties": {"aws-sdk": {"type": "string"}}, "required": ["aws-sdk"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "dependencies", "peerDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"derivation": {"type": "string"}, "pron": {"type": "string"}, "outline": {"type": "string"}, "kjv_def": {"type": "string"}, "lemma": {"type": "string"}, "frequency": {"type": "integer"}, "strongs_def": {"type": "string"}, "xlit": {"type": "string"}}, "required": ["derivation", "pron", "outline", "kjv_def", "lemma", "frequency", "strongs_def", "xlit"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"derivation" : "from H5753 (\u05e2\u05b8\u05d5\u05b8\u05d4); (compare H5856 (\u05e2\u05b4\u05d9))", "pron" : "meh-ee'", "outline" : "<ol><li> ruin, heap</li></ol>", "kjv_def" : "heap.", "lemma" : "\u05de\u05b0\u05e2\u05b4\u05d9", "frequency" : 1, "strongs_def" : "a pile of rubbish (as contorted), i.e. a ruin", "xlit" : "m\u1d49\u02bb\u00eey"} | json_instruct | {"type": "object", "properties": {"derivation": {"type": "string"}, "pron": {"type": "string"}, "outline": {"type": "string"}, "kjv_def": {"type": "string"}, "lemma": {"type": "string"}, "frequency": {"type": "integer"}, "strongs_def": {"type": "string"}, "xlit": {"type": "string"}}, "required": ["derivation", "pron", "outline", "kjv_def", "lemma", "frequency", "strongs_def", "xlit"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"label": {"type": "string"}, "sequences": {"type": "array", "items": {"type": "object", "properties": {"viewingDirection": {"type": "string"}, "canvases": {"type": "array", "items": {"type": "object", "properties": {"thumbnail": {"type": "string"}, "height": {"type": "integer"}, "width": {"type": "integer"}, "images": {"type": "array", "items": {"type": "object", "properties": {"resource": {"type": "object", "properties": {"format": {"type": "string"}, "height": {"type": "integer"}, "width": {"type": "integer"}, "@id": {"type": "string"}, "@type": {"type": "string"}}, "required": ["format", "height", "width", "@id", "@type"]}, "on": {"type": "string"}, "motivation": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}}, "required": ["resource", "on", "motivation", "@id", "@type"]}}, "label": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}}, "required": ["thumbnail", "height", "width", "images", "label", "@id", "@type"]}}, "@id": {"type": "string"}, "@type": {"type": "string"}, "label": {"type": "string"}}, "required": ["viewingDirection", "canvases", "@id", "@type", "label"]}}, "@context": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}, "seeAlso": {"type": "object", "properties": {"@id": {"type": "string"}, "format": {"type": "string"}}, "required": ["@id", "format"]}}, "required": ["label", "sequences", "@context", "@id", "@type", "seeAlso"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"label" : "Grand Canyon from Point West of Yavapai Point", "sequences" : [{"viewingDirection" : "left-to-right", "canvases" : [{"thumbnail" : "https://american-art.github.io/iiif/thumbnails/gm/TU2009.39.7650.84_o6.jpg", "height" : 1500, "width" : 1926, "images" : [{"resource" : {"format" : "image/jpeg", "height" : 750, "width" : 963, "@id" : "https://gm-piction-live.s3.amazonaws.com/styles/primary_asset/s3/assets/TU2009.39.7650.84_o6.jpg", "@type" : "dctypes:Image"}, "on" : "https:/gm-piction-live.s3.amazonaws.com/styles/primary_asset/s3/assets/canvas/TU2009.39.7650.84_o6.jpg", "motivation" : "sc:painting", "@id" : "https:/gm-piction-live.s3.amazonaws.com/styles/primary_asset/s3/assets/annotation/TU2009.39.7650.84_o6.jpg", "@type" : "oa:Annotation"}], "label" : "Grand Canyon from Point West of Yavapai Point", "@id" : "https:/gm-piction-live.s3.amazonaws.com/styles/primary_asset/s3/assets/canvas/TU2009.39.7650.84_o6.jpg", "@type" : "sc:Canvas"}], "@id" : "https://american-art.github.io/iiif/sequence/FBTI4D7eyVQiFGeV/0", "@type" : "sc:Sequence", "label" : "Sequence 1"}], "@context" : "http://iiif.io/api/presentation/2/context.json", "@id" : "https://american-art.github.io/iiif/manifest/gm/TU2009.39.7650.84_o6.json", "@type" : "sc:Manifest", "seeAlso" : {"@id" : "http://data.americanartcollaborative.org/GM/object/47594", "format" : "text/rdf"}} | json_instruct | {"type": "object", "properties": {"label": {"type": "string"}, "sequences": {"type": "array", "items": {"type": "object", "properties": {"viewingDirection": {"type": "string"}, "canvases": {"type": "array", "items": {"type": "object", "properties": {"thumbnail": {"type": "string"}, "height": {"type": "integer"}, "width": {"type": "integer"}, "images": {"type": "array", "items": {"type": "object", "properties": {"resource": {"type": "object", "properties": {"format": {"type": "string"}, "height": {"type": "integer"}, "width": {"type": "integer"}, "@id": {"type": "string"}, "@type": {"type": "string"}}, "required": ["format", "height", "width", "@id", "@type"]}, "on": {"type": "string"}, "motivation": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}}, "required": ["resource", "on", "motivation", "@id", "@type"]}}, "label": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}}, "required": ["thumbnail", "height", "width", "images", "label", "@id", "@type"]}}, "@id": {"type": "string"}, "@type": {"type": "string"}, "label": {"type": "string"}}, "required": ["viewingDirection", "canvases", "@id", "@type", "label"]}}, "@context": {"type": "string"}, "@id": {"type": "string"}, "@type": {"type": "string"}, "seeAlso": {"type": "object", "properties": {"@id": {"type": "string"}, "format": {"type": "string"}}, "required": ["@id", "format"]}}, "required": ["label", "sequences", "@context", "@id", "@type", "seeAlso"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Construct a JSON document that adheres to this schema specification:
{"type": "object", "properties": {"description": {"type": "string"}, "steps": {"type": "array", "items": {"type": "object", "properties": {"actionKey": {"type": "string"}, "title": {"type": "string"}, "goto": {"type": "string"}}, "required": ["actionKey", "title", "goto"]}}}, "required": ["description", "steps"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"description" : "An indigenous guard stands of the road to the mountain. He looks very surprised to see yme, probably because noone ever comes in the part of the island, maybe because I'm whiter than his feather crown.\n\nHe points towards the direction where I saw smoke earlier.", "steps" : [{"actionKey" : "smoke", "title" : "I go towards the smoke.", "goto" : "road"}, {"actionKey" : "avoid", "title" : "Try to go around the guard", "goto" : "fight"}]} | json_instruct | {"type": "object", "properties": {"description": {"type": "string"}, "steps": {"type": "array", "items": {"type": "object", "properties": {"actionKey": {"type": "string"}, "title": {"type": "string"}, "goto": {"type": "string"}}, "required": ["actionKey", "title", "goto"]}}}, "required": ["description", "steps"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "main": {"type": "string"}, "bin": {"type": "object", "properties": {"touchstone": {"type": "string"}}, "required": ["touchstone"]}, "devDependencies": {"type": "object", "properties": {"tap": {"type": "string"}}, "required": ["tap"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "dependencies": {"type": "object", "properties": {"commander": {"type": "string"}, "qunitjs": {"type": "string"}, "tap-test-converter": {"type": "string"}, "combined-stream": {"type": "string"}, "through": {"type": "string"}}, "required": ["commander", "qunitjs", "tap-test-converter", "combined-stream", "through"]}}, "required": ["name", "version", "description", "author", "main", "bin", "devDependencies", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "touchstone", "version" : "0.0.4", "description" : "Touchstone is a nodejs server and javascript client for collecting test results from browsers in virtualized environments.", "author" : "Lee Treveil", "main" : "lib/trecv.js", "bin" : {"touchstone" : "bin/cli.js"}, "devDependencies" : {"tap" : "~0.3.3"}, "scripts" : {"test" : "node test/test-server.js"}, "dependencies" : {"commander" : "~1.1.1", "qunitjs" : "~1.11.0", "tap-test-converter" : "0.0.0", "combined-stream" : "0.0.4", "through" : "~2.3.4"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "main": {"type": "string"}, "bin": {"type": "object", "properties": {"touchstone": {"type": "string"}}, "required": ["touchstone"]}, "devDependencies": {"type": "object", "properties": {"tap": {"type": "string"}}, "required": ["tap"]}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "dependencies": {"type": "object", "properties": {"commander": {"type": "string"}, "qunitjs": {"type": "string"}, "tap-test-converter": {"type": "string"}, "combined-stream": {"type": "string"}, "through": {"type": "string"}}, "required": ["commander", "qunitjs", "tap-test-converter", "combined-stream", "through"]}}, "required": ["name", "version", "description", "author", "main", "bin", "devDependencies", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Please provide a valid JSON object following this schema:
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "dependencies": {"type": "object", "properties": {"bootstrap": {"type": "string"}, "angular": {"type": "string"}, "angular-resource": {"type": "string"}, "angular-mocks": {"type": "string"}, "angular-cookies": {"type": "string"}, "angular-animate": {"type": "string"}, "angular-touch": {"type": "string"}, "angular-sanitize": {"type": "string"}, "angular-bootstrap": {"type": "string"}, "angular-ui-utils": {"type": "string"}, "angular-ui-router": {"type": "string"}, "angular-chart.js": {"type": "string"}, "moment": {"type": "string"}}, "required": ["bootstrap", "angular", "angular-resource", "angular-mocks", "angular-cookies", "angular-animate", "angular-touch", "angular-sanitize", "angular-bootstrap", "angular-ui-utils", "angular-ui-router", "angular-chart.js", "moment"]}, "main": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "homepage": {"type": "string"}, "ignore": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "dependencies", "main", "authors", "license", "homepage", "ignore"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "spirittime", "description" : "", "dependencies" : {"bootstrap" : "~3", "angular" : "~1.2", "angular-resource" : "~1.2", "angular-mocks" : "~1.2", "angular-cookies" : "~1.2", "angular-animate" : "~1.2", "angular-touch" : "~1.2", "angular-sanitize" : "~1.2", "angular-bootstrap" : "~0.11.2", "angular-ui-utils" : "~0.1.1", "angular-ui-router" : "~0.2.11", "angular-chart.js" : "^1.1.1", "moment" : "^2.18.1"}, "main" : "index.js", "authors" : ["skywang329"], "license" : "ISC", "homepage" : "https://github.com/skywang329/Spirit-Time", "ignore" : ["**/.*", "node_modules", "bower_components", "test", "tests"]} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "dependencies": {"type": "object", "properties": {"bootstrap": {"type": "string"}, "angular": {"type": "string"}, "angular-resource": {"type": "string"}, "angular-mocks": {"type": "string"}, "angular-cookies": {"type": "string"}, "angular-animate": {"type": "string"}, "angular-touch": {"type": "string"}, "angular-sanitize": {"type": "string"}, "angular-bootstrap": {"type": "string"}, "angular-ui-utils": {"type": "string"}, "angular-ui-router": {"type": "string"}, "angular-chart.js": {"type": "string"}, "moment": {"type": "string"}}, "required": ["bootstrap", "angular", "angular-resource", "angular-mocks", "angular-cookies", "angular-animate", "angular-touch", "angular-sanitize", "angular-bootstrap", "angular-ui-utils", "angular-ui-router", "angular-chart.js", "moment"]}, "main": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "homepage": {"type": "string"}, "ignore": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "dependencies", "main", "authors", "license", "homepage", "ignore"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "private": {"type": "boolean"}, "devDependencies": {"type": "object", "properties": {"backpack-core": {"type": "string"}, "node-sass": {"type": "string"}, "nodemon": {"type": "string"}, "sass-loader": {"type": "string"}, "vue-i18n": {"type": "string"}}, "required": ["backpack-core", "node-sass", "nodemon", "sass-loader", "vue-i18n"]}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "build": {"type": "string"}, "start": {"type": "string"}, "generate": {"type": "string"}}, "required": ["dev", "build", "start", "generate"]}, "dependencies": {"type": "object", "properties": {"@antv/g2plot": {"type": "string"}, "@ethersproject/contracts": {"type": "string"}, "@ethersproject/providers": {"type": "string"}, "@ethersproject/solidity": {"type": "string"}, "@pancakeswap-libs/sdk": {"type": "string"}, "@uniswap/sdk": {"type": "string"}, "@uniswap/v2-core": {"type": "string"}, "@walletconnect/client": {"type": "string"}, "@walletconnect/qrcode-modal": {"type": "string"}, "@walletconnect/web3-provider": {"type": "string"}, "clipboard": {"type": "string"}, "cross-env": {"type": "string"}, "koa": {"type": "string"}, "moment": {"type": "string"}, "nuxt": {"type": "string"}, "tp-js-sdk": {"type": "string"}, "web3": {"type": "string"}, "wowjs": {"type": "string"}}, "required": ["@antv/g2plot", "@ethersproject/contracts", "@ethersproject/providers", "@ethersproject/solidity", "@pancakeswap-libs/sdk", "@uniswap/sdk", "@uniswap/v2-core", "@walletconnect/client", "@walletconnect/qrcode-modal", "@walletconnect/web3-provider", "clipboard", "cross-env", "koa", "moment", "nuxt", "tp-js-sdk", "web3", "wowjs"]}}, "required": ["name", "version", "description", "author", "private", "devDependencies", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"name" : "helmet", "version" : "0.0.1", "description" : "trxage", "author" : "sunny", "private" : true, "devDependencies" : {"backpack-core" : "^0.8.4", "node-sass" : "4.14.1", "nodemon" : "^1.18.9", "sass-loader" : "^10.0.2", "vue-i18n" : "^8.21.0"}, "scripts" : {"dev" : "backpack dev", "build" : "nuxt build && backpack build", "start" : "cross-env NODE_ENV=production node server/index.js", "generate" : "nuxt generate"}, "dependencies" : {"@antv/g2plot" : "^2.3.3", "@ethersproject/contracts" : "^5.0.2", "@ethersproject/providers" : "^5.0.2", "@ethersproject/solidity" : "^5.0.2", "@pancakeswap-libs/sdk" : "^1.0.1", "@uniswap/sdk" : "^3.0.3", "@uniswap/v2-core" : "^1.0.1", "@walletconnect/client" : "^1.3.1", "@walletconnect/qrcode-modal" : "^1.3.1", "@walletconnect/web3-provider" : "1.2.0", "clipboard" : "^2.0.1", "cross-env" : "^5.2.0", "koa" : "^2.6.2", "moment" : "^2.29.0", "nuxt" : "^2.0.0", "tp-js-sdk" : "^3.3.0", "web3" : "1.2.6", "wowjs" : "^1.1.3"}} | json_instruct | {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "private": {"type": "boolean"}, "devDependencies": {"type": "object", "properties": {"backpack-core": {"type": "string"}, "node-sass": {"type": "string"}, "nodemon": {"type": "string"}, "sass-loader": {"type": "string"}, "vue-i18n": {"type": "string"}}, "required": ["backpack-core", "node-sass", "nodemon", "sass-loader", "vue-i18n"]}, "scripts": {"type": "object", "properties": {"dev": {"type": "string"}, "build": {"type": "string"}, "start": {"type": "string"}, "generate": {"type": "string"}}, "required": ["dev", "build", "start", "generate"]}, "dependencies": {"type": "object", "properties": {"@antv/g2plot": {"type": "string"}, "@ethersproject/contracts": {"type": "string"}, "@ethersproject/providers": {"type": "string"}, "@ethersproject/solidity": {"type": "string"}, "@pancakeswap-libs/sdk": {"type": "string"}, "@uniswap/sdk": {"type": "string"}, "@uniswap/v2-core": {"type": "string"}, "@walletconnect/client": {"type": "string"}, "@walletconnect/qrcode-modal": {"type": "string"}, "@walletconnect/web3-provider": {"type": "string"}, "clipboard": {"type": "string"}, "cross-env": {"type": "string"}, "koa": {"type": "string"}, "moment": {"type": "string"}, "nuxt": {"type": "string"}, "tp-js-sdk": {"type": "string"}, "web3": {"type": "string"}, "wowjs": {"type": "string"}}, "required": ["@antv/g2plot", "@ethersproject/contracts", "@ethersproject/providers", "@ethersproject/solidity", "@pancakeswap-libs/sdk", "@uniswap/sdk", "@uniswap/v2-core", "@walletconnect/client", "@walletconnect/qrcode-modal", "@walletconnect/web3-provider", "clipboard", "cross-env", "koa", "moment", "nuxt", "tp-js-sdk", "web3", "wowjs"]}}, "required": ["name", "version", "description", "author", "private", "devDependencies", "scripts", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Based on the schema below, produce a valid JSON object:
{"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"id" : "10", "provinceId" : "12", "regencyId" : "16", "name" : "Tarabintang"} | json_instruct | {"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Using the following JSON schema, generate a compatible JSON instance:
{"type": "object", "properties": {"124": {"type": "string"}, "126": {"type": "string"}}, "required": ["124", "126"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"124" : "125", "126" : "127"} | json_instruct | {"type": "object", "properties": {"124": {"type": "string"}, "126": {"type": "string"}}, "required": ["124", "126"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Generate a valid JSON object that conforms to the following schema:
{"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
| [{"year" : 2002, "sex" : "F", "n" : 6, "prop" : 3.04e-06}, {"year" : 2017, "sex" : "M", "n" : 5, "prop" : 2.55e-06}] | json_instruct | {"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"} |
The schema below describes a JSON structure. Generate a valid example:
{"type": "object", "properties": {"devDependencies": {"type": "object", "properties": {"bootstrap": {"type": "string"}, "browserify": {"type": "string"}, "canvas-text-metrics-polyfill": {"type": "string"}, "jquery": {"type": "string"}, "knockout": {"type": "string"}, "less": {"type": "string"}, "popper.js": {"type": "string"}, "pug-cli": {"type": "string"}, "string.fromcodepoint": {"type": "string"}, "uglify-js": {"type": "string"}, "uglify-js-es6": {"type": "string"}, "uglifycss": {"type": "string"}}, "required": ["bootstrap", "browserify", "canvas-text-metrics-polyfill", "jquery", "knockout", "less", "popper.js", "pug-cli", "string.fromcodepoint", "uglify-js", "uglify-js-es6", "uglifycss"]}}, "required": ["devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
| {"devDependencies" : {"bootstrap" : "^4.0.0", "browserify" : "^16.1.1", "canvas-text-metrics-polyfill" : "git+https://github.com/motiz88/canvas-text-metrics-polyfill.git", "jquery" : "^3.3.1", "knockout" : "^3.5.0-beta", "less" : "^3.0.1", "popper.js" : "^1.14.1", "pug-cli" : "^1.0.0-alpha6", "string.fromcodepoint" : "git+https://github.com/mathiasbynens/String.fromCodePoint.git", "uglify-js" : "^3.3.16", "uglify-js-es6" : "^2.8.9", "uglifycss" : "0.0.28"}} | json_instruct | {"type": "object", "properties": {"devDependencies": {"type": "object", "properties": {"bootstrap": {"type": "string"}, "browserify": {"type": "string"}, "canvas-text-metrics-polyfill": {"type": "string"}, "jquery": {"type": "string"}, "knockout": {"type": "string"}, "less": {"type": "string"}, "popper.js": {"type": "string"}, "pug-cli": {"type": "string"}, "string.fromcodepoint": {"type": "string"}, "uglify-js": {"type": "string"}, "uglify-js-es6": {"type": "string"}, "uglifycss": {"type": "string"}}, "required": ["bootstrap", "browserify", "canvas-text-metrics-polyfill", "jquery", "knockout", "less", "popper.js", "pug-cli", "string.fromcodepoint", "uglify-js", "uglify-js-es6", "uglifycss"]}}, "required": ["devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.