task stringlengths 42 101 | input stringlengths 0 1.28k | output stringlengths 1 1.25k | options list | pageTitle stringlengths 28 119 | outputColName stringlengths 1 130 | url stringlengths 52 146 | wdcFile stringlengths 71 74 |
|---|---|---|---|---|---|---|---|
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] IsNumeric [What It Does] | Returns True if an expression can be evaluated as a number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] IsObject [What It Does] | Returns True if an expression references an OLE Automation object | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Join [What It Does] | Returns a string created by joining a number of substrings contained in an array | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] LBound [What It Does] | Returns the lower bound of an array | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] LCase [What It Does] | Returns a string converted to lowercase | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Left [What It Does] | Returns a specified number of characters from the left of a string | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Len [What It Does] | Returns the length of a string, in characters | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Loc [What It Does] | Returns the current read or write position of a text file | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] LOF [What It Does] | Returns the number of bytes in an open text file | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Log [What It Does] | Returns the natural logarithm of a number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] LTrim [What It Does] | Returns a copy of a string with no leading spaces | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Mid [What It Does] | Returns a specified number of characters from a string | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] MidB [What It Does] | Returns a specified number of bytes from a specified position in a string string | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Minute [What It Does] | Returns the minute of a time | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Month [What It Does] | Returns the month of a date | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] MonthName [What It Does] | Returns a string indicating the specified month | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] MsgBox [What It Does] | Displays a modal message box and returns the ID of the button clicked | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Now [What It Does] | Returns the current system date and time | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Oct [What It Does] | Converts from decimal to octal | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Replace [What It Does] | Returns a string in which one substring is replaced with another | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] RGB [What It Does] | Returns a number representing an RGB color value | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Right [What It Does] | Returns a specified number of characters from the right of a string | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Rnd [What It Does] | Returns a random number between 0 and 1 | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Round [What It Does] | Rounds a number to a specific number of decimal places | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] RTrim [What It Does] | Returns a copy of a string with no trailing spaces | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Second [What It Does] | Returns the second of a time | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Seek [What It Does] | Returns the current position in a text file | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Sgn [What It Does] | Returns an integer that indicates the sign of a number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Shell [What It Does] | Runs an executable program | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Sin [What It Does] | Returns the sine of a number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Space [What It Does] | Returns a string with a specified number of spaces | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Split [What It Does] | Returns an array consisting of a number of substrings | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Sqr [What It Does] | Returns the square root of a number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Str [What It Does] | Returns a string representation of a number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] StrComp [What It Does] | Returns a value indicating the result of a string comparison | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] StrConv [What It Does] | Returns a string variant converted as specified | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] String [What It Does] | Returns a repeating character or string | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] StrReverse [What It Does] | Returns the characters of a string in reverse order | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Switch [What It Does] | Evaluates a list of expressions and returns a value associated with the first expression in the list that is True | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Tab [What It Does] | Positions output in an output stream | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Tan [What It Does] | Returns the tangent of a number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Time [What It Does] | Returns the current system time | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Timer [What It Does] | Returns the number of seconds since midnight | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] TimeSerial [What It Does] | Returns the time for a specified hour, minute, and second | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] TimeValue [What It Does] | Converts a string to a time serial number | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Trim [What It Does] | Returns a string without leading and spaces and replaces multiple spaces with a single space | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] TypeName [What It Does] | Returns a string that describes the data type of a variable | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] UBound [What It Does] | Returns the upper bound of an array | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] UCase [What It Does] | Converts a string to uppercase | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Val [What It Does] | Returns the numbers contained in a string | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] VarType [What It Does] | Returns a value indicating the subtype of a variable | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Weekday [What It Does] | Returns a number representing a day of the week | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Weekday Name [What It Does] | Returns a string indicating the specified weekday | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
6639c7a7__VBA_Programming___For_Dummies__What_It_Does | [VBA Function] Year [What It Does] | Returns the year of a date | [] | VBA Functions for Excel VBA Programming - For Dummies | What It Does | http://www.dummies.com/how-to/content/vba-functions-for-excel-vba-programming.html | 43/1438042988310.3_20150728002308-00137-ip-10-236-191-2_429079576_0.json |
9b086b33_bsidiary_Motions___For_Dummies_on_Uses_for_Subsidiary_Motions_Use_This_Motion_____ | [To Accomplish This . . .] Avoid taking a direct vote on a motion [Use This Motion. . .] | Postpone Indefinitely | [] | Robert's Rules and Subsidiary Motions - For Dummies | Use This Motion. . . | http://www.dummies.com/how-to/content/roberts-rules-and-subsidiary-motions.html | 43/1438042988399.65_20150728002308-00086-ip-10-236-191-2_417615603_0.json |
9b086b33_bsidiary_Motions___For_Dummies_on_Uses_for_Subsidiary_Motions_Use_This_Motion_____ | [To Accomplish This . . .] Change the wording of the motion [Use This Motion. . .] | Amend | [] | Robert's Rules and Subsidiary Motions - For Dummies | Use This Motion. . . | http://www.dummies.com/how-to/content/roberts-rules-and-subsidiary-motions.html | 43/1438042988399.65_20150728002308-00086-ip-10-236-191-2_417615603_0.json |
9b086b33_bsidiary_Motions___For_Dummies_on_Uses_for_Subsidiary_Motions_Use_This_Motion_____ | [To Accomplish This . . .] Have a committee discuss a motion in detail and come back with a recommendation [Use This Motion. . .] | Commit or Refer | [] | Robert's Rules and Subsidiary Motions - For Dummies | Use This Motion. . . | http://www.dummies.com/how-to/content/roberts-rules-and-subsidiary-motions.html | 43/1438042988399.65_20150728002308-00086-ip-10-236-191-2_417615603_0.json |
9b086b33_bsidiary_Motions___For_Dummies_on_Uses_for_Subsidiary_Motions_Use_This_Motion_____ | [To Accomplish This . . .] Discuss a motion later in the meeting, or maybe put it off until your next meeting [Use This Motion. . .] | Postpone to a Certain Time (or Definitely) | [] | Robert's Rules and Subsidiary Motions - For Dummies | Use This Motion. . . | http://www.dummies.com/how-to/content/roberts-rules-and-subsidiary-motions.html | 43/1438042988399.65_20150728002308-00086-ip-10-236-191-2_417615603_0.json |
9b086b33_bsidiary_Motions___For_Dummies_on_Uses_for_Subsidiary_Motions_Use_This_Motion_____ | [To Accomplish This . . .] Provide for a certain amount of time for discussion of the motion, either for the subject matter or for each speaker [Use This Motion. . .] | Limit or Extend Limits of Debate | [] | Robert's Rules and Subsidiary Motions - For Dummies | Use This Motion. . . | http://www.dummies.com/how-to/content/roberts-rules-and-subsidiary-motions.html | 43/1438042988399.65_20150728002308-00086-ip-10-236-191-2_417615603_0.json |
9b086b33_bsidiary_Motions___For_Dummies_on_Uses_for_Subsidiary_Motions_Use_This_Motion_____ | [To Accomplish This . . .] End debate on the motion and vote now [Use This Motion. . .] | Previous Question | [] | Robert's Rules and Subsidiary Motions - For Dummies | Use This Motion. . . | http://www.dummies.com/how-to/content/roberts-rules-and-subsidiary-motions.html | 43/1438042988399.65_20150728002308-00086-ip-10-236-191-2_417615603_0.json |
9b086b33_bsidiary_Motions___For_Dummies_on_Uses_for_Subsidiary_Motions_Use_This_Motion_____ | [To Accomplish This . . .] Stop dealing with the motion temporarily to allow something of an urgent nature to be done immediately [Use This Motion. . .] | Lay on the Table | [] | Robert's Rules and Subsidiary Motions - For Dummies | Use This Motion. . . | http://www.dummies.com/how-to/content/roberts-rules-and-subsidiary-motions.html | 43/1438042988399.65_20150728002308-00086-ip-10-236-191-2_417615603_0.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] Asc, AscB, or AscW [To Do This] | Convert a character into its ASCII, DBCS, or Unicode numeric value | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] Chr, ChrB, or ChrW [To Do This] | Convert a number into its ASCII, DBCS, or Unicode character | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] CStr [To Do This] | Convert any expression, including any supported data type, into a string | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] CVErr [To Do This] | Create a user-defined error number for your program | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] Format [To Do This] | Change an enumeration or other expression into formatted text | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] InputBox [To Do This] | Get a single input from the program user | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] MsgBox [To Do This] | Display a short message box onscreen | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] Str, Format, or CStr [To Do This] | Convert a number into a string | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
42f649c8_mies_Cheat_Sheet___For_Dummies__To_Do_This | [Use This Function] Val, CByte, CCur, CDbl, CDec, CInt, CLng, or CSng [To Do This] | Convert a string into a number | [] | VBA For Dummies Cheat Sheet - For Dummies | To Do This | http://www.dummies.com/how-to/content/vba-for-dummies-cheat-sheet.html | 43/1438042988399.65_20150728002308-00290-ip-10-236-191-2_419154899_1.json |
c8eae2ff_IS_Map_Functions___For_Dummies__Where_It_Operates | [Function Type] Local [What It's Used For] To change cell values based on user definition or the value of corresponding grid cells on other layers. [Where It Operates] | On individual grid cells | [] | Grid-Based GIS Map Functions - For Dummies | Where It Operates | http://www.dummies.com/how-to/content/gridbased-gis-map-functions.html | 2/1438042981856.5_20150728002301-00300-ip-10-236-191-2_412415721_0.json |
c8eae2ff_IS_Map_Functions___For_Dummies__Where_It_Operates | [Function Type] Focal [What It's Used For] To return a value (such as an average) based on the values of neighboring grid cells [Where It Operates] | On a specifically targeted grid cell | [] | Grid-Based GIS Map Functions - For Dummies | Where It Operates | http://www.dummies.com/how-to/content/gridbased-gis-map-functions.html | 2/1438042981856.5_20150728002301-00300-ip-10-236-191-2_412415721_0.json |
c8eae2ff_IS_Map_Functions___For_Dummies__Where_It_Operates | [Function Type] Zonal [What It's Used For] To calculate values based on analysis of specified regions that are not necessarily connected [Where It Operates] | On grid cells in specifically identified regions | [] | Grid-Based GIS Map Functions - For Dummies | Where It Operates | http://www.dummies.com/how-to/content/gridbased-gis-map-functions.html | 2/1438042981856.5_20150728002301-00300-ip-10-236-191-2_412415721_0.json |
c8eae2ff_IS_Map_Functions___For_Dummies__Where_It_Operates | [Function Type] Block [What It's Used For] To return a value for the identified block (for example, a 4 x 4 block of cells) on an output grid [Where It Operates] | On square blocks of grid cells | [] | Grid-Based GIS Map Functions - For Dummies | Where It Operates | http://www.dummies.com/how-to/content/gridbased-gis-map-functions.html | 2/1438042981856.5_20150728002301-00300-ip-10-236-191-2_412415721_0.json |
c8eae2ff_IS_Map_Functions___For_Dummies__Where_It_Operates | [Function Type] Global [What It's Used For] To highlight hard-to-find features and spot general trends by moving through the entire grid [Where It Operates] | On the entire grid | [] | Grid-Based GIS Map Functions - For Dummies | Where It Operates | http://www.dummies.com/how-to/content/gridbased-gis-map-functions.html | 2/1438042981856.5_20150728002301-00300-ip-10-236-191-2_412415721_0.json |
c8eae2ff_IS_Map_Functions___For_Dummies__Where_It_Operates | [Function Type] Specialty [What It's Used For] To perform high-end statistical analysis or create models for moving surfaces (such as water or pollution) [Where It Operates] | On specified grid cells | [] | Grid-Based GIS Map Functions - For Dummies | Where It Operates | http://www.dummies.com/how-to/content/gridbased-gis-map-functions.html | 2/1438042981856.5_20150728002301-00300-ip-10-236-191-2_412415721_0.json |
af1b063a_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] RAW [Description] | Sequence format that doesn't contain any header. Spaces and numbers are usually tolerated. | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 2/1438042981856.5_20150728002301-00196-ip-10-236-191-2_415508236_0.json |
af1b063a_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] FASTA [Description] | This is the default format. Sequence format that contains a header line and the sequence: >name AGCTGTGTGGGTTGGTGGGTT | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 2/1438042981856.5_20150728002301-00196-ip-10-236-191-2_415508236_0.json |
af1b063a_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] PIR [Description] | Sequence format that's similar to FASTA but less common | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 2/1438042981856.5_20150728002301-00196-ip-10-236-191-2_415508236_0.json |
af1b063a_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] MSF [Description] | Multiple sequence alignment format | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 2/1438042981856.5_20150728002301-00196-ip-10-236-191-2_415508236_0.json |
af1b063a_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] CLUSTAL [Description] | Multiple sequence alignment format (works with T-Coffee) | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 2/1438042981856.5_20150728002301-00196-ip-10-236-191-2_415508236_0.json |
af1b063a_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] TXT [Description] | Text format | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 2/1438042981856.5_20150728002301-00196-ip-10-236-191-2_415508236_0.json |
af1b063a_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] GIF, JPEG, PNG, PDF [Description] | Graphic formats. Do not use them to store important information. | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 2/1438042981856.5_20150728002301-00196-ip-10-236-191-2_415508236_0.json |
14163a9e__Navigation_Keys___For_Dummies__Action_3 | [Keystroke] Home [Action] Go to the beginning of current text line [Keystroke_2] Ctrl+Home [Action_3] | Go to the beginning of current text box | [] | Microsoft Publisher 2007 Navigation Keys - For Dummies | Action_3 | http://www.dummies.com/how-to/content/microsoft-publisher-2007-navigation-keys.html | 2/1438042981856.5_20150728002301-00069-ip-10-236-191-2_418692355_0.json |
14163a9e__Navigation_Keys___For_Dummies__Action_3 | [Keystroke] End [Action] Go to the end of current text line [Keystroke_2] Ctrl+End [Action_3] | Go to the end of current text box | [] | Microsoft Publisher 2007 Navigation Keys - For Dummies | Action_3 | http://www.dummies.com/how-to/content/microsoft-publisher-2007-navigation-keys.html | 2/1438042981856.5_20150728002301-00069-ip-10-236-191-2_418692355_0.json |
14163a9e__Navigation_Keys___For_Dummies__Action_3 | [Keystroke] Up arrow [Action] Move up one text line [Keystroke_2] Ctrl+Up [Action_3] | Go to the beginning of current paragraph | [] | Microsoft Publisher 2007 Navigation Keys - For Dummies | Action_3 | http://www.dummies.com/how-to/content/microsoft-publisher-2007-navigation-keys.html | 2/1438042981856.5_20150728002301-00069-ip-10-236-191-2_418692355_0.json |
14163a9e__Navigation_Keys___For_Dummies__Action_3 | [Keystroke] Down arrow [Action] Move down one text line [Keystroke_2] Ctrl+Down arrow [Action_3] | Go to the beginning of next paragraph | [] | Microsoft Publisher 2007 Navigation Keys - For Dummies | Action_3 | http://www.dummies.com/how-to/content/microsoft-publisher-2007-navigation-keys.html | 2/1438042981856.5_20150728002301-00069-ip-10-236-191-2_418692355_0.json |
14163a9e__Navigation_Keys___For_Dummies__Action_3 | [Keystroke] Right arrow [Action] Move right one character [Keystroke_2] Ctrl+Right arrow [Action_3] | Move right one word | [] | Microsoft Publisher 2007 Navigation Keys - For Dummies | Action_3 | http://www.dummies.com/how-to/content/microsoft-publisher-2007-navigation-keys.html | 2/1438042981856.5_20150728002301-00069-ip-10-236-191-2_418692355_0.json |
14163a9e__Navigation_Keys___For_Dummies__Action_3 | [Keystroke] Left arrow [Action] Move left one character [Keystroke_2] Ctrl+Left arrow [Action_3] | Move left one word | [] | Microsoft Publisher 2007 Navigation Keys - For Dummies | Action_3 | http://www.dummies.com/how-to/content/microsoft-publisher-2007-navigation-keys.html | 2/1438042981856.5_20150728002301-00069-ip-10-236-191-2_418692355_0.json |
14163a9e__Navigation_Keys___For_Dummies__Action_3 | [Keystroke] Ctrl+Tab [Action] Move to next connected text box [Keystroke_2] Ctrl+Shift+Tab [Action_3] | Move to previous connected text box | [] | Microsoft Publisher 2007 Navigation Keys - For Dummies | Action_3 | http://www.dummies.com/how-to/content/microsoft-publisher-2007-navigation-keys.html | 2/1438042981856.5_20150728002301-00069-ip-10-236-191-2_418692355_0.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] ALL [Description] | All privileges | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] ALTER [Description] | Can alter the structure of tables | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] CREATE [Description] | Can create new databases or tables | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] DELETE [Description] | Can delete rows in tables | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] DROP [Description] | Can drop databases or tables | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] FILE [Description] | Can read and write files on the server | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] GRANT [Description] | Can change the privileges on a MySQL account | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] INSERT [Description] | Can insert new rows into tables | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] SELECT [Description] | Can read data from tables | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
4806c37a_count_Privileges___For_Dummies_MySQL_Account_Privileges_Description | [Privilege] SHUTDOWN [Description] | Can shut down the MySQL server | [] | MySQL Account Privileges - For Dummies | Description | http://www.dummies.com/how-to/content/mysql-account-privileges.html | 2/1438042982745.46_20150728002302-00051-ip-10-236-191-2_421350999_1.json |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.