task stringlengths 42 101 | input stringlengths 0 1.28k | output stringlengths 1 1.25k | options list | pageTitle stringlengths 28 119 | outputColName stringlengths 1 130 | url stringlengths 52 146 | wdcFile stringlengths 71 74 |
|---|---|---|---|---|---|---|---|
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Meal] Breakfast [Have:] Muesli [Instead of:] | Cornflakes | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Unprocessed oats made into porridge [Instead of:] | Instant porridge oats | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Granary toast [Instead of:] | White toast | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Meal] Lunch [Have:] Baked sweet potato with filling [Instead of:] | Jacket potato with filling | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Pitta bread [Instead of:] | White baguette | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Wholegrain bread sandwiches [Instead of:] | Brown bread sandwiches | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Meal] Dinner [Have:] Curry with basmati rice [Instead of:] | Curry with white rice | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Spaghetti bolognese [Instead of:] | Shepherd’s pie | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Stir-fry with noodles [Instead of:] | Stir-fry with instant rice | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Meal] Desserts [Have:] Bread and butter pudding made with fruit loaf [Instead of:] | Bread and butter pudding made with white bread | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Fruit crumble made with oat topping [Instead of:] | Fruit crumble made with white flour | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Meal] Snacks [Have:] Cakes, biscuits, or muffins made with fruit, oats, and wholegrains [Instead of:] | Muffins/cakes/biscuits | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Fruit loaf with ricotta [Instead of:] | White bread and jam | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3de391f_rb_Substitutions___For_Dummies__Instead_of_ | [Have:] Wholegrain crispbread with avocado or hummus dip [Instead of:] | White crackers and cheese | [] | How to Handle PCOS Symptoms through Low-Carb Substitutions - For Dummies | Instead of: | http://www.dummies.com/how-to/content/how-to-handle-pcos-symptoms-through-lowcarb-diet.navId-323518.html | 39/1438043062723.96_20150728002422-00190-ip-10-236-191-2_400020051_0.json |
e3a485c3_ics_Data_Formats___For_Dummies__Description | [Format Name] RAW [Description] | Sequence format that doesn't contain any header. Spaces and numbers are usually tolerated. | [] | Bioinformatics Data Formats - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-data-formats.seriesId-178448.html | 39/1438043062723.96_20150728002422-00143-ip-10-236-191-2_420049292_0.json |
e3a485c3_ics_Data_Formats___For_Dummies__Description | [Format Name] FASTA [Description] | This is the default format. Sequence format that contains a header line and the sequence: >name AGCTGTGTGGGTTGGTGGGTT | [] | Bioinformatics Data Formats - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-data-formats.seriesId-178448.html | 39/1438043062723.96_20150728002422-00143-ip-10-236-191-2_420049292_0.json |
e3a485c3_ics_Data_Formats___For_Dummies__Description | [Format Name] PIR [Description] | Sequence format that's similar to FASTA but less common | [] | Bioinformatics Data Formats - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-data-formats.seriesId-178448.html | 39/1438043062723.96_20150728002422-00143-ip-10-236-191-2_420049292_0.json |
e3a485c3_ics_Data_Formats___For_Dummies__Description | [Format Name] MSF [Description] | Multiple sequence alignment format | [] | Bioinformatics Data Formats - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-data-formats.seriesId-178448.html | 39/1438043062723.96_20150728002422-00143-ip-10-236-191-2_420049292_0.json |
e3a485c3_ics_Data_Formats___For_Dummies__Description | [Format Name] CLUSTAL [Description] | Multiple sequence alignment format (works with T-Coffee) | [] | Bioinformatics Data Formats - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-data-formats.seriesId-178448.html | 39/1438043062723.96_20150728002422-00143-ip-10-236-191-2_420049292_0.json |
e3a485c3_ics_Data_Formats___For_Dummies__Description | [Format Name] TXT [Description] | Text format | [] | Bioinformatics Data Formats - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-data-formats.seriesId-178448.html | 39/1438043062723.96_20150728002422-00143-ip-10-236-191-2_420049292_0.json |
e3a485c3_ics_Data_Formats___For_Dummies__Description | [Format Name] GIF, JPEG, PNG, PDF [Description] | Graphic formats. Do not use them to store important information. | [] | Bioinformatics Data Formats - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-data-formats.seriesId-178448.html | 39/1438043062723.96_20150728002422-00143-ip-10-236-191-2_420049292_0.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Add the alternative text attribute, either with or without a description, as in . [Problem] | alt text attribute missing from tag | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Add tags below each instance when JavaScript is present in in-line JavaScript or at the end of the content before the closing body tag. Between the tags, insert HTML content (text, graphics, media files, and so on) that describes the function of the JavaScript and, when appropriate, how visitors can access the information revealed by it, as shown here: The JavaScript used on this page provides a quick link that allows visitors to automatically bookmark this page. As an alternative, please use your browser’s Bookmark This Page feature. [Problem] | tags missing from code | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Adjust the speed of any animations to avoid causing the screen to flicker with a frequency between 2 Hz and 55 Hz. Animations that exceed these two measures may cause seizures in visitors with photosensitive epilepsy. [Problem] | Flashing or flickering element(s) detected, such as animated GIFs, Java applets, and other multimedia plug-ins | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Add a valid DOCTYPE above the opening tag. [Problem] | No DOCTYPE specified | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] This special meta tag specifies the character set used in the HTML code. Some HTML editors include it automatically when generating new blank web pages. If validation finds that this tag is missing from your HTML or XHTML code, insert the following code by hand: . For HTML5, insert . [Problem] | No HTTP charset parameter specified | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Add a unique title between tags in the head area on each page. [Problem] | No tag specified | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Add meta keywords and meta description tags to the head of each page. These can be identical on every page on the site. If desired, you may also add additional meta tags as needed. [Problem] | No tags specified | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Add the Robots tag in the head of the page to instruct web spiders and robots whether to index the page and follow any hyperlinks, such as . [Problem] | No Robots tags specified | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Move all the presentation markup of the HTML (page, fonts, tables, links, and so on) to an external CSS file and remove all tags and HTML and inline formatting attributes. [Problem] | Deprecated tags detected | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Control table cell heights, when necessary, with CSS styles. [Problem] | Deprecated table height attribute detected | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Move body attributes, like margin attributes and background page color, to a BODY tag redefine style in an external CSS file. [Problem] | Style attributes detected in the opening tag | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Add the type=text/css attribute for [Problem] | type attribute not specified for JavaScript or CSS | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Change the entity name to an entity number, such as using $#169; instead of © to create the copyright symbol (c). [Problem] | Entity name used instead of entity number | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
22053b8e_on_Your_Web_Page___For_Dummies__Problem | [Solution] Provide each style that contains a text color attribute with an attending background color attribute. The background color should match, or closely match, the background color upon which the text will display on. [Problem] | No background color attribute was specified for a CSS style that specifies text color | [] | How to Fix Noncompliant Code on Your Web Page - For Dummies | Problem | http://www.dummies.com/how-to/content/how-to-fix-noncompliant-code-on-your-web-page.html | 39/1438043062723.96_20150728002422-00285-ip-10-236-191-2_406368921_1.json |
ee8d7753_mies_Cheat_Sheet___For_Dummies__Possible_Contributors | [Savings Vehicle] 529 plans [Tax Issues] No tax paid on interest earned until distributions are made. Currently, distributions used for qualified educational expenses are tax-exempt. [Possible Uses] Any expenses you choose. However, distributions used to pay for nonqualified expenses are subject to income tax on the earnings portion, plus a 10% penalty. Designated beneficiary. [Possible Contributors] | No relationship or income-limitation test. | [] | 529 and Other College Savings Plans For Dummies Cheat Sheet - For Dummies | Possible Contributors | http://www.dummies.com/how-to/content/529-and-other-college-savings-plan-for-dummies-che.html | 39/1438042989126.22_20150728002309-00280-ip-10-236-191-2_412464383_0.json |
ee8d7753_mies_Cheat_Sheet___For_Dummies__Possible_Contributors | [Savings Vehicle] Coverdell accounts [Tax Issues] No tax paid on interest earned until distributions are made. Currently, distributions used for qualified educational expenses are tax-exempt. [Possible Uses] Any expenses you choose. However, distributions used to pay for nonqualified expenses are subject to income tax on the earnings portion, plus a 10% penalty. Designated beneficiary. [Possible Contributors] | No relationship test. Must satisfy income-limitation test. | [] | 529 and Other College Savings Plans For Dummies Cheat Sheet - For Dummies | Possible Contributors | http://www.dummies.com/how-to/content/529-and-other-college-savings-plan-for-dummies-che.html | 39/1438042989126.22_20150728002309-00280-ip-10-236-191-2_412464383_0.json |
ee8d7753_mies_Cheat_Sheet___For_Dummies__Possible_Contributors | [Savings Vehicle] Series EE and Series II savings bonds [Tax Issues] No tax paid on interest earned if redeemed bonds are used for qualified educational expenses. [Possible Uses] Any expenses you choose. However, only the portion used for qualified educational expenses is tax-free. Bond owner. [Possible Contributors] | Must satisfy relationship and income-limitation tests to qualify for tax-free treatment of interest upon redemption of bonds. | [] | 529 and Other College Savings Plans For Dummies Cheat Sheet - For Dummies | Possible Contributors | http://www.dummies.com/how-to/content/529-and-other-college-savings-plan-for-dummies-che.html | 39/1438042989126.22_20150728002309-00280-ip-10-236-191-2_412464383_0.json |
ee8d7753_mies_Cheat_Sheet___For_Dummies__Possible_Contributors | [Savings Vehicle] Personal investment accounts [Tax Issues] Tax paid yearly on income earned within the account. No additional tax assessed when you take distributions for any reason. [Possible Uses] All expenses. Account owner. [Possible Contributors] | You contribute to your own account or may make gifts into someone else's. | [] | 529 and Other College Savings Plans For Dummies Cheat Sheet - For Dummies | Possible Contributors | http://www.dummies.com/how-to/content/529-and-other-college-savings-plan-for-dummies-che.html | 39/1438042989126.22_20150728002309-00280-ip-10-236-191-2_412464383_0.json |
ee8d7753_mies_Cheat_Sheet___For_Dummies__Possible_Contributors | [Savings Vehicle] Trust accounts [Tax Issues] Tax paid yearly on income earned within the account. No additional tax assessed when you take distributions for any reason. [Possible Uses] All expenses. In years in which distributions are made, person to whom the distribution is made. In all other years, the trust pays the tax. [Possible Contributors] | Trust grantor (the donor) only. | [] | 529 and Other College Savings Plans For Dummies Cheat Sheet - For Dummies | Possible Contributors | http://www.dummies.com/how-to/content/529-and-other-college-savings-plan-for-dummies-che.html | 39/1438042989126.22_20150728002309-00280-ip-10-236-191-2_412464383_0.json |
ee8d7753_mies_Cheat_Sheet___For_Dummies__Possible_Contributors | [Savings Vehicle] Retirement accounts [Tax Issues] Tax deferred until you take distributions. Early distributions may also be subject to an additional penalty. [Possible Uses] Any expenses you choose. However, distributions used to pay for nonqualified expenses are subject to income tax on the earnings portion, plus a 10% penalty. Account owner. [Possible Contributors] | Account owner only. | [] | 529 and Other College Savings Plans For Dummies Cheat Sheet - For Dummies | Possible Contributors | http://www.dummies.com/how-to/content/529-and-other-college-savings-plan-for-dummies-che.html | 39/1438042989126.22_20150728002309-00280-ip-10-236-191-2_412464383_0.json |
ee8d7753_mies_Cheat_Sheet___For_Dummies__Possible_Contributors | [Savings Vehicle] Home equity [Tax Issues] No tax owed if you refinance your house and use some or all of your equity to pay for college expenses. If you sell your house, you may be liable for a capital gains tax in some situations. [Possible Uses] All expenses. Homeowner. [Possible Contributors] | Anyone may buy you a house or make payments against an existing mortgage; generally, only the homeowner actually does. | [] | 529 and Other College Savings Plans For Dummies Cheat Sheet - For Dummies | Possible Contributors | http://www.dummies.com/how-to/content/529-and-other-college-savings-plan-for-dummies-che.html | 39/1438042989126.22_20150728002309-00280-ip-10-236-191-2_412464383_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] the [1] he [2] at [4] there [3] | but | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] of [1] was [2] be [4] use [3] | not | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] and [1] for [2] this [4] an [3] | what | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] a [1] on [2] have [4] each [3] | all | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] to [1] are [2] from [4] which [3] | were | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] in [1] as [2] or [4] she [3] | we | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] is [1] with [2] ine [4] do [3] | when | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] you [1] his [2] had [4] how [3] | your | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] that [1] they [2] by [4] their [3] | can | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
ade55818_mies_Cheat_Sheet___For_Dummies__3 | [0] it [1] I [2] word [4] if [3] | said | [
[
"b",
"u",
"t"
],
[
"n",
"o",
"t"
],
[
"w",
"h",
"a",
"t"
],
[
"a",
"l",
"l"
],
[
"w",
"e",
"r",
"e"
],
[
"w",
"e"
],
[
"w",
"h",
"e",
"n"
],
[
"y",
"o",
"u",
"r"
],
[
"c",
"a",
"n"
],
[
"s",
"a",
"i",
"d"
]
] | Teaching Kids to Spell For Dummies Cheat Sheet - For Dummies | 3 | http://www.dummies.com/how-to/content/teaching-kids-to-spell-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00299-ip-10-236-191-2_419400105_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Rods/reels [General Equipment] First-aid kit [Clothing] | Life jacket | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Tackle carrier containing all your terminal tackle, as well as your lures and flies [General Equipment] Camera [Clothing] | Foul-weather waterproof bag containing rainsuit, knit hat, gloves, and dry socks) | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Line clippers [General Equipment] Meals and snacks [Clothing] | Polarized sunglasses | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Needlenose pliers [General Equipment] Insect repellant [Clothing] | Baseball cap | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Towel (for drying hands after catching fish) [General Equipment] Flashlight or headlamp [Clothing] | Waterproof boots | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Cooler containing bait (keep livebait cool and dry, and keep minnows cool and wet) [General Equipment] Cooler containing (nonalcoholic) beverages [Clothing] | Deck shoes | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Landing net [General Equipment] Thermos [Clothing] | Gloves | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Extra spool of line [General Equipment] GPS unit or compass [Clothing] | Waders or hip boots | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Measuring tape [General Equipment] Knife or multitool [Clothing] | Fleece jacket | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Castnet or seine if you plan to gather bait [General Equipment] Lighter or matches in waterproof case [Clothing] | Shirt – SPF fabric and longsleeved | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Mouth spreader if you’re fishing for species with teeth [General Equipment] Sunscreen [Clothing] | Shirt – SPF fabric and shortsleeved | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [Fishing Equipment] Weight scale [General Equipment] Hand sanitizer [Clothing] | Long underwear | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [General Equipment] Hand warmers [Clothing] | Convertible pants (pants with zippered legs, making instant shorts) | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
2ed09dbb_ent_and_Clothing___For_Dummies__Clothing | [General Equipment] Plastic bags [Clothing] | Socks | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Clothing | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Touch the screen. [Action] | Touch | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Touch the screen twice in the same location. [Action] | Double-tap | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Touch a spot on the screen and keep your finger down. [Action] | Long press | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Touch the screen, keep your finger down, but move your finger around. [Action] | Drag | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Touch a spot on the screen and drag your finger left, right, up, or down. [Action] | Swipe | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Use two fingers to touch the screen and bring both fingers together as you continue to touch the screen. [Action] | Pinch | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Use two fingers close together and then spread them apart, touching the screen as you spread them. [Action] | Spread | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
6b25bdd6_s_on_the_Droid_4___For_Dummies__Action | [How to Do It] Use two fingers to twist around a central point which has the effect of rotating an object on the screen. [Action] | Rotate | [
[
"T",
"o",
"u",
"c",
"h"
],
[
"D",
"o",
"u",
"b",
"l",
"e",
"-",
"t",
"a",
"p"
],
[
"L",
"o",
"n",
"g",
" ",
"p",
"r",
"e",
"s",
"s"
],
[
"D",
"r",
"a",
"g"
],
[
"S",
"w",
"i",
"p",
"e"
],
[
"P",
"i",
"n",
"c",
"h"
],
[
"S",
"p",
"r",
"e",
"a",
"d"
],
[
"R",
"o",
"t",
"a",
"t",
"e"
]
] | Touchscreen Operations on the Droid 4 - For Dummies | Action | http://www.dummies.com/how-to/content/touchscreen-operations-on-the-droid-4.html | 39/1438043062723.96_20150728002422-00318-ip-10-236-191-2_405678780_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Tap [How to Do It] | Choose an on-screen icon, button, or menu option by tapping it with your finger. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Double-tap [How to Do It] | Zoom in or out of a portion of the screen by tapping it twice in rapid succession. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Touch and hold [How to Do It] | Touching and holding your finger against the glass often brings up a menu, lets you move an item across the screen, or selects a word. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Drag [How to Do It] | Touch something on the screen and drag your finger up, down, or sideways to move that item across the screen. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Drag, hold, and drop [How to Do It] | Touch and hold something on-screen, then slide your finger to that object's new location on-screen. Lift your finger to drop it into its new place. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Flick [How to Do It] | Much like flicking a piece of dust off the screen, a flick lets you scroll quickly through menus or long lists. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Pinch [How to Do It] | Placing two fingers on-screen and bringing the fingers together shrinks that portion of the screen, bringing more of the image into view. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
9903f487_mies_Cheat_Sheet___For_Dummies__How_to_Do_It | [Action] Spread [How to Do It] | The opposite of pinch, spreading your two fingers along the glass zooms into that portion of the screen. | [] | MOTOROLA XOOM For Dummies Cheat Sheet - For Dummies | How to Do It | http://www.dummies.com/how-to/content/motorola-xoom-for-dummies-cheat-sheet.html | 39/1438042989126.22_20150728002309-00061-ip-10-236-191-2_418061737_0.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] 200 [Definition] The web page appears as expected. [What it Means] You want to see this status. Your server and web page have the welcome mat out for search engine spiders (and users, too). [Description] | OK | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] 301 [Definition] The web page has been redirected permanently to another web-page URL. [What it Means] When a search engine spider sees this status code, it moves easily to the appropriate new page. A 301 Redirect status doesn't cause a problem for search engine optimization. [Description] | Moved Permanently | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] 302 [Definition] The web page has been moved temporarily to a different URL. [What it Means] This status should raise a red flag if you find it on your web server. Even though people claim legitimate uses for a 302 Redirect code, this code can cause serious problems for your optimization efforts. Spammers frequently use 302 Redirects maliciously, so if you don't want a search engine mistaking your site for a spam site, avoid them. [Description] | Found (Moved Temporarily) | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] 400 [Definition] The server couldn't understand the request because of bad syntax. [What it Means] A typo in the URL could cause this status. Whatever the cause, you don't want to block a search engine spider from reaching your content pages, so investigate what's causing this status code on your site. [Description] | Bad Request | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] 401 [Definition] The request requires user authentication. [What it Means] Usually, this status means that you need to log in before you can view the page content. Not a good error for spiders to hit.403 [Description] | Unauthorized | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] Forbidden [Definition] If you find this status code on your web site, find out why. If you want to block the spiders from entering, have a good reason. [Description] | The server understood the request but refuses to fulfill it. | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] 404 [Definition] The web page isn't available. [What it Means] You see this error code as the Page Cannot Be Displayed page that appears when a web site is down or nonexistent. You definitely don't want a spider following a link to your web site only to be greeted by a 404 error! That's like visiting a house and finding the lights off and the doors locked. If your server check shows that you have a 404 error for one of your landing pages, fix it ASAP. [Description] | Not Found | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
59955070_mies_Cheat_Sheet___For_Dummies__Description | [Code] 500 and up [Definition] The 500–505 status codes indicate that something's wrong with your server. Check them out. [Description] | Miscellaneous server errors | [] | Search Engine Optimization All-in-One For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/search-engine-optimization-allinone-for-dummies-ch.navId-410387.html | 39/1438043062723.96_20150728002422-00054-ip-10-236-191-2_408021486_1.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] First-aid kit [Clothing] Life jacket [Fishing Equipment] | Rods/reels | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Camera [Clothing] Foul-weather waterproof bag containing rainsuit, knit hat, gloves, and dry socks) [Fishing Equipment] | Tackle carrier containing all your terminal tackle, as well as your lures and flies | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Meals and snacks [Clothing] Polarized sunglasses [Fishing Equipment] | Line clippers | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Insect repellant [Clothing] Baseball cap [Fishing Equipment] | Needlenose pliers | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Flashlight or headlamp [Clothing] Waterproof boots [Fishing Equipment] | Towel (for drying hands after catching fish) | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Cooler containing (nonalcoholic) beverages [Clothing] Deck shoes [Fishing Equipment] | Cooler containing bait (keep livebait cool and dry, and keep minnows cool and wet) | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Thermos [Clothing] Gloves [Fishing Equipment] | Landing net | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] GPS unit or compass [Clothing] Waders or hip boots [Fishing Equipment] | Extra spool of line | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Knife or multitool [Clothing] Fleece jacket [Fishing Equipment] | Measuring tape | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
0315f41e_ent_and_Clothing___For_Dummies__Fishing_Equipment | [General Equipment] Lighter or matches in waterproof case [Clothing] Shirt – SPF fabric and longsleeved [Fishing Equipment] | Castnet or seine if you plan to gather bait | [] | Outfitting Your Fishing Trip with the Right Equipment and Clothing - For Dummies | Fishing Equipment | http://www.dummies.com/how-to/content/outfitting-your-fishing-trip-with-the-right-equipm.seriesId-240203.html | 39/1438042989126.22_20150728002309-00059-ip-10-236-191-2_414769670_0.json |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.