id
stringlengths
3
8
content
stringlengths
100
981k
11571333
from __future__ import absolute_import, division, print_function import tensorflow as tf import sys sys.path.append("..") from stg_node import * from utils.learning import * class InputTensorSummarizer(object): def __init__(self, features, labels, mode, hps, node, robot_node, neighbors_via_edge_type, instance_connected_to_robot, edge_state_combine_method, edge_influence_combine_method): self.hps = hps TD = {} # tensor_dict self.robot_traj = robot_traj = features[robot_node] self.our_traj = our_traj = features[node] self.extras = extras = features["extras"] self.traj_lengths = features["traj_lengths"] self.features = features self.node = node self.robot_node = robot_node self.neighbors_via_edge_type = neighbors_via_edge_type self.connected_edge_types = neighbors_via_edge_type.keys() self.instance_connected_to_robot = instance_connected_to_robot self.edge_state_combine_method = edge_state_combine_method self.edge_influence_combine_method = edge_influence_combine_method our_present = str(self.node) + "_present" robot_present = str(self.robot_node) + "_present" our_future = str(self.node) + "_future" robot_future = str(self.robot_node) + "_future" self.node_type_connects_to_robot = False for edge_type in self.connected_edge_types: if 'robot' in edge_type: self.node_type_connects_to_robot = True break with tf.variable_scope(self.node.type, reuse=tf.AUTO_REUSE): with tf.variable_scope("data_rearranging"): if mode == tf.estimator.ModeKeys.TRAIN: mhl, ph = self.hps.minimum_history_length, self.hps.prediction_horizon self.bag_idx = bag_idx = features["bag_idx"] self.prediction_timesteps = mhl - 1 + tf.mod(tf.random_uniform(self.traj_lengths.shape, maxval=2**31-1, dtype=tf.int32), self.traj_lengths-mhl-ph+1) TD[robot_present] = extract_subtensor_per_batch_element(robot_traj, self.prediction_timesteps) # [bs, state_dim] TD[our_present] = extract_subtensor_per_batch_element(our_traj, self.prediction_timesteps) # [bs, state_dim] TD["extras_present"] = extract_subtensor_per_batch_element(extras, self.prediction_timesteps) # [bs, extras_dim] TD["bag_idx"] = extract_subtensor_per_batch_element(bag_idx, self.prediction_timesteps) # [bs, 1] TD[robot_future] = tf.stack([extract_subtensor_per_batch_element(robot_traj, self.prediction_timesteps+i+1) for i in range(self.hps.prediction_horizon)], axis=1) # [bs, ph, state_dim] TD[our_future] = tf.stack([extract_subtensor_per_batch_element(labels, self.prediction_timesteps+i+1) for i in range(self.hps.prediction_horizon)], axis=1) # [bs, ph, state_dim] elif mode == tf.estimator.ModeKeys.EVAL: self.bag_idx = bag_idx = features["bag_idx"] TD[robot_present] = self.extract_ragged_subarray(robot_traj) # [nbs, state_dim] TD[our_present] = self.extract_ragged_subarray(our_traj) # [nbs, state_dim] TD["extras_present"] = self.extract_ragged_subarray(extras) # [nbs, extras_dim] TD["bag_idx"] = self.extract_ragged_subarray(bag_idx) # [nbs, 1] TD[robot_future] = tf.stack([self.extract_ragged_subarray(robot_traj, i+1) for i in range(self.hps.prediction_horizon)], axis=1) # [nbs, ph, state_dim] TD[our_future] = tf.stack([self.extract_ragged_subarray(labels, i+1) for i in range(self.hps.prediction_horizon)], axis=1) # [nbs, ph, state_dim] elif mode == tf.estimator.ModeKeys.PREDICT: TD[robot_present] = self.extract_subarray_ends(robot_traj) # [bs, state_dim] TD[our_present] = self.extract_subarray_ends(our_traj) # [bs, state_dim] TD["extras_present"] = self.extract_subarray_ends(extras) # [bs, extras_dim] TD[robot_future] = features[robot_future] # [bs, ph, state_dim] our_prediction_present = tf.concat([TD[our_present][:,p:p+1] for p in hps.pred_indices], axis=1) # [bs/nbs, pred_dim] TD["joint_present"] = tf.concat([TD[robot_present], our_prediction_present], axis=1) # [bs/nbs, state_dim+pred_dim] # Node History TD["history_encoder"] = self.encode_node_history(mode) batch_size = tf.shape(TD["history_encoder"])[0] # Node Edges TD["edge_encoders"] = [self.encode_edge(mode, edge_type, self.neighbors_via_edge_type[edge_type]) for edge_type in self.connected_edge_types] # List of [bs/nbs, enc_rnn_dim] TD["total_edge_influence"] = self.encode_total_edge_influence(TD["edge_encoders"], batch_size, mode) # [bs/nbs, 4*enc_rnn_dim] # Tiling for multiple samples if mode == tf.estimator.ModeKeys.PREDICT: # This tiling is done because: # a) we must consider the prediction case where there are many candidate robot future actions, # b) the edge and history encoders are all the same regardless of which candidate future robot action we're evaluating. TD["joint_present"] = tf.tile(TD["joint_present"], [tf.shape(features[robot_future])[0], 1]) TD[robot_present] = tf.tile(TD[robot_present], [tf.shape(features[robot_future])[0], 1]) TD["history_encoder"] = tf.tile(TD["history_encoder"], [tf.shape(features[robot_future])[0], 1]) TD["total_edge_influence"] = tf.tile(TD["total_edge_influence"], [tf.shape(features[robot_future])[0], 1]) concat_list = list() # Every node has an edge-influence encoder (which could just be zero). concat_list.append(TD["total_edge_influence"]) # [bs/nbs, 4*enc_rnn_dim] # Every node has a history encoder. concat_list.append(TD["history_encoder"]) # [bs/nbs, enc_rnn_dim] if self.instance_connected_to_robot: TD[self.robot_node.type + "_robot_future_encoder"] = self.encode_node_future(TD[robot_present], TD[robot_future], mode, self.robot_node.type + '_robot') # [bs/nbs, 4*enc_rnn_dim] concat_list.append(TD[self.robot_node.type + "_robot_future_encoder"]) else: # Four times because we're trying to mimic a bi-directional RNN's output (which is c and h from both ends). concat_list.append(tf.zeros([batch_size, 4*self.hps.enc_rnn_dim_future[0]])) TD["x"] = tf.concat(concat_list, axis=1) # [bs/nbs, (4 + 1 + 4)*enc_rnn_dim] if mode == tf.estimator.ModeKeys.TRAIN or mode == tf.estimator.ModeKeys.EVAL: TD[self.node.type + "_future_encoder"] = self.encode_node_future(TD[our_present], TD[our_future], mode, self.node.type) # [bs/nbs, 4*enc_rnn_dim] self.tensor_dict = TD def encode_multiple_input_states(self, input_feature_list, mode): with tf.variable_scope("multiple_input_encoder"): cell = stacked_rnn_cell(self.hps.rnn_cell, self.hps.rnn_cell_kwargs, self.hps.enc_rnn_dim_multiple_inputs, self.hps.rnn_io_dropout_keep_prob, mode) # THIS IS BROKEN NOW! # axis=1 because then we get size [batch_size, num_inputs, max_time, depth] encoded_edges = tf.stack(input_feature_list, axis=1) print(encoded_edges.get_shape()) outputs, _ = tf.nn.bidirectional_dynamic_rnn(cell, cell, input_feature_list, sequence_length=len(input_feature_list), dtype=tf.float32, time_major=False) # outputs, _ = tf.nn.dynamic_rnn(cell, node_history, self.traj_lengths, # dtype=tf.float32, # time_major=False) # [bs, max_time, enc_rnn_dim] if mode == tf.estimator.ModeKeys.TRAIN: return extract_subtensor_per_batch_element(outputs, self.prediction_timesteps) elif mode == tf.estimator.ModeKeys.EVAL: return self.extract_ragged_subarray(outputs) # [nbs, enc_rnn_dim] elif mode == tf.estimator.ModeKeys.PREDICT: return self.extract_subarray_ends(outputs) # [bs, enc_rnn_dim] def encode_edge(self, mode, edge_type, connected_nodes): with tf.variable_scope(edge_type, reuse=tf.AUTO_REUSE): with tf.variable_scope("edge_encoder"): cell = stacked_rnn_cell(self.hps.rnn_cell, self.hps.rnn_cell_kwargs, self.hps.enc_rnn_dim_edge, self.hps.rnn_io_dropout_keep_prob, mode) if mode == tf.estimator.ModeKeys.PREDICT: naming_func = lambda x: str(x) else: naming_func = lambda x: x input_feature_list = [self.features[node] for node in connected_nodes] if self.edge_state_combine_method == 'sum': # Used in Structural-RNN. stacked_edge_states = tf.stack(input_feature_list, axis=0) combined_neighbors = tf.reduce_sum(stacked_edge_states, axis=0) elif self.edge_state_combine_method == 'max': # Used in NLP, e.g. max over word embeddings. stacked_edge_states = tf.stack(input_feature_list, axis=0) combined_neighbors = tf.reduce_max(stacked_edge_states, axis=0) elif self.edge_state_combine_method == 'mean': # Least destructive method that allows for a fixed output size. stacked_edge_states = tf.stack(input_feature_list, axis=0) combined_neighbors = tf.reduce_mean(stacked_edge_states, axis=0) joint_history = tf.concat([combined_neighbors, self.our_traj, self.extras], 2, name="joint_history") outputs, _ = tf.nn.dynamic_rnn(cell, joint_history, self.traj_lengths, dtype=tf.float32, time_major=False) # [bs, max_time, enc_rnn_dim] if mode == tf.estimator.ModeKeys.TRAIN: return extract_subtensor_per_batch_element(outputs, self.prediction_timesteps) elif mode == tf.estimator.ModeKeys.EVAL: return self.extract_ragged_subarray(outputs) # [nbs, enc_rnn_dim] elif mode == tf.estimator.ModeKeys.PREDICT: return self.extract_subarray_ends(outputs) # [bs, enc_rnn_dim] def encode_total_edge_influence(self, encoded_edges, batch_size, mode): with tf.variable_scope(self.node.type, reuse=tf.AUTO_REUSE): with tf.variable_scope("total_edge_influence_encoder"): if self.edge_influence_combine_method == 'sum': stacked_encoded_edges = tf.stack(encoded_edges, axis=0) combined_edges = tf.reduce_sum(stacked_encoded_edges, axis=0) elif self.edge_influence_combine_method == 'max': stacked_encoded_edges = tf.stack(encoded_edges, axis=0) combined_edges = tf.reduce_max(stacked_encoded_edges, axis=0) elif self.edge_influence_combine_method == 'bi-rnn': if len(encoded_edges) == 0: # Four times because we're trying to mimic a bi-directional # RNN's output (which is c and h from both ends). combined_edges = tf.zeros([batch_size, 4*self.hps.enc_rnn_dim_edge_influence[0]]) else: cell = stacked_rnn_cell(self.hps.rnn_cell, self.hps.rnn_cell_kwargs, self.hps.enc_rnn_dim_edge_influence, self.hps.rnn_io_dropout_keep_prob, mode) # axis=1 because then we get size [batch_size, max_time, depth] encoded_edges = tf.stack(encoded_edges, axis=1) _, state = tf.nn.bidirectional_dynamic_rnn(cell, cell, encoded_edges, dtype=tf.float32, time_major=False) combined_edges = tf.concat([unpack_RNN_state(state[0]), unpack_RNN_state(state[1])], axis=1) return combined_edges def encode_node_history(self, mode): with tf.variable_scope(self.node.type, reuse=tf.AUTO_REUSE): with tf.variable_scope("history_encoder"): cell = stacked_rnn_cell(self.hps.rnn_cell, self.hps.rnn_cell_kwargs, self.hps.enc_rnn_dim_history, self.hps.rnn_io_dropout_keep_prob, mode) node_history = tf.concat([self.our_traj, self.extras], 2, name="node_history") outputs, _ = tf.nn.dynamic_rnn(cell, node_history, self.traj_lengths, dtype=tf.float32, time_major=False) # [bs, max_time, enc_rnn_dim] if mode == tf.estimator.ModeKeys.TRAIN: return extract_subtensor_per_batch_element(outputs, self.prediction_timesteps) elif mode == tf.estimator.ModeKeys.EVAL: return self.extract_ragged_subarray(outputs) # [nbs, enc_rnn_dim] elif mode == tf.estimator.ModeKeys.PREDICT: return self.extract_subarray_ends(outputs) # [bs, enc_rnn_dim] def encode_node_future(self, node_present, node_future, mode, scope): with tf.variable_scope(scope, reuse=tf.AUTO_REUSE): with tf.variable_scope("future_encoder"): cell = stacked_rnn_cell(self.hps.rnn_cell, self.hps.rnn_cell_kwargs, self.hps.enc_rnn_dim_future, self.hps.rnn_io_dropout_keep_prob, mode) initial_state = project_to_RNN_initial_state(cell, node_present) _, state = tf.nn.bidirectional_dynamic_rnn(cell, cell, node_future, initial_state_fw=initial_state, dtype = tf.float32, time_major=False) return tf.concat([unpack_RNN_state(state[0]), unpack_RNN_state(state[1])], axis=1) def extract_ragged_subarray(self, tensor, offset=0): # defines a new "batch size", call it "nbs" mhl, ph = self.hps.minimum_history_length, self.hps.prediction_horizon return tf.boolean_mask(tensor[:,mhl-1+offset:,:], #tensor.shape[1] tf.sequence_mask(self.traj_lengths-mhl-ph+1, tf.shape(tensor)[1]-mhl+1-offset)) def extract_subarray_ends(self, tensor, offset=0): # ON THE CHOPPING BLOCK return extract_subtensor_per_batch_element(tensor, self.traj_lengths-1+offset)
11571349
from functools import wraps from disco.bot.command import CommandEvent def require(*perms): def func_wrap(func): @wraps(func) def wrapper(self, event: CommandEvent, *args, **kwargs): perm_code = event.channel.get_permissions(event.author.id) if perm_code.can(*perms): func(self, event, *args, **kwargs) else: event.msg.reply("Sorry, but you do not have sufficient privileges to do this.") return wrapper return func_wrap def parse_member(func): @wraps(func) def wrapper(self, event: CommandEvent, member: str, *args, **kwargs): if member.isnumeric(): real_member = event.guild.members.get(int(member)) elif len(event.msg.mentions) == 1: real_member = event.guild.members.get(next(iter(event.msg.mentions))) # Epic Hacks lmao else: for guild_member in event.guild.members.values(): if "#".join([guild_member.user.username, guild_member.user.discriminator]) == member: real_member = guild_member break else: real_member = None if real_member is None: event.msg.reply("Sorry, but we could not find the user ({user})".format(user=member)) else: func(self, event, real_member, *args, **kwargs) return wrapper
11571355
def application(environ, start_response): content_length = int(environ.get('CONTENT_LENGTH', 0)) body = bytes(environ['wsgi.input'].read(content_length)) start_response('200', [('Content-Length', str(len(body)))]) return [body]
11571376
import sys from os.path import join, isdir, sep from os import listdir from mock import patch from nose.tools import raises fake_path = join('tmp', 'file_fake', '') def random_string_gen(range1=12): import string import random return ''.join(random.choice(string.ascii_uppercase) for i in range(range1)) # redirect output for testing from contextlib import contextmanager try: # compatibility with python2 and python3. from StringIO import StringIO except ImportError: from io import StringIO @contextmanager def captured_output(): new_out, new_err = StringIO(), StringIO() old_out, old_err = sys.stdout, sys.stderr try: sys.stdout, sys.stderr = new_out, new_err yield sys.stdout, sys.stderr finally: sys.stdout, sys.stderr = old_out, old_err def init_imports(): try: import errno import menpo import menpodetect import menpofit return 1 except ImportError: return -1 def test_init_functions(): assert(init_imports() == 1) # confirm that all imports work p1 = './' + random_string_gen(25) msg = random_string_gen(23) from ..utils import check_if_path with captured_output() as (out, err): # check_if_path prints the right message for non-existent paths. check_if_path(p1, msg) output = out.getvalue().strip() assert(output == msg) assert(check_if_path('.', '') is True) # should return True, since this is a path. # fake_path = '/tmp/test.fake/' # tt = check_if_path(fake_path, '') # mock1.assert_called_once_with(fake_path) def test_crop_rescale_img(): from .pipeline_aux import crop_rescale_img from menpo.image import Image import numpy as np from menpo.shape import PointCloud test_img = Image(np.random.random([100, 100])) test_img.landmarks['PT'] = PointCloud([[20, 20], [20, 40], [40, 80], [40, 20]]) res_im = crop_rescale_img(test_img.copy()) # crop image and check reduced shapes assert(res_im.shape[0] < test_img.shape[0]) assert(res_im.shape[1] < test_img.shape[1]) res_im2 = crop_rescale_img(test_img.copy(), crop_reading=1, pix_thres=40) # check pixel threshold assert(res_im2.shape[0] < test_img.shape[0]) res_im3 = crop_rescale_img(test_img.copy(), crop_reading=1, pix_thres=400) # test that the image remains the same assert(res_im3.shape[1] > test_img.shape[1]-3) def test_pipeline_aux(): # @patch.object(pipeline_aux, 'load_images') # def test_pipeline_aux(mock_load): from .pipeline_aux import check_img_type, load_images with patch('sys.stdout', new=StringIO()) as fake_out: # check_img_type for non valid path check_img_type(['greg', 'l1', 'm1'], fake_path) assert('valid path' in fake_out.getvalue()) def test_pipeline_aux_load_images(): from .pipeline_aux import load_images with patch('sys.stdout', new=StringIO()) as fake_out: # check for negative number of images as max_images load_images(listdir('.'), '.', '.', '', max_images=-5) assert('negative' in fake_out.getvalue()) # since python files (*.py) are here, it will fail reading an image at least once. assert('Ignoring' in fake_out.getvalue()) with patch('sys.stdout', new=StringIO()) as fake_out: # check for positive number of images load_images(listdir('.'), '.', '.', '', max_images=5) assert('negative' not in fake_out.getvalue()) with patch('sys.stdout', new=StringIO()) as fake_out: # check for not valid path if not isdir(fake_path): ret = load_images(listdir('.'), fake_path, fake_path, '', max_images=5) print(fake_out) assert('not a valid path' in fake_out.getvalue()) assert(ret == []) @raises(AssertionError) def test_strip_separators_in_the_end_error(): from ..utils import strip_separators_in_the_end strip_separators_in_the_end(9) def test_strip_separators_in_the_end(): from ..utils import strip_separators_in_the_end name = 'fake1' name1 = name + sep assert(name == strip_separators_in_the_end(name1)) # one sep in the end assert(name == strip_separators_in_the_end(name)) # no sep in the end name1 += sep*3 assert(name == strip_separators_in_the_end(name1)) # several sep in the end assert('' == strip_separators_in_the_end('')) # several sep in the end
11571388
from . import nodes from .lexer import LlvmIrLexer from .parser import LlvmIrParser from .codegenerator import CodeGenerator def llvm_to_ir(source): """ Convert llvm assembly code into an IR-module """ llvm = LlvmIrFrontend() ir_module = llvm.compile(source) return ir_module class LlvmIrFrontend: def __init__(self): context = nodes.Context() self.lexer = LlvmIrLexer(context) self.parser = LlvmIrParser(context) self.codegen = CodeGenerator() def compile(self, f): src = f.read() if f.name: self.lexer.filename = f.name tokens = self.lexer.tokenize(src, eof=True) self.parser.init_lexer(tokens) module = self.parser.parse_module() return self.codegen.generate(module)
11571412
import asyncio from dataclasses import asdict from model.Price import Price from services.fetch import fetch_json from services.s3 import write_to_s3 from services.time import current_time async def bitcoin_price(session, s3_client): coingecko, gemini, blockchain = await asyncio.gather( fetch_json(session, "https://api.coingecko.com/api/v3/exchange_rates"), fetch_json(session, "https://api.gemini.com/v1/pubticker/btcusd"), fetch_json(session, "https://api.blockchain.info/stats") ) prices = [ Price( source="coingecko", price=coingecko["rates"]["usd"]["value"] ), Price( source="gemini", price=float(gemini["last"]) ), Price( source="blockchain", price=blockchain["market_price_usd"] ) ] prices_document = { 'last_updated': current_time(), 'prices': [asdict(price) for price in prices] } await write_to_s3(prices_document, 'bitcoin_price', client=s3_client)
11571416
import cv2 import torch.hub import os import model from PIL import Image from torchvision import transforms from grad_cam import BackPropagation import time import matplotlib.pyplot as plt import matplotlib.image as mpimg import threading import vlc from os.path import dirname, join from twilio.rest import Client import urllib.request import smbus import json class MMA7455(): bus = smbus.SMBus(1) def __init__(self): self.bus.write_byte_data(0x1D, 0x16, 0x55) # Setup the Mode self.bus.write_byte_data(0x1D, 0x10, 0) # Calibrate self.bus.write_byte_data(0x1D, 0x11, 0) # Calibrate self.bus.write_byte_data(0x1D, 0x12, 0) # Calibrate self.bus.write_byte_data(0x1D, 0x13, 0) # Calibrate self.bus.write_byte_data(0x1D, 0x14, 0) # Calibrate self.bus.write_byte_data(0x1D, 0x15, 0) # Calibrate def getValueX(self): return self.bus.read_byte_data(0x1D, 0x06) def getValueY(self): return self.bus.read_byte_data(0x1D, 0x07) def getValueZ(self): return self.bus.read_byte_data(0x1D, 0x08) current_dir = dirname(__file__) # Alarm sound file file = 'alarm.mp3' # Sound player start p = vlc.MediaPlayer(current_dir+'/'+file) timebasedrow= time.time() timebasedis= time.time() timerundrow= time.time() timerundis= time.time() face_cascade = cv2.CascadeClassifier(current_dir+'/haar_models/haarcascade_frontalface_default.xml') eye_cascade = cv2.CascadeClassifier(current_dir+'/haar_models/haarcascade_eye.xml') MyModel="BlinkModel.t7" shape = (24,24) classes = [ 'Close', 'Open', ] eyess=[] cface=0 sens=30 mma = MMA7455() # Obtaining the X, Y and Z values. xmem=mma.getValueX() ymem=mma.getValueY() zmem=mma.getValueZ() x = mma.getValueX() y = mma.getValueY() z = mma.getValueZ() # Creating the base accelerometer values. if(xmem > 127): xmem=xmem-255 if(ymem > 127): ymem=ymem-255 if(zmem > 127): zmem=zmem-255 if(x > 127): x=x-255 if(y > 127): y=y-255 if(z > 127): z=z-255 def send(): # Your Account SID from twilio.com/console account_sid = "XXXXXXXX<KEY>" # Your Auth Token from twilio.com/console auth_token = "<PASSWORD>" client = Client(account_sid, auth_token) phone = "+XXXXXXXXXXXX" print('crash') send_url = 'http://ip-api.com/json' r = requests.get(send_url) j = json.loads(r.text) text="The Driver Crash Here: " text+="http://maps.google.com/maps?q=loc:{},{}".format(j['lat'],j['lon']) print(text) message = client.messages.create(to=phone, from_="++XXXXXXXXXXXX",body=text) print(message.sid) time.sleep(10) stop() def preprocess(image_path): global cface transform_test = transforms.Compose([ transforms.ToTensor() ]) image = cv2.imread(image_path['path']) faces = face_cascade.detectMultiScale( image, scaleFactor=1.1, minNeighbors=5, minSize=(1, 1), flags=cv2.CASCADE_SCALE_IMAGE ) if len(faces) == 0: ... else: cface=1 (x, y, w, h) = faces[0] face = image[y:y + h, x:x + w] cv2.rectangle(image,(x,y),(x+w,y+h),(255,255,0),2) roi_color = image[y:y+h, x:x+w] """ Depending on the quality of your camera, this number can vary between 10 and 40, since this is the "sensitivity" to detect the eyes. """ sensi=20 eyes = eye_cascade.detectMultiScale(face,1.3, sensi) i=0 for (ex,ey,ew,eh) in eyes: (x, y, w, h) = eyes[i] cv2.rectangle(roi_color,(ex,ey),(ex+ew,ey+eh),(0,255,0),2) eye = face[y:y + h, x:x + w] eye = cv2.resize(eye, shape) eyess.append([transform_test(Image.fromarray(eye).convert('L')), eye, cv2.resize(face, (48,48))]) i=i+1 cv2.imwrite(current_dir+'/temp-images/display.jpg',image) def eye_status(image, name, net): img = torch.stack([image[name]]) bp = BackPropagation(model=net) probs, ids = bp.forward(img) actual_status = ids[:, 0] prob = probs.data[:, 0] if actual_status == 0: prob = probs.data[:,1] #print(name,classes[actual_status.data], probs.data[:,0] * 100) return classes[actual_status.data] def func(imag,modl): drow(images=[{'path': imag, 'eye': (0,0,0,0)}],model_name=modl) def drow(images, model_name): global eyess global cface global timebasedrow global timebasedis global timerundrow global timerundis net = model.Model(num_classes=len(classes)) checkpoint = torch.load(os.path.join(current_dir+'/model', model_name), map_location=torch.device('cpu')) net.load_state_dict(checkpoint['net']) net.eval() flag =1 status="" for i, image in enumerate(images): if(flag): preprocess(image) flag=0 if cface==0: image = cv2.imread(current_dir+"/temp-images/display.jpg") image = cv2.putText(image, 'No face Detected', (50, 50), cv2.FONT_HERSHEY_SIMPLEX, 1, (255, 0, 0), 2, cv2.LINE_AA) cv2.imwrite(current_dir+'/temp-images/display.jpg',image) timebasedrow= time.time() timebasedis= time.time() timerundrow= time.time() timerundis= time.time() elif(len(eyess)!=0): eye, eye_raw , face = eyess[i] image['eye'] = eye image['raw'] = eye_raw image['face'] = face timebasedrow= time.time() timerundrow= time.time() for index, image in enumerate(images): status = eye_status(image, 'eye', net) if(status =="Close"): timerundis= time.time() if((timerundis-timebasedis)>1.5): image = cv2.imread(current_dir+'/temp-images/display.jpg') image = cv2.putText(image, 'Distracted', (50, 50), cv2.FONT_HERSHEY_SIMPLEX, 1, (255, 0, 0), 2, cv2.LINE_AA) cv2.imwrite(current_dir+'/temp-images/display.jpg',image) if(not(p.is_playing())): p.play() else: p.stop() else: timerundrow= time.time() if((timerundrow-timebasedrow)>3): if(not(p.is_playing())): p.play() image = cv2.imread(current_dir+'/temp-images/display.jpg') image = cv2.putText(image, 'Drowsy', (50, 50), cv2.FONT_HERSHEY_SIMPLEX, 1, (255, 0, 0), 2, cv2.LINE_AA) cv2.imwrite(current_dir+'/temp-images/display.jpg',image) def main(): while 1: global eyess global cface eyess=[] cface=0 ret, img = cap.read() cv2.imwrite(current_dir+'/temp-images/img.jpg',img) func(current_dir+'/temp-images/img.jpg',MyModel) def readAccel(): while 1: try: x = mma.getValueX() y = mma.getValueY() z = mma.getValueZ() if(x > 127): x=x-255 if(y > 127): y=y-255 if(z > 127): z=z-255 # Send sms if crash if(abs(xmem-x)>sens or abs(ymem-y)>sens or abs(zmem-z)>sens): send() print('Crash') except: ... cap = cv2.VideoCapture(0) timebasedrow= time.time() timebasedis= time.time() timerundrow= time.time() timerundis= time.time() r = threading.Thread(target=readAccel, name='readAccel') m = threading.Thread(target=main, name='main') r.start() m.start()
11571418
from service.appservice import AppService if __name__ == '__main__': service = AppService(new_toolchain=True)
11571454
import requests from resources.lib.soundcloud.api_interface import ApiInterface class ApiPublic(ApiInterface): """This class uses the official SoundCloud API.""" api_host = "https://api.soundcloud.com/" def _do_request(self, path, payload): return requests.get(self.api_host + path, params=payload).json() def search(self, query, kind): pass def charts(self, filters): pass def call(self, url): pass def discover(self, selection): pass def resolve_id(self, id): pass def resolve_url(self, url): pass def resolve_media_url(self, url): pass
11571473
import os.path from typing import List import pytest from click.testing import CliRunner from localstack.cli.lpm import cli, console from localstack.services.install import CommunityInstallerRepository, Installer @pytest.fixture def runner(): return CliRunner() @pytest.mark.skip_offline def test_list(runner, monkeypatch): monkeypatch.setattr(console, "no_color", True) result = runner.invoke(cli, ["list"]) assert result.exit_code == 0 assert "elasticmq/community" in result.output @pytest.mark.skip_offline def test_install_with_non_existing_package_fails(runner): result = runner.invoke(cli, ["install", "elasticmq", "funny"]) assert result.exit_code == 1 assert "unable to locate installer for package funny" in result.output @pytest.mark.skip_offline def test_install_failure_returns_non_zero_exit_code(runner, monkeypatch): def failing_installer(): raise Exception("failing installer") def successful_installer(): pass def patched_get_installer(self) -> List[Installer]: return [ ("failing-installer", failing_installer), ("successful-installer", successful_installer), ] monkeypatch.setattr(CommunityInstallerRepository, "get_installer", patched_get_installer) result = runner.invoke(cli, ["install", "successful-installer", "failing-installer"]) assert result.exit_code == 1 assert "one or more package installations failed." in result.output @pytest.mark.skip_offline def test_install_with_package(runner): from localstack.services.install import INSTALL_PATH_ELASTICMQ_JAR result = runner.invoke(cli, ["install", "elasticmq"]) assert result.exit_code == 0 assert os.path.exists(INSTALL_PATH_ELASTICMQ_JAR)
11571530
import torch class AffineLandmarkTransformation(torch.nn.Module): """ Layer to apply a given transformation matrix to a set of landmarks """ def __init__(self): super().__init__() def forward(self, lmk_tensor, affine_tensor, inverse=False): """ the actual transformation Parameters ---------- lmk_tensor : :class:`torch.Tensor` the landmarks to transform (of shape N x Num_landmarks x 2) affine_tensor : :class:`torch.Tensor` the transformation to apply (of shape N x 6) inverse : bool, optional whether to apply the given transformation or it's inverse (the default is False) Returns ------- :class:`torch.Tensor` the transformed landmarks """ A = torch.zeros((affine_tensor.size(0), 2, 2), device=affine_tensor.device) A[:, 0] = affine_tensor[:, :2].clone() A[:, 1] = affine_tensor[:, 2:4].clone() t = affine_tensor[:, 4:6].clone() if inverse: A = A.inverse() t = torch.bmm( (-t).view(affine_tensor.size(0), -1, 2), A.permute(0, 2, 1)) t = t.squeeze(1) output = torch.bmm(lmk_tensor.view(affine_tensor.size(0), -1, 2), A) t = t.unsqueeze(1) output = output + t output = output.view(affine_tensor.size(0), -1, 2) return output
11571564
from .bbox_head import BBoxHead from .convfc_bbox_head import ConvFCBBoxHead, SharedFCBBoxHead from .centripetal_mask import Centripetal_mask __all__ = [ 'BBoxHead', 'ConvFCBBoxHead', 'SharedFCBBoxHead', 'Centripetal_mask' ]
11571572
import random as r #function for otp generation def otpgen(): otp="" for i in range(5): otp+=str(r.randint(1,9)) print("Your One Time Password is ") print(otp) otpgen()
11571586
from django import template from django.conf import settings from django.contrib import admin from django.contrib.admin import AdminSite from django.urls import resolve, reverse register = template.Library() def get_semantic_sidebar(app_list, current_app): semantic_sidebar = getattr(settings, "SEMANTIC_SIDEBAR", None) if semantic_sidebar: ordered = [] for app_label in semantic_sidebar: for app in app_list: is_current = app["app_label"] == current_app app["is_current"] = is_current if app_label == app["app_label"]: ordered.append(app) app_list = ordered return app_list def get_app_label(resolver_match): if "app_label" in resolver_match.kwargs: return resolver_match.kwargs.get("app_label") else: # Reconstruct from url_name. url_name = resolver_match.url_name # Exclude model and action. parts = url_name.split("_")[:-2] # Return parts. return "_".join(parts) @register.simple_tag(takes_context=True) def get_app_list(context): request = context["request"] resolver_match = resolve(request.path_info) admin_name = resolver_match.namespace current_app = get_app_label(resolver_match) admin_site = get_admin_site(admin_name) app_list = admin_site.get_app_list(request) return get_semantic_sidebar(app_list, current_app) def get_admin_site(current_app): try: resolver_match = resolve(reverse("%s:index" % current_app)) for func_closure in resolver_match.func.func_closure: if isinstance(func_closure.cell_contents, AdminSite): return func_closure.cell_contents except Exception: pass return admin.site def get_admin_url(request, admin_site): try: url = "{}:index".format(admin_site) url = reverse(url) except Exception: pass else: return url @register.simple_tag(takes_context=True) def admin_apps(context): return get_app_list(context)
11571598
from .best_config import BEST_CONFIGS from .dgl_graph import * from .utils import * from .evaluator import * from .logger import Logger
11571609
import numpy as np import scipy.io as sio import argparse from camera import Camera from plotting import * # A very simple, but useful method to take the difference between the # first and second element (usually for 2D vectors) def diff(x): return x[1] - x[0] ''' FORM_INITIAL_VOXELS create a basic grid of voxels ready for carving Arguments: xlim - The limits of the x dimension given as [xmin xmax] ylim - The limits of the y dimension given as [ymin ymax] zlim - The limits of the z dimension given as [zmin zmax] num_voxels - The approximate number of voxels we desire in our grid Returns: voxels - An ndarray of size (N, 3) where N is approximately equal the num_voxels of voxel locations. voxel_size - The distance between the locations of adjacent voxels (a voxel is a cube) Our initial voxels will create a rectangular prism defined by the x,y,z limits. Each voxel will be a cube, so you'll have to compute the approximate side-length (voxel_size) of these cubes, as well as how many cubes you need to place in each dimension to get around the desired number of voxel. This can be accomplished by first finding the total volume of the voxel grid and dividing by the number of desired voxels. This will give an approximate volume for each cubic voxel, which you can then use to find the side-length. The final "voxels" output should be a ndarray where every row is the location of a voxel in 3D space. ''' def form_initial_voxels(xlim, ylim, zlim, num_voxels): # TODO: Implement this method! x_dim = xlim[-1] - xlim[0] y_dim = ylim[-1] - ylim[0] z_dim = zlim[-1] - zlim[0] total_volume = x_dim * y_dim * z_dim voxel_volume = float(total_volume / num_voxels) voxel_size = np.cbrt(voxel_volume) x_voxel_num = np.round(x_dim / voxel_size) y_voxel_num = np.round(y_dim / voxel_size) z_voxel_num = np.round(z_dim / voxel_size) x_coor = np.linspace(xlim[0]+0.5*voxel_size, xlim[0]+(0.5+x_voxel_num-1)*voxel_size, x_voxel_num) y_coor = np.linspace(ylim[0]+0.5*voxel_size, ylim[0]+(0.5+y_voxel_num-1)*voxel_size, y_voxel_num) z_coor = np.linspace(zlim[0]+0.5*voxel_size, zlim[0]+(0.5+z_voxel_num-1)*voxel_size, z_voxel_num) XX, YY, ZZ = np.meshgrid(x_coor, y_coor, z_coor) voxels = np.vstack((XX.reshape(-1), YY.reshape(-1), ZZ.reshape(-1))).reshape(3, -1).T return voxels, voxel_size ''' GET_VOXEL_BOUNDS: Gives a nice bounding box in which the object will be carved from. We feed these x/y/z limits into the construction of the inital voxel cuboid. Arguments: cameras - The given data, which stores all the information associated with each camera (P, image, silhouettes, etc.) estimate_better_bounds - a flag that simply tells us whether to set tighter bounds. We can carve based on the silhouette we use. num_voxels - If estimating a better bound, the number of voxels needed for a quick carving. Returns: xlim - The limits of the x dimension given as [xmin xmax] ylim - The limits of the y dimension given as [ymin ymax] zlim - The limits of the z dimension given as [zmin zmax] The current method is to simply use the camera locations as the bounds. In the section underneath the TODO, please implement a method to find tigther bounds: One such approach would be to do a quick carving of the object on a grid with very few voxels. From this coarse carving, we can determine tighter bounds. Of course, these bounds may be too strict, so we should have a buffer of one voxel_size around the carved object. ''' def get_voxel_bounds(cameras, estimate_better_bounds = False, num_voxels = 4000): camera_positions = np.vstack([c.T for c in cameras]) xlim = [camera_positions[:,0].min(), camera_positions[:,0].max()] ylim = [camera_positions[:,1].min(), camera_positions[:,1].max()] zlim = [camera_positions[:,2].min(), camera_positions[:,2].max()] # For the zlim we need to see where each camera is looking. camera_range = 0.6 * np.sqrt(diff( xlim )**2 + diff( ylim )**2) for c in cameras: viewpoint = c.T - camera_range * c.get_camera_direction() zlim[0] = min( zlim[0], viewpoint[2] ) zlim[1] = max( zlim[1], viewpoint[2] ) # Move the limits in a bit since the object must be inside the circle xlim = xlim + diff(xlim) / 4 * np.array([1, -1]) ylim = ylim + diff(ylim) / 4 * np.array([1, -1]) if estimate_better_bounds: # TODO: Implement this method! voxels, voxel_size = form_initial_voxels(xlim, ylim, zlim, num_voxels) for c in cameras: voxels = carve(voxels, c) xlim = [voxels[0][0]-1.5*voxel_size, voxels[0][0]+1.5*voxel_size] ylim = [voxels[0][1]-1.5*voxel_size, voxels[0][1]+1.5*voxel_size] zlim = [voxels[0][2]-1.5*voxel_size, voxels[0][2]+1.5*voxel_size] return xlim, ylim, zlim ''' CARVE: carves away voxels that are not inside the silhouette contained in the view of the camera. The resulting voxel array is returned. Arguments: voxels - an Nx3 matrix where each row is the location of a cubic voxel camera - The camera we are using to carve the voxels with. Useful data stored in here are the "silhouette" matrix, "image", and the projection matrix "P". Returns: voxels - a subset of the argument passed that are inside the silhouette ''' def carve(voxels, camera): # TODO: Implement this method! # find all corresponding image points of voxels homo_voxels = np.hstack((voxels, np.ones((voxels.shape[0], 1)))).T # keep track of voxels index N = voxels.shape[0] voxel_index = np.arange(0, N) # project from 3D to 2D, projection matrix: (3, 4) P = camera.P img_voxels = P.dot(homo_voxels) # normalize img_voxels /= img_voxels[2, :] # drop out z img_voxels = img_voxels[0:2, :].T # check whether the voxel points are in range of image img_y_max, img_x_max = camera.silhouette.shape img_y_min = 0; img_x_min = 0 voxelX = img_voxels[:, 0] x_range_filter = np.all([voxelX > img_x_min, voxelX < img_x_max], axis=0) img_voxels = img_voxels[x_range_filter, :] voxel_index = voxel_index[x_range_filter] voxelY = img_voxels[:, 1] y_range_filter = np.all([voxelY > img_y_min, voxelY < img_y_max], axis=0) img_voxels = img_voxels[y_range_filter, :] voxel_index = voxel_index[y_range_filter] # check whether the point is in the silhouette img_voxels = img_voxels.astype(int) silhouette_filter = (camera.silhouette[img_voxels[:, 1], img_voxels[:, 0]] == 1) voxel_index = voxel_index[silhouette_filter] return voxels[voxel_index, :] ''' ESTIMATE_SILHOUETTE: Uses a very naive and color-specific heuristic to generate the silhouette of an object Arguments: im - The image containing a known object. An ndarray of size (H, W, C). Returns: silhouette - An ndarray of size (H, W), where each pixel location is 0 or 1. If the (i,j) value is 0, then that pixel location in the original image does not correspond to the object. If the (i,j) value is 1, then that that pixel location in the original image does correspond to the object. ''' def estimate_silhouette(im): return np.logical_and(im[:,:,0] > im[:,:,2], im[:,:,0] > im[:,:,1] ) if __name__ == '__main__': estimate_better_bounds = True use_true_silhouette = True frames = sio.loadmat('frames.mat')['frames'][0] cameras = [Camera(x) for x in frames] # Generate the silhouettes based on a color heuristic if not use_true_silhouette: for i, c in enumerate(cameras): c.true_silhouette = c.silhouette c.silhouette = estimate_silhouette(c.image) if i == 0: plt.figure() plt.subplot(121) plt.imshow(c.true_silhouette, cmap = 'gray') plt.title('True Silhouette') plt.subplot(122) plt.imshow(c.silhouette, cmap = 'gray') plt.title('Estimated Silhouette') plt.show() # Generate the voxel grid # You can reduce the number of voxels for faster debugging, but # make sure you use the full amount for your final solution num_voxels = 6e6 xlim, ylim, zlim = get_voxel_bounds(cameras, estimate_better_bounds) # This part is simply to test forming the initial voxel grid voxels, voxel_size = form_initial_voxels(xlim, ylim, zlim, 4000) plot_surface(voxels) voxels, voxel_size = form_initial_voxels(xlim, ylim, zlim, num_voxels) # Test the initial carving voxels = carve(voxels, cameras[0]) if use_true_silhouette: plot_surface(voxels) # Result after all carvings for c in cameras: voxels = carve(voxels, c) plot_surface(voxels, voxel_size)
11571620
import itertools import socket import unittest from stompest._backwards import nextMethod from stompest.error import StompConnectTimeout from stompest.protocol import StompFailoverUri, StompFailoverTransport from stompest.tests import mock class StompFailoverUriTest(unittest.TestCase): def test_configuration(self): uri = 'tcp://localhost:61613' configuration = StompFailoverUri(uri) self.assertEqual(configuration.brokers, [{'host': 'localhost', 'protocol': 'tcp', 'port': 61613}]) self.assertEqual(configuration.options, {'priorityBackup': False, 'initialReconnectDelay': 10, 'reconnectDelayJitter': 0, 'maxReconnectDelay': 30000, 'backOffMultiplier': 2.0, 'startupMaxReconnectAttempts': 0, 'maxReconnectAttempts':-1, 'useExponentialBackOff': True, 'randomize': True}) uri = 'tcp://123.456.789.0:61616?randomize=true,maxReconnectAttempts=-1,priorityBackup=true' configuration = StompFailoverUri(uri) self.assertTrue(configuration.options['randomize']) self.assertEqual(configuration.options['priorityBackup'], True) self.assertEqual(configuration.options['maxReconnectAttempts'], -1) self.assertEqual(configuration.brokers, [{'host': '123.456.789.0', 'protocol': 'tcp', 'port': 61616}]) uri = 'failover:(tcp://primary:61616,tcp://secondary:61616)?randomize=false,maxReconnectAttempts=2,backOffMultiplier=3.0' configuration = StompFailoverUri(uri) self.assertEqual(configuration.uri, uri) self.assertFalse(configuration.options['randomize']) self.assertEqual(configuration.options['backOffMultiplier'], 3.0) self.assertEqual(configuration.options['maxReconnectAttempts'], 2) self.assertEqual(configuration.brokers, [ {'host': 'primary', 'protocol': 'tcp', 'port': 61616}, {'host': 'secondary', 'protocol': 'tcp', 'port': 61616} ]) def test_configuration_invalid_uris(self): for uri in [ 'tcp://:61613', 'tcp://61613', 'tcp:localhost:61613', 'tcp:/localhost', 'tcp://localhost:', 'tcp://localhost:a', 'tcp://localhost:61613?randomize=1', 'tcp://localhost:61613?randomize=True', 'tcp://localhost:61613??=False', 'tcp://localhost:61613?a=False', 'tcp://localhost:61613?maxReconnectDelay=False' 'failover:(tcp://primary:61616, tcp://secondary:61616)', 'failover:tcp://primary:61616, tcp://secondary:61616', 'failover:tcp://primary:61616,tcp://secondary:61616)', 'failover:(tcp://primary:61616,tcp://secondary:61616', ]: self.assertRaises(ValueError, lambda: StompFailoverUri(uri)) class StompFailoverTest(unittest.TestCase): def test_time_scales_and_reconnect_attempts(self): uri = 'failover:tcp://remote1:61615,tcp://localhost:61616,tcp://remote2:61617?randomize=false,startupMaxReconnectAttempts=3,initialReconnectDelay=7,backOffMultiplier=3.0,maxReconnectAttempts=1' protocol = StompFailoverTransport(uri) expectedDelaysAndBrokers = [ (0, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}), (0.007, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}), (0.021, {'host': 'remote2', 'protocol': 'tcp', 'port': 61617}), (0.063, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}) ] self._test_failover(iter(protocol), expectedDelaysAndBrokers) expectedDelaysAndBrokers = [ (0, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}), (0.007, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}) ] self._test_failover(iter(protocol), expectedDelaysAndBrokers) uri = 'failover:(tcp://remote1:61615,tcp://localhost:61616)?randomize=false,startupMaxReconnectAttempts=3,initialReconnectDelay=7,maxReconnectDelay=8,maxReconnectAttempts=0' protocol = StompFailoverTransport(uri) expectedDelaysAndBrokers = [ (0, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}), (0.007, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}), (0.008, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}), (0.008, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}) ] self._test_failover(iter(protocol), expectedDelaysAndBrokers) expectedDelaysAndBrokers = [ (0, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}) ] self._test_failover(iter(protocol), expectedDelaysAndBrokers) uri = 'failover:(tcp://remote1:61615,tcp://localhost:61616)?randomize=false,startupMaxReconnectAttempts=2,initialReconnectDelay=3,useExponentialBackOff=false' protocol = StompFailoverTransport(uri) expectedDelaysAndBrokers = [ (0, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}), (0.003, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}), (0.003, {'host': 'remote1', 'protocol': 'tcp', 'port': 61615}) ] self._test_failover(iter(protocol), expectedDelaysAndBrokers) def test_priority_backup(self): uri = 'failover:tcp://remote1:61616,tcp://localhost:61616,tcp://127.0.0.1:61615,tcp://remote2:61616?startupMaxReconnectAttempts=3,priorityBackup=true,randomize=false' protocol = StompFailoverTransport(uri) self._test_failover(iter(protocol), [ (0, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}), (0.01, {'host': '127.0.0.1', 'protocol': 'tcp', 'port': 61615}), (0.02, {'host': 'remote1', 'protocol': 'tcp', 'port': 61616}), (0.04, {'host': 'remote2', 'protocol': 'tcp', 'port': 61616}) ]) @mock.patch('socket.gethostbyname') def test_priority_backup_localhost_lookup(self, mock_gethostbyname): local_ip = '1.2.3.4' uri = 'failover:tcp://remote1:61616,tcp://localhost:61616,tcp://127.0.0.1:61615,tcp://%s:61616?startupMaxReconnectAttempts=3,priorityBackup=true,randomize=false' % local_ip protocol = StompFailoverTransport(uri) mock_gethostbyname.side_effect = lambda *_args, **_kwargs: local_ip self._test_failover(iter(protocol), [ (0, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}), (0.01, {'host': '127.0.0.1', 'protocol': 'tcp', 'port': 61615}), (0.02, {'host': local_ip, 'protocol': 'tcp', 'port': 61616}), (0.04, {'host': 'remote1', 'protocol': 'tcp', 'port': 61616}), ]) @mock.patch('socket.gethostbyname') def test_priority_backup_broken_localhost_lookup(self, mock_gethostbyname): local_ip = '1.2.3.4' uri = 'failover:tcp://remote1:61616,tcp://localhost:61616,tcp://127.0.0.1:61615,tcp://%s:61616?startupMaxReconnectAttempts=3,priorityBackup=true,randomize=false' % local_ip protocol = StompFailoverTransport(uri) def _broken_gethostbyname(host): raise socket.gaierror() mock_gethostbyname.side_effect = _broken_gethostbyname self._test_failover(iter(protocol), [ (0, {'host': 'localhost', 'protocol': 'tcp', 'port': 61616}), (0.01, {'host': '127.0.0.1', 'protocol': 'tcp', 'port': 61615}), (0.02, {'host': 'remote1', 'protocol': 'tcp', 'port': 61616}), (0.04, {'host': local_ip, 'protocol': 'tcp', 'port': 61616}), ]) def test_randomize(self): uri = 'failover:tcp://remote1:61616,tcp://localhost:61616,tcp://127.0.0.1:61615,tcp://remote2:61616?priorityBackup=true,randomize=true,startupMaxReconnectAttempts=3' protocol = StompFailoverTransport(uri) localShuffled = remoteShuffled = 0 localHosts = ['localhost', '127.0.0.1'] remoteHosts = ['remote1', 'remote2'] while (localShuffled * remoteShuffled) == 0: protocol = StompFailoverTransport(uri) hosts = [broker['host'] for (broker, _) in itertools.islice(protocol, 4)] self.assertEqual(set(hosts[:2]), set(localHosts)) if (hosts[:2] != localHosts): localShuffled += 1 self.assertEqual(set(hosts[2:]), set(remoteHosts)) if (hosts[2:] != remoteHosts): remoteShuffled += 1 def test_jitter(self): uri = 'failover:tcp://remote1:61616?useExponentialBackOff=false,startupMaxReconnectAttempts=1,reconnectDelayJitter=4' for j in itertools.count(): protocol = iter(StompFailoverTransport(uri)) nextProtocol = nextMethod(protocol) nextProtocol() _, delay = nextProtocol() self.assertTrue(abs(delay - 0.01) < 0.004) if (j > 10) and (abs(delay - 0.01) > 0.003): break def _test_failover(self, brokersAndDelays, expectedDelaysAndBrokers): for (expectedDelay, expectedBroker) in expectedDelaysAndBrokers: nextBrokerAndDelay = nextMethod(brokersAndDelays) broker, delay = nextBrokerAndDelay() self.assertEqual(delay, expectedDelay) self.assertEqual(broker, expectedBroker) self.assertRaises(StompConnectTimeout, nextBrokerAndDelay) if __name__ == '__main__': unittest.main()
11571621
from unittest import TestCase from idewavecore.errors.storage import OverwriteFrozenFieldError from idewavecore.session import Storage, ItemFlag TEST_KEY = 'key' TEST_VALUE = 'value' TEST_ANOTHER_VALUE = 'another value' TEST_NON_EXISTENT_KEY = 'this key not exists' class TestStorage(TestCase): def setUp(self) -> None: self.storage = Storage() def test_set_and_get_item(self): self.storage.set_items([ { TEST_KEY: { 'value': TEST_VALUE } } ]) self.assertEqual(self.storage.get_value(TEST_KEY), TEST_VALUE) def test_clean_temporary_fields(self): self.storage.set_items([ { TEST_KEY: { 'value': TEST_VALUE } } ]) self.storage.clean_temporary_fields() self.assertIsNone(self.storage.get_value(TEST_KEY)) def test_not_clean_persistent_fields(self): self.storage.set_items([ { TEST_KEY: { 'value': TEST_VALUE, 'flags': ItemFlag.PERSISTENT } } ]) self.storage.clean_temporary_fields() self.assertIsNotNone(self.storage.get_value(TEST_KEY)) self.assertEqual(self.storage.get_value(TEST_KEY), TEST_VALUE) def test_cannot_change_frozen_field(self): self.storage.set_items([ { TEST_KEY: { 'value': TEST_VALUE, 'flags': ItemFlag.FROZEN } } ]) with self.assertRaises(OverwriteFrozenFieldError): self.storage._set_item(TEST_KEY, TEST_ANOTHER_VALUE) self.assertEqual(self.storage.get_value(TEST_KEY), TEST_VALUE) def test_get_non_existent_value(self): self.assertIsNone(self.storage.get_value(TEST_NON_EXISTENT_KEY))
11571646
import numpy as np import scipy.sparse from utils import SGD_regression_test_error class RandomBinning(object): def __init__(self, D, lifetime, M): """ Sets up a random binning object for the isotropic Laplacian kernel in D dimensions. A random binning object is a 3-tuple (widths, shifts, keys) where - widths is a list of D reals, specifying bin widths in each input dimension - shifts is a list of D reals, specifying bin shifts - keys is a dictionary int -> int giving sequential numbers to non-empty bins """ self.widths = [np.array([np.random.gamma(shape=2, scale=1.0 / lifetime) for _ in range(D)]) for _ in range (M)] self.shifts = [np.array([np.random.uniform(low=0.0, high=width) for width in widths]) for widths in self.widths] self.keys = {} self.C = 0 self.M = M self.D = D def get_features(self, X, M=None, expand=True): """ Returns unnormalized Random binning features for the provided datapoints X (one datapoint in each row). :param X: Matrix of dimensions NxD, containing N datapoints (one in each row). :param expand: Specifies whether new features should be created if a datapoint lies in a bin that has been empty so far. (True for training, False for testing.) :return: Sparse binary matrix of dimensions NxC, where C is the number of generated features. Each row is the feature expansion of one datapoint and contains at most M ones. """ N = np.shape(X)[0] if M is None: M = self.M assert M <= self.M # stacking experiment X_stack = np.tile(X, self.M) shifts_stack = np.concatenate(self.shifts) widths_stack = np.concatenate(self.widths) X_coordinates = np.ceil((X_stack - shifts_stack) / widths_stack).astype(int) # compute indices row_indices = [] col_indices = [] X_coordinates.flags.writeable = False feature_from_repetition = [] for m in range(M): X_coords = X_coordinates[:, (self.D*m):(self.D*(m+1))] X_coords.flags.writeable = False for n, coordinates in enumerate(X_coords): coordinates.flags.writeable = False #h = hash(coordinates.data) h = tuple(coordinates.tolist()) if (m, h) in self.keys: row_indices.append(n) col_indices.append(self.keys[(m, h)]) elif expand: row_indices.append(n) col_indices.append(self.C) self.keys[(m, h)] = self.C feature_from_repetition.append(m) self.C += 1 # construct features values = [1]*len(row_indices) Z = scipy.sparse.coo_matrix((values, (row_indices, col_indices)), shape=(N, self.C)) return Z.tocsr(), np.array(feature_from_repetition) def random_binning_features(X, lifetime, R_max): D = X.shape[1] rb = RandomBinning(D, lifetime, R_max) return rb.get_features(X) def evaluate_random_binning(X, y, X_test, y_test, M, lifetime, delta): # construct random binning features rb = RandomBinning(X.shape[1], lifetime, M) Z, _ = rb.get_features(X) / np.sqrt(M) Z_test, _ = rb.get_features(X_test, expand=False) / np.sqrt(M) # solve primal problem using SGD SGD_epochs = 10 error_test = SGD_regression_test_error(Z, y, Z_test, y_test, delta, SGD_epochs) print 'RB lg_lifetime = %.2f; C = %d; error_test = %.2f%%' \ % (np.log2(lifetime), np.shape(Z)[1], error_test) return error_test
11571659
from __future__ import annotations import typing from typing_extensions import TypedDict from . import block_crud from . import block_normalize from ctc import spec if typing.TYPE_CHECKING: class BlockGasStats(TypedDict): base_fee: int | float | None min_gas_price: int | float | None median_gas_price: int | float | None mean_gas_price: float | None max_gas_price: int | float | None gas_used: int gas_limit: int n_transactions: int class BlocksGasStats(TypedDict): min_base_fee: int | float | None median_base_fee: int | float | None mean_base_fee: int | float | None max_base_fee: int | float | None min_gas_price: int | float | None min_median_gas_price: int | float | None min_mean_gas_price: int | float | None min_max_gas_price: int | float | None median_min_gas_price: int | float | None median_median_gas_price: int | float | None median_mean_gas_price: int | float | None median_max_gas_price: int | float | None mean_min_gas_price: int | float | None mean_median_gas_price: int | float | None mean_gas_price: int | float | None mean_max_gas_price: int | float | None max_min_gas_price: int | float | None max_median_gas_price: int | float | None max_mean_gas_price: int | float | None max_gas_price: int | float | None min_gas_used: int | float | None median_gas_used: int | float | None mean_gas_used: int | float | None max_gas_used: int | float | None min_gas_limit: int | float | None median_gas_limit: int | float | None mean_gas_limit: int | float | None max_gas_limit: int | float | None min_n_transactions: int | float | None median_n_transactions: int | float | None mean_n_transactions: int | float | None max_n_transactions: int | float | None n_blocks: int async def async_get_block_gas_stats( block: spec.BlockNumberReference | spec.Block, normalize: bool = True, provider: spec.ProviderSpec = None, ) -> BlockGasStats: """get gas statistics for a given block""" if isinstance(block, dict): block_data = block else: block_data = await block_crud.async_get_block( block, include_full_transactions=True, provider=provider ) return get_block_gas_stats(block_data, normalize=normalize) def get_block_gas_stats( block: spec.Block, normalize: bool = True, ) -> BlockGasStats: import numpy as np base_fee: int | float | None = block.get('base_fee_per_gas') if len(block['transactions']) > 0: if isinstance(block['transactions'][0], str): raise Exception( 'transaction data not in block, use include_full_transactions=True when retrieving block' ) gas_prices: list[int | float] = [ typing.cast(spec.Transaction, transaction)['gas_price'] for transaction in block['transactions'] ] if normalize: gas_prices = [gas_price / 1e9 for gas_price in gas_prices] if base_fee is not None: base_fee = base_fee / 1e9 min_gas_price = min(gas_prices) median_gas_price = float(np.median(gas_prices)) mean_gas_price = sum(gas_prices) / len(gas_prices) max_gas_price = max(gas_prices) else: min_gas_price = None median_gas_price = None mean_gas_price = None max_gas_price = None return { 'base_fee': base_fee, 'min_gas_price': min_gas_price, 'median_gas_price': median_gas_price, 'mean_gas_price': mean_gas_price, 'max_gas_price': max_gas_price, 'gas_used': block['gas_used'], 'gas_limit': block['gas_limit'], 'n_transactions': len(block['transactions']), } async def async_get_gas_stats_by_block( blocks: typing.Sequence[spec.BlockNumberReference | spec.Block], normalize: bool = True, provider: spec.ProviderSpec = None, ) -> list[BlockGasStats]: import asyncio coroutines = [ async_get_block_gas_stats( block=block, normalize=normalize, provider=provider, ) for block in blocks ] return await asyncio.gather(*coroutines) async def async_get_blocks_gas_stats( blocks: typing.Sequence[spec.BlockNumberReference] | None = None, start_block: spec.BlockNumberReference | None = None, end_block: spec.BlockNumberReference | None = None, normalize: bool = True, provider: spec.ProviderSpec = None, ) -> BlocksGasStats: """get gas statistics aggregated over multiple blocks""" if blocks is None: if start_block is None or end_block is None: raise Exception( 'must specify blocks or {start_block and end_block}' ) start_block = await block_normalize.async_block_number_to_int( block=start_block, provider=provider ) end_block = await block_normalize.async_block_number_to_int( block=end_block, provider=provider ) blocks = list(range(start_block, end_block + 1)) blocks_gas_stats = await async_get_gas_stats_by_block( blocks=blocks, normalize=normalize, provider=provider, ) return aggregate_blocks_gas_stats(blocks_gas_stats=blocks_gas_stats) def _mmmm( items: typing.Sequence[int | float | None], ) -> list[int | float | None]: import numpy as np non_none = [item for item in items if item is not None] median = np.median(non_none) if type(non_none[0]) is int: typed_median: int | float = int(median) else: typed_median = float(median) if len(items) == 0: return [None, None, None, None] else: return [ min(non_none), typed_median, np.mean(non_none), max(non_none), ] def aggregate_blocks_gas_stats( blocks_gas_stats: typing.Sequence[BlockGasStats], ) -> BlocksGasStats: base_fees = [stats['base_fee'] for stats in blocks_gas_stats] min_gas_prices = [stats['min_gas_price'] for stats in blocks_gas_stats] median_gas_prices = [ stats['median_gas_price'] for stats in blocks_gas_stats ] mean_gas_prices = [stats['mean_gas_price'] for stats in blocks_gas_stats] max_gas_prices = [stats['max_gas_price'] for stats in blocks_gas_stats] gas_useds = [stats['gas_used'] for stats in blocks_gas_stats] gas_limits = [stats['gas_limit'] for stats in blocks_gas_stats] n_transactionss = [stats['n_transactions'] for stats in blocks_gas_stats] min_base_fee, median_base_fee, mean_base_fee, max_base_fee = _mmmm( base_fees ) ( min_gas_price, median_min_gas_price, mean_min_gas_price, max_min_gas_price, ) = _mmmm(min_gas_prices) ( min_median_gas_price, median_median_gas_price, mean_median_gas_price, max_median_gas_price, ) = _mmmm(median_gas_prices) ( min_mean_gas_price, median_mean_gas_price, mean_gas_price, max_mean_gas_price, ) = _mmmm(mean_gas_prices) ( min_max_gas_price, median_max_gas_price, mean_max_gas_price, max_gas_price, ) = _mmmm(max_gas_prices) ( min_gas_used, median_gas_used, mean_gas_used, max_gas_used, ) = _mmmm(gas_useds) ( min_gas_limit, median_gas_limit, mean_gas_limit, max_gas_limit, ) = _mmmm(gas_limits) ( min_n_transactions, median_n_transactions, mean_n_transactions, max_n_transactions, ) = _mmmm(n_transactionss) return { 'min_base_fee': min_base_fee, 'median_base_fee': median_base_fee, 'mean_base_fee': mean_base_fee, 'max_base_fee': max_base_fee, # 'min_gas_price': min_gas_price, 'min_median_gas_price': min_median_gas_price, 'min_mean_gas_price': min_mean_gas_price, 'min_max_gas_price': min_max_gas_price, # 'median_min_gas_price': median_min_gas_price, 'median_median_gas_price': median_median_gas_price, 'median_mean_gas_price': median_mean_gas_price, 'median_max_gas_price': median_max_gas_price, # 'mean_min_gas_price': mean_min_gas_price, 'mean_median_gas_price': mean_median_gas_price, 'mean_gas_price': mean_gas_price, 'mean_max_gas_price': mean_max_gas_price, # 'max_min_gas_price': max_min_gas_price, 'max_median_gas_price': max_median_gas_price, 'max_mean_gas_price': max_mean_gas_price, 'max_gas_price': max_gas_price, # 'min_gas_used': min_gas_used, 'median_gas_used': median_gas_used, 'mean_gas_used': mean_gas_used, 'max_gas_used': max_gas_used, # 'min_gas_limit': min_gas_limit, 'median_gas_limit': median_gas_limit, 'mean_gas_limit': mean_gas_limit, 'max_gas_limit': max_gas_limit, # 'min_n_transactions': min_n_transactions, 'median_n_transactions': median_n_transactions, 'mean_n_transactions': mean_n_transactions, 'max_n_transactions': max_n_transactions, # 'n_blocks': len(blocks_gas_stats), }
11571676
import numpy as np from cykhash import unique_int64, unique_int32, unique_float64, unique_float32 from cykhash import unique_stable_int64, unique_stable_int32, unique_stable_float64, unique_stable_float32 UNIQUE={ np.float64 : unique_float64, np.float32 : unique_float32, np.int64 : unique_int64, np.int32 : unique_int32, } UNIQUE_STABLE = { np.float64 : unique_stable_float64, np.float32 : unique_stable_float32, np.int64 : unique_stable_int64, np.int32 : unique_stable_int32, } class UniqueArange: params = [ [np.float64, np.float32, np.int64, np.int32], [1_000, 2_000, 8_000, 10_000, 100_000, 1_000_000, 10_000_000, 100_000_000], ] param_names = ["dtype", "M"] def setup(self, dtype, M): self.array = np.arange(M, dtype=dtype) def time_unique(self, dtype, M): UNIQUE[dtype](self.array) def time_unique_stable(self, dtype, M): UNIQUE_STABLE[dtype](self.array) def peakmem_unique(self, dtype, M): UNIQUE[dtype](self.array) def peakmem_unique_stable(self, dtype, M): UNIQUE_STABLE[dtype](self.array) class UniqueRandomDivFactor10: params = [ [np.float64, np.float32, np.int64, np.int32], [1_000, 2_000, 8_000, 10_000, 100_000, 1_000_000, 10_000_000, 100_000_000], ] param_names = ["dtype", "M"] def setup(self, dtype, M): np.random.seed(42) self.array = np.random.randint(0, M//10, M).astype(dtype) def time_unique(self, dtype, M): UNIQUE[dtype](self.array) def time_unique_stable(self, dtype, M): UNIQUE_STABLE[dtype](self.array) def peakmem_unique(self, dtype, M): UNIQUE[dtype](self.array) def peakmem_unique_stable(self, dtype, M): UNIQUE_STABLE[dtype](self.array) class UniqueRandomDivFactor10Add220: params = [ [np.float64, np.float32, np.int64, np.int32], [1_000, 2_000, 8_000, 10_000, 100_000, 1_000_000, 10_000_000, 100_000_000], ] param_names = ["dtype", "M"] def setup(self, dtype, M): np.random.seed(42) self.array = (np.random.randint(0, M//10, M)+2**26).astype(dtype) def time_unique(self, dtype, M): UNIQUE[dtype](self.array) def time_unique_stable(self, dtype, M): UNIQUE_STABLE[dtype](self.array) class UniqueRandomMulFactor10: params = [ [np.float64, np.float32, np.int64, np.int32], [1_000, 2_000, 8_000, 10_000, 100_000, 1_000_000, 10_000_000, 100_000_000], ] param_names = ["dtype", "M"] def setup(self, dtype, M): np.random.seed(42) self.array = np.random.randint(0, M*10, M).astype(dtype) def time_unique(self, dtype, M): UNIQUE[dtype](self.array) def time_unique_stable(self, dtype, M): UNIQUE_STABLE[dtype](self.array) class UniqueSingle: params = [ [np.float64, np.float32, np.int64, np.int32], [10_000_000, 100_000_000], ] param_names = ["dtype", "M"] def setup(self, dtype, M): self.array = np.ones(M, dtype=dtype) def peakmem_unique(self, dtype, M): UNIQUE[dtype](self.array) def peakmem_unique_stable(self, dtype, M): UNIQUE_STABLE[dtype](self.array)
11571696
import os import numpy as np import _pickle as pickle import pandas as pd # for e2e long_dir = './rnastralign/long/pseudoknot_ct' short_dir = './rnastralign/short/pseudoknot_ct' long_list = os.listdir(long_dir) short_list = os.listdir(short_dir) pred_list = list(filter(lambda x: 'pred' in x, long_list+short_list)) pseudoknot_f1 = list(map(lambda x: float(x.split('_')[0]), pred_list)) print('Exact f1: ', np.average(pseudoknot_f1)) # for rnastructure with open('../data/rnastralign_test_pseudoknot_tag.pickle', 'rb') as f: pseudoknot_tag = pickle.load(f) # load rna structure data filepath = './traditional_method_results/rnastralign/results_no_shift/RNAStructure.tsv' df = pd.read_csv(filepath, sep='\t', header=None) rnastructure_f1 = df.iloc[:, -1].values rnastructure_pse_f1 = list() for i in range(len(pseudoknot_tag)): if pseudoknot_tag[i][-1]: rnastructure_pse_f1.append(rnastructure_f1[i])
11571698
from lib.utils.import_helper import import_module_with_default ALL_PLUGIN_EXPORTERS = import_module_with_default( "exporter_plugin", "ALL_PLUGIN_EXPORTERS", default=[] ) # No default exporter is provided ALL_EXPORTERS = ALL_PLUGIN_EXPORTERS def get_exporter(name: str): for exporter in ALL_EXPORTERS: if exporter.exporter_name == name: return exporter raise ValueError(f"Unknown exporter name {name}")
11571765
from precise.skaters.portfolioutil.portfunctions import portfolio_variance from precise.skaters.portfoliostatic.diagportfactory import diagonal_portfolio_factory from typing import List from itertools import zip_longest from precise.skaters.locationutil.vectorfunctions import normalize def diagonal_portfolio_variance(cov=None, pre=None): """ Variance of the unit min-var portfolio (Used in some hierarchical methods to allocate capital) """ w = diagonal_portfolio_factory(pre=pre, cov=cov) return portfolio_variance(cov=cov,w=w) def diagonal_allocation_factory(covs:List, pres:List=None)->[float]: """ Allocate capital between portfolios using either cov or pre matrices :param covs: List of covariance matrices :param pres: List of precision matrices :return: Capital allocation vector """ if pres is None: pres = [] # Remark: This was used in <NAME>'s original HRP portfolio paper https://papers.ssrn.com/sol3/papers.cfm?abstract_id=2708678 return normalize([ 1/diagonal_portfolio_variance(cov=cov, pre=pre) for cov, pre in zip_longest(covs, pres, fillvalue=None) ])
11571778
import unittest import requests from src.config import PYTHON_MODULE_PORT, MESSAGE_LOCAL_WRONG_ID, TEST_RUN_EDITS from src.helper import env class APIProductPostTest(unittest.TestCase): def setUp(self): self.local_id_wrong = 0 self.local_id = 1 self.url = f'http://localhost:{PYTHON_MODULE_PORT}/admin/{self.local_id}/product' self.url_wrong_id = f'http://localhost:{PYTHON_MODULE_PORT}/admin/{self.local_id_wrong}/product/1' self.status_code = 200 self.product_name = 'Bordar' self.currency = 'EUR' self.price_type = 'UNIT' self.price = 10.5 self.new_name = 'Llenites' self.product_id = 1 def test_status_code(self): response = requests.put(f'{self.url}/{self.product_id}', json=dict()) self.assertEqual(response.status_code, self.status_code) def test_local_id_wrong(self): request_body = dict( name=self.product_name, currency=self.currency, price=self.price, price_type=self.price_type, local_id=self.local_id_wrong ) response = requests.put(self.url_wrong_id, json=request_body).json() self.assertEqual(response.get('error'), True) self.assertEqual(response.get('message'), MESSAGE_LOCAL_WRONG_ID) def test_edit(self): if env.run_modifications() or TEST_RUN_EDITS: request_body = dict(name=self.new_name) response = requests.put(f'{self.url}/{self.product_id}', json=request_body).json() self.assertEqual(response.get('error'), False) self.assertEqual(response.get('response').get('edited'), True) else: self.assertTrue(True)
11571786
import stgfunc as stg import lvsfunc as lvf import EoEfunc as eoe from vsdpir import DPIR import vapoursynth as vs from stgfunc import depth from vsutil import insert_clip from debandshit import dumb3kdb from lvsfunc.util import get_prop from vardautomation import FileInfo from vardautomation import PresetWEB from vardefunc.noise import Graigasm from .constants import graigasm_args from vardefunc.misc import merge_chroma from vardefunc.util import finalise_output from stgfunc.utils import replace_squaremask from typing import Tuple, List, Dict, Optional from vsutil import get_y, join, plane, iterate core = vs.core core.max_cache_size = 16 * 2 ** 10 class SeleProFiltering: FUNI: FileInfo BILI: FileInfo lowpass: List[int] Oycore: stg.oyster.Core dfttest_args: Dict[str, int] def __init__( self, FUNI: FileInfo, BILI: FileInfo, OP_ED: Optional[Tuple[Optional[Tuple[int, int]], Optional[Tuple[int, int]]]] = None, OP_START_REPLACE: bool = False ): self.FUNI = FUNI self.BILI = BILI self.OP_ED = OP_ED self.OP_START_REPLACE = OP_START_REPLACE @finalise_output() def workraw_filterchain(self): src = depth(self.FUNI.clip_cut, 16) ref = src.rgvs.RemoveGrain(16) denoise = eoe.dn.BM3D(src, 1.95, 1, 'fast', fast=True, ref=ref, skip_basic=True, chroma=False) deband = dumb3kdb(denoise, 8, 24) return deband.add.Grain(0.25) @finalise_output() def filterchain(self): self.mix_sources() if self.OP_ED: self.mix_OP_ED(self.FUNI) self.mix_OP_ED(self.BILI) y = depth(get_y(self.FUNI.clip_cut), 16) self.__setup_oyster(y, plane(self.FUNI.clip_cut, 1)) y1, y2 = self.__freqmerging_luma(y) u, v = self.__freqmerging_chroma() diff_mask = self.__masks_diff(y1, y2) detail_mask = self.__masks_detail(y) linemask = self.__masks_linemask(y2) exp_linemask = self.__masks_exp_linemask(linemask) detail_mask2 = self.__masks_detail2(detail_mask, exp_linemask, diff_mask) details = y1.std.MaskedMerge(y, detail_mask2) y_masked = details.std.MaskedMerge(y2, linemask) merge = join([y_masked, u, v]) denoise = self.__denoise(merge) if self.OP_ED: denoise = self.__scenefilter_OP_ED(denoise) custom = self.custom_scenefiltering(denoise, merge) grain = self.__graining(custom, detail_mask2) return grain.std.MaskedMerge(custom, linemask) def mix_sources(self) -> None: pass def mix_OP_ED(self, file: FileInfo) -> None: if self.OP_ED[0]: OP_AV1 = stg.src(r".\Extra\NCs\Source\SELECTION PROJECT OPテーマ 「Glorious Days」_AV1.mp4", ref=file.clip_cut)[:2158] OP_START, OP_ENDIN = self.OP_ED[0] texture = OP_AV1.grain.Add(20, 3, 0.07, 0.12, 69420, True).bilateral.Gaussian(1) merge = file.clip_cut[OP_START:OP_ENDIN + 1] if self.OP_START_REPLACE: FUNI03 = FileInfo(r".\Source\[SubsPlease] Selection Project - 03 (1080p) [4C3303CD].mkv", (240, 0), preset=PresetWEB) OP_EP03 = FUNI03.clip_cut[480:2637 + 1][0:195 + 1] merge = insert_clip(merge, OP_EP03, 0) deband = OP_AV1.bilateral.Gaussian(1.5) merge = replace_squaremask(merge, deband, (727, 50, 599, 516), (None, 195)) merge = replace_squaremask(merge, texture, (993, 50, 464, 516), (2042, None)) merge = replace_squaremask(merge, OP_AV1, (624, 50, 833, 516), (2042, None)) black = merge.std.BlankClip(length=1) white = black.std.Invert() merge = black + merge[1:195] + white + merge[196:2041] + white + merge[2042:] file.clip_cut = insert_clip(file.clip_cut, merge, OP_START) file.clip_cut = lvf.rfs(file.clip_cut, self.FUNI.clip_cut, (OP_START, OP_START + 56)) if self.OP_ED[1]: ED_START, ED_ENDIN = self.OP_ED[1] ED_VP9 = stg.src(r".\Extra\NCs\Source\SELECTION PROJECT EDテーマ 「Only One Yell」_VP9.webm", ref=file.clip_cut) ED_CUT = file.clip_cut[ED_START:ED_ENDIN + 1] while ED_VP9.num_frames == ED_CUT.num_frames: ED_VP9 += ED_VP9[-1] merge = replace_squaremask(ED_CUT, ED_VP9, (993, 50, 464, 516), (1791, None)) file.clip_cut = insert_clip(file.clip_cut, merge, ED_START) def custom_scenefiltering(self, denoise: vs.VideoNode, merge: vs.VideoNode): return denoise def __setup_oyster(self, y: vs.VideoNode, chroma: vs.VideoNode) -> None: self.Oycore = stg.oyster.Core() self.lowpass = [0.0, 0.0, 0.12, 1024.0, 1.0, 1024.0] self.dfttest_args = dict(smode=0, sosize=0, tbsize=1, tosize=0, tmode=0) self.block_mask = depth(self.Oycore.GenBlockMask(y), 32) self.block_mask_uv = depth(self.Oycore.GenBlockMask(chroma), 32) def __freqmerging_luma(self, funi: vs.VideoNode = None, bili: vs.VideoNode = None) -> Tuple[vs.VideoNode, vs.VideoNode]: funi_y, bili_y = depth(get_y(funi or self.FUNI.clip_cut), get_y(bili or self.BILI.clip_cut), 32) funi_y_ref = stg.oyster.Basic(funi_y, None, 6, 1, 2400, True) bili_y_ref = stg.oyster.Basic(bili_y, None, 6, 1, 2800, True) args = dict(sbsize=9, slocation=self.lowpass, **self.dfttest_args) funif = core.dfttest.DFTTest(funi_y, **args) bilif = core.dfttest.DFTTest(bili_y, **args) funi_y_reff = core.dfttest.DFTTest(funi_y_ref, **args) bili_y_reff = core.dfttest.DFTTest(bili_y_ref, **args) funi_mer_y = core.std.MergeDiff(bilif, core.std.MakeDiff(funi_y, funif)) bili_mer_y = core.std.MergeDiff(funif, core.std.MakeDiff(bili_y, bilif)) funi_y_ref_mer = core.std.MergeDiff(bili_y_reff, core.std.MakeDiff(funif, funi_y_reff)) bili_y_ref_mer = core.std.MergeDiff(funi_y_reff, core.std.MakeDiff(bilif, bili_y_reff)) freqmerged_funi = core.std.MaskedMerge( funi_mer_y, funi_y_ref_mer, self.block_mask ).std.Merge(funi_mer_y, 4 / 7) freqmerged_bili = core.std.MaskedMerge( bili_mer_y, bili_y_ref_mer, self.block_mask ).std.Merge(funi_y_ref_mer, 2 / 5) # Intentional Funi here return depth(freqmerged_funi, freqmerged_bili, 16) def ___freqmerge_chroma(self, clip_y: vs.VideoNode, filt_y: vs.VideoNode) -> vs.VideoNode: ref = stg.oyster.Basic(clip_y, None, 6, 1, True) ref = self.Oycore.FreqMerge(filt_y, ref, 9, self.lowpass) mer_y = self.Oycore.FreqMerge(filt_y, clip_y, 9, self.lowpass) freqmerged = core.std.MaskedMerge( mer_y, ref, self.block_mask_uv ).std.Merge(ref, 3 / 5) return depth(freqmerged, 16) def __freqmerging_chroma(self, funi: vs.VideoNode = None, bili: vs.VideoNode = None) -> Tuple[vs.VideoNode, vs.VideoNode]: funi, bili = funi or self.FUNI.clip_cut, bili or self.BILI.clip_cut ub, uf = depth(plane(bili, 1), plane(funi, 1), 32) vb, vf = depth(plane(bili, 2), plane(funi, 2), 32) return self.___freqmerge_chroma(ub, uf), self.___freqmerge_chroma(vb, vf) def __masks_diff(self, y1: vs.VideoNode, y2: vs.VideoNode) -> vs.VideoNode: _diff_mask = core.std.MakeDiff(y1, y2).std.PlaneStats() black = _diff_mask.std.BlankClip()[0].get_frame(0) thr = 100 << 8 def ___diff_mask_process(f, n) -> vs.VideoNode: low_range = get_prop(f, 'PlaneStatsMin', int) <= thr hig_range = get_prop(f, 'PlaneStatsMax', int) >= (2 << 16) - 1 - thr > thr return f if low_range or hig_range else black diff_mask = _diff_mask.std.ModifyFrame( _diff_mask, ___diff_mask_process ) return diff_mask.std.BinarizeMask(135 << 8).std.Inflate() def __masks_detail(self, y: vs.VideoNode) -> vs.VideoNode: return stg.mask.linemask(y) def __masks_linemask(self, y: vs.VideoNode) -> vs.VideoNode: return stg.mask.tcanny(y, 0.0275, True).std.Inflate() def __masks_exp_linemask(self, linemask: vs.VideoNode) -> vs.VideoNode: exp_linemask = linemask.std.BinarizeMask(24 << 8) exp_linemask = iterate( iterate( exp_linemask, lambda x: x.std.Maximum().std.Minimum(), 10 ), lambda x: x.std.Inflate().std.Deflate(), 5 ) exp_linemask = exp_linemask.bilateral.Gaussian(1.5, 1) return iterate(exp_linemask, core.std.Deflate, 15) def __masks_linemask3(self, linemask: vs.VideoNode, exp_linemask: vs.VideoNode, diff_mask: vs.VideoNode) -> vs.VideoNode: return core.std.Expr([linemask, exp_linemask, diff_mask], 'y x 2 * - 4 * z +').std.Limiter() def __masks_detail2(self, details_mask: vs.VideoNode, exp_linemask: vs.VideoNode, diff_mask: vs.VideoNode) -> vs.VideoNode: return core.std.Expr([details_mask, exp_linemask, diff_mask], 'x y - z +').std.Limiter() def __masks_deband( self, linemask: vs.VideoNode, exp_linemask: vs.VideoNode, linemask3: vs.VideoNode, diff_mask: vs.VideoNode ) -> vs.VideoNode: return core.std.Expr([ core.std.Expr([ linemask, exp_linemask, linemask3, diff_mask ], 'y x 2 * - 4 * z log - a +'), linemask3 ], 'x y -').std.Limiter() def __denoise(self, clip: vs.VideoNode) -> vs.VideoNode: denoise_bm3d = eoe.dn.BM3D(clip, 1.75, 1, ['np', 'high'], chroma=False) return stg.denoise.KNLMeansCL( denoise_bm3d, sigma=[None, 0.37], contraSharpening=True, ref_clip=clip ) def __scenefilter_OP_ED(self, clip: vs.VideoNode) -> vs.VideoNode: if self.OP_ED[0]: OP_START, OP_ENDIN = self.OP_ED[0] deband = dumb3kdb( DPIR( depth(clip.resize.Spline64(format=vs.RGB24, matrix_in=1), 32), 4.35 ).resize.Spline64(format=clip.format.id, matrix=1), 16, 12 ) return lvf.rfs(clip, deband, (OP_START + 1, OP_START + 56)) return clip def __graining(self, clip: vs.VideoNode, detail_mask: vs.VideoNode) -> vs.VideoNode: grain_mask = core.adg.Mask(clip.std.PlaneStats(), 8) grain_mask = core.std.Expr([grain_mask, detail_mask], 'x y -') y = get_y(clip) pref = iterate(y, core.std.Maximum, 2).std.Convolution([1] * 9) grainY = Graigasm(**graigasm_args).graining(y, prefilter=pref) return merge_chroma(grainY, clip)
11571813
import datetime import logging from queries import pool import queries from tornado import gen, ioloop, web class ExampleHandler(web.RequestHandler): SQL = 'SELECT * FROM pg_stat_activity' @gen.coroutine def get(self): try: result = yield self.application.session.query(self.SQL) except queries.OperationalError as error: logging.error('Error connecting to the database: %s', error) raise web.HTTPError(503) rows = [] for row in result.items(): row = dict([(k, v.isoformat() if isinstance(v, datetime.datetime) else v) for k, v in row.items()]) rows.append(row) result.free() self.finish({'pg_stat_activity': rows}) class ReportHandler(web.RequestHandler): @gen.coroutine def get(self): self.finish(pool.PoolManager.report()) if __name__ == '__main__': logging.basicConfig(level=logging.DEBUG) application = web.Application([ (r'/', ExampleHandler), (r'/report', ReportHandler) ], debug=True) application.session = queries.TornadoSession() application.listen(8000) ioloop.IOLoop.instance().start()
11571828
import FWCore.ParameterSet.Config as cms from GeneratorInterface.Pythia6Interface.pythiaDefault_cff import * generator = cms.EDFilter("Pythia6GeneratorFilter", pythiaVerbosity = cms.untracked.bool(False), comEnergy = cms.double(10000.0), PythiaParameters = cms.PSet( # Default (mostly empty - to keep PYTHIA default) card file # Name of the set is "pythiaDefault" pythiaDefaultBlock, # User cards - name is "myParameters" myParameters = cms.vstring('PMAS(32,1)= 5000. !mass of Zprime', 'MSEL=0 !(D=1) to select between full user control (0, then use MSUB) and some preprogrammed alternative', 'MSTP(44) = 3 !only select the Z process', 'MSUB(141) = 1 !ff gamma z0 Z0', 'MSTJ(11)=3 ! Choice of the fragmentation function', 'MSTJ(22)=2 !Decay those unstable particles', 'MSTP(2)=1 !which order running alphaS', 'MSTP(33)=0 !(D=0) inclusion of K factors in (=0: none, i.e. K=1)', 'MSTP(51)=7 !structure function chosen', 'MSTP(81)=1 !multiple parton interactions 1 is Pythia default', 'MSTP(82)=4 !Defines the multi-parton model', 'MSTU(21)=1 !Check on possible errors during program execution', 'PARJ(71)=10. !for which ctau 10 mm', 'PARP(82)=1.9 !pt cutoff for multiparton interactions', 'PARP(89)=1000. !sqrts for which PARP82 is set', 'PARP(84)=0.4 !Multiple interactions: matter distribution Registered by <EMAIL>', 'PARP(90)=0.16 !Multiple interactions: rescaling power Registered by <EMAIL>', 'PMAS(5,1)=4.2 !mass of b quark', 'PMAS(6,1)=175. !mass of top quark', 'PMAS(23,1)=91.187 !mass of Z', 'PMAS(24,1)=80.22 !mass of W', 'MDME(289,1)= 1 !d dbar', 'MDME(290,1)= 1 !u ubar', 'MDME(291,1)= 1 !s sbar', 'MDME(292,1)= 1 !c cbar', 'MDME(293,1)= 0 !b bar', 'MDME(294,1)= 0 !t tbar', 'MDME(295,1)= 0 !4th gen Q Qbar', 'MDME(296,1)= 0 !4th gen Q Qbar', 'MDME(297,1)= 0 !e e', 'MDME(298,1)= 0 !neutrino e e', 'MDME(299,1)= 0 ! mu mu', 'MDME(300,1)= 0 !neutrino mu mu', 'MDME(301,1)= 0 !tau tau', 'MDME(302,1)= 0 !neutrino tau tau', 'MDME(303,1)= 0 !4th generation lepton', 'MDME(304,1)= 0 !4th generation neutrino', 'MDME(305,1)= 0 !W W', 'MDME(306,1)= 0 !H charged higgs', 'MDME(307,1)= 0 !Z', 'MDME(308,1)= 0 !Z', 'MDME(309,1)= 0 !sm higgs', 'MDME(310,1)= 0 !weird neutral higgs HA'), # This is a vector of ParameterSet names to be read, in this order # The first two are in the include files below # The last one are simply my additional parameters parameterSets = cms.vstring('pythiaDefault', 'myParameters') ) )
11571890
from ask_sdk_core.skill_builder import SkillBuilder from ask_sdk.standard import StandardSkillBuilder from ask_sdk_core.utils import is_request_type, is_intent_name from ask_sdk_model.dialog.delegate_directive import DelegateDirective import random import re import os ################# # Set Up Logger # ################# import logging logger = logging.getLogger() logger.setLevel(logging.INFO) ########### # Globals # ########### DB = os.environ.get('DDB_NAME', None) if DB: sb = StandardSkillBuilder( table_name=DB, auto_create_table=True) else: logger.info("DB Name not set") sb = SkillBuilder() ########### # Outputs # ########### SKILL_NAME = "<NAME>" #Randomize speechcons SPEECHCONS = { 'excited': [ "high five", "hurray", "kaboom", "kerching", "magnificent", "okey dokey", "splendid", "way to go", "wahoo", "well done", "yahoo", "yippee" ], 'apology': [ "aw man", "aww applesauce", "d'oh", "fiddlesticks", "good grief", "gracious me", "my bad", "my goodness", "oof", "oops", "ruh roh", "shucks", "uh oh", "whoops" ] } logger.info("Outputs are set") ############# # Utilities # ############# def get_speechcon(emotion): speech_con_number = random.randint(0,(int(len(SPEECHCONS[emotion])-1))) return '<say-as interpret-as="interjection">%s</say-as>.' % SPEECHCONS[emotion][speech_con_number] def prepare_card(text): return re.sub('<[^<]+?>', '', text) def set_session_attr(handler_input, key, value): handler_input.attributes_manager.session_attributes[key]=value return handler_input def append_session_attr(handler_input, key, value): if value != None: if key in handler_input.attributes_manager.session_attributes: handler_input.attributes_manager.session_attributes[key].append(value) else: handler_input.attributes_manager.session_attributes[key] = [] handler_input.attributes_manager.session_attributes[key].append(value) return handler_input def get_session_attr(handler_input, key): try: return handler_input.attributes_manager.session_attributes.get(key, None) except: return None def get_slot(handler_input, slot): try: return handler_input.request_envelope.request.intent.slots.get(slot, None) except: return None def del_session_attr(handler_input, key): try: del handler_input.attributes_manager.session_attributes[key] return except: return def save_data(handler_input): try: handler_input.attributes_manager.persistent_attributes = handler_input.attributes_manager.session_attributes handler_input.attributes_manager.save_persistent_attributes() return True except: return False def get_data_from_database(handler_input): try: handler_input.attributes_manager.persistent_attributes = handler_input.attributes_manager.session_attributes = handler_input.attributes_manager.persistent_attributes except: return None SPEECH = { 'End': "Goodbye!", 'Exception': "Sorry, there was some problem. Please try again!", 'LaunchRequest': "Welcome to %s! To begin making ice cream just say, Lets start." % SKILL_NAME, 'CancelIntent': "Okay. To start over you can say, Lets start. If you would like to exit the %s, just say, stop." % SKILL_NAME, 'StopIntent': "Thank you for making ice cream together! Come back soon!", 'HelpIntent': "If you would like to start making Ice Cream, just say, lets start. To add a topping, just say, I want sprinkles", 'addTopping': "%s If you would like to add more toppings just tell me what you would like. To start over, just say, lets start." % get_speechcon('excited'), 'addToppingNoIceCream': "That sounded like a topping, but I did not get your ice cream flavor yet. Just tell me flavor of ice cream you would like.", 'Start': "Now, every good ice cream starts with a base, so tell me what flavor of ice cream do you want?", 'StartReplay': "What flavor of ice cream do you want?", 'IceCreamBuilder': "%s Now, what are some toppings you would like to add?" % get_speechcon('excited'), 'IceCreamBuilderWithTopping': "%s If you would like to add toppings just tell me what you would like. When you are done adding toppings, just say, all done." % get_speechcon('excited'), 'Finish': "Alright! What a wonderful %s ice cream with %s! To make a new ice cream just say, lets start!", 'FinishNoState': "%s It does not appear that you have created an ice cream yet. To start, just say, Lets start. To exit, just say, close" % get_speechcon('apology'), 'FinishNoTopping': "Alright! What a wonderful %s ice cream. Next time, add some toppings by saying, Add fudge. To make a new ice cream just say, lets start!", 'FinishNoFlavor': "%s It does not appear that you have created an ice cream yet. To start, just say, Lets start. To exit, just say, close" % get_speechcon('apology'), 'Fallback': "%s I cannot help you with that. To start making ice cream, just say, lets start. For help, you can say, help" % get_speechcon('apology') } REPROMPT = { 'addTopping': "To add a topping just tell me what you want to add. To start over, just say, lets start.", 'IceCreamBuilder': "To add a topping just tell me what you want to add. To start over, just say, lets start.", 'IceCreamBuilderWithTopping': "To add a topping just tell me what you want to add. To start over, just say, all done.", 'Fallback': "To start making ice cream, just say, lets start. For help, you can say, help" } logger.info("Utilities are set") ############ # Handlers # ############ ## Custom Intents ## @sb.request_handler(can_handle_func=is_intent_name("IceCreamBuilderIntent")) def ice_cream_builder_intent_handler(handler_input): """Handler for Ice Cream Builder Intent.""" # type: (HandlerInput) -> Response logger.info("Entering IceCreamBuilderIntent") flavor = get_slot(handler_input, slot='flavor') topping = get_slot(handler_input, slot='topping') if flavor.value: handler_input = set_session_attr(handler_input, key='FLAVOR', value=flavor.value) logger.info("Set flavor to %s" % flavor.value) if topping.value: logger.info("Set topping to %s" % topping.value) handler_input = append_session_attr(handler_input, key='TOPPING', value=topping.value) speech_text = SPEECH['IceCreamBuilderWithTopping'] reprompt = REPROMPT['IceCreamBuilderWithTopping'] handler_input = set_session_attr(handler_input, key='STATE', value='TOPPING') else: speech_text = SPEECH['IceCreamBuilder'] reprompt = REPROMPT['IceCreamBuilder'] handler_input = set_session_attr(handler_input, key='STATE', value='FLAVOR') return handler_input.response_builder.speak(speech_text).ask(reprompt).set_should_end_session( False).response else: handler_input.response_builder.add_directive(DelegateDirective()) return handler_input.response_builder.response @sb.request_handler(can_handle_func=is_intent_name("StartIntent")) def start_intent_handler(handler_input): """Handler for Start Intent.""" # type: (HandlerInput) -> Response logger.info("Entering StartIntent") if get_session_attr(handler_input, key='STATE'): speech_text = SPEECH['StartReplay'] del_session_attr(handler_input, 'TOPPING') del_session_attr(handler_input, 'FLAVOR') else: speech_text = SPEECH['Start'] handler_input = set_session_attr(handler_input, key='STATE', value='START') return handler_input.response_builder.speak(speech_text).set_should_end_session( False).response @sb.request_handler(can_handle_func=is_intent_name("FinishIntent")) def finish_intent_handler(handler_input): """Handler for Finish Intent.""" # type: (HandlerInput) -> Response logger.info("Entering FinishIntent") if get_session_attr(handler_input, key='STATE'): flavor = get_session_attr(handler_input, key='FLAVOR') topping = get_session_attr(handler_input, key='TOPPING') toppingList = "" if topping: if len(topping) > 1: topping[-1]= 'and ' + topping[-1] for t in topping: toppingList += "%s, " % t #remove last comma and space toppingList = toppingList[:-2] else: toppingList = topping[0] if not flavor: speech_text = SPEECH['FinishNoFlavor'] elif not toppingList: speech_text = SPEECH['FinishNoTopping'] % flavor handler_input = set_session_attr(handler_input, key='STATE', value='Finish') else: speech_text = SPEECH['Finish'] % (flavor, toppingList) handler_input = set_session_attr(handler_input, key='STATE', value='Finish') else: speech_text = SPEECH['FinishNoState'] return handler_input.response_builder.speak(speech_text).set_should_end_session( False).response @sb.request_handler(can_handle_func=is_intent_name("addToppingIntent")) def add_topping_intent_handler(handler_input): """Handler for Add Topping Intent.""" # type: (HandlerInput) -> Response logger.info("Entering addToppingIntent") topping = get_slot(handler_input, slot='topping') if topping: handler_input = append_session_attr(handler_input, key='TOPPING', value=topping.value) speech_text = SPEECH['addTopping'] reprompt = REPROMPT['addTopping'] handler_input = set_session_attr(handler_input, key='STATE', value='Topping') return handler_input.response_builder.speak(speech_text).ask(reprompt).set_should_end_session( False).response else: handler_input.response_builder.add_directive(DelegateDirective()) return handler_input.response_builder.response ## Built-in Intents ## @sb.request_handler(can_handle_func=is_request_type("LaunchRequest")) def launch_request_handler(handler_input): """Handler for Skill Launch.""" # type: (HandlerInput) -> Response logger.info("Entering LaunchRequest") get_data_from_database(handler_input) speech_text = SPEECH['LaunchRequest'] return handler_input.response_builder.speak(speech_text).set_should_end_session( False).response @sb.request_handler(can_handle_func=is_intent_name("AMAZON.HelpIntent")) def help_intent_handler(handler_input): """Handler for Help Intent.""" # type: (HandlerInput) -> Response logger.info("Entering HelpIntent") speech_text = SPEECH['HelpIntent'] return handler_input.response_builder.speak(speech_text).ask( speech_text).response @sb.request_handler(can_handle_func=is_intent_name("AMAZON.StopIntent")) def stop_intent_handler(handler_input): """Handler for Stop Intent.""" # type: (HandlerInput) -> Response logger.info("Entering AMAZON.StopIntent") speech_text = SPEECH['StopIntent'] return handler_input.response_builder.speak(speech_text).set_should_end_session( True).response @sb.request_handler(can_handle_func=is_intent_name("AMAZON.CancelIntent")) def cancel_intent_handler(handler_input): """Handler for Cancel Intent.""" # type: (HandlerInput) -> Response logger.info("Entering AMAZON.CancelIntent") speech_text = SPEECH['CancelIntent'] return handler_input.response_builder.speak(speech_text).set_should_end_session( False).response @sb.request_handler(can_handle_func=is_intent_name("AMAZON.FallbackIntent")) def fallback_handler(handler_input): """AMAZON.FallbackIntent is only available in en-US locale. This handler will not be triggered except in that locale, so it is safe to deploy on any locale. """ # type: (HandlerInput) -> Response logger.info("Entering AMAZON.FallbackIntent") speech = SPEECH['Fallback'] reprompt = REPROMPT['Fallback'] handler_input.response_builder.speak(speech).ask(reprompt) return handler_input.response_builder.response @sb.request_handler(can_handle_func=is_request_type("SessionEndedRequest")) def session_ended_request_handler(handler_input): """Handler for Session End.""" # type: (HandlerInput) -> Response logger.info("Entering AMAZON.SessionEndedRequest") save_data(handler_input) return handler_input.response_builder.response logger.info("Handlers are set") handler = sb.lambda_handler()
11571898
import glob from PIL import Image, ImageOps from utils import IMAGE_SIZE if __name__ == "__main__": background_rate = 0 border_rate = 0 content_rate = 0 folder = "./dataset/training/segmentation_mask/" images = glob.glob(f'{folder}*.png') number_of_images = len(images) print(f"Starting training data analysis for {number_of_images} images") for filename in images: print(f"Analysing image {filename}") size = IMAGE_SIZE, IMAGE_SIZE image = Image.open(filename) pixels = image.load() width, height = image.size if height >= width: delta_w = height - width delta_h = 0 else: delta_w = 0 delta_h = width - height padding = (delta_w // 2, delta_h // 2, delta_w - (delta_w // 2), delta_h - (delta_h // 2)) image = ImageOps.expand(image, padding).resize(size, Image.NEAREST) pixels = image.load() width, height = image.size number_of_pixels_per_image = width * height background_counter = 0 border_counter = 0 content_counter = 0 for x in range(width): for y in range(height): rgba_info = pixels[x, y] r_channel = rgba_info[0] g_channel = rgba_info[1] b_channel = rgba_info[2] if r_channel == 255: border_counter += 1 elif g_channel == 255: content_counter += 1 elif b_channel == 255: background_counter += 1 elif r_channel == 0 and g_channel == 0 and b_channel == 0: background_counter += 1 else: print("ERROR: INVALID PIXEL") background_rate += background_counter / number_of_pixels_per_image border_rate += border_counter / number_of_pixels_per_image content_rate += content_counter / number_of_pixels_per_image image.close() print(f" - Percentage of background in files = {background_rate / number_of_images}") print(f" - Percentage of border in files = {border_rate / number_of_images}") print(f" - Percentage of content in files = {content_rate / number_of_images}")
11571908
import datetime import json import logging import multiprocessing from pathlib import Path import time import flask import pandas as pd import werkzeug from topicsexplorer import database from topicsexplorer import utils from topicsexplorer import workflow # Initialize logging with logfile in tempdir: utils.init_logging(logging.INFO) # Initialize Flask application: web = utils.init_app("topicsexplorer") @web.route("/") def index(): """Home page.""" logging.debug("Rendering home page template...") utils.init_db(web) return flask.render_template("index.html", help=True) @web.route("/help") def help(): """Help page.""" logging.debug("Rendering help page template...") return flask.render_template("help.html", go_back=True) @web.route("/error") def error(): """Error page.""" with utils.LOGFILE.open("r", encoding="utf-8") as logfile: log = logfile.read().split("\n")[-20:] return flask.render_template( "error.html", reset=True, log="\n".join(log), tempdir=utils.TEMPDIR ) @web.route("/modeling", methods=["POST"]) def modeling(): """Modeling page.""" logging.debug("Calling modeling page endpoint...") # Must be global to use anywhere: global start global process start = time.time() logging.info("Initializing topic modeling process...") logging.info("Started topic modeling process.") workflow.wrapper() logging.debug("Rendering modeling page template...") return flask.render_template("modeling.html", abort=True) @web.route("/overview-topics") def overview_topics(): """Topics overview page.""" logging.debug("Calling topics overview page endpoint...") logging.info("Get document-topic distributions...") response = get_document_topic_distributions() document_topic = pd.read_json(response, orient="index") logging.info("Get token frequencies...") response = get_token_frequencies() token_freqs = json.loads(response) logging.info("Add frequencies to weights...") document_topic = document_topic.multiply(token_freqs, axis=0) logging.info("Sum the weights...") dominance = document_topic.sum(axis=0) logging.info("Scale weights...") proportions = utils.scale(dominance) proportions = pd.Series(proportions, index=dominance.index) proportions = proportions.sort_values(ascending=False) # Convert pandas.Series to a 2-D array: proportions = list(utils.series2array(proportions)) corpus_size = get_corpus_size() number_topics = get_number_of_topics() logging.debug("Rendering topics overview template...") return flask.render_template( "overview-topics.html", current="topics", help=True, reset=True, topics=True, documents=True, document_topic_distributions=True, parameters=True, export_data=True, proportions=proportions, corpus_size=corpus_size, number_topics=number_topics, ) @web.route("/overview-documents") def overview_documents(): """Documents overview page.""" logging.debug("Calling documents overview page endpoint...") sizes = pd.DataFrame(get_textfile_sizes(), columns=["title", "size"]) proportions = utils.scale(sizes["size"]) proportions = pd.Series(proportions, index=sizes["title"]) proportions = proportions.sort_values(ascending=False) # Convert pandas.Series to a 2-D array: proportions = list(utils.series2array(proportions)) corpus_size = get_corpus_size() return flask.render_template( "overview-documents.html", current="documents", help=True, reset=True, topics=True, documents=True, document_topic_distributions=True, parameters=True, export_data=True, proportions=proportions, corpus_size=corpus_size, ) @web.route("/document-topic-distributions") def document_topic_distributions(): """Document-topic distributions page.""" logging.debug("Calling document-topic distributions endpoint...") logging.debug("Rendering document-topic distributions page template...") return flask.render_template( "document-topic-distributions.html", current="document-topic-distributions", help=True, reset=True, topics=True, documents=True, document_topic_distributions=True, parameters=True, export_data=True, ) @web.route("/topics/<topic>") def topics(topic): """Topic page.""" logging.debug("Calling topic page endpoint...") logging.info("Get topics...") topics = json.loads(get_topics()) logging.info("Get document-topic distributions...") document_topic = pd.read_json(get_document_topic_distributions(), orient="index") logging.info("Get topic similarity matrix...") topic_similarites = pd.read_json(get_topic_similarities()) logging.info("Get related documents...") related_docs = document_topic[topic].sort_values(ascending=False)[:10] related_docs_proportions = utils.scale(related_docs, minimum=70) related_docs_proportions = pd.Series( related_docs_proportions, index=related_docs.index ) related_docs_proportions = related_docs_proportions.sort_values(ascending=False) # Convert pandas.Series to a 2-D array: related_docs_proportions = list(utils.series2array(related_docs_proportions)) logging.info("Get related words...") related_words = topics[topic][:15] logging.info("Get similar topics...") similar_topics = topic_similarites[topic].sort_values(ascending=False)[1:4] logging.debug("Rendering topic page template...") return flask.render_template( "detail-topic.html", current="topics", help=True, reset=True, topics=True, documents=True, document_topic_distributions=True, parameters=True, export_data=True, topic=topic, similar_topics=similar_topics.index, related_words=related_words, related_documents=related_docs_proportions, ) @web.route("/documents/<title>") def documents(title): """Document page.""" logging.debug("Calling document page endpoint...") logging.info("Get textfiles...") text = get_textfile(title) logging.info("Get document-topics distributions...") document_topic = pd.read_json(get_document_topic_distributions(), orient="index") logging.info("Get document similarity matrix...") document_similarites = pd.read_json(get_document_similarities()) logging.info("Get related topics...") related_topics = document_topic.loc[title].sort_values(ascending=False) * 100 distribution = list(related_topics.to_dict().items()) logging.info("Get similar documents...") similar_docs = document_similarites[title].sort_values(ascending=False)[1:4] logging.debug("Use only the first 10000 characters (or less) from document...") text = ( text if len(text) < 10000 else "{}... This was an excerpt of the original text.".format(text[:10000]) ) logging.debug("Split paragraphs...") text = text.split("\n\n") n = get_number_of_topics() top_topics = [ "{} most relevant".format(n) if int(n) >= 10 else n, "Top {}".format(n), ] logging.debug("Rendering document page template...") return flask.render_template( "detail-document.html", current="documents", help=True, reset=True, topics=True, documents=True, document_topic_distributions=True, parameters=True, export_data=True, title=title, text=text, distribution=distribution, similar_documents=similar_docs.index, related_topics=related_topics.index, top_topics=top_topics, ) @web.route("/parameters") def parameters(): """Paramter page.""" logging.debug("Calling parameters page endpoint...") logging.info("Get parameters...") data = json.loads(get_parameters())[0] info = json.loads(data) logging.debug("Rendering parameters page template...") return flask.render_template( "overview-parameters.html", current="parameters", parameters=True, help=True, reset=True, topics=True, documents=True, document_topic_distributions=True, export_data=True, **info ) # API endpoints: @web.route("/api/status") def get_status(): """Current modeling status.""" seconds = int(time.time() - start) elapsed_time = datetime.timedelta(seconds=seconds) with utils.LOGFILE.open("r", encoding="utf-8") as logfile: messages = logfile.readlines() message = messages[-1].strip() message = utils.format_logging(message) return "Elapsed time: {}<br>{}".format(elapsed_time, message) @web.route("/api/document-topic-distributions") def get_document_topic_distributions(): """Document-topics distributions.""" return database.select("document_topic_distributions") @web.route("/api/topics") def get_topics(): """Topics.""" return database.select("topics") @web.route("/api/document-similarities") def get_document_similarities(): """Document similarity matrix.""" return database.select("document_similarities") @web.route("/api/topic-similarities") def get_topic_similarities(): """Topic similarity matrix.""" return database.select("topic_similarities") @web.route("/api/textfiles/<title>") def get_textfile(title): """Textfiles.""" return database.select("textfile", title=title) @web.route("/api/stopwords") def get_stopwords(): """Stopwords.""" return database.select("stopwords") @web.route("/api/token-frequencies") def get_token_frequencies(): """Token frequencies per document.""" return database.select("token_freqs") @web.route("/api/parameters") def get_parameters(): """Model parameters.""" return json.dumps(database.select("parameters")) @web.route("/api/textfile-sizes") def get_textfile_sizes(): """Textfile sizes.""" return database.select("textfile_sizes") @web.route("/api/corpus-size") def get_corpus_size(): """Corpus size.""" return str(len(get_textfile_sizes())) @web.route("/api/number-topics") def get_number_of_topics(): """Number of topics.""" return str(len(json.loads(get_topics()))) @web.route("/export/<filename>") def export(filename): """Data archive.""" if "topicsexplorer-data.zip" in {filename}: utils.export_data() path = Path(utils.TEMPDIR, filename) return flask.send_file(filename_or_fp=str(path)) @web.errorhandler(werkzeug.exceptions.HTTPException) def handle_http_exception(e): """Handle errors..""" return error() for code in werkzeug.exceptions.default_exceptions: web.errorhandler(code)(handle_http_exception) @web.after_request def add_header(r): """Clear cache after request.""" r.headers["Cache-Control"] = "no-cache, no-store, must-revalidate" r.headers["Pragma"] = "no-cache" r.headers["Expires"] = "0" r.headers["Cache-Control"] = "public, max-age=0" return r @web.teardown_appcontext def close_connection(exception): """Close connection to SQLite database.""" db = getattr(flask.g, "_database", None) if db is not None: db.close()
11571931
from typing import List from pydantic import Field from tarkov import models from tarkov.fleamarket.models import OfferId from tarkov.inventory.types import ItemId, TemplateId from tarkov.inventory_dispatcher.models import ActionModel, ActionType class RequiredItem(models.Base): id: ItemId count: int class RagfairBuyOffer(models.Base): offer_id: OfferId = Field(alias="id") count: int requirements: List[RequiredItem] = Field(alias="items") class RagfairOfferRequirement(models.Base): template_id: TemplateId = Field(alias="_tpl") count: int level: int side: int onlyFunctional: bool class Buy(ActionModel): Action: ActionType offers: List[RagfairBuyOffer] class Add(ActionModel): Action: ActionType sellInOnePiece: bool items: List[ItemId] requirements: List[RagfairOfferRequirement]
11571970
import tensorflow as tf import argparse import gym import pybullet_envs import roboschool from mvc.envs.wrappers import BatchEnvWrapper, MuJoCoWrapper from mvc.controllers.ppo import PPOController from mvc.controllers.eval import EvalController from mvc.models.networks.ppo import PPONetwork, PPONetworkParams from mvc.models.metrics import Metrics from mvc.models.rollout import Rollout from mvc.view import View from mvc.interaction import interact def make_envs(env_name, num_envs, reward_scale): return [MuJoCoWrapper(gym.make(env_name), reward_scale)\ for _ in range(num_envs)] def main(args): # environments env = BatchEnvWrapper( make_envs(args.env, args.num_envs, args.reward_scale), args.render) env.seed(args.seed) eval_env = BatchEnvWrapper( make_envs(args.env, args.num_envs, args.reward_scale)) eval_env.seed(args.seed) num_actions = env.action_space.shape[0] # network parameters params = PPONetworkParams(fcs=args.layers, num_actions=num_actions, state_shape=env.observation_space.shape, num_envs=args.num_envs, batch_size=args.batch_size, epsilon=args.epsilon, learning_rate=args.lr, grad_clip=args.grad_clip, value_factor=args.value_factor, entropy_factor=args.entropy_factor) # deep neural network network = PPONetwork(params) # rollout buffer rollout = Rollout() # metrics saver = tf.train.Saver() metrics = Metrics(args.name, args.log_adapter, saver) # controller controller = PPOController(network, rollout, metrics, args.num_envs, args.time_horizon, args.epoch, args.batch_size, args.gamma, args.lam, args.final_steps, args.log_interval, args.save_interval, args.eval_interval) # view view = View(controller) # evaluation eval_controller = EvalController(network, metrics, args.eval_episodes) eval_view = View(eval_controller) # save hyperparameters metrics.log_parameters(vars(args)) with tf.Session() as sess: sess.run(tf.global_variables_initializer()) # save model graph for debugging metrics.set_model_graph(sess.graph) if args.load is not None: saver.restore(sess, args.load) interact(env, view, eval_env, eval_view, batch=True) if __name__ == '__main__': parser = argparse.ArgumentParser() parser.add_argument('--time-horizon', type=int, default=2048, help='interval to update') parser.add_argument('--num-envs', type=int, default=1, help='the number of environments') parser.add_argument('--epoch', type=int, default=10, help='epoch of training') parser.add_argument('--batch-size', type=int, default=64, help='batch size of training') parser.add_argument('--gamma', type=float, default=0.99, help='discount factor') parser.add_argument('--lam', type=float, default=0.95, help='lambda of generalized advantage estimation') parser.add_argument('--log-interval', type=int, help='interval of logging') parser.add_argument('--final-steps', type=int, default=10 ** 6, help='the number of training steps') parser.add_argument('--layers', type=int, nargs='+', default=[64, 64], help='layer units') parser.add_argument('--epsilon', type=float, default=0.2, help='clipping factor') parser.add_argument('--lr', type=float, default=3e-4, help='learning rate') parser.add_argument('--grad-clip', type=float, default=0.5, help='gradient clipping') parser.add_argument('--value-factor', type=float, default=1.0, help='value loss weight') parser.add_argument('--entropy-factor', type=float, default=0.0, help='entropy loss weight') parser.add_argument('--env', type=str, default='Pendulum-v0', help='training environment') parser.add_argument('--reward-scale', type=float, default=1.0, help='reward scaling') parser.add_argument('--name', type=str, default='experiment', help='experiment name') parser.add_argument('--log-adapter', type=str, default='tfboard', help='log adapter (visdom, tfboard)') parser.add_argument('--save-interval', type=int, default=2048 * 50, help='interval of saving parameters') parser.add_argument('--load', type=str, help='path to model') parser.add_argument('--eval-interval', type=int, default=2048 * 10, help='interval of evaluation') parser.add_argument('--eval-episodes', type=int, default=10, help='the number of evaluation episode') parser.add_argument('--render', action='store_true', help='show frames of environment') parser.add_argument('--seed', type=int, default=0, help='Random seed of environment') args = parser.parse_args() main(args)
11571971
import os import deprecation import numpy as np import tensorflow as tf from kungfu._utils import _log_event from kungfu.python import propose_new_size from kungfu.tensorflow.initializer import BroadcastGlobalVariablesOp from kungfu.tensorflow.ops import (all_reduce, consensus, current_cluster_size, resize_cluster_from_url, step_based_schedule) class KungFuElasticTrainHook(tf.train.SessionRunHook): @deprecation.deprecated() def __init__(self, schedule, max_step, model_dir, save_final_model=False): self._schedule = schedule self._max_step = max_step self._model_dir = model_dir self._save_final_model = save_final_model self._need_sync = True def _build_resize_op(self, config, step): new_size_op = step_based_schedule(config, step) resize_op = resize_cluster_from_url() return resize_op, new_size_op def begin(self): self._sync_op = BroadcastGlobalVariablesOp() self._step = 0 self._step_place = tf.placeholder(dtype=tf.int32, shape=()) self._sync_step_op = all_reduce(self._step_place, op='max') self._resize_op, self._new_size_op = self._build_resize_op( self._schedule, self._step_place) def after_create_session(self, sess, coord): pass def before_run(self, run_context): if self._step >= self._max_step: # shouldn't happen print('request_stop before kungfu_step: %d' % (self._step)) # run_context.request_stop() # FIXME: force quit if self._need_sync: is_first = self._step == 0 if is_first: _log_event('BEFORE first _sync_step_op') self._step = run_context.session.run( self._sync_step_op, feed_dict={self._step_place: self._step}) if is_first: _log_event('BEFORE first _sync_op') run_context.session.run(self._sync_op) if is_first: _log_event('AFTER first _sync_op') self._need_sync = False def after_run(self, run_context, run_values): new_size = run_context.session.run( self._new_size_op, feed_dict={self._step_place: self._step}) propose_new_size(new_size) changed, detached = run_context.session.run(self._resize_op) if detached: run_context.request_stop() return if changed: print('changed on %d' % (self._step)) self._need_sync = True self._step += 1 if self._step >= self._max_step: print('request_stop on kungfu_step: %d' % (self._step)) run_context.request_stop() def end(self, sess): print('stopped at step: %d' % (self._step)) if self._save_final_model: self.save(sess, 'final') def save(self, sess, idx): vs = tf.global_variables() d = dict() for t in vs: v = sess.run(t) d[t.name] = v np.savez(os.path.join(self._model_dir, 'variables-%s.npz' % (idx)), **d)
11572074
from __future__ import print_function import uuid import msgpack import raft.tcp as tcp class NoConnection(Exception): pass class RaftClient(object): def __init__(self, server): self.tcp = tcp.TCP(0, 'client') self.tcp.start() self.msgs = {} self.tcp.connect(server) if not self.tcp.u2c: # wait 2 seconds to connect self.tcp.recv(0.5) if not self.tcp.u2c: raise NoConnection self.leader = next(iter(self.tcp.u2c.keys())) def _send(self, rpc, msgid): self.tcp.send(rpc, self.leader) msgids = self.poll(0.5) if not msgids or not msgid in msgids: return # XXX put real recovery logic here msg = self.msgs[msgid][0] if msg['type'] == 'cr_rdr': self.leader = msg['leader'] print("redirected to %s! %s" % (self.leader, msg['addr'])) self.tcp.connect(msg['addr']) del self.msgs[msgid] return self._send(rpc, msgid) def poll(self, timeout=0): ans = self.tcp.recv(timeout) if not ans: return msgids = set() for _, msgs in ans: for msg in msgs: msg = msgpack.unpackb(msg, use_list=False) msgid = msg['id'] msgids.add(msgid) ums = self.msgs.get(msgid, []) ums.append(msg) self.msgs[msgid] = ums return msgids def send(self, data): msgid = uuid.uuid4().hex rpc = self.cq_rpc(data, msgid) self._send(rpc, msgid) return msgid def update_hosts(self, config): msgid = uuid.uuid4().hex rpc = self.pu_rpc(config, msgid) self._send(rpc, msgid) return msgid def cq_rpc(self, data, msgid): # client query rpc rpc = { 'type': 'cq', 'id': msgid, 'data': data } return msgpack.packb(rpc) def pu_rpc(self, config, msgid): # protocol update rpc rpc = { 'type': 'pu', 'id': msgid, 'config': config } return msgpack.packb(rpc)
11572105
import click import json, cPickle import os, glob, subprocess import h5py from music21 import * from constants import * @click.group() def analysis(): """Performs various analyses.""" pass @click.command() def embed_note(): text_to_utf = { v:k for k,v in json.load(open(SCRATCH_DIR + '/utf_to_txt.json', 'rb')).items() } utf_to_idx = json.load(open(SCRATCH_DIR + '/concat_corpus.json', 'rb'))['token_to_idx'] in_text = [] for utf in utf_to_idx: # we iterate across 'concat_corpus.json' because it omits unseen symbols (like the torch-rnn model) in_text.append(utf) in_text = ''.join(in_text) input_fp = SCRATCH_DIR + '/input.utf' open(input_fp, 'wb').write(in_text) subprocess.call(' '.join([ 'zsh', '~/bachbot/scripts/analysis/embed_note.zsh', input_fp, '~/data', ]), shell = True) @click.command() def embed_chords(): text_to_utf = { v:k for k,v in json.load(open(SCRATCH_DIR + '/utf_to_txt.json', 'rb')).items() } utf_to_idx = json.load(open(SCRATCH_DIR + '/concat_corpus.json', 'rb'))['token_to_idx'] chords = [ chord.Chord(['C3','E3','G3','C4']), chord.Chord(['E3','G3','C4','E4']), chord.Chord(['G3','C4','E4','G4']), chord.Chord(['A3', 'C4', 'E4', 'A4']) ] for c in chords: in_text = [START_DELIM] for note in c: data = (note.pitch.midi, True) text_data = str(data) in_text.append(text_to_utf[text_data]) in_text.append(text_to_utf[CHORD_BOUNDARY_DELIM]) in_text = ''.join(in_text) input_fp = SCRATCH_DIR + '/input.utf' open(input_fp, 'wb').write(in_text) # key, mode = harmony.chordSymbolFigureFromChord(c, True) # TODO: use this out_dir = "/home/fl350/data/chord_embed/\'{0}\'".format(c.fullName) #print out_dir, key, mode subprocess.call(' '.join([ 'zsh', '~/bachbot/scripts/analysis/embed_note.zsh', input_fp, out_dir, ]), shell = True) map(analysis.add_command, [ embed_note, embed_chords ])
11572111
import subprocess from torchpack.utils.logging import logger import argparse if __name__ == '__main__': parser = argparse.ArgumentParser() parser.add_argument('--dataset', type=str) parser.add_argument('--name', type=str) parser.add_argument('--space', type=str) parser.add_argument('--pr', type=float, nargs='+') parser.add_argument('--mode', type=str) args = parser.parse_args() pres = ['python', 'examples/eval.py', f'examples/configs/' f'{args.dataset}/{args.name}/eval/x2/real/opt2/pruned/300.yml', '--jobs=5', '--run-dir'] with open(f"logs/x2/pruned/{args.dataset}.{args.name}." f"{'-'.join(list(map(str, args.pr)))}.{args.space}." f"{args.mode}.pruned.txt", 'a') as wfid: for prune_ratio in args.pr: if 'maxwell' in args.space: n_blk = 4 else: n_blk = 8 exp = f'runs/{args.dataset}.{args.name}.prune.searched.x2.noise.' \ f'opt2.setting0.pr{prune_ratio}.{args.space}.{args.mode}' logger.info(f"running command {pres + [exp]}") subprocess.call(pres + [exp], stderr=wfid)
11572129
from pulpo_forms.fieldtypes import TextField from pulpo_forms.fieldtypes import FieldFactory class TextAreaField(TextField.TextField): """ Validator for text area is the same as simple TextField """ template_name = "text_area/template.html" edit_template_name = "text_area/template_edit.html" prp_template_name = "text_area/properties.html" def get_assets(): return ['js/fields/TextAreaField.js'] def get_styles(): return ['css/fields/TextAreaField.css'] def __str__(self): return "Multi Line Text" FieldFactory.FieldFactory.register('TextAreaField', TextAreaField)
11572142
from ._misc import RegressBoxes, RegressDims, UpsampleLike, Anchors, ClipBoxes # noqa: F401 from .filter_detections import FilterDetections # noqa: F401 from .fit_road_planes import FitRoadPlanes # noqa: F401
11572156
import GLWindow import moderngl from PIL import Image, ImageDraw, ImageFont import numpy as np wnd = GLWindow.create_window() ctx = moderngl.create_context() prog = ctx.program( vertex_shader=''' #version 330 in vec2 in_vert; in vec3 in_text; out vec3 v_text; void main() { v_text = in_text; gl_Position = vec4(in_vert, 0.0, 1.0); } ''', fragment_shader=''' #version 330 uniform sampler2DArray Texture; in vec3 v_text; out vec4 f_color; void main() { f_color = texture(Texture, v_text); } ''', ) x1 = np.cos(np.linspace(0.0, 2.0 * np.pi, 3, False)) * 0.3 * 9/16 - 0.4 y1 = np.sin(np.linspace(0.0, 2.0 * np.pi, 3, False)) * 0.3 z1 = np.full(3, 0.0) x2 = np.cos(np.linspace(0.0, 2.0 * np.pi, 4, False)) * 0.3 * 9/16 y2 = np.sin(np.linspace(0.0, 2.0 * np.pi, 4, False)) * 0.3 z2 = np.full(4, 1.0) x3 = np.cos(np.linspace(0.0, 2.0 * np.pi, 5, False)) * 0.3 * 9/16 + 0.4 y3 = np.sin(np.linspace(0.0, 2.0 * np.pi, 5, False)) * 0.3 z3 = np.full(5, 2.0) shapes = [ np.dstack([x1, y1, x1, y1, z1]).astype('f4'), np.dstack([x2, y2, x2, y2, z2]).astype('f4'), np.dstack([x3, y3, x3, y3, z3]).astype('f4'), ] vbo = ctx.buffer(b''.join(shape.tobytes() for shape in shapes)) dbo = ctx.buffer(np.array([ 3, 1, 0, 0, 0, 4, 1, 3, 0, 0, 5, 1, 7, 0, 0, ], dtype='i4')) images = [ Image.new('RGB', (256, 256), 'red'), Image.new('RGB', (256, 256), 'green'), Image.new('RGB', (256, 256), 'blue'), ] merged = b''.join(img.tobytes() for img in images) tex = ctx.texture_array((256, 256, 3), 3, merged) tex.use() vao = ctx.simple_vertex_array(prog, vbo, 'in_vert', 'in_text') while wnd.update(): ctx.clear(1.0, 1.0, 1.0, 1.0) # vao.mglo.render(moderngl.TRIANGLE_FAN, 3, 0, 1) # vao.mglo.render(moderngl.TRIANGLE_FAN, 4, 3, 1) # vao.mglo.render(moderngl.TRIANGLE_FAN, 5, 7, 1) vao.render_indirect(dbo, moderngl.TRIANGLE_FAN)
11572211
import os import pickle import re import nltk import numpy as np import pandas as pd from nltk.corpus import stopwords from nltk.tokenize import regexp_tokenize from tqdm import tqdm from sklearn.neighbors import KernelDensity import gensim import torch import torch.utils.data as Data import torchtext.vocab as vocab from torch.utils.data import Dataset import torch.nn.functional as F from utils import sentence_tokenize, transform_format, check_ack_word def read_all_unlabeled(limited_unlabeled_data): with open(data_path + 'labeled_data.pkl', 'rb') as f: labeled_data = pickle.load(f) # {mid: sentences, labels} with open(data_path + 'unlabeled_data.pkl', 'rb') as f: unlabeled_data = pickle.load(f) # {mid: message} with open(data_path + 'mid2target.pkl', 'rb') as f: mid2target = pickle.load(f) # {mid: target, team_size} with open(data_path + 'label_mapping.pkl', 'rb') as f: label_mapping = pickle.load(f) print(label_mapping) try: with open(data_path + 'vocab_2.pkl', 'rb') as f: vocab = pickle.load(f) print('unk words: ', vocab.unk_count) print('vocab size: ', vocab.vocab_size) except: vocab = Vocab(unlabeled_data=unlabeled_data, labeled_data=labeled_data, embedding_size=embedding_size) with open(data_path + 'vocab_2.pkl', 'wb') as f: pickle.dump(vocab, f) print('unk words: ', vocab.unk_count) print('vocab size: ', vocab.vocab_size) all_ids = [k for k in limited_unlabeled_data] train_unlabeled_dataset = Loader_unlabeled( vocab, limited_unlabeled_data, all_ids, mid2target, max_seq_num, max_seq_len) return train_unlabeled_dataset def read_data(data_path, n_labeled_data=300, n_unlabeled_data=-1, max_seq_num=8, max_seq_len=64, embedding_size=128): with open(data_path + 'labeled_data.pkl', 'rb') as f: labeled_data = pickle.load(f) # {mid: sentences, labels} with open(data_path + 'unlabeled_data.pkl', 'rb') as f: unlabeled_data = pickle.load(f) # {mid: message} with open(data_path + 'mid2target.pkl', 'rb') as f: mid2target = pickle.load(f) # {mid: target, team_size} with open(data_path + 'label_mapping.pkl', 'rb') as f: label_mapping = pickle.load(f) print(label_mapping) try: with open(data_path + 'vocab_2.pkl', 'rb') as f: vocab = pickle.load(f) print('unk words: ', vocab.unk_count) print('vocab size: ', vocab.vocab_size) except: vocab = Vocab(unlabeled_data=unlabeled_data, labeled_data=labeled_data, embedding_size=embedding_size) with open(data_path + 'vocab_2.pkl', 'wb') as f: pickle.dump(vocab, f) print('unk words: ', vocab.unk_count) print('vocab size: ', vocab.vocab_size) np.random.seed(1) labeled_data_ids = list(labeled_data.keys()) np.random.shuffle(labeled_data_ids) unlabeled_data_ids = list(unlabeled_data.keys()) np.random.shuffle(unlabeled_data_ids) if len(labeled_data_ids) > 1000: n_labeled_data = min(len(labeled_data_ids)-800, n_labeled_data) else: n_labeled_data = min(len(labeled_data_ids)-500, n_labeled_data) train_labeled_ids = labeled_data_ids[:n_labeled_data] if n_unlabeled_data == -1: n_unlabeled_data = len(unlabeled_data_ids) train_unlabeled_ids = unlabeled_data_ids[:n_unlabeled_data] if len(labeled_data_ids) > 1000: val_ids = labeled_data_ids[-800:-400] test_ids = labeled_data_ids[-400:] else: val_ids = labeled_data_ids[-500:-300] test_ids = labeled_data_ids[-300:] train_labeled_dataset = Loader_labeled( vocab, labeled_data, train_labeled_ids, mid2target, label_mapping, max_seq_num, max_seq_len) train_unlabeled_dataset = Loader_unlabeled( vocab, unlabeled_data, train_unlabeled_ids, mid2target, max_seq_num, max_seq_len) val_dataset = Loader_labeled( vocab, labeled_data, val_ids, mid2target, label_mapping, max_seq_num, max_seq_len) test_dataset = Loader_labeled( vocab, labeled_data, test_ids, mid2target, label_mapping, max_seq_num, max_seq_len) n_class_sentence = 0 for (u,v) in label_mapping.items(): if v!= 0: n_class_sentence += 1 n_class_sentence += 1 doc_label = [] for (u,v) in mid2target.items(): doc_label.append(v) n_class_doc = max(doc_label) + 1 print("#Labeled: {}, Unlabeled {}, Val {}, Test {}, N class {}, {}".format( len(train_labeled_ids), len(train_unlabeled_ids), len(val_ids), len(test_ids), n_class_sentence, n_class_doc)) return train_labeled_dataset, train_unlabeled_dataset, val_dataset, test_dataset, vocab, n_class_sentence, n_class_doc class Vocab(object): def __init__(self, unlabeled_data=None, labeled_data=None, embedding_size=128, max_seq_num=6, max_seq_len=128): self.word2id = {} self.id2word = {} self.pattern = r"""(?x) (?:[A-Z]\.)+ |\$?\d+(?:\.\d+)?%? |\w+(?:[-']\w+)* |\.\.\. |(?:[.,;"'?():-_`]) """ self.english_punctuations = [] # ',', '.', ':', ';', '(', ')', '[', ']', '@', '#', '%', '*', '\"', '=', '^', '_', '~', '-'] self.build_vocab(unlabeled_data, labeled_data, embedding_size, max_seq_num, max_seq_len) self.vocab_size = len(self.word2id) self.embed = self.build_embed_matrix(embedding_size) def build_vocab(self, unlabeled_data, labeled_data, embedding_size, max_seq_num, max_seq_len): sentences = [] words = [] if unlabeled_data is not None: for (u, v) in unlabeled_data.items(): try: results = re.compile(r'http[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", v) results = re.compile(r'www.[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", dd) results = re.compile(r'[a-zA-Z0-9.?/&=:#%_-]*.(com|net|org|io|gov|me|edu)', re.S) dd = results.sub(" <website> ", dd) sents = sentence_tokenize(dd) for j in range(0, len(sents)): a = regexp_tokenize( transform_format(sents[j]), self.pattern) temp = [] for k in range(0, len(a)): if a[k] not in self.english_punctuations and check_ack_word(a[k]) == 1: if a[k].isdigit(): a[k] = '<number>' elif a[k][0] == '$': a[k] = '<money>' elif a[k][-1] == '%': a[k] = '<percentage>' temp.append(a[k].lower()) words.append(a[k].lower()) if len(temp) > 0: sentences.append(temp) except: #print(u,v) #exit() pass if labeled_data is not None: for (u, v) in labeled_data.items(): for i in range(0, len(v[0])): v[0][i] = str(v[0][i]) try: results = re.compile(r'http[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", v[0][i]) results = re.compile(r'www.[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", dd) results = re.compile(r'[a-zA-Z0-9.?/&=:#%_-]*.(com|net|org|io|gov|me|edu)', re.S) dd = results.sub(" <website> ", dd) except: print(u, v) print(v[0][i]) exit() a = regexp_tokenize(transform_format(dd), self.pattern) temp = [] for k in range(0, len(a)): if a[k] not in self.english_punctuations and check_ack_word(a[k]) == 1: if a[k].isdigit(): a[k] = '<number>' elif a[k][0] == '$': a[k] = '<money>' elif a[k][-1] == '%': a[k] = '<percentage>' temp.append(a[k].lower()) words.append(a[k].lower()) if len(temp) > 0: sentences.append(temp) word_frequency = {} for i in range(0, len(words)): if words[i] in word_frequency: word_frequency[words[i]] += 1 else: word_frequency[words[i]] = 1 self.model = gensim.models.Word2Vec( sentences, size=embedding_size, window=5, min_count=1, iter=20, negative=50) x = 4 self.word2id['<pad>'] = 0 self.id2word[0] = '<pad>' self.word2id['<sos>'] = 2 self.id2word[2] = '<sos>' self.word2id['<eos>'] = 3 self.id2word[3] = '<eos>' self.unk_count = 0 for i in range(0, len(sentences)): for j in range(0, len(sentences[i])): if word_frequency[sentences[i][j].lower()] >= 2: if sentences[i][j].lower() in self.model: if sentences[i][j].lower() in self.word2id: pass else: self.word2id[sentences[i][j].lower()] = x self.id2word[x] = sentences[i][j].lower() x = x + 1 else: self.word2id['<unk>'] = 1 self.id2word[1] = '<unk>' self.unk_count += 1 def build_embed_matrix(self, embedding_size): X = np.random.normal(loc=0.0, scale=1.0, size=[ self.vocab_size, embedding_size]) X[0] = np.zeros([1, embedding_size]) #X[0] = np.zeros([1, embedding_size]) #X[0] = np.zeros([1, embedding_size]) for (u, v) in self.id2word.items(): if v in self.model: vector = self.model.wv[v] X[u] = vector return X class Loader_labeled(Dataset): def __init__(self, vocab, labeled_data, ids, target, label_set, max_seq_num=8, max_seq_len=64): self.vocab = vocab self.labeled_data = labeled_data self.ids = ids self.target = target self.max_seq_len = max_seq_len self.max_seq_num = max_seq_num self.pattern = r"""(?x) (?:[A-Z]\.)+ |\$?\d+(?:\.\d+)?%? |\w+(?:[-']\w+)* |\.\.\. """ self.english_punctuations = [] # ',', '.', ':', ';', '(', ')', '[', ']', '@', '#', '%', '*', '\"', '=', '^', '_', '~', '-'] self.label_set = label_set self.kde = KernelDensity(bandwidth=0.5, kernel='gaussian') self.load_data(labeled_data, ids) def __len__(self): return len(self.ids) def __getitem__(self, idx): mid = self.ids[idx] sents, l, sent_len, doc_len= self.message[mid] message_target = self.lookup_score(mid) labels = np.array([10] * self.max_seq_num) doc_len = np.array(doc_len) sent_length = np.array([0] * self.max_seq_num) # select labeled sent mask1 = np.array([0] * self.max_seq_num) # select unlabeled sent mask2 = np.array([0] * self.max_seq_num) # select padded sent mask3 = np.array([1] * self.max_seq_num) # select unpadded sent mask4 = np.array([0] * self.max_seq_num) for i in range(0, len(l)): labels[i] = l[i] sent_length[i] = sent_len[i] if l[i] != 10: mask1[i] = 1 mask2[i] = 0 mask3[i] = 0 mask4[i] = 1 if l[i] == 10: mask1[i] = 0 mask2[i] = 1 mask3[i] = 0 mask4[i] = 1 message_vec = torch.LongTensor(self.message2id(sents)) return (message_vec, labels, message_target, mask1, mask2, mask3, mask4, mid, sent_length, doc_len) def lookup_score(self, id): return self.target[id] def lookup_label_id(self, s): return self.label_set[s] def message2id(self, message): X = np.zeros([self.max_seq_num, self.max_seq_len]) for i in range(0, len(message)): for j, si in enumerate(message[i]): if i < self.max_seq_num and j < self.max_seq_len: try: id = self.vocab.word2id[si.lower()] X[i][j] = id except: X[i][j] = 1 for i in range(len(message), self.max_seq_num): X[i][0] = 2 X[i][1] = 3 return X def load_data(self, labeled_data, ids): self.message = {} labels_esit = [] for i in ids: sentences = [] labels = [] doc_len = [] sent_len = [] sents, l = labeled_data[i] for j in range(0, len(sents)): sents[j] = str(sents[j]) results = re.compile(r'www.[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", sents[j]) results = re.compile(r'http[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", dd) results = re.compile(r'[a-zA-Z0-9.?/&=:#%_-]*.(com|net|org|io|gov|me|edu)', re.S) dd = results.sub(" <website> ", dd) a = regexp_tokenize(transform_format(dd), self.pattern) temp = [] for k in range(0, len(a)): if a[k] not in self.english_punctuations and check_ack_word(a[k]) == 1: if a[k].isdigit(): a[k] = '<number>' elif a[k][0] == '$': a[k] = '<money>' elif a[k][-1] == '%': a[k] = '<percentage>' temp.append(a[k].lower()) if len(temp) > 0: temp_ = ['<sos>'] for k in range(0, min(len(temp), self.max_seq_len -2)): temp_.append(temp[k]) temp_.append('<eos>') sentences.append(temp_) labels.append(self.lookup_label_id(l[j])) labels_esit.append(self.lookup_label_id(l[j])) sent_len.append(len(temp_) - 1) doc_len.append(len(sents) - 1) self.message[i] = (sentences, labels, sent_len, doc_len) x_d = set() for (u, v) in self.label_set.items(): x_d.add(v) x_d = np.array(list(x_d)) self.kde.fit(np.array(labels_esit)[:, None]) self.dist = self.kde.score_samples(x_d[:, None]) self.esit_dist = F.softmax(torch.tensor(self.dist), dim = -1) class Loader_unlabeled(Dataset): def __init__(self, vocab, unlabeled_data, ids, target, max_seq_num=8, max_seq_len=64): self.vocab = vocab self.unlabeled_data = unlabeled_data #self.ids = ids self.target = target self.max_seq_num = max_seq_num self.max_seq_len = max_seq_len self.pattern = r"""(?x) (?:[A-Z]\.)+ |\$?\d+(?:\.\d+)?%? |\w+(?:[-']\w+)* |\.\.\. """ self.english_punctuations = [] # ',', '.', ':', ';', '(', ')', '[', ']', '@', '#', '%', '*', '\"', '=', '^', '_', '~', '-'] self.load_data(unlabeled_data, ids) def __len__(self): return len(self.ids) def __getitem__(self, idx): mid = self.ids[idx] sents, l, sent_len, doc_len = self.message[mid] message_target = self.lookup_score(mid) doc_len = np.array(doc_len) sent_length = np.array([0] * self.max_seq_num) labels = np.array([10] * self.max_seq_num) # select labeled sent mask1 = np.array([0] * self.max_seq_num) # select unlabeled sent mask2 = np.array([0] * self.max_seq_num) # select padded sent mask3 = np.array([1] * self.max_seq_num) # select unpadded sent mask4 = np.array([0] * self.max_seq_num) for i in range(0, len(l)): labels[i] = l[i] sent_length[i] = sent_len[i] if l[i] != 10: mask1[i] = 1 mask2[i] = 0 mask3[i] = 0 mask4[i] = 1 if l[i] == 10: mask1[i] = 0 mask2[i] = 1 mask3[i] = 0 mask4[i] = 1 message_vec = torch.LongTensor(self.message2id(sents)) return (message_vec, labels, message_target, mask1, mask2, mask3, mask4, mid, sent_length, doc_len) def message2id(self, message): X = np.zeros([self.max_seq_num, self.max_seq_len]) for i in range(0, len(message)): for j, si in enumerate(message[i]): if i < self.max_seq_num and j < self.max_seq_len: try: id = self.vocab.word2id[si.lower()] X[i][j] = id except: X[i][j] = 1 for i in range(len(message), self.max_seq_num): X[i][0] = 2 X[i][1] = 3 return X def lookup_score(self, id): return self.target[id] def load_data(self, unlabeled_data, ids): self.message = {} self.ids = [] self.data_num = 0 for i in ids: try: sentences = [] labels = [] doc = unlabeled_data[i] doc_len = [] sent_len = [] doc += '.' results = re.compile(r'http[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", doc) results = re.compile(r'www.[a-zA-Z0-9.?/&=:#%_-]*', re.S) dd = results.sub(" <website> ", dd) results = re.compile(r'[a-zA-Z0-9.?/&=:#%_-]*.(com|net|org|io|gov|me|edu)', re.S) dd = results.sub(" <website> ", dd) sents = sentence_tokenize(dd) # print(sents) for j in range(0, len(sents)): a = regexp_tokenize( transform_format(sents[j]), self.pattern) temp = [] for k in range(0, len(a)): if a[k] not in self.english_punctuations and check_ack_word(a[k]) == 1: if a[k].isdigit(): a[k] = '<number>' elif a[k][0] == '$': a[k] = '<money>' elif a[k][-1] == '%': a[k] = '<percentage>' temp.append(a[k].lower()) if len(temp) > 0: temp_ = ['<sos>'] for k in range(0, min(len(temp), self.max_seq_len - 2)): temp_.append(temp[k]) temp_.append('<eos>') sentences.append(temp_) labels.append(10) sent_len.append(len(temp_) - 1) doc_len.append(min(len(sents) - 1, self.max_seq_num - 1)) self.message[i] = (sentences[:self.max_seq_num], labels[:self.max_seq_num], sent_len[:self.max_seq_num], doc_len) self.ids.append(i) except: if str(doc) != "nan": print(doc) pass
11572244
import re from .default import DefaultParser class KarmaParser(DefaultParser): name = "karma" def command_matches(self, command): return "karma" in command def num_passed(self, result): return self.num_total(result) - self.num_failed(result) def num_total(self, result): # Executed 2 of 2 (1 FAILED) m = re.findall('Executed (\d+) of (\d+)', result.cleaned_output) return int(m[-1][1]) def num_failed(self, result): # You'll see either # Executed 2 of 2 (1 FAILED) # Executed 1 of 1 SUCCESS # Note that karma rewrites the screen as it goes, # so you have to grab the last one. fails = re.findall( 'Executed (\d+) of (\d+) \((\d+) FAILED\)', result.cleaned_output ) if len(fails) > 0: return int(fails[-1][-1]) else: m = re.findall( 'Executed (\d+) of (\d+) SUCCESS', result.cleaned_output ) if len(m) > 0: return 0
11572245
from agileutil.rpc.transport import TcpTransport, UdpTransport, HttpTransport, ClientUdpTransport, RpcTransport from agileutil.rpc.serialize import BinarySerialize, JsonSerialize from multiprocessing import cpu_count class RpcProtocal(object): __slots__ = ('transport') def __init__(self): self.transport = RpcTransport() def serialize(self, obj): serializer = None if self.serializeType == 'bin': serializer = BinarySerialize() elif self.serializeType == 'json': serializer = JsonSerialize() if serializer == None: raise Exception('unknown serializeType') return serializer.serialize(obj) def unserialize(self, msg): serializer = None if self.serializeType == 'bin': serializer = BinarySerialize() elif self.serializeType == 'json': serializer = JsonSerialize() if serializer == None: raise Exception('unknown serializeType') return serializer.unserialize(msg) def parseRequest(self, package): func = package['func'] args = package['args'] kwargs = package['kwargs'] return func, args, kwargs class UdpProtocal(RpcProtocal): def __init__(self): pass class HttpProtocal(RpcProtocal): def __init__(self, host, port, worker = cpu_count(), serializeType = 'bin', timeout = 10, poolConnection=5, poolMaxSize = 20, maxRetries = 3): RpcProtocal.__init__(self) self.host = host self.port = port self.worker = worker self.serializeType = serializeType self.timeout = timeout self.transport = HttpTransport(host, port, timeout, poolConnection, poolMaxSize, maxRetries) class TcpProtocal(RpcProtocal): def __init__(self, host, port, serializeType = 'bin', timeout = 10): RpcProtocal.__init__(self) self.serializeType = serializeType self.timeout = timeout self.transport = TcpTransport(host, port, timeout) class UdpProtocal(RpcProtocal): def __init__(self, host, port, serializeType = 'bin', timeout = 10): RpcProtocal.__init__(self) self.serializeType = serializeType self.timeout = timeout self.transport = UdpTransport(host, port) class ClientUdpProtocal(UdpProtocal): def __init__(self, host, port, serializeType = 'bin', timeout = 10): UdpProtocal.__init__(self, host, port, serializeType=serializeType, timeout=timeout) self.serializeType = serializeType self.host = host self.port = port self.timeout = timeout self.transport = ClientUdpTransport(host, port, timeout) def newTransport(self): self.transport.close() self.transport = ClientUdpTransport(self.host, self.port, self.timeout)
11572249
import unittest from tinyber.c_nodes import int_max_size_type class TestBasic(unittest.TestCase): def test_int8(self): size = "int8_t" self.assertEqual(int_max_size_type(-2**7, 0), size) self.assertEqual(int_max_size_type(-1, 0), size) self.assertEqual(int_max_size_type(-1, 2**7 - 1), size) self.assertEqual(int_max_size_type(-2**7, 2**7 - 1), size) self.assertNotEqual(int_max_size_type(0, 2**7), size) self.assertNotEqual(int_max_size_type(0, 2**7 - 1), size) def test_int16(self): size = "int16_t" self.assertEqual(int_max_size_type(-1, 256), size) self.assertEqual(int_max_size_type(-1, 2**15 - 1), size) self.assertEqual(int_max_size_type(-2**15, 2**15 - 1), size) self.assertNotEqual(int_max_size_type(0, 2**15), size) self.assertNotEqual(int_max_size_type(0, 2**15 - 1), size) def test_int32(self): size = "int32_t" self.assertEqual(int_max_size_type(-1, 2**16), size) self.assertEqual(int_max_size_type(-1, 2**31 - 1), size) self.assertEqual(int_max_size_type(-2**31, 2**31 - 1), size) self.assertNotEqual(int_max_size_type(-1, 2**31), size) self.assertNotEqual(int_max_size_type(0, 2**31), size) def test_int64(self): size = "int64_t" self.assertEqual(int_max_size_type(-1, 2**32), size) self.assertEqual(int_max_size_type(-1, 2**63 - 1), size) self.assertEqual(int_max_size_type(-2**63, 2**63 - 1), size) self.assertNotEqual(int_max_size_type(0, 2**63), size) with self.assertRaises(NotImplementedError): int_max_size_type(-1, 2**63) with self.assertRaises(NotImplementedError): int_max_size_type(-2**64, 0) def test_uint8(self): size = "uint8_t" self.assertEqual(int_max_size_type(0, 0), size) self.assertEqual(int_max_size_type(0, 2**8 - 1), size) # self.assertNotEqual(int_max_size_type(0, -1), size) self.assertNotEqual(int_max_size_type(0, 2**8), size) def test_uint16(self): size = "uint16_t" self.assertEqual(int_max_size_type(0, 256), size) self.assertEqual(int_max_size_type(0, 2**16 - 1), size) self.assertNotEqual(int_max_size_type(0, 2**16), size) def test_uint32(self): size = "uint32_t" self.assertEqual(int_max_size_type(0, 2**16), size) self.assertEqual(int_max_size_type(0, 2**32 - 1), size) self.assertNotEqual(int_max_size_type(0, 2**32), size) def test_uint64(self): size = "uint64_t" self.assertEqual(int_max_size_type(0, 2**32), size) self.assertEqual(int_max_size_type(0, 2**64 - 1), size) with self.assertRaises(NotImplementedError): int_max_size_type(0, 2**64) if __name__ == '__main__': unittest.main()
11572322
import numpy as np import ora from ora import * import pytest pytest.importorskip("ora.np") #------------------------------------------------------------------------------- # FIXME: Combine. TIME_TYPES = (SmallTime, Unix32Time, Unix64Time, Time, NsTime, HiTime, Time128) # FIXME: Put the offset dtype in an attribute. @pytest.mark.parametrize("Time,offset_dtype", [ (SmallTime , np.dtype("uint32")), (Unix32Time , np.dtype("int32")), (Unix64Time , np.dtype("int64")), (Time , np.dtype("uint64")), (NsTime , np.dtype("int64")), (HiTime , np.dtype("uint64")), ]) def test_to_offset(Time, offset_dtype): arr = np.array([ Time.MIN, Time.from_offset(0), Time.MAX, Time.INVALID, Time.MISSING, ]) off = ora.np.to_offset(arr) assert off.dtype == offset_dtype assert len(off) == 5 assert off[0] == Time.MIN.offset assert off[1] == 0 assert off[2] == Time.MAX.offset
11572325
from aws_cfn_update.rest_api_body_updater import RestAPIBodyUpdater import json def test_new_resource_name(): updater = RestAPIBodyUpdater() updater.resource_name = 'RestAPI' result = updater.new_resource_name('RestAPI') assert result == 'RestAPIv1' result = updater.new_resource_name(result) assert result == 'RestAPIv2' updater.resource_name = 'Restv2Api' result = updater.new_resource_name('Restv2Apiv3') assert result == 'Restv2Apiv4' def test_matching_names(): updater = RestAPIBodyUpdater() updater.resource_name = 'RestAPI' updater.template = { 'Resources': { 'RestAPIv10': {'Type': 'AWS::ApiGateway::RestApi'}, 'RestApi': {'Type': 'AWS::ApiGateway::RestApi'}, 'Restv2APiv1': {'Type': 'AWS::ApiGateway::RestApi'}, 'RestAPIv1': {'Type': 'AWS::ApiGateway::RestApi'}, 'RestAPIv0': {'Type': 'AWS::ApiGateway::RestApi'}, 'RestAPIv_01': {'Type': 'AWS::ApiGateway::RestApi'} } } result = updater.find_matching_resources() assert result == ['RestAPIv0', 'RestAPIv1', 'RestAPIv10'] updater.resource_name = 'RestApi' result = updater.find_matching_resources() assert result == ['RestApi'] updater.resource_name = 'NotARestApi' result = updater.find_matching_resources() assert not result sample = { "Resources": { "Deployment": { "Type": "AWS::ApiGateway::Deployment", "Properties": { "RestApiId": { "Ref": "RestAPI" } } }, "RestAPI": { "Type": "AWS::ApiGateway::RestApi", "Properties": { "EndpointConfiguration": { "Types": [ "REGIONAL" ] }, "Body": { "swagger": "2.0" } } } } } def test_replace_body(): updater = RestAPIBodyUpdater() updater.resource_name = 'RestAPI' updater.template = json.loads(json.dumps(sample)) updater.body = {'swagger': '2.0', 'description': 'a new one'} updater.update_template() assert updater.dirty assert 'description' in updater.template['Resources']['RestAPI']['Properties']['Body'] assert updater.template['Resources']['RestAPI']['Properties']['Body']['description'] == 'a new one' def test_add_new_version(): updater = RestAPIBodyUpdater() updater.resource_name = 'RestAPI' updater.template = json.loads(json.dumps(sample)) updater.body = {'swagger': '2.0', 'description': 'a new one'} updater.add_new_version = True updater.update_template() assert updater.dirty assert 'RestAPI' not in updater.template['Resources'] assert 'RestAPIv1' in updater.template['Resources'] assert 'description' in updater.template['Resources']['RestAPIv1']['Properties']['Body'] assert updater.template['Resources']['RestAPIv1']['Properties']['Body']['description'] == 'a new one' multiple = { "Resources": { "Deployment": { "Type": "AWS::ApiGateway::Deployment", "Properties": { "RestApiId": { "Ref": "RestAPIv3" } } }, "RestAPI": { "Type": "AWS::ApiGateway::RestApi", "Properties": { "EndpointConfiguration": { "Types": [ "REGIONAL" ] }, "Body": { "swagger": "2.0" } } }, "RestAPIv2": { "Type": "AWS::ApiGateway::RestApi", "Properties": { "EndpointConfiguration": { "Types": [ "REGIONAL" ] }, "Body": { "swagger": "2.0" } } }, "RestAPIv3": { "Type": "AWS::ApiGateway::RestApi", "Properties": { "EndpointConfiguration": { "Types": [ "GLOBAL" ] }, "Body": { "swagger": "2.0" } } } } } def test_add_new_version_keep_two(): updater = RestAPIBodyUpdater() updater.resource_name = 'RestAPI' updater.template = json.loads(json.dumps(multiple)) updater.body = {'swagger': '2.0', 'description': 'a new one'} updater.add_new_version = True updater.keep = 2 updater.update_template() assert updater.dirty assert 'RestAPI' not in updater.template['Resources'] assert 'RestAPIv2' not in updater.template['Resources'] assert 'RestAPIv3' in updater.template['Resources'] assert 'RestAPIv4' in updater.template['Resources'] assert 'GLOBAL' == updater.template['Resources']['RestAPIv4']['Properties']['EndpointConfiguration']['Types'][0] assert 'description' in updater.template['Resources']['RestAPIv4']['Properties']['Body'] assert updater.template['Resources']['RestAPIv4']['Properties']['Body']['description'] == 'a new one' assert updater.template['Resources']['Deployment']['Properties']['RestApiId']['Ref'] == 'RestAPIv4' def test_load_and_merge(): updater = RestAPIBodyUpdater() updater.resource_name = 'RestAPI' updater.template = json.loads(json.dumps(sample)) updater.api_gateway_extensions = 'tests/aws-extensions.yaml' updater.open_api_specification = 'tests/api-specification.yaml' updater.body = updater.load_and_merge_swagger_body() updater.update_template() assert updater.dirty assert updater.template['Resources']['RestAPI']['Properties']['Body'] == updater.body
11572326
import sys import os import config.parser as config from brain.helpers.sql import session_transaction from brain.models.sqlobjects import User, Base from sqlalchemy import create_engine from irma.common.base.exceptions import IrmaDatabaseResultNotFound,\ IrmaDatabaseError if len(sys.argv) not in (4, 5): print("usage: {0} <username> <rmqvhost> <ftpuser>\n" " with <username> a string\n" " <rmqvhost> the rmqvhost used for the frontend\n" " <ftpuser> the ftpuser used by the frontend\n" "example: {0} test1 mqfrontend frontend" "".format(sys.argv[0])) sys.exit(1) name = sys.argv[1] rmqvhost = sys.argv[2] ftpuser = sys.argv[3] # Auto-create directory for sqlite db db_name = os.path.abspath(config.sqldb.dbname) dirname = os.path.dirname(db_name) if not os.path.exists(dirname): print("SQL directory does not exist {0}" "..creating".format(dirname)) os.makedirs(dirname) os.chmod(dirname, 0o777) elif not (os.path.isdir(dirname)): print("Error. SQL directory is a not a dir {0}" "".format(dirname)) raise IrmaDatabaseError("Can not create Brain database dir") if not os.path.exists(db_name): # touch like method to create a rw-rw-rw- file for db open(db_name, 'a').close() os.chmod(db_name, 0o666) # Retrieve database informations engine = create_engine(config.sqldb.url, echo=config.sql_debug_enabled()) # and create Database in case Base.metadata.create_all(engine) with session_transaction() as session: try: user = User.get_by_rmqvhost(session, rmqvhost=rmqvhost) print("rmqvhost {0} is already assigned to user {1}. " "Updating with new parameters.".format(user.name, user.rmqvhost)) session.query(User)\ .filter_by(id=user.id)\ .update({'name': name, 'ftpuser': ftpuser}) except IrmaDatabaseResultNotFound: user = User(name=name, rmqvhost=rmqvhost, ftpuser=ftpuser) session.add(user)
11572340
import os import socket sockname = os.environ['KAA_SOCKNAME'] s = socket.socket(socket.AF_UNIX, socket.SOCK_STREAM) s.connect(sockname) s.send(b'ok\n') s.recv(4096) s.close()
11572373
from corehq.apps.reports.filters.fixtures import AsyncLocationFilter class RestrictedAsyncLocationFilter(AsyncLocationFilter): def load_locations_json(self, loc_id): user = self.request.couch_user if user.has_permission(self.domain, 'access_all_locations'): return super(RestrictedAsyncLocationFilter, self).load_locations_json(loc_id) return RestrictedLocationDrillDown(domain=self.domain, user=user).get_locations_json()
11572398
import logging import math import ConfigParser import numpy as np from nn_dataflow import ConvLayer from src.utils.utils import ceil_a_by_b, log2, lookup_pandas_dataframe from src.simulator.stats import Stats from src.simulator.loop_stack import LoopStack from src.optimizer.optimizer import optimize_for_order, get_stats_fast from src.simulator.accelerator import Accelerator from sram.sram_stats import get_sram_dataframe, get_sram_data import os import pandas class Simulator(object): """ Simulator class """ def __init__(self, config_file='conf.ini', verbose=False, energy_costs=None): # custom energy cost self.energy_costs = energy_costs self.config_file = config_file self.config = ConfigParser.ConfigParser() self.config.read(config_file) systolic_dim = [self.config.getint('accelerator', 'a'), 1, self.config.getint('accelerator', 'c')] if verbose: log_level = logging.DEBUG else: log_level = logging.INFO # logging.basicConfig(level=log_level) self.logger = logging.getLogger('{}.{}'.format(__name__, 'Simulator')) self.logger.setLevel(log_level) self.logger.debug("Creating Simulator Object") self.logger.debug("Systolic Array dimentions: {}".format(systolic_dim)) mem_if_width = self.config.getint('system', 'if_width') self.logger.debug("Memory Interface Bit-Width: {}-bits".format(mem_if_width)) pmax = self.config.getint('accelerator', 'high_prec') pmin = self.config.getint('accelerator', 'low_prec') self.logger.debug("High Precision: {}-bits".format(pmax)) self.logger.debug("Low Precision: {}-bits".format(pmin)) # Using half the size assuming double buffering sram = {} sram['act'] = self.config.getint('accelerator', 'Act_SRAM') self.logger.debug("Activation SRAM size: {:,} Bytes".format(sram['act'])) sram['wgt'] = self.config.getint('accelerator', 'Wgt_SRAM') self.logger.debug("Weight SRAM size: {:,} Bytes".format(sram['wgt'])) sram['out'] = self.config.getint('accelerator', 'Out_SRAM') self.logger.debug("Output SRAM size: {:,} Bytes".format(sram['out'])) frequency = self.config.getint('accelerator', 'frequency') self.logger.debug('Frequency: {:,} Hz'.format(frequency)) hp_peak_throughput = systolic_dim[0] * \ systolic_dim[1] * \ systolic_dim[2] peak_throughput = hp_peak_throughput * \ (int(pmax / pmin) ** 2) self.logger.debug('Lowest precision: Peak Throughput: {:,} Ops/cycle'.format(peak_throughput)) self.logger.debug('Highest precision: Peak Throughput: {:,} Ops/cycle'.format(hp_peak_throughput)) N = systolic_dim[0] beta = systolic_dim[1] M = systolic_dim[2] assert beta == 1 self.accelerator = Accelerator(N, M, pmax, pmin, sram, mem_if_width, frequency) ################################################## # Get stats for SRAM frequency = self.accelerator.frequency tech_node = 45 voltage = 0.85 sram_csv = 'hardware_sweep/sram_results.csv' self.sram_df = get_sram_dataframe(tech_node, voltage, int(frequency * 1.e-6), './sram/data', logpath='./sram/mcpat.sram/SampleScirpts/RunLog') def get_area(self): frequency = self.accelerator.frequency ################################################## N = self.accelerator.N M = self.accelerator.M pmax = self.accelerator.pmax pmin = self.accelerator.pmin wbuf_size = self.accelerator.sram['wgt'] * 8 ibuf_size = self.accelerator.sram['act'] * 8 obuf_size = self.accelerator.sram['out'] * 8 wbuf_bank = N * 2 ibuf_bank = N * 2 obuf_bank = 2 wbuf_bits = (pmax * pmax / pmin) * M ibuf_bits = (pmax * pmax / pmin) obuf_bits = 32 * M wbuf_word = ceil_a_by_b(wbuf_size, wbuf_bank * wbuf_bits) ibuf_word = ceil_a_by_b(ibuf_size, ibuf_bank * ibuf_bits) obuf_word = ceil_a_by_b(obuf_size, obuf_bank * obuf_bits) ################################################## wbuf_area, wbuf_leak_power, wbuf_read_energy, wbuf_write_energy = get_sram_data(self.sram_df, wbuf_bits, wbuf_size/8, wbuf_bank, 2) self.logger.debug('WBUF :') self.logger.debug('\tBanks : {0:>8}'.format(wbuf_bank)) self.logger.debug('\tBitWidth : {0:>8}'.format(wbuf_bits)) self.logger.debug('\tWords : {0:>8}'.format(wbuf_word)) self.logger.debug('\tTotal Size (kBytes) : {0:>8}'.format(wbuf_size/8./1024.)) self.logger.debug('\tArea : {0:>8.2f}'.format(wbuf_area)) self.logger.debug('\tLeak Energy (per clock) : {0:>8.6f}'.format(wbuf_leak_power)) self.logger.debug('\tRead Energy (per bit) (nJ) : {0:>8.6f}'.format(wbuf_read_energy)) self.logger.debug('\tWrite Energy (per bit) (nJ) : {0:>8.6f}'.format(wbuf_write_energy)) ################################################## ibuf_area, ibuf_leak_power, ibuf_read_energy, ibuf_write_energy = get_sram_data(self.sram_df, ibuf_bits, ibuf_size/8, ibuf_bank, 2) self.logger.debug('IBUF :') self.logger.debug('\tBanks : {0:>8}'.format(ibuf_bank)) self.logger.debug('\tBitWidth : {0:>8}'.format(ibuf_bits)) self.logger.debug('\tWords : {0:>8}'.format(ibuf_word)) self.logger.debug('\tTotal Size (kBytes) : {0:>8}'.format(ibuf_size/8./1024.)) self.logger.debug('\tArea : {0:>8.2f}'.format(ibuf_area)) self.logger.debug('\tLeak Energy (per clock) : {0:>8.6f}'.format(ibuf_leak_power)) self.logger.debug('\tRead Energy (per bit) (nJ) : {0:>8.6f}'.format(ibuf_read_energy)) self.logger.debug('\tWrite Energy (per bit) (nJ) : {0:>8.6f}'.format(ibuf_write_energy)) ################################################## obuf_area, obuf_leak_power, obuf_read_energy, obuf_write_energy = get_sram_data(self.sram_df, obuf_bits, obuf_size/8, obuf_bank, 2) self.logger.debug('OBUF :') self.logger.debug('\tBanks : {0:>8}'.format(obuf_bank)) self.logger.debug('\tBitWidth : {0:>8}'.format(obuf_bits)) self.logger.debug('\tWords : {0:>8}'.format(obuf_word)) self.logger.debug('\tTotal Size (kBytes) : {0:>8}'.format(obuf_size/8./1024.)) self.logger.debug('\tArea : {0:>8.2f}'.format(obuf_area)) self.logger.debug('\tLeak Energy (per clock) : {0:>8.6f}'.format(obuf_leak_power)) self.logger.debug('\tRead Energy (per bit) (nJ) : {0:>8.6f}'.format(obuf_read_energy)) self.logger.debug('\tWrite Energy (per bit) (nJ) : {0:>8.6f}'.format(obuf_write_energy)) ################################################## # Get stats for systolic array core_csv = os.path.join('./results', 'systolic_array_synth.csv') core_synth_data = pandas.read_csv(core_csv) lookup_dict = {} lookup_dict['Max Precision (bits)'] = pmax lookup_dict['Min Precision (bits)'] = pmin lookup_dict['N'] = N lookup_dict['M'] = M core_data = lookup_pandas_dataframe(core_synth_data, lookup_dict) if len(core_data) == 0: lookup_dict['N'] = 4 lookup_dict['M'] = 4 core_data = lookup_pandas_dataframe(core_synth_data, lookup_dict) assert len(core_data) == 1 core_area = float(core_data['Area (um^2)']) * 1.e-6 * (N * M) / 16. core_dyn_power = float(core_data['Dynamic Power (nW)']) * (N * M) / 16. core_dyn_energy = core_dyn_power / float(core_data['Frequency']) core_leak_power = float(core_data['Leakage Power (nW)']) * (N * M) / 16. core_leak_energy = core_leak_power / float(core_data['Frequency']) else: core_area = float(core_data['Area (um^2)']) * 1.e-6 core_dyn_power = float(core_data['Dynamic Power (nW)']) core_dyn_energy = core_dyn_power / float(core_data['Frequency']) core_leak_power = float(core_data['Leakage Power (nW)']) core_leak_energy = core_leak_power / float(core_data['Frequency']) self.logger.debug('Core :') self.logger.debug('\tDimensions : {0}x{1}-systolic array'.format(N, M)) self.logger.debug('\tMax-Precision : {}'.format(pmax)) self.logger.debug('\tMin-Precision : {}'.format(pmin)) self.logger.debug('\tLeak Energy (nJ) : {}'.format(core_leak_energy)) self.logger.debug('\tDynamic Energy (nJ) : {}'.format(core_dyn_energy)) self.logger.debug('\tArea (mm^2) : {}'.format(core_area)) ################################################## return core_area, wbuf_area, ibuf_area, obuf_area def get_energy_cost(self): if self.energy_costs is not None: return self.energy_costs frequency = self.accelerator.frequency ################################################## N = self.accelerator.N M = self.accelerator.M pmax = self.accelerator.pmax pmin = self.accelerator.pmin wbuf_size = self.accelerator.sram['wgt'] * 8 ibuf_size = self.accelerator.sram['act'] * 8 obuf_size = self.accelerator.sram['out'] * 8 wbuf_bank = N * 2 ibuf_bank = N * 2 obuf_bank = 2 wbuf_bits = (pmax * pmax / pmin) * M ibuf_bits = (pmax * pmax / pmin) obuf_bits = 32 * M wbuf_word = ceil_a_by_b(wbuf_size, wbuf_bank * wbuf_bits) ibuf_word = ceil_a_by_b(ibuf_size, ibuf_bank * ibuf_bits) obuf_word = ceil_a_by_b(obuf_size, obuf_bank * obuf_bits) ################################################## wbuf_area, wbuf_leak_power, wbuf_read_energy, wbuf_write_energy = get_sram_data(self.sram_df, wbuf_bits, wbuf_size/8, wbuf_bank, 2) self.logger.debug('WBUF :') self.logger.debug('\tBanks : {0:>8}'.format(wbuf_bank)) self.logger.debug('\tBitWidth : {0:>8}'.format(wbuf_bits)) self.logger.debug('\tWords : {0:>8}'.format(wbuf_word)) self.logger.debug('\tTotal Size (kBytes) : {0:>8}'.format(wbuf_size/8./1024.)) self.logger.debug('\tArea : {0:>8.2f}'.format(wbuf_area)) self.logger.debug('\tLeak Energy (per clock) : {0:>8.6f}'.format(wbuf_leak_power)) self.logger.debug('\tRead Energy (per bit) (nJ) : {0:>8.6f}'.format(wbuf_read_energy)) self.logger.debug('\tWrite Energy (per bit) (nJ) : {0:>8.6f}'.format(wbuf_write_energy)) ################################################## ibuf_area, ibuf_leak_power, ibuf_read_energy, ibuf_write_energy = get_sram_data(self.sram_df, ibuf_bits, ibuf_size/8, ibuf_bank, 2) self.logger.debug('IBUF :') self.logger.debug('\tBanks : {0:>8}'.format(ibuf_bank)) self.logger.debug('\tBitWidth : {0:>8}'.format(ibuf_bits)) self.logger.debug('\tWords : {0:>8}'.format(ibuf_word)) self.logger.debug('\tTotal Size (kBytes) : {0:>8}'.format(ibuf_size/8./1024.)) self.logger.debug('\tArea : {0:>8.2f}'.format(ibuf_area)) self.logger.debug('\tLeak Energy (per clock) : {0:>8.6f}'.format(ibuf_leak_power)) self.logger.debug('\tRead Energy (per bit) (nJ) : {0:>8.6f}'.format(ibuf_read_energy)) self.logger.debug('\tWrite Energy (per bit) (nJ) : {0:>8.6f}'.format(ibuf_write_energy)) ################################################## obuf_area, obuf_leak_power, obuf_read_energy, obuf_write_energy = get_sram_data(self.sram_df, obuf_bits, obuf_size/8, obuf_bank, 2) self.logger.debug('OBUF :') self.logger.debug('\tBanks : {0:>8}'.format(obuf_bank)) self.logger.debug('\tBitWidth : {0:>8}'.format(obuf_bits)) self.logger.debug('\tWords : {0:>8}'.format(obuf_word)) self.logger.debug('\tTotal Size (kBytes) : {0:>8}'.format(obuf_size/8./1024.)) self.logger.debug('\tArea : {0:>8.2f}'.format(obuf_area)) self.logger.debug('\tLeak Energy (per clock) : {0:>8.6f}'.format(obuf_leak_power)) self.logger.debug('\tRead Energy (per bit) (nJ) : {0:>8.6f}'.format(obuf_read_energy)) self.logger.debug('\tWrite Energy (per bit) (nJ) : {0:>8.6f}'.format(obuf_write_energy)) ################################################## # Get stats for systolic array core_csv = os.path.join('./results', 'systolic_array_synth.csv') core_synth_data = pandas.read_csv(core_csv) lookup_dict = {} lookup_dict['Max Precision (bits)'] = pmax lookup_dict['Min Precision (bits)'] = pmin lookup_dict['N'] = N lookup_dict['M'] = M core_data = lookup_pandas_dataframe(core_synth_data, lookup_dict) if len(core_data) == 0: lookup_dict['N'] = 4 lookup_dict['M'] = 4 core_data = lookup_pandas_dataframe(core_synth_data, lookup_dict) assert len(core_data) == 1 core_area = float(core_data['Area (um^2)']) * 1.e-6 * (N * M) / 16. core_dyn_power = float(core_data['Dynamic Power (nW)']) * (N * M) / 16. core_dyn_energy = core_dyn_power / float(core_data['Frequency']) core_leak_power = float(core_data['Leakage Power (nW)']) * (N * M) / 16. core_leak_energy = core_leak_power / float(core_data['Frequency']) else: core_area = float(core_data['Area (um^2)']) * 1.e-6 core_dyn_power = float(core_data['Dynamic Power (nW)']) core_dyn_energy = core_dyn_power / float(core_data['Frequency']) core_leak_power = float(core_data['Leakage Power (nW)']) core_leak_energy = core_leak_power / float(core_data['Frequency']) self.logger.debug('Core :') self.logger.debug('\tDimensions : {0}x{1}-systolic array'.format(N, M)) self.logger.debug('\tMax-Precision : {}'.format(pmax)) self.logger.debug('\tMin-Precision : {}'.format(pmin)) self.logger.debug('\tLeak Energy (nJ) : {}'.format(core_leak_energy)) self.logger.debug('\tDynamic Energy (nJ) : {}'.format(core_dyn_energy)) self.logger.debug('\tArea (mm^2) : {}'.format(core_area)) ################################################## total_leak_energy = core_leak_energy + (wbuf_leak_power + ibuf_leak_power + obuf_leak_power) * 1.e9 / frequency return total_leak_energy, core_dyn_energy, wbuf_read_energy, wbuf_write_energy, ibuf_read_energy, ibuf_write_energy, obuf_read_energy, obuf_write_energy def __str__(self): ret = '' ret += 'Simulator object' ret += '\n' ret += '\tMax supported precision: {}'.format(self.accelerator.pmax) ret += '\n' ret += '\tMin supported precision: {}'.format(self.accelerator.pmin) ret += '\n' ret += '\tSystolic array size: {} -inputs x {} -outputs'.format( self.accelerator.N, self.accelerator.M) ret += '\n' ret += '\tWbuf size: {:,} Bytes'.format(self.accelerator.sram['wgt']) ret += '\n' ret += '\tIbuf size: {:,} Bytes'.format(self.accelerator.sram['act']) ret += '\n' ret += '\tObuf size: {:,} Bytes'.format(self.accelerator.sram['out']) ret += '\n' ret += 'Double buffering enabled. Sizes of SRAM are halved' return ret def loop_estimate_stats(self, loop_instruction, verbose=False): """ args: loop_instruction: Loops for the NN. index 0 = outer loop index -1 = inner loop """ # The following loop promotes Memory accesses to improve reuse loop_instruction.promote_mem_ops(self.accelerator.sram) # get stats stats = loop_instruction.get_stats(self.accelerator, verbose) return stats def get_FC_cycles(self, Ni, No, iprec, wprec, batch_size=1): """ Get number of cycles required for Fully-Connected Layer. args: Ni: Input neurons No: Output neurons batch_size: Batch size for FC layer iprec: Precision for activations (bits) wprec: Precision for weights (bits) batch_size: Batch size for the layer description: This function calls the get_conv_cycles function """ total_cycles = self.get_conv_cycles(1, 1, 1, Ni, No, iprec, wprec, batch_size) return total_cycles def get_perf_factor(self, iprec, wprec): iprec = max(iprec, self.accelerator.pmin) wprec = max(wprec, self.accelerator.pmin) return int(self.accelerator.pmax / iprec) * int(self.accelerator.pmax / wprec) def get_conv_cycles(self, K, O, S, IC, OC, iprec, wprec, batch_size=1, im2col=False): """ Get number of cycles required for Fully-Connected Layer. args: K: Kernel Size O: Output Size S: Input Stride IC: Input Channels OC: Output Channels iprec: Precision for activations (bits) wprec: Precision for weights (bits) batch_size: Batch size for the layer description: This functions does an exhaustive search for finding the optimal Tiling and Ordering parameters assumptions: (1) uses an estimate of the compute cycles, instead of actually simulating the number of cycles """ B = batch_size I = (O - 1) * S + K # We do not tile the "K" dimension and compute an entire 2-D conv at a # time num_O_tiles = int(math.ceil(log2(O))) + 1 num_IC_tiles = int(math.ceil(log2(IC))) + 1 num_OC_tiles = int(math.ceil(log2(math.ceil(float(OC)/self.accelerator.M)))) + 1 num_B_tiles = int(math.ceil(log2(B))) + 1 self.logger.debug('Number of O Tiles: {}'.format(num_O_tiles)) self.logger.debug('Number of IC Tiles: {}'.format(num_IC_tiles)) self.logger.debug('Number of OC Tiles: {}'.format(num_OC_tiles)) self.logger.debug('Number of B Tiles: {}'.format(num_B_tiles)) best_instructions_dict = {} conv_params = self.accelerator, K, O, S, IC, OC, B, iprec, wprec, im2col, self.get_energy_cost() best_instructions, best_tiling, best_order, _, _ = optimize_for_order(conv_params) stats = get_stats_fast(conv_params, best_tiling, best_order, verbose=False) act_reads = stats.reads['act'] wgt_reads = stats.reads['wgt'] out_reads = stats.reads['out'] dram_reads = stats.reads['dram'] out_writes = stats.writes['out'] dram_writes = stats.writes['dram'] best_cycles = stats.total_cycles num_ops = O * O * K * K * IC * OC * B # self.logger.debug('Best Operations: {}'.format(best_operations)) self.logger.debug('Conv Layer') self.logger.debug('Num of ops: {}'.format(num_ops)) self.logger.debug('Kernel Size: {}x{}x{}x{}'.format(K, K, IC, OC)) self.logger.debug('Output Size: {}x{}x{}'.format(O, O, OC)) self.logger.debug('Stride Size: {}x{}'.format(S, S)) self.logger.debug('Input Size: {}x{}x{}'.format(I, I, IC)) self.logger.debug('Max Precision: {}'.format(self.accelerator.pmax)) self.logger.debug('Min Precision: {}'.format(self.accelerator.pmin)) self.logger.debug('Activation Precision: {}'.format(iprec)) self.logger.debug('Weight Precision: {}'.format(wprec)) self.logger.debug('Performance Factor: {}'.format(self.get_perf_factor(iprec, wprec))) self.logger.debug('Total Cycles: {:,}'.format(best_cycles)) cycles_per_batch = ceil_a_by_b(best_cycles, batch_size) self.logger.debug('Total Cycles per batch: {:,}'.format(cycles_per_batch)) ops_per_cycle = float(num_ops) / best_cycles self.logger.debug('Ops/Cycle: {:,.2f}'.format(ops_per_cycle)) ops_per_cycle_per_pe = float(ops_per_cycle) / (self.accelerator.N * self.accelerator.M) self.logger.debug('Ops/Cycle/PE: {:,.4}'.format(ops_per_cycle_per_pe)) return stats, best_instructions def get_cycles(self, layer, batch_size=1): if isinstance(layer, ConvLayer): return self.get_conv_cycles(layer.sfil, # K layer.hofm, # Oh == Ow layer.htrd, # S layer.nifm, # NI layer.nofm, # NO layer.iprec, # Activation Precision layer.wprec, # Weight Precision batch_size, # Batch Size im2col=layer.im2col) # Batch Size
11572406
from setuptools import setup, find_packages setup( name='django-node-assets', version='0.9.9', description='The Django application that allows install and serve assets via Node.js package ' 'manager infrastructure.', author='<NAME>', author_email='<EMAIL>', url='https://github.com/whitespy/django-node-assets', long_description=open('README.rst').read(), packages=find_packages(), include_package_data=True, keywords='django assets staticfiles Node.js npm package.json', classifiers=[ 'Environment :: Web Environment', 'Intended Audience :: Developers', 'Operating System :: OS Independent', 'Programming Language :: Python', 'Programming Language :: Python :: 3.6', 'Programming Language :: Python :: 3.7', 'Programming Language :: Python :: 3.8', 'Programming Language :: Python :: 3.9', 'Framework :: Django', 'Framework :: Django :: 2.1', 'Framework :: Django :: 2.2', 'Framework :: Django :: 3.0', 'Framework :: Django :: 3.1', 'Framework :: Django :: 3.2', ] )
11572444
import os from flask import Flask, jsonify, request from discord_interactions import verify_key_decorator, InteractionType, InteractionResponseType, InteractionResponseFlags CLIENT_PUBLIC_KEY = os.getenv('CLIENT_PUBLIC_KEY') app = Flask(__name__) @app.route('/interactions', methods=['POST']) @verify_key_decorator(CLIENT_PUBLIC_KEY) def interactions(): if request.json['type'] == InteractionType.APPLICATION_COMMAND: return jsonify({ 'type': InteractionResponseType.CHANNEL_MESSAGE_WITH_SOURCE, 'data': { 'content': 'Hello world' } }) elif request.json['type'] == InteractionType.MESSAGE_COMPONENT: return jsonify({ 'type': InteractionResponseType.CHANNEL_MESSAGE_WITH_SOURCE, 'data': { 'content': 'Hello, you interacted with a component.', 'flags': InteractionResponseFlags.EPHEMERAL } })
11572446
from __future__ import absolute_import from rlib import jit from rlib.debug import make_sure_not_resized from rtruffle.node import Node from som.interpreter.ast.frame import ( create_frame_args, create_frame_3, create_frame_2, create_frame_1, ) from som.vmobjects.method import AbstractMethod def get_printable_location(node): assert isinstance(node, AstMethod) return node.source_section.identifier jitdriver_1 = jit.JitDriver( greens=["node"], get_printable_location=get_printable_location, reds=["rcvr"], is_recursive=True, # the next line is a workaround around a likely bug in RPython # for some reason, the inlining heuristics default to "never inline" when # two different jit drivers are involved (in our case, the primitive # driver, and this one). # the next line says that calls involving this jitdriver should always be # inlined once (which means that things like Integer>>< will be inlined # into a while loop again, when enabling this driver). should_unroll_one_iteration=lambda self: True, ) jitdriver_2 = jit.JitDriver( greens=["node"], get_printable_location=get_printable_location, reds=["rcvr", "arg"], is_recursive=True, should_unroll_one_iteration=lambda self: True, ) jitdriver_3 = jit.JitDriver( greens=["node"], get_printable_location=get_printable_location, reds=["rcvr", "arg1", "arg2"], is_recursive=True, should_unroll_one_iteration=lambda self: True, ) jitdriver_args = jit.JitDriver( greens=["node"], get_printable_location=get_printable_location, reds=["rcvr", "args"], is_recursive=True, should_unroll_one_iteration=lambda self: True, ) class _Invokable(Node): """ Only needed to work around RPython type system. Otherwise the parent field would point to a non-Node type (AstMethod) """ _immutable_fields_ = ["expr_or_sequence?"] _child_nodes_ = ["expr_or_sequence"] def __init__(self, expr_or_sequence): Node.__init__(self) self.expr_or_sequence = self.adopt_child(expr_or_sequence) class AstMethod(AbstractMethod): _immutable_fields_ = [ "invokable", "_arg_inner_access[*]", "_size_frame", "_size_inner", "_embedded_block_methods", "source_section", "_lexical_scope", ] def __init__( self, signature, expr_or_sequence, arg_inner_access, size_frame, size_inner, embedded_block_methods, source_section, lexical_scope, ): AbstractMethod.__init__(self, signature) assert isinstance(arg_inner_access, list) make_sure_not_resized(arg_inner_access) self._arg_inner_access = arg_inner_access self._size_frame = size_frame self._size_inner = size_inner self._embedded_block_methods = embedded_block_methods self.source_section = source_section self.invokable = _Invokable(expr_or_sequence) self._lexical_scope = lexical_scope def set_holder(self, value): self._holder = value for method in self._embedded_block_methods: method.set_holder(value) @jit.elidable_promote("all") def get_number_of_arguments(self): return self._signature.get_number_of_signature_arguments() def invoke_1(node, rcvr): # pylint: disable=no-self-argument jitdriver_1.jit_merge_point(node=node, rcvr=rcvr) frame = create_frame_1( rcvr, node._size_frame, node._size_inner, ) return node.invokable.expr_or_sequence.execute(frame) def invoke_2(node, rcvr, arg): # pylint: disable=no-self-argument jitdriver_2.jit_merge_point(node=node, rcvr=rcvr, arg=arg) frame = create_frame_2( rcvr, arg, node._arg_inner_access[0], node._size_frame, node._size_inner, ) return node.invokable.expr_or_sequence.execute(frame) def invoke_3(node, rcvr, arg1, arg2): # pylint: disable=no-self-argument jitdriver_3.jit_merge_point(node=node, rcvr=rcvr, arg1=arg1, arg2=arg2) frame = create_frame_3( rcvr, arg1, arg2, node._arg_inner_access, node._size_frame, node._size_inner, ) return node.invokable.expr_or_sequence.execute(frame) def invoke_args(node, rcvr, args): # pylint: disable=no-self-argument assert args is not None make_sure_not_resized(args) jitdriver_args.jit_merge_point(node=node, rcvr=rcvr, args=args) frame = create_frame_args( rcvr, args, node._arg_inner_access, node._size_frame, node._size_inner, ) return node.invokable.expr_or_sequence.execute(frame) def inline(self, mgenc): mgenc.merge_into_scope(self._lexical_scope) self.invokable.expr_or_sequence.adapt_after_inlining(mgenc) return self.invokable.expr_or_sequence def adapt_after_outer_inlined(self, removed_ctx_level, mgenc_with_inlined): self.invokable.expr_or_sequence.adapt_after_outer_inlined( removed_ctx_level, mgenc_with_inlined ) if removed_ctx_level == 1: self._lexical_scope.drop_inlined_scope()
11572458
import synapse.lib.module as s_module class GovCnModule(s_module.CoreModule): def getModelDefs(self): modl = { 'types': ( ('gov:cn:icp', ('int', {}), {'doc': 'A Chinese Internet Content Provider ID.'}, ), ('gov:cn:mucd', ('int', {}), {'doc': 'A Chinese PLA MUCD.'}, ), ), 'forms': ( ('gov:cn:icp', {}, ( ('org', ('ou:org', {}), { 'doc': 'The org with the Internet Content Provider ID.', }), )), # TODO - Add 'org' as a secondary property to mcud? ('gov:cn:mucd', {}, ()), ) } name = 'gov:cn' return ((name, modl), )
11572535
import math from bluegraph.core.utils import * from bluegraph.core.utils import _aggregate_values def test_normalize_to_set(): assert( normalize_to_set({1, 2, 3}) == {1, 2, 3}) assert( normalize_to_set(1) == {1}) assert( normalize_to_set(math.nan) == set()) assert( normalize_to_set("lala") == {"lala"}) assert( normalize_to_set("lala") == set(["lala"])) def test_safe_intersection(): assert( safe_intersection("lala", {"lala", 1}) == {"lala"}) assert( safe_intersection("lala", "lala") == {"lala"}) assert( safe_intersection("lala", math.nan) == set()) def test_str_to_set(): assert(str_to_set("{'1', '2', '3'}") == {'1', '2', '3'}) def test_top_n(): d = { "a": 4, "b": 5, "c": 1, "d": 6, "e": 10 } assert(top_n(d, 3) == ['e', 'd', 'b']) assert(top_n(d, 3, smallest=True) == ["c", "a", "b"]) def test_aggregate_values(): assert( _aggregate_values(["1", {"1", "2"}, {"2", "3"}]) == {"1", "2", "3"}) def test_element_has_type(): assert(element_has_type({"M", "N", "O"}, {"M", "N"})) assert(not element_has_type({"M", "N", "O"}, {"M", "K"}))
11572601
import sys import os import argparse import xmltodict import json from datetime import datetime from glob import glob from concurrent.futures import ThreadPoolExecutor import re MAX_WORKERS = 50 FORCE_LIST = ('course', 'section', 'schedule', 'instructor', 'attribute', 'tag', 'learningObjective') MAX_SECTIONS = 20 BASE_TIME = datetime.strptime('', '') TIME_FORMAT = '%I:%M:%S %p' def postprocessor(path, key, value): if value and key[:-1] in FORCE_LIST: return key, value[key[:-1]] else: return key, value def parse_time(s): if not s: return 0 dt = datetime.strptime(s, TIME_FORMAT) return (dt - BASE_TIME).total_seconds() def parse_courses_xml(doc): body = xmltodict.parse(doc, force_list=FORCE_LIST, postprocessor=postprocessor) courses = body['xml']['courses'] if not courses: return [] result = [] for course in courses: PLUCK_KEYS = ('year', 'subject', 'code', 'title', 'description', 'repeatable', 'grading', 'unitsMin', 'unitsMax') generated = {k: course[k] for k in PLUCK_KEYS} generated['sections'] = [] generated['gers'] = [] # Metadata generated['objectID'] = course['administrativeInformation']['courseId'] generated['number'] = '{} {}'.format(course['subject'], course['code']) # GER list for filtering if course['gers']: generated['gers'] = [x.strip() for x in course['gers'].split(',')] # Generate all possible units counts (for filtering) min_units = int(course['unitsMin']) max_units = int(course['unitsMax']) generated['units'] = list(range(min_units, max_units + 1)) if course['sections']: total_sections = len(course['sections']) generated['totalSections'] = total_sections course['sections'].sort(key=lambda c: c['sectionNumber']) for section in course['sections'][:MAX_SECTIONS]: PLUCK_SECTION_KEYS = ('term', 'termId', 'sectionNumber', 'component', 'notes', 'classId', 'currentClassSize', 'maxClassSize') gen_section = {k: section[k] for k in PLUCK_SECTION_KEYS} gen_section['schedules'] = [] # Timestamps for sort / filter for schedule in section['schedules']: PLUCK_SCHEDULE_KEYS = ('startTime', 'endTime', 'location') gen_schedule = {k: schedule[k] for k in PLUCK_SCHEDULE_KEYS} if schedule['instructors']: gen_schedule['instructors'] = [({ 'name': i['name'], 'sunet': i['sunet'] }) for i in schedule['instructors']] else: gen_schedule['instructors'] = [] gen_schedule['startTimestamp'] = parse_time( schedule['startTime']) gen_schedule['endTimestamp'] = parse_time( schedule['endTime']) # Fix whitespace in days if schedule['days']: gen_schedule['days'] = \ re.sub(r'\s+', ' ', schedule['days']).strip() else: gen_schedule['days'] = None gen_section['schedules'].append(gen_schedule) generated['sections'].append(gen_section) result.append(generated) return result def process_file(name, f, dest): print(' Processing', name) try: courses = parse_courses_xml(f.read()) with open(dest, 'w+') as f: json.dump(courses, f, indent=4) except Exception as e: print(' Error encountered processing', name, e) raise e print(' Processed', name) def main(): parser = argparse.ArgumentParser(description='fast-courses parser') parser.add_argument('--key', '-k', type=str) parser.add_argument('--outdir', '-o', type=str, required=True) parser.add_argument('--pattern', '-p', type=str) parser.add_argument('files', nargs='*', type=argparse.FileType('r'), default=[sys.stdin]) args = parser.parse_args() print('Serializing ExploreCourses XML to JSON...') os.makedirs(args.outdir, exist_ok=True) if args.pattern: names = glob(args.pattern) files = [open(n, 'r') for n in names] else: files = args.files with ThreadPoolExecutor(max_workers=MAX_WORKERS) as executor: for f in files: if args.key: base = args.key else: base = os.path.splitext(os.path.basename(f.name))[0] dest = os.path.join(args.outdir, base + '.json') # process_file(base, f, dest) executor.submit(process_file, base, f, dest) print('Finished serializing ExploreCourses XML to JSON!') if __name__ == '__main__': main()
11572604
from os import system from time import sleep from random import randrange def RunManyJobs(): # run many simple jobs jobPath = 'autotest/simple_one_cpu.job' task = '' for i in range(0, 500): task += 'run ' + jobPath + ';' cmd = './prun -c "' + task + '"' system(cmd) jobPath = 'autotest/simple_many_cpu.job' task = '' for i in range(0, 500): task += 'run ' + jobPath + ';' cmd = './prun -c "' + task + '"' system(cmd) # send many large source code files jobPath = 'autotest/many_code.job' task = '' for i in range(0, 1): task += 'run ' + jobPath + ';' cmd = './prun -c "' + task + '"' system(cmd) # run many medium jobs jobPath = 'autotest/medium.job' task = '' for i in range(0, 50): task += 'run ' + jobPath + ';' cmd = './prun -c "' + task + '"' system(cmd) # run many heavy jobs jobPath = 'autotest/heavy.job' task = '' for i in range(0, 10): task += 'run ' + jobPath + ';' cmd = './prun -c "' + task + '"' system(cmd) # run many meta jobs jobPath = 'test.meta' task = '' for i in range(0, 50): task += 'run ' + jobPath + ';' cmd = './prun -c "' + task + '"' system(cmd) # run cron jobs task = 'run cron.job; run cron.meta' cmd = './prun -c "' + task + '"' system(cmd) def RunHeavyJobs(): # run many heavy jobs jobPath = 'autotest/heavy.job' task = '' for i in range(0, 10): task += 'run ' + jobPath + ';' cmd = './prun -c "' + task + '"' system(cmd) def AddExistingUser(): task = '' for i in range(0, 100): task += 'add localhost groupx;' cmd = './prun -c "' + task + '"' system(cmd) def StopAll(): cmd = './prun -c "stopall"' system(cmd) def DeleteGroup(): task = 'deleteg groupx; deleteg hosts_group1' cmd = './prun -c "' + task + '"' system(cmd) def AddGroup(): task = 'addg hosts_group1' cmd = './prun -c "' + task + '"' system(cmd) def JobInfo(jobId): task = 'info ' + str(jobId) cmd = './prun -c "' + task + '"' system(cmd) def StopJob(jobId): task = 'stop ' + str(jobId) cmd = './prun -c "' + task + '"' system(cmd) def Stat(): task = 'stat; jobs; ls;' cmd = './prun -c "' + task + '"' system(cmd) # check job stopping RunManyJobs() AddExistingUser() StopAll() for i in range(0, 10): RunManyJobs() StopAll() sleep(2) StopAll() for i in range(0, 5): RunHeavyJobs() sleep(1) StopAll() # check group removal for i in range(0, 5): RunManyJobs() sleep(1) DeleteGroup() sleep(1) AddGroup() StopAll() # check job info statistics and certain job stopping RunManyJobs() for i in range(0, 100): jobId = randrange(0, 1000) JobInfo(jobId) jobId = randrange(0, 1000) StopJob(jobId) StopAll() # check statistics RunManyJobs() for i in range(0, 1000): Stat() print('done')
11572615
import asyncio from unittest import mock import pytest from aiohttp import web from aiohttp_cors import CorsConfig, APP_CONFIG_KEY from aiohttp_cors import ResourceOptions, CorsViewMixin, custom_cors DEFAULT_CONFIG = { '*': ResourceOptions() } CLASS_CONFIG = { '*': ResourceOptions() } CUSTOM_CONFIG = { 'www.client1.com': ResourceOptions(allow_headers=['X-Host']) } class SimpleView(web.View, CorsViewMixin): async def get(self): return web.Response(text="Done") class SimpleViewWithConfig(web.View, CorsViewMixin): cors_config = CLASS_CONFIG async def get(self): return web.Response(text="Done") class CustomMethodView(web.View, CorsViewMixin): cors_config = CLASS_CONFIG async def get(self): return web.Response(text="Done") @custom_cors(CUSTOM_CONFIG) async def post(self): return web.Response(text="Done") @pytest.fixture def _app(): return web.Application() @pytest.fixture def cors(_app): ret = CorsConfig(_app, defaults=DEFAULT_CONFIG) _app[APP_CONFIG_KEY] = ret return ret @pytest.fixture def app(_app, cors): # a trick to install a cors into app return _app def test_raise_exception_when_cors_not_configure(): request = mock.Mock() request.app = {} view = CustomMethodView(request) with pytest.raises(ValueError): view.get_request_config(request, 'post') async def test_raises_forbidden_when_config_not_found(app): app[APP_CONFIG_KEY].defaults = {} request = mock.Mock() request.app = app request.headers = { 'Origin': '*', 'Access-Control-Request-Method': 'GET' } view = SimpleView(request) with pytest.raises(web.HTTPForbidden): await view.options() def test_method_with_custom_cors(app): """Test adding resource with web.View as handler""" request = mock.Mock() request.app = app view = CustomMethodView(request) assert hasattr(view.post, 'post_cors_config') assert asyncio.iscoroutinefunction(view.post) config = view.get_request_config(request, 'post') assert config.get('www.client1.com') == CUSTOM_CONFIG['www.client1.com'] def test_method_with_class_config(app): """Test adding resource with web.View as handler""" request = mock.Mock() request.app = app view = SimpleViewWithConfig(request) assert not hasattr(view.get, 'get_cors_config') config = view.get_request_config(request, 'get') assert config.get('*') == CLASS_CONFIG['*'] def test_method_with_default_config(app): """Test adding resource with web.View as handler""" request = mock.Mock() request.app = app view = SimpleView(request) assert not hasattr(view.get, 'get_cors_config') config = view.get_request_config(request, 'get') assert config.get('*') == DEFAULT_CONFIG['*']
11572678
import psycopg2 from flask import request from structlog import get_logger from tenacity import retry, wait_random_exponential, retry_if_exception_type, stop_after_delay from entityservice import database as db from entityservice.cache.active_runs import set_run_state_deleted from entityservice.database import delete_run_data, get_similarity_file_for_run from entityservice.views.auth_checks import abort_if_run_doesnt_exist, abort_if_invalid_results_token from entityservice.views.serialization import RunDescription from entityservice.tasks import delete_minio_objects logger = get_logger() def get(project_id, run_id): log = logger.bind(pid=project_id, rid=run_id) log.info("request description of a run") authorize_run_detail(project_id, run_id) log.debug("request for run description authorized") with db.DBConn() as conn: log.debug("Retrieving run description from database") run_object = db.get_run(conn, run_id) return RunDescription().dump(run_object) @retry(wait=wait_random_exponential(multiplier=1, max=60), retry=retry_if_exception_type(psycopg2.IntegrityError), stop=stop_after_delay(120)) def _delete_run(run_id, log): # Retry if a db integrity error occurs (e.g. when a worker is writing to the same row) # Randomly wait up to 2^x * 1 seconds between each retry until the range reaches 60 seconds, then randomly up to 60 seconds afterwards set_run_state_deleted(run_id) with db.DBConn() as conn: log.debug("Retrieving run details from database") similarity_file = get_similarity_file_for_run(conn, run_id) delete_run_data(conn, run_id) return similarity_file def delete(project_id, run_id): log = logger.bind(pid=project_id, rid=run_id) log.debug("request to delete run") authorize_run_detail(project_id, run_id) log.debug("approved request to delete run") similarity_file = _delete_run(run_id, log) log.debug("Deleted run from database") if similarity_file: log.debug("Queuing task to remove similarities file from object store") delete_minio_objects.delay([similarity_file], project_id) return '', 204 def authorize_run_detail(project_id, run_id): # Check the project and run resources exist abort_if_run_doesnt_exist(project_id, run_id) # Check the caller has a valid results token. Yes it should be renamed. abort_if_invalid_results_token(project_id, request.headers.get('Authorization'))
11572683
import os import torch import torch.nn as nn from torch.utils.model_zoo import load_url from .universal import UniversalProcess from .util import remove_layer from .util import initialize_weights __all__ = ['resnet50'] model_urls = { 'resnet50': 'https://download.pytorch.org/models/resnet50-19c8e357.pth', } class Bottleneck(nn.Module): expansion = 4 def __init__(self, inplanes, planes, stride=1, downsample=None, base_width=64): super(Bottleneck, self).__init__() width = int(planes * (base_width / 64.)) self.conv1 = nn.Conv2d(inplanes, width, 1, bias=False) self.bn1 = nn.BatchNorm2d(width) self.conv2 = nn.Conv2d(width, width, 3, stride=stride, padding=1, bias=False) self.bn2 = nn.BatchNorm2d(width) self.conv3 = nn.Conv2d(width, planes * self.expansion, 1, bias=False) self.bn3 = nn.BatchNorm2d(planes * self.expansion) self.relu = nn.ReLU(inplace=True) self.downsample = downsample self.stride = stride def forward(self, x): identity = x out = self.conv1(x) out = self.bn1(out) out = self.relu(out) out = self.conv2(out) out = self.bn2(out) out = self.relu(out) out = self.conv3(out) out = self.bn3(out) if self.downsample is not None: identity = self.downsample(x) out += identity out = self.relu(out) return out class ResNet(nn.Module): def __init__(self, block, layers, num_classes=1000, large_feature_map=False, attribution_method='CAM', **kwargs): super(ResNet, self).__init__() stride_l3 = 1 if large_feature_map else 2 self.inplanes = 64 self.num_classes = num_classes self.block = block self.attribution_method = attribution_method self.process = UniversalProcess(attribution_method) self.conv1 = nn.Conv2d( 3, self.inplanes, kernel_size=7, stride=2, padding=3, bias=False) self.bn1 = nn.BatchNorm2d(self.inplanes) self.relu = nn.ReLU(inplace=True) self.maxpool = nn.MaxPool2d(kernel_size=3, stride=2, padding=1) self.layer1 = self._make_layer(block, 64, layers[0], stride=1) self.layer2 = self._make_layer(block, 128, layers[1], stride=2) self.layer3 = self._make_layer(block, 256, layers[2], stride=stride_l3) self.layer4 = self._make_layer(block, 512, layers[3], stride=1) self.conv_last = nn.Conv2d( 512 * block.expansion, num_classes, kernel_size=1) self.attention = self._get_attention() initialize_weights(self.modules(), init_mode='xavier') self.process.set_layers(self.conv_last, self.attention) def forward(self, x, labels=None, superclass=None, return_cam=False): x = self.conv1(x) x = self.bn1(x) x = self.relu(x) x = self.maxpool(x) x = self.layer1(x) x = self.layer2(x) x = self.layer3(x) f_former = self.layer4(x) f = self.conv_last(f_former) if return_cam: f = f.detach() f_former = f_former.detach() cams = self.process.get_cam(f, f_former, labels, superclass, return_cam) return cams else: inputs = self.process.input_for_loss(f, f_former) return {'logits': inputs['logits'], 'probs': inputs['probs'], 'features': inputs['inputs']} def _make_layer(self, block, planes, blocks, stride): layers = self._layer(block, planes, blocks, stride) return nn.Sequential(*layers) def _layer(self, block, planes, blocks, stride): downsample = get_downsampling_layer( self.inplanes, block, planes, stride) layers = [block(self.inplanes, planes, stride, downsample)] self.inplanes = planes * block.expansion for _ in range(1, blocks): layers.append(block(self.inplanes, planes)) return layers def _get_attention(self): return nn.Sequential( nn.Conv2d(512 * self.block.expansion, 1, kernel_size=1), nn.ReLU(inplace=True), ) def get_downsampling_layer(inplanes, block, planes, stride): outplanes = planes * block.expansion if stride == 1 and inplanes == outplanes: return else: return nn.Sequential( nn.Conv2d(inplanes, outplanes, 1, stride, bias=False), nn.BatchNorm2d(outplanes), ) def load_pretrained_model(model, path=None): strict_rule = True if path: state_dict = torch.load(os.path.join(path, 'resnet50.pth')) else: state_dict = load_url(model_urls['resnet50'], progress=True) state_dict = remove_layer(state_dict, 'fc') strict_rule = False model.load_state_dict(state_dict, strict=strict_rule) return model def resnet50(pretrained=False, pretrained_path=None, **kwargs): model = ResNet(Bottleneck, [3, 4, 6, 3], **kwargs) if pretrained: model = load_pretrained_model(model, path=pretrained_path) return model
11572695
from django.urls import path from . import views urlpatterns = [ path('', views.index, name='index'), path('dashboard', views.dashboard, name='dashboard'), path('corpus', views.tstart, name='corpus'), path('translate', views.new, name='translate'), path('corpusinput', views.corpusinput, name='corpusinput'), path('getinput', views.getinput, name='getinput'), path('translate_new', views.translate_new, name='translate_new'), path('add_control_scheme', views.add_control_scheme, name='add_control_scheme'), #path('translate_single_sentence', views.translate_single_sentence, name='translate_single_sentence'), path('pushoutput', views.pushoutput, name='pushoutput'), path('getoutput', views.getoutput, name='getoutput'), path('preview', views.end, name='preview'), path('transdelete', views.transdelete, name='transdelete'), path('exportcsv', views.export_keystroke_csv, name='export_keystroke_csv'), path('set_keyboard_controls', views.set_keyboard_controls, name = 'set_keyboard_controls'), path('iscontrolschemedefined', views.isControlSchemeDefined, name = 'iscontrolschemedefined' ) ]
11572701
import numpy as np import param from holoviews import Store, Options, Layout, HoloMap, Histogram, Dimension try: # HoloViews <1.8 from holoviews.operation import TreeOperation except: # HoloViws >=1.8 from featuremapper.analysis import TreeOperation class WeightIsotropy(TreeOperation): """ Computes a histogram of azimuths between the positional preferences of pre- and post-synaptic neurons weighted by the connection strength and normalized relative to the orientation preference. Useful for determining whether lateral connection are anisotropic along the axis of preferred orientation. """ num_bins = param.Integer(default=20, doc=""" Number of bins in the histogram.""") roi = param.NumericTuple(default=(-0.5, -0.5, 0.5, 0.5), doc=""" Region of interest supplied as a four-tuple of the form (left, bottom, right, top)""") projections = param.List(default=[], doc=""" List of tuples of the form (sheet, projection).""") threshold = param.Integer(default=70, doc=""" Threshold as a percentile of the weight field.""") min_dist = param.Number(default=0.1, doc=""" Minimum distance in sheet coordinates""") symmetric = param.Boolean(default=True, doc=""" Whether to make isotropy symmetric.""") @classmethod def _last(cls, obj): return obj.last if isinstance(obj, HoloMap) else obj def _process(self, tree, key=None): layout = Layout() for s, p in self.p.projections: # Get last element orelmnt = self._last(tree.OrientationPreference[s]) selelmnt = self._last(tree.OrientationSelectivity[s]) xelmnt = self._last(tree.XPreference[s]) yelmnt = self._last(tree.YPreference[s]) # If any preference has not been supplied skip analysis if any(not o for o in [orelmnt, xelmnt, yelmnt]): return Layout() # Flatten preferences xpref_arr = xelmnt.dimension_values(2) ypref_arr = yelmnt.dimension_values(2) sel_arr = selelmnt.dimension_values(2) # Iterate over CFs in ROI l, b, r, t = self.p.roi lat_weights = tree.CFs[p] azimuths, weights = [], [] for key, cf in lat_weights[l:r, b:t].items(): # Get preferences for a particular unit unit_angle, unit_x, unit_y = orelmnt[key], xelmnt[key], yelmnt[key] unit_sel = selelmnt[key] weight_arr = cf.situated.dimension_values(2) mask = weight_arr>np.percentile(weight_arr, self.p.threshold) sel = sel_arr[mask] weight = weight_arr[mask] * unit_sel * sel xpref = xpref_arr[mask] ypref = ypref_arr[mask] # Compute x/y-preference differences between # pre- and post-synaptic neurons dx = xpref - unit_x dy = ypref - unit_y d = np.sqrt(dx**2 + dy**2) # Compute angle between position preferences # of the pre- and post-synaptic neurons # Correcting for preferred orientation conn_angle = np.arctan2(dy, dx) delta = conn_angle - unit_angle delta[delta<0] += np.pi*2 delta2 = delta + np.pi delta2 %= np.pi*2 azimuths.append(delta[d>self.p.min_dist]) weights.append(weight[d>self.p.min_dist]) if self.p.symmetric: azimuths.append(delta2[d>self.p.min_dist]) weights.append(weight[d>self.p.min_dist]) # Combine azimuths and weights for all CFs azimuths = np.concatenate(azimuths) weights = np.concatenate(weights) # Compute histogram bins, edges = np.histogram(azimuths, range=(0, 2*np.pi), bins=self.p.num_bins, weights=weights, normed=True) # Construct Elements label =' '.join([s, p]) histogram = Histogram(bins, edges, group="Weight Isotropy", kdims=[Dimension('Azimuth')], label=label) layout.WeightIsotropy['_'.join([s, p])] = histogram return layout def circular_dist(a, b, period): """ Returns the distance between a and b (scalars) in a domain with `period` period. """ return np.minimum(np.abs(a - b), period - np.abs(a - b)) class WeightDistribution(TreeOperation): """ Computes histogram of the difference in feature preference between pre- and post-synaptic neurons weighted by the connection strength between them. """ feature = param.String(default='Orientation', doc=""" Feature to compute the distribution over""") num_bins = param.Integer(default=10, doc=""" Number of histogram bins.""") normalized = param.Boolean(default=False, doc=""" Whether to normalize the histogram""") projections = param.List(default=[], doc=""" List of tuples of the form (sheet, projection).""") weighted = param.Boolean(default=True) def _process(self, tree, key=None): preferences = tree[self.p.feature+'Preference'] layout = Layout() for s, p in self.p.projections: if s not in preferences: continue featurepref = preferences[s] if isinstance(featurepref, HoloMap): featurepref = featurepref.last feature = featurepref.value_dimensions[0] feature_arr = featurepref.data.flat cfs = tree.CFs[p] deltas, weights = [], [] for k, cf in cfs.items(): preferred = featurepref[k] weight_arr = cf.situated.data.flat feature_slice = feature_arr[weight_arr>0] weight_slice = weight_arr[weight_arr>0] if feature.cyclic: feature_delta = circular_dist(preferred, feature_slice, feature.range[1]) else: feature_delta = np.abs(feature_slice-preferred) deltas.append(feature_delta) weights.append(weight_slice) deltas = np.concatenate(deltas) weights = np.concatenate(weights) bin_range = (0, feature.range[1]/2.) if feature.cyclic else None bins, edges = np.histogram(deltas, range=bin_range, bins=self.p.num_bins, weights=weights, normed=self.p.normalized) # Construct Elements label = ' '.join([s,p]) group = '%s Weight Distribution' % self.p.feature histogram = Histogram(bins, edges, group=group, label=label, kdims=[' '.join([self.p.feature, 'Difference'])], vdims=['Weight']) layout.WeightDistribution['_'.join([s,p])] = histogram return layout options = Store.options(backend='matplotlib') options.Histogram.Weight_Isotropy = Options('plot', projection='polar', show_grid=True)
11572716
import unittest from katas.kyu_6.group_in_10s import group_in_10s class GroupInTensTestCase(unittest.TestCase): def test_equals(self): self.assertEqual(group_in_10s(1, 2, 3), [[1, 2, 3]]) def test_equals_2(self): self.assertEqual(group_in_10s(8, 12, 38, 3, 17, 19, 25, 35, 50), [[3, 8], [12, 17, 19], [25], [35, 38], None, [50]]) def test_equals_3(self): self.assertEqual(group_in_10s(12, 10, 11, 13, 25, 28, 29, 49, 51, 90), [None, [10, 11, 12, 13], [25, 28, 29], None, [49], [51], None, None, None, [90]]) def test_equals_4(self): self.assertEqual(group_in_10s(), []) def test_equals_5(self): self.assertEqual(group_in_10s(100), [ None, None, None, None, None, None, None, None, None, None, [100]])
11572736
from abc import ABC, abstractmethod from typing import Optional from datahub.metadata.com.linkedin.pegasus2avro.schema import SchemaMetadata class KafkaSchemaRegistryBase(ABC): @abstractmethod def get_schema_metadata( self, topic: str, platform_urn: str ) -> Optional[SchemaMetadata]: pass
11572743
FILEPATHS = ["/valid/file1", "/valid/file2"] DIRPATHS = ["/valid/dir1", "/valid/dir2"] USERS = ['xdsuper', 'samsuper'] GROUPS = ['xdgroup', 'samgroup'] PORTS = ["3000", "3001"] NAMESERVICES = ["ns1", "ns2"] INTERFACES = ["eth1", "eth2"] IPS = ["127.0.0.1"] PERMISSIONMASKS = ["007", "002"] PERMISSIONCODES = ["rwx------", "rwxrwx---"] ZKPORTADDRS = ["0.0.0.0:3000", "0.0.0.0:3001"] ZKLIMIT = ["1", "10"] ZKSIZE = ["1", "10"] key_phrases_plural = [ "values are:", "values are", "options are:", "options are", "types are:", "types are", "Value may be:", "Value may be", "One of:", "One of", ] key_phrases_singular = [ "set to", "replaced with", ]
11572781
from django.core.cache import cache from django.core.cache.backends.base import DEFAULT_TIMEOUT from rendertron.storage.base import RendertronStorage def get_cache_key(request): return "rendertron:{}".format(request.path) class DjangoCacheStorage(RendertronStorage): """ A storage class that uses Django's cache as storage """ @staticmethod def get_default_options(): return {"TIMEOUT": DEFAULT_TIMEOUT, "VERSION": None} def get_stored_response(self, request): cache_key = get_cache_key(request) cached = cache.get(cache_key, default=None, version=self.options.get("VERSION")) if cached is not None: return cached["response"], cached["meta"] return None, None def store_response(self, request, response, meta): cache_key = get_cache_key(request) cache.set( cache_key, {"response": response, "meta": meta}, timeout=self.options.get("TIMEOUT"), version=self.options.get("VERSION"), )
11572787
import os import numpy as np import math import keras.backend as K import matplotlib.pyplot as plt import pickle import time import itertools from scipy.ndimage.filters import gaussian_filter from keras.models import Sequential from keras.layers import Dense from keras.layers import LSTM, TimeDistributed, Dropout from sklearn.preprocessing import MinMaxScaler from sklearn.metrics import mean_squared_error from itertools import product from random import randint from scipy import signal import sys from numpy import NaN, Inf, arange, isscalar, asarray, array # Build the model def construct_model(hidden = 32, lstm_layers = 2, input_dim = 15, output_dim = 1): model = Sequential() model.add(LSTM(input_shape = (input_dim,),input_dim=input_dim, output_dim=hidden, return_sequences=True)) for i in range(lstm_layers-1): model.add(LSTM(output_dim = hidden, return_sequences=True)) model.add(TimeDistributed(Dense(output_dim, activation='sigmoid'))) model.compile(loss=weighted_binary_crossentropy, optimizer='adam', metrics=['accuracy']) return model def weighted_binary_crossentropy(y_true, y_pred): a1 = K.mean(np.multiply(K.binary_crossentropy(y_pred[0:1,:], y_true[0:1,:]),(y_true[0:1,:] + 0.01)), axis=-1) # a2 = K.mean(np.multiply(K.binary_crossentropy(y_pred[1:2,:], y_true[1:2,:]),(y_true[1:2,:] + 0.01)), axis=-1) # a1 = K.mean(np.multiply(K.binary_crossentropy(y_pred, y_true),(y_true + 0.01)), axis=-1) return a1 #+ a2 # Build the model def construct_model(hidden = 32, lstm_layers = 2, input_dim = 15, output_dim = 2): model = Sequential() model.add(LSTM(input_shape = (input_dim,),input_dim=input_dim, output_dim=hidden, return_sequences=True)) for i in range(lstm_layers-1): model.add(LSTM(output_dim = hidden / 2**i, return_sequences=True)) model.add(TimeDistributed(Dense(output_dim, activation='sigmoid'))) model.compile(loss=weighted_binary_crossentropy, optimizer='adam', metrics=['accuracy']) return model def plot_history(history): nepoch = len(history.history['loss']) plt.plot(range(nepoch),history.history['loss'],'r') plt.plot(range(nepoch),history.history['val_loss'],'b') axes = plt.gca() axes.set_ylim([0.001,0.005]) plt.title('model loss') plt.ylabel('loss') plt.xlabel('epoch') plt.legend(['train', 'validation'], loc='upper right') plt.show() def peakdet(v, delta, x = None): """ Converted from MATLAB script at http://billauer.co.il/peakdet.html Returns two arrays function [maxtab, mintab]=peakdet(v, delta, x) %PEAKDET Detect peaks in a vector % [MAXTAB, MINTAB] = PEAKDET(V, DELTA) finds the local % maxima and minima ("peaks") in the vector V. % MAXTAB and MINTAB consists of two columns. Column 1 % contains indices in V, and column 2 the found values. % % With [MAXTAB, MINTAB] = PEAKDET(V, DELTA, X) the indices % in MAXTAB and MINTAB are replaced with the corresponding % X-values. % % A point is considered a maximum peak if it has the maximal % value, and was preceded (to the left) by a value lower by % DELTA. % <NAME>, 3.4.05 (Explicitly not copyrighted). % This function is released to the public domain; Any use is allowed. """ maxtab = [] mintab = [] if x is None: x = arange(len(v)) v = asarray(v) if len(v) != len(x): sys.exit('Input vectors v and x must have same length') if not isscalar(delta): sys.exit('Input argument delta must be a scalar') if delta <= 0: sys.exit('Input argument delta must be positive') mn, mx = Inf, -Inf mnpos, mxpos = NaN, NaN lookformax = True for i in arange(len(v)): this = v[i] if this > mx: mx = this mxpos = x[i] if this < mn: mn = this mnpos = x[i] if lookformax: if this < mx-delta: maxtab.append((mxpos, mx)) mn = this mnpos = x[i] lookformax = False else: if this > mn+delta: mintab.append((mnpos, mn)) mx = this mxpos = x[i] lookformax = True return array(maxtab), array(mintab) def load_file(filename, input_dim, output_dim, nseqlen = 128): try: R = np.loadtxt(filename, delimiter=',') except: return None # find first event positives1 = np.where(R[:,input_dim] > 0.5) positives2 = np.where(R[:,input_dim + 1] > 0.5) if len(positives1[0]) == 0 or len(positives2[0]) == 0: return None nstart = max(positives1[0][0], positives2[0][0]) nstart = nstart - randint(15,nseqlen / 2) if R.shape[0] < (nstart + nseqlen): return None X = R[nstart:(nstart + nseqlen),0:input_dim] Y = R[nstart:(nstart + nseqlen),input_dim:(input_dim + output_dim)] # Y = gaussian_filter(Y * 1.0, 1.0) if (not Y.any()): return None if R[0,90] > R[R.shape[1]-1,90]: cols = [ i for i in range(30,99) if (i % 3) == 0 or (i%3)==2] X[:,cols] = -X[:,cols] return X, Y.astype(int)[:,0:output_dim] def load_data(fdir, input_dim, output_dim, nseqlen, nsamples = 100000): files = os.listdir(fdir) # Merge inputs from different files together ids = [] inputs = np.zeros((len(files), nseqlen, input_dim)) outputs = np.zeros((len(files), nseqlen, output_dim)) n = 0 for i,filename in enumerate(files): fname = "%s/%s" % (fdir, filename) data = load_file(fname, input_dim, output_dim, nseqlen) if not data: continue X, Y = data inputs[n,:,:] = X outputs[n,:,:] = Y ids.append(filename) n = n + 1 if n >= nsamples: break return inputs[0:n,:,:], outputs[0:n,:,:], ids def peak_cmp(annotated, predicted): dist = [] if len(predicted) == 0 or len(annotated) == 0: return -1 if len(predicted) != len(annotated): return -1 for a in annotated: # if a > 120: # continue dist = dist + [min(np.abs(predicted - a))] if not len(dist): return -1 return min(dist) def eval_prediction(likelihood, true, patient, plot = True, shift = 0): sdist = [] peakind = peakdet(likelihood[:,0],0.5) for k,v in peakind[0]: if plot: plt.axvline(x=k) sdist.append(peak_cmp(np.where(true[:,0] > 0.5)[0], [k + shift for k,v in peakind[0]])) # peakind = peakdet(likelihood[:,1],0.5) # for k,v in peakind[0]: # if plot: # plt.axvline(x=k) # sdist.append(peak_cmp(np.where(true[:,1] > 0.5)[0], [k for k,v in peakind[0]])) if plot: plt.plot(likelihood) # continous likelihood process plt.plot(true) # spikes on events plt.title(patient) axes = plt.gca() axes.set_xlim([0,true.shape[0]]) plt.show() return sdist def plot_stats(sdist): plt.hist(sdist,100,[0, 100]) filtered = [k for k in sdist if k >= 0] def off_by(threshold, filtered): ob = [k for k in filtered if k <= threshold] nel = float(len(filtered)) print("<= %d: %f" % (threshold, len(ob) / float(nel))) print("Error distribution:") off_by(1, filtered) off_by(3, filtered) off_by(5, filtered) off_by(10, filtered) off_by(60, filtered) print("Mean distance: %f" % (np.mean(filtered))) def plot_kinematics(filename, fdir="", ids = None, fromfile=False, input_dim = 15, output_dim = 15, model = None, cols = None): if not fromfile: ntrial = ids.index(filename) X = inputs[ntrial,:,cols] Y = outputs[ntrial,:,0:output_dim] else: R = np.loadtxt("%s/%s" % (fdir, filename), delimiter=',') X = R[:,cols] Y = R[:,input_dim:(input_dim + output_dim)] likelihood = model.predict(X.reshape((1,-1,len(cols))))[0] pylab.rcParams['figure.figsize'] = (5, 4) eval_prediction(likelihood, Y, filename) pylab.rcParams['figure.figsize'] = (15, 20) print("Kinematics of %s" % (filename)) for i in range(15): ax = plt.subplot(5,3,1+i) ax.plot(X[:,i]) ax.set_xlim([0,X.shape[0]]) for x in np.where(Y[:,0] > 0.5)[0]: plt.axvline(x=x, color='g', linewidth=2) # for x in np.where(Y[:,1] > 0.5)[0]: # plt.axvline(x=x,color="r") plt.show()
11572817
import unittest from katas.beta.credit_card_validifier import credit class CreditTestCase(unittest.TestCase): def test_equals(self): self.assertEqual(credit(6011364837263748), 'Discover') def test_equals_2(self): self.assertEqual(credit(5318273647283745), 'Master') def test_equals_3(self): self.assertEqual(credit(12345678910), 'Invalid') def test_equals_4(self): self.assertEqual(credit(371236473823676), 'AMEX') def test_equals_5(self): self.assertEqual(credit(4128374839283), 'VISA')
11572818
from dbeditor.database import Database from dbeditor.loaders import import_to_table from dbeditor.loaders.csv_loader import CSVLoader def test_import_to_table(database: Database, csv_loader: CSVLoader) -> None: table = database.get_table("second") import_to_table(table, database.session, csv_loader) with database.session as s: assert s.query(table).all() == [ (1, 42, "example"), (2, 7, "lorem ipsum"), ]
11572836
from .checkerro import CSPReportOnlyChecker from .cspcheck_unsafeeval import CSPCheckUnsafeEval class CSPReportOnlyUnsafeEvalChecker(CSPReportOnlyChecker): def check(self, headers, opt_options=dict()): csp = self.getcsp(headers) if not csp: return [] directive = csp.directive.SCRIPT_SRC values = self.effectiveDirectiveValues(headers,directive, opt_options) return CSPCheckUnsafeEval(csp,directive, values).check()
11572902
import importlib import six from scrapy.utils.misc import load_object from . import connection, defaults # TODO: add SCRAPY_JOB support. class Scheduler(object): """Redis-based scheduler Settings -------- SCHEDULER_PERSIST : bool (default: False) Whether to persist or clear redis queue. SCHEDULER_FLUSH_ON_START : bool (default: False) Whether to flush redis queue on start. SCHEDULER_IDLE_BEFORE_CLOSE : int (default: 0) How many seconds to wait before closing if no message is received. SCHEDULER_QUEUE_KEY : str Scheduler redis key. SCHEDULER_QUEUE_CLASS : str Scheduler queue class. DUPEFILTER_KEY : str Scheduler dupefilter redis key. DUPEFILTER_CLASS : str Scheduler dupefilter class. SCHEDULER_SERIALIZER : str Scheduler serializer. """ def __init__(self, server, persist, flush_on_start, queue_key, queue_cls, dupefilter_key, dupefilter_cls, idle_before_close): """Initialize scheduler. Parameters ---------- server : Redis The redis server instance. persist : bool Whether to flush requests when closing. Default is False. flush_on_start : bool Whether to flush requests on start. Default is False. queue_key : str Requests queue key. queue_cls : str Importable path to the queue class. dupefilter_key : str Duplicates filter key. dupefilter_cls : str Importable path to the dupefilter class. idle_before_close : int Timeout before giving up. """ if idle_before_close < 0: raise TypeError("idle_before_close cannot be negative") self.server = server self.persist = persist self.flush_on_start = flush_on_start self.queue_key = queue_key self.queue_cls = queue_cls self.dupefilter_cls = dupefilter_cls self.dupefilter_key = dupefilter_key self.idle_before_close = idle_before_close self.stats = None def __len__(self): return len(self.queue) @classmethod def from_settings(cls, settings): kwargs = { 'persist': defaults.SCHEDULER_PERSIST, 'flush_on_start': defaults.SCHEDULER_FLUSH_ON_START, 'queue_key': defaults.SCHEDULER_QUEUE_KEY, 'queue_cls': defaults.SCHEDULER_QUEUE_CLASS, 'dupefilter_cls': defaults.DUPEFILTER_CLASS, 'dupefilter_key': defaults.DUPEFILTER_KEY, 'idle_before_close': defaults.SCHEDULER_IDLE_BEFORE_CLOSE, } optional = { 'SCHEDULER_PERSIST': 'persist', 'SCHEDULER_FLUSH_ON_START': 'flush_on_start', 'SCHEDULER_QUEUE_KEY': 'queue_key', 'SCHEDULER_QUEUE_CLASS': 'queue_cls', 'DUPEFILTER_CLASS': 'dupefilter_cls', 'DUPEFILTER_KEY': 'dupefilter_key', 'SCHEDULER_IDLE_BEFORE_CLOSE': 'idle_before_close', } for setting_name, name in optional.items(): val = settings.get(setting_name) if val: kwargs[name] = val server = connection.from_settings(settings) return cls(server=server, **kwargs) @classmethod def from_crawler(cls, crawler): instance = cls.from_settings(crawler.settings) # FIXME: for now, stats are only supported from this constructor instance.stats = crawler.stats return instance def open(self, spider): self.spider = spider try: self.queue = load_object(self.queue_cls)( server=self.server, spider=spider, key=self.queue_key % {'spider': spider.name} ) except TypeError as e: raise ValueError("Failed to instantiate queue class '%s': %s", self.queue_cls, e) try: if self.dupefilter_cls == 'scrapy_redis_bloomfilter_block_cluster.dupefilter.LockRFPDupeFilter': self.df = load_object(self.dupefilter_cls)( server=self.server, key=self.dupefilter_key % {'spider': spider.name}, debug=spider.settings.getbool('DUPEFILTER_DEBUG', defaults.DUPEFILTER_DEBUG), bit=spider.settings.getint('BLOOMFILTER_BIT', defaults.BLOOMFILTER_BIT), hash_number=spider.settings.getint('BLOOMFILTER_HASH_NUMBER', defaults.BLOOMFILTER_HASH_NUMBER), block_num=spider.settings.getint('BLOOMFILTER_BLOCK_NUM', defaults.BLOOMFILTER_BLOCK_NUM), lock_key=spider.settings.get('DUPEFILTER_LOCK_KEY', defaults.DUPEFILTER_LOCK_KEY) % {'spider': spider.name}, lock_num=spider.settings.getint('DUPEFILTER_LOCK_NUM', defaults.DUPEFILTER_LOCK_NUM), lock_timeout=spider.settings.getint('DUPEFILTER_LOCK_TIMEOUT', defaults.DUPEFILTER_LOCK_TIMEOUT) ) elif self.dupefilter_cls == 'scrapy_redis_bloomfilter_block_cluster.dupefilter.ListLockRFPDupeFilter': self.df = load_object(self.dupefilter_cls)( server=self.server, key=self.dupefilter_key % {'spider': spider.name}, debug=spider.settings.getbool('DUPEFILTER_DEBUG', defaults.DUPEFILTER_DEBUG), bit=spider.settings.getint('BLOOMFILTER_BIT', defaults.BLOOMFILTER_BIT), hash_number=spider.settings.getint('BLOOMFILTER_HASH_NUMBER', defaults.BLOOMFILTER_HASH_NUMBER), block_num=spider.settings.getint('BLOOMFILTER_BLOCK_NUM', defaults.BLOOMFILTER_BLOCK_NUM), lock_key=spider.settings.get('DUPEFILTER_LOCK_KEY', defaults.DUPEFILTER_LOCK_KEY) % {'spider': spider.name}, lock_num=spider.settings.getint('DUPEFILTER_LOCK_NUM', defaults.DUPEFILTER_LOCK_NUM), lock_timeout=spider.settings.getint('DUPEFILTER_LOCK_TIMEOUT', defaults.DUPEFILTER_LOCK_TIMEOUT), rules_list=spider.rules_list, key_list=spider.settings.get('DUPEFILTER_KEY_LIST', defaults.DUPEFILTER_KEY_LIST) % {'spider': spider.name}, bit_list=spider.settings.getint('BLOOMFILTER_BIT_LIST', defaults.BLOOMFILTER_BIT_LIST), hash_number_list=spider.settings.getint('BLOOMFILTER_HASH_NUMBER_LIST', defaults.BLOOMFILTER_HASH_NUMBER_LIST), block_num_list=spider.settings.getint('BLOOMFILTER_BLOCK_NUM_LIST', defaults.BLOOMFILTER_BLOCK_NUM_LIST) ) else: self.df = load_object(self.dupefilter_cls)( server=self.server, key=self.dupefilter_key % {'spider': spider.name}, debug=spider.settings.getbool('DUPEFILTER_DEBUG', defaults.DUPEFILTER_DEBUG), bit=spider.settings.getint('BLOOMFILTER_BIT', defaults.BLOOMFILTER_BIT), hash_number=spider.settings.getint('BLOOMFILTER_HASH_NUMBER', defaults.BLOOMFILTER_HASH_NUMBER), block_num=spider.settings.getint('BLOOMFILTER_BLOCK_NUM', defaults.BLOOMFILTER_BLOCK_NUM) ) except TypeError as e: raise ValueError("Failed to instantiate dupefilter class '%s': %s", self.dupefilter_cls, e) if self.flush_on_start: self.flush() # notice if there are requests already in the queue to resume the crawl if len(self.queue): spider.log("Resuming crawl from redis(%d requests scheduled)" % len(self.queue)) def close(self, reason): if not self.persist: self.flush() def flush(self): self.df.clear() self.queue.clear() def enqueue_request(self, request): if not request.dont_filter and self.df.request_seen(request): self.df.log(request, self.spider) return False if self.stats: self.stats.inc_value('scheduler/enqueued/redis', spider=self.spider) self.queue.push(request) return True def next_request(self): request = self.queue.pop(self.idle_before_close) # PriorityQueue 不支持 self.idle_before_close if request and self.stats: self.stats.inc_value('scheduler/dequeued/redis', spider=self.spider) return request def has_pending_requests(self): return len(self) > 0
11572932
import torch from torch_geometric.nn import DMoNPooling def test_dmon_pooling(): batch_size, num_nodes, channels, num_clusters = (2, 20, 16, 10) x = torch.randn((batch_size, num_nodes, channels)) adj = torch.ones((batch_size, num_nodes, num_nodes)) mask = torch.randint(0, 2, (batch_size, num_nodes), dtype=torch.bool) pool = DMoNPooling([channels, channels], num_clusters) assert str(pool) == 'DMoNPooling(16, num_clusters=10)' s, x, adj, spectral_loss, ortho_loss, cluster_loss = pool(x, adj, mask) assert s.size() == (2, 20, 10) assert x.size() == (2, 10, 16) assert adj.size() == (2, 10, 10) assert -1 <= spectral_loss <= 0 assert 0 <= ortho_loss <= 2 assert -1 <= cluster_loss <= 0
11572939
import cv2 import numpy as np from numpy.core.arrayprint import printoptions import skimage.io as io # Create a VideoCapture object and read from input file # If the input is the camera, pass 0 instead of the video file name cap = cv2.VideoCapture('trimmed1.mp4') # Check if camera opened successfully if (cap.isOpened()== False): print("Error opening video stream or file") picList=[] # Read until video is completed i=200 while(cap.read()): # Capture frame-by-frame i-=1 if(i==0): break ret, frame = cap.read() if ret == True: if(i==2): print(frame.shape) picList.append(frame) # Display the resulting frame #cv2.imshow('Frame',frame) # Press Q on keyboard to exit if cv2.waitKey(25) & 0xFF == ord('q'): break # Break the loop else: break # When everything done, release the video capture object # cap.release() # Closes all the frames # cv2.destroyAllWindows() arr = np.asarray(picList) print(arr.shape) meanimage=np.sum(arr,axis=0)//len(picList) print(meanimage.shape) io.imshow(meanimage) print(meanimage) #cv2.imshow(meanimage) cv2.imshow("lol", meanimage) # waits for user to press any key # (this is necessary to avoid Python kernel form crashing) cv2.waitKey(0) # closing all open windows cv2.destroyAllWindows()
11572942
class Subtracao: def __init__(self, expressao_esquerda, expressao_direita): self.__expressao_esquerda = expressao_esquerda self.__expressao_direita = expressao_direita def avalia(self): return ( self.__expressao_esquerda.avalia() - self.__expressao_direita.avalia() ) class Soma: def __init__(self, expressao_esquerda, expressao_direita): self.__expressao_esquerda = expressao_esquerda self.__expressao_direita = expressao_direita def avalia(self): return ( self.__expressao_esquerda.avalia() + self.__expressao_direita.avalia() ) class Numero: def __init__(self, numero): self.__numero = numero def avalia(self): return self.__numero if __name__ == '__main__': expressao_esquerda = Soma(Numero(10), Numero(20)) expressao_direita = Soma(Numero(5), Numero(2)) expressao_conta = Soma(expressao_esquerda, expressao_direita) print(expressao_conta.avalia()) expressao_conta2 = Subtracao(Numero(100), Numero(70)) print(expressao_conta2.avalia())
11572975
import threading import time import sys from unittest import TestCase from apiritif.http import _EventRecorder, Event class EventGenerator(threading.Thread): def __init__(self, recorder, index, events_count): self.recorder = recorder self.index = index self.events_count = events_count self.events = [Event(response=self.index * (i + 1)) for i in range(self.events_count)] super(EventGenerator, self).__init__(target=self._record_events) def _record_events(self): for event in self.events: self.recorder.record_event(event) time.sleep(0.1) self.result_events = self.recorder.pop_events(from_ts=-1, to_ts=sys.maxsize) class TestRecorder(TestCase): # _EventRecorder class have to store separate events for separate thread. # Here each fake thread (EventGenerator) generate an event for common recorder. # Then each thread read this event from this recorder with some delay. # As the result written and read events should be the same. def test_recorder_events_per_thread(self): recorder = _EventRecorder() event_generators = [EventGenerator(recorder, i, 3) for i in range(5)] for generator in event_generators: generator.start() for generator in event_generators: generator.join() for generator in event_generators: self.assertEqual(generator.events, generator.result_events)
11572978
import os def remove_files(*filenames): """ Remove the files created during the test """ for filename in filenames: try: os.remove(filename) except FileNotFoundError: pass
11573010
class Solution: def canPermutePalindrome(self, s: str) -> bool: char_set = set() for char in s: if char in char_set: char_set.remove(char) else: char_set.add(char) return len(char_set) <= 1
11573011
import re import secrets from yarl import URL from tests.e2e.conftest import RunCLI # TODO: remove --local-executor when projoect.yml parsing is fixed async def test_seq_batch(run_cli: RunCLI) -> None: random_text = secrets.token_hex(20) captured = await run_cli( ["bake", "--local-executor", "seq", "--param", "token", random_text] ) assert f"task_b_out: {random_text}" in captured.out # Now test the cache: captured = await run_cli( ["bake", "--local-executor", "seq", "--param", "token", random_text] ) assert "cached" in captured.out async def test_batch_with_local( run_cli: RunCLI, run_neuro_cli: RunCLI, project_id: str, username: str, project_role: str, cluster_name: str, ) -> None: captured = await run_cli( [ "bake", "--local-executor", "print-local", "--param", "file_path", "rw_dir/initial_file", ] ) assert f"file_content: initial_file_content" in captured.out m = re.search(r"Task print_readme (job-\S+) is", captured.out) assert m is not None job_id = m[1] job_uri = URL.build(scheme="job", host=cluster_name) / username / job_id captured = await run_neuro_cli(["acl", "list", "--shared", str(job_uri)]) assert sorted(line.split() for line in captured.out.splitlines()) == [ [f"job:{job_id}", "write", project_role], ] async def test_batch_action(run_cli: RunCLI) -> None: captured = await run_cli(["bake", "prime-checks", "--local-executor"]) assert f"5 is prime" in captured.out assert f"4 is not prime" in captured.out assert f"3 is prime" in captured.out
11573049
import random class PonyNamesGenerator: def get_next_pony(self, epoch=0): """ "Бесконечный" рандомный генератор имен поней из My Little Pony. Имена образуются путем рекомбинации половинок оригинальных имен из сериала. Исчерпав все варианты, повторяет их заново (но в другом порядке), добавив постфикс с римской записью поколения. К примеру: <NAME> II <NAME> II Rari Dash II Генератор реализован через рекурсию, так что технически он не совсем бесконечный, но на несколько десятков тысяч вариантов точно можно расчитывать (при проверке на MacBook 70 000 комбинаций создавались, а 80 000 уже нет). """ names = self.new_names_portion() random.shuffle(names) for name in names: if epoch == 0: yield name else: yield f'{name} {self.roman_numerals(epoch + 1)}' epoch += 1 yield from self.get_next_pony(epoch=epoch) @classmethod def new_names_portion(cls): """ Данный метод возвращает список имен, причем всегда одинаковый и в одинаковом порядке. """ container = [] cls.halfs_combinations( container, first_halfs = [ 'Twilight', 'Apple', 'Flutter', 'Rari', 'Pinkie', 'Rainbow', 'Derpy', ], second_halfs = [ ' Sparkle', 'jack', 'shy', 'ty', ' Pie', ' Dash', ' Hooves', ], ) cls.halfs_combinations( container, first_halfs = [ 'Cad', 'Sky', 'Amo', 'Cele', 'Lu', ], second_halfs = [ 'ance', 'star', 're', 'stia', 'na', ], prefix='Princess ' ) return container @staticmethod def halfs_combinations(container, first_halfs, second_halfs, prefix=''): """ Берем два списка с половинками имен и кладем их декартово произведение в список container. При необходимости, добавляем префиксы. """ for half in first_halfs: for half_2 in second_halfs: new_name = f'{prefix}{half}{half_2}' container.append(new_name) @staticmethod def roman_numerals(number): """ Генератор римских цифр, взят отсюда: https://py.checkio.org/mission/roman-numerals/publications/mdeakyne/python-3/first/share/53882d47af904f942fc8daf06c0ed270/ """ if number > 0: ones = ["", "I", "II", "III", "IV", "V", "VI", "VII", "VIII", "IX"] tens = ["", "X", "XX", "XXX", "XL", "L", "LX", "LXX", "LXXX", "XC"] hunds = ["", "C", "CC", "CCC", "CD", "D", "DC", "DCC", "DCCC", "CM"] thous = ["", "M", "MM", "MMM", "MMMM"] thous = thous[number // 1000] hunds = hunds[number // 100 % 10] tens = tens[number // 10 % 10] ones = ones[number % 10] return thous + hunds + tens + ones
11573070
import setuptools from distutils.core import setup setup( name="open_energy_view", version="0.1dev", author="<NAME>", author_email="<EMAIL>", packages=setuptools.find_packages(), license="MIT", long_description=open("README.md").read(), )
11573088
from collections import defaultdict from enum import Enum from sklearn.base import ClassifierMixin, RegressorMixin, BaseEstimator from sklearn_pmml import pmml from sklearn_pmml.convert.utils import pmml_row, assert_equal from sklearn_pmml.convert.features import * from pyxb.utils.domutils import BindingDOMSupport as bds import numpy as np class TransformationContext(object): """ Context holder object """ def __init__(self, schemas=None): """ :type schemas: dict[Schema, list[Feature]] | None """ if schemas is None: schemas = {} self.schemas = schemas class ModelMode(Enum): CLASSIFICATION = 'classification' REGRESSION = 'regression' class Schema(Enum): INPUT = ('input', True, True) """ Schema used to define input variables. Short names allowed """ OUTPUT = ('output', True, True) """ Schema used to define output variables. Short names allowed. For the categorical variables the continuous probability variables will be automatically created as <feature_name>.<feature_value> """ DERIVED = ('derived', False, False) """ Schema used to define derived features. Short names not allowed due to potential overlap with input variables. """ NUMERIC = ('numeric', False, False) """ Schema used to encode categorical features as numbers. Short names not allowed due to their overlap with input variables """ MODEL = ('model', True, False) """ Schema used to define features fed into the sklearn estimator. Short names allowed because these variables are not going into PMML. """ INTERNAL = ('internal', False, True) """ This schema may be used by complex converters to hide the variables used for internal needs (e.g. the raw predictions of GBRT) """ CATEGORIES = ('categories', True, False) """ This schema is used to extend categorical outputs with probabilities of categories """ def __init__(self, name, short_names_allowed, data_dict_elibigle): self._name = name self._short_names_allowed = short_names_allowed self._data_dict_elibigle = data_dict_elibigle @property def namespace(self): """ The namespace corresponding to the schema """ return self._name @property def short_names_allowed(self): """ The schema allows usage of short names instead of fully-qualified names """ return self._short_names_allowed @property def eligible_for_data_dictionary(self): """ The variables defined in the schema should appear in the DataDictionary """ return self._data_dict_elibigle def extract_feature_name(self, f): """ Extract the printed name of the feature. :param f: feature to work with :type f: Feature|str """ if self.short_names_allowed: if isinstance(f, str): return f else: return f.full_name else: return "{}.{}".format(self.namespace, f if isinstance(f, str) else f.full_name) class EstimatorConverter(object): """ A new base class for the estimator converters """ EPSILON = 0.00001 SCHEMAS_IN_MINING_MODEL = {Schema.INPUT, Schema.INTERNAL} def __init__(self, estimator, context, mode): self.model_function = mode self.estimator = estimator self.context = context assert not any(isinstance(_, DerivedFeature) for _ in context.schemas[Schema.INPUT]), \ 'Input schema represents the input fields only' assert all(isinstance(_, DerivedFeature) for _ in context.schemas[Schema.DERIVED]), \ 'Derived schema represents the set of automatically generated fields' assert not any(isinstance(_, DerivedFeature) for _ in context.schemas[Schema.OUTPUT]), \ 'Only regular features allowed in output schema; use Output transformation if you want to transform values' # create a new schema for categories probabilities categories = [] for feature in context.schemas[Schema.OUTPUT]: if isinstance(feature, CategoricalFeature): for value in feature.value_list: categories.append(RealNumericFeature( name=value, namespace=feature.name )) context.schemas[Schema.CATEGORIES] = categories def data_dictionary(self): """ Build a data dictionary and return a DataDictionary element. DataDictionary contains feature types for all variables used in the PMML, except the ones defined as Derived Features """ dd = pmml.DataDictionary() for schema, fields in sorted(self.context.schemas.items(), key=lambda x: x[0].name): assert isinstance(schema, Schema) if schema.eligible_for_data_dictionary: for f in fields: data_field = pmml.DataField( dataType=f.data_type.value, name=schema.extract_feature_name(f), optype=f.optype.value) dd.DataField.append(data_field) if isinstance(f, CategoricalFeature): for v in f.value_list: data_field.append(pmml.Value(value_=v)) return dd def output(self): """ Output section of PMML contains all model outputs. :return: pmml.Output """ output = pmml.Output() # the response variables for feature in self.context.schemas[Schema.OUTPUT]: output_field = pmml.OutputField( name=Schema.OUTPUT.extract_feature_name(feature), feature='predictedValue' ) output.append(output_field) return output def transformation_dictionary(self): """ Build a transformation dictionary and return a TransformationDictionary element """ td = pmml.TransformationDictionary() # define a schema with all variables available for a model encoded_schema = [] self.context.schemas[Schema.NUMERIC] = encoded_schema idx = {} # First, populate transformation dictionary for _all_ derived fields, because they can be requested later for f in self.context.schemas[Schema.DERIVED]: ef = RealNumericFeature(name=f.name) df = pmml.DerivedField( name=ef.full_name, optype=ef.optype.value, dataType=ef.data_type.value ) df.append(f.transformation) td.append(df) assert f.name not in idx, 'Duplicate field definition: {}'.format(f.name) idx[f.name] = ef # second, define the numeric transformations for the categorical variables for f in self.context.schemas[Schema.INPUT]: assert f.name not in idx, 'Duplicate field definition: {}'.format(f.name) if isinstance(f, CategoricalFeature): ef = RealNumericFeature(name=f.name, namespace=Schema.NUMERIC.namespace) # create a record in transformation dictionary with mapping from raw values into numbers df = pmml.DerivedField( name=ef.full_name, optype=ef.optype.value, dataType=ef.data_type.value ) mv = pmml.MapValues(outputColumn='output', dataType=ef.data_type.value) mv.append(pmml.FieldColumnPair(field=f.full_name, column='input')) it = pmml.InlineTable() for i, v in enumerate(f.value_list): it.append(pmml_row(input=v, output=i)) td.append(df.append(mv.append(it))) idx[f.name] = ef else: idx[f.name] = f # now we can build a mirror of model schema into the numeric schema self.context.schemas[Schema.NUMERIC] = [idx[f.name] for f in self.context.schemas[Schema.MODEL]] return td def model(self, verification_data=None): """ Build a mining model and return one of the MODEL-ELEMENTs """ pass def model_verification(self, verification_data): """ Use the input verification_data, apply the transformations, evaluate the model response and produce the ModelVerification element :param verification_data: list of dictionaries or data frame :type verification_data: dict[str, object]|pd.DataFrame :return: ModelVerification element """ verification_data = pd.DataFrame(verification_data) assert len(verification_data) > 0, 'Verification data can not be empty' verification_input = pd.DataFrame(index=verification_data.index) verification_model_input = pd.DataFrame(index=verification_data.index) for key in self.context.schemas[Schema.INPUT]: # all input features MUST be present in the verification_data assert key.full_name in verification_data.columns, 'Missing input field "{}"'.format(key.full_name) verification_input[Schema.INPUT.extract_feature_name(key)] = verification_data[key.full_name] if isinstance(key, CategoricalFeature): verification_model_input[Schema.INPUT.extract_feature_name(key)] = np.vectorize(key.to_number)(verification_data[key.full_name]) else: verification_model_input[Schema.INPUT.extract_feature_name(key)] = verification_data[key.full_name] for key in self.context.schemas[Schema.DERIVED]: assert isinstance(key, DerivedFeature), 'Only DerivedFeatures are allowed in the DERIVED schema' verification_model_input[key.full_name] = key.apply(verification_input) # at this point we can check that MODEL schema contains only known features for key in self.context.schemas[Schema.MODEL]: assert Schema.MODEL.extract_feature_name(key) in verification_model_input.columns, \ 'Unknown feature "{}" in the MODEL schema'.format(key.full_name) # TODO: we can actually support multiple columns, but need to figure out the way to extract the data # TODO: from the estimator properly # building model results assert len(self.context.schemas[Schema.OUTPUT]) == 1, 'Only one output is currently supported' key = self.context.schemas[Schema.OUTPUT][0] model_input = verification_model_input[list(map(Schema.MODEL.extract_feature_name, self.context.schemas[Schema.MODEL]))].values model_results = np.vectorize(key.from_number)(self.estimator.predict(X=model_input)) if key.full_name in verification_data: # make sure that if results are provided, the expected and actual values are equal assert_equal(key, model_results, verification_data[key.full_name].values) verification_input[Schema.OUTPUT.extract_feature_name(key)] = model_results if isinstance(key, CategoricalFeature): probabilities = self.estimator.predict_proba(X=model_input) for i, key in enumerate(self.context.schemas[Schema.CATEGORIES]): verification_input[Schema.CATEGORIES.extract_feature_name(key)] = probabilities[:, i] fields = [] field_names = [] for s in [Schema.INPUT, Schema.OUTPUT, Schema.CATEGORIES]: fields += self.context.schemas[s] field_names += list(map(s.extract_feature_name, self.context.schemas[s])) mv = pmml.ModelVerification(recordCount=len(verification_input), fieldCount=len(fields)) # step one: build verification schema verification_fields = pmml.VerificationFields() for key in fields: if isinstance(key, NumericFeature): vf = pmml.VerificationField(field=key.name, column=key.name, precision=self.EPSILON) else: vf = pmml.VerificationField(field=key.name, column=key.name) verification_fields.append(vf) mv.append(verification_fields) # step two: build data table it = pmml.InlineTable() for data in verification_input.iterrows(): data = data[1] row = pmml.row() row_empty = True for key in field_names: if verification_input[key].dtype == object or not np.isnan(data[key]): col = bds().createChildElement(key) bds().appendTextChild(data[key], col) row.append(col) row_empty = False if not row_empty: it.append(row) mv.append(it) return mv def mining_schema(self): """ Mining schema contains the model input features. NOTE: In order to avoid duplicates, I've decided to remove output features from MiningSchema NOTE: We don't need to specify any DERIVED/NUMERIC fields here, because PMML interpreter will create them in a lazy manner. """ ms = pmml.MiningSchema() if Schema.INPUT in self.SCHEMAS_IN_MINING_MODEL: for f in sorted(self.context.schemas[Schema.INPUT], key=lambda _: _.full_name): ms.append(pmml.MiningField(invalidValueTreatment=f.invalid_value_treatment.value, name=f.full_name)) for s in [Schema.OUTPUT, Schema.INTERNAL]: if s in self.SCHEMAS_IN_MINING_MODEL: for f in self.context.schemas.get(s, []): ms.append(pmml.MiningField( name=s.extract_feature_name(f), usageType="predicted" )) return ms def header(self): """ Build and return Header element """ return pmml.Header() def pmml(self, verification_data=None): """ Build PMML from the context and estimator. Returns PMML element """ p = pmml.PMML(version="4.2") p.append(self.header()) p.append(self.data_dictionary()) p.append(self.transformation_dictionary()) p.append(self.model(verification_data)) return p class ClassifierConverter(EstimatorConverter): """ Base class for classifier converters. It is required that the output schema contains only categorical features. The serializer will output result labels as output::feature_name and probabilities for each value of result feature as output::feature_name::feature_value. """ def __init__(self, estimator, context): """ :param estimator: Estimator to convert :type estimator: BaseEstimator :param context: context to work with :type context: TransformationContext """ super(ClassifierConverter, self).__init__(estimator, context, ModelMode.CLASSIFICATION) assert isinstance(estimator, ClassifierMixin), 'Classifier converter should only be applied to the classification models' for f in context.schemas[Schema.OUTPUT]: assert isinstance(f, CategoricalFeature), 'Only categorical outputs are supported for classification task' # create hidden variables for each categorical output internal_schema = list(filter(lambda x: isinstance(x, CategoricalFeature), self.context.schemas[Schema.OUTPUT])) self.context.schemas[Schema.INTERNAL] = internal_schema def output(self): """ Output section of PMML contains all model outputs. Classification tree output contains output variable as a label, and <variable>.<value> as a probability of a value for a variable :return: pmml.Output """ output = pmml.Output() # the response variables for feature in self.context.schemas[Schema.OUTPUT]: output_field = pmml.OutputField( name=Schema.OUTPUT.extract_feature_name(feature), feature='predictedValue', optype=feature.optype.value, dataType=feature.data_type.value ) output.append(output_field) # the probabilities for categories; should only be populated for classification jobs for feature in self.context.schemas[Schema.CATEGORIES]: output_field = pmml.OutputField( name=Schema.CATEGORIES.extract_feature_name(feature), optype=feature.optype.value, dataType=feature.data_type.value, feature='probability', targetField=Schema.INTERNAL.extract_feature_name(feature.namespace), value_=feature.name ) output.append(output_field) return output class RegressionConverter(EstimatorConverter): def __init__(self, estimator, context): super(RegressionConverter, self).__init__(estimator, context, ModelMode.REGRESSION)
11573095
import unittest import math import numpy import pyglet from pygly.viewport import Viewport class test_viewport( unittest.TestCase ): def setUp( self ): pass def tearDown( self ): pass def test_viewport_creation( self ): window = pyglet.window.Window( fullscreen = False, width = 1024, height = 512 ) viewport = Viewport( [ [0, 0], [1024, 512] ] ) self.assertEqual( viewport.x, 0, "Viewport x incorrect" ) self.assertEqual( viewport.y, 0, "Viewport y incorrect" ) self.assertEqual( viewport.width, 1024, "Viewport width incorrect" ) self.assertEqual( viewport.height, 512, "Viewport height incorrect" ) self.assertEqual( viewport.aspect_ratio, 2.0, "Viewport aspect ratio incorrect" ) if __name__ == '__main__': unittest.main()
11573111
import unittest from wifipumpkin3.exceptions.errors.dhcpException import DHCPServerSettingsError from wifipumpkin3.core.common.platforms import Linux from wifipumpkin3.core.ui.dhcpConfig import ui_DhcpSettingsClass class TestUIDHCPSettings(unittest.TestCase): def test_dhcp_error_message(self): with self.assertRaises(DHCPServerSettingsError): raise DHCPServerSettingsError("", "") def test_read_file_exception(self): pass #self.result_content = ui_DhcpSettingsClass(self) #self.result_content.start() # def test_raise(self): # raise DHCPServerSettingsError('DHCP Server', 'range ip error') if __name__ == "__main__": unittest.main()
11573117
import torch as ch import numpy as np from robustness.model_utils import make_and_restore_model from robustness.tools.helpers import save_checkpoint import sys import utils def chuck_inf_means(senses): chucked = [] for i in range(senses.shape[0]): x = senses[i] chucked.append(np.mean(x[x != np.inf])) return np.array(chucked) if __name__ == "__main__": model_arch = sys.argv[1] model_type = sys.argv[2] random_drop = sys.argv[3] == 'random' num_drop = int(sys.argv[4]) model_path = sys.argv[5] if random_drop not in ['random', 'most', 'least']: raise ValueError("Method of selecting neurons to drop not supported") constants = utils.CIFAR10() ds = constants.get_dataset() model_kwargs = { 'arch': model_arch, 'dataset': ds, 'resume_path': model_type } # Get scaled delta values senses = constants.get_deltas(model_type, model_arch) (mean, std) = constants.get_stats(model_type, model_arch) # Load model model, _ = make_and_restore_model(**model_kwargs) model.eval() print("Dropping %d out of %d neurons" % (num_drop, senses.shape[0])) # Random weight drop-out if negative factor if random_drop: print("Random drop-out!") worst_n = np.random.permutation(senses.shape[0])[:num_drop] else: # 99.7% interval threshold = mean + 3 * std # Only consider neurons with any hopes of attackking (delta within some sensible range) senses = utils.scaled_values(senses, mean, std) senses = chuck_inf_means(senses) if random_drop == 'most': worst_n = np.argsort(np.abs(senses))[:num_drop] else: worst_n = np.argsort(-np.abs(senses))[:num_drop] # Extract final weights matrix from model with ch.no_grad(): model.state_dict().get("module.model.classifier.weight")[:, worst_n] = 0 # Save modified model sd_info = { 'model': model.state_dict(), 'epoch': 1 } save_checkpoint(sd_info, False, model_path)
11573149
from flask import current_app from lxml import etree from zeus.config import db from zeus.constants import Severity from zeus.models import StyleViolation from .base import ArtifactHandler class CheckstyleHandler(ArtifactHandler): supported_types = frozenset(["application/x-checkstyle+xml", "text/xml+checkstyle"]) def process(self, fp): try: root = etree.fromstring(fp.read()) except Exception: current_app.logger.exception("Failed to parse XML") return [] job = self.job # <file name="/var/lib/jenkins/workspace/Releases/ESLint Release/eslint/fullOfProblems.js"> # <error line="1" column="10" severity="error" message="&apos;addOne&apos; is defined but never used. (no-unused-vars)" source="eslint.rules.no-unused-vars" /> for f_node in root.iter("file"): # name filename = f_node.get("name") for e_node in f_node.iter("error"): # line, column, severity, message, source db.session.add( StyleViolation( job=job, repository_id=job.repository_id, filename=filename, severity=Severity[e_node.get("severity")], message=e_node.get("message"), source=e_node.get("source"), lineno=e_node.get("line"), colno=e_node.get("column"), ) ) db.session.flush()
11573151
import sys import os import unittest import shutil import copy from io import StringIO sys.path.append(".") from mock_gff3 import Create_generator from mock_helper import import_data, gen_file import annogesiclib.optimize_TSSpredator as ot from mock_args_container import MockClass class Mock_func(object): def __init__(self): self.example = Example() def mock_run_TSSpredator_paralle( self, config_files, tsspredator_path, processes): pass def mock_convert2gff(self, out_path, gff_files, args, test): if not os.path.exists("test_folder/gffs"): os.mkdir("test_folder/gffs") gen_file("test_folder/gffs/aaa.gff", self.example.gff_file) gff_files.append("test_folder/gffs/aaa.gff") class TestOptimizeTSSpredator(unittest.TestCase): def setUp(self): self.example = Example() self.mock_args = MockClass() self.test_folder = "test_folder" if (not os.path.exists(self.test_folder)): os.mkdir(self.test_folder) def tearDown(self): if os.path.exists(self.test_folder): shutil.rmtree(self.test_folder) def test_initiate(self): args = self.mock_args.mock() args.height = 0.9 args.height_reduction = 0.8 args.factor = 0.9 args.factor_reduction = 0.8 args.base_height = 0.01 args.enrichment = 0.5 args.processing = 0.5 max_num, best_para, current_para, indexs = ot.initiate(args) self.assertDictEqual(max_num, { 're_factor': 0.8, 'processing': 0.5, 'enrichment': 0.5, 'height': 0.9, 'base_height': 0.01, 're_height': 0.8, 'factor': 0.9}) self.assertDictEqual(best_para, { 're_factor': 0, 'processing': 0, 'enrichment': 0, 'height': 0, 'base_height': 0, 're_height': 0, 'factor': 0}) self.assertDictEqual(current_para, { 're_factor': 0, 'processing': 0, 'enrichment': 0, 'height': 0, 'base_height': 0, 're_height': 0, 'factor': 0}) self.assertDictEqual(indexs, { 'step': 0, 'change': False, 'num': 0, 'first': True, 'length': 0, 'exist': False, 'switch': 0, 'extend': False, 'count': 0}) def test_read_predict_manual_gff(self): gff = os.path.join(self.test_folder, "test.gff") gen_file(gff, self.example.gff_file) args = self.mock_args.mock() args.gene_length = 1000 num, gffs = ot.read_predict_manual_gff(gff, 1000) self.assertEqual(num, 1) self.assertEqual(gffs[0].start, 633) def test_scoring_function(self): stat_value = {"tp_rate": 0.8, "fp_rate": 0.0003, "tp": 100, "fp": 3} best = {"tp_rate": 0.8, "fp_rate": 0.0005, "tp": 100, "fp": 31, "fn": 45, "missing_ratio": 0.004} ot.scoring_function(best, stat_value, self.example.indexs, 1000) self.assertTrue(self.example.indexs["change"]) self.example.indexs["change"] = False stat_value = {"tp_rate": 0.8, "fp_rate": 0.0004, "tp": 100, "fp": 13} best = {"tp_rate": 0.8, "fp_rate": 0.0003, "tp": 100, "fp": 3} ot.scoring_function(best, stat_value, self.example.indexs, 1000) self.assertFalse(self.example.indexs["change"]) def test_load_stat_csv(self): stat_file = os.path.join(self.test_folder, "stat.csv") gen_file(stat_file, self.example.stat) list_num = [] best_para = {} datas = ot.load_stat_csv( self.test_folder, list_num, self.example.best, best_para, self.example.indexs, 1000, stat_file) self.assertEqual(datas[0], 2) self.assertDictEqual(datas[1], { 'fp': 230.0, 'tp': 789.0, 'missing_ratio': 0.29991126885536823, 'fp_rate': 8.15542105020548e-05, 'tp_rate': 0.7000887311446318, 'fn': 338.0}) self.assertDictEqual(datas[2], { 'processing': 5.2, 'base_height': 0.086, 'factor': 7.6, 're_height': 2.3, 're_factor': 5.5, 'enrichment': 3.1, 'height': 2.4}) def test_reload_data(self): stat_file = os.path.join(self.test_folder, "stat.csv") gen_file(stat_file, self.example.stat) list_num = [] best_para = {} log = open(os.path.join(self.test_folder, "test.log"), "w") datas = ot.reload_data(self.test_folder, list_num, self.example.best, best_para, self.example.indexs, 1000, stat_file, log) self.assertDictEqual(datas[0], { 'base_height': 0.086, 'processing': 5.2, 'height': 2.4, 'enrichment': 3.1, 're_factor': 5.5, 're_height': 2.3, 'factor': 7.6}) self.assertDictEqual(datas[1], { 'tp_rate': 0.7000887311446318, 'tp': 789.0, 'fn': 338.0, 'fp': 230.0, 'fp_rate': 8.15542105020548e-05, 'missing_ratio': 0.29991126885536823}) def test_extend_data(self): best_para = copy.deepcopy(self.example.best_para) current_para = ot.extend_data(self.test_folder, self.example.best, best_para, 100, "aaa") self.assertDictEqual(current_para, best_para) def test_run_random_part(self): list_num = [] current_para = copy.deepcopy(self.example.ref_para) para = ot.run_random_part(current_para, list_num, self.example.max_nums, 1000, self.example.indexs) self.assertTrue(para != self.example.ref_para) def test_run_large_change_part(self): list_num = [] seeds = {"seed": 0, "pre_seed": []} features = {"feature": "r", "pre_feature": ""} current_para = copy.deepcopy(self.example.ref_para) best_para = copy.deepcopy(self.example.best_para) para = ot.run_large_change_part(seeds, features, self.example.indexs, current_para, self.example.max_nums, best_para, list_num) self.assertTrue(para != self.example.ref_para) self.assertTrue(para != best_para) def test_gen_large_random(self): list_num = [] index_large = {0: "height", 1: "re_height", 2: "factor", 3: "re_factor", 4:"base_height", 5: "enrichment", 6: "processing"} best_para = copy.deepcopy(self.example.best_para) para = ot.gen_large_random(self.example.max_nums, "height", 0.2, list_num, 0.3, best_para, index_large, self.example.indexs) self.assertTrue(para != best_para) self.assertTrue(para["height"] > para["re_height"]) def test_run_small_change_part(self): seeds = {"seed": 0, "pre_seed": []} features = {"feature": "l", "pre_feature": ""} current_para = copy.deepcopy(self.example.ref_para) list_num = [] best_para = copy.deepcopy(self.example.best_para) para = ot.run_small_change_part( seeds, features, self.example.indexs, current_para, best_para, list_num, self.example.max_nums) self.assertTrue(para != best_para) def test_small_change(self): list_num = [] best_para = copy.deepcopy(self.example.best_para) para = ot.small_change(0.9, "height", 0.2, list_num, 0.5, best_para) self.assertTrue(para != 0.5) self.assertTrue(para > 0.2) def test_plus_process(self): list_num = [] actions = {"plus": False, "minus": False} best_para = copy.deepcopy(self.example.best_para) para = ot.plus_process("height", best_para, 0.9, 0.5, actions, list_num, 0.2) self.assertEqual(para, 0.4) def test_minus_process(self): list_num = [] actions = {"plus": False, "minus": False} best_para = copy.deepcopy(self.example.best_para) para = ot.minus_process("height", best_para, 0.9, 0.5, actions, list_num, 0.1) self.assertEqual(para, 0.2) def test_compare_manual_predict(self): out = StringIO() manual = os.path.join(self.test_folder, "manual.gff") predict = os.path.join(self.test_folder, "predict.gff") gen_file(manual, self.example.manual_file) gen_file(predict, self.example.gff_file) para_list = [copy.deepcopy(self.example.best_para)] args = self.mock_args.mock() args.manual = manual args.cores = 1 args.gene_length = 2000 args.cluster = 3 ot.compare_manual_predict(1000, para_list, [predict], self.test_folder, out, args, self.example.mans, 3, 2000) self.assertEqual( out.getvalue(), "1000\the_0.3_rh_0.2_fa_0.7_rf_0.3_bh_0.0_ef_2.5_pf_3.3\tTP=0\tTP_rate=0.0\tFP=2\tFP_rate=0.00100150225338007\tFN=2\tmissing_ratio=0.6666666666666666\n") def test_compute_stat(self): list_num = [self.example.best_para] best_para = {'re_factor': 0.3, 'processing': 3.3, 'enrichment': 2.5, 'height': 0.5, 'base_height': 0.0, 're_height': 0.2, 'factor': 0.7} self.example.indexs["change"] = True best = {"tp_rate": 0.6, "fp_rate": 0.0025, "tp": 40, "fp": 32, "fn": 45, "missing_ratio": 0.004} datas = ot.compute_stat(self.example.best, best, best_para, 1, list_num, self.test_folder, self.example.indexs, "aaa") self.assertDictEqual(datas[0], self.example.best_para) self.assertDictEqual(datas[1], self.example.best) def test_run_tss_and_stat(self): list_num = [self.example.best_para] seeds = {"seed": 0, "pre_seed": []} features = {"feature": "l", "pre_feature": ""} best_para = {'re_factor': 0.3, 'processing': 3.3, 'enrichment': 2.5, 'height': 0.5, 'base_height': 0.0, 're_height': 0.2, 'factor': 0.7} current_para = {'re_factor': 0.3, 'processing': 2.3, 'enrichment': 2.5, 'height': 0.5, 'base_height': 0.2, 're_height': 0.2, 'factor': 0.7} stat_out = StringIO() wig = os.path.join(self.test_folder, "wig") fasta = os.path.join(self.test_folder, "aaa.fa") gff = os.path.join(self.test_folder, "aaa.gff") if not os.path.exists(wig): os.mkdir(wig) gen_file(fasta, self.example.fasta) gen_file(gff, self.example.gff_file) output_prefix = ["test_aaa"] ot.run_TSSpredator_paralle = Mock_func().mock_run_TSSpredator_paralle ot.convert2gff = Mock_func().mock_convert2gff args = self.mock_args.mock() args.steps = 2000 args.cores = 1 args.tsspredator_path = "test" args.libs = self.example.libs args.program = "TSS" args.cluster = 3 args.utr = 200 args.replicate = "all_2" args.replicate_name = "rep" args.project_strain = "aaa" args.manual = os.path.join(self.test_folder, "manual.gff") args.gene_length = 2000 log = open(os.path.join(self.test_folder, "test.log"), "w") gen_file(args.manual, self.example.manual_file) datas, set_config, run_tss = ot.run_tss_and_stat( self.example.indexs, list_num, seeds, 0.4, 0.3, self.test_folder, stat_out, best_para, current_para, wig, fasta, gff, self.example.best, 3, args, "aaa", self.example.mans, 2000, log, True, True) self.assertFalse(datas[0]) def test_gen_config(self): wig = os.path.join(self.test_folder, "wig") if not os.path.exists(wig): os.mkdir(wig) fasta = os.path.join(self.test_folder, "aaa.fa") gff = os.path.join(self.test_folder, "aaa.gff") gen_file(fasta, self.example.fasta) gen_file(gff, self.example.gff_file) args = self.mock_args.mock() args.libs = self.example.libs args.cores = 1 args.cluster = 3 args.program = "TSS" args.project_strain = "aaa" args.replicate = "all_1" args.utr = 200 args.replicate_name = "test" filename = ot.gen_config(self.example.best_para, self.test_folder, 1, wig, fasta, gff, args, "aaa") self.assertEqual(filename, "test_folder/config_1.ini") data = import_data("test_folder/config_1.ini") self.assertEqual("\n".join(data), self.example.config) def test_comparison(self): nums = {"overlap": 0, "predict": 0, "manual": 0} for index in range(0, 3): self.example.mans[index].attributes["print"] = False self.example.gffs[index].attributes["print"] = False args = self.mock_args.mock() args.cluster = 3 args.gene_length = 2000 ot.comparison(self.example.mans, self.example.gffs, nums, args, 2000) self.assertDictEqual(nums, {'manual': 1, 'predict': 2, 'overlap': 1}) def test_check_overlap(self): nums = {"overlap": 0, "predict": 0, "manual": 0} datas = ot.check_overlap(True, None, nums, 2000, self.example.mans[0], self.example.gffs[0], 100) self.assertFalse(datas[0]) self.assertEqual(datas[1], 140) def test_print_lib(self): libs = [{"condition": 1, "replicate": "a", "wig": "test_1.wig"}, {"condition": 2, "replicate": "a", "wig": "test_2.wig"}] out = StringIO() ot.print_lib(2, libs, out, self.test_folder, "aaa", ["a"]) self.assertEqual( out.getvalue(), "aaa_1a = test_folder/test_1.wig\naaa_2a = test_folder/test_2.wig\n") def test_import_lib(self): out = StringIO() if not os.path.exists(os.path.join(self.test_folder, "wigs")): os.mkdir(os.path.join(self.test_folder, "wigs")) wig_folder = os.path.join(self.test_folder, "wigs", "tmp") if not os.path.exists(wig_folder): os.mkdir(wig_folder) lib_dict = {"fp": [], "fm": [], "np": [], "nm": []} gen_file(os.path.join( wig_folder, "GSM1649587_Hp26695_ML_B1_HS1_-TEX_forward_STRAIN_aaa.wig"), "test") gen_file(os.path.join( wig_folder, "GSM1649587_Hp26695_ML_B1_HS1_-TEX_reverse_STRAIN_aaa.wig"), "test") gen_file(os.path.join( wig_folder, "GSM1649588_Hp26695_ML_B1_HS1_-TEX_forward_STRAIN_aaa.wig"), "test") gen_file(os.path.join( wig_folder, "GSM1649588_Hp26695_ML_B1_HS1_-TEX_reverse_STRAIN_aaa.wig"), "test") args = self.mock_args.mock() args.project_strain = "aaa" args.program = "TSS" args.libs = self.example.libs lib_num = ot.import_lib(wig_folder, set(), lib_dict, out, "aaa.gff", [], "aaa.fa", args, "aaa") self.assertEqual(lib_num, 1) def test_optimization_process(self): current_para = copy.deepcopy(self.example.ref_para) best_ref_para = copy.deepcopy(self.example.best_para) list_num = [best_ref_para] indexs = copy.deepcopy(self.example.indexs) best_para = {'re_factor': 0.3, 'processing': 3.3, 'enrichment': 2.5, 'height': 0.6, 'base_height': 0.0, 're_height': 0.2, 'factor': 0.7} stat_out = StringIO() output_prefix = ["test_1"] gen_file(os.path.join(self.test_folder, "manual.gff"), self.example.manual_file) if not os.path.exists(os.path.join(self.test_folder, "wigs")): os.mkdir(os.path.join(self.test_folder, "wigs")) wig_folder = os.path.join(self.test_folder, "wigs", "tmp") if not os.path.exists(wig_folder): os.mkdir(wig_folder) gen_file(os.path.join( wig_folder, "GSM1649587_Hp26695_ML_B1_HS1_-TEX_forward_STRAIN_aaa.wig"), "test") gen_file(os.path.join( wig_folder, "GSM1649587_Hp26695_ML_B1_HS1_-TEX_reverse_STRAIN_aaa.wig"), "test") gen_file(os.path.join( wig_folder, "GSM1649588_Hp26695_ML_B1_HS1_-TEX_forward_STRAIN_aaa.wig"), "test") gen_file(os.path.join( wig_folder, "GSM1649588_Hp26695_ML_B1_HS1_-TEX_reverse_STRAIN_aaa.wig"), "test") ot.run_TSSpredator_paralle = Mock_func().mock_run_TSSpredator_paralle ot.convert2gff = Mock_func().mock_convert2gff args = self.mock_args.mock() args.libs = self.example.libs args.cores = 1 args.cluster = 3 args.program = "TSS" args.project_strain = "aaa" args.replicate = "all_1" args.utr = 200 args.replicate_name = "test" args.steps = 2 args.tsspredator_path = "test" args.gene_length = 2000 args.manual = os.path.join(self.test_folder, "manual.gff") log = open(os.path.join(self.test_folder, "test.log"), "w") ot.optimization_process( indexs, current_para, list_num, self.example.max_nums, best_para, self.test_folder, stat_out, self.example.best, wig_folder, "aaa.fa", "aaa.gff", 2, True, args, "aaa", self.example.mans, 2000, log) self.assertDictEqual(best_para, { 're_height': 0.2, 'factor': 0.7, 'processing': 3.3, 'height': 0.6, 'base_height': 0.0, 're_factor': 0.3, 'enrichment': 2.5}) def test_optimization(self): ot.run_TSSpredator_paralle = Mock_func().mock_run_TSSpredator_paralle ot.convert2gff = Mock_func().mock_convert2gff if not os.path.exists(os.path.join(self.test_folder, "wigs")): os.mkdir(os.path.join(self.test_folder, "wigs")) wig_folder = os.path.join(self.test_folder, "wigs", "tmp") if not os.path.exists(wig_folder): os.mkdir(wig_folder) fasta = os.path.join(self.test_folder, "aaa.fa") gff = os.path.join(self.test_folder, "aaa.gff") gen_file(fasta, self.example.fasta) gen_file(gff, self.example.gff_file) output_prefix = ["test_1"] args = self.mock_args.mock() args.libs = self.example.libs args.cores = 1 args.cluster = 3 args.program = "TSS" args.project_strain = "aaa" args.replicate = "all_1" args.utr = 200 args.steps = 2 args.gene_length = 2000 args.height = 0.9 args.height_reduction = 0.8 args.factor = 0.9 args.factor_reduction = 0.8 args.base_height = 0.01 args.enrichment = 0.5 args.processing = 0.5 args.length = None args.replicate_name = "test" args.tsspredator_path = "test" args.manual = os.path.join(self.test_folder, "manual.gff") gen_file(args.manual, self.example.manual_file) log = open(os.path.join(self.test_folder, "test.log"), "w") args.output_folder = self.test_folder os.mkdir(os.path.join(self.test_folder, "optimized_TSSpredator")) ot.optimization(wig_folder, fasta, gff, args, args.manual, 2000, "aaa", log) self.assertTrue(os.path.exists(os.path.join( self.test_folder, "optimized_TSSpredator", "stat_aaa.csv"))) class Example(object): libs = ["GSM1649587_Hp26695_ML_B1_HS1_-TEX_forward.wig:notex:1:a:+", "GSM1649587_Hp26695_ML_B1_HS1_-TEX_reverse.wig:notex:1:a:-", "GSM1649588_Hp26695_ML_B1_HS1_+TEX_forward.wig:tex:1:a:+", "GSM1649588_Hp26695_ML_B1_HS1_+TEX_reverse.wig:tex:1:a:-"] best = {"tp_rate": 0.8, "fp_rate": 0.0005, "tp": 100, "fp": 3, "fn": 45, "missing_ratio": 0.004} best_para = {'re_factor': 0.3, 'processing': 3.3, 'enrichment': 2.5, 'height': 0.3, 'base_height': 0.0, 're_height': 0.2, 'factor': 0.7} max_nums = {'re_factor': 0.9, 'processing': 9.0, 'enrichment': 9.0, 'height': 0.9, 'base_height': 0.1, 're_height': 0.9, 'factor': 0.9} ref_para = {'re_factor': 0.4, 'processing': 0.3, 'enrichment': 2.0, 'height': 0.5, 'base_height': 0.0, 're_height': 0.1, 'factor': 0.5} indexs = {'step': 0, 'change': False, 'num': 0, 'first': True, 'length': 0, 'exist': False, 'switch': 0, 'extend': False, 'count': 0} fasta = """>aaa AGACTTCCTGATAGTTAAACACATGAGATGTTGGCGTACACACCCGGTGTTTACGTATACGTTACTATGATATTTAGAAAAAACCCGTGTATACGTTCGTGA""" gff_file = """NC_000915.1 RefSeq TSS 633 633 . - . Name=nusB;gene=nusB;locus_tag=HP0001;ID=gene0;Dbxref=GeneID:898756;gbkey=Gene NC_000915.1 RefSeq TSS 1105 1105 . - . Name=ribH;gene=ribH;locus_tag=HP0002;ID=gene1;Dbxref=GeneID:898768;gbkey=Gene""" manual_file = """NC_000915.1 RefSeq TSS 633 633 . - . Name=nusB;gene=nusB;locus_tag=HP0001;ID=gene0;Dbxref=GeneID:898756;gbkey=Gene NC_000915.1 RefSeq TSS 1125 1125 . - . Name=ribH;gene=ribH;locus_tag=HP0002;ID=gene1;Dbxref=GeneID:898768;gbkey=Gene""" stat = """0 he_2.4_rh_2.3_fa_7.6_rf_5.5_bh_0.086_ef_3.1_pf_5.2 TP=789 TP_rate=0.7000887311446318 FP=230 FP_rate=8.15542105020548e-05 FN=338 missing_ratio=0.29991126885536823 1 he_1.4_rh_1.2_fa_7.5_rf_2.5_bh_0.149_ef_5.2_pf_5.0 TP=595 TP_rate=0.5279503105590062 FP=195 FP_rate=6.91437871647856e-05 FN=532 missing_ratio=0.4720496894409938""" gffs_dict = [ {"seq_id": "aaa", "source": "Refseq", "feature": "TSS", "start": 140, "end": 140, "phase": ".", "strand": "+", "score": "."}, {"seq_id": "aaa", "source": "Refseq", "feature": "TSS", "start": 30, "end": 30, "phase": ".", "strand": "+", "score": "."}, {"seq_id": "aaa", "source": "Refseq", "feature": "TSS", "start": 430, "end": 430, "phase": ".", "strand": "-", "score": "."}] attributes_gffs = [ {"ID": "TSS0", "Name": "TSS_0", "locus_tag": "AAA_00001"}, {"ID": "TSS1", "Name": "TSS_1", "locus_tag": "AAA_00002"}, {"ID": "TSS2", "Name": "TSS_2", "locus_tag": "AAA_00003"}] mans_dict = [ {"seq_id": "aaa", "source": "Refseq", "feature": "TSS", "start": 140, "end": 142, "phase": ".", "strand": "+", "score": "."}, {"seq_id": "aaa", "source": "Refseq", "feature": "TSS", "start": 40, "end": 40, "phase": ".", "strand": "+", "score": "."}, {"seq_id": "aaa", "source": "Refseq", "feature": "TSS", "start": 5167, "end": 5167, "phase": ".", "strand": "-", "score": "."}] attributes_mans = [ {"ID": "TSS0", "Name": "TSS_0", "locus_tag": "AAA_00001"}, {"ID": "TSS1", "Name": "TSS_1", "locus_tag": "AAA_00002"}, {"ID": "TSS2", "Name": "TSS_2", "locus_tag": "AAA_00003"}] gffs = [] mans = [] for index in range(0, 3): gffs.append(Create_generator( gffs_dict[index], attributes_gffs[index], "gff")) mans.append(Create_generator( mans_dict[index], attributes_mans[index], "gff")) config = """TSSinClusterSelectionMethod = HIGHEST allowedCompareShift = 1 allowedRepCompareShift = 1 annotation_1 = test_folder/aaa.gff fivePrimeMinus_1a = test_folder/wig/GSM1649588_Hp26695_ML_B1_HS1_+TEX_reverse.wig fivePrimePlus_1a = test_folder/wig/GSM1649588_Hp26695_ML_B1_HS1_+TEX_forward.wig genome_1 = test_folder/aaa.fa idList = 1 maxASutrLength = 100 maxGapLengthInGene = 500 maxNormalTo5primeFactor = 3.3 maxTSSinClusterDistance = 4 maxUTRlength = 200 min5primeToNormalFactor = 2.5 minCliffFactor = 0.7 minCliffFactorDiscount = 0.3 minCliffHeight = 0.3 minCliffHeightDiscount = 0.2 minNormalHeight = 0.0 minNumRepMatches = 1 minPlateauLength = 0 mode = cond normPercentile = 0.9 normalMinus_1a = test_folder/wig/GSM1649587_Hp26695_ML_B1_HS1_-TEX_reverse.wig normalPlus_1a = test_folder/wig/GSM1649587_Hp26695_ML_B1_HS1_-TEX_forward.wig numReplicates = 1 numberOfDatasets = 1 outputDirectory = test_folder/MasterTable_1 outputPrefix_1 = t outputPrefix_2 = e outputPrefix_3 = s outputPrefix_4 = t projectName = aaa superGraphCompatibility = igb texNormPercentile = 0.5 writeGraphs = 0 writeNocornacFiles = 0""" table = """SuperPos SuperStrand mapCount detCount Genome detected enriched stepHeight stepFactor enrichmentFactor classCount Pos Strand Locus_tag sRNA/asRNA Product UTRlength GeneLength Primary Secondary Internal Antisense Automated Manual Putative sRNA Putative asRNA Comment Sequence -50 nt upstream + TSS (51nt) 179 - 1 1 test 1 1 4.45 31.93 8.69 1 179 - orphan orphan NA NA 0 0 0 0 1 0 0 0 ACCCTTGAATTGAGGGTGTTTTATACCTAAATTTAAAAAATGATGCTATAA 681 - 1 1 test 1 1 4.2 3.0 3.54 2 681 - HP0001 transcription antitermination protein NusB 48 417 1 0 0 0 1 0 0 0 GATTGAAAGAGCGGGCAGTAAAGCCGGCAATAAGGGCTTTGAAGCGATGAG 681 - 1 1 test 1 1 4.2 3.0 3.54 2 681 - HP0002 6%2C7-dimethyl-8-ribityllumazine synthase NA 471 0 0 1 0 1 0 0 0 GATTGAAAGAGCGGGCAGTAAAGCCGGCAATAAGGGCTTTGAAGCGATGAG 1361 - 1 1 test 1 1 24.16 6.31 3.98 2 1361 - HP0002 6%2C7-dimethyl-8-ribityllumazine synthase 256 471 1 0 0 0 1 0 0 0 TATGGGAATTTAGTGGTGGATATGCGCTCTTTAAAAATCATGCGAGAATTT 1361 - 1 1 test 1 1 24.16 6.31 3.98 2 1361 - HP0003 2-dehydro-3-deoxyphosphooctonate aldolase NA 831 0 0 1 0 1 0 0 0 TATGGGAATTTAGTGGTGGATATGCGCTCTTTAAAAATCATGCGAGAATTT 2689 - 1 1 test 1 1 10.15 10.67 11.97 2 2689 - HP0004 carbonic anhydrase IcfA 92 666 1 0 0 0 1 0 0 1 CAATGCGACACATAATTGCATGAAAGCCCTTTAAAGTGTAAAATAACGCCA 2689 - 1 1 test 1 1 10.15 10.67 11.97 2 2689 - HP0005 orotidine 5%27-phosphate decarboxylase NA 684 0 0 0 1 1 0 0 1 CAATGCGACACATAATTGCATGAAAGCCCTTTAAAGTGTAAAATAACGCCA""" if __name__ == "__main__": unittest.main()
11573159
import sys def main(): new_version = sys.argv[1] with open("Changelog.md") as stream: contents = stream.read() if not new_version in contents: sys.exit("new_version: %s not found in Changelog" % new_version) if __name__ == "__main__": main()
11573169
from ._package_utils \ import \ parse_package_full_name from .errors \ import \ DepSolverError from .constraints \ import \ Equal, GEQ, GT, LEQ, LT, Not from .package \ import \ parse_package_full_name from .requirement_parser \ import \ RawRequirementParser from .version \ import \ MaxVersion, MinVersion, SemanticVersion class Requirement(object): """Requirements instances represent a 'package requirement', that is a package + version constraints. Arguments --------- name: str PackageInfo name specs: seq Sequence of constraints """ @classmethod def from_string(cls, requirement_string, version_factory=SemanticVersion.from_string): """Creates a new Requirement from a requirement string. Arguments --------- requirement_string: str The requirement string, e.g. 'numpy >= 1.3.0' Examples -------- # This creates a requirement that will match any version of numpy >>> Requirement.from_string("numpy") numpy * # This creates a requirement that will only version of numpy >= 1.3.0 >>> Requirement.from_string("numpy >= 1.3.0") numpy >= 1.3.0 """ parser = RequirementParser(version_factory) requirements = parser.parse(requirement_string) if len(requirements) != 1: raise DepSolverError("Invalid requirement string %r" % requirement_string) else: return requirements[0] @classmethod def from_package_string(cls, package_string, version_factory=SemanticVersion.from_string): """Creates a new Requirement from a package string. This is equivalent to the requirement 'package.name == package.version' Arguments --------- package_string: str The package string, e.g. 'numpy-1.3.0' """ name, version = parse_package_full_name(package_string) return cls(name, [Equal(version)], version_factory) def __init__(self, name, specs, version_factory=SemanticVersion.from_string): self.name = name self._min_bound = MinVersion() self._max_bound = MaxVersion() # transform GE and LE into NOT + corresponding GEQ/LEQ # Take the min of GEQ, max of LEQ equals = set(req for req in specs if isinstance(req, Equal)) if len(equals) > 1: self._cannot_match = True self._equal = None elif len(equals) == 1: self._cannot_match = False self._equal = version_factory(equals.pop().version) self._min_bound = self._max_bound = self._equal else: self._cannot_match = False self._equal = None self._not_equals = set(version_factory(req.version) for req in specs if isinstance(req, Not)) gts = [req for req in specs if isinstance(req, GT)] lts = [req for req in specs if isinstance(req, LT)] geq = [req for req in specs if isinstance(req, GEQ)] geq.extend(gts) geq_versions = [version_factory(g.version) for g in geq] if len(geq_versions) > 0: self._min_bound = max(geq_versions) leq = [req for req in specs if isinstance(req, LEQ)] leq.extend(lts) leq_versions = [version_factory(l.version) for l in leq] if len(leq_versions) > 0: self._max_bound = min(leq_versions) self._not_equals.update(version_factory(gt.version) for gt in gts) self._not_equals.update(version_factory(lt.version) for lt in lts) if self._min_bound > self._max_bound: self._cannot_match = True def __repr__(self): r = [] if self._cannot_match: r.append("%s None" % self.name) elif self._equal: r.append("%s == %s" % (self.name, self._equal)) else: if self._min_bound != MinVersion(): if self._min_bound in self._not_equals: operator_string = ">" else: operator_string = ">=" r.append("%s %s %s" % (self.name, operator_string, self._min_bound)) if self._max_bound != MaxVersion(): if self._max_bound in self._not_equals: operator_string = "<" else: operator_string = "<=" r.append("%s %s %s" % (self.name, operator_string, self._max_bound)) if self.is_universal: r.append("%s *" % self.name) for neq in self._not_equals: if neq > self._min_bound and neq < self._max_bound: r.append("%s != %s" % (self.name, neq)) return ", ".join(r) @property def is_universal(self): """Returns True if the requirement can matche any version.""" return self._min_bound == MinVersion() and self._max_bound == MaxVersion() \ and len(self._not_equals) == 0 def __eq__(self, other): return repr(self) == repr(other) def __hash__(self): return hash(repr(self)) def _nonempty_interval_intersection(self, provider): return self._max_bound >= provider._min_bound and provider._max_bound >= self._min_bound def matches(self, provider): """Return True if provider requirement and this requirement are compatible. Arguments --------- provider: Requirement The requirement to match Examples -------- >>> req = Requirement.from_string("numpy >= 1.3.0") >>> req.matches(Requirement.from_string("numpy")) True >>> req.matches(Requirement.from_string("numpy >= 1.2.0")) True >>> req.matches(Requirement.from_string("numpy >= 1.4.0")) True """ if self.name != provider.name: return False if self._cannot_match: return False if self._nonempty_interval_intersection(provider): if self._equal or provider._equal: return self._equal not in provider._not_equals \ and provider._equal not in self._not_equals else: return True else: return False class RequirementParser(object): def __init__(self, version_factory=SemanticVersion.from_string): self._parser = RawRequirementParser() self.version_factory = version_factory def iter_parse(self, requirement_string): for distribution_name, specs in self._parser.parse(requirement_string).items(): yield Requirement(distribution_name, specs, self.version_factory) def parse(self, requirement_string): return [r for r in self.iter_parse(requirement_string)]
11573187
import upwork from upwork.routers.hr.freelancers import applications from unittest.mock import patch @patch.object(upwork.Client, "get") def test_get_list(mocked_method): applications.Api(upwork.Client).get_list({}) mocked_method.assert_called_with("/hr/v4/contractors/applications", {}) @patch.object(upwork.Client, "get") def test_get_specific(mocked_method): applications.Api(upwork.Client).get_specific("reference") mocked_method.assert_called_with("/hr/v4/contractors/applications/reference")
11573199
import argparse import tasks def modify_command_options(opts): if opts.dataset == 'voc': opts.num_classes = 21 if opts.dataset == 'ade': opts.num_classes = 150 if not opts.visualize: opts.sample_num = 0 if opts.where_to_sim == 'GPU_server': opts.net_pytorch = False if opts.method is not None: if opts.method == 'FT': pass if opts.method == 'LWF': opts.loss_kd = 100 if opts.method == 'CIL': opts.loss_CIL == 1 if opts.method == 'LWF-MC': opts.icarl = True opts.icarl_importance = 10 if opts.method == 'ILT': opts.loss_kd = 100 opts.loss_de = 100 if opts.method == 'EWC': opts.regularizer = "ewc" opts.reg_importance = 1000 if opts.method == 'RW': opts.regularizer = "rw" opts.reg_importance = 1000 if opts.method == 'PI': opts.regularizer = "pi" opts.reg_importance = 1000 if opts.method == 'MiB': opts.loss_kd = 10 opts.unce = True opts.unkd = True opts.init_balanced = True if opts.method == 'SDR': # Note: for the best results these hyperparameters may need to be changed. # Typical ranges are: # loss_kd : 1 - 100 # loss_de_prototypes : 1e-3 - 1e-1 # lfc (same value is used for both attractive and repulsive) : 1e-3 - 1e-2 # lfs : 1e-5 - 1e-3 # A kick-start could be to use loss_kd 10, loss_de_prototypes 1e-2, lfc 1e-3 and lfs 1e-4 opts.loss_kd = 100 opts.unce = True opts.unkd = True opts.loss_featspars = 1e-3 opts.lfs_normalization = 'max_maskedforclass' opts.lfs_shrinkingfn = 'exponential' opts.lfs_loss_fn_touse = 'ratio' opts.loss_de_prototypes = 0.01 opts.loss_de_prototypes_sumafter = True opts.lfc_sep_clust = 1e-3 opts.loss_fc = 1e-3 opts.no_overlap = not opts.overlap opts.no_cross_val = not opts.cross_val return opts def get_argparser(): parser = argparse.ArgumentParser() # NB: on CPU not feasible because of inplace_ABN functions. # on GPU_windows need to remove apex since not supported # on GPU_server code as it has been downloaded parser.add_argument('--where_to_sim', type=str, choices=['GPU_windows', 'GPU_server', 'CPU', 'CPU_windows'], default='GPU_server') parser.add_argument("--net_pytorch", action='store_false', default=True, help='whether to use default resnet from pytorch or to use the network as in MiB (default: True)') # Performance Options parser.add_argument("--local_rank", type=int, default=0) parser.add_argument("--random_seed", type=int, default=42, help="random seed (default: 42)") parser.add_argument("--num_workers", type=int, default=1, help='number of workers (default: 1)') # Dataset Options parser.add_argument("--data_root", type=str, default='data', help="path to Dataset") parser.add_argument("--dataset", type=str, default='voc', choices=['voc', 'ade'], help='Name of dataset') parser.add_argument("--num_classes", type=int, default=None, help="num classes (default: None), set by method modify_command_options()") # Method Options # BE CAREFUL USING THIS, THEY WILL OVERRIDE ALL THE OTHER PARAMETERS. # This argument serves to use default parameters for the methods defined in function: modify_command_options() parser.add_argument("--method", type=str, default=None, choices=['FT', 'LWF', 'LWF-MC', 'ILT', 'EWC', 'RW', 'PI', 'MiB', 'CIL', 'SDR'], help="The method you want to use. BE CAREFUL USING THIS, IT MAY OVERRIDE OTHER PARAMETERS.") # Train Options parser.add_argument("--epochs", type=int, default=30, help="epoch number (default: 30)") parser.add_argument("--fix_bn", action='store_true', default=False, help='fix batch normalization during training (default: False)') parser.add_argument("--batch_size", type=int, default=8, help='batch size (default: 8)') parser.add_argument("--crop_size", type=int, default=512, help="crop size (default: 513)") parser.add_argument("--lr", type=float, default=0.007, help="learning rate (default: 0.007)") parser.add_argument("--momentum", type=float, default=0.9, help='momentum for SGD (default: 0.9)') parser.add_argument("--weight_decay", type=float, default=1e-4, help='weight decay (default: 1e-4)') parser.add_argument("--lr_policy", type=str, default='poly', choices=['poly', 'step'], help="lr schedule policy (default: poly)") parser.add_argument("--lr_decay_step", type=int, default=5000, help="decay step for stepLR (default: 5000)") parser.add_argument("--lr_decay_factor", type=float, default=0.1, help="decay factor for stepLR (default: 0.1)") parser.add_argument("--lr_power", type=float, default=0.9, help="power for polyLR (default: 0.9)") parser.add_argument("--bce", default=False, action='store_true', help="Whether to use BCE or not (default: no)") # whether to consider clustering on feature spaces as loss parser.add_argument("--loss_fc", type=float, default=0., # Features Clustering help="Set this hyperparameter to a value greater than " "0 to enable features clustering loss") parser.add_argument("--lfc_L2normalized", action='store_true', default=False, help="enable features clustering loss L2 normalized (default False)") parser.add_argument("--lfc_nobgr", action='store_true', default=False, help="enable features clustering loss without background (default False)") parser.add_argument("--lfc_orth_sep", action='store_true', default=False, help="Orthogonal separation loss applied on the current prototypes only") parser.add_argument("--lfc_orth_maxonly", action='store_true', default=False, help="Orthogonal separation loss, only the maximum value is considered") parser.add_argument("--lfc_sep_clust", type=float, default=0., # Separation of Clusters help="Set this hyperparameter to a value greater than " "0 to enable separation between clusters loss") parser.add_argument("--lfc_sep_clust_ison_proto", action='store_true', default=False, help="enable separation clustering loss on prototypes (default False)") # whether to consider Soft Nearest Neighbor Loss (SNNL) as loss at features space parser.add_argument("--loss_SNNL", type=float, default=0., # SNNL help="Set this hyperparameter to a value greater than " "0 to enable SNNL at feature level") parser.add_argument("--loss_featspars", type=float, default=0., # features sparsification help="Set this hyperparameter to a value greater than " "0 to enable features sparsification loss") parser.add_argument("--lfs_normalization", type=str, default='max_foreachfeature', choices=['L1', 'L2', 'max_foreachfeature', 'max_maskedforclass', 'max_overall', 'softmax'], help="The method you want to use to normalize lfs") parser.add_argument("--lfs_shrinkingfn", type=str, default='squared', choices=['squared', 'power3', 'exponential'], help="The method you want to use to shrink the lfs") parser.add_argument("--lfs_loss_fn_touse", type=str, default='ratio', choices=['ratio', 'max_minus_ratio', 'lasso', 'entropy'], help="The loss function you want to use for the lfs") parser.add_argument("--loss_bgruncertainty", type=float, default=0., help="Set this hyperparameter to a value greater than " "0 to enable background uncertainty loss") parser.add_argument("--lbu_inverse", action='store_true', default=False, help="enable inverse on lbu loss") parser.add_argument("--lbu_mean", action='store_true', default=False, help="enable lbu_mean on lbu loss") parser.add_argument("--loss_CIL", type=float, default=0., help="Set this hyperparameter to a value greater than " "0 to enable loss of CIL paper") parser.add_argument("--feat_dim", type=float, default=2048, help="Dimensionality of the features space (default: 2048 as in Resnet-101)") # Validation Options parser.add_argument("--val_on_trainset", action='store_true', default=False, help="enable validation on train set (default: False)") parser.add_argument("--cross_val", action='store_true', default=False, help="If validate on training or on validation (default: Train)") parser.add_argument("--crop_val", action='store_false', default=True, help='do crop for validation (default: True)') # Logging Options parser.add_argument("--logdir", type=str, default='./logs', help="path to Log directory (default: ./logs)") parser.add_argument("--name", type=str, default='Experiment', help="name of the experiment - to append to log directory (default: Experiment)") parser.add_argument("--sample_num", type=int, default=0, help='number of samples for visualization (default: 0)') parser.add_argument("--debug", action='store_true', default=False, help="verbose option") parser.add_argument("--visualize", action='store_false', default=True, help="visualization on tensorboard (def: Yes)") parser.add_argument("--print_interval", type=int, default=10, help="print interval of loss (default: 10)") parser.add_argument("--val_interval", type=int, default=15, help="epoch interval for eval (default: 15)") parser.add_argument("--ckpt_interval", type=int, default=1, help="epoch interval for saving model (default: 1)") # Model Options parser.add_argument("--backbone", type=str, default='resnet101', choices=['resnet50', 'resnet101'], help='backbone for the body (def: resnet50)') parser.add_argument("--output_stride", type=int, default=16, choices=[8, 16], help='stride for the backbone (def: 16)') parser.add_argument("--no_pretrained", action='store_true', default=False, help='Wheather to use pretrained or not (def: True)') parser.add_argument("--norm_act", type=str, default="iabn_sync", choices=['iabn_sync', 'iabn', 'abn', 'std'], help='Which BN to use (def: abn_sync') parser.add_argument("--fusion-mode", metavar="NAME", type=str, choices=["mean", "voting", "max"], default="mean", help="How to fuse the outputs. Options: 'mean', 'voting', 'max'") parser.add_argument("--pooling", type=int, default=32, help='pooling in ASPP for the validation phase (def: 32)') # Test and Checkpoint options parser.add_argument("--test", action='store_true', default=False, help="Whether to train or test only (def: train and test)") parser.add_argument("--ckpt", default=None, type=str, help="path to trained model. Leave it None if you want to retrain your model") # Parameters for Knowledge Distillation of ILTSS (https://arxiv.org/abs/1907.13372) parser.add_argument("--freeze", action='store_true', default=False, help="Use this to freeze the feature extractor in incremental steps") parser.add_argument("--loss_de", type=float, default=0., # Distillation on Encoder help="Set this hyperparameter to a value greater than " "0 to enable distillation on Encoder (L2)") parser.add_argument("--loss_de_maskedold", default=False, action='store_true', help="If enabled, loss_de is masked to consider only old classes features (default: False)") parser.add_argument("--loss_de_prototypes", type=float, default=0., # Distillation on Encoder help="Set this hyperparameter to a value greater than " "0 to enable loss_de with prototypes (idea 1b)") parser.add_argument("--loss_de_prototypes_sumafter", action='store_true', default=False, help="Whether to sum after of average during loss_DE") parser.add_argument("--loss_de_cosine", action='store_true', default=False, help="Use cosine similarity ad distillation function on the encoded features") parser.add_argument("--loss_kd", type=float, default=0., # Distillation on Output help="Set this hyperparameter to a value greater than " "0 to enable Knowledge Distillation (Soft-CrossEntropy)") # Parameters for EWC, RW, and SI (from <NAME> https://arxiv.org/abs/1801.10112) parser.add_argument("--regularizer", default=None, type=str, choices=['ewc', 'rw', 'pi'], help="regularizer you want to use. Default is None") parser.add_argument("--reg_importance", type=float, default=1., help="set this par to a value greater than 0 to enable regularization") parser.add_argument("--reg_alpha", type=float, default=0.9, help="Hyperparameter for RW and EWC that controls the update of Fisher Matrix") parser.add_argument("--reg_no_normalize", action='store_true', default=False, help="If EWC, RW, PI must be normalized or not") parser.add_argument("--reg_iterations", type=int, default=10, help="If RW, the number of iterations after each the update of the score is done") # Arguments for ICaRL (from https://arxiv.org/abs/1611.07725) parser.add_argument("--icarl", default=False, action='store_true', help="If enable ICaRL or not (def is not)") parser.add_argument("--icarl_importance", type=float, default=1., help="the regularization importance in ICaRL (def is 1.)") parser.add_argument("--icarl_disjoint", action='store_true', default=False, help="Which version of icarl is to use (def: combined)") parser.add_argument("--icarl_bkg", action='store_true', default=False, help="If use background from GT (def: No)") # METHODS parser.add_argument("--init_balanced", default=False, action='store_true', help="Enable Background-based initialization for new classes") parser.add_argument("--unkd", default=False, action='store_true', help="Enable Unbiased Knowledge Distillation instead of Knowledge Distillation") parser.add_argument("--alpha", default=1., type=float, help="The parameter to hard-ify the soft-labels. Def is 1.") parser.add_argument("--unce", default=False, action='store_true', help="Enable Unbiased Cross Entropy instead of CrossEntropy") # Incremental parameters parser.add_argument("--task", type=str, default="19-1", choices=tasks.get_task_list(), help="Task to be executed (default: 19-1)") parser.add_argument("--step", type=int, default=0, help="The incremental step in execution (default: 0)") # Consider the dataset as done in # http://openaccess.thecvf.com/content_ICCVW_2019/papers/TASK-CV/Michieli_Incremental_Learning_Techniques_for_Semantic_Segmentation_ICCVW_2019_paper.pdf # and https://arxiv.org/pdf/1911.03462.pdf : same as disjoint scenario (default) but with label of old classes in # new images, if present. parser.add_argument("--no_mask", action='store_true', default=False, help="Use this to not mask the old classes in new training set, i.e. use labels of old classes" " in new training set (if present)") parser.add_argument("--overlap", action='store_true', default=False, help="Use this to not use the new classes in the old training set") parser.add_argument("--step_ckpt", default=None, type=str, help="path to trained model at previous step. Leave it None if you want to use def path") parser.add_argument('--opt_level', type=str, choices=['O0', 'O1', 'O2', 'O3'], default='O0') return parser
11573223
import warnings from pathlib import Path import context # noqa import typer from edsnlp.conjugator import conjugate from edsnlp.pipelines.qualifiers.hypothesis.patterns import verbs_eds, verbs_hyp from edsnlp.pipelines.qualifiers.negation.patterns import verbs as neg_verbs from edsnlp.pipelines.qualifiers.reported_speech.patterns import verbs as rspeech_verbs warnings.filterwarnings("ignore") def conjugate_verbs( output_path: Path = typer.Argument( "edsnlp/resources/verbs.csv", help="Path to the output CSV table." ) ) -> None: """ Convenience script to automatically conjugate a set of verbs, using mlconjug3 library. """ all_verbs = set(neg_verbs + rspeech_verbs + verbs_eds + verbs_hyp) typer.echo(f"Conjugating {len(all_verbs)} verbs...") df = conjugate(list(all_verbs)) typer.echo(f"Saving to {output_path}") output_path.parent.mkdir(exist_ok=True, parents=True) df.to_csv(output_path, index=False) typer.echo("Done !") if __name__ == "__main__": typer.run(conjugate_verbs)
11573229
from __future__ import annotations from typing import List, Dict from reamber.algorithms.playField import PlayField from reamber.algorithms.playField.parts.PFDrawable import PFDrawable from reamber.base.RAConst import RAConst class PFDrawBeatLines(PFDrawable): def __init__(self, divisions: List = None, default_color: str = "#666666", division_colors: Dict = None): """ Draws beat lines by division specified Supported Default Snap Colors: 1, 2, 3, 4, 5, 6, 8, 12, 16, 24, 32. The colors can be found in RAConst. You can specify non-default snaps (including floats) and your custom divisionColors. The new colors will override the default colors if they overlap. :param divisions: Defaults to [1, 2, 4], will draw 1/1, 1/2, 1/4 lines in the field :param default_color: Default color to use when the snap color is not supported. :param division_colors: A custom color dictionary to use. This can be specified if you want to override colors. \ A template can be found in RAConst.DIVISION_COLOR. """ self.divisions = divisions if divisions else [1, 2, 4] # Default divisions self.default_color = default_color # The unpacking operator resolves the dictionary as specified in the docstring self.division_colors = \ {**RAConst.DIVISION_COLORS, **division_colors} if division_colors else RAConst.DIVISION_COLORS def draw(self, pf: PlayField) -> PlayField: """ Refer to __init__ """ # Need to draw it from most common to least common, else it'll overlap incorrectly for division in sorted(self.divisions, reverse=True): if division not in self.division_colors.keys(): color = self.default_color # Default color if val not found else: color = self.division_colors[division] for beat in pf.m.bpms.snap_offsets(nths=division, last_offset=pf.m.stack().offset.max()): pf.canvas_draw.line([pf.get_pos(beat), pf.get_pos(beat, pf.keys)], # [(0, pf.canvasH - int((beat - pf.start) / pf.durationPerPx)), # (pf.canvasW - pf.padding, pf.canvasH - int((beat - pf.start) / pf.durationPerPx))], fill=color) return pf
11573230
from torch.utils.data import Dataset import torch import config import numpy as np from scipy.stats import norm from tqdm import tqdm class DKTDataset(Dataset): def __init__(self, group, max_seq, min_seq, overlap_seq, user_performance, n_levels, mu_itv): self.samples = group self.max_seq = max_seq self.min_seq = min_seq self.overlap_seq = overlap_seq self.user_performance = user_performance self.data = [] self.n_levels = n_levels self.mu_itv = mu_itv self.mu_levels, self.std_levels = self._fit_norm(user_performance) for user_id, (exercise, part, correctness, elapsed_time, lag_time_s, lag_time_m, lag_time_d, p_explanation) in tqdm(self.samples.items(), total=len(self.samples), desc="Loading Dataset"): content_len = len(exercise) if content_len < self.min_seq: continue # skip sequence with too few contents if content_len > self.max_seq: initial = content_len % self.max_seq if initial >= self.min_seq: self.data.extend([(user_id, np.append([config.START], exercise[:initial]), np.append([config.START], part[:initial]), np.append([config.START], correctness[:initial]), np.append([config.START], elapsed_time[:initial]), np.append([config.START], lag_time_s[:initial]), np.append([config.START], lag_time_m[:initial]), np.append([config.START], lag_time_d[:initial]), np.append([config.START], p_explanation[:initial]))]) for seq in range(content_len // self.max_seq): start = initial + seq * self.max_seq end = initial + (seq + 1) * self.max_seq self.data.extend([(user_id, np.append([config.START], exercise[start: end]), np.append([config.START], part[start: end]), np.append([config.START], correctness[start: end]), np.append([config.START], elapsed_time[start: end]), np.append([config.START], lag_time_s[start: end]), np.append([config.START], lag_time_m[start: end]), np.append([config.START], lag_time_d[start: end]), np.append([config.START], p_explanation[start: end]))]) else: self.data.extend([(user_id, np.append([config.START], exercise), np.append([config.START], part), np.append([config.START], correctness), np.append([config.START], elapsed_time), np.append([config.START], lag_time_s), np.append([config.START], lag_time_m), np.append([config.START], lag_time_d), np.append([config.START], p_explanation))]) def _fit_norm(self, user_perf): data = [d for d in user_perf.values()] mu, std = norm.fit(data) mu_levels = [mu - (self.n_levels - 1) * self.mu_itv / 2 + i * self.mu_itv for i in range(self.n_levels)] std_levels = [np.sqrt(std ** 2 / self.n_levels) for _ in range(self.n_levels)] return mu_levels, std_levels def _predict_level(self, user_perf, mu_levels, std_levels): probs = [] for mu, std in zip(mu_levels, std_levels): probs.append(norm.pdf(user_perf, mu, std)) probs = np.array(probs) probs = probs / sum(probs) return probs def __len__(self): return len(self.data) def __getitem__(self, idx): raw_user_id, raw_content_ids, raw_part, raw_correctness, raw_elapsed_time, raw_lag_time_s, raw_lag_time_m, raw_lag_time_d, raw_p_explan = self.data[idx] if raw_user_id in self.user_performance: user_per = self.user_performance[raw_user_id] probs = self._predict_level(user_per, self.mu_levels, self.std_levels) else: probs = np.ones(len(self.mu_levels)) probs /= len(self.mu_levels) seq_len = len(raw_content_ids) input_content_ids = np.zeros(self.max_seq, dtype=np.int64) input_part = np.zeros(self.max_seq, dtype=np.int64) input_correctness = np.zeros(self.max_seq, dtype=np.int64) input_elapsed_time = np.zeros(self.max_seq, dtype=np.int64) input_lag_time_s = np.zeros(self.max_seq, dtype=np.int64) input_lag_time_m = np.zeros(self.max_seq, dtype=np.int64) input_lag_time_d = np.zeros(self.max_seq, dtype=np.int64) input_p_explan = np.zeros(self.max_seq, dtype=np.int64) label = np.zeros(self.max_seq, dtype=np.int64) if seq_len == self.max_seq + 1: # START token input_content_ids[:] = raw_content_ids[1:] input_part[:] = raw_part[1:] input_p_explan[:] = raw_p_explan[1:] input_correctness[:] = raw_correctness[:-1] input_elapsed_time[:] = np.append(raw_elapsed_time[0], raw_elapsed_time[2:]) input_lag_time_s[:] = np.append(raw_lag_time_s[0], raw_lag_time_s[2:]) input_lag_time_m[:] = np.append(raw_lag_time_m[0], raw_lag_time_m[2:]) input_lag_time_d[:] = np.append(raw_lag_time_d[0], raw_lag_time_d[2:]) label[:] = raw_correctness[1:] - 2 else: input_content_ids[-(seq_len - 1):] = raw_content_ids[1:] # Delete START token input_part[-(seq_len - 1):] = raw_part[1:] input_p_explan[-(seq_len - 1):] = raw_p_explan[1:] input_correctness[-(seq_len - 1):] = raw_correctness[:-1] input_elapsed_time[-(seq_len - 1):] = np.append(raw_elapsed_time[0], raw_elapsed_time[2:]) input_lag_time_s[-(seq_len - 1):] = np.append(raw_lag_time_s[0], raw_lag_time_s[2:]) input_lag_time_m[-(seq_len - 1):] = np.append(raw_lag_time_m[0], raw_lag_time_m[2:]) input_lag_time_d[-(seq_len - 1):] = np.append(raw_lag_time_d[0], raw_lag_time_d[2:]) label[-(seq_len - 1):] = raw_correctness[1:] - 2 _input = {"content_id": input_content_ids.astype(np.int64), "part": input_part.astype(np.int64), "correctness": input_correctness.astype(np.int64), "elapsed_time": input_elapsed_time.astype(np.int64), "lag_time_s": input_lag_time_s.astype(np.int64), "lag_time_m": input_lag_time_m.astype(np.int64), "lag_time_d": input_lag_time_d.astype(np.int64), "prior_explan": input_p_explan.astype(np.int64)} return _input, label, probs
11573233
import os import sys import copy import logging from checker import * from .ofp import register_ofp_creators from .ofp import OfpBase from .ofp_match import SCE_MATCH from .ofp_match import OfpMatchCreator from .ofp_instruction import SCE_INSTRUCTIONS from .ofp_instruction import OfpInstructionCreator # YAML: # flow_stats: # cookie: 0 # match: # in_port: 1 # eth_dst: "ff:ff:ff:ff:ff:ff" # instructions: # - apply_actions: # actions: # - output: # port: 0 SCE_FLOW_STATS = "flow_stats" class OfpFlowStatsCreator(OfpBase): @classmethod def create(cls, test_case_obj, dp, ofproto, ofp_parser, params): # FlowStats. kws = copy.deepcopy(params) # match. match = None if SCE_MATCH in params: match = OfpMatchCreator.create(test_case_obj, dp, ofproto, ofp_parser, params[SCE_MATCH]) kws[SCE_MATCH] = match # instructions. instructions = [] if SCE_INSTRUCTIONS in params: instructions = OfpInstructionCreator.create(test_case_obj, dp, ofproto, ofp_parser, params[SCE_INSTRUCTIONS]) kws[SCE_INSTRUCTIONS] = instructions # create FlowStats. msg = ofp_parser.OFPFlowStats(**kws) msg._set_targets(["table_id", "priority", "idle_timeout", "hard_timeout", "flags", "cookie", "packet_count", "byte_count", "match", "instructions"]) return msg
11573245
class MockSerial(object): def __init__(self, response): self.response = response self.inputs = [] def write(self, message): self.inputs.append(message) def readlines(self): return self.response
11573277
class Solution: def maxAreaOfIsland(self, grid: List[List[int]]) -> int: res = 0 m, n = len(grid), len(grid[0]) dirs = [(1,0),(-1,0),(0,1),(0,-1)] for i in range(m): for j in range(n): if grid[i][j] == 1: stack = [] stack.append((i,j)) grid[i][j] = '#' cur_area = 1 while stack: x, y = stack.pop() for dx, dy in dirs: nx = dx + x ny = dy + y if 0<=nx<m and 0<=ny<n and grid[nx][ny] == 1: cur_area += 1 stack.append((nx,ny)) grid[nx][ny] = '#' res = max(res, cur_area) return res
11573290
from contextlib import contextmanager from mock import MagicMock from mock import patch import os import chainer from chainerrl.agents import a3c import chainerrl.distribution import gym import numpy import pytest from chainerrl_visualizer import launch_visualizer import chainerrl_visualizer.launcher as launcher @contextmanager def change_execution_dir(path): cwd = os.getcwd() try: os.chdir(path) yield finally: os.chdir(cwd) # argument must be a subclass of Agent, using A3c is no particular meaning. class MockAgent(MagicMock, a3c.A3C): def __init__(self, *args, **kwargs): super(MagicMock, self).__init__(*args, **kwargs) @pytest.mark.parametrize('outs', [ ( chainer.Variable(numpy.zeros(1).reshape(1, 1)), chainerrl.distribution.SoftmaxDistribution(chainer.Variable(numpy.zeros(2).reshape(1, 2))) ), ( chainerrl.action_value.DiscreteActionValue(chainer.Variable(numpy.ones(2).reshape(1, 2))) ) ]) def test_launch_visualizer(tmpdir, outs): agent = MockAgent() agent.model = MagicMock(side_effect=lambda *args: outs) gymlike_env = MagicMock(spec=gym.Env) action_meanings = {0: 'hoge', 1: 'fuga'} # This assertion checks the instances is called correctly. # In the target luncher function, the instance is called from forked process internally, # So cannot use `assert_called` and shared values. # It's not smart, and address with touch file to check called or not. websrv_called_touch = os.path.join(tmpdir, 'websrv_called.log') worker_called_touch = os.path.join(tmpdir, 'worker_called.log') def assert_server_called(*args): assert len(args) == 12 assert id(args[0]) == id(agent) assert id(args[1]) == id(gymlike_env) open(websrv_called_touch, 'w').close() web_server = MagicMock(side_effect=assert_server_called) def assert_worker_called(*args): assert len(args) == 6 assert id(args[0]) == id(agent) assert id(args[1]) == id(gymlike_env) open(worker_called_touch, 'w'). close() job_worker = MagicMock(side_effect=assert_worker_called) webbrowser = MagicMock() webbrowser.open_new_tab = MagicMock() with change_execution_dir(tmpdir): with patch('chainerrl_visualizer.launcher.modify_gym_env_render') as modify_gymenv, \ patch('chainerrl_visualizer.launcher.web_server', web_server), \ patch('chainerrl_visualizer.launcher.job_worker', job_worker), \ patch('chainerrl_visualizer.launcher.webbrowser', webbrowser): launch_visualizer(agent, gymlike_env, action_meanings) modify_gymenv.assert_called_once() assert os.path.exists(websrv_called_touch) assert os.path.exists(worker_called_touch) def test_launch_visualizer_canceled(tmpdir): agent = MockAgent() gymlike_env = MagicMock() action_meanings = {0: 'hoge', 1: 'fuga'} os.makedirs(os.path.join(tmpdir, 'log_space')) with change_execution_dir(tmpdir): with patch('chainerrl_visualizer.launcher.input', side_effect='n'), \ patch('chainerrl_visualizer.launcher.inspect_agent') as inspect_agent: launch_visualizer(agent, gymlike_env, action_meanings) inspect_agent.assert_not_called() @pytest.mark.parametrize('act_list,err_kw', [ ((1, 'a'), 'to be dictionary'), ({}, 'number of entries'), ({0: 'a', 2: 'b'}, 'Invalid key index') ]) def test_validate_action_meanings(act_list, err_kw): with pytest.raises(Exception) as excinfo: launcher.validate_action_meanings(act_list) assert err_kw in str(excinfo.value) def test_modify_gym_env_render(): gym_env, render = MagicMock(), MagicMock() gym_env.render = render launcher.modify_gym_env_render(gym_env) gym_env.render() render.assert_called_once_with(mode='rgb_array') @pytest.mark.parametrize( 'input,expected', [('y', True), ('Y', True), ('n', False), ('N', False), ('x', False)]) def test_prepare_log_directory_existed(tmpdir, input, expected): log_dir = os.path.join(tmpdir, 'log_space', 'rollouts') os.makedirs(log_dir) with patch('chainerrl_visualizer.launcher.input', side_effect=input): prepared = launcher.prepare_log_directory(log_dir) assert prepared == expected class UnsupportedDistribution(chainerrl.distribution.SoftmaxDistribution): def __init__(self): pass class UnsupportedActionValue(chainerrl.action_value.DiscreteActionValue): def __init__(self): pass @pytest.mark.parametrize('outs,err_kw', [ (numpy.zeros(1), 'Model output type of ndarray'), (chainer.Variable(numpy.zeros(1)), 'Outputs of model do not contain'), (UnsupportedDistribution(), 'Distribution type UnsupportedDistribution'), (UnsupportedActionValue(), 'ActionValue type UnsupportedActionValue') ]) def test_inspect_agent(outs, err_kw): agent = MagicMock() agent.model = MagicMock(side_effect=lambda *args: outs) gymlike_env = MagicMock() contains_rnn = MagicMock() with pytest.raises(Exception) as excinfo: launcher.inspect_agent(agent, gymlike_env, contains_rnn) assert err_kw in str(excinfo.value) def test_inspect_agent_reccurrent_model(): # in this test case, agent, model and outs are nonsense scheme # to check only error handling logic outs = chainerrl.action_value.DiscreteActionValue(chainer.Variable(numpy.ones(2).reshape(1, 2))) agent = MagicMock() # to check working the function if agent does not have 'xp' attribute # if process of agent check is more than one, this case should be separated into another one. delattr(agent, 'xp') agent.model = MagicMock(spec=chainerrl.recurrent.RecurrentChainMixin, return_value=outs) gymlike_env = MagicMock() contains_rnn = MagicMock() launcher.inspect_agent(agent, gymlike_env, contains_rnn)
11573345
from __future__ import absolute_import, division, print_function import logging import sys logging.basicConfig( stream=sys.stdout, level=logging.DEBUG, format='%(asctime)s %(name)s-%(levelname)s: %(message)s', datefmt='%Y-%m-%d %H:%M:%S') import numpy as np import mdtraj as md from demystifying import feature_extraction as fe, visualization, traj_preprocessing as tp logger = logging.getLogger("VSD") def run_VSD(working_dir="bio_input/VSD/", cluster_for_prediction=None, dt_for_prediction=10, multiclass=False): data = np.load(working_dir + 'frame_i_j_contacts_dt1.npy') cluster_indices = np.loadtxt(working_dir + 'clusters_indices.dat') kwargs = { 'samples': data, 'labels': cluster_indices, 'filter_by_distance_cutoff': True, 'use_inverse_distances': True, 'n_splits': 3, 'n_iterations': 5, 'scaling': True, 'shuffle_datasets': True } if cluster_for_prediction is not None: cluster_traj = md.load("{}/{}_dt{}.xtc".format(working_dir, cluster_for_prediction, dt_for_prediction), top=working_dir + "alpha.pdb") other_samples, _, _ = tp.to_distances( traj=cluster_traj, scheme="closest-heavy", pairs="all-residues", use_inverse_distances=True, ignore_nonprotein=True, periodic=True) logger.debug("Loaded cluster samples for prediction of shape %s for state %s", other_samples.shape, cluster_for_prediction) cluster_traj = None # free memory else: other_samples = False feature_extractors = [ fe.RandomForestFeatureExtractor( classifier_kwargs={ 'n_estimators': 100}, one_vs_rest=not multiclass, **kwargs), fe.KLFeatureExtractor(bin_width=0.1, **kwargs), fe.MlpFeatureExtractor( classifier_kwargs={ 'hidden_layer_sizes': [100, ], 'max_iter': 100000, 'alpha': 0.0001}, activation="relu", one_vs_rest=not multiclass, per_frame_importance_samples=other_samples, per_frame_importance_labels=None, # If None the method will use predicted labels for LRP per_frame_importance_outfile="{}/mlp_perframe_importance_{}/" "VSD_mlp_perframeimportance_{}_dt{}.txt".format(working_dir, "multiclass" if multiclass else "binaryclass", cluster_for_prediction, dt_for_prediction), **kwargs) ] common_peaks = { "R1-R4": [294, 297, 300, 303], "K5": [306], "R6": [309], } do_computations = True filetype = "svg" for extractor in feature_extractors: logger.info("Computing relevance for extractors %s", extractor.name) extractor.extract_features() p = extractor.postprocessing(working_dir=working_dir, pdb_file=working_dir + "alpha.pdb", filter_results=False) if do_computations: p.average() p.evaluate_performance() p.persist() else: p.load() visualization.visualize([[p]], show_importance=True, show_performance=False, show_projected_data=False, highlighted_residues=common_peaks, outfile=working_dir + "{extractor}/importance_per_residue_{suffix}.{filetype}".format( suffix="", extractor=extractor.name, filetype=filetype)) if do_computations: visualization.visualize([[p]], show_importance=False, show_performance=True, show_projected_data=False, outfile=working_dir + "{extractor}/performance_{suffix}.{filetype}".format( extractor=extractor.name, suffix="", filetype=filetype)) visualization.visualize([[p]], show_importance=False, show_performance=False, show_projected_data=True, outfile=working_dir + "{extractor}/projected_data_{suffix}.{filetype}".format( extractor=extractor.name, suffix="", filetype=filetype)) logger.info("Done") if __name__ == "__main__": run_VSD(cluster_for_prediction="gamma")
11573383
import logging from sciencebeam_parser.models.training_data import ( AbstractTeiTrainingDataGenerator ) LOGGER = logging.getLogger(__name__) # based on: # https://github.com/kermitt2/grobid/blob/0.7.0/grobid-core/src/main/java/org/grobid/core/engines/TableParser.java ROOT_TRAINING_XML_ELEMENT_PATH = ['text', 'figure[@type="table"]'] # Note: # The table training data generation is different to figures in # how the following labels are mapped: `content`, `other`, `note` TRAINING_XML_ELEMENT_PATH_BY_LABEL = { '<figure_head>': ROOT_TRAINING_XML_ELEMENT_PATH + ['head'], '<label>': ROOT_TRAINING_XML_ELEMENT_PATH + ['head', 'label'], '<figDesc>': ROOT_TRAINING_XML_ELEMENT_PATH + ['figDesc'], '<content>': ROOT_TRAINING_XML_ELEMENT_PATH + ['table'], '<other>': ROOT_TRAINING_XML_ELEMENT_PATH + ['other'], '<note>': ROOT_TRAINING_XML_ELEMENT_PATH + ['note'] } class TableTeiTrainingDataGenerator(AbstractTeiTrainingDataGenerator): DEFAULT_TEI_FILENAME_SUFFIX = '.table.tei.xml' DEFAULT_DATA_FILENAME_SUFFIX = '.table' def __init__(self): super().__init__( root_training_xml_element_path=ROOT_TRAINING_XML_ELEMENT_PATH, training_xml_element_path_by_label=TRAINING_XML_ELEMENT_PATH_BY_LABEL, use_tei_namespace=False, root_tag='tei', default_tei_filename_suffix=( TableTeiTrainingDataGenerator.DEFAULT_TEI_FILENAME_SUFFIX ), default_data_filename_suffix=( TableTeiTrainingDataGenerator.DEFAULT_DATA_FILENAME_SUFFIX ), default_tei_sub_directory='table/corpus/tei', default_data_sub_directory='table/corpus/raw' )
11573398
from model_bakery import baker from rest_framework import status from rest_framework.authtoken.models import Token from rest_framework.test import APITestCase from restaurants.models import Restaurant from .models import User email = '<EMAIL>' password = '<PASSWORD>' nickname = 'nickname' class UserRegisterTestCase(APITestCase): url = '/users' def test_should_create(self): data = { 'email': email, 'password': password, 'nickname': None } response = self.client.post(self.url, data) r = response.data self.assertEqual(response.status_code, status.HTTP_201_CREATED, r) self.assertEqual(r['email'], data['email']) self.assertEqual(r['nickname'], data['nickname']) self.assertFalse(User.objects.get(id=r['id']).is_active) def test_without_email(self): response = self.client.post(self.url, {'email': '', 'password': password}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) def test_email_format(self): wrong_email = 'wrong@format' response = self.client.post(self.url, {'email': wrong_email, 'password': password}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) def test_without_password(self): response = self.client.post(self.url, {'email': email, 'password': ''}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) def test_with_duplicated_email(self): duplicated_email = '<EMAIL>' self.user = baker.make(User, email=duplicated_email, password=password) response = self.client.post(self.url, {'email': duplicated_email, 'password': password}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) class UserRetrieveTestCase(APITestCase): def setUp(self) -> None: self.user = baker.make('users.User') baker.make('users.Profile', user=self.user) def test_success(self): self.client.force_authenticate(user=self.user) response = self.client.get(f'/users/{self.user.id}') r = response.data self.assertEqual(response.status_code, status.HTTP_200_OK, r) self.assertEqual(self.user.profile.nickname, r['nickname']) self.assertEqual(self.user.profile.phone_num, r['phone_num']) self.assertEqual(self.user.email, r['email']) class UserAuthorizePhoneNumTestCase(APITestCase): def setUp(self) -> None: self.user = baker.make('users.User', is_active=False) baker.make('users.Profile', user=self.user) self.data = { 'phone_num': '010-1111-1111' } self.url = f'/users/{self.user.id}/authorize_phone_num' def test_success(self): response = self.client.patch(self.url, data=self.data) r = response.data self.assertEqual(response.status_code, status.HTTP_200_OK, r) authorizde_user = User.objects.get(id=r['id']) self.assertEqual(self.data['phone_num'], r['phone_num']) self.assertEqual(authorizde_user.profile.phone_num, r['phone_num']) self.assertTrue(authorizde_user.is_active) self.assertEqual(self.user.email, r['email']) self.assertEqual(self.user.profile.nickname, r['nickname']) # def test_fail_401(self): # response = self.client.patch(self.url, data=self.data) # self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED, response.data) # # def test_fail_403(self): # self.client.force_authenticate(user=baker.make('users.User')) # response = self.client.patch(self.url, data=self.data) # self.assertEqual(response.status_code, status.HTTP_403_FORBIDDEN, response.data) class UserUpdatePasswordTestCase(APITestCase): def setUp(self) -> None: self.old_password = '<PASSWORD>' self.new_password = '<PASSWORD>' self.user = baker.make('users.User', email=email, password=self.old_password) baker.make('users.Profile', user=self.user) self.data = {'password': <PASSWORD>} self.url = f'/users/{self.user.id}/update_password' def test_success(self): self.client.force_authenticate(user=self.user) response = self.client.patch(self.url, data=self.data) self.assertEqual(response.status_code, status.HTTP_200_OK, response.data) response = self.client.post('/users/login', {'email': email, 'password': <PASSWORD>}) self.assertEqual(response.status_code, status.HTTP_201_CREATED, response.data) def test_fail_401(self): response = self.client.patch(self.url, data=self.data) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED, response.data) def test_fail_403(self): self.client.force_authenticate(user=baker.make('users.User')) response = self.client.patch(self.url, data=self.data) self.assertEqual(response.status_code, status.HTTP_403_FORBIDDEN, response.data) class UserUpdateNicknameTestCase(APITestCase): def setUp(self) -> None: self.old_nickname = 'old' self.new_nickname = 'new' self.user = baker.make('users.User') baker.make('users.Profile', user=self.user, nickname=self.old_nickname) self.data = {'nickname': self.new_nickname} def test_success(self): self.client.force_authenticate(user=self.user) response = self.client.patch(f'/users/{self.user.id}', data=self.data) r = response.data self.assertEqual(response.status_code, status.HTTP_200_OK, r) def test_fail_put(self): self.client.force_authenticate(user=self.user) response = self.client.put(f'/users/{self.user.id}', data=self.data) self.assertEqual(response.status_code, status.HTTP_405_METHOD_NOT_ALLOWED, response.data) def test_fail_401(self): response = self.client.patch(f'/users/{self.user.id}', data=self.data) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED, response.data) def test_fail_403(self): self.client.force_authenticate(user=baker.make('users.User')) response = self.client.patch(f'/users/{self.user.id}', data=self.data) self.assertEqual(response.status_code, status.HTTP_403_FORBIDDEN, response.data) class UserLoginTestCase(APITestCase): url = '/users/login' def setUp(self) -> None: self.user = baker.make('users.User', email=email, password=password) def test_with_correct_info(self): response = self.client.post(self.url, {'email': email, 'password': password}) r = response.data self.assertEqual(response.status_code, status.HTTP_201_CREATED, r) self.assertTrue('token' in r) self.assertTrue(Token.objects.filter(user=self.user, key=r['token']).exists()) def test_without_password(self): response = self.client.post(self.url, {'email': email}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) def test_with_wrong_password(self): response = self.client.post(self.url, {'email': email, 'password': '<PASSWORD>'}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) def test_without_email(self): response = self.client.post(self.url, {'password': password}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) def test_with_wrong_email(self): response = self.client.post(self.url, {'email': '<EMAIL>', 'password': password}) self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST) class UserLogoutTestCase(APITestCase): url = '/users/logout' def setUp(self) -> None: self.user = baker.make('users.User', email=email, password=password) self.token = baker.make(Token, user=self.user) def test_should_delete_token(self): self.client.force_authenticate(user=self.user, token=self.token) response = self.client.delete(self.url) self.assertEqual(response.status_code, status.HTTP_200_OK, response.data) self.assertFalse(Token.objects.filter(user_id=self.user.id).exists()) def test_should_denied_delete_token(self): response = self.client.delete(self.url) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED) self.assertTrue(Token.objects.filter(user_id=self.user.id).exists()) class BookmarkListTest(APITestCase): def setUp(self) -> None: self.users = baker.make('users.User', _quantity=2) baker.make('users.Bookmark', user=self.users[0]) baker.make('users.Bookmark', user=self.users[1]) def test_success(self): self.client.force_authenticate(user=self.users[0]) response = self.client.get('/bookmarks') self.assertEqual(response.status_code, status.HTTP_200_OK, response.data) for r in response.data['results']: self.assertTrue(Restaurant.objects.filter(id=r['id'], bookmark__user=self.users[0]).exists()) owner_comment_count = r['owner_comment_count'] self.assertTrue(owner_comment_count != 0)