text
large_stringlengths 63
5.87k
| label
large_stringclasses 2
values | netloc
large_stringlengths 5
48
| url
large_stringlengths 32
1.63k
|
|---|---|---|---|
Under the contract, Northrop Grumman will enhance the system's multi-radar tracker and data communications unit and sustain and upgrade the software and hardware of the command and control systems that support the tactical air operations center and circuit card assemblies. "As the original equipment manufacturer of the AN/TYQ-23, Northrop Grumman has supported changing needs in the command and control arena for more than 40 years," said Ike Song, Northrop Grumman Electronic Systems vice president Of situational awareness systems. The tactical operations center is a transportable command, control and communications facility that works with the sector anti-air warfare facility and peripheral equipment for surveillance, identification, threat evaluation, weapons coordination, airspace management and communications capabilities.
|
forward
|
executivebiz.com
|
https://executivebiz.com/2014/01/northrop-wins-7-3m-marine-corps-c4isr-contract-ike-song-comments
|
Goldman, Sachs & Co. and Morgan Stanley & Co. LLC will act as lead joint book-running managers. Wells Fargo Securities, LLC and Credit Suisse Securities (USA) LLC will act as joint book-running managers. William Blair & Company, L.L.C. and Compass Point Research & Trading, LLC will act as co-managers.
|
forward
|
www.insidearm.com
|
https://www.insidearm.com/news/00019031-performant-financial-announces-offering-o
|
▶ Watch Video: Silicon Valley Bank client speaks about the impact of the collapse on her business New York-based swimwear company Andie Swim founder Melanie Travis was caught unprepared by the sudden collapse of Silicon Valley Bank, she told CBS News. On Friday, Silicon Valley Bank (SVB), the 16th-largest U.S. bank with $210 billion in assets, was seized by California regulators after depositors rushed to withdraw funds over concerns the bank might become insolvent. SVB catered to envelope-pushing tech startups, internet and software companies, as well as firms in the life science and health care space, and premium winemakers. Andie Swim was among the bank's customers and Travis told CBS News that she was "panicked and flustered," upon hearing the news of the bank's closing. Travis said she and her team knew there was a crisis looming and they were working on moving to another bank Friday midday during which she learned SVB had collapsed.
|
not-forward
|
www.wsgw.com
|
https://www.wsgw.com/andie-swim-founder-stunned-by-silicon-valley-bank-collapse-did-we-lose-everything
|
Northland Capital Markets acted as Sole Placement Agent to the Company. Lowenstein Sandler LLP acted as legal counsel to the Company. Ellenoff Grossman & Schole acted as legal counsel to the Investors. The securities described above (including any securities issuable pursuant to the conversion provisions of the preferred stock) have not been registered under the Securities Act of 1933, as amended, and may not be offered or sold in the United States absent registration or an applicable exemption from registration requirements. The Company has agreed to file one or more resale registration statements with the Securities and Exchange Commission for purposes of registering the resale of the shares of common stock issuable upon conversion of the preferred stock issued under the Facility. About Applied Digital Applied Digital (Nasdaq: APLD ) develops, builds and operates next-generation data centers and cloud infrastructure.
|
forward
|
www.stocktitan.net
|
https://www.stocktitan.net/news/APLD/applied-digital-enters-into-a-150-million-convertible-preferred-p8zvl033aaw0.html
|
Roku is on the right side of the streaming war as more competition in the space only adds to its product offering. Roku has become almost synonymous with cord-cutting. According to Roku's most recent shareholders' letter, "roughly 50% of U.S. cord cutters are Roku customers, and around 56 million households in total will have canceled cable or satellite TV subscriptions by 2023." Its devices range from a $30 4K plug-ins to very affordable TV options, partnering with top brands.
|
not-forward
|
www.zacks.com
|
https://www.zacks.com/stock/news/704779/zacks-investment-ideas-feature-highlights-nvidia-and-roku/?art_rec=blog-press_releases-up_next-ID01-img-704779
|
Jefferies LLC acted as sole bookrunning manager of the offering. A registration statement relating to these securities was declared effective by the U.S. Securities and Exchange Commission (the "SEC") on October 14, 2021. This press release shall not constitute an offer to sell or the solicitation of an offer to buy, nor shall there be any sale of these securities in any state or jurisdiction in which such offer, solicitation or sale would be unlawful prior to registration or qualification under the securities laws of any such state or jurisdiction.
|
not-forward
|
apnews.com
|
https://apnews.com/press-release/globe-newswire/business-initial-public-offerings-67722f3bb22ffd0775f2e248e0f8ab77
|
Michael Saylor's crypto portfolio, primarily centered around Bitcoin, has played a pivotal role in shaping institutional investment in digital assets. His unwavering confidence in Bitcoin has positioned MicroStrategy as both a tech company and a Bitcoin powerhouse. While his strategy has yielded substantial gains, it also carries risks that investors must consider. As Bitcoin adoption grows, Saylor's influence in the space will likely continue to expand, making him one of the most significant figures in cryptocurrency history. MicroStrategy 's crypto investments are a case study in bold financial strategy, blending corporate finance with Bitcoin maximalism.
|
not-forward
|
tradersunion.com
|
https://tradersunion.com/interesting-articles/michael-saylor-crypto-portfolio
|
Align Technology ( ALGN - Free Report ) manufactures and markets a system of clear aligner therapy, intra-oral scanners and CAD/CAM (computer-aided design and computer-aided manufacturing) digital services used in dentistry, orthodontics, and dental records storage. Align Technology exited the fourth quarter of 2020 with better-than-expected results despite the pandemic-led challenges. The company saw higher sales of Invisalign clear aligners and iTero scanners amid the pandemic. Impressive international performance across geographies and increased shipment volumes buoy optimism on the stock. Robust segmental performances and margin expansions look encouraging.
|
not-forward
|
www.zacks.com
|
https://www.zacks.com/stock/news/1283752/top-stock-picks-for-week-of-march-22-2021/?art_rec=blog-video_blog-up_next-ID01-img-1283752
|
We have the concept which unlocks cost-attractive eVTOL opportunity by addressing efficiency and noise hurdles in vehicle lift, hover, and cruise stages of flight." Honeywell possesses more than 100 years of experience pioneering aircraft technologies across every application from commercial airliners to military platforms. This century of expertise and a wealth of technology innovation in avionics, navigation, propulsion and more has positioned Honeywell to effectively collaborate with Pipistrel on defining a future for the emerging urban air mobility space.
|
forward
|
www.suasnews.com
|
https://www.suasnews.com/2019/01/pipistrel-and-honeywell-collaborate-on-aircraft-technologies-for-urban-air-mobility
|
A different revolution in healthcare is gene enhancing. Experts revolutionary gene modifying Never only want to deal with a illness following prognosis. Alternatively, they hope gene editing can focus on the fundamental genetic explanation for the disease, even in advance of diagnosis. CRISPR, shorter for clustered frequently interspaced brief palindromic repeats, is often a gene-modifying tool that may someday cure disorders which include blindness, sickle-mobile sickness, as well as cancer. Firms for instance Editas (NASDAQ:EDIT) and CRISPR Therapeutics (NASDAQ:CRSP) are main the best way, with human tests established to start in 2018.
|
forward
|
seekingalpha.com
|
https://seekingalpha.com/instablog/49670041-steromarket/5200589-invest-eu-pharmaceutical-stocks
|
NORWOOD, Mass., 18 Sept. 2012. Analog Devices Inc. in Norwood, Mass., is introducing three high-performance 16- and 14-bit transmit digital-to-analog (D/A) converters with extended operating temperature ranges and high-reliability packaging for radar, secure communications, avionics, and other aerospace and defense electronics applications.
|
not-forward
|
www.militaryaerospace.com
|
http://www.militaryaerospace.com/articles/2012/09/adi-mil-adconverter.html
|
Qorvo, Inc. also supplies RF components to smartphone players such as Apple, as well as to the infrastructure, and defense space. The stock is up 13% this year. (See our analysis Is Skyworks A Better Bet Than Qorvo? )
|
not-forward
|
www.forbes.com
|
https://www.forbes.com/sites/greatspeculations/2021/04/12/how-is-the-semiconductor-shortage-impacting-5g-stocks
|
Next up is Rackspace Hosting (NYSE: RAX), a data-center operator that's adding thousands of clients to its cloud-computing servers each quarter. If that sounds like a pedestrian business with an indefensible moat, it is. And isn't.
|
not-forward
|
www.fool.com
|
https://www.fool.com/investing/general/2010/09/22/can-this-cloud-computing-winner-keep-winning.aspx
|
Read more: IAG Gets EU Warning Shot Over €400 Million Air Europa Deal "We maintain very frequent conversations with the European Commission with the aim of resolving all their possible objections to the acquisition of Air Europa," an IAG representative said. "This meeting is part of that constructive dialog process." IAG's tilt at Air Europa is one of several potential attempts at consolidation in the European airline space. Deutsche Lufthansa AG's bid for a 41% stake in ITA Airways is also under the microscope for its potential impact on competition.
|
forward
|
www.bnnbloomberg.ca
|
https://www.bnnbloomberg.ca/iag-ceo-gallego-cuts-short-airline-meet-to-race-to-brussels-1.2080276
|
Ready Nodes are purpose-built PowerEdge server products that have been tested, validated and certified for specific hyper-convergence software that customers can install themselves to build out a hyper-converged infrastructure. The point is to reduce project risk, improve storage efficiency, simplify management and quicken scaling. Dell EMC offers Ready Nodes for vSAN (subsidiary VMware's hyper-converged and software-defined storage software), VxFlex and Microsoft Storage Spaces Direct software-defined storage technology. Microsoft introduced Storage Spaces Direct with Windows Server 2016, adding support for it to Windows Admin Center to simplify management with Windows Server 2019.
|
not-forward
|
www.techtarget.com
|
https://www.techtarget.com/searchdatacenter/feature/Get-to-know-Dell-EMC-hyper-converged-infrastructure-products
|
Tags A330, American Airlines, Australia, B/E Aerospace, Baggage Allowance, Basic Economy, Boeing, British Airways, business class, buy-on-board, Club World, comfort, Delta Airlines, first class, In Conversation, In-flight Food, Inflight food, Korean Air, Longhaul, New Zealand, podcast, Seating, seats, Singapore Airlines, Singapore Airlines Private Room, United Airlines
|
not-forward
|
runwaygirlnetwork.com
|
https://runwaygirlnetwork.com/2017/01/watch-paxex-minute-news-from-nose-to-tail-and-beyond/?share=x"
|
International Data Corp. analyst Ryan O'Leary said DocuSign is well-placed to solve problems for small businesses in the contract lifecycle management space.
|
not-forward
|
siliconangle.com
|
https://siliconangle.com/2022/04/05/docusign-debuts-new-contract-lifecycle-management-tool-smbs
|
The markets often get it wrong when they push the price of quality companies lower due to short-term events in the marketplace. This very phenomenon may be happening in the fertilizer industry as a weak pricing environment and negative news have sent shares lower this year. The market's reaction to news often creates brief opportunity for investors seeking value, but is it time to step in or time to be patient and let the markets take their course?
|
not-forward
|
www.fool.ca
|
https://www.fool.ca/2013/08/15/stepping-into-fertilizer-stocks
|
Canopy Growth Corp. is a diversified cannabis firm, with multiple brands, curated strains, half a million square feet of production space, and a $4.35 billion valuation. The bullish company also boasts partnerships with leading names in the cannabis industry, including Tweed, Spectrum Cannabis and Bedrocan.
|
not-forward
|
finance.yahoo.com
|
https://finance.yahoo.com/news/5-companies-watch-marijuana-legalization-233000916.html
|
Social Capital Hedosophia Holdings III is a bit of a mouthful, but that won't last long. It has a pending merger with Medicare Advantage insurance and healthcare information provider Clover Health. More importantly, the SPAC that will eventually be Clover Health is the third vehicle bankrolled by Chamath Palihapitiya. He struck gold with with space travel company Virgin Galactic Holdings and next-gen home flipper Opendoor with his first two SPACs. His pedigree is strong with a winning track record of early-stage investments long before he jumped into the SPAC market.
|
forward
|
www.fool.com
|
https://www.fool.com/investing/2020/12/10/3-top-stocks-under-20
|
In a blog post on the new release, Eliot Horowitz, chief technology officer and co-founder of 10gen, said, "Using a hashed shard key allows users to get a good distribution of load and data in a simple manner, in cases where documents are accessed randomly through the key space, or if the access patterns may not be totally predictable."
|
not-forward
|
www.eweek.com
|
http://www.eweek.com/database/10gen-s-mongodb-2.4-ships-adds-enterprise-features
|
The wait is finally over. Today GoPro took the wraps off its first drone, called Karma. It's a foldable unit, and in fact it ships in a small backpack that you can use to carry it around. The quadcopter's controller has a touchscreen and two joysticks. The drone itself has a 3-axis gimbal which stabilizes the camera, and this can be removed and used in handheld mode too. As for cameras, the Karma is compatible with the Hero 4 as well as the newly announced Hero 5 series. The GoPro Karma will become available on October 23 for $799 (or £720 in the UK) with no camera included, $999 with the Hero 5 Session, and $1,099 or £999 with the Hero 5 Black. Speaking of which, let's take a look at GoPro's newest action cams too. The Hero 5 Black is the company's new top of the line offering in this space. It records 4K footage at 30fps (with wide dynamic range even), takes 12 MP pictures (RAW too), has a 2-inch touchscreen, built-in GPS, and it's water resistant up to 10m.
|
not-forward
|
www.gsmarena.com
|
https://www.gsmarena.com/gopro_karma_drone_is_finally_official_alongside_hero_5_black_and_hero_5_session_cameras-news-20590.php
|
The London Stock Exchange Group plc (LSEG) operates in the financial services industry, providing a range of services including stock exchange listings, trading, and market data. It focuses on facilitating capital markets and offering financial information services to a global clientele.
|
not-forward
|
www.tipranks.com
|
https://www.tipranks.com/news/company-announcements/lseg-updates-shareholders-on-remuneration-policy-following-agm
|
Roku makes money by selling ad space across its marketplace and taking a share of streaming service subscription revenue and ad inventory. Roku allows marketers to buy targeted ads, promote their streaming movies, shows, platforms, and more. The category soared 117% in Q2, while its overall revenue climbed 81% to easily beat the Zacks estimate. Image Source: Zacks Investment Research Outlook Roku swung from an adjusted loss of -$0.35 a share in Q2 FY20 to +$0.52 last quarter to top our projection by 270%—its fourth straight bottom-line beat.
|
not-forward
|
www.zacks.com
|
https://www.zacks.com/commentary/1789426/bull-of-the-day-roku-inc-roku/?art_rec=commentary-bull_of_the_day-up_next-ID01-txt-1789426
|
Honeywell Aerospace began its operations in Puerto Rico with 12 employees in 2007 and has grown consistently. The company's Moca facility is a state-of-the-art engineering design center and laboratory used for research and development work in the field of interference and electromagnetic compatibility. The Aguadilla Service Center provides support to Honeywell's operations and customers worldwide.
|
not-forward
|
newsismybusiness.com
|
https://newsismybusiness.com/honeywell-aerospace-begins-operations-in-guaynabo
|
The investment seems to be a strategy to take on Amazon in the grocery segment. Amazon entered grocery space last year via Amazon Now. It's currently operational in Bengaluru, Mumbai, Delhi (NCR) and Hyderabad, and does about 6,000 to 8,000 orders on a daily basis Paytm Mall aims to strengthen its online-to-offline strategy using BigBasket's partnerships with corner stores. The report mentions that Alibaba will deploy around $150 million directly in Bigbasket, remaining $50 million will go to existing investors in a secondary transaction. Earlier, Amazon had also shown interest in Bigbasket, however talks failed owing to differences over valuation. After failed attempt to invest in Bigbasket, now Amazon is talking to Grofers for a minority stake in the Gurugram-headquartered company. Interest of Alibaba and Amazon in grocery is growing as overall growth of e-commerce has been sluggish from the beginning of the last year.
|
forward
|
entrackr.com
|
https://entrackr.com/2017/08/alibaba-paytm-extend-investment-interest-bigbasket-amazon-eyes-grofers
|
These dynamics provide Taiwan Semiconductor with enormous leverage, as the company is able to command a premium for its fabrication and foundry services. Moreover, Taiwan Semi represents a more agnostic approach to investing in the AI chip space. Said differently, TSMC stands to benefit from more secular trends fueling chip demand as opposed to a specific company's products being in demand over the competition.
|
not-forward
|
finance.yahoo.com
|
https://finance.yahoo.com/news/2-artificial-intelligence-ai-stocks-121500824.html
|
Winner: Hungary Waberer's IPO Citigroup and Berenberg as Joint Global Coordinators, Citigroup, Berenberg, Erste Group, and Renaissance Capital as Joint Bookrunners, Erste Group as Mandated Lead Arrangers (Kinstellar; Shearman & Sterling ) Summary: Lakatos, Koves and Partners and White & Case advised Mid Europa Partners on the IPO of Waberer's International Nyrt., one of Europe's largest haulage and logistics companies. Shearman & Sterling and Kinstellar represented the Mandated Lead Arrangers. Kinstellar Comment: "Waberer's IPO is Hungary's biggest public listing in more than a decade. This landmark transaction represents a major milestone for the Waberer's strategic growth and may give a shot in the arm to the Hungarian market currently dominated by four blue-chip stocks."
|
not-forward
|
www.ceelegalmatters.com
|
https://www.ceelegalmatters.com/ceelm-announcements/9338-deal-of-the-year-awards-banquet
|
The analysts said they'll also be closely watching the release of a few of Research In Motion Ltd (NASDAQ:BBRY) (TSE:BB)'s products. Later this month, the BlackBerry maker will release Secure Work Space for both iOS and Android. By the beginning of July, the BlackBerry Q5 will launch in the U.K. BlackBerry Messenger will be out for iOS and Android by summer and BlackBerry Messenger Channels officially launches in the BlackBerry 10.2 update, which is expected by September or October.
|
forward
|
www.valuewalk.com
|
https://www.valuewalk.com/research-in-motion-ltd-bbry-could-surprise-raymond-james/
|
Foolish bottom line While 2012 was unkind to Intel and its shareholders, and while Intel underperformed in 2013, it's going to be pretty interesting to see how well the company does in 2014. If PC sales stabilize and by year's end show a return to growth, then all bets are off and Intel goes much higher – regardless of its position in the mobile space. If PCs continue to decline, then the focus will inevitably turn back to mobile – a story that doesn't get really interesting for Intel until 2015.
|
forward
|
www.fool.com
|
http://www.fool.com/investing/general/2014/01/15/intel-soars-all-eyes-on-earnings.aspx
|
Perbak Capital Partners LLP purchased a new position in shares of GE Aerospace ( NYSE:GE – Free Report ) during the 1st quarter, according to its most recent filing with the Securities and Exchange Commission. The firm purchased 1,576 shares of the company's stock, valued at approximately $315,000.
|
not-forward
|
www.thecerbatgem.com
|
https://www.thecerbatgem.com/2025/09/03/perbak-capital-partners-llp-buys-new-stake-in-ge-aerospace-ge.html
|
Founded in 1992 in Dover, NH, Planet Fitness is one of the largest and fastest-growing franchisors and operators of fitness centers in the United States by number of members and locations. As of March 31, 2022, Planet Fitness had more than 16.2 million members and 2,291 stores in 50 states, the District of Columbia, Puerto Rico, Canada, Panama, Mexico and Australia. The Company's mission is to enhance people's lives by providing a high-quality fitness experience in a welcoming, non-intimidating environment, which we call the Judgement Free Zone®. More than 90% of Planet Fitness stores are owned and operated by independent businessmen and women.
|
not-forward
|
thalhimer.com
|
https://thalhimer.com/marketwatch/our-blog/planet-fitness-gym-coming-to-new-town-shops-on-main
|
Until then, Maersk and B2C Europe remain two separate companies and thus will perform their business as usual. Both Visible SCM and B2C Europe are well-established and recognised players in the e-commerce logistics industry and these two acquisitions will bring proven, high performance expertise, infrastructure and technology to the services and network already offered at Maersk. It further gives you the opportunity to sell online independently with market competitive service levels and a seamless omni-channel integration between B2B and B2C supply chains. Our aim is for you to be able to sell through any sales channel and deliver in any way while at the same time improve flexibility and supply chain resilience when navigating risks and opportunities. We want to help you seize all relevant market opportunities and our goal is to provide you with reliable and connected solutions that enable you to grow in the e-commerce space without losing the direct interface to your customers.
|
forward
|
www.maersk.com
|
https://www.maersk.com/news/articles/2021/08/05/maersk-to-acquire-e-commerce-logistics-capabilities-in-europe-and-united-states
|
"Web-based games, which can be played in a browser without installation of a client application, are experiencing rapid growth and this is the right time to invest to and enter this space," said Mr. Tao Wang, Changyou's chief executive officer. "Changyou has been leading the market for massively multiplayer online games in China, and with the addition of a proven development team from 7Road, their successful game and wide network of partner websites, we are pushing forward in our plans to reach new audiences with the addition of quality products designed for different consumers."
|
forward
|
www.prnewswire.com
|
https://www.prnewswire.com/news-releases/sohucom-announces-acquisition-of-a-majority-stake-in-7road-by-changyoucom-120585114.html
|
The Dzire is an ideal option for sedan lovers who seek reliable performance, a spacious interior, and low maintenance costs. The car has a 1.2-litre Z Series petrol engine that produces a maximum power output of 80bhp and a peak torque of 112Nm and is mated to a five-speed manual or an AMT transmission. It also comes with a CNG powertrain on select variants, producing 68bhp and 102Nm.
|
not-forward
|
www.autox.com
|
https://www.autox.com/news/car-news/top-5-cars-to-buy-under-rs-10-lakh-this-diwali-121981
|
SM Prime Holdings [ SMPH 31.20 0.65% ] [ link ] will open its newest supermall in Tanza tomorrow, called SM City Tanza. This will be SMPH's 7th supermall in Cavite. SM City Tanza will open with 89% of its leasable space under contract.
|
forward
|
www.philstar.com
|
https://www.philstar.com/business/stock-commentary/2022/10/13/2216380/quick-take-elon-musks-starlink-delay-ph-launch-and-2-more-market-updates
|
Previously, Chun served as director of Communications for Global Services & Support and Boeing Military Aircraft, both of which were divisions of Boeing Defense, Space & Security. In his new role, Chun will continue reporting to Anne Toulouse, senior vice president of Communications, and Stan Deal, president and CEO of Boeing Commercial Airplanes. "Stan and I are confident in Conrad's abilities to help us prepare to safely return the 737 MAX to service and continue to drive progress across our commercial airplanes business," Toulouse said.
|
forward
|
airlinergs.com
|
https://airlinergs.com/boeing-names-new-communications-leader-for-commercial-airplanes-business/
|
US-based Viasat has received "unconditional clearance" from the UK's Competition and Markets Authority in its bid to acquire Inmarsat. The deal was first announced in November 2021 with a total transaction value of $7.3 billion which included $850 million in cash, 46.36 million Viasat shares worth $3.1 billion, and the assumption of $3.4 billion of net debt.
|
not-forward
|
europeanspaceflight.com
|
https://europeanspaceflight.com/viasat-clears-latest-hurdle-in-bid-to-buy-inmarsat
|
Colocation provider Switch said it sold 19 megawatts of power capacity in August, its highest one-month total ever. The majority of that capacity was for space in SuperNAP 8, the company's newest mega-data center in Las Vegas.
|
not-forward
|
www.datacenterknowledge.com
|
https://www.datacenterknowledge.com/archives/2013/09/06/vegas-switch-adds-19-megawatts-colo-supernap-sales
|
His many contributions across GE and GE Aerospace have been invaluable and help build a world-class business and team. Shane, thank you. The opportunity and the imperative to embrace Lean more deeply, both within our four walls and with our partners, suppliers, and customers, has really stood out to me over the last several months. We've been taking a harder look at our operating rhythms, moving toward a more frequent weekly and monthly cadence for each of our P&Ls.
|
not-forward
|
www.nasdaq.com
|
https://www.nasdaq.com/articles/general-electric-ge-q3-2022-earnings-call-transcript
|
Tags: Anders Angell-Olsen Brent Horwitz Color Line cruiseferry Germany Iridium Certus Kiel Norway omni-directional LTE antennas Oslo Speedcast tracking LTE antennas VSAT
|
not-forward
|
spacewatch.global
|
https://spacewatch.global/2019/07/speedcast-wins-contract-for-fully-managed-communications-with-color-line
|
Nearly two years later, SoftBank gave up on its investment but not without a series of missteps by Wag first. As CNN Business reported in September 2019, Wag went through multiple rounds of layoffs, endured management changes, and failed to get its anticipated global expansion off the ground. Former employees told CNN Business that its then-CEO Hilary Schneider, a veteran tech executive who was tapped as CEO around the time of the SoftBank investment, had yet to get a handle on fundamental issues facing the business, including pet safety, customer service, and growth.
|
not-forward
|
localnews8.com
|
https://localnews8.com/news/2022/02/03/wag-a-dog-walking-startup-that-once-raised-300-million-from-a-single-investor-is-going-public-through-a-spac/
|
Canadian pot stocks appear to be in for a particularly rough day today. As proof, shares of Aurora Cannabis ( ACB 4.59% ), Canopy Growth Corporation ( CGC 10.79% ), and Cronos Group ( CRON 1.37% ) all fell by at least 10% in pre-market trading this morning. What's the driving force behind this latest widespread sell-off in the cannabis space?
|
not-forward
|
www.fool.com
|
https://www.fool.com/investing/2018/12/06/why-aurora-cannabis-canopy-growth-corp-and-cronos.aspx?source=iedfolrf0000001
|
Invitation Homes Inc. ( INVH ), which owns more than 80,000 single-family houses, and American Homes 4 Rent ( AMH ), which has nearly 53,000, announced record occupancy and rents this week, the Wall Street Journal reports.
|
not-forward
|
finance.yahoo.com
|
https://finance.yahoo.com/news/reit-etfs-capitalize-increasing-number-195503658.html
|
In the latest trading session, Raytheon Technologies (RTX) closed at $88.54, marking a +1.49% move from the previous day. This move lagged the S&P 500's daily gain of 2.37%. Meanwhile, the Dow gained 2.47%, and the Nasdaq, a tech-heavy index, lost 0.07%. Coming into today, shares of the an aerospace and defense company had gained 4.54% in the past month. In that same time, the Aerospace sector gained 0.84%, while the S&P 500 lost 4.82%.
|
not-forward
|
au.news.yahoo.com
|
https://au.news.yahoo.com/raytheon-technologies-rtx-gains-lags-214509056.html
|
Flipkart has officially stepped into the travel bookings space. Flipkart today said that it had tied up with MakeMyTrip to offer travel bookings on its platform. Flipkart will use all of MakeMyTrip's many properties — MakeMyTrip, Ibibo, and Redbus — to offer travel solutions to its customers. In return, MakeMyTrip will get access to Flipkart's 100 million plus strong customer base. Flipkart will begin offering domestic flight tickets in the next few weeks, while other travel options will be added in the coming months. "Flipkart and MakeMyTrip have played a defining role in shaping the consumer internet ecosystem in India and bringing millions of people online," said Flipkart CEO Kalyan Krishnamurthy.
|
forward
|
officechai.com
|
https://officechai.com/miscellaneous/flipkart-ties-makemytrip-offer-travel-bookings-platform
|
Gentleman. I can confirm that Melrose informed both my Department and the Ministry of Defence of the proposals to close the site on 1 April. Since then, there have been ongoing discussions between GKN and the Government on how best to support workers. He asked whether any alternatives to closing the site had been discussed. I am sure he will appreciate that this was a commercial decision for the company, but in our conversations GKN has said that it is at an early stage in the process. It has confirmed that it will do all it can to support the 172 affected employees, including providing help in seeking alternative employment both within and outside GKN.
|
forward
|
hansard.parliament.uk
|
https://hansard.parliament.uk/commons/2019-04-24/debates/d570b94f-83ce-4ed5-9204-192beda24bbf/details"
|
Stocks likely to be in focus later include chipmaker Broadcom (NASDAQ: AVGO ) and cloud services provider VMware (NYSE: VMW ), which reportedly may announce a merger agreement as early as this morning. Zoom Video heads a thin earnings roster after the close.
|
forward
|
au.investing.com
|
https://au.investing.com/news/economy/biden-taiwan-gaffe-lagarde-flags-hikes-broadcomvmware--whats-moving-markets-2574653
|
BlackBerry Ltd. (NASDAQ: BBRY ), formerly Research in Motion Ltd. (NASDAQ: RIMM ), revamped its company name and its version of the smartphone when it announced the launch of BlackBerry 10 last week, an operating system compatible for touch-screen smartphones. As the company has suffered mightily in the mobile device space over the last several years – just about since the iPhone was introduced in 2007 – this seems to be the last stand for the company, if all of the buzz and marketing work by the company is any indication.
|
not-forward
|
www.insidermonkey.com
|
http://www.insidermonkey.com/blog/blackberry-ltd-bbry-spikes-on-promising-bb10-talk-from-uk-54308
|
"These strategic investments evidence our commitment to our customers to co-create emerging technologies and help ensure we are in position to deliver long-term value to our shareholders," said Thomas Sonderman, president and CEO of SkyWater. "We believe our investment in GaN technologies – which expand possibilities for next generation microelectronics – enhances SkyWater's position for leadership in the aerospace and defense, industrial and automotive markets. As recently noted in the White House 100 Day Supply Chain Review, there is a significant need for a U.S.-based foundry to offer technology services for GaN. We firmly believe SkyWater is that foundry."
|
forward
|
apnews.com
|
https://apnews.com/press-release/BusinessWire/technology-business-health-coronavirus-pandemic-94be24aeef354b29a79ba787bd416744
|
San Antonio, Texas — According to state and local economic development sources Wells Fargo plans to invest $866,000.00 to build out 21,310 square feet of new space in San Antonio. The company plans to occupy the new space at 4101 Wiseman Blvd, Bldg 108 in San Antonio, on or about November 1, 2020. According to the company website Wells Fargo & Company is a diversified, community-based financial services company with $1.9 trillion in assets. Wells Fargo's vision is to satisfy our customers' financial needs and help them succeed financially. Founded in 1852 and headquartered in San Francisco, Wells Fargo provides banking, investment and mortgage products and services, as well as consumer and commercial finance, through 8,050 locations, 13,000 ATMs, the internet and mobile banking, and has offices in 38 countries and territories to support customers who conduct business in the global economy. With approximately 265,000 team members, Wells Fargo serves one in three households in the United States.
|
forward
|
www.intelligence360.news
|
https://www.intelligence360.news/wells-fargo-to-spend-866000-00-to-occupy-21310-square-feet-of-space-in-san-antonio-texas
|
Early last year, Deere & Company issued requests for proposals to several aerospace companies. While the full details of the project are being kept under wraps, it appears that the company wants to offer better connectivity for its farm equipment by deploying a satellite-based communications network.
|
forward
|
www.thomasnet.com
|
https://www.thomasnet.com/insights/john-deere-company-story
|
Skechers (NYSE: SKX) is a $4.16 billion performance and lifestyle footwear company. On the brick-and-mortar side, it sells through department, specialty, and independent stores, as well as more than 2,650 of its own retail outlets. Talk Business & Politics reached out to the Manhattan Beach, Calif.-based company for information on the number of employees and a hard opening date. Skechers Public Relations Director Lara Diab could not provide jobs numbers but said the store would officially open Sept. 21.
|
forward
|
talkbusiness.net
|
https://talkbusiness.net/2018/07/skechers-to-open-this-september-in-fort-smith-pavilion-two-stores-coming-available
|
A SPAC is typically a shell company created for the purpose of acquiring a private company (the de-SPAC transaction) within a certain timeframe (typically 18-24 months). A SPAC is organized and managed by a sponsor investor and typically conducts a firm commitment underwritten IPO of redeemable shares and warrants. Following the IPO, the SPAC usually places most or all of the proceeds in a trust or escrow account to fund the de-SPAC transaction, and the SPAC's shares and warrants are registered and begin trading on a national securities exchange.
|
not-forward
|
www.mondaq.com
|
https://www.mondaq.com/unitedstates/shareholders/1182250/sec-releases-proposal-to-enhance-disclosures-for-spacs-and-de-spac-transactions
|
"The completion of the Amended AMA with Front Yard in May 2019 was a significant achievement for AAMC, as it created a base management fee floor for AAMC with the potential for fees to increase as Front Yard's performance improves and provided important termination fee protection for AAMC that had not existed under the former asset management agreement," stated George Ellison, Chief Executive Officer. "We managed the internalization of Front Yard's property management platform ahead of schedule without impact to its residents.
|
not-forward
|
www.benzinga.com
|
https://www.benzinga.com/pressreleases/19/08/g14217944/altisource-asset-management-corporation-reports-second-quarter-2019-results
|
The Offering was co-led by Canaccord Genuity Corp. and GMP Securities L.P., on behalf of a syndicate of underwriters including Beacon Securities Limited and Dundee Securities Ltd. (the "Underwriters"). GreenSpace and the Central Roast vendors have also entered into a mandatory secured agreement to acquire the remaining 30% shares of Central Roast with closing to occur 13 months from the date hereof. Each Unit consists of one common share in the capital of GreenSpace ("Common Share") and one-half of one common share purchase warrant ("Warrant"), with each whole Warrant entitling the holder to purchase one Common Share at a price of $1.20 per share until February 25, 2019. GreenSpace has received conditional approval from the TSX Venture Exchange (the "TSXV") to list the Common Shares and the Warrants on the TSXV. The Warrants will commence trading on the TSXV on Monday, February 29, 2015 under the symbol "JTR.WT".
|
forward
|
www.newswire.ca
|
https://www.newswire.ca/news-releases/greenspace-brands-announces-closing-of-public-offering-over-allotment-option-and-acquisition-570174771.html
|
Schmitt said Brocade has upgraded its Tapestry StorageX 5.8 namespace software with more namespace scalability; improved namespace policies; replication reporting; and greater data movement speed.
|
not-forward
|
www.enterprisestorageforum.com
|
https://www.enterprisestorageforum.com/networking/brocade-bulks-up"
|
While we all know that home improvement giant Home Depot (HD) is a great place to buy hammers and saws and lumber and such, we often do not consider the value of its advertising space. But Home Depot has, via its Orange Apron Media network. And Home Depot is shaking up the way it presents advertiser value, by not looking so much at ROAS—Return on Ad Spend—so much as ROMO. That shift is causing a shakeup in the landscape, and shareholders are skeptical about the impact. Home Depot shares are down fractionally in Tuesday afternoon's trading.
|
not-forward
|
markets.businessinsider.com
|
https://markets.businessinsider.com/news/stocks/from-roas-to-romo-home-depot-stock-nyse-hd-slips-with-new-advertising-focus-1035079772
|
Belviq will become the second obesity bet to be launched in the market within a year. VIVUS, Inc. (NASDAQ : VVUS ) 's Qsymia is already available through mail order and specialty pharmacies. The only key player still waiting for an FDA approval is Orexigen Therapeutics, Inc. (NASDAQ : OREX ) with its candidate Contrave.
|
forward
|
www.insidermonkey.com
|
https://www.insidermonkey.com/blog/arena-pharmaceuticals-inc-arna-vivus-inc-vvus-why-this-obesity-drug-is-the-sectors-best-bet-149599
|
Nurtec also competes with a second AbbVie drug, newly launched Qulipta, in the preventive space for episodic migraine. AbbVie rolled out a DTC campaign for that drug in February with a TV spot repeating the tagline: "Qulipta can help prevent migraine attacks."
|
not-forward
|
www.fiercepharma.com
|
https://www.fiercepharma.com/marketing/abbvie-puts-u-center-latest-ubrelvy-ad-tennis-star-serena-williams
|
DFDS operates two combined freight and passenger ferries (RoPax) on Karlshamn-Klaipeda and four other ferries on Baltic Sea routes connecting Germany and Sweden, Sweden and Estonia, and Denmark and Lithuania. Contact Torben Carlsen, CEO +45 33 42 32 01 Karen Boesen, CFO +45 20 58 58 40 Søren Brøndholt Nielsen, IR +45 33 42 33 59 Dennis Kjærsgaard, Media +45 42 30 38 47 About DFDS We operate a transport network in and around Europe with an annual revenue of DKK 30bn and 16,500 full-time employees. We move goods in trailers by ferry, road & rail, and we offer complementary and related transport and logistics solutions. We also move car and foot passengers on short sea and overnight ferry routes. DFDS was founded in 1866 and headquartered and listed in Copenhagen. This information is subject to the disclosure requirements pursuant to Section 5-12 the Norwegian Securities Trading Act Attachment MENAFN26082025004107003653ID1109976988
|
not-forward
|
menafn.com
|
https://menafn.com/1109976988/DFDS-ENTERS-BALTIC-SEA-SPACE-CHARTER-AGREEMENT
|
In the UK, the developers of the world's largest offshore wind farm, Dogger Bank, plan to build a new Operations and Maintenance (O&M) Base at the Port of Tyne. Equinor and SSE Renewables, the two companies behind the Dogger Bank development, announced the new multi-million pound facility, which includes both office space and a warehouse and which will be the onshore base for Equinor's teams ensuring the efficient operation of the wind farm. The Dogger Bank Wind Farm is estimated to trigger a total capital investment of around £9 billion between 2020 and 2026 and will be able to generate around 5% of the UK's electricity needs, according to Equinor.
|
forward
|
ogv.energy
|
https://ogv.energy/news-item/european-energy-review-june-2020
|
In a landmark development for India's defense sector, French aerospace giant Dassault Aviation has announced plans to establish a production facility for Rafale fighter jet fuselages in India, alongside Maintenance, Repair, and Overhaul (MRO) facilities for the aircraft's engines, sensors, and weapons. This initiative, formalized as part of a €7 billion deal signed on April 28, 2025, for 26 Rafale-Marine fighters for the Indian Navy, marks a significant step toward India's vision of self-reliance under the "Make in India" initiative.
|
forward
|
idrw.org
|
https://idrw.org/dassault-to-set-up-rafale-fuselage-production-and-mro-facilities-in-india
|
Technology Filtronic announces £6.4m order with Elon Musk's SpaceX The US rocket and satellite company has an option to take a stake in the North East and Yorkshire-based innovator
|
not-forward
|
www.business-live.co.uk
|
https://www.business-live.co.uk/technology/cornwall-tech-firm-forecasts-sales-21791653
|
DeNA Ushers in Next Revolution of Core Mobile Games with First-person Shooter The Drowning™ SAN FRANCISCO – December 6, 2012 – DeNA Co., Ltd. (TSE: 2432) today announced the development of The Drowning, a high-intensity, console-quality, first-person-shooter (FPS) game custom built for mobile devices. The Drowning is the first game developed by Scattered Entertainment, a DeNA studio in Stockholm, Sweden. Set in an immersive 3D world and featuring a grim, suspenseful storyline, The Drowning is a free-to-play game that will be published on iOS devices in early 2013. "We've been at the forefront of innovation in free-to-play mobile games since the beginning, and we're changing the definition of the space once again with The Drowning," said Clive Downie, CEO at DeNA's U.S. subsidiary ngmoco, LLC. "We can't wait to give players a quality, hardcore FPS experience for their mobile devices."
|
forward
|
www.engadget.com
|
https://www.engadget.com/2012/12/08/the-drowning-headed-to-ios-for-free-next-year
|
Overall, this provides a superior experience for customers." Not only with the Department of Transportation help states build half a million EV charging stations by 2030, the White House also convinced Tesla to share a portion of its existing Supercharger network with non-Tesla EVs. On Thursday, Ford became the first automaker to formalize that pact with Tesla, announcing during a Twitter Spaces event that "Ford electric vehicle customers access to more than 12,000 Tesla Superchargers across the U.S. and Canada," starting in Spring 2024, per the company release.
|
forward
|
au.news.yahoo.com
|
https://au.news.yahoo.com/ford-ev-drivers-will-get-access-to-12000-north-american-tesla-superchargers-next-spring-221752191.html
|
Get started and learn more from our Developer Relations team and engineers at o ur blog space. These Terraform Providers can be found alongside our other supported open-source automation tools available and acce ssible here. Also available on the Terraform registry at Terraform Registry Dell Technologies | Terraform Registry. ( 1 ) Gartner – Predicts 2023 Collaborate, Automate and Orchestrate to Optimize Costs and Value During the Economic Crisis, November 1, 2022 ( 2 ) Pearl Zhu, a uthor, The Digital Master
|
not-forward
|
www.storagenewsletter.com
|
https://www.storagenewsletter.com/2023/03/14/accelerate-platform-operations-with-hashicorp-terraform-and-dell-storage
|
Commercial capabilities are also set to come online next year, Mark Stevenson, chief operating officer at Thermo Fisher, said over email. RELATED: The top 10 global R&D institutes | 6. University of California, San Francisco The site will be built on leased space from UCSF. Thermo Fisher didn't say how much it paid for the lease, and while it does plan to staff the site with new recruits, it's too early to say how many, Stevenson said.
|
forward
|
www.fiercepharma.com
|
https://www.fiercepharma.com/manufacturing/thermo-fisher-links-up-uc-san-francisco-cell-therapy-factory-and-collaboration-center
|
LONDON -- I strongly believe that shares in Associated British Foods should continue their relentless march higher, as the company's products offer the perfect panacea for customers looking for bargains in challenging financial times. With the Bank of England warning this week that inflation is likely to remain above its 2% target until 2016, reduced spending power should keep demand for ABF's suite of budget goods firmly on the burner. Primark powering higher ABF's interims released last month showed group revenues up 10% during the 16 weeks to Jan. 5, fueled by the group's Primark budget clothes chain where turnover leapt by a quarter. Excellent like-for-like sales growth, a chunky rise in new retail space, and better sales densities within new, larger stores all helped to drive revenue skyward.
|
forward
|
www.aol.com
|
https://www.aol.com/2013/02/15/is-associated-british-foods-a-buy
|
For some wells, the spacer was also foamed to increase the sweeping efficiency, reducing hydrostatic pressure and assisting successful placement of foamed lead and conventional tail slurry. On inner-string cementing jobs, a drill pipe dart was released and latched into the float shoe to help address cement slurry residue/contamination on the walls of the drill pipe. In total, Halliburton batch-set 23 wells by mixing and pumping 96,000 sacks of cement in an offshore environment of over 8,500-ft water depth. In all, this was a very successful cementing operation with zero NPT related to the cementing operations. Permanent Monitoring and Chemical Injection Halliburton WellDynamics has supplied Shell with permanent monitoring and chemical injection systems for their subsea installations since the mid-1990s. Due to the reliability and success of these previous installations, Halliburton won the contract to supply the permanent monitoring and chemical injection systems for the Perdido project.
|
not-forward
|
www.ogj.com
|
http://www.ogj.com/articles/shell/perdido/2010/04/halliburton-providing-life-of-field-solutions-for-shell-perdido.html
|
But Tanger management insists that, on the whole, its outlet centers are continuing to perform well, with relatively consistent traffic and strong sales by the vast majority of its tenants. As it recaptures the square footage related to bankruptcies and brandwide restructurings, it should have little trouble filling that space with other tenants who recognize that outlets -- as CEO Steven Tanger reminded investors earlier this year -- "remain an important and profitable channel of distribution for retailers and manufacturers."
|
forward
|
www.fool.com
|
https://www.fool.com/investing/2018/05/08/3-top-retail-stocks-to-buy-in-may.aspx
|
Now headquartered at the Waterfront Corporate Center in Hoboken, the 30-year-old company – whose brands include Celestial Seasonings tea, Garden of Eatin' snacks and Terra chips – just kicked off a multiyear transformation strategy aimed at driving long-term sustainable growth. Unveiled at its Investors Day event in September, the plan includes several steps to simplify business, reset global operations and invest in jumpstarting capabilities around brand building, channel expansion and innovation. Once a leader in the better-for-you-space, Hain is increasingly facing competition from larger companies, as well as headwinds like inflation and supply chain issues.
|
forward
|
njbiz.com
|
https://njbiz.com/presenting-the-2023-companies-to-watch-slideshow
|
This will include Sephora's prominent position at the store front, with expanded categories in surrounding areas. The initial small-store formats mentioned above will be the first to test Sephora at Kohl's in a smaller space. Moving on, Kohl's stated that it is introducing dedicated zones in its stores for discovery, which will enable the curation of cross-category products and brands, such as diverse-and female-owned companies. The company has also been focused on offering an integrated store and digital experience for which it has been making several technological investments. Kohl's is rolling out self-serve buy online, pick up in store, which will be available across all stores by the end of the year. Further, the company continues to test self-serve returns, presently available in more than 100 stores, with growth plans over the next 18 months.
|
forward
|
www.zacks.com
|
https://www.zacks.com/stock/news/1929737/kohls-kss-focuses-on-store-enhancement-things-worth-noting
|
Filo shareholders will be able to elect to receive the consideration as either (i) CAD 33.00 in cash per Filo Share or (ii) 2.3578 Lundin Mining shares per Filo Share, or some combination of cash and shares, subject to proration. The total cash consideration will be subject to maximum cash consideration of approximately CAD 2,767 million (representing 68.2% of the aggregate total consideration). The total share consideration will be subject to maximum share consideration of 92.1 million Lundin Mining Shares (representing 31.8% of the aggregate total consideration). As part of the acquisition, BHP Investments Canada Inc. and Lundin Mining have agreed to jointly acquire the two copper deposits Filo del Sol and Josemaria located in the same San Juan province of Argentina as Los Azules. Shareholders that do not make an election will be deemed to have elected to receive cash consideration.
|
forward
|
www.marketscreener.com
|
https://www.marketscreener.com/quote/stock/FILO-CORP-32104248/news/BHP-Investments-Canada-Inc-and-Lundin-Mining-Corporation-completed-the-acquisition-of-remaining-93-48775941
|
Terran Orbital Corporation, a global leader in satellite solutions, primarily serving the United States and Allied aerospace and defense industries, has announced the successful completion of CAPSTONE's first TCM burn (TCM-1). As the first statistical maneuver of the mission, TCM-1 is designed to clean up expected dispersions from the launch vehicle injection – enabling CAPSTONE to continue its pathfinding lunar journey in support of NASA's Artemis program.
|
not-forward
|
www.satelliteevolution.com
|
https://www.satelliteevolution.com/post/terran-orbital-successfully-completes-capstone-s-first-tcm-burn
|
Leading U.S. food delivery service DoorDash is expanding its selection of cosmetics, a lightweight, high-cost category that racks-up large order values while taking up minimal space in drivers' cars.
|
forward
|
www.pymnts.com
|
https://www.pymnts.com/news/delivery/2022/aggregators-step-up-efforts-to-offer-everything-on-demand
|
CEO Larry Ellison has repeatedly highlighted Oracle's partnerships with AI companies during recent earnings calls, positioning the company as an essential provider of the computing power necessary for AI development. These strategic moves have resonated with investors looking for established companies that might benefit from the AI boom.
|
not-forward
|
www.selfemployed.com
|
https://www.selfemployed.com/news/oracle-stock-surges-on-ai-demand-echoing-dot-com-era
|
NEW YORK, Aug. 1, 2012 /PRNewswire/ -- JetBlue Airways (Nasdaq: JBLU ) today announces the reconfiguration of its Embraer E190 fleet to offer customers two more rows of its coveted Even More Space seats. For a small additional fee, sixteen seats in rows 1, 12, 13 and 14 offer extra legroom and are now available on all of the airline's 100-seat E190 aircraft. Rows 1 and 12 offer 38 inches of legroom while rows 13 and 14 offer 39 inches in addition to bonus Even More services including early boarding, early access to overhead bin space and Even More Speed expedited security at select airports.
|
not-forward
|
www.prnewswire.com
|
http://www.prnewswire.com/news-releases/jetblue-airways-reconfigures-embraer-e190-fleet-to-offer-even-more-of-its-popular-even-more-space-seats-164591246.html
|
The dunce cap There were plenty of reasons to give Bill Cobb a longevity gaffe award long before last week. Over the past decade or so, his company has allowed Intuit Inc. (NASDAQ: INTU ) to completely steal the show when it comes to tax preparation software. According to COMSCORE, Inc. (NASDAQ:SCOR), TurboTax accounted for 59.8% of all DIY tax preparation last year with H&R Block, Inc. (NYSE:HRB)'s 14.7% market share even coming in behind Blucora Inc (NASDAQ: BCOR ) 's (formerly InfoSpace) TaxAct, which notched 17.7% of all DIY tax-prep market share. H&R Block lingered too long onto its bricks-and-mortar locations which still act as a drag on its operational performance.
|
not-forward
|
www.insidermonkey.com
|
https://www.insidermonkey.com/blog/ceo-gaffe-of-the-week-hr-block-inc-hrb-intuit-inc-intu-blucora-inc-bcor-88367
|
Renault Espace I (1984-1990): Europe's MPV pioneer Audi A5 Avant, test drive of the 204-bhp diesel hybrid wagon Renault is already working on the new Espace (electric) Hopper: E-bike with bodywork now available to order from 11,900 euros 2024 Renault Espace debuts as seven-seat SUV replacement of iconic MPV Opel Kadett E driving report: 40 years after launch Renault Espace spied looking weird with extended wheel arches
|
forward
|
uk.motor1.com
|
https://uk.motor1.com/news/652408/2024-renault-espace-suv-teasers
|
FCs are also flexible enough that they can be used as the token issuers to facilitate Initial Coin Offerings (" ICOs "), Security Token Offerings (" STOs ") and Initial Exchange Offerings (" IEOs "). An FC can be moulded to fit the specific needs and circumstances of each issuance. FCs are seen as popular vehicles for token issuers in light of ICOs traditionally being Swiss foundations.
|
not-forward
|
www.mondaq.com
|
https://www.mondaq.com/caymanislands/CorporateCommercial-Law/811904/Foundation-Companies-The-Future-Of-FinTech
|
For investors looking for a way to play a competitor to UnitedHealth's Optum division, this is the way I'd go. Cigna remains a key profitable player in this space that's worth considering for long-term growth, for those who believe the healthcare industry will look much the same as it does now a few years down the line.
|
forward
|
247wallst.com
|
https://247wallst.com/investing/2025/05/16/unitedhealth-is-imploding-3-stocks-that-could-eat-its-lunch
|
As per the merger agreement, the share swap deal has been fixed at a ratio of 73 shares of LTI for every 100 shares of Mindtree. The record date to identify eligible shareholders is November 24, 2022.
|
forward
|
www.moneycontrol.com
|
https://www.moneycontrol.com/news/business/stocks/lti-mindtree-unlikely-to-make-it-to-nifty50-in-march-2023-review-9528151.html
|
It wasn't until the late 1960s that the interest in electric cars saw a revival due to environmental issues and adverse impacts of greenhouse gas emission associated with modern day's gas guzzlers. One of the major turnarounds for electric cars was the energy crises in the 1970s that continued for a decade due to political volatilities in Arab countries and the Iranian revolution. It was then that the most popular electric car model – CitiCar – was developed and marketed by Fla.-based Sebring-Vanguard, Inc. Other prototypes of electric cars – Electrovair and Electrovette – were being developed by General Motors Company (GM- Free Report) but failed to hit the road. Overall, these developments were short lived and failed to make an impression in the commercial space due to several associated drawbacks, the major being high expenses.
|
not-forward
|
finance.yahoo.com
|
http://finance.yahoo.com/news/zacks-analyst-blog-highlights-general-112813244.html?soc_src=mediacontentstory
|
A registration statement on Form S-1 relating to these securities was declared effective by the Securities and Exchange Commission on September 9, 2021. This offering is being made only by means of a prospectus. Copies of the final prospectus relating to the offering may be obtained, when available, from Morgan Stanley & Co. LLC, Attention: Prospectus Department, 180 Varick Street, 2nd Floor, New York, NY 10014 or Goldman Sachs & Co. LLC, Attention: Prospectus Department, 200 West Street, New York, New York 10282 or by telephone: 1-866-471-2526. This press release does not constitute an offer to sell or the solicitation of an offer to buy these securities, nor shall there be any sale of these securities in any state or jurisdiction in which such offer, solicitation or sale would be unlawful prior to registration or qualification under the securities laws of any such state or jurisdiction. About McAfee McAfee is a global leader in online protection.
|
not-forward
|
apnews.com
|
https://apnews.com/press-release/BusinessWire/business-morgan-stanley-b43ea9e8c4714a09aa344e503b99502a
|
Kimco Realty Corp. New Hyde Park, N.Y. In Philadelphia, Kimco's redevelopment of the Cottman & Bustleton Center, a 332,583-sq.-ft. grocery-anchored site, was completed in 2009. The site, which is 98% leased, features a 137,000-sq.-ft. Target, a 67,000-sq.-ft. Pathmark and 21,000 sq. ft. each for Pep Boys and PetSmart. With community support, Kimco removed an outdated multiplex movie theater and in-line retail to accommodate Target. The success of this urban redevelopment involved cooperation from both PetSmart and Pep Boys, who allowed Kimco to move them within the site as Kimco worked around space constraints to accommodate the Target store.
|
not-forward
|
chainstoreage.com
|
https://chainstoreage.com/real-estate/focus-americas-top-redevelopers-0
|
MindMed is a leader in the biotech space. The company is hard at work developing psychedelic-derived therapies to improve the human condition. MindMed's 18-MC clinical trial centered on the testing of a non-hallucinogenic drug that is a proprietary derivative of ibogaine. Ibogaine has been analyzed and uses as a treatment modality for opioid addiction in the past. The industry's top scientists insist ibogaine has promise yet there are some concerns regarding whether it is completely safe for human use.
|
not-forward
|
thedalesreport.com
|
https://thedalesreport.com/psychedelics/mindmed-finishes-18-mc-phase-1-clinical-trial
|
Overview: China Resources Mixc Lifestyle Services Limited is an investment holding company offering property management and commercial operational services in the People's Republic of China, with a market cap of HK$64.94 billion.
|
not-forward
|
simplywall.st
|
https://simplywall.st/stocks/cn/tech/szse-300115/shenzhen-everwin-precision-technology-shares/news/3-stocks-estimated-to-be-up-to-471-below-intrinsic-value
|
Norwegian Cruise Line's short-cruise ship sailing from Miami, the Norwegian Sky, has returned from a three-week drydock with new venues, updated spaces and redesigned staterooms and corridors.
|
not-forward
|
www.travelweekly.com
|
https://www.travelweekly.com/Cruise-Travel/Renovated-Norwegian-Sky-emerges-from-drydock
|
In the fiscal third quarter, HD witnessed big-ticket strength across many Pro-heavy categories like fasteners, pipe and fittings, and gypsum. The company remains on track with its investments to build a Pro ecosystem that includes professional-grade products, exclusive brands, enhanced delivery, credit, digital capabilities, field sales support and HD rental. The company continues to invest in Pro capabilities like enhanced fulfillment, more personalized online experience, and other business management tools to drive deeper engagement with Pro customers. The company is impressed with the momentum in its pro extra loyalty program. The company remains on track with the building of a unique, interconnected pro ecosystem and expects this to increase its ability to expand its share in a $450-billion addressable pro space. Home Depot's guidance for fiscal 2022 is impressive. HD anticipates year-over-year sales and comps growth of 3% for fiscal 2022.
|
forward
|
au.news.yahoo.com
|
https://au.news.yahoo.com/heres-keeps-home-depot-hd-140802809.html
|
Lockheed Martin's combat system approach focuses on an open systems architecture that leverages commercial technology proven on the U.S. Navy's Virginia, Seawolf and Los Angeles class submarines. Lockheed Martin's proven open architecture approach enables navies to easily upgrade systems with new commercial technology and capabilities for enhanced performance and greatly reduced cost over the life of the platform.
|
not-forward
|
www.militaryaerospace.com
|
https://www.militaryaerospace.com/home/article/16722449/spain-picks-lockheed-martin-to-develop-submarine-combat-system
|
BlackSky, a subsidiary of Seattle's Spaceflight Industries, has a similar purpose in mind for Global-1. Once it's up and running, the satellite should be capable of sending down on-demand multispectral images for near-real-time applications. BlackSky already has its prototype Pathfinder-1 satellite in orbit, but Global-1 should provide imagery with 1-meter as opposed to 2-meter resolution with quicker response time.
|
forward
|
www.geekwire.com
|
https://www.geekwire.com/2018/indias-pslv-rocket-launches-blackskys-global-1-satellite-plus-30-satellites
|
Invasion draws hype If hype dictates success, Tesco is already a hit. Earlier this week, news broke that Tesco secretly opened its first Fresh & Easy store in the remote Southern California community of Hemet. That caused a flurry of stories from bloggers and British publications reporting on Tesco's U.S. invasion. The Hemet grocery store was brimming with activity last week as local residents stopped in to size up the new store, which featured reserved spaces for hybrid cars, self-serve checkout lanes and a food sampling kiosk. "I picked up stuff you wouldn't typically find in self-serve stores, like Gruyere cheese," said shopper Jim Smith, 63. Orange County shoppers and businesses also have been waiting anxiously for Tesco's arrival. "I'm telling you, we've been trying (to talk to Tesco) since January, but they've limited who they talk with," said Yair Crane, an Orange-based avocado packer.
|
not-forward
|
www.ocregister.com
|
http://www.ocregister.com/articles/tesco-12670-fresh-easy.html?pic=1
|
PayPal was a huge enabler for the online auction site eBay, and later in 2002, the company acquired it for $1.5 billion in stock. Musk, PayPal's largest shareholder, took home around $180 million from the deal.
|
not-forward
|
insideevs.com
|
https://insideevs.com/news/341975/before-tesla-spacex-elon-musk-was-a-serial-entreprenuer
|
However, the debut of SharePlay indicates that Zillow does recognize the fundamentally social nature of looking at real estate. And in that context, it's interesting to contemplate where SharePlay might take Zillow; millions of people already use platforms such as Twitch to live stream and play video games in a social context, and its conceivable that something broadly analogous could eventually emerge in the real estate space.
|
forward
|
www.inman.com
|
https://www.inman.com/2021/12/21/zillow-debuts-collaborative-shareplay-search-feature
|
"This choice has led to the reclassification of almost all of its range of Article 9 funds into Article 8." It added the decision was based on a deliberately cautious approach to protect investors and distributors from a significant risk of confusion. Amundi follows BlackRock, UBS Asset Management, Invesco and HSBC Asset Management in downgrading their Paris-Aligned Benchmark (PAB) and Climate Transition Benchmark funds earlier in November.
|
not-forward
|
investment-international.com
|
https://investment-international.com/News/amundi-downgrades-raft-of-esg-funds
|
For demultiplexing, we employed scTagger 26, which uses a direct matching approach for barcodes. We matched Visium dataset tissue barcodes from the 10X Space Ranger output to the long reads, allowing for up to two mismatches as per scTagger's default string edit distance values. To extract the UMI region of the read, we identified the Illumina Adapter Read1 (CTACACGACGCTCTTCCGATCT) sequence as an anchor. We conducted two scTagger runs: one to extract the first 16 bp after the adapter match for barcode matching, and another to extract 28 bp after the match, considering the last 12 bases as UMIs for subsequent UMI correction. The detected barcodes and extracted UMI regions were tabulated, and unprocessed reads were used in downstream correction pipeline steps. To correct amplification errors, we utilized directional UMI clustering with the UMI-Tools suite.
|
not-forward
|
www.nature.com
|
https://www.nature.com/articles/s41467-023-43201-6/?fromPaywallRec=true
|
DexCom may not be the only kid on the block in the diabetes care space, but it is among the most prominent, and multiple companies can win here. One of its biggest competitors is Abbott, known for its FreeStyle Libre CGMs. DexCom still serves the largest share of the Type 1 diabetic population in the U.S., while its rival maintains the leading footprint in the Type 2 diabetes market.
|
not-forward
|
www.fool.com
|
https://www.fool.com/investing/2024/02/03/2-phenomenal-stocks-to-buy-for-the-new-year
|
With analysts now setting targets as high as $500, Carvana's second-quarter results have reignited bullish sentiment, positioning the company as one of the most compelling recovery stories in the large-cap growth space.
|
forward
|
finbold.com
|
https://finbold.com/carvana-stock-hits-new-all-time-high-as-analysts-boost-cvna-price-target
|
The driving factor is the clout DraftKings has in the betting industry. Just look at New Jersey, where they dominate the space and over 80% of wagers are placed on a mobile device. Pivot to the midwest where Indiana, Iowa, Michigan, and Illinois (which in my opinion will become the future gambling mecca of the US) are all slowly starting to get sports betting up and running. Oscars betting will go as far as DraftKings' reach, which in this case appears to be unlimited.
|
forward
|
www.playusa.com
|
https://www.playusa.com/news/oscar-betting-cinema-expert
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.