PMCID
string
Title
string
Sentences
string
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The ODC inhibitor, DFMO, was obtained from P. Woster.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
DFMO was dissolved in drinking water and supplied to mice ad libitum at a dose of 1% in the drinking water.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Survival end point: only Th-MYCN mice were randomized.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
DFMO was provided to mothers on day 1 (partially transmitted to pups in breastmilk) and then directly to pups at day 28 of life, post-weaning; diet change was started at day 21 of life, per treatment assignment.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Mice were weighed and assessed for tumour growth and symptoms, at least thrice weekly by a single experienced animal technician.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Mice were euthanized at pre-defined humane endpoints related to overall health or tumour burden (hunching, immobility, hindlimb paresis, weight loss or respiratory distress).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
An additional ‘late start’ trial was done with Th-MYCN mice enrolled at the time of a palpable progressing abdominal tumour (typically day of life 35–50), randomized to diet and/or DFMO as above, and taken down for tumour mass after 14 days of therapy, sooner if humane endpoints were reached.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
For metabolomics studies.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Th-MYCN mice were treated as above, serum was obtained at day 43 (±2 days) and tumours and organs were collected at that time if tumour was present or delayed to the earliest time tumour became palpable.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Time to tumour collection depended on the treatment group.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
In order to ensure homogenous timing of metabolic tumour collection, Th-MYCN mice ProArg-free diet plus DFMO had therapy delayed to day 28.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Mice bearing established IMR5 xenografts at ≥200 mm were randomized to diets and/or DFMO as above.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Mice were weighed and assessed for tumour volume and symptoms, at least thrice weekly.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
End point: mice were euthanized when tumour volume >2 cm using calipers measurements and assuming an ellipsoid volume.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Polyamine concentrations and amino acids in the single-amino-acid trials (Pro-free and Arg-free) were quantified using the AccQ-Tag fluorescence dye (Waters) as described.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Derivatives were separated on an Acquity BEH C18 column (150 mm×2.1 mm, 1.7 μm, Waters) by reverse phase UPLC (Acquity H-class UPLC system, Acquity FLR detector, Waters).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The column was equilibrated with buffer A (140 mM sodium acetate pH 6.3, 7 mM triethanolamine) at a flow rate of 0.45 ml min and heated at 42 °C.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Pure acetonitrile served as buffer B. The gradient was produced by the following concentration changes: 1 min 8% B, 7 min 9% B, 7.3 min 15% B, 12.2 min 18% B, 13.1 min 41% B, 15.1 min 80% B, hold for 2.2 min, and return to 8% B in 1.7 min.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Chromatograms were recorded and processed with the Empower3 software (Waters).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
For acetylated polyamines a MS/MS method was used.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
In brief, a Waters Acquity I-class Plus UPLC system (Binary Solvent Manager, thermostatic Column Manager and FTN Sample Manager) (Waters) coupled to an QTRAP 6500+ (Sciex) mass spectrometer with electrospray ionization (ESI) source was used.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Data acquisition was performed with Analyst (Sciex), and data quantification was performed with the SciexOS software suite (Sciex).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Chromatography was made on an Acquity HSS T3 column (150 mm × 2.1 mm, 1.7 μm, Waters) kept at 20 °C and a flow rate of 0.3 ml min.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Eluent A consisted of water with 0.1% formic acid and eluent B in acetonitrile with 0.1% formic acid.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Gradient elution consisted in changing %B as follows: 0–1 min 0%; 5 min 20%; 5.5–7.5 min 100%, and 8–10 min 0%.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The ion source settings were as follow: curtain gas: 30 psi; collision gas: low; ion spray: 4,500 V; source temperature: 500 °C; ion source gas 1: 40 (GS1) and ion source gas 2: 50 (GS2).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
All compounds were measured in positive electrospray ion mode.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
To ensure comparability of amino acid levels the signal intensity was scaled based on samples that were in parallel analysed by LC–MS.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
For fate tracing of C-labelled amino acids into polyamines an ice-cold extraction solvent consisting of 0.1 M HCl plus 10 μM Norleucine (internal standard) was added as follows: 45 μl for 5 μl of serum and 300 μl for 20–30 mg of mouse tissue.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
After a 15-min incubation on ice, samples were vortexed and centrifuged at 14,000 rpm for 5 min at 4 °C.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The supernatants were then labelled with the fluorescence dye AccQ-Tag (Waters) according to the manufacturer’s protocol, with a modification for serum samples where the final volume was adjusted to 120 μl instead of 500 μl.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The method used an I-class UPLC system coupled to a QTRAP 6500+ mass spectrometry system (AB SCIEX) with an electrospray ionization (ESI) source.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The derivatives were separated using an Acquity HSS T3 column (100 mm × 2.1 mm, 1.8 µm, Waters) maintained at 40 °C.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The mobile phases were: A, 0.1% formic acid in water; and B, 0.1% formic acid in acetonitrile.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The mass spectrometer was operated in positive-ion mode with an ion spray voltage of 5,500 V, a source temperature of 550 °C, and GS1 and GS2 set at 70.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Data acquisition was performed using Analyst 1.7.2 (AB SCIEX).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Polyamine concentration were compared to AMXT1501 treated Th-MYCN tumours from Gamble et al.. Metabolomics data for 180 cancer cell lines was obtained from Cherkaoui et al.. Associations between metabolite levels in core metabolic pathways and MYCN transcriptional activity were obtained from https://cancer-metabolomics.azurewebsites.net/page2.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Gene-expression profiles of 649 neuroblastoma tumours were obtained from R2 (R2 Genomics Analysis and Visualization Platform; http://r2.amc.nl).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Differential expression analysis between MYCN amplification status was performed using the Bioconductor package limma (v.3.40.6).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Expression profiles of 39 neuroblastoma cell lines were obtained from Gene Expression Omnibus.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Differential analysis was performed using the Bioconductor package limma (v.3.40.6) and by comparing MYCN amplification status provided in the study.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Data from the CCLE was taken from the release from the second quarter of 2021 (21Q2).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Total RNA was isolated from the same extracts that were used to obtain mRNA protected fragments (RPFs) (‘Ribo-seq of Th-MYCN tumours’).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Three volumes of QIAzol (Qiagen, 79306) were added to 80 μl of cell extracts, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
RNA were sent to Genomic Platform (UNIGE) for stranded mRNA libraries preparation.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 10 libraries in 1 pool.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Mouse tumours were mechanically disrupted in liquid nitrogen and homogenized in a lysis buffer (LB, 50 mM Tris, pH 7.4, 100 mM KCl, 1.5 mM MgCl2, 1.0% Triton X-100, 0.5% sodium deoxycholate, 25 U ml Turbo DNase I, 1 mM DTT, 100 μg ml cycloheximide, and protease inhibitors) 3 ml of LB per 1 g of tissue.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
To obtain ribosome footprints 0.12 ml of total extracts containing 300 μg of total RNA were treated with RNAse I (Epicentre) (25 U per mg of total RNA), for 45 min at 20 °C with slow agitation.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
10 ml SUPERaseIn RNase inhibitor was added to stop nuclease digestion.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Monosomes were isolated using S-400 columns.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
For isolation of RPFs, 3 volumes of QIAzol were added to the S-400 eluate, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
RPF libraries were prepared as described.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
In brief, RPFs (25–34 nucleotides) were size-selected by electrophoresis using 15% TBE–Urea polyacrylamide gel electrophoresis (PAGE) and two RNA markers, 25-mer (5′-AUGUACACGGAGUCGAGCACCCGCA-3′) and 34-mer (5′-AUGUACACGGAGUCGAGCACCCGCAACGCGAAUG-3′).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
After dephosphorylation with T4 Polynucleotide Kinase (NEB, M0201S) the adapter Linker-1 (5′-rAppCTGTAGGCACCATCAAT/3ddC/-3′) was ligated to the 3′ end of the RPF using T4 RNA Ligase 2.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Ligated products were purified using 10% TBE–Urea PAGE.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Ribosomal RNA was subtracted using RiboCop rRNA Depletion Kit V2 H/M/R. The adapter Linker-1 was used for priming reverse transcription with the reverse transcription primer Ni-Ni-9 (5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC5CACTCA5TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3′) using ProtoScript II Reverse Transcriptase.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Reverse transcription products were purified using 10% TBE–Urea PAGE.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The cDNA was circularized with CircLigase II ssDNA Ligase.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The final libraries were generated by PCR using forward index primer NI-N-2 (5′-AATGATACGGCGACCACCGAGATCTACAC-3′) and one of the reverse index primers.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Amplified libraries were purified using 8% TBE-PAGE and analysed by Qubit and TapeStation.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 4 libraries in 1 pool.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Fastq files were adaptor stripped using cutadapt with a minimum length of 15 and a quality cut-off of 2 (parameters: -a CTGTAGGCACCATCAAT –minimum-length = 15 –quality-cutoff = 2).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Resulting reads were mapped, using default parameters, with HISAT2, using a GRCm38, release 101 genome and index.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Differential expression analysis was performed using DESeq2, using a GRCm38, release 101 genome and index.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Fastq files were adaptor stripped using cutadapt.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Only trimmed reads were retained, with a minimum length of 15 and a quality cut-off of 2 (parameters: -a CTGTAGGCACCATCAAT – trimmed-only –minimum-length = 15 –quality-cutoff = 2).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Histograms were produced of ribosome footprint lengths and reads were retained if the trimmed size was 28 or 29 nucleotides.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Resulting reads were mapped, using default parameters, with HISAT2 using a GRCm38, release 101 genome and index and were removed if they mapped to rRNA or tRNA according to GRCm38 RepeatMasker definitions from UCSC.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
A full set of transcripts and coding sequence (CDS) sequences for Ensembl release 101 was then established.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Only canonical transcripts (defined by known canonical table, downloaded from UCSC) were retained with their corresponding CDS.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Reads were then mapped to the canonical transcriptome with bowtie2 using default parameters.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The P-site position of each read was predicted by riboWaltz and confirmed by inspection.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Counts were made by aggregating P-sites overlapping with the CDS and P-sites per kilobase million (PPKMs) were then generated through normalizing by CDS length and total counts for the sample.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Differential expression and translational efficiency analysis was performed using DESeq2.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
All metagenes, stalling and ribosome dwelling occupancy (RDO) analyses are carried out on a subset of expressed canonical transcripts which had PPKM values greater than 1 across all samples (10,366 total).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Within these, P-site depths per nucleotide were normalized to the mean value in their respective CDS.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
For metagenes around codon types, the mean of these normalized values is taken for each codon within 90 nucleotides of every instance of that codon.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
For RDO calculation for a given type of codon, the mean of these normalized values is taken over all instances of that codon, then these are compared using a log2-transformed fold change ratio between conditions.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
To assess relative pausing, P-site depths normalized to the CDS mean were compared at each codon position in the CDS.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
A value of 1 was added to these normalized depths and a log2-transformed fold change ratio was taken pairwise between conditions.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
To compare effects of different codon ending bases, the resulting values were separated by the ending base of each codon and plotted across their respective positions in the CDS.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The relative pausing sum for each ending A, T, G or C is then the sum of these values for every codon containing the respective ending codon across the CDS.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
The fraction of nucleotides at ending codons were evaluated from extracting the codons for the CDS of each gene using GRCm38, release 101.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Pathway level fractions were computed using the average of each gene contained in the pathway.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
To inhibit hypusination, cells were treated with 6.25 μM of the DHPS inhibitor GC7 (MedChemExpress) for 5 days.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
For MYCN inhibition, cells were treated with 5 μM MYCi975 (Selleckchem) for 4 days.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Western blot analysis was performed to assess the efficacy of the inhibition.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Following the respective treatment periods, cells were incubated with 100 μg ml cycloheximide (Sigma) for 10 min at 37 °C.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Cells were washed once with PBS containing 100 μg ml cycloheximide, then trypsinized using a solution containing 100 μg ml cycloheximide for 1 min at 37 °C.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Cells were pelleted by centrifugation and washed with cold PBS containing 100 μg ml cycloheximide.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
IMR5 cells were disrupted in a lysis buffer (20 mM Tris, pH 7.4, 140 mM KCl, 5 mM MgCl2, 1.0% Triton X-100, 1 mg ml heparin, 25 U ml Turbo DNase I (Roche, 04716728001), 1 mM DTT, 100 μg ml cycloheximide (Sigma, C7698) and protease inhibitors (Roche, 04693132001).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
To obtain ribosome footprints 80 μl of lysates containing 150 g of total RNAs were treated with RNAse I (Ambion, AM2295) (250 U per mg of total RNA), for 60 min at 20°С with gentle agitation.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Four microlitres SUPERaseIn RNase inhibitor (Ambion, AM2694) was added to stop nuclease digestion.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Monosomes were isolated using S-400 columns (Cytiva, 27514001).
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Samples were then processed using Ribo-seq as described above.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Ribo-seq data from lymphoma cells with shRNAs targeting Renilla (sh-contl), Eif5a or Dhps were taken from Nakanishi et al.. Raw data were downloaded from Gene Expression Omnibus (GEO) accession GSE190670 and were processed using Ribo-seq analysis as described above.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Reprocessed and reanalysed data were from Elkon et al.. Raw data were downloaded from GEO GSE66927 and were processed using Ribo-seq analysis as described above.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Reprocessed and reanalysed data from Volegova et al.. Raw data were downloaded from GEO accession GSE261760 and were processed using Ribo-seq analysis as described above.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
IMR5 cells were cultured in RPMI medium supplemented with 10% dialysed FBS (Gibco) and seeded into 384-well plates.
PMC12527938
Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Stock solutions of arginine, proline, DFMO and GC7 were dispensed into the 384-well plates using the Echo 650 (Beckmann Coulter) liquid handler in a concentration-dependent manner.