PMCID string | Title string | Sentences string |
|---|---|---|
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The ODC inhibitor, DFMO, was obtained from P. Woster. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | DFMO was dissolved in drinking water and supplied to mice ad libitum at a dose of 1% in the drinking water. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Survival end point: only Th-MYCN mice were randomized. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | DFMO was provided to mothers on day 1 (partially transmitted to pups in breastmilk) and then directly to pups at day 28 of life, post-weaning; diet change was started at day 21 of life, per treatment assignment. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Mice were weighed and assessed for tumour growth and symptoms, at least thrice weekly by a single experienced animal technician. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Mice were euthanized at pre-defined humane endpoints related to overall health or tumour burden (hunching, immobility, hindlimb paresis, weight loss or respiratory distress). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | An additional ‘late start’ trial was done with Th-MYCN mice enrolled at the time of a palpable progressing abdominal tumour (typically day of life 35–50), randomized to diet and/or DFMO as above, and taken down for tumour mass after 14 days of therapy, sooner if humane endpoints were reached. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | For metabolomics studies. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Th-MYCN mice were treated as above, serum was obtained at day 43 (±2 days) and tumours and organs were collected at that time if tumour was present or delayed to the earliest time tumour became palpable. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Time to tumour collection depended on the treatment group. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | In order to ensure homogenous timing of metabolic tumour collection, Th-MYCN mice ProArg-free diet plus DFMO had therapy delayed to day 28. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Mice bearing established IMR5 xenografts at ≥200 mm were randomized to diets and/or DFMO as above. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Mice were weighed and assessed for tumour volume and symptoms, at least thrice weekly. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | End point: mice were euthanized when tumour volume >2 cm using calipers measurements and assuming an ellipsoid volume. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Polyamine concentrations and amino acids in the single-amino-acid trials (Pro-free and Arg-free) were quantified using the AccQ-Tag fluorescence dye (Waters) as described. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Derivatives were separated on an Acquity BEH C18 column (150 mm×2.1 mm, 1.7 μm, Waters) by reverse phase UPLC (Acquity H-class UPLC system, Acquity FLR detector, Waters). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The column was equilibrated with buffer A (140 mM sodium acetate pH 6.3, 7 mM triethanolamine) at a flow rate of 0.45 ml min and heated at 42 °C. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Pure acetonitrile served as buffer B. The gradient was produced by the following concentration changes: 1 min 8% B, 7 min 9% B, 7.3 min 15% B, 12.2 min 18% B, 13.1 min 41% B, 15.1 min 80% B, hold for 2.2 min, and return to 8% B in 1.7 min. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Chromatograms were recorded and processed with the Empower3 software (Waters). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | For acetylated polyamines a MS/MS method was used. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | In brief, a Waters Acquity I-class Plus UPLC system (Binary Solvent Manager, thermostatic Column Manager and FTN Sample Manager) (Waters) coupled to an QTRAP 6500+ (Sciex) mass spectrometer with electrospray ionization (ESI) source was used. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Data acquisition was performed with Analyst (Sciex), and data quantification was performed with the SciexOS software suite (Sciex). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Chromatography was made on an Acquity HSS T3 column (150 mm × 2.1 mm, 1.7 μm, Waters) kept at 20 °C and a flow rate of 0.3 ml min. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Eluent A consisted of water with 0.1% formic acid and eluent B in acetonitrile with 0.1% formic acid. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Gradient elution consisted in changing %B as follows: 0–1 min 0%; 5 min 20%; 5.5–7.5 min 100%, and 8–10 min 0%. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The ion source settings were as follow: curtain gas: 30 psi; collision gas: low; ion spray: 4,500 V; source temperature: 500 °C; ion source gas 1: 40 (GS1) and ion source gas 2: 50 (GS2). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | All compounds were measured in positive electrospray ion mode. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | To ensure comparability of amino acid levels the signal intensity was scaled based on samples that were in parallel analysed by LC–MS. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | For fate tracing of C-labelled amino acids into polyamines an ice-cold extraction solvent consisting of 0.1 M HCl plus 10 μM Norleucine (internal standard) was added as follows: 45 μl for 5 μl of serum and 300 μl for 20–30 mg of mouse tissue. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | After a 15-min incubation on ice, samples were vortexed and centrifuged at 14,000 rpm for 5 min at 4 °C. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The supernatants were then labelled with the fluorescence dye AccQ-Tag (Waters) according to the manufacturer’s protocol, with a modification for serum samples where the final volume was adjusted to 120 μl instead of 500 μl. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The method used an I-class UPLC system coupled to a QTRAP 6500+ mass spectrometry system (AB SCIEX) with an electrospray ionization (ESI) source. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The derivatives were separated using an Acquity HSS T3 column (100 mm × 2.1 mm, 1.8 µm, Waters) maintained at 40 °C. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The mobile phases were: A, 0.1% formic acid in water; and B, 0.1% formic acid in acetonitrile. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The mass spectrometer was operated in positive-ion mode with an ion spray voltage of 5,500 V, a source temperature of 550 °C, and GS1 and GS2 set at 70. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Data acquisition was performed using Analyst 1.7.2 (AB SCIEX). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Polyamine concentration were compared to AMXT1501 treated Th-MYCN tumours from Gamble et al.. Metabolomics data for 180 cancer cell lines was obtained from Cherkaoui et al.. Associations between metabolite levels in core metabolic pathways and MYCN transcriptional activity were obtained from https://cancer-metabolomics.azurewebsites.net/page2. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Gene-expression profiles of 649 neuroblastoma tumours were obtained from R2 (R2 Genomics Analysis and Visualization Platform; http://r2.amc.nl). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Differential expression analysis between MYCN amplification status was performed using the Bioconductor package limma (v.3.40.6). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Expression profiles of 39 neuroblastoma cell lines were obtained from Gene Expression Omnibus. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Differential analysis was performed using the Bioconductor package limma (v.3.40.6) and by comparing MYCN amplification status provided in the study. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Data from the CCLE was taken from the release from the second quarter of 2021 (21Q2). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Total RNA was isolated from the same extracts that were used to obtain mRNA protected fragments (RPFs) (‘Ribo-seq of Th-MYCN tumours’). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Three volumes of QIAzol (Qiagen, 79306) were added to 80 μl of cell extracts, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | RNA were sent to Genomic Platform (UNIGE) for stranded mRNA libraries preparation. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 10 libraries in 1 pool. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Mouse tumours were mechanically disrupted in liquid nitrogen and homogenized in a lysis buffer (LB, 50 mM Tris, pH 7.4, 100 mM KCl, 1.5 mM MgCl2, 1.0% Triton X-100, 0.5% sodium deoxycholate, 25 U ml Turbo DNase I, 1 mM DTT, 100 μg ml cycloheximide, and protease inhibitors) 3 ml of LB per 1 g of tissue. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | To obtain ribosome footprints 0.12 ml of total extracts containing 300 μg of total RNA were treated with RNAse I (Epicentre) (25 U per mg of total RNA), for 45 min at 20 °C with slow agitation. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | 10 ml SUPERaseIn RNase inhibitor was added to stop nuclease digestion. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Monosomes were isolated using S-400 columns. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | For isolation of RPFs, 3 volumes of QIAzol were added to the S-400 eluate, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | RPF libraries were prepared as described. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | In brief, RPFs (25–34 nucleotides) were size-selected by electrophoresis using 15% TBE–Urea polyacrylamide gel electrophoresis (PAGE) and two RNA markers, 25-mer (5′-AUGUACACGGAGUCGAGCACCCGCA-3′) and 34-mer (5′-AUGUACACGGAGUCGAGCACCCGCAACGCGAAUG-3′). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | After dephosphorylation with T4 Polynucleotide Kinase (NEB, M0201S) the adapter Linker-1 (5′-rAppCTGTAGGCACCATCAAT/3ddC/-3′) was ligated to the 3′ end of the RPF using T4 RNA Ligase 2. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Ligated products were purified using 10% TBE–Urea PAGE. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Ribosomal RNA was subtracted using RiboCop rRNA Depletion Kit V2 H/M/R. The adapter Linker-1 was used for priming reverse transcription with the reverse transcription primer Ni-Ni-9 (5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC5CACTCA5TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3′) using ProtoScript II Reverse Transcriptase. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Reverse transcription products were purified using 10% TBE–Urea PAGE. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The cDNA was circularized with CircLigase II ssDNA Ligase. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The final libraries were generated by PCR using forward index primer NI-N-2 (5′-AATGATACGGCGACCACCGAGATCTACAC-3′) and one of the reverse index primers. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Amplified libraries were purified using 8% TBE-PAGE and analysed by Qubit and TapeStation. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 4 libraries in 1 pool. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Fastq files were adaptor stripped using cutadapt with a minimum length of 15 and a quality cut-off of 2 (parameters: -a CTGTAGGCACCATCAAT –minimum-length = 15 –quality-cutoff = 2). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Resulting reads were mapped, using default parameters, with HISAT2, using a GRCm38, release 101 genome and index. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Differential expression analysis was performed using DESeq2, using a GRCm38, release 101 genome and index. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Fastq files were adaptor stripped using cutadapt. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Only trimmed reads were retained, with a minimum length of 15 and a quality cut-off of 2 (parameters: -a CTGTAGGCACCATCAAT – trimmed-only –minimum-length = 15 –quality-cutoff = 2). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Histograms were produced of ribosome footprint lengths and reads were retained if the trimmed size was 28 or 29 nucleotides. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Resulting reads were mapped, using default parameters, with HISAT2 using a GRCm38, release 101 genome and index and were removed if they mapped to rRNA or tRNA according to GRCm38 RepeatMasker definitions from UCSC. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | A full set of transcripts and coding sequence (CDS) sequences for Ensembl release 101 was then established. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Only canonical transcripts (defined by known canonical table, downloaded from UCSC) were retained with their corresponding CDS. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Reads were then mapped to the canonical transcriptome with bowtie2 using default parameters. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The P-site position of each read was predicted by riboWaltz and confirmed by inspection. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Counts were made by aggregating P-sites overlapping with the CDS and P-sites per kilobase million (PPKMs) were then generated through normalizing by CDS length and total counts for the sample. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Differential expression and translational efficiency analysis was performed using DESeq2. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | All metagenes, stalling and ribosome dwelling occupancy (RDO) analyses are carried out on a subset of expressed canonical transcripts which had PPKM values greater than 1 across all samples (10,366 total). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Within these, P-site depths per nucleotide were normalized to the mean value in their respective CDS. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | For metagenes around codon types, the mean of these normalized values is taken for each codon within 90 nucleotides of every instance of that codon. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | For RDO calculation for a given type of codon, the mean of these normalized values is taken over all instances of that codon, then these are compared using a log2-transformed fold change ratio between conditions. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | To assess relative pausing, P-site depths normalized to the CDS mean were compared at each codon position in the CDS. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | A value of 1 was added to these normalized depths and a log2-transformed fold change ratio was taken pairwise between conditions. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | To compare effects of different codon ending bases, the resulting values were separated by the ending base of each codon and plotted across their respective positions in the CDS. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The relative pausing sum for each ending A, T, G or C is then the sum of these values for every codon containing the respective ending codon across the CDS. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | The fraction of nucleotides at ending codons were evaluated from extracting the codons for the CDS of each gene using GRCm38, release 101. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Pathway level fractions were computed using the average of each gene contained in the pathway. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | To inhibit hypusination, cells were treated with 6.25 μM of the DHPS inhibitor GC7 (MedChemExpress) for 5 days. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | For MYCN inhibition, cells were treated with 5 μM MYCi975 (Selleckchem) for 4 days. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Western blot analysis was performed to assess the efficacy of the inhibition. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Following the respective treatment periods, cells were incubated with 100 μg ml cycloheximide (Sigma) for 10 min at 37 °C. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Cells were washed once with PBS containing 100 μg ml cycloheximide, then trypsinized using a solution containing 100 μg ml cycloheximide for 1 min at 37 °C. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Cells were pelleted by centrifugation and washed with cold PBS containing 100 μg ml cycloheximide. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | IMR5 cells were disrupted in a lysis buffer (20 mM Tris, pH 7.4, 140 mM KCl, 5 mM MgCl2, 1.0% Triton X-100, 1 mg ml heparin, 25 U ml Turbo DNase I (Roche, 04716728001), 1 mM DTT, 100 μg ml cycloheximide (Sigma, C7698) and protease inhibitors (Roche, 04693132001). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | To obtain ribosome footprints 80 μl of lysates containing 150 g of total RNAs were treated with RNAse I (Ambion, AM2295) (250 U per mg of total RNA), for 60 min at 20°С with gentle agitation. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Four microlitres SUPERaseIn RNase inhibitor (Ambion, AM2694) was added to stop nuclease digestion. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Monosomes were isolated using S-400 columns (Cytiva, 27514001). |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Samples were then processed using Ribo-seq as described above. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Ribo-seq data from lymphoma cells with shRNAs targeting Renilla (sh-contl), Eif5a or Dhps were taken from Nakanishi et al.. Raw data were downloaded from Gene Expression Omnibus (GEO) accession GSE190670 and were processed using Ribo-seq analysis as described above. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Reprocessed and reanalysed data were from Elkon et al.. Raw data were downloaded from GEO GSE66927 and were processed using Ribo-seq analysis as described above. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Reprocessed and reanalysed data from Volegova et al.. Raw data were downloaded from GEO accession GSE261760 and were processed using Ribo-seq analysis as described above. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | IMR5 cells were cultured in RPMI medium supplemented with 10% dialysed FBS (Gibco) and seeded into 384-well plates. |
PMC12527938 | Reprogramming neuroblastoma by diet-enhanced polyamine depletion | Stock solutions of arginine, proline, DFMO and GC7 were dispensed into the 384-well plates using the Echo 650 (Beckmann Coulter) liquid handler in a concentration-dependent manner. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.