PMCID string | Title string | Sentences string |
|---|---|---|
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To create PA2G4DelEx2-5 transgenic mice, double-stranded breaks were created within the PA2G4 locus (chromosome 10) in C57BL/6J mice using CRISPR/Cas9 and 2 sgRNAs (ggccggtcgcgccggccgac and ccatacccggctgtatggtc) targeting the region of exons 1–5 of the PA2G4 coding sequence. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To detect the wild-type allele, mice were genotyped using forward primer ATGTCATTAAGGCCGCTCAC and reverse primer GGCTGGGTACCTTCAAAGTG. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The expected wildtype PCR product size is 471 bp. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To detect the deleted allele, mice were genotyped using forward primer CAGCACCCTAGGACTTCCAC and reverse primer CACCAGGGAAGAAAAGATGAC. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The expected deleted PCR product size is 374 bp. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Hemizygous PA2G4 mice were crossed with Th-MYCN hemizygous transgenic mice and backcrossed to congenicity over three generations. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Offspring were palpated twice a week and monitored for tumor development over a 52-week period. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Mice were culled, necropsies were performed, and tumors were collected for IHC analysis once the tumor reached 1 cm or at the end of 52 weeks. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | For single-cell neuroblastoma analysis, the publicly available NBAtlas dataset (https://data.mendeley.com/datasets/yhcf6787yp/3; accessed on 7 September 2025) was utilized. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Processed and annotated data were downloaded, and cells annotated as neuroendocrine were extracted. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Patients with fewer than 100 neuroendocrine cells, or with fewer than 100 malignant or 100 normal neuroendocrine cells, were excluded. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Normal adrenal medulla single-nucleus data were obtained from Jansky et al. (2021), and developmental adrenal medulla datasets (including 8 weeks postconception) were downloaded from https://adrenal.kitz-heidelberg.de/developmental_programs_NB_viz/; accessed on 7 September 2025) . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Pseudobulk profiles were generated at the patient level for NBAtlas by averaging expression across cells within malignant and normal neuroendocrine subsets. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Spearman correlation analysis was performed at both the single-cell and pseudobulk levels using the correlatePairs function from the scater R package (v1.32.1), with p-values adjusted using the Benjamini–Hochberg method. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | For bulk RNA-seq, TPM-normalized expression data for malignant and normal cell lines were obtained from the Cancer Cell Line Encyclopedia (CCLE) and Human Protein Atlas (HPA) (PMID: 37669926) via Zenodo (https://zenodo.org/records/7874749; accessed on 7 September 2025)) . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Immune cell datasets, comprising 29 sorted immune cell types from 4 individuals and PBMCs from 13 individuals, were obtained from GSE107011. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | For all bulk datasets, TPM-normalized counts were log2-transformed [log2(TPM + 1)] prior to analysis. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Spearman correlation coefficients (ρ), p-values, and confidence intervals were calculated using GraphPad Prism 10. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | All statistical analysis was conducted using GraphPad Prism 10 software. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Differences between groups were evaluated using unpaired two-sided t-tests. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | All data are presented as mean ± standard error of the mean (SEM) from at least three independent biological replicates. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | We previously demonstrated that pharmacological inhibition of the PA2G4-MYCN protein interaction using the small molecule WS6 exerts anti-tumorigenic effects in neuroblastoma models . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | In vitro, PA2G4 knockout partially reduced cell viability in neuroblastoma cell lines, with effects observed in MYCN-dependent and -independent contexts. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To investigate the functional importance of PA2G4 in MYCN-driven neuroblastoma in vivo, we utilized the Th-MYCN transgenic mouse model, in which the human MYCN gene is expressed under the control of the tyrosine hydroxylase promoter. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | This model reliably develops neuroblastoma in 100% of homozygote animals by 6–8 weeks of age . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To determine the importance of PA2G4 to MYCN-driven neuroblastoma in vivo, we created Th-MYCN transgenic mice harboring a deletion of the PA2G4 gene. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | A whole body PA2G4 knockout mouse model was established using CRISPR/Cas-9 technology, introducing double-strand breaks within the PA2G4 locus using sgRNAs targeting exons 1–5 of the PA2G4 coding sequence in C57BL/6 mice (Figure 1A). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Hemizygous PA2G4 mice were crossed with Th-MYCN hemizygous transgenic mice and bred to congenicity over three generations. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | This breeding strategy produced six genotypic groups: homozygous Th-MYCN crossed with either hemizygous PA2G4, homozygous PA2G4 knockout mice, or PA2G4 WT mice; and hemizygous Th-MYCN crossed with hemizygous PA2G4, homozygous PA2G4 knockout mice, and PA2G4 WT mice (Figure 1B). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The PA2G4 knockout mice showed no obvious phenotype. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Immunohistochemical analysis of tumors from each genotype confirmed differential expression of PA2G4 and MYCN (Supplementary Figure S1). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The PA2G4 x Th-MYCN mice exhibited 100% postnatal mortality due to aggressive neuroblastoma development (Figure 1C). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Strikingly, homozygous deletion of PA2G4 significantly increased the survival probability of homozygous Th-MYCN mice from 0% to 60%, whereas heterozygous deletion of PA2G4 had no significant effect on survival in this genotype. ( |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Figure 1C). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Hemizygous Th-MYCN mice had a survival probability of 30% when the PA2G4 gene was wildtype, whereas both hemizygous PA2G4 and homozygous PA2G4 knockout equally increased tumor-free survival probability of the homozygous Th-MYCN mice to 80% (Figure 1C). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | These findings demonstrate that PA2G4 is required for efficient MYCN-driven neuroblastoma tumorigenesis in vivo, and its loss impairs neuroblastoma progression in a gene dosage-dependent manner. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | When more MYCN is present, knockdown of both alleles of PA2G4 is required for inhibition of tumor development. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To investigate correlations between PA2G4 and MYCN or MYC in the context of neuroblastoma and neuroendocrine development, we analyzed publicly available single-cell datasets from the neuroblastoma atlas (NBAtlas, Bonine et al., 2024 ) (Supplementary Figure S2) and the normal adrenal gland (Jansky et al., 2021 ) (Supplementary Figure S3). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | In MYCN-amplified malignant neuroendocrine cells, PA2G4 expression correlated strongly with MYCN (ρ = 0.65, p < 0.001) and moderately with MYC (ρ = 0.42, p < 0.001). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | This relationship persisted when restricting the analysis to cells co-expressing both genes (ρ = 0.70 and ρ = 0.49, respectively). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | In NBAtlas (Supplementary Figure S2), we observed a significant positive correlation between PA2G4 and MYCN in both malignant and normal neuroendocrine cells, with malignant cells showing slightly stronger correlations (Supplementary Figure S2d,e; left panels). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | While single-cell analyses suggested a correlation between PA2G4 and MYC, this did not hold at the pseudobulk level for either malignant or normal cells. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Notably, MYC expression was relatively sparse across this dataset. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Taken together, these results suggest that in the NBAtlas dataset, where MYCN is more frequently expressed than MYC, PA2G4 shows a stronger correlation with MYCN. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The relationship between PA2G4 and MYC remains less clear, particularly in contexts where MYC expression is low, and may depend on tumor subtype. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | This leaves open the possibility that in MYC-driven neuroblastoma, PA2G4 could also play a role, though further datasets will be needed to clarify this. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Given the shared biological functions and 80% structural homology between MYCN and c-MYC , we investigated a potential regulatory relationship between c-MYC and PA2G4. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Western blot analysis was performed to quantify basal levels of both c-MYC and PA2G4 proteins in a panel of cancer cell lines (Figure 2A), including neuroblastoma (SH-SY5Y, SK-N-AS), medulloblastoma (DAOY, UW-228), and Burkitt Lymphoma and B-Acute Lymphoblastic Leukemia (ALL) cell lines (Raji, KOPN-8, SEMK2, P493-6, WEHI-116, WEHI-47). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | All malignant cells expressed moderate to high levels of both c-MYC and PA2G4, except the medulloblastoma cell line, UW228. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | This was in contrast to normal fibroblasts (MRC-5, WI-38). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Transcript expression of PA2G4 and c-MYC was analyzed in a panel of Neuroblastoma, Leukemia, Medulloblastoma, and non-cancerous cells using the publicly available datasets (CCLE, HPA) (Supplementary Table S1), and a positive correlation (R = 0.57, R = 0.53) was observed between c-MYC and PA2G4 levels across these cell lines in both the Western blot and the transcript expression data (Figure 2A). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To determine whether c-MYC regulates PA2G4 protein expression, levels of PA2G4 were assessed by the immunoblotting of total protein extracts from human neuroblastoma cell lines (SH-SY5Y, SK-N-AS) 48 h after c-MYC siRNA knockdown. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | There was a significant (p < 0.01) decrease in PA2G4 protein expression after c-MYC knockdown in both cell lines (Figure 2B). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Knockdown of c-MYC following the addition of Doxycycline (Dox) to the murine Burkitt lymphoma cell line, P493-6, in vitro also led to a significant (p < 0.05) decrease in c-MYC and PA2G4 protein expression over 96 h (Figure 2C). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Real-time PCR analysis showed that c-MYC knockdown resulted in a significant (p < 0.01) decrease in PA2G4 mRNA expression compared to the control after 48 h in neuroblastoma cells (Figure 2D), suggesting that c-MYC plays a role in PA2G4 transcriptional regulation. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To investigate whether PA2G4 forms a positive feed-forward expression loop with c-MYC, similar to its previously described interaction with MYCN , we transiently silenced PA2G4 using siRNA in neuroblastoma cell lines. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Protein and mRNA expressions of c-MYC and PA2G4 were examined using immunoblotting and qPCR, respectively. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | There was a significant decrease (p < 0.01) observed in both c-MYC and PA2G4 protein expression 48 h after PA2G4 knockdown in SH-SY5Y and SK-N-AS cells (Figure 3A). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | There was no change observed in c-MYC mRNA expression after PA2G4 silencing (p > 0.05; Figure 3B). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To further examine the effect of PA2G4 on c-MYC protein stability, a cycloheximide (CHX) chase assay was performed. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | PA2G4 expression was reduced in SK-N-AS cells transfected with a siRNA targeting PA2G4 (siPA2G4#2) for 48 h. Addition of CHX (100 μg/μL) reduced protein expression of c-MYC in both siControl and siPA2G4 conditions (Figure 3C); however, c-MYC degradation occurred more rapidly after PA2G4 knockdown in comparison to control. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The half-life of c-MYC protein decreased from 67.8 min to 29.1 min after PA2G4 knockdown (Figure 3C). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Together, these results showed that PA2G4 was required for c-MYC protein stability in these neuroblastoma cell lines, independent of transcriptional regulation. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | WS6 is a known small molecule inhibitor of PA2G4 . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Given our findings that PA2G4 and c-MYC form a positive forward feedback expression loop in MYC- and MYCN-driven cancers, we hypothesized that WS6 would repress the expression of both proteins in c-MYC-driven malignant cells. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Neuroblastoma cell lines (SH-SY5Y and SK-N-AS and BL cell lines (WEHI-47 and KOPN-8), characterized by high c-MYC expression, were treated with increasing concentrations of WS6 (0–2 µM). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Immunoblot analysis revealed a dose-dependent reduction in both c-MYC and PA2G4 protein levels in SK-N-AS and SH-SY5Y cells (Figure 4A) at all concentrations. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Significant downregulation of these proteins in WEHI-47 and KOPN-8 lymphoma cells was only observed at the highest WS6 concentration (2 μM). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | WS6 demonstrated cytotoxic effects with IC50s (0.095–2.94 µM) in the neuroblastoma, medulloblastoma, leukemia, and lymphoma cell lines, compared to normal fibroblasts (4.9 & >10 µM) (Figure 4B and Figure S4). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | To investigate whether c-MYC was necessary for the WS6-mediated cytotoxicity, we used the P493-6 Burkitt lymphoma cell line, which expresses a doxycycline-repressible c-MYC transgene . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | WS6 was significantly more cytotoxic in c-MYC-expressing P493-6 -Dox cells, compared to P493-6 +Dox cells. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The IC50 of WS6 increased to twice as much after the addition of Dox, with the greatest change observed in the IC50 at 96 h from 0.8 µM in c-MYC-expressing cells (P493-6 -dox) to 2.2 µM in c-MYC-suppressed cells (P493-6 +dox) (Figure 4C). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | These results indicate that c-MYC knockdown reduces sensitivity to WS6 treatment, thus demonstrating that the growth inhibitory effects of the PA2G4 inhibitor, WS6, are partially c-MYC dependent. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Given that cytotoxic chemotherapy is routinely used to treat each of these c-MYC-driven malignancies , we hypothesized that chemical PA2G4 and c-MYC inhibition by WS6 would have synergistic growth-inhibitory effects with chemotherapy in c-MYC-driven malignant cells. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | We examined the effects of WS6 used in combination with either Vincristine, Cisplatin, or Etoposide on the cell viability of the neuroblastoma cell line, SH-SY5Y. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Synergy was determined using BLISS (Supplementary Figure S5). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The combinations of WS6 with these conventional chemotherapy agents (Vincristine, Cisplatin, and Etoposide) led to synergistic cytotoxicity when compared to the single agents alone (Figure 5). |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Our study provides novel insights into the role of PA2G4 as a critical regulator of c-MYC stability and underscores its potential as a therapeutic target across MYC-driven cancers. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | We present the first in vivo evidence demonstrating the essential role of PA2G4 in MYCN-driven neuroblastoma . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Mechanistically, we demonstrated that PA2G4 is essential for maintaining c-MYC protein stability and cell viability across various c-MYC-expressing cancer cell lines. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Pharmacological inhibition of PA2G4 using the small molecule inhibitor WS6 resulted in a decrease in both c-MYC and PA2G4 protein levels and significantly enhanced cytotoxicity in c-MYC overexpressing cell lines. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Together, these findings establish PA2G4 as a critical modulator of MYC oncogenic activity and a promising therapeutic vulnerability in c-MYC-driven malignancies. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Our study demonstrates for the first time that PA2G4 is essential for MYCN-driven tumorigenesis in vivo, as knockout of PA2G4 significantly increased the survival of Th-MYCN mice. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Notably, both alleles of PA2G4 had to be knocked out to observe a survival benefit in homozygous Th-MYCN mice. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | However, in hemizygous Th-MYCN mice, a single allele knockout was sufficient to prolong survival, suggesting a gene dosage effect between MYCN and PA2G4 in driving tumor progression. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | MYC is an intrinsically disordered protein that has long been considered “undruggable” due to the absence of a defined binding pocket. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | As such, previous efforts have primarily focused on indirect strategies to target MYC, including disrupting the MYC/MAX dimer or inhibiting its interaction with various other protein binding partners . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Compounds that target the MYC/MAX interaction have some effect in cancer, though these inhibitors often suffer from limited potency and significant off-target effects . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | As a result, attention has shifted toward regulatory proteins that influence MYC stability. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | The stability of the MYC protein is tightly regulated through phosphorylation and interactions with specific proteins. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Phosphorylation at Ser62 (by ERK/CDK) followed by Thr58 (by GSK3β) allows the E3 ubiquitin ligase FBXW7 to recognize and target MYC for degradation . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | However, this process can be counteracted. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | PP2A stabilizes MYC by dephosphorylating Ser62 . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | PIN1 prevents FBXW7 recognition by isomerizing the phosphorylated Thr58-Pro motif ; and deubiquitinases USP28 and USP7 , as well as Aurora A kinase, protect MYC from degradation . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Our study introduces PA2G4 as a novel regulator of MYC protein stability. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | We demonstrate that PA2G4 stabilizes c-MYC in cancer cells, thereby expanding the landscape of MYC-interacting proteins that can be exploited for therapeutic intervention. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Targeting PA2G4 may offer a new and more selective approach to destabilize MYC in malignancies where direct targeting remains challenging. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | PA2G4 is a DNA and RNA-binding protein involved in key cellular processes such as growth, apoptosis, and differentiation , with the longer isoform, PA2G4-p48, exhibiting oncogenic properties . |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | Overexpression of PA2G4 has been associated with enhanced tumor progression in glioblastoma and oral squamous cell carcinoma pre-clinical models , supporting its role as a driver of malignancy. |
PMC12468391 | PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies | In line with these findings, a recent proteogenomic analysis identified the PA2G4-MYC axis as a druggable vulnerability in 3q26-amplified acute myeloid leukemia (AML) , where PA2G4 overexpression conferred resistance to HDAC inhibitors, while its inhibition suppressed leukemia progression in patient-derived xenograft models. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.