PMCID
string
Title
string
Sentences
string
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To create PA2G4DelEx2-5 transgenic mice, double-stranded breaks were created within the PA2G4 locus (chromosome 10) in C57BL/6J mice using CRISPR/Cas9 and 2 sgRNAs (ggccggtcgcgccggccgac and ccatacccggctgtatggtc) targeting the region of exons 1–5 of the PA2G4 coding sequence.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To detect the wild-type allele, mice were genotyped using forward primer ATGTCATTAAGGCCGCTCAC and reverse primer GGCTGGGTACCTTCAAAGTG.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The expected wildtype PCR product size is 471 bp.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To detect the deleted allele, mice were genotyped using forward primer CAGCACCCTAGGACTTCCAC and reverse primer CACCAGGGAAGAAAAGATGAC.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The expected deleted PCR product size is 374 bp.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Hemizygous PA2G4 mice were crossed with Th-MYCN hemizygous transgenic mice and backcrossed to congenicity over three generations.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Offspring were palpated twice a week and monitored for tumor development over a 52-week period.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Mice were culled, necropsies were performed, and tumors were collected for IHC analysis once the tumor reached 1 cm or at the end of 52 weeks.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
For single-cell neuroblastoma analysis, the publicly available NBAtlas dataset (https://data.mendeley.com/datasets/yhcf6787yp/3; accessed on 7 September 2025) was utilized.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Processed and annotated data were downloaded, and cells annotated as neuroendocrine were extracted.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Patients with fewer than 100 neuroendocrine cells, or with fewer than 100 malignant or 100 normal neuroendocrine cells, were excluded.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Normal adrenal medulla single-nucleus data were obtained from Jansky et al. (2021), and developmental adrenal medulla datasets (including 8 weeks postconception) were downloaded from https://adrenal.kitz-heidelberg.de/developmental_programs_NB_viz/; accessed on 7 September 2025) .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Pseudobulk profiles were generated at the patient level for NBAtlas by averaging expression across cells within malignant and normal neuroendocrine subsets.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Spearman correlation analysis was performed at both the single-cell and pseudobulk levels using the correlatePairs function from the scater R package (v1.32.1), with p-values adjusted using the Benjamini–Hochberg method.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
For bulk RNA-seq, TPM-normalized expression data for malignant and normal cell lines were obtained from the Cancer Cell Line Encyclopedia (CCLE) and Human Protein Atlas (HPA) (PMID: 37669926) via Zenodo (https://zenodo.org/records/7874749; accessed on 7 September 2025)) .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Immune cell datasets, comprising 29 sorted immune cell types from 4 individuals and PBMCs from 13 individuals, were obtained from GSE107011.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
For all bulk datasets, TPM-normalized counts were log2-transformed [log2(TPM + 1)] prior to analysis.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Spearman correlation coefficients (ρ), p-values, and confidence intervals were calculated using GraphPad Prism 10.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
All statistical analysis was conducted using GraphPad Prism 10 software.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Differences between groups were evaluated using unpaired two-sided t-tests.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
All data are presented as mean ± standard error of the mean (SEM) from at least three independent biological replicates.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
We previously demonstrated that pharmacological inhibition of the PA2G4-MYCN protein interaction using the small molecule WS6 exerts anti-tumorigenic effects in neuroblastoma models .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
In vitro, PA2G4 knockout partially reduced cell viability in neuroblastoma cell lines, with effects observed in MYCN-dependent and -independent contexts.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To investigate the functional importance of PA2G4 in MYCN-driven neuroblastoma in vivo, we utilized the Th-MYCN transgenic mouse model, in which the human MYCN gene is expressed under the control of the tyrosine hydroxylase promoter.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
This model reliably develops neuroblastoma in 100% of homozygote animals by 6–8 weeks of age .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To determine the importance of PA2G4 to MYCN-driven neuroblastoma in vivo, we created Th-MYCN transgenic mice harboring a deletion of the PA2G4 gene.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
A whole body PA2G4 knockout mouse model was established using CRISPR/Cas-9 technology, introducing double-strand breaks within the PA2G4 locus using sgRNAs targeting exons 1–5 of the PA2G4 coding sequence in C57BL/6 mice (Figure 1A).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Hemizygous PA2G4 mice were crossed with Th-MYCN hemizygous transgenic mice and bred to congenicity over three generations.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
This breeding strategy produced six genotypic groups: homozygous Th-MYCN crossed with either hemizygous PA2G4, homozygous PA2G4 knockout mice, or PA2G4 WT mice; and hemizygous Th-MYCN crossed with hemizygous PA2G4, homozygous PA2G4 knockout mice, and PA2G4 WT mice (Figure 1B).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The PA2G4 knockout mice showed no obvious phenotype.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Immunohistochemical analysis of tumors from each genotype confirmed differential expression of PA2G4 and MYCN (Supplementary Figure S1).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The PA2G4 x Th-MYCN mice exhibited 100% postnatal mortality due to aggressive neuroblastoma development (Figure 1C).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Strikingly, homozygous deletion of PA2G4 significantly increased the survival probability of homozygous Th-MYCN mice from 0% to 60%, whereas heterozygous deletion of PA2G4 had no significant effect on survival in this genotype. (
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Figure 1C).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Hemizygous Th-MYCN mice had a survival probability of 30% when the PA2G4 gene was wildtype, whereas both hemizygous PA2G4 and homozygous PA2G4 knockout equally increased tumor-free survival probability of the homozygous Th-MYCN mice to 80% (Figure 1C).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
These findings demonstrate that PA2G4 is required for efficient MYCN-driven neuroblastoma tumorigenesis in vivo, and its loss impairs neuroblastoma progression in a gene dosage-dependent manner.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
When more MYCN is present, knockdown of both alleles of PA2G4 is required for inhibition of tumor development.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To investigate correlations between PA2G4 and MYCN or MYC in the context of neuroblastoma and neuroendocrine development, we analyzed publicly available single-cell datasets from the neuroblastoma atlas (NBAtlas, Bonine et al., 2024 ) (Supplementary Figure S2) and the normal adrenal gland (Jansky et al., 2021 ) (Supplementary Figure S3).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
In MYCN-amplified malignant neuroendocrine cells, PA2G4 expression correlated strongly with MYCN (ρ = 0.65, p < 0.001) and moderately with MYC (ρ = 0.42, p < 0.001).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
This relationship persisted when restricting the analysis to cells co-expressing both genes (ρ = 0.70 and ρ = 0.49, respectively).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
In NBAtlas (Supplementary Figure S2), we observed a significant positive correlation between PA2G4 and MYCN in both malignant and normal neuroendocrine cells, with malignant cells showing slightly stronger correlations (Supplementary Figure S2d,e; left panels).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
While single-cell analyses suggested a correlation between PA2G4 and MYC, this did not hold at the pseudobulk level for either malignant or normal cells.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Notably, MYC expression was relatively sparse across this dataset.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Taken together, these results suggest that in the NBAtlas dataset, where MYCN is more frequently expressed than MYC, PA2G4 shows a stronger correlation with MYCN.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The relationship between PA2G4 and MYC remains less clear, particularly in contexts where MYC expression is low, and may depend on tumor subtype.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
This leaves open the possibility that in MYC-driven neuroblastoma, PA2G4 could also play a role, though further datasets will be needed to clarify this.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Given the shared biological functions and 80% structural homology between MYCN and c-MYC , we investigated a potential regulatory relationship between c-MYC and PA2G4.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Western blot analysis was performed to quantify basal levels of both c-MYC and PA2G4 proteins in a panel of cancer cell lines (Figure 2A), including neuroblastoma (SH-SY5Y, SK-N-AS), medulloblastoma (DAOY, UW-228), and Burkitt Lymphoma and B-Acute Lymphoblastic Leukemia (ALL) cell lines (Raji, KOPN-8, SEMK2, P493-6, WEHI-116, WEHI-47).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
All malignant cells expressed moderate to high levels of both c-MYC and PA2G4, except the medulloblastoma cell line, UW228.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
This was in contrast to normal fibroblasts (MRC-5, WI-38).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Transcript expression of PA2G4 and c-MYC was analyzed in a panel of Neuroblastoma, Leukemia, Medulloblastoma, and non-cancerous cells using the publicly available datasets (CCLE, HPA) (Supplementary Table S1), and a positive correlation (R = 0.57, R = 0.53) was observed between c-MYC and PA2G4 levels across these cell lines in both the Western blot and the transcript expression data (Figure 2A).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To determine whether c-MYC regulates PA2G4 protein expression, levels of PA2G4 were assessed by the immunoblotting of total protein extracts from human neuroblastoma cell lines (SH-SY5Y, SK-N-AS) 48 h after c-MYC siRNA knockdown.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
There was a significant (p < 0.01) decrease in PA2G4 protein expression after c-MYC knockdown in both cell lines (Figure 2B).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Knockdown of c-MYC following the addition of Doxycycline (Dox) to the murine Burkitt lymphoma cell line, P493-6, in vitro also led to a significant (p < 0.05) decrease in c-MYC and PA2G4 protein expression over 96 h (Figure 2C).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Real-time PCR analysis showed that c-MYC knockdown resulted in a significant (p < 0.01) decrease in PA2G4 mRNA expression compared to the control after 48 h in neuroblastoma cells (Figure 2D), suggesting that c-MYC plays a role in PA2G4 transcriptional regulation.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To investigate whether PA2G4 forms a positive feed-forward expression loop with c-MYC, similar to its previously described interaction with MYCN , we transiently silenced PA2G4 using siRNA in neuroblastoma cell lines.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Protein and mRNA expressions of c-MYC and PA2G4 were examined using immunoblotting and qPCR, respectively.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
There was a significant decrease (p < 0.01) observed in both c-MYC and PA2G4 protein expression 48 h after PA2G4 knockdown in SH-SY5Y and SK-N-AS cells (Figure 3A).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
There was no change observed in c-MYC mRNA expression after PA2G4 silencing (p > 0.05; Figure 3B).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To further examine the effect of PA2G4 on c-MYC protein stability, a cycloheximide (CHX) chase assay was performed.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
PA2G4 expression was reduced in SK-N-AS cells transfected with a siRNA targeting PA2G4 (siPA2G4#2) for 48 h. Addition of CHX (100 μg/μL) reduced protein expression of c-MYC in both siControl and siPA2G4 conditions (Figure 3C); however, c-MYC degradation occurred more rapidly after PA2G4 knockdown in comparison to control.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The half-life of c-MYC protein decreased from 67.8 min to 29.1 min after PA2G4 knockdown (Figure 3C).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Together, these results showed that PA2G4 was required for c-MYC protein stability in these neuroblastoma cell lines, independent of transcriptional regulation.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
WS6 is a known small molecule inhibitor of PA2G4 .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Given our findings that PA2G4 and c-MYC form a positive forward feedback expression loop in MYC- and MYCN-driven cancers, we hypothesized that WS6 would repress the expression of both proteins in c-MYC-driven malignant cells.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Neuroblastoma cell lines (SH-SY5Y and SK-N-AS and BL cell lines (WEHI-47 and KOPN-8), characterized by high c-MYC expression, were treated with increasing concentrations of WS6 (0–2 µM).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Immunoblot analysis revealed a dose-dependent reduction in both c-MYC and PA2G4 protein levels in SK-N-AS and SH-SY5Y cells (Figure 4A) at all concentrations.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Significant downregulation of these proteins in WEHI-47 and KOPN-8 lymphoma cells was only observed at the highest WS6 concentration (2 μM).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
WS6 demonstrated cytotoxic effects with IC50s (0.095–2.94 µM) in the neuroblastoma, medulloblastoma, leukemia, and lymphoma cell lines, compared to normal fibroblasts (4.9 & >10 µM) (Figure 4B and Figure S4).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
To investigate whether c-MYC was necessary for the WS6-mediated cytotoxicity, we used the P493-6 Burkitt lymphoma cell line, which expresses a doxycycline-repressible c-MYC transgene .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
WS6 was significantly more cytotoxic in c-MYC-expressing P493-6 -Dox cells, compared to P493-6 +Dox cells.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The IC50 of WS6 increased to twice as much after the addition of Dox, with the greatest change observed in the IC50 at 96 h from 0.8 µM in c-MYC-expressing cells (P493-6 -dox) to 2.2 µM in c-MYC-suppressed cells (P493-6 +dox) (Figure 4C).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
These results indicate that c-MYC knockdown reduces sensitivity to WS6 treatment, thus demonstrating that the growth inhibitory effects of the PA2G4 inhibitor, WS6, are partially c-MYC dependent.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Given that cytotoxic chemotherapy is routinely used to treat each of these c-MYC-driven malignancies , we hypothesized that chemical PA2G4 and c-MYC inhibition by WS6 would have synergistic growth-inhibitory effects with chemotherapy in c-MYC-driven malignant cells.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
We examined the effects of WS6 used in combination with either Vincristine, Cisplatin, or Etoposide on the cell viability of the neuroblastoma cell line, SH-SY5Y.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Synergy was determined using BLISS (Supplementary Figure S5).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The combinations of WS6 with these conventional chemotherapy agents (Vincristine, Cisplatin, and Etoposide) led to synergistic cytotoxicity when compared to the single agents alone (Figure 5).
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Our study provides novel insights into the role of PA2G4 as a critical regulator of c-MYC stability and underscores its potential as a therapeutic target across MYC-driven cancers.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
We present the first in vivo evidence demonstrating the essential role of PA2G4 in MYCN-driven neuroblastoma .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Mechanistically, we demonstrated that PA2G4 is essential for maintaining c-MYC protein stability and cell viability across various c-MYC-expressing cancer cell lines.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Pharmacological inhibition of PA2G4 using the small molecule inhibitor WS6 resulted in a decrease in both c-MYC and PA2G4 protein levels and significantly enhanced cytotoxicity in c-MYC overexpressing cell lines.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Together, these findings establish PA2G4 as a critical modulator of MYC oncogenic activity and a promising therapeutic vulnerability in c-MYC-driven malignancies.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Our study demonstrates for the first time that PA2G4 is essential for MYCN-driven tumorigenesis in vivo, as knockout of PA2G4 significantly increased the survival of Th-MYCN mice.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Notably, both alleles of PA2G4 had to be knocked out to observe a survival benefit in homozygous Th-MYCN mice.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
However, in hemizygous Th-MYCN mice, a single allele knockout was sufficient to prolong survival, suggesting a gene dosage effect between MYCN and PA2G4 in driving tumor progression.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
MYC is an intrinsically disordered protein that has long been considered “undruggable” due to the absence of a defined binding pocket.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
As such, previous efforts have primarily focused on indirect strategies to target MYC, including disrupting the MYC/MAX dimer or inhibiting its interaction with various other protein binding partners .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Compounds that target the MYC/MAX interaction have some effect in cancer, though these inhibitors often suffer from limited potency and significant off-target effects .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
As a result, attention has shifted toward regulatory proteins that influence MYC stability.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
The stability of the MYC protein is tightly regulated through phosphorylation and interactions with specific proteins.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Phosphorylation at Ser62 (by ERK/CDK) followed by Thr58 (by GSK3β) allows the E3 ubiquitin ligase FBXW7 to recognize and target MYC for degradation .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
However, this process can be counteracted.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
PP2A stabilizes MYC by dephosphorylating Ser62 .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
PIN1 prevents FBXW7 recognition by isomerizing the phosphorylated Thr58-Pro motif ; and deubiquitinases USP28 and USP7 , as well as Aurora A kinase, protect MYC from degradation .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Our study introduces PA2G4 as a novel regulator of MYC protein stability.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
We demonstrate that PA2G4 stabilizes c-MYC in cancer cells, thereby expanding the landscape of MYC-interacting proteins that can be exploited for therapeutic intervention.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Targeting PA2G4 may offer a new and more selective approach to destabilize MYC in malignancies where direct targeting remains challenging.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
PA2G4 is a DNA and RNA-binding protein involved in key cellular processes such as growth, apoptosis, and differentiation , with the longer isoform, PA2G4-p48, exhibiting oncogenic properties .
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
Overexpression of PA2G4 has been associated with enhanced tumor progression in glioblastoma and oral squamous cell carcinoma pre-clinical models , supporting its role as a driver of malignancy.
PMC12468391
PA2G4 Functions as a Cofactor for MYC Family Oncoproteins in MYC-Driven Malignancies
In line with these findings, a recent proteogenomic analysis identified the PA2G4-MYC axis as a druggable vulnerability in 3q26-amplified acute myeloid leukemia (AML) , where PA2G4 overexpression conferred resistance to HDAC inhibitors, while its inhibition suppressed leukemia progression in patient-derived xenograft models.