text
stringlengths
0
868k
Tsc is an autosomal dominant disorder caused by the inactivation of either of 2 tumor suppressor genes, hamartin (tsc1) or tuberin (tsc2). In the normal state, the hamartin - tuberin complex activates the protein ras homolog enriched in brain (rheb), which inhibits mammalian target of rapamycin (mtor). If a tsc mutation is present, mtor is constitutively activated, leading to abnormal cellular proliferation, ribosome biogenesis, and mrna translation . As a consequence, tsc is characterized clinically by the growth of benign tumors in multiple organs, including the brain, the heart, the kidneys, the lungs, and the skin1). The severity of the disease is highly variable, ranging from mild skin manifestations to intractable epilepsy, mental retardation, and autism3). Rapamycin (also called sirolimus) is an immunosuppressive drug that has recently been shown to extend lifespan in multiple species, including mammals4). This anti - aging property is presumably related to the mtor - inhibiting properties of rapamycin . The mtor pathway is crucial for the coordination of growth in response to energy status, stress, and nutrient availability5). The potential anti - aging properties of rapamycin and other mtor inhibitors, such as rad001 (everolimus), and cci-779 (temsirolimus) are of great interest . Unfortunately, the side effects associated with these drugs preclude research trials to study their impacts on aging in healthy individuals . In view of this obstacle, experts in the field of aging have suggested that these potential anti - aging drugs should be introduced in clinical trials for the treatment of particular diseases, and then, if appropriate, be approved for prevention of all age - related diseases in healthy individuals6). Mtor is a 290-kda serine / threonine protein kinase that is highly conserved among mammals and also has closely related analogs in lower eukaryotes, such as drosophila and yeast7). Mtor has been implicated in numerous cellular functions, many of which are related to the fundamental processes of cell growth, survival, and homeostasis8). A variety of upstream signaling pathways can regulate mtor activity in response to different extracellular stimuli or intracellular signals, including nutrient and energy status, growth factors, and stress9). In turn, mtor responds to these upstream signals by modulating multiple downstream pathways, which mediate cellular growth, proliferation, metabolism, and survival, usually due to direct changes in the translation of relevant proteins10). Thus, during anabolic states in the presence of nutrients, growth factors, or insulin, signaling through specific upstream pathways, such as the phosphatidylinositol-3 kinase (pi3k)/akt (protein kinase b) pathway, activates mtor, leading to increased protein synthesis, cellular growth, and proliferation11). In catabolic states with nutrient / energy or oxygen deprivation, other upstream regulators, such as amp - kinase, inhibit mtor activity, thus decreasing protein translation and cellular growth, proliferation, and metabolism9). Activation or inhibition of mtor by upstream pathways is generally accomplished through opposing effects on the tuberous sclerosis gene products, hamartin and tuberin, and on the small gtpase protein, rheb . The cell signaling pathway involving mtor is further complicated by poorly defined intermediate steps, multiple feedback loops, and the formation of mtor complex 1 (mtorc1) and mtor complex 2 (mtorc2). Mtorc1 and mtorc2 are functional complexes of mtor bound to the regulatory proteins raptor and rictor respectively, which differ in their sensitivity to the mtor inhibitor, rapamycin12). In addition to its functions in cellular growth and proliferation, mtor has other important and complex roles in regulating cell survival and cell death, especially in relation to the processes of autophagy, apoptosis, and immune regulation . Autophagy involves the degradation and recycling of proteins and other macromolecules, and normally promotes cell survival under conditions of bioenergetic stress or in catabolic states where resources are limited . However, in some situations, autophagy may also mediate an alternative (non - apoptotic, autophagic) form of programmed cell death (type ii pcd), thus revealing a dual role of autophagy in promoting both cell survival and death, depending on the cellular context13). In anabolic states, in addition to stimulating protein synthesis, mtor generally inhibits autophagy and thus reduces the degradation of proteins . Conversely, mtor inhibitors, such as rapamycin, usually stimulate autophagy, with a resultant neuroprotective effect in various models of brain injury14). Finally, mtor plays a critical role in immune responses via regulation of antigen - presenting cells and t - cells, and rapamycin is used clinically as a potent immunosuppressant drug . While the effects of rapamycin on autophagy, apoptosis, and immune regulation may most directly translate into neuromodulatory and neuroprotective properties, these features may also have anti - epileptogenic effects . The clinical and therapeutic importance of mtor is wide - reaching and continues to expand . Abnormal mtor activity, leading to excessive cellular growth and proliferation, has been implicated in the pathophysiology of numerous human cancers, including both sporadic, isolated organ - specific and multiorgan tumors, genetic tumor syndromes . In many of these cases, specific mutations of some component of the mtor signaling pathway has been documented, resulting in hyperactivation of mtor or its downstream effectors . On the basis of the physiological and pathophysiological properties of mtor, it is reasonable to hypothesize that mtor signaling could be involved in mechanisms of epileptogenesis15). The current main clinical complication related to tsc for which treatment with mtor inhibitors is indicated is subependymal giant cell astrocytoma (sega). This complication affects approximately 15% of patients with tsc and it occurs in the pediatric age group16). The traditional management approach is to monitor segas with periodic neuroimaging, and to resect those that exhibit growth and/or are associated with clinical signs of intracranial hypertension . This approach is being challenged by recent observations that suggest that mtor inhibitors such as rapamycin (sirolimus) and rad001 can induce partial regression of segas17,18). The first report showing clear regression of segas in 5 patients with the use of rapamycin recently, a phase ii trial18) using everolimus to treat segas in 28 patients with tsc showed sega reduction of at least 30% in 21 patients (75%) and at least 50% in 9 patients (32%). Everolimus was well tolerated, as only single cases of grade 3 treatment - related sinusitis, pneumonia, viral bronchitis, tooth infection, stomatitis, and leukopenia were reported . These observations suggest that treatment with mtor inhibitors could serve as an acceptable alternative to sega surgery . Renal angiomyolipomas and lymphangioleimyomatosis are other tsc manifestations against which mtor inhibitors have proven potential efficacy19). In addition, animal models of tsc have suggested that mtor inhibitors could have beneficial effects on cognitive deficits20) and on epileptogenesis15). Whether similar benefits would be observed in humans with tsc there is clear evidence that segas grow back after administration of the mtor inhibitor is stopped17). This cohort of patients, who will experience prolonged exposure to mtor inhibitors, should be carefully followed longitudinally to better document long - term side effects, but also to compare their longevity with that of similar patients receiving tscs . These patients represent a unique opportunity to study the potential anti - aging properties of mtor inhibitors in humans . In animal models, mtor inhibitors showed that mtorc1 blockade alone and pi3k - mtor blockade lead to suppression of tumor development and longer survival of the treated animals21). Rapamycin, the first mtor inhibitor used in individuals with tsc - associated lesions, was able to stimulate regression of subependymal giant cell tumors (sgcts)17). Subsequent studies have confirmed its efficacy in sgcts, but also in other lesions such as angiomyolipomas22). The effects of mtor inhibitors on the mtor pathway result in decreased protein synthesis and cell - cycle arrest, as well as decreased angiogenesis . More recently, a new mtor inhibitor, rad001, has been used in the treatment of 28 patients with tsc - associated brain lesions but with no symptoms of increased intracranial pressure18). In particular, this study reports a reduction in tumor size of at least 30% in 75% of patients and at least 50% in 32% of treated individuals . Varying degrees of reduction of sgct size have been observed in all the 38 patients treated with mtor inhibitors (sirolimus or everolimus) to date . Most sgct reductions occur in the first 3 months of mtor inhibitor treatment, after which the rate of reduction slows . In recent case reports, a similar anti - tumor efficacy was achieved, even with lower serum levels of everolimus23). None of the patients treated with mtor inhibitors required surgery or developed new sgcts while receiving treatment17,18). The treatment was also associated with a clinically relevant reduction in the overall frequency of seizures and an improvement in quality of life . Unfortunately, regrowth of sgcts occurred a few months after drug discontinuation in all but one of the reported patients24). Therefore, mtor inhibition may need to be continuous for the benefits to persist, and the benefits and hazards of long - term treatment with low - dosage mtor inhibitors should be evaluated . An early diagnosis of sgct in neurologically asymptomatic children with tsc may allow prompt surgical removal of the tumor before the appearance of signs of increased intracranial pressure, and this approach is being progressively adopted to lessen the morbidity / mortality rate . However, the dramatic response of tsc - associated sgcts to mtor inhibitors suggests that these drugs could be a potential alternative to surgery in many cases . Mtor inhibitors could be recommended when an asymptomatic sgct shows growth in 2 consecutive magnetic resonance imaging evaluations following diagnosis . Mtor inhibitors could also be used as an initial treatment to facilitate subsequent surgery in individuals with bilateral lesions . Medical therapy may also have a role when sgcts present in an atypical location or exhibit aggressive growth . Furthermore, in case of regrowth after a first resection, considering the higher risk of further surgery, pharmacotherapy could provide an alternative method to keep lesion size under control . Little is known about the long - term efficacy and safety of low dosage use of mtor inhibitors and whether regrowth could be prevented by a more prolonged treatment course . In animal models, rapamycin dosing comparison studies indicated that the duration of rapamycin treatment is more important than dose intensity in terms of efficacy; prolonged treatment with low doses of mtor inhibitors resulted in more complete and durable tumor responses25,26). Our current understanding of the effects of continuous mtor inactivation in individuals with tsc is still poor . Mtor inhibitors may also activate pathways that should not be activated, and this issue will need to be taken into account when a long - term treatment is proposed . The feasibility and timeline for discontinuation of mtor inhibitor - based pharmacotherapy also remains unclear, and further studies are required to explore the optimal duration of treatment . Since it is known that the growth of sgcts tends to slow in early adulthood, mtor inhibitor treatment should theoretically be undertaken until the patient reaches around 20 years of age . Strategies for future clinical trials with mtor inhibitors may include the investigation of longer treatment durations with minimum dosage . When choosing between surgical and/or medical intervention, clinicians should take the risks and benefits of each option into account . There are several issues to be considered, and every decision should be discussed thoroughly with the parents and tailored to the individual case . Depending on the age of the patient, one option may be more valid than the other . For example, pharmacotherapy might be preferred when a growing sgct is discovered in adolescents, as the therapy may only be required for a few years . On the other hand, in childhood the positive effect that mtor inhibitors have on several manifestations of tsc is an important factor in favor of pharmacotherapy, and should be considered in patients presenting with problems such as renal angiomyolipomas, pulmonary lymphangioleiomyomatosis, and/or intractable epilepsy, in addition to sgcts . Since the activation of the mtor pathway has been implicated in epileptogenesis, mtor inhibition could have antiepileptic effects in patients with tsc18,27). Inhibition of the mtor pathway may provide a biologically targeted therapy that has the potential to change current clinical practice regarding management of sgcts . Currently, it is still unclear whether pharmacotherapy is able to prevent or merely delay the need for surgical resection of sgcts . In the coming years, medical treatment will certainly play a larger role in the management of children with tsc, as our understanding of the pathogenesis of this disorder at the molecular level improves . In conclusion, a new treatment era has begun in the field of tsc since the discovery of the potential beneficial effects of mtor inhibitors . Although the use of mtor inhibitors is becoming increasingly accepted, especially for the treatment of segas in tsc, questions remain concerning the duration of treatment and long - term side effects . Whether mtor inhibitors will have a significant impact on longevity in tsc is unknown, but warrants attention, as mtor inhibitors are increasingly recognized as anti - aging drugs in animal models . Long - term prospective studies in patients with tsc will provide information on the potential anti - aging properties of mtor inhibitors in humans.
Toe gripping is defined as a complex motion that involves several muscles, similar to hand gripping . The muscles involved in the foot include the flexor pollicis brevis, flexor pollicis longus, lumbrical, flexor brevis, and flexor longus1 . The position in which toe grip strength is measured has been standardized; the subject is required to sit with the trunk in the vertical position, the hip and knee joints at 90, and the ankle joint in a neutral position1,2,3,4,5 . However, there are few reports6,7,8 on positions for measuring toe grip strength, and the positions used during these measurements have not been sufficiently investigated . Souma et al.6 reported that the ankle angles in a neutral position and in dorsal flexion were better than plantar flexion in terms of producing the maximum toe grip strength . Nakae et al.7 reported similar levels of muscle strength exerted in the currently used measurement positions, namely sitting with the hips and knees flexed to 90 and the standing position . Studied toe grip strength under the following 3 conditions in order to determine their reproducibility: 90 hip and knee flexion while sitting, 90 hip flexion and knee extension while sitting, and a standing position . They reported that 90 hip and knee flexion while sitting could be exerted and allowed for measurement reproducibility . However, these reports suggest that the current 90 hip and knee flexion while sitting position is the most suitable limb position for measuring toe grip strength in terms of reproducibility and the ability to exhibit maximum strength8 . Ankle angle is defined as the angle formed between the long axis of the foot and the line of progression9, with hip and knee rotation and ankle abduction / adduction presumably acting as determining factors . In young adults, the normal ankle angle during walking ranges from 2.6 to 17.410,11,12 . The muscles involved in the exertion of toe grip strength have been shown to operate from the mid stance to the forward swing phase of the gait cycle13, contributing to forward propulsion and stance stability, among others . Thus, the amount of toe grip strength exerted on a horizontal surface can be affected by the ankle angle . Nevertheless, nakae et al.7 did not consider the effects of ankle angle in the horizontal plane when comparing between sitting and standing toe grip strength . Therefore, evidence on the ankle angle while sitting and standing, which focuses on the foot being on a horizontal surface, is needed . The purposes of this study were to investigate whether toe grip strength and muscle activities are affected by the ankle angle in the horizontal plane in the sitting upright and standing positions . Their age, height, and body weight (mean standard deviation) were 20.8 0.7 years, 159.3 5.8 cm, and 50.9 6.2 kg, respectively . The present study was approved by the ethics committee for human research of tohoku fukushi university (rs160102), and the subjects provided informed consent to participate . We synchronously recorded the toe gripping strength of the dominant foot and the emg activity of the ipsilateral lower leg to assess the muscle activities of the rectus femoris, biceps femoris, anterior tibialis, and medial head of the gastrocnemius . The sitting upright and standing positions were used in the measurement of toe grip strength . For the sitting upright position, the subjects were instructed to sit with the trunk vertical and the hip and knee joints at 90. for the standing position, the feet were placed shoulder - width apart, and the ankle was in a neutral position with regard to dorsiflexion and plantar flexion with the arms hanging down at the sides of the trunk . To compensate for the height of the toe grip dynamometer, the height of the leg not being measured was adjusted using a supplemental platform . In each position, toe grip strength was assessed in 3 different ankle joint positions between the long axis of the foot and the line of progression in the horizontal plane, namely 10 of internal rotation, 0, and 10 of external rotation . After a sufficient number of training trials and adequate rest, the toe gripping strength was measured twice . The right toe was dominant; the dominant toe was defined as the toe used to kick a ball . To measure the maximum voluntary contraction (mvc) activities of the tibialis anterior and medial head of the gastrocnemius muscle, each subject was instructed to sit in a chair with the ankle joint in a neutral position and to exert the maximal forces of plantar flexion and dorsiflexion in isometric contraction to resist the forces applied by the examiner in the directions of dorsiflexion and plantar flexion . To measure the mvc activity of the rectus femoris and biceps femoris muscles, each subject was instructed to sit in a chair with the hip and knee joints at 90 and to exert the maximal isometric forces of knee extension and flexion in isometric contraction to resist the forces applied by the examiner in the directions of flexion and extension . Muscular activity was measured using a surface emg apparatus (telemyo g2, noraxon usa inc ., scottsdale, az, usa). After confirming adequate skin preparation (skin resistance of <5 k), electrodes (blue sensor, ambu inc ., ballerup, denmark) were attached to the tibialis anterior, medial head of the gastrocnemius, rectus femoris, and biceps femoris muscles, as described by peroto14 . The emg signals were collected and transferred to a personal computer using analysis software (myoresearch xp, noraxon usa inc ., scottsdale, az, usa).the bandwidth was 10500 hz . The emg signal segment selected and integrated (iemg) for analysis was the middle 1 s of the entire 3-s duration of continuous maximal toe grip strength exertion . The muscular activity used for analysis was based on the data for the maximum toe grip strength . Chicago, il, usa) was used for statistical analysis . The comparison between grip strength and muscle activities during the toe gripping action for position and measurement conditions was performed by using the two - way repeated - measures analysis of variance (anova). Table 1table 1.comparison of each positions and each measurement conditionssitting upright positionstanding positionmain effectinternal rotationneutral positionexternal rotationinternal rotationneutral positionexternal rotationpositionmeasurement conditionstoe gripping strength (kg)20.03.320.22.621.13.720.23.620.53.220.33.5rectus femoris muscle (% iemg) 3.12.0 3.12.0 3.01.610.38.011.39.410.78.6**long head of the biceps femoris muscle (% iemg)21.612.823.116.123.017.115.58.016.97.217.09.8tibialis anterior muscle (% iemg)23.116.023.116.123.916.427.218.032.924.730.019.7medial head of the gastrocnemius muscle (% iemg)54.323.959.720.661.423.131.711.333.810.433.910.7**mean standard deviation (sd). * p <0.05 shows the average and standard deviations of the measured values in the 16 subjects . The results of the two - way anova showed significant differences . A significant main effect was observed in the measurement conditions for the percent integrated electromyography (% iemg) of the rectus femoris muscle (f(2,13) = 13.1, p <0.05) and the long head of the biceps femoris (f(2,13) = 28.4, p <0.05). Multiple comparisons revealed that the% iemg of the rectus femoris muscle was significantly higher in the standing position than in the sitting upright position and that the% iemg of the medial head of the gastrocnemius was significantly lower in the standing position than in the sitting upright position (p <0.05; table 1). * p <0.05 the results of the two - way anova did not show any significant difference . A significant main effect was not observed in toe grip strength,% iemg of biceps femoris, and anterior tibialis muscles . The present study investigated whether toe grip strength and muscle activities are affected by the ankle angle in the horizontal plane in the sitting upright and standing positions . In our analysis, these findings suggest that exerted toe grip strength is only slightly affected by the ankle angle in the horizontal plane in the sitting upright and standing positions . The present study showed that toe grip strength was not affected by the positions and measurement conditions . Previous studies also demonstrated a similar level of muscle strength exerted in both measurement positions, namely sitting with the hips and knees flexed to 90 and the ankle at its neutral position, and the standing position . Furthermore, the present study demonstrated the new finding that toe grip strength is not affected by changes in ankle angle . Joint movement is limited by, for example, ligaments and joint capsule soft tissues, but this limitation presumably begins after muscles and other soft tissues have been extended . The subjects in this study were healthy women who demonstrated greater flexibility and range of motion in their joints than the men in previous studies15, 16 . The fixed ankle angle positions of 10 of internal rotation, 0, and 10 of external rotation may not be determining factors of toe grip strength in the present study because of the subjects extraordinary joint flexibility, which allowed them to exert general movement through knee and hip rotation and ankle abduction / adduction . The muscles with which toe grip strength is exerted (flexor hallucis brevis, flexor hallucis longus, flexor digitorum brevis, flexor digitorum longus, and lumbricals) originate in the legs and upper feet and insert into the toes . Therefore, as hip and knee joint rotation presumably has a large effect on ankle abduction / adduction, future studies must keep hip and knee joint rotation fixed . The present study showed that the% iemg of the rectus femoris muscle was significantly higher in the standing position than in the sitting upright position and that the% iemg of the medial head of the gastrocnemius was significantly lower in the standing position than in the sitting upright position . Previous studies also demonstrated that the% iemg of the medial head of the gastrocnemius was significantly lower in the standing position than in the sitting upright position7 . In addition, the present study revealed was as new knowledge that the% iemg of the rectus femoris muscle was significantly higher in the standing position than in the sitting upright position . The activities of the quadriceps muscle increase more easily in the standing position than in the sitting upright position because this muscle is an antigravity muscle, the activities of which are controlled in the standing position . In addition, we inferred the following observations: when measuring toe grip strength in the standing position, the center of gravity can shift posteriorly as toe grip strength is exerted, requiring the subject to bend the forefoot (including the toes). Both the ankle and hip joints are used to compensate for this posterior center of gravity, which results in knee joint extension . The joints should be stabilized when exerting muscular force; therefore, we feel that by fixing the knee joint in the direction of extension, great toe gripping power can be exerted . Thus, it appears that the quadriceps activity increases to fix the knee in an extended position, that is, to stabilize the knee . The present results show that the current measurement positions, namely sitting with the trunk vertical and the hip and knee joints at 90 angles and the ankle joint at neutral position, was optimal for measurement because it has the added advantage of facilitating measurement in subjects who are unable to maintain a stable standing posture or have difficulty in standing.our study has some limitations . First, we were unable to avoid various common problems that negatively affect surface emg, such as resistance of the skin, artifacts, and the effects of proximal muscles . Second, only healthy young women participated; thus, it is difficult to extrapolate our findings to the general population.
Fractures have a high incidence rate in traffic accidents and are one of the three most important complications during accidents (1). Each year millions of people all over the world suffer from bone fractures, the complications of which threaten the patients health for several years (2, 3). One of the most important measures in the management of such patients in the emergency unit is fixation and pain control . Opioids are one of the main and most effective medications to relieve pain (4, 5) by suppression of pain center in the cns through stimulation of and receptors . However, complications such as dependence, tolerance, suppression of respiratory center and activation of vomiting center are some of their problems (6). Nonetheless, this group of medications has gastrointestinal complications and even some of them exhibit renal and hepatic toxicity (7). Paracetamol, aminophylline, tramadol, nefopam etc are some other drugs that have been evaluated in different studies for pain relief . It is one of the medications, which is used for general anesthesia and sedation . Ketamine is an antagonist of n - methyl - d - aspartate (nmda) (8, 9) and is used in iv, intramuscular, enteric, subcutaneous, intra - nasal, rectal and epidural forms . However, at higher doses it can have complications such as hallucination, dysphoria, nightmares, an increase in intracranial pressure, hypertension, tachycardia, tremors and clonic - tonic seizures (10, 11). Several studies have shown that ketamine is effective in pain relief; however, in the majority of studies available, ketamine has been used in conjunction with other analgesics and no study is available in which use of this medication alone has been comprehensively evaluated for pain relief . On the other hand, studies available have not evaluated the use of this medication in trauma patients in emergency units . Therefore, the present study was designed to evaluate the effect of ketamine alone on pain relief in trauma patients referring to an emergency unit of a third - level hospital . Study design and setting the present double - blind clinical trial was carried out in 2012 - 2013 in al - zahra and ayatollah kashani educa - tional centers in isfahan, iran . The subjects consisted of patients with fractures of long bones, referring to the emergency unit . The protocol of the study was ap - proved by the ethics committee of isfahan university of medical sciences . The study was registered in iranian registry of clinical trial (irct number: irct2015042812072n3). The inclusion criteria consisted of an age range of 18 - 55 years, fractures of long bones and consent to participate in the study . Exclusion criteria consisted of drug abuse, trauma to the head, symptoms and signs of increased intracranial pressure, a decrease in consciousness level, respiratory problems, a history of asthma, contraindications for ketamine (i.e. A history of cardiac problems, especially congestive heart failure, ischemic cardiac conditions, hypertension and patients with cerebrovascular attack) and morphine (i.e. Asthma, respiratory problems, hemodynamic instability). In addition, in case of any allergic reaction to any of the medications used, the patient was excluded from the study . The sample size was estimated at 63 subjects in each group based on numeric rating scale (nrs) at 95% confidence interval, a study power of 80%, a standard deviation of 1.6 for pain severity and a minimum difference significance of 2 between the two groups (12). First the patients demographic and clinical data were recorded, which consisted of background diseases, drugs taken, drug abuse, drug allergies, the last meal eaten, location of fracture and severity of pain . Then the eligible patients were randomly divided into two groups: the group receiving iv morphine at a dose of 0.1 mg / kg and the group receiving iv ketamine at a dose of 0.5 mg / kg . To make sure of the double - blind protocol of the study, preparation of the solutions, injections and registration of the results were carried out by three different physicians who had no contact or relationship with each other . The data on the injection of medications were available only to the chief researcher and the medical care personnel were granted access to such data only when drug complications arose . In such a case, the severity of pain was registered before injection and 10 minutes after injection based on nrs (13). In cases in which pain did not subside after 10 minutes (a decrease in pain severity equal to or less than 3), the patient received half the initial dose again . Demographic variables (%) of patients statistical analysis data were entered into spss 11.5 and were analyzed after being transferred to stata 11.0 software . The severity of pain before administration of medications and 10 minutes after initiation of treatment, was reported as means standard deviations and analyzed using independent t - test . Then kaplan - meier curves and log rank analysis were used to evaluate the success of treatment, which was defined as a decrease of 3 scores in pain severity . 126 patients were included in the study and randomly divided into two equal groups of morphine and ketamine . The mean ages of the patients in the morphine and ketamine groups were 53.614.3 and 35.113.5 years, respectively (p=0.54). Forty - five (71.4%) and 51 (80.95%) patients were male in the ketamine and morphine groups, respectively (p=0.21). The mean pain severity scores at admission in the ketamine and morphine groups were 8.80.8 and 8.950.8, respectively (p=0.32). After therapeutic intervention, the severity of pain decreed significantly in the ketamine (2.71.8; p<0.001) and morphine groups (2.41.5; p<0.001), with no significant differences between the two groups (p=0.28), indicating that both medications are equally effective in alleviating pain (figure 1). Kaplan - meier curve showed that five minutes after initiation of injection, ketamine and morphine resulted in a successful decrease in pain severity in 33 (52.4%) and 38 (60.3%) patients, respectively . This rate increased to 59 (93.65%) and 61 (96.8%) patients, respectively, after 10 minutes . Log rank test did not show any significant difference in success rates between the two groups (p=0.62) (figure 2). None of the patients receiving morphine exhibited any complications; however, during the intervention, six patients (9.5%) receiving ketamine developed emergence phenomenon (p=0.28). And four patients (6.3%) in this group required a rescue dose due to the short period of the drug effect (p=0.12). The results of the present study showed that administration of a low dose of ketamine (0.5 mg / kg) results in a significant decrease in pain severity of long bone fractures . The incidence of drug complications was higher in the ketamine group compared to the morphine group (p=0.028), with emergence phenomenon in four subjects . Although the incidence of this complication was higher in the ketamine group, other studies have emphasized that since ketamine is one of the safest and most appropriate medications for sedation in emergency wards, such a complication should not preclude its use because this complication is resolved spontaneously without any therapeutic intervention (14). The majority of studies available have evaluated the efficacy of combination treatment with morphine/ ketamine in decreasing pain due to fractures . Galinski et al showed that use of low doses of ketamine decreases the need for morphine up to 26% and its efficacy when administered alone is similar to that of morphine in alleviating pain (5). Weinbroum et al evaluated the simultaneous administration of morphine / ketamine compared with morphine alone in decreasing pain severity after surgery and showed that simultaneous administration of morphine and ketamine results in a significant decrease in pain severity perception by patients (15). A systematic review, too, showed that use of ketamine as a supplementary medication results in a decrease in the need for morphine, preventing unfavorable complications (16). Means (sd) of pain severity in patients receiving ketamine and morphine before and after intervention . * nrs: numeric rating scale . The treatment success rate in the morphine and ketamine groups at different time intervals . Mccarty et al, too, reported that ketamine is an appropriate, rapid and safe sedative agent, which facilitates reduction of fractures in children in the emergency unit . However, they claim that ketamine should only be administered in locations, such as emergency units, where precise monitoring of patients is possible and an experienced physician is available in the center for the management of airways (17). Snijdelaar et al reported that the combination of ketamine / morphine significantly decreases the need for morphine and has better analgesic effects (18). Jennings et al reported similar findings but emphasized that more minor complications are seen with a combination of morphine / ketamine (12). One of the most important limitations of the present study was a short follow - up period of patients . In the present study, all the patients were evaluated for only 10 minutes, which precluded evaluation of the effect of ketamine at longer periods . Therefore, it is suggested that in future studies the efficacy of the medication be evaluated at longer follow - up periods . Due to ethical considerations, it was not possible to follow the patients without any medicinal intervention and use only placebo . It was shown in the present study that iv administration of ketamine results in pain relief in bone fracture patients . However, the effect of this medication on the recurrence of pain is still unknown . Therefore, it is possible that further administration of the medication will prevent recurrence of pain . In addition, the efficacy of other routes for administration of the medication, such as intramuscular, intra - nasal and local use, should be evaluated in future studies . In addition, use of different administration regimens, such the continuous use or infusion, should be evaluated in future studies . The results of the present study showed that administration of a low dose of ketamine (0.5 mg / kg) results in a significant decrease in the severity of acute pain in patients with fractures of long bones . All authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors.
Dermatosis neglecta is a condition secondary to lack of cleanliness, characterized by the formation of hyperkeratotic plaques located in a specific region of the body, usually due to a psychiatric condition, physical disability or neurological deficit . It is considered a diagnostic challenge because it can mimic other entities such as hyperkeratotic syndromes or hyperchromic lesions . An 18-year - old woman presented with a 2-month history of progressive brown verrucous plaque on the face, previously treated with no improvement (fig . Our first impression was seborrheic dermatitis and we treated her with facial cleanser soap, topical hydrocortisone 1% b.i.d . Per 3 days and then q.d . One month later she arrived with new lesions, therefore our diagnosis changed to darier's disease versus seborrheic pemphigus versus foliaceus pemphigus . Biopsy with histopathological and immunofluorescence studies were ordered with results being compatible with seborrheic dermatitis . We performed a new patient interview and discovered depression secondary to her pathology as well as social withdrawal . Dermatitis neglecta or unwashed dermatosis was first described in 1995 by poskitt et al . As a condition secondary to the accumulation of sebum, sweat, corneocytes and bacteria forming a hyperkeratotic plaque if affects all age groups and both sexes and clinically presents as hyperkeratotic plaques with cornflake - like scales with an evolution of 24 months; the lesions disappear with proper washing of the affected area [6, 7]. The diagnosis is clinical and lesions can be identified by removing the crusts with isopropyl alcohol . A biopsy is usually not necessary and orthokeratotic hyperkeratosis, papillomatosis and mild acanthosis can be seen without an inflammatory infiltrate [8, 9]. The main differential diagnoses are terra firma - forme dermatosis, confluent reticulated papillomatosis of gourgeot and carteaud, acanthosis nigricans, verrucous nevi, vagabond's disease, and genetic disorders such as darier's disease and x - linked ichthyosis [1, 8]. Terra firma - forme dermatosis is clinically very similar to dermatosis neglecta, but unlike dermatosis neglecta, it has a history of good hygiene and responds only to cleaning with isopropyl alcohol 70% [2, 6, 8]. Dermatitis artefacta presents as self - inflicted injuries or injuries worsened by the patient, while dermatosis neglecta is an act of omission of cleaning by the patient either intentionally or unconsciously . A diagnostic algorithm can be used as a tool when confronted with a difficult pathology (fig . Treatment is based on reinforcing hygiene measures and using keratolytic agents such as urea, retinoic acid, glycolic acid, lactic acid or salicylic acid [1, 7, 11]. Dermatosis neglecta is a disease that can be frequently misdiagnosed, since it has many differential diagnoses which include hyperkeratotic syndromes . The authors have no conflict of interest to declare . There were no funding sources.
Polymorphous low - grade adenocarcinoma (plga) has been known as a comparatively less aggressive malignant tumor that predominantly occurs in the minor salivary glands . It has been reported to occur rarely in the palate and the prognosis of this lesion is far better than adenocarcinoma as the regional metastasis would be very minimal . A clear difference between the biologic behaviors of adenocarcinoma and plga has been reported in literature . A 63-year - old female reported at our institute with a swelling in relation to her upper left back region of her jaw for three months, gradual in onset and associated with pain . After clinical and radiological examination, the differential diagnosis were consolidated abscess or minor salivary gland tumor . The post - operative follow up showed no evidence of recurrence and the healing was satisfactory . The site of predilection of plga is more in favor of palate (49 - 77.8%) followed by either upper lip or buccal mucosa (7.4 - 13.4%). There are sporadic reports of metastasis sometimes even transformation to a high grade adenocarcinoma, sometimes ending in mortality . Cervical lymph node metastasis is rare with reported incidence of 5 - 15% and is more commonly seen in recurrent tumor than the initial diseases . Extra palatal plgas present with significant papillary growth or arising from ventral surface of tongue frequently metastasize to cervical lymph nodes . Distant metastasis is very rare with an incidence of 7.5% and the site involved is the lung which is attributed to the inadequate control of the disease . Evans and batsakis first described plga as a distinct entity in 1984 as it is characterized as a tumor with low grade biologic behavior and diverse architectural pattern (1). Previously lobular carcinoma or terminal duct carcinoma of minor salivary glands were the terms used to describe the histological appearance of this tumor (2, 3). Plga is an indolent tumor, exclusively arising in the minor salivary glands (4, 5). Waldron et al . Has reported that it is the third most common intra oral malignancy occurring in minor salivary glands with an incidence rate of 26.4% among intraoral malignancies (6). Though it is common in minor salivary glands, two cases have reported in parotid gland (7) and one in the sublingual gland (8). As the tumor is asymptomatic, many times it is only diagnosed during routine diagnostic evaluation (9). A 63-year - old patient had reported at our institute with the chief complaint of swelling in relation to her upper left back tooth region for 15 days which has associated with pain for 3 days . There was no history of any secondary changes and the pain associated with the swelling was of a severe, throbbing type in relation to the middle third of face, which was aggravated on chewing food, causing difficulty in food intake . Her general examination has shown that review of her systems were normal except for bilateral palpable submandibular lymph nodes of size 1 2 cm which were soft, tender and mobile with no fixation to the underlying structures . Intraorally, on inspection, a solitary diffuse swelling of size 3 2 cm was present in relation to the left posterior part of the hard palate (figure 1). The swelling has extended anteriorly up to the 1 molar and posteriorly to the soft palate . The surface of the lesion appeared smooth with necrotic slough seen in the buccal vestibule . On palpation, all the inspectory findings in relation to the site, size and extent of the lesion have confirmed . There was also a root stump in relation to the left second molar which was tender on percussion . The provisional diagnosis was given as a minor salivary gland tumor with 2 other differential diagnosis namely palatal abscess and consolidated abscess in relation to left second molar . Routine hematologic investigations were normal and the radiologic investigations included a maxillary occlusal radiograph which had revealed an ill - defined radiolucency of size 1 2 cm present in relation to left third molar with ill - defined borders and an opg has revealed a root stump in relation to left third molar, there was no evidence of erosion or invasion of the underlying structures . The ct scan revealed involvement of the posterior aspect of the left hard palate, the alveolar process and buccal vestibule and multiple bilateral lymph nodes with possibility of pathology . An incisional biopsy of the lesion has done, and the histopathological features were indicative of uniform tumor cells exhibiting moderate eosinophilic to amphophilic cytoplasm, vesicular nuclei and occasional prominent nucleoli . Cytologically bland tumor cells have shown various patterns like nest, ductular, tubular and papillary patterns (figure 2) showing apoptotic bodies . A treatment plan of surgical excision of the primary lesion with immediate obturator placement was made . Accordingly the patient was administered general anesthesia and through an intraoral approach, palatal and buccal mucoperiosteal flaps were elevated and the lesion has exposed . Partial maxillectomy was done maintaining a tumor free margin of 2 cm and including the involved alveolar process . Regular follow up was done postoperatively, initially every day to change the gauze packing and later review was done every month . The wound healing was satisfactory showing healthy granulation tissue at the periphery of the lesion (figure 3). Since there were no signs of recurrence, after 6 months of follow up, the patient was given a definitive functional obturator . Plga is a distinct entity due to its architectural diversity, cytological uniformity, and indolent clinical behavior (2, 10). Its clinical behavior is characterized by slow rate of growth, absence of symptoms, less aggressiveness, minimal metastatic potential and good prognosis (11). The lesion described in this patient was similar to the ones previously described in literature in terms of the location, indolent course, minimal symptoms, delayed detection and histopathological features . From the past literature it is seen that plga is more frequent in females than in males with the female to male ratio being 3:1 (12). Also adults from the age group of the 3 and 7 decades were more frequently affected with the peak prevalence being in the 5 and 6 decades . In accordance with the prevalence of plga in literature site of predilection is more in favor of the palate (49 - 77.8%) followed by either the upper lip or buccal mucosa (7.4 - 13.4%) and rarely could involve floor of mouth, lower lip, alveolar ridge and tongue (1, 13 - 15). Literature has shown that plga could also arise in lung (16) maxilla (17), parotid gland (18) and submandibular gland (19). In our case the tumor had presented as an asymptomatic swelling with smooth margins and surface and was seen in the soft palate extending anteriorly to the hard palate . There were sporadic reports of metastasis sometimes even transformation to a high grade adenocarcinoma, sometimes ending in mortality as reported by evans et al . Cervical lymph node metastasis was rare with reported incidence of 5 - 15% and was more commonly seen in recurrent tumor than the initial disease (17). Extra palatal plgas had presented with significant papillary growth or arising from the ventral surface of the tongue and frequently metastasize to cervical lymph nodes (18). Distant metastasis was very rare with an incidence of 7.5% and the site involved is the lung which has attributed to the inadequate control of the disease (19). In our case neck and chest imaging many times a small incisional biopsy specimen was sufficient for diagnosis if the lesion was small or multiple incisional biopsy samples might be necessary for large tumors especially in case the differential diagnosis includes a salivary gland malignancy (1, 20). The tumor margins should also be examined to assess the presence of infiltration (1, 16, 17). In our patient, postoperative histopathological analysis of the excised specimen had indicated a plga which had bone invasion . If positive or close surgical margins is there, post - operative radiotherapy is recommended but it has not shown to alter outcome in patients without neck node metastasis . The recurrence rate for plga is minimal following wide excision and if present radical excision is warranted (12). In our case partial maxillectomy was followed by placement of an obturator . In general minor salivary gland tumors more case reports are needed to understand the site, age, sex, and prevalence and histological typing of this tumor which would help in the proper diagnosis and appropriate management of polymorphous low grade adenocarcinoma . Wide local excision should be the ideal treatment of choice . If positive or close surgical margins is there, post - operative radiotherapy is recommended but it has not shown to alter outcome in patients without neck node metastasis . The recurrence rate for plga is minimal following wide excision and if present radical excision is warranted (12). In our case more case reports are needed to understand the site, age, sex, and prevalence and histological typing of this tumor which would help in the proper diagnosis and appropriate management of polymorphous low grade adenocarcinoma.
One of the most common complaints of the gait disorders in infants and children is an intoeing gait, which is caused by excessive anteversion of the proximal femur, internal tibial torsion, and/or metatarsal adductus [15]. A careful evaluation of the children is essential to rule out serious pathological conditions such as cerebral palsy, infantile blount's disease, metabolic bone diseases, and skeletal dysplasias . An intoeing gait in the majority of patients without these pathological conditions is a minor problem and is observed to spontaneously improve with time . The parents or grandparents are concerned that the child will have a permanent disability or that the condition will interfere with the child's physical performance; thus they sometimes hope for some treatments . A shoe modification with wedges or arch supports is one of the tolerable nonsurgical treatments for children to correct an intoeing gait and modify the gait pattern . The sensomotor insole (smi), which had been introduced by the german shoemaker jarhling, was originally developed to improve abnormal gait patterns in children with spastic gait [6, 7]. It was expected to change the muscle tone of the lower limbs by stimulating the proprioceptors of the sole . Jahrling and rockenfeller demonstrated improvement of the gait patterns in cerebral palsy patients with flexible equinus or equinovarus deformities using smi . This information prompted us to try the use of smi for a pediatric intoeing gait, since the patients usually have more flexible feet than the cerebral palsy patients . In the present study, the effects of smi on a pediatric intoeing gait were evaluated using the three - dimensional (3d) gait analysis with a vicon motion capture system . The parents of patients treated with smi for their intoeing gait at our institution between january 2009 and december 2010 were invited to have their child participate in this prospective study, which was approved by an institutional review board . Patients who had rigid deformities of the feet with an ankle range of motion less than 30 degrees or forefoot abduction less than 10 degrees were excluded from this study . There were five boys and five girls, and the average age at testing was 5.6 years (range, 39 years). Bilateral intoeing gait was observed in eight, right side in one, and left side in one . Among six congenital clubfeet patients who had initially been treated with serial casting and braces, the torsional profile was assessed with the patient prone on the examining table, as described by staheli et al ., so that the examiner can determine the amount of internal and external rotation of the hip as an indication of the amount of femoral anteversion, measure the thigh - foot angle in order to estimate tibial torsion, and examine the shape of the lateral border of the foot to assess the presence of metatarsal adductus . Smi comprises of five exclusive bars, including medial and lateral heel bars, a retro bar, a toe bar, and a lateral wedge (figure 1). Before first application of the insole, patients were individually ground to size velcro trial elements that were attached to a base sole by the orthopaedic shoe technician . The trial elements can be readjusted repeatedly until the desired gait pattern has been achieved . Once the final position of the bars has been determined, the individual smi was made up in the workshop using the care set . The computerized motion analysis tests were performed with a six - camera vicon 3d motion system (vicon mx system, oxford, uk) during walking at a self - selected speed along a five - meter walkway using 16 passive retroreflective markers attached to specific bony landmarks of the lower extremities and the pelvis . Patients underwent gait analysis in the same shoes with and without smi . Walking speed, stride length, and cadences were calculated using the vicon plug - in gait (vicon mx system, oxford, uk), and the 3d joint kinematic data were obtained at 100 hz for the hips, knees and ankles in the sagittal plane and the hips and knees in the coronal and transverse planes from bilateral lower extremities . Comparisons in walking speed, step length, cadences, and joint kinematic data of the lower extremities were made between the conditions with and without smi . The data were analyzed using the vicon nexus plug - in gait and the custom - made software; the vicon normalizer ver . Gait cycle events that were defined by perry were adopted for descriptions in this study . Paired t - test was conducted to determine any difference among the demographics of the two groups (with and without smi). Analysis was performed with spss version 16.0 (spss inc, chicago, il, usa). All patients with clubfeet showed residual metatarsal adductus without apparent hindfoot deformities . In four patients with idiopathic intoeing gait, excessive anteversion of the proximal femur was seen in three, and internal tibial torsion was found in two (one of the four patients had both deformities) (table 1). Improvement of the gait pattern was clinically recognized after a couple of steps on wearing smi in most patients . There were significant differences in transverse plane motions of the hip and knee joints between the patients with and without smi . Smi decreased internal rotation of the proximal femur relative to the pelvis in loading response phase (18.3 28.1 versus 21.6 28.0, p = 0.009) and terminal swing phase (16.3 27.4 versus 19.0 26.4, p = 0.047) (table 2, figure 2). Smi also decreased internal rotation of the tibia relative to the femur in mid stance phase (0.7 12.5 versus 2.0 14.9, p = 0.030) and terminal stance phase (1.4 11.9 versus 2.3 14.5, p = 0.042) (table 3, figure 3). There were no significant differences of the hip and knee kinematics in the sagittal plane between the patients with and without smi . Ankle dorsiflexion was increased in loading response phase and terminal swing phase and decreased in terminal stance phase and terminal swing phase on wearing smi . In regard to cadence parameters, smi significantly increased the walking speed (67.9 m / min versus 64.9 m / min, p <0.001) and the stride length (500 mm versus 477 mm, p <0.001), although cadence did not differ between the two groups (137.6 steps / min versus 136.7 steps / min, p = 0.89) (table 4). Li and leong emphasized the importance of a correct diagnosis and understanding the causes and natural course of the condition in the management of a pediatric intoeing gait . Thackeray and beeson pointed out that identification of the level of torsional deformities (excessive femoral anteversion, internal tibial torsion, or metatarsal adductus) that produced an intoeing gait should be essential for planning of the specific intervention . The present study, however, demonstrated that smi improved abnormal gait patterns not only children with idiopathic intoeing gait but also those with congenital clubfeet, who had deformities of different levels in lower limbs . Although smi cannot correct dynamic and structural abnormalities of the lower extremities of feet and its long - term effectiveness is unknown, it is one of the easy and effective treatment options in the management of a pediatric intoeing gait . Smi inhibited internal rotation of the leg in loading response phase, which is usually observed in normal gait . Nakajima reported that the foot progression angle, which is the angle formed by the direction of gait progression and the foot axis at mid stance, was reduced by using a lateral wedged sole, but it recovered in the use of a lateral wedge and an arch support that resembles smi . The present study revealed that the decreased internal rotation of the lower limb by smi was shown to be due to decreased internal rotation of the proximal femur through the end of the swing phase and the beginning of the stance phase and decreased internal rotation of the tibia during the mid and terminal stance phases . Although the precise biomechanical effect of this specific insole on the hip and knee joints remains unknown, it is recognized that the leg - ankle - foot alignment is affected by the varus - valgus of the calcaneus . We speculated that the calcaneus stabilized in neutral position between the medial and the lateral heel bar at the initial contact may provide favorable effects on entire lower limbs by suppressing pronation of the subtalar joint which is accompanied by internal rotation of the leg (figure 4). In addition to changing the rotational profile of the lower limb, smi accelerated children's walking speed and increased stride lengths . The increase of the walking speed depended on the increase of the stride length because cadence did not show significant differences between children with and without smi . Smi increased external rotation of the femur relative to the pelvis during the end of the swing phase, which reflected the internal rotation of the pelvis relative to the femur . The increment of stride lengths could be due to internally rotated pelvis toward the direction of progression in walking . Young children were tested under a nonthreatening environment with parents present and distractions such as toys available in the present study, but the likelihood of not walking in their normal fashion while undergoing instrumented gait analysis is questionable . The foot progression angle, which is the most important variable to be measured, was not addressed in the present study because we unfortunately did not possess a force plate instrument that is indispensable to show the accurate direction of gait progression . The measurements of children without smi may not reflect the actual gait situation because the shoes, which were adjusted on wearing smi, would be a little large when children put them on without smi . Finally, the number of patients examined in this study was limited because of difficulties in performing the gait analysis for toddlers or naughty children . In conclusion, smi improved an intoeing gait pattern in patients with congenital clubfeet and idiopathic intoeing by externally rotating the proximal femur through the end of the swing phase and the beginning of the stance phases and externally rotating the tibia during the mid and terminal stance phase, resulting in acceleration of the walking speed and increase in the stride lengths.
Epicardial fat directly surrounding the major epicardial coronary arteries is a rich source of free fatty acids and numerous bioactive adipocytokines that play important roles in the development of atherosclerosis . Recently, due to advances in temporal and spatial resolution, multidetector computed tomography (mdct) has emerged as a noninvasive diagnostic modality that allows for simultaneous assessment of coronary artery calcium (cac), coronary artery stenosis and coronary plaque, and epicardial fat volume (efv) without increased radiation exposure or cost . Several studies using mdct have shown a relationship between efv and cac, the presence of coronary plaque, plaque composition, and plaque vulnerability . However, it is unknown whether elevated efv is associated with a greater likelihood of developing atherosclerosis over time, and whether increases in efv are accompanied by a parallel increase in coronary plaque volume . The relationship between serial changes in efv and coronary plaque volume has not yet been investigated; therefore, the aim of the present study was to determine whether baseline indexed efv (efvi) and serial changes in efvi are related to increase in coronary plaque volume as assessed by mdct . We reviewed the cardiac computed tomography (ct) patient data set from april 2007 to december 2014, retrospectively, and there were 237 patients who underwent mdct examination more than once . After excluding patients who underwent coronary artery bypass graft (n = 48) and percutaneous coronary angioplasty (n = 5), we reviewed the mdct data of the remaining 184 patients . We also excluded patients (n = 63) who had no coronary artery plaques detected by ct and those (n = 34) who underwent cardiac ct using a different tube voltage . As a result, this study ultimately examined data of 87 patients . This study was approved by the ajou institutional review board, in which there was no need to take informed consent due to the retrospective design . The pretest probability of coronary artery disease (cad) was estimated for each patient based on age, sex, and symptoms . Medical records were obtained by reviewing the electronic medical database, and cardiovascular (cv) risk factors were analyzed at the time of the cardiac ct examination . Body mass index (bmi) was calculated in each patient, and a bmi value of 25 kg / m was deemed to be obese . Systolic blood pressure of 140 mm hg, diastolic blood pressure of 90 mm hg, or current use of an antihypertensive agent was considered hypertension . A confirmed diagnosis of diabetes mellitus or current use of any antidiabetic medication was evaluated . Finally, the 10-year risk of coronary heart disease (chd) was calculated using the framingham risk score . Cardiac ct examinations were performed using a brilliance 64-slice ct scanner (philips medical systems, eindhoven, the netherlands) from january 2009 to february 2011 or a somatom definition flash dual - source 128-slice ct scanner (siemens healthcare, forchheim, germany) from march 2011 to april 2013 . Using the 64-slice ct scanner, nonenhanced imaging was performed using 120 kv and 55 ma s with prospective electrocardiogram (ecg) triggering to calculate calcium score and volume . Coronary computed tomography angiography (ccta) was performed with retrospective ecg gating using the following parameters: detector collimation of 64 0.625 mm, gantry rotation of 400 milliseconds, pitch of 0.2, tube voltage of 120 kv, and an effective tube current of 600 to 900 ma with ecg modulation . Contrast medium (80 ml, iomeron 400; bracco spa, milan, italy) was administered intravenously, at a rate of 4.5 ml / s . Using the dual - source 128-slice ct scanner, nonenhanced imaging was performed using 120 kv and 80 ma s with tube current modulation . A prospective ecg tube current modulation technique, based on the patient's bmi, and the mindose protocol (siemens healthcare) were used . Contrast medium was injected using a split - bolus technique: first, 60 to 80 ml of pure iodine - containing contrast material (iomeron 400; bracco spa) was administered intravenously at 4.5 ml / s, based on the patient's body weight . Then, 40 ml of a 60%-to-40% mixture of contrast medium and saline was administered . Cardiac ct images were assessed by a single observer with 15 years of experience in cardiac ct . For the cac score, agatston calcium scores were calculated using semiautomated software (ebw; philips medical systems, best, the netherlands), which identified areas of at least 0.5 mm and a density 130 hu as calcification . The software also measured the corresponding calcified plaque volume . To evaluate the coronary arteries, images at 75% r if there were severe motion artifacts, additional images at other cardiac cycles were used to obtain a better - quality image . Maximum intensity projection, volume rendering, multiplanar reformation, and curved multiplanar reformation were routinely constructed using a commercial workstation (ebw, philips medical systems). According to the american heart association classification, a 15-segment model was used . If the ramus intermedius was present, segment 16 was also used . However, if there were motion artifacts that lowered the image quality, nonevaluable segments were excluded from the analysis . If an abnormal segment was identified, that coronary artery was evaluated using an aquarius workstation (terarecon, san mateo, ca) and the volume of noncalcified plaque was measured . Referring to previous studies, noncalcified plaques were divided into 2 categories based on the ct value (hu): low (049 hu; deemed a lipid - rich plaque) and intermediate attenuation compositions (50129 hu; deemed a fibrous plaque). The plaques were color coded and the volume of each component was measured (fig . The color - coded area was adjusted manually, including the full thickness of the vessel wall, and surrounding tissues were excluded . The 2 curved multiplanar reconstruction images of the baseline and follow - up ct were displayed in parallel and then identical segments were compared side by side using the aquarius workstation . The lesions were matched on baseline and follow - up images using adjacent anatomical landmarks . The ct values of the proximal segments of the right coronary artery, left anterior descending artery, and left circumflex artery were measured and the mean intracoronary lumen density (hu) was calculated . A 54-year - old male patient with low pretest probability underwent calcium score ct (a) and coronary ct angiography (b). (a) the semiautomated software was used to identify an area of at least 0.5 mm with a density 130 hu as calcified plaque, and then to measure the coronary calcium score and volume . Noncalcified plaque was color - coded according to ct value (hu) and classified into low attenuation plaque (049 hu; designated as lipid - rich plaque) and intermediate attenuation plaque (50129 hu; designated as fibrous plaque). Lipid - rich and fibrous plaque volumes of the patient were 13.13 and 31.59 mm, respectively . The observers were blinded to the patients clinical histories, cac scores, and ccta results . Epicardial fat was defined as the adipose tissue between the surface of the myocardium and the visceral layer of the pericardium . The superior boundary of epicardial fat was set at the center of the right pulmonary artery, and the inferior extent was indicated by the end of the pericardial sac . Efv was quantified by calculating the total volume of the tissue in which the ct density ranged from 190 to 30 hu within the epicardium . Efv was reported in cubic centimeters and indexed (efvi) to body surface area . A 50-year - old male patient with low pretest probability . Epicardial fat was defined as the adipose tissue between the surface of the myocardium and the visceral layer of the pericardium . (a) the border of the epicardium (yellow line) was traced semiautomatically . (b) efv was quantified by calculating the total volume of the tissue (green color) showing a ct density of 190 to 30 hu within the epicardium . (c) the computer software constructed a 3-dimensional image of the epicardial fat automatically, with the data reported in cubic centimeters . The efv of the patient was 119 cm, and that indexed to body surface area (efvi; 1.91 m) was 62.3 m / m . Ct = computed tomography, efv = epicardial fat volume, efvi = indexed epicardial fat volume . The excel 2010 software (microsoft corp, redmond, wa) was used for data collection . Comparisons of data between baseline and follow - up were performed using the test for categorical data and the paired t test for continuous variables . Relationships between clinical variables, efvi, and plaque volume were explored by regression analysis . Annual changes in plaque volume and efvi were calculated for each plaque by subtracting the values measured at baseline ct from the values measured at follow - up . Then, the difference value was divided by the time elapsed between the 2 ct scans . Annual change values in the highest tertile for each plaque volume were considered to indicate rapid increases in plaque volume . Logistic regression analysis was used to determine whether baseline clinical variables and efvi were predictors of rapid increase in plaque volume . Variables that achieved significance in the univariate analysis were included in a stepwise logistic regression analysis . Statistical analyses were performed using medcalc (version 13.1.2.0; medcalc software, mariakerke, belgium). A p value <0.05 was considered to indicate statistical significance . We reviewed the cardiac computed tomography (ct) patient data set from april 2007 to december 2014, retrospectively, and there were 237 patients who underwent mdct examination more than once . After excluding patients who underwent coronary artery bypass graft (n = 48) and percutaneous coronary angioplasty (n = 5), we reviewed the mdct data of the remaining 184 patients . We also excluded patients (n = 63) who had no coronary artery plaques detected by ct and those (n = 34) who underwent cardiac ct using a different tube voltage . As a result, this study ultimately examined data of 87 patients . This study was approved by the ajou institutional review board, in which there was no need to take informed consent due to the retrospective design . The pretest probability of coronary artery disease (cad) was estimated for each patient based on age, sex, and symptoms . Medical records were obtained by reviewing the electronic medical database, and cardiovascular (cv) risk factors were analyzed at the time of the cardiac ct examination . Body mass index (bmi) was calculated in each patient, and a bmi value of 25 kg / m was deemed to be obese . Systolic blood pressure of 140 mm hg, diastolic blood pressure of 90 mm hg, or current use of an antihypertensive agent was considered hypertension . A confirmed diagnosis of diabetes mellitus or current use of any antidiabetic medication was evaluated . Finally, the 10-year risk of coronary heart disease (chd) was calculated using the framingham risk score . Cardiac ct examinations were performed using a brilliance 64-slice ct scanner (philips medical systems, eindhoven, the netherlands) from january 2009 to february 2011 or a somatom definition flash dual - source 128-slice ct scanner (siemens healthcare, forchheim, germany) from march 2011 to april 2013 . Using the 64-slice ct scanner, nonenhanced imaging was performed using 120 kv and 55 ma s with prospective electrocardiogram (ecg) triggering to calculate calcium score and volume . Coronary computed tomography angiography (ccta) was performed with retrospective ecg gating using the following parameters: detector collimation of 64 0.625 mm, gantry rotation of 400 milliseconds, pitch of 0.2, tube voltage of 120 kv, and an effective tube current of 600 to 900 ma with ecg modulation . Contrast medium (80 ml, iomeron 400; bracco spa, milan, italy) was administered intravenously, at a rate of 4.5 ml / s . Using the dual - source 128-slice ct scanner, nonenhanced imaging was performed using 120 kv and 80 ma s with tube current modulation . A prospective ecg tube current modulation technique, based on the patient's bmi, and the mindose protocol (siemens healthcare) were used . Contrast medium was injected using a split - bolus technique: first, 60 to 80 ml of pure iodine - containing contrast material (iomeron 400; bracco spa) was administered intravenously at 4.5 ml / s, based on the patient's body weight . Then, 40 ml of a 60%-to-40% mixture of contrast medium and saline was administered . Cardiac ct images were assessed by a single observer with 15 years of experience in cardiac ct . For the cac score, agatston calcium scores were calculated using semiautomated software (ebw; philips medical systems, best, the netherlands), which identified areas of at least 0.5 mm and a density 130 hu as calcification . The software also measured the corresponding calcified plaque volume . To evaluate the coronary arteries, images at 75% r if there were severe motion artifacts, additional images at other cardiac cycles were used to obtain a better - quality image . Maximum intensity projection, volume rendering, multiplanar reformation, and curved multiplanar reformation were routinely constructed using a commercial workstation (ebw, philips medical systems). According to the american heart association classification, a 15-segment model was used . If the ramus intermedius was present, segment 16 coronary segments with a diameter> 2.0 mm were analyzed . However, if there were motion artifacts that lowered the image quality, nonevaluable segments were excluded from the analysis . If an abnormal segment was identified, that coronary artery was evaluated using an aquarius workstation (terarecon, san mateo, ca) and the volume of noncalcified plaque was measured . Referring to previous studies, noncalcified plaques were divided into 2 categories based on the ct value (hu): low (049 hu; deemed a lipid - rich plaque) and intermediate attenuation compositions (50129 hu; deemed a fibrous plaque). The plaques were color coded and the volume of each component was measured (fig . The color - coded area was adjusted manually, including the full thickness of the vessel wall, and surrounding tissues were excluded . The 2 curved multiplanar reconstruction images of the baseline and follow - up ct were displayed in parallel and then identical segments were compared side by side using the aquarius workstation . The lesions were matched on baseline and follow - up images using adjacent anatomical landmarks . The ct values of the proximal segments of the right coronary artery, left anterior descending artery, and left circumflex artery were measured and the mean intracoronary lumen density (hu) was calculated . A 54-year - old male patient with low pretest probability underwent calcium score ct (a) and coronary ct angiography (b). (a) the semiautomated software was used to identify an area of at least 0.5 mm with a density 130 hu as calcified plaque, and then to measure the coronary calcium score and volume . Noncalcified plaque was color - coded according to ct value (hu) and classified into low attenuation plaque (049 hu; designated as lipid - rich plaque) and intermediate attenuation plaque (50129 hu; designated as fibrous plaque). Lipid - rich and fibrous plaque volumes of the patient were 13.13 and 31.59 mm, respectively . The observers were blinded to the patients clinical histories, cac scores, and ccta results . Epicardial fat was defined as the adipose tissue between the surface of the myocardium and the visceral layer of the pericardium . The superior boundary of epicardial fat was set at the center of the right pulmonary artery, and the inferior extent was indicated by the end of the pericardial sac . Efv was quantified by calculating the total volume of the tissue in which the ct density ranged from 190 to 30 hu within the epicardium . Efv was reported in cubic centimeters and indexed (efvi) to body surface area . A 50-year - old male patient with low pretest probability . Epicardial fat was defined as the adipose tissue between the surface of the myocardium and the visceral layer of the pericardium . (a) the border of the epicardium (yellow line) was traced semiautomatically . (b) efv was quantified by calculating the total volume of the tissue (green color) showing a ct density of 190 to 30 hu within the epicardium . (c) the computer software constructed a 3-dimensional image of the epicardial fat automatically, with the data reported in cubic centimeters . The efv of the patient was 119 cm, and that indexed to body surface area (efvi; 1.91 m) was 62.3 m / m . Ct = computed tomography, efv = epicardial fat volume, efvi = indexed epicardial fat volume . The excel 2010 software (microsoft corp, redmond, wa) was used for data collection . Comparisons of data between baseline and follow - up were performed using the test for categorical data and the paired t test for continuous variables . Relationships between clinical variables, efvi, and plaque volume were explored by regression analysis . Annual changes in plaque volume and efvi were calculated for each plaque by subtracting the values measured at baseline ct from the values measured at follow - up . Then, the difference value was divided by the time elapsed between the 2 ct scans . Annual change values in the highest tertile for each plaque volume were considered to indicate rapid increases in plaque volume . Logistic regression analysis was used to determine whether baseline clinical variables and efvi were predictors of rapid increase in plaque volume . Variables that achieved significance in the univariate analysis were included in a stepwise logistic regression analysis . Statistical analyses were performed using medcalc (version 13.1.2.0; medcalc software, mariakerke, belgium). A p value <0.05 was considered to indicate statistical significance . The baseline patient characteristics are listed in table 1 . The mean age of the study population was 54.8 7.9 years at the baseline examination and 56.5 7.9 years at the follow - up examination . The mean interval between the baseline and the follow - up ct was 25.5 15.7 months . The icc for interobserver agreement was 0.975 (95% confidence interval: 0.962, 0.984) for baseline efv and 0.970 (95% confidence interval: 0.954, 0.980) for follow - up efv . Both baseline and follow - up efvi were positively correlated with age and bmi (table 2). With the exception of lipid - rich plaque volume on follow - up ct, comparisons between the baseline and follow - up examination results are provided in table 3 . Cac score and coronary plaque volumes increased significantly (p = 0.010 to <0.001) on follow - up ct . The mean annual change values were 4.1 26.8 mm / y for lipid - rich plaque, 5.9 26.8 mm / y for fibrous plaque, and 15.1 27.0 mm / y for calcified plaque volume . However, efv (116.0 37.5 vs 116.6 37.4 cm, p = 0.604) and efvi (65.7 21.8 vs 66.0 21.8 cm / m, p = 0.620) change values between baseline and follow - up ct were not significant . The mean intracoronary lumen density was not significantly different (424.5 58.1 vs 430.3 78.8 hu, p = 0.811) between baseline and follow - up ct examinations . The mean annual changes in efv and efvi were 0.8 8.0 cm / y and 0.5 4.8 cm / m / y, respectively . The annual change in efvi was not accompanied by a parallel change in coronary plaque volume (p = 0.286 for lipid - rich plaque, 0.500 for fibrous plaque, and 0.096 for calcified plaque) (fig . The mean annual change values in plaque volume in the highest tertile were 32.4 17.9 mm / y for lipid - rich plaque, 32.6 18.5 mm / y for fibrous plaque, and 39.5 35.3 mm / y for calcified plaque (table 4). A 43-year - old male patient with an intermediate pretest probability underwent baseline cardiac ct (a d). The baseline efv was 54.0 cm (a, b), calcified plaque volume was 380.1 mm (c), and noncalcified plaque volume (d) was 289.4 mm (lipid - rich plaque volume, 103.9 mm; fibrous plaque volume, 185.5 mm). After 31 months, follow - up ct images (e h) showed no rapid annual change in efv (1.9 cm / y) or efvi (1.0 cm / m / y). Although the calcified plaque volume (62.9 mm / y) increased rapidly, the noncalcified plaque volume (lipid - rich plaque volume, 9.4 mm / y; fibrous plaque volume, 1.2 mm / y) did not . Ct = computed tomography, efv = epicardial fat volume, efvi = indexed epicardial fat volume . Plaque and epicardial fat volume according to tertile group . On univariate analysis, predictors of rapid increases in lipid - rich and fibrous plaque volumes were smoking, hypercholesterolemia, 10-year chd risk, obesity, and baseline efvi (table 5). Diabetes mellitus was the only significant predictor of a rapid increase in calcified plaque volume . On multivariate analysis, 10-year chd risk was an independent predictor of rapid increases in lipid - rich (odds ratio [or] = 1.184, p = 0.002) and fibrous (or = 1.413, p <0.001) plaque volume . Baseline efvi (or = 1.029, p = 0.016) was an independent predictor of a rapid increase in lipid - rich plaque volume, but not fibrous plaque volume (table 6). Or for prediction of rapid plaque increases (univariate analysis). Or for prediction of rapid plaque increases (multivariate analysis). Djaberi et al reported that efv is a significant predictor of coronary atherosclerosis after adjusting for cv risk factors . Sarin et al and iwasaki et al showed that higher efv (> 100 ml) was associated with the presence and severity of cad . Bastarrika et al showed that patients with significant coronary artery stenosis had significantly greater efv than those without significant cad . However, there have been no previous studies on the relationship between efv and coronary plaque volume . To the best of our knowledge, first, we investigated the relationship between efvi and coronary plaque volume and found that efvi was correlated significantly and positively with age and bmi, which accords with previous reports of a strong association between efv and obesity and bmi . However, with the exception of lipid - rich plaque volume on follow - up ct, no index of plaque volume was correlated with efvi (table 2). Second, we investigated serial changes in efvi and coronary plaque volume, which could be helpful to determine the relationship between efvi change and coronary plaque progression . The efvi did not change significantly from baseline to the time of follow - up ct, although plaque volumes increased significantly on follow - up ct (table 3). Therefore, the annual change in efvi was not accompanied (p = 0.0960.500) by a parallel change in any index of coronary plaque volume . Third, we investigated whether baseline characteristics, including efvi, were predictors of rapid increase in plaque volume . In addition to smoking, hypercholesterolemia, 10-year chd risk (framingham risk score), and obesity, baseline efvi was a predictor of rapid increases in lipid - rich and fibrous plaque volumes on univariate analysis (table 5). After controlling for cv risk factors, baseline efvi remained a significant independent predictor of a rapid increase in lipid - rich plaque volume (table 6). However, baseline efvi was not an independent predictor of a rapid increase in fibrous plaque volume . Cac score measured by mdct may reflect the overall burden of coronary atherosclerosis and may predict the risk of future cv events better than the framingham risk score . An association between a high cac score and large efv has been reported by several studies . Gorter et al and bettencourt et al observed that efv was positively related to the cac score . Ahmadi et al observed that efv was higher in both males and females with higher cac scores . However, in our study, efv was not significantly related to cac score or calcified plaque volume . Nakanishi et al reported that an increase in efv was associated with a greater progression of cac . At follow - up, efv, efvi, and the degree of change in efvi (%) were higher in the high progression group than in the low progression group . However, our result does not accord with this previous report . In our study, the increase in calcified plaque volume was not accompanied by an increase in efvi in serial studies (fig . 3). Yerramasu et al reported that the median efv was significantly higher in patients who progressed compared with in those who did not progress (93.1 vs 68.8 cm, respectively, p <0.001). However, our results showed that baseline efvi did not predict a rapid increase in calcified plaque volume . Our data agree with the results of otaki et al who reported that neither baseline efv nor the change in efv over time was associated with accumulation of cac after a median follow - up of 4 years in low - risk patients . Despite extensive research, the mechanistic understanding of atherosclerotic calcification in humans remains limited . In the progression of atherosclerotic lesions, recurrent plaque rupture and hemorrhage with subsequent healing in addition, cac growth under treatment with statins represents plaque repair rather than continuing plaque expansion . Lipid - rich plaque, however, occurs relatively early in the process of atherosclerosis, which might be more affected by efv compared with calcified plaque . In a report by greif et al, efv was elevated in patients with exclusively noncalcified plaque, compared to in those with mixed and calcified plaque . It is therefore likely that efv is associated with plaque formation per se, rather than plaque calcification . . However, plaque can also mix with various components, the volume of which we measured in our study . Therefore, the predictive ability of efvi in our study is relevant to the plaque composition, but not the type of plaque . In previous reports, the association between epicardial however, assessment of epicardial fat by echocardiography is not optimal, because the method is highly acoustic and time - window - dependent, is associated with difficulties in differentiating between epicardial and pericardial fat, and has low reproducibility . Mdct is a more accurate and highly reproducible method of quantifying efv due to its higher spatial resolution . However, volumetric quantification of epicardial fat using ct is time - consuming, requires an advanced cardiac imaging workstation, and should be performed only by an experienced observer . Manual tracing of the pericardium is also somewhat difficult at the bifurcation level of the pulmonary artery, and there may be a partial volume averaging effect near the diaphragm . Nevertheless, in our study, the icc for interobserver agreement was very high (0.975 for baseline efv and 0.970 for follow - up efv). First, the study was a retrospective observational trial with a limited number of heterogeneous patients . Therefore, potential biases cannot be ruled out despite use of multivariate regression analysis, especially because the model has not been evaluated . Second, the study population was derived from a single center, and was composed exclusively of ethnic koreans who were referred for ccta . Third, information regarding lifestyle (e.g., dietary changes and exercise) and treatment that may have affected efv was not available . However, the efvi was indexed by body surface area to correct for weight fluctuations between ct examinations . Fourth, it is somewhat doubtful that the accuracy of ccta is sufficient for detecting small noncalcified atherosclerotic plaques . In addition, the ct density of the plaque can be affected by the contrast media used within the coronary artery, and serial mdct for obtaining efv is subject to interscan variability . Regarding this limitation, we found that the intracoronary lumen density was not significantly different (p = 0.811) between baseline and follow - up ct examinations . Finally, we did not evaluate stenosis severity or plaque instability . In conclusion, in addition to the 10-year chd risk based on the framingham risk score, efvi was shown to be an independent predictor of a rapid increase in lipid - rich plaque volume . However, changes in efvi were not associated with parallel changes in coronary plaque volume.
Escs have the potential to be induced to differentiate into almost any cell type of an embryo or adult tissue 1 presenting great therapeutic promise in regenerative medicine 2, 3 . To derive appropriate cell types for clinical use it is necessary to understand how pluripotency gene networks function in vivo . The regulation of pluripotency has been described mainly in mammals and in vivo functional analysis of nanog, oct4 (pou5f1) and sox2, which form the gene core of pluripotency, has been performed using the mouse model 4 - 7 . This was partly due to the lack of nanog orthologs identified in other non - mammalian species in the past . However, nanog and oct4 sequences have recently been published in non - mammalian vertebrate species, such as chicken 8, 9, xenopus (only oct4 homologs) 10, zebrafish (danio rerio) 11, 12 and medaka fish (oryzias latipes) 12, 13, demonstrating that these key pluripotency factors are not exclusive to mammals . The third key pluripotency factor of the triad is sox2, which acts as a cofactor with oct4 to maintain pluripotency 14, 15 . Sox2 was initially described as an early neural marker and an important factor for eye development 16, 17, however its putative interaction with oct4 in fish has not been studied in detail . Additionally, other important pluripotency factors in mammals have been studied in fish such as klf4, tcf3, stat3 and telomerase (table 1). Although their embryonic roles have been studied in different developmental contexts, little is known about their function in fish pluripotency . Here, we will review the recent introduction and use of fish models to study early pluripotency in vivo comparing the results to those obtained in mammals . The many experimental advantages that offer teleost animal models 18, 19 allow researchers to combine embryological, molecular and genetic analyses required in the study of pluripotency . This makes them an excellent choice to study pluripotency in vivo, thus complementing the mouse model . Oct4 and nanog proteins are central to the maintenance of esc pluripotency 4, 6, 7 . Both proteins moct4 and mnanog are expressed in the inner cell mass (icm) and epiblast of the early mouse embryo and in mouse germ cells (figure 1). Mnanog null embryos fail to form epiblast and the icm differentiates into parietal endoderm - like cells 7, while icm from moct4 null embryos is not pluripotent and differentiates into trophoblast 4 . In xenopus, nanog homologs have not been detected . On the other hand, morrison and brickman 10 described three oct4 homolog genes in xenopus laevis, xlpou25, xlpou60 and xlpou91, grouped under the name xlpouv . Depleting the levels of these three xlpouv genes using morpholino oligos caused embryonic lethality in injected xenopus embryos . In order to further evaluate their functional conservation, only xlpou91 was able to rescue the self - renewal capability of the cells almost to the same extent as moct4, suggesting that in xenopus, xlpou91 may be the gene that during evolution has retained the same role in regulating pluripotency as the mammalian oct4 gene 10 . Xenopus embryos do not form trophectoderm, therefore xlpouv genes depletion cannot produce differentiation to this tissue, as observed after moct4 depletion in the mouse embryo . However, xlpouv genes depletion induces an expansion of xcad3 expression, which is the xenopus homologue of mouse cdx2, a marker of trophectoderm . Xlpouv genes depletion also induces an early progression to a committed cell type, provoking an increase in the expression of early commitment markers such as goosecoid, chordin and cerberus, and a decrease in genes associated with the inhibition of differentiation such as bmp4 10 . In view of the results obtained in xenopus, the role of oct4 is associated with preventing the premature commitment of pluripotent cells before and during gastrulation . In chicken, cnanog and coct4 sequences have been described with only one homolog of each identified to date 8, 9 . The functional conservation of these genes was analyzed by performing overexpression experiments of cnanog and coct4 in mouse and chicken esc cultures and comparing their effects with those of mnanog and moct4 . Mnanog or cnanog overexpression maintains proliferation of mouse escs in the absence of leukaemia inhibition factor (lif), while overexpression of coct4 induces differentiation in chicken escs and mouse escs . On the other hand, inactivation of cnanog or coct4 moreover, cnanog and coct4 expression is detected in chicken primordial germ cells (pgcs) just as observed in the mouse 6, 8, 9 . In zebrafish and medaka, these escs from fish share the in vitro properties with murine escs and exhibit self - renewal capacity 20 - 22 . Oct4 orthologous sequences have been identified in medaka oloct4 (olpou5f1) 13 and zebrafish pou2/spg 11, 23 . Furthermore, in vitro analysis has demonstrated that moct4 promoter can be activated in medaka escs, suggesting that the pluripotency regulatory network in mammals is conserved in fish 24 . In addition, a single nanog orthologous gene has been found in medaka and zebrafish genomes and the medaka nanog (olnanog) gene has been functionally characterized 12 . Other genes associated with pluripotency in mammals (sox2, tcf3, klf4, stat3) have been described and analyzed in other species such as xenopus, fish or chicken . However, the initial absence of nanog or oct4 orthologs in these species suggested that pluripotency might be an exclusive mammalian property and focused the study of these genes to their roles in other aspects of development . The recent description and characterization of nanog and oct4 in non - mammal animals paves the way for a thorough comparative analysis of the genetic networks regulating embryonic pluripotency . Furthermore, the experimental advantages provided by these species, particularly zebrafish and medaka embryos, such as the number of embryos and their transparency, ex utero development, easy gene function manipulation and transgenic generation, will further expand the field of in vivo pluripotency . For example, new in vivo genetic screens can be designed to reveal other proteins involved in pluripotency, generation of inducible transgenes or the roles of pluripotency genetic networks in adult stem cells and regenerating tissues . In mouse escs, repression of moct4 expression causes differentiation to trophectoderm and loss of pluripotency, while overexpression produces the differentiation to primitive mesoderm and endoderm 25 however oct4 alone is necessary but not sufficient to support stem cell renewal in these cells 25 . On the other hand, oct4 is one of the transcription factors needed for the reprogramming of human and mouse fibroblasts into induced pluripotent stem cells (ipsc) 26 - 28 . In fact, oct4 is the only transcription factor that appears to be irreplaceable for reprogramming to occur 29, making oct4 a potential key factor to be used in regenerative medicine . During evolution, the ancestral oct4 gene seems to have been duplicated once, resulting in pou5 and pou2 . However pou5 was subsequently lost in teleost fish and pou2 was lost in mammals, thus, the remaining copy of the ancestral oct4 gene in each class of vertebrate would most likely have retained oct4 functions and/or acquired new ones 30 . Expression and functional analysis shows that oct4 is expressed in the icm of mouse embryos and in all cells from zygote to gastrula embryos in zebrafish and medaka (figure 1) 31 - 33 . During later stages of development, medaka and zebrafish oct4 also share an expression domain in the posterior part of the embryo . Additionally, mouse, chicken and medaka oct4 are expressed in the pgcs 9, 31, 33 and, in mouse, moct4 is necessary for pgc survival 34 . This suggests that oct4 in pgcs may be maintained during pgc migration without de novo synthesis . In sum, the duplicated oct4 gene copy which remains in teleost fish and mammals has maintained similar expression patterns before gastrulation and in pgcs throughout evolution in the two classes of vertebrates, although in zebrafish pou2/spg is not expressed in pgcs . This is a particular interesting evolutionary difference of the oct4 homolog between medaka and zebrafish . The pou2/spg gene in zebrafish is not duplicated and the question remains of how the roles of oct4 in pgc and gonad development in zebrafish may have been substituted . It will be interesting to analyze the expression patterns of the oct4 homolog in fugu (takifugu rubripres) and tetraodon to determine how these functions may have evolved in different teleost species . In this evolutionary context, it is interesting to note that after gastrulation, the zebrafish oct4 homolog, spg / pou2, has a different spatial pattern of expression compared to oct4 homologues in other vertebrates, and it has acquired other functions . One specific difference is that spg / pou2 is differentially expressed in the developing zebrafish brain where it plays an important role in regionalization 32 . Furthermore maternal and early zygotic spg / pou2 expression has been found to play an important role in endoderm development 35 . Moreover, although the presence of spg / pou2 protein has not been analyzed, spg / pou2 expression has not been detected in the pgcs, and it has also been found not to be necessary for the correct development of pgcs in zebrafish 35 in contrast to medaka and mice . Thus, it appears that in zebrafish, oct4 has acquired a new role during brain development and lost its function in pgc biology . Additionally, initial cross - species complementation experiments suggest that spg / pou2 cannot rescue moct4 function and maintain es cell renewal when transfected into moct4 mutant mouse escs 10 . This indicates that at least some interactions necessary for pluripotency maintenance in mice have been lost in zebrafish, although in fish pou2 may still regulate pluripotency . On the other hand, the function of the oloct4 homolog during medaka development and its capabilities to rescue es cell renewal and cross - species pluripotency characteristics these studies will help to understand the evolution of oct4 and determine the extent to which functional homology has been conserved between fish and mammals . Nanog is a homeodomain (hd) transcription factor expressed in early embryo cells and pgcs in mouse 6, 7, chicken 9 and medaka fish 12 . Mnanog expression is initially detected at the morula stage of the mouse embryo 6, 7, while in medaka it is maternally inherited (figure 1) and its expression is detected as early as the unfertilized egg 12 . In other teleost species the expression pattern of nanog has not been described and thus we will focus on the medaka olnanog for comparison with the mouse mnanog . Similarly, in medaka, olnanog inhibition using morpholino oligos causes embryos to die without completing epiboly 12 . Thus, in both mouse and medaka, nanog plays a central role in early embryo survival . Additionally, in mouse esc cultures, mnanog is a necessary factor for esc to maintain their ability to differentiate into multiple cell lineages acting as a gatekeeper of the gateway to pluripotency 36, 37 . However, mnanog protein is expressed in mouse esc in a mosaic pattern and cells which do not express mnanog in these cell cultures still retain expression of pluripotency markers and possess the ability to self - renew 38 . Moreover, mouse chimeras formed by implanting mnanog knock - out cells into wild type embryos develop normally and demonstrate that mnanog depleted cells can differentiate into all tissues except the gonads 38 . Thus, in the mouse, mnanog seems to be necessary to maintain pluripotency only during a short period of time since loss of mnanog does not irremediably provoke cell differentiation . A similar finding is also observed in medaka, where olnanog depleted embryos maintain the expression levels of pluripotency markers such as oct4, tert, and tcf3 12 . Moreover, in these medaka olnanog morphant embryos, in which olnanog may not have been removed completely, the expression levels of differentiation markers associated with early lineage commitment such as bra, sox17, gata3 or sox2 were not significantly changed 12 . These results suggest that olnanog function in olnanog - depleted embryonic cells can be rescued by neighbouring olnanog positive cells, indicating a non - cell autonomous olnanog - mediated effect on undifferentiated cells . Thus, mouse and medaka in vivo studies suggest that the crucial role of nanog in pluripotency may affect proliferation and survival . However, cross - species complementation experiments are necessary between medaka and mouse or human nanog to determine the extent of functional conservation among species . Functional characterization of pluripotency genes in teleost fish can provide new clues to understand the roles and evolution of pluripotency in mammals, particularly in humans . For example, the study of nanog function using medaka embryos revealed that nanog controls cellular proliferation during the s phase transition by regulating cyclina expression 12 . These results are consistent with findings in human escs, where overexpression of human nanog results in an increase in proliferation . Simultaneously to the medaka studies, zhang and colleagues described the role of human nanog in regulating the transition from g1 to s phase of the cell cycle in human escs by direct regulation of cdc25a and cdk6 expression 39 . In view of these results, the function of medaka nanog is similar to that observed in human cells, hence validating the use of teleost fish as models to study pluripotency . Later in development, nanog expression is restricted to pgcs in human, mouse, chicken and medaka (figure 1) 6, 8, 9, 12, 40, 41 . In mice, nanog deleted escs were implanted in wild - type morulae to form chimeras that developed normally . In these chimeric mice, nanogcells can be detected in all tissues, but pgcs lacking nanog do not mature 38 . In fact, nanog depletion using shrna induced cell death in the migratory pgcs 42 . In medaka embryos, ol - nanog loss - of - function experiments using morpholinos provoked an altered migration and abnormal distribution of pgcs . In fish and mice, the signaling chemokine sdf1 and its receptor cxcr4 are necessary for pgc migration 43 - 47 . In medaka, thus ol - nanog mediates correct pgc migration by directly regulating the expression of cxcr4b 41 . The role of nanog in controlling pgc migration and apoptosis could explain the mouse chimera phenotype where nanog - deficient escs do not generate mature pgcs 38 . It would be beneficial to investigate the relationship between the apoptotic and migratory processes in that nanog could be acting in the mouse pgcs . Their analysis in fish embryos may help to resolve questions about the evolution of pluripotency in the vertebrate lineage and clarify some discrepancies that have raised in the gene functions in mice and humans . A clear example is the stat3 gene which is essential to maintain mouse esc in an undifferentiated state, however, in human and monkey esc stat3 seems to be dispensable . In medaka, analysis of stat3 showed that stat3 was also inactive in medaka esc and blastula embryos, as in primates . These results suggest that the requirement of stat3 in mouse pluripotency may be species specific, whereas in medaka, monkey and human stat3 seems to be inactive 48 . Thus, from an evolutionary point of view, further studies in fish are providing clues about the evolution of pluripotency and which mechanisms are conserved among vertebrates . Other important genes for mammalian pluripotency have been described in medaka, although their roles in early fish pluripotency have not been studied in detail . For example, klf4 belongs to the krppel - like factor (klf) family of transcriptional regulators and is necessary for maintaining mouse pluripotency . In zebrafish, many klf orthologs have been identified and functional studies suggest that at least klf1 and klf4 play important roles in zebrafish hematopoiesis . However, other klf orthologs, such as klf2a and klf2b which are expressed from 70% epiboly, may have a role in early fish pluripotency 49 - 52 . Finally, telomerase is necessary to maintain telomere length and is active in all stem cells . Telomerase rna template and its catalytic subunit, telomerase reverse transcriptase (tert), have been described in medaka and zebrafish 53 - 55 which provide further circumstancial evidence that pluripotency mechanisms have been conserved in the vertebrate lineage . It is interesting to note that telomerase activity cannot be detected in most human somatic tissues, but it is ubiquitously detected in teleost fish somatic tissues . This telomerase expression pattern and its similarity to its human homolog substantiate the use of teleost fish as a model to easily study telomerase function and molecular mechanisms in vivo 56 . Nanog and oct4 are expressed in gonads of human, mouse, chicken and medaka suggesting that both proteins may play a role in gamete differentiation and/or gonadal stem cell maintenance 6 - 9, 12, 33, 40, 57 - 59 . Also, telomerase activity is detected in the gonads of both mammals and teleost fish 53, 54, 56 . However, experimentation in these adult tissues is difficult and it remains an important task to characterize the in vivo roles of pluripotency genes in the gonads . Nevertheless, the expression patterns of these genes provide some clues that point to a putative role in maintaining pluripotency in the gonad germ cells . In medaka female gonads, olnanog and oloct4 transcript and proteins are detected in the small previtellogenic oocytes, however the signal diminishes and becomes undetectable in medium to large previtellogenic oocytes, which are arrested in meiosis . In medaka male gonads, olnanog and oloct4 transcript and protein are detected in the periphery of the testis, where undifferentiated spermatogonia, which constitutes the germ stem cell population of the testis, are located 12, 33 . Mouse nanog is expressed in germ cells and its expression is down - regulated in cells undergoing meiosis in female gonads, and at the onset of mitotic arrest in male gonads (figure 1) 12, 42 . Thus, the initial role of nanog may be to provide gonad stem cells with pluripotency characteristics and, therefore, its expression would be lost during differentiation . However, it is interesting to note that in mice mnanog is detected in type a spermatogonia and in pachytene spermatocytes, during haploid germ cell maturation, suggesting that it may play a role as an epigenetic modifier 59 . This putative role of mnanog as an epigenetic modifier during gamete maturation would introduce a new twist into nanog function that may extend to its roles in pluripotency maintenance . In the case of oct4, medaka and mouse adult testis are detected in the most undifferentiated type a spermatogonia population in mice and medaka 33, 57 . Experiments in mice have shown that moct4 is required for spermatogonia stem cell self - renewal 60 . On the other hand, moct4 expression in mice ovaries has not been described and, in medaka, oloct4 is detected in the most undifferentiated germ cells and in the germ plasm of oocytes, which will form the embryo germ cells 33 . Thus, the oct4 expression pattern suggests that this transcription factor plays a role during gamete maturation . This hypothesis is supported by the results described in mice, where conditional inactivation of oct4 in pgcs generates a sterility phenotype in the adult 34 . The different embryological and genetic manipulations to which zebrafish and medaka are amenable will expand the possibilities to study the roles of the different pluripotency factors that operate during vertebrate embryonic development (table 2). The studies in medaka during early embryo development have already contributed important information on nanog function . Furthermore, the use of medaka or zebrafish will allow researchers to design new screening strategies to identify proteins involved in pluripotency in vivo . Experiments in fish may also provide valuable information on new specific molecular interactions in vivo between nanog, oct4, klf4, sox2, tert, stat3 or tcf3 which may be differentially conserved in mice or humans . The generation of transgenic animals for promoter analysis and conditional gene manipulation will further contribute to the understanding of the roles of these genes during embryonic development . Thus, the introduction of medaka and zebrafish to the study of embryonic pluripotency raises new and exciting questions and opportunities for the field.
Nhanes is a cross - sectional survey of the health and nutrition of the noninstitutionalized, household - dwelling u.s . Population conducted by the national center for health statistics and by the centers for disease control and prevention (10,11). The survey consists of two components: the in - home interview and the mobile exam center, which performs several laboratory tests including the fasting plasma glucose (fpg) test and the 2-hr oral glucose tolerance test (ogtt). The in - home survey collects demographic and clinical information, including the subject's age, race, sex, medical history, therapy, and lifestyle variables such as the frequency and duration of exercise and dietary habits . We restricted our analyses to the subjects in the subsample that had morning examinations since they were the only subjects who had valid fpg and ogtt testing . We also excluded from our analyses subjects aged <18 years, those with diagnosed or undiagnosed diabetes, and those with a history of myocardial infarction (mi). The current ada definition for ifg is blood glucose 100125 mg / dl after an 8-h fast (12). When the ifg category was initially introduced by the ada, ifg was defined as 110125 mg / dl after fasting . In 2003, the ada lowered the threshold of ifg to better capture those who met the world health organization's (who) criteria for igt . Who defines igt as a glucose level of 140199 mg / dl 2 h after a glucose load (13). We compared the estimates of the prevalence of pre - diabetes using the old and the new fasting blood glucose criterion . Subjects were asked if their physicians have ever told them that they have borderline diabetes, pre - diabetes, impaired fasting glucose, or impaired glucose tolerance . A prior diagnosis of pre - diabetes was considered to be a yes to any of the four terms . The ada recommends metformin alone as the antihyperglycemic of choice based upon the dpp results . However, because nhanes does not indicate the class of antihyperglycemic used for ifg / igt, we could only determine whether any antihyperglycemic medication was given . Subjects who averaged at least 30 min of vigorous or moderate activity daily for the previous 30 days were considered compliant with ada recommendations for treatment of ifg / igt (4). Vigorous activity was defined as activity that causes heavy sweating or large increases in breathing or heart rate . Moderate activity was defined as activity that causes moderate sweating or slight to moderate increases in breathing or heart rate . Subjects were asked if they maintained their activity levels over the last year relative to the last 30 days . Provider recommendation for diet modification included reporting either counseling to reduce weight or counseling to reduce fat / calorie intake, or both . Nhanes did not indicate the chronological order of the physician recommendations and the actual change in exercise or diet, so it was not possible to determine if lifestyle behaviors changed in response to the recommendations . The associations between subject demographics and medical conditions and the presence of pre - diabetes were examined using the statistic for categorical predictor variables and logit modeling for continuous predictor variables . Most variables analyzed had little missing data (<4%), but 16.7% of subjects were missing data for either income, education, or both . Therefore, multiple imputation was used to more accurately account for the high level of missing data for all analyses involving these two variables (14). Multivariable logistic regression was used to examine independent predictors of treatment and adherence to lifestyle modification therapies . Independent variables in the model included sex, race, education, insurance status, and the percent of poverty level . All statistical analyses were performed using the stata software (version 10.0; statacorp lp, college station, tx). Nhanes is a cross - sectional survey of the health and nutrition of the noninstitutionalized, household - dwelling u.s . Population conducted by the national center for health statistics and by the centers for disease control and prevention (10,11). The survey consists of two components: the in - home interview and the mobile exam center, which performs several laboratory tests including the fasting plasma glucose (fpg) test and the 2-hr oral glucose tolerance test (ogtt). The in - home survey collects demographic and clinical information, including the subject's age, race, sex, medical history, therapy, and lifestyle variables such as the frequency and duration of exercise and dietary habits . We restricted our analyses to the subjects in the subsample that had morning examinations since they were the only subjects who had valid fpg and ogtt testing . We also excluded from our analyses subjects aged <18 years, those with diagnosed or undiagnosed diabetes, and those with a history of myocardial infarction (mi). The current ada definition for ifg is blood glucose 100125 mg / dl after an 8-h fast (12). When the ifg category was initially introduced by the ada, ifg was defined as 110125 mg / dl after fasting . In 2003, the ada lowered the threshold of ifg to better capture those who met the world health organization's (who) criteria for igt . Who defines igt as a glucose level of 140199 mg / dl 2 h after a glucose load (13). We compared the estimates of the prevalence of pre - diabetes using the old and the new fasting blood glucose criterion . Borderline diabetes, pre - diabetes, impaired fasting glucose, or impaired glucose tolerance . A prior diagnosis of pre - diabetes was considered to be a yes to any of the four terms . The ada recommends metformin alone as the antihyperglycemic of choice based upon the dpp results . However, because nhanes does not indicate the class of antihyperglycemic used for ifg / igt, we could only determine whether any antihyperglycemic medication was given . Subjects who averaged at least 30 min of vigorous or moderate activity daily for the previous 30 days were considered compliant with ada recommendations for treatment of ifg / igt (4). Vigorous activity was defined as activity that causes heavy sweating or large increases in breathing or heart rate . Moderate activity was defined as activity that causes moderate sweating or slight to moderate increases in breathing or heart rate . Subjects were asked if they maintained their activity levels over the last year relative to the last 30 days . Provider recommendation for diet modification included reporting either counseling to reduce weight or counseling to reduce fat / calorie intake, or both . Nhanes did not indicate the chronological order of the physician recommendations and the actual change in exercise or diet, so it was not possible to determine if lifestyle behaviors changed in response to the recommendations . The associations between subject demographics and medical conditions and the presence of pre - diabetes were examined using the statistic for categorical predictor variables and logit modeling for continuous predictor variables . Most variables analyzed had little missing data (<4%), but 16.7% of subjects were missing data for either income, education, or both . Therefore, multiple imputation was used to more accurately account for the high level of missing data for all analyses involving these two variables (14). Multivariable logistic regression was used to examine independent predictors of treatment and adherence to lifestyle modification therapies . Independent variables in the model included sex, race, education, insurance status, and the percent of poverty level . All statistical analyses were performed using the stata software (version 10.0; statacorp lp, college station, tx). The nhanes 20052006 cohort included 2,425 subjects aged 18 years or older in the morning examination (fasting) sample . From this sample, 878 were excluded from our analysis: 87 because they had had a prior mi (since we were interested in pre - diabetes and diabetes as coronary artery disease risk factors); 659 because they had missing ogtt data; 16 because they had diagnosed diabetes; and 116 because they had undiagnosed diabetes (based on fpg and/or ogtt testing). Subjects who were on oral medications or receiving insulin for their diagnosed diabetes were excluded from ogtt testing; hence, only 16 subjects were excluded for diagnosed diabetes and 116 for undiagnosed diabetes . These exclusions resulted in a sample of 1,547 subjects in the study . By applying sample weights to make the results representative of the nondiabetic u.s . Population without a history of mi, we estimate that about 34.6% (ci 30.338.9%) of nondiabetic u.s . Adults had pre - diabetes . Of the pre - diabetic subjects, 84% met ifg criteria, 44% met igt criteria, and 28% met both . Using the 1997 ada criteria for ifg (110125 mg / dl) resulted in 43% fewer subjects meeting the criteria for ifg, reducing the estimate of the prevalence of pre - diabetes in nondiabetic u.s . Prevalence of pre - diabetes in 20052006 of a nationally representative sample of 1,547 nondiabetic u.s . Adults using older vs. newer ada criteria pre - diabetes = having either ifg or igt . Those with pre - diabetes had substantially higher cardiovascular risk, with a mean framingham 10-year risk for cardiovascular events of 8.5% (ci 6.010.6%), which was almost twice that of normoglycemic subjects (5.2% [ci 3.96.4%], p <0.001) (15,16). Demographic and medical information for the study population (a nationally representative sample of 1,547 nondiabetic u.s . Adults in 20052006) * * the study population is a 20052006 nationally representative sample of nondiabetic u.s . Adults . Statistical significance was tested using testing for differences in percentages and t testing for differences in means . Only 3.4% of the entire study sample reported a prior diagnosis of impaired fasting glucose, impaired glucose tolerance, borderline diabetes, or pre - diabetes 38.5% no longer met the pre - diabetes criteria (either due to resolution or misdiagnosis); 61.5% had unresolved pre - diabetes . No diagnosed pre - diabetic subjects reported receiving oral antihyperglycemic medications (ci 010.8%). Multivariable analysis found that subjects who had pre - diabetes tended to be older, male, and mexican american (table 3). Independent associations with the presence of pre - diabetes (a 20052006 nationally representative sample of 1,546 nondiabetic u.s . Adults) * independent associations in a multiple logistic regression model controlling for all listed variables . Or, odds ratio; ref, reference . Of pre - diabetic subjects, 31.7% (ci 23.340.2%) reported receiving counseling for exercise, 33.4% (ci 26.440.5%) for diet, and 25.9% (ci 17.934.5%) for both (table 4). Of those who reported exercising, only about half reported achieving the ada ifg / igt guidelines of at least 30 min daily . Rates of recommendations for and practice of diabetes prevention behaviors were similar when the 1997 ada criteria for ifg (fpg of 110125 mg / dl) were applied . Subject - reported recommendations for and practice of diabetes prevention behaviors for 584 subjects with pre - diabetes in a 20052006 nationally representative sample of u.s . Adults * * data were only available on patient behavior, if recommendation for exercise was given at all . Nhanes did not indicate the chronological order of the physician recommendations and the actual change in exercise or diet so it is not possible to determine if lifestyle behaviors changed in response to recommendations . Applying who ifg criteria (fpg 110125) showed similar results . The nhanes 20052006 cohort included 2,425 subjects aged 18 years or older in the morning examination (fasting) sample . From this sample, 878 were excluded from our analysis: 87 because they had had a prior mi (since we were interested in pre - diabetes and diabetes as coronary artery disease risk factors); 659 because they had missing ogtt data; 16 because they had diagnosed diabetes; and 116 because they had undiagnosed diabetes (based on fpg and/or ogtt testing). Subjects who were on oral medications or receiving insulin for their diagnosed diabetes were excluded from ogtt testing; hence, only 16 subjects were excluded for diagnosed diabetes and 116 for undiagnosed diabetes . These exclusions resulted in a sample of 1,547 subjects in the study . By applying sample weights to make the results representative of the nondiabetic u.s . Population without a history of mi, we estimate that about 34.6% (ci 30.338.9%) of nondiabetic u.s . Adults had pre - diabetes . Of the pre - diabetic subjects, 84% met ifg criteria, 44% met igt criteria, and 28% met both . Using the 1997 ada criteria for ifg (110125 mg / dl) resulted in 43% fewer subjects meeting the criteria for ifg, reducing the estimate of the prevalence of pre - diabetes in nondiabetic u.s . Prevalence of pre - diabetes in 20052006 of a nationally representative sample of 1,547 nondiabetic u.s . Adults using older vs. newer ada criteria pre - diabetes = having either ifg or igt . Those with pre - diabetes had substantially higher cardiovascular risk, with a mean framingham 10-year risk for cardiovascular events of 8.5% (ci 6.010.6%), which was almost twice that of normoglycemic subjects (5.2% [ci 3.96.4%], p <0.001) (15,16). Demographic and medical information for the study population (a nationally representative sample of 1,547 nondiabetic u.s . Adults in 20052006) * * the study population is a 20052006 nationally representative sample of nondiabetic u.s . Adults . Statistical significance was tested using testing for differences in percentages and t testing for differences in means . Only 3.4% of the entire study sample reported a prior diagnosis of impaired fasting glucose, impaired glucose tolerance, borderline diabetes, or pre - diabetes 38.5% no longer met the pre - diabetes criteria (either due to resolution or misdiagnosis); 61.5% had unresolved pre - diabetes . No diagnosed pre - diabetic subjects reported receiving oral antihyperglycemic medications (ci 010.8%). Multivariable analysis found that subjects who had pre - diabetes tended to be older, male, and mexican american (table 3). Independent associations with the presence of pre - diabetes (a 20052006 nationally representative sample of 1,546 nondiabetic u.s . Adults) * independent associations in a multiple logistic regression model controlling for all listed variables . Or, odds ratio; ref, reference . Of pre - diabetic subjects, 31.7% (ci 23.340.2%) reported receiving counseling for exercise, 33.4% (ci 26.440.5%) for diet, and 25.9% (ci 17.934.5%) for both (table 4). Of those who reported exercising, only about half reported achieving the ada ifg / igt guidelines of at least 30 min daily . Rates of recommendations for and practice of diabetes prevention behaviors were similar when the 1997 ada criteria for ifg (fpg of 110125 mg / dl) were applied . Subject - reported recommendations for and practice of diabetes prevention behaviors for 584 subjects with pre - diabetes in a 20052006 nationally representative sample of u.s . Adults * * data were only available on patient behavior, if recommendation for exercise was given at all . Nhanes did not indicate the chronological order of the physician recommendations and the actual change in exercise or diet so it is not possible to determine if lifestyle behaviors changed in response to recommendations . Applying who ifg criteria (fpg 110125) showed similar results . This study is the first to publish a combined estimate of ifg / igt and explore its contemporary diagnosis and treatment patterns in a national sample . Using nhanes data gathered roughly 3 years after the publication of the dpp, we found that the majority of people with ifg and/or igt are undiagnosed and untreated with interventions that the dpp suggests can substantially reduce progression to type 2 diabetes, reducing the risk of both microvascular and macrovascular complications . However, given the significant potential benefits of metformin and lifestyle modification, the very low level of detection and intervention are concerning . In the dpp randomized trial, lifestyle modification and metformin reduced the incidence of type 2 diabetes by 58 and 38%, respectively, in just 3 years (1517). We found similar rates of prevalence of ifg and igt in reports from earlier time periods (1,2) and found a combined prevalence of 34.6% nondiabetic u.s . Consistent with prior studies, relative to normoglycemic subjects, pre - diabetic subjects in this cohort tended to be older, male, mexican american, hypertensive, hyperlipidemic, and have substantially greater overall 10-year cardiovascular risk . Disappointingly, only 3.4% of pre - diabetes individuals reported that their physicians diagnosed them with pre - diabetes . This extremely low rate could in part be due to incomplete recollection by subjects or because physicians did not emphasize the importance of pre - diabetes to their patients . Another likely explanation is that physicians do not adequately screen for and diagnose pre - diabetes, resulting in marked underdiagnosis of pre - diabetes . For instance, physicians did not recommend lifestyle modification to pre - diabetic subjects any more intensively than normoglycemic subjects . In addition, not one subject reported receiving metformin, suggesting that physicians were either unaware of metformin's benefits, were hesitant to prescribe it, or were unaware the subject had pre - diabetes; however, it is also possible that many physicians are aware of the dpp findings, but found its results unconvincing . Three years after the dpp, however, subjects reported that lifestyle interventions were recommended to less than one - third of pre - diabetic subjects . Of pre - diabetic subjects, less than half reported exercising, less than two - thirds reported recent attempts at weight and/or diet control, and 44% reported both . Though it could be argued that the recent formal guidelines may improve upon practice at the time of study (our nhanes cohort was from 20052006 and u.s . Preventive services task force and ada guidelines were published around this time), most evidence suggests that passive dissemination of national guidelines is ineffective in changing clinical practice . While substantial evidence has demonstrated the benefits of early glycemic control in reducing the incidence of type 2 diabetes, whether early glycemic control significantly reduces cardiovascular outcomes has been debated . However, unlike most studies of early or intensive antihyperglycemic medication interventions, intervention with a lifestyle modification in pre - diabetes substantially improved cardiovascular risk factors in the dpp (such as blood pressure and lipids), making it likely that such interventions will improve cardiovascular outcomes (18). It is also possible that lowering the lifetime glycemic burden by early intervention could reduce long - term cardiovascular outcomes, as seen in the 17-year follow - up of the diabetes control and complications trial (dcct) (19). Finally, the cardiovascular risk associated with overt type 2 diabetes is substantially greater than the cardiovascular risk associated with pre - diabetes, suggesting that delaying or preventing type 2 diabetes should improve both cardiovascular and microvascular outcomes regardless of the direct impact on other cardiovascular risk factors (20). The limitations of our study include large amounts of missing data for smoking, particularly when calculating the framingham risk score . In addition, the rates of physician diagnosis were dependent on subject self - report and were not verified by chart abstraction; consequently the rates of diagnosis and treatment of ifg / igt may have been underreported . Also, only subjects reporting pre - diabetes were asked about whether they were on oral hypoglycemic medications, so some additional subjects may have been treated that were not captured in our results . Nhanes also does not report the chronological order of diagnosis, recommendation, and treatment . Finally, the ada 2003 criteria for ifg resulted in a dramatic increase in the number of people being diagnosed with ifg and has been controversial; many physicians may disagree with this lower threshold for diagnosis . However, the 20% of the population who met 1997 ada pre - diabetes criteria had similar results of recommendation and compliance with lifestyle modification measures as did those who met the new ada pre - diabetes criteria . Three years after a landmark study demonstrated that early diagnosis of and intervention of pre - diabetes can substantially reduce progression to type 2 diabetes, the majority of people with ifg and/or igt were undiagnosed and untreated . Whether this is due to physicians being unaware of the evidence, unconvinced by consideration should be given to national policies to improve upon this situation such as public and provider education programs.
Mature cystic teratomas (mct; also called dermoid cysts) account for about 30 - 45% of all ovarian neoplasms and around 60% of all benign tumors arising in the ovary with a 0.17 - 1.4% reported incidence of malignant transformation . Squamous cell carcinoma in mcts is most commonly seen in postmenopausal women . There are no definitive clinical features, tumor markers are not often raised and imaging methods are many times not helpful . Hence, most cases are diagnosed postoperatively . Tumors confined to the ovary usually have a better prognosis and patients with stage iii or iv disease rarely survive five years . Here, we are presenting a case of squamous cell carcinoma of the ovary which was diagnosed at an early stage and was managed appropriately keeping in mind the poor prognosis of the condition . A 53-year - old postmenopausal lady, gravida3para2 with 1 abortion, presented in the outpatient wing of gynecologic oncology department of bhagwan mahaveer cancer hospital & research centre, jaipur, rajasthan with the complaint of pain in right lower abdomen since one month . There was no visible or palpable evidence of any neck swelling, breast abnormality or lymphadenopathy . Her per abdominal examination showed a large firm to hard, non - tender, well - defined, mobile mass in right iliac and hypogastric region arising out of pelvis . Usg whole abdomen suggested the possibility of a dermoid cyst of the ovary (side not specified). Mri of the abdomen reported a large complex multicystic abdomino - pelvic mass with fat fluid levels . A large solid component along right side of lesion was seen extending in right iliac fossa . Tumor markers were carried out and values were reported as follows: ca 125: 143 u / ml.cea: 13.1ng / ml.ca 19.9: 2350 u / ml . Adhesions were dissected and the mass along with appendix and part of the adherent omentum were sent for frozen section . Frozen section reported possibility of squamous cell carcinoma arising in a dermoid cyst and no malignancy in appendix . Final histopathology was reported as squamous cell carcinoma of left ovary arising from dermoid cyst and a benign dermoid cyst in the right ovary [figure 1]. Both fallopian tubes, parametrial tissues, peritoneal biopsies, uterus, cervix, omentum and pelvic lymph nodes were unremarkable . Peritoneal fluid was negative for malignant cells . A dermoid cyst showing area of squamous cell carcinoma for management, the patient was assigned to squamous cell carcinoma of the ovary arising in anmct, surgical stage ic2 . Squamous cell carcinoma of the ovary is quite rare and usually arises in mct of the ovary (up to 2%). Takagi et al have found cea to be more useful than ca 125 and ca 19 - 9 in malignant transformation of mct . Suspicious features (clinical and on mri) include: postmenopausal women (mean age-55years vs. 37.5 years for benign dermoid cysts).larger size of tumor (mean- 152 mm vs. 88 mm for benign).solid areas within the cyst.invasion of adjacent organs / capsule . Postmenopausal women (mean age-55years vs. 37.5 years for benign dermoid cysts). Larger size of tumor (mean- 152 mm vs. 88 mm for benign). Solid areas within the cyst . Sixty - four suitable studies provided information on 277 patients . It was observed that squamous cell carcinoma in mct was mainly found in women above 50 years of age, having a high concentration of ca 125 and ovarian tumors more than 10 cm in size . They also found that figo stage ia had better survival than those with advanced disease . Complete resection with advanced disease followed by adjuvant chemotherapy was seen to be associated with higher survival . According to them adjuvant radiotherapy a case series and review of literature was published in european oncology and hematology, 2013 . In this retrospective review conducted over 24 years between 1986 and 2010, they found six women treated for squamous cell carcinoma in mct, all stage iii/ iv . They found that durable responses were difficult to achieve but best treatment response was seen in a woman who had partial response to chemo - radiotherapy (survival 19 months). According to them, however, khajuria et al and santwani et al have reported squamous cell carcinoma in dermoid cyst at younger ages i.e., 37 years and 40 years, respectively . Keeping in view the rarity and poor prognosis of squamous cell carcinoma of the ovary arising in a mature cystic teratoma, it is very essential for a gynecologic oncologist to be aware of this condition and be equipped to deal with it.
We present an unusual case in which a patient presented to our hand surgery service 15 days after injury, and reconstruction was performed with reposition + flap, with good functional and cosmetic outcomes . A 55-year - old woman presented to an outside facility after amputation of the distal phalanx of the ring finger after accidental knife injury . Primary closure of the stump was performed with 4 - 0 nylon and compression dressing . The patient returned home and placed the amputated segment in a sealed glass jar at 4c in her refrigerator . Dressing changes were performed at a public clinic every 48 h. fifteen days after initial injury, she presented to our service and inquired about the possibility of replantation . The senior author explained to her about his experience with reposition + flap (r+f); however, he usually performed this on the day of injury, rather than 2 weeks later . The patient brought the amputated fragment to the office [figure 1]; it seemed viable, and the segment to be replaced (nail complex and distal bone fragment of the distal phalanx) was in good overall condition, despite the prolonged time from injury . After careful evaluation of the amputated fragment and discussion about risks and benefits with the patient, decision was made for surgery . The entire distal volar segment was resected, and reposition was performed with a homodigital island advancement flap . The patient progressed well postoperatively, with very good functional and cosmetic results [figure 2]. Amputated distal ring finger segment and stump at initial presentation to our service, 2 weeks after injury homodigital volar island advancement flap raised at 8-year follow - up, the patient was seen in the office, with only minimal functional deficits (range of motion 2070) [figure 3], and x - ray demonstrating adequate consolidation [figure 4]. Semmes weinstein monofilament test and two - point discrimination with standard callipers were both normal . The patient had no complaints of allodynia, hyper- or hypoalgesia and heat or cold intolerance . On a visual analogue scale, the patient was satisfied with the reconstruction, rating it 8 out of 10 (110; 1 - poor result, 10 - best result). Final result after reposition + flap at 8-year and 5-month follow - up x - ray at 8-year and 5-month follow - up demonstrating adequate bone consolidation when microsurgical repair of the neurovascular pedicle is impossible, r + f may be an adequate choice, in an attempt to preserve finger size, the nail bed complex and sensation [figures 57]. Close - up of reconstructed fingertip at eight years, dorsal aspect with intact nail adequate cosmetic result in comparison to 5 and 4 fingers volar aspect of the reconstructed 4 finger demonstrates absence of hook nail r + f was described by mantero in 1975 . After 15 days, nonviable tissue was debrided, and a volar advancement flap was used to cover the distal phalanx . This technique had a high rate of osteitis with subsequent resorption of the distal phalanx and was thus abandoned . In 1992, foucher et al . Published a series of cases, in which tissue from the palmar surface of the amputated segment was excised and an advancement flap was performed in the emergency room . Digital replants have proven successful after up to 33 h of warm ischaemia and 94 h of cold preservation . Replantation after such prolonged ischaemic times, however, should only be attempted in a very select number of cases, due to the increased risks of necrosis, infection and thrombosis . Multiple recent studies have shown conflicting data with regard to the influence of ischaemic time on outcomes in digital replantation . This case, in line with the latest literature, illustrates that we may need to review the significance of the role played by ischaemic time on survival and functional outcomes of distal finger amputation; r + f is an option which should be in the hand surgeon's armamentarium.
Unconjugated hyperbilirubinemia (uhb) is common and is associated with a variety of physiologic and pathologic conditions . This occurs as a result of excessive bilirubin formation and because the neonatal liver cannot clear bilirubin rapidly enough from the blood . Greater awareness is needed among all health workers about the description, causes, risk factors, effective treatment, and sequelae of neonatal jaundice . The american academy of pediatrics (aap) has published guidelines outlining the management of healthy newborns with hyperbilirubinemia, which includes maternal abo and rh typing, direct coombs test, blood and rh (d) typing of infants cord blood, and a total serum bilirubin level . Laboratory tests recommended in case of readmission of the newborn for phototherapy or exchange transfusion in addition to the above mentioned are complete blood count with differential and smear, reticulocyte count, etco (if available), g6pd if suggested by ethnic group or geographic origin or if poor response to phototherapy, urine for reducing substances, sepsis workup if suggested by clinical picture . Indirect hyperbilirubinemia can be associated with severe illnesses such as hemolytic disease, metabolic and endocrine disorders, enzymatic deficiencies of the liver, and infections . Urinary tract infections (uti) are attributed as the main reason for prolonged jaundice, and it is well known that uti can occur without apparent signs, and jaundice is an important and sometimes the presenting feature of uti . The first objective of this study is to determine the incidence of urinary tract infections in asymptomatic, jaundiced newborns admitted to makassed general hospital (mgh) under 4 weeks of age, and the second objective is to find a relationship between prolonged neonatal jaundice and uti . Charts of jaundiced newborns below 4 weeks of age who were admitted to icn or nursery at mgh from january 1, 2004 till april 1 2009 were reviewed . The demographic features including name, sex, date of admission, age at presentation, mode of delivery, mode of anesthesia, use of oxytocin or cytotec, type of assistance used, presence of cephalohematoma, bruising or caput succedaneum, weight at birth and at admission, age at onset of jaundice, baby's and mother's blood group, direct and indirect coomb's test, tsh and g6pd levels, mode of collection of the urine culture, type of organism revealed, result of urine analysis, bilirubin level at presentation and maximum level reached during hospitalization, crp, wbc, blood culture, type of feeding, use and duration of antibiotics, duration of phototherapy, intensive phototherapy and exchange transfusion, final diagnosis, duration of hospital stay, discharge status, vcug and ultrasound of the kidneys and urinary tract . Urine was collected in a sterile way using a urine bag in males and catheterization in females . Culture was considered positive when a single pathogen with more than 10,000 colony forming units / ml were discovered by catheterization or more than 10,000 colony forming units / ml if urine collected by bag . Urine culture was repeated if more than one pathogen was discovered or if the number of colonies did not match the above criteria . Excluded charts were those of newborns more than four weeks of age, cases with direct hyperbilirubinemia, those having uti not coinciding with the time of onset of jaundice, cases with co - morbidities causing indirect hyperbilirubinemia and septic condition or any sign of infection in the newborns during jaundice . Data were analyzed using statistical package of social sciences (spss) version 16.0 program using whole numbers, frequencies, means (sd), median (minimum - maximum). Data were analyzed using statistical package of social sciences (spss) version 16.0 program using whole numbers, frequencies, means (sd), median (minimum - maximum). Data were analyzed using statistical package of social sciences (spss) version 16.0 program using whole numbers, frequencies, means (sd), median (minimum - maximum). All charts of newborns admitted to makassed general hospital intensive care unit from january 2004 till april 2009 was reviewed all of the newborns with positive urine culture result were full term whereas 114 (95%) newborns of the negative urine culture group were full term and only 6 (5%) were preterms . 19 (59.4%) of the positive urine culture group and 57 (47.5%) of the negative urine culture group were males, while 13 (40.6%) of the first group and 63 (52.5%) of the second group were females, male to female ratio was 1:1.46 . 6 (19.4%) of the first group and 27 (23.1%) of the second group started to get jaundiced before 24 hours of life, the majority of newborns in both groups (24 and 83 in the first and second groups respectively) started to become jaundiced in the interval between 24 and 168 hours (8 days). Only 1 (3.2%) newborn from the first group and 7 (6%) of the second group started to become jaundiced after the 8 day of life . Concerning the mode of delivery 24 (75%) newborns of the first group and 86 (53.44%) of the second group were delivered vaginally and 8 (25%) from the first group and 33 (27.7%) of the second group were delivered by cesarean section . Exclusive breast milk was given to 15 (48.4%) and 55 (46.6%) of newborns from the first and second group respectively, nearly the same number of the newborns received mixed formula and breast milk feeding in both groups (48.4% and 51.7% respectively). Only a very small number received formula feeding (3.2% and 1.7% respectively). The demographic characteristics of patients with positive and negative urine culture are presented in table 1 . No statistically significant differences were found between the two groups with regard to gestational age, gender, age at onset of jaundice, mode of delivery and type of feeding . Demographic characteristics of infants with positive and negative urine cultures of 152 cases enrolled, positive urine cultures were found in 32 neonates (21.1%). Bacterial pathogens isolated from urine culture were: klebsiella 15 cases (46.87%), e. coli 12 cases (37.5%), pseudomonas 2 cases (6.25%), enterobacter 1 case (3.12%), gbs 1 case (3.12%), and staph aureus 1 case (3.12%) (table 2). Pathogens isolated from urine culture in hyperbilirubinemic neonates before the age of 8 days, jaundice was seen in 27 (84.3%) newborns of the uti group and 100 (83.4%) of the non uti group . While after the age of 8 days jaundice was seen in 5 (15.6%) of the newborns with uti and 20 (16.6%) of newborns without uti . 31 (96.7%) of newborns in the uti group, and 110 (91.7%) of newborns in the non - uti group started to have yellowish discoloration of skin before the age of 8 days while only one (3.3%) newborn with uti and 10 (8.3%) of newborns without uti started to have jaundice after the age of eight days . The maximum duration of treatment in the uti group was 4 days with the majority of newborns (14 cases) receiving 2 days of phototherapy . In the non - uti group the maximum duration of phototherapy was 7 days with the majority of newborns (45) receiving 2 days of phototherapy . Intensive phototherapy was used in 6 (18.7%) in the uti group and 35 (29.16%) of the non - uti group (table 3). None of the newborns in the uti group underwent exchange transfusion therapy versus the non - uti group where 4 (3.3%) of the newborns underwent exchange (figure 1). Intensive phototherapy duration of phototherapy in uti and non - uti groups although not part of the study design, 32 of 32 newborns diagnosed with uti had renal ultrasounds performed . Urinary tract abnormalities were found in 7 (21.87%) patients, which included pelvi - calyceal system dilatation . No abnormalities were found in voiding cystourethrogram obtained in 12 out of the 32 newborns in the uti group . All charts of newborns admitted to makassed general hospital intensive care unit from january 2004 till april 2009 was reviewed all of the newborns with positive urine culture result were full term whereas 114 (95%) newborns of the negative urine culture group were full term and only 6 (5%) were preterms . 19 (59.4%) of the positive urine culture group and 57 (47.5%) of the negative urine culture group were males, while 13 (40.6%) of the first group and 63 (52.5%) of the second group were females, male to female ratio was 1:1.46 . 6 (19.4%) of the first group and 27 (23.1%) of the second group started to get jaundiced before 24 hours of life, the majority of newborns in both groups (24 and 83 in the first and second groups respectively) started to become jaundiced in the interval between 24 and 168 hours (8 days). Only 1 (3.2%) newborn from the first group and 7 (6%) of the second group started to become jaundiced after the 8 day of life . Concerning the mode of delivery 24 (75%) newborns of the first group and 86 (53.44%) of the second group were delivered vaginally and 8 (25%) from the first group and 33 (27.7%) of the second group were delivered by cesarean section . Exclusive breast milk was given to 15 (48.4%) and 55 (46.6%) of newborns from the first and second group respectively, nearly the same number of the newborns received mixed formula and breast milk feeding in both groups (48.4% and 51.7% respectively). Only a very small number received formula feeding (3.2% and 1.7% respectively). The demographic characteristics of patients with positive and negative urine culture are presented in table 1 . No statistically significant differences were found between the two groups with regard to gestational age, gender, age at onset of jaundice, mode of delivery and type of feeding . Demographic characteristics of infants with positive and negative urine cultures of 152 cases enrolled, positive urine cultures were found in 32 neonates (21.1%). Bacterial pathogens isolated from urine culture were: klebsiella 15 cases (46.87%), e. coli 12 cases (37.5%), pseudomonas 2 cases (6.25%), enterobacter 1 case (3.12%), gbs 1 case (3.12%), and staph aureus 1 case (3.12%) (table 2). Pathogens isolated from urine culture in hyperbilirubinemic neonates before the age of 8 days, jaundice was seen in 27 (84.3%) newborns of the uti group and 100 (83.4%) of the non uti group . While after the age of 8 days jaundice was seen in 5 (15.6%) of the newborns with uti and 20 (16.6%) of newborns without uti . 31 (96.7%) of newborns in the uti group, and 110 (91.7%) of newborns in the non - uti group started to have yellowish discoloration of skin before the age of 8 days while only one (3.3%) newborn with uti and 10 (8.3%) of newborns without uti started to have jaundice after the age of eight days . The maximum duration of treatment in the uti group was 4 days with the majority of newborns (14 cases) receiving 2 days of phototherapy . In the non - uti group the maximum duration of phototherapy was 7 days with the majority of newborns (45) receiving 2 days of phototherapy . Intensive phototherapy was used in 6 (18.7%) in the uti group and 35 (29.16%) of the non - uti group (table 3). None of the newborns in the uti group underwent exchange transfusion therapy versus the non - uti group where 4 (3.3%) of the newborns underwent exchange (figure 1). Intensive phototherapy duration of phototherapy in uti and non - uti groups although not part of the study design, 32 of 32 newborns diagnosed with uti had renal ultrasounds performed . Urinary tract abnormalities were found in 7 (21.87%) patients, which included pelvi - calyceal system dilatation . No abnormalities were found in voiding cystourethrogram obtained in 12 out of the 32 newborns in the uti group . All charts of newborns admitted to makassed general hospital intensive care unit from january 2004 till april 2009 was reviewed all of the newborns with positive urine culture result were full term whereas 114 (95%) newborns of the negative urine culture group were full term and only 6 (5%) were preterms . 19 (59.4%) of the positive urine culture group and 57 (47.5%) of the negative urine culture group were males, while 13 (40.6%) of the first group and 63 (52.5%) of the second group were females, male to female ratio was 1:1.46 . 6 (19.4%) of the first group and 27 (23.1%) of the second group started to get jaundiced before 24 hours of life, the majority of newborns in both groups (24 and 83 in the first and second groups respectively) started to become jaundiced in the interval between 24 and 168 hours (8 days). Only 1 (3.2%) newborn from the first group and 7 (6%) of the second group started to become jaundiced after the 8 day of life . Concerning the mode of delivery 24 (75%) newborns of the first group and 86 (53.44%) of the second group were delivered vaginally and 8 (25%) from the first group and 33 (27.7%) of the second group were delivered by cesarean section . Exclusive breast milk was given to 15 (48.4%) and 55 (46.6%) of newborns from the first and second group respectively, nearly the same number of the newborns received mixed formula and breast milk feeding in both groups (48.4% and 51.7% respectively). Only a very small number received formula feeding (3.2% and 1.7% respectively). The demographic characteristics of patients with positive and negative urine culture are presented in table 1 . No statistically significant differences were found between the two groups with regard to gestational age, gender, age at onset of jaundice, mode of delivery and type of feeding . Of 152 cases enrolled, positive urine cultures were found in 32 neonates (21.1%). Bacterial pathogens isolated from urine culture were: klebsiella 15 cases (46.87%), e. coli 12 cases (37.5%), pseudomonas 2 cases (6.25%), enterobacter 1 case (3.12%), gbs 1 case (3.12%), and staph aureus 1 case (3.12%) (table 2). Before the age of 8 days, jaundice was seen in 27 (84.3%) newborns of the uti group and 100 (83.4%) of the non uti group . While after the age of 8 days jaundice was seen in 5 (15.6%) of the newborns with uti and 20 (16.6%) of newborns without uti . 31 (96.7%) of newborns in the uti group, and 110 (91.7%) of newborns in the non - uti group started to have yellowish discoloration of skin before the age of 8 days while only one (3.3%) newborn with uti and 10 (8.3%) of newborns without uti started to have jaundice after the age of eight days . All newborns in both groups were treated with phototherapy . The maximum duration of treatment in the uti group was 4 days with the majority of newborns (14 cases) receiving 2 days of phototherapy . In the non - uti group the maximum duration of phototherapy was 7 days with the majority of newborns (45) receiving 2 days of phototherapy . Intensive phototherapy was used in 6 (18.7%) in the uti group and 35 (29.16%) of the non - uti group (table 3). None of the newborns in the uti group underwent exchange transfusion therapy versus the non - uti group where 4 (3.3%) of the newborns underwent exchange (figure 1). Intensive phototherapy duration of phototherapy in uti and non - uti groups although not part of the study design, 32 of 32 newborns diagnosed with uti had renal ultrasounds performed . Urinary tract abnormalities were found in 7 (21.87%) patients, which included pelvi - calyceal system dilatation . No abnormalities were found in voiding cystourethrogram obtained in 12 out of the 32 newborns in the uti group . Older children and adults, newborns have a high rate of hemoglobin catabolism and bilirubin production because of their elevated hematocrit and red blood cell volume per body weight, and their shorter life span of red blood cells (70 to 90 days). Although bilirubin production is elevated in newborns, conjugation and clearance of bilirubin intake can cause delayed clearance of bilirubin . In most jaundiced neonates, only unconjugated bilirubin is found in the blood, and the accumulated bilirubin is distributed by the circulation throughout the body and produces clinical jaundice . It generally is assumed that to cross intact cell membrane barriers the bilirubin must be free, or dissociated, from its albumin binding . Uti in newborn infants affects 1 in 3 babies with proven bacterial infection, and the incidence is higher in low birth weight and preterm infants as well as febrile or hyperbilirubinemic patients . Bilgen in a series of 102 patients with asymptomatic unexplained indirect hyperbilirubinemia, uti was diagnosed in (8%) of cases . Garcia and nager in a series of 160 asymptomatic jaundiced infants found positive urine culture in 7.5% of the infants younger than 8 weeks . Our study showed similar results but with greater prevalence of uti where in a series of 152 asymptomatic jaundiced newborns 32 (21%) had urinary tract infection all documented by urine cultures (table 2). E. coli is the most common etiologic agent of urinary tract infection, as found in older patients . Gram - positive bacteria, with the exception of enterococci, are rare causes of urinary tract infections . The most common organism discovered in our study was klebsiella with 15 (46.87%) cases, the second most common was the e. coli with 12 (37.5%) cases . A study conducted by jafarzadeh and mohammadzadeh in neonatal research center in iran had similar results of our study with klebsiella the most common organism encountered . Garcia et al . Reported that infants with the onset of jaundice after eight days were more likely to have uti, our study showed that almost all of the newborns with asymptomatic jaundice who were diagnosed to have uti presented before the age of 8 days . This data was supported by a study done by hlya bilgen et al . In 2003 where they found that the onset of jaundice was <7 days in most of their cases . Although garcia et al reported that patients with an elevated conjugated bilirubin fraction were more likely to have uti, none of our patients had a high direct bilirubin level . Concerning the duration of phototherapy our data showed that patients from the uti group received phototherapy for a maximum of 4 days with the majority of patients receiving only 4 days, while patients in the non - uti group received a maximum of 7 days of phototherapy with a similar majority receiving 2 days of phototherapy . The fact that our patients needed phototherapy for only a short period of time and that intensive phototherapy was used in only 18% of the cases compared to 81% in the second group may be indicative of the fact that our practice of early detection of the uti in these newborns may lead to a lesser need of phototherapy intensity and duration as well . Older children and adults, newborns have a high rate of hemoglobin catabolism and bilirubin production because of their elevated hematocrit and red blood cell volume per body weight, and their shorter life span of red blood cells (70 to 90 days). Although bilirubin production is elevated in newborns, conjugation and clearance of bilirubin intake can cause delayed clearance of bilirubin . In most jaundiced neonates, only unconjugated bilirubin is found in the blood, and the accumulated bilirubin is distributed by the circulation throughout the body and produces clinical jaundice . It generally is assumed that to cross intact cell membrane barriers the bilirubin must be free, or dissociated, from its albumin binding . Uti in newborn infants affects 1 in 3 babies with proven bacterial infection, and the incidence is higher in low birth weight and preterm infants as well as febrile or hyperbilirubinemic patients . Bilgen in a series of 102 patients with asymptomatic unexplained indirect hyperbilirubinemia, uti was diagnosed in (8%) of cases . Garcia and nager in a series of 160 asymptomatic jaundiced infants found positive urine culture in 7.5% of the infants younger than 8 weeks . Our study showed similar results but with greater prevalence of uti where in a series of 152 asymptomatic jaundiced newborns 32 (21%) had urinary tract infection all documented by urine cultures (table 2). E. coli is the most common etiologic agent of urinary tract infection, as found in older patients . Gram - positive bacteria, with the exception of enterococci, are rare causes of urinary tract infections . The most common organism discovered in our study was klebsiella with 15 (46.87%) cases, the second most common was the e. coli with 12 (37.5%) cases . A study conducted by jafarzadeh and mohammadzadeh in neonatal research center in iran had similar results of our study with klebsiella the most common organism encountered . Garcia et al . Reported that infants with the onset of jaundice after eight days were more likely to have uti, our study showed that almost all of the newborns with asymptomatic jaundice who were diagnosed to have uti presented before the age of 8 days . This data was supported by a study done by hlya bilgen et al . In 2003 where they found that the onset of jaundice was <7 days in most of their cases . Although garcia et al reported that patients with an elevated conjugated bilirubin fraction were more likely to have uti, none of our patients had a high direct bilirubin level . Concerning the duration of phototherapy our data showed that patients from the uti group received phototherapy for a maximum of 4 days with the majority of patients receiving only 4 days, while patients in the non - uti group received a maximum of 7 days of phototherapy with a similar majority receiving 2 days of phototherapy . The fact that our patients needed phototherapy for only a short period of time and that intensive phototherapy was used in only 18% of the cases compared to 81% in the second group may be indicative of the fact that our practice of early detection of the uti in these newborns may lead to a lesser need of phototherapy intensity and duration as well . Older children and adults, newborns have a high rate of hemoglobin catabolism and bilirubin production because of their elevated hematocrit and red blood cell volume per body weight, and their shorter life span of red blood cells (70 to 90 days). Although bilirubin production is elevated in newborns, conjugation and clearance of bilirubin intake can cause delayed clearance of bilirubin . In most jaundiced neonates, only unconjugated bilirubin is found in the blood, and the accumulated bilirubin is distributed by the circulation throughout the body and produces clinical jaundice . It generally is assumed that to cross intact cell membrane barriers the bilirubin must be free, or dissociated, from its albumin binding . Uti in newborn infants affects 1 in 3 babies with proven bacterial infection, and the incidence is higher in low birth weight and preterm infants as well as febrile or hyperbilirubinemic patients . Bilgen in a series of 102 patients with asymptomatic unexplained indirect hyperbilirubinemia, uti was diagnosed in (8%) of cases . Garcia and nager in a series of 160 asymptomatic jaundiced infants found positive urine culture in 7.5% of the infants younger than 8 weeks . Our study showed similar results but with greater prevalence of uti where in a series of 152 asymptomatic jaundiced newborns 32 (21%) had urinary tract infection all documented by urine cultures (table 2). E. coli is the most common etiologic agent of urinary tract infection, as found in older patients . Gram - positive bacteria, with the exception of enterococci, are rare causes of urinary tract infections . The most common organism discovered in our study was klebsiella with 15 (46.87%) cases, the second most common was the e. coli with 12 (37.5%) cases . A study conducted by jafarzadeh and mohammadzadeh in neonatal research center in iran had similar results of our study with klebsiella the most common organism encountered . Garcia et al . Reported that infants with the onset of jaundice after eight days were more likely to have uti, our study showed that almost all of the newborns with asymptomatic jaundice who were diagnosed to have uti presented before the age of 8 days . This data was supported by a study done by hlya bilgen et al . In 2003 where they found that the onset of jaundice was <7 days in most of their cases . Although garcia et al reported that patients with an elevated conjugated bilirubin fraction were more likely to have uti, none of our patients had a high direct bilirubin level . Concerning the duration of phototherapy our data showed that patients from the uti group received phototherapy for a maximum of 4 days with the majority of patients receiving only 4 days, while patients in the non - uti group received a maximum of 7 days of phototherapy with a similar majority receiving 2 days of phototherapy . The fact that our patients needed phototherapy for only a short period of time and that intensive phototherapy was used in only 18% of the cases compared to 81% in the second group may be indicative of the fact that our practice of early detection of the uti in these newborns may lead to a lesser need of phototherapy intensity and duration as well . Thus, jaundice may be the first sign of uti in these babies before other signs become evident . We recommend that testing for a uti be part of the diagnostic evaluation of asymptomatic jaundiced newborns especially when no other obvious reason of jaundice is found . This may lead to early detection and treatment of these newborns leading to lesser long term complications of the urogenital tract especially the kidneys . We could also achieve shorter duration of phototherapy and consequently hospital stay which decreases the risk of nosocomial infection and the cost of hospital stay.
Gypsies and travellers are recognized as one of the most disadvantaged minority groups in the united kingdom and globally . Research into the health needs of this group is an emerging field, and gypsies and travellers could justly be described as an invisible minority1 in being rarely captured in health statistics, unassertive of their health needs and with few champions.2, 3 in the united kingdom, gypsies and travellers are known to have poorer health status and a higher risk of mortality than socioeconomically matched comparison groups4 and to experience health inequalities which are greater than could be expected simply from socioeconomic disadvantage or from belonging to a minority ethnic group.5 gypsies and travellers access to health services is also known to be poor.6, 7 in several european countries, roma people have been shown to have poorer health than other ethnic groups and poorer access to health services,8, 9, 10 and a recent literature review identified a higher prevalence of both communicable and noncommunicable disease in the roma community with significantly shorter life expectancies than national averages.11 gypsies and travellers share a history of persecution and rejection by mainstream society, which continues today.12, 13, 14, 15 the umbrella term gypsies and travellers covers a diversity of people, including continental roma, english and welsh gypsies and irish and scottish travellers.3 in the 2001, uk census gypsy or irish traveller was included as an ethnic category for the first time . Gypsies have a shared common history, language and oral literature4 and share with travellers beliefs about the centrality of the family as a social structure, nomadism and ideals of purity which influence hygiene in daily life and behaviour towards the opposite sex.13, 16 a component of the gypsy traveller identity is a strong awareness of the differences between gypsy culture and that of the majority population,17, 18 which has been described as contributing to gypsies and travellers ability to maintain a unique identity as internaloutsiders within often hostile host populations.16 some community values such as taking a pride in resilience and resourcefulness, particularly in children, and setting a higher value on lived experience above learning from books diverge from those of the settled community.13 the common use of the word gorgio to describe nongypsies emphasizes the status of gypsy travellers as a race apart who share defined cultural characteristics which define and confirm their unique identity.18 given the poor health outcomes experienced by gypsies and travellers, it is important to explore their views on the services they receive from health providers and to establish their primary health needs . It has been noted that roma women are often overlooked in health research due to dual discrimination, both ethnic and gender, within and outside the community,19 and there is currently little qualitative research exploring women's views on maternal and child health and the health services provided . The uk healthy child progamme20 stipulates that mothers should be visited antenatally to support infant feeding and that postnatal visits should promote breastfeeding, with introduction of solids foods at around 6 months, as recommended by the world health organization.21 encouraging engagement with children's preventive health services has been recognized as the starting place for reducing health inequalities among gypsies and travellers, particularly in the area of nutrition.11 how a baby is fed in the first year of life has an impact upon health in the long and short term.21, 22, 23 breastfed babies are less likely to experience morbidity in the first year of life24 and to have a reduced risk of diabetes, hypertension and obesity in later life.25 health benefits for mothers who breastfeed include a reduced risk of breast and ovarian cancer and type 2 diabetes.24 in the united kingdom, infant feeding behaviour is strongly related to socioeconomic class and ethnicity, with highly educated professional women most likely to breastfeed among the white community, but mothers from nonwhite ethnic minority groups more likely to breastfeed than the general population.22 despite exclusive breastfeeding for 6 months being advised, only 34% of babies in the united kingdom are breastfed at all at 6 months of age and only 1% exclusively.22 a small quantitative study of gypsies and travellers feeding practices in one primary care trust in england, suggested very low breastfeeding rates, with only 3% estimated to have initiated breastfeeding and none continuing to 68 weeks (data based on health visitors reports); however, a survey of 20 gypsy traveller women suggested a rate of 15% who had ever breastfed.26 breastfeeding rates were found to be slightly above average among roma mothers in serbia27, but no difference was identified between the duration of breastfeeding for czech and roma children (a median duration of 3 months breastfeeding in both groups).28 no studies have looked at weaning practices among gypsies and travellers, although these are recognized as being important in relation to continuation of breastfeeding,22 and to later eating habits which have an impact upon risk of obesity and cardiac disease.29, 30 the aim of this study was to explore the views of gypsy traveller mothers and grandmothers on infant feeding and health service provision . Semistructured interviews were conducted with a purposive sample of mothers and grandmothers from english gypsy, irish traveller and romanian roma communities between november 2011 and february 2012 . Grandmothers were included as they are considered to have an influence upon mothers infant feeding choices.31 the sample size was designed to facilitate in depth exploration of the subject and allowed the comparison of the views of roma mothers and grandmothers with their english gypsy and irish traveller counterparts . Twentytwo mothers and grandmothers were recruited, half from the roma community, and half from english gypsy and irish traveller backgrounds (see table 1 for demographic details). Inclusion criteria were as follows: demographic details of participants nvq, national vocational qualification (a uk occupational qualification). Mothers of roma, english gypsy or irish traveller ethnicity with a child aged 3 years or undergrandmothers of roma, english gypsy or irish traveller ethnicity with one or more grandchildren mothers of roma, english gypsy or irish traveller ethnicity with a child aged 3 years or under grandmothers of roma, english gypsy or irish traveller ethnicity with one or more grandchildren recruitment was carried out by a researcher (lc), following introductions by local authority and voluntary workers who were either members of, or wellknown to, the community . These workers initially identified potential participants, and the researcher checked inclusion criteria at interview, including the participant's own selfdefinition of ethnicity . One interviewee was excluded at interview as she did not agree that her ethnicity was irish traveller, despite the link worker having identified her as such . Participants were interviewed in their homes or in a community setting, including a church . Travelling participants were interviewed in their homes on both privately owned and council caravan sites . The sample size was achieved with consideration to ritchie et al . 's view that further data collection would lead to diminishing returns in terms of new insights and ideas gained.32 ethical consent was granted by a university ethics committee (application number hsc/11/09/89). All were given directly to study participants by a link worker who could explain the content; the researcher visited a few days later in the company of a link worker to offer an interview . Prior to interview, the researcher read the information sheet with each participant and completed a consent form, thus ensuring that participants were able to opt out if they wished at this stage . All written materials were translated into romanian for roma participants and also read through at interview by an interpreter . Consent was requested for audiotaping and use of anonymized quotations, in addition to participation . To preserve anonymity, questions were based upon a topic guide developed in collaboration with the steering committee, which included local experts in infant feeding and nutrition in addition to two members of gypsy traveller ethnicity . The topic guide was focused on personal experience of milk and solid feeding, as well as perceived family and community views of infant feeding . Only one roma participant spoke english, so interviews with the roma were conducted in romanian, with professional interpreters providing concurrent translation . For all roma participants, romanian was a second language; no romanyspeaking interpreters existed in bristol . Liamputtong33 suggests that in crosscultural research, interpreters are best considered as joint researchers, as in facilitating communication through translation, they play a part in shaping the data collected . Both interpreters who took part in the project were wellknown to the community and often acted as interpreters in health and educational settings . Permission was requested to audiotape the interview . Where participants agreed to audiotaping, interviews were subsequently transcribed . For the remainder, the interviewer (lc) documented responses contemporaneously by hand . No participants objected to notes being taken, but some interviewees felt that no traveller would allow their voice to be recorded . A sample of audiotaped interviews with roma participants was checked for validity of translation by an independent romanian interpreter; all were confirmed to be accurate . Data were coded using nvivo 9 as part of data analysis using a framework approach by which data are classified and organized according to key themes and concepts.34 members of the steering group contributed to the preliminary identification of codes from iterative reading of transcripts and contemporaneous notes and reached agreement on emergent categories . Following coding of all transcripts, lc and ds identified dominant themes and developed a conceptual framework from an interpretation of the data set as a whole . The framework approach allowed movement from raw data to abstraction in the analytical process, without losing the voice of participants.35 semistructured interviews were conducted with a purposive sample of mothers and grandmothers from english gypsy, irish traveller and romanian roma communities between november 2011 and february 2012 . Grandmothers were included as they are considered to have an influence upon mothers infant feeding choices.31 the sample size was designed to facilitate in depth exploration of the subject and allowed the comparison of the views of roma mothers and grandmothers with their english gypsy and irish traveller counterparts . Twentytwo mothers and grandmothers were recruited, half from the roma community, and half from english gypsy and irish traveller backgrounds (see table 1 for demographic details). Inclusion criteria were as follows: demographic details of participants nvq, national vocational qualification (a uk occupational qualification). Mothers of roma, english gypsy or irish traveller ethnicity with a child aged 3 years or undergrandmothers of roma, english gypsy or irish traveller ethnicity with one or more grandchildren mothers of roma, english gypsy or irish traveller ethnicity with a child aged 3 years or under grandmothers of roma, english gypsy or irish traveller ethnicity with one or more grandchildren recruitment was carried out by a researcher (lc), following introductions by local authority and voluntary workers who were either members of, or wellknown to, the community . These workers initially identified potential participants, and the researcher checked inclusion criteria at interview, including the participant's own selfdefinition of ethnicity . One interviewee was excluded at interview as she did not agree that her ethnicity was irish traveller, despite the link worker having identified her as such . Participants were interviewed in their homes or in a community setting, including a church . Travelling participants were interviewed in their homes on both privately owned and council caravan sites . The sample size was achieved with consideration to ritchie et al . 's view that further data collection would lead to diminishing returns in terms of new insights and ideas gained.32 all were given directly to study participants by a link worker who could explain the content; the researcher visited a few days later in the company of a link worker to offer an interview . Prior to interview, the researcher read the information sheet with each participant and completed a consent form, thus ensuring that participants were able to opt out if they wished at this stage . All written materials were translated into romanian for roma participants and also read through at interview by an interpreter . Consent was requested for audiotaping and use of anonymized quotations, in addition to participation . To preserve anonymity, questions were based upon a topic guide developed in collaboration with the steering committee, which included local experts in infant feeding and nutrition in addition to two members of gypsy traveller ethnicity . The topic guide was focused on personal experience of milk and solid feeding, as well as perceived family and community views of infant feeding . Only one roma participant spoke english, so interviews with the roma were conducted in romanian, with professional interpreters providing concurrent translation . For all roma participants, romanian was a second language; no romanyspeaking interpreters existed in bristol . Liamputtong33 suggests that in crosscultural research, interpreters are best considered as joint researchers, as in facilitating communication through translation, they play a part in shaping the data collected . Both interpreters who took part in the project were wellknown to the community and often acted as interpreters in health and educational settings . Permission was requested to audiotape the interview . Where participants agreed to audiotaping, interviews were subsequently transcribed . For the remainder, the interviewer (lc) documented responses contemporaneously by hand . No participants objected to notes being taken, but some interviewees felt that no traveller would allow their voice to be recorded . A sample of audiotaped interviews with roma participants was checked for validity of translation by an independent romanian interpreter; all were confirmed to be accurate . Data were coded using nvivo 9 as part of data analysis using a framework approach by which data are classified and organized according to key themes and concepts.34 members of the steering group contributed to the preliminary identification of codes from iterative reading of transcripts and contemporaneous notes and reached agreement on emergent categories . Following coding of all transcripts, lc and ds identified dominant themes and developed a conceptual framework from an interpretation of the data set as a whole . The framework approach allowed movement from raw data to abstraction in the analytical process, without losing the voice of participants.35 three dominant themes were identified as influencing infant feeding behaviour, which were common to all participants and related to the culture of their community . These themes were as follows: the centrality of the family, beliefs and traditions related to culture, and a travelling lifestyle . A fourth crosscutting theme was identified as interaction with health professionals; this was interwoven with the themes relating to gypsy and traveller culture throughout . It was apparent that at many points, interactions with health professionals led to some conflict with beliefs and attitudes prevalent in the community, and these conflicts are brought out in the account below . Large families are commonplace among gypsies and travellers, and there is an expectation that older children help care for younger siblings . As a result, women considered that they had preexisting knowledge and skills when they became parents . Few participants described themselves as requiring professional support in caring for children irrespective of age or number of children: the travelling community are reared up with children . I was married at 13 when you are small you are with your mum, and she shows you how to do things . Roma 11, mother i'll tell you again, my mum had 10 kids and i helped look after them, i didn't need to learn from scratch, i already knew . Some people don't know, they have to learn from scratch and they need people telling them what to do and what not to do . I was married at 13 when you are small you are with your mum, and she shows you how to do things . I'll tell you again, my mum had 10 kids and i helped look after them, i didn't need to learn from scratch, i already knew . Some people don't know, they have to learn from scratch and they need people telling them what to do and what not to do . English gypsy 4, mother young motherhood increased participants view of themselves as being highly experienced in all aspects of child care . Compared with the experiential knowledge that was easily available within the family, the advice of health professionals was often set at a low value by mothers and grandmothers.i don't think they need any advice in feeding their children because it's passed on from their own mums and grandmothers . Irish traveller 1, grandmother i've no idea when health visitors say to introduce baby dinners . I think the health visitor advises 3 months but i would do what i thought, from my experience . Lots of health visitors haven't had a baby; they don't know anything about it, just what they have read . Irish traveller 4, mother i don't think they need any advice in feeding their children because it's passed on from their own mums and grandmothers . Irish traveller 1, grandmother i've no idea when health visitors say to introduce baby dinners . I think the health visitor advises 3 months but i would do what i thought, from my experience . Lots of health visitors haven't had a baby; they don't know anything about it, just what they have read . Irish traveller 4, mother contact with health services was described as less common in the past (early on they didn't want anything to do with travellers, now it's more accepted. Irish traveller 5, grandmother), but english gypsies and irish travellers now expected contact with midwifery and health visiting services . Roma women were sometimes unclear about difference in roles, referring to professionals generically as being from the doctor's. All described a minimal service with little routine contact beyond the immediate postnatal period . Mothers took a pride in being capable mothers and did not see themselves as requiring extensive contact with health professionals.the health visitor came once or twice and saw i could get along, now she doesn't come . Translated roma 3, mother the health visitor came once or twice and saw i could get along, now she doesn't come . Translated health professionals were described by all groups as relying on written materials to give health promotion information, despite low literacy levels . Although none of the roma interviewees read english, most mentioned having been given leaflets . Several nonroma participants also could not read health promotion materials: we received leaflets in english, about how to breast feed and what to expect when you're a mum, but we don't actually know how to read in english . Translated roma 8, mother she gave me some [leaflets], but i can't read, not unless i ask someone to read it, then i find out what's in it . I just looked at the pictures, but i didn't often look in the book . Irish traveller 4, mother we received leaflets in english, about how to breast feed and what to expect when you're a mum, but we don't actually know how to read in english . Translated she gave me some [leaflets], but i can't read, not unless i ask someone to read it, then i find out what's in it i just looked at the pictures, but i didn't often look in the book . Irish traveller 4, mother these contacts often served to highlight the differences between travelling people and the settled community . Many participants had little contact with people outside their community and were aware only of their own infant feeding norms . English gypsy and irish traveller participants frequently expressed pride in their culture, and where there was opposition between family traditions and health professional advice, a common response was to reaffirm the positives about the community way. One mother commented to the researcher: me meself, i like me own way of life, i've been brought up as a romany gypsy and that's the way i want me boys to be brought up to be truthful . I'm not racialist against outsiders, but what we call like gaujes or house people like yourself you likes your way, we got our own way . English gypsy 5, mother me meself, i like me own way of life, i've been brought up as a romany gypsy and that's the way i want me boys to be brought up to be truthful . I'm not racialist against outsiders, but what we call like gaujes or house people like yourself english gypsy 5, mother few demands were made on health services by gypsy and traveller mothers at the time of pregnancy and birth, and most health professionals were described as offering little beyond the minimum routine service . Roma mothers described breastfeeding as the usual method of feeding, which babies much enjoyed . While the overriding reason given for preferring breastfeeding was its participants placed more emphasis on ease and the fact it was common practice: it is better to breastfeed because it is healthier . . We don't give the bottle, you just put the breast in his mouth and that's it . Translated roma 6, mother well it's easier because you don't have to spend the money on powder milk and bottles and all that stuff . It's not just about the money; it's just that i find it better . Translated roma 8, mother we raise them with the breast . Translated roma 10, grandmother it is better to breastfeed because it is healthier . We don't give the bottle, you just put the breast in his mouth and that's it . Translated well it's easier because you don't have to spend the money on powder milk and bottles and all that stuff . And it's not just about the money; it's just that i find it better . . Translated roma 10, grandmother when a mother had a baby in the roma community, help with breastfeeding was available from within the extended family . Mothers could learn by watching others breastfeed, and some described being explicitly taught how to breastfeed by their own mother.my mum showed him my breasts and she was showing this is how you do it then you take it out and you.pat him and when you feed him you put him like this . Translated roma 4, mother my mum showed him my breasts and she was showing this is how you do it then you take it out and you.pat him and when you feed him you put him like this . Translated by contrast, english gypsies and irish travellers described a predominantly bottlefeeding culture . As with the roma, feeding behaviours prevalent within the community were passed on to the next generation, but in this case, community knowledge was of how to prepare and store bottles of formula milk, and which brand to choose . Some harmful practices continued among english gypsies and irish travellers including adding foods such as rusks in the bottle at an early age which was justified as being a customary practice and as having been recommended by health professionals in the past . Some of the younger mothers were aware that adding solid foods to bottles was no longer advised, citing the immaturity of the baby's digestive system as a reason to delay the introduction of solid foods . Both irish traveller and english gypsy mothers continued with pured foods beyond the recommended date (even up to 18 months), due to a fear that the baby would choke if offered finger foods . To avoid this, two mothers offered food which they had prechewed, a practice which was described as being a traditional custom among gypsies . Some irish traveller and english gypsy mothers wished to try breastfeeding, primarily because they were aware of the health benefits.they said it was better for the baby, and so because they said that, i thought, go on then, i'll try it . English gypsy 2, mother there are more natural things in your own breast milk than are ever in formula i saw some traveller girls who would dare to breastfeed and i wanted to try . Irish traveller 2, mother they said it was better for the baby, and so because they said that, i thought, go on then, i'll try it . English gypsy 2, mother there are more natural things in your own breast milk than are ever in formula i saw some traveller girls who would dare to breastfeed and i wanted to try . Irish traveller 2, mother although most interviewees knew of a relative or friend who had breastfed, choosing to initiate breastfeeding carried a sense of breaking a taboo . Breastfeeding was frequently described as not being part of the gypsy or traveller tradition, instead being something that gauje women would do . Breastfeeding conflicted with ideals of female behaviour, such as covering the body at all times, particularly in the presence of the opposite sex . Many mothers considered that breastfeeding could only be carried out alone in a private place, not even in the presence of other women.breastfeeding is something that i would not do . I'd never do it, no one in my family would you can't pull out a boob in front of a man, it would a bit embarrassing like some travelling women do it, in the trailer . I'd never do it, no one in my family would you can't pull out a boob in front of a man, it would a bit embarrassing like some travelling women do it, in the trailer . Irish traveller 6, mother one mother stated that because men did not understand the health benefits of breast milk, they preferred women to bottlefeed.most traveller men are old fashioned in their ways and strict about how women behave . These men think that giving the bottle is exactly the same without a woman exposing herself . Irish traveller 2, mother most traveller men are old fashioned in their ways and strict about how women behave . These men think that giving the bottle is exactly the same without a woman exposing herself . Irish traveller 2, mother the one instance where irish traveller and english gypsy interviewees described themselves as actively seeking help from midwives and health visitors was in initiating and continuing breastfeeding . Advice was then sought from professionals because no skilled help was available from within their communities . While messages about the health benefits of breastfeeding were successfully assimilated, postnatal support for breastfeeding was described as insufficient, with professionals failing to grasp the extent of cultural taboos which made breastfeeding as a dangerously immodest act . A mother, who had bottle fed in hospital due to fear of being observed by visitors, received only telephone advice (just carry on trying) from her midwife when she subsequently asked for help in attempting to breastfeed her baby at home . This parsimonious support offered by health professionals contrasted unfavourably with the support which was always available from within the family and community . A warm, trusting relationship which had developed over time appeared a prerequisite for successfully supporting a mother to breastfeed.i don't know what decided me to breastfeed, perhaps it was the midwife . With the last one i had the best service from the midwife . I don't know what decided me to breastfeed, perhaps it was the midwife . With the last one i had the best service from the midwife . Irish traveller 5, grandmother names of helpful and respected health professionals were known throughout the community even if they worked in another city . Participants considered that being informed about gypsy traveller culture was an important characteristic of the respected health professional . Grandmothers described a tradition in romania of breastfeeding until around 2 years, with solid foods, such as polenta, pork and nettle soup, being introduced at around 56 months . However, once in the united kingdom, some mothers started giving formula feeds, even though this had led to some problems with milk supply, babies refusing the breast and subsequent constipation . Commercially manufactured baby foods were given in place of solid family foods, sometimes as early as 4 weeks of age . More civilized and thinking it is better to give the bottle (roma 10, grandmother). Several mothers stated that in the united kingdom, they could afford to bottlefeed and give commercially made baby foods, and therefore did so . There was no evidence of awareness that a very high standard of infant nutrition was being replaced with a less healthy diet.in romania i didn't have the possibility to buy all the things i needed to bottle feed, so that's why i breast fed . Translated roma 7, grandmother in romania i did not have enough money for baby food; i had to feed the same food as everyone else . Roma 11, mother in romania i didn't have the possibility to buy all the things i needed to bottle feed, so that's why i breast fed . Translated roma 7, grandmother in romania i did not have enough money for baby food; i had to feed the same food as everyone else . When asked about any potential longterm health benefits of breastfeeding for babies or mothers, no participant was aware of any impact on lifelong health . Two roma women responded to this question by quoting a gypsy proverb, how will a man live if he does not eat? Which places emphasis upon the importance of food to avoid starvation rather than seeking additional health benefits . For roma women, economic opportunities played a part in dictating infant feeding patterns . Some introduced formula feeds in order to be able to do housework, shop or work outside the home, as other family members could bottlefeed . Others clung to the traditional maternal role of which breastfeeding was seen as a part, in order to have freedom from paid labour.some [women] bottle feed their babies and they have other occupations like selling newspapers or doing something to get money . I just stay at home and take care of the children and my husband goes and works translated roma 1, mother some [women] bottle feed their babies and they have other occupations like selling newspapers or doing something to get money . I just stay at home and take care of the children and my husband goes and works i'd rather stay at home, rather than going and selling newspapers . Translated for english gypsy and irish traveller, interviewees travelling could lead to disrupted contacts with health professionals due to moving between sites . For mothers who wanted to breastfeed, breastfeeding while living in a caravan placed a responsibility on the mother to avoid the risk of offending others . The sociability of travelling life contributed to the difficulties of finding an acceptable place to breastfeed, and for some shortened the duration of breastfeeding.i did try with the last one and i did it for a couple of months . If was difficult because i had no privacy i didn't have a problem with breastfeeding but it was very hard living in a caravan with people in and out i didn't mind giving up.irish traveller 5, grandmother i did try with the last one and i did it for a couple of months . If was difficult because i had no privacy i didn't have a problem with breastfeeding but it was very hard living in a caravan with people in and out large families are commonplace among gypsies and travellers, and there is an expectation that older children help care for younger siblings . As a result few participants described themselves as requiring professional support in caring for children irrespective of age or number of children: the travelling community are reared up with children . I was married at 13 when you are small you are with your mum, and she shows you how to do things . Roma 11, mother i'll tell you again, my mum had 10 kids and i helped look after them, i didn't need to learn from scratch, i already knew . Some people don't know, they have to learn from scratch and they need people telling them what to do and what not to do . I was married at 13 when you are small you are with your mum, and she shows you how to do things . I'll tell you again, my mum had 10 kids and i helped look after them, i didn't need to learn from scratch, i already knew . Some people don't know, they have to learn from scratch and they need people telling them what to do and what not to do . English gypsy 4, mother young motherhood increased participants view of themselves as being highly experienced in all aspects of child care . Compared with the experiential knowledge that was easily available within the family, the advice of health professionals was often set at a low value by mothers and grandmothers.i don't think they need any advice in feeding their children because it's passed on from their own mums and grandmothers . Irish traveller 1, grandmother i've no idea when health visitors say to introduce baby dinners . I think the health visitor advises 3 months but i would do what i thought, from my experience . Lots of health visitors haven't had a baby; they don't know anything about it, just what they have read . Irish traveller 4, mother i don't think they need any advice in feeding their children because it's passed on from their own mums and grandmothers . Irish traveller 1, grandmother i've no idea when health visitors say to introduce baby dinners . I think the health visitor advises 3 months but i would do what i thought, from my experience . Lots of health visitors haven't had a baby; they don't know anything about it, just what they have read . Irish traveller 4, mother contact with health services was described as less common in the past (early on they didn't want anything to do with travellers, now it's more accepted. Irish traveller 5, grandmother), but english gypsies and irish travellers now expected contact with midwifery and health visiting services . Roma women were sometimes unclear about difference in roles, referring to professionals generically as being from the doctor's. All described a minimal service with little routine contact beyond the immediate postnatal period . Mothers took a pride in being capable mothers and did not see themselves as requiring extensive contact with health professionals.the health visitor came once or twice and saw i could get along, now she doesn't come . Translated roma 3, mother the health visitor came once or twice and saw i could get along, now she doesn't come . Translated health professionals were described by all groups as relying on written materials to give health promotion information, despite low literacy levels . Although none of the roma interviewees read english, most mentioned having been given leaflets . Several nonroma participants also could not read health promotion materials: we received leaflets in english, about how to breast feed and what to expect when you're a mum, but we don't actually know how to read in english . Translated roma 8, mother she gave me some [leaflets], but i can't read, not unless i ask someone to read it, then i find out what's in it . I just looked at the pictures, but i didn't often look in the book . Irish traveller 4, mother we received leaflets in english, about how to breast feed and what to expect when you're a mum, but we don't actually know how to read in english . Translated she gave me some [leaflets], but i can't read, not unless i ask someone to read it, then i find out what's in it . I just looked at the pictures, but i didn't often look in the book . Irish traveller 4, mother these contacts often served to highlight the differences between travelling people and the settled community . Many participants had little contact with people outside their community and were aware only of their own infant feeding norms . English gypsy and irish traveller participants frequently expressed pride in their culture, and where there was opposition between family traditions and health professional advice, a common response was to reaffirm the positives about the community way. One mother commented to the researcher: me meself, i like me own way of life, i've been brought up as a romany gypsy and that's the way i want me boys to be brought up to be truthful . Gaujes or house people like yourself you likes your way, we got our own way . English gypsy 5, mother me meself, i like me own way of life, i've been brought up as a romany gypsy and that's the way i want me boys to be brought up to be truthful . I'm not racialist against outsiders, but what we call like gaujes or house people like yourself you likes your way, we got our own way . English gypsy 5, mother few demands were made on health services by gypsy and traveller mothers at the time of pregnancy and birth, and most health professionals were described as offering little beyond the minimum routine service . Roma mothers described breastfeeding as the usual method of feeding, which babies much enjoyed . While the overriding reason given for preferring breastfeeding was its participants placed more emphasis on ease and the fact it was common practice: it is better to breastfeed because it is healthier . We don't give the bottle, you just put the breast in his mouth and that's it . Translated roma 6, mother well it's easier because you don't have to spend the money on powder milk and bottles and all that stuff . It's not just about the money; it's just that i find it better . Translated roma 8, mother we raise them with the breast . Translated roma 10, grandmother it is better to breastfeed because it is healthier . We don't give the bottle, you just put the breast in his mouth and that's it . Translated well it's easier because you don't have to spend the money on powder milk and bottles and all that stuff it's not just about the money; it's just that i find it better . Translated we raise them with the breast . Translated roma 10, grandmother when a mother had a baby in the roma community, help with breastfeeding was available from within the extended family . Mothers could learn by watching others breastfeed, and some described being explicitly taught how to breastfeed by their own mother.my mum showed him my breasts and she was showing this is how you do it then you take it out and you.pat him and when you feed him you put him like this . Translated roma 4, mother my mum showed him my breasts and she was showing this is how you do it then you take it out and you.pat him and when you feed him you put him like this . Translated by contrast, english gypsies and irish travellers described a predominantly bottlefeeding culture . As with the roma, feeding behaviours prevalent within the community were passed on to the next generation, but in this case, community knowledge was of how to prepare and store bottles of formula milk, and which brand to choose . Some harmful practices continued among english gypsies and irish travellers including adding foods such as rusks in the bottle at an early age which was justified as being a customary practice and as having been recommended by health professionals in the past . Some of the younger mothers were aware that adding solid foods to bottles was no longer advised, citing the immaturity of the baby's digestive system as a reason to delay the introduction of solid foods . Both irish traveller and english gypsy mothers continued with pured foods beyond the recommended date (even up to 18 months), due to a fear that the baby would choke if offered finger foods . To avoid this, two mothers offered food which they had prechewed, a practice which was described as being a traditional custom among gypsies . Some irish traveller and english gypsy mothers wished to try breastfeeding, primarily because they were aware of the health benefits.they said it was better for the baby, and so because they said that, i thought, go on then, i'll try it . English gypsy 2, mother there are more natural things in your own breast milk than are ever in formula breast milk has more vitamins and stuff that they can't put in sma i saw some traveller girls who would dare to breastfeed and i wanted to try . Irish traveller 2, mother they said it was better for the baby, and so because they said that, i thought, go on then, i'll try it . English gypsy 2, mother there are more natural things in your own breast milk than are ever in formula i saw some traveller girls who would dare to breastfeed and i wanted to try . Irish traveller 2, mother although most interviewees knew of a relative or friend who had breastfed, choosing to initiate breastfeeding carried a sense of breaking a taboo . Breastfeeding was frequently described as not being part of the gypsy or traveller tradition, instead being something that gauje women would do . Breastfeeding conflicted with ideals of female behaviour, such as covering the body at all times, particularly in the presence of the opposite sex . Many mothers considered that breastfeeding could only be carried out alone in a private place, not even in the presence of other women.breastfeeding is something that i would not do . I'd never do it, no one in my family would you can't pull out a boob in front of a man, it would a bit embarrassing like some travelling women do it, in the trailer . I'd never do it, no one in my family would you can't pull out a boob in front of a man, it would a bit embarrassing like some travelling women do it, in the trailer . Irish traveller 6, mother one mother stated that because men did not understand the health benefits of breast milk, they preferred women to bottlefeed.most traveller men are old fashioned in their ways and strict about how women behave . These men think that giving the bottle is exactly the same without a woman exposing herself . Irish traveller 2, mother most traveller men are old fashioned in their ways and strict about how women behave . These men think that giving the bottle is exactly the same without a woman exposing herself . Irish traveller 2, mother the one instance where irish traveller and english gypsy interviewees described themselves as actively seeking help from midwives and health visitors was in initiating and continuing breastfeeding . Advice was then sought from professionals because no skilled help was available from within their communities . While messages about the health benefits of breastfeeding were successfully assimilated, postnatal support for breastfeeding was described as insufficient, with professionals failing to grasp the extent of cultural taboos which made breastfeeding as a dangerously immodest act . A mother, who had bottle fed in hospital due to fear of being observed by visitors, received only telephone advice (just carry on trying) from her midwife when she subsequently asked for help in attempting to breastfeed her baby at home . This parsimonious support offered by health professionals contrasted unfavourably with the support which was always available from within the family and community . A warm, trusting relationship which had developed over time appeared a prerequisite for successfully supporting a mother to breastfeed.i don't know what decided me to breastfeed, perhaps it was the midwife . With the last one i had the best service from the midwife . I don't know what decided me to breastfeed, perhaps it was the midwife . With the last one i had the best service from the midwife . Irish traveller 5, grandmother names of helpful and respected health professionals were known throughout the community even if they worked in another city . Participants considered that being informed about gypsy traveller culture was an important characteristic of the respected health professional . Grandmothers described a tradition in romania of breastfeeding until around 2 years, with solid foods, such as polenta, pork and nettle soup, being introduced at around 56 months . However, once in the united kingdom, some mothers started giving formula feeds, even though this had led to some problems with milk supply, babies refusing the breast and subsequent constipation . Commercially manufactured baby foods were given in place of solid family foods, sometimes as early as 4 weeks of age . More civilized and thinking it is better to give the bottle (roma 10, grandmother). Several mothers stated that in the united kingdom, they could afford to bottlefeed and give commercially made baby foods, and therefore did so . There was no evidence of awareness that a very high standard of infant nutrition was being replaced with a less healthy diet.in romania i didn't have the possibility to buy all the things i needed to bottle feed, so that's why i breast fed . Translated roma 7, grandmother in romania i did not have enough money for baby food; i had to feed the same food as everyone else . Roma 11, mother in romania i didn't have the possibility to buy all the things i needed to bottle feed, so that's why i breast fed . Translated roma 7, grandmother in romania i did not have enough money for baby food; i had to feed the same food as everyone else . When asked about any potential longterm health benefits of breastfeeding for babies or mothers, no participant was aware of any impact on lifelong health . Two roma women responded to this question by quoting a gypsy proverb, how will a man live if he does not eat? Which places emphasis upon the importance of food to avoid starvation rather than seeking additional health benefits . For roma women, some introduced formula feeds in order to be able to do housework, shop or work outside the home, as other family members could bottlefeed . Others clung to the traditional maternal role of which breastfeeding was seen as a part, in order to have freedom from paid labour.some [women] bottle feed their babies and they have other occupations like selling newspapers or doing something to get money . I just stay at home and take care of the children and my husband goes and works i'd rather stay at home, rather than going and selling newspapers . Translated roma 1, mother some [women] bottle feed their babies and they have other occupations like selling newspapers or doing something to get money . I just stay at home and take care of the children and my husband goes and works i'd rather stay at home, rather than going and selling newspapers . Translated for english gypsy and irish traveller, interviewees travelling could lead to disrupted contacts with health professionals due to moving between sites . For mothers who wanted to breastfeed, breastfeeding while living in a caravan placed a responsibility on the mother to avoid the risk of offending others . The sociability of travelling life contributed to the difficulties of finding an acceptable place to breastfeed, and for some shortened the duration of breastfeeding.i did try with the last one and i did it for a couple of months . If was difficult because i had no privacy i didn't have a problem with breastfeeding but it was very hard living in a caravan with people in and out i didn't mind giving up.irish traveller 5, grandmother i did try with the last one and i did it for a couple of months . If was difficult because i had no privacy i didn't have a problem with breastfeeding but it was very hard living in a caravan with people in and out this qualitative study presents the views of gypsy and traveller mothers and grandmothers in an under explored area . Its strength lies in giving voice to women from a marginalized group to comment on the health services provided for them and to indicate in which aspects of infant feeding culturally sensitive health promotion could be developed . There are indications from this study that cultural beliefs about infant feeding between uk gypsy travellers are not identical, and a wider range of views may have emerged from a larger sample . Limitations of the study include the use of romanian, rather than roma interpreters, which could reduce the ability of participants to express themselves, and the use of interpreters who had ongoing contact with families in all aspects of their lives . However, this study adds to research which suggests that infant feeding in the united kingdom is influenced by ethnicity and culture36, 37, 38 and indicates that a common gypsy traveller identity influences infant feeding practices . Shared aspects of gypsy life, such as observing defined gender roles, having large families and living within a close community13, 16, influence how mothers feed their babies . This study has highlighted that common aspects of the gypsy traveller identity affect feeding differently in different groups, a finding which has important implications for policy and practice in health promotion . In the roma community, studies of other ethnic groups have shown that migrant mothers who interact least with the host community are most likely to retain traditional feeding habits.38, 39 romanian roma mothers exhibited a strong sense of community and could describe traditional feeding behaviours but took a pragmatic approach to changing these, particularly if infant feeding needed to fit in with the demands of paid and unpaid work . The economic necessity to return to work soon after delivery has been previously identified as a factor reducing migrant women's ability to breastfeed.40 roma women described limited involvement with health professionals and seemed unaware of the potential cost to infant and maternal health in switching to formula feeding and early weaning . Ceasing to practice traditional infant feeding behaviours, which are superior to the usual feeding practices of the uk settled population, poses an increased risk to child and maternal health . As roma children are known to have a higher prevalence of health risk factors,41 it is important to recognize where new risks are posed to child and maternal health . In this study, english gypsies and irish travellers exhibited a strong awareness of their political and cultural identity and commonly described their behaviour as characteristic of their community and unlike that of the gauje or nongypsies . Shared infant feeding practices may play a part in maintaining family traditions and values, hence contributing to the community cohesion and resilience which can combat the effects of social disadvantage and racism.42 gypsies and travellers have been noted to define their identity as much by what is rejected as by what is chosen,18 and in this study, the identification of practices, such as breastfeeding, as something that a gypsy would not do demonstrates this . As demonstrated in other studies, developing a relationship with a trusted health professional appeared to be a key factor in facilitating breastfeeding, particularly for mothers who face exceptional barriers.43, 44 in a community, where family support is ubiquitously present, it is vital that health professionals offer a responsive and accessible service . To this end, guidelines have previously been developed to assist health professionals in working effectively with gypsies and travellers.45 despite these, this study has highlighted again the futility of promoting the health benefits of breastfeeding in the antenatal period while failing to provide an adequate service postnatally.46 the disadvantage experienced by gypsies and travellers is exemplified by the demographic details of participants (table 1), which showed that participants had larger than average families, younger age of maternity and low educational achievement in comparison with the majority uk population; all these factors increase disadvantage and reduce life chances.47 given the emphasis on providing health promotion and support to the most disadvantaged in the healthy child programme, it is remarkable that mothers in this study described receiving very little targeted support from health professionals . The frequency with which health professionals were reported as giving health education leaflets to women who did not read english suggests that cultural competency is undeveloped and not prioritized by practitioners.48 mcfadden et al . Suggest that current provision of community breastfeeding support may be inappropriate and inaccessible to some women from minority ethnic backgrounds,49 and this study lends corroboration to this view . The effects of social disadvantage, exclusion and racism compound the difficulties faced by gypsy it is important to explore the views of gypsies and travellers in order to gain insight into their health needs and to address the extreme health inequalities they experience . This study has implications for policy and the practice of health professionals, both in indicating the customary feeding behaviours of some gypsy and traveller groups, and in suggesting how culturally sensitive support could facilitate optimal infant feeding practices . In a culture which prizes children, improving health outcomes by ensuring the best infant feeding is a potentially powerful health promotion message . This study was internally funded by the university of the west of england as part of the spur early career researcher funding stream.
Parkinson's disease (pd) is an age - related neurodegenerative disease with progressive loss of dopaminergic (da) neurons in the substantia nigra pars compacta (snpc). In patients, this depletion of neurons presents clinically with severe motor symptoms including uncontrollable resting tremor, bradikinesia, rigidity and postural imbalance (lang and lozano, 1998a; 1998b; lotharius and brundin, 2002). These symptoms, which affect 1% of individuals over the age of 65, start to manifest when 70~80% of da neurons in the snpc are lost (mandel et al . The exact etiology of pd remains to be fully elucidated, but the key theories propose either an environmental (e.g. Insecticides (calne et al ., 1987; schoenberg, 1987; paolini et al ., 2004)) or a genetic (e.g. Parkin (kitada et al ., 1998) the market value for pd and ad therapies exceeded us$6.5 billion, (schapira et al ., 2005) with projections that these will surpass cancer as the second most common cause of death of the elderly (lang and lozano, 1998a). Therefore, there is a real sense of urgency to discover novel therapies for the treatment or preferably, prevention of these diseases . Currently the only therapies approved for the treatment of pd and ad are agents that attenuate the symptoms (symptomatic) of the disease without disease modifying activity except the anti parkinson drug rasagiline (azilect) (olanow et al ., 2009), which we developed (youdim et al ., 2005) the mainstay for pd treatment focuses on the replacement of lost da with l - dopa, dopamine (da) agonists, monoamine oxidase b inhibitors and catechol - o - methyl tranferase inhibitors, thereby normalizing the patient symptomatically (schapira et al ., 2005). While for ad there are the cholinesterase inhibitors and the glutamate antagonist memantine . Tragically, but important in view of the seriousness of disease progression, is the fact that the course of the disease is not affected by the utilization of these drugs, and the loss of neurons continues unabated even as symptoms may be controlled, at least following initial treatment . Currently, no drugs with claimed neuroprotective activity have been approved by the fda for the treatment of pd or ad (table 1) (mandel et al ., 2003; stocchi and olanow, 2003). Significantly though, recent research has suggested that some drugs used for symptomatic relief in pd, such as azilect, pramipexole (hall et al ., 1996; dooley and markham, 1998; piercey, 1998) and memantine (rogawski and wenk, 2003; plosker and lyseng - williamson, 2005) may also possess neuroprotective activities, rasagiline is currently only drug that may have a disease modifying activity (olanow et al ., 2009). Recent literature show that there has been a paradigm shift in the way researchers are considering the development and design of drugs to treat diseases with complex etiological pathways (i.e. Diseases with multiple drug targets) (morphy et al ., 2004; gal et al ., 2005; morphy and rankovic, 2005; youdim and buccafusco, 2005a; 2005b; van der schyf et al ., 2006a; 2006b; zimmermann et al ., 2007) a drug with a single - target mechanism of action cannot always compensate or correct a complex pathway, which suggests that a complex pathway disease should be treated 1) with a multitude of molecules, each acting on different pathways in the disease (polypharmacy), or 2) with one molecule that possesses promiscuous activity acting on different pathways (multiple mechanism drugs). 1) therefore, is the clinical practice of combining two or more medications in a patient's medication profile, with a view to treat one specific disease . For example, the combination use of salmeterol (a 2-adrenergic agonist) and fluticasone (a glucocorticoid steroid) in asthma, has led to the combination of these two medications in one (advair). Also, the combination (in vytorin) of simvastatin (an hmg - coa reductase inhibitor) and ezetimibe (an inhibitor of dietary cholesterol uptake) is used to treat hyperlipidemia (zimmermann et al ., 2007). The major dilemma encountered in a polypharmaceutical approach, is a significant chance increase in side effects, which may be reduced statistically with the use of only one compound . The recent appearance on the market of drugs that display two mechanisms to treat a particular disease has been a clear move in the direction of the latter paradigm . One example, duloxetine (cymbalta), used in the treatment of depression, inhibits both serotonin and norepinepherine uptake in the central nervous system (cns) (wong et al ., 1988; kihara and ikeda, 1995; the introduction of drugs such as duloxetine indicates the clinical feasibility of designing multi - functional ligands to treat cns disorders with complex disease pathways . In this review, we will consider examples of compounds with multi - functional neuroprotective - neurorescue (table 1 for definitions) properties that may have promise in the treatment of pd and similar approaches have been made for multimodal drugs for ad (youdim et al ., 2006; zheng et al ., 2009), but for the present discussion we shall focus on pd only . Some of the compounds discussed were discovered through serendipity while others were the products of active drug design projects . Rasagiline (n - propargyl-1r - aminoindan) is an anti - pd drug with selective mao - b inhibitory activity (youdim et al ., 2005a). Its s isomer, tv1022 (n - propargyl-1s - aminoindan), is more than a 1,000 times less potent as an mao inhibitor than rasagiline, but still retains neuroprotective activity, which suggests that the propargylamine moiety (even when ostensibly not involved in michael chemistry at the fad within the mao catalytic site as the processing group in suicide inhibition) is responsible for the neuroprotective activity seen in both these compounds (weinreb et al . The selectivity of rasagiline as an mao - b inhibitor compared with tvp-1022, is thought to be associated with the ability of rasagiline to enter the catalytic site gorge of mao - b . On the other hand, the configuration of the s - isomer imparts a highly restrictive conformation on the enzyme - ligand complex, which prevents the molecule from entering the catalytic site, precluding it from acting as a mechanism - based inhibitor . Interestingly, the neuroprotective activity associated with these compounds has now been shown to be associated with the ability of propargylamine (weinreb et al ., 2004a; bar - am et al ., 2005) to protect mitochondrial viability by activation of bcl-2 and protein kinase c (pkc) and, and by down regulating proapoptotic fas and bax, and pkc and - (youdim et al ., 2005a) additionally, these drugs induce the release of the soluble neuroprotective - neurotrophic form of the amyloid precursor protein (sapp) through a pck - map mediated activation of -secretase (youdim and buccafusco, 2005b). The identification of the propargylamine moiety as a key element that confers neuroprotective activity and, in cases such as rasagiline and selegiline, also mao inhibitory activity, led to the development of ache inhibitors such as ladostigil (tv3326, now in phase ii clinical studies), another anti - alzheimer (ad)/anti - pd / antidepressant drug (sterling et al ., 2002; weinstock et al ., 2002; youdim et al ., 2005a; youdim and buccafusco, 2005b). 3) is a dual acetylcholine - butyrylcholine - esterase, and brain - selective mao - a / b inhibitor in vivo, designed by combining the carbamate cholinesterase inhibitory moiety found in the rivastigmine molecule, with the pharmacophore of rasagiline and tvp1022 both of which possess the propargylamine moiety . Ladostigil has been shown to have antidepressant activity due to its ability to inhibit mao - a in the raphe nucleus, striatum, hippocampus, and hypothalamus, and to raise brain levels of da, norepinephrine, and serotonin (weinstock et al ., 2002). Its ability to also inhibit mao - b attenuates 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (mptp) toxicity in mice, a rodent model of parkinsonism (sagi et al . Although a poor mao - b inhibitor, the s isomer of ladostigil, tv3279, has shown similar neuroprotective activity to rasagiline and ladostigil in vitro and in laboratory animals (youdim and buccafusco, 2005b), with molecular mechanisms apparently identical to that of rasagiline . Degenerating nigrostriatal da neurons are the main pathological feature in the snpc of pd sufferers . In addition, many pd patients also experience dementia and depression that likely result from sporadic neurodegeneration in cholinergic, noradrenergic, and serotonergic pathways . In pd, accumulation of iron is found inside some melanin - containing da - ergic neurons and inside amyloid plaques and neurofibrillary tangles associated with pd dementia (zecca et al ., it has been suggested that iron accumulation may contribute to the oxidative stress - induced apoptosis reported in both pd and pd dementia (zecca et al ., 2004; youdim et al ., 2005b). Such oxidative stress may result from increased glial monoamine oxidase (mao) activity leading to exacerbated hydrogen peroxide production that can generate reactive hydroxyl radical through fenton chemistry with intracellular ferrous iron . Iron chelators such as desferoxamine, clioquinol and vk-28 have been shown to have neuroprotective activity in animal models of ad and pd (zecca et al ., 2004). (2005b) developed neuroprotective compounds with dual iron chelating and mao - b inhibitory activity . These authors combined the antioxidant chelator moiety present in an 8-hydroxyquinoline derivative of the neuroprotective brain - permeable iron chelator vk-28, with the propargylamine moiety (found in compounds such as rasagiline and selegiline, as stated earlier). Hla20 was identified as a potential lead compound for further studies having selectivity for mao - b with an ic50 value in the region of 110 m (fig . 4;> 200 m for mao - a), as well as acting as a free radical scavenger . However, a related compound designated m30, unlike hla20 was found in vitro, to be a highly potent mao - a and b inhibitor with brain selectivity for these enzymes in vivo, in addition to possessing iron chelating properties similar to desferoxamine (gal et al ., 2005; zheng et al ., 2005a; 2005b). M30 behaves similarly to other propargylamine mao inhibitors by acting as a suicide- or mechanism - based inhibitor after being identified and processed as a substrate by the enzyme and imparts similar neuroprotective properties as those found in rasagiline and ladostigil (fig . M30 protects against mptp and kainate neurotoxicity in mice by virtue of both its mao inhibitory and iron chelating / radical scavenging properties in these two animal models of neurodegeneration . It has recently been shown to have dopaminergic neurorestorative activity in post treatment with mptp (gal et al ., 2009) and lactacystin (zhu et al ., 2007) models of pd . The neurogenic activity of m30 and hla-20 has been attributed to the inhibition of iron dependent prolyl-4-hydroxylase, via chelation of iron and activation of hif (hypoxia inducing factor) that regulates transcription of a series of neurotropins such as bdnf, gdnf, erythropoietin and vegf . The consequence of hif activation is inhibition of cell cycle g / g, that results in inhibition of cyclin d1 that causes cell arrest differentiation into neurons as seen in the neurorestorative activity of m30 in the two models of pd (zhu et al . We have introduced a carbamate cholinesterase inhibitor (chei) moieties into m30, such as m30c - n and into hla-20 to give hla-20a and have even added the glutamate antagonist, memantine, which is presently in the clinical use . These compounds 7) have been shown to have potent che i and mao - a and b inhibitory activity and possess similar neuroprotective activity to those of their parent compounds, hla-20 and m30 (zheng et al ., 2009). The accumulation of iron at sites where neurons degenerate in pd, is thought to be a major event that is linked to the neurodegenerative process (zecca et al ., 2004). The novel non - toxic lipophilic (and therefore brain - permeable) iron chelator vk-28, and its multi - functional derivative, m30 (both of which possess the mao inhibitory and neuroprotective propargyl moiety of rasagiline), offer potential therapeutic benefits for pd . M30 attenuates apoptotic events in sh - sy5y neuroblastoma cells in a serum deprivation model via multiple protection mechanisms, including 1) reduction of the pro - apoptotic proteins, bad and bax; 2) reduction of apoptosis - associated ser139-phosphorylated h2a.x; 3) induction of the anti - apoptotic protein, bcl-2 and 4) inhibition of the cleavage and activation of caspase-3 . M30 also promotes morphological changes, resulting in axonal growth - associated protein-43 (gap-43), which is implicated in neuronal differentiation . The compound markedly reduces the levels of cellular holo - app, the -c - terminal fragment (-ctf), and levels of amyloidogenic a peptide in the medium of sh - sy5y and cho cells stably transfected with the app " swedish " mutation . In addition, levels of the nonamyloidogenic sapp in cell medium, as well as levels of -ctf in cell lysate were found to be elevated . These results are consistent with the presence of an iron - responsive element (ire) in the 5'-untranslated region (5'utr) of app and demonstrate the effectiveness of m30 in limiting holo - app expression and a peptide secretion . Therefore, the multifunctional properties of m30 suggest that it may offer extraordinary potential as a drug for the treatment of pd, especially pd dementia (avramovich - tirosh et al ., 2006) and ad (mandel et al ., 2007; 2008) and more recently in transgenic g93a sod model of als (amyotrophic lateral sclerosis) where it extends the life span of these animals and has neurogenic activity in ncs-34 rat motor neurons (kupershmidt et al ., 2009). In pd, a dual mechanism that includes inhibition of mao - b, as well as adenosine a2a receptor blockade as detailed earlier, mao - b plays a role in the catabolism of neurotransmitters such as da, serotonin and norepinephrine, leading to hydrogen peroxide formation which contributes to oxidative stress and neuronal cell death (riederer et al ., 2004). Levels of mao - b are found to be increased in older patients (saura et al ., 1994; 1997; mahy et al ., 2000) which has led to the rationale for the use of drugs such as selegiline (deprenyl) and lazabemide, (sramek and cutler, 1999) and the design of drugs such as ladostigil, (youdim and buccafusco, 2005b) as described before . Caffeine, a non - selective adenosine receptor antagonist, is under some scrutiny as a potential drug to counteract age - related cognitive decline (fig . Work in this regard is supported by evidence that critical changes in adenosine - related neurotransmission occur with aging and may be counteracted by adenosine receptor antagonists (maiade and mendonca, 2002; dall'igna et al ., 2003; prediger et al ., 2005). Caffeine, in fact, has been suggested to protect against -amyloid neurotoxicity, (dall'igna et al ., 2003) while acute treatment with caffeine and the a2a receptor antagonist zm241385 was recently found to reverse age - related olfactory deficits and memory decline in rats (prediger et al ., 2005) clearly suggesting involvement of a2a, but not a1 receptors, in cognitive decline and possibly, neurodegenerative processes . Evidence such as the preceding, and other evidence for neuroprotection also in parkinsonian models, led petzer et al . (petzer et al ., 2003) to evaluate (e)-8-styrylxanthinyl derived adenosine a2a receptor antagonists for inhibition also of brain mao - b . Included in these studies were kw-6002, a potent a2a receptor antagonist (ki of 2.2 nm) which is undergoing clinical trials for pd, and (e)-8-(3-chlorostyryl)-caffeine (csc; fig . 8), which has been shown to be neuroprotective in the mptp parkinsonian mouse model (chen et al ., 2002). (petzer et al ., 2003) showed mao - b inhibition in the low micromolar to high nanomolar range, with the ki of kw-6002 at 21 m, and that of csc at 0.1 m . These results clearly suggest that the neuroprotective properties of kw-6002 and csc may in part be due to mao - b inhibition, in synergism with the a2a antagonism (castagnoli et al ., 2003). The divalent calcium cation plays an important role in neuronal cell death (lipton, 1999; horn and limburg, 2000; kemp and mckernan, 2002; ovbiagele et al ., 2003). One of the receptors activated by glutamate (together with its co - agonist glycine), the nmda receptor, is a major conduit for the influx of calcium ions into cells under excitotoxic conditions . The prevention of such excessive influx of calcium (known as excitotoxicity) therefore remains a major drug target in the design of neuroprotective agents . Excess accumulation of calcium in neuronal cells rapidly leads to cell death through a variety of mechanisms including activation of proteases, nucleases, phospholipases, nitric oxide synthase (nos), and other degradative enzymes that not only lead to activation of death cascades, but also to free radical formation (lipton, 1999). Nmda receptor antagonists such as dizocilpine (mk-801) and memantine may possess a dual mechanism by which neuronal cells are protected, both by direct blockade of the nmda receptor and by attenuating tnf-induced potentiation of glutamate toxicity (zou and crews, 2005). Brain injury after ischemic stroke also triggers a release of glutamate - associated excitotoxic events, and the incidence of cognitive impairment and dementia have both been reported to be elevated after cerebral stroke, especially in the elderly (kalaria and ballard, 2001). Up to 25% of stroke patients exhibit symptoms of dementia, including symptoms reminiscent of pd dementia (van kooten and koudstaal, 1998). Stroke is the third leading cause of death in the united states (ovbiagele et al ., 2003) and there is a definitive need to develop drugs that can protect or save neurons after an ischemic incident since, to date, no effective treatment has been developed to prevent neuronal cells from dying during stroke conditions (horn and limburg, 2000). Several studies have shown that nmda receptor antagonists, such as dizocilpine (mk-801) and the polycyclic cage amine memantine, display neuroprotective effects in experiments using ischemia paradigms in neurons (gorgulu et al ., 2000; horn and limburg, 2000; gerriets et al . An alternative pathway for calcium to enter into neuronal cells is through voltage - gated ion channels, such as l - type calcium channels . Animal experiments with nimodipine have suggested that calcium channel antagonists may be neuroprotective in ischemia by antagonizing the influx of calcium into neuronal cells (horn and limburg, 2000). The importance of calcium overload during cell death, suggests that a dual calcium channel and nmda receptor antagonist might be useful as a neuroprotective drug in stroke and other neurodegenerative disease such as idiopathic pd, where it has been suggested that brain - permeable l - type calcium channel blockers may have a salutary effect on the disease . Ngp1 - 01 (8-benzylamino-8,11-oxapentacycloundecane) is a polycyclic cage amine derived from the reductive amination of benzylamine and cookson's " bird cage " diketone of which the biology was first described by van der schyf (van der schyf et al ., 1986) (fig . The l - type calcium channel blocking activity of ngp1 - 01 was investigated utilizing electrophysiological experiments in isolated guineapig papillary muscle and sheep purkinje fibers (van der schyf et al ., 1986). The structural similarity of ngp1 - 01 to another polycyclic cage amine and nmda receptor antagonist, memantine, led to the evaluation of ngp1 - 01 for potential nmda receptor antagonism . Memantine is an uncompetitive nmda receptor antagonist which is used clinically to treat ad, but has also been used for pd in germany (parsons et al ., 1999; rogawski and wenk, 2003; plosker and lyseng - williamson, 2005). Its favorable fast on - off binding kinetics gives this compound an improved side effect profile compared with other nmda antagonists such as mk-801 (parsons et al . Ngp1 - 01 was shown to also be an uncompetitive nmda antagonist in murine whole brain synaptoneurosomes and blocked nmda - mediated ca uptake with an ic50 of 2.98 m (geldenhuys et al ., 2007). (2006) showed that ngp1 - 01 (at 1 m) inhibited depolarizationinduced calcium influx by 78% in cortical neurons preloaded with fura-2 am, with a potency similar to that of nimodipine, while simultaneously inhibiting nmda - induced (1 mm) calcium influx by 52%, only slightly less potent than memantine . Using in vivo - microdialysis, intraperitoneal injection of ngp1 - 01 (40 mg / kg) reduced nmda - induced membrane breakdown by 31% (p<0.01) while memantine (10 mg / kg) reduced choline release by 40% . These results demonstrate that ngp1 - 01 simultaneously blocks both major neuronal calcium channels and is brain - permeable after peripheral administration . This dual mechanism of modulating calcium entry into neuronal cells might suggest that ngp1 - 01 may have utility as a neuroprotective agent in pd, stroke and other neurodegenerative diseases, especially in patients with comorbidity among these diseases . This promise of neuroprotection has recently been partly confirmed in in vivo studies using the middle cerebral artery occlusion (mcao) mouse model of stroke, wherein it was shown that ngp1 - 01, administered 30 minutes before mcao, afforded substantial protection against cerebral ischemia - induced brain lesioning, as well as brain swelling measured 24 hours after mcao (mdzinarishvili et al ., 2005). Another role assigned to cage amines such as ngp1 - 01 in pd therapy is the ability of these compounds to inhibit da re - uptake into nerve terminals (fig . Compounds that are able to block the da transporter (dat) have been suggested to be more useful in treating the motor symptoms in pd, as opposed to norepinephrine and serotonin re - uptake inhibitors (hansard et al ., 2002). Additionally, compounds with the ability to block dat, may also have neuroprotective activity (kirby et al ., 2002). Ngp1 - 01 was recently shown to block da re - uptake in murine synaptosomes with an ic50 of 57 m . One of ngp1 - 01's derivatives, a phenylethylamine derivative, was even more potent with an ic50 of 23 m (geldenhuys et al ., 2004). The latter compound was also found to be neuroprotective in the mptp - parkinsonian mouse model, affording protection against a single 35 mg / kg (ip) dose of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (mptp) (geldenhuys et al ., 2003). Polyphenols are natural products present in beverages such as red wine and tea (weinreb et al ., 2004b). One of the classes of polyphenols which are pharmaceutically interesting is the flavenoids (fig . These compounds are characterized by an aromatic ring which is condensed to a heterocyclic ring and attached to a second aromatic ring . An innovative therapeutic approach could be the use of natural plant polyphenol flavonoids, reported to have access to the brain and to possess multifunctional activities as iron chelators, radical scavengers, anti - inflammatory agents and neuroprotectants (morel et al ., 1993; guo et al ., 1996; hider et al ., 2001; joseph et al ., 2005). These compounds and their actions have been extensively reviewed (mandel et al ., 2005). In particular, the major constituent of green tea catechin extract (-)-epigallocatechin-3-gallate (egcg; fig . 11) plays a major role in the prevention of neurodegeneration in a variety of cellular and animal models of neurodegenerative diseases (mandel et al ., 2006). This effect appears to be mediated through multiple pathways, including the participation of the pro - survival pkc and extracellular mitogen - activated protein kinase (mapk) signaling and the promotion of neurite outgrowth (reznichenko et al ., 2005). Structurally important features defining their chelating potential are the 3',4'-dihydroxyl group in the b ring (hider et al ., 2001), as well as the gallate group (kumamoto et al ., 2001) which may neutralize ferric iron to form redox - inactive iron, thereby protecting cells against oxidative damage (grinberg et al ., 1997). Recent studies have shown that prolonged administration of egcg to mice induced a significant reduction in membrane - associated app levels in hippocampus (levites et al ., 2003) and in cerebral a levels concomitant with reduced -amyloid plaques (rezai - zadeh et al ., 2005). This effect may be accounted for, in part, by the chelation of the intracellular free - iron labile pool, modulating app mrna translation via its ire - type ii (reznichenko et al ., 2006), as has recently been described for other metal chelators, such as desferoxamine, clioquinol and dimercaptopropanol (payton et al ., 2003; rogers and lahiri, 2004). Rasagiline (n - propargyl-1r - aminoindan) is an anti - pd drug with selective mao - b inhibitory activity (youdim et al ., 2005a). Its s isomer, tv1022 (n - propargyl-1s - aminoindan), is more than a 1,000 times less potent as an mao inhibitor than rasagiline, but still retains neuroprotective activity, which suggests that the propargylamine moiety (even when ostensibly not involved in michael chemistry at the fad within the mao catalytic site as the processing group in suicide inhibition) is responsible for the neuroprotective activity seen in both these compounds (weinreb et al . The selectivity of rasagiline as an mao - b inhibitor compared with tvp-1022, is thought to be associated with the ability of rasagiline to enter the catalytic site gorge of mao - b . On the other hand, the configuration of the s - isomer imparts a highly restrictive conformation on the enzyme - ligand complex, which prevents the molecule from entering the catalytic site, precluding it from acting as a mechanism - based inhibitor . Interestingly, the neuroprotective activity associated with these compounds has now been shown to be associated with the ability of propargylamine (weinreb et al . To protect mitochondrial viability by activation of bcl-2 and protein kinase c (pkc) and, and by down regulating proapoptotic fas and bax, and pkc and - (youdim et al ., 2005a). Additionally, these drugs induce the release of the soluble neuroprotective - neurotrophic form of the amyloid precursor protein (sapp) through a pck - map mediated activation of -secretase (youdim and buccafusco, 2005b). The identification of the propargylamine moiety as a key element that confers neuroprotective activity and, in cases such as rasagiline and selegiline, also mao inhibitory activity, led to the development of ache inhibitors such as ladostigil (tv3326, now in phase ii clinical studies), another anti - alzheimer (ad)/anti - pd / antidepressant drug (sterling et al . 3) is a dual acetylcholine - butyrylcholine - esterase, and brain - selective mao - a / b inhibitor in vivo, designed by combining the carbamate cholinesterase inhibitory moiety found in the rivastigmine molecule, with the pharmacophore of rasagiline and tvp1022 both of which possess the propargylamine moiety . Ladostigil has been shown to have antidepressant activity due to its ability to inhibit mao - a in the raphe nucleus, striatum, hippocampus, and hypothalamus, and to raise brain levels of da, norepinephrine, and serotonin (weinstock et al ., 2002). Its ability to also inhibit mao - b attenuates 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (mptp) toxicity in mice, a rodent model of parkinsonism (sagi et al ., 2003). Although a poor mao - b inhibitor, the s isomer of ladostigil, tv3279, has shown similar neuroprotective activity to rasagiline and ladostigil in vitro and in laboratory animals (youdim and buccafusco, 2005b), with molecular mechanisms apparently identical to that of rasagiline . Degenerating nigrostriatal da neurons are the main pathological feature in the snpc of pd sufferers . In addition, many pd patients also experience dementia and depression that likely result from sporadic neurodegeneration in cholinergic, noradrenergic, and serotonergic pathways . In pd, accumulation of iron is found inside some melanin - containing da - ergic neurons and inside amyloid plaques and neurofibrillary tangles associated with pd dementia (zecca et al ., 2004). It has been suggested that iron accumulation may contribute to the oxidative stress - induced apoptosis reported in both pd and pd dementia (zecca et al ., 2004; . Such oxidative stress may result from increased glial monoamine oxidase (mao) activity leading to exacerbated hydrogen peroxide production that can generate reactive hydroxyl radical through fenton chemistry with intracellular ferrous iron . Iron chelators such as desferoxamine, clioquinol and vk-28 have been shown to have neuroprotective activity in animal models of ad and pd (zecca et al ., 2004). (2005b) developed neuroprotective compounds with dual iron chelating and mao - b inhibitory activity . These authors combined the antioxidant chelator moiety present in an 8-hydroxyquinoline derivative of the neuroprotective brain - permeable iron chelator vk-28, with the propargylamine moiety (found in compounds such as rasagiline and selegiline, as stated earlier). Hla20 was identified as a potential lead compound for further studies having selectivity for mao - b with an ic50 value in the region of 110 m (fig . 4;> 200 m for mao - a), as well as acting as a free radical scavenger . However, a related compound designated m30, unlike hla20 was found in vitro, to be a highly potent mao - a and b inhibitor with brain selectivity for these enzymes in vivo, in addition to possessing iron chelating properties similar to desferoxamine (gal et al ., 2005; zheng et al ., 2005a; 2005b). M30 behaves similarly to other propargylamine mao inhibitors by acting as a suicide- or mechanism - based inhibitor after being identified and processed as a substrate by the enzyme and imparts similar neuroprotective properties as those found in rasagiline and ladostigil (fig . M30 protects against mptp and kainate neurotoxicity in mice by virtue of both its mao inhibitory and iron chelating / radical scavenging properties in these two animal models of neurodegeneration . It has recently been shown to have dopaminergic neurorestorative activity in post treatment with mptp (gal et al ., 2009) and lactacystin (zhu et al ., 2007) models of pd . The neurogenic activity of m30 and hla-20 has been attributed to the inhibition of iron dependent prolyl-4-hydroxylase, via chelation of iron and activation of hif (hypoxia inducing factor) that regulates transcription of a series of neurotropins such as bdnf, gdnf, erythropoietin and vegf . The consequence of hif activation is inhibition of cell cycle g / g, that results in inhibition of cyclin d1 that causes cell arrest differentiation into neurons as seen in the neurorestorative activity of m30 in the two models of pd (zhu et al . We have introduced a carbamate cholinesterase inhibitor (chei) moieties into m30, such as m30c - n and into hla-20 to give hla-20a and have even added the glutamate antagonist, memantine, which is presently in the clinical use . These compounds 7) have been shown to have potent che i and mao - a and b inhibitory activity and possess similar neuroprotective activity to those of their parent compounds, hla-20 and m30 (zheng et al ., 2009). The accumulation of iron at sites where neurons degenerate in pd, is thought to be a major event that is linked to the neurodegenerative process (zecca et al ., 2004). The novel non - toxic lipophilic (and therefore brain - permeable) iron chelator vk-28, and its multi - functional derivative, m30 (both of which possess the mao inhibitory and neuroprotective propargyl moiety of rasagiline), offer potential therapeutic benefits for pd . M30 attenuates apoptotic events in sh - sy5y neuroblastoma cells in a serum deprivation model via multiple protection mechanisms, including 1) reduction of the pro - apoptotic proteins, bad and bax; 2) reduction of apoptosis - associated ser139-phosphorylated h2a.x; 3) induction of the anti - apoptotic protein, bcl-2 and 4) inhibition of the cleavage and activation of caspase-3 . M30 also promotes morphological changes, resulting in axonal growth - associated protein-43 (gap-43), which is implicated in neuronal differentiation . The compound markedly reduces the levels of cellular holo - app, the -c - terminal fragment (-ctf), and levels of amyloidogenic a peptide in the medium of sh - sy5y and cho cells stably transfected with the app " swedish " mutation . In addition, levels of the nonamyloidogenic sapp in cell medium, as well as levels of -ctf in cell lysate were found to be elevated . These results are consistent with the presence of an iron - responsive element (ire) in the 5'-untranslated region (5'utr) of app and demonstrate the effectiveness of m30 in limiting holo - app expression and a peptide secretion . Therefore, the multifunctional properties of m30 suggest that it may offer extraordinary potential as a drug for the treatment of pd, especially pd dementia (avramovich - tirosh et al ., 2006) and ad (mandel et al ., 2007; 2008) and more recently in transgenic g93a sod model of als (amyotrophic lateral sclerosis) where it extends the life span of these animals and has neurogenic activity in ncs-34 rat motor neurons (kupershmidt et al ., 2009). In pd, a dual mechanism that includes inhibition of mao - b, as well as adenosine a2a receptor blockade offer a novel therapeutic approach to prevent neuronal cell death (fig . As detailed earlier, mao - b plays a role in the catabolism of neurotransmitters such as da, serotonin and norepinephrine, leading to hydrogen peroxide formation which contributes to oxidative stress and neuronal cell death (riederer et al ., 2004). Levels of mao - b are found to be increased in older patients (saura et al ., 1994; 1997; mahy et al ., 2000) which has led to the rationale for the use of drugs such as selegiline (deprenyl) and lazabemide, (sramek and cutler, 1999) and the design of drugs such as ladostigil, (youdim and buccafusco, 2005b) as described before . Caffeine, a non - selective adenosine receptor antagonist, is under some scrutiny as a potential drug to counteract age - related cognitive decline (fig . Work in this regard is supported by evidence that critical changes in adenosine - related neurotransmission occur with aging and may be counteracted by adenosine receptor antagonists (maiade and mendonca, 2002; dall'igna et al ., 2003; prediger et al ., 2005). Caffeine, in fact, has been suggested to protect against -amyloid neurotoxicity, (dall'igna et al ., 2003) while acute treatment with caffeine and the a2a receptor antagonist zm241385 was recently found to reverse age - related olfactory deficits and memory decline in rats (prediger et al ., 2005) clearly suggesting involvement of a2a, but not a1 receptors, in cognitive decline and possibly, neurodegenerative processes . Evidence such as the preceding, and other evidence for neuroprotection also in parkinsonian models, led petzer et al . (petzer et al ., 2003) to evaluate (e)-8-styrylxanthinyl derived adenosine a2a receptor antagonists for inhibition also of brain mao - b . Included in these studies were kw-6002, a potent a2a receptor antagonist (ki of 2.2 nm) which is undergoing clinical trials for pd, and (e)-8-(3-chlorostyryl)-caffeine (csc; fig . 8), which has been shown to be neuroprotective in the mptp parkinsonian mouse model (chen et al ., 2002). (petzer et al ., 2003) showed mao - b inhibition in the low micromolar to high nanomolar range, with the ki of kw-6002 at 21 m, and that of csc at 0.1 m . These results clearly suggest that the neuroprotective properties of kw-6002 and csc may in part be due to mao - b inhibition, in synergism with the a2a antagonism (castagnoli et al ., 2003). The divalent calcium cation plays an important role in neuronal cell death (lipton, 1999; horn and limburg, 2000; kemp and mckernan, 2002; ovbiagele et al ., 2003). One of the receptors activated by glutamate (together with its co - agonist glycine), the nmda receptor, is a major conduit for the influx of calcium ions into cells under excitotoxic conditions . The prevention of such excessive influx of calcium (known as excitotoxicity) therefore remains a major drug target in the design of neuroprotective agents . Excess accumulation of calcium in neuronal cells rapidly leads to cell death through a variety of mechanisms including activation of proteases, nucleases, phospholipases, nitric oxide synthase (nos), and other degradative enzymes that not only lead to activation of death cascades, but also to free radical formation (lipton, 1999). Nmda receptor antagonists such as dizocilpine (mk-801) and memantine may possess a dual mechanism by which neuronal cells are protected, both by direct blockade of the nmda receptor and by attenuating tnf-induced potentiation of glutamate toxicity (zou and crews, 2005). Brain injury after ischemic stroke also triggers a release of glutamate - associated excitotoxic events, and the incidence of cognitive impairment and dementia have both been reported to be elevated after cerebral stroke, especially in the elderly (kalaria and ballard, 2001). Up to 25% of stroke patients exhibit symptoms of dementia, including symptoms reminiscent of pd dementia (van kooten and koudstaal, 1998). Stroke is the third leading cause of death in the united states (ovbiagele et al ., 2003) and there is a definitive need to develop drugs that can protect or save neurons after an ischemic incident since, to date, no effective treatment has been developed to prevent neuronal cells from dying during stroke conditions (horn and limburg, 2000). Several studies have shown that nmda receptor antagonists, such as dizocilpine (mk-801) and the polycyclic cage amine memantine, display neuroprotective effects in experiments using ischemia paradigms in neurons (gorgulu et al ., 2000; horn and limburg, 2000; gerriets et al ., 2003; richard green et al ., 2003). An alternative pathway for calcium to enter into neuronal cells is through voltage - gated ion channels, such as l - type calcium channels . Animal experiments with nimodipine have suggested that calcium channel antagonists may be neuroprotective in ischemia by antagonizing the influx of calcium into neuronal cells (horn and limburg, 2000). The importance of calcium overload during cell death, suggests that a dual calcium channel and nmda receptor antagonist might be useful as a neuroprotective drug in stroke and other neurodegenerative disease such as idiopathic pd, where it has been suggested that brain - permeable l - type calcium channel blockers may have a salutary effect on the disease . Ngp1 - 01 (8-benzylamino-8,11-oxapentacycloundecane) is a polycyclic cage amine derived from the reductive amination of benzylamine and cookson's " bird cage " diketone of which the biology was first described by van der schyf (van der schyf et al ., 1986) the l - type calcium channel blocking activity of ngp1 - 01 was investigated utilizing electrophysiological experiments in isolated guineapig papillary muscle and sheep purkinje fibers (van der schyf et al ., 1986). The structural similarity of ngp1 - 01 to another polycyclic cage amine and nmda receptor antagonist, memantine, led to the evaluation of ngp1 - 01 for potential nmda receptor antagonism . Memantine is an uncompetitive nmda receptor antagonist which is used clinically to treat ad, but has also been used for pd in germany (parsons et al ., 1999; rogawski and wenk, 2003; plosker and lyseng - williamson, 2005). Its favorable fast on - off binding kinetics gives this compound an improved side effect profile compared with other nmda antagonists such as mk-801 (parsons et al . Ngp1 - 01 was shown to also be an uncompetitive nmda antagonist in murine whole brain synaptoneurosomes and blocked nmda - mediated ca uptake with an ic50 of 2.98 m (geldenhuys et al ., 2007). In a recent paper kiewert et al . (2006) showed that ngp1 - 01 (at 1 m) inhibited depolarizationinduced calcium influx by 78% in cortical neurons preloaded with fura-2 am, with a potency similar to that of nimodipine, while simultaneously inhibiting nmda - induced (1 mm) calcium influx by 52%, only slightly less potent than memantine . Using in vivo - microdialysis, intraperitoneal injection of ngp1 - 01 (40 mg / kg) reduced nmda - induced membrane breakdown by 31% (p<0.01) while memantine (10 mg / kg) reduced choline release by 40% . These results demonstrate that ngp1 - 01 simultaneously blocks both major neuronal calcium channels and is brain - permeable after peripheral administration . This dual mechanism of modulating calcium entry into neuronal cells might suggest that ngp1 - 01 may have utility as a neuroprotective agent in pd, stroke and other neurodegenerative diseases, especially in patients with comorbidity among these diseases . This promise of neuroprotection has recently been partly confirmed in in vivo studies using the middle cerebral artery occlusion (mcao) mouse model of stroke, wherein it was shown that ngp1 - 01, administered 30 minutes before mcao, afforded substantial protection against cerebral ischemia - induced brain lesioning, as well as brain swelling measured 24 hours after mcao (mdzinarishvili et al ., 2005). Another role assigned to cage amines such as ngp1 - 01 in pd therapy is the ability of these compounds to inhibit da re - uptake into nerve terminals (fig . Compounds that are able to block the da transporter (dat) have been suggested to be more useful in treating the motor symptoms in pd, as opposed to norepinephrine and serotonin re - uptake inhibitors (hansard et al ., 2002). Additionally, compounds with the ability to block dat, may also have neuroprotective activity (kirby et al ., 2002). Ngp1 - 01 was recently shown to block da re - uptake in murine synaptosomes with an ic50 of 57 m . One of ngp1 - 01's derivatives, a phenylethylamine derivative, was even more potent with an ic50 of 23 m (geldenhuys et al . The latter compound was also found to be neuroprotective in the mptp - parkinsonian mouse model, affording protection against a single 35 mg / kg (ip) dose of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (mptp) (geldenhuys et al ., 2003). Polyphenols are natural products present in beverages such as red wine and tea (weinreb et al ., 2004b). One of the classes of polyphenols which are pharmaceutically interesting is the flavenoids (fig . These compounds are characterized by an aromatic ring which is condensed to a heterocyclic ring and attached to a second aromatic ring . An innovative therapeutic approach could be the use of natural plant polyphenol flavonoids, reported to have access to the brain and to possess multifunctional activities as iron chelators, radical scavengers, anti - inflammatory agents and neuroprotectants (morel et al ., 1993; guo et al ., 1996; hider et al ., 2001; joseph et al ., these compounds and their actions have been extensively reviewed (mandel et al ., 2005). In particular, the major constituent of green tea catechin extract (-)-epigallocatechin-3-gallate (egcg; fig . 11) plays a major role in the prevention of neurodegeneration in a variety of cellular and animal models of neurodegenerative diseases (mandel et al ., 2006). This effect appears to be mediated through multiple pathways, including the participation of the pro - survival pkc and extracellular mitogen - activated protein kinase (mapk) signaling and the promotion of neurite outgrowth (reznichenko et al ., 2005). Structurally important features defining their chelating potential are the 3',4'-dihydroxyl group in the b ring (hider et al ., 2001), as well as the gallate group (kumamoto et al ., 2001) which may neutralize ferric iron to form redox - inactive iron, thereby protecting cells against oxidative damage (grinberg et al ., 1997). Recent studies have shown that prolonged administration of egcg to mice induced a significant reduction in membrane - associated app levels in hippocampus (levites et al ., 2003) and in cerebral a levels concomitant with reduced -amyloid plaques (rezai - zadeh et al ., 2005). This effect may be accounted for, in part, by the chelation of the intracellular free - iron labile pool, modulating app mrna translation via its ire - type ii (reznichenko et al ., 2006), as has recently been described for other metal chelators, such as desferoxamine, clioquinol and dimercaptopropanol (payton et al ., 2003; rogers and lahiri, 2004). Pd and ad are complex diseases with multiple pathways which contribute to its etiology and finally cell death of da - ergic, cholinergic and other neurons . To address this multiplicity, compounds that target more than one drug target in the cell death cascades the feasibility of moving these drugs to market has been shown through the success of rasagiline, which has been shown to have neuroprotective activity and has made it to the market as a pd therapeutic (olanow et al ., 2009). The development of multimodal drugs is not limited to neurodegenerative disease, but rather that similar approaches are under way with other complex disease such as cancer, aids, depressive illness, schizophrenia and possibly cardiovascular disorders (youdim and van der schyf, 2009).
Neutrinoless double - beta decay (0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document}) is a process that violates the lepton number conservation law by two units, in which a parent nucleus decays into a daughter nucleus and emits two \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta $$\end{document} particles . Unlike the process accompanied by the emission of two neutrinos, allowed by the standard model and observed in several nuclei, 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta its discovery would reveal physics beyond the standard model: it would tell us that neutrinos, unlike all other elementary fermions, are majorana particles, and would point to leptogenesis as the origin of the matter antimatter asymmetry after the big bang (for a recent review see for example and references therein). The experimental signature is very clear, a peak in the sum energy spectrum of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta $$\end{document}s at the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q$$\end{document}q - value of the decay . Bolometers proved to be good detectors to search for 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document}, thanks to the high variety of isotopes that can be studied, the excellent energy resolution, and the low background they can achieve . The cuore experiment [2, 3] will search for the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te with an array of 988 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 bolometers, cryogenic calorimeters working at a temperature around 10\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~mk}$$\end{document}mk . Each bolometer weighs 750\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~g}$$\end{document}g, for a total active mass of 741, 206\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kg}$$\end{document}kg of which are \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te (34.2% natural abundance in tellurium). The energy resolution at the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q$$\end{document}q - value of the decay, 2,528\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev, is expected to be 5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev~fwhm}$$\end{document}kevfwhm . Cuore is under construction at laboratory nazionali del gran sasso (lngs) in italy, and it will start to take data in 2015 . The technology of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 bolometers has been demonstrated by cuoricino, a 40\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kg}$$\end{document}kg tower of 62 bolometers that, with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$19.75\mathrm {~kg\,year}$$\end{document}19.75kgyear of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te data, set a lower limit to the decay half - life of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$2.4\times 10^{24}\mathrm {~years}$$\end{document}2.41024years at 90% c.l . . The analysis of the data pointed out that the main source of background in the energy region of interest (roi) for the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} consisted in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} particles generated by natural radioactivity of the copper structure holding the crystals . To reduce it, the cuore collaboration developed techniques to clean the copper and to assemble the detector in ultra radiopure environments . The success of this effort has recently been demonstrated by the cuore-0 experiment, an array of 52 bolometers that reached an \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background index of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$0.019\pm 0.002\mathrm {~counts/(kev\,kg\,year)}$$\end{document}0.0190.002counts/(kevkgyear), a factor 6 less than cuoricino . The background in cuore, however, is still foreseen to be dominated by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} particles, limiting the sensitivity to the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} half - life to around \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$10^{26}$$\end{document}1026 years in 5 years of data taking . This corresponds to an effective neutrino majorana mass that ranges, depending on the choice of the nuclear matrix element, from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$40$$\end{document}40 to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$100\mathrm {~mev}$$\end{document}100mev, values that are quite far from covering the entire interval of masses corresponding to the inverted hierarchy scenario, that ranges from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$10$$\end{document}10 to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$50\mathrm {~mev}$$\end{document}50mev . The background can be reduced by detecting the small amount of cherenkov light that is emitted by interacting particles in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystals . In fact, at the energy scale of interest for 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document}, the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta $$\end{document}s (signal) are above threshold for cherenkov emission, while \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} particles (background) are not . In a previous paper we operated a 117\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~g}$$\end{document}g\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 bolometer surrounded by a 3 m vm2002 reflecting foil, monitoring a crystal face with a germanium bolometer acting as light detector . In coincidence with the heat released in the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 we were able to detect the light emitted by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta /\gamma $$\end{document}/ particles, which amounted to 173\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ev}$$\end{document}ev at 2,528\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev . The crystal was doped with natural samarium, which contains \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{147}$$\end{document}147sm, an \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}-unstable isotope with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q=2310\mathrm {~kev}$$\end{document}q=2310kev . The light detected from these decays was compatible with zero, confirming that at the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} energy scale no light is emitted by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}s . Finally, room temperature tests confirmed that the light emitted by particles interacting in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 can be ascribed to the sole cherenkov emission, excluding a contribution from the scintillation . In this paper we present the results of a test conducted on a cuore bolometer, i.e. A 750\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~g}$$\end{document}g crystal, 6 times larger than that used in our previous work and without samarium doping . The results confirm that the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} discrimination in cuore is possible, but the light signal is small and requires light detectors with higher sensitivity than that provided by bolometers . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal comes from samples of the cuore batches used to check the radiopurity and the bolometric performances during the production, and therefore is identical to the crystals that are currently being mounted in cuore . The crystal is a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$5\times 5\times 5\mathrm {~cm^3}$$\end{document}555cm3 cube with translucent faces, two opposite of which have a better polishing quality, close to optical polishing grade . All faces are surrounded by the vm2002 light reflector except for an optical one that is monitored by a 5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~cm}$$\end{document}cm in diameter, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$300\mathrm {~\upmu m}$$\end{document}300m thick germanium light detector (ld) (fig . 1). Both the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal and the germanium are operated as bolometers, using a neutron transmutation doped germanium (ntd - ge) thermistor as temperature sensor . The detectors are held in a copper structure by means of teflon (ptfe) supports, anchored to the mixing chamber of a dilution refrigerator . The setup is operated in the cuore / lucifer r&d cryostat, in hall c of lngs .fig . 1the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal in the copper holder, surrounded by a 3 m vm2002 light reflector and monitored by the germanium bolometric light detector the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal in the copper holder, surrounded by a 3 m vm2002 light reflector and monitored by the germanium bolometric light detector as in ref ., the read - out of the thermistor is performed using the cuoricino electronics . The analog signals are filtered by 6-pole active bessel filters and then fed into an 18-bit national instrument pxi analog - to - digital converter (adc), the same system being used in cuore-0 . The filter cutoff and the adc sampling frequency are set to 12\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~hz}$$\end{document}hz and 125\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~hz}$$\end{document}hz for the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2, respectively, and to 120\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~hz}$$\end{document}hz and 2,000\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~hz}$$\end{document}hz for the ld, respectively . When it fires, waveforms 5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~s}$$\end{document}s long on the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 and 250\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ms}$$\end{document}ms long on the ld are saved on disk . Additionally, when the trigger fires on the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2, the waveform on the ld is acquired irrespective of its own trigger . To maximize the signal to noise ratio, the waveforms are processed offline with the optimum filter algorithm [17, 18]. On the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 the pulse is identified with a peak finder algorithm, and the amplitude is evaluated as the maximum of the peak . On the ld, to eliminate noise artifacts at the threshold, the pulse amplitude is evaluated at the characteristic time delay of the ld response with respect to the pulse on the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2, which is estimated in calibration runs using events generated by particles interacting in both detectors (for more details see ref . ). The light detector is exposed to a permanent \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{55}$$\end{document}55fe source, providing 5.9 and 6.5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev calibration x - rays . The typical rise and decay times of the pulses are 2.6 and 6\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ms}$$\end{document}ms, respectively, while the energy resolution at the iron peaks and at the baseline is 135 and 72\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ev~rms}$$\end{document}evrms, respectively . To calibrate the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 and to generate events in the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} region, the setup is illuminated by a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{232}\mathrm {th}$$\end{document}232th source placed outside the cryostat . The rise and decay times of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 pulses are 40 and 532\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ms}$$\end{document}ms, respectively, values that are similar to the cuore-0 ones . The energy resolution at the 2615 kev \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{208}$$\end{document}208tl peak from the thorium source is 11.5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev~fwhm}$$\end{document}kevfwhm, worse than the 5.7\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev fwhm obtained averaging all the cuore-0 bolometers . This might be due to the different working temperature, which was chosen higher than in cuore-0 (20 mk instead of 10 mk) in order to improve the energy resolution of the light detector (see ref . For details). The worse energy resolution of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 bolometer does not affect our results, since attention is focused on the light signal . The energy spectrum acquired from the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 bolometer in 6.86 days of data taking is shown in fig . 2 . The peak around 5400\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev is due to the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}-decay of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{210}$$\end{document}210po, a natural contamination of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal observed also in the 117\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~g}$$\end{document}g detector and in cuore-0 . The remaining peaks are \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document}s from the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{232}\mathrm {th}$$\end{document}232th source, except for the peak at 1,461\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev, which is a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{40}$$\end{document}40k contamination of the cryostat . Both the single escape (se) and the double escape (de) peaks of the 2615 kev \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{208}\mathrm {tl}$$\end{document}208tl are visible . The presence of the de peak is of particular interest because it is a single site production of a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e^-$$\end{document}e- and of a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e^+$$\end{document}e+, a process similar to the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document}.fig . 2energy spectrum acquired by the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal . All the labeled peaks are \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document}s, except for the single and double escape peaks of the 2615\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{208}\mathrm {tl}$$\end{document}208tl, which are \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e^- + e^+ + \gamma $$\end{document}e-+e++ and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e^- + e^+$$\end{document}e-+e+ events, respectively, and for the events around 5.4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~mev}$$\end{document}mev, which are generated by the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}-decay of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{210}$$\end{document}210po in the crystal energy spectrum acquired by the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal . All the labeled peaks are \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document}s, except for the single and double escape peaks of the 2615\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~kev}$$\end{document}kev \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{208}\mathrm {tl}$$\end{document}208tl, which are \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e^- + e^+ + \gamma $$\end{document}e-+e++ and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e^- + e^+$$\end{document}e-+e+ events, respectively, and for the events around 5.4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~mev}$$\end{document}mev, which are generated by the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}-decay of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{210}$$\end{document}210po in the crystal the light detected versus calibrated heat in the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal is shown in fig . 3 . The distribution of the light corresponding to each peak in fig . 2 (blue dots in the figure) is fitted with a gaussian, the mean of which is overlaid onto the figure . The mean light from the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}-decay of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{210}$$\end{document}210po is found to be \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\langle l_\alpha \rangle = -3.9\pm 14.5\mathrm {~ev}$$\end{document}l=-3.914.5ev, i.e. Compatible with zero . The mean light from the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} peaks is fitted with a line \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\langle l_{\beta /\gamma} \rangle = \mathrm{ly}\times (\mathrm{energy}-e_\mathrm{th})$$\end{document}l/=ly(energy - eth), with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${e_\mathrm{th}} = 280\pm 60\mathrm {~kev}$$\end{document}eth=28060kev and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{ly} = 45\pm 2\mathrm {~ev / mev}$$\end{document}ly=452ev / mev . The standard deviations of the light distributions are found compatible with the baseline noise of the ld, which therefore appears as the dominant source of fluctuation, hiding any possible dependence on the position of the interaction in the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal or statistical fluctuations of the number of photons . As in our previous work, the light from the de peak is compatible with the light from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document}s, indicating that the fitted line can be used to predict the amount of light detectable from 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} events . We compute \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$101.4\pm 3.4$$\end{document}101.43.4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ev}$$\end{document}ev of light for a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta /\gamma $$\end{document}/ event with 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} energy, 72\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ev}$$\end{document}ev less than the light detected at the same energy in the 117\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~g}$$\end{document}g detector.fig . 3(color online) detected light versus calibrated heat in the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 bolometer for all the acquired events (gray) and for the events belonging to the peaks labeled in fig 2 (blue). The mean light is clearly energy dependent for the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} peaks (red circles below 3 mev) and compatible with zero for the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}-decay of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{210}$$\end{document}210po (pink circle at 5.4 mev) (color online) detected light versus calibrated heat in the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 bolometer for all the acquired events (gray) and for the events belonging to the peaks labeled in fig 2 (blue). The mean light is clearly energy dependent for the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} peaks (red circles below 3 mev) and compatible with zero for the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document}-decay of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{210}$$\end{document}210po (pink circle at 5.4 mev) the detected light at the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} is small, at the same level of the ld noise, and does not allow one to perform an event by event rejection of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background . As indicated in ref ., the emitted cherenkov light amounts to several hundreds of ev, a much higher value than what we detect . To increase the light collection efficiency, we applied various modifications to the setup: we changed the vm 2002 light reflector to aluminum foils . Aluminum is expected to have higher reflectivity in the uv band, the region where the cherenkov emission is more intense . Nevertheless, the amount of light detected is 25% less than in the case of vm 2002.we removed the vm 2002, which is a specular light reflector, and wrapped the crystal with teflon tape, which is a light diffusor . The amount of light detected is compatible with the vm 2002 measurement.we changed the ld to an identical one, but we coated the side faced to the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 with 60\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~nm}$$\end{document}nm of sio\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$_2$$\end{document}2 . It has been demonstrated, in fact, that in the red / infrared band this layer enhances the light absorption by up to 20% [20, 21]. In our application, however, the amount of light detected does not change significantly.we added a second ld, monitoring opposite faces with two different light detectors . The amount of light detected from each ld is found to be the 50% of the amount detected with a single ld . This causes an overall decrease of the signal to noise ratio, because each ld adds its own noise.we replaced the crystal with a cylindrical one, 4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~cm}$$\end{document}cm in diameter and in height . Again the amount of light detected does not change.summarizing, none of the above trials succeeded in providing a significant increase of the light collection efficiency, indicating that most of the light is absorbed by the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal . This is due to the high refractive index of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 crystal (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n\sim 2.4$$\end{document}n2.4): many photons are reflected internally several times up to absorption . This effect is confirmed by the higher light yield obtained with the small (117 g) crystal and by preliminary results from simulations of the light collection . Aluminum is expected to have higher reflectivity in the uv band, the region where the cherenkov emission is more intense . Nevertheless, the amount of light detected is 25% less than in the case of vm 2002 . We removed the vm 2002, which is a specular light reflector, and wrapped the crystal with teflon tape, which is a light diffusor . We changed the ld to an identical one, but we coated the side faced to the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2 with 60\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~nm}$$\end{document}nm of sio\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$_2$$\end{document}2 . It has been demonstrated, in fact, that in the red / infrared band this layer enhances the light absorption by up to 20% [20, 21]. In our application, however, the amount of light detected does not change significantly . The amount of light detected from each ld is found to be the 50% of the amount detected with a single ld . This causes an overall decrease of the signal to noise ratio, because each ld adds its own noise . We replaced the crystal with a cylindrical one, 4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~cm}$$\end{document}cm in diameter and in height . Again the setup providing the highest light signal, around 100\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ev}$$\end{document}ev at the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document}, consists in a single ld with the crystal surrounded by the vm 2002 reflector or wrapped with teflon tape . The recent cuore-0 result restricted the prediction of the amount of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background in cuore from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$b_\alpha = 0.01 - 0.04$$\end{document}b=0.01 - 0.04 to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$b_\alpha = 0.01\mathrm {~counts/(kev\,kg\,year)}$$\end{document}b=0.01counts/(kevkgyear), while the ultimate source of background, due to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta /\gamma $$\end{document}/ radioactivity from the setup, still amounts to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$b_{\beta /\gamma} = 0.001\mathrm {~counts/(kev\,kg\,year)}$$\end{document}b/=0.001counts/(kevkgyear). From these numbers and from the specs of cuore we perform toy monte carlo simulations to estimate the 90% \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~c.l. }$$\end{document}c.l . The outcome of a toy experiment is fitted in energy with a flat probability density function (pdf) for the background and a gaussian pdf for the signal, and is simultaneously fitted in light with gaussians pdfs for the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta /\gamma $$\end{document}/ light distributions . The posterior pdf of the signal events is obtained integrating over the nuisance parameters and assuming a flat prior . The sensitivity of a single experiment (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n_{90}$$\end{document}n90) is computed as the number of signal events corresponding to the 90% of the posterior cumulative distribution . Several (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sim 3{,}000$$\end{document}3,000) experiments are generated, and the median of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n_{90}$$\end{document}n90 is used as estimator of the sensitivity . The entire procedure is repeated while varying the signal to noise ratio in the light detector (fig . 4). From the figure one sees that the application of light detectors to cuore would increase its 90% c.l . Sensitivity to the half - life of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$2.7\times 10^{26}\mathrm {~years}$$\end{document}2.71026years, a factor 3 higher than cuore without light detectors . To achieve this goal one needs a signal to noise ratio in the light detector greater than 5, a value that is far from that featured by the setup in this work, equal to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$101/72=1.4\mathrm {~ev / ev}$$\end{document}101/72=1.4ev / ev . From the results presented the increase of the light signal is difficult, and therefore to upgrade cuore light detectors able to provide a noise level below \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$20\mathrm {~ev~rms}$$\end{document}20evrms are needed . Other than trying to improve the ntd technology, there are at least two possible alternatives . The use of phonon - mediated transition edge sensors (tes), as in the cresst dark matter experiment, or the use of phonon - mediated kinetic inductance detectors (kid), as recently proposed in ref . . The tes technology has already proved to reach very good noise levels, but the implementation of 988 light detectors implies a complicated read - out, mainly because of the cryogenic squid amplifiers that are employed . Kids already proved to be a highly multiplexable technology in astrophysical applications (up to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$400$$\end{document}400 channels on the same read - out line) but the required energy resolution in our application still needs to be demonstrated.fig . Sensitivity to the half - life of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te as a function of the signal to noise ratio of the light detectors, under the reasonable hypothesis of an \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background index in cuore of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$0.01\mathrm {~counts/(kev\,kg\,year)}$$\end{document}0.01counts/(kevkgyear). The sensitivity of the experiment without light detectors corresponds to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{s / n = 0}$$\end{document}s / n=0 . When \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{s / n> 5}$$\end{document}s / n>5 the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background is hidden by the irreducible background predicted from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} interactions, amounting to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$0.001\mathrm {~counts/(kev\,kg\,year)}$$\end{document}0.001counts/(kevkgyear), and the sensitivity is maximal . The performance of the light detectors used in this work, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{s / n} = 1.4$$\end{document}s / n=1.4, is clearly too low 90% c.l . Sensitivity to the half - life of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te as a function of the signal to noise ratio of the light detectors, under the reasonable hypothesis of an \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background index in cuore of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$0.01\mathrm {~counts/(kev\,kg\,year)}$$\end{document}0.01counts/(kevkgyear). The sensitivity of the experiment without light detectors corresponds to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{s / n = 0}$$\end{document}s / n=0 . When \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{s / n> 5}$$\end{document}s / n>5 the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background is hidden by the irreducible background predicted from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document} interactions, amounting to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$0.001\mathrm {~counts/(kev\,kg\,year)}$$\end{document}0.001counts/(kevkgyear), and the sensitivity is maximal . The performance of the light detectors used in this work, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{s / n} = 1.4$$\end{document}s / n=1.4, is clearly too low we tested the possibility to discriminate the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background in cuore by tagging the signal from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta $$\end{document} particles through the detection of cherenkov light . The detected light at the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q$$\end{document}q - value is around 100\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~ev}$$\end{document}ev for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\beta /\gamma $$\end{document}/ particles and no light is detected from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} interactions, confirming the validity of this technology . However, the signal is small at the same level of the noise of the bolometric light detectors we are using, and does not allow us to perform an event by event discrimination of the background . We tested modifications of the setup, by using different light reflectors or multiple light detectors, but the light yield did not increase . We are working on simulations to estimate the fraction of emitted light that escapes the crystal and is eventually absorbed by the light detector . Critical parameters are the index of refraction and the absorbance of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {teo}_2$$\end{document}teo2, which unfortunately are not available in the literature for low temperatures . To this end given the results obtained so far, we conclude that, to remove completely the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background in cuore, light detectors with a noise of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$20\mathrm {~ev~rms}$$\end{document}20evrms are needed, a factor 34 times better than the bolometric light detectors we used in this work . Changing the technology to tes or kid devices could be an alternative, provided that the present read - out and sensitivity limits are overcome . Cuore without \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha $$\end{document} background would reach a 90% c.l . Sensitivity to the 0\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nu \beta \beta $$\end{document} half - life of more than \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3\times 10^{26}\mathrm {~years}$$\end{document}31026years, a factor 3 better than the upcoming experiment . Combining the light read - out with an enrichment in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{130}\mathrm {te}$$\end{document}130te from the natural 34 to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sim 90\,\%$$\end{document}90% would push the half - life sensitivity by another factor \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sim 3$$\end{document}3 . Depending on the choice of the nuclear matrix elements, this corresponds to an effective neutrino mass sensitivity in the range 1435 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm {~mev}$$\end{document}mev, down into the inverted hierarchy of neutrino masses.
Since the introduction of laparoscopic donor nephrectomy in 1995 by ratner et al.,1 the procedure has gained in popularity because of the high graft quality and the inherent advantages of laparoscopic surgery (e.g., decreased postoperative pain, decreased length of hospital stay, early recovery and return to work, and better cosmetic results).25 in addition, some centers have observed increases in the number of donations and have attributed these increases to the use of less invasive surgical procedures that are more acceptable to donors . In 1998, hand - assisted laparoscopic nephrectomy was introduced that combined the laparoscopic technique with quicker and safer organ retrieval offered by the open access.6 by using the hand, complete mobilization of the colon is facilitated and the kidney and the aorta are easily exposed . In addition, tissue planes are more easily defined using the intraperitoneal hand for retraction.7 the surgical time is comparable with open nephrectomy and tends to decrease with a surgeon s learning curve . It can be safely performed without harm to the donor and without affecting the graft function.810 this technique was perceived by most laparoscopic surgeons as easier to learn and more rapid to perform . However, some laparoscopic urologists considered it to be a learning step towards full laparoscopy.11 in experienced hands, both the pure and hand - assisted laparoscopic surgeries were considered safe and resulted in kidneys that functioned identically to those obtained following open nephrectomies.6,7,12,13 comparisons between these two techniques have not demonstrated any statistically significant differences in analgesic requirements, hospital stays, or allograft function . Significantly shorter operation and warm ischemia times have been demonstrated in the hand - assisted laparoscopic groups compared with the standard laparoscopic groups.4,14,15 the aim of the present study was to compare the hand - assisted (haldn) with the pure laparoscopic (plldn) technique in laparoscopic donor nephrectomies with respect to intra - operative and post - operative donor outcomes . We retrospectively examined the records of all patients submitted to pure laparoscopic or hand - assisted live donor nephrectomies at the cruz vermelha hospital of curitiba and the pr - rim foundation of joinville, between may 2002 and december 2007 . All potential donors had extensive medical, immunologic and psychological evaluations to confirm his / her suitability . The exams requested to delineate the anatomy of the kidney vasculature preoperatively were those usually performed for conventional renal donors, including digital angiography and intravenous pyelogram . The donor selection criteria for laparoscopic donor nephrectomy were identical to the standard criteria for open donor nephrectomy . For all donors, the left kidney was preferred because of the longer left renal vein . However, for a donor whose renal vascular anatomy was more favorable in the right kidney, the right kidney was selected . Similarly, for a donor whose right kidney was affected by a medical condition, the right kidney was also selected because we abided by the basic tenet that in choosing a donor s kidney for removal, the better kidney should remain in situ.10 all procedures were performed by the same urologist, who had experience in advanced laparoscopic surgery and no experience in open nephrectomy . The surgical data that was collected included operative time, warm ischemia time, estimated blood loss and intra - operative complications . Operative time was defined as the time from the initial skin incision to the final skin suture.16 warm ischemia time was defined as the time elapsed from the application of haemostatic clips to the renal artery to the perfusion of the kidney with cold preservation fluid17 . The post - operative variables included the time to first oral intake, the length of hospital stay, and post - operative complications . All patients received a light mechanical bowel preparation 12 h before surgery and a single dose of cefazolin after anesthesic induction . Procedures were performed using our previously described techniques: hand - assisted live donor nephrectomy,10 using the lapdisc (ethicon endosurgery inc ., usa) (figure 1) or the omniport (advanced surgical concepts ltd ., when necessary, maximization of the length of the right renal vein9 (figures 3 and 4) or artery8 (figure 5) was performed . The data were analyzed using student s t tests and fisher exact tests as appropriate, with statistical significance defined at p <0.05 . During the study period, 156 laparoscopic nephrectomies were performed, including 67 haldn and 89 plldn . Table 1 shows the patient demographics and surgical outcomes in the haldn and plldn groups . Indications for right kidney harvesting included: multiple left renal vessels (n=37), right renal cyst (n=5), fibromuscular dysplasia of the right renal artery (n=2), early bifurcation of the left renal artery (n=2), right ureterocele (n=1), right renal ptosis (n=1), right - sided ureteropyelic junction stenosis (n=1), right pelvic kidney (n=1) and left ureteral duplicity (n=1). In nine patients, we performed maximization of one of the right renal vessels, including four with maximization of the right renal vein and five with maximization of the right renal artery . All nephrectomies were completed as scheduled, except for one haldn (with bleeding) and one plldn (with low carbon dioxide during the warm ischemia time) that required conversion to open surgery . The mean (range) kidney warm ischemia time was 3.6 (1.58.0) min for the haldn and 2.5 (1.54.5) min for the plldn (p<0.0001). The mean operating time was 83 (45180) min in the haldn group and 78.4 (33130) min in the plldn group (p=0.29), and the mean intra - operative bleeding was 130.9 (401000) cc in the haldn group and 98.9 (40350) cc in the plldn group (p=0.08). Only one patient required blood transfusion during surgery; this person was in the haldn group . The frequency of intra - operative donor complications was 6% in the haldn group and 4.5% in the plldn group (table 2). Six major vascular bleedings occurred (three renal veins, two vena cavas, and one renal artery) and all but one were laparoscopically controlled . The only patient that required conversion to open surgery had an intra - operative bleeding of 1000 cc and needed blood transfusion . One gallbladder perforation during a veress needle placement in the right subcostal area was observed and was laparoscopically managed . One malfunction of the titanium clip placed on the renal artery was observed with the hand - assisted technique . The frequency of post - operative donor complications was 7.5% in the haldn group and 0.6% in the plldn group (table 2). Two patients who had haldn required re - operation due to peri - pancreactic fluid collection and a peri - renal hematoma . The patient with peri - pancreactic fluid collection probably developed this complication because of manipulation of the pancreatic fascia during dissection; the patient underwent laparoscopic drainage with a good post - operative course . The other patient had an inguinal hematoma due to femoral bleeding, which is a complication of the angiography, and subsequent coagulopathy because of the use of clotting factors . Although the laparoscopic nephrectomy was performed without difficulty, this patient presented with a peri - renal hematoma on the third postoperative day because of the coagulopathy and required laparoscopic drainage and a red blood cell transfusion . Both cases of prolonged ileus resolved spontaneously after npo (nothing by mouth) for 4 days and were discharged on the seventh post - operative day . We found that the plldn technique was associated with markedly reduced hospital los compared with donors undergoing haldn (2.8 vs. 1.4; p<0.0001) (table 2). Within 24 hours of surgery, 63 patients in the plldn group were discharged while none were discharged in the haldn group . Live donor kidney transplantation is the treatment of choice for end - stage renal failure . Living donors are healthy individuals who take the risk of a major operation to donate one of their kidneys . If a donor s post - operative quality of life in terms of morbidity and mortality could be improved, more people may volunteer for kidney donations3 . A major improvement was achieved by the introduction in 1995 of the laparoscopic live donor nephrectomy1, which was shown to offer a graft with a quality that was high and similar to that of grafts obtained with open nephrectomy . Haldn is a modification of the laparoscopic technique that may carry a number of theoretical advantages including a greater margin of safety, a shorter learning curve and a potential reduction in operative time and procedure cost1820 while maintaining high graft quality . The first meta - analysis comparing both techniques3 showed that the hand - assisted procedure 1) offered a quicker method of kidney retrieval as reflected by the shorter total operating and warm ischemia times, 2) maintained safety (as evidenced by a similar number of donor complications), 3) offered good renal graft quality as demonstrated by the post - transplant creatinine levels and 4) was associated with lower estimated blood loss, an important parameter to indicate the level of difficulty of the procedure . Explanations for these advantages include a gain in spatial orientation for the surgeon with the hand - assisted method and better bleeding control achieved by direct digital manipulation . In our experience, the total operating time was shorter with the plldn than with haldn (78.4 vs. 83 minutes), but the difference was not statistically significant (p=0.29). Estimated blood loss was also similar in the two groups (98.9 vs. 130.9 cc, p=0.08). Warm ischemia time was significantly shorter with plldn compared with haldn (2.5 vs. 3.6 min, p<0.0001). In our opinion, these differences can be attributed to the fact that the plldns were performed after the initial learning curve on haldns . Initially, all procedures were performed using hand assistance (from the 1 to the 67 donor). Independent of the technique used, donor complications in laparoscopic donor nephrectomies seem to be declining, and the frequency of complications decrease with the increasing experience of the surgeons . In the meta - analysis by kokkinos et al.3, the hand - assisted group had less intra- and post - operative complications than the pure laparoscopic group, but the difference was not statistically significant . Most of the intra - operative complications were vessel injuries (five for the haldn and five for the plldn group). Furthermore, the haldn group also had one bowel injury, whereas the plldn group had three splenic injuries, one diaphragmatic tear, two renal torsions, and two cases of equipment failure (endoscopic vascular stapler failed to divide the renal vein, retrieval bag failed to trap the kidney). Conversion to the open procedure was less frequent with haldn patients than with plldn patients (2.6% vs. 4.1%), but the difference was not statistically significant . In a recent series from the university of maryland21 among 738 laparoscopic donor nephrectomies, 15 major complications were reported, including 13 vascular injuries and two bowel injuries . In the present study, there were no significant differences in intra - operative complications between both groups . We observed four intra - operative complications in the haldn group, including three vessel injuries (two renal veins and one vena cava) and one malfunction of the titanium clip placed on the renal artery . We observed four intra - operative complications in the plldn group (one renal vein, one renal artery, one vena cava, and one gallbladder perforation by the veress needle). The one patient who needed conversion to open surgery and a blood transfusion due to intra - operative bleeding was in the hand - assisted technique group . In previous studies, the conversion to open surgery from laparoscopic donor nephrectomies was 1.613%,14,21,22 but such conversion was required in only two patients (1.3%) in the present study . Since the carbon dioxide gas finished just during the warm ischemia time, we had to convert to open surgery to retrieve the specimen from the abdominal cavity . Post - operative complications were more frequent in the haldn group compared with the plldn group (7.5% vs. 0.6%, p=0.04). Both cases of prolonged ileus occurred in the haldn group and resolved spontaneously, but these patients required 7 days of hospitalization . One case of abdominal wall hematoma was observed in each group . Both patients were drained and good post - operative courses . Two patients required re - operation, one for peri - pancreatic fluid collection and the other for a peri - renal hematoma . The procedures were performed by laparoscopy and, after the second procedure, post - operative courses were uneventful . Velidedeoglu et al.20 compared the open, laparoscopic and hand - assisted approaches to live - donor nephrectomy . Their data revealed that both of the minimally invasive techniques could be applied with excellent results and that reductions in donors los were observed due to the accelerated postoperative recovery . In a similar comparison study, el - galley et al.2 observed a post - operative hospitalization of 22 days for the laparoscopic techniques and 32 days for the open approach (p=0.01). In the beginning of surgeons experience with the laparoscopic techniques, patients were discharged on the third post - operative day . However, after the first 20 patients, probably due to the shortened operative time, the majority of full laparoscopic patients were discharged on the second post - operative day . After our initial learning curve on haldn, we were able to discharge 63 patients submitted to plldn during the first post - operative day . The experience of the surgeon is an important variable that determines the result of a surgical procedure and should be considered when determining the most appropriate treatment . Based on our data, se suggest that once the surgeons learning curves are reached, plldn seems to have some advantages compared with haldn in terms of warm ischemia time, time to first oral intake, length of hospital stay, and post - operative donor complications . Future research should be conducted in large, multi - center, randomized controlled trials with defined follow - up periods, taking into consideration the experience of the surgeon, the learning curve of the procedure, and the comorbidity of the patient.
Diabetic retinopathy (dr) is one of the most common and serious complications of diabetes mellitus (dm). With the improvement of people's living standards, patients who suffer from diabetes for a long time likely experience chronic vascular injury caused by high blood sugar levels; these patients are also at risk of dr when chronic vascular injury occurs in the retina [2, 3]. The pathogenesis of dr is generally divided into two stages, namely, nonproliferative dr (npdr) and proliferative dr (pdr). In early npdr stage, dr is characterized by retinal blood vessel permeability as a result of damaged blood retinal barrier (brb); in pdr stage, retinal neoangiogenesis occurs [2, 3]. Previous studies have demonstrated that both inflammation and angiogenesis play important roles in regulating the development of dr, and thus anti - inflammation and antiangiogenesis are potential therapeutic strategies for the treatment of dr [4, 5]. It is worth mentioning that, in the opinion of adamis, dr is considered as an inflammatory disease . More than 70 species of dendrobium are found in the mountain ranges of southern and western china; some of these species are reported to exhibit antioxidant, immunomodulatory, anticancer, and antisenescence activities . In traditional chinese medicine, shi - hu is a famous and precious chinese herbal medicine derived from different species of dendrobium, including d. chrysotoxum lindl . Shi - hu has been used to prepare various medicinal and health products in many asian countries . D. chrysotoxum is a commonly used species of medicinal dendrobium (shi - hu), indexed in the chinese pharmacopoeia (2010 version). Furthermore, a series of aromatic compounds, such as bibenzyls and fluorenones, were reported to be isolated from d. chrysotoxum [10, 11]. Among those compounds, bibenzyl erianin is reported to exhibit antiangiogenic activity and has the potential capacity to be developed into anticancer drug [12, 13]. In our previous study, the ethanol extract isolated from d. chrysotoxum (dc) alleviates retinal angiogenesis during the development of dr . In the present study, we aimed to observe whether dc can ameliorate streptozotocin- (stz-) induced dr in rats by alleviating retinal inflammation and restoring the decreased expression of tight junction proteins . D. chrysotoxum was a gift from jinling pharmaceutical co., ltd (nanjing, china). The ethanol extract of d. chrysotoxum (dc) was prepared, as described in our previous study . Enzyme - linked immunosorbent assay (elisa) kits were purchased from rapidbio (west hills, ca). Primescript rt master mix and sybr premix ex taq were purchased from takara (shiga, japan). Phospho - p65, phospho - ib, and phospho - ib kinase (ikk) antibodies were purchased from cell signaling technology (danvers, ma). The chemiluminescent kit for western blot analysis was purchased from millipore (billerica, ma). Occludin and claudin-1 antibodies were purchased from santa cruz (santa cruz, ca). 4, 6-diamidino-2-phenylindole (dapi), alexa fluor 488 goat anti - mouse igg (h+l) antibody and cy3 goat anti - rabbit igg (h+l) antibody were purchased from life technology (carlsbad, ca). Pierce bca protein assay kit was purchased from thermofisher scientific (waltham, ma). All of the other reagents were purchased from sigma (st . Louis, mo), unless otherwise is indicated . Sprague - dawley rats (160200 g) were purchased from shanghai laboratory animal center of chinese academy of sciences (shanghai, china). These rats were maintained under controlled temperature (23 2c), humidity (50%), and lighting (12 h light/12 h dark) conditions . The rats were fed with a standard laboratory diet and given free access to tap water . All animals received humane care according to the institutional animal care guidelines approved by the experimental animal ethical committee of shanghai university of traditional chinese medicine . A total of 65 rats were randomly divided into two groups . Among these rats, 50 rats were administered intraperitoneally (i.p .) With 65 mg / kg stz, and other 15 rats were i.p . Injected with physiological saline; and the latter served as control rats . Serum glucose concentration was measured after 7 d. rats with high glucose concentration (> 16.5 mmol / l; these rats were randomly divided into three groups: dr model (n = 14), dc (30 mg / kg) (n = 15), and dc (300 mg / kg) (n = 15). Two months after stz was injected, the rats were orally treated with dc (30 or 300 mg / kg per day) for one month . The rats in the control group and the dr model group were orally administered with vehicle control . Three months after stz was injected, six rats from each group were selected to evaluate brb breakdown by using evans blue dye . The other rats were anesthetized with sodium pentobarbital (40 mg / kg, i.p . ). Blood samples were collected from the abdominal aorta, and the eyes were removed immediately . Brb breakdown was evaluated according to previously reported method with some modifications . In brief, the rats were injected with 2% evans blue dye (10 l / g, i.p .) In pbs . 2 h later, blood was extracted through the left ventricle and the rats were perfused with pbs to completely remove evans blue dye from blood vessels . The retinas were carefully dissected and thoroughly dried the retinas were then incubated in 120 l formamide for 18 h at 70c to extract evans blue dye . The extract was centrifuged twice at 10,000 g for 1 h at 4c . The concentration of evans blue dye in the extracts was calculated using a standard curve of evans blue dye in formamide and then normalized to the dried retinal weight . Total rna of the retina was isolated using trizol reagent according to the manufacturer's instructions . Cdna was synthesized according to the manufacturer's instructions described in primescript rt master mix kits . The mrna expressions of occludin (ocln), zo-1 (tjp1), claudin-1 (cldn1), claudin-5 (cldn5), icam-1 (icam1), tnf (tnf), il-6 (il6), il-1 (il1b), and actin (actb) were quantified by real - time pcr . Real - time pcr was performed using stepone plus (carlsbad, ca) with sybr green premix in accordance with the manufacturer's instructions . Relative target gene expressions were normalized to actb (actin), analyzed by 2 method, and expressed as ratio relative to the control . Paraffin - embedded retinal sections (5 m) were deparaffinized in xylene and rehydrated in an ethanol gradient with distilled water . After endogenous peroxidase activity was quenched, retinal sections were incubated with 5% bovine serum albumin to minimize nonspecific binding . Retinal sections were incubated with occludin or claudin-1 antibody at 4c overnight and were further incubated with cy3 goat anti - rabbit igg (h+l) antibody or alexa fluor 488 goat anti - mouse igg (h+l) antibody at room temperature for 1 h. the nuclei were stained with dapi; images were captured under an inverted microscope (nikon, japan). Retinas (proximately 20 mg) were homogenized in ice - cold lysis buffer containing 50 mm tris (ph7.5), 1 mm edta, 150 mm nacl, 20 mm naf, 0.5% np-40, 10% glycerol, 1 mm phenylmethylsulfonyl fluoride, 10 g / ml aprotinin, 10 g / ml leupeptin, and 10 g / ml pepstatin a. homogenates were centrifuged at 3,000 g for 10 min before the supernatant was transferred to new tubes . Protein concentrations in the supernatants were assayed by bca protein assay kit and every sample was normalized to equal protein concentration . Proteins were separated by sds - page and transferred to immobilon - p pvdf membranes (millipore). The membranes were blocked with 5% nonfat milk in tbst for 1 h and then were incubated with respective primary antibodies at 4c overnight . The membranes were subsequently washed with tbst and incubated with horseradish peroxidase conjugated secondary antibodies for 1 h at room temperature; afterward, the membranes were visualized using a chemiluminescent kit . Whole blood was allowed to stand at room temperature for 2 h and then centrifuged at 3,000 rpm, at 4c for 15 min . Serum was collected to detect the concentrations of tnf, il-6, il-1, ifn, il-8, il-12, il-2, il-3, and il-10 by elisa according to the manufacturer's instructions . Cytokines concentrations in the respective samples were determined on the basis of standard curves prepared using recombinant cytokines of known concentrations . The significance of differences between groups was evaluated by one - way anova with lsd post hoc test when the significance of the test of homogeneity of variances is above 0.05 . Otherwise, the significance of differences between groups was evaluated by nonparametric tests with mann - whitney u test . Serum glucose concentrations in all of the groups were significantly different from the control rats during the experimental periods (figure 1(a)). Dc (30 or 300 mg / kg) was administrated two months after stz was injected . As shown in figure 1, we can see that dc (30 and 300 mg / kg) had no effect on the increased serum glucose concentration in stz - induced diabetic rats . Furthermore, the body weights of stz - induced diabetic rats were lower than those of the normal control rats (p <0.001) (figure 1(b)). No evident differences were observed between diabetic rats with or without the treatment of dc (30 and 300 mg / kg). Increased leakages of evans blue dye were observed in the retinas of stz - induced diabetic rats (p <0.01) (figure 2(a)). After the rats were treated with 300 mg / kg dc, the increased retinal vessel leakage was reduced (p <0.05). However, 30 mg / kg dc did not inhibit the increased retinal vessel leakage in stz - induced diabetic rats . The mrna expressions of tight junction proteins were further analyzed by real - time pcr . The retinal mrna expressions of occludin (olcn), zo-1 (tjp1), claudin-1 (cldn1), and claudin-5 (cldn5) were decreased in stz - induced diabetic rats (p <0.05, p <0.05, p <0.01, and p <0.01, resp . ). Dc (30 and 300 mg / kg) reversed the decreased retinal mrna expression of occludin in stz - induced diabetic rats (p <0.05) (figure 2(b)); by contrast, dc did not evidently affect the decreased zo-1 expression . The decreased retinal mrna expression of claudin-1 in stz - induced diabetic rats was increased after these rats were treated with dc (30 and 300 mg / kg) (p <0.01) (figure 2(b)). However, the decreased mrna expression of claudin-5 in the stz - induced diabetic rats remained unchanged after the rats were treated with 300 mg / kg dc, but 30 mg / kg dc could weakly increase the decreased expression of claudin-5 (p <0.05). The protein expression of occludin and claudin-1 was decreased in the stz - induced diabetic rats; conversely, dc (30 and 300 mg / kg) reversed the decreased protein expressions of occludin and claudin-1 (figure 2(c)). Occludin and claudin-1 were subjected to immunofluorescence staining to detect their corresponding expressions in the retinas . Dapi staining results (figures 3(a) and 3(b)-b, e, h, and k) showed ganglion cell layer (gcl), inner plexiform layer (ipl), inner nuclear layer (inl), outer plexiform layer (opl), and outer nuclear layer (onl) in the retinas . The retinas stained with occludin were also observed (figure 3(a)-a, d, g, and j). After the occludin - stained images were merged with dapi - stained images, we can see that the retinal expression of occludin was decreased in gcl, inl, and opl (figure 3(a)-f); this decrease was reversed by dc (30 and 300 mg / kg) (figure 3(a)-i and l). The retinas stained with claudin-1 were also observed (figure 3(b)-a, d, g, and j). After the claudin-1-stained images were merged with dapi - stained images, we can see that the retinal expression of claudin-1 was decreased in gcl, inl, and opl (figure 3(b)-f); this decrease was reversed by dc (30 and 300 mg / kg) (figure 3(b)-i and l). The retinal mrna expressions of icam-1 (icam1), tnf (tnf), il-6 (il6), and il-1 (il-1b) were increased in the stz - induced diabetic rats (p <0.05, p <0.01) (figure 4(a)). Dc (300 mg / kg) reduced the increased retinal mrna expressions of icam-1, tnf, il-6, and il-1 (p <0.05, p <0.01). Dc (30 mg / kg) also reduced the increased retinal mrna expressions of tnf and il-1 (p <0.05, p <0.01). The protein expression of icam-1 was increased in the retinas of stz - induced diabetic rats, but it was decreased in dc - treated (30 and 300 mg / kg) diabetic rats (p <0.01) (figures 4(b) and 4(c)). In addition, the expressions of the phosphorylated p65, ib, and ikk were increased in the stz - induced diabetic rats (p <0.05, p <0.01), but this increase was decreased after the rats were treated with dc (30 and 300 mg / kg) (p <0.05, p <0.01, p <0.001, resp . ). The elisa results showed that the serum levels of tnf, ifn-, il-6, il-1, il-8, il-12, il-2, il-3, and il-10 were increased in the stz - induced diabetic rats (p <0.001) (figure 5). Dc (30 and 300 mg / kg) reduced the increased serum levels of those cytokines (p <0.01, p <0.001); and the inhibitory effect of 300 mg / kg dc was better than that of 30 mg / kg dc . According to the historical records of traditional chinese medicine, shi - hu can be used to improve eyesight . In general, shi - hu is a monarch drug of several chinese patent drugs, such as shi - hu - ye - guang - wan and shi - hu - ming - mu - wan, which are traditionally used to improve eyesight and indexed in chinese and local pharmacopeia . Although shi - hu is traditionally used to improve eyesight in china, there are no much scientific evidences supporting its activity and mechansim . One report demonstrated the amelioration of total alkaloids extracted from d. nobile on diabetic cataract in rats . Recently, our previous study showed that d. chrysotoxum alleviated retinal angiogenesis during the development of dr . Our results in this study showed that dc did not evidently affect body weight and blood glucose concentration of diabetic rats; however, 300 mg / kg dc alleviated retinal brb breakdown in stz - induced diabetic rats . The results provided additional evidences regarding the potential amelioration of d. chrysotoxum on dr; these results also contributed to the treatment of dr affecting diabetic patients . Zo-1, occludin, and claudin-1/5 are the main proteins involved in the tight junction complex, which is essential for the control of endothelial permeability [17, 18]. Retinal endothelial barrier integrity is also implicated in the maintenance of vascular permeability and the development of dr . Zo-1, occludin, and claudin-1/5 expressions are decreased in npdr [20, 21]. Our results showed the decreased retinal mrna expression of zo-1, occludin, and claudin-1/5 in diabetic rats, but the decreased expressions of occludin and claudin-1 were reversed by dc (30 and 300 mg / kg). Furthermore, the reversed protein expressions of occludin and claudin-1 induced by dc were confirmed by western blot analysis and immunofluorescence staining results of occludin and claudin-1 in the retinas . These results indicated that dc could prevent the decreased expression of tight junction proteins, such as occludin and claudin-1, which may also contribute to the alleviation of dc on stz - induced npdr . Icam-1 is critical for regulating retinal leukocyte adhesion, and its expression is induced by nf-b activation mediated by proinflammatory cytokines; this process has been correlated with the increase in leukostasis and further breakdown of brb in the development of dr . Our results demonstrated that dc (300 mg / kg) reduced the increased retinal mrna expression of icam-1 . Furthermore, dc (30 and 300 mg / kg) reduced the increased protein expression of icam-1 in stz - induced diabetic rats . Therefore, dc could prevent retinal vascular leakage in the development of stz - induced dr . Tnf, il-6, and il-1 are common proinflammatory cytokines; these cytokines are increased in serum, vitreous, or retinas from diabetic patients or rats [2325]. This increase in proinflammatory cytokine concentration in diabetic rats can be decreased by panax notoginseng, radix astragali, and angelica sinensis aqueous extracts, tinospora cordifolia extract, and compounds, including -linolenic acid and curcumin, and these substances elicit obviously beneficial effects by preventing the development of dr [2629]. Furthermore, nf-b / rel family plays a critical role in regulating host immune and inflammatory responses by regulating the production of various pro - inflammatory cytokines, such as tnf and il-1, and so forth [30, 31]. Our results showed that dc reduced the increased retinal mrna expression and serum levels of tnf, il-6, and il-1, and also reduced the increased phosphorylation of p65, ib, and ikk in stz - induced diabetic rats . Other cytokines, such as il-8, ifn-, il-2, and il-3, are increased in patients or rats with dr [3235]. In the present study, dc (30 and 300 mg / kg) prevented the increased serum levels of these cytokines, which may also contribute to the amelioration of dc on dr . Il-10 is considered as an anti - inflammatory cytokine; however, serum or intravitreal il-10 levels are not remarkably different in diabetic patients and nondiabetic patients [3537]. No difference in serum il-12 level has been observed in nondiabetic patients and diabetic patients; however, decreased serum il-12 level has been detected in some diabetic patients . Despite these contradictory results, sera il-10 and il-12 levels our results showed that sera il-10 and il-12 concentrations were increased in stz - induced diabetic rats but decreased in dc - treated diabetic rats . The increased sera il-10 and il-12 levels may be attributed to the enhanced self - defense of diabetic rats during the development of dr to counteract inflammation and angiogenesis . As dr was ameliorated by dc, the increased il-10 and il-12 levels were also alleviated . Dc also prevented the decreased expression of tight junction proteins, such as occludin and claudin-1 . The schematic diagram of mechanism involved in the amelioration of dc against dr was shown in figure 6 . The present study and previous study demonstrate that d. chrysotoxum could ameliorate retinal inflammation, maintain retinal brb, and attenuate retinal angiogenesis, thereby attenuating the development of dr . Thus, d. chrysotoxum may be recommended as a supplementary treatment for patients with dr . These results also provided strong experimental evidences for the eyesight - improving capacity of medicinal dendrobium (shi - hu).
M. solifugus rainierensis are annelid worms belonging to the family enchytraeidae (clitellata: annelida). Ice worms are typically found on pacific coastal glaciers in north america between oregon and alaska, but a related species has also been reported in tibet . Ice worms are the largest glacially obligate metazoan that completes their life cycles in glacier ice / snow . Interestingly, ice worms maintain unusually high energy levels (i.e., 5 adenosine triphosphate, atp) compared to their mesophilic counterparts, which has been interpreted as a possible mechanism to offset cold temperature - induced lethargy and death [79]. Specifically, elevated adenylate levels may counter inherent reductions in molecular motion and enzyme kinetics at low physiological temperatures by increasing the probability of molecular collisions . Indeed, ice worms respond to temperature change by increasing adenylate levels as temperatures fall well below 0c . To explore this phenomenon, we considered the putative role(s) of two amp degradative enzymes, amp phosphatase (ampp) and amp deaminase (ampd), which indirectly control the adenylate pool size by adjusting the rate of amp degradation . Since relative amp concentrations change more dramatically than do adp or atp, it is logical for any system that monitors cellular energy status to respond to variations in amp [10, 11]. Ampp represents a major amp degradative enzyme in eukaryotes but, curiously, we have been unable to detect its presence in ice worms despite extensive efforts . Ice worm ampd, on the other hand, appears relatively abundant in adult, whole animal specimens . Ampd (ec no 3.5.4.6) catalyses the irreversible hydrolysis of 5 adenosine monophosphate (amp) to form inosine monophosphate (imp) and ammonia . Sequence comparisons across animal phyla demonstrate that ampd has a highly conserved c - terminal catalytic domain, and a divergent n - terminal region with probable roles in isoform - specific catalytic properties, protein - protein interactions, and subunit associations [13, 14]. To examine the structure and putative role of ampd in ice worm energy metabolism, we cloned cdnas by degenerate pcr using an ice worm cdna library as template . We isolated a combined fragment 543 amino acids in length that included the complete ampd catalytic region, and a 69 amino acid n - terminal region . The predicted ice worm ampd amino acid sequence was compared with respective homologues across eucaryotic phyla . Although general conservation of ice worm amino acid residues was observed throughout the coding sequence, a few substitutions occurred proximal to highly conserved binding sites; in particular, an ice worm - specific amino acid substitution near the amp binding site (i.e., k188e) may negatively alter the enzyme's activity and paradoxically contribute to atypically high energy levels observed in glacier ice worms . Mesenchytraeus solifugus specimens were collected on byron glacier, alaska, usa, and maintained as described . Enchytraues albidus and lumbriculus variegatus were purchased from the bug farm (san rafael, calif, usa), and maintained as described . Cdna was synthesized with a smart cdna construction kit as specified by the manufacturer (clontech). The following degenerate primer set was used to amplify ampd: 5 aartayaayccnrtnggngmn 3, 5 catngcdatnssdatytgngy 3 (834 bp expected size). Touchdown pcr (drop of 0.2c annealing temperature per cycle) was performed with titanium taq dna polymerase (clontech) using the following conditions: 94c (10 seconds); 53 46c (1 minute); 72c (1 minute) for 35 cycles . The 5 end of ice worm ampd was amplified by race - pcr (rapid amplification of cdna ends by pcr) using nested, gene - specific primers (5 gcctttatgatttctgcaaag 3-outside; 5 ctctcccacagggttgtac 3-inside), and a clontech anchor primer (5 sequencing primer). Independent probes comprising ice worm ampd cdnas were constructed with a prime - a - gene labeling kit (promega), incorporating [p]-dctp (perkin - elmer). Approximately 500 000 phage from a triplex2 whole animal ice worm cdna library were plated and screened at high stringency, as described . Positive plaques were cored from agar plates with a glass pipette and subjected to cre - lox - mediated in vivo excision (clontech). Plasmid dna was purified using a wizard plus sv minipreps dna purification system (promega). Following restriction endonuclease digestion with eco r1, xba i, and hin d iii, inserts 600 bp were dna sequenced (northwoods dna, inc; becida, minn, usa). Dna sequence chromatograms were analyzed by vector nti 10.3.0 (invitrogen corporatioon) and genbank blast analysis . Newly sequenced ampd genbank accession numbers are mesenchytraeus solifugus (eu624492); enchytraeus albidus (eu624493); lumbriculus variegatus (eu624494). Ampd - specific forward and reverse primers (atgcggacagaaacacgttcca and tccgagtagacgttgtttgcga, resp .) Were employed to amplify a fragment of amp deaminase from genomic dna and cdna encoding the ice worm - specific k188e substitution . Genomic dna was extracted from ice worm specimens collected from byron glacier, alaska, usa, as described, and previously constructed ice worm cdna libraries were used as templates in cdna reactions . Standard pcr reactions were conducted with the following parameters: 94 (2 minutes 30 seconds) followed by 30 cycles of 94 (30 seconds); 64 (40 seconds) 72 (1 minute). Reaction products (~650 bp from genomic dna; ~260 bp from cdna) were gel - purified and sequenced with the negative strand ampd specific primer, tgctgtcttcaaggtcgtgcat (genewiz, south plainfield, nj, usa). Positions that contained an identical amino acid in both ice worm and a mesophilic counterpart were excluded from the comparison . In variable positions (i.e., different amino acids present among mesophilic counterparts, all of which differed from the ice worm sequence), the most abundant amino acid was chosen; in the absence of a dominant residue, the drosophila melanogaster sequence served as default in animal comparisons, and e. albidus was default in clitellate comparisons . Amino acid compositions, molecular weights, and hydrophobicities were calculated with protparam . The protein database was employed to locate crystallized protein structure templates for the construction of predicted candidate protein models using swiss model in the expasy server [23, 24]. The crystal structure of arabidopsis thaliana adenosine 5-monophosphate deaminase (ampd; chain a) in complex with coformycin 5 phosphate (an allosteric phosphate ion inhibitor) and the catalytic zinc ion (in 3.3 resolution; pdb: 2a3l) was used as a template structure to generate the 3d model of ice worm ampd . This was the only ampd crystal structure available at pdb, but the sequence identity between ice worm and a. thaliana ampd (307 out of 535 amino acids; ~58%) is sufficient for supporting model accuracy . The presence of coformycin 5 phosphate is unlikely to alter the ampd 3d structure since coformycin 5 phosphate, a well - known ampd and ada transition state analogue inhibitor, is structurally very similar to amp and is thought to interact in the same way inside the ampd catalytic site . Ice worm - specific amino acid changes and predicted tertiary structures were manipulated in the swiss - pdb viewer and pymol to highlight amino acid changes within structures . Amp deaminase mutant models were prepared by introducing k480e and e188k substitutions in the arabidopsis thaliana (pdb i d 2a3l chain a) and m. solifugus amp deaminase linear amino acid sequences, respectively (position 480 in a. thaliana is equivalent to 188 in the ice worm). Swiss model in the expasy server [23, 24] was used to model mutant sequences to the template amp deaminase crystal structure (pdb i d 2a3l chain a). Surface area of the substrate binding plane was defined by four residues within 3.1 proximity (k173, y174, d444, d445) to coformycin 5-phosphate as determined by pymol, and was calculated in all models by the sum of the surface area of the two triangles composing the substrate binding plane . A 2,493 bp cdna representing ice worm amp deaminase (ampd) was assembled with overlapping fragments obtained by degenerate pcr, race - pcr, and library screening . The combined sequence encoded 543 amino acids of ampd, including a 69 amino acid n - terminal region, and a 474 amino acid c - terminal catalytic domain containing active sites for amp binding and regulatory binding sites for the allosteric effectors atp and inorganic phosphate (figure 1). Homologous ampd gene fragments were cloned from two mesophilic annelids (e. albidus, l. variegatus), and retrieved from genbank for homo sapiens (chordata), d. melanogaster (arthropoda), caenorhabditis elegans (nematoda) and the plant arabidopsis thaliana, from which the only ampd structural model was available . Ampd homologues displayed> 50% sequence identity across all taxa; ice worms were most similar to their clitellate, mesophilic counterparts (~73%) and d. melanogaster (~72%), and most distant from homo sapiens (isoform 3) and a. thaliana (~58% and ~57%, resp . ; table 1). Insertions at positions 129 (t) and 129 (r) characterized clitellate ampd homologues (figure 1). The ice worm ampd n - terminal domain was considerably more divergent than the c - terminus: identity among animal homologues within the c - terminal domain ranged from 5773%, while n - terminal domain values were 716% (table 1). Based on these alignments, we defined ice worm - specific substitutions as those positions at which no other ampd homologue contained the same amino acid as the ice worm sequence, and at least 50% of the available homologues contained the same amino acid . For example, d122 t identifies the dominant mesophilic amino acid at position 122 as d (i.e., six out of seven available homologue sequences encode d at position 122), while ice worm ampd encodes t. by these criteria, 26 ice worm - specific substitutions (16 nonconservative changes) were identified in the linear ice worm ampd sequence, all of which occurred in the c - terminal catalytic region (figure 1). Among invertebrates, only the nematode c. elegans displayed a larger number of nonconservative changes than m. solifugus, consistent with its deeply rooted ancestry (table 1). The linear amino acid sequences of ice worm ampd homologues were modeled in an effort to predict potential structure / function relationships of ice worm - specific amino acid substitutions . The three - dimensional homology model of the ice worm ampd enzyme (figures 2(a) and 2(b)) followed the pattern of the known amidohydrolase . Ice worm ampd, which contains 26 predicted helices and 10 strands, displayed an incomplete triose - phosphate isomerase (tim) (/)8 barrel fold, with the active site located on the c - terminal side of the imperfect barrel, in a cleft surrounded by multiple helices and loops (figures 1 and 2(a)). The root mean square deviation between the c atoms from both structures was 0.15, with the largest differences concerning residues not involved in catalysis (figure 2(a)). Apart from the obvious absence in ice worm ampd of the large n terminal transmembrane domain, including the walker a motif that characterizes plant ampd, other differences included an ice worm - specific 16 amino acid loop (v8-d24) at the n terminus, and a loop connecting strands 2 and 3 (t129-g131) (figures 1 and 2(a)). Ice worm ampd showed general conservation of residues that coordinate the zinc ion, accommodate amp groups, and bind the allosteric inhibitors atp and inorganic phosphate (figure 1). With respect to a. thaliana ampd, slight changes in the position of a few residues involved with the catalytic zinc ion (d305, h367 and d444; figure 3(a)), and accommodating the amp (d445; figure 3(a)) were detected . Additionally, a few nonconservative substitutions occurred within known helices (e.g., l77s, a345s, p430a, c472v), sheets (e.g., n216k) and linker regions (e.g., p323s, k268d) (table 3). Inorganic phosphate is considered as one of the primary physiological inhibitors of ampd [31, 32], and thus the ice worm - specific n216k substitution proximal to the phosphate allosteric effector site (and also the amp binding site) may modify electrostatics and structure at these sites (figure 3(b)). Most dramatic was a k188e ice worm - specific substitution, predicted to occur ~10 proximal to the amp binding site within an already negatively charged pocket . In a comprehensive analysis incorporating> 100 known ampd homologues, the k188e substitution is the result of an a g nucleotide transition at the first position of codon 188 (figure 3(a)). We detected this substitution in multiple, independent cdna clones, and also verified the ice worm change by amplifying the corresponding region of genomic dna (which contained a 522 base - pair intron following amino acid residue k203). One consequence of the ice worm k188e substitution was a predicted reduction of the substrate binding plane surface area by> 5% relative to a. thaliana (figures 4(a)4(c)); specifically, the k188e substitution was necessary and sufficient for this size reduction in the ice worm's binding pocket . The reciprocal substitution (i.e., e188k) in the context of ice worm sequences, however, did not rescue the substrate binding plane's surface area, but rather distorted the binding plane grossly (figure 4(d)). Taken together, these point substitutions suggest that position 188 contributes significantly to the architecture of the active site . Note that ice worm - specific substitutions other than k188e likely compensate for the gross distortion observed in figure 4(d), since the native ice worm structure is clearly similar to that of a. thaliana ampd (cf . Figures 4(a)4(c)). To gain a perspective on the types of amino acid substitutions favored in ice worm ampd, its amino acid sequence was compared to consensus sequences (i.e., the dominant amino acid residue at each position) from clitellates and other mesophilic eukaryotes (table 2). In comparison with representative animal ampd homologues, ice worm ampd showed net gains of asp, his, leu, and ser; net reductions in asn, cys, glu, lys, and met; slight increases in the number of charged and acidic residues; a gain of polar residues in the clitellate comparison; and a reduction in amino acid side chain volumes (i.e., mwt) and hydrophobic amino acids, more remarkable in the clitellate comparison (table 2). The most frequent ice worm ampd residue preferences were v i, a s, l f, and k d, though no significant directional bias was detected (table 3). The majority of substitutions occurred in -helices and in loops connecting different secondary structures, while relatively few substitutions occurred in -strands (table 3). Finally, ice worm ampd contained fewer h - bonding residues than a. thaliana ampd (185 and 167 amino acids devoid of h bonds, resp . ). Cold adapted enzymes typically display gains in flexibility at the expense of thermal stability [3335]. Among the 26 ice worm - specific amino acid substitutions deduced in this study, many are likely to increase flexibility based on reduction of the side chain volume (e.g., y192v, f304l), increasing local hydrophilicity (e.g., l77s, a121s) or loss of well - conserved proline residues (e.g., p323s, p430a), in comparison with mesophilic ampd counterparts . Flexibility introduced by the single ice worm - specific change f304l (adjacent to d305, which is critical in stabilizing zn coordination;) may facilitate reactivity of the catalytic zinc critical for deamination through a short - lived tetrahedral intermediate transition state [12, 36]. Apart from a slight increase in charged amino acids in ice worm ampd with respect to its animal counterparts, increased polarity, reductions in side chain volumes and charged residues (e.g., glu and lys), and decreased core hydrophobicity (table 2) are all trends present in cold adapted proteins, and consistent with gains in molecular flexibility [34, 37, 38]. The modest gain in acidic amino acids (i.e., lys and arg) has also been observed in other cold adapted enzymes, and explained by feller et al . As improved solvent interactions that can destabilize the external shell of proteins . The increase in asp, however, is less obvious; it has the shortest side chain of the charged amino acid and thus destabilizes a protein by forming ionic bonds less easily . Additionally, the observed reduction in h - bond number in ice worm ampd is consistent with strategies to increase backbone flexibility . Likewise, gains in flexibility have been reported to occur particularly at -helical segments, and several ice worm - specific ampd substitutions occurred within loops and helices (table 3). Position 188 in ampd is located at the center of a negatively charged pocket, and the addition of yet another negative charge (i.e., k188e in ice worms) could introduce additional destabilizing forces owing to negative - negative repulsion . Since the substitution lies adjacent to the active site, the effect of repelling charges may indeed introduce flexibility to the enzyme's active site, contributing to its catalytic efficiency at low temperatures . Bae and phillips and fields have hypothesized and empirically validated that substitutions within the active site of enzymes performing homologous functions, varying only in temperature optima, will not occur . While residue 188 has been proposed to accommodate the amp ribose and phosphate groups, our model based on a. thaliana ampd suggests that ice worm residue 188 does not function in such a faculty . Rather, k188e is 1015 from the amp binding pocket and interacts with a loop of decreased flexibility (owing to p176) responsible for coordinating amp . In fact, comparison of the a. thaliana structure (figure 4(a)) with the a. thaliana k188e ampd model (figure 4(b)) supports a loss of area in the active site due to k188e (comparable with the calculated area of the ice worm's active site; figure 4(c)). Due to these topological considerations, k188e may induce an architectural change of the active site in ice worm ampd, raising interesting evolutionary questions (mentioned in what follows). The quest to understand the molecular adaptations of proteins to cold environments usually centers on the assumption that the psychrophilic protein should function more efficiently than its mesophilic counterpart at lower temperatures . For ice worm ampd the reaction catalyzed by the ampd represents a branch - point in the energy - generating adenylate catabolic pathway regulating the availability of adenosine nucleotides: blocking this pathway reduces the depletion of the total adenine pool and thus the metabolically expensive requirement for the de novo synthesis of atp . Ice worms (and other psychrophiles) paradoxically increase atp levels with falling temperatures [7, 8], and the mechanism underlying this response appears to be dependent on the cell's ability to degrade amp [9, 10]. Consistent with this idea, knocking out the major amp degradative enzyme in bacteria (5 amp nucleosidase) resulted in an ~30% increase in steady - state atp levels in the mutant strain, which was significantly more cold tolerant than wild type . Thus the putative mechanism by which ice worms increase their cellular atp levels involves a predicted reduction in the ability to remove amp from the adenylate pool, and subsequent activation of atp synthetic processes as a direct consequence of increased amp levels [10, 11]. Our ongoing studies suggest that the major eucaryotic amp degradative enzyme, amp phosphatase, may be silenced in ice worms and, based on the current study, that the alternate amp degradative pathway (i.e., amp imp via ampd) may not function efficiently . Specifically, nonconforming ice worm - specific substitutions in ampd primarily k188e would arguably decrease the enzyme's catalytic activity by altering the architecture of the active site . However, ice worms have maintained expression of the ampd gene over evolutionary time, as evidenced by its abundance in our cdna libraries, and so ampd must have some function in ice worm energy metabolism . Thermostat by dramatically reducing their ability to degrade amp, but still retain the potential to remove amp from the adenylate pool should atp levels become excessively high.
A 36-year - old woman with no history of any trauma exhibited a palpable mass on the volar ulnar aspect of her left middle finger at the level of the distal interphalangeal joint for a year . Physical examination revealed a 11.5-cm hard, non - tender, non - movable mass . Plain radiographs of the finger revealed a calcifying soft tissue mass associated with large cortical scalloping on the volar ulnar side of the distal phalanx (fig . The distal interphalangeal joint was normal in appearance . On the high - resolution ultrasound (us) exam (hdi5000, philips medical system, bothell, wa) with a high - frequency (15 - 7 mhz) compact linear transducer, a heterogeneously hyper - echoic mass with surface lobulation and extrinsic cortical erosion by the mass was clearly observable (fig . Surgery revealed a flesh - colored lobulated mass was firmly attached to the periosteum of the distal phalanx and eroded it . Microscopic sections revealed a spindle - cell neoplasm with scattered calcifications and chondroid differentiation (fig . 3). A pathologic diagnosis of calcifying aponeurotic fibroma was made . During the last nine months calcifying aponeurotic fibroma usually appears in the first decade of life and most of the lesions manifest within the first 2 decades of life . For this reason, the tumor has since been reported in the fingers, wrist, forearm, elbow, upper arm, neck, abdominal wall, lumbar paravertebral area, leg, ankle, and thigh (4, 5). Fibromatoses can be divided into two subdivisions, based on anatomic location and on age of presentation . One is the " juvenile fibromatoses " including juvenile aponeurotic fibroma, congenital generalized fibromatosis, fibromatosis coli, fibrous hamartoma of infancy, recurring digital fibrous tumor of reye, juvenile hyaline fibromatosis, diffuse infantile fibromatosis, and hereditary gingival fibromatosis . The second subdivision includes the aggressive fibromatoses, plantar - palmar fibromatosis, and nodular fasciitis (1). Radiologically, calcifying aponeurotic fibroma may show a soft tissue mass with no associated osseous lesions and a fine stippling of focal calcification (4). However, in extremely rare cases, occasional scalloping of the cortex (1, 3) and thickening of the bone (2) have been reported in pediatric patients . To our knowledge, there has been no case with involvement of the distal digital phalanx . On mri, kwak et al . (7) reported that the signal intensity of the calcifying aponeurotic fibroma was lower than that of muscle on t1- and t2-weighted images . In our case, us also clearly demonstrated the extent and character of the soft tissue mass with internal calcific foci and cortical erosive changes of the adjacent bone . The recurrence rate after surgical excision of this tumor is high and generally reported at 50% (8). This necessitates an accurate diagnosis and complete excision . Therefore, evaluation of the extent of the mass and its relationship with surrounding soft tissue or bone is important . The differential diagnosis of calcifying aponeurotic fibroma differs depending on the patient's age, location of the lesion, presence of the calcification, and osseous involvement . Calcifying aponeurotic fibroma in adults should be differentiated from other fibrous tumors such as aggressive fibromatoses, plantar - palmar fibromatosis, and nodular fasciitis . However, in this case, considering distal phalangeal erosive soft tissue mass with calcification, the differential diagnoses were parosteal / soft tissue chondroma, synovial sarcoma, and the calcified epidermoid . In summary, calcifying aponeurotic fibroma is a rare soft tissue tumor that presents as a painless mass primarily on the volar surface of the hands and plantar aspects of the feet in juveniles, but this tumor should be also included in differential diagnoses of any mass with calcification and adjacent bone involvement in the distal phalanx of the finger . In addition, us could be useful for the preoperative evaluation of digital calcifying aponeurotic fibroma.
Nowadays, following development of bearing system of hip arthroplasty, various combinations of metal, polyethylene and ceramic articulation are using as an alternative bearing . Each bearing system has their pros and cons, so not only metal on polyethlene (mop) bearing but also ceramic on ceramic (coc) or ceramic on polyethelene (cop) are used in worldwide . Thr used coc components showed excellent clinical result on short to mid - term follow - up, especially overall survivorship and other complications such as prosthesis failure, aseptic loosening and prosthetic joint infection12). The number of ceramic fracture was rapidly decreased but still there was reported 0.004% ceramic fracture on third generation ceramics and 0.002% ceramic fracture was reported on fourth generation ceramic articulation3). It remained one of the most catastrophic complication in coc thr and we need revision thr surgery in all cases of ceramic fracture . With the increasing the number of hip arthroplasty cases, the number of revision surgery also increasing . There is no definite consensus on the bearing choice of revision thr following ceramic fracture, but when we performed revision surgery using mop articulation, we should alert cobalt intoxication caused by cobalt - chrome wearing . Until now some cases have been reported about cobalt intoxication including toxic heart failure in western45). However, despite high incidence of coc bearing thr in korea, there was no previous report of cobalt intoxication after mop revision thr following previous ceramic fracture . The objective of this case report is to present a fatal massive cobalt intoxication with heart failure induced by prosthesis wear and to inform that once we considering it, we could treat successfully this issue . Fifty - three year old male presented to emergency room in our hospital with progressive shortness of breath . Simple chest radiograph and enhanced heart magnetic resonance imaging study were performed and they showed bilateral pericardial and pleural effusion . Transthoracic echocardiogram showed the evidence of heart failure, left ventricular ejection fraction (ef) was 40% . A month later follow - up echocardiogram was performed and ef was checked below 31%, heart function getting worse . He was admitted at local hospital and started on vasopressors but urine output was decreased and follow - up echocardiogram showed a 25% of ef . Patient recommended heart transplantation and transferred our hospital emergency room . In january 2002 and march 2005, he underwent sequential bilateral total hip arthroplasties due to alcohol - induced osteonecrosis of the femoral head using cop bearing surfaces (c2 stem [lima corporate, udine, italy], 28-mm forte ceramic head [biolox; ceramtec inc ., plochingen, germany], cross - linked polyethylene liner and 54-mm sph acetabular cup [lima corporate]). At 12 years postoperatively, he presented to the other hospital with acute onset of left hip pain . Head and liner change revision surgery was performed using cobalt - chrome alloy 28-mm metal head and protruded cross - linked polyethylene liners by lima corporate . Following the operation record, the ceramic particles were located inside the joint capsule at revision surgery . Also at that time, his heart function was normal (ef=65%). As the cause of heart failure, the medical team initially suspected autoimmune disease such as systematic lupus erythematosus . However, laboratory findings were not suspected . Patient complained nonspecific fatigue and general weakness but had no other symptoms such as visual and hearing loss, cognitive dysfuction . During work - up, patient presented progressive left hip pain and complaint of discomfort for the mass on the left groin . Simple radiograph image shows radiodense area around the hip joint and radiologist suspected heterotopic ossification . The cardiovascular department consulted orthopedic department . In the image findings showed huge mass combined hemorrhagic component lining acetabular component extending psoas compartment and eccentric wear on cobalt - chrome alloy metal head . Also highly radiodense material was seen around neck inferior portion and severly deformed metal head was seen . It was highly suspected that metal related granuloma, which means severe metallosis . Performed heavy metals screen, cobalt levels were 397,800 g / l (normal range, 0 to 3.9 g / l) and chrome levels were 236,000 g / l (normal range, 0 to 3.0 hip joint aspiration was done for decompression as radiologic intervention and ethylenediamine tetraacetate chelation therapy started immediately . After 10 cycle chelating therapy, metal level was lowered cobalt levels by 255.2 g / l and chrome levels by 39.5 g / l . Patient experienced symptomatic improvement and he was tolerable to tapering vasopressor . When hospital day after 134, medical condition of patient was getting improved, we underwent revision surgery . Following previous operation scar, 3). Continually we exposed metal head by using trochanter osteotomy and could find severely deformed metal head . Not only eccentric wear on metal head, but defect of metal head was seen on apex of head . Meticulous removal all the visible ceramic fragments and aggressive debridement of involved soft tissue was done . 5), but complete remove all of the involved soft tissue was impossible . Removed all implants except the stem and repeated washings out of the joint space, coc re - revision thr was done (fig . After the revision surgery, the patient s general condition was more improved but remained left leg neuropathy . Nerve conduction velocity test and electromyography test was done and it suggested left femoral neuropathy . Final heavy metals screen results were 27.79 g / l on cobalt and 22.17 g / coc bearing not only demonstrated the lowest wear rate in several studies but also highly resist scratch and biologically enert6). Especially in korea, comparing to western countries, most of surgeons favor coc bearing surface up to 80%7), so ceramic fracture is more issued and ceramic fracture predicted to increase in near future . Also in present case, cobalt toxicity was diagnosed after mop bearing revision thr following ceramic breakage . In western, there were some previous cases89) reported heart intoxication which used ceramic bearing as index surgery . However, most of them were manifestation combined other systemic complication such as auditory complication, hypothyroidism or neuropathy, but our case shows only heart problem and in our knowledge this is first report in korea of toxic heart failure due to cobalt after thr . Sometimes toxic heart failure due to cobalt intoxication after thr surgery is very hard to diagnose if we do nt have experience or if we are not considering about thr bearing choice . Especially the clinical manifestation shows only about heart failure like this case, usually internal medicine doctor contacts the patient first so it can be easily misdiagnosed or neglected hip problem . Also in current case, medical team suspect rheumatoid disease at first . Until diagnose cobalt toxicity cardiomyopathy it takes about two months after admission and we could do revision surgery about four months hospital day . Because the trends of bearing surface usage in thr in korea are different from those in other western countries, we should more consider about this issues following ceramic fracture and need toxicology work up when treat the heart failure patient who had history of arthroplasty . Also if we found abnormal toxicology result, we should consider not only chelation therapy but revision surgery as possible . There are no definite consensus of bearing choice yet when revision thr following ceramic breakage which index surgery performed by coc . The most popular bearing in revision thr after ceramic fracture is coc bearing again and theoretically also ideal, but only a few clinical result and there were no long term study yet . Even there were also reported good clinical result of revision surgery using mop bearing10), and some surgeons reluctant to use coc articulation because concern about re - fracture of ceramic . But take into account like this devastating complications after cobalt - chrome wear caused by remained ceramic particles, we should carefully select which bearing is more safe.
Capable staff and an efficient system are essential requirements in order to provide an acceptable level of health services in a community . Therefore, there are special quality assurance schemes in place to assess the excellence of education in medical sciences fields in most of developed countries . For such an assessment, accreditation is a high - quality evaluation scheme (1). According to the definition introduced by the council on higher education accreditation (chea) in usa, accreditation is a process based on self and elite s assessment for guaranteeing and improving the quality and responsibility of an institute or university course . In such a process, it can be specified whether the studied institute or program is based on standards issued by the chea and whether their performances fulfills the specified goals of the chea or not (2). Thus, one of the most important advantages of accreditation is to ensure the government, society, learners, and the executive authorities of educational institutes about education quality and the quality of learners through guaranteeing the quality of the under - assessment unit . However, it should be considered that the value of accreditation is not limited to investigations and supervisions, but experiences of accreditation systems rather show that the activities of such systems will lead to establishment and reinforcement of internal assessment processes in educational institutes . In fact, internal and external assessment inside an accreditation structure can help such structures to make best use of the benefits of the both methods (3, 4). Edcs were established in universities of medical sciences in iran in the late 90s; their main aim has been to improve the education quality (5). The tasks for these centers, classified in five main fields: 1) educational planning 2) teacher training 3) research in education, 4) standardization of exams and teaching assessments, and 5) continuous medical education (6). However, by extension of the education fields in clinical and non - clinical fields, the tasks of edc especially in recent years has been widening, which are as follows (7): directing, coordinating, and supervising the educational programs, the evaluation of new assessment / examination techniques, analyzing the results of exams, and comprehensive assessment of academic stafforganizing and supervising activities in related to top and gifted and talented studentssupporting and scaling up researches in educationcoordinating activities in tele - education and e - learning, educational excellencecoordinating and supervising the education development offices in schools and training hospitalscoordinating all activities in related to academic staff development directing, coordinating, and supervising the educational programs, the evaluation of new assessment / examination techniques, analyzing the results of exams, and comprehensive assessment of academic staff organizing and supervising activities in related to top and gifted and talented students supporting and scaling up researches in education coordinating activities in tele - education and e - learning, educational excellence coordinating and supervising the education development offices in schools and training hospitals coordinating all activities in related to academic staff development regarding the goal of these centers, it is important to make sure that edcs are working efficiently . Therefore, formal monitoring of their performance is one of the crucial steps for constant improvement in medical education (8). It is obvious that the activity and tasks of edcs in all universities are not exactly the same . Therefore, creating appropriate and comprehensive indicators is a very critical step for any type of assessments of edcs performance . Based on the above logic, in the 42 session of the council of education deputy managers on 17/12/2008 approved that only universities with standard edcs can apply to establish new educational program (7). Therefore, a real need for accreditation of edcs was materialized . However, generating a valid tool with comprehensive standards is literally complicated . In order to address to this request, a process was defined in the education deputy of ministry of health and medical education (mohme) to designs an accurate model for accrediting the edcs of ums . In this paper, the steps and the process of this development is presented . Special criteria were used to select the best candidates out of experts in the medical education field from the whole country . All of the team members had deep and vast knowledge in the medical education field, long term of experience as a manager in ums, and were familiar with accreditation concepts . Accreditation elements in vertern model (9) are as follows: explanation of pre - defined standardsinternal - assessment by institutemaking a team for external assessmentsite visitreporting the external team s reportassessment of the report by expert committeefinalizing the report and decision making accordingly explanation of pre - defined standards internal - assessment by institute making a team for external assessment reporting the external team s report assessment of the report by expert committee finalizing the report and decision making accordingly having reviewed all available documents and shared experiences, the team decided to design a set of standards in two levels which were basic (essential) and quality improvement standards . The basic standard means the required standard (the musts) which each center has to prove complying with for accreditation . Quality improvement standard means the preferred standard (the shoulds), specifying the development path of the center . Of course, only the basic standards were used in executing the presented model . In order to maximize the content validity of these standards, then, minimums and ideals of each edc were defined through reviewing existed rules and regulations . In the next step, then, the written standards were criticized in the group and a final version of standards was developed by consensus . Each standard was explicitly explored the different sessions before finalizing indicators . In the next phase, the five selected areas 1)governing and leadership, 2)educational planning, 3)faculty development, 4)assessment and examination, and 5)research in education are presented in tables 1 along with their standards . A questioner was sent to ums including operational definitions of each standard as the first step . The main goal of this step was to assess if ums could find standards appropriate and applicable . A new national committee was formed from among those who had appropriate scientific and experimental experiences and did not hold any executive positions in educational management of the university . In addition, they verified responses of ums using independent sources . Using cluster analysis, we assessed the similarities between the obtained scores for indicators; then we classified indictors into clusters in a way to minimize the distance of scores for ever indictor from the centers of clusters . A questioner was sent to ums including operational definitions of each standard as the first step . The main goal of this step was to assess if ums could find standards appropriate and applicable . A new national committee was formed from among those who had appropriate scientific and experimental experiences and did not hold any executive positions in educational management of the university . In addition, they verified responses of ums using independent sources . Using cluster analysis, we assessed the similarities between the obtained scores for indicators; then we classified indictors into clusters in a way to minimize the distance of scores for ever indictor from the centers of clusters . Findings delineated that all medical - sciences edcs of iran were capable of taking part in the project and presented required data and information to execute the project which showed that the defined indices were measurable and perceivable . As shown in table 2, edcs failed to pass in the following standards: - responsive training in education planning area- resources in governing and leadership area- variety of curriculums in the area of faculty members development- modern assessment methods in the assessment area - responsive training in education planning area - resources in governing and leadership area - variety of curriculums in the area of faculty members development - modern assessment methods in the assessment area on the other hand, the standards in the area of faculty members participation in projects (management, website, clinical skills training, assessment of faculty members, and internal assessment) had the best optimum levels . The above case showed that edcs in ums have to pay more attention in the following areas in order to improve their performance: - responsive training- variety of curriculums,- empowerment of faculty members- applying modern assessment methods - responsive training - variety of curriculums, - empowerment of faculty members - applying modern assessment methods fixing 2 as the number of clusters, the averages of distances from the centers were dropped from 2.03 to 0.44 in cluster 1, and from 0.97 to 0.14 in cluster 2 . Fixing 3 as the number of clusters, the averages of distances from centers were dropped from 1.78 to 0.68 in cluster 1, from 1.6 to 0.55 in cluster 2, and 2.19 to 0.17 in cluster 3 . For example, defining two clusters, the indicators in cluster 1 were 1) responsive training in educational planning, 2) the variety curriculums, 3) modern assessment methods, 4) manpower, 5) recourses, and 6) the structure the edc . Based on the above findings, it seems that although cluster analysis might find a few factors by combining indicators, the components of these created factors belongs to the indicators from every groups of governing and leadership, educational planning, faculty development, assessment and examination and research in education . In other words, the conceptual framework for defining main categories of indicators our findings showed that the generated indicators have enough comprehensiveness to cover nearly all activities within edc . However, the pattern of responses and scores did not support the initial conceptual framework . It seems for development of a valid and feasible accreditation scheme of edcs more experience and practice is needed ., accreditation has been quickly spreading outside its initial borders (i.e. North america). This spread, by itself, resulted in some modifications in basic concepts of accreditation like the role of government as well as it s voluntarily nature in accreditation . Accreditation which was initially an association to empower an organization, gradually changed into a tool in order to supervise and improve quality . So, in the definitions of accreditation among references outside the us, there is not any point regarding the non - governmental and voluntary concepts of accreditation (10). In usa, too, supervising the accreditation process is performed by the government; moreover, accrediting the accreditation institutes of medical education is also done by the us government (11). Methods and contents of modern accreditation systems are generally very similar to the previous and initial structures (10). In iran, from the 3rd national development plan from one decade ago, special attention has been directed to launch different sorts of assessments and accreditation systems to assess and improve the efficiency of educational institutes . Different enactments have numerously emphasized the importance of accreditation in medical universities and colleges (12), and among edcs have a critical role to reform in medical education (13) for improving social accountability of medical education in iran (14). The generated indicators were based on a consensus among a group of experts in medical education in iran . These experts defined indictors and their standards based on the current list of edc tasks after a long discussion . Most of universities could address to these indicators easily without any objections; which might imply that the selected indicators and their standards were clear and comprehensive to cover almost all of their activities . However, the results of factorial analysis were not compatible with the initial designed conceptual framework . It means that the strength of the association among edc activities did not have a strong relationship with their labels and groups; as an example, responsive training and modern assessment methods had strong association although they are categorizing in two different groups . These discrepancies are very important and more targeted researches are recommended to address why some of a part activities have strong correlations, but more similar and conceptually linked activities did not strong correlations . Although, this study might be unique, because of its approach to the concept of accreditation in the assessment of the quality edcs activities; we did not check the validity of universities responses in field observation . Nonetheless, usually the responses of university in similar assessments were acceptable in national programs . However, for a real accreditation, it is recommended the main steps of the vertern model to be followed (9). The implementation of this accreditation scheme of the edcs would be a critical point for quality improvement of medical education . However, based on our observation, ums have to work intensively to fill their gaps to obtain basic standards in all indicators; otherwise, in the next round of accreditation a considerable number of edcs will be disapproved . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.
Polo - like kinase 1 (plk1) is the most well - studied member of the polo - like family of kinases and is most commonly known for its regulatory role during mitosis, where it has been shown to be a critical component of centrosome maturation, kinetochore microtubule attachment, bipolar spindle formation, and cytokinesis . The overexpression of plk1 is common in aberrant cells and has been identified in roughly 60% of reported cancers including melanoma, breast, ovarian, thyroid, colon, prostate, pancreatic, head and neck, nonsmall cell lung, and non - hodgkin s lymphomas . Furthermore, the overexpression of plk1 has been linked to poor disease prognosis and a decreased survival rate . In vitro studies have shown that specific inhibition of plk1 can significantly reduce the proliferation and viability of multiple melanoma cell lines by inducing g2/m phase cell cycle arrest and mitotic catastrophe without detriment to normal adult or neonatal human epidermal melanocytes (hems). These data have made plk1 an attractive target for small - molecule inhibition and provoked the development of over a dozen plk1 inhibitors, six of which have gone to clinical trials . However, despite plk1 inhibition having great preclinical success for cancer treatment, the clinical potential of plk1-targeted inhibition for human cancers has yet to be realized . This emphasizes the need for a more in - depth understanding of plk1 signaling in cancer . This study addresses that need by employing a large - scale comparative proteomics analysis to examine the downstream effects of plk1 inhibition using the small - molecule inhibitor bi 6727 . Bi 6727 (volasertib) is a second - generation plk1 inhibitor and is currently the most specific plk1 atp - competitive inhibitor commercially available with an ic50 of 0.87 nm . Plk1 inhibition by bi 6727 has been shown to have potent antitumorigenic activity in multiple preclinical studies, but the downstream mechanism by which bi 6727 confers its therapeutic effect remains largely undefined . In an effort to identify novel regulatory effects of plk1 inhibition in melanoma, we used a label - free, relative quantitation strategy to compare the proteomes of a375 melanoma cells cultured in the presence or absence of bi 6727 . The a375 melanoma cell line has been reported to express high levels of plk1 when compared with hems and is sensitive to the targeted depletion of plk1 . Furthermore, a375 cells harbor the braf mutation, a mutation present in roughly 50% of melanoma cases, thus making it an ideal candidate for our proteomics analysis . Our comparative proteomics strategy was conducted by employing data - dependent nano - lc ms / ms analysis on a q - exactive with the resultant data being searched against the human proteome using the sequest search engine and further analyzed with the sieve software package to reveal proteins with altered expression . This analysis resulted in the positive identification of 1819 proteins (1% false discovery rate (fdr)), 343 of which had significantly altered expression . Using ingenuity pathway analysis (ipa) to filter the data under more stringent conditions, we identified a subset of 23 proteins that were significantly altered due to bi 6727 inhibition of plk1, most of which have no previously reported associations with plk1 . Importantly, we have identified proteins involved in cellular metabolism, proteasomal degradation, and p53 translation, thus providing novel insight into plk1 s role in cancer cell survival . A375 human melanoma cells (atcc, va) were cultured in hyclone dulbecco s modified eagle s medium (dmem, thermo, ca) supplemented with 10% fetal bovine serum (fbs, thermo, ca). 1 10 a375 human melanoma cells (atcc, va) were seeded in 100 mm tissue culture plates (tpp, mo) containing 10 ml of supplemented dmem (thermo, ca) and were allowed to recover in untreated medium for 24 h under standard cell culture conditions . Following recovery, medium was aspirated, and cells were treated with 25 nm bi 6727 (chemietek, in) or vehicle control (dmso) in supplemented dmem . After 24 h, cells were collected by trypsin digestion and centrifugation at 300 g for 3 min at 4 c . The treatments were performed using identical procedures on two varying a375 cell passages three times each for a total of six experimental replicates per treatment group . Cell pellets were lysed mechanically with a needle in the absence of protease inhibitors or lysis buffer according to the following protocol . 0.3 ml of ice cold pbs was added to frozen cell pellets, and the resulting mixture was lysed by passing through a 23 gauge needle 15 times . The cytosolic protein fraction was isolated by centrifugation at 10 000 g for 10 min at 4 c to remove cellular debris . Protein concentration of the extracts was measured by microbca assay (thermo fisher scientific, il). A total of 20 g of protein from each of the six replicates (control and treated) was digested with 1 g of sequencing grade trypsin (promega, fitchburg, wi). Following an overnight digestion at 37 c samples were acidified with 10% formic acid and prepared for lc ms / ms by c18 zip - tip purification according to the manufacturers protocol (millipore, billerica, ma). Peptide samples were resuspended in water with 0.1% formic acid (v / v) and analyzed by nano - lc ms / ms . For label - free, relative, quantitative analysis, six replicates of each sample were analyzed by nano - lc ms / ms . For each run, 1 g of the digest was injected on a 100 m 100 mm, reverse - phase c18 beh column with 1.7 um particles and a 300 pore size (waters, milford, ma) using a waters nanoacquity system . Chromatography solvents were water (a) and acetonitrile (b), both with 0.1% formic acid . Peptides were eluted from the column with the following gradient 3 to 35% b (130 min). At 140 min, the gradient increased to 95% b and was held there for 10 min . At 160 min, the gradient returned to 3% to re - equilibrate the column for the next injection . A short 50 min linear gradient blank was run between samples to prevent sample carryover . Peptides eluting from the column were analyzed by data - dependent ms / ms on a q - exactive orbitrap mass spectrometer (thermo fisher scientific, ma). A top-15 method was used to acquire data . In brief, the instrument settings were as follows: resolution was set to 70 000 for ms scans and 17 500 for the data - dependent ms / ms scans to increase speed . The ms agc target was set to 10 counts, while ms / ms agc target was set to 10 . Ms scans were recorded in profile mode, while the ms / ms was recorded in centroid mode, to reduce data file size . Dynamic exclusion was set to a repeat count of 1 with a 25 s duration . Following lc ms / ms acquisition, the data were searched using sequest ht proteome discoverer 1.4 search engine (thermo fisher scientific), against the uniprot human database (6/23/2013, 20 209 sequences) at a false discovery cut off 1% . Following protein identification, the lc quantitation of peptides eluting between 38 and 145 min was performed on the processed data using sieve 2.1 (thermo fisher scientific), which uses ms intensities from raw lc ms data to find statistical proteomic differences between two samples . Proteins ratios calculated had to be significant with a p value lower than 0.05, and the cv raw ms intensities of the six replicates had to be within 30% . Identified proteins from the sieve processing were initially analyzed and filtered using ipa (ingenuity systems, ca) under a trial license . A data set containing proteins with only uniquely identified amino acid sequences (peptides) with a high level of confidence (p <0.05) was uploaded into ipa with number of peptides identified, triggered ms / ms fragmentation scans (hits), and the corresponding ratio (treated / untreated) set as the observational parameters with swiss - prot accession numbers used for gene i d . A secondary data set was then generated using ipa filters set to proteins with more than two identified peptides on no fewer than four hits with a greater than two - fold change in expression . Another secondary data set was generated using the ipa connect tool to identify any plk1-associated proteins with an expression change greater than two - fold . The two secondary data sets were combined, and their molecular function and biological processes were assessed using panther (protein analysis through evolutionary relationships). 5 10 a375 cells were plated and grown in a 10 cm culture dish and treated with bi 6727 at 25 nm, 100 nm, or vehicle control, as previously described . Following 24 h treatment, cells were trypsinized, washed with ice - cold pbs, and lysed with ripa buffer (50 mm tris, 150 mm nacl, 1% np-40, 0.5% deoxycholic acid, 0.1% sds) with phenylmethylsulfonyl fluoride (pmsf) and protease inhibitor cocktail (pierce, il). For immunoblot analysis, 30 g of protein was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds - page) using mini - protean tgx precast gels and transferred onto nitrocellulose membrane . Blots were blocked in 5% nonfat dry milk in tris - buffered saline + 0.1% tween-20 (tbst), followed by probing with desired primary antibodies: anti - ldha, aurkb, p53, -actin (cell signaling nos . 2012, 3094, 9282, 4970), psmb1, psmb2, or psmb5 (abcam nos . Blots were then incubated with the appropriate hrp - conjugated antibodies followed by chemiluminescent detection (pierce, il). 5 10 a375 cells were plated and grown in a 10 cm culture dish and treated with bi 6727 at 25 nm, 100 nm, or vehicle control, as previously described . Following 24 h of treatment, cells were trypsinized and washed with ice - cold pbs, followed by rna isolation using the rneasy plus mini kit (qiagen, ca) and first strand cdna created with m - mlv reverse transcriptase (promega, wi) according to vendor s protocol . Quantitative real - time rt - pcr was performed in triplicate in 20 l reactions with sybr premix ex taq perfect real time (takara, wi) with 100 ng first - strand cdna and 0.2 g of each desired primer pair . The sequences for gpi, ldhb, and p21 (primerbankid 296080692c3, 291575126c2, 310832423c1) were acquired from the primerbank online database . Samples were cycled once at 95 c for 10 min, then 35 cycles of 95, 58, and 72 c for 5, 15, and 20 s, respectively . Relative mrna was calculated using the ct method with gapdh as an endogenous control . For lactate assay, 8 10 a375 cells were plated and grown in a 96-well plate and treated with bi 6727 at 25 nm, 100 nm, or vehicle control, as previously described . 24 h following treatments, 500 l of spent media was removed from each group and immediately cleared of ldh proteins by centrifugation in 10 kda molecular weight cutoff spin columns and stored at 80 c . All samples were diluted by adding 10 l of media to 90 l of lactate assay buffer and subsequently used in a serial dilution containing a final concentration of either 1, 0.5, 0.25, or 0.125% media in lactate assay buffer with a final volume of 50 l in black 96-well half area plates (corning, ma). Lactate assay was performed per manufacturer s protocol, and fluorescence intensity was measured on the biotek synergy h1 microplate reader at ex = 535/em = 587 . 3 10 a375 cells were plated and grown in 96-well half - volume white - wall plates (corning, ma) and treated with bi 6727, as previously described . Following 24 h treatments, samples were processed using the nad(p)h - glo detection system (promega, wi) or nad / nadh - glo assay (promega, wi) as per manufacturer s protocol . Luminescence was detected using the biotek synergy h1 microplate reader . For assessing 20s proteasome activity, a375 cells were treated with bi 6727 at 25 nm, 100 nm, or vehicle control, as previously described . Following 24 h treatments, cells were lysed in 50 l of ice - cold ripa buffer for 10 min at room temperature while shaking . Next, 25 l of lysate was added to a 96-well plate containing bca reagent (pierce, rockford, il) and incubated at 37 c for 30 min, while 10 l of lysate was added to the 20s proteasome activity assay (millipore, ma) prepared per manufacturer s protocol and incubated at 37 c for 2 h. relative levels of protein were quantified using the bca assay absorbance detected using the biotek synergy h1 microplate reader at 562 nm . 20s proteasome activity was quantified using fluorescence intensity on the synergy h1 microplate reader at ex = 380/em = 460 . Proteasome activity was then normalized to relative protein concentration, and the mean of relative activity for each treatment (n = 6) was represented graphically . For immunofluorescence staining, cells were plated and grown on bd falcon cultureslides (bd biosciences, san jose, ca) and treated with bi 6727 as previously described . The cells were fixed with a 4% paraformaldehyde in pbs (ph 7.1) for 15 min at room temperature, then blocked with 5% normal goat serum in 0.3% triton x-100 for 1 h. after blocking, cells were incubated overnight in anti--tubulin primary antibody in blocking buffer (1:100, cell signaling no . 2128), followed by a secondary incubation with alexa fluor 594 antirabbit igg antibody in blocking buffer (5 g / ml, invitrogen no . The cells were then counter - stained with hoecsht 33342 (invitrogen, grand island, ny) for nuclear staining, and a prolong antifade kit was applied per vendor s protocol (molecular probes, eugene, or). Slides were examined under a nikon ti microscope using the respective manufacturer s suggested filter sets . 1 10 a375 cells were plated and grown in a six - well tissue culture dish (tpp, che) and treated with bi 6727, as previously described . Following treatment, cells were trypsinized for 5 min and transferred to 5 ml falcon tubes containing cultured media . Samples were centrifuged at 1000 rpm for 2 min, and the supernatant was aspirated prior to the cells being resuspended in ice - cold 100% ethanol added dropwise while gently vortexing . Samples were stored at 20 c overnight prior to centrifugation and resuspension in 500 l of propidium iodide (pi) buffer (pbs, 50 g / ml pi, 0.1 mg / ml rnase a, 0.05% triton - x). Samples were incubated at 37 c for 40 min in dark and stored at 4 c until processed by flow cytometry in the fl-2a channel . Cell cycle analysis was done using modfit lt software (verity software, topsham, me). In an effort to identify the downstream molecular mechanisms of plk1 in melanoma, we elucidated quantitative changes in the proteome of human melanoma cells following plk1 inhibition with bi 6727 . Ms / ms on a q - exactive spectrometer were processed with sieve software to reveal up- or down - regulated proteins following plk1 inhibition . To determine the most effective concentration of bi 6727, we assessed a375 cell viability following a defined range of bi 6727 treatments (0.11000 nm, data not shown). We determined 25 nm of bi 6727 as the lowest effective concentration to cause a statistically significant decrease in cell viability after 48 h. to assess the molecular functions that contribute to the reduction of a375 cell viability, we terminated treatments after 24 h to limit the necrotic and late apoptotic cell population . Labeling methods, including chemical modification approaches (i - traq, etc .) And stable isotope labeling, can be expensive but generally require fewer lc label - free approaches are becoming more popular as improvements in instrumentation (resolution and mass accuracy), and improvements in data analysis software facilitate analysis of large data sets . The capabilities of our q - exactive spectrometer made a label - free approach attractive . The high scanning speed coupled to the resolving power and mass accuracy of the q - exactive orbitrap make it particularly useful for accurate, label - free, quantitative protein analysis . This is primarily due to the higher resolution (smaller diameter) orbitrap cell of the q - exactive . High - resolution and mass accuracy facilitate area - under - the - curve analysis with the sieve software by allowing accurate tracking of peptides through their chromatographic elution . This improves the duty cycle and allows for increased peptide identification at the ms / ms level . The q exactive has been shown to identify a higher number of compounds with better confidence in multiple comparison studies . Thus, there is greater proteome coverage, which enhances the ability to quantitate lower abundant proteins than is achieved with spectral - counting approaches . Indeed, the power of this combination of instrumentation and software was born out in the ability of our analysis to positively identify over 1800 proteins, at a cutoff of 1% fdr, with 343 of these identified proteins showing significantly altered expression (tables s1 and s2 in the supporting information). A key step in label - free quantitative proteomic analysis is the evaluation of run - to - run and sample - to - sample reproducibility / variability . Prior to the full analysis, we performed a pilot study of bi 6727-treated cells and control replicates, using identical sample preparation and lc ms parameters as previously described to assess variability . Two a375 human melanoma aliquots were seeded in 100 mm tissue culture plates as previously described and grown for 24 h under standard cell culture conditions . Two replicate injections of 1 g of both control and treated samples were run . Resulting data were subject to sequest searches against uniprot human at 2% fdr, using proteome discoverer . A higher fdr was used in assessing the run - to - run variability to delve deeper into the data . These four control runs had an average of 715 proteins identified, with an average of 1500 unique peptides and over 3100 total scans . Percent overlap between the two control biological replicates was 67% at the protein level and 55% at the peptide level (data not shown). Not surprisingly, percent overlap of the duplicate injections was higher with 70% overlap at the protein level and 62% at the peptide level (data not shown). Percent overlap between both injection and biological replicates is consistent with a recent review article highlighting the strengths and limitations of label - free proteomic quantification . Our control runs emphasize the need for more than three experimental replicates of each sample type to accurately determine protein ratios in label - free studies . To maximize the statistical power of our analysis, we opted to analyze six replicates of control versus plk1 treated a375 cells . The first step in any direct comparison of treated versus control samples ms peak our data showed average alignment scores of 0.825, with the treatment groups clustering together (figure 1a). Because sieve, like many other label - free methods, allows for conserved peptides to be equally considered for all candidate proteins this avoids inaccurate fold - change calculations due to differential regulation of proteins sharing a conserved peptide . The q - exactive s speed, was key in being able to take this stringent approach to label - free proteomics . Label - free quantitation approaches do not rely on internal standards, and thus care needs to be taken to accurately filter the data to reproducibly quantitate proteins . Sieve allows for calculated peptides ratios between samples to be filtered not only on p value using fisher s combined probability but also based on variation in the ms peak intensities between the experimental replicates . After data were normalized to the total ion current (tic), we filtered all protein ratios to have a cv between the six replicates (25 nm bi 6727 or vehicle control) to be 30% . Peptides had to show up in all six replicates of a treatment at the ms level to be quantitated (figure 1b, c). One of the benefits sieve has over spectral counting is as long as a peptide has a consistent ms peak, it only has to be positively identified once to determine its ratio . Finally, peptide fold - change ratios had to be significant at a p value of 0.05 to be considered in our analysis . (a) for label - free relative quantitation, six replicates of the tryptic digests were analyzed . An overlay of the base peak chromatograms of control (blue) and treated (red) samples shows good alignment and comparable loading in the region of peptide elution (38145 min rt). (b) an example of a peptide that is down - regulated in response to treatment . Shown is a sieve - aligned, extracted - ion chromatograms for peptide 524.9481 m / z (metastasis - associated protein). (c) example of a peptide that is up - regulated in response to treatment . Shown is a sieve - aligned, extracted - ion chromatogram for peptide 373.3691 m / z (ph - domain leucine - rich protein). A data set containing proteins with only uniquely identified peptides with a high level of confidence (p <0.05) was uploaded into ipa with the number of peptides identified (figure 2a) and the corresponding ratio (treated / untreated) (figure 2b) set as the observational parameters . A secondary data set was then generated using ipa filters set to proteins with more than two identified peptides, no fewer than four hits, and greater than a two - fold change in expression . Another secondary data set was generated using less stringent criteria allowing for one uniquely identified peptide and integrated the ipa connect tool to identify any plk1-associated proteins with more than four hits and an expression change greater than two - fold . These two analyses resulted in a data set containing 23 proteins of interest (table 1). Next, we employed panther (protein annalysis through evolutionary relationships) to assess the molecular function of the collective proteins and identified catalytic activity and binding as the primary protein function (figure 2c). Interestingly, using panther to identify the biological processes, cell cycle was scored at 8%, while metabolic process was scored at 57% (figure 2d). Furthermore, when scored by protein classes, the hydrolase, nucleic acid binding and protease classes were the three highest ranks, respectively . Given the known biological function of plk1, it would be difficult to predict that plk1 inhibition would have considerable association with cellular metabolism, nucleic acid binding, and proteolytic activity . Therefore, we sought to further investigate these observations and substantiate our proteomics findings . (a) graphical breakdown representing the number of peptides recognized in all identified proteins . (b) graphical representation of the calculated protein ratios showing bi 6727-treated samples compared with the vehicle control . (c) proteins of interest molecular function reported by panther (protein analysis through evolutionary relationships) as characterized by gene ontology . (d) proteins of interest biological processes reported by panther as characterized by gene ontology . Proteins identified as having greater than a two - fold change and triggering no less than four separate ms / ms fragmentation scans (hits) of at least two uniquely identified amino acid sequences (peptides) for proteins with no known association to plk1 or one unique peptide for proteins with a plk1 association, as identified by ingenuity pathway analysis (ipa). Also included is the number of lc peaks within a well - defined rectangular region in the m / z versus retention time plane (frames), where each unique peptide was identified . The results of our proteomics analysis have revealed that the inhibition of plk1 activity results in the decreased expression of multiple metabolic proteins including malate dehydrogenase 1 (mdh1), glutamic - oxaloacetic transaminase 2 (got2), and transketolase (tkt). Additionally, we observed a significant reduction in lactate dehydrogenase a (ldha), confirmed by western blot (figure 3a) as well as glucose-6-phosphate isomerase (gpi) and lactate dehydrogenase b (ldhb), which were further assessed at the mrna level (figure 3b). Of interest, ldha, ldhb, and gpi each play an essential role in glycolysis, a metabolic pathway that allows tumor cells to thrive under hypoxic conditions . Glycolysis is an evolutionarily conserved reaction that allows cells to generate atp from glucose under hypoxic conditions . However, cellular metabolism under normoxic conditions is primarily driven by a much more efficient reaction, mitochondrial oxidative phosphorylation (oxphos), yet a hallmark of many cancer cells is their propensity to use the inefficient glycolytic reaction for the production of energy in the presence of oxygen, a phenomenon known as the warburg effect or aerobic glycolysis . It is interesting to speculate that plk1 overexpression may contribute to the cancer - related switch from oxphos to aerobic glycolysis . (a) lactate dehydrogenase a (ldha) protein expression was significantly reduced following plk1 inhibition in both proteomics (top) and western blot (bottom) analyses . (b) qpcr analysis suggests a dose - dependent decrease in polo - like kinase 1 (plk1), lactate dehydrogenase b (ldhb), and glucose-6-phosphate isomerase (gpi) transcript levels following bi 6727 treatment (25 nm, 100 nm). (c) bi 6727 treatment significantly reduces extracellular lactate levels (p <0.001). (d) plk1 inhibition significantly reduces reduced nicotinamide adenine dinucleotide (nadh) and nicotinamide adenine dinucleotide phosphate (nadph) levels (p <0.001). (e) nad and nadh levels are significantly reduced in bi 6727-treated cells when compared with control (p <0.001). (f) nad / nadh ratio decreases in a bi 6727 dose - dependent manner (* * p <0.01, * * * p <0.001). To assess the effect of plk1 inhibition on aerobic glycolysis, we first measured extracellular levels of lactate, the major byproduct of glucose breakdown . Following a 24 h incubation with bi 6727 under normoxic conditions, there was a significant decrease in lactate levels in both treatment groups (25 nm, 100 nm) when compared with control (figure 3c). Because these data suggest a disruption in metabolic activity, we next assessed the levels of nicotinamide adenine dinucleotide (nadh) and nicotinamide adenine dinucleotide phosphate (nadph), the enzymatic cofactors produced during glucose breakdown by glycolysis and the pentose phosphate pathway, respectively . The nadh and nadph levels were significantly reduced in bi-6727-treated cells, resulting in nearly a five - fold decrease (figure 3d). To determine if these observations correlate to energy production, we independently measured levels of nad, an essential coenzyme in atp production . Interestingly, in addition to the nad levels being significantly decreased in both the oxidized (nad) and reduced (nadh) forms (figure 3e), plk1 inhibition also significantly altered the nad / nadh ratio (figure 3f). The nad / nadh ratio is considered to be an indicator of the metabolic state and is important in regulating the intracellular redox state, while a shift in the nad / nadh ratio is closely linked to physiological and pathological states . Our data suggest a greater decrease in nad following plk1 inhibition, and given that the pyruvate to lactate conversion is a major route of nad regeneration, it is reasonable to expect that the observed decrease in ldha is a primary factor in the ratio shift . Although our data suggest that plk1 inhibition decreases the metabolic activity of melanoma cells, the question of how plk1 signaling relates to glycolysis remains to be answered . The initial warburg hypothesis attributed its effects to dysfunctional oxphos; however, recent studies have indicated that oxphos remains functional in cancer cells and the shift toward aerobic glycolysis is driven by tumor suppressors such as p53 and pten or the oncogenes ras, c - myc, and hypoxia - inducible factor-1 (hif-1). Plk1 has not only been shown to be involved in p53, pten, and c - myc signaling pathways; recent studies suggest that plk1 has the potential to act as a mediator between them . For example, the loss of pten expression is a frequent occurrence in human malignancies and results in elevated phosphoinositide 3-kinase (pi3k) signaling . Recently, tan et al . Have shown that hyperactivation of the pi3k downstream target, pi3k - dependent protein kinase-1 (pdk1), activates plk1, which in turn stabilizes myc through direct phosphorylation at ser-62 . While this study has shown a direct connection between two key tumorigenic pathways through plk1, further correlations can be made when considering the numerous interactions between plk1 and p53 (discussed later). Given these data, it is interesting to hypothesize that plk1 overexpression may contribute to the glycolytic shift described by the warburg effect; however, further studies are needed to define the role of plk1 in metabolic signaling . The ubiquitin - proteasome system (ups) plays an integral role in cellular homeostasis through a systematic process that is responsible for 8090% of intracellular protein degradation . The 26s proteasome is the primary proteolytic complex of the system and is composed of two subcomplexes, the catalytic 20s core particle (cp) and either one or two terminal 19s regulatory particles (rps). The rps are responsible for protein capturing by ubiquitin recognition, followed by protein unfolding and translocation to the proteolytic channel of the cp . The cp is made up of four stacked rings, each containing seven - (1 - 7, psma1 - 7) or -subunits (1 - 7, psmb1 - 7) in an configuration (figure 4a). The outer -subunits act as a physical barrier to the active -subunits and create a docking site for the rp, while the inner -rings are responsible for protein cleavage through caspase - like, trypsin - like, and chymotrypsin - like activities by the catalytically active subunits 1, 2, and 5, respectively . Plk1 inhibition significantly alters 20s proteasome expression and activity . (a) basic structure of the 20s proteasome . (b) proteomics analysis identified four 20s proteasome subunits as being down - regulated . (c) western blot analysis of the catalytically active 20s proteasome subunits, proteasome subunits 2, 5, and 1 (psmb2, psmb5, and psmb1) following plk1 inhibition . (d) bi 6727-treated cells have significantly decreased 20s proteasome activity (p <0.001). In our comparative proteomics analysis, we found that bi 6727 treatment results in significant downregulation of multiple 20s subunits in human melanoma cells . Following our ipa analysis, we initially identified subunits 3 and 2 as being 2.20- and 7.41-fold downregulated, respectively . Broadening our ipa analysis to include plk1-associated proteins with only one unique peptide but still having a greater than a two - fold change and no fewer than four hits, we further identified the 20s subunits 7 and 6 as being downregulated by 2.46 and 5.56 fold, respectively (figure 4b). Because these data suggest that plk1 inhibition has an effect on a wide range of subunits, we performed a western blot analysis of the catalytically active subunits 1, 2, and 5 following inhibition of plk1 by bi 6727 (figure 4c). We confirmed a decrease in 2, as reported by our proteomics analysis, and additionally observed a modest decrease in 5, while there was no apparent effect on 1 . To assess if the decreased subunit expression reflected on proteasome cleavage, we measured 20s proteasome activity using a fluorophore - labeled proteasome substrate . This assay demonstrated a significant reduction in 20s activity in bi 6727-treated cells when compared with control (figure 4d). These data suggest that plk1 activity influences proteasome cleavage and is potentially upstream of multiple proteasome subunits in a signaling pathway that has yet to be defined . However, there is evidence of plk1 indirectly associating with the proteasome through the transcription factors forkhead box m1 (foxm1) and p53 . Similar to plk1, foxm1 is overexpressed in numerous human carcinomas and is correlated to poor disease prognosis . Plk1 is involved in a positive feedback loop with foxm1, where plk1-dependent phosphorylation is required for efficient foxm1 activation, which in turn is required for expression of multiple mitotic regulators, including plk1 . Interestingly, proteasome inhibitors have been shown to suppress foxm1 transcriptional activity, suggesting that proteasome - dependent degradation may confer a level of indirect regulation to plk1 overexpression in human carcinomas . In addition to foxm1, the classical tumor suppressor p53 also intersects with both plk1 and the proteasome . Studies have revealed that plk1 contributes to p53 repression by directly binding to p53 in addition to phosphorylating gtse1 and topors, negative regulators of p53 . Furthermore, plk1 has also been shown to stabilize the oncoprotein mdm2, an e3 ubiquitin ligase and the principal cellular antagonist of p53 . Mdm2 mediates p53 protein turnover through constant monoubiquitination, a critical step in the polyubiquitnation of p53 and targeted degradation by the 26s proteasome . Because p53 negatively regulates plk1, a negative feedback loop exists in the plk1-p53 axis . Considering the findings presented in this study and given the relationships among plk1, foxm1, and p53, these data suggest that increased proteasome activity would be conducive to plk1 overexpression . The heterogeneous ribonucleoprotein c1/c2 (hnrnpc) is a ubiquitous rna - binding protein that is expressed in two main isoforms, hnrnpc1 and hnrnpc2 . Studies have shown hnrnpc s biological functions to include mrna transcript packaging, splicing, nuclear retention, and mrna stability . In this study, we report a significant up - regulation of hnrnpc following plk1 inhibition, which was confirmed at the protein level by western blot analysis (figure 5a). Interestingly, a recent study has shown that hnrnpc overexpression induces micronucleation through the repression of the mitotic protein aurora kinase b (aurkb) in hepatocellular carcinoma (hcc) cells . Using an immunofluorescent nuclear stain, we were able to observe a similar micronucleation phenotype in melanoma cells following plk1 inhibition (figure 5b). Next, we wanted to determine if there was also a repression of aurkb . Despite a significant g2/m arrest (figure 5c), we did not observe any significant changes to aurkb expression at the protein level; however, we did observe a significant reduction in aurkb mrna (figure 5d). With the understanding that an accumulation of cells in g2/m would result in increased mitotic proteins such as aurkb and given the consistent protein expression we observed at 24 h, it is possible that we are seeing early evidence of aurkb protein degradation and the reduced transcript levels may be a better indicator of aurkb repression . This evidence suggests that inhibition of plk1 activity may negatively affect aurkb expression and the mitotic catastrophe associated with plk1 inhibition may in part be mediated through hnrnpc and aurkb . (a) heterogeneous ribonucleoprotein c1/c2 (hnrnpc) protein expression was significantly increased following plk1 inhibition in both proteomics (top) and western blot (bottom) analyses . (b) immunofluorescence microscopy of -tubulin (red) and hoecsht dna (blue) staining, demonstrating micronucleation following plk1 inhibition . (c) cell cycle analysis of bi 6727-treated cells demonstrates a pronounced g2/m arrest . (d) western blot analysis of aurora kinase b (aurkb) does not indicate significantly altered protein expression following bi 6727 treatment (top), but qpcr analysis reveals decreased mrna expression levels (bottom). (e) plk1 inhibition causes a marked increase in p53 protein expression, visualized by western blot analysis (top) and p53 activity, demonstrated by increased p21 mrna expression (bottom). Although we have already discussed numerous connections between plk1 and p53, an additional association exists through hnrnpc . Hnrnpc has been shown to enhance p53 translation by directly binding to a cis - element in the 5 coding region of p53 mrna . In accordance with these findings, we did find a corresponding increase in p53 protein expression and activity as determined by western blot and transcriptional analysis of p21, respectively (figure 5e). These data provide compelling evidence of a novel pathway in plk1-mediated p53 expression through regulation of hnrnpc . However, the plk1p53 axis is a complex signaling network, and extensive studies will be required to determine the role of hnrnpc . Inhibition of plk1 by small - molecule inhibitors has become an extremely active area of research based on the preclinical success of plk1 inhibition in a wide variety of cancers . While it has been shown in multiple studies that plk1 inhibition selectively targets cancerous cells over that of their normal counterparts, the molecular mechanisms that contribute to plk1 s selectivity remains poorly understood . Our proteomics study of plk1 inhibition by bi 6727 in human melanoma a375 cells has revealed the altered expression of multiple proteins that have yet to be identified as part of the plk1 signaling network . Our proteomics analysis provides evidence of a novel relationship between plk1 and hnrnpc and that plk1 inhibition has considerable effect on anaerobic glycolysis and proteasome activity, two pathways that are essential in cancer cell survival . Further studies are needed to determine the significance of these protein interactions, but overall these data provide a solid foundation for novel plk1 signaling pathways and potential candidates for future targeted therapies.
Different studies in animal models have demonstrated that the combination of vrb and cape has a synergistic activity against breast cancer cells, due to their different mechanism of action . These results have been subsequently confirmed in numerous studies conducted in metastatic breast cancer patients, heavily pretreated with taxanes and anthracyclines, in which vrb was administered as iv formulation . Subsequent trials showed that there was a substantial equivalence between the iv and the oral formulations of vrb, even if this latter was characterized by a higher rate of haematological toxicity [35]. In all these studies, vrb and cape were administered on days 1 and 8, according to the approved standard schedule . Metronomic chemotherapy refers to the frequent, even daily, administration of drugs at doses significantly lower than the maximum tolerated dose (mtd), with no prolonged drug - free breaks . A recent study by dellapasqua et al . Showed that the metronomic combination of cyclophosphamide and cape with bevacizumab was effective and minimally toxic in advanced breast cancer patients . This study fixed the dose of cape as 500 mg thrice a day, continuously . Different studies have evaluated the possibility to administer vrb in a metronomic way [8, 9], trying to establish the mtd of the drug, both as single agent or as part of a multidrug regimen . These studies fixed the mtd of oral metronomic therapy with vrb at 4060 mg / tot thrice a week . No studies to our knowledge investigated the administration of an all - oral metronomic combination of the two drugs . Aim of the present trial was to determine the mtd of metronomic vrb in combination with a fixed dose of cape in locally advanced or metastatic breast cancer patients . After defining the mtd, we conducted a phase ii study in order to verify the activity and the tolerability of the schedule . Patients aged 18 years or more, with histological proven locally advanced (inoperable) or metastatic breast cancer with the following characteristics were eligible: pre- or postmenopausal, pretreated with anthracyclines and taxanes or not suitable for each of these drugs or both due to clinical conditions, her2-negative or her2-positive not suitable or no longer suitable to anti - her2 agents due to cardiac impairment, measurable or evaluable disease, life - expectancy> 12 weeks, ecog ps 2, adequate (bone) marrow, liver, and renal function (absolute neutrophil count> 1.5 10/l, platelets> 100 10/l, haemoglobin> 10 g / dl; total bilirubin within the normal institutional limits, ast / alt <2.5 unl, or <5 unl in the case of liver involvement, creatinine within normal institutional limits, or creatinine clearance 50 ml / min, according to cockroft - gault formula), inr <3 at the screening for patients taking warfarin, and absence of cerebral or leptomeningeal metastases . The starting dose (level i) of vrb was 20 mg thrice a week for 3 consecutive weeks (1 cycle). The first cohort started with level i dose (20 mg), receiving the drug for 1 cycle . If no grade 3 - 4 toxicity was observed during the 1st cycle, the first cohort escalated to level ii (30 mg) in the 2nd cycle, together with the initiation of the second cohort, which started with level ii directly in the 1st cycle . Both groups of patients received 1 cycle (3 weeks); if no grade 3 - 4 toxicity was observed, they could increase the vrb dose to level iii (40 mg), together with the initiation of the third cohort, which directly began with 30 mg . All patients who reached the level of 40 mg continued to be treated with the same dose up to disease progression, up to refusal to continue the study, and in any case up to 9 cycles of therapy (27 weeks overall). All toxicities were graduated according to the national cancer institute common terminology criteria of adverse events (nci - ctc, version 3). The baseline evaluation included complete history and physical examination, assessment of performance status, cbc and differential, metabolic profile, coagulation studies, and serum pregnancy test in women with childbearing potential . Baseline staging was performed with total body ct scan, ultra sound for abdomen, standard chest x - ray, or clinical examination . Haematological toxicity was evaluated by cbc count every week and renal and liver function by biochemistry at the beginning of each subsequent cycle . Thus, for each mtd common toxicities (occurring in 30% of patients) would rarely be unobserved (p = 0.11), and very common toxicities (occurring in 50% of patients) would almost never be missed . Standard descriptive statistics were used for describing baseline characteristics and relevant safety and activity endpoints . Median age was 72 years (4981), 2 patients were metastatic d'emble at the time of enrolment, but they could not be treated with anthracyclines or taxanes due to cardiac impairment in the first case and refusal to have hair loss in the second one . Two patients were her2 +, but one has been already treated with trastuzumab, developing a cardiac heart failure which precluded any other therapy with anti - her2 agents; the second could not receive any anti - her2 treatment due to the presence of severe cardiomyopathy . In 3 patients her2 status was not assessable due to little available histological material in 2 cases and paraffin block too old in another one . All patients but 3 had been treated with previous therapies, which were endocrine therapy in 2 patients, sequential chemotherapy and endocrine therapy in 6, and chemotherapy plus trastuzumab in 1 case . Nine patients presented 2 or more metastatic sites; the remaining patients had just one organ involved . Seven out of 12 (58.3%) patients received anthracyclines, of whom 6 were treated with anthracycline plus paclitaxel combination and 7 received taxanes, alone (1 patient) or in combination with anthracyclines (6 patients). Four patients received vrb plus cape as first - line treatment of their metastatic disease because of their comorbidities, which precluded the use of other drugs . Three cycles have been conducted at level i (20 mg), 6 cycles at level ii, and 16 cycles at level iii . All 3 patients of the first cohort completed the planned cycle of 3 weeks; no delay or dose reduction was required . In level i we observed 4 adverse events per cycle: 2 constipation g2, 1 nausea g1, and 1 dyspnoea g1 . Six patients were treated at level ii for a total of 6 cycles, without any delay, dose reduction, or suspension . We observed a total of 15 adverse events per cycle, of which 11 were classified g1 (73.3%); abdominal pain was reported in 3 cases, nausea in 4, and gastric pain, stomatitis, and asthenia in 1 . Grade 2 adverse events were reported in 4 cases: nausea 2 and constipation 2 . Eight patients were treated with vrb 40 mg for a total of 16 cycles . One patient of the second cohort did not complete the planned treatment because of death due to liver metastases at the end of level ii dose . We observed a total of 46 adverse events, grade 1 in 38 cases (82.6%); the majority of them concerned the gastrointestinal area (33 events, 86.8%). Regarding haematological toxicity, we observed 2 events of leukopenia and 2 cases of anaemia, in all cases grade 1 . The mtd dose of metronomic vrb in combination with fixed doses of cape was established at 40 mg days 1, 3, and 5 of each week . In order to confirm the toxicity profile observed in the dose - finding part of the study, we further treated 22 patients with vrb 40 mg and cape 500 mg thrice a day, for a total of 187 cycles . We observed 90 grade 1 events (48.1%), 29 grade 2 (15.5%), 7 grade 3 (0.03%), and 4 grade 4 events (0.02%) per cycle . Among grade 3 events, grade 3 neutropenia was associated to grade 1 leukopenia, which required 1-week delay in chemotherapy administration; the event spontaneously recovered and the patients continued her therapy at the same dose . One case of hand - foot syndrome was described, which required the reduction of cape to 500 mg bid . Grade 3 neurological toxicity occurred in 1 patient and vrb was reduced to 20 mg / tot . Among grade 4 events, 2 neutropenia events of which 1 of febrile neutropenia, and 2 leukopenia events occurred . Febrile neutropenia was complicated by the presence of erysipelas and required hospitalization and antibiotic treatment with amoxicillin and clindamycin, together with g - csf administration for 5 days . In this case, tumour restaging was performed every 3 cycles (9 weeks). At the 3rd evaluation (27 weeks of treatment), patients who did not progress accounted for the clinical benefit . Thirty - one patients were evaluable for efficacy: 3 patients in the phase i part did not reach the timing of tumour evaluation due to rapid progression in 2 patients and development of febrile neutropenia which determined definitive suspension of the treatment in the reaming one . Clinical benefit defined as cr + pr + sd 24 weeks the present study was designed to establish the mtd of oral metronomic vrb in association with fixed metronomic doses of cape . To our knowledge, this is the first study which investigates the combination of a full oral, metronomic schedule of vrb and cape . Assuming that vrb and cape have different toxicity profiles and no enhanced toxicity should be expected from the combination, we initially designed a study to evaluate the clinical activity of the combination . Vrb was planned to be administered at the dose of 50 mg every other day, which was the recommended dose coming from the studies of briasoulis et al ., whereas cape dose was 500 mg, tid, which was the dose used by dellapasqua et al . . Despite the results of the above - mentioned study, we excluded this dose from the combination with cape 500 mg tid continuously, because of the occurrence of one event of g4 neutropenia and one event of g3 neurological toxicity, clearly related to vrb instead of cape, in 2 out of the first 3 patients . Considering that these toxicities were strongly related to the administration of vrb instead of cape, we reviewed our initial intention by designing the present intrapatient, dose - finding study, with no modifications of cape dose and assuming 50 mg thrice a week of vrb as the limit dose . In the study by briasoulis et al ., the dose of vrb 50 mg determined just 3 adverse events, all of them being g1 - 2 (anaemia 1 and nonhaematological 2). The patient who developed g4 neutropenia has received 6 cycles of epirubicin and paclitaxel as first - line treatment for the metastatic disease and her blood reserve could have been compromised by that treatment . The patient who developed 3 neurological pain events was in excellent general condition at the beginning of the protocol, without any preclinical neurological condition . During the 25 cycles delivered in the dose - finding part of the study, no grade 3 - 4 adverse events occurred in our patients . A total of 51 grade 1 events were described, most of them regarding the gastrointestinal area (45 events, 88.2%) and 14 grade 2, 8 of them were concerning the same area . Different studies [5, 1014] have evaluated the efficacy and the safety of oral vrb in combination with cape; most of them used vrb at doses ranging from 60 to 80 mg / mq, administered on days 1 and 8 every 21 days, as the classical regimen . In all those studies, cape was administered at a dose ranging from 800 to 1250 mg / mq bid, from day 1 to day 14, every 21 days . Five trials [5, 1012] studied the combination of vrb 60 mg / mq (days 18) and cape 2000 mg / mq / day, days 114, every 3 weeks . In the study by lorusso et al ., 38 advanced breast cancer patients received a total of 228 courses . The authors observed grade 2 - 3 neutropenia in 18.9% and grade 4 in 2.7%, thrombocytopenia grade 3 in 2.7%, and nausea / vomiting grade 3 in 2.7% of the patients, concluding that that regimen was safe and easy to administer in an outpatient setting . Tubiana - mathieu et al . Reported a 49% of grade 3 - 4 neutropenia treating 54 patients for a median number of 7 cycles (range 158); in addiction, 2 patients experienced febrile neutropenia (3.8%) and 3 additional patients had documented infection associated with grade 3 - 4 neutropenia, one of them producing a fatal septicaemia . A similar but larger phase ii study was conducted by finek et al . Reporting a 0.8% incidence of grade 4 neutropenia in approximately 115 patients . Nol et al . Treated 44 patients with metastatic breast cancer with the same dose of oral vrb 6080 mg / mq and escalating doses of cape from 1650 to 2500 mg / mq / day, days 14 every 3 - 4 weeks . Neutropenia was the main dose - limiting toxicity of the combination; it was reported in 40 patients (90.0%), with grade 3 in 14 patients (31.8%) and 6.2% of the cycles and grade 4 in 12 patients (27.3%) and 4.3% of the cycles . The authors also reported a frequent gastrointestinal toxicity, even if the incidence of grade 3 was low, with no episode of grade 4 . Nevertheless, cycle delay occurred in 61.4% of the patients and 26.12% of the cycles . Day 1 oral vrb administration was cancelled in 38.6% of the patients and 7.7% of the cycles and dose reduction occurred in 22 patients (50%) and 7.4% of the cycles . In the study by jones et al ., forty patients received a median number of 4 cycles (range 131); main toxicity was haematological, with 7.9% of grade 3 and 3.5% of grade 4 neutropenia per cycles . Febrile neutropenia occurred in 0.4% of the cycles . Comparing to the standard administration of the combination of vrb and cape, we observed a significantly lower incidence of grade 3 - 4 events; this could be explained by the metronomic schedule of administration, which, by definition, consists of low, repeated doses of the same drug without rest period . This kind of administration warrants the delivery of similar, if not superior, dose intensity than the 18 schedule of vrb: if we consider the definition of a cycle as a 3-week period and a median body surface area (bsa) of 1.6 for women, the standard schedule provides the administration of approximately 192 mg / tot / cycle, in comparison to 360 mg / tot / cycle of the metronomic regimen . The delivered dose of cape in the standard schedule would be 44800 mg / tot, in comparison to 31500 mg / tot of the metronomic schedule . One could argue that the dose of cape delivered in the metronomic schedule is below the standard accepted dose, but some data would suggest that lower doses of cape could have a more favourable therapeutic index in metastatic breast cancer because of a less incidence of suspension or delay . The study by saridaki et al . Described the results of a phase i trial of the all - oral combination of metronomic vrb (starting dose 30) and cape (starting dose 800 mg / mq, bid on days 114 every 21 days). The dose - limiting - toxicity (dlt) level was reached at oral metronomic vrb 70 mg and cape 1250 mg / mq . Dlts were febrile neutropenia grades 3 and 4, diarrhoea grade 4, and treatment delays due to unresolved neutropenia . The incidence of grade 3 gastrointestinal adverse events was 16.5% (nausea / vomiting 11% and diarrhoea 5.5%), whereas grade 4 diarrhoea was observed in 2.7% of the patients . The administration of cape with a metronomic schedule could reduce the incidence of gastrointestinal disorders, increasing the compliance of the patients and assuring the best dose intensity of the drug . In our study, as well in the one by dellapasqua et al ., the incidence of diarrhoea and nausea / vomiting was very low (4 and 16 events, resp .) With any reporting of grade 3 - 4 events . The major limit of the dose - finding part of the study was the low number of administered cycles . In order to assess the toxicity of prolonged treatment, 22 additional patients were treated with the recommended dose of 40 mg of vrb and cape 500 mg tid . The low incidence of haematological toxicity observed in the dose - finding part of the study was confirmed . In conclusion, the mtd of oral metronomic vrb was 40 mg / tot on days 135 of a week and it is the recommended dose for the ongoing phase ii trial . The all - oral combination of vrb 40 mg thrice a week and cape 500 mg tid continuously was feasible and well tolerated also during prolonged treatment.
Laugier - hunziker syndrome (lhs) is a benign pigmentary condition characterized by hyperpigmented mucocutaneous macules progressively arising during adulthood . The asymptomatic melanotic macules most commonly involve the lips, oral mucosa, and acral surfaces, with occasional nail involvement . While lhs is a rare disorder of unknown etiology, it is important to differentiate it from conditions with similar pigmentary changes with somatic abnormalities that necessitate further investigation and treatment . In this case, we present the history, clinical findings, and histopathology of a patient exhibiting the pigmentary features consistent with lhs in order to highlight the critical differential diagnosis of asymptomatic mucosal and acral hyperpigmentation and to explore the potential pathogenesis of lhs . A man in his 50s presented with multiple pigmented macules of the lips, palate, and fingers . Over the course of one year, the patient noted the gradual onset and progression in the number of lesions and degree of pigmentation . The patient s history was significant for melanoma in situ which was treated five years prior to the onset of the pigmentation of his lips and fingers . The patient was a non - smoker and he had no other relevant medication history . Physical examination revealed multiple 2 to 5 mm brown to grayish macules on the lower lip (figure 1a) and two grayish macules on the hard palate (figure 2). On dermoscopy the macules on the lip revealed a fish scale - like dermoscopy pattern (figure 1b). There were several brown to grayish - brown macules on the lateral aspect of his right index, thumb, and middle fingers (figure 3), accompanied by similar appearing macules on his left thumb . Dermoscopy revealed pigmented macules with a brown to grayish homogeneous pattern (figure 4a, b). There were no pigmented lesions noted on the palms, soles, nails, perineum, or conjunctiva . There was hyperparakeratosis and acanthosis of the epithelium, with elongated rete ridges, as well as a few melanophages in the dermis . Given the morphology and distribution of the pigmented macules on the palate, lower lip, and fingers, and based on the fact that the patient had no exposure to heavy metals, no signs of addison s disease, or peutz - jeghers syndrome, leads one to conclude that the patient has lhs . Laugier and hunziker first reported an uncommon condition characterized by acquired melanotic hyperpigmented macules of the oral mucosa, lips, fingers, with occasional nail involvement, in otherwise asymptomatic patients . The lesions are most commonly located on the lips and oral cavity, including the buccal mucosa, soft palate, hard palate, and gingiva . Histopathologic features of the pigmented macules described by laugier and hunziker demonstrated intraepidermal melanosis without melanocytosis . The majority of subsequent reports of melanotic macules from lhs demonstrate normal numbers and normal morphologic appearance of melanocytes with increased basal pigmentation due to melanin deposition without hyperplasia of melanocytes . However, there have been some publications reporting increased numbers of intraepidermal melanocytes distributed in a lentiginous pattern . Due to the rarity of this condition, there are no long - term studies to determine risk for malignant degeneration . With that said, there is one reported case of mucosal melanoma of the upper lip in a patient affected by the long - standing melanocytic hyperplasia of lhs . Although the etiology of lhs is unknown, the pathogenesis is thought to be due to an alteration of melanocytes, resulting in an increased synthesis of melanosomes and their transport to the basal cell layers, resulting in the accumulation of melanin in the basal keratinocytes of the epidermis . To our knowledge, no prior studies have examined the significance of the distribution of the lesions in lhs . Localization of this condition primarily to mucosal and acral surfaces may provide a clue into the mechanism of action of this disease . Advancements in our understanding of mucosal and acral melanoma have revealed the type iii tyrosine kinase receptor c - kit (cd117) as a key player in the oncogenic alterations involved in some acral and mucosal melanomas . This is supported by evidence of successful use of c - kit inhibitors, such as imatinib, in achieving remission for patients with metastatic melanomas from acral and mucosal sites with c - kit aberrations . Gain - of - function mutations in the kit oncogene, encoding c - kit, are associated with chronic myeloid leukemia and gastrointestinal stromal tumor (gist) development . Interestingly, there are reported cases of germline mutation of c - kit demonstrated in a patient with numerous lentigines and gists . It is possible that the gain - of - function mutation of c - kit pathway may activate the downstream pathways and promote proliferation of melanocytes, leading to the melanocytic hyperplasia involved in formation of mucosal and acral macules of lhs . It has been shown that at the site of the ligand stem cell factor (scf) injection (used for promoting hematopoiesis), there is an increased number of melanocytes, melanocytic dendrite extension and melanin . With the xenografts of normal human skin, scf stimulation resulted in hyperplasia of melanocytes, causing the increased size and number of melanocytes and expression of melanocyte differentiation antigen, while inhibition of kit resulted in decreased antigen expression, and size and number of melanocytes . Several differential diagnoses must be considered in an adult patient presenting with multiple mucocutaneous pigmented macules . Due to the benign nature of the disease, it is critical to differentiate this disorder from conditions with similar mucocutaneous pigmentary changes with somatic abnormalities that require medical attention . The differential diagnosis considered for this adult patient with hyperpigmentation of fingers and lips included medication - induced, exposures to heavy metals, addison s disease, and rare genetic syndromes such as peutz - jeghers syndrome (pjs). Drug - induced pigmentation, most commonly associated with phenytoin, anti - malarial, and hiv medications, will usually occur after months or years of chronic use of drugs and resolves once the drug is discontinued . Anti - malarial drug administration may cause asymptomatic hyperpigmented macules on the oral mucosa and pretibial shin . Exogenous brown to black pigmentation may also result from exposure to tar, dirt, tobacco, and potassium permanganate . For example, cigarette smoking may result in oral mucosal pigmentation in the anterior gingiva . Addison s disease, an endocrine disease caused by insufficient cortisol and aldosterone production, is characterized by hyperpigmentation of the skin and mucosal membranes, with increased level of circulating adrenocorticotropic hormone (acth). In addison s disease, longitudinal pigmented bands may appear on the nails and diffuse pigmentation may appear on mucosal surfaces, especially the buccal mucosa, gums, and tongue . The well - circumscribed macules of lhs are distinctive from the more diffuse pigmentation of addison s disease . Negative systemic symptoms, such as fatigue and weight loss, and normal plasma levels of cortisol and acth rule out this possibility . Jeghers syndrome (pjs), an autosomal dominant genodermatosis due to mutations in the gene encoding serine / threonine kinase 11 (stk11), is notable for mucocutaneous lentigines and intestinal polyposis . Patients with pjs present with hyperpigmented macules of oral and acral skin arising in the first few years of life . A histologic examination of these lesions shows increased melanin in the stratum basalis, and melanin is concentrated at the tips of the rete ridges . Overlapping clinical features in both lhs and pjs may cause diagnostic confusion . In pjs, hyperpigmented macules of the oral mucosa and acral skin may be present at birth or appear in early life, in contrast to the lesions in lhs, which usually occur in adulthood . Unlike lhs, lesions of pjs typically do not involve the tongue, palate, or fingernails . Lastly, pjs is associated with hamartomatous polyps of the gastrointestinal tract, whereas lhs is not . Although rare, bandler syndrome presents as hyperpigmented macules on the hands, nails, and oral mucosa and is associated with intestinal vascular malformation developing in infancy . Lamb syndrome is characterized by pigmentation of the skin mucosa, atrial and mucocutaneous melanomas, and multiple blue nevi . Leopard syndrome is manifested by numerous lentigines, electrocardiographic abnormalities, occasional hypertelorism, pulmonic stenosis, abnormalities of genitalia, retardation of growth, and deafness . Given that our patient s pigmented macules of the lips and oral mucosa appeared late in life, in the absence of other somatic abnormalities and without a relevant family history of findings typical of pjs, our diagnosis was most consistent with lhs . In conclusion, lhs is an important consideration with a patient presenting with otherwise asymptomatic mucosal and acral hyperpigmentation . Despite the low prevalence of the lhs,
The discovery of the green fluorescent protein (gfp) and its ensuing applications as a genetically encoded fluorescent label have significantly advanced our understanding of the complex biochemical processes in living systems . Mutations of wtgfp and similar fluorescent and chromoproteins gave rise to a palette of biomarkers covering the entire visible range from blue to far - red . Red fluorescent proteins (rfps) are particularly important for in vivo imaging as they enable better penetration depth and signal separation from cellular autofluorescence . Fps enable studies of protein protein interactions, gene expression, protein localization, and intracellular protein targeting . The unique properties of fps have also been exploited for development of ph, metal, redox and hydrogen peroxide sensors, and phototoxic agents . However, fps as fluorescent markers suffer from irreversible (photobleaching) and reversible (blinking or flickering) loss of fluorescence that limits their applications . Despite being crucial for engineering of better fluorescent labels, the mechanistic understanding of these processes in fps is quite rudimentary, in stark contrast to similar phenomena in synthetic dyes . Several photobleaching and blinking pathways have been determined using a combination of theoretical and experimental approaches . Photoinduced rapture of the -conjugated system in irisfp resulting in a (dark) chromophore with sp - hybridized c was shown to be responsible for blinking . Similar chromophore structures with partially destroyed -conjugation have been suggested to explain the x - ray structure of a bleached state of killerred . Among other suggested blinking / flickering pathways are transitions to triplet states, reversible conformational changes, and changes of the chromophore h - bonding network and its protonation state . Although photobleaching of organic dyes is often initiated by electron attachment to (or detachment from) electronically excited chromophores, it is unclear whether such photoreduction and photo - oxidation processes play a role in fps . It was suggested that formation of radical species precedes photobleaching of irisfp upon x - ray irradiation . Photoinduced electron transfer in fps leads to the so - called oxidative redding, the photoconversion resulting in the green - to - red shift of the fluorescence . However, the mechanism of oxidative redding and even the chemical identity of the red form are still unknown . Apart from their relevance to photostability, formation of long - living radical species may have implications for the phototoxicity of fps . Indeed, an epr spectrum was reported for the killerred protein, the most phototoxic fp, although the structure of the long - lived radical is not known . Killerred is strongly phototoxic when irradiated with light of 540580 nm (2.302.14 ev) in the presence of oxygen; the phototoxicity was attributed to the formation of reactive oxygen species (ros). Figure 1 illustrates major pathways of ros formation including superoxide radical and singlet oxygen . The key point is that electronic excitation increases both reducing and oxidizing abilities of the chromophore, because chro and chro can accept an extra electron into the highest occupied molecular orbital (homo) or donate an electron from the lowest unoccupied molecular orbital (lumo), in contrast to the ground - state chromophore (chro) that accepts an electron into the lumo and donates one from the homo . The photo - oxidation / photoreduction leads to a formation of doublet radicals, chro and chro, respectively . The latter can then donate an electron to a nearby oxygen molecule forming o2. Superoxide can also be formed by direct oxidation of chro by oxygen . Contrary to superoxide formation, o2 production must proceed through the triplet state of the chromophore, thus requiring an intersystem crossing step . The chromophore in killerred is linked to the protein via glu68 (r1) and ile64 (r3), and r2 is a side chain of gln forming the chromophore . (b) photoinduced processes that can lead to the formation of reactive oxygen species (ros), o2 (singlet oxygen), and o2 (superoxide). Relevant chromophore states are the ground and excited singlet states (chro and chro), a triplet state (chro), and electron - attached and electron - detached doublet states (chro and chro). (c) electronic configurations of the ground - state singlet, lowest excited singlet and triplet states, and two doublet radicals derived by electron attachment and detachment from chro . Solid arrows denote pathways supported by the previous and present studies, whereas dotted lines represent merely speculative (at this moment) pathways of ros formation . The lack of singlet oxygen emission suggests that killerred is a radical - based type i photosensitizer, although superoxide s relatively low toxicity is difficult to reconcile with the very strong phototoxicity of killerred . Photoreduction / photo - oxidation of the chromophore does not necessarily involve external redox agents; that is, nearby amino acids may also serve as electron donors / acceptors . For example, photoinduced electron transfer from neighboring glu to the chromophore is believed to be an initial step in the photoinduced decarboxylation of gfp and dsred . In sum, the bulk of knowledge of synthetic dyes properties, along with emerging data on fps, suggests that understanding the dynamics of photoinduced electron transfer events in rfps as well as lifetimes and chemical identity of the species involved in these processes is of central importance for understanding the photobleaching and phototoxicity of fps . Aiming to elucidate photoinduced transformations of fps, we performed a time - resolved spectroscopic study of rfp dynamics in the micro- to millisecond range bridging the gap between two commonly studied regimes, femto- to microseconds and seconds to minutes . This time scale is typical for processes involving triplet states and radical species in related systems . Here, we report the first broadband transient absorption (ta) in the microsecond to second time domain of three rfps, dsred, mrfp, and killerred . All three share an identical anionic chromophore (figure 1a) and have similar steady - state absorption / emission properties; however, variations in the local environment and the barrel s structure lead to different photostability, brightness, and phototoxicity . Dsred is a tetrameric rfp from which many other fps, including mrfp, have been derived . Despite the common chromophore structure, these proteins differ dramatically in their phototoxicity in the order dsred <mrfp <killerred . Interestingly, dsred shows better photostability than, for example, monomeric rfps from the mfruit series, which is attributed to the structural weakness of their -barrels facilitating the diffusion of small species in and out of the protein interior . To understand their photocycle section ii describes experimental and computational details (additional information is provided in the supporting information (si)). Time - resolved emission and absorption spectra were acquired using the instruments described below . Fluorescence lifetimes were measured using an edinburgh instruments time - correlated single photon counting (tcspc) system . In these measurements, picosecond diode laser (picoquant) and subnanosecond led excitation pulses (edinburgh instruments) emitting at 467 and 590 nm, respectively, were used as excitation light sources . The detection system consisted of a high - speed microchannel plate photomultiplier tube (mcp - pmt, hamamatsu r3809u-50) and tcspc electronics . The time resolution of the system was 30 ps after deconvolution with an irf signal . Subpicosecond excited - state absorption spectra of rfps were measured using a commercially available pump probe spectroscopic system (helios, ultrafast systems) pumped by the femtosecond laser system consisting of a ti: sapphire regenerative amplifier (solstice, spectra - physics, 800 nm, 1 khz) and an optical parametric amplifier (opa, topas - c, spectra - physics, 2902800 nm, 100 fs fwhm). Transient absorption spectroscopy measurements in the microsecond - to - second time domain were performed using a custom - built kinetic setup based on andor and basler vision microarray imaging cameras, allowing the broadband ta measurements with 1 s time resolution after a single pulse excitation . This setup, previously used to study multiheme o2-reducing electron - transfer enzymes, is located at the university of helsinki (helsinki, finland), where measurements were performed . Unit a from the 3gb3 (pdb: id) x - ray structure was used as a model of the killerred protein . The only amino acids found in the nonstandard protonation states are glu68 and glu218; they were protonated in our model . The protonation states of the amino acids were consistent with the hydrogen - bonding pattern in the x - ray structure (see the si for detailed discussion). The protein was placed in the 100 100 100 water box . Eight cl and 15 na counterions were added to neutralize the protein s surface charges . Molecular dynamics (md) simulations were performed to sample the ground - state structure of the protein . The system was first equilibrated during consecutive nvt (t = 300 k) and npt (p = 1 atm, t = 300 k) 100 ps simulations . The equilibrium parameters (bond lengths and angles) were taken from the optimized b97x - d/6 - 31+g(d, p) (see ref (44)) killerred chromophore structure . Nbo partial charges computed with b97x - d/6 - 31+g(d, p) were used . Force constants were taken from ref (46) and from the charmm27 parameters for the chemically similar moieties . The list of all force field parameters for the killerred chromophore is given in the si . All excitation / attachment / detachment energies were computed using the geometries taken from the md snapshots for killerred with the chromophore in the closed - shell anionic form . The qm part included the chromophore, as shown in figure s10 in the si . The rest of the system was represented by the mm force field point charges . In our previous studies of gfp and mstrawberry, we found that the effects of extending the qm part by including nearby residues are insignificant . In the present study, we revisited this question and investigated the effect of including arg94 in the qm part . As discussed in the si, the shifts in excitation energies caused by including the arg94 side chain into the qm part were negligible (si table s1). The resulting nonzero total charge on a truncated residue was redistributed equally between the rest of the residue sos - cis(d) and tddft(b5050lyp) were used in the qm calculations for the anion and dianion excitation energies, respectively . Sos - cis(d) was demonstrated to provide accurate results for the excitation energies of the gfp chromophore and its analogues . However, the benchmark calculations for the dianion radical showed that sos - cis(d) based on the uhf reference suffers from spin contamination (s 1.5), whereas rohf calculations exhibit problematic convergence behavior . We found that for this open - shell dianionic system, the tddft description is more reliable (s 0.80.9); thus, this method was used for excitation energy calculation . Electron attachment and detachment energies were computed with b97x - d (see ref (44)) within the same qm / mm scheme . B97x - d was previously shown to provide reliable estimates of ionization energies of organic molecules, for example, dna bases . We note that the computed excitation energies are almost identical for tddft(b97x - d), tddft(b5050lyp), and sos - cis(d) with a rohf - like reference (table 1). The quantitative agreement between the three different approaches validates the applicability of the chosen tddft scheme for calculation of excitation energies of the open - shell dianion . The 6 - 31g(d, p) basis was used for more expensive excitation energies calculations (50 calculations for the md trajectory). The cc - pvdz basis was employed for attachment / detachment energy calculations . In addition, extrapolation to aug - cc - pvtz was performed using the following protocol . In calculations of fluctuation of the excitation and electron attachment / detachment energies along the md trajectory, the calculations were performed for the md trajectory snapshots extracted each 20 ps using the 6 - 31g(d, p) and cc - pvdz bases for excitation and attachment / detachment energies, respectively . Each 200 ps the same calculations were performed with the aug - cc - pvtz basis set . These data were used for extrapolation to the aug - cc - pvtz basis set . Uhf reference converged to the solution close to the rohf one using maximum overlap method; s = 1.2 . All quantum - chemical calculations were performed using the q - chem package . Table 2 summarizes spectral features and lifetimes of the ta components in microsecond - to - second and subpicosecond decays . All data are taken in pbs buffer, ph 7.5 at 25 c . Owing to their structural similarity, all three rfps have similar steady - state spectra . Killerred and mrfp have identical absorption and emission maxima at 585 nm (2.12 ev) and 609 nm (2.04 ev). Dsred has absorption and emission maxima at 561 nm (2.21 ev) and 595 nm (2.08 ev), respectively, which were close to the previously reported values . A spectroscopic signature of blinking or bleaching behavior is delayed recovery of the ground - state absorption relative to the decay of the bright excited state . To test whether bleaching is significant at our conditions, we measured the transient absorption spectra with subpicosecond time resolution in the 03 ns time window, a common time scale for the fluorescent - state lifetime . The subpicosecond transient absorption (ta) spectra of the three rfps show that the recovery of the ground - state absorption occurs on a longer time scale than the decay of the bright excited state . All three rfps exhibit ta bands in the 8001400 nm (1.550.89 ev) range and a band at 430 nm (2.88 ev). Analysis of the transient decays measured at different wavelengths yields lifetimes of 1.5, 1.8, and 3.9 ns in killerred, mrfp, and dsred, respectively . All lifetimes were equal to or close to the fluorescence lifetime of the proteins measured using the time - correlated single photon counting technique (see the si). Therefore, we attribute these transients to the simple decay of the excited singlet - state population . The s1 lifetimes decrease in the order dsred> mrfp> killerred, revealing the increased quenching in this order . This effect can be attributed to the increased permeability of the -barrels by the external quenchers, variations of the local structure around the chromophore, and/or increase of the isc rate . Altogether, the properties of the s0 s1 and s1 s0 transitions of the three rfps are similar . However, we note that the recovery of the ground - state bleach is slower than the decay of the s1 state, indicating other possible deactivation pathways for chro . Therefore, we investigated these pathways using measurements at longer (s - to - s) time scales . The photophysics of rfps on this time scale was previously studied using fluorescence correlation spectroscopy and single - molecule spectroscopy techniques . Complex flickering dynamics was observed; it was interpreted in the framework of kinetic models involving several dark and bright states . Figure 2 shows ta spectra of the three rfps in the micro- to millisecond range . The main features of the spectra are ground - state bleach and one major red - shifted ta feature separated by isosbestic points . The best exponential fit (global) of the ta data gave three components for all rfps studied (see the si for the kinetic fit details). The kinetic fits with their residuals at selected wavelengths are shown in figure s3 in the si . The major component, 2, for all three rfps has a maximum centered close to 740 nm (table 2) and absorption that spans beyond 1040 nm, where we reach the limit of our detector . The minor features beyond 800 nm could be attributed to the vibronic structure of the same absorption band . Note that ground - state bleach recovery in killerred and mrfp is slower than the decay of 730 nm transient, which suggests that the recovery may proceed through additional intermediates or that there are additional pathways for reversible and irreversible bleaching . The detailed understanding of the mechanism of interconversion between the bright state of killerred protein and the red - shifted intermediate is the subject of future work and is beyond the scope of the current study . Here, we focus on the assignment of the chemical nature of the intermediate . Micro- to millisecond transient absorption of killerred (a), mrfp (b), and dsred (c) at various time points . For experimental details, see the si . Notably, all three proteins exhibit a major similar transient feature peaking at 731, 722, and 740 nm for killerred, mrfp, and dsred, respectively . To elucidate the structure of this red - shifted intermediate (rsi) (720740 nm), qm a relatively short lifetime of this intermediate (s) suggests that the spectral changes are likely due to changes in the electronic structure, conformation, or protonation state of the chromophore, rather than dramatic changes in the chemical nature (processes such as chromophore maturation and oxidative redding occur on the minutes to hours time scale). Figure 3 illustrates the energetics of the relevant electronic states of killerred protein: the ground state (chro), the first excited state (chro), the lowest and excited triplets (chro and chro), electronic states formed by electron detachment (chro and chro *) from and electron attachment (chro and chro) to the anionic chromophore . The left panel shows the values averaged along molecular dynamics trajectory sampling ground - state geometries of the protein . (a) excitation energy of chro (black), electron attachment energy (blue), excitation energy of chro (red), electron detachment energy (orange), and excitation energy of chro (violet). Excitation energies were computed using a qm / mm protocol with the mm part represented by point charges . The values are averaged over 50 snapshots taken from the md trajectory of the killerred protein . (b) fluctuation of the excitation and electron attachment / detachment energies along the md trajectory extrapolated to the aug - cc - pvtz values . The lowest excited state of the neutral radical (photooxidation product) lies 0.5 ev above the rsi absorption maximum and is a dark state (fl <0.01). The only bright transitions that are energetically close to the observed intermediate absorption (1.70 ev or 731 nm) are chro chro (1.3 ev or 954 nm) and chro chro (1.7 ev or 729 nm). Because the upper bound for triplet lifetime in killerred is 40 s, which is 1 order of magnitude shorter than the transient centered at 731 nm, we rule out the triplet state as a possible candidate for the rsi . Thus, the only viable candidate responsible for the transient intermediate with max = 731 nm is an electron - attached dianionic state of the chromophore (chro). Such a doubly charged state is unstable in the gas phase; however, it is stabilized by the interactions with the nearby charged amino acid residues and is 1.7 ev below the ground anionic state of the protein - bound chromophore . We attribute this stabilization to interaction with the positively charged arg94 residue forming an h - bond with the chromophore . Indeed, calculations with arg excluded from the mm system show no stabilization of the dianion electron attachment becomes energetically unfavorable (+ 1.0 ev). Although electron attachment to the anionic chromophore in killerred is 1.7 ev exothermic (computed value) even for the ground - state chromophore, there should be a reducing agent providing an electron with matching or greater oxidation potential . However, amino acids have much higher ionization energies, and it is unlikely that the environmental effects can make electron transfer from nearby amino acids to the ground - state chromophore energetically favorable (otherwise, chro would undergo spontaneous reduction). Thus, we posit that the intermediate can be formed only via an excited state of the chromophore . The preliminary ta data taken with nanosecond resolution demonstrate that the rsi is formed within the 0.5 ns pulsewidth of the excitation laser . This indeed supports the direct formation of this intermediate from the chro singlet excited states . Direct formation of the dianion from the lowest singlet excited state of the chromophore will be accompanied by a 4 ev energy gain . We note that the ionization energies of the amino acids are still higher; for example, ionization energy of 7.3 0.2 ev was reported for tryptophan on the basis of vacuum ultraviolet single - photon ionization mass spectrometry experiments . However, the local environment may significantly alter the ionization / attachment energies as well as the resulting oxidation / reduction potentials of the amino acids, similarly to the observed effect of the nearby residues on the chromophore s energetics . To interrogate the identity of the main transient, we investigated the effect of external oxidative / reducing agents on the observed ta for all three rfps . First, the ta was measured for samples in ambient, aerobic (oxygen - saturated), and fully anaerobic conditions . The lifetime of the main ta component decreased significantly in oxygen - saturated conditions for killerred and mrfp (table 3), whereas in dsred it remained mostly unchanged (si figure s5). The effects of several oxidant and reductants (cytochrome c, -mercaptoethanol, nad, potassium ferricyanide, flavin mononucleotide) were also tested on the kinetics of the rsi feature in killerred, mrfp, and dsred . In all three cases, these oxidants and reductants are likely too large or hydrophilic and, therefore, are unable to access the chromophore buried inside the protein barrels . Thus, we tested a smaller molecule, h2o2, that can act as either a relatively strong oxidant or a weak reductant . Remarkably, h2o2 had a profound effect on the lifetime of the transient in killerred, decreasing the lifetime to 95 s in the presence of 5 m h2o2 . The effect was much weaker in mrfp and dsred, for which the lifetimes decreased to 147 and 810 s, respectively . We attribute this phenomenon to the unique structural feature of killerred s -barrel interior, a long water - filled channel . It has been hypothesized that this channel facilitates the escape of ros from the protein, thereby contributing to killerred s phototoxicity . In the control experiments, we observe that the same levels of h2o2 have little to no effect on the ground - state absorption spectrum in all three proteins (si). Thus, the transient is efficiently quenched by h2o2, which is consistent with the proposed strongly reducing dianionic state . The dianionic radical chromophore (chro) can then donate an electron to o2 to generate superoxide, which is likely the main mechanism of phototoxicity in killerred . Kinetics of transient absorption signal at 731 nm (1.70 ev) for killerred (top), at 722 nm (1.72 ev) for mrfp (middle), and at 745 nm (1.66 ev) for dsred in the absence and presence h2o2 . For experimental details, see the si . Among the three cytotoxic proteins studied, the phototoxicity and radical production increase in the order dsred <mrfp <killerred . Thus, there is a direct correlation between phototoxicity and our quenching experiments in which the main ta component (rsi) is quenched with o2 and h2o2 . For example, the transient in the most phototoxic fluorescent protein, killerred, shows the greatest quenching with h2o2 and o2, whereas the lifetime of the transient in dsred remains mostly unaffected . This observation suggests using weak reducing / oxidative pairs to control the phototoxicity and photostability of fps, as successfully done for organic dyes in solution . It is quite interesting that an agent as small as o2 is unable to penetrate the -barrel of dsred; however, it is not that surprising because previous researchers had to use guanadinium hcl to add flexibility to a gfp mutant to detect singlet oxygen production . Recent studies of rfps from the mfruit family attribute their poor photostability to the structural weakness of their -barrel that facilitates oxygen diffusion . We report an observation of a novel strongly red - shifted (max 720740 nm) photoinduced intermediate that is common for killerred, mrfp, and dsred and decays on the microsecond time scale . On the basis of the electronic structure calculations we interpret the signal as absorption by the dianionic open - shell state of the chromophore formed by photoreduction . The rsi is effectively quenched by oxygen and hydrogen peroxide in killerred, which features a large water channel facilitating access to the chromophore, whereas its lifetimes in dsred and mrfp are not strongly affected . The results raise the question of whether photoreduction is common for all fps and if the corresponding electron - attached states are common gateway states for photobleaching and blinking . In such a case, understanding the protein environment effects on the formation and lifetime of the radical species is crucial for development of more photostable fps, of phototoxic agents for photodynamic therapy, and of more stable fps with respect to photoinduced decarboxylation . Further studies including time - resolved epr, ir, and raman spectroscopies are needed for a detailed characterization of the structure and, especially, of the formation mechanism of these species, which possibly play a crucial role in the photochemistry of photoactive proteins.
An infected thoracic aortic aneurysm (itaa) is a relatively rare disease, and its incidence has been reported to comprise about 1% of all aneurysms . Patients with itaa have a high incidence of aneurismal rupture due to the abrupt growth of the aneurysm . Therefore, itaa is associated with both high morbidity and mortality, and the mortality has been reported to range from 23 to 37% . Regrettably, there are no standard guidelines for the medical or surgical treatment of itaa because it is a rare and frequently lethal disease . The major concerns regarding surgical treatment of itaa are the control of infection, resection of the entire infected tissue, grafting via an aseptic route, and prevention of recurrent infection . Surgical intervention is principally indicated to prevent aneurysm rupture, and is only recommended when the maximum diameter of the aneurysm is over 55 mm or when rapid expansion of the aneurysm is observed . Ideally, surgery is performed only in patients with a controlled infection, and for such patients in - situ reconstruction is also ideal . However, emergency surgery is often required in patients with uncontrolled infection, due to the risk of aneurysmal rupture . In such cases, extra - anatomical bypass is useful for avoiding routing in the infected site and is better than using cardiopulmonary bypass, because cardiopulmonary bypass may reduce the immunologic competence following surgery . Infected aortic aneurysms have historically been classified into the following four types; mycotic aneurysms, microbial arteritis with aneurysm, infected preexisting aneurysms, and post - traumatic infected false aneurysms . Mycotic aneurysms develop when septic emboli of cardiac origin lodge in the lumen or the vasa vasorum of the aorta . Mycotic aneurysms can occur in both normal and abnormal arteries and develop in virtually any named artery . Diseases of the intima with atherosclerosis allow blood - borne bacteria to inoculate the aortic wall . When an infection is established, suppurations, localized perforation and false aneurysm formation occur . The predominant microorganisms involved in microbial arteritis are escherichia coli, and salmonella and staphylococcus species . The abdominal aorta is the predominant site, and the most prevalent organisms are staphylococcus species.post-traumatic infected false aneurysms are the most prevalent type of infected aneurysms that develop in the peripheral arteries . This type of infection may also occur in the thoracic aorta accompanied by endovascular stent grafting . The clinical symptoms of itaa are fever, and chest / abdominal pain or discomfort . Infected aneurysms occur in all age groups, but the typical patient is older and has asthelosclerosis . Blood examination usually reveals leukocytosis and positive levels of blood c reactive protein, but these examinations are nonspecific . Several series of blood cultures are mandatory to confirm the causal bacterial species, however, negative blood cultures are common because that the majority of patients receive antibiotics before confirming the diagnosis of itaa . The most frequent source of infection has not been identified; however, gram - positive organisms such as staphylococcus aureus are predominant, in addition to salmonella species . Gram - negative organisms such as e. coli or bacteroides species are also frequently observed . The diagnosis of itaa is generally made comprehensively based on symptoms, laboratory data and ct findings . Itaa is generally suspected from results of ct findings in patients with symptoms of unknown fever and/or focal chest pain or discomfort . A short - interval ct re - examination is also essential to confirm the correct diagnosis (fig.1 - 3). As with non - infectious aneurysmogenic processes, the ct scan commonly demonstrates rapid enlargement of the aneurysmal lumen and a soft tissue mass surrounding the aorta . Ct findings of itaa often reveal aortic nodularity, an irregular configuration, rupture of calcification, or air in an aortic wall . One of the characteristics of itaa is the presence of several nodular or saccular aneurysms localized in different aortic portions, (fig.4,5). Indeed, infected aneurysms commonly develop as a result of bacteria invation into the aortic vessel wall (microbial arteritis with aneurysm). The presence of multiple aneurysms demonstrating either a saccular or nodular type, with a rapid expansion in size, are the most typical ct findings for itaa . The utility of intravenous digital subtraction angiography (dsa) in the aorta and femoral artery has been established . However, multi - detector computed tomography (mdct) is a more useful method for detecting the shapes and other aspects of aneurysms, (fig.4,5). Magnetic resonance imaging may also prove helpful when screening certain anatomic sites or when contrast media is contraindicated . Gallium scintigraphy has usually been used, but positron emission tomography (pet) can diagnose the precise site of inflammation . The following suv (standardized uptake value) is important for deciding positive findings . Suv = uptake (kbq / ml) / injected dose (kbq) / patient weight (g) infected aortic aneurysm occurred in thoracic aorta in 32% of cases, upper abdominal aorta in 26% of cases and lower abdominal aorta in 42% of cases, however, multiple aneurysms were detected in many cases . Distal arch aorta revealed an ulcer - like protrusion with low density mass under thickened and enhanced adventitia at first (fig.1). The ulcer - like protrusion expanded abruptly (fig.2), and the diameter of the aneurysm increased from 40 mm to 70 mm within 10 days (fig.3). The aneurysm developed as a result of invasion of bacteria into the aortic vessel wall (microbial arteritis with aneurysm). This aneurysm expanded from 30 mm to 40 mm in diameter within the same period (fig.5). Patients with itaa have a high incidence of aneurysm rupture due to rapid growth of the aneurysm . Antibiotic therapy, using agents which are sensitive and effective against the specific causal bacterial species, is mandatory for treating the infection . Ampicillin or cepharosporin, which combat salmonella species, should be the first choice antibiotics . Bactericidal antibiotics must be given both before and after surgery, with continuous administration ranging from 4 to 8 weeks . Elective surgery is ideal for patients demonstrating a controlled infectious state . However, emergency surgery is often unavoidable due to the risk of aneurysmal rupture . It is still difficult to determine the optimal timing of surgical intervention and the best surgical procedure . Short - interval ct re - examinations are helpful for determining the best timing for surgical intervention . A maximum aneurysm diameter of more than 55 mm is the principle indication for surgical intervention . In addition, a case with an abrupt aneurismal expansion of over 10 mm / week should be indicated for urgent surgery as an impending aneurysmal rupture . The major concerns about surgical treatment for itaa are ensuring the resection of the entire infected tissue, reconstruction of the vessels via an aseptic route, and prevention of re - infection . The exclusion or debridement of the infected aneurysm and surrounding tissues is essential, especially during the active infection phase . However, when such patients are complicated with pyothorax, an in - situ reconstruction should be avoided to prevent re - infection, while an extra - anatomical bypass is feasible, an in - situ reconstruction can be performed and is ideal, when the entire infected tissue can be successfully excised from the patient, and the infectious state is under sufficient antibiotic therapy control . The use of a woven dacron graft soaked with antibiotics has been reported to prevent graft infection even during in - situ replacement . Experimental studies demonstrated prolonged antistaphylococcal activity of rifampin - bonded, gelatin - impregnated dacron grafts after implantation in the arterial circulation . A silver - coated polyester prosthesis is also available for management of aortic infections, and favorable outcomes have been reported . A cryopreserved homograft is known to better resist bacterial colonization and to present better mechanical properties than prosthestic grafts . However, in - situ aortic reconstruction with a cryopreserved homograft in an infected field still carries a high mortality rate . In order to reduce the risk of infection after resection of an itaa, the defect is often filled with the omentum, or grafts are wrapped with the omentum (omentpexy). Kam and colleagues reported that endovascular aortic repair (tevar) could be successfully carried out in an hiv positive immunocompromised host with itaa . However, tevar for itaa is considered to be associated with a high risk of recurrence of infection, especially when aneurysms form a fistula with the gastroinstestinal tract or respiratory tract . Stellemes and collegues performed tevar as emergency therapy despite suspected aortic infection in 6 cases and reported 1 hospital mortality . They concluded that tevar as emergency therapy is feasible, but life - long clinical and morphological surveillance remains mandatory as recurring infection cannot be entirely excluded . Endovascular stenting may be indicated for high co - morbidity patients under a controlled infection state . The bridge use of tevar can be considered to prevent an aneurismal rupture, but open surgery should be scheduled under cautious follow - up . The surgical strategies for itaa should be determined on a case - by - case basis and include a careful ct follow - up . Specimens obtained from the itaa usually reveal the presence of lymphocytes and neutrophils, while plasma cells invade the aortic tissue with signs of an infected aneurysm . Although itaa is a relatively rare disease, it has a high morbidity and mortality rate . The type, duration and dose of antibiotics should be determined according to the guidelines for infected endocarditis . The mortality of itaa is much higher than for non - infected aneurysms because the prognosis of itaa is greatly influenced by the management of infection . Therefore, antibiotic therapy is the most essential part of the treatment for itaa . A clinical study of axillobifemoral bypass for infected infra - renal abdominal aortic aneurysm has been reported . It showed that early and overall mortality were 24% and 42%, respectively . A higher rate of late complications was reported, including aortic stump rupture or graft infection . Several series have reported satisfactory outcomes with in - situ reconstruction, but results varied according to the graft materials . Reconstruction with in - situ cryopreserved allograft showed superior disease - related survival - free reoperation than that treated with prostatic graft . The u.s . Cryopreserved aortic allograft registry reported a 30-day mortality rate of 13% and an overall mortality rate of 25% during a mean follow - up period of 5.3 months . It was associated with a high complication rate, including limb amputation, hemorrhage, graft occlusion and reinfection (3 to 14%). Reconstruction with an antibiotic - soaked dacron graft has also been reported with better clinical outcomes . Oderich and coworkers reported an operative mortality of 21% in 43 cases and muller and coworkers reported an overall hospital mortality of 36% in 33 cases with infected aortic aneurysm . Hsu and coworkers reported a hospital mortality of 10% in 10 patients who underwent in - situ aortic arch replacement for infected aortic arch aneurysm . They also reported that major complication including hypoxic encephalopathy occurred in 70% patients and late prosthetic graft infection occurred in 10% of patients . Extra - anatomic reconstruction was performed in 1 patient and in - situ reconstruction was performed in 7 other patients . There were no hospital mortalities but a patient who underwent extra - anatomic reconstruction died suddenly 2 years after surgery . Even when patients can survive the perioperative period, long - term reinfection can occur clinically . Indications for life - long antibiotic therapy are not well documented, however, cautious follow - up is essential for such patients . The survival rate has been reported to be 6776% at 2 years and 47% at 5 years due to late aortic events . Patients with itaa are associated with a high incidence of aneurismal rupture due to the abrupt growth of the aneurysms . The major concerns regarding surgical treatment for itaa are control of infection, resection of whole infected tissue, grafting via an aseptic route and prevention of recrudescent infection . It is essential to excise the whole infected aneurysm and to reconstruct in - situ grafting via an aseptic route . However, urgent surgery is often required in patients with an uncontrolled infection due to impending aneurismal rupture . In such cases, an extra - anatomical bypass without cardiopulmonary bypass is applicable, because cardiopulmonary bypass may reduce the immunologic competence and thereby enhance septicemia . Surgical strategies should therefore be determined on a case - by - case basis because patients may present various clinical courses.
The recent studies in china and india has shown that the number of diabetic individuals has surpassed the estimate of idf-2009 i.e., approximately 285 million people worldwide will have diabetes in 2010 and by 2030, 438 million people of adult population is expected to have diabetes with majority of effected population from china, india and usa . The comforts like natural dentition, conservative treatment compared to teeth supported fpds and long term success for the edentulous patients, as well as partially edentulous patients have made dental implants supported prosthetic treatment as an attractive substitute to traditional removable or fixed dental prosthesis besides being costly and lengthy procedures with surgical intervention . The growing economy of developing nations like china and india has also been playing a key role in popularizing the implant dental treatment . In light of above facts, the dental fraternity may encounter with more number of diabetic patients for dental implant treatments . Diabetes mellitus is a chronic disorder of carbohydrate metabolism characterized by hyperglycemia, reflecting distortion in physiological equilibrium in utilization of glucose by tissue, liberation of glucose by liver and production - liberation of pancreatic anterior pituitary and adrenocortical hormone . The debilitating characteristic of diabetes mellitus was known as early as in second century ad, when areteous named it as diabetes means a siphon as he perceived that the condition was characterized by melting down of flesh and limb into urine . Various modern research and discoveries have shown that diabetes mellitus, more or less, affects every tissues of body directly or indirectly through late complications [table 1]. Concerning the effect on oral tissues, loe . Recognized the periodontal disease as sixth major complication of diabetes . Number of studies has proved the adverse effect of chronic hyperglycemia on oral mucosa and with some controversies on alveolar bone . Late - onset complications of diabetes this review caters actual scenario to practicing dentists regarding success and failure of dental implant treatment in diabetic individuals observed by various studies . The experience based suggestions and experimental studies about increasing osteointegration and consequently improving success rate of dental implant treatment in diabetic patients have also been discussed . The persistent hyperglycemia in diabetic individuals, inhibit osteoblastic activity and alters the response of parathyroid hormone that regulates metabolism of ca and p, decreases collagen formation during callus formation, induces apoptosis in lining cells of bone and increases osteoclastic activity due to persistent inflammatory response . It also induces deleterious effect on bone matrix and diminishes growth and accumulation of extracellular matrix . The consequent result is diminished bone formation during healing, which is observed in number of experimental animal studies . Type -1 diabetes causes decreased bone mineral density, as well as reduced bone formation and higher bone resorption whereas type -2 diabetes produces normal or greater bone mineral density in some patients . It has been observed that insulin not only reduces the deleterious effect of hyperglycemia by controlling it but also stimulates osteoblastic activity . Hence, bone matrix formation in insulin treated experimental models is similar to control ones . Most of the studies have been performed in streptozotocin / alloxan induced diabetic experimental models (rat / rabbit) to observe osseointegration of implants . Histo - chemical / histomorphic / planimetric / biomechanical torque / manometric analysis showed that bone volume formed in diabetic animals was similar to non - diabetic animals however, bone implant contact (bic) in diabetic animals was lesser compared to non - diabetics . The rate of mineral apposition in newly formed bone and bone density around implant was significantly less in uncontrolled diabetic animals . The bone volume and bone density around implant in insulin controlled diabetic animals was observed similar or greater to non - diabetic but bic was found significantly less(even in insulin controlled diabetic animals). Only few case studies for histological observation of dental implant osseointegration in human being have been reported . In one report, an implant was placed and intended to support an overdenture in 65-year - old diabetic women was retrieved after 2 months due to prosthetically unfavorable condition . In histological analysis, no symptoms of implant failure recognized with 80% bone implant contact ratio . A case of diabetes mellitus type-2 having implant failure within 6 months, was reported by park jb with conclusion that osseointegration was not affected by diabetes mellitus as there was no sign and symptoms of failure before loading . Most of the studies observed slightly high percentage of early failure of implants in diabetics compared to late failure . The published retrospective and prospective studies data, retrieved through various sources from 1994 to 2011 [table 2], indicated that the success rate of dental implants in diabetic patients were in range of 85.5 - 100% and were comparable to the non - diabetic patients . Most of the studies were of opinion that success rate in well / fairly controlled diabetics was either equal or insignificantly lower than normal individuals . Two studies, has taken chance to involve uncontrolled diabetic patients for dental implantation and observed encouraging results as early implant success was similar to non - diabetics . However, it is noteworthy that number of patients and implants placed (4 implants in 3 patients) in uncontrolled diabetics was quite low and all the patients selected were free of micro and macro - vascular complications . Only two studies reported significantly high failure of implant in diabetic patients even when glucose level was adequately under control . One of these studies retrospectively included early, as well as late failures of implants over the period of 10 years but did not specify the glycemic control over that period . While other study, prospective in nature, observed significantly high early failures with probable reason that placement of multiple adjoining implants in diabetic patients increased the failure rates due to large wound, delayed healing and greater force posed over implants . Inadequate time (study period 90 days only) provided for osseointegration and regaining stability to implant in the study seems to be the cause of observing very high failure in diabetic patients . Outcome of studies showing survival / success of dental implant in diabetic patients most of the studies observed slightly high percentage of early failure of implants in diabetics compared to late failure . Some reports indicated increased failure rate within first year of loading suggesting the risk of implant failure is associated with uncovering of implants and early phase of implant loading . T w oates observation also supports high early failure in diabetic patients as such patients experienced low implant stability quotient (isq) in period of 2 - 12 weeks and lower the level of glycemic control, higher the amount of isq reduction and longer the duration of recovery in isq at base level was required . However, most of implants attained base level of stability within 4 months even in uncontrolled diabetic patients, if the patients were refrained with micro- and macro - vascular complications . Duration of diabetes significantly affected the success of dental implant, observed in one study while another did not demonstrate significantly higher late implant failures in diabetic patients even with longer duration . Overall lower success of implant in patients with diabetes of longer duration may be due to higher chance of micro - vascular complications which consequently lead to delayed healing around implants and hence higher early failure . Few studies, demonstrated significantly higher failure of implant in type-1 diabetic patients than patients with type-2 diabetes (in one study, only one implant placed in a person with diabetes type-1 and it failed i.e., failure rate = 100%, an extremely unlikely true estimate of risk). While one study did not find any significant difference in late failure of dental implant in type-1 and type-2 diabetic patients . Higher failure rate in diabetic type-1 may be due to depletion of insulin in tissues whereas presence of insulin in tissues of type-2 diabetic individuals may reduce deleterious effect of hyperglycemia . There is no study exclusively reported the survival / success of implant in type-1 diabetes however, very few retrospective studies had subject with type-1 and type-2 diabetes but little number of type-1 diabetic subjects . Immediate loading did not significantly affect the survival of dental implant in diabetic patients provided their plasma glucose level were under normal range . Balshi sf reported 100% survival of 18 implants after 2.5 years after placement followed by immediate loading with screwed retained fixed prosthesis in a 71-year - old diabetic patient . The study suggests that controlled mechanical stimuli over implant can be beneficial for osseointegration and implant survival . The studies observed lower survival of implant in diabetic patients of very old age group but difference was not statically significant . Although, none of the studies had compared success of implant in diabetic females and males but number of studies reported survival as good as in females compared to males in general population . The experience of surgeons and advance surgical process did not significantly affect success of dental implant in diabetics as observed in studies . Good glycemic control, preoperative and post - operative, is required to achieve improved osseointegration in diabetics . Prophylactic antibiotics [table 3] have shown to be effective for success of dental implants in diabetic patients and use of 0 . Certain factors like implant surface characteristics (implant coated with bioactive material) and higher implant length and width has been shown to improve success rate of implant in diabetic patients . Some researcher has found positive results in experimental studies to improve osseointegration and results are yet to be verified in human being . In few studies, it was observed that systemic administration of aminoguanidine reduced the deleterious effect of diabetes on osseointregration . Used rhfgf2 (recombinant human fibroblast growth factor-2) encapsulated with poly glycosylated poly lactide (pgla) membrane in calvarial defect of diabetic rat and formation of normal bone level was observed in histomorphic analysis . Wang et al ., in a study based on similar concept, used rrigf-1(recombinant rat insulin like growth factor) encapsulated with pgla around ti implant inserted in calvaria of diabetic rat . It was found in histomorphic analysis that diabetic rat with rrigf-1 had higher bic around the implant compare to rat without rrigf-1 after 4 - 8 weeks of surgical placement . That adiponectin, an insulin sensitive adipokine may improve osseointregration in diabetic patients by infusing it systemically or using locally as it has shown potent anti - inflammatory properties and increased bone density by enhancing osteoblast and inhibiting osteoclast formation . The persistent hyperglycemia in diabetic individuals, inhibit osteoblastic activity and alters the response of parathyroid hormone that regulates metabolism of ca and p, decreases collagen formation during callus formation, induces apoptosis in lining cells of bone and increases osteoclastic activity due to persistent inflammatory response . It also induces deleterious effect on bone matrix and diminishes growth and accumulation of extracellular matrix . The consequent result is diminished bone formation during healing, which is observed in number of experimental animal studies . Type -1 diabetes causes decreased bone mineral density, as well as reduced bone formation and higher bone resorption whereas type -2 diabetes produces normal or greater bone mineral density in some patients . It has been observed that insulin not only reduces the deleterious effect of hyperglycemia by controlling it but also stimulates osteoblastic activity . Hence, bone matrix formation in insulin treated experimental models is similar to control ones . Most of the studies have been performed in streptozotocin / alloxan induced diabetic experimental models (rat / rabbit) to observe osseointegration of implants . Histo - chemical / histomorphic / planimetric / biomechanical torque / manometric analysis showed that bone volume formed in diabetic animals was similar to non - diabetic animals however, bone implant contact (bic) in diabetic animals was lesser compared to non - diabetics . The rate of mineral apposition in newly formed bone and bone density around implant was significantly less in uncontrolled diabetic animals . The bone volume and bone density around implant in insulin controlled diabetic animals was observed similar or greater to non - diabetic but bic was found significantly less(even in insulin controlled diabetic animals). Only few case studies for histological observation of dental implant osseointegration in human being have been reported . In one report, an implant was placed and intended to support an overdenture in 65-year - old diabetic women was retrieved after 2 months due to prosthetically unfavorable condition . In histological analysis, no symptoms of implant failure recognized with 80% bone implant contact ratio . A case of diabetes mellitus type-2 having implant failure within 6 months, was reported by park jb with conclusion that osseointegration was not affected by diabetes mellitus as there was no sign and symptoms of failure before loading . Most of the studies observed slightly high percentage of early failure of implants in diabetics compared to late failure . The published retrospective and prospective studies data, retrieved through various sources from 1994 to 2011 [table 2], indicated that the success rate of dental implants in diabetic patients were in range of 85.5 - 100% and were comparable to the non - diabetic patients . Most of the studies were of opinion that success rate in well / fairly controlled diabetics was either equal or insignificantly lower than normal individuals . Two studies, has taken chance to involve uncontrolled diabetic patients for dental implantation and observed encouraging results as early implant success was similar to non - diabetics . However, it is noteworthy that number of patients and implants placed (4 implants in 3 patients) in uncontrolled diabetics was quite low and all the patients selected were free of micro and macro - vascular complications . Only two studies reported significantly high failure of implant in diabetic patients even when glucose level was adequately under control . One of these studies retrospectively included early, as well as late failures of implants over the period of 10 years but did not specify the glycemic control over that period . While other study, prospective in nature, observed significantly high early failures with probable reason that placement of multiple adjoining implants in diabetic patients increased the failure rates due to large wound, delayed healing and greater force posed over implants . Inadequate time (study period 90 days only) provided for osseointegration and regaining stability to implant in the study seems to be the cause of observing very high failure in diabetic patients . Outcome of studies showing survival / success of dental implant in diabetic patients most of the studies observed slightly high percentage of early failure of implants in diabetics compared to late failure . Some reports indicated increased failure rate within first year of loading suggesting the risk of implant failure is associated with uncovering of implants and early phase of implant loading . T w oates observation also supports high early failure in diabetic patients as such patients experienced low implant stability quotient (isq) in period of 2 - 12 weeks and lower the level of glycemic control, higher the amount of isq reduction and longer the duration of recovery in isq at base level was required . However, most of implants attained base level of stability within 4 months even in uncontrolled diabetic patients, if the patients were refrained with micro- and macro - vascular complications . Duration of diabetes significantly affected the success of dental implant, observed in one study while another did not demonstrate significantly higher late implant failures in diabetic patients even with longer duration . Overall lower success of implant in patients with diabetes of longer duration may be due to higher chance of micro - vascular complications which consequently lead to delayed healing around implants and hence higher early failure . Few studies, demonstrated significantly higher failure of implant in type-1 diabetic patients than patients with type-2 diabetes (in one study, only one implant placed in a person with diabetes type-1 and it failed i.e., failure rate = 100%, an extremely unlikely true estimate of risk). While one study did not find any significant difference in late failure of dental implant in type-1 and type-2 diabetic patients . Higher failure rate in diabetic type-1 may be due to depletion of insulin in tissues whereas presence of insulin in tissues of type-2 diabetic individuals may reduce deleterious effect of hyperglycemia . There is no study exclusively reported the survival / success of implant in type-1 diabetes however, very few retrospective studies had subject with type-1 and type-2 diabetes but little number of type-1 diabetic subjects . Immediate loading did not significantly affect the survival of dental implant in diabetic patients provided their plasma glucose level were under normal range . Balshi sf reported 100% survival of 18 implants after 2.5 years after placement followed by immediate loading with screwed retained fixed prosthesis in a 71-year - old diabetic patient . The study suggests that controlled mechanical stimuli over implant can be beneficial for osseointegration and implant survival . The studies observed lower survival of implant in diabetic patients of very old age group but difference was not statically significant . Although, none of the studies had compared success of implant in diabetic females and males but number of studies reported survival as good as in females compared to males in general population . The experience of surgeons and advance surgical process did not significantly affect success of dental implant in diabetics as observed in studies . Good glycemic control, preoperative and post - operative, is required to achieve improved osseointegration in diabetics . Prophylactic antibiotics [table 3] have shown to be effective for success of dental implants in diabetic patients and use of 0 . Certain factors like implant surface characteristics (implant coated with bioactive material) and higher implant length and width has been shown to improve success rate of implant in diabetic patients . Some researcher has found positive results in experimental studies to improve osseointegration and results are yet to be verified in human being . In few studies, it was observed that systemic administration of aminoguanidine reduced the deleterious effect of diabetes on osseointregration . Used rhfgf2 (recombinant human fibroblast growth factor-2) encapsulated with poly glycosylated poly lactide (pgla) membrane in calvarial defect of diabetic rat and formation of normal bone level was observed in histomorphic analysis . Wang et al ., in a study based on similar concept, used rrigf-1(recombinant rat insulin like growth factor) encapsulated with pgla around ti implant inserted in calvaria of diabetic rat . It was found in histomorphic analysis that diabetic rat with rrigf-1 had higher bic around the implant compare to rat without rrigf-1 after 4 - 8 weeks of surgical placement . That adiponectin, an insulin sensitive adipokine may improve osseointregration in diabetic patients by infusing it systemically or using locally as it has shown potent anti - inflammatory properties and increased bone density by enhancing osteoblast and inhibiting osteoclast formation . Prophylactic antibiotics and their doses most of the experimental studies have been indicated that the bone matrix formation and bone mineralization was almost equal in controlled diabetic and non - diabetic animals but bic was lower even in controlled diabetic subjects . Number of studies has proposed and explained mechanism of deleterious effect of diabetes over wound healing and true association (osseointegration) of bone to implant surface [figures 1 and 2]. However studies, performed in humans specifically with diabetes type-2, observed insignificant effect over bic and consequently good osseointegration of dental implant in controlled diabetic patients . As most of the experimental studies conducted in rats and rabbits, the architectural and compositional difference in bone, higher metabolic rate, very permissive bone healing, faster skeletal changes and bone turnover may be the reason for the difference in results of experimental animals and humans . The difference in developing diabetes (alloxan or streptozotocin destruct beta cells of langerhans consequently induces diabetes) in experimental animals and human being (type-2 diabetes develop due to glucose resistance at cellular level and higher level of glucose in tissue consequently suppress the function of beta cells of langerhans in long duration) maybe one reason for the difference in bic . The result of an experimental study in obese diabetic rat strengthens the above explanation, as no difference in bic was observed in obese diabetic rat than normal one . Mechanism of development of diabetic complication possible effects of diabetes over mechanism of osteointegration most of clinical studies reported success of dental implant in diabetic individual as good as normal peoples . The reason may appear to be the inclusion of controlled diabetics in the almost all studies . The persistent hyperglycemia is responsible for development of micro - vascular complication and consequently the early or late implant failure . Hence the uncontrolled level of diabetes, reflected through measurement of glycated hemoglobin hbac1 (indicate average glucose level over preceding 2 - 3 months period, level 6 to 8 shows well controlled, 8.1 to 10 moderately controlled and more than 10 shows poorly controlled diabetes), persistent for longer duration with sign of micro - vascular complication may affect the success of dental implant significantly . However, none of the study included such uncontrolled patients or in other word it can be concluded that none of the surgeon had taken risk to insert dental implant in such human beings . Even the fairly or moderately controlled diabetes persisting for very longer duration (more than 10 years) may produce complications and diminish the health of tissues . The compromised condition along with some unfavorable restorative factors may bargain the success of dental implants . Therefore, numerous factors associated with rehabilitation and diabetes itself, more or less, affect the survival of dental implant in diabetic subjects [table 4]. Cautious consideration of the mentioned factors during rehabilitation improves the success and hence the survival of dental implants in diabetic individuals . The survival of dental implant in well / fairly controlled diabetic patients appears as good as in general population . Use of prophylactic antibiotic, longer duration of post surgical antibiotic course, chlorhexidine mouth rinse, bioactive material coated implants and implant with higher width and length seems to further improve the survival of implant in diabetic individuals . Systemic administration of some insulin sensitive adipokine and use of local growth factors have been found to improve osseointegration in diabetic experimental animals but yet to be verified in human beings . However, it is advisable to delay the placement of implant in poorly controlled diabetics till the control of diabetes . Longer duration prospective clinical studies with greater number of diabetic individuals and non - diabetic controls are still required to develop better understanding of impact of diabetes over dental implant success.
Percutaneous liver biopsy is the most specific test currently available to assess the nature and severity of liver disease, and ultrasound guidance has allowed this technique to be performed routinely and safely in the outpatient setting . Because of its invasive nature, pain is considered the most common complication, with an incidence of 35% reported in the literature . Although the intensity of pain has not been specifically studied, a majority of patients have a short duration of symptoms that is considered minor by most hepatologists . The use of short - acting opioids like fentanyl for periprocedural analgesia after liver biopsy is common practice, and most patients do not require hospitalization . Serotonin syndrome is a rare but potentially life - threatening adverse drug reaction resulting from the therapeutic use or intentional overdosage of serotonergic medications alone or in combination . This condition is often described as a clinical triad of mental status changes, neuromuscular abnormalities and autonomic hyperactivity . The majority of cases occur within 6 h of a change or initiation of a serotonergic drug . Instead, the presence of tremor, akathisia or clonus in the proper clinical situation should lead clinicians to consider serotonin syndrome . The general principles of management include discontinuation of all serotonergic agents, supportive care with intravenous hydration and control of agitation with anxiolytics . The list of drugs and drug combinations associated with serotonin syndrome is extensive and includes antidepressants, antiemetics, antitussive agents, antibiotics, antimigraine medications, drugs of abuse, dietary supplements and analgesics . Use of opioids for post - procedure pain control may therefore have significant clinical consequences, especially with the abundance of polypharmacy in current practice . The risk for misdiagnosis of this syndrome is further potentiated by the limited knowledge of multiple interactions among prescribed medications . To our knowledge, this is the first reported case of serotonin syndrome experienced by a patient undergoing a liver biopsy . The diagnosis was made after a diligent history and physical examination and after exclusion of other diagnoses . Our patient was managed conservatively with administration of benzodiazepines and close monitoring, with a good outcome . A 59-year - old white female with chronic hepatitis c presented to our endoscopy suite for a percutaneous liver biopsy . The patient had been diagnosed with hepatitis c virus genotype 1a 5 years prior and had initially been treated with a 48-week course of pegylated interferon alfa-2a (pegasys; genentech usa, inc .) And ribavirin . The patient had failed a second course of antiviral therapy with pegylated interferon and ribavirin . After discussing the risks and benefits of protease inhibitor - based antiviral therapy, the decision was made to perform a surveillance percutaneous liver biopsy for restaging of her disease . The patient's home medications included valsartan 160 mg daily for hypertension, lansoprazole 30 mg every morning for dyspepsia, simvastatin 10 mg daily for hyperlipidemia, and lorazepam as needed for anxiety . She was also taking trazodone 100 mg at bedtime for insomnia and duloxetine 60 mg daily for depression . She reported stable control of her symptoms with these medications for several years without any adverse drug interactions . She had medication allergies to sulfa - containing compounds, acetaminophen and erythromycin . Before the procedure the patient was without any noted complaint . She was afebrile with normal vital signs (blood pressure of 120/78 mm hg and pulse of 71 beats per minute). A percutaneous liver biopsy was performed without immediate complication using sterile technique and ultrasound guidance . The patient's vital signs remained stable during the procedure, and she was sent to the recovery suite for continued observation . Approximately 10 min post - procedure, the patient developed intense right - sided abdominal and chest pain . On re - evaluation, chest radiography showed no evidence of pneumothorax or free air, and laboratory testing was unremarkable for acute anemia, renal insufficiency, acidemia or transaminitis . She was medicated with 50 g of intravenous fentanyl, which did not alleviate her pain . She was then administered an additional 50 g of fentanyl divided in two separate doses . Approximately 5 min after receiving the fentanyl the patient became agitated, diaphoretic and hypertensive . She was breathing spontaneously at 25 breaths per minute with a blood pressure of 198/106 mm hg, a pulse of 82 beats per minute and an oxygen saturation of 98% on room air . Serial physical examination revealed profound flushing, diaphoresis, a soft abdomen with increased bowel sounds and mild rigidity in all four extremities . 2 mg of intravenous lorazepam was administered with marked improvement in her vital signs and symptoms . She was admitted to the medical intensive care unit for close observation where she was made nil per os, and computed tomography imaging of her chest, abdomen and pelvis demonstrated no complications from the biopsy . The patient remained afebrile during her brief hospital stay, with gradual resolution of her agitated state and widespread pain within 24 h. her blood pressures demonstrated improvement, but did not return to baseline . She was resumed on valsartan and tolerated advancement of her diet . Although no specific etiology for her abdominal and chest pain was found, review of the patient's medications suggested a possible interaction between the recently administered fentanyl and her antidepressants duloxetine and trazodone . Considering the presentation, a diagnosis of serotonin syndrome was made, and fentanyl was added to her medication allergy list . Since her depression and insomnia had been stable on duloxetine and trazodone without any previous adverse interactions, she was discharged from the hospital with instructions to restart these antidepressants . The patient was seen in follow - up 1 week after her hospital discharge and her physical exam revealed normal vital signs and no neurologic findings . Serotonin syndrome is a rare but potentially life - threatening adverse drug reaction resulting from the therapeutic use or intentional overdosage of serotonergic medications alone or in combination . First described in the 1950s as an idiopathic drug reaction between iproniazid and pethidine, serotonin syndrome is a recognized clinical condition with established diagnostic criteria and predictable consequences . The current literature cites an incidence of 1416% in patients who overdose solely on selective serotonin reuptake inhibitors, although this number likely underestimates the true number of cases reported annually because symptoms are often unrecognized by clinicians or perceived secondary to other disease processes [7, 8]. Serotonin is a monoamine neurotransmitter located centrally (central nervous system) in the brainstem raphe nuclei where it is responsible for thermoregulation and wakefulness and peripherally (peripheral nervous system) within platelets and intestinal enterochromaffin cells where it modulates smooth muscle function . The pathophysiologic mechanisms for this condition center around postsynaptic hyperstimulation of 5-hydroxytryptamine 1a and 2a serotonin receptors in the central and peripheral nervous system, typically via the simultaneous administration of two or more drugs that enhance serotonin . The list of drugs and drug combinations associated with serotonin syndrome is extensive and includes antidepressants, antiemetics, antitussive agents, antibiotics, antimigraine medications, drugs of abuse, dietary supplements and analgesics . The diagnosis of serotonin syndrome is historically based on a triad of neuroexcitatory features, including altered mental status, neuromuscular abnormalities and autonomic hyperactivity . The condition encompasses a wide spectrum of clinical findings that directly correlate with intrasynaptic serotonin levels, but interestingly not serum serotonin concentrations . Moderate cases, such as the patient reported here, often display frank vital sign abnormalities like hypertension, tachypnea and agitation . Severe cases of serotonin syndrome manifest with critical hypertension and muscle rigidity, and these patients can deteriorate rapidly into disseminated intravascular coagulation, rhabdomyolysis and shock, and become comatose . Regardless of the severity, the majority of cases occur within 6 h of the change or initiation of a serotonergic drug, thus emphasizing the need for a high index of suspicion and immediate recognition . The general principles of management include discontinuation of all serotonergic agents, supportive care with intravenous hydration and control of agitation with anxiolytics . In some instances opioids are a mainstay of pain management, and in clinical practice they are often administered for sedation during outpatient surgeries or for immediate postoperative analgesia . Fentanyl is one of the most commonly used opioids in this ambulatory setting because of its short half - life and lack of histamine - releasing effect . In recent years, the synthetic phenylpiperidine series of opioids, including fentanyl and meperidine, has been associated with serotonin syndrome through weak serotonin reuptake inhibition and direct serotonergic agonism . The first reported case of serotonin syndrome involving a medication interaction with fentanyl occurred in a 65-year - old female chronically treated with citalopram for depression . Within 24 h of initiation of a topical fentanyl patch to manage symptoms of worsening back and abdominal pain, the patient developed confusion, agitation, myoclonic jerks and hyperreflexia . In recent years, several additional case scenarios have raised awareness for the number of potential iatrogenic adverse interactions of serotonergic drugs with commonly prescribed opioids like fentanyl . To date, there has been only one case of serotonin syndrome described as a complication of fentanyl use specifically in the endoscopic setting . A 39-year - old woman with alcoholic cirrhosis underwent esophagogastroduodenoscopy for evaluation of hematemesis and was found to have mallory - weiss syndrome and grade i nonbleeding esophageal varices . Pre - procedure, the patient was medicated with 50 g of fentanyl divided in two doses of 25 g each . After the esophagogastroduodenoscopy, she became somnolent and hyperthermic and developed rigidity in all four extremities, ultimately requiring intubation for airway protection . The diagnosis of serotonin syndrome was made because of a suspected interaction between fentanyl and sertraline . Serotonin syndrome is a potentially deadly result of polypharmacy that has been well described in the literature for years . Mild symptoms, overlapping features between syndromes such as neuroleptic malignant syndrome and malignant hyperthermia, and clinician lack of awareness are reasons for an often missed diagnosis . Our patient displayed moderate neuroexcitatory symptoms immediately after the administration of fentanyl for periprocedural pain, yet was admitted to the hospital for several hours before an accurate recognition of her condition was made . We propose that clinicians need to be aware of the increased risk of serotonin syndrome in the perioperative and outpatient endoscopic setting, especially with the wider use of selective serotonin reuptake inhibitors and the growing number of serotonergic medications available today in clinical practice . Specific patient characteristics such as anxiety level, chronic use of addictive medications and request for sedation have been identified as risk factors for analgesic use following liver biopsy . Special consideration of these factors may improve decision making and resource utilization in the care of patients with pain after liver biopsy . Furthermore, gastroenterologists and hepatologists need to be aware of the increased risk of serotonin syndrome in the perioperative setting where high - dose opioids are often administered . Stringent attention must be paid to a patient's list of home medications and documented allergies . If a patient is taking multiple serotonergic medications, it is wise to avoid or use with caution the phenylpiperidine opioids, including fentanyl, for post - procedure analgesia because of their weak serotonin reuptake inhibition.
Stroke has become the leading cause of death in the people s republic of china1 and the second most common cause of death worldwide.2 cardiac autonomic dysfunction is common after stroke, which is correlated with unfavorable outcome.3,4 as an electrophysiological method, heart rate variability (hrv) has been used to assess the autonomic function for decades . Studies have shown that hrv is related to the severity of stroke5 and has some mortality predictive values.6 however, it cannot accurately distinguish the sympathetic and vagal nerve activity . Phase - rectified signal averaging (prsa) is a newly developed technique for detecting cardiac autonomic function, which can quantitatively detect the function of vagal and sympathetic nerves by calculating the deceleration capacity (dc) and acceleration capacity (ac) of the heart, respectively . Its advantages have been shown in the field of cardiology.7 however, this method has not yet been used in the study of autonomic dysfunction after stroke . In this study, the changes in dc and ac of heart rate and other related parameters were studied in patients with acute cerebral infarction for the purpose of investigating their values in assessing the autonomic function of patients with stroke . A total of 63 patients (38 men and 25 women; mean age, 7112 years) with first - ever acute cerebral infarction and sinus rhythm were recruited within 72 hours after stroke . A magnetic resonance imaging (mri) or computed tomography (ct) scan confirmed the infarction located in the cerebral hemispheres, with 35 in the left hemisphere and 28 in the right . Patients with manifestations of other nervous system lesions and patients with any other diseases or medication known to affect the autonomic nervous system were excluded . Patients with tumor, infection, previous heart, or pulmonary disease were also excluded . A total of 50 controls (24 men and 26 women; mean age, 6811 years) were recruited from subjects with high risk of stroke but without history of stroke . Patients who had two or more of the following major risk factors, or one major risk factor, and two or more secondary risk factors were defined as patients with high risk of stroke . Major risk factors include 1) hypertension, 2) hyperlipidemia, 3) diabetes mellitus, 4) age> 50 years, and 5) metabolic syndrome; secondary risk factors include 1) atrial fibrillation or heart disease, 2) smoking, 3) family history of stroke or heart attack, 4) obesity, 5) regular alcohol consumption, 6) lack of physical exercise, 7) dietary excess oil, 8) sleep apnea, 9) male, 10) often gums bleeding, teeth loose, or loss, 11) ischemic ophthalmopathy, and 12) sudden deafness . This study was approved by the ethics committee of shanghai jiao tong university affiliated sixth people s hospital . Sex, age, and combined basic diseases and conditions were not statistically different between the two groups (table 1). If mri was contraindicated or unable to be obtained, repeat ct scans were used in order to identify the exact location of infarction . The national institutes of health stroke scale (nihss) was used to record the severity of neurologic deficit . The recordings were analyzed by a dms holter system (dms300 - 3; diagnostic monitoring software, stateline, nv, usa). The interferences were excluded, and the events of arrhythmia were tagged artificially when playing back the recordings . R intervals obtained from the holter recordings.8 this technique provides separate characterizations of deceleration- and acceleration - related modulations, quantified by dc and ac . It is believed that dc reflects vagal activity and ac reflects sympathetic activity of the heart . Meantime, standard deviation of all normal - to - normal intervals (sdnn) and square root of the mean of the sum of the squares of differences between adjacent normal - to - normal intervals (rmssd) were also calculated through the 24-hour holter recordings, which were widely used parameters of hrv and were considered to reflect overall variability and parasympathetic modulation of the heart, respectively . As the values of ac were negative, we used the absolute value of ac (|ac|) in the analyses . We also calculated the d - value between |ac| and dc (|ac|dc) and the ratio of |ac| and dc (|ac|/dc) to reflect the balance of sympathetic and parasympathetic modulation . Mean values (standard deviation [sd]) were calculated for continuous variables . Group differences were assessed by student s t - test or mann whitney u - test . Comparisons of categorical variables were made using chi - square test or fisher s exact test . Correlations between different autonomic parameters were calculated using pearson s correlation test, and correlations between autonomic parameters and nihss scores were calculated using spearman rank correlation test . A total of 63 patients (38 men and 25 women; mean age, 7112 years) with first - ever acute cerebral infarction and sinus rhythm were recruited within 72 hours after stroke . A magnetic resonance imaging (mri) or computed tomography (ct) scan confirmed the infarction located in the cerebral hemispheres, with 35 in the left hemisphere and 28 in the right . Patients with manifestations of other nervous system lesions and patients with any other diseases or medication known to affect the autonomic nervous system were excluded . Patients with tumor, infection, previous heart, or pulmonary disease were also excluded . A total of 50 controls (24 men and 26 women; mean age, 6811 years) were recruited from subjects with high risk of stroke but without history of stroke . Patients who had two or more of the following major risk factors, or one major risk factor, and two or more secondary risk factors were defined as patients with high risk of stroke . Major risk factors include 1) hypertension, 2) hyperlipidemia, 3) diabetes mellitus, 4) age> 50 years, and 5) metabolic syndrome; secondary risk factors include 1) atrial fibrillation or heart disease, 2) smoking, 3) family history of stroke or heart attack, 4) obesity, 5) regular alcohol consumption, 6) lack of physical exercise, 7) dietary excess oil, 8) sleep apnea, 9) male, 10) often gums bleeding, teeth loose, or loss, 11) ischemic ophthalmopathy, and 12) sudden deafness . This study was approved by the ethics committee of shanghai jiao tong university affiliated sixth people s hospital . Sex, age, and combined basic diseases and conditions were not statistically different between the two groups (table 1). If mri was contraindicated or unable to be obtained, repeat ct scans were used in order to identify the exact location of infarction . The national institutes of health stroke scale (nihss) was used to record the severity of neurologic deficit . The recordings were analyzed by a dms holter system (dms300 - 3; diagnostic monitoring software, stateline, nv, usa). The interferences were excluded, and the events of arrhythmia were tagged artificially when playing back the recordings . R intervals obtained from the holter recordings.8 this technique provides separate characterizations of deceleration- and acceleration - related modulations, quantified by dc and ac . It is believed that dc reflects vagal activity and ac reflects sympathetic activity of the heart . Meantime, standard deviation of all normal - to - normal intervals (sdnn) and square root of the mean of the sum of the squares of differences between adjacent normal - to - normal intervals (rmssd) were also calculated through the 24-hour holter recordings, which were widely used parameters of hrv and were considered to reflect overall variability and parasympathetic modulation of the heart, respectively . As the values of ac were negative, we used the absolute value of ac (|ac|) in the analyses . We also calculated the d - value between |ac| and dc (|ac|dc) and the ratio of |ac| and dc (|ac|/dc) to reflect the balance of sympathetic and parasympathetic modulation . Mean values (standard deviation [sd]) were calculated for continuous variables . Group differences were assessed by student s t - test or mann whitney u - test . Comparisons of categorical variables were made using chi - square test or fisher s exact test . Correlations between different autonomic parameters were calculated using pearson s correlation test, and correlations between autonomic parameters and nihss scores were calculated using spearman rank correlation test . R intervals, dc, ac, and sdnn of the infarction group were lower . But the difference of rmssd, the d - value between |ac| and dc (|ac|dc), and the ratio of |ac| and dc (|ac|/dc) were not statistically significant compared with controls (table 1). Some autonomic parameters of patients with the right hemispheric infarction were slightly lower than that of the left, but the differences were not statistically significant (table 2). In the infarction group, dc correlated significantly with |ac|, sdnn, and rmssd . In 63 patients with stroke, nihss scores ranged from 0 to 21 (6.525.68). No significant correlation was identified between nihss scores and rmssd, the d - value between |ac| and dc, and the ratio of |ac| and dc (table 3; figures 13). R intervals, dc, ac, and sdnn of the infarction group were lower . But the difference of rmssd, the d - value between |ac| and dc (|ac|dc), and the ratio of |ac| and dc (|ac|/dc) were not statistically significant compared with controls (table 1). Some autonomic parameters of patients with the right hemispheric infarction were slightly lower than that of the left, but the differences were not statistically significant (table 2). In the infarction group, dc correlated significantly with |ac|, sdnn, and rmssd . In 63 patients with stroke, nihss scores ranged from 0 to 21 (6.525.68). No significant correlation was identified between nihss scores and rmssd, the d - value between |ac| and dc, and the ratio of |ac| and dc (table 3; figures 13). Patients with stroke often complicate with cardiac autonomic dysfunction, which can lead to a variety of cardiac arrhythmias, t wave change, myocardial infarction, and even sudden death.9 cardiac involvement is an important cause of death after stroke.10 sympathetic hyperactivity and decrease in parasympathetic activity caused by stroke may be the reason of arrhythmia and sudden death . Studies found that cardiac autonomic dysfunction was related to the location and severity of stroke4,5 and may be related to the unfavorable outcome of stroke.6,11,12 hrv has been used to detect the cardiac autonomic modulation for decades . In addition, there is no hrv parameter directly reflecting sympathetic modulation.13 plasma catecholamine concentrations are usually used to measure the function of sympathetic nerve . However, plasma catecholamine concentrations are affected by many factors, such as the release, distribution, metabolism, and excretion of amines,14 and they are also affected by circadian rhythm.15 prsa is a new technique for detecting autonomic function . It can detect the ac and dc of the heart directly through analyzing the overall trend of 24-hour heart rate, and thus it can quantitatively detect the sympathetic activity and vagus activity, respectively, at the same time.7,8 this technique has been used mainly in the field of cardiovascular medicine, but not yet in the analysis of autonomic dysfunction after stroke . In our study, we found that dc and ac as well as sdnn were all lower than controls, reflecting both sympathetic and vagal modulation loss in patients with hemispheric infarction . Dc and ac were correlated with each other strongly, and the d - value and the ratio of absolute value of ac and dc had no significant difference compared with controls, reflecting that there was no major change in sympathovagal balance in patients with stroke . The loss of parasympathetic modulation is consistent with hrv studies.3,16 however, the decrease in ac reflects a decrease in sympathetic activity, which is inconsistent with studies concluding that the sympathetic activity of stroke increased through the detection of catecholamine concentrations.16,17 in the clinic, increased blood pressure, heart rate, and other characteristics of enhanced sympathetic activity are common in patients with cerebral infarction . In our study, we also found that r r intervals of patients with infarction were shorter than those in controls, which might be a reflection of sympathetic hyperactivity . Our findings demonstrate a phenomenon that both the vagal and sympathetic modulation decrease after stroke, but the combined effects of the two result in predominant sympathetic activity . This phenomenon could be explained by the fact that the effect of heart rate increasing by decreased vagal activity was larger than the effect of heart rate decreasing by decreased sympathetic activity . The study results were not conclusive of whether the lateralization and location of infarction were associated with autonomic derangement . Most studies found that if the infarctions are located in the right hemisphere especially with insula involvement, the cardiac autonomic dysfunction was more pronounced.4,18,19 in this study, autonomic parameters of patients with left and right cerebral infarction were compared . Although the autonomic parameters of patients with right hemispheric infarction were slightly lower than those of the left hemisphere, the differences were not statistically significant . Due to limited sample size, patients with the insula involvement were not analyzed separately . A further study of a larger number of cases is needed to search for the effect of lateralization and location of infarction on the autonomic nervous system . In this study, the nihss score was used to assess the severity of stroke . Correlation analysis showed that dc, absolute value of ac, and sdnn were negatively correlated with nihss scores, which indicates a higher risk of autonomic complications in patients with more severe stroke.5 although significant correlations between autonomic parameters and nihss scores were found, the r values were rather low . We assume that autonomic function is affected by many factors such as age, sex, and combined diseases, which do not influence the nihss scores directly . The infarction location and lateralization also have different effects on autonomic modulation and nihss scores . Declining autonomic modulation predicts poor outcomes in many diseases, such as myocardial infarction,20 chronic heart failure,21 and ischemic stroke.6 studies also showed that vagus nerve had protective effects.22,23 the decline of vagal modulation may decrease this protective effect . Dc, which is a direct reflection of vagal modulation, has shown its value in predicting mortality after myocardial infarction.7 our study has also shown a decline in dc in patients with hemispheric infarction . Further studies for the value of dc in prognosis prediction in patients with stroke are deserved . Both dc and ac decrease in patients with acute hemispheric infarction, reflecting the loss of both parasympathetic and sympathetic modulation after stroke . The clinical manifestations of hyperactivity of sympathetic nerve after stroke are possibly a reflection of the relative increase of sympathetic activity caused by more decline of vagal activity . Both dc and ac were correlated negatively with the severity of stroke . For the protective effect of vagal nerve, a decline of vagal modulation might have some predictive values for unfavorable outcomes after stroke . Further studies for the predictive value of dc and ac for the prognosis of stroke are deserved.
Urinary catheterization is a common procedure, particularly among patients with neurogenic bladder secondary to spinal cord injury (sci). The specific bladder dysfunction related to sci depends on both the level of cord injury and the duration of time passed since the original injury . Patients with hyperactive and flaccid bladder secondary to sci are often managed with long - term urethral or suprapubic catheterization . Urethral catheterization is associated with the well - recognized complications of catheter - associated urinary tract infections (utis) and limited genitourinary trauma . Unintentional ureteral cannulation represents a rare complication of urethral catheterization and has been previously described in only eight cases within the literature . We describe two cases of aberrant ureteral cannulation involving two patients with quadriplegia seen at our institution . These cases along with prior reports identify the spastic, insensate bladder and altered pelvic sensorium found in upper motor neuron syndromes as major risk factors for ureteral cannulation with a urinary catheter . A 48-year - old quadriplegic female with a chronic indwelling foley catheter secondary to neurogenic bladder from a c6 sci presented to the emergency department (ed) with a 1-day history of acute right flank pain and visualized blood clots within her catheter bag . Upon presentation to the ed, the patient was found to be hypertensive (206/129 mmhg). Initial laboratory results revealed leukocytosis (12.910/l), and urinalysis was significant for> 100 red blood cells (rbcs) and 4 - 10 white blood cells (wbcs). Electrolyte panel demonstrated normal renal function (creatinine level, 0.6 mg / dl; estimated glomerular filtration rate>60 ml / min / body surface area). A contrast computed tomography (ct) scan of her abdomen / pelvis revealed cannulation of the right distal ureter by the foley catheter with the tubing extending 1 cm into the distal right ureter; mild right hydronephrosis was also visualized with diffuse enhancement of the right urinary collecting system consistent with inflammation and infection (fig . 1). Careful review of the images showed the foley catheter balloon completely filling this patient's small spastic bladder . After replacement of the foley catheter, the patient's exaggerated autonomic response, pain, hematuria, and leukocytosis rapidly resolved . A 68-year - old gentleman with a history of c4 - 5 quadriplegia complicated by neurogenic bladder and recurrent utis as well as known left - sided urolithiasis presented to the ed with a 1-day history of hematuria and abdominal pain . On presentation, the patient was afebrile (36.7) and normotensive (120/83 mmhg); initial labs demonstrated leukocytosis (12.910/l), and urine microscopy detailed> 100 rbcs / high power field (hpf) as well as> 100 wbcs / hpf . A three - way urinary catheter was placed to facilitate continuous bladder irrigation, which yielded further expression of numerous blood clots . The following day, a ct urogram was performed that showed obstruction of the right distal ureter by the foley catheter resulting in mild to moderate pyeloureterectasis (fig . 2). The indwelling catheter was promptly readjusted and continuous bladder irrigation was stopped . Over the following 24 hours, a 48-year - old quadriplegic female with a chronic indwelling foley catheter secondary to neurogenic bladder from a c6 sci presented to the emergency department (ed) with a 1-day history of acute right flank pain and visualized blood clots within her catheter bag . Upon presentation to the ed, the patient was found to be hypertensive (206/129 mmhg). Initial laboratory results revealed leukocytosis (12.910/l), and urinalysis was significant for> 100 red blood cells (rbcs) and 4 - 10 white blood cells (wbcs). Electrolyte panel demonstrated normal renal function (creatinine level, 0.6 mg / dl; estimated glomerular filtration rate>60 ml / min / body surface area). A contrast computed tomography (ct) scan of her abdomen / pelvis revealed cannulation of the right distal ureter by the foley catheter with the tubing extending 1 cm into the distal right ureter; mild right hydronephrosis was also visualized with diffuse enhancement of the right urinary collecting system consistent with inflammation and infection (fig . 1). Careful review of the images showed the foley catheter balloon completely filling this patient's small spastic bladder . After replacement of the foley catheter, the patient's exaggerated autonomic response, pain, hematuria, and leukocytosis rapidly resolved . A 68-year - old gentleman with a history of c4 - 5 quadriplegia complicated by neurogenic bladder and recurrent utis as well as known left - sided urolithiasis presented to the ed with a 1-day history of hematuria and abdominal pain . On presentation, the patient was afebrile (36.7) and normotensive (120/83 mmhg); initial labs demonstrated leukocytosis (12.910/l), and urine microscopy detailed> 100 rbcs / high power field (hpf) as well as> 100 wbcs / hpf . A three - way urinary catheter was placed to facilitate continuous bladder irrigation, which yielded further expression of numerous blood clots . The following day, a ct urogram was performed that showed obstruction of the right distal ureter by the foley catheter resulting in mild to moderate pyeloureterectasis (fig . 2). The indwelling catheter was promptly readjusted and continuous bladder irrigation was stopped . Over the following 24 hours, manual irrigation of the catheter demonstrated marked improvement in the patient's hematuria . Urinary catheterization is a common practice whose most frequent complications include catheter - associated infections and genitourinary trauma . In patients in whom indwelling or intermittent catheterization represents a daily component of a health maintenance routine, the risk for catheter - associated complications increases . Within the hospital setting, others have reported that approximately 1.8% of total foley catheter days are associated with possible uti episodes, whereas 1.5% of foley catheter days are associated with genitourinary trauma . Urinary catheter - associated trauma is commonly inclusive for urethral damage resulting in hematuria, accidental removal of the catheter without sufficient balloon deflation, or false passage creation . The two cases of ureteral cannulation we identified from our institution prompted us to review the literature for similar cases . Our review identified eight previous cases involving ureteral cannulation in the setting of urinary catheterization . These cases occurred between the ages of 26 and 77 years, with the majority occurring after the fifth decade of life . Including our two presented cases, 80% of complications entailed female patients, and 5 patients (50%) had known neurologic conditions (paraplegia, quadriplegia, or multiple sclerosis with autonomic dysreflexia) traditionally associated with bladder dysfunction . Interestingly, four of the patients with underlying neurological conditions experienced cannulation of the right ureter while both iatrogenic placements during surgery occurred on the left . Additionally, all patients experiencing left - sided ureteral cannulation were female . Cord injuries above the conus medullaris contribute to an upper motor neuron syndrome and may lead to bladder hyperactivity resulting in bladder spasm, urgency, and incontinence . Over time, the reduction in bladder capacity as well as bladder and bladder sphincter hyperactivity may also lead to elevated bladder pressures, which results in increased vesicoureteral reflux . Spinal cord injuries involving the conus medullaris or caudae equina cause a lower motor neuron syndrome that can lead to bladder flaccidity and urinary retention . Others have proposed that the underlying mechanism of ureter cannulation may be attributed to insertion of the foley catheter during bladder contraction . The findings from this series and review of existing cases suggest that individuals with bladder dysfunction due to upper motor neuron disease are at the highest risk for this complication among patients undergoing urethral catheterization . We suggest that this population is particularly at risk because of their small spastic bladders and altered pain perception . Those patients identified as having experienced this complication through iatrogenic placement under surgical anesthesia and with a history of fibrotic bladder confirmation of urinary catheter placement typically constitutes the visualization of urine flow into the collection tubing as well as subjective resistance after inflation of the retaining balloon . However, these methods of confirmation remain error prone, particularly in the setting of frequent catheterization . In patients who experience the complication of ureteral cannulation shortly after catheter placement during a surgical procedure, aberrant ureteral placement during introduction is the most likely scenario . However, in many cases, particularly in patients with underlying neurologic conditions, it is unclear whether ureteral cannulation occurs during the initial introduction of the catheter device or after subsequent migration . Traditionally, patients are instructed that if they experience resistance to instillation, pain, or autonomic instability, catheter placement should be adjusted . However, patients with neurologic sequelae are often unable to rely upon these clues as a means of detecting a catheter - associated complication . Additionally, given the unclear role that catheter migration may play in the development of ureteral cannulation, patients should also be instructed to monitor for adequate urine flow not solely at the time of catheter placement, but on a continuing basis . Given the observed association between autonomic dysreflexia and ureteral cannulation, patients with upper motor neuron disease or altered pelvic sensorium and a history of indwelling or intermittent catheterization presenting with autonomic instability should prompt evaluation for irregular catheter placement . As observed within the presented cases, complications of ureteral cannulation are inclusive for hydronephrosis and pyeloureterectasis in addition to various mechanisms of ureteral injury or possible ureteral rupture . These complications may subsequently contribute to infectious processes such as uti, abscess formation, or even fistulous formation . Following suspected or confirmed ureteral cannulation, manual removal of the catheter following deflation of the catheter bulb should be attempted, if possible, and further management decisions including surgical intervention should be based upon clinical correlation with consideration given to the timing of the resulting complication or injury . Review of known cases identifies patients with bladder dysfunction due to upper motor neuron syndromes as the population at highest risk for developing this complication, particularly among female patients . The contributing features of underlying neurological disease suggest that the elements of bladder contraction and altered sensorium significantly add to the increased danger appreciated within this high - risk population . Those patients at high risk should be educated at regular intervals regarding the importance of safe, aseptic placement and monitoring techniques at both initiation of and continuing foley catheter use.
Adenocarcinoma is the most common type of malignant gastric neoplasm (95%) but gastrointestinal stromal tumors (gists) have relatively appeared rare (1%) [1 - 4]. Gists and adenocarcinoma are distinct malignancies originating from different cell layers and the simultaneous development of a gist and gastric adenocarcinoma is relatively rare [5 - 10]. Here we present a very rare combination of synchronous prepyloric gastric adenocarcinoma and a gist of fundic body region . Sixty four - year - old female has admitted to our hospital complaining of dyspeptic symptoms, during the last 2 months . Chest x - ray and abdominal ct - scan have not shown any signs of metastasis . Subsequently the patient has undergone an elective subtotal gastrectomy and billroth - ii gastrojejunal anastomosis during the operation .there was a second nodule has palpated in the fundic body region at the greater curvature which has separately resected . Pathology examination has shown a polypoid and infiltrative circumferential mass that has measured 642 cm in antropyloric region on macroscopic examination . In gross examination of specimen the histopathologic examination has revealed a signet ring type poorly differentiated adenocarcinoma of stomach, that has been infiltrating the wall and reaching the subserosa . The separate nodule of fundic body region of stomach was a well circumscribed tan elastic tumoral mass measuring 1 cm in diameter . In microscopic examination it was a spindle cells neoplasm located in muscularis propria extending up to serosa composed of intersecting fascicles of spindle cells with abundant eosinophilic fibrillar cytoplasm and minor degree of nuclear pleomorphism (figure 2). In immunohistochemical study focal positivity for desmin (figure 3) and diffuse strong positivity for cd117 (figure 4) have detected which has confirmed the diagnosis of gastrointestinal stromal tumor . The patient has received imatinibas adjuvant therapy for the gist, according to the international guidelines for gists risk stratification . Four month later on her follow up visit she has shown clinically and radiographically disease free . The collision of adenocarcinoma and gist in the stomach is extremely rare and to the best of our knowledge only few cases have been reported in the english literature [5 - 10]. In the cases the synchronous tumors have located in different parts of the stomach, in our case there was prepyloric gastric signet cell adenocarcinoma and a proximal gastric gist . Gists are typically sessile big soft tumors and could develop necrosis or ulceration of overlying mucosa . However when the gist is sub mucosal or subserosal the gastric mucosa might not be invaded and endoscopic assessment could be normal . In our case preoperative diagnosis was adenocarcinoma and during laparotomy we have incidentally found a small nodule in proximal part of stomach and the histopathological and immunohistochemical examination of the specimen have revealed the diagnosis of gist . This designates a heterogeneous group of mesenchymal malignancies that consist of spindle or epithelioid cells with varying degrees of differentiation . These tumors had an annual incidence of approximately 10 - 15 cases per 1 million people; however gists are the most common mesenchymal tumors of the gastrointestinal tract accounting for 0.1 to 3% of all gi tumors [12, 13]. These tumors are thought to originate either from the stem cells that differentiate towards interstitial cells of cajal or directly from interstitial cells of cajal [14, 15]. In general gists could distinguish from other spindle or epithelioid cell tumors by expressing cd117and cd 34 in 50 - 80% of cases [14, 15]. Ninety percent of gists have a mutation in the kit oncogene but 10% miss this mutation . Approximately 70 - 85% of patients have a complete resection but overall five - year survival is only 50% . Since 2002 a novel therapy, imatinib mesylate, has introduced to treat this kind of malignancies . This is a tyrosine kinase inhibitor and has demonstrated with great dramatic effects in majority of patients [16, 17]. They have considered whether such an association was incidental coexistence, or the two lesions have connected by a connecting relationship . Some articles suggest that gene mutations or a single carcinogenic agent might interact with two neighboring tissues inducing tumors development of different histotypes in the same organ . But no evidence of this last hypothesis has yet been found [10, 21,22]. Both tumors have different precursor cells and molecular make up and if there were a single carcinogen, these types of tumor would probably diagnose . More often simple coincidence have also known as the case especially in geographical regions with high incidence rate of gastric cancer such as japan . Although helicobacter pylori infection has been implicated in gastric cancer development, there is no evidence of such association in gist . N - methyl - n nitro - nnitrosogunidine has inducedgastric adenocarcinoma development of following oral administration in rats and when it has combined with agents such as aspirin or stress, leiomyosarcomashas developed in combination with epithelial tumors . Other articles have reported induction of gastric adenocarcinoma after injection of 9, 10-dimethyl-1, 2-benzanthrancene (dmba) where management with dmba and cellophane plate could cause mainly the induction of gastric sarcomas . In collision tumors the adenocarcinoma has been determined to have a greater unfavorable effect on prognosis than the gist, even if the gist has belonged to the high - risk group.
Ischemic heart disease and stroke are leading causes of disability and mortality worldwide . As a result of improved survival and the lifelong aspect of these diseases, health - related quality of life (hrqol), including physical and mental functioning, has become an increasingly important clinical and research outcome when evaluating burden of disease and treatment benefits . In addition, reduced physical and mental functioning not only interferes with daily living, but also increases the risk of incident ischemic vascular events and mortality [24]. Compared to the general population, hrqol is substantially lower in patients with ischemic heart disease and stroke, especially in the domain of physical functioning [57]. A recent study indicated that hrqol not only is lower in the acute phase of recovery from stroke, but also can decline up to five years after stroke in survivors free of recurrence or myocardial infarction . Also, marked impairments in hrqol have been observed in patients with other manifestations of atherosclerotic disease, including peripheral arterial disease [9, 10] and abdominal aortic aneurysm [11, 12]. Patients with symptomatic vascular disease frequently have atherosclerotic changes in the small vasculature in the brain, which are characterized by white matter lesions (wmls) on magnetic resonance imaging (mri). Although wmls are often asymptomatic, they have been identified as a risk factor for functional decline, late - life depression [15, 16], and cognitive impairment [1719]. It has been suggested that greater disease activity, characterized by an accelerated progression of wml volume, is an important underlying mechanism contributing to this elevated risk [20, 21], but longitudinal studies are still relatively scarce . Whether greater progression of wml volume is also associated with a poorer hrqol has not been studied yet, although it could be expected that more subtle impairments in physical and mental functioning could already be present in patients with greater wml disease activity, before the development of depression or functional decline . In addition, it is unknown whether the influence of wml progression on physical and mental functioning is comparable between patients with different locations of symptomatic atherosclerotic disease . Our first aim was to investigate the course of physical and mental functioning in patients with different manifestations of atherosclerotic disease over four years of follow - up . Second, we examined whether greater progression of wml volume contributed to poorer physical and mental functioning in these patients and whether these associations depended on the location of symptomatic atherosclerotic disease . Data were used from the second manifestations of arterial disease - magnetic resonance (smart - mr) study, a prospective cohort study aimed to investigate brain changes on mri in 1309 independently living patients with symptomatic atherosclerotic disease . Details of the design and participants have been described elsewhere . For the current study, data were used from 989 patients newly referred to the university medical center utrecht between january 2002 and december 2005 with manifest peripheral arterial disease, coronary artery disease, cerebrovascular disease, or abdominal aortic aneurysm without mr contraindications and available data on the hrqol questionnaire . During a 1-day visit to our medical center, an mri of the brain, physical examination, blood, and urine sampling were performed . Risk factors, medical history, and functioning were assessed with questionnaires . Between january 2006 and may 2009, all participants still alive were invited for follow - up measurements, including mri of the brain, neuropsychological testing, a physical examination, blood and urine sampling, risk factors, medical history, and functioning . The smart - mr study was approved by the ethics committee of our institution, and written informed consent was obtained from all participants . In total, 585 of the surviving cohort (62% of n = 943) gave written informed consent; 346 (37%) persons refused, and 12 (1%) were lost to followup . Mr investigations were performed on a 1.5-tesla whole - body system (gyroscan acs - nt, philips medical systems, best, the netherlands). The protocol consisted of a transversal t1-weighted gradient - echo sequence (repetition time (tr)/echo time (te): 235/2 ms; flip angle, 80), a transversal t2-weighted turbo spin - echo sequence (tr / te: 2200/11 ms and 2200/100 ms; turbo factor 12), a transversal t2-weighted fluid attenuating inverse recovery (flair) sequence (tr / te / inversion time (ti): 6000/100/2000 ms), and a transversal inversion recovery (ir) sequence (tr / te / ti: 2900/22/410 ms) (field of view 230 230 mm; matrix size, 180 256; slice thickness, 4.0 mm; no gap; 38 slices). We used the t1-weighted gradient echo, ir sequence, and flair sequence for brain segmentation . The segmentation program distinguishes cortical gray matter, white matter, sulcal and ventricular cerebrospinal fluid (csf), and lesions . The results of the segmentation analysis were visually checked for the presence of infarcts and adapted if necessary to make a distinction between wml and infarct volumes . Total brain volume was calculated by summing the volumes of gray and white matter and, if present, the volumes of wml and infarcts . Total intracranial volume (icv) was calculated by summing the total brain volume and the volumes of the sulcal and ventricular csf . The whole brain was visually searched for infarcts by a trained investigator and a neuroradiologist . Infarcts were defined as focal hyperintensities on t2-weighted images of at least 3 mm in diameter . Hyperintensities located in the white matter also had to be hypointense on t1-weighted and flair images in order to distinguish them from wml . Dilated perivascular spaces were distinguished from infarcts on the basis of their location, form, and the absence of gliosis . The location, affected flow territory, and type were scored for every infarct . Volumes of wml were normalized for icv and expressed as percentage of icv . At baseline and followup, patients completed the short form-12 (sf-12), a shortened version of the short form-36 (sf-36) medical outcomes study health survey, to measure hrqol at baseline and followup . The sf-12 questionnaire includes 1 or 2 items from each of the 8 health summary scales of the sf-36 and enables calculation of the physical (pcs) and mental component summary scales (mcs). The sf-12 summary scales are positively scored and normalized to a general population mean of 50 with standard deviation of 10 . Higher sf-12 scores indicate better hrqol; a positive change in sf-12 scores indicates an improvement, and a negative change a deterioration in hrqol . Because of its brevity, the sf-12 is considered advantageous over the sf-36 for large studies focusing on overall physical and mental functioning . In patients with peripheral arterial disease, stage 1 (pain - free walking distance> 200 m) and stage 2 (pain - free walking distance <200 m) were defined as mild or moderate ischaemia, whereas stage 3 (rest pain) and stage 4 (ulceration or gangrene) were defined as severe ischaemia . In patients with coronary artery disease, disease severity was rated according to the number of coronary arteries with marked atherosclerosis (> 70% stenosis or fractional flow reserve <0.80 or treatment of the vessel). One - vessel, two - vessel, three - vessel, left main disease with or without right coronary artery involvement was rated in all coronary artery disease patients on the basis of coronary angiography reports . Information was incomplete in some patients, and additional information was obtained from percutaneous coronary intervention or coronary artery bypass grafting reports . For patients with cerebrovascular disease, disease severity was classified with a handicap scale, the modified rankin scale (mrs). During the visit to the medical center systolic and diastolic blood pressures (mmhg) were measured twice with a sphygmomanometer and averaged . Hypertension was defined as mean systolic blood pressure 160 mmhg, mean diastolic blood pressure 95 mmhg, or self - reported antihypertensive drug use . Packyears of smoking was calculated, and alcohol use was categorized into never, past, and current . Of the 585 patients participating at followup, data on baseline or follow - up mri variables were missing in 74 patients (no mr (n = 41), irretrievable mr data (n = 5), missing flair images (n = 7), or artefacts (n = 21)). Of these of these 494 patients, data on vascular risk factors were missing in 8 patients . This resulted in a total study sample of 486 patients . Compared to patients who were lost to followup (n = 503), patients who participated at followup (n = 486) were significantly younger (mean 57.5 versus 59.6 years) at baseline, had less often hypertension (50% versus 57%) and diabetes mellitus (16% versus 25%), more often reported current alcohol intake (79% versus 72%), had lower wml volume (median 1.3 versus 1.7 ml), had better mental functioning (median 51.0 versus 48.3), and were less often included with peripheral arterial disease (19% versus 26%) or abdominal aortic aneurysm (5% versus 11%) (table 1). First, we calculated changes in physical and mental functioning after on average 4 years of followup in the total sample and then compared changes in physical and mental functioning between different locations of symptomatic atherosclerotic disease using generalized linear models with physical and mental functioning scores at followup as the dependent variables and location of symptomatic atherosclerotic disease, age, sex, baseline physical or mental functioning, and follow - up time as independent variables . Second, linear regression analysis was used to investigate whether greater progression of wml volume was associated with changes in physical and mental functioning . Progression of wml volume was defined as the difference in wml volume (% of icv) between baseline and followup . We divided wml progression into quartiles, and dichotomized wml progression (highest quartile (n = 126) versus lower quartiles (n = 360) to investigate whether patients with greatest progression showed a different course of physical and mental functioning than patients with no or minimal wml progression . Analyses were first performed in the total sample, and because we expected that associations could be influenced by the type of underlying atherosclerotic disease, we repeated the analyses within strata of locations of atherosclerotic disease . In model i, associations were adjusted for age, sex, baseline physical or mental functioning and follow - up time . We additionally adjusted for smoking, alcohol use, hypertension, and diabetes mellitus in model ii, because it is not clear to what extent these vascular risk factors are confounders or preceding factors in the pathway between wml volume and functioning, or both . We repeated the analyses after excluding patients with severe atherosclerotic disease at baseline, defined as patients with coronary artery disease and three - vessel or left main disease at inclusion, patients with cerebrovascular disease and a mrs grade 2 at inclusion, or patients with peripheral arterial disease with fontaine grade 3 at inclusion . This was done to assess to what extent the observed associations between small - vessel disease and functioning were influenced by the severity of macrovascular disease . Further, to examine whether associations were independent of incident vascular events during followup, analyses were repeated after excluding patients who experienced a new vascular complication (nonfatal ischemic stroke or myocardial infarction) between baseline and followup . In all analyses, 95% spss version 15.0 (chicago, ill, usa) was used to analyze our data . Mean age of the study population was 58 9 years, and 80% was male . At baseline, median physical functioning was 44 (1090th percentile 2955) and mental functioning was 51 (1090th percentile 3260). Mean elapsed time between the vascular event and screening date was 2.1 1.4 months . In the total sample, physical functioning improved (median 3.8, 10th90th percentile 6.5 to 18.3) and mental functioning deteriorated (median 4.0, 10th90th percentile 14.0 to 13.0) after a mean followup of 3.9 0.4 years . When different locations of atherosclerotic disease were identified, physical functioning improved in all groups (figure 1). This improvement was significantly lower in patients with cerebrovascular disease compared to patients with other locations of symptomatic atherosclerotic disease (b = 2.58, 95% ci 4.29 to 0.87). Mental functioning deteriorated in all groups, without any significant differences between different locations of symptomatic atherosclerotic disease (figure 1). Patients with greatest progression of wml volume (highest quartile,> 0.07% increase in wml volume as% of icv) showed a significantly stronger deterioration in mental functioning than patients with lower wml progression (b = 1.76, 95% ci 3.11 to 0.42, figure 2) in model i. additional adjustment for vascular risk factors did not change the results (data not shown). When analyses were repeated within different strata of locations of symptomatic atherosclerotic disease, greater wml progression was associated with a stronger deterioration in mental functioning in all patients except for patients with cerebrovascular disease (figure 3), although the deterioration was statistically significant only in patients with coronary artery disease (model i, b = 2.03, 95% ci 3.61 to 0.45). Additional adjustment for vascular risk factors did not change these associations . Greater progression of wml volume was not significantly associated with changes in physical functioning at followup in model i in the total sample (b = 0.04, 95% ci 1.79 to 1.72, figure 2) or within strata of patients with coronary artery disease (b = 0.02, 95% ci 2.26 to 2.30), peripheral arterial disease (b = 1.26, 95% ci 3.65 to 6.16), cerebrovascular disease (b = 0.00, 95% ci 3.46 to 3.46), or abdominal aortic aneurysm (b = 0.38, 95% ci 7.07 to 6.32). Excluding patients with most severe symptomatic atherosclerotic disease (n = 46) did not materially change the results . Greater wml progression was still significantly associated with a stronger deterioration in mental functioning (model i, b = 1.82, 95% 3.25 to 0.38). Between baseline and followup, 17 patients experienced a nonfatal vascular event . Excluding these patients did not change the observed associations of greater wml progression with a stronger deterioration in mental functioning (model i, b = 1.83, 95% ci 3.20 to 0.46). In a cohort of patients with different manifestations of symptomatic atherosclerotic disease, physical functioning substantially improved in all patients after four years of followup, although the improvement was less in patients with cerebrovascular disease . Greater progression of wml volume over four years of followup was associated with a stronger decline in mental functioning in all patients except for those with cerebrovascular disease . To our knowledge, this is the first study directly investigating the influence of wml progression on the course of physical and mental functioning in patients with different manifestations of symptomatic atherosclerotic disease . A strength of this study is that by including patients with different locations of symptomatic atherosclerotic disease we could investigate whether the effect of wml progression on physical and mental functioning depended on the type of underlying vascular disease . Furthermore, volumetric wml assessment provided estimates that are more precise and less influenced by observer bias than visual rating scales [2931] and enabled the measurement of relatively small volume changes over time . In addition, we included a large number of patients, and the extensive information available on cardiovascular risk factors and the extent of clinical and subclinical atherosclerosis made it possible to adjust for potential confounders . A limitation of this study is that, despite the large sample size, relatively few patients had peripheral arterial disease, cerebrovascular disease, or abdominal aortic aneurysm . Although similar associations were found in patients with coronary artery disease, peripheral arterial disease and abdominal aortic aneurysm, the relatively low number of patients with locations of symptomatic atherosclerotic disease other than coronary artery disease contributed to large confidence intervals and possibly nonsignificant relations in these patients . Further, the largest impact on physical and mental functioning would be expected in patients suffering most severe atherosclerotic events . Because these patients are less likely to participate in our study, this could have contributed to a relative underestimation of the effect . Moreover, patients who participated at followup were healthier at baseline, with fewer vascular risk factors, lower wml volume, and higher mental functioning than patients lost to followup . Therefore, the changes in physical and mental functioning might have been less prominent in the total cohort . Also, because baseline mental functioning was higher in patients with complete data at followup, regression to the mean could have contributed to the observed decline in mental functioning after four years . On the other hand, the selection of relatively healthy patients could have resulted in a decreased contrast between those with greatest wml progression and those without, which could have led to an underestimation of the effect of wml progression on changes in mental functioning . In recent years, hrqol has become an increasingly important clinical and research outcome measure when evaluating burden of disease and treatment benefits in patients with atherosclerotic disease . Population - based studies have shown that patients with various manifestations of symptomatic atherosclerotic disease have a poorer hrqol compared to the general population, with most pronounced effects on physical functioning [57, 9, 10]. It is unclear whether physical and mental functioning returns to population levels after the acute phase of recovery or whether functioning remains lower, or perhaps even further declines after the initial event . Our data showed that physical functioning was substantially lower in patients with symptomatic atherosclerotic disease in the acute phase of recovery from an atherosclerotic event compared to previously published age - adjusted population norms . In a previous population - based study, a prolonged decline in hrqol was observed in stroke survivors free from recurrent stroke or myocardial infarction . Although we found an improvement in physical functioning in our sample of patients with cerebrovascular disease after four years followup, this improvement was substantially lower compared to patients with other locations of symptomatic atherosclerotic disease . In line with our findings, another study also reported significant improvements in functioning in postoperative abdominal aortic aneurysm patients, which returned to population norms in long - term survivors . In our study, mental functioning was similar to population norms in the acute phase of recovery from a vascular event, but declined during a four year follow - up period . Other studies reported an increased prevalence of mood disturbances already in the acute phase in patients hospitalized for ischemic cardiac or cerebrovascular events [33, 34]. One explanation for our findings could be that in the acute phase of an atherosclerotic event, subjective well - being is dominated by the substantial impairments in physical functioning, whereas awareness of the emotional consequences arises after recovery of physical functioning . An alternative explanation could be that the course of mental functioning in patients with symptomatic atherosclerotic disease depends on the severity of the atherosclerotic event . Relatively few patients were included with severe atherosclerotic disease in our study, which could contribute to the different findings in the course of mental functioning between our study and others . The underlying mechanisms contributing to a lower hrqol in patients with symptomatic atherosclerotic disease are unclear . It has been suggested that a lower hrqol could result from direct complications of the disease or treatment of underlying vascular risk factors, or from raised awareness of the disease . An alternative mechanism contributing to a lower perceived hrqol could be the presence of co - occurring intracerebral atherosclerotic changes, characterized by wmls on mri . Wmls are strongly associated with the presence of common vascular risk factors, including increased age, hypertension, and diabetes mellitus [3638]. Although the exact underlying pathophysiological mechanisms remain unclear, arteriosclerotic changes to the cerebral small vasculature, with consequent ischemia, apoptosis, and blood - brain barrier alterations, are thought to be involved in the formation and progression of wmls . Although wmls are often asymptomatic mri findings, increased volume and progression of wml have been previously associated with an increased risk of functional decline, depression, and cognitive impairment [18, 19]. Wmls are thought to account for the increased risks of functional decline and mood disorders by disrupting brain pathways that are involved in the regulation of physical and emotional responses . Although we did not formally measure depression, our finding that increased wml activity was associated with a greater decline in mental functioning may be interpreted as being supportive of this vascular depression hypothesis . Greater progression of wml volume contributed to a stronger decline in mental functioning in all patients except for patients with cerebrovascular disease . This finding is somewhat counterintuitive but may be explained by our finding of little improvement in physical functioning in patients with cerebrovascular disease . It could be that as a result of the substantial impairments and disability already associated with stroke lesions, increased progression of wml volume does not substantially contribute to the decline in mental functioning in these patients . In summary, in patients with different manifestations of atherosclerotic disease, we found that physical functioning was mainly impaired in the acute phase after a symptomatic atherosclerotic event and improved during four years of followup, although improvement in physical functioning remained substantially lower in patients with cerebrovascular disease . Mental functioning was relatively unimpaired in the early phase, but declined in the four years thereafter . Greater progression of wml volume contributed to an even stronger decline in mental functioning in patients with symptomatic atherosclerotic disease . Considering the substantial impact on well - being and previously reported increased risk of adverse events associated with lower mental and physical functioning, further research should investigate whether modification of wml through better control of vascular risk factors could influence the course of hrqol in patients with symptomatic atherosclerotic disease.
Withdrawal treatment (often referred to as detoxification) is a common treatment practice in heroin - dependent patients attempting to quit heroin use and in order to facilitate entry into psychosocial treatment . Intuitively, retention during inpatient detoxification is likely to be of great value in order to initiate and succeed in subsequent treatment . The premature termination of heroin detoxification is common, and high rates of relapse into heroin abuse are seen in patients who fail to enter other treatment after detoxification . Buprenorphine is common as medication in opioid withdrawal and has demonstrated good efficacy in such treatment [47]. Typically, withdrawal symptoms occurring during detoxification with buprenorphine have been described to be mild . In addition to a withdrawal medication against specific opioid withdrawal symptoms, a limited amount of previous research has evaluated the role of potential risk factors of dropout from detoxification . The abuse of nonopioid drugs prior to admission, including cocaine, has been suggested as a risk factor for dropout from heroin detoxification [8, 9]. Also, apart from the role of withdrawal medication in the prediction of outcome, early data have suggested that completers of detoxification may have a more severe psychological profile, expressed as symptoms on the symptom checklist 90 (scl-90) measure . A majority of studies comparing different strategies for opioid detoxification have been pharmacological trials comparing different medications, and there has been considerably less research assessing other potential predictors of outcome in this area . Previous data yet unpublished from our group indicate that the presence of a postdetoxification plan may increase completion of detoxification . The present study aimed to analyse predictors of dropout during inpatient opioid detoxification treatment, with a focus on baseline urine toxicology and the type of postdetoxification planning, in a setting where the medical management was intended to follow the same principles for all patients, thus, attempting to keep medication a constant factor . The present study is a retrospective chart review, using hospital records for pharmacological opioid detoxifications carried out in an inpatient detoxification unit of malm addiction center, malm, sweden . Here, detoxification refers to a short - term inpatient procedure aiming at detoxifying the patient from her / his primary opioid of abuse (typically heroin, see below), through a procedure where withdrawal symptoms are treated with an opioid agonist which is tapered while the patient remains in the inpatient hospital setting . The setting of the present study is a closed ward designed specifically for the voluntary detoxification of patients with illicit substance use disorders, mostly heroin users . The planning of admissions to this ward always involved a postdetoxification plan for either inpatient residential treatment or outpatient treatment . In the present setting, such postdetoxification psychosocial treatment is planned and financed by social authorities after an active application of the client . The type of postdetoxification planned is made by social authorities in collaboration with the clients, attempting to optimize the treatment plan with respect to the individual needs and other relevant conditions of each patient . Patients admitted for opioid detoxification in the present ward typically have a severe drug use pattern involving a high degree of illicit drug use, separated from patients with a more pronounced prescription drug abuse who are treated in another part of the treatment organization . According to full - year statistics reported from this ward, heroin is the primary drug of abuse in 98% of patients admitted for opioid detoxification (the few remaining patients reporting methadone, buprenorphine, fentanyl, or morphine). In the treatment of opioid withdrawal symptoms, patients are observed until they develop subjective and objective withdrawal symptoms, and the medication with buprenorphine is initiated once such symptoms appear . Thereafter, the buprenorphine medication is titrated by an experienced nurse until physical withdrawal symptoms are controlled . From that peak dose, the dose is thereafter tapered gradually and in an individualized manner, but typically reducing the dose by 2 mg daily . The present study included detoxification episodes with a date of admission from october, 2005, until june, 2007 . However, for patients with more than one admission during this period of time, only the first admission was included . Patients admitted during this period of time were included if they underwent detoxification and presented with a withdrawal syndrome requiring medication, and who underwent detoxification with buprenorphine . The period assessed was chosen in order to include only detoxifications carried out after a change of policy in the detoxification center, allowing only admissions for detoxification if a structured postdetoxification plan was set upon admission, involving either an inpatient / residential or an outpatient treatment plan, typically set up by social authorities . For all patients, urine drug screen (uds) results and type of postdetoxification plan were registered . Postdetoxification has been shown in unpublished data to have an influence on retention in detoxification, and here, where all patients had some kind of such postdetoxification plan, treatment plans were categorized depending on whether they involved a treatment associated with an inpatient treatment or an outpatient treatment . Postdetoxification plans were categorized such that inpatient treatment included structured psychosocial treatment carried out in the context of a residential stay, whereas outpatient treatment comprised all outpatient psychosocial treatment and planning basically involving only housing (in addition to outpatient psychosocial treatment or support). Also, in statistical analysis, age and gender were included as potential predictors to control for . Uds was carried out for opiates, cannabis, cocaine, amphetamine, and benzodiazepines . Uds results were available for 119 patients, excluding three individuals who dropped out before urine testing . Results of the baseline uds were missing in four cases for cannabis, in five cases for benzodiazepines, in eleven cases for amphetamine, and in thirteen cases for cocaine, leaving 104 individuals for whom a complete uds was available . Peak dose of the withdrawal medication (buprenorphine) was included in the model, but as early dropouts may not have reached their peak dose (or, in two cases, left before receiving any buprenorphine doses at all), peak dose analyses were also carried out when excluding dropouts who remained for only one day, or excluding dropouts who remained for up to two days, respectively . In the present setting, peak doses are typically reached within one or two days in detoxification . Statistical analysis involved bivariate comparisons of patients who completed the inpatient detoxification episode (completers, patients who underwent full tapering of medication and were discharged according to the plan) and patients who left the ward prematurely against medical advice (dropouts), using chi - square analysis for categorical variables and student's t - test for continuous variables . Variables which were significantly associated (p <0.05) or which tended to be associated with dropout (p <0.10) were entered (simultaneously) in a multivariate logistic regression analysis with dropout status as the dependent variable . As the results of the uds were available in all but three patients (n = 119) and complete for all included substances in 104 patients, a control analysis was carried out, including only these 104 patients . These 104 patients did not differ from clients with fewer drug tests available (15 clients), with respect to age, gender, or number of drugs reported . All statistical analyses were carried out in spss version 21 . Given the legislation for ethical approval in sweden, the present chart review, carried out in the context of pregraduate medical school research, does not require ethical approval . Mean age was 34.3 years (standard deviation 9.2 years), with a median age of 33 years (range 1956 years). In the 119 patients for whom uds data were available, 117 (98%) screened positive for opiates . Among available analyses, cannabis was positive in 42% of cases, cocaine in 12%, amphetamine in 20%, and benzodiazepine in 63% of cases . Forty - two patients (34%) dropped out of detoxification against medical advice, on average after 6.7 days . Completers remained for a mean of 13.3 days . Among dropouts, 11 (26%) dropped out before reaching peak dosing of buprenorphine (two of whom left before receiving their first dose), after a mean of 1.8 days, 13 (31%) left during buprenorphine treatment and after reaching their peak dose (after a mean of 5.3 days), and 18 (43%) after receiving their final dose of buprenorphine (after a mean of 10.8 days). The mean peak dose reached during detoxification or before dropout was 14.1 mg (sd 5.1, median 13 mg, range 024 mg). No significant difference was seen in peak dose between completers and noncompleters (p = 0.20). This was confirmed in a secondary analysis eliminating patients who dropped out too early to reach a peak dose, including only patients who remained for more than one day (n = 119, 14.6 mg for completers and 14.1 mg for noncompleters, p = 0.61) or only patients who remained for more than two days (n = 112, 14.6 mg versus 15.3 mg for noncompleters, p = 0.49). Two variables at least tended to be associated with dropout in the binary analysis; completers of detoxification were older (36.0 versus 31.0 yrs, p = 0.004, t = 3.00) and tended to be more likely to have a postdetoxification plan involving inpatient / residential treatment (p = 0.08, = 3.05) rather than an outpatient postdetoxification plan (see table 1). In bivariate analysis of all clients who provided a uds, none of the nonopioid substances assessed at baseline were significantly associated with dropout (although a tendency was seen for cocaine to predict dropout, p = 0.09, although this was also the substance with the highest number of missing data). The total number of nonopioid substances in the urines also did not differ between dropouts and completers (p = 0.25), and nor did the percentage of patients who screened positive for more than one drug (p = 0.74, table 2). When restricting the analysis to patients for whom no urine drug results were missing, there also was no association between cocaine use and dropout (p = 0.30), such that no drug screen variable was further entered in the analysis . When entering age and postdetoxification plan (the two variables demonstrating at least a trend to predict dropout in binary analyses) in a multivariate logistic regression analysis, dropout was significantly and negatively associated with an inpatient postdetoxification plan (or 0.41 [0.180.94], p = 0.03) and with older age (or 0.93 [0.890.97]), thus indicating that older patients and patients with an inpatient postdetoxification plan were more likely to complete detoxification . The present study aimed to assess predictors of dropout against medical advice during inpatient opioid detoxification and demonstrated that younger patients and patients with only an outpatient postdetoxification plan were at significantly higher risk of dropout . Despite some previous findings indicating that nonopioid drug use may increase the risk of dropping out, no association was seen with urine toxicology results in the present study . The aim was to assess other factors of potential importance, including postdetoxification planning, polydrug use pattern, and demographic data, and the intention was to keep pharmacological strategy as constant as possible, given the principles applied in the present detoxification unit during this period . For this reason, we studied a period of time when buprenorphine taper was the standard procedure in opioid detoxification in this ward, and where dosing procedures were similar, although flexible based on levels of symptoms . Although dosing is difficult to compare for a group where a significant proportion of patients drop out too early from treatment, bivariate data (including data excluding the earliest dropouts) indicated that the groups were comparable regarding peak doses of buprenorphine . Short - term detoxification procedures, typically an opioid taper, aim to decrease withdrawal symptoms and facilitate subsequent treatment and abstinence . Despite the obvious role of opioid maintenance treatment with methadone, buprenorphine, or buprenorphine - naloxone in the treatment of opioid dependence, inpatient withdrawal treatment remains, either as a necessity in the acute treatment of withdrawal in patients who discontinue opioid use for various reasons, or in order to initiate any kind of nonopioid treatment such as antagonist treatment or psychosocial treatment . Given the relative paucity of research in this area, our study provides data which call for further research, potentially assessing a wider range of variables possibly predicting the course and outcome of detoxification . In the present study, the type of postdetoxification planning was associated with dropout, indicating that patients with a structured inpatient postdetoxification plan, typically referred to as residential or institution treatment, were more likely to complete detoxification . The transfer into institution treatment may require a higher degree of commitment than if a patient's plan is to return home after detoxification and from her / his home to attend treatment in an outpatient setting without the total around - the - clock separation from her / his habitual environment . As such, it cannot be excluded that patients who appear to have a higher level of functioning and to be more likely to complete detoxification are offered a higher degree of postdetoxification planning . However, although this study was able to include only a low number of variables, nothing indicated a clear difference between the groups in terms of clinical severity; instead, urine toxicology indicating a common pattern of polydrug use did not reveal any differences likely to indicate a difference in severity between completers and noncompleters . Thus, although results have to be interpreted with caution, one plausible theory is that patients undergoing inpatient detoxification from opioids may perceive a stronger motivation for continued treatment if this involves the direct transfer from an inpatient hospital ward directly into an inpatient residential treatment . As an outpatient postdetoxification plan means that the patient simply returns home upon discharge, patients with a fluctuating level of treatment motivation may be more prone to leave prematurely against medical advice if their discharge plan was to return home, compared to a structured transition into residential treatment . This may be further emphasized by previous data showing that opioid - dependent patients are likely to return to illicit drug use after a short - term opioid taper, again causing a greater challenge to patients with only an outpatient followup after detoxification . This topic needs to be elaborated in future research, possibly also in a prospective study design . Older age was a significant predictor of retention in detoxification, indicating that younger patients were more likely to drop out against medical advice . Further research is needed in order to elaborate on this finding, but the relatively pronounced difference in mean age between completers and noncompleters (five years) indicates that age plays a role in the prediction of retention in this context, or theoretically that the effect may be due to a difference in duration of drug use, a variable which could not be controlled for here . Younger patients may not have developed the same degree of negative consequences due to substance use, but this or other possible explanations may need to be assessed in further research . The present study failed to demonstrate any association between polydrug use or any other specific nonopioid substance and the risk of dropout . While polydrug use in opioid - dependent patients has been shown to complicate opioid use in many aspects, including lower long - term treatment retention and increased overdose mortality [12, 13], there also have been data demonstrating an increased risk of dropout against medical advice from detoxification [9, 14]. This discrepancy may call for further research in the area, as a difference in risk of dropout in different groups of drug users may require differentiated management based on such knowledge . First, the dataset is limited to 122 individuals, and the number of potential predictors included in the study was limited . For example, the presence of other psychiatric disorders than opioid dependence could not be included in the analysis, and systematic evaluation for psychiatric disorders likely would have been strongly biased in these individuals quitting a heavy use of illicit drugs immediately prior to admission . Also, available data on patients' substance use pattern were based only on baseline urine toxicology upon admission, thus, aiming more at describing the most recent drug use than to describe a more stable drug use pattern, and without systematic reporting of actual substance use disorders related to other substances than opioids . In addition, information on the quantity and frequency of substance use prior to admission was not systematically available . In addition, the retrospective nature of the study does not allow for a systematic description of withdrawal severity, such as with an objective symptom screening . Instead, medication has been individualized based on clinical assessment of withdrawal symptoms and should intuitively correlate to individual withdrawal severity, although the present study does not provide any measure to calculate this . Also, as this is a retrospective study with a naturalistic rather than experimental approach, it cannot be excluded that the type of postdetoxification plan is influenced by external factors which, in turn, may influence dropout rates . This risk may be reduced by the control for factors such as age, gender, and the dose required for withdrawal symptom relief, but the potential influence of further factors cannot be excluded . One another limitation is the missing uds data . For cocaine, missing in 13 cases and the substance most commonly missing in drug tests, we had no systematic information about the reasons for missing cases, which is the reason for conducting an analysis on only cases with all urine data available . To conclude, the present data indicate that the type of treatment planned to occur after detoxification may affect the possibility of retaining patients in the detoxification procedure . Also, younger patients admitted for detoxification may be at higher risk of dropping out against medical advice.
Asthma is a chronic inflammatory lung disease, characterized by recurrent wheezing, and is the leading cause of morbidity and mortality in children worldwide . Most infants who experience wheezing episodes also exhibit evidence of an ongoing viral respiratory infection . The viral agents respiratory syncytial virus (rsv), influenza a (flu a), and particularly human rhinovirus (hrv) appear to be the most prevalent and recurring threats . Hrvs have been noted as pathogens of the common cold for over 50 years; however, recent advances in viral molecular diagnostics have led to an appreciation of their role in more significant respiratory diseases . These include asymptomatic infections, frequent common colds, and severe lower respiratory infections, especially infantile bronchiolitis, childhood pneumonia, and acute exacerbations of chronic respiratory diseases, such as asthma . Hrvs can be divided into three genetically distinct species: hrv - a, hrv - b, and the recently identified hrv - c . A proposed classification protocol based on the sequence of the hrv capsid genes revealed approximately 78 a types, 30 b types, and 51 c types . As with many other viruses, genetically, hrv - c is most closely related to hrv - a and hrv - b, but even small genetic variance can result in significant differences in clinical impact . It is well - known that hrvs are a major trigger for asthma exacerbations, and hrv - c is now under investigation for its potential role in the development of asthma . This is a preliminary study to assess the associations between different hrv species, particularly hrv - c, and asthma in young children in china . Nasopharyngeal aspirates (npas) were obtained for respiratory virus screening from three groups of patients who visited the children's hospital affiliated to the capital institute of pediatrics in beijing, china . These groups included: (1) asthma group: the inclusion criteria were pediatric patients younger than 16 years of age, diagnosed with asthma characterized by recurrent episodes (3) of wheezing, breathlessness, chest tightness, and coughing, particularly at night or in the early morning . The exclusion criteria were pediatric patients diagnosed with bronchiolitis or other diseases with symptoms of wheezing, breathlessness, chest tightness, and coughing . (2) nonasthma, acute respiratory infection (ari) group: the inclusion criteria were pediatric patients younger than 16 years of age, diagnosed with ari, including rhinitis, laryngitis, tonsillitis, tracheitis, bronchitis, bronchiolitis, and pneumonia . (3) control group: the inclusion criteria were pediatric patients with underlying surgical therapy . The exclusion criterion was pediatric patients confirmed with respiratory infections within the 10 days prior to collection of npa . The study was approved by the ethics committee of the capital institute of pediatrics . Written informed consent was obtained from the parents or guardians of participants in the control group . The capital institute of pediatrics determined informed consent was not needed for the participants in the asthma and nonasthma ari groups for using the leftover npa for respiratory virus screening . Supernatants were inoculated onto madin darby canine kidney cell cultures to isolate flu a and b, onto cultured hep-2 and vero cell lines to isolate rsv and human adenovirus (hadv), and llc - mk2 cell cultures for parainfluenza virus (piv) types 13 . Cell pellets from all npa samples were re - suspended and spotted onto an acetone - cleaned slide . Then, individual monoclonal antibody reagents, labeled with fluorescein isothiocyanate (fitc) against rsv, hadv, flu a and b, and piv 13, were used for specific virus identification by direct immunofluorescence assay (dfa) with a d ultra dfa respiratory virus screening & i d kit (diagnostic hybrids inc ., athens, oh, usa). In addition, fitc - labeled monoclonal antibody against human metapneumovirus (hmpv) (diagnostic hybrids inc ., athens, oh, usa) was also used to detect hmpv . Next, dna and rna were extracted from 150 l of each npa specimen using trizol reagent (invitrogen inc ., carlsbad, ca, usa) and solubilized in 30 l of 8 mmol / l naoh for dna or 30 l of diethylpyrocarbonate - treated water for rna, according to the manufacturer's instructions . Reverse transcription - polymerase chain reaction (rt - pcr) and pcr assays were performed for detection of piv types 14, human bocavirus, and wu and ki polyomaviruses . Both rt - pcr and dfa methods can detect piv types 13 from specimens; however, rt - pcr can detect piv-4; therefore, the piv results in this study refer to those of rt - pcr . Semi - nested pcr was performed for hrv screening using primers p1 (163181): 5-c(a / g)a (g / a)ca ctt ctg t(t / c)(t / a) ccc c-3, p2 (533551): 5-c(a / g)a cta ctt tgg gtg tcc g-3, and r2 (10821064): 5-c(t / g / c / a)g g(t / c / a / g)a (a / g)(t / c) t tcc a(c / a)c acc a-3, designed according to the conserved vp4/vp2 region of hrv (genbank sequence l24917), resulting in amplification of a 920-bp fragment in the first run with primers p1 and r2 and a 550-bp fragment in the second run with primers p2 and r2 . A previously published protocol was used, and all procedures, including specimen processing, rna and dna extraction, rt - pcr / pcr amplification, and gel electrophoresis, were performed in separate areas of the laboratory to avoid pcr contamination . Amplified products from the second semi - nested pcr run were sequenced by invitrogen inc ., and phylogenetic analysis performed via an ncbi blast search (http://blast.ncbi.nlm.nih.gov) and the mega version 6.0 software package, to identify hrv species . Phylogenetic trees were constructed with the neighbor - joining method and maximum composite likelihood model, using hrv sequences from our study and from genbank . A discrete gamma distribution used to model evolutionary rate differences among sites (1 category, + g) was constructed with mega 6.0 . Bootstrap resampling (1000 replications) was used to assess the reliability of individual nodes in each phylogenetic tree . Chi - square and analysis of variance were used to compare the prevalence of the three hrv species in each study group . To identify the correlation of different species of hrv infection with asthma, spearman's rank correlation was used to compare the positive rates of hrv - a, b, or c between the asthma group and control group or nonasthma ari group . Using odds ratio (or) as an indicator, regression analysis was used to determine the effect of different species of hrv infection on asthma . All tests were two - tailed, and p <0.05 was considered statistically significant . All analyses were conducted in spss statistics version 22.0 (ibm, ny, usa). Nasopharyngeal aspirates (npas) were obtained for respiratory virus screening from three groups of patients who visited the children's hospital affiliated to the capital institute of pediatrics in beijing, china . These groups included: (1) asthma group: the inclusion criteria were pediatric patients younger than 16 years of age, diagnosed with asthma characterized by recurrent episodes (3) of wheezing, breathlessness, chest tightness, and coughing, particularly at night or in the early morning . The exclusion criteria were pediatric patients diagnosed with bronchiolitis or other diseases with symptoms of wheezing, breathlessness, chest tightness, and coughing . (2) nonasthma, acute respiratory infection (ari) group: the inclusion criteria were pediatric patients younger than 16 years of age, diagnosed with ari, including rhinitis, laryngitis, tonsillitis, tracheitis, bronchitis, bronchiolitis, and pneumonia . (3) control group: the inclusion criteria were pediatric patients with underlying surgical therapy . The exclusion criterion was pediatric patients confirmed with respiratory infections within the 10 days prior to collection of npa . The study was approved by the ethics committee of the capital institute of pediatrics . Written informed consent was obtained from the parents or guardians of participants in the control group . The capital institute of pediatrics determined informed consent was not needed for the participants in the asthma and nonasthma ari groups for using the leftover npa for respiratory virus screening . Supernatants were inoculated onto madin darby canine kidney cell cultures to isolate flu a and b, onto cultured hep-2 and vero cell lines to isolate rsv and human adenovirus (hadv), and llc - mk2 cell cultures for parainfluenza virus (piv) types 13 . Cell pellets from all npa samples were re - suspended and spotted onto an acetone - cleaned slide . Then, individual monoclonal antibody reagents, labeled with fluorescein isothiocyanate (fitc) against rsv, hadv, flu a and b, and piv 13, were used for specific virus identification by direct immunofluorescence assay (dfa) with a d ultra dfa respiratory virus screening & i d kit (diagnostic hybrids inc ., athens, oh, usa). In addition, fitc - labeled monoclonal antibody against human metapneumovirus (hmpv) (diagnostic hybrids inc ., athens, oh, usa) was also used to detect hmpv . Next, dna and rna were extracted from 150 l of each npa specimen using trizol reagent (invitrogen inc ., carlsbad, ca, usa) and solubilized in 30 l of 8 mmol / l naoh for dna or 30 l of diethylpyrocarbonate - treated water for rna, according to the manufacturer's instructions . Reverse transcription - polymerase chain reaction (rt - pcr) and pcr assays were performed for detection of piv types 14, human bocavirus, and wu and ki polyomaviruses . Both rt - pcr and dfa methods can detect piv types 13 from specimens; however, rt - pcr can detect piv-4; therefore, the piv results in this study refer to those of rt - pcr . Semi - nested pcr was performed for hrv screening using primers p1 (163181): 5-c(a / g)a (g / a)ca ctt ctg t(t / c)(t / a) ccc c-3, p2 (533551): 5-c(a / g)a cta ctt tgg gtg tcc g-3, and r2 (10821064): 5-c(t / g / c / a)g g(t / c / a / g)a (a / g)(t / c) t tcc a(c / a)c acc a-3, designed according to the conserved vp4/vp2 region of hrv (genbank sequence l24917), resulting in amplification of a 920-bp fragment in the first run with primers p1 and r2 and a 550-bp fragment in the second run with primers p2 and r2 . A previously published protocol was used, and all procedures, including specimen processing, rna and dna extraction, rt - pcr / pcr amplification, and gel electrophoresis, were performed in separate areas of the laboratory to avoid pcr contamination . Amplified products from the second semi - nested pcr run were sequenced by invitrogen inc ., and phylogenetic analysis performed via an ncbi blast search (http://blast.ncbi.nlm.nih.gov) and the mega version 6.0 software package, to identify hrv species . Phylogenetic trees were constructed with the neighbor - joining method and maximum composite likelihood model, using hrv sequences from our study and from genbank . A discrete gamma distribution used to model evolutionary rate differences among sites (1 category, + g) was constructed with mega 6.0 . Bootstrap resampling (1000 replications) was used to assess the reliability of individual nodes in each phylogenetic tree . Chi - square and analysis of variance were used to compare the prevalence of the three hrv species in each study group . To identify the correlation of different species of hrv infection with asthma, spearman's rank correlation was used to compare the positive rates of hrv - a, b, or c between the asthma group and control group or nonasthma ari group . Using odds ratio (or) as an indicator, regression analysis was used to determine the effect of different species of hrv infection on asthma . All tests were two - tailed, and p <0.05 was considered statistically significant . All analyses were conducted in spss statistics version 22.0 (ibm, ny, usa). Between october 2013 and november 2014, 155 young children with a mean age 2.7 1.5 years, 116 (74.8%) male, and 39 (25.2%) female were enrolled in the asthma group, 461 children with a mean age 3.0 3.3 years, 288 (62.5%) male, and 173 (37.5%) female were enrolled in the nonasthma group . Between august 2014 and march 2015, 86 children with a mean age 3.0 2.3 years, 70 (81.4%) male, and 16 (18.6%) female were enrolled in the control group . The viral pathogen screening for all patients [table 1] revealed that hrvs were the most common pathogens, with a prevalence of 15.4% (108/702). Similarly, in the asthma group, hrvs were the most common pathogens, with a prevalence of 25.8% (40/155). In the nonasthma ari group, 11.1% (51/461) patients were positive for hrv . In the control group, 19.8% (17/86) of patients were hrv - positive . The prevalence of hrv was significantly different (f = 10.680, p <0.001) among the three study groups (25.8%; 11.1%; 19.8%). While no significant difference was found between the asthma and control groups (f = 1.113, p = 0.293), there was a significant difference between the asthma and nonasthma ari groups (f = 20.633, p = 0.000). Results of viral detection in different patient groups ari: acute respiratory infection; rsv: respiratory syncytial virus; hadv: human adenovirus; flu a: influenza virus a; flu b: influenza virus b; hmpv: human metapneumovirus; hrvs: human rhinoviruses; hbov: human bocavirus; wu: wu polyomavirus; ki: ki polyomavirus; piv1, piv2, piv3, and piv4: parainfluenza viruses 1, 2, 3, and 4; dfa: direct immunofluorescence assay; pcr: polymerase chain reaction . In the 108 samples positive for hrv by semi - nested pcr, there were 105 (97.2%) specimens with sufficient pcr product for sequencing . By sequencing the 105 pcr products, partial vp4/vp2 nucleotide sequences were obtained, then blast - searched against available sequences of hrv - a, hrv - b, and hrv - c from genbank . Figure 1 shows these 105 sequences from the three patient groups were divided into three hrv species groups (a, b, and c). The hrv - a cluster was closer to hrv - b than hrv - c . The hrv - c cluster, with 56 of the 105 sequences, is the largest one of these three clusters, revealing hrv - c as the dominant species in the study population . The hrv - a cluster, with 41 sequences, is the second largest, and the hrv - b cluster, with eight sequences, is the smallest . The sequences belonging to different hrv species from the different patient groups were stratified into different subclusters, together with sequences of different hrv serotypes from genbank, and there are sequences from different patient groups clustered into one subcluster [figure 1]. The 105 partial vp4/vp2 gene sequences from this study and hrv species a, b, and c sequences from genbank were used for tree construction . Turquoise circles denote hrv sequences from the control group, blue triangles those from the asthma group, and purple diamonds the sequences from the nonasthma group . The sequence analysis results showed that 41 cases (5.8%, 41/702) were confirmed as hrv - a, including 22 from the nonasthma ari group (4.8%, 22/461), 13 from the asthma group (8.4%, 13/155), and six from the control group (7.0%, 6/86), eight cases (1.4%, 8/702) were confirmed as hrv - b, including four from the nonasthma ari group (0.8%, 4/461), one from the asthma group (0.6%, 1/155), and three from the control group (3.5%, 3/86), and 56 (8.0%, 56/702) were confirmed as hrv - c, including 22 from the nonasthma ari group (4.8%, 22/461), 26 from the asthma group (16.8%, 26/155), and 6 from the control group (9.3%, 6/86). The overall proportion of hrv - a and hrv - c positive samples in the study were similar (= 2.171, p> 0.05), and both were higher than that of hrv - b (= 21.654, p <0.01 and = 36.164, p <0.01, for hrv - a and hrv - c, respectively). In the nonasthma ari group, there were significant correlations between hrv - a and hrv - c and asthma, with r values of 0.08 (p = 0.037, p <0.05) and 0.20 (p <0.001), respectively [table 2]. No significant correlations were identified for hrv - a, b, and c infections between the asthma group and control group (p> 0.05). Correlation between different species hrv infection with asthma ari: acute respiratory infection; hrvs: human rhinoviruses . Sex and age were not evenly distributed, with more male cases and more young patients in all groups; therefore, the distribution of sex and age in different groups was adjusted prior to regression analysis [table 3]. The or between the asthma group and nonasthma ari group for hrv - a and hrv - c were 2.2 (95% confidence interval [ci], 1.0654.409) and 4.2 (95% ci, 2.2627.906), respectively, which confirmed patients with hrv - c infection were 4.2 times more likely to have asthma (p <0.001), and patients with hrv - a infection were 2.2 times more likely to have asthma (p <0.05). Association between different species of hrv infection and asthma in a sample of 702 children in beijing * adjusted . Hrv: human rhinoviruses; ci: confidence interval; or: odds ratio; ari: acute respiratory infection . Between october 2013 and november 2014, 155 young children with a mean age 2.7 1.5 years, 116 (74.8%) male, and 39 (25.2%) female were enrolled in the asthma group, 461 children with a mean age 3.0 3.3 years, 288 (62.5%) male, and 173 (37.5%) female were enrolled in the nonasthma group . Between august 2014 and march 2015, 86 children with a mean age 3.0 2.3 years, 70 (81.4%) male, and 16 (18.6%) female were enrolled in the control group . The viral pathogen screening for all patients [table 1] revealed that hrvs were the most common pathogens, with a prevalence of 15.4% (108/702). Similarly, in the asthma group, hrvs were the most common pathogens, with a prevalence of 25.8% (40/155). In the nonasthma ari group, 11.1% (51/461) patients were positive for hrv . In the control group, 19.8% (17/86) of patients were hrv - positive . The prevalence of hrv was significantly different (f = 10.680, p <0.001) among the three study groups (25.8%; 11.1%; 19.8%). While no significant difference was found between the asthma and control groups (f = 1.113, p = 0.293), there was a significant difference between the asthma and nonasthma ari groups (f = 20.633, p = 0.000). Results of viral detection in different patient groups ari: acute respiratory infection; rsv: respiratory syncytial virus; hadv: human adenovirus; flu a: influenza virus a; flu b: influenza virus b; hmpv: human metapneumovirus; hrvs: human rhinoviruses; hbov: human bocavirus; wu: wu polyomavirus; ki: ki polyomavirus; piv1, piv2, piv3, and piv4: parainfluenza viruses 1, 2, 3, and 4; dfa: direct immunofluorescence assay; pcr: polymerase chain reaction . In the 108 samples positive for hrv by semi - nested pcr, there were 105 (97.2%) specimens with sufficient pcr product for sequencing . By sequencing the 105 pcr products, partial vp4/vp2 nucleotide sequences were obtained, then blast - searched against available sequences of hrv - a, hrv - b, and hrv - c from genbank . Figure 1 shows these 105 sequences from the three patient groups were divided into three hrv species groups (a, b, and c). The hrv - a cluster was closer to hrv - b than hrv - c . The hrv - c cluster, with 56 of the 105 sequences, is the largest one of these three clusters, revealing hrv - c as the dominant species in the study population . The hrv - a cluster, with 41 sequences, is the second largest, and the hrv - b cluster, with eight sequences, is the smallest . The sequences belonging to different hrv species from the different patient groups were stratified into different subclusters, together with sequences of different hrv serotypes from genbank, and there are sequences from different patient groups clustered into one subcluster [figure 1]. The 105 partial vp4/vp2 gene sequences from this study and hrv species a, b, and c sequences from genbank were used for tree construction . Turquoise circles denote hrv sequences from the control group, blue triangles those from the asthma group, and purple diamonds the sequences from the nonasthma group . The sequence analysis results showed that 41 cases (5.8%, 41/702) were confirmed as hrv - a, including 22 from the nonasthma ari group (4.8%, 22/461), 13 from the asthma group (8.4%, 13/155), and six from the control group (7.0%, 6/86), eight cases (1.4%, 8/702) were confirmed as hrv - b, including four from the nonasthma ari group (0.8%, 4/461), one from the asthma group (0.6%, 1/155), and three from the control group (3.5%, 3/86), and 56 (8.0%, 56/702) were confirmed as hrv - c, including 22 from the nonasthma ari group (4.8%, 22/461), 26 from the asthma group (16.8%, 26/155), and 6 from the control group (9.3%, 6/86). The overall proportion of hrv - a and hrv - c positive samples in the study were similar (= 2.171, p> 0.05), and both were higher than that of hrv - b (= 21.654, p <0.01 and = 36.164, p <0.01, for hrv - a and hrv - c, respectively). In the nonasthma ari group, there were significant correlations between hrv - a and hrv - c and asthma, with r values of 0.08 (p = 0.037, p <0.05) and 0.20 (p <0.001), respectively [table 2]. No significant correlations were identified for hrv - a, b, and c infections between the asthma group and control group (p> 0.05). Correlation between different species hrv infection with asthma ari: acute respiratory infection; hrvs: human rhinoviruses . Sex and age were not evenly distributed, with more male cases and more young patients in all groups; therefore, the distribution of sex and age in different groups was adjusted prior to regression analysis [table 3]. The or between the asthma group and nonasthma ari group for hrv - a and hrv - c were 2.2 (95% confidence interval [ci], 1.0654.409) and 4.2 (95% ci, 2.2627.906), respectively, which confirmed patients with hrv - c infection were 4.2 times more likely to have asthma (p <0.001), and patients with hrv - a infection were 2.2 times more likely to have asthma (p <0.05). Association between different species of hrv infection and asthma in a sample of 702 children in beijing * adjusted . Hrv: human rhinoviruses; ci: confidence interval; or: odds ratio; ari: acute respiratory infection . In this study, respiratory virus screening (including hrvs) by dfa, virus isolation, and pcr revealed that hrvs were the most common pathogens, with a prevalence of 15.4% (108/702) in all patients, and 25.8% (40/155) in the asthma group, 11.1% (51/461) in the nonasthma ari group, and 19.8% (17/86) in the control group . The prevalence of hrv was higher in the asthma group, compared with the nonasthma group, which may imply an association between hrvs and asthma . Hrvs are the most common cause of respiratory illness in children and are commonly associated with asthma symptoms, requiring escalation of care and emergency room visits in many patients . A previous study in beijing reported 19.0% (14/73) of patients diagnosed with asthma were hrv - positive, and wheezing was a common symptom in children with ari . This suggests that hrv is an important pathogen for children with ari, particularly those with lower respiratory infections . However, the epidemiology and clinical significance of different species of hrvs, especially hrv - c, are poorly characterized . Based on the phylogenetic analysis, these hrvs were divided into different species, hrv - a, b, and c. hrv - c cluster was the largest among the three clusters, followed by hrv - a, then hrv - b, identifying hrv - c as the dominant species in the study . Hrv - c was also the dominant species in the asthma (16.8%) and control groups (9.3%) but not in the nonasthma ari group, where the prevalence of hrv - c and hrv - a was equal . In a study aiming to characterize the clinical and demographic features associated with different hrv species in northeast brazil, fawkner - corbett et al . Believed that hrv - a was the dominant species, with a prevalence of 73%, compared with 27% in hrv - c and 0 hrv - b . In addition, hrv - c was detected more frequently than hrv - a in children with asthma or episodic viral wheeze, which supports the association of hrv - c with asthma, identified in the present study that the or between the asthma and nonasthma ari group for hrv - a and hrv - c confirmed patients with hrv - c infection were 4.2 times more likely to have asthma (p <0.001), and patients with hrv - a infection were 2.2 times (p <0.05). Therefore, hrv - c had the strongest correlation with asthma in the study population . There was no significant difference in the prevalence of hrv - b among the three groups, which may be because there was no correlation between hrv - b and asthma . However, the proportion of hrv - b in the control group (3.5%, 3/86) is higher than that in the asthma group (0.6%, 1/155) and the nonasthma ari group (0.8%, 4/461). In addition, there were few hrv - b positive specimens in this study, as in a previous study that nine infants had hrv - a, 13 had hrv - c, and one infant had hrv - b . Therefore, more data are needed to evaluate the association between hrv - b infection and asthma . There was a high prevalence of hrvs in the control group (19.8%), which may suggest a high prevalence of asymptomatic hrv infection in children . However, this contradicts the association identified between hrv - a and hrv - c infection and asthma . Chen et al . Reported that the prevalence of hrv species differed with age, and hrv - c infection was more common in children compared with adults, with the majority of adults being infected with hrv - a . Other research has described a high prevalence of hrv - c in children, regardless of clinical status . In the present study, compared with 155 patients in the asthma group, more data are needed to determine the clinical significance of a high prevalence of hrvs in the control group . The sequences of different clusters from the different patient groups in the phylogenetic analysis were blast - searched against hrv serotypes from genbank, and some patient group sequences were clustered into one subcluster . Further studies are needed to understand the relationship of hrv serotype with the severity of illness or specific disease, especially with asthma . In conclusion, the results in this study suggest there is a high prevalence of hrvs in children in beijing, regardless of clinical status, and hrv - c may be a key factor in determining an association between hrvs and asthma . This work was supported by the grants from beijing municipal science and technology commission (no . 2011 - 3 - 068) and national health and family planning commission special funds for public welfare projects this work was supported by the grants from beijing municipal science and technology commission (no . 2011 - 3 - 068) and national health and family planning commission special funds for public welfare projects (no.
Peripheral blood collection and cd14 cell isolation - peripheral blood was obtained from healthy volunteers after providing informed written consent according to the ethical research committee or israel institute of education and research (105/02). Mononuclear cells were purified from the peripheral blood using density gradient ficoll - paque plus (ge healthcare, buckinghamshire, uk) according the manufacturer's instructions . The cd14 cell population was isolated from the mononuclear fraction by magnetic bead separation according to the manufacturer's protocol (miltenyi biotec, bergisch gladbach, germany). Dc generation and treatment with vegf a - the cd14 cell population was dispensed into six - well plates containing x - vivo 15 medium (cambrex, walkersville, md, usa) supplemented with antibiotic - antimycotics (gibco, north andover, ma, usa). To generate immature dcs, the cells were cultured in the presence of 20 ng / ml recombinant il-4 (ril-4) (r&d system) and 50 ng / ml rgm - csf (r&d system) for six days (d6). Mature dcs were obtained after 24 h (d7) of stimulation of the immature dc culture with 10 ng / ml rtnf- (r&d system) plus 0.01 mmol / l pge2 (sigma, st . Louis, mo, usa), referred to in this paper as pg - tnf; the concentrations used were previously described (szabolcs et al . Alternatively, the immature dc cultures were stimulated to maturity by adding 20 g bcg (ataulpho de paiva foundation, rio de janeiro, brazil). The bcg suspension was previously titrated to obtain the lowest dose capable of stimulating efficient dc maturation (data not shown). To study the effect of vegf on dcs, the cells were cultivated after the initial day of culture in the presence or absence of 20 ng / ml of human rvegf a, isoform165 (calbiochem - millipore, billerica, ma, usa), which it the predominant form of vegf during angiogenesis . Flow cytometry analysis - staining of the cells for flow cytometry analyses was performed using commercially available monoclonal antibodies (mabs) according to the manufacturer's instructions . Briefly, the cells were stained with the selected mabs and incubated in the dark for 30 min at room temperature . The cells were then washed and fixed with 1% paraformaldehyde, with the exception of the cells tested for apoptosis, which were resuspended in the annexin v binding buffer (bd pharmingen, san diego, ca, usa) provided with the reagent set . Intracellular staining was performed in previously fixed and permeabilised surface - stained cells prior to adding the labelled intracellular mab . The mabs used to evaluate dc markers or maturation were as follows: cd11c - pe clone: b - ly6, cd14-fluorescein isothiocyanate (fitc) clone: m5e2, cd80-pe clone: l307.4, cd83-pe clone: hb15e, cd86-pe clone:2331, cd123-pe clone:9f5 and cd209-pe clone: dcn46 (all purchased from bd pharmingen); hla - dr - percp - cy5.5 clone: l243 and isotype controls (purchased from bd biosciences, san jose, ca, usa). To assess lymphocyte proliferation, we used ki-67-fitc clone: b56 and cd3-percp cy5.5 clone: sk7 in addition to isotype controls (bd biosciences). Monoclonal abs against the vegf receptors, including anti - vegfr1-pure clone:49560 and vegfr2-pe clone:89106 (r&d system) and vegfr3-pure clone:9d9f9 (chemicon, temecula, ca, usa) and isotype controls were also used . Annexin v - fitc, propidium iodide, anti - caspase-3 active form - pe and isotype controls were purchased from bd pharmingen . The secondary abs included goat anti - mouse - fitc, goat anti - rabbit - fitc and sheep anti - mouse - pe and were purchased from chemicon . The data were acquired using the facsaria flow cytometer (bd biosciences) and the analyses were performed using the facsdiva software (bd biosciences) and/or flowjo (tree star, ashland, or, usa). Ag - specific proliferation assay - mature dcs cultured in the presence or absence of vegf (10 cells/100 l) were co - cultivated in 96-well tissue culture plates (bd biosciences - discovery labware, san jose, ca, usa) for four days with autologous lymphocytes (10 cells/100 l) previously stained with 5 m / ml of carboxyfluorescein succinimidyl ester (cfse) (invitrogen). Ag - specific stimulation was performed by priming the dcs with lyophilised candida albicans (10 g / ml) and non - specific stimulation of the cultures was performed by adding the mitogen phytohaemagglutinin (pha) 1 g / ml). The dcs were -irradiated at 1,500 rads (gammacell 1000 cs source) prior to co - cultivation . After four days in culture, lymphocyte proliferation was monitored according to the cfse fluorescence levels in the 530/30 channel . The lymphocyte populations were gated by size and granularity [side light scatter (ssc) vs. forward light scatter (fsc)] and the events selected in the lymphocyte gate were analysed in a second plot (histogram). The results were expressed using the division index, which represents the average number of divisions that a cell has undergone . We also analysed non - specific (pha) lymphocyte proliferation in co - cultures arranged as described, in which a specific inhibitor of ido, 1-methyl - d - tryptophan (1-mt) at 1 mm (aldrich, st . Louis, mo, usa), was added at the beginning of the culture together with the vegf - matured dcs . After four days in culture, lymphocyte proliferation was monitored for the cd3 population using ki-67 nuclear staining as a proliferation marker . The lymphocytes were gated based on ssc vs. fsc, followed by cd3 gating; the selected events were analysed in a second plot for ki-67 expression . Rna isolation and quantitative real - time polymerase chain reaction (qpcr) - monocytes, immature dcs and mature dcs were cultured in the presence or absence of vegf for subsequent rna isolation . Total rna was isolated using the kit rneasy mini kit (qiagen, germany). The extracted rna was then reverse transcribed into cdna using oligo, dntpmix and reverse transcriptase from the superscript ii reverse transcriptase kit (invitrogen). The primers were based on the homo sapiens gene sequences for ido and glyceraldehyde 3-phosphate dehydrogenase (gapdh) obtained in the genbank database (ncbi.nlm.nih.gov). The primers were designed using primer - select (dnastar inc, usa) and were synthesised by invitrogen as ido (forward, 5'-ggcaacccccagctatcaga-3'; reverse, 5'-cagggagaccagagctttcaca-3') and gapdh (forward, 5'-ggagaaggctggggctcat-3'; reverse, 5'-gtccttccacgataccaaagtt-3'). The qpcr was performed using the quanti tect sybr green pcr kit according to the manufacturer's instructions (qiagen, germany). The qpcr data were analysed by normalising the cycle threshold (ct) values of the gene of interest to the ct values of the housekeeping gene gapdh (livak & schmittgen 2001). The results are displayed showing monocytes as the baseline for comparison . Ultrastructural characterisation by transmission electron microscopy (tem) - the ultrastructures of monocytes and mature dcs grown in presence or absence of vegf was examined by tem . The pellets of these cells were fixed in 0.2 m cacodylate buffer with 1% glutaraldehyde for 2 h at 48c . Post - fixation was performed with 1% osmium tetroxide for 1 h at 48c, followed by washing for 15 min in the same buffer . For contrast, the pellet was immersed in a solution of uranyl acetate for 30 min . After dehydration, the material was embedded in epon resin diluted in acetone (1:1) and incubated at 48c for 24 h with agitation . The pellet was then transferred to pure epon resin and incubated at 60c for 72 h until completely polymerised . The semithin sections were stained with azure ii (1%) and methylene blue (1%). The ultrathin sections were placed on copper grids and stained with uranyl acetate and citrate . Statistical analysis - statistical analyses were performed by employing a two - tailed student t test, with statistical significance set at a p - value <0.05 . Dc phenotypes after maturation induced pg - tnf or bcg - the differentiation of monocytes into dcs was assessed according to the expression of markers on d6 of culture in comparison to that of the original monocyte population at the start of the culture (d0). The expression of maturation markers was determined one day after the maturation stimuli were added to the six - day - old cultures (d7). The frequencies of cd14 populations on d0, d6 and d7 are shown in fig . 1 . 1a) (d0). After six days of culture in the presence of il-4 + gm - csf, the frequency of cd14 cells 1a) (d6) and was maintained at low levels in either the pg + tnf or bcg - matured dcs (d7) (fig . In contrast, cd209, a marker exclusively expressed on dcs (geijtenbeek et al . 2000), was not observed on d0, but was found in nearly 90% of the cells on d6 and its frequency was maintained in the matured dcs (fig . No differences in the frequency of cells expressing cd11c or hla - dr were detected when comparing the cells at the d0, d6 and d7 stages of culture (fig . 1c, d); however, the mean fluorescence index (mfi) showed increases on the order of two - three - fold . Significant increases in the frequency of cd123 cells were also observed as the monocytes differentiated into dcs and subsequently matured (fig . These results indicate that the phenotypic differentiation of monocytes into dcs occurred in vitro . 1a - hexpression of cell surface markers by human monocytes differentiated in vitro to dendritic cells (dcs) and cultured in the presence of prostaglandin e2 + tumour necrosis factor alpha (pg - tnf) or bacillus calmette - gurin (bcg) as maturation factors . Blood monocytes were isolated from peripheral blood mononuclear cells obtained from normal donors and cultured, day zero (d0), in the presence of rgm - csf and recombinant interleukin four - six days to differentiate them to immature dc (d6) and further cultured for 24 h in pg - tnf or bcg (d7) as maturation factors . The cell suspensions were initially sorted by side light scatter (ssc) vs. forward light scatter (fsc) to exclude debris . The means and standard deviation (of 5 independent experiments) of the frequencies of positive cells for the different markers are shown in the graphs and significant (p <0.05) differences are indicated by an asterisk . The respective mean fluorescence intensities (mfi) for each fluorescent marker are shown as insets to each graph accompanied by its isotype - matched irrelevant fluorescent igg control . Dc maturation was evidenced by increases in the frequency and expression of the co - stimulation molecule cd80 and the maturation marker cd83 from d0-d6 and d7 . In contrast, the mfi value of the co - stimulation molecule cd86 increased from d0-d6 and further increased as the cells matured (d7), although the cd86 cell frequencies were maintained from d0-d7 (fig . Pg + tnf was more effective at promoting the maturation of dcs than bcg, as the mfis and frequencies of cells expressing cd80, cd83 and cd86 were lower after bcg treatment (fig . We also examined the monocytes and dcs for the presence of vegfr and found that 90% of the monocytes expressed vegfr1, vegfr2 or vegfr3 (fig . 2a - c), however, among the differentiated dcs (d6), the frequency of cells positive for each receptor fell to approximately 30%, as did the vegfr1 and vegfr3 mfi (but not for vegfr2). At 24 h after the addition of maturation stimuli, the mean frequency of cells expressing vegfr1 increased to 50%, but this increase was only significant for pg + tnf and not for bcg . This result was most likely due to the greater intensity of the pg + tnf maturation stimulus and therefore its effect on the cells could be better observed and evaluated (fig . 2expression of vascular endothelial growth factor (vegf) receptors during human dendritic cell differentiation and subsequent maturation in the presence of prostaglandin e2 + tumour necrosis factor alpha (pg - tnf) or bacillus calmette - gurin (bcg). Human peripheral blood monocytes were cultured and differentiated as described in the legend to fig . 1 . The mean frequencies and standard deviation (n = 5 independent experiments) of dendritic cell expressing vegfr1 (a), vegfr2 (b) or vegfr3 (c) are shown in the graphs accompanied by the mean values of mean fluorescence intensities (mfi). Significant differences (p <0.05) are indicated by an asterisk . Vegf stimulates ido expression by dcs treated with pg + tnf - pg has been broadly used as a potent dc maturation factor and has been shown to induce ido expression (braun et al . Ido mrna expression in monocytes is very low and the mean value was used as a baseline for the comparison of the values after differentiation and maturation . As the monocytes differentiated into immature dcs (d6), the ido relative mrna expression levels were not significantly altered (fig . However, a 1,000-fold increase in ido mrna expression was observed in dcs that had been matured with pg + tnf for 24 h (fig . 3a) and the presence of vegf in the maturation cultures further increased ido mrna expression (fig . Indeed, we found that vegf stimulated 100% increases in ido mrna expression in mature dcs (d7 v vs. d7). When these cell populations were stained for ido and analysed by flow cytometry, the frequency of the cells matured with vegf was 30% higher than those cultivated without vegf (fig . 3effect of vascular endothelial growth factor (vegf) during dendritic cell (dc) maturation on the relative expression of indoleamine 2,3-dioxygenase (ido) mrna and on intracellular ido content detected by flow cytometry . Human peripheral blood monocytes were cultured and differentiated until day six (d6) as described in the legend of fig . Maturation was carried out with prostaglandin e2 + tumour necrosis factor alpha (pg - tnf) in the presence of vegf: d7 (v) or just pg - tnf (d7). A: ido mrna relative expression in logarithmic scale; b: data in linear scale (asterisk means significant difference at p <0.05). For comparison, very low levels of ido mrna of immature dc (d6) compare to monocytes (baseline) and mature dc [d7: dc matured in the absence of vegf; d7v: dc matured in the presence of vegf (representative of 3 independent experiments)] are shown in a. the difference between d7v - d7 is better seem in b due to linear scale; c: flow cytometry data of mature dc stained for intracellular ido accompanied by the mean fluorescence intensities (mfi) values; igg1: fluorescein isothiocyanate - labelled isotype control . Vegf influence on the morphology of pg + tnf - treated dcs, as revealed by tem - under tem observation, the preparations of monocytes (d0) showed a predominance of regular, round - shaped cells containing ovoid nuclei with loose chromatin and evident nucleoli (fig . The mature dcs that had been treated with pg + tnf were irregular and often star - shaped, exhibiting characteristic dendritic - like prolongments (fig . These cells also demonstrated ovoid - shaped nuclei with loose chromatin and nucleoli; in addition, the mitochondria and rough endoplasmic reticulum were well developed and few lysosomes were observed (fig . The morphology of the dcs treated with vegf (in addition to pg + tnf) was not much different than the above - described features, although some cells displayed intense cytoplasmic vacuolation (fig . 4h); these changes were compatible with the initial senescent cell population . 4transmission electron micrographs of monocytes and of dendritic cells (dcs) matured with prostaglandin e2 + tumour necrosis factor alpha (pg - tnf) in the presence or absence of vascular endothelial growth factor (vegf). 3 . A: monocyte culture on day zero; b - d: dcs matured in pg - tnf (d7); e - h: dcs matured in pg - tnf + vegf (d7v); c: cytoplasm; cp: cytoplasmic prolongations; li: lysossome; mi: mitochondria; mt: microtubule; n: nuclei; nu: nucleoli; rer: rough endoplasmic reticulum; v: vacuolation . Vegf effect on apoptosis in pg + tnf - treated dcs, as revealed by flow cytometry - the cell cultures matured with pg + tnf + vegf showed an increased frequency of annexin v+ cells (a sign of early apoptosis) by 24 h (dc7v) and 48 h (dc8v) in comparison to cells cultured in the absence of vegf (fig . Was also evidenced in the vegf - treated cultures after 48 h, as shown by higher frequencies of double staining for annexin and pi (dc8v) (fig . These data were also confirmed for late apoptosis, as a higher frequency of cells were positive for active caspase-3 (dc8v) (fig . These results suggest that vegf enhanced the apoptosis of dcs when present during the maturation process and were in agreement with the ultrastructural changes described for these cell cultures . 5effect of vascular endothelial growth factor (vegf) on the expression of early and late markers of apoptosis and/or necrosis by dendritic cell (dc) cultures . 3 with the maturation step carried out for 24 h with prostaglandin e2 + tumour necrosis factor alpha in the presence (dc7v) of vegf or in its absence (dc7). In additional cultures the maturation step was carried out for 48 h in similar conditions, identified respectively as dc8v and dc8 . The cells were double - stained for annexin v / propidium iodide (apoptosis and/or necrosis) or stained only for caspase-3 . A: cells that stained for annexin v only (early apoptosis); b: cells double stained for annexin v and propidium iodide only (late apoptosis / necrosis); c: frequencies of cells staining for annexin v / pi + annexin indicating the total number of cells undergoing apoptosis (early and late) and necrosis; d: cells expressing caspase 3 active (late apoptosis). Dcs exposed to vegf during maturation are less capable of inducing ag - specific or mitogen - triggered lymphocyte proliferation - to determine whether the changes observed in vegf - exposed dcs (e.g., ido over - expression and accelerated apoptosis / senescence) would also translate into functional alterations, we next assessed ag - specific and pha - triggered lymphocyte proliferation . To this end, we employed a 2 x 2 factorial design in which we examined the level of autologous lymphocyte proliferation in the presence of dcs treated or not with vegf . We used two independent stimuli, a specific stimulus dependent on presentation (c. albicans) and a non - specific mitogen, pha, for four days of culture . We also repeated the experiment with pha, evaluating lymphocyte proliferation by ki-67 expression . To assess the effect of ido on the maturation step, the dcs were matured in the presence of pg + tnf + vegf and the ido - inhibitor 1-mt was simultaneously added to the cultures; the resulting dc population was then tested in proliferation assays . The vegf - treated dcs caused a reduction in lymphocyte proliferation in response to candida (fig . 6d - f) in comparison to the dcs matured in the absence of vegf . This result was further confirmed by a reduction in lymphocyte proliferation to pha according to ki-67 expression (fig . 7d, e). Of note, the addition of 1-mt to vegf - treated dcs generated dcs that were as affective as dcs matured without vegf (fig . 7d, f), indicating that the impaired proliferation observed in the co - cultures of vegf - treated dcs and lymphocytes was related to the activation of the ido pathway during the maturation phase . 6 t cell proliferation is impaired in the presence of dendritic cells (dcs) matured in the presence of vascular endothelial growth factor (vegf) lymphocytes were co - cultivated with autologous dc that were treated with vegf in addition to prostaglandin e2 + tumour necrosis factor alpha (pg - tnf) or only with pg - tnf during their maturation phase . Candida albicans was used to stimulate antigen - specific t lymphocyte proliferation (a - c). Histograms for lymphocytes labelled with side light scatter (ssc) vs. forward light scatter (fsc) are shown in b for co - cultures with pg - tnf - dc and in c for co - cultures with pg - tnf - v - dc . A: respective calculated indexes of cell division; d: respective calculated indexes of cell division for phytohemagglutinin (pha)-stimulated cultures; d - f: pha was used as t - cell mitogen; e, f: histograms of cfs - labelled lymphocytes co - cultured with dc matured without (e) or with vegf (f). 7addition of the inhibitor 1-methyl - d - tryptophan (1-mt) of indoleamine 2,3-dioxygenase (ido) prevents vascular endothelial growth factor (vegf)-matured dendritic cell (dc) from suppressing lymphocyte proliferation . T cell proliferation stimulated by phytohemagglutinin (pha) was estimated by flow - cytometry of cd3 + lymphocytes expressing the antigen ki-67 (a) lymphocytes gated on side light scatter (ssc) vs. forward light scatter (fsc) (b), histogram of gated cd3 + cells (c), ki-67 expression on cd3 + lymphocytes without stimuli (1.56% of the cells express the marker) (d), ki-67 expression on pha - stimulated cd3 + lymphocytes co - cultured with autologous dc matured without vegf (frequency of positive cells - 37.4%) (e), ki-67 expression on pha - stimulated cd3 + lymphocytes co - cultured with autologous dc matured with vegf (frequency of positive cells - 17.6%) and ki-67 expression on pha - stimulated cd3 + lymphocytes co - cultured with autologous dc matured with vegf in the presence of 1-mt as inhibitor of ido (frequency of positive cells - 35%) (representative of 3 independent experiments) (f). Although it is well known that vegf affects dc maturation, our results demonstrate for the first time that vegf increases the expression and activity of ido, which has a suppressive effect on ag - specific and mitogen - stimulated lymphocyte proliferation . Bcg was originally used as a maturation factor because of its similarity to lps and because it was already in use as a human therapy . However, we observed that pg + tnf induced a more robust phenotype than bcg in dc maturation; thus, we used only pg + tnf in these experiments . Because we did not use bcg in the ensuing steps, these evaluations are valid for inflammatory environments, but are not necessarily relevant to infectious pathways . 1998); furthermore, tnf- in combination with pg induces ido activity during dc maturation (trinchieri 1995, braun et al . Ido - expressing dcs are considered to be immunological tolerance inducers because they suppress lymphocyte activation and proliferation (munn et al . Although pge2 induces ido mrna expression through its receptor e - prostanoid 2 (ep2), enzyme activation is dependent on a second signal provided by tnfr or by tlr ligands (braun et al . In contrast to these findings, it was reported that the induction of ido expression by pge2 occurs through its receptor ep4 instead of ep2 and that pge2-matured dcs were more capable of inducing both allogeneic and ag - specific t cell proliferation when compared to dcs matured in the absence of this molecule (krause et al . 2007). More recently (lanzinger et al . 2012), it was shown that the stimulatory effect of pge2-matured dcs on allogeneic t cells is variable and may be highly context dependent . When the ido activity in the microenvironment is low, dcs act as effective stimulators of immune responses; however, once the enzymatic activity of ido predominates, these cells suppress t cell responsiveness and/or promote regulatory t cell responses . Because of the importance of ido as a regulator of immune responses and the ubiquitous presence of vegf in tumoural or inflammatory microenvironments, it was of interest to investigate whether vegf would affect ido expression by dcs . Indeed, our results show that ido expression by dcs was significantly increased in the presence of vegf compared to untreated dcs . In fact, both pg - tnf and vegf contributed to augment ido expression, suggesting a synergistic effect . Corroborating these data, we also observed that the induction of dc maturation by pg + tnf significantly increased the expression of vegfr1, thereby facilitating synergic signalling by vegf (dikov et al . Our data concerning the ultrastructure of dcs treated with vegf revealed morphological changes, predominantly vacuolation, which were compatible with processes that ultimately lead to cell death . This was further confirmed by annexin v / propidium iodide staining of vegf - treated dcs, which is indicative of apoptosis / necrosis (henics & wheatley 1999, orabona et al . The accelerated apoptosis of vegf - treated dcs was most likely caused by a combination of factors . First, as has been previously shown, pg can stimulate programmed cell death by inducing the pro - apoptotic protein bax (lalier et al . 2011); second, vegf acting in synergy would most likely further enhance apoptosis . In addition, tryptophan is an amino acid that is essential to cell survival and ido activation reduces its availability to the cell (broker et al . 2005). One important question, however, was how dcs exposed to vegf would function as regulators of the immune response . We found that specific (c. albicans) and mitogen - induced (pha) lymphocyte proliferation were reduced in the presence of vegf - treated dcs . This effect was due to ido activity, as confirmed by experiments in which the addition of a specific ido inhibitor (1-mt) during the maturation of vegf - dcs completely abolished their suppressive activity on lymphocyte proliferation . Another mechanism by which dcs develop an immunosuppressive phenotype is the ingestion of apoptotic cells (da costa et al . Because the dcs added to the co - cultures were mature and also -irradiated, their phagocytic activity was much reduced; thus, it is unlikely that such a mechanism was important to the observed suppression of lymphocyte proliferation in our assays . In addition, phagocytosis of apoptotic cells was not observed in our tem examination of sections of vegf - matured dcs . Taken together, our results suggest that vegf plays a role in the complex process of immunological tolerance, as it can stimulate dcs to over - activate the ido pathway . The ensuing tryptophan depletion leads to the inhibition of t cell activation and expansion (grohmann & bronte 2010, kushwah & hu 2010). In addition, dcs that express ido can stimulate the cellular general control non - depressible 2 kinase - dependent stress response in nave and mature t cells and in functionally quiescent t regulatory cells, leading to active bystander suppression (fallarino et al . These mechanisms have broad implications in the study of immunological responses and tolerance under conditions as diverse as cancer, graft rejection and autoimmunity.
Lactobacillus rhamnosus gg (lgg) is a gram positive lactic acid bacterium that is part of the commensal microflora in humans . It is generally regarded as safe and has been used extensively in food products and health supplements . Meta - analysis of probiotic supplementation during pregnancy and early infancy indicates a reduced risk ratio of developing eczema in early infancy . A meta - analysis of lgg supplementation showed increased treatment responders in subjects with abdominal pain related gastrointestinal disorders and irritable bowel syndrome . Ohashi et al . Also found that long - term consumption of lactobacillus casei was associated with the reduced risk of bladder cancer . Lgg was also shown to possess antitumor effects in animal models of bladder cancer [6, 7]. The antitumor effects were comparable to that induced by mycobacterium bovis, bacillus calmette - gurin . Intravesical instillations of lgg resulted in an influx of dendritic cells (dcs) and neutrophils . Despite bcg's efficacy it is associated with significant side - effects and less toxic therapies are needed; thus this study further evaluates the immunotherapeutic potential of lgg . Dcs are antigen presenting cells that play an important role in cancer immunotherapy by stimulating cytotoxic t lymphocytes (ctl) and polarizing t helper cells towards a th1 profile . Dc maturation causes enhanced expression of surface costimulatory molecules and production of cytokines and chemokines . However, extensive stimulation of dc can result in dc exhaustion that is characterized by diminished production of il-12 which is necessary for ctl induction and interferon gamma (ifn) production . Dc exhaustion can be the result of prolonged exposure to a stimulus or exposure to a very high dose of a stimulus either of which scenarios are possible when analyzing the interaction of microbes with immune cells . Miyazaki et al . Showed that, upon inflammation, neutrophils migrate from the site of infection to neighboring lymph nodes where they undergo apoptosis and are taken up by dcs, thus ensuring that neutrophil derived antigens are presented to t cells . Neutrophils are also able to directly transfer antigens to dcs as was demonstrated by morel et al ., studying bcg infected neutrophils . This work evaluates the impact of the dose of lgg and time of exposure on dc activation in the absence and presence of neutrophils and the consequent stimulation of t cells . The mouse orthotopic tumor model used to assess the intravesical instillation of lgg into the bladder followed the clinical protocol of bcg immunotherapy and was performed over a 2-hour time frame . Thus, this was the minimum time of interaction that was analyzed and 18 h was chosen as the maximum time of interaction as, beyond this time frame, dc viability was greatly reduced after exposure to a high dose of lgg . The death induced by lgg on longer exposure may be a consequence of lactic acid production as observed with cancer cells exposed to lgg . L. rhamnosus gg (national collections of industrial and marine bacterial ltd ., uk) was streaked onto deman rogosa sharpe (mrs) agar (difco laboratories, usa) and incubated at 37c in 5% co2 . Single colonies were used to produce seed cultures (9 h) which were used to start 50 ml cultures . Bacteria were harvested at the late log phase by centrifugation (1699 g for 10 minutes at room temperature) and washed twice with sterile saline (0.85% nacl). The colony forming units (cfu) were determined by plating serial dilutions of the bacterial samples on mrs agar plates which were incubated at 37c in 5% co2 . Protocols were approved by the institutional animal care and use committee (iacuc) at the national university of singapore . Bone marrow derived neutrophils and dc were generated as previously described . In brief, neutrophils were derived by positive selection with anti - ly6 g microbead kit (miltenyi biotec, germany) and were at least 95% positive for ly6 g, by flow cytometry . Dcs were obtained from the bone marrow derived cells after 9 days of culture (with fresh media replacement every other day) in rpmi 1640 supplemented with 10% heat - inactivated fcs, 50 m 2-mercaptoethanol, 1% penicillin, streptomycin, glutamine, mem (minimum essential medium), and 0.1% sodium pyruvate with 40 ng / ml of gm - csf (bd bioscience, usa). The media used for both neutrophil and dc experiments were dmem supplemented with 10% fetal bovine serum (hyclone, usa), 2 mm l - glutamine (gibco, japan), 50 g / ml penicillin g (sigma aldrich, usa), and 50 m of 2-mercaptoethanol (merck, germany) with the addition of 20 ng / ml of gm - csf for the culture of dendritic cells . T lymphocytes were isolated from spleens of naive c57bl/6 mice and enriched with the easyseptm t cell isolation kit (stemcell technologies, vancouver, canada). The lgg to cell ratios of 5: 1 and 10: 1 were defined as exposure to low dose lgg, while exposure to a ratio of 100: 1 was defined as exposure to high dose lgg . Neutrophils (5 10) and dcs (2.5 10) were cocultured with lgg at bacteria to mammalian cell ratios of 5: 1, 10: 1, and 100: 1 for 2 h in 24-well plates, before 200 g / ml of gentamicin was added for 2 h at 37c to kill extracellular lgg . Cells were washed thrice with pbs to remove extracellular bacteria and then neutrophils were incubated with dcs (2.5 10) for 18 h and dcs were incubated in fresh media for 18 h. untreated neutrophils and dcs were evaluated as controls . For 2.5 10 dcs the bacteria cfu that corresponded to 5: 1, 10: 1, and 100: 1 were 1.25 10, 2.5 10, and 25 10 cfu . The neutrophils (5 10 cells) were treated with 2.5 10, 5 10, and 50 10 cfu of lgg that corresponded to 5: 1, 10: 1, and 100: 1, lgg to cells . For the dc 18 h experiment the dcs were exposed to lgg for 18 h. similarly cells were treated with bcg at a 5: 1 ratio . The supernatants were assayed for tnf-, il-12p70, and il-10 (ebioscience, san diego, usa) and prostaglandin e2 (pge2) (cayman chemical, usa) by elisa using a genios pro microplate reader (tecan, switzerland). The cells were harvested in pba (pbs with 1% bovine serum albumin and 0.01% sodium azide) for flow analysis of surface markers . Il-10 and cox-2 were inhibited by pretreatment with 400 ng / ml of anti - il-10 antibody (biolegend, san diego, usa) and 10 m of ns398 (sapphire bioscience, australia), respectively, for 30 mins at 37c prior to addition of bacteria and fixed dcs were double stained with anti - cd11c antibody and antibodies of the following surface markers: cd40, cd80, cd83, cd86, and mhc ii (biolegend) or the respective isotype controls in pba (1x pbs with 1% bsa, 0.05% sodium azide) for 20 mins at 4c . After that the cells were washed once and resuspended with pba before they were analyzed with bd facs canto using facs diva software (becton dickinson, usa). Dcs or t cells were resuspended in lda medium (nctc 109 and rpmi 1640 [1: 1]), supplemented with 10% heat - inactivated fcs, 10 mm l - glutamine, 1 mm oxaloacetic acid, 0.2 u of bovine insulin per ml, and 50 m 2-mercaptoethanol . Naive t cells (1.0 10 cells / ml) were cultured with untreated dcs (1.0 l0 cells / ml) or dcs stimulated with lactobacilli for 2 h and 18 h (treated as described above), in 200 l of lda medium in 96-well u - bottom plates at 37c under 5% co2 for 5 days . One - way anova with post hoc bonferroni test was used to analyze all the data except for the comparison of cytokine profile of the treatment groups with anti - il-10 antibody or ns398 and their respective controls, which were analyzed with student's t - test . A short exposure (2 h) to low dose lgg (lgg to cell ratios of 10: 1 and 5: 1) reduced dc viability slightly (91.7 2.0% and 94.7 1.7%, resp .) And there was little loss in viability even at 18 h. exposure to activated neutrophils had a similar effect . However at a prolonged exposure of 18 h to high dose lgg (100: 1 lgg to dc ratio), there was reduced dc viability (63.7 1.8%). About 50% of neutrophils were dead (apoptotic and necrotic death) at 18 h after the initial 2 h exposure to lgg regardless of dose . But in contrast there was increased lgg internalized with exposure to increased lgg dose . At a 5: 1 ratio of lgg: neutrophils there were 228 51 cfu internalized/5 10 neutrophils and this almost doubled after exposure to 10: 1 and more than doubled again after exposure to 100: 1 lgg to neutrophils . Activation markers on nave dc were examined and after exposure to lgg there was a significant increase in all markers with respect to nave dc, table 1 . As a further control dcs after high dose lgg exposure for 2 h, there was significantly (p <0.05) higher expression of cd80, cd86, and cd40 compared to low dose lgg . But at 18 h coincubation with lgg, expression of cd86 and cd40 was significantly reduced (p <0.05) after exposure to high dose lgg compared to low dose lgg . Dcs cocultured with neutrophils, activated with low doses of lgg for 2 h, showed higher expression of cd86 and reduced cd83 compared to dcs exposed directly to low dose lgg for 2 h. dc exposed to bcg at a dose of 5: 1, for 2 h or 18 h, or stimulated by neutrophils activated with bcg did not show a difference in surface marker expression . In contrast lgg at the same dose showed changes in the expression of cd83 and cd86 . Neutrophils cultured with lgg showed decreased mhc class i expression, no increase in mhc class ii expression, and an increase in cd11b expression when placed directly in contact with lgg . Cd11b is an activation marker for neutrophils and has been shown to activate dc maturation via interaction with dc - sign . Mhc class ii mean fluorescence index (mfi) showed a doubling on exposure to low dose lgg or activated neutrophils, table 2 . The mfi for mhc class ii, cd40, and cd80 was decreased after exposure to dc activated for 18 h, with either high dose lgg or neutrophils activated with high dose lgg (p <0.05). But the reverse was true for cd83 when dcs were exposed to high dose lgg for 18 h (p <0.05), table 2 . More il-10 was produced after exposure to high dose lgg (figure 1(a)) for 2 h and 18 h and via neutrophil mediated activation . Tnf- production was higher in dc exposed to high dose lgg (figure 1(a)) for 2 h, but at 18 h, dc exposed to low dose lgg produced more tnf-. Both indirect (via neutrophils) and direct dc activation for 18 h resulted in more il-12p70 production after low dose lgg exposure (figure 1(a)). With a short 2 h exposure to lgg, lgg activated neutrophils (2 h) induced more il-10, tnf-, and il-12p70 production in dc compared to dc exposed directly to low dose lgg for 2 h. at high dose lgg there was no significant difference in il-12p70 and tnf- production, whether the dc was stimulated directly with lgg or with activated neutrophils . In contrast, when dc and neutrophils were exposed to bcg at a 5: 1 ratio, there was comparable production of il-10 from all groups except dc exposed to bcg for 18 h. the amount of il-12p70 produced after bcg stimulation was at least 10-fold lower than that produced by lgg . Since, at high dose lgg, il-10 production is significantly higher in dcs, as well as dc treated with activated neutrophils, we determined if the dose dependent effects on il-12 production were due to il-10 levels . Pge2 is known to modulate il-10 expression; induce indoleamine 2,3-dioxygenase (a potent suppressor of dc function); and modulate chemokine production and dc maturation and il-12p70 production [1820]. Therefore pge2 and il-10 production / function were inhibited individually and the impact on il-12p70 production was monitored, figure 1(b). There was a significant increase in pge2 levels on dc stimulation with high rather than low dose lgg . At the concentration of ns398 that completely blocked the production of pge2 (figure 1(b)) there was no significant effect on either il-10 or il-12p70 levels, figure 1(b). Blocking il-10 with a neutralizing antibody this corresponded to 2.1- and 4.4-fold increases, respectively, in dc stimulated with neutrophils activated with low and high dose lgg . Expression of surface markers on dendritic cells was not significantly affected by the presence of either the anti - il-10 antibody or ns398 (data not shown). Neutrophils stimulated with lgg did not induce ifn production by t cells (figure 2(a)) but induced il-2 production (figure 2(b)). Dcs stimulated with lgg activated neutrophils induced a significant increase (p <0.05) in ifn production (figure 2(a)) and a slight increase in il-2 production by t cells (figure 2(b)) similar to dc directly activated with low dose lgg . The dc - neutrophil - t cell triple cell culture by itself induced il-2 production . A dose dependent effect was clearly seen with ifn production (p <0.05) (figure 2(a)) which was consistent with the decrease in il-12p70 production that was observed earlier . Direct or indirect dc activation with low dose lgg for 2 h induced more ifn and il-2 production by t cells (p <0.05 for ifn) compared to high dose lgg, figures 2(a) and 2(b). At 18 h on activation by lgg, there was an increase in the percentage of dc expressing cd40, cd80, and cd86 with increasing dose . But only cd40 had a significant increase in mfi (p <0.05), indicating increased protein expression . Cd86 and cd80 interact with cd28 on t cells while cd40 binds to the cd40 ligand on t cells to induce t cell activation . On prolonged exposure (18 h) to high dose lgg, the percentage of cells expressing cd86 and cd40 and the mfi of cd40, cd86, and cd80 were reduced . Thus, these dcs may not be as able to activate t cells as efficiently; that is, there is a point beyond which lgg dose can be inhibitory to dc activation . A similar effect was observed with l. casei which also has antitumor effects and other commensal lactobacilli such as l. gasseri, l. johnsonii, and l. reuteri . Different lactobacillus species induce variable levels of il-10, il-12, and tnf- via toll - like receptor (tlr) dependent activation of dc . Indirect dc stimulation via lgg activated neutrophils showed no difference in tnf- production with increasing dose . Lgg is known to adhere to epithelial cells with greater ability than other lactobacillus species . Such binding to dc may also increase the cellular signals triggered by direct interaction with dc . Found that lgg pili s spacba could interact with dc - sign and that blocking this interaction reduced dc cytokine production . Dc - sign also modulates tlr activation and it is possible that lgg pili interaction with dc - sign could have modulated tlr activated cytokine production . An 18 h exposure to low dose lgg produced more tnf- and il-12 than exposure to high dose lgg . It is likely that prolonged exposure led to increasing phagocytosis of lgg with time which resulted in triggering the downregulation of tnf- and il-12 production . Il-12 production is tlr2 independent but tlr9, myd88, and ros dependent . However, with a short exposure to lgg there was a dose dependent effect only on tnf- production which might reflect tlr2 engagement . As neutrophils are generally the first to encounter microbes and move to the lymph nodes to educate dc, we evaluated the dose effect of lgg on the ability of neutrophils to activate dc . Stimulating dc with lgg treated neutrophils exposed to low dose lgg induced higher cd86 than direct stimulation of dcs with lgg . Neutrophils cultured with high dose lgg induced a decrease in the mfi of cd40, cd80, and cd83 (p <0.05) on dcs . Though the number of neutrophils undergoing apoptosis was similar at all doses of lgg the number of internalized lgg increased with dose of lgg . The latter may have resulted in increased lgg or lgg components being transferred to dc [11, 12] causing strong stimulation of dc and consequently dc exhaustion . In line with this hypothesis, il-12p70 and tnf- production were much higher when the dcs were cultured with neutrophils activated with low dose lgg . Dcs are known to internalize apoptotic cells which like necrotic cells are able to stimulate dc . Phagocytosis of apoptotic cells induces anti - inflammatory signals such as the high levels of il-10 which was found in this study . Ifn production was higher in t cells cocultured with dc and neutrophils treated with low dose lgg for 2 h rather than high dose lgg . Similarly, when dcs were treated with lgg at 200: 1 bacteria to cell ratio, phenotypic maturation and cytokine production but not th1 polarization were observed . Instead, the cd4 cells were converted to hyporesponsive t cells that secrete low ifn. Thus, for optimal t cell activation, low dose lgg is overall the better therapeutic option . Prolonged stimulation of dcs (for 24 h or longer) can result in the loss of the ability to produce cytokines like il-12, which is termed dc exhaustion [9, 34]. Reported that the optimal temporal window to induce dc maturation in order to have sustained il-12 production for cancer immunotherapy is narrow, with a time frame of 1018 h, but our results indicate that a 2 h exposure is sufficient for dc maturation . Further lgg was much better at inducing il-12p70 production than bcg, the current standard therapy for bladder cancer . Il-10 is widely reported to downregulate dc maturation [35, 36] and its ability to activate t cells as well as induce dc apoptosis . Pge2, a potent inducer of il-10, was also found to be produced in greater amounts when dcs were stimulated with neutrophils treated with high dose lgg . However, it was still lower than the levels produced by dc coculture with neutrophil stimulated with low dose lgg, suggesting that there are other inhibitory factors aside from il-10 . Low dose lgg stimulates dc to induce greater th1 polarization in t cells compared to high dose lgg . In mice lgg (1 10 cfu/100 l) was effective at reducing tumor growth with comparable efficacy to bcg connaught (1 10 cfu / ml). The former is roughly in the range of a 100: 1, lgg to cells for 2 h. thus future analysis should consider the effect of a 10-fold lower dose of lgg as an immunotherapeutic agent . The dose response is an important consideration if lgg is to be used for human bladder cancer therapy.
Squamous cell carcinoma may arise from dysplastic epithelium or may be entirely independent of it . In the indian population, field cancerization (slaughters theory) is found to be extremely prevalent, thereby throwing up fresh challenges for the surgeon . Squamous cell carcinoma primarily spreads via direct invasion and lymphatic routes. [13] invasive carcinoma is histologically graded and specified as well - differentiated, moderately well - differentiated, or poorly differentiated types . The grading of the tumor serves as an important aid to the overall biologic behavior of the tumor . Tumors which more closely resemble their native tissue are considered to be well differentiated (low grade). This is in contrast to the tumors exhibiting significant cytomorphologic atypia and demonstrating little or no resemblance to native squamous epithelium . These lesions are considered to be poorly differentiated (high grade) and have an increased propensity for regional metastasis and a poorer prognosis . Perineural spread, lymphatic invasion, and tumor extension beyond the lymph node capsule usually point to a poorer prognosis overall . Generally, metastasis from oral squamous cell carcinoma most frequently develops in the ipsilateral cervical lymph nodes . Tumors of the lower lip and floor of mouth may initially involve the submental lymph nodes, but this is relatively rare. [24] contralateral or bilateral cervical metastases canal occur especially in tumors of the base of the tongue, in advanced tumors, and in tumors that occur near the midline . If a tumor perforates the nodal capsule and invades into the surrounding connective tissue, the node will feel fixed and immobile . As many as 30% of oral cancers have cervical metastases, either palpable or occult, at the time of initial evaluation . Distant metastases are most common in the lungs, prostrate, liver, and bones, but any part of the body may be affected. [14] in all cases of suspected oral carcinoma, the neck should be staged prior to biopsy of the primary tumor; otherwise, regional reactive lymphadenopathy develops subsequent to biopsy, thus hindering the appropriate staging of disease . Unfortunately, some patients may have microscopic lymph node disease which may not be detected clinically, and as such, elective neck dissections are sometimes performed to eliminate this eventuality, though the role of positron emission tomography (pet) scans has been debated . The most important indicator of prognosis which serves to establish appropriate treatment modalities is the staging of oral cancer . Staging protocol depends on quantifying three basic clinical features: size of primary tumor, status of regional lymph nodes, and the presence or absence of metastasis . The american joint committee on cancer (ajcc) utilizes the tumor, lymph node, and metastases (tnm) classification system for their staging protocol . At our center, we also incorporate the guidelines for treatment of oral cancer, as determined by tata memorial cancer centre in mumbai . Although surgery is the primary mode of treating squamous cell carcinoma of the head and neck, radiotherapy and chemotherapy, either alone or in combination, play important roles . The goal of surgery is to eradicate all visibly gross disease and at the same time provide adequate disease free margins to counter the risk of microscopic metastasis [figures 1 and 2]. Resected primary with free margins to limit microscopic disease spread the disease (gross) free neck with preservation of internal jugular vein, sternocleidomastoid muscle and spinal accessory nerve in our center, the neck is cleared as per the regional cancer centre, thiruvanthapuram protocol, where the continuity of the specimen may be sacrificed to preserve all the vital structures, similar to functional neck dissection, but all the gross disease with margins of a minimum of 2 cm are carefully removed . Dissections are performed for patients who have positive lymph node involvement at the initial workup stage and entails complete removal of all lymphatic tissue from the neck (levels i iv), though elective dissections are performed for all patients with tumor size more than 1.5 cm regardless of neck node involvement due to the poor patient compliance regarding follow - up in our center . The classic radical neck dissection includes comprehensive node dissection with removal of the sternocleidomastoid muscle, internal jugular vein, and spinal accessory nerve . Modified radical (functional) neck dissection was developed to diminish the morbidity by removing all cervical nodes but preserving important anatomical structures . Selective neck dissections involve the removal of lymph node groups at highest risk of containing metastasis from a primary tumor . Radiotherapy is primarily used as postoperative treatment for cases in which resection margins are not free of tumor, or there is surgical inaccessibility, or there has been perineural growth and bone invasion . All cases in our center are sent for a radiotherapy reference prior to and after surgery . Chemotherapy may also be given as palliative treatment to patients with locally recurrent disease, which cannot be cured with surgery or radiotherapy, or to patients with distant metastases. [13] successive treatment of squamous cell carcinoma of the oral cavity involves a combination of addressing the anatomic site of the primary cancer, status of the neck, anticipated functional and cosmetic results, anticipated patient compliance, and the overall medical status of the patient . We feel that the ability to control oral cancer depends upon two principles: prevention and early detection . Therefore, with squamous cell carcinoma being the most common head and neck malignancy, it is mandatory that all dental professionals and facio - maxillary surgeons examine all patients with precancerous disease and early disease, with an emphasis on maximum patient education.
To report a case of bilateral ophthalmic artery occlusion in rhino - orbito - cerebral mucormycosis . An 89-year - old man with poorly controlled diabetes developed sudden bilateral ptosis, complete ophthalmoplegia of the right eye, and superior rectus palsy of the left eye . Brain and orbit magnetic resonance imaging showed midbrain infarction and mild diffuse sinusitis . On the 2nd day of hospitalization, sudden visual loss and light reflex loss developed . There were retinal whitening, absence of retinal arterial filling, and a total lack of choroidal perfusion on fluorescein angiography of the right eye . The left eye showed a cherry red spot in the retina and the absence of retinal arterial filling and partial choroidal perfusion on fluorescein angiography . On rhinologic examination, mucormyosis was noticed . Despite treatment, visual acuity and light reflex did not recover and he died 4 days after admission . An 89-year - old man presented with sudden onset of bilateral ptosis on november 2, 2005 . Three days prior to hospitalization, the patient was diagnosed with diabetes mellitus and had a history of surgery for gastric cancer, which occurred four years ago . His fasting glucose level and postprandial (2 hr - after - meal) glucose level were 196 mg / dl and 300 mg / dl, respectively . Complete ophthlamoplegia of the right eye and superior rectus palsy of the left eye were observed . His anterior segment examination was notable for moderate nuclear sclerotic cataracts and mild chemosis, while fundoscopic examination revealed no specific abnormal finding . Brain and orbit magnetic resonance imaging (mri) revealed no specific abnormal findings in the cavernous sinus and orbit, except bilateral midbrain infarction and mild diffuse sinusitis (fig . The bilateral ptosis and superior rectus palsy of the left eye were regarded to be caused by 3 nuclear palsy . The results of csf analysis showed that white blood cell count and protein were elevated and intravenous antibiotics were given for a central nervous system infection . On november 3, 2005, the visual acuity of both eyes decreased to perception of hand motion and bilateral complete ophthlamoplegia developed (fig . Fundoscopic examination revealed that the optic disc was pale and the posterior pole was generally edematous in both eyes . Fluorescein angiography (fag) demonstrated that retinal vessels were not imaged, even 10 minutes after injecting the dye . Choroidal perfusion was not found in the right eye and partial choroidal fluorescence was observed in the left eye (fig . Thus, he was diagnosed with simultaneous bilateral ophthalmic artery occlusions . On the same day, rhinologic examination revealed a destructed nasal septum, black necrotic lump in the nasal cavity and an ulcer on the hard palate, which was confirmed as murcomycosis upon biopsy (fig . Rocm was diagnosed and amphotericin b (50 mg / day) was intravenously administered . Although extensive local excision was required, the patient and his guardian rejected to have surgery . On november 6, 2005, the patient died . Typical rocm initially involves general weakness, headache in the occipital area, fever and bloody rhinorrhea . Subsequently, facial and/or orbital cellulitis, ptosis, and ophthlamoplegia occur.1 in this case, 3 nuclear palsy, 4th, and 6th cranial nerve palsies of the right eye initially developed and subsequently, ophthalmolplegia of the left eye and bilateral ophthalmic artery occlusions followed . Ferry et al.2 reported 16 patients with rhino - orbito - cerebral mucormycosis . In their report, rhinologic symptoms were mostly common initial symptoms (11 cases), while ocular pain and facial cellulitis were observed in 6 and 5 cases, respectively . This patient did not complain of rhinologic symptoms, although rhinologic examination revealed a black eschar in the nasal cavity . Absence of a cherry red spot in the retina and fag finding of the right eye are consistent with concomitant choroidal and retinal ischemia . Although a cherry red spot in the retina was present in the left eye, retinal arterial imaging was not found, and partial choroidal perfusion was observed . The lack of sign of anterior segment ischemia can be explained by incomplete ophthalmic arterial occlusion . Also, the 3 cranial nerve palsy of the right eye may have been caused by orbital ischemia, infarction of the midbrain, or both . In this case, the brain mri revealed no specific abnormal findings in the cavernous sinus and orbit, except bilateral midbrain infarction . It suggested that midbrain infarction caused the ophthalmoplegia; however, ocular ischemia secondary to invasion of the orbital artery cannot be excluded as the cause of ophthalmoplegia . The mechanism of orbital ischemia is that the hyphae have a marked tendency to invade and thrombose arteries.3,4 in this case, the orbital apex was not involved according to radiologic examination . A case of unilateral orbital infarction syndrome associated with rhino - orbito - cerebral mucormycosis has been reported in korea.5 when the eye is infected, the choroids usually exhibit the greatest number of organisms, the fungi having entered the globe via the ciliary arteries.3,4 as is the case with acute central retinal artery obstruction, retinal opacification is also present with acute ophthalmic artery obstruction . However, the latter it is usually more pronounced, both in the severity and the extent of the area involved . The presence of a cherry red spot with an acute ophthalmic artery obstruction is variable . With an ophthalmic artery obstruction, the presence or absence of a cherry red spot is probably determined by the degree of choroidal hypoperfusion, the rapidity of onset of vascular compromise, and the duration of the insult . The most common causes of ophthalmic artery and/or central retinal artery occlusion are embolization from ulcerated plaques of the carotid artery and atherosclerotic occlusion of the internal carotid artery . However, it is extremely rare for either one of these etiologies to cause bilateral visual loss . Brown et al.6 reported a case of acute simultaneous bilateral obstruction of central retinal and posterior choroidal circulations in atrial fibrillation and typhoid fever . A case of virtually simultaneous bilateral ophthalmic artery occlusions was reported in a patient with acquired immunodeficiency syndrome and central nervous system lymphoma . In rocm, visual loss usually has been attributed to ophthalmic artery and/or central retinal artery occlusions; however, most previous reports covered unilateral or sequential ophthalmic artery and/or central retinal artery occlusions . Physicians should be alerted to rhino - orbito - cerebral mucormycosis in patients who present with ocular abnormalities, including orbital cellulitis, ptosis, and ophthlamoplegia, and have diabetes mellitus or a weak immune system . A high index of suspicion is very important for the early diagnosis of this very progressive disease . Our case illustrates that patients with rhino - orbito - cerebral mucormycosis can have bilateral ophthalmic artery occlusion and loss of vision within a few days.
Preconference workshop a: the nuts and bolts of antibody development: accelerating antibody drugs to the clinic . Co - chairs: james larrick (panorama research institute and velocity pharmaceutical development llc) and mark alfenito (engen bio, inc .) The silver anniversary antibody engineering & therapeutics meeting will be kicked off with a dynamic, audience - participatory workshop on antibody drug development chaired by veterans jim larrick (panorama research institute and velocity pharmaceutical development llc) and mark alfenito (engen bio, inc . ). Larrick's introductory remarks regarding an investor's perspective on therapeutic antibody drugs, max vasquez (adimab) will describe state - of - the - art bioinformatic and in silico methods to facilitate preclinical antibody development . Akbar nayeem (molecular discovery technologies) will expand on this topic describing computational methods to optimize the structure of clinical candidate antibodies . Next, nicola beaucamp (roche innovation center penzberg) will describe roche's integrated approach to chinese hamster ovary (cho) cell line selection, upstream process, downstream process and analytics to deliver high - quality bispecific antibodies . The first, by dorina saro (johnson & johnson), on the development of analytical and biophysical tools to select bispecific monoclonal antibody (mab) candidates will focus on product develop - ability, and the second, by thi - sau migone (igenica biotherapeutics), will cover proteomic - based discovery of a novel hematologic cancer target and ind - enabling studies of a site - specific antibody - drug conjugate (adc). Preconference workshop b: advances in precision targeting chair: paul whi parren (genmab) precise targeting by biopharmaceuticals remains a major challenge in almost all therapeutic areas . This workshop brings together a number of experts who will present recent key knowledge - based advances to optimize target binding for increased specific activity . Juergen schanzer (roche innovation center penzberg) discusses xgfr, a novel glycoengineered bispecific antibody scaffold targeting egfr and igf-1r that combines potent signaling inhibition and antibody - dependent cell - mediated cytotoxicity (adcc), demonstrating improved targeting properties compared with tetravalent bispecific formats . Christopher thanos (halozyme therapeutics) and sanjay khare (immungene, inc .) Will discuss advances in adc targeting to improve therapeutic index . Thanos engineered an egfr antibody for increased tumor specificity, leading to activity against kras / braf - mutated tumors in vivo . Khare demonstrates selective targeting of an interferon (ifn) payload with reduced systemic toxicity . After the break, davide corti (humabs biomed sa) will turn our attention to infectious disease, in which escape from antibody targeting remains a critical topic . Corti shows studies for a number of antibodies derived from human infection that employ various antiviral mechanisms to allow for extraordinary breadth in activity against a range of virus subtypes and subfamilies . Rudolf kerschbaumer (baxter innovations gmbh) will discuss novel data on the well - known pleiotropic proinflammatory cytokine macrophage migration inhibitory factor (mif). Kerschbaumer isolated antibodies that target oxidized mif (ox - mif), a previously unrecognized disease - related variant of the cytokine with interesting activity against cancer - associated inflammation and in vivo tumor growth inhibition . Finally, yuki iwayanagi (chugai pharmaceutical co, ltd) will complete the session by discussing a novel approach to enhance the clearance of soluble antigens by making use of engineered antibodies that combine ph - dependent binding activity with enhanced selectivity for the igg fc receptor fcriib . Overall, the session highlights a number of novel insights and important advances in the selection or engineering of antibodies that, through better precision, bear great promise for the development of improved immunotherapies . Keynote presentations chair: james d. marks (university of california, san francisco; san francisco general hospital) the meeting will open with keynote presentations by five luminaries in the field of molecular therapeutics development . Douglas a. lauffenburger (massachusetts institute of technology) will discuss systems analysis of cell communication network dynamics for therapeutic biologics design . Although the targets of antibodies and other protein drugs are identifiable and specifically addressable, understanding the effects of corresponding perturbations within complex tissue pathophysiology contexts requires multi - variate analysis of key components of the myriad of cellular and molecular actors potentially involved in execution and regulation of phenotypic behaviors in integrated manner . Lauffenburger will inform meeting participants of how his group is pursuing development of in vivo systems biology approaches to meet this challenge . Ira pastan (national cancer institute) will discuss his extensive experience with the development of recombinant immunotoxins (rits) composed of a cancer cell - targeted fv or fab fused to a portion of pseudomonas exotoxin a. rits targeting either cd22 on leukemias or mesothelin on mesotheliomas have produced complete and dramatic remissions in some patients, but their efficacy is limited by immunogenicity and capillary leak syndrome (cls). To overcome these deficiencies, pastan's group has identified and removed b- and t - cell epitopes and sequences responsible for cls to produce new immunotoxins with high efficacy, low immunogenicity and low side effects . James wells (university of california, san francisco) will give his views on engineered antibodies for challenging targets . Antibody phage display technologies have proven useful for selecting high quality, reliable and renewable antibodies . Many technological challenges remain, however, for selecting antibodies that can activate functions or bind specific ptms, and for developing high through - put technologies . Dr . Wells will present recent work to select conformationally selective antibodies as activators or inhibitors, new scaffolds for anti - peptide antibodies for ptms, and a new automation platform for large - scale antibody phage selections . Ian tomlinson (glaxosmithkline) will discuss the past, present and future of antibody repertoires . Over twenty years have passed since the first high - affinity antibody was selected from a naive library without the use of animals or any form of immunization . Today, many large libraries and many different display technologies can be used to identify such antibodies, but only a few antibodies made this way have made it to the market . Tomlinson will present his views on events of the last two decades, and address the questions: what were the barriers? What were the key advances? And what is state of the art today? In commemoration of the 25 anniversary of the conference, anthony rees (rees consulting ab and emeritus professor, university of bath) will provide a historical perspective on the antibody molecule and the remarkable journey scientists have taken while trying to understand its functions . As prof . Rees will recount, this journey has included controversy, excitement beyond belief and disappointment, and, if truth be told, where we are today is as much an accident as the result of a logical itinerary . Track 1: immunocytokine engineering co - chairs: james s. huston (the antibody society: huston bioconsulting, llc) and stephen d. gillies (provenance biopharmaceuticals) the potential merits of cytokine therapy, such as interleukin (il)-2 administration in treating cancer, have long been recognized but it was blocked from routine use by adverse side effects that were generally not tolerated by patients at the dosages necessary for therapeutic effects . This barrier was eliminated with the observation in 1992 by stephen d. gillies and co - workers that antibody - targeted il-2 stimulates cytotoxic t - cell killing of tumor cells at doses far below the threshold for il-2 toxicity . They genetically fused il-2 to the c - termini of both h chains in the targeting antibody . Since antibody - cytokine fusion proteins are localized in tumors by virtue of association of the antibody with its tumor target, the il-2 fusion partner can be concentrated exactly where it is needed, so it is locally effective at doses far below the systemic therapeutic window required for il-2 alone . This discovery was made when antibody engineering had emerged with a new generation of methods and molecules that provided for antibody - targeted delivery of human therapeutic fusion proteins . I.e., a variety of fusion proteins, alternative cytokines and distinct targets, will discuss their work, along with two more recent converts to the development of immunocytokine (ic) therapeutics . The session marks a pivotal juncture for these singular immunotherapeutics, and will include presentations on the latest advances in ic engineering to the most recent clinical results . Stephen d. gillies (provenance biopharmaceuticals) will open the session by orienting the audience with some background on ics and the overall field . He will then discuss his progress in the design and engineering of entirely new formats of ics . These are intended to be a new generation of ics that can integrate cytokine immunomodulatory effects with antibody effector functions to achieve significant improvements in ic capabilities . Dario neri (eth zrich) will describe their vigorous activities on the engineering of advanced ics that utilize il-2, il-4, il-10, and il-12 for the treatment of different diseases, three of which have already advanced to phase 2 clinical trials . His most recent preclinical advancement involves a trifunctional diabody immunotherapeutic that combines an il-2 ic with site - specific conjugation to the dm1 maytansinoid microtubular inhibitor . It displays exceptionally potent anti - tumor activity and thus opens the prospect for a new class of tripartite targeted anti - cancer agents . Sherie l. morrison (university of california los angeles) has contributed many firsts to engineered antibody therapeutics . These include chimerized antibodies (human c domains and murine v domains, as exemplified by rituximab) and scfv fusions to the c - termini of the h chains in igg (currently a favored design for tetravalent bispecific antibodies). She has contributed to the ic field from its early years, developing an interest in targeted ifn . She will discuss her group's research, emphasizing her interest in anti - tumor antibody - ifn fusion proteins for cancer therapy . Paul sondel (university of wisconsin) has maintained a major interest in ic therapy after beginning studies with anti - gd2 chimeric 14.18 ab-(il-2) fusion proteins . As an m.d. Ph.d . Scientist, he is particularly well - qualified to bridge the gap between preclinical studies and clinical investigations with patients . He will describe insights with patients that are sometimes distinct from mouse model - derived conclusions . He has combined his ic interests with a dedication to developing a cure for childhood neuroblastoma and continues to pursue this goal with important clinical trials . K. dane wittrup (massachusetts institute of technology) invented antibody - yeast display libraries and has leveraged that technology to propel his research into diverse areas of cancer biology and antibody engineering . He has worked on aspects of cellular immunology during much of the past decade, and recently became interested in the definition of boundary conditions and design objectives for ic engineering, which he will discuss in this session . Ekkehard moessner (roche innovation center zrich) is the head of protein engineering for roche pharmaceutical research and early development . He will discuss their progress in development of a novel class of ics that include an optimized il-2 . They have tried to separate the cytokine contributions from adcc by making antibody fusions with or without the fc region . This will be a stimulating conclusion to a session that offers many examples of how scientific creativity is an ongoing process in the ic field . Conceptual progress in understanding ic mechanisms of action provide the basis of more advanced molecular designs and improved protocols for ic administration . This will ultimately reinforce the addition of ic therapy to routine clinical use, in oncology and other areas of medicine . Track 2: the high - hanging fruit: targeting difficult antigens chair: andreas plckthun while the different selection methods (phage display, ribosome display, yeast display) have become rather mature over the years, the great majority of targets have been individual proteins, which can be expressed and purified, and thus handled in a well understood and rather similar manner . In this session chaired by andreas it will probably be emphasized by the speakers that an important part to success is the ability to produce the target in the first place . The first part of the session will be devoted to integral membrane proteins particularly those which do not have a significant extracellular domain, and where the problem cannot simply be solved by expressing only the extracellular piece . The two key examples of such difficult proteins are g - protein - coupled receptors and ion channels . It goes without saying that these two protein classes have a huge potential as disease - relevant targets . Markus enzelberger (morphosys) will talk on the challenges of selecting antibodies binding to gpcrs and how the use of stabilized gpcrs, obtained either by directed evolution or by alanine scanning, has helped in this endeavor . Furthermore, advanced screening methods play a decisive role . A different approach will be presented by michael gallo (innovative targeting solutions), who has generated antibodies against the glp-1 receptor and glucagon receptor, two class b gpcrs . Here the antibodies were engineered to contain pieces of the natural ligand and libraries were generated on this principle . Stefan zahn (novo nordisk) will present approaches to target t - cell specific ion channels such as crac, and the approaches which are necessary for achieving this . In the talk by andreas plckthun (university of zurich) a very different challenge will be addressed: is it possible to direct a targeting agent to the cytoplasm with high efficiency? The challenge is to engineer a cell - specific uptake mechanism that is much more efficient and much less cell - toxic than the traditionally used cell - penetrating peptides or hypercharged proteins . Yet another challenge is the generation of specific antibodies against non - proteins, e.g., glycans . This can be of interest since some glycans are massively overexpressed in tumors, and might therefore constitute very generically useful targets . Lindy durrant (university of nottingham) will present new results on antibodies targeting such specific glycans . Much of the above technology development might be short - cut if it was possible to design an antibody binding site de novo to any structurally defined surface . Sarel fleishman (weizmann institute) will give an update on what has been possible in using the rosetta software package, and the experimental validation of novel binders . Morning track 1: high quality research antibodies against the proteome chair: andrew bradbury (los alamos national laboratory) the current lack of standardized, renewable and low - cost protein affinity reagents impedes progress in biomedical research . This session will update participants on a number of initiatives intended to produce and distribute such reagents . In his extended chairman's introductory remarks, andrew bradbury will provide his insights to the problems existing with research antibodies, as related to functionality, characterization and reproducibility, proposing possible solutions . He will be followed by andreas plckthun (university of zrich), who in his inimitable manner will open the session by examining whether creating a repertoire of binding agents against all proteins is practical, as compared to an alternative approach in which technologies are developed, and implemented, to create affinity reagents rapidly and in high throughput on demand to the requirements of the intended experiment(s). David l. rimm (yale university school of medicine) will relate his group's experience with the use of antibodies both in the research and clinical setting, and show how errors in assessment or validation can produce flawed data . He will also provide guidelines for antibody validation that can be used to avoid these problems . Anthony kossiakoff (university of chicago) will update participants on the activities of the recombinant antibody network (ran), which is an international consortium of 3 expert centers at the university of chicago, university of toronto and the university of california at san francisco . These centers are unified under a common set of goals, technologies and operational procedures, and each has a robotic technology platform capable of generating high - quality recombinant antibodies in a high throughput manner . Ran is currently undertaking large proteomics - based projects to rapidly produce, validate and distribute high impact antibodies to the community . Andrew bradbury (los alamos national laboratory) will describe the generation of renewable recombinant polyclonal antibodies using a combination of phage and yeast display, and the analysis of these polyclonals using next - generation sequencing . Roberto d. polakiewicz (cell signaling technology, inc .) Will discuss the current problem of inadequate validation of marketed research antibodies, and the potential for problems with the quality of the large quantities of antibodies that would be needed to cover the whole proteome . He will then present new strategies for effective discovery and validation of high quality mabs . A progress report on the national institutes of health's protein capture reagents initiative will be given by seth blackshaw (johns hopkins university school of medicine). The goal of the initiative is to generate and distribute standardized, renewable and low - cost protein affinity reagents to the scientific community . Blackshaw will update participants on the initiative's progress toward generation of monospecific mabs targeting a broad range of human transcription factors . Chair: ian tomlinson (glaxosmithkline) the concept of hard - wiring 2 binding specificities into a single antibody molecule has been around for over 25 y and there are now over a hundred of these bispecifics in preclinical and clinical development . Despite the availability of several validated platforms for making such bispecifics and the obvious application for combination targeting in cancer or immune - mediated disorders, one of the real challenges remains choosing the precise pair of targets to go after in such a format . Haijun sun (f - star biotechnology) will open the session with a presentation on fcabs, which are fc fragments with mab - like antigen binding capability . Fcabs can serve as a modular platform for testing bispecific target combinations through both rational design and empirical approaches . They can also be developed as drugs or replace the fc of a mab to create a bispecific molecule . Simon chell (glaxosmithkline) will discuss effective target identification, stressing the importance of the manufacturability of new antibody architectures such as bispecific antibodies . Martin steegmaier (roche innovation center penzberg) will describe how careful target selection and the development of the crossmab technology for creation of bispecific heterodimeric antibodies has led to the discovery of molecules that are efficiently transferred from the blood to the brain . In a preclinical model, the brain shuttle, which exploits receptor - mediated transcytosis and dual targeting, was shown to increase target engagement of investigational antibodies in the brain by over 50-fold compared to the parent antibody . Janine schuurman (genmab) will draw on her experience with the duobody platform to provide general strategies and considerations for bispecific antibody discovery . The importance of using the final format for bispecific discovery approaches will be illustrated with surprising results found during the selection of a lead cmetxegfr bispecific antibody . Michael t. stumpp (molecular partners) will update participants on the latest results with multispecific darpins, including inhibitors of soluble targets, receptors, and localized action darpins . These non - antibody small binding proteins have proven useful in understanding the biology of target combinations . In concluding the session, jijie gu (abbvie biopharmaceuticals) will discuss how to select bispecific target pairs and how to select the right molecules with desired pharmacological and development properties while taking the safety and efficacy of the molecules into consideration . Afternoon track 1: antibody - based therapeutics for diabesity chair: james larrick (panorama research institute, velocity pharmaceutical development) novel therapies to address the global pandemic of diabesity diabetes and obesity- are urgently needed . Session chair james larrick (panorama research institute, velocity pharmaceutical development) will kick off this session by providing a perspective on the problem and the potential role of antibody - based therapeutics . Next, gerd wallukat (max delbrch center for molecular medicine) will describe work on autoantibodies (aabs) against gpcrs found in sera of patients with cardiovascular diseases . These aabs are directed against epitopes localized on the first or second extracellular loop of the membrane - spanning hormone receptors and act like the corresponding agonists . The aabs directed against these epitopes induce their agonist - like effect by cross - linking and stabilization of the active receptor conformation . In contrast to the classical agonists, the functional aabs prevent the receptor desensitization normally seen if the receptors were stimulated for a longer time with the agonists . Because these aabs act like the corresponding receptor agonists and prevent the receptor desensitization, such aabs may play a role in the pathogenesis of several cardiometabolic diseases . Various glucagon - like peptide (glp)-1 therapies (e.g., liraglutide, exenatide, dulaglutide) exhibit efficacious glycemic control, but limited weight reduction in patients . Bo yu (larix bioscience llc) will describe efforts to improve glp-1-fc fusions utilizing antibody membrane switch (ams) technology, which employs a switchable cell - surface display of the glp-1-fc fusion protein . Sachdev sidhu (university of toronto) has developed a comprehensive set of synthetic antibodies that act as antagonists and agonists of the fgfr / klotho signaling pathway . Antibodies displaying different effects in the modulation of signaling pathways related to diabesity will be described . After a break, maria groves (medimmune) will describe approaches employed by medimmune to generate potent antibody therapeutics to a selection of targets implicated in diabesity . Lead isolation, affinity maturation strategies and preclinical data for the antibody therapeutics will be discussed . Next, mingyue zhou (amgen) will describe development of novel lcat proteins for modulating hdl metabolism and reverse cholesterol transport (rct). A modified lcat protein with fc fusion (mlcat - fc) exhibited enhanced enzyme activity, improved manufacturability, and desirable pharmacokinetic and pharmacodynamic properties in preclinical models, including cynomolgus monkeys . Mlcat - fc administration to rabbits generated large hdl particles, promoted reverse cholesterol transport (rct), and attenuated progression of atherosclerosis . A panel of novel agonistic human anti - lcat antibodies suitable for therapeutic development will also be discussed . There is enormous interest in the blockbuster potential of proprotein convertase subtilisin / kexin type 9 (pcsk9) antibodies . The final presentation by jesper gromada (regeneron pharmaceuticals) will focus on antibody therapies to pcsk9 for the regulation of plasma ldl - c and angiopoietin - like protein 3 (angptl3) to increase lipoprotein lipase activity and lower circulating triglyceride levels . We anticipate an exciting afternoon of first - rate science in this most important field . Afternoon track 2: preclinical and clinical case studies: emerging targets, new approaches chair: kerry a chester (university college london) in her opening remarks, chair kerry chester (university college london) will introduce a series of studies focused on emerging targets and approaches with potential to expand the scope of current immunotherapeutic and diagnostic imaging agents . Mesothelin (msln) is becoming an increasingly attractive target for delivery of potent toxins, as it is highly expressed in a range of epithelial cancers but has very limited expression in healthy tissue, predicting low non - specific toxicity . Klaus bosslet (roche diagnostics gmbh) will begin by giving an update on their latest work with rg7787, a recombinant antibody - toxin fusion protein that targets msln with a de - immunized 24-kd fragment of pseudomonas exotoxin . Rg7787 is effective against both quiescent and proliferating tumor cells and has shown potential for clinical development in triple - negative breast and gastric cancers . The development of therapeutic antibodies capable of targeting intracellular proteins will be addressed by david a. scheinberg (memorial sloan kettering cancer center). The work constitutes a paradigm shift for pharmaceutical anti - cancer antibodies which, despite the abundance of intracellular tumor targets, have traditionally been directed to cell - surface or extracellular molecules . The approach exploits the fact that degraded small peptides from intracellular proteins are presented on the cell surface in the pocket of major histocompatibility complex (mhc) class i molecules . The presentation will focus on wilms tumor protein (wt1), an intracellular, oncogenic transcription factor that is overexpressed in a wide range of cancers, but has limited expression in normal adult tissues . Scheinberg's group has developed antibodies to rmfpnapyl (rmf), a wilms' tumor1-derived hla - a*02:01 epitope . The antibodies have been generated in multiple formats, including a glycoengineered human igg1 with enhanced adcc function (eskm) and bispecific forms . Mark cobbold (university of birmingham) will present an intriguing approach to selectively harness the power of adaptive immunity using immunogenic viral epitopes covalently coupled to clinically relevant antibodies . This novel therapeutic entity, termed an antibody - peptide epitope conjugate (apec), has been designed to release the viral antigens by proteolytic cleavage only in close proximity to the surface of the tumor . The technology renders tumors susceptible to immune attack by mimicking viral infection and engaging a potent t - cell response, with engineered control of which t cells engage with the target cell . In vitro and in vivo work will be used to demonstrate proof - of - concept . Chimeric antigen receptors (cars) are fusion proteins that link an extracellular antigen binding domain, usually a single chain fv (scfv), with intracellular t - cell signaling domains . In clinical studies, patient's peripheral blood t - cells are engineered to express cars by transduction with integrating vectors, resulting in generation of antigen specific car t - cells that can target and kill cancer cells . Car t - cells are highly potent cellular therapeutics which, despite the complexity of the treatment, are emerging as a realistic therapeutic option for the clinic . After the refreshment break, martin pule (university college london) will present his work on clinical development of cars and will discuss the challenges of finding tumor targets with acceptable on - target off - tumor toxicity . A new approach in directing cars against multiple myeloma using a high - affinity natural ligand rather than an scfv will be presented . In addition, the concept of using a combinatorial approach will be introduced, exploring the ability of engineered t cells to sample and trigger in response to patterns of antigen expression on target cells . Ror1 is a type tyrosine - kinase - like onco - embryonic surface antigen that is expressed in early development and has an emerging role in cancer biology . Ror1 is expressed by a variety of human cancers, including solid tumors of the colon, lung, and pancreas and chronic lymphocytic leukemia (cll), the most common blood malignancy in adults . Expression of ror1 enhances the growth, survival, and migration of cancer initiating cells in vitro and in vivo . Thomas j. kipps (moores ucsd cancer center) will show the latest results from an evaluation of a first - in - class anti - cancer stem cell antibody targeting ror1 . The mab drug has recently entered a phase 1 trial to evaluate whether it is a safe and well - tolerated cancer stem cell - targeted agent in patients with cll . Michel eisenblaetter (king's college london) will conclude the session with a discussion of multi - modal molecular imaging of immune cell activity with antibodies that target the exosome - associated calcium binding proteins s100a8/a9, which are key markers of activated monocytes . Results from in vivo fluorescence and radionuclide imaging of s100a8/a9 expression indicate that s100a8/a9 has utility as new target for diagnostic imaging of immunosuppressive inflammation . The work is ground breaking because, although early detection, localization and monitoring of inflammation are crucial for tailoring individual therapies, reliable biomarkers to detect local inflammatory activities and predict disease outcome are not yet available . Morning track 1: antibody effector functions co - chairs: dennis r burton (the scripps research institute) and paul whi parren (genmab) on wednesday at 8 am, chairs dennis r burton and paul whi parren will be ready to kick - off an exciting session on antibody effector functions . So fill up on plenty of coffee, and join us for the first part of the session, which focuses on the interaction of antibody with igg fc receptors (fcr). Mark cragg (southampton university) will show data on a novel class of antagonistic anti - fcriib antibody for tumor therapy that overcomes previously experienced drawbacks of inhibitory signaling and internalization, and that bears promise for combination therapies with contemporary therapeutic mabs . Mark hogarth (burnett institute) will discuss recent data identifying critical functional polymorphisms between human and macaque fcr with important implications for research, as well as non - clinical safety studies with human mab in non - human primates . David szymkowski (xencor) will present 2 case studies of antibodies with fc domains exhibiting enhanced fcriib binding . By making use of specific fcriib functions, an anti - cd19 antibody was derived that inhibits b cell function without inducing depletion, whereas an anti - ige antibody, among others, exploits fcriib's role in antigen clearance as its mechanism of action . Following the break, this is a novel platform to enhance effector function after antibody binds its cognate antigen on the cell surface . Development of the platform was built on the novel insight provided by the observation that fc - mediated hexamerization on cell surfaces is required for optimal complement activation . Sophia karagiannis (king's college london school of medicine) will discuss ige as an exciting novel class of antibody for immunotherapy of cancer with unexpected and superior activity compared to the matching igg counterparts . Richard blumberg (brigham and women's hospital) will conclude the session by presenting his recent work on the critical, but previously unappreciated, role of the interaction between the neonatal fc receptor fcrn and antibody in modulating both innate and adaptive immune responses . In summary, you can look forward to an eye - opening session in which a number our best studied and favorite proteins are shown to convey novel functions, activity and therapeutic promise . Morning track 2: new targets and applications in immune checkpoint inhibitors chair: gregory p adams (fox chase cancer center). Antibodies targeted against inhibitory or activating receptors on immune effector cells are rapidly emerging as powerful agents for the treatment of cancer and other diseases . The approval of ipilimumab (anti - ctla-4) and more recently pembrolizumab (anti - pd-1) for the treatment of melanoma represent the first of what will likely be a large panel of clinically - approved antibodies capable of modulating the immune response to treat a variety of diseases . Blocking inhibitory receptors to promote immune responses against cancer and blocking activating receptors to diminish autoimmune responses represent the most obvious applications, but other potential indications will likely include prevention of the rejection of organ transplants and stimulation of the immune system to fight infectious diseases . This session will focus on recent efforts in developing new agents for these and related applications . The session will be opened by sumit k. subudhi (md anderson cancer center) who will describe how the recent successes with anti - ctla-4 and anti - pd-1/pd - l1 antibodies can be improved on by targeting a variety of other immune checkpoints, including icos, b7-h3, b7-h4, lag-3, 41bb, ox40, cd40, that have shown promise in preclinical studies . He will discuss the identification of promising targets and the design of agents with potential therapeutic properties . Stephen willingham (stanford university school of medicine) will then discuss the role played by cd47 in the protection of cancer cells from phagocytosis by the innate immune system . He will describe a humanized monoclonal antibody (hu5f9-g4), which was developed by his group to block the interaction between cd47 and its ligand sirp- on phagocytic cells . Willingham will share the results of in vivo preclinical studies demonstrating the ability of hu5f9-g4 to inhibit tumor growth and metastasis of hematologic malignancies and solid tumors . A novel approach to inhibit the suppressive activity of tregs using neutralizing antibodies directed against garp (glycoprotein a repetitions predominant) will be presented by michael saunders (argen - x). Antibodies targeting critical epitopes on garp expressed on the surface of tregs block its ability to bind tgf--1, which plays a key role in treg - mediated immunosuppression . Saunders will share evidence of the ability of one of their anti - garp antibodies, mhg-8, to inhibit immune suppression mediated by tregs in a graft - versus - host disease model induced by transplantation of human pbmcs (+ /- autologous tregs) into immunocompromised nod / scid / il2rg-/- mice, suggesting a potential role of anti - garp antibodies in the treatment of cancer or chronic infections . Holbrook kohrt (stanford university) will discuss the role played by activated cd137 (41bb) on nk cell - mediated adcc of cancer . He will present the results of studies showing that the addition of an agonistic anti - cd137 antibody enhanced the antitumor activity of rituximab, trastuzumab and cetuximab both in vitro and in vivo . The inhibition of t cell costimulation has emerged as an attractive alternative to the use of highly toxic immunosuppressive drugs in the prevention of organ transplant rejection . However, clinical trials with belatacept, a novel fusion receptor biologic that binds to cd80/86 with high affinity and inhibits costimulation signals to t cells did not achieve the success seen in preclinical studies . Flavio vincenti (university of california, san francisco) will describe new approaches using combinations of belatacept with inhibition of the cd40/cd154 pathway, anti - il6 or possibly infusion of t regulatory cells to increase belatacept efficacy in the prevention of renal transplant rejection . While therapies that interfere with ctla-4 and pd-1 have been very promising in the clinic, many cancer patients fail to respond to these therapies . Ana carrizosa anderson (harvard medical school) will describe her work studying how the tim family of molecules regulate t cell responses and the development and evaluation of agents that block signaling through tim-3 and other novel checkpoint targets . Afternoon track 1: engineering antibody developability: expression, solubility and polyreactivity chair: k dane wittrup (massachusetts institute of technology). To advance in development as therapeutics, antibody leads must have appropriate biophysical properties, as well as suitable binding affinity, target specificity and functional activity . In this session, speakers will provide practical advice on the design and selection of antibodies that should have minimal downstream problems . Yan wu (genentech) will open the session with a discussion of antibody lead selection . Yingda xu (adimab) will describe high throughput assays that target detection of antibody self- and cross - interaction to predict the fate of an antibody during expression, purification, storage and serum clearance . Bojana popovic (medimmune) will illustrate how an in silico spatial aggregation propensity tool was used in conjunction with antibody engineering to improve the stability and pharmacokinetic profile of medi-1912, an anti - nerve growth factor mab, without compromising potency or affinity . Silke hansen, (roche innovation center penzberg) will describe the production of high quality, complex format antibody molecules, including bispecific antibodies and antibody fusion proteins consisting of up to 4 different polypeptide chains, in a single cho cell line at . As dr . Hansen will discuss, the application of diligent cell line selection strategies, supported by high throughput analytical methods, were critical to the successful identification of cell clones with well - characterized cell properties giving rise to a stable product profile and high product quality . Ernest smith (vaccinex, inc .) Will provide details of an antibody discovery platform that enables efficient mammalian cell - based expression of a library of human antibodies in full - length igg format on the surface of vaccinia virus . Upon infection of mammalian cells, the antibody is incorporated into newly produced virus and displayed on the surface of the host cell . This approach combines the advantages of virus panning and cell sorting into one technology . To conclude the session, diana bowley (abbvie bioresearch center) will give an overview of an informatics platform that supports the design, cloning, expression, and purification of large panels of bispecific dual - variable domain immunoglobulin (dvd - ig) candidates bowley will describe how the platform is also used to assess properties of the molecules, including selectivity, cross reactivity, epitope binding, and stability . The system can thus enable the parallel engineering of 1,000s of dvd - ig molecules via combinatorial design of v - domains, linker positions and lengths, and fc chains . Afternoon track 2: emerging clinical data with therapeutic antibodies and adcs chair: louis m weiner (georgetown university medical center) therapeutic antibodies and adcs have important clinical applications in the treatment of cancer and other diseases . This session will focus primarily on emerging data from antibodies that target immune checkpoints to treat cancer . Starting with antibodies targeting ctla4, as presented by nils lonberg (bristol - myers squibb), the field has rapidly expanded to include antibodies targeting the immune checkpoints pd-1, as presented by omid hamid (the angeles clinic and research institute) and jonathan cheng (merck), and pdl1, as presented by edward cha (genentech), and antibodies against additional immune checkpoints are being developed . Moreover, combinations of immune modulating antibodies, such as ipilimumab plus anti - pd-1 demonstrate extremely promising activity in patients with advanced malignant melanoma . Important emerging clinical indications include non - small cell lung cancer, as presented by hossein borghaei (fox chase cancer center). Finally, adcs are beginning to fulfill their clinical promise, as exemplified by the success of ado - trastuzumab emtansine, an anti - her2: maytansinoid conjugate . As presented by kyle holen (abbvie), another agent that is showing early promise, abt-414, targets activated egfr and delivers a cytotoxic payload . The antibody society's special session rounding out wednesday's program, meeting participants will get a glimpse of the future at the antibody society's special session on antibodies to watch in 2015 . The commercial pipeline of antibody therapeutics is highly dynamic, with a multitude of transitions occurring during the year as molecules advance through the clinical phases and onto the market . The president of the antibody society, janice m. reichert (reichert biotechnology consulting llc; editor - in - chief, mabs), will recap the important events of 2014, including the first approvals of 5 antibody therapeutics (vedolizumab, ramucirumab, siltuximab, nivolumab and pembrolizumab), and discuss expectations for 2015 . Recent results suggest that activity in 2015 may be even greater than 2014, which was a banner year for transitions into pivotal studies, as well as for first marketing approvals . Relevant data for transitions to first phase 3 studies that occurred in 2014 and those projected for 2015 will be summarized . Metrics for novel antibody therapeutics development, and the evolving field of biosimilar antibody development, will also be discussed . Track 1: antibody repertoires: next generation sequencing, data analysis, storage and sharing chair: jamie k scott (simon fraser university) the advent of next - generation sequencing (ngs) allows deep analysis of immune repertoires, a term collectively referring to antibody repertoires (comprising the b - cell receptors (bcrs) and antibodies produced by b - cells and plasma cells, respectively), and to t - cell receptor (tcr) repertoires . Productively rearranged vl and vh genes encode the variable domains of antibodies and b - cell receptors; similarly, those of v and v genes encode the variable domains of / t - cell receptors . B- and t - cell mrna encoding antibodies and tcrs, or plasmid dna encoding phage libraries, constitute the material from which ngs immune repertoires are derived . V regions from tens of millions of cells or phage clones can be sequenced in bulk with high coverage (i.e., in the 100 s of millions) to arrive at dna sequences reflecting a repertoire's sequence diversity and relative copy numbers . From such data, the progress of phage library screenings can be precisely followed; antibody and tcr repertoires can be assessed in depth (e.g., following residual disease after treatment for leukemia or lymphoma), and differences among b- and/or t - cell populations can be assessed between healthy vs. diseased states, and after vaccination . As well, somatic mutations among clonally related antibodies can be identified, and analyzed to reveal the the purpose of this session is to provide participants in this year's antibody engineering and therapeutics conference a taste of current progress in immune - repertoire ngs data acquisition, analysis, storage and sharing . The first half of the session will focus on immune repertoire library technology and data analysis . Brandon dekosky (university of texas, austin) will present new methods for high - throughput analysis of paired antibody / bcr heavy and light chain variable - region (vh and vl) sequences from b cells and plasma cells . (los alamos national laboratory) will discuss ngs data - analysis tools her group has used to identify selected antibody clones from a phage - displayed, single - chain (scfv), nave antibody library . And finally, ramy arnaout (beth israel deaconess medical center) will present his analysis of ngs data from murine bone marrow and splenocytes, which identified vh genes from non - productive and nave follicular and marginal - zone b - cells subsets . His analysis reveals biased vh gene - segment usage among these b - cell subsets, and from this, differential pathways for follicular and marginal - zone b cell maturation . The second half of this session will focus on the storage and sharing of immune repertoire ngs data . Felix breden (simon fraser university) will present ireceptor, a distributed data management system for sharing and comparing immune repertoires . In this scheme, users store primary data at their local sites, which they bring to the ireceptor system for analysis of their and other users data . David johnson (gigagen, inc ..) will present clonalysis, a cloud - based web portal for the storage and analysis of ngs immune repertoire data . He has developed tools to rapidly perform cdr3 analysis, v - gene assignment, and clustering of related sequences . Finally, lindsay cowell (ut southwestern medical center) will present vdjserver, a web portal for storing, analyzing, sharing and archiving immune repertoire data . She is also developing standards for data sharing and interoperability, and analysis pipelines to support data reproducibility . Track 2: the best of both worlds: antibodies with enhanced or multiple functionalities chair: mark r alfenito (engen bio, inc .) As a class of drugs, antibodies are uniquely complex because they can come ready - armed with multiple functions, including a targeting function represented by the variable regions that can have blocking, agonizing or antagonizing functions, and effector functions, contained within the c domains, conferring adcc, opsonization and complement functions . This session will cover several strategies to take advantage, and enhance the flexible nature, of antibody functions . Zhenping zhu (kadmon china) will discuss several formats of an anti - pd - l1 (programmed death ligand) antibody, including immunoconjugates, and show both in vitro and in vivo data of their efficacy . Takehisa kitazawa (chugai pharmaceutical co) will show the use of a bispecific antibody to recreate a very novel function, that of binding coagulation factors ixa and x, for the treatment of hemophilia a. this is the first time a hemophilia treatment has been reported at this antibody conference . The molecular design of the molecule will be discussed, along with preclinical and early clinical data . Bent jakobsen (immunocore ltd) will also speak about bispecific antibodies, the immtacs (immune mobilizing monoclonal t cell receptors against cancer). This talk will cover engineering of immtacs, evidence for potent and specific killing of tumor cells and details of their mechanism of action . In addition, the latest clinical data on the most advanced immtac, imcgp100, will be presented . Kristian jensen (dutalys) will discuss dutamabs, a form of bispecific antibody with 2 binding sites in each fv region . The presentation will illustrate their benefits, using a case study of a novel bispecific angiogenesis blocker with best - in - class properties in the areas of affinity, potency, stability, solubility, manufacturability and tolerability . Ronit mazor (national cancer institute) will speak on the engineering of antibody - toxin conjugates that minimize patient toxicity and immunogenicity by silencing human t cell epitopes contained within the molecule . Mazor will present data for a redesigned immunotoxin with t cell epitope mutations that demonstrates high cytotoxicity to cells isolated from cancer patients, and that produces complete remissions in mice with human cancer xenografts . Finally, david miao (concortis biosystems) will discuss the enhancement of an antibody's efficacy by delivery of a toxic payload via their adc technology . Antibody therapeutics for non - cancer indications chair: trudi veldman (abbvie) the last session of the meeting highlights the diversity of approaches to disease modification with antibody therapies . In addition to blocking inflammatory and disease promoting processes driven by pro - inflammatory cytokines, the focus has now been extended to blocking negative regulators such as myostatin and lingo-1 to achieve muscle growth and remyelination, respectively . Clinical experience is now emerging with several of these antibodies, and these studies will inform us whether the preclinical promise of these approaches will translate to the clinical setting . Tony de fougerolles (ablynx) will present the unique scientific opportunities for the use of single domain antibodies (nanobodies) and the experience in preclinical and clinical development through several case studies in the fields of inflammation and host defense . Next, dimiter dimitrov (national cancer institute) will discuss the significant efforts to develop mabs against several emerging and biodefense - related viruses as candidate therapeutics and prophylactics . Three exceptionally potent new mabs against mers - cov and their potential for therapy of humans will be described . Lioudmila tchistiakova (pfizer) will present interesting results from studies of 2 antibodies to myostatin (gdf-8), a negative regulator of muscle growth, which were both evaluated in clinical trials . Detailed studies of the structural interactions of the antibody rk35 with the target may provide insight into the superior clinical efficacy that was obtained with this antibody . Dupilumab, an anti- il4r antibody that inhibits both il4 and il13 signaling, blocks th2 inflammation in patients with moderate - to - severe atopic dermatitis and eosinophilic asthma . Neil graham (regeneron pharmaceuticals) will present data on the clinical efficacy and safety of dupilumab in these two conditions . Then, john latham (alder biopharmaceuticals) will discuss a novel strategy to prevent migraine using a potent anti - cgrp antagonistic antibody . Ald403 is a humanized, high - affinity mab that targets the neuropeptide cgrp, which has been shown to play an important role in migraine initiation and propagation . A summary of the properties of this antibody in preclinical studies and the efficacy in a human clinical trial will be presented . Multiple sclerosis (ms) researchers are looking beyond anti - inflammatory drugs to halt disease progression and are interested in exploring neuronal repair mechanisms that have the potential to be groundbreaking therapies in the treatment of ms and other neurodegenerative diseases . Of special interest are the ongoing studies with biib033, an antagonist antibody to lingo-1, which is a negative regulator of oligodendrocyte differentiation and myelination . Werner meier (biogen idec) will discuss the discovery, engineering and development of biib033 for the treatment of ms.
External fixation has gained wide acceptance in osteotomy, limb lengthening, and treatment of open fractures because it enables easy reduction of bone fragments, even under unfavorable soft tissue conditions, and secondary corrections and modifications can be made.1 despite these positive qualities, there is still a high incidence of pin site infection, which may cause mechanical deterioration of the bone - pin interface and lead to pin loosening and osteomyelitis.26 pin site infection is due to indigenous micro - organisms adhering to the pin surface and subsequently forming aggregates that may lead to formation of a biofilm and eventual spread of infection to the surrounding host tissue . Reported rates of pin site infection vary widely in the literature, ranging from virtually zero to over 50%.3,5,6 generally, the cleaning and/or dressing of pin sites and systemic antibiotics are used for prevention and treatment of pin site infection.3,6 however these anti - infection measures have limitations . Pins with deep infection should be removed and suppression of infection must be given priority, which means that continuation of treatment with external fixation for the primary disease becomes impossible . An additional problem arising from pin site infection is the risk of deep tissue infection, such as osteomyelitis, when converting external fixation to internal fixation, because of penetration of the skin barrier.7 therefore, a new strategy for prevention and treatment of pin site infection is required . Modifications to biomaterial surfaces enable programming of cells to substratum events, thereby diminishing infection by inhibiting bacterial adhesion or by enhancing tissue compatibility or integration . Recent studies by other groups have investigated the bactericidal effects of silver and antibiotics used as coatings for metal materials.813 however, mass et al aborted a study of the clinical application of silver - coated pins due to elevated blood levels of silver ions.9 furno et al concluded that the clinical failure of silver is mainly due to obliteration by proteinaceous materials in the human body.10 development of bacterial resistance to silver coating has also been reported.11 another group demonstrated the antibacterial effect of pins impregnated with tobramycin or gentamicin in an animal model . However, there are still concerns about the side effects of these agents and the emergence of resistant strains of bacteria.12,13 the bactericidal activity of photocatalytic titanium dioxide (tio2) has recently been highlighted as an alternative strategy to assist in environmental purification of water and air because of its high catalytic activity, chemical stability, low energy requirements, and nontoxic properties.14,15 pure titanium and titanium alloys are widely used in modern orthopedic surgery because of their high resistance to corrosion and their biocompatibility . Tio2 photocatalysts have strong oxidizing ability and can decompose various organic compounds when exposed to ultraviolet light by generating active oxygen species, such as free hydroxyl radicals, superoxide anion radicals, and hydrogen peroxide . This photodecomposition of organic compounds is also useful for killing bacteria, so self - sterilizing surfaces can be prepared . It has been confirmed that these active oxygen species can destroy the outer bacterial cell membrane, ultimately leading to nonselective cell death without fostering drug - resistant species, as well as decompose endotoxins and provide nourishment for bacteria.1620 in our previous in vitro studies, tio2 film had a strong photocatalytic bactericidal effect on staphylococcus aureus,21 which is one of the main bacteria causing pin site infection and can easily become antibiotic - resistant.9,2224 arciola et al found that s. aureus accounted for about 68% of bacteria isolated from infected incision sites postoperatively.22 tio2 can act as a potent biocidal agent because of its high oxidation potential and nonselective reactivity, so we hypothesized that a tio2 photocatalyst might reduce the risk of harmful pin site infection and then conducted an in vitro experiment . The purpose of the current in vivo study was to evaluate the efficacy of photocatalytic tio2 in inhibition of infection when using percutaneous external fixation pins in a rat model under low energy ultraviolet illumination . The substrates were prepared using 2 mm diameter pin screws (atlas sports and medicine co, ltd, nagasaki, japan) made of stainless steel (sus316l) which is the basic material in external fixation pins . The native oxides were removed by cleaning the samples with distilled water and acetone and then immersing them in a mixture of aqueous hf and hno3 acids . The plasma source ion implantation apparatus used in this study has been described elsewhere.21,25 this implantation method has several advantages compared with other methods, including a large area, multiple targets, and reasonable costs . Tio2 films were deposited onto the stainless steel pins using titanium tetraisopropoxide plasma in the chamber . A pulsed high negative bias voltage of 18 kv was applied to the sample holder at a pulse duration of 10 sec with a pulse repetition rate of 1 khz . The pin was annealed at 923 k for one hour to obtain a crystalline anatase tio2 film . The pins were divided into two groups (30 control pins and 30 pins coated with tio2). Glancing - angle x - ray diffraction patterns for the tio2 pins showed peaks at positions corresponding mainly to an anatase - type structure, including a rutile one, and x - ray photoelectron spectroscopy revealed the chemical composition was almost all tio2 . Energy - dispersive spectroscopy indicated that the homogeneous microstructure was composed of titanium, oxygen, and elements of stainless steel . Cross - sectional analysis of the tio2 layers revealed an average thickness of 1.0 m, with no interfaces evident between the substrate and the dense layer . The surface roughness parameters for tio2-coated stainless steel (ra = 808 nm, rz = 1674) were almost the same as for untreated stainless steel (ra = 837 nm, rz = 1755), as reported in our previous study.21 micrographs of the surfaces of the tio2-coated pins were obtained using a field emission scanning electron microscope (jsm 6400f, jeol, tokyo, japan). This series of in vivo experiments was performed in accordance with the principles stated in the established guidelines for the treatment of animal subjects, and animal welfare assurance was strictly maintained . S. aureus (seattle 1945 strain, atcc 25923) was incubated for 6 hours at 37c in 10 ml of trypticase soy broth . The bacterial cells were harvested by centrifugation at 3000 rpm for 10 minutes and then suspended in sterilized distilled water to a concentration of 1 10 cells / ml . Sixty female, 7-week - old sprague - dawley (specific pathogen - free) rats were obtained from charles river laboratories japan inc, yokohama, japan . The animals were housed individually in a secure, climate - controlled facility for the duration of the experiment . The operative procedure was performed under general anesthesia by intraperitoneal administration of a sodium pentobarbital (50mg / kg of body weight). The insertion areas on the hind limb of each animal were shaved, and the area over the femur was aseptically prepared with 70% ethanol . A small linear skin incision (about 12 mm) was made and the pins were inserted through the incision into the femoral bones (one pin per bone), followed by bacterial contamination with 100 l of an identifiable s. aureus strain on the insertion area, ie, the skin - pin interface . Ultraviolet a light was emitted using a black light source set 30 cm above the rats for 30 minutes . In our previous in vitro study, the tio2-coated material significantly suppressed the viability of bacteria after 30 minutes of ultraviolet illumination,21 so the illumination time was set to 30 minutes . The intensity of the light was 2.0 mw / cm at a peak wavelength of 352 nm . The pin sites were examined daily and the dressings were carefully changed to avoid cross - contamination of the pin sites . Additional treatment, including incision closure, blood coagulation, or antibiotic dressing was not needed . On day 14, visible clinical findings at each pin site were classified according to pin site infection criteria as no infection, inflammation or serous drainage without frank purulence, or frank purulence.26,27 clinical determination of infection was defined as all three observers being in agreement . After evaluation by eye, the animals were sacrificed and the bone and soft tissue around the pin were retrieved . We used an automated microbiology system (bd phoenix system, nippon becton dickinson co, tokyo, japan) to identify the bacteria isolated (panel type pmic / id-68). The tissues obtained were fixed for one day in a 10% formalin solution buffered at ph 7.2, dehydrated through a series of graded alcohol solutions, and embedded in paraffin . Immediately after removal of the pins, 4 m thick longitudinal sections in the sagittal plane were cut using a microtome (hm325, thermo scientific mircom, walldorf, germany) with a 40 degree stainless steel knife, taking care not to damage the bone - implant interface . Slices in the same bone plane were assessed according to bone infection score as: 1) abscess formation; 2) sequestrum formation; 3) enlargement of corticalis; 4) destruction of corticalis; and 5) general appearance.12,28 parameters 1 to 4 were scored as 0 (absent) or 1 (present). Parameter 5 was scored as 0 (absent), 1 (mild), or 2 (severe). We then computed the rate of contact between bone and screw, on the assumption that the part in which it is possible to confirm the shape of a screw thread in the tissue specimen is the part contacted, based on a modification of the method reported by giavaresi et al and moroni et al.29,30 we did the actual image processing of the hematoxylin and eosin staining sample automatically using an optical microscope (bx51 - 33, olympus optical co, tokyo, japan) connected to public domain image analysis software (image j) and computed the data . In addition, the shape of the bone for the part corresponding to a screw thread was evaluated by gram staining . We first chose a part in which it was possible to confirm the two consecutive screw threads from the entrance part of a pin screw and then made a planimetric rate of occupation for bacterial colonies and intraosseous neutrophils in the shape of a screw thread using image j. the clinical and histomorphometric results for the control group (n = 30) were analyzed and compared with those of the tio2-coated pin group (n = 30). All statistical analyses were performed using the statistical package for social sciences version 20 software (spss inc, chicago, il). The mean and standard deviation of bone infection score, bone - implant contact ratio, and planimetric rate of occupation for bacterial colonies and intraosseous neutrophils were analyzed using the student s t - test . The substrates were prepared using 2 mm diameter pin screws (atlas sports and medicine co, ltd, nagasaki, japan) made of stainless steel (sus316l) which is the basic material in external fixation pins . The native oxides were removed by cleaning the samples with distilled water and acetone and then immersing them in a mixture of aqueous hf and hno3 acids . The plasma source ion implantation apparatus used in this study has been described elsewhere.21,25 this implantation method has several advantages compared with other methods, including a large area, multiple targets, and reasonable costs . Tio2 films were deposited onto the stainless steel pins using titanium tetraisopropoxide plasma in the chamber . A pulsed high negative bias voltage of 18 kv was applied to the sample holder at a pulse duration of 10 sec with a pulse repetition rate of 1 khz . The pin was annealed at 923 k for one hour to obtain a crystalline anatase tio2 film . The pins were divided into two groups (30 control pins and 30 pins coated with tio2). Glancing - angle x - ray diffraction patterns for the tio2 pins showed peaks at positions corresponding mainly to an anatase - type structure, including a rutile one, and x - ray photoelectron spectroscopy revealed the chemical composition was almost all tio2 . Energy - dispersive spectroscopy indicated that the homogeneous microstructure was composed of titanium, oxygen, and elements of stainless steel . Cross - sectional analysis of the tio2 layers revealed an average thickness of 1.0 m, with no interfaces evident between the substrate and the dense layer . The surface roughness parameters for tio2-coated stainless steel (ra = 808 nm, rz = 1674) were almost the same as for untreated stainless steel (ra = 837 nm, rz = 1755), as reported in our previous study.21 micrographs of the surfaces of the tio2-coated pins were obtained using a field emission scanning electron microscope (jsm 6400f, jeol, tokyo, japan). This series of in vivo experiments was performed in accordance with the principles stated in the established guidelines for the treatment of animal subjects, and animal welfare assurance was strictly maintained . S. aureus (seattle 1945 strain, atcc 25923) was incubated for 6 hours at 37c in 10 ml of trypticase soy broth . The bacterial cells were harvested by centrifugation at 3000 rpm for 10 minutes and then suspended in sterilized distilled water to a concentration of 1 10 cells / ml . Sixty female, 7-week - old sprague - dawley (specific pathogen - free) rats were obtained from charles river laboratories japan inc, yokohama, japan . The animals were housed individually in a secure, climate - controlled facility for the duration of the experiment . The operative procedure was performed under general anesthesia by intraperitoneal administration of a sodium pentobarbital (50mg / kg of body weight). The insertion areas on the hind limb of each animal were shaved, and the area over the femur was aseptically prepared with 70% ethanol . A small linear skin incision (about 12 mm) was made and the pins were inserted through the incision into the femoral bones (one pin per bone), followed by bacterial contamination with 100 l of an identifiable s. aureus strain on the insertion area, ie, the skin - pin interface . Ultraviolet a light was emitted using a black light source set 30 cm above the rats for 30 minutes . In our previous in vitro study, the tio2-coated material significantly suppressed the viability of bacteria after 30 minutes of ultraviolet illumination,21 so the illumination time was set to 30 minutes . The intensity of the light was 2.0 mw / cm at a peak wavelength of 352 nm . The pin sites were examined daily and the dressings were carefully changed to avoid cross - contamination of the pin sites . Additional treatment, including incision closure, blood coagulation, or antibiotic dressing was not needed . On day 14, visible clinical findings at each pin site were classified according to pin site infection criteria as no infection, inflammation or serous drainage without frank purulence, or frank purulence.26,27 clinical determination of infection was defined as all three observers being in agreement . After evaluation by eye, the animals were sacrificed and the bone and soft tissue around the pin were retrieved . We used an automated microbiology system (bd phoenix system, nippon becton dickinson co, tokyo, japan) to identify the bacteria isolated (panel type pmic / id-68). The tissues obtained were fixed for one day in a 10% formalin solution buffered at ph 7.2, dehydrated through a series of graded alcohol solutions, and embedded in paraffin . Immediately after removal of the pins, 4 m thick longitudinal sections in the sagittal plane were cut using a microtome (hm325, thermo scientific mircom, walldorf, germany) with a 40 degree stainless steel knife, taking care not to damage the bone - implant interface . Slices in the same bone plane were assessed according to bone infection score as: 1) abscess formation; 2) sequestrum formation; 3) enlargement of corticalis; 4) destruction of corticalis; and 5) general appearance.12,28 parameters 1 to 4 were scored as 0 (absent) or 1 (present). Parameter 5 was scored as 0 (absent), 1 (mild), or 2 (severe). We then computed the rate of contact between bone and screw, on the assumption that the part in which it is possible to confirm the shape of a screw thread in the tissue specimen is the part contacted, based on a modification of the method reported by giavaresi et al and moroni et al.29,30 we did the actual image processing of the hematoxylin and eosin staining sample automatically using an optical microscope (bx51 - 33, olympus optical co, tokyo, japan) connected to public domain image analysis software (image j) and computed the data . In addition, the shape of the bone for the part corresponding to a screw thread was evaluated by gram staining . We first chose a part in which it was possible to confirm the two consecutive screw threads from the entrance part of a pin screw and then made a planimetric rate of occupation for bacterial colonies and intraosseous neutrophils in the shape of a screw thread using image j. the clinical and histomorphometric results for the control group (n = 30) were analyzed and compared with those of the tio2-coated pin group (n = 30). All statistical analyses were performed using the statistical package for social sciences version 20 software (spss inc, chicago, il). The mean and standard deviation of bone infection score, bone - implant contact ratio, and planimetric rate of occupation for bacterial colonies and intraosseous neutrophils were analyzed using the student s t - test . The tio2 surface had a number of global microstructures with diameters of 12 m and were well separated and homogeneously distributed over the sample . All of the animals tolerated surgery well and survived until the end of the experiment . Clinical evaluation revealed purulence and/or serous drainage in 23 of the 30 control pins (76.7%), compared with only 11 of the 30 tio2 pins (36.7%, p <0.01), as shown in table 1 . The automated microbiology system identified the micro - organisms isolated from the purulence or drainage around the infected pin as being the same strain as that from the initial pin inoculation . Severe bone resorption and destruction caused by infection were seen in the control pin group, whereas the tio2 pin was directly in contact with bone tissue, and new vessels and osteoblast cells were seen . The mean bone infection score for the tio2 pins was significantly lower than that for the control pins (3.1 1.6 points versus 4.9 1.0 points, p <0.01). The mean bone - implant contact ratio for the untreated stainless steel pin group was 58.2% 8.1%, whereas the tio2 pin group showed a mean ratio of 71.4% 5.4% . The rate of contact in the control pin group was significantly lower than in the tio2-coated pin group (p <0.01). In the group of untreated pins, the planimetric rate of occupation for bacterial colonies and intraosseous neutrophils in the shape of a screw thread was 24.7% 10.3% for the control pins and 13.3% 6.4% for the tio2-coated pins, so the rate of occupation for the group of tio2 pins was significantly lower (p <0.01). Pin site infection with external fixation can easily occur by contiguous spreading, ie, commensal skin bacteria pass subcutaneously along the surface of the device towards the internal tissues . Infected pins may lead to pin loosening, need for pin removal, and chronic osteomyelitis, which is considered to be a risk factor for deep infection in the conversion to internal fixation.24,7 in terms of treatment, much money and time are needed, in addition to the distress caused to patients . Although various studies have been conducted to develop antibacterial external fixation pins, there remain concerns about the side effects of the agents used and emergence of resistant bacteria . Hence we tested the photocatalytic anti - infective activity of tio2 in a rat model of external fixation . Tio2 mainly consists of three polymorphs, ie, anatase, rutile, and brookite . Using different methods and conditions, single or multiple polymorphs can be formed, with various morphologies . Anatase is the most photocatalytic polymorph and generates many free radicals, which can decompose bacteria and other organic compounds via its strong oxidative effects.14,15 therefore, anatase tio2 was used in this study . Several investigations have been done to elucidate the mechanism of photokilling of escherichia coli and other bacteria.1618 sunada et al proposed that decomposition of the outer membrane by photocatalytic reaction ultimately leads to cell death.31 maness et al reached the more specific conclusion that photocatalysis promotes peroxidation of phospholipids in the membrane.19 meanwhile, matsunaga et al32 and saito et al20 reported a loss of respiratory activity resulting from oxidization of coenzyme a. however, there are few published studies concerning the use of tio2 for microbial inactivation and focusing on prevention and treatment for pin site infection after external fixation.33s . Aureus is one of the most common pathogens in percutaneous implant infections and readily mutates into multidrug - resistant forms that can be extremely difficult to treat, eg, staphylococcus epidermidis, e. coli, and pseudomonas aeruginosa.9,2224 in this study, we introduced a new method for inhibiting s. aureus infection at percutaneous pin sites based on the photocatalytic bactericidal reactions of tio2 in a rat model under ultraviolet illumination . In our animal study, the tio2-coated pin group showed fewer clinical signs of infection and quantitative histomorphometric findings than the untreated pin group . This result indicates that the amount of contaminated bacteria decreased due to the photocatalytic activity of tio2 . Tio2 pins also had better compatibility with bone tissue and prevented bacterial migration and deep tissue infection in vivo . These findings suggest that photocatalytic tio2 has the potential to decrease the risk of pin site infection clinically and prevent loosening of the interface between bone and the pin, and that the external fixation pin performs its function effectively . It is known that ultraviolet a has deleterious effects on bacterial cells, depending on the type of bacteria, the dose of light administered, and degree of bacterial sensitivity.34 there was no sign of infection around seven of the 30 untreated pins (23.3%) and 19 of the 30 tio2 pins (63.3%) on clinical evaluation . In our earlier study, ultraviolet a from the same light source had deleterious effects on this type of bacterium.21 therefore, there is no doubt that ultraviolet a killed bacteria in the two groups . However, evidence of significantly fewer signs of infection on clinical and quantitative histomorphometric analysis in the tio2 group compared with the control group suggests the presence of a photocatalytic bactericidal action against s. aureus cells . Another problem is the extended period of ultraviolet a illumination required to suppress pin site infection . Our method of contamination, which was direct inoculation of a large number of bacteria with no additional treatment given, does not reflect how a percutaneous implant would be infected clinically . Photocatalysts are not particularly useful for breaking down large volumes of bacteria, but they are capable of destroying bacteria as they accumulate . Bactericidal efficacy would be more evident in a clinical situation where appropriate pin care is provided and bacterial exposure is much lower . In this study, ultraviolet a illumination was carried out as a single course only, but we can expect improvement in photocatalytic sterilization activity with multidirectional or multiple illuminations . We acknowledge that the negative effects of ultraviolet rays on the human body pose potential problems in clinical application . The intensity of the black light used in our animal model was 2.0 mw / cm, which is as low an intensity as that experienced outdoors . Although ultraviolet a is less harmful than ultraviolet b or ultraviolet c, research is underway to resolve these problems using materials with photocatalytic actions triggered by visible light, so the need to use ultraviolet light will decrease in the near future.35,36 other groups have developed silver composite - type materials in order to maintain long - lasting bactericidal properties, even in dark conditions.37,38 however, use of silver in biomaterials or medical devices is still controversial.811 in this study, we tested and confirmed the efficacy of photocatalytic anatase tio2 in inhibition of infection associated with external fixation . Tio2 can kill bacteria independent of bacterial strain or antibiotic susceptibility without generating drug - resistant species . Moreover, it has been confirmed that tio2-coated implants do not prevent osteointegration in a rabbit.29,39 essentially, titanium together with its natural oxide film is known to be bio - inert and to enable bioactivity for osteointegration . For orthopedic surgeons, although such a photocatalytic surface offers new and favorable properties from a hygiene point of view, it is very important that there should be no disadvantages in regard to achieving osteointegration . Zhu et al reported that the tio2 gradient improved corrosion and polarization resistance remarkably, as well as biocompatibility.40 therefore, it can be said that a photocatalytic surface is advantageous for biocompatibility and durability . The high bone - implant contact ratio in the tio2 pin group might have resulted from inhibition of the influence of infection due to good bone compatibility, as well as from the prevention of destruction or absorption of bone tissue due to bacterial infection . We used a rat model to investigate the ability of photocatalytic tio2 to inhibit infection at the insertion site of external fixation pins in vivo . Infection was inhibited on the tio2-coated pins compared with the untreated stainless steel control pins clinically and histomorphometrically . Tio2 has the potential to reduce the pin site infection rates associated with external fixation.
This was a retrospective study (20022010) that was approved by the yaound gynaeco - obstetric and paediatric hospital s ethical committee . The data collected included age, sex, past history, delay in presentation (duration between onset of symptoms and presentation), initial visual acuity, type of corneal lesion, and visual acuity at last follow - up . Cases with corneal involvement resulting from an intraocular disease, such as glaucoma, were excluded . The world health organization s definition of blindness was used: corrected visual acuity in the better eye of less than 1/20.1 data analysis was performed using spss statistics version 17.0 (ibm corporation, armonk, ny, usa) and office excel 2007 (microsoft corporation, redmond, wa, usa). Corneal pathologies were seen in 168 children, giving a prevalence of 2.1% (table 1). There were 98 males and 70 females, representing 2.6% and 1.74%, respectively, of the male and female children (table 1). This difference was statistically significant when these proportions were compared using the chi - square test (p = 0.0086). Ages ranged from 2 weeks to 15 years, with a mean (standard deviation) of 7.1 4.4 years and a median of 7.0 years . Children aged 05 years and 610 years, were the most represented groups (n = 65 for each) (figure 1) it was approximately 1 day for cases with chemical injury; 34 days for mechanical injury, with 25.7% (n = 18/70) examined within 24 hours following injury; 52 days for infections; and 1,827 days for dystrophies . Predisposing factors included ocular trauma in 71 cases (43.3%); ocular surface infection, including conjunctivitis and blepharoconjunctivitis, in 15 cases (8.9%); the use of traditional eye medicine in eight cases (4.8%); systemic disease in two cases, including stevens johnson syndrome and xeroderma pigmentosum (1.2%); family history of corneal dystrophy in two cases (1.2%); and ocular herpes in one case (0.6%). Corneal pathology was unilateral in 86.3% of cases (n = 145) and bilateral in 13.7% (n = 23). The most frequent anatomical lesions were scars of unknown origin (16.1%) and superficial foreign bodies (14.3%). The most frequent etiologies of corneal pathologies were trauma (81 cases [48.2%]) and infection (47 cases [28.0%]) (figure 2). Trauma was the most frequent etiology in all age groups, with the highest prevalence of 58.5% (n = 38) occurring amongst those aged 610 years . Out of the 109 cases, 51% registered an initial visual acuity of 0.3 (table 2). Visual acuity at last follow - up was available in 24 cases (while there was inability to cooperate in ten cases). Visual impairment and blindness were recorded in 12 cases (50%), with one case being bilateral (table 2). Refractive errors, conjunctivitis, trauma, eyelid, and orbital pathologies are usually the most prevalent.69 srinivas reported a prevalence of 26.3% amongst 4,022 indian children aged 016 years.10 onabolu et al reported a prevalence of 42% amongst 169 children aged 016 years in the gambia.11 the difference in prevalence of corneal pathologies in this study, compared to the others, could be due to differences in the relative frequencies of specific entities . In the gambia, vernal keratoconjunctivitis was reported in 22.5% of cases, as compared to 6% in this study . In the study from india, this is due to the strategies put in place to combat vitamin a deficiency . A significantly greater proportion of male than female children were affected by corneal pathologies . Srinivas reported a similar finding.10 this can be explained by the fact that trauma is the leading cause of corneal pathologies in children; boys are usually more involved in outdoor play than girls, and indulge in more aggressive play, which predisposes them to injury . Identifiable risk factors were detected in 58.9% of cases, with ocular trauma being the most predominant . Besides direct traumatic involvement, trauma has been identified as a risk factor for microbial keratitis.1214 contact lens wear was the most important risk factor for microbial keratitis in taiwanese children.15 the use of contact lenses is not common in our setting . The mean time for presentation following mechanical injury was 34.3 days; 25.7% of cases were seen within 24 hours . In a study on ocular trauma in children in douala,16 55.5% of the children were seen within the first 24 hours . In a study from ibadan,17 nigeria, accessibility of hospitals, the cost of medical care, and the use of self - medication and tem could explain the delay in presentation . However, it was noted that, compared to urban dwellers, rural dwellers used tem more frequently . Tem mainly uses plant extracts (citrus aurantifolia, allium cepa) and human breast milk . In a study on the use of tem by corneal ulcer patients in south india, prajna et al reported the use of tem in 47.7% of cases.18 the most frequent etiology was trauma (48.2% of cases). Onabolu et al also reported trauma as the most frequent etiology (32.4%).11 srinivas, however, reported nutritional involvement as the leading etiology, with trauma ranking fourth . Al - bdour and azab also reported a preponderance of injury in this age group.19 these are children of primary school age, who are physically more active . The lowest proportion of infective keratitis was from the 610 years age group (21.3%), and the highest (48.9%) from the 05 years age group . The age distribution of patients with childhood microbial keratitis from southern india shows a similar trend, with 18.9% from the 610 years age group.14 in our setting, the diagnosis of infective keratitis is usually made on a clinical basis, given that most cases use eye drops containing antibiotics before presentation . Considering visual acuity at last follow - up, 50% cases suffered visual impairment and blindness . Onabolu et al reported that 45% of children with corneal diseases suffered blindness from trauma and from congenital diseases.11 congenital diseases involving the cornea were uncommon (3%). No case was reported by srinivas in india,10 while onabolu et al reported a prevalence of 16.9% in cases from the gambia.11 the most frequent congenital eye anomalies are cataract and glaucoma.20,21 this study is limited by the high number of patients lost to follow - up, and the lack of microbiology reports for cases with suspected microbial keratitis . Although the prevalence is low, corneal pathology in children leads to poor visual outcomes . Thus, parents, childhood health care givers, teachers, and children should be educated on the prevention of ocular injury.
Chronic obstructive pulmonary disease (copd) is a heterogeneous condition diagnosed by not completely reversible airflow obstruction detected during spirometry . Beyond this unifying functional definition, it is known that the lung may react to cigarettes smoking and environmental exposure with conductive airways remodeling or parenchymal destruction . The extent and the concomitance of airways and parenchymal changes determine the severity of the disease . In the last few years, several methods to identify the predominant phenotype and the severity of copd in clinical practice have been proposed.15 in addition to lung involvement, several comorbidities may coexist in patients with copd such as cardiovascular disease, metabolic dysfunctions, and anxious depressive disorders as the most commonly reported . A number of potential biological mechanisms linking copd and comorbidities have been proposed: the proinflammatory milieu,68 increased oxidative stress,9 increased arterial stiffness,10,11 catabolic state,12 and sedentary lifestyle.13 as a matter of fact, patients with copd are often multi - diseased patients, presenting different clinical pictures, with a poorer quality of life and outcomes,14 and a high disease - related burden.15,16 they also need a complex diagnostic and therapeutic approach.17 the prevalence of the various comorbidities in copd varies widely according to the methods used to define phenotype and severity of the disease.1822 the purpose of this study is to investigate the prevalence of idiopathic arterial hypertension (iah), ischemic heart disease (ihd), heart failure (hf), peripheral vascular disease (pvd), diabetes (d), osteoporosis (o), and anxious depressive syndrome (ads) in a clinical setting of copd outpatients whose predominant phenotype and severity were determined by a standardized method, derived from computerized tomography (ct),2 allowing patients to be classified based on simple clinical and pulmonary function parameters . A total of 412 outpatients with copd (299 males), in stable clinical condition were consecutively enrolled and completed the study . The ethical committee of the university hospital of florence approved the study and an informed consent was signed by each patient . Severity of dyspnea was assessed by the modified medical research council (mmrc) dyspnea scale . Static and dynamic lung volumes and single breath diffusing capacity (dlco) were measured (v6200 autobox body plethysmograph; sensor medics, yorba linda, ca, usa) according to american thoracic society / european respiratory society guidelines and expressed as percentage of the predicted values (%).23 each patient was assigned a predominant airway or predominant emphysematous phenotype and a mild or severe category of disease according to the results of a multivariate analysis of 14 continuous variables (age, years; body mass index [bmi]; pack / years; forced vital capacity [fvc]% predicted; forced expiratory volume in 1 second [fev1]% predicted; fev1/vital capacity [vc] and fev1/fvc ratios, total lung capacity [tlc]% predicted, residual volume [rv]% predicted, rv / tlc ratio, functional residual capacity [frc]% predicted; vc% predicted; inspiratory capacity [ic]% predicted; dlco% predicted plus three categorical variables (mmrc dyspnea scale, cough, and sputum, scored as follows: dyspnea [0= none; 1= slight; 2=moderate; 3= severe; 4= very severe]; cough [0= absent; 1=occasional; 2= chronic]; and sputum [0= absent / occasional; 1= chronic non - purulent; 2= chronic purulent]), which have been validated by quantitative ct.2 the variables entered to classify copd patients according to the predominant mechanism of airflow limitation were dlco%, tlc%, and sputum purulence . These variables were linearly combined to determine the relative predominance of an airway or emphysema phenotype according to the following computation . Sputum purulence was assigned a categorical value (0, absent; 1, present). Phenotype=0.3240.018dlco%0.58(sputumpurulence)+0.011tlc% patients were classified as being affected by predominant emphysema or by predominant airway disease when the result of the above - mentioned equation was either positive or negative, respectively.2 fev1/vc ratio, frc%, and sputum purulence were entered to classify the severity of the disease . These variables were linearly combined to compute the copd severity score according to the following equation: severity=0.5750.013fev1/vc+0.013(sputumpurulence)+0.013frc% patients were classified as being affected by severe or mild disease when the result of the computation was positive or negative, respectively.2 the following comorbidities were chosen to investigate cardiovascular, metabolic, and behavioral domains in patients with copd . We ascertained the presence of iah, ihd, hf, pvd, d, o, and ads by means of an interview, outcomes of functional diagnostic procedures, and current medical treatment . The presence of each comorbidity was confirmed by the investigators through a detailed review of available medical records and medications or therapy specific to any disease . Data were presented as mean standard deviation for continuous variables, and as counts and proportions for nominal and ordinal variables . The student s t - test was used to compare the mean of continuous variables among different subsets of patients . The fisher s exact test was used to compare the prevalence of categorical variables among different subsets of patients . A total of 412 outpatients with copd (299 males), in stable clinical condition were consecutively enrolled and completed the study . The ethical committee of the university hospital of florence approved the study and an informed consent was signed by each patient . Severity of dyspnea was assessed by the modified medical research council (mmrc) dyspnea scale . Static and dynamic lung volumes and single breath diffusing capacity (dlco) were measured (v6200 autobox body plethysmograph; sensor medics, yorba linda, ca, usa) according to american thoracic society / european respiratory society guidelines and expressed as percentage of the predicted values (%).23 each patient was assigned a predominant airway or predominant emphysematous phenotype and a mild or severe category of disease according to the results of a multivariate analysis of 14 continuous variables (age, years; body mass index [bmi]; pack / years; forced vital capacity [fvc]% predicted; forced expiratory volume in 1 second [fev1]% predicted; fev1/vital capacity [vc] and fev1/fvc ratios, total lung capacity [tlc]% predicted, residual volume [rv]% predicted, rv / tlc ratio, functional residual capacity [frc]% predicted; vc% predicted; inspiratory capacity [ic]% predicted; dlco% predicted plus three categorical variables (mmrc dyspnea scale, cough, and sputum, scored as follows: dyspnea [0= none; 1= slight; 2=moderate; 3= severe; 4= very severe]; cough [0= absent; 1=occasional; 2= chronic]; and sputum [0= absent / occasional; 1= chronic non - purulent; 2= chronic purulent]), which have been validated by quantitative ct.2 the variables entered to classify copd patients according to the predominant mechanism of airflow limitation were dlco%, tlc%, and sputum purulence . These variables were linearly combined to determine the relative predominance of an airway or emphysema phenotype according to the following computation . Sputum purulence was assigned a categorical value (0, absent; 1, present). Phenotype=0.3240.018dlco%0.58(sputumpurulence)+0.011tlc% patients were classified as being affected by predominant emphysema or by predominant airway disease when the result of the above - mentioned equation was either positive or negative, respectively.2 fev1/vc ratio, frc%, and sputum purulence were entered to classify the severity of the disease . These variables were linearly combined to compute the copd severity score according to the following equation: severity=0.5750.013fev1/vc+0.013(sputumpurulence)+0.013frc% patients were classified as being affected by severe or mild disease when the result of the computation was positive or negative, respectively.2 the following comorbidities were chosen to investigate cardiovascular, metabolic, and behavioral domains in patients with copd . We ascertained the presence of iah, ihd, hf, pvd, d, o, and ads by means of an interview, outcomes of functional diagnostic procedures, and current medical treatment . The presence of each comorbidity was confirmed by the investigators through a detailed review of available medical records and medications or therapy specific to any disease . Data were presented as mean standard deviation for continuous variables, and as counts and proportions for nominal and ordinal variables . The student s t - test was used to compare the mean of continuous variables among different subsets of patients . The fisher s exact test was used to compare the prevalence of categorical variables among different subsets of patients . Anthropometric, smoke exposure, and functional data of the recruited patients and classification according to the prevailing phenotype and severity of the disease are reported in table 1 . No difference in smoke exposure was found across the subgroups . Compared with patients with predominant airway disease, those with predominant emphysema were younger, with a lower bmi and a more impaired lung function involving all the considered functional variables . Table 2 shows the number of comorbidities in the whole set and according to prevailing phenotype and disease severity . No comorbidities were found in 16% of patients (65 out of 412). In more details, 29 (13%) predominant airway disease patients and 36 (19%) predominant emphysema patients had no detectable comorbidities . The vast majority of patients turned out to be affected by two or three comorbidities (table 2). Figures 2 and 3 display the prevalence of each comorbidity within each of the two phenotypes . The most frequent was iah, which affected 62% of the patients, followed by pvd (28%). While iah was significantly more prevalent in patients with predominant airway disease, osteoporosis prevailed in those with predominant emphysema . As for copd severity (figure 4), we found a significantly higher prevalence of ihd and pvd in patients with mild copd . Out of 412 patients, 309 (75%) were affected by at least one cardiovascular comorbidity . The prevalence of all considered cardiovascular comorbidities was significantly higher in patients with mild disease and in those with predominant airway phenotype of copd (figure 5). The main finding of this study was that specific comorbidities prevailed in the two considered phenotypes of copd; notably the highest prevalence of comorbidities was found among patients with mild stage of the disease . In particular, iah was significantly more prevalent in patients with the predominant airway phenotype, whereas osteoporosis seemed to prevail in the predominant emphysema phenotype . In addition, we found a significantly higher prevalence of ihd and pvd in the subset of patients with mild copd . The second relevant result was that the cardiovascular comorbidities were found to be significantly more prevalent in patients with the predominant airways phenotype and with a milder expression of the disease . A growing body of evidence suggests that copd is associated with comorbidities whose prevalence varies largely among epidemiological studies . In this study, the prevalence of the whole set of considered comorbidity and cardiovascular comorbidities was consistent with those of anecchino et al,18 which was based upon a different method for comorbidity detection and classification . Indeed, they found at least one prescription of drugs for a chronic condition other than respiratory disease in a vast majority of their wide cohort of patients with copd . It is important to underline that the presence of comorbidities in our study has been investigated by an objective method, with the exclusion of patients with a single drug prescription and/or a self - reported diagnosis, which was not considered probative for the presence of a comorbidity . In our study, patients with predominant airway disease were slightly older than those with predominant emphysema . This result is in contrast with those of feary et al20 and sode et al19 who showed the highest risk of comorbidity in the youngest patients with copd, suggesting to look for comorbidities at earlier stages of the disease . On the other hand, the present results of a higher prevalence of comorbidities in mild diseases severity confirm the hypothesis of individual susceptibility to factors implicated in the genesis of copd, which could arise and develop up to different degrees of severity, and progress more or less into more severe stages independently of the age of the patients . In patients with predominant airway phenotype of copd this result is consistent with that of watz et al,24 who detected iah in a high proportion (73%) of patients with symptoms of chronic bronchitis without airflow limitation, as well as in those with mild copd (77%). Interestingly, they found that circulatory markers of systemic inflammation were increased in patients with chronic bronchitis and copd when metabolic syndrome was detected, irrespective of the degree of lung function impairment . Visceral adipocytes have been suspected to play a role by producing interleukin-6, which in turn induces the synthesis of c - reactive protein by hepatocytes . This finding has been confirmed in a study by poulain et al,25 who demonstrated that systemic inflammation was higher in obese patients with moderate copd compared with those with normal weight and severe disease . We confirmed these observations indirectly, as bmi was significantly higher in patients with the predominant airway phenotype compared with those with predominant emphysema phenotype, and in moderate disease compared with severe disease . Recently, new evidence has emerged suggesting that hypoxia, a frequent finding in patients with copd, may be an additional cardiovascular risk factor for its role in the atherosclerosis process.2629 moreover, patients with copd are often affected by a neglected condition such as sleep disorders, resulting in nighttime hypoxia . Obesity strongly contributes along with age and active smoking for sleep disordered breathing, accelerated pulmonary hypertension, obesity hypoventilation syndrome, and obstructive sleep apnea, irrespective of the degree of airflow obstruction.29 hypoxia resulting from the above - mentioned conditions can be continuous or intermittent.26 these high frequency cycles of hypoxia and reoxygenation are similar to ischemia reperfusion injury and result in an increased production of reactive oxygen species and oxidative stress . Cell damage, remodeling of extracellular matrix and blood vessels, endothelial dysfunction, and inactivation of antiproteases are some of the consequences of oxidative imbalance . Furthermore, in animals models, chronic intermittent hypoxia increases the amount of oxidized lipids and low - density lipoproteins in serum and arterial walls, which have stronger atherogenic effects, such as the formation of plaques in arteries which start due to lipid peroxidation . These results have been confirmed and extended in a small cohort of patients with copd and sustained nocturnal, nonapneic hypoxia, which showed increased levels of serum lipid peroxidation and decreased paraoxonase activity.28 patients with copd and obesity, hypoventilation syndrome, and obstructive sleep apnea resemble the so - called blue bloater phenotype29 and also the predominant airway phenotype objectively classified in this paper . Among the extrapulmonary effects of copd this association has been explained in terms of age, sex, reduced daily activity, chronic hypoxemia, and systemic corticosteroids therapy.30 recently, the presence of osteoporosis also in patients with milder airflow obstruction and clinically stable conditions has led to linking osteoporosis to a low - grade systemic inflammation sustained by increased plasma levels of c - reactive protein, interleukin-6, and tumor necrosis factor-.31 furthermore, copd exacerbations, associated with increased systemic inflammation, have been demonstrated to enhance osteoporosis progression.32 the high prevalence of osteoporosis in the predominant emphysema phenotype in our study supports the view that, beyond a pure catabolic process, a mechanical derangement of lung structure due to hyperinflation and parenchymal disruption might also be relevant in sustaining a widespread chronic inflammation and its consequences . It could not be otherwise explained that a significant improvement of bone mineral density occurred 1 year after lung volume reduction surgery in patients with a pure, severe, ct - detected emphysema phenotype of copd compared with a control group undergoing rehabilitation.33 the other important finding of this study was that ihd and pvd are significantly more prevalent in the subset of patients with mild copd . This finding is in keeping with the previous studies19,20 demonstrating that the association between cardiovascular comorbidities and copd is a risk factor for poor prognosis, hospitalization, and death of patients with mild copd.19 our results showed that the highest burden of comorbidities is seen mostly in patients with less severe pulmonary disease . These findings were in agreement with findings of watz et al24 and in contrast with those of mahboub et al22 and dal negro et al21 who reported an association between the prevalence of comorbidity and copd severity measured by a copd assessment test score> 10 or by global initiative on obstructive lung disease stages, respectively . Our results were also in contrast with mannino et al34 and johnston et al35 who reported a direct relationship between severity of airflow limitation and risk for cardiovascular diseases, and for ihd, arrhythmias, stroke, and iah, each one considered separately . Furthermore, other studies failed to demonstrate any significant association between the prevalence of cardiovascular comorbidities and the severity of copd evaluated by the level of airflow obstruction in a small cohort of patients,36 or by the degree of airflow obstruction, exercise capacity, and bode index.37 the discrepancies may be related to the method by which the disease severity was scored . Conceivably, disease severity is unlikely to be satisfactorily depicted by the reduction of a single functional parameter (eg, fev1). Indeed, this has been the sole criterion employed to assess copd severity in many studies, actually before the publication of the revised global initiative on obstructive lung disease guidelines in 2011; here symptoms and clinical events (exacerbations) have been introduced first, along with airway obstruction, to describe a disease that is actually far more complex than airway obstruction alone . Furthermore, this functional feature also reflects at least two pathological mechanisms, namely reduction of airway caliber (due to inflammation) and reduction of elastic recoil (due to parenchymal destruction). We are confident that the method employed to investigate copd in this study takes into account both the predominant mechanism of airway obstruction for phenotyping each patient and the total amount of parenchymal and airways involvement to score severity.2 we acknowledge that this study has some limitations: 1) the small cohort of patients recruited; 2) the retrospective collection of data concerning diagnosis and therapy of each examined comorbidity; and 3) the methodology used to report the presence of a comorbidity that is not completely objective because it was not based on repeating or seeking confirmatory tests for each disease, a task that would have been prohibitively expensive.14,16 therefore, based on this consideration and in keeping with most of the studies on the subject, we preferred to assess the presence of a comorbidity by means of a combination of clinical history and medical records documentation . Understanding the association between comorbidities and phenotypes of copd may be relevant to clarify the relationship between different pathophysiological mechanisms and such a disease: we can hypothesize to assign each phenotype of copd a specific comorbidity panel . The increased prevalence of comorbidities among patients with mild disease has several relevant practical aspects: first of all, the need of an early diagnosis of copd, especially in those patients with slight symptoms who turn to general practitioners more often than to pulmonologists . For this purpose, we wish to stress that the results of this study can easily be translated into daily clinical practice due to the simple method suggested here to phenotype and score the disease . Accordingly, the complementary role of general practitioners and the specialist is highlighted in this study: given the large number of potential candidates to develop copd, it would be impossible to care for all patients at a specialist level . A need exists to lay bridges and to share a common language that allow both specialists and general practitioners to diagnose and treat copd and its comorbidities early and effectively, in order to slow the disease progression and improve the quality of life.38,39 increasing knowledge on links between copd and comorbidities could provide innovative treatment strategies and it would assign each patient with copd targeted therapies according to their personalized profile of phenotype, severity, and comorbidity.40
Ovarian hyperstimulation syndrome (ohss) is a well - known complication of assisted reproductive techniques (arts) and is characterized by enlargement of the ovaries and fluid shift from the intravascular compartment to the third space . Tuberculosis is common in developing countries, and peritoneal tuberculosis (tb) which is the 6th most frequent extrapulmonary tb usually presents with ascites . We report a case of a 31-year - old lady who presented with tubercular ascites that simulated ovarian hyperstimulation (ohss). The patient had no evidence of tuberculosis as proven by a negative mantoux, chest x - ray, acid fast staining of ascitic fluid, and a negative pcr . The final diagnosis and management were based on a rising adenosine deaminase (ada) level and a low haematocrit of 19.8% . The uniqueness lies in the yet unreported simulation leading to a suspicion of an unknown pathological mechanism in stimulating the ovaries, which might have caused a flare - up of tuberculosis . A 31-year - old lady came to us with evidence of spontaneous abortion at 14 weeks of her pregnancy, which was conceived following in vitro fertilization . She had fever at the time, and hence a course of antibiotics was given . Her hemoglobin levels were low, for which she was given a unit of packed red blood cells . She was a booked case with us and had a past history of two episodes of ascites (ohss) following the embryo transfer . The first episode was within 12 days of embryo transfer, and the second episode was at 9 - 10 weeks of gestation . Both episodes were diagnosed as ohss and treated symptomatically with albumin infusion . At 14 weeks of gestation, she had fever and recurrence of ascites . Ascites did not subside even with albumin and cabergoline; hence other causes of ascites were evaluated by mantoux test and chest x - ray, which were negative for tuberculosis . Her bleeding per vaginum persisted, for which a scan was done again which showed some retained products of conception for which she underwent dilatation and evacuation . The tissue obtained was sent for histopathology examination and came back as only degenerated products of conception and negative for mycobacterium tuberculosis by pcr . When the ascites did not disappear after the regular treatment, the ascitic fluid was tapped thrice . It was green in color, leading to suspicion of presence of bile salts or pigments in it though her liver function tests were normal . When analyzed for the same, there were no bile salts or pigments found . Upon culturing it, the ascitic fluid was further investigated with acid fast staining, which showed no acid fast bacilli . A pcr sent for mycobacterium tuberculosis came back negative . She was started on antitubercular treatment with hrze (isoniazid + rifampicin + pyrazinamide + ethambutol), which finally resolved the ascites within a week . Ovarian hyperstimulation is a rare complication of using gnrh antagonist protocol for ovulation induction in patients undergoing assisted reproductive techniques . But when it gets severe, like it rarely does, shortness of breath and orthopnoea due to pleural effusion are also seen . Upon using ovulation induction drugs, but what really causes them to go into overdrive and start secreting excessive fluid is not well understood yet . Pathologically, in ovarian hyperstimulation, the fluid lost is transudate in nature . Clinically, it is seen as a sudden increase in the weight of the patient along with some pelvic pains . Usually, it is a mild complication, which does not require much intervention . But in some cases, it can cause massive ascites and proceed to a pleural effusion leading to life - threatening dyspnoea . Furthermore, investigating with an ultrasound will show fluid in the peritoneal cavity which might also be in the pleural cavity, which can be confirmed with a chest x - ray . The routine treatment involves a 100 ml of saline with 20% albumin infusion intravenously, which will help bring the excessive fluid back into the intravascular compartment . Another effective drug is cabergoline, which acts by influencing the vasoactive endothelial growth factor (vegf) pathway, restricting the loss of fluid into third spaces . Tuberculosis is very commonly seen in the developing countries and usually affects the lungs primarily . So, a clear chest x - ray is usually taken to mean no tuberculosis anywhere else . When it affects the peritoneum and produces ascites, it is an exudate . The difference in the two underlying pathologies of ascites is that when a transudate is seen, concentration of hematocrit can be seen . On the other hand, in exudative ascites, it was the persisting hematocrit at low levels (19.8%) even with ongoing ascites that led to a suspicion of a cause other than hyperstimulation of the ovaries . Most of the population in such a country is affected, but a good immunity keeps the disease in check, not letting it flare up . But whenever a body experiences a kind of stress, it loses part of its immunity, and this, in turn, leads to flaring up of tuberculosis . Some of the stresses known to cause flaring up are immunosuppression therapy, nephropathy, and so forth . This case gives rise to the possibility that ovulation induction might actually be a stress factor in causing flaring up of tuberculosis . Estimation of adenosine deaminase (ada) in ascetic fluid has value in diagnosing tuberculosis . Ada is a purine - degrading enzyme, widely distributed in tissues and body fluids, necessary for proliferation and differentiation of t lymphocytes . It has enough discriminatory power to either confirm or rule out the diagnosis of peritoneal tb . It can be used as a reliable test to start treatment while waiting for the report of cultures . A meta - analysis of 4 studies showed a sensitivity of 99 to 100% and specificity of 97% in diagnosing peritoneal tb . In our case though pcr and acid fast staining were negative for tuberculosis, the persisting low haematocrit levels along with rising ada levels led to the suspicion of tubercular ascites, and when treated with att, ascites was resolved completely.
All abstracts at the krs conference and the abstracts presented by korean investigators at the rsna and ecr from 2001 to 2002 were identified, using a search of the conference program books containing the abstracts . In addition, a search of the official websites of the krs (http://www.radiology.or.kr/event/annual.html), the rsna (http://archive.rsna.org/index.cfm), and the ecr (http://www.myesr.org/cms/website.php?id=/en/congress/ecr_2007/about_the_congress/past_meetings.htm) was performed on the internet . We only included original research studies . Abstracts that illustrated an imaging technique or reported case(s) of educational value or special interests were excluded . When more than one country was listed on the abstract, we considered that the abstract originated from korea if more than 50% of authors were korean nationals (with a typical korean name). A computer - based search for each abstract was performed to determine whether it was published in a peer - reviewed journal . The publication status was assessed by using the pubmed database (http://www.ncbi.nlm.nih.gov/pubmed/) and the korean medical database (http://kmbase.medric.or.kr/) from january 1, 2000 to june 30, 2007 (the date of completion of the search). Therefore, the follow - up periods ranged from 55 months (for the rsna 2002 conference) to 76 months (for the ecr 2001 conference). The searches began with the first name initial(s) and the full last name of the first author . If no corresponding publication was found, this search was followed by a search for subsequent authors or keywords from the title of the abstract . A published manuscript was considered as a full publication of a corresponding abstract when it satisfied the following two criteria: 1) at least one author on the abstract was listed as an author of the full publication, and 2) at least one conclusion from the presented abstract was included in the conclusions of the final publication . Six investigators (an investigator for each of the six meetings) performed primary data curation . Another investigator performed validation of the data from the abstracts and differences were resolved by consensus . The following variables were evaluated: 1) the overall publication rate (the ratio of the number of subsequent publications to the total number of abstracts) for each of the respective meetings; 2) publication rates according to the classification of presentations; 3) time to publication; 4) journals in which the study was published; 5) consistency between the abstract and the final publication . Based on the outcome of our search, overall rates of publication were calculated for each of the respective meetings . These publication rates were compared with each other and with the rates reported for other radiological and other medical disciplines . For evaluation of publication rates according to the classification of presentation, we collected the following information from each abstract: radiological subspecialty, presentation type (oral or poster), sample size (20, 21 - 50, or> 50), study design (prospective [including experimental studies] or retrospective [including no available information]), statistical analysis (present [authors stated the method of statistical analysis used or reported p values] or absent), and study outcome (positive [the studied variables produced beneficial or statistically significant results] or negative). For purposes of analysis, the abstracts were subdivided into the following 10 radiology subspecialties based on generally accepted categorizations often found in the literature as well as on the grouping of abstracts in the final program of each respective meeting . These subspecialties included breast, cardiac, chest, gastrointestinal, genitourinary, musculoskeletal, neuroradiology / head and neck, pediatric, vascular / interventional, and others (including nuclear medicine, physics, basic science, and radiation oncology). The time to publication was defined in months for the duration between the month of publication and the month of abstract presentation . When a journal was published every two months if a publication had occurred in the same month as the meeting or any time before the abstract presentation, the time to publication was recorded as zero months . The journal impact factor of medline - indexed journals was retrieved from the science citation report on the thompson scientific isi web of knowledge server (http://scientific.thompson.com/webofknowledge/). This impact factor is calculated by dividing the number of citations in the current year to the number of articles published in the past two years . The mean impact factor for each journal between 2002 and 2006 we also evaluated consistency between the abstract and the final publication, including differences in the title, the number of authors, the position of the first author in the abstract, study objective / hypothesis, study design, sample size, statistical analysis, study results, and conclusions . When a full publication was confirmed, two investigators independently compared the content of the abstracts of the presentations and the summaries of the published studies; discrepancies were resolved by discussion with another investigator . Statistical analyses for overall publication rates and predictive factors for publication were determined using tests . A p value <0.05 was considered as statistically significant . All statistical analyses were performed by using spss statistical software (version 10.0; spss, chicago, il). All abstracts at the krs conference and the abstracts presented by korean investigators at the rsna and ecr from 2001 to 2002 were identified, using a search of the conference program books containing the abstracts . In addition, a search of the official websites of the krs (http://www.radiology.or.kr/event/annual.html), the rsna (http://archive.rsna.org/index.cfm), and the ecr (http://www.myesr.org/cms/website.php?id=/en/congress/ecr_2007/about_the_congress/past_meetings.htm) was performed on the internet . We only included original research studies . Abstracts that illustrated an imaging technique or reported case(s) of educational value or special interests were excluded . When more than one country was listed on the abstract, we considered that the abstract originated from korea if more than 50% of authors were korean nationals (with a typical korean name). A computer - based search for each abstract was performed to determine whether it was published in a peer - reviewed journal . The publication status was assessed by using the pubmed database (http://www.ncbi.nlm.nih.gov/pubmed/) and the korean medical database (http://kmbase.medric.or.kr/) from january 1, 2000 to june 30, 2007 (the date of completion of the search). Therefore, the follow - up periods ranged from 55 months (for the rsna 2002 conference) to 76 months (for the ecr 2001 conference). The searches began with the first name initial(s) and the full last name of the first author . If no corresponding publication was found, this search was followed by a search for subsequent authors or keywords from the title of the abstract . A published manuscript was considered as a full publication of a corresponding abstract when it satisfied the following two criteria: 1) at least one author on the abstract was listed as an author of the full publication, and 2) at least one conclusion from the presented abstract was included in the conclusions of the final publication . Six investigators (an investigator for each of the six meetings) performed primary data curation . Another investigator performed validation of the data from the abstracts and differences were resolved by consensus . The following variables were evaluated: 1) the overall publication rate (the ratio of the number of subsequent publications to the total number of abstracts) for each of the respective meetings; 2) publication rates according to the classification of presentations; 3) time to publication; 4) journals in which the study was published; 5) consistency between the abstract and the final publication . Based on the outcome of our search, overall rates of publication were calculated for each of the respective meetings . These publication rates were compared with each other and with the rates reported for other radiological and other medical disciplines . For evaluation of publication rates according to the classification of presentation, we collected the following information from each abstract: radiological subspecialty, presentation type (oral or poster), sample size (20, 21 - 50, or> 50), study design (prospective [including experimental studies] or retrospective [including no available information]), statistical analysis (present [authors stated the method of statistical analysis used or reported p values] or absent), and study outcome (positive [the studied variables produced beneficial or statistically significant results] or negative). For purposes of analysis, the abstracts were subdivided into the following 10 radiology subspecialties based on generally accepted categorizations often found in the literature as well as on the grouping of abstracts in the final program of each respective meeting . These subspecialties included breast, cardiac, chest, gastrointestinal, genitourinary, musculoskeletal, neuroradiology / head and neck, pediatric, vascular / interventional, and others (including nuclear medicine, physics, basic science, and radiation oncology). The time to publication was defined in months for the duration between the month of publication and the month of abstract presentation . When a journal was published every two months, we defined the time of publication as occurring halfway between the two months . If a publication had occurred in the same month as the meeting or any time before the abstract presentation, the time to publication was recorded as zero months . The journal impact factor of medline - indexed journals was retrieved from the science citation report on the thompson scientific isi web of knowledge server (http://scientific.thompson.com/webofknowledge/). This impact factor is calculated by dividing the number of citations in the current year to the number of articles published in the past two years . The mean impact factor for each journal between 2002 and 2006 we also evaluated consistency between the abstract and the final publication, including differences in the title, the number of authors, the position of the first author in the abstract, study objective / hypothesis, study design, sample size, statistical analysis, study results, and conclusions . When a full publication was confirmed, two investigators independently compared the content of the abstracts of the presentations and the summaries of the published studies; discrepancies were resolved by discussion with another investigator . Statistical analyses for overall publication rates and predictive factors for publication were determined using tests . A p value <0.05 was considered as statistically significant . All statistical analyses were performed by using spss statistical software (version 10.0; spss, chicago, il). A total of 1,230 abstracts (732 oral and 498 poster presentations) presented at the six meetings were identified . One hundred thirty - three posters presented at the krs meeting were excluded from the study (108 educational exhibits, 17 technical exhibits, and 8 case reports). Of these abstracts, 301 were subsequently published as full - text articles by june 30 2007, as determined by the computerized search, giving an overall publication rate of 27% (table 1). The publication rate for studies presented at the ecr conference (50.5%) was significantly higher than the rate for the rsna conference (35.4%; p = 0.029) and krs conference (23.6%; p <0.001). In addition, there is a statistically significant difference between the publication rate for the rsna and krs conferences (p = 0.002). However, there was no significant difference in publication rates between abstracts for oral (28.6%) and poster presentations (25.2%; p = 0.272). " Vascular / interventional radiology " had the highest publication rate (33.1%), whereas " musculoskeletal radiology " had the lowest publication rate (17.1%). Studies in the field of " musculoskeletal radiology " were published significantly less often than the mean (p = 0.03). Studies described in abstracts with a prospective design had higher publication rates than studies with a retrospective design (33.4% vs 25.1%, respectively, p = 0.007). There was also a significant difference in publication rates based on statistical analysis and study outcome (p <0.0001 and p = 0.0001, respectively). However, the sample size did not significantly influence the publication rate (p = 0.136). For published articles, the time course between abstract presentation and journal publication for each meeting is shown in table 4 . Interestingly, 41 (3.7% of all presented abstracts and 14% of all published papers) were published before the date of abstract presentation at a scientific meeting . The overall mean time to publication was 15.8 months (standard deviation, 13.8 months), when studies published before the meeting were given a time to publication value of zero . Most (81.7%) of the studies presented in the abstracts were published within two years of presentation . Only 10% of the studies presented in the abstracts were published more than three years after presentation . Seventy - six studies (38.0%) were published in journal of the korean radiological society (jkrs). In contrast, 101 studies from the rsna and ecr meetings were published in a total of 27 journals including, in decreasing order of frequency, american journal of roentgenology (n = 23, 22.8%), radiology (n = 21, 20.8%), jkrs (n = 15, 14.9%), and korean journal of radiology (n = 9, 8.9%). We sought to identify any inconsistencies between the abstracts and the subsequent full - text publications . Study information was consistent for the position of the first author, study objective / hypothesis, design, statistical analysis, results, and conclusions (table 6). In contrast, investigators altered presentations by changing the title for 41% of the studies, adding or deleting authors for 79%, of the studies and changing the sample size for 42% of the studies . A total of 1,230 abstracts (732 oral and 498 poster presentations) presented at the six meetings were identified . One hundred thirty - three posters presented at the krs meeting were excluded from the study (108 educational exhibits, 17 technical exhibits, and 8 case reports). Of these abstracts, 301 were subsequently published as full - text articles by june 30 2007, as determined by the computerized search, giving an overall publication rate of 27% (table 1). The publication rate for studies presented at the ecr conference (50.5%) was significantly higher than the rate for the rsna conference (35.4%; p = 0.029) and krs conference (23.6%; p <0.001). In addition, there is a statistically significant difference between the publication rate for the rsna and krs conferences (p = 0.002). However, there was no significant difference in publication rates between abstracts for oral (28.6%) and poster presentations (25.2%; p = 0.272). Table 2 shows publication rates according to subspecialty . " Vascular / interventional radiology " had the highest publication rate (33.1%), whereas " musculoskeletal radiology " had the lowest publication rate (17.1%). Studies in the field of " musculoskeletal radiology " were published significantly less often than the mean (p = 0.03). Studies described in abstracts with a prospective design had higher publication rates than studies with a retrospective design (33.4% vs 25.1%, respectively, p = 0.007). There was also a significant difference in publication rates based on statistical analysis and study outcome (p <0.0001 and p = 0.0001, respectively). However, the sample size did not significantly influence the publication rate (p = 0.136). For published articles, the time course between abstract presentation and journal publication for each meeting is shown in table 4 . Interestingly, 41 (3.7% of all presented abstracts and 14% of all published papers) were published before the date of abstract presentation at a scientific meeting . The overall mean time to publication was 15.8 months (standard deviation, 13.8 months), when studies published before the meeting were given a time to publication value of zero . Most (81.7%) of the studies presented in the abstracts were published within two years of presentation . Only 10% of the studies presented in the abstracts were published more than three years after presentation . Seventy - six studies (38.0%) were published in journal of the korean radiological society (jkrs). In contrast, 101 studies from the rsna and ecr meetings were published in a total of 27 journals including, in decreasing order of frequency, american journal of roentgenology (n = 23, 22.8%), radiology (n = 21, 20.8%), jkrs (n = 15, 14.9%), and korean journal of radiology (n = 9, 8.9%). We sought to identify any inconsistencies between the abstracts and the subsequent full - text publications . Study information was consistent for the position of the first author, study objective / hypothesis, design, statistical analysis, results, and conclusions (table 6). In contrast, investigators altered presentations by changing the title for 41% of the studies, adding or deleting authors for 79%, of the studies and changing the sample size for 42% of the studies . The annual krs meeting is a national radiology meeting that provides an important forum for the dissemination of current research findings in korea . The rsna and ecr meetings are two internationally prominent meetings in the field of radiology . Recently, many abstracts have been presented by korean investigators at both scientific meetings, and the number of presentations from korea has increased gradually . Our survey of 1,097 abstracts from three radiology meetings revealed that 27% of abstracts presented at these meeting in 2001 and 2002 were subsequently published in peer - reviewed journals . In comparing the publication rates between the three meetings, the publication rates from two international meetings (rsna and ecr) were significantly higher than that from the krs meeting, perhaps because fewer but better quality studies were presented at international meetings . Moreover, the publication rate for studies presented at the ecr conference was significantly higher than that for the rsna conference, although the exact reason for the difference is unclear . A few studies that were performed in the field of radiology revealed the publication rate for presentations at international meetings to be between 33% and 47% (table 7) (5 - 8, 11), although all studies included only oral presentations . In our series, the publication rate in medline - indexed journals of abstracts presented by korean investigators at the rsna and ecr meetings was 33% (83/249). Although this rate is lower than the rates for the ecr 2000 and 2001 conferences (47% and 45%, respectively) (7, 8), it is comparable to those observed at other usa - based national and international radiological meetings (33 - 40%). 10) reported that 25% of studies described in abstracts that were presented at the 1992 - 1996 krs meetings were subsequently published in jkrs . The publication rate in jkrs as determined in the present study from the krs meeting was 9% (76/848). A possible explanation for this difference may include that many researchers published research in the medline - indexed journals, or korean researchers have less interest in publishing studies in jkrs . In contrast, the publication rate in medline - indexed journals for studies described in abstracts presented at the 2001 and 2002 krs meetings was 12% (102/848). This publication rate is comparable to rates reported for a meeting in france (12) and turkey (13), but markedly lower than the rates rate for australian and new zealand meetings (4) (table 7). Failure to publish a study originally presented in an abstract is problematic for a variety of reasons . First, although some journals publish the abstracts of society meetings, in general the abstracts of meetings may be available only to meeting attendees . Second, the abstracts presented at scientific meetings usually have not undergone rigorous peer review, and lack the necessary detail for readers to critically appraise a given study for its validity . Third, nonpublication of negative results may lead to publication bias (14, 15). In the field of radiology last, failure to publish may be unethical and wasteful, leading to the potential replication of almost identical studies . In this study, we documented that only a relatively small percentage of studies presented at scientific meetings were finalized in the form of a published paper . Although most investigators have identified " lack of time " as a reason for not publishing findings presented in abstracts, actual reasons are multifactorial . Other reasons for failure of publication include low priority, ongoing preparation of results, lack of funds or other resources, lack of faith in the quality of research, rejection of a submitted paper, problematic relationships with co - authors, negative results, and the existence of other published reports with identical results (1, 16 - 19). In this study, we included six study variables (presentation type, radiological subspecialty, sample size, study design, statistical analysis, and study outcome) to identify factors predictive of publication . Our findings suggest that a prospectively designed study, use of statistical testing, and positive outcome were significant predictors of publication . These results are similar to those found in some previous analyses (1, 6, 15, 20 - 23). In addition, studies in oral presentations are more likely to be published in peer - reviewed journals than studies in poster presentations, although this difference did not reach significance . The influence of an oral presentation on publication has been well documented in other specialties (1, 19, 20, 24 - 26). One might hypothesize that high - quality research abstracts would be selected for oral presentation by the program committee and authors of studies not selected for oral presentation are given the option of presenting a poster . The topic of the presentation may be related to the publication rate, but in our study the publication rate according to the 10 different subspecialties did not markedly differ . Only the musculoskeletal radiology subspecialty had a markedly lower publication rate than the other subspecialties . Although we did not specifically evaluate all variables that may influence the publication rate, a broad spectrum of predictor variables influencing publication among presentations at meetings has been identified . Investigators of previous studies have reported that country of origin (7 - 8), basic research (27), originality of a study (19), affiliation with a university (28), a randomized study (28), external financial support (22, 29), and international collaboration (9) appeared to influence the publication rate . We found a substantial change in sample size and authorship from the time of initial presentation to final publication . The sample size of a study changed in 43% of the published studies originally presented as abstracts; this finding is similar to reported values of 39 - 46% found in other surveys (7, 30). In addition, in our study, 79% of published studies originally presented as abstracts had at least one different author than the original presented report, and this rate is higher than the rates observed at other meetings (59 - 73%) (30, 31). However, the percentage of studies where the first author of the presentation had changed or disappeared in the derived article was lower in our study (18.3%) than in surveys of other analyzed medical specialty meetings (22 - 36%) (7, 31, 32). An increase in sample size may be related to the continued enrollment of subjects after presentation of preliminary results, while a decrease in the sample size suggests possible tampering with the data to increase the quality of the paper . The possible reasons for changes in authorship are more complex and may include further analysis by another investigator, removal of authors if contribution is below standard required for authorship, limiting the number of authors in some meetings or journals, and so called " honorary " authorship . The fact that the first author of the presentation disappeared in 4% of publications is of interest . A possible reason for this result is that this author was chosen only for the presentation . First, we determined publication status based on a particular medical database (pubmed and korean medical databases) search; therefore, it is possible that we missed some studies that were published in journals not indexed in the database . These errors may occur due to the misspelling of the name of an author or merely because of a faulty search . Although we tried to minimize these errors by searching with two independent investigators, major changes of the author names or the key words from the title stand as possible causes of error during the search . Second, we did not investigate the possibility of duplicate presentations (presentations of the same study at multiple meetings) or duplicate publications (multiple publications resulting from a single abstract) as one of our aims was to compare the publication rate in our study with that of other studies . Only a few previous studies have addressed the situation of duplicate presentation or publication (19, 25). Finally, in this study, no attempt was made to contact the authors of presentations; further research needs to be conducted to determine the precise reasons why presentations were not published . In conclusion, the publication rate is significantly lower for the krs (23.6%) as compared to the rsna (35.4%) and ecr (50.5%) meetings . Prospective design, use of statistical testing, and a positive study outcome have a statistically significant effect on the publication rate.
Progressive facial hemiatrophy (pfh) was described initially by parry in 1825 . In 1846, romberg described the same as a syndrome . Eulenberg, in 1871, coined the name progressive facial hemiatrophy. We describe a case series of six patient presenting to us who were diagnosed as having pfh . The clinical features, history, and relevant investigations including serological findings of the patients are highlighted . Six patients presenting to our outpatient department were diagnosed with progressive facial hemiatrophy (pfh). The clinical features, history, and relevant investigations including serological findings of the patients are highlighted in table 1 . Patient demographics, clinical, and serological features all the six patients in our series were female . There was no significant family history of similar disease in the family in any of the patients . The age of onset of the disease ranged from eight to twenty - six years . Hyperpigmentation was seen in the patients and was a major concern for all of them . The cheek was involved in five of the patients, the forehead in two, and the nose in one . Bone involvement was not clinically evident in any patient; however, the youngest patient showed minimal bone atrophy on radiography . The auto - antibody profile showed a positive screen for anti - nuclear - antibodies in one patient; however, no specific positivity was seen on anti - nuclear - antibody profile testing, which included anti - single - stranded dna (anti - ssdna), anti - double - stranded dna (anti - dsdna), anti - centromere (aca), anti -scl-70, anti - jo / la, and anti - u1rnp . Right - sided pfa, mainly cheek and jaw right - sided pfa, mainly cheek and jaw right - sided pfa, mainly cheek left - sided pfa, mainly cheek and forehead the different treatment options tried by the patients included topical steroids, topical vitamin e preparations, anti - malarials, and topical calcipotriene . Two of the patients were referred for plastic surgery, for surgical management with autologous fat / fascial grafts, with subjectively satisfactory results . It has been described as a slowly progressive atrophy of the skin, subcutaneous tissue, and muscle, involving one side of the face, typically presenting during the first or second decade of life . It is characterized by the unilateral atrophy of the skin, subcutaneous tissue or the underlying bony structures, often accompanied by hyperpigmentation of the skin . This syndrome has many features of linear scleroderma en coup de saber, but is distinguished by a more extensive involvement of the lower face with only slight cutaneous sclerosis . It is often difficult to differentiate between scleroderma of the en coup de sabre type and pfh . Total hemi - facial involvement, neurological features, and ocular changes are more characteristic of pfh. [58] histopathological features that might contribute to differentiating the two conditions include: connective tissue fibrosis, adnexal atrophy, and mononuclear cell infiltrates, which are present more commonly in scleroderma of the en coup de sabre. In our series we have included only those cases that did not show histological evidence of sclerosis . All the patients in our series considered the associated hyperpigmentation of the skin to be a major problem . However, pfh has been reported in one of a monozygotic twin pair, suggesting that genetic factors are not involved in its etiology . In our study none of the patients had any significant associated family history of a similar condition . Cory et al, hypothesized that a noninfectious, unilateral inflammatory process, possibly associated with a chronic vasomotor disturbance and sympathetic nerve chain inflammation, was a major factor in the pathogenesis of this syndrome . There is a hypothesis that there are probably different subcategories among patients presenting with pfh . Even as some cases may be autoimmune in nature many of the cases are likely to be idiopathic and big majorities have only facial atrophy, with no evidence of eye or cns involvement . Sahin et al, reported a case of progressive hemifacial atrophy occurring in a 30-year - old woman, in whom the etiology was thought to be lyme disease . No sure link was established between these two disease states, but their coincident occurrence in this patient was noted . The authors suggested that the etiology of the parry - romberg syndrome could involve borreliosis . However, pfh has been reported from many areas, which are non - endemic for borreliosis, hence, making the significance of this association questionable . The association of idiopathic / progressive facial hemiatrophy with various auto - antibodies has been reported . However, the significance or specificity of the association is debatable, especially as many of these cases have been diagnosed as overlaps of the parry romberg syndrome (prs) and linear scleroderma . In the study by garcia - de la torre et al, in a series of prs cases, the rheumatoid factor was positive in 36%, anti - histone antibody positivity was seen in 21%, and anti centromere antibody positivity in 14% . They did not find any positivity for the anti - ds - dna antibody . Gonul et al, reported a case of a 21-year - old caucasian man with hemifacial atrophy on the right side . Serological studies with anti - single - stranded dna (anti - ssdna), anti - double - stranded dna (anti - dsdna), anticentromere (aca), and antinuclear (ana) antibodies were conducted . Anti - dsdna antibodies were found to be positive, but the others were negative . The rheumatoid factor (rf) was also negative . Some other reports also showed positivity to anti - ds - dna . In our series only one patient had a positive anti - nuclear - antibody (ana) screen, however, none of the patients showed specific positivity in an ana profile test, which included anti - single - stranded dna (anti - ssdna), anti - double - stranded dna (anti - dsdna), anticentromere (aca), anti - scl-70, anti - jo / la, and anti - u1rnp . Management of pfh comprises of a long - term follow - up of somatic disorders, and prevention of psychological problems . Treatment of pfh is symptomatic and mainly consists of plastic surgery after the disease activity has stopped . Various modalities of treatment have been tried for pfh, with varying results; however, very often these are prescribed under the assumption of associated localized scleroderma . These include intralesional or systemic products, such as, glucocorticoids, vitamin e, vitamin d derivatives, phenytoin, retinoids, penicillin, griseofulvin, interferons, d - penicillamine, antimalarials, and phototherapy . Surgical treatment is probably the only option in cases of definite pfh, parry - romberg syndrome or atrophic stages of localized scleroderma . Various surgical options used with varying results include simple / composite grafts (dermal and dermal - fat grafts), local or free flap surgery, injection of autologous tissues / lipofilling, paraffin, silicone, or polyalkylimide gel / poly - l - lactic acid. [1517] in our case series different medical options had been tried, including topical / intralesional steroids, anti - malarials, topical vitamin e preparations, and topical vitamin d analogs . Two of the patients had been referred for plastic surgery, as both had deep subcutaneous involvement (without bone involvement). Both the patients had a fat / fascial graft done, with satisfactory cosmetic results . It is essential to differentiate the condition from localized scleroderma, as the medical options used in the latter may have no benefits in pfh . Patient counseling is essential, so that the patients understand the nature of the disease and the prognosis.
Helicobacter pylori (h. pylori) infection is acquired mainly in childhood, especially in developing countries, where the influence of socioeconomic factors on the prevalence of h. pylori infection has been shown . There is a great contrast between developed countries, where only few children are infected and developing countries, where most children reach adulthood being h. pylori positive . In underdeveloped countries, up to 66% of individuals harbor the organism . In developing regions, for socioeconomic reasons, most infected children are not diagnosed and/or treated for h. pylori infection . Although one important controversy relates to the presence of recurrent abdominal pain in children, where an important association was observed between recurrent abdominal pain and h. pylori infection in some populations, some studies show h. pylori infection is probably not a cause of recurrent abdominal pain in children . Many investigators have studied the criteria for diagnosis and treatment of children infected by h. pylori, but association of symptoms with h. pylori infection in children presenting with nonulcer - dyspepsia is controversial . The criterion standards for diagnosis of active h. pylori infection are methods based on endoscopy and biopsy . Invasive tests include histology, culture and rapid urease test which require endoscopy to obtain biopsies of the gastric mucosa which is expensive and inconvenient . Noninvasive tests, which are based on analysis of samples of breath, blood, or stool, have been developed . Urease breath test (ubt) has been shown to be excellent in performance, but is expensive, may involve a visit to the hospital, and may be complicated to perform . Among the noninvasive methods, reliable non - invasive methods for detection of h. pylori infection are required to investigate the incidence, transmission, and clearance of infection in childhood . Detecting bacterial antigens in stool its performance in children and teenagers has been tested in some developed countries, showing a sensitivity and specificity above 90%; however, its accuracy in developing countries is not well established . The aim of this study was to evaluate the performance of stool antigen test for h pylori in iranian children with recurrent abdominal pain . One hundred three children (aged 4 - 15 y, 47 females, 56 males) who underwent upper gastrointestinal endoscopy due to recurrent abdominal pain were enrolled in this study . Exclusion criteria included receiving antibiotics, h2 antagonists, or proton pump inhibitors within the preceding 3 months . Recurrent abdominal pain is defined as paroxysmal abdominal pain in children between the ages of 4 and 16 years that persists for more than 3 months and affects normal activity . The study was approved by the ethics committee of the qom university of medical sciences . Endoscopy and biopsy was done on all patients providing a criterion standard for validation of the h. pylori stool antigen (hpsa) tests . Gastric biopsy specimens were collected from the same location in the antrum of the stomach . H. pylori was cultured on columbia agar supplemented with 7% horse blood at 37c for 4 to 6 days under microaerophilic conditions . Isolated strains were identified as h. pylori by gram stain, morphology, and positive urease, oxidase, and catalase tests . The presence of h pylori organisms in stool was determined by an enzyme - linked immunosorbent assay using a commercially available polyclonal antibody kit (astra srl, via ciro menotti, milano, italy). H pylori - specific polyclonal antibodies conjugated to horseradish peroxidase were added, incubated, and washed before peroxidase was added; a visible blue reaction indicated the presence of h pylori . Hpsa sensitivity, specificity, and positive and negative likelihood ratios were determined with reference to the results of cultures of gastric biopsy specimens . There were 56 (54/4%) male and 47 (45/6%) female patients, with a mean age of 8.32 years . 39 (37.8%) of the 103 children tested, including 22 (56.4%) females and 17 (43.6%) males with mean age of 9.14 years, were positive for h pylori according to the results of hpsa test . No statistically significant difference was found between sex and h. pylori infection (p=0.4). Of 41 patients who were positive by endoscopy - based tests 35 patients were also positive by the hpsa test; of 62 patients diagnosed as negative by endoscopy - based tests, 58 patients were also negative by the hpsa test . In this context, qualitative enzyme - linked immunosorbent assay polyclonal antibodies were done for determination of the bacterial antigen in human stool . According to the detailed information provided within the commercial kit, the sensitivity, specificity, and positive and negative likelihood ratios of the test used in our study were 85%, 93%, 89.7%, and 90%, respectively . Table 1 shows the cross - classification of the defined standard for h. pylori infection status of these 103 children with the results of the cultures of gastric biopsy specimens . H pylori status by cultures of gastric biopsy specimens and hpsa hpsa: h pylori stool antigen methods for the detection of h. pylori infection are classically divided into invasive and noninvasive . No single test is a fully reliable method for detection of h. pylori in all instances . The current criterion standard for diagnosing h. pylori infection is endoscopic biopsy of the gastric tissue for rapid urease test, histology, and culture . However, such an invasive procedure has major disadvantages of anesthesia, discomfort, and the possibility to be a source of ethical problems . Based on the recommendations of the european task force for h. pylori infection in children the authors stated that upper gastrointestinal endoscopy with gastric biopsy is the method of choice for symptomatic children, and noninvasive tests to screen children with abdominal pain are not recommended . However, in developing countries the infection rate in infants and young children is high and in such situations, an invasive test in children may not be suitable . Although studies have suggested that the ubt is the most reliable noninvasive test in the general population, it may be less efficient in pediatric patients . And despite the excellent diagnostic accuracy of the ubt, it requires special instrumentation and specialized staff . Several noninvasive diagnostic methods based on the detection of fecal antigens of h. pylori have been developed . At present, their diagnostic accuracy is controversial . Three different forms of the test have been commercialized, an enzyme linked immunosorbent assay using polyclonal antibodies, an enzyme - linked immunosorbent assay using a monoclonal antibody, and a rapid immunochromatographic test using a monoclonal antibody . The united states and european authorities approved the stool antigen tests as a reliable tool in the primary diagnosis and also in the monitoring of post treatment outcome of h. pylori infection . In the present study, hpsa test had sensitivity and specificity of 85% and 93%, respectively for h. pylori screening in children with abdominal pain . Most previous studies in adults and children have compared the efficacy and accuracy of the polyclonal hpsa with the various invasive and non - invasive tests used for diagnosing h. pylori infection . We demonstrated high sensitivity, specificity and likelihood ratios for the polyclonal stool antigen compared with invasive test in the diagnosis of h. pylori infection in children . The sensitivity and specificity of the stool test are reported to be over 90% in children with gastrointestinal symptoms . Although many investigators have reported high sensitivities and specificities of hpsa tests in children, the opinions on the efficacy of the hpsa test in patients with abdominal pain in developing countries are conflicting . The accuracy of the stool antigen test has been confirmed in children, and this may be the optimal test to screen and confirm success of eradication therapy . The test may also be recommended for children when endoscopic examination is infeasible and for post treatment eradication testing in children . The stool antigen test was found to be a useful method to screen children with abdominal pain for h. pylori infection in developing countries . Stool antigen test, which detects present but not previous infection of h. pylori, would be applicable in mass survey . However there is a need for further studies with a greater number of patients for evaluation of its accuracy in children of developing countries . In this pilot study, a low - cost and rapid diagnostic technique, stool antigen test, proved to be highly sensitive and specific for detecting h. pylori infection in children with recurrent abdominal pain . Our results are comparable to those reported elsewhere in children and demonstrate that the hpsa test can replace endoscopy and biopsy for detecting h. pylori infection.
Amyotrophic lateral sclerosis (als) is a progressive and devastating neurodegenerative disease characterized by selective loss of motor neurons in the motor cortex, brain stem, and spinal cord . The mechanisms underlying the loss of motor neurons are complex and have to be clarified yet . A variety of hypotheses on the pathogenesis of als have been proposed so far, such as apoptosis, excitotoxicity, immune reactivity, inflammatory mechanism, mitochondrial dysfunction, protein aggregation, and oxidative stress . And some previous studies identified the mutations in the superoxide dismutase 1 (sod1) gene caused immune and inflammation abnormalities in animal models of als . Some pathological studies found the immune abnormalities in the central nervous system (cns), blood, and cerebrospinal fluid (csf) of the patients with als . Other studies in the patients with als found that the expression of c - reactive protein (crp), interleukin (il)-6, il-8, and macrophage chemotactic protein-1 was increased, which demonstrated a systemic pro - inflammatory condition and adaptive immune system responses in als . Furthermore, the autopsies of the als patients showed that galectin-3 levels in the spinal cord and brainstem homogenates were significantly higher than the normal controls (ncs). A study on sod1 (g93a) mutant mice showed that early disease was associated with astrogliosis while late disease was correlated with microglial activation . The elevated galectin-3 levels by microglia in a mouse model of als was related to the progression of disease . It has been identified that galectin-3 plays an important role in plentiful cellular functions including apoptosis, cellular adhesion, cell migration, cell growth or differentiation, innate or adaptive immune response, and inflammation . Despite of these studies indicating the involvement of galectin-3 in the pathophysiological processes of als, whether galectin-3 plays a protective, anti - inflammatory response in als they have been shown to impact diagnosis, understanding of pathogenic mechanisms, and efficiency of therapeutic clinical trials . Although many biomarkers have been derived from csf and blood so far, none of the known biomarkers can accurately distinguish als from the ncs, including some protein biomarkers in csf and blood, which showed a bit contradictory results . Group analyses that stratify the patients with als by gender, type of disease onset, duration of disease and so on might be helpful in identifying biomarkers of als . While galectin-3 is a secretory protein, the former studies on csf suggested that galectin-3 might be a biomarker of als, but failed to reveal the change of galectin-3 in different stages of als . The csf samples were obtained using lumbar puncture (commonly called spinal tap); the blood samples were obtained using venipuncture . Lumbar puncture is a little inconvenient and invasive compared with the low cost and easily access of venipuncture . Besides, all of the foregoing studies on galectin-3 in the tissues of als patients were from the postmortem (end - stage) of als . That encouraged us to set up a suitable source for clinical measurement of galectin-3 in patients with als . In this study, we evaluated plasma galectin-3 levels in different stages of als, which were rarely investigated before as far as we know . The results validated our expectation very well, suggesting that plasma galectin-3 might be a useful factor which might reveal the underlying pathogenesis of als . Between july 2010 and december 2014, 51 patients with als (als group) and 60 ncs (nc group) were enrolled in this study . All cases were recruited from the department of neurology and the department of geriatric medicine of affiliated nanjing brain hospital of nanjing medical university . This study was approved by the ethics committees of affiliated nanjing brain hospital of nanjing medical university (clinical trials government identifier: nct201006). All cases were examined according to the standardized protocol, which included a general medical and neurological examination by a neurologist . There were 38 patients with clinically definite als and 13 patients with clinically probable als patients with inflammatory, gastrostomy, or a predicted forced vital capacity <50% were excluded from the study . Patients with evidence of a systemic inflammation on clinical examinations or serum biochemical tests (e.g., increased number of white blood cells, high levels of crp, or erythrocyte sedimentation rate) were excluded from the study . Patients who used nonsteroidal anti - inflammatory drugs, steroids, or statins during the last 2 months before enrollment were excluded from the study . The neurological functional assessment of the als group was recorded by the revised version of amyotrophic lateral sclerosis functional rating scale (alsfrs - r) at the time of diagnoses . According to this scale, als patients were scored from 0 to 48 points and divided into two groups: the patients with a mild clinical condition (over 24 points according to alsfrs - r) and the patients with a severe clinical condition (up to 24 points according to alsfrs - r). Besides, the patients were divided into two groups according to the type of disease onset: the patients with limb onset and the patients with bulbar onset . The duration of als was 296 months; the average of the duration was 19.8 months . According to the duration of disease, two groups of patients were isolated: the patients with duration 12 months and the patients with duration> 12 months . Within 30 min after admission, the plasma samples were collected into the plastic tubes with the ethylenediaminetetraacetic acid as an anticoagulant, centrifuged for 15 min at 1000 g, 2c8c, and then stored at 80c until the analyses were carried out . The levels of galectin-3 in plasma were determined using the commercially available enzyme - linked immunosorbent assay kit for human galectin-3 (cusabio biotech co., ltd, wuhan, hubei, china) according to the manufacturer's instructions . Armonk, ny, usa). Whether the data follow the normal distribution or not was performed with kolmogorov - smirnov test . The nonparametric mann - whitney u - test and wilcoxon signed - rank test were used to examine the difference between two groups because the data were not normally distributed . Correlation analyses were performed using the spearman's rank correlation to investigate whether there is an association of plasma galectin-3 levels with the clinical characteristics of disease . All statistical analyses were performed using the spss statistics 23.0 (ibm corp ., armonk, ny, usa). Whether the data follow the normal distribution or not was performed with kolmogorov - smirnov test . The nonparametric mann - whitney u - test and wilcoxon signed - rank test were used to examine the difference between two groups because the data were not normally distributed . Correlation analyses were performed using the spearman's rank correlation to investigate whether there is an association of plasma galectin-3 levels with the clinical characteristics of disease . The clinical characteristics of the als group and the nc group are shown in table 1 . All the patients with als were divided into groups according to their clinical characteristics: male (n = 26) and female (n = 25), duration 12 months (n = 26) and duration> 12 months (n = 25), bulbar onset (n = 13) and limb onset (n = 38), and mild clinical condition (n = 39) and severe clinical condition (n = 12). The age and the male: female ratio between the nc group and each of the als group clinical characteristics of the als groups and the normal controls values were n or mean sd . The comparisons of plasma galectin-3 levels in the als group and with the nc are listed in table 2 . The preliminary statistical analyses found that galectin-3 levels in all the als patients were not different as compared with the ncs (254.14 [69.12859.22] vs. 201.64 [22.35401.63] ng / ml, p = 0.05). However, the further statistical analyses revealed the differences between the als group and the nc group elaborated hereafter . In addition, compared with the nc group, galectin-3 levels in the als group with mild clinical condition and the als group with severe clinical condition were not different at all (253.62 [69.12859.22] vs. 201.64 [22.35401.63] ng / ml, p> 0.05; 263.27 [109.99531.92] vs. 201.64 [22.35401.63] ng / ml, p> 0.05). Comparisons of plasma galectin-3 levels between the als and normal control groups pn values were estimated by kolmogorov - smirnov test; pn<0.05 means that the data were not following the normal distribution . Pc values were estimated by mann - whitney u - test; pc<0.05 means that the difference between two groups was statistically significant . Compared with the nc group, galectin-3 levels in the als group with duration> 12 months were significantly increased (341.17 [69.12859.22] vs. 201.64 [22.35401.63] ng / ml, p <0.05). However, no significant difference was found between the als group with duration 12 months and the nc group (250.62 [109.77334.92] vs. 201.64 [22.35401.63] ng / ml, p> 0.05). Furthermore, as shown in figure 1b, compared with the als group with duration 12 months, galectin-3 levels in the als group with duration> 12 months were increased significantly (341.17 [69.12859.22] vs. 250.62 [109.77334.92] ng / ml, p <0.05). (a) comparison between the als group with duration> 12 months and the normal controls (341.17 [69.12859.22] vs. 201.64 [22.35401.63] ng / ml, pc = 0.006, pc <0.05); comparison between the als group with limb onset and the normal controls (254.14 [69.12859.22] vs. 201.64 [22.35401.63] ng / ml, pc = 0.037, pc <0.05); comparison between the female als group and the normal controls (263.27 [9123.32859.22] vs. 201.64 [22.35401.63] ng / ml, pc = 0.005, pc <0.05). (b) comparison between the als group with duration 12 months and the als group with duration> 12 months (250.62 [109.77334.92] vs. 341.17 [69.12859.22] ng / ml, pc = 0.02, pc <0.05); comparison between the als group of limb onset with duration 12 months and the als group of limb onset with duration> 12 months (251.79 [116.03334.92] vs. 481.30 [69.12859.22] ng / ml, pc = 0.04, pc <0.05). (c) correlation between the plasma levels of galectin 3 and the duration of als (n = 51), r = 0.293, pa = 0.037, pa <0.05 . Pc values were estimated by mann - whitney u - test; pc <0.05 means that the difference between two groups was statistically significant . Pa values were estimated by spearman's rank correlation; pa <0.05 means that the association between two factors was statistically significant . Compared with the nc group, galectin-3 levels in the als group with limb onset were significantly increased (254.14 [69.12859.22] vs. 201.64 [22.35401.63] ng / ml, p <0.05). The further analyses in the als group with limb onset showed that significant difference of galectin-3 levels was found in the als group with duration> 12 months and the als group with duration 12 months (481.30 [69.12859.22] vs. 251.79 [116.03334.92] ng / ml, p <0.05) [figure 1b]. However, no significant difference was found between the als group with bulbar onset and the nc group (251.79 [109.20404.76] vs. 201.64 [22.35401.63] ng / ml, p> 0.05). The same result was found between the als group with limb onset and the als group with bulbar onset (254.14 [69.12859.22] vs. 251.79 [109.20404.76] ng / ml, p> 0.05). As shown in figure 1a, galectin-3 levels were significantly increased in the als female group compared with the nc group (263.27 [123.32859.22] vs. 201.64 [22.35401.63] ng / ml, p <0.05), while there was no significant difference between the als male group and the nc group (220.39 [69.12748.73] vs. 201.64 [22.35401.63] ng / ml, p> 0.05). Moreover, there was no significant difference between the als female group and the als male group (263.27 [123.32859.22] vs. 220.39 [69.12748.73] ng / ml, p> 0.05). The comparisons of plasma galectin-3 levels between the als groups and the ncs are listed in table 3 . Comparisons of plasma galectin-3 levels between the als (segmentation) and normal control groups pn values were estimated by kolmogorov - smirnov test; pn<0.05 means that the data were not following the normal distribution . Pc values were estimated by mann - whitney u - test; pc<0.05 means that the difference between two groups was statistically significant . The association between galectin-3 levels and the duration of disease is shown in figure 1c, suggesting a significant positive correlation between them (r = 0.293, p = 0.037). However, there was no statistically significant correlation between galectin-3 levels and the severity of clinical conditions . As far as we know, this study indicated that plasma galectin-3 levels were related to the clinical characteristics of disease, associated with limb onset of disease and the female patients with als . Moreover, there was a positive correlation between plasma galectin-3 levels and the duration of disease, suggesting that plasma galectin-3 might be a very interesting factor associated with als . Als is a fatal neurodegenerative disease with few therapeutic options; currently, riluzole is the only drug to treat als approved by the food and drug administration of usa . Nevertheless, early biomarkers, which would ideally be useful in disease monitoring, are very limited up to now . Ibudilast is a phosphodiesterase inhibitor, which affects the function of lymphocytes, glial cells, and inhibits the release of tumor necrosis factor - a (tnf - a) by inflammatory cells . In 2015, a report from the american academy of neurology showed that the coadministration of ibudilast and riluzole was safe and tolerable in patients with als, which could improve als function and delay progression . A study using sod1 (g93a) rats (an animal model of als) showed that immunomagnetically isolated microglia were in different cns regions at different points in the progression of disease . The authors also found that at the end stage of disease, microglias were characterized by high expressions of galectin-3, and the concomitant downregulated expressions of inflammatory factors such as tnf - a and il-6 . Moreover, galectin-3 or osteopontin - positive microglia were restricted only to the ventral horns of spinal cord and the regions with severe motor neurons degeneration . Other researchers used sod1 (g93a) or galectin-3 transgenic mice to evaluate the role of galectin-3 in a mouse model of als; the results suggested that although the deletions of galectin-3 did not change the onset of disease, it resulted in a greater rapid progression, and more severely impaired neurological symptoms at all stages of disease . Zhou et al . Found increased levels of galectin-3 in the spinal cord tissues from the patients with als in comparison to the ncs . These data suggested that the elevation in galectin-3 as the disease progresses might play a protective, anti - inflammatory role in innate immune responses to als . Csf communicates directly with brain parenchyma and medulla spinals, and thus is an important source of biomarkers that can indicate the presence and extents of als . A previous study showed that the patients with als had approximately two - fold galectin-3 in csf as the ncs and other neurological diseases including stroke and dementia . Given the fact that lumbar puncture is painful, invasive, and dangerous, detection methods that are more convenient may be better . Peripheral blood is easy to access and handle and allows multiple tests harmlessly at a low cost . In addition, it is relatively accepted that the integrity of blood - brain barrier and blood - spinal cord barrier is perturbed in als . So that, the levels of galectin-3 in plasma were determined in this study . This study indicated that plasma galectin-3 levels were not increased in the whole group of patients with als significantly compared to the nc group . However, further analyses showed that galectin-3 levels were increased significantly in the als patients with duration> 12 months . Moreover, the study showed that there was a positive correlation between galectin-3 and the duration of disease . In sod1 (g93a) mutant mice, late disease was associated with microglial activation . Besides, the majority of microglia or macrophages expressed galectin-3 . In addition, the former studies from the postmortem of als showed increased galectin-3 levels compared to the ncs . All the studies indicated that galectin-3 levels in als might be elevated in the late stage of disease, which was consisted with our results very well . Furthermore, our data showed that in the als patients with limb onset, there were higher galectin-3 levels in the patients with durations> 12 months . To the best of our knowledge, this is a rare study that analyzed the relationship between galectin-3 and the duration of disease in als so far . Moreover, no former research analyzed the association between galectin-3 and the severity of clinical conditions of als . Our study showed the enhanced expressions of galectin-3 potentially correlated with the stage of disease, suggesting that as the disease progresses the immune inflammation is aggravated gradually . Our data showed that there was a gender difference in plasma galectin-3 levels remarkably, which were only increased in the als female patients but not in the als male patients as compared with the ncs . Moreover, even in the als female patients, galectin-3 levels were only increased when the duration of disease> 12 months, both in als patients with bulbar onset and in als patients with limb onset . This study demonstrated that there was a significant positive correlation between galectin-3 levels and the duration of disease and further the gender of patients influenced the clinical features of disease . The possible reasons for gender disparity include different immune responsiveness, hormone levels, and biological responses to exogenous toxins . However, there was no difference between female als patients and male als patients in our data, which have to be clarified in the future . Furthermore, in the study, increased galectin-3 levels were only observed in the als patients with limb onset but not with bulbar onset compared with the ncs . It is well known that the als patients with bulbar onset have much more severe clinical conditions than the patients with limb onset . A recent study found that in a mouse model of als, after the onset of disease, the frequency of galectin-3 microglia in the spinal cord was significantly elevated compared to the brainstem, which indicated that galectin-3 might play a protective role in als . Admittedly, als is a disease with very complicated mechanisms, most of which are not clarified yet . Interestingly, our study indicated that the association between plasma galectin-3 and the severity of clinical conditions of als was not statistically significant . This might be due to that the alsfrs - r does not conform with the requirements of measurement . The assessment of stages on the severity of disease is very helpful in prognosis, therapeutic options, and resource planning; recently, a new staging system was proposed . The main limitation of this work was that it was just a cross - section study . Future studies should be longitudinal so as to evaluate the change of plasma galectin-3 greatly in more stages of als . Disease heterogeneity is an important factor when performing a biomarker investigation, requiring larger cohorts, and proper patient groups . Therefore, we could not find the difference between gender and the onset of disease in this study, which might be due to the small number of cases enrolled . In conclusion, this study showed that plasma galectin-3 levels were elevated in als patients with limb onset, especially in female patients with als, and positively correlated with the duration of disease . Plasma galectin-3 levels were increased with the progression of als, which indicated that it potentially plays a protective role . Plasma galectin-3 is a very interesting factor associated with als that might be useful in evaluating the progress of als and even a potential therapeutic target in the future . This work was supported by grants from the national 973 basic research program of china (no . 2014cb943303), the national natural science foundation of china (no . 81230026, no . 81171085, no . 81361120247), the science and technology development foundation of jiangsu province of china (no . Bl2012013), and the medical science and technology development foundation of nanjing department of health (no . This work was supported by grants from the national 973 basic research program of china (no . 2014cb943303), the national natural science foundation of china (no . 81230026, no . 81171085, no . 81471157, and no . 81361120247), the science and technology development foundation of jiangsu province of china (no . Bl2012013), and the medical science and technology development foundation of nanjing department of health (no.
Early childhood caries is a significant public health problem in both developing and industrialized countries which continues to affect babies and preschool children worldwide . Early childhood caries (ecc) is not life - threatening but it may contribute to suboptimal health and failure to thrive . Ecc is a chronic, transmissible, infectious disease with a complex and multifactorial etiology . The short - term consequences of untreated decay in children's teeth include pain, with up to 12% of 5-year olds reported to have experienced tooth ache, systemic infection and abscesses . Untreated caries may lead to early loss of the primary dentition and affect the growth and maturation of the secondary, adult dentition . In fact, decay in the primary dentition is the best predictor for decay in the permanent dentition; poor dental health and disease often persist to adulthood, affecting speech articulation, growth, and dietary practices . Thus, poor dental health has a significant impact on the growth and cognitive development of child by interfering with nutrition, concentration and subsequently school participation. [68] ecc prevalence varies from population to population; however, children of disadvantaged subpopulations, regardless of race, ethnicity or culture, have been found to be most vulnerable . In england the prevalence reported ranges from 6.8 - 12% and in usa prevalence varies from 11.0 - 53.1% . In asia, in the far east region, which seems to have one of the highest prevalence and severity for the disease, the prevalence in three - year - olds ranges from 36 to 85%,[914] while in india a prevalence of 44% has been reported for caries in 8- to 48-month - olds . Another study reported a caries prevalence of 54.1% in the preschool children of hubli and dharwad city . There has been a considerable amount of information about prevalence of early childhood caries in pre - schoolers in other parts of the world, whereas in india, not much baseline data is available . Hence the aim of this study was to find out the prevalence of early childhood caries among 3 - 5 year old pre - schoolers in kindergartens of schools of marathahalli, bangalore . A cross sectional study was conducted among 3 - 5 years old pre - schoolers in schools of marathahalli, bangalore . A list of schools having kindergartens was obtained from deputy director of public instructions (ddpi) office, bangalore south . All the schools with kindergartens in marathahalli were included in the study . Out of the eight schools, six schools permitted to conduct the study . Before conducting the study, ethical clearance was obtained from the institutional review board . Also, prior permission to conduct the study was obtained from the authorities of respective schools . Voluntary written informed consent was obtained from parents of the children participating in the study before the clinical examination . All the children aged 3 - 5 years attending the schools of marathahalli, bangalore whose parents gave consent to participate in the study and who co - operated during the oral examination were included in the study . Children with acute infections of oral cavity which interfered with oral examination were excluded from the study . A total of 717 pre - schoolers participated in the study . Before the start of the survey, intra - examiner reliability was assessed on 10 subjects on different days and the examiner repeated her examinations on them . The kappa co - efficient value for intra - examiner reliability with respect to decayed, indicated for extraction and filled teeth index (deft) was 0.8 which reflected high degree of conformity in observations . A pilot study was carried out in one school chosen using simple random sampling, on all the 3 - 5 year old pre - schoolers present on the day of examination to check the feasibility and relevance of proforma, to have prior idea regarding the estimate of the time taken to examine each patient and the survey was planned accordingly . Early childhood caries was diagnosed using early childhood caries diagnostic criteria, consistent with the nidcr (national institute of dental and craniofacial research) workshop statement . Both d1 and d2 stages of caries were recorded . Clinical examination was conducted at respective schools by making child sit on ordinary chair with back rest, with the examiner sitting in front of the chair and deft index was recorded using gruebell's criteria . The d component included decayed deciduous teeth (both initial and cavitated lesions), e component included deciduous teeth extracted due to caries or indicated for extraction, and f included filled teeth . Descriptive statistics that included mean, standard deviation and percentages were calculated for each of the categories . Student t - test, anova was used to find out significant differences in mean deft between groups . Significance for all statistical tests was predetermined at a probability value of 0.05 or less . The study population consisted of 717 pre - schoolers in the age range of 3 - 5 years . Out of 717 children, 317 (44.2%) were females and 400 (55.8%) were males . 201 (28%) were 3 years old, 243 (33.9%) were 4 years old and 273 (38.1%) were 5 years old with a mean age of 4.10 (0.8) years . The prevalence of early childhood caries among the study population was 40% with a mean dmft of 1.89 3.3 while the sic index of the study population was 5.51 . Out of 201 3 year old children, 90 (44.8%) had early childhood caries and 111 (55.2%) did not had caries . Among 243 4 year old children, 85 (35%) had early childhood caries and 158 (65%) were caries free . Out of 273 5 year old children, 112 (41%) had early childhood caries and 161 (59%) did not had caries . 126 (39.7%) females and 161 (40.3%) males had early childhood caries [table 1]. Age and gender wise prevalence of early childhood caries the mean dmft of 3 year old was 1.86 2.9, of 4 year old was 2.0 3.8 and in 5 year old was 1.81 3.1 . The mean dmft in females was 1.71 2.9 while in males it was 2.03 3.6 . However, this difference was also not statistically significant (p = 0.198) [table 2]. Mean dmft of study population according to age and gender the pattern of tooth wise distribution of early childhood caries among the study population showed that the most severely affected teeth were maxillary central incisors (19.5% and 20.2% for maxillary right and maxillary left central incisor respectively) followed by maxillary lateral incisors (14.9% and 14.6% for maxillary right and maxillary left lateral incisor respectively) and mandibular second molars (14.9% on right side of the arch and 14.4% on left side of the arch). The caries pattern was fairly symmetrical across the arches [table 3]. Pattern of tooth wise distribution of early childhood caries this present study was conducted on 717 pre - schoolers aged 3 - 5 years in kindergartens of schools of marathahalli, bangalore, karnataka, india . Early childhood caries is a lifestyle disease that begins when the child's teeth erupt in the oral cavity . The distinctive pattern of decay rapidly spreads from one tooth to another and involves the surfaces of teeth that are usually not at risk . The children were examined both for non cavitated (including white spot lesions) and cavitated lesions . No attempt was made to use a dental explorer to confirm cavitation of the lesions due to the young age of the children . This ensured their compliance with the examination without adversely affecting their cooperation and behavior in the dental environment in future . This study documented a 40% prevalence of early childhood caries which is in equivalence to karnataka state average (40.5%), our country average (40 - 60%, 52%) and studies done by saravanan s (44.4%) and simratvir, et al . Caries prevalence (40%) was higher in this population in comparison to studies conducted by wyne, askarizadeh, et al . Who reported a prevalence of 27.3% and 17.2% respectively . On the other hand, the prevalence of the present study was less in comparison to studies done by mazhari and sadeghi . This can be attributed to the inclusion of early carious lesions and non cavitated lesions into consideration for diagnosis in the present study . The study population in the present study had a mean dmft of 1.89 3.3 . This mean dmft values are in conformity with the karnataka state average (1.7), studies by simratvir, sudha p., horowitz, et al . However, it was much lesser in comparison to study done by wyne who reported a mean dmft of 8.6 (3.4) and sadeghi who reported a mean dmft of (2.6 3.15). Since the caries was diagnosed entirely on visual examination in the present study, this certainly resulted in an underestimation of the actual caries status; hence it is possible that the true carious lesion prevalence would be higher than reported in our present study . The other contributory factors could be varied diagnostic criteria used for diagnosis of early childhood caries, genetic predisposition, lack of parental education and varied socioeconomic status among the population studied, lack of dietary and oral hygiene discipline, in addition to very late first dental visit for routine checkup. [61820] the mean deft among the 3 year old children was 44.8% (dmft 1.86 2.9) which was less in comparison to that reported by schroth, et al . Similar difference was found for 4 year old and 5 year old children who reported a mean dmft of 2.0 3.8 in 4 years old and 1.81 3.1 in 5 years old in the present study while it was 13.9 2.8 in 4 years old and 13.7 2.9 in 5 year old according to scroth, et al . However the results of the present study were similar to those done in ludhiana, hubli - dharwad which shows that most of the lesions recorded were of d category (decayed teeth, which required treatment). This clearly reflect that the availability of oral health services, oral health awareness, socioeconomic status and attitude of masses towards oral health greatly influence the distribution of def components . The mean dmft was slightly high among boys compared to the girls with a mean dmft of 2.03 3.6 and 1.71 2.9 respectively which was similar to the studies by simratvir, et al . However this difference was not statistically significant (p = 0.081) which was consistent with the other studies. [6102223] the early childhood caries pattern among the present study group showed that maxillary right and left central incisors showed highest prevalence of caries (19.5% and 20.2% respectively) followed by mandibular second molars (14.9% and 14.4% on left and right side respectively) and the mandibular incisors showed the lowest prevalence of caries being 0.3% and 0.1% . It is noteworthy that majority of the children, who had decay, had anterior tooth involvement as well; clearly indicative of the fact that besides oral hygiene, erratic nursing habit might have also contributed to caries . Lack of dexterity in this age group and negligence on the part of caretakers might have accounted for poor oral health . Also, besides oral hygiene the present study showed a sic index value of 5.51 for 3 - 5 year old pre - schoolers . This was slightly higher than the sic index of 4.11 in brazilian population reported by carvalho, et al . This aims at focusing the interest on the neglected and needy high risk group pre - schoolers and calls for a more specific and targeted actions . Past caries experience is an important indicator for future caries risk and children with high caries levels will most likely be those adults requiring complex and expensive treatments in the future . Effective early prevention measures will cut down treatment expenditure for this caries prone group in their adult life . Thus, the aim should be population based prevention to reduce the overall caries burden of this underprivileged preschool age group . Early childhood caries is a public health problem that warrants the attention and resources of the community . This study showed a 40% prevalence of early childhood caries among 3 - 5 year old pre - schoolers in marathahalli, bangalore . Efforts to increase awareness of the public on the prevalence, severity and impact of ecc on general and oral health, growth and development of children should be undertaken . Awareness on the diagnosis, prevention and treatment of ecc should be increased among dentists, physicians, paediatricians, nurses, midwives and other community health workers involved in care of preschool children . Thus, the result of the present study calls for a need to focus on pre - schoolers oral health and parental education for prevention and early detection of early childhood caries.
Stress among both medical students[16] and residents has been investigated in several studies . At the start of medical school, medical students have mental health similar to nonmedical peers, but frequent studies suggest that students mental health worsens during the medical training. [16914] several stressors threaten medical students mental health . Common stressors include: adjustment to the medical school environment, educational debt, heavy workload, sleep deprivation, difficult patients, poor learning environments, financial concerns, information overload and career planning . These stressors can lead to catastrophic consequences such as anxiety, depression, impaired academic performance, impaired competency, medical errors and attrition from medical schools . In a large study in uk using the 12-item general health questionnaire (ghq-12), 30.6% of first - year medical students, 30.6% of fourth year and 21.9% of fifth year medical students scored above the threshold indicating that medical students were suffering from some sorts of psychological distress . Using the same questionnaire, a study from turkey indicated that 47.9% of the second - year medical students experienced emotional disorders, well above the percentage of students studying economics (29.2%) and physical education (29.2%). A study from malaysia also reported that 41.9% of medical students experienced emotional disturbances . However, there is minimal information in the literature documenting the prevalence of psychological distress in iranian medical students as well as residents . Hence, the aim of this cross - sectional study was to determine the prevalence of psychological morbidity among iranian medical students in different levels of training . It was hoped that the study could contribute to the existing literature on the topic and provide information for possible future interventions . All participants were recruited from isfahan university of medical sciences (iums), isfahan, iran . Medical curriculum at undergraduate level in iums is divided into three periods: first five semesters of basic science, then six semesters of clinical clerkship, and finally three semesters of internship. At the end of this period, students will graduate as a medical doctor and then if they wish they could take part in a national exam to enter into the postgraduate medical studies, known as residency stage . Between january and june 2010, a stratified random sampling was done . Based on 95% confidence interval (p = 0.44, d= 0.13), we considered 45 participants in each level of training . Students were asked to complete a self - rated instrument measuring psychological distress as well as a short questionnaire containing items on demographic variables including age, gender, marital status and training level . Psychological distress was measured using the iranian version of the 12-item general health questionnaire, ghq-12 . It is used to detect non - psychotic psychiatric disorders, such as depression and anxiety . Each item is rated on a four - point scale (less than usual, no more than usual, rather more than usual, or much more than usual). The ghq-12 is a brief, simple, easy to complete, and its application in research settings as a screening tool is well documented . This questionnaire is translated and validated in persian by montazeri et al . In 2003 and they found that the iranian version of the ghq-12 is a reliable and valid measure and hence can be used for measuring psychological well - being in iran (cronbach's alpha coefficient = 0.87). The higher values indicate more psychological symptoms . Between january 2010 and june 2010, the medical students were asked to complete the self - rated ghq-12 questionnaire as well as a short questionnaire containing items on demographic variables including age, gender, marital status and training level . Descriptive statistics were used to present the demographic data and the scores for the ghq-12 . The students t - test and one - way analysis of variance logistic regression analysis was performed to assess the association between demographic data and the ghq-12 scores . For the purpose of analysis relative to threshold score for the iranian adolescents (score> 3.5), the categorized ghq-12 score was considered as dependent variable and age, gender, marital status, and level of training were considered as independent factors in logistic regression analysis . The analysis of data was performed by the predictive analytic software (spss version 18) for windows . All participants were recruited from isfahan university of medical sciences (iums), isfahan, iran . Medical curriculum at undergraduate level in iums is divided into three periods: first five semesters of basic science, then six semesters of clinical clerkship, and finally three semesters of internship. At the end of this period, students will graduate as a medical doctor and then if they wish they could take part in a national exam to enter into the postgraduate medical studies, known as residency stage . Between january and june 2010, a stratified random sampling was done . Based on 95% confidence interval (p = 0.44, d= 0.13), we considered 45 participants in each level of training . Students were asked to complete a self - rated instrument measuring psychological distress as well as a short questionnaire containing items on demographic variables including age, gender, marital status and training level . Psychological distress was measured using the iranian version of the 12-item general health questionnaire, ghq-12 . It is used to detect non - psychotic psychiatric disorders, such as depression and anxiety . Each item is rated on a four - point scale (less than usual, no more than usual, rather more than usual, or much more than usual). The ghq-12 is a brief, simple, easy to complete, and its application in research settings as a screening tool is well documented . This questionnaire is translated and validated in persian by montazeri et al . In 2003 and they found that the iranian version of the ghq-12 is a reliable and valid measure and hence can be used for measuring psychological well - being in iran (cronbach's alpha coefficient = 0.87). The higher values indicate more psychological symptoms . Between january 2010 and june 2010, the medical students were asked to complete the self - rated ghq-12 questionnaire as well as a short questionnaire containing items on demographic variables including age, gender, marital status and training level . Descriptive statistics were used to present the demographic data and the scores for the ghq-12 . The students t - test and one - way analysis of variance logistic regression analysis was performed to assess the association between demographic data and the ghq-12 scores . For the purpose of analysis relative to threshold score for the iranian adolescents (score> 3.5), the categorized ghq-12 score was considered as dependent variable and age, gender, marital status, and level of training were considered as independent factors in logistic regression analysis . The analysis of data was performed by the predictive analytic software (spss version 18) for windows . All participants were recruited from isfahan university of medical sciences (iums), isfahan, iran . Medical curriculum at undergraduate level in iums is divided into three periods: first five semesters of basic science, then six semesters of clinical clerkship, and finally three semesters of internship. At the end of this period, students will graduate as a medical doctor and then if they wish they could take part in a national exam to enter into the postgraduate medical studies, known as residency stage . Between january and june 2010, a stratified random sampling was done . Based on 95% confidence interval (p = 0.44, d= 0.13), we considered 45 participants in each level of training . Students were asked to complete a self - rated instrument measuring psychological distress as well as a short questionnaire containing items on demographic variables including age, gender, marital status and training level . Psychological distress was measured using the iranian version of the 12-item general health questionnaire, ghq-12 . It is used to detect non - psychotic psychiatric disorders, such as depression and anxiety . Each item is rated on a four - point scale (less than usual, no more than usual, rather more than usual, or much more than usual). The ghq-12 is a brief, simple, easy to complete, and its application in research settings as a screening tool is well documented . This questionnaire is translated and validated in persian by montazeri et al . In 2003 and they found that the iranian version of the ghq-12 is a reliable and valid measure and hence can be used for measuring psychological well - being in iran (cronbach's alpha coefficient = 0.87). Between january 2010 and june 2010, the medical students were asked to complete the self - rated ghq-12 questionnaire as well as a short questionnaire containing items on demographic variables including age, gender, marital status and training level . Descriptive statistics were used to present the demographic data and the scores for the ghq-12 . The students t - test and one - way analysis of variance were used for comparing . Logistic regression analysis was performed to assess the association between demographic data and the ghq-12 scores . For the purpose of analysis relative to threshold score for the iranian adolescents (score> 3.5), the categorized ghq-12 score was considered as dependent variable and age, gender, marital status, and level of training were considered as independent factors in logistic regression analysis . The analysis of data was performed by the predictive analytic software (spss version 18) for windows . In all 220 medical students were invited (55 students at each level: basic science, clerkship, internship, and residency). Of these, 192 students agreed to take part in the study, giving a response rate of 87% . The mean ghq-12 score was 3.90 (sd = 3.2), and about 50% of the students scored above threshold (score> 3.5). There were no significant differences between genders with respect to marital status and level of training . There were significant differences between students ghq-12 scores with regard to age, gender and level of training . The characteristics of the study sample and descriptive findings (n = 192) the results obtained from logistic regression analysis indicated that gender and level of training were significant independent variables in predicting poor psychological distress among medical students . The female students showed a three fold (or = 2.99, 95% ci = 1.58 - 5.66, p = 0.001) and basic science students showed six times higher risk for scoring above threshold on the ghq-12 (or = 6.73, 95% ci = 2.13 - 21 - 2, p = 0.001). The aim of this study was to assess the prevalence of psychological morbidity among iranian undergraduate medical students in different levels of training . Nearly half of the students scored above threshold on the scale measuring psychological distress (ghq), indicating significant mental problems . The results revealed that the medical students had a higher level of psychological distress compared to their peers in iranian general population (44%). In addition, the percentage of psychological morbidity determined by this study (50%) was found to be higher than those reported by guthrie et al . Reported that the prevalence of psychological distress was 48% in the second - year turkish medical students . Also a lower prevalence of psychological morbidity was reported among nepalese medical students (21%). Our findings showed that students in basic science level were more psychologically distressed than interns and students of clinical clerkship . Although not investigated in this study, the findings might be associated with heavy workload and forceful curriculum, poor campus conditions and complications in adjustment with the different environment in the university . However, our findings are in line with previous studies; for instance, a study from turkey reported that the global mental health, depression, and anxiety in medical students be came worse during the first year of medical education . Another study on swedish medical students showed that first year students indicated experiencing the highest degree of pressure . Also a study at three medical schools showed that the level of depressive symptoms varies by year of training, with the highest during the second year . A number of studies reported different results . In a study from brazil, the beck depression inventory (bdi) score was determined for 481 medical students and they concluded that the internship period resulted in the highest bdi scores in comparison to both the basic and intermediate levels . Studies from pakistan and thailand reported a higher level of stress among third and fourth year students . However, the findings of our study did not support the above - mentioned results and the differences observed among several studies may be due to the different instruments used and curricula in these universities and countries . Therefore, it seems critical to evaluate any result in its own context or perhaps use instruments that especially developed for measuring distress in medical students . Psychological disturbance was more frequent in females than males and this result is compatible with previous studies indicating that women usually show higher levels of psychological distress than men in general population . A recent publication indicated that since female students feel less social support thus they might suffer from decreased sense of coherence which in turn is a strong explanatory variable for psychological distress among medical students in general and in female students in particular . The reasons for such high levels of psychiatric morbidity among medical students are likely to be complex, and to reflect both the environment and personal characteristics . In the first semester, there are major changes in the students lifestyle . Issues such as work overload, several examinations and competitive situation may lead to the development of depressive symptoms among medical students . Therefore with early diagnosis and effective psychological services, additionally, providing some welfare programs for married students and also educating the stress management and coping strategies can be useful in reducing students distresses. [3335] furthermore, while personal factors may be more difficult to control, curricular factors such as the amount and intensity of work may need to be reviewed from an institutional perspective . We believe that the question about the prevalence and variation of psychological distress in different levels of medical training seems to be sufficiently answered by this study; although, our study had certain limitations . Firstly, the cross - sectional design of this study did not allow us to determine the cause - and - effect relationship of psychological morbidity with stress and coping strategies . Also the ghq is a general measure of mental health and it is not a measure of diagnostic depression . In addition, most of the data were obtained from self - reporting questionnaires and thus object to a potential source of bias . Despite these limitations, the current study appears to be unique in that it used a standardized measure to quantitatively evaluate the mental health of medical students in different level of training . Findings of this study indicated that psychological morbidity was common in medical students and this phenomenon was more obvious among students of basic science and females . The psychological well - being of medical students needs to be more carefully addressed, and closer attention to eliminating the risk factors may prevent consequent distress . Further studies based on larger sample sizes are recommended to explore causes, consequences, and solutions for this problem rather than simply describing it.
Bullous skin lesions and necrosis of eccrine sweat glands have been described in drug induced coma . The commonest reported cause is barbiturates; alcohol is a rare cause . A previously reported patient with alcohol induced coma and bullous skin lesions had biochemical evidence of rhabdomyolysis . Coma due to barbiturate toxicity is perhaps the most widely known setting in which such lesions develop . Though, mostly reported in association with drug induced coma, it has been postulated that bullous lesions associated with sweat gland necrosis can occur in comatose states due to any cause . A 42-year - old male with normal previous medical history was brought to the casualty with altered sensorium and numerous bullae and erosions on the skin . He was found lying unconscious on the floor of a cramped room, after a prolonged bout of alcohol consumption . On examination, he was drowsy and had multiple, bilateral, asymmetrically distributed vesicles, hemorrhagic bullae and erosions of irregular shapes on the front of trunk, forearms, legs, and face; mostly limited to areas in contact with the floor while he was lying unconscious [figures 1 and 2]. Irregular and bizarre - shaped bullae and erosions on anterior trunk close - up view of bullous skin lesions urine was dark red in colour and showed albuminuria, numerous rbcs, and granular casts . Blood urea was 108 mg / dl and serum creatinine 3.1 mg / dl, which rose to 140 mg / dl and 5.6 mg / dl, respectively on the subsequent days . Prothrombin time (pt) was 15.7 s (control: 11.9) with international normalized ratio (inr) 1.3 and activated partial thromboplastin time (aptt) 35.8 s (control: 30.2). Serum glutamic oxaloacetic transaminase (sgot) was 450 iu / l (control: 5 - 40), serum glutamic pyruvic transaminase (sgpt) 295 iu / l (control: 5 - 50) and serum creatine phosphokinase (cpk) was 14,120 iu / l (control: 40 - 320). Ultrasonogram of abdomen showed hepatomegaly with coarse parenchyma, hyperechoic kidneys with minimal corticomedullary differentiation, and mild ascites . Vesicles on erythematous and edematous skin on the lateral aspect of forearm histopathological examination of the skin on the edge of the erosions using hematoxylin and eosin (h and e) stain showed mild acanthosis, spongiosis, intraepidermal vesiculation; and focal lymphocytic infiltrate particularly around eccrine sweat glands, extravasated erythrocytes, and dilated blood vessels in the dermis [figures 4 and 5]. There was necrosis of sweat glands with denudation of secretory epithelial lining cells [figure 6]. Spongiosis, intraepidermal vesiculation, and focal dermal lymphocytic infiltrate around eccrine sweat gland and duct . H and e, 400 necrosed eccrine sweat gland with denuded secretory epithelial lining cells . H and e, 400 provisional diagnosis was bullous lesions related to coma, alcoholic liver disease, and acute renal failure (arf) due to rhabdomyolysis . He was treated with parenteral fluids, injections of ceftriaxone, and metronidazole; other supportive measures and four cycles of hemodialysis . This patient had a sudden onset of hemorrhagic blisters progressing to erosions and necrotic ulcers, strikingly on the areas in contact with the floor in comatose state . The skin lesions were not considered to be associated with sepsis as the bullae were hemorrhagic, neither flaccid nor pustular; nikolsky's sign was negative and the bullous fluid did not grow bacteria on culture . Histopathological examination confirmed the diagnosis of sweat gland necrosis in our patient . Presence of dark coloured urine and elevated cpk levels in the context of arf suggested the possibility of rhabdomyolysis . Bullous lesions have been reported in patients with carbon monoxide poisoning as early as in 1865, while such lesions have been associated with barbiturate poisoning from 1950 . Both of the previously reported cases of sweat gland necrosis associated with alcoholic coma had bullous lesions on pressure points . One of them also had biochemical evidence of muscle damage as in our patient . However, our case is unique in that rhabdomyolysis complicated by arf was a prominent clinical presentation . Vesiculobullous lesions seen in unconscious patients are believed to be due to a combined effect of generalized or localized hypoxia or drug toxicity coupled with trauma and friction . Inflammation is usually minimal or absent in the adjacent dermis . In severe cases, sweat ducts, and the pilosebaceous units this case highlights the need for greater awareness about this relatively uncommon cause of bullous disease on the skin . When one encounters a case of sudden appearance of bullous lesions in a comatose patient, history of ingestion of drugs or toxins including alcohol should be sought for . A skin biopsy showing spongiosis, intraepidermal as well as subepidermal vesicles and necrosis of eccrine sweat glands will confirm the diagnosis . These patients should be evaluated for associated rhabdomyolysis and other life - threatening complications such as arf . While evaluating comatose patients with bullous skin lesions, history of excessive consumption of alcohol should be sought for.
Basic helix - loop - helix (bhlh) transcription factors belong to a large family of genes present in the shared ancestor of plants, animals, and fungi, and this family has undergone an expansion in the land plant lineage . Often referred to as helix - loop - helix (hlh) proteins, a loosely defined basic domain is involved in dna binding and present in the great majority of characterized proteins in this family; thus the term bhlh factors is used henceforth . Bhlh transcription factors have been implicated in numerous biological processes in plants including responses to light, cold, and hormones, epidermal cell fate determination, developmental patterning in roots and flowers, and anthocyanin biosynthesis [314]. In many cases, the bhlh family is critically important for correct developmental and environmental responses, as demonstrated by a large number of mutants in arabidopsis with severe phenotypes as a result of a lesion in a bhlh - encoding gene . Development and dehiscence of the seed and seed pod (silique) [13, 15, 16] and responses to light quality and photoperiod [9, 1721] are particularly known to be under the control of bhlh factors, and these phenomena are important to soybean agronomic performance . Characterization of the bhlh - encoding gene family can therefore be a useful step in the detailed functional characterization of the soybean genome . The bhlh transcription factors have been extensively characterized at the sequence and structural level . In animals, the best - known and most thoroughly characterized bhlhs are well - known regulators and proto - oncogenes such as c - myc, max, and e47, where in many cases structural data on the proteins and their interaction with dna molecules is available . Many animal bhlhs show a binding preference for the so - called e - box motif (canntg) and the residues within the protein that are required for sequence specific recognition are well defined (reviewed in [2, 22, 23]). A number of plant bhlh proteins have been demonstrated to show a particular preference for binding the g - box (cacgtg) sequence (a subset of e - box) [3, 19, 2427]. Homo- and heterodimer formation are also ubiquitous and required for dna binding within the bhlh family, a property that increases the combinatorial possibilities for regulation of transcription . The -helices in the bhlh domain and the other motifs outside the conserved bhlh domain are required for protein - protein interactions and function [2832]. Classification of bhlh proteins is usually based on sequence homology within the conserved bhlh domain . In recent years, a number of proteins have been identified genetically that represent novel and atypical bhlh proteins that were not previously classified by homology - based approaches, in some cases because a basic domain was lacking [31, 3336]. An intriguing feature of the bhlh family is that the proteins can often be very divergent outside of the highly conserved bhlh domain and contain a range of other motifs, not all of which have known functions [1, 37]. For this reason, a sequence - homology - based search approach using the entire gene sequence (such as blast of the canonical bhlhs from arabidopsis) may not be the most appropriate tool to identify all the bhlh - encoding genes in a genome such as soybean . An alternative approach is to use data from the conserved hlh motif across the kingdoms of life to develop a hidden markov model (hmm) that allows the detection of the bhlh domain across highly divergent sequences without the need for extensive sequence identity . This type of approach has been successfully deployed for identifying conserved motifs in distantly related proteins and allows more sensitive and accurate discovery of a specific motif like the bhlh domain . The pfam project (http://pfam.sanger.ac.uk/) uses a curated alignment approach to provide constantly updated hmms for most characterized protein families, including the hlhs . Hmms for the subsidiary motifs of the different bhlh families can be generated using protein alignments . Several recent genome - wide studies have examined and classified the bhlh protein family in arabidopsis thaliana, rice, poplar, and other plants with whole - genome sequences, but these studies have not examined the conservation and diversification of this family in the soybean [1, 33, 37, 3942]. The bhlh transcription factor family is the second largest family of transcription factors in plants (behind the myb family), and the complete whole - genome sequence of soybean revealed a number of genes predicted to encode bhlh proteins [4345]. A study of this family of genes in soybean and classification of the bhlhs into subfamilies orthologous with those present in other species is useful in order to provide a list of candidate genes that are likely to be upstream regulators of a number of processes . Such lists of candidate genes enable association mapping approaches to proceed with knowledge of potential functions for regulatory genes likely involved in conferring seed and agronomic traits . They are also very helpful as a means to rapidly identify candidate genes within positional genomic intervals defined by conventional genetic fine mapping in mutant studies or as quantitative trait loci (qtl) in recombinant inbred populations of soybean . Soybean, arabidopsis, and rice gene models were originally identified from annotation versions contained in the phytozome v7.0 package . The most recent version of the soybean assembly (assembly v.2.0 and gene models for phytozome v.10) was compared with our data; however since stringent new rules for inclusion of genes in the newer assembly and annotation resulted in the loss of 62 conserved bhlh genes including several with confirmed expression data, the legacy annotation and assembly were retained for this analysis (http://www.phytozome.net/) [44, 47, 48]. To identify bhlh transcription factors in the soybean genome, a hidden markov model search (hmmsearch v. 3.0; http://hmmer.janelia.org/) was applied to the predicted open reading frames (orfs) of soybean (genome and assembly version gmax109;) using the pfam hlh hidden markov model (pf00010; http://pfam.sanger.ac.uk). No e - value cutoff was initially applied in order to maximize detection of poorly annotated and orphan bhlh sequences . A total of 329 hits to unique predicted proteins containing putative hlh domains were initially identified . These included 31 orfs not annotated as bhlhs by the soybean genome annotation and a small group of hlh proteins that lack the basic domain (see section 3). Data on expression of soybean bhlh genes was obtained from http://www.soybase.org/ and is described in . Sequences were manually curated to identify mispredictions of splice sites, which often led to omission of part of the bhlh domain in the genome annotation, reducing the hidden markov model score . Sequences that included in - frame stop codons in the williams-82 genomic sequence or were missing part of the hlh domain were removed, and these soybean gene models are listed in additional file 2 (see additional file 2 in supplementary material available online at http://dx.doi.org/10.1155/2015/603182). We then examined the revised list for sequences that were atypical or were unlikely to be true bhlhs . Several studies have used a stringent cutoff restricting the number of mismatches to the canonical bhlh motif found in mammals [22, 39, 40, 50]. Other studies have used a less stringent cutoff to identify additional, atypical bhlhs in characterized genomes . Empirically, it was observed in the soybean bhlh domains that such a cutoff of 6 mismatches to the core 11 residues or 11 mismatches to the larger 19 defined residues would eliminate the soybean homologs of functionally characterized, bhlh - related proteins, and this also corresponded to the maximum number of mismatches observed in the soybean bhlh domains . Therefore, no cutoffs were used, other than those previously described (i.e., the hmm search had to hit the sequence (at any e - value) and no sequences with incomplete bhlh domains or that contained stop codons were included). Alignments were performed using mafft v.6.811b with the following parameters: alignments were visualized and edited using geneious pro v.5.4.6 for the macintosh (biomatters ltd ., auckland, new zealand). The construction of the bootstrapped maximum likelihood phylogenetic tree was performed using the hpc - mpi version of raxml version 7.3.0 with geneious used to manage, curate, and reformat the mafft alignment files . The protcat option was used to select the appropriate model, and appropriate gamma model parameters were automatically selected by the software as was a maximum likelihood estimate of 25 per - site rate categories . 1052 bootstrap trees were generated, and the highest - scoring tree was visualized using the treeexplorer utility of mega 5.0 and used together with bootstrap confidence values (as a percentage of trees) to create the figures . Assignment of subsidiary motifs in the bhlh or hlh proteins was performed using the alignment of motifs provided in supplemental material by pires and dolan . Hidden markov models were generated from script - reformatted versions of these alignments using hmmbuild 2.3.2 (the 3.0 version of hmmbuild lacks import filters for alignments in formats other than stockholm or selex). The presence of motifs was detected by running the full - length predicted proteins against each model using hmmsearch as described above, using a bash shell script for automation . For the apb domain, the sequences in the alignment described by khanna et al . Were realigned (using mafft --auto --reorder --clustalout) and models generated and used for searching as described for the other motifs . Using meme (http://meme.sdsc.edu) we searched for up to 10 new sites between 2 and 300 residues wide . Using discriminative motif discovery a file was supplied containing the bhlh motif plus the sequences used to create the hidden markov models from the known bhlh secondary motifs . As above, the alignment supplied by meme for the new motif was used to create a hidden markov model, and this model was used to search the soybean bhlhs to determine which of them contained the motif . As before no e - value cutoff was applied, however the family x sequences all showed e <10 while the two family ix sequences gmbhlh262 and 261 showed e - values of 0.0025 and 0.003, respectively . In total, 319 gene models were identified as encoding bhlh transcription factors in soybean (see section 2). Each soybean bhlh sequence in the alignment was assigned a number, as is the convention in other species . A table showing the correspondence of the gmbhlh numbers to the soybean gene models from glyma version 1.1 as well as version 2.0 and other bhlh classification information in tabular form can be found in additional file 1 . The bhlh domain consists of an n - terminal basic region of approximately 13 amino acids, followed by two alpha helices (14 - 15 residues in length) separated by a loop that ranges from 5 to 14 amino acids (figure 1, additional file 3). (position numbers in figure 1 and additional file 3 follow the convention of, with the exception of the numbering of the second hlh domain which is numbered consistent with our soybean alignment .) This pattern is conserved in multiple plant species as well as soybean [50, 51]. Within the two -helices, several hydrophobic residues are thought to be required to stabilize the secondary structure of the protein, and these residues are highly conserved in both plant and animal sequences [22, 23]. At position 23, over 99% of soybean bhlhs have a characteristic l residue . At position 55, positions 45 and 52 are occupied by either i, l, or v, in 98.4% and 94% of soybean bhlh proteins, respectively (figure 1). Additional file 3 contains a full text multiple sequence alignment for all of the soybean bhlh domains . The conservation of key residues within the basic region of the bhlh domain can predict both the potential to bind dna and the preferred recognition sequence . The e residue at position 9 within the basic domain has been shown in protein crystal structures to make contact with the major groove of the dna (reviewed in). This position is conserved in 245 of 319 of the bhlhs identified in soybean (77%) and has previously been shown to be present in 74% of bhlh sequences from other plants . It has been shown that e at position 9 and r at position 12 are required for the recognition of an e - box sequence 244 of the soybean bhlhs have this configuration and can be classed as e - box binding . Another pattern has been described that includes h or k at position 5, e at position 9, and r at position 13 (h5-e9-r13); in animals these bhlhs recognize the e - box subset cacgtg . This sequence is a commonly occurring promoter motif in plant genomes, where it is referred to as the g - box, and a number of plant bhlh proteins have demonstrated g - box binding activity [3, 24, 26, 27]. 186 (58%) of soybean bhlh proteins have a conserved h / k5-e9-r13 motif and thus could be candidates for binding the g - box sequence . The conservation of these residues that are potentially involved in protein - dna interaction within soybean is an indication that the dna - binding function and also the recognition sequence may be conserved . Of the soybean bhlh proteins that lack the e9 residue (74 proteins) only eight have five or more basic residues within the basic region . The number of basic residues has been previously used as a criterion to classify hlh proteins as having the potential to bind dna . Since the e9 residue is thought to be required for e - box binding, it is possible that these proteins bind dna at a non - e - box dna sequence, although this has not yet been demonstrated for plant bhlhs . The remaining 66 hlh domains, which contain 4 or fewer basic residues within the basic region, are classified as hlh proteins and are unlikely to bind dna directly . Many proteins identified through mutant studies in recent years in plants as atypical or nonbasic bhlhs have few or no basic residues in this region [7, 31, 34, 35, 57]. They do not bind dna but in some cases act in concert with the more typical bhlhs to regulate gene expression by negative interference, and similar non - dna binding hlhs exist in animal systems [22, 31, 58, 59]. Since these helix - loop - helixes are related to the bhlhs and are involved in many of the same pathways, they are included in our characterization of soybean bhlhs if they are recognized by the hlh hmm . Most plant bhlhs have a conserved intron structure with three introns within the bhlh domain [33, 39, 40]. The intron / exon patterns were examined for soybean bhlh - encoding genes, and it was determined that 31% of soybean bhlhs contain the pattern of three conserved introns (pattern a, figure 2). 43% of the soybean bhlhs contain only one of these introns (pattern d), and 4% of soybean bhlhs have another subset of these conserved introns (patterns b, c, and e). Only 8.7% of soybean bhlhs exhibit a different splicing pattern, which fall into other distinct classes (figure 2, patterns f, g, h, or other). The proportions of distinct intron patterns in soybean genes are consistent with the intron structure distribution in the arabidopsis and rice bhlh families [33, 39, 40]. As previously observed for the bhlh superfamily, intron distribution tends to be conserved within bhlh subfamilies and lends additional credence to these class distinctions . The bhlh superfamily in plants is composed of between 14 and 32 subfamilies based on phylogenetic analysis of the bhlh region [1, 33, 37, 39, 40]. Supporting these classifications, it has been found that both the intron patterns, other domains of sequence homology outside the bhlh region, and dna binding potential are often conserved within these subfamilies . A phylogenetic reconstruction of the soybean bhlhs shown in figure 1, together with at least one arabidopsis bhlh sequence representing each of the major subfamilies, was generated based on the alignment of the bhlh domain (figure 1 and additional file 3). The alignment used to generate the phylogenetic tree, which contains representative arabidopsis sequences and excludes all but one of any identical soybean sequences, is supplied as additional file 7 . A bootstrapped maximum likelihood tree (1,052 bootstraps) the best scoring tree is displayed in figure 3 using a summary radiation diagram to show branch lengths and provide an overview of the similarities within 24 bhlh subfamilies found in soybean . The full phylogeny including bootstrap support values (expressed as percentages) is presented in additional file 4 . A number of intriguing aspects of the soybean bhlh proteins are apparent from this tree . Family xiv has one functionally characterized member in arabidopsis, sac51/atbhlh142, which is involved in spermidine synthase - mediated stem elongation . Secondly, family viia / b has been repeatedly shown to be involved in light signalling [9, 1721]. Interestingly, pif3 (atbhlh008), which interacts directly with phytochromes and mediates light - responsive gene expression, has a number of highly conserved homologs in soybean family viia / b . The short branch lengths within this family may indicate higher levels of sequence or structural constraint . Hfr1 (atbhlh026), also involved in light signalling and normally placed in family viia / b, has only very distant similarity to any soybean protein and, in our analysis, appears as an outlier of family xv (figure 3, additional file 4). We did not observe any atypical bhlh proteins or families in soybean that clearly do not fit into one of the characterized arabidopsis families; however several ambiguous sequences were observed in the phylogeny (figure 3, additional file 4). We were able to assign families to all these sequences using branch length data, additional motif information, and blast searches; however not all families formed monophyletic groups (see additional file 4). In addition to the bhlh domain analysis, any of the bhlh subfamilies can also be distinguished by the presence of one or more characteristic motifs outside the bhlh domain [1, 33, 37, 55]. To identify these motifs in the predicted full - length sequences of the soybean bhlhs, hmms were created from alignments of the motifs from across the plant kingdom that were previously published . The soybean bhlhs and subfamilies that possess these defined motifs are highlighted in additional file 1 . All of the previously described motifs were detected with the exception of motif 28, which is associated with family xiv, which was also found to be absent from soybean . The hmm created from the alignment of the active phytochrome binding (apb) domain described in matched precisely the same protein motifs as those identified using the hmm for motif 14 . A search was conducted using meme (http://meme.sdsc.edu) for new motifs, by excluding the known secondary motifs plus the bhlh domain . This sequence is strongly conserved in all the gmbhlh sequences 165184 (family x). In the supplemental material this is named motif 40, although it follows closely the distribution of motif 20; the ngadywap portion of this motif is similar to motif 20 and it likely represents an expanded version of this motif . Much weaker similarity to motif 40 is also observed in gmbhlh261 and gmbhlh262 of family xi . This motif is also conserved in several arabidopsis bhlhs in family x. to compare the soybean bhlhs to arabidopsis and o. sativa homologs, blast searches of the predicted arabidopsis and rice proteomes were conducted with the predicted full - length coding sequences of the soybean bhlhs . A total of 141 soybean bhlhs hit arabidopsis proteins with> 50% amino acid sequence identity, and 288 had hits with an e - value of less than 10 (additional file 5). A total of 151 soybean bhlhs shared> 50% sequence identity with rice, 255 with an e - value of less than 10 . In order to increase confidence that true orthologs were detected, a reciprocal blast search of the soybean genome was performed using full - length arabidopsis and rice bhlh sequences, and the orthologs are presented in additional file 5 . Of the arabidopsis bhlhs identified as matching soybean bhlhs, all but one of the arabidopsis sequences are known from previous classification of bhlh proteins in arabidopsis [33, 37, 40]. The one arabidopsis protein not previously classified as a bhlh is at2g40435, a protein with homology to 5 soybean hlh proteins . The soybean proteins lack a complete basic domain, show a reasonably conserved hlh motif but have some divergence from previously described consensus sequences, and match the hlh hmm with relatively low scores . At2g40435 has strong similarity to these soybean proteins in this predicted hlh region, but hmmer does not find a match to the hlh hmm at all . Five rice proteins (corresponding to 16 soybean genes, all of which were identified as similar to known arabidopsis bhlhs) were also not in previous classifications of rice bhlh proteins (additional file 5) [33, 39]. All but one of these proteins have a hlh domain predicted by the hmm search as used here for soybean; the fifth has no hmm similarity to the hlh but does have similarity to the hlhmycn conserved domain . Because of the recent duplication of the soybean genome, many soybean bhlh proteins have closely related homeologs (recently duplicated paralogs arising as a result of polyploidy) which may be as much as 98% identical at the dna sequence level . To determine which bhlhs were recent homeologs, we combined the data on recently duplicated genomic regions of soybean and validated potential homeologs by sequence identity (tabulated data provided by dr . 135 are present as two copy loci, 21 are present in three copies, 52 are present in 4 copies, and 6 are present in 6 copies . Information on the homeologous groups of soybean bhlhs is included in the table in additional file 1 . Using a survey of the publicly available transcriptome data for soybean, it was investigated what fraction of the soybean bhlhs were actively expressed at some stage of plant development . It was determined that 281 of 319 (88%) bhlhs showed some evidence of expression at the mrna level (figure 4). 47% of these are expressed across root and leaf, as well as developing seed tissues, while the remaining genes showed some evidence of tissue specific expression (one or more tissue types). Notably, this included 5 soybean bhlh mrnas that are expressed preferentially in nodules and are mostly absent from aerial tissues (additional file 6). The closest arabidopsis orthologs of these preferentially nodule - expressed bhlhs do not have known biological functions and do not cluster in any particular subfamily . Are homologs of target of monopteros 5 and transparent testa 8, both of which have known roles in arabidopsis embryo development (additional file 6) [61, 62]. The whole - genome duplication events in soybean that occurred 59 million years ago and 13 million years ago have clearly had a substantial impact on the size of the bhlh family in soybean when compared to other plant species [1, 37, 39, 40, 44]. Most of the soybean bhlhs (213) were present in homeologous copies duplicated two or more times . Expression evidence was identified for 281 of the bhlh genes, and 122 bhlhs were expressed in leaf, seed, and root tissue . These single - copy genes are likely the result of deletion of the homeolog after whole - genome duplication, perhaps because of negative selection due to deleterious effects from multigene dosage . Speculatively, these genes may be involved in critical developmental or other processes in which these deleterious effects are seriously disadvantageous, and thus selection for loss of the homeologous copy has already taken place . Several of the genes with strong evidence for expression and/or conservation were omitted from the current soybean genome annotation, suggesting that this version of the annotation omits a relatively large number of bhlh genes . Based on sequence conservation within the basic domain, it can be predicted that the majority of soybean bhlhs (77%) have the potential to bind dna, and 58% of all soybean bhlhs are likely to recognize the core g - box sequence, of which there are over 17,000 represented in the promoters of actively transcribed genes in the soybean genome (meh, unpublished data). There is experimental evidence that different bhlh proteins have a preference for certain nucleotides flanking the core g - box sequence and that residues in the second -helix may also be involved in dna contact, increasing specificity of genomic sequence targets [24, 56, 63]. All but one of the bhlh subfamilies represented in other land plants are present in soybean, and the proportion of bhlhs in each subfamily was largely consistent between arabidopsis and soybean, although soybean contains many more bhlh - encoding genes, implying a broadly similar set of functions for each bhlh family may be conserved . All but one of the conserved motifs identified in bhlh subfamilies were found in soybean bhlh genes . A small number of these motifs are known to be involved interactions with other proteins (such as the apb and leucine zipper motifs) [32, 55]. Using meme a long, highly conserved motif was identified, which we term motif 40 . The strongly conserved ngadywap portion of this motif is similar to motif 20, with which it shares very similar distribution . We do not believe motif 40 is related to motif 22 because flanking conserved residues of motif 22 are very different to those of motif 40, and because the distribution of motif 40 is strongly correlated with and predictive of membership in family x. motif 20 also correlates with family x but is not found in all members with strong significance, perhaps due to greater discriminative power and sensitivity for the longer motif . Recently the hmm method identified the bhlh domain in the closest soybean homologs of several of these genes including kidari, atbs1, and pre1, and these were used in our analysis . In the case of lonesome highway, a clear ortholog was present in soybean (glyma12g31460, at a blastp e - value of 10) but this gene was not predicted to contain a bhlh domain using our hmm search . In the case of par1 and par2, by contrast, while par1 and par2 have blast hits in soybean, they are not clearly orthologs . The blastp e values of the best hits are in the range 10 to 10, which represents strong similarity but is a lower level of confidence than for the orthologs of other genes such as kidari . This may indicate that the putative hlh domains of lonesome highway, par1, and par2 are divergent to an extent where structural similarity to canonical bhlhs is limited, or it could indicate that the hmm we used is not sensitive to this type of hlh domain, since it did not include representatives of this type of atypical bhlh . However, five soybean predicted hlh genes were identified, highly similar to an arabidopsis gene (with greater than 50% amino acid sequence identity and blast e - value of less than 2e 33) not within the set of classified bhlh proteins . Interestingly, while all five soybean proteins are predicted to contain a hlh domain using the hmm approach, the same method does not predict a bhlh domain in the highly similar at2g40435 protein . The amino acid similarity between these proteins is very strong in the predicted hlh region of the soybean proteins, and the hmm score for the hlh prediction in the soybean proteins is not strong . The putative hlh domain is located at the extreme n - terminus of the soybean proteins, which fall into bhlh subfamily iii but are not predicted to bind dna . The intriguingly high level of sequence conservation in these genes across arabidopsis and soybean may point to an important, previously unknown biological function, possibly connected with the bhlh similarity . We have identified a large number of candidate genes from a family with likely regulatory roles in many processes critical for soybean growth and genetic improvement . These results establish a foundation for future functional genomics studies to target bhlh - controlled processes for modification and improvement in soybean.
A thyroid colloid cyst (tcc) is a nonneoplastic thyroid nodule with a histology showing marked follicular dilatation and epithelial flattening . A tcc contains a dense viscous material comprised of a concentrated solution of thyroglobulin; the cause of a tcc may be related to a defect in intraluminal thyroglobulin reabsorption . A tcc is commonly detected by an ultrasound (us) examination of the neck or thyroid; however, its clinical significance is low because a tcc is not associated with a thyroid malignancy and is easily diagnosed by us examination because of its typical sonographic features [2, 3]. Many researchers and guidelines do not recommend us - guided fine - needle aspiration for tccs because tccs have inadequate cytology and typical sonographic features [28]. However, tccs can result in an acute onset of symptoms, such as a palpable mass or pain, if they become larger than 2 cm at their largest diameter and if they develop an intralesional hemorrhage [2, 9]. Nevertheless, no data exists regarding the long - term interval changes of tccs . To the best of my knowledge, no previous study has employed a sonographic follow - up for tccs by using a long - term follow - up interval of over 5 years . This study assessed the prevalence and interval changes of tccs 3 mm at their largest diameter in postlobectomy patients who received treatment for papillary thyroid microcarcinoma (ptmc). From january 2007 to december 2008, 437 patients (374 women and 63 men; range 1872 years; mean age 45.5 years) underwent lobectomy for the treatment of papillary thyroid microcarcinoma (ptmc) in our hospital . All the patients underwent thyroxine - replacement therapy after lobectomy . Among them, 268 patients (227 women and 41 men; range 1870 years; mean age 45.5 years) were included in this study that had 4 or more postoperative follow - up us examinations after lobectomy . The institutional review board approved this study (irb 13 - 158), and informed consent was waived for this retrospective study . An experienced radiologist performed the thyroid us examinations using a high - resolution ultrasound instrument (hdi 5000 or iu 22; philips medical systems, bothell, wa, usa) equipped with a 515 mhz linear probe . A tcc was defined as a pure thyroid cyst with intracystic comet - tail artifact(s). To clarify the sonographic detection and to facilitate the evaluation of an interval change for the tccs, only tccs 3 mm at their largest diameter were included in this study . In the case of multiple tccs, only the dominant tcc (i.e., the largest tcc) was included in this study . In our hospital, the routine us follow - ups of postlobectomy patients who received treatment for ptmc were performed as follows: the initial 3 us follow - ups were performed at a 1-year interval, and the later us follow - ups were performed at 1- or 2-year interval depending on patient agreement . In this study, patients were excluded if they had 3 or less us follow - ups or did not have at least 1 us follow - up after the 5-year or more interval from thyroid surgery . An interval increase or decrease for each tcc was defined as a positive or negative interval change of 10% or more in the largest diameter of a tcc during the us follow - ups . On the basis of the us follow - ups, each tcc was retrospectively classified into 1 of 7 diagnostic categories by a single radiologist: (1) no interval change: an interval change of <10% occurred in the largest diameter of the tcc; (2) gradual increase: an interval increase occurred in the tcc at its largest diameter but did not have any fluctuations during the sequential us follow - ups; (3) gradual decrease: an interval decrease occurred in the tcc at its largest diameter but did not have any fluctuations during the sequential us follow - ups; (4) positive fluctuation: an interval decrease occurred in the tcc during the early us follow - ups and an interval increase occurred in the tcc during the late us follow - ups; (5) negative fluctuation: an interval increase occurred in the tcc during the early us follow - ups and an interval decrease occurred in the tcc during the late us follow - ups; (6) disappearance: no tcc was visualized during the us follow - ups; and (7) new detection: a new tcc was observed during a late or the last us follow - up . Of the 437 patients, 268 patients (61.3%) underwent a long - term follow - up with us examinations (range 6078 months; mean 65.7 months). Of the 268 patients, 41 patients (15.3%; 32 women and 9 men; range 2466 years; mean age 42.2 years) had tccs 3 mm at the largest diameter of the tccs (range 3.08.2 mm; mean 3.9 mm). Among them, 35 patients (13.1%) had tccs during both the preoperative thyroid us examination and us follow - ups; however, 6 patients (2.2%) had tccs only during the us follow - ups . Through the preoperative thyroid us examinations and us follow - ups, the interval change for the tccs was classified as follows: no interval change (n = 8), gradual increase (n = 8) (figure 1), gradual decrease (n = 5), positive fluctuation (n = 3), negative fluctuation (n = 6), disappearance (n = 5), and new detection (n = 6). Of the 41 patients with tccs, no patient had a tcc 10 mm at its largest diameter during both the preoperative thyroid us examinations and us follow - ups . During the thyroid us follow - ups, no tccs demonstrated an increase that was 2 or more times of their largest diameter . Further, no patients had any sonographically suspected intracystic hemorrhages or complained of any relevant symptoms . The clinical significance of a tcc is very low because a tcc is not associated with a thyroid malignancy and is easily diagnosed by a thyroid us examination [24, 7]. In particular, a tcc can be sonographically diagnosed because a tcc has some typical sonographic features (i.e., pure thyroid cyst with intracystic comet - tail artifacts), and thus many radiologists do not recommend us - guided fine - needle aspiration for a tcc [24, 7]. Sometimes, a tcc results in an intracystic hemorrhage, and thus patients can complain of local pain or a palpable neck mass . However, a long - term interval change in a tcc has not been reported . This study attempted to investigate the long - term sonographic interval changes of tccs in postlobectomy patients who were treated for ptmc . In the present study, tccs had various interval changes, although no tcc had largest diameter 10 mm . Among them, the most common patterns were no interval change (19.5%) and gradual increase (19.5%). However, the incidence of a gradual decrease (12.2%) and disappearance (12.2%) was not low . In this study, various interval changes were observed with respect to tccs, but none of the tccs demonstrated an abrupt increase or acute onset of symptoms . Therefore, the author believes long - term us follow - up for tcc is unnecessary . High - resolution thyroid us examinations have been used worldwide for the evaluation of thyroid nodules that resulted in the general acceptance of certain characteristics that mark benign and malignant thyroid nodules [48]. A thyroid us examination has been considered the most accurate imaging tool for evaluating thyroid nodules despite its operator dependency [4, 7, 8]. In this study, an experienced radiologist who had 10 years of experience in thyroid us (> 2500 cases / year) only a thyroid nodule showing an anechoic thyroid nodule with comet - tail artifact was considered to be a tcc . First, of the 437 patients, 169 patients (38.7%) were not included because of insufficient us follow - ups . Further, only patients who underwent lobectomy because of ptmc were included; thus, a selection bias was possible . In addition, a comparison analysis was not performed for tcc interval changes secondary to thyroxine - replacement therapy during the maintenance periods because of the small number of cases in each category . Several reports have shown that shrinkage of thyroid nodules occurs more frequently in patients with long - term thyroid - stimulating hormone suppression than in untreated patients [10, 11]. For clarity, a large - scale study involving a general population may be required . Finally, a single radiologist performed all the thyroid us examinations, including preoperative thyroid us and postoperative us follow - ups . In conclusion, tccs show various interval changes in the patients who underwent lobectomy for papillary thyroid microcarcinoma, but tccs rarely have an abrupt increase or acute onset of symptoms.
After vsr was first described by latham in 1874, there had been steady increase of reported case . However, the development of reperfusion therapy has contributed to the reduction in incidence of vsr . The event usually occurs 3 to 5 days after ami and often precipitates into cardiogenic shock, and early surgical treatment is necessary to reduce risk of fatality . We report a case of medically - treated vsr developed 16 days after pci in a patient with acute anterior mi . A 70-year - old female had chest pain for three days prior to admission as well as hemiplegia and dysarthria for 5 days . She was referred to our hospital for aggravating chest pain . At the previous hospital, she was admitted for the treatment of type 2 diabetes mellitus and tentorial ischemia . Four years ago, she was diagnosed as mucinous ovarian cystadenoma and underwent bilateral oophorectomy and total hysterectomy . Her father had a history of cardiogenic shock . On admission, the pulse was 112 beats per minute, the respiration 20 per minute, the blood pressure 120/70 mmhg and the body temperature 36. the patient was alert at the time of admission . However, she appeared to be acutely ill, and presented with pale conjunctiva and non - icteric sclera . There was no jugular vein distension, and the heart rhythm was irregular without s3 or heart murmur . L (normal 0~185), ck - mb was 19.2 ng / ml (normal 0~5.0), and tnt was 1.93 ng / ml (normal 0~0.01), and these levels decreased following admission . Wbc count was 15,800/l (normal 4000~10,000), and neutrophil count 78.9% (normal 42.2~75.2%). The glucose level was 279 mg / dl and ldl - cholesterol level 157 mg / dl . On the initial electrocardiogram, 3 mm st segment elevation in leads v2 through v4 and q wave in lead ii, iii, and avf was observed (figure 1a). There was severe hypokinesia of the cardiac apex and along the inferior wall with moderate pulmonary hypertension (right ventricular systolic pressure was estimated as 55 mmhg). She was given conservative care with medications consisting of heparin, iv nitrate, clopidogrel, and aspirin . On the fourth inpatient day, coronary angiography and pci was performed . From the coronary angiography, 70% and 90% stenosis ninety percent stenosis on the 2 obtuse marginal branch was also observed (figure 3a). On the seventh inpatient day, the patient experienced dyspnea but her heart rhythm was regular and no cardiac murmur was heard . The lung sounds were not coarse but fine crackles were heard at both lung bases . The patient was treated with diuretics, and she managed well . On day 20, her heart rhythm was regular but a grade 4/6 pansystolic murmur was heard at the mid - left sternal border . Echocardiography revealed improved wall motion of the anterior wall and the cardiac apex, but a ventricular septal defect approximately 1.3 cm in diameter was observed at the apical septum (figure 4). Because she did not show any serious symptoms related to the ventricular septal rupture and was nearly bed - ridden due to right hemiplegia as a sequel of cerebral infartion, only medical treatment was done . One month after discharge, she complained of dyspnea, and the chest radiograph showed pulmonary congestion with bilateral pleural effusion, but transthoracic echocardiography revealed normal wall motion of the cardiac apex and no change in the size of the defect . The incidence of septal rupture1), decreased with the advent of reperfusion therapy since 1980's, prior to which septal rupture was reported to complicate 1 to 3 percent of ami . Vsr usually occurs within the first 10 to 14 days when necrotic tissue is abundant and the collateral circulation is not well developed2). In recent studies, the mean onset time of vsr was reported to be about 4 days (range 1~19 days) after ami, and thrombolytic therapy was shown to shorten the onset time of vsr3 - 5). In the case of primary angioplasty, vsr rarely occurred . Reported one case of septal rupture occurring on the 19th day after ami out of 45 patients diagnosed as vsr after ami from 1987 to 19956). Risk factors for septal rupture include hypertension, advanced age, being female, the absence of smoking, the absence of a history of angina or mi, extensive mi, and right ventricular infarction1). In angiographic patterns, total occlusion of coronary arteries are more common . Although thrombolytic therapy prevents extensive transmural necrosis, thrombolysis also induces myocardial hemorrhage during the lytic state and precipitates the process of ventricular septal perforation . In anterior ami, loss of apical contraction may result in a further decrease in the apical wall thickness in systole, increasing tensile stress per unit cross - sectional area of the apical wall . That suggests mechanical factors in the development of early - phase rupture . Becker and van mantgen7) have classified cases of cardiac rupture into 3 types, and cases of vsr are similar to those of cardiac rupture . Type i is characterized as an abrupt, slit - like myocardial tear correlating clinically with a recent infarction (<24h); type ii has an area of myocardial erosion, indicative of a slowly progressive tear; and in type iii, a fatal tear typically occurs where an aneurysm has formed . However, residual ischemia itself and reperfusion injury may delay the recovery of infarcted myocardial function . The difference of hemodynamic influence between the infarcted zone and the border zone may play an important role on vsr . We didn't confirm whether myocardial salvage of tissue level was successful through other imaging studies . However, the echocardiography showed improved apical wall motion suggesting that myocardial salvage of tissue level was successful since non - viable myocardium cannot contract . After cooley et al . Performed the first successful surgical repair of vsr, early surgical repair has helped to lower mortality rates and improve survival . Medication use to stabilize the patient's condition is only a temporary option, because most patients rapidly deteriorate and die . The mortality rate among patients with septal rupture who are treated conservatively without surgical closure is approximately 24 percent in the first 24 hours, 46 percent at one week, and 62 to 82 percent at two months8, 9). We report this case since there have been no reported case of delayed ventricular septal rupture, which developed after the improvement of wall motion following pci.
Ileosigmoid knotting (isk) is a rare cause of closed - loop intestinal obstruction, which rapidly progresses to gangrene of involved gut segments . Isk is a very unusual entity in western world, but is relatively common in asian, middle eastern and african nations . Although the reported mortality rate in isk varies from 0 to 48% (mean 35.5%), but isk with gangrene has a mortality rate [1, 3] of 20100% . More than 330 cases in world and only 22 cases from india have been described so far in the literature as summarized in table i. it is still a diagnostic dilemma for surgeons all over the world and only 028% cases could be diagnosed preoperatively . X - ray abdomen can reveal large gas - filled loops of small and large bowels in the right mid and lower abdomen . Computed tomography (ct) is the best diagnostic modality in clinching the diagnosis . A 51-year - old male was brought in our casuality in shock with history of abdomen pain and non - passage of flatus and stools for 24 h. his blood pressure was 78/56 mmhg and pulse rate was 112 min . Abdomen was distended and tender . He was resuscitated, and x - ray of abdomen revealed multiple dilated gut loops as depicted in fig . 1 . Ileum was wrapped around sigmoid colon making two complete turns with gangrene of sigmoid colon and ileum as depicted in fig . Clamps applied on large gut and sigmoid colon removed followed by ileum, and end jejunostomy was done in view of haemodynamic unstability of the patient along with descending sigmoid colon anastomosis . The patient expired after 2 weeks despite exhaustive efforts due to complications of short bowl syndrome . Figure 2:intraoperative picture showing ileal knotting around sigmoid colon resulting in gangrene of both . The isk is rare but life - threatening type of closed - loop intestinal obstruction . The exact mechanism of isk is still speculative . A long small bowel mesentery, long sigmoid mesocolon on a narrow pedicle and ingestion of high bulk diet after fasting are predisposing factors [1, 6]. The ileal loops can twist around sigmoid colon in clockwise (60.963.2%) or anticlockwise direction (36.839.1%). The knot is 360 in 52.9%, two 360 turns in 19.1% and three 360 turns in 5.9% cases . Isk is seen predominantly in males (80.2%), with a mean age of 40 years (490 years). Isk has been classified into four types as described in table 2 . In the present case, we have type ia knot (most common variety) with two 360 turns of ileum over sigmoid colon . Atamanalp et al . In 2008 described a new classification of isk based on age, shock, associated chronic illness and shock as summarized in table 3 . Pain abdomen (100%), abdomen distension (94100%), nausea and vomiting (87100%) and shock (060%) are usually present at admission [1, 2, 9]. X - ray abdomen reveals a large gas - filled loop of sigmoid colon in the right mid and lower abdomen . Ct of abdomen can help to clinch the diagnosis in preoperative stage [1, 2]. It can markedly reveal a dilated loop of sigmoid colon with loss of haustration and non - enhancing thinned out wall . The characteristic whirl sign (twisted mesentery and bowel) convergence of superior mesenteric vein towards knot and medial pointing of caecum are other suggestive findings . Despite availability of various modern diagnostic tools in the present era 2b18.920.65sigmoid colonileumclockwiseanticlockwise3type 31.5ileocaecal segmentsigmoid colon4type 4undetermined table 3:new classification for isk c1c2ac2bc3ac3bc4ac4bc5c6a0d0one of a, d1two of a, d1at most 1 of a, d1two of a, d1at most 1 of a, d1two of a, d1s0s0s0s1s1s0s0s1g0g0g0g0g0g1g1g1g2c: class; a (age): a0: under 60 years; a1: 60 years and older; d (associated disease): d0: absent; d1: present; s (shock): s0: absent; s1: present; g (bowel gangrene): g0: absent; g1: present in the ileum or sigmoid colon; g2: in both segments . Classification of isk [1, 2, 7] new classification for isk c: class; a (age): a0: under 60 years; a1: 60 years and older; d (associated disease): d0: absent; d1: present; s (shock): s0: absent; s1: present; g (bowel gangrene): g0: absent; g1: present in the ileum or sigmoid colon; g2: in both segments . Exploratory laparotomy is the definite key to diagnose majority of these cases of diagnostic dilemma . The incidence rate of gangrene was paradoxically high (90.9%) in cases who presented within 24 h of onset of their symptoms than those presenting after 24 h of their symptoms (57%) as happened in the present case also . Excision of gangrenous segment with end - to - end anastomosis of healthy bowel is the most acceptable surgical procedure in the literature [1, 2]. A high index of suspicion is required for all these cases . In view of diagnostic dilemma and rapidly fatal course of disease, urgent exploratory laparotomy is the best answer for better outcome . While selecting the type of surgery, general condition of patient m.s . As the main and corresponding author certifies all authors that this paper is original and had not been sent to any other journal for publication . Wish to state that as in this case report, no research work is conducted so institutional ethical committee involvement was not done . Informed consent of the patient was taken, and he was acknowledged orally regarding the process and ensured that his identity will not be revealed anywhere.
Sudden sensorineural hearing loss (ssnhl) is defined as a loss of hearing of 30 db or more over at least three contiguous frequencies . Usually, symptoms present unilaterally and suddenly within 2472 h. most of the cases are referred to as idiopathic sensorineural hearing loss (issnhl) since etiologies remain unclear in the majority of the patients . Sudden snhl occurs in five to 20 cases per 100,000 per year in the united states 1, 2 . The rate of spontaneous recovery was rated between 25 and 89% according to recent publications 4 . Different treatment regimens like antioxidants, corticosteroids, vasodilatators, hyperbaric oxygen (hbo), or carbogen therapy 5 have been described . Among these approaches, intratympanic injection of steroids (its) is regarded as effective, safe, and well tolerated 6, and was shown to be as sufficient as orally applied steroids 7, 8 . Although many studies have reported on the usefulness of steroids, the authors of a recent cochrane review came to the conclusion that the value of steroids in the treatment of issnhl remains unclear 9 . For the treatment of issnhl, hbot has been applied over decades either alone or in addition to other medical treatments 10 . In combination with hbot, however, hbot in addition to application of a vitamin cocktail and dexamethasone, did not improve chronic issnhl in another study 12 . Nevertheless, since benefits of hbo in the treatment of issnhl were demonstrated 13, the committee of the undersea and hyperbaric medical society approved issnhl as indication for hbot 14 . These authors claim that best results are achieved when hbot starts within 2 weeks and is combined with steroid treatment . The combination of hbot with systemic steroid treatment was especially successful for patients with an initial hearing loss of more than 90 db 15 . Additionally, hbot resulted in an improvement of thresholds especially in the low frequencies of patients with otherwise therapyrefractory ssnhl 16 . In another study, its was compared to hbot and to a combination of both after unsuccessful systemic corticoid treatment of issnhl 17 . All three modalities resulted in an improvement of word scores and pure tone audiometry (pta). However, the highest success was achieved, especially at low frequencies, after the combined use of hbot and its . Despite of the excellent results that can be achieved after treating patients with acute issnhl (duration max . 2 weeks) with hbo, data concerning the outcome of hbot of patients with chronic (> 6 months) issnhl have not been reported hitherto 18 . We therefore present a case study on patients with severe issnhl receiving hbot combined with its as salvage treatment after an unsuccessful attempt with systemic steroids application . In most of the cases, the delay between onset of hearing loss and start of the combined therapy was much more than the recommended maximum of 30 days 17 . Over 4 months, we prospectively identified seven consecutive cases (three female and four male) with idiopathic (case 1, 2, 4, and 6), noise most of the patients presented after unsuccessful corticoid treatment with the symptoms persisting for up to 10 weeks (table 1). In every patient, diagnostic tests were performed in order to rule out neurologic, vascular, or other etiologies for the hearing loss . Most of the patients were pretreated according to the guidelines of the german society of otorhinolaryngology for idiopathic hearing loss elsewhere . All patients, except for cases 3 and 7, had been subjected to unsuccessful treatment with systemic corticoids elsewhere prior to being referred to our institute (h. l, c.f . Patients received bilateral paracentesis and its (dexamethasone with hyaluronic acid), and were immediately transferred to the hbo chamber (2.5 atm for 2 30 min for each session). Thresholds were determined by pta before the start and after finishing the salvage treatment at frequencies between 125 hz and 8 khz . In figure 1, the ptas of all seven patients at the time of their first presentation to our institute are depicted . Case 1 presented 5 weeks after ssnhl before salvage therapy, after unsuccessful treatment with systemic corticosteroids starting 3 days after the onset of unilateral issnhl and its (four injections) without hbot, the patients was referred for salvage treatment to our institution . Since no benefits of this therapy could be detected within 6 days, the patient was referred to our institute for its and hbot . Case 3 experienced bilateral hearing loss and tinnitus after intense noise exposure over several hours . He was presented at our institute, 3 weeks after the onset of the symptoms without being subjected to any other treatment or diagnosis earlier . After other conditions than the noise exposure were excluded as causes for ssnhl, hbot and intratympanic steroid application (its) were initiated . However, his symptoms did not improve and he presented 4 weeks later to our institution . Case 5 developed combined hearing loss after noise trauma (explosion), accompanied by contusio labyrinthi . He was treated with systemic steroids immediately over a period of 10 days without success . Ten weeks after the noise incidence, the patient sought for salvage treatment in our institute and received concurrent hbot with its . Case 6 received unsuccessful systemic corticoid treatment immediately after development of a profound issnhl at the right side . Approximately 4 weeks later, she was referred to our institute for salvage treatment . Although she was advised for a tympanoscopy to rule out and treat a rupture of the round window membrane, she refused surgery and was referred to our institute 3 days after the incidence . Patients' demographics and history are summarized in table 1 . In this cases series, four male and four female patients with an age range from 25 to 62 years were included . All patients experienced unilateral ssnhl, except case 3 who presented with bilateral hearing loss and tinnitus after severe noise trauma . Audiograms for all cases after salvage treatment are provided for both ears in figure 2 . In case 1, after 10 courses of hbot with three concurrent its, an improvement of hearing in the right ear could be achieved . Case 2 showed a significant recovery of hearing and vanishing of her tinnitus after 33 courses of hbot, accompanied by six its . In case 3, combined hbot and its lead to a dramatic improvement of hearing also in the higher frequencies . Case 4 received 20 courses with hbot with five its and his hearing recovered mainly in the lower frequencies . In case 5, combined hbot (20) and its (3) resulted in dramatic improvement of the leftsided hearing threshold . After 30 hbot and five its, case 6 regained hearing especially in the lower frequencies . Case 7 achieved recovery of hearing only in the lower frequencies (33 hbot; 13 its). The pta performed before treatment revealed pantonal hearing loss in all patients . In some of the patients, in addition, all patients experienced and reported substantial relieve from their symptoms during the course of the salvage therapy . The average gain in hearing for all cases (and for case 3 for each ear) is presented in figure 3 . The lowest gain (20 db) was achieved in case 7 (barotrauma) even though treatment started already on day three after the trauma without any steroids as pretreatment . The mean improvements gained in patients suffering from noiseinduced ssnhl (37.2 db) and issnhl (36.9 db) were comparable . Some patients experienced huge benefits (more than 50 db gain for case 5 and 6), whereas some only gained about 25 db (case 2 and case 3r). Gain in hearing threshold for all patients averaged over all frequencies (mean standard error). In general, the improvement was larger at low frequencies (figure 4), whereas at high frequencies, not all patients could benefit . The average gain ranged between 15 db for 8 khz and 46.4 db for 0.125 khz . For all patients, no side effects due to hbot or other applied therapies could be observed . Randomized controlled trials concerning the benefit of antiinflammatory treatment with corticoids in patients with sshl are contradictory in outcome . A metaanalysis published and recently updated in the cochrane library concludes that the value of steroids in the treatment of issnhl still remains unclear 9, even though oral or systemic steroid application is recommended as treatment of ssnhl by the guidelines of the american academy of otolaryngologyhead and neck surgery 19 . Intratympanic injection of steroids (its) for the local application has recently emerged to a promising treatment modality for ssnhl 6, 11 . This is favorable as it minimizes systemic side effects 20 especially in patients with contraindications for the systemic application of corticosteroids, e.g., diabetic patients 21 . In recent years, combined application of steroids and hbot for the treatment of ssnhl as salvage therapy has become more popular since promising results were achieved 17, 22 . Only in one of these studies, hbot and its were applied concurrently in patients refractory to other treatment regimen, and partial or even full hearing recovery in the low frequencies was achieved in most of the patients 17 . In this study, the salvage therapy was started <1 week after the onset of hearing loss in all patients included . By contrast, in the herein presented series of patients, most of them with chronic ssnhl, we have shown that concurrent application of both its and hbot can alleviate the symptoms even if the onset of the symptoms was several months ago . The lowest recovery rate was achieved in a patient with barotrauma, even though treatment started as early as 3 days after the onset of hearing loss (case 7). Here, other effects might have contributed to the hearing loss, for example, the rupture of the round window . These were documented by pta and were also based on the subjective improvement as reported by the patients at each consultation . However, evaluation of patients' satisfaction using standardized measures such as visual analog scala was not performed . Regarding possible mechanisms for the positive results achieved, some further aspects will be discussed . Permeability of the round window membrane, clearance as well as the longitudinal perilymph flow rate are interindividual factors that influence accumulation of pharmacologically active substances from the cavum tympani to the perilymph . After its, a rapid loss of the drug may occur due to the clearing functions of the eustachian tube 23 . In order to accumulate in the perilymph, the round window seems to be the dominant route to the inner ear 24 . The size, concentration, solubility, and electrical charge of the drug affect its permeation through the round window membrane 25, 26 . In addition, the thickness and the state of the round window membrane strongly influence the permeability of the drug . After transtympanic administration of gadolinium and monitoring of the threedimensional distribution using magnetic resonance imaging, permeability of the round window membrane was impaired in approximately 20% of the patients 27 . Therefore, it is not surprising that some of the patients with ssnhl remain unresponsive to both systemic and intratympanic steroid application . For these patients, concurrent application of its and hbot might present a successful treatment regimen . We speculate that higher concentrations of corticoids may accumulate in the perilymph under hbot due to a potentially increased permeability of the round window membrane and that increased partial oxygen pressure may account for the benefits experienced by the patients included in our study . However, there is hitherto no evidence available to support this hypothesis . Trying to understand the mechanisms that are involved, a closer look to the round window membrane is important . For example, substances like gentamycin and dexamethasone are able to pass the membrane under normal conditions, whereas bigger molecules, such as albumin, are not 28 . The permeability of the round window membrane changes under pathological conditions, for example, middle ear infection, and larger molecules are then able to penetrate to the inner ear 29 . After application via the cavum tympani, substances (e. g., glucocorticoids) penetrate through the round window membrane and generate a gradient in the cochlea 30 . For dexamethasone, basoapical differences in concentration up to a factor of 1000 have been measured in guinea pigs 30 . These results show that the delivered substances mainly accumulate in the basal turn of the cochlea 30 . Since permeability of the round window membrane can be modulated by pathological conditions, it seems likely that hbot may also influence its properties . To sufficiently explain the results obtained under this regimen, many pathophysiological mechanisms have to be considered and further investigations need to be performed . A hyperbaric environment may facilitate the diffusion rate of chemicals in solution, such as of corticoids into the perilymph through the round window membrane . Transport functions via gap junctions and the mechanism behind could also play a role in the transport of substances into the cochlea . Gap junctions allow the passage of molecules up to a size of approximately 2 nm 31 . Some of them are mechanosensitive 32 and their state can be influenced, for example, by temperature . Postulate that in lower temperature ranges, only small molecules can pass . At higher temperature ranges, beginning with 23c, the passage of bigger molecules becomes possible . Considering these data a synergistic effect of its and hbot has been proposed in order to explain the gain of threshold: on the one side, steroids reduce inflammation in the inner ear that may be contributing to hearing loss, on the other side, hbot increases the intracochlear aiding in the recovery of hearing 17 . However, based on our experience, the hearing recovery may be achievable even if the onset of ssnhl was several weeks to months ago, if the patients were attributed to hbot immediately after its . In addition to the synergistic effort in reducing edema in the inner ear, we assume that hbot changes the permeability of the round window membrane allowing increased influx of steroids into the perilymph, especially into the basal turn of the cochlea, where dexamethasone levels can be expected to be the highest . This may explain the recovery of hearing not only in the low frequencies but also in the high frequencies that are more refractory to recovery treatment . Earlier studies have reported on the role of hbot in order to enhance results achieved by systemic or oral steroid application 15, 22 . The partial pressure of oxygen in the scala tympani in an experimental setting increased resulting in the protection of neurosensory cells and restoration of the oxidative metabolism in the vascular strip 34 . In addition, hbot improves rheology and microcirculation by lowering the blood viscosity and improving erythrocyte elasticity 35 . The guidelines of the american academy of otolaryngology head and neck surgery 19 state that the evidence supports a possible benefit of hbot as an adjuvant treatment, in cases of acute ssnhl when used within 3 months of the onset of the hearing loss . Nonetheless, a recent review points out that the costs and the limited availability of hbot as well as the lack of high quality evidence make it impractical for most patients 36 . The findings of the herein presented study encourage further research on the treatment of noiseinduced ssnhl and issnhl with the concurrent use of hbot and its respecting also patients with longterm or therapyrefractory ssnhl.
Impaction of canine teeth is a well - documented phenomenon, particularly in the recent literature . The occurrence of maxillary canine impaction is considerable and its frequency increases with other genetically associated dental anomalies . Possible causes may include one or more of the following local factors and systemic conditions: inadequate space for eruption or early loss of primary canines; abnormal position of the tooth bud; the presence of an alveolar cleft, a cystic lesion, or neoplasm; ankylosis; dilacerations of the root; an iatrogenic or idiopathic cause; endocrine deficiencies; malnutrition; fever; or irradiation [25]. Suggested that palatal canine impaction is genetic in origin, whereas labial impaction is due to inadequate arch space . Numerous studies have been conducted to investigate the incidence and prevalence of impacted maxillary canines in different populations [711]. Impacted canines are more commonly seen in female than in male patients, and there is wide variation among different racial populations [12, 13]. Both the maxillary and mandibular canines may be impacted, although maxillary canine impaction is considerably more common [3, 4, 14]. Unilateral impaction is more prevalent than bilateral impaction [24], and impaction is ~50 times more frequent in the palate than in the buccal vestibule [3, 4, 10]. However, despite information from other ethnic groups, studies on impacted maxillary canines have not yet been performed in kosovo . The purpose of this study was to determine the incidence of impacted maxillary canines in a kosovar population . This study was conducted on a kosovar population that had been treated in the oral surgery department at the university dentistry clinical center of kosovo from august 2001 to february 2004 . These records were examined to reveal any evidence of impacted maxillary canines (i.e., visual inspection, palpation, and/or radiographs). Clinical examination was done by conventional methods and included whole - arch inspection; palpation to identify any retained deciduous canine; visualization of the canine bulge, splaying of the lateral incisors, lost space, crowding, or fibrous tissue overlying the canine region, and mobility of the primary canines; and a review of the patient's chronological age and history of dental eruption / exfoliation patterns . According to ericson and kurol, clinical examination should be supplemented with a radiographic evaluation to produce an accurate diagnosis . Panoramic radiographs were taken using a planmeca 2002 cc proline (helsinki, finland) using kodak dental films (t - mate; kodak, new york, usa). Other radiographs, including anterior occlusal radiographs, were used to determine the position of the impacted canine by parallaxing . These were acquired using a philips x - ray machine (philips medical systems, london, uk) with kodak dental films (kodac e - speed plus). All films were processed in a xr-24 nova machine (durr dental, bietigheim, germany) using durr dental developer and fixer . All radiographs were placed on a viewing screen and the area surrounding the radiographs was shielded with a dark material to block interfering lateral light and improve viewing contrast . The chi - squared test was used to reveal any differences in the distribution of impacted maxillary canines when stratified by gender, age, location (left or right), and position from the 8101 patients, 131 (1.62%) were found to have impacted maxillary canines . Of these, 101 were female and 30 were male, which was a statistically significant difference (p <0.0001) (table 1). Ages were in the range of 9 to> 20 years, with a mean age of 24.38 8.09 years (table 2). In 99 patients (75.57%), we found unilateral impaction, whereas the remaining 32 (24.43%) were bilateral (table 3). This difference was also statistically significant (p <0.0001). Among the 99 unilaterally impacted canines, 57 were on the left side and 42 were on the right side . In 92 cases (70.2% of total), the impacted tooth was palatally positioned (class i, according to the classification of archer). Seventy - five of these were in a semivertical position, whereas 11 and 6 were in vertical and horizontal positions, respectively . A further 18 canines (13.7% of total) were labially positioned (class ii), with nine being semivertical and seven being in a vertical position (figures 1 and 2). There were 15 cases (11.5% of total) in which the crown of the impacted canine was palatally positioned but the root extended between the adjacent teeth to end labially (class iii). Five canines (3.8%) were impacted within the alveolar process in a vertical position between the incisors and first premolars (class iv). Finally, there was a single case of an ectopic canine (class v) (figure 1). The chi - squared test revealed that the proportion of impacted canines in each position was statistically significantly different (chi - test = 283, p <0.00001). Comparison of the results from this study with those reported previously is complex because of differences in sample size, grouping methods, clinical examination methods, and the radiographic techniques used to make the diagnosis . However, numerous studies have been conducted to investigate the incidence and prevalence of impacted maxillary canines in different populations . The prevalence of maxillary canine impaction appears to vary within a range of 0.93.5%, depending on the population examined [7, 8, 11, 14, 17]. In our study, the overall incidence of impacted maxillary canines was 1.6%, suggesting that ethnicity and geographic location have little influence on the incidence of maxillary canine impaction . Female patients have been reported to be more commonly affected [1721], and our results support this conclusion, with a female: male ratio of 3: 1 . It is possible that this higher frequency in female patients is associated with the smaller cranium in female patients, which may lead to diminution of the facial skeleton and the jaws . Other authors have hypothesized that the higher female incidence may simply reflect a trend whereby female patients are more likely to seek orthodontic treatment and thus have their impacted canines discovered [7, 22]. Most of the studies published on impacted maxillary canines have dealt with characteristics of unilateral impactions [17, 18, 23], although others conclude that bilateral impaction is more usual . Our findings are in line with previous results suggesting that unilateral impaction is more prevalent than bilateral . In a european population, palatal canine impaction was around five times more frequent than in an asian population . In contrast, kim et al . Argue that there is a threefold greater tendency for labial impaction in a korean population . These differences likely relate, at least in part, to racial differences in jaw bone structure . The report by zhong et al . Strongly supports this opinion, finding that the chinese also exhibit a greater prevalence of labial impactions (2.1 times more than palatal). In the present study, this finding is comparable to previous reports evaluating the positional distribution of impacted maxillary canines [19, 26]. The prevalence of the impacted maxillary canine has been investigated extensively elsewhere, but never in a kosovar population . The present study found a relatively high frequency of impacted maxillary canines in a kosovar population . However, the study has several limitations, including difficulty in comprehensively tracing every appropriate dental record, note, and orthopantomographs . Further studies are likely to be required to identify the etiology behind the high prevalence of impacted maxillary canine teeth in kosovar subjects . This present study concluded thatthe incidence of impacted maxillary canines was 1.6%;the most affected gender of impacted maxillary canines is the female;the impaction had occurred more unilaterally than in both sides;the most frequent location of impacted canines was palatal . The incidence of impacted maxillary canines was 1.6%; the most affected gender of impacted maxillary canines is the female; the impaction had occurred more unilaterally than in both sides; the most frequent location of impacted canines was palatal.
In our clinical experience some parents with epilepsy express concern how the condition will affect their child . This is especially the case when the parent has therapy - resistant epilepsy and often suffers from seizures . On the other hand, there are also parents who are not at all concerned about the consequences of epilepsy for their children . The children of people with epilepsy (pwe) comprise a group that possibly can be affected by their parent s condition for different reasons . There is a potential risk that the child can be hurt in association with a seizure affecting their parent, but there are also possible psychosocial consequences associated with growing up with a parent with a chronic disease . Epilepsy is associated with an increased prevalence of mental - health disorder compared with the general population1 and it is also associated with a higher risk of suicide . One may speculate that growing up with a parent under these conditions could be difficult for a child . Our interest in this matter is explained by information from focus - group interviews that we undertook with young to middle - aged persons with epilepsy and memory problems . Here, many informants were worried about how growing up with a parent with epilepsy affected the situation of their children,2 and gave a more detailed description of the psychosocial stress that pwe may suffer, in relation to a reduced capability to look after their children, that some of them report . There is not much knowledge about the situation of or risk for children of persons with a chronic disease such as epilepsy.3 one may suspect that such children could be at risk of developing psychosocial / psychological problems or even physical symptoms, but we have found no research on this subject . There are some reports on these issues from people with other conditions such as multiple sclerosis47 and cancer.8 a literature search revealed just a few reports on the situation for children of persons with epilepsy9,10 and none that focused on the risks for the children . Studies indicate that epilepsy may cause psychosocial difficulties for family members, but have concentrated on the effect of children with epilepsy on adult family members.3 epilepsy also affects family members quality of life, but this has also been studied in adults exclusively.11 family members of adult pwe, especially of mothers, have increased levels of anxiety, depression, and somatic complaints.12 the literature search revealed no reports on the deeper meaning of being a parent with epilepsy and, to our knowledge, this area has not been investigated before . The aim of this paper is to describe aspects of what it means to be a parent with epilepsy, focusing the parent s perspective and their thoughts on having children . A qualitative method was used to obtain knowledge and understanding on this issue; this method is often used to start research on a new area . This method does not produce any numbers, but can help to understand more complex human behavior . In the study reported here, we reused preexisting data and performed a secondary analysis.2 heaton describes secondary analyses as a way of reworking and analyzes preexisting qualitative data by asking new and expanded questions of the text.13 focus - group interviews of young adults, aged 1835 years old, with epilepsy, treated in our clinics, that aimed to investigate the impact of memory problems in epilepsy, actually turned out to reveal much information about epilepsy and parenthood . Altogether, 18 young adults were invited to take part in the study, but four of them did not show up at the appointed time . Most of the participants were interested in meeting other young people with the same condition as themselves, and therefore wanted to join the study . The interviews were conducted by two of the authors (hg and aml) and took place in four groups . Each group contained three or four individuals, two groups with women and two groups with men . The participants have been described in a previous article2 and many of the participants had therapy - resistant epilepsy, but some of the participants were seizure free . The participants (male [m] 52 years old and m 55) who were interviewed for the book leva med epilepsi [to live with epilepsy]14 were interviewed in face - to - face interviews by one of the authors (aml). For demographic information the participants in focus - group interviews were asked open questions on living with epilepsy and subjective memory problems . If there were feelings the participants did not want to share in the group, they were informed they could meet the doctor confidentially after the interviews . There were no questions about being a parent with epilepsy, but since the participants were free to discuss subjects of importance to them, this subject was raised spontaneously in the groups . Such naturalistic data that have been collected with minimal interference by researchers, heaton13 describes as being very suitable for secondary analysis . Interviews by the same method, but without concentrating on cognitive problems, were also performed with people of different ages with epilepsy when preparing the book leva med epilepsi.14 the focus - group interviews were recorded and verbatim transcribed, which means that every word, sound, and silent period during the interviews was written down as a long text . Relevant areas and aspects covering the participants narratives and issues of being a parent with epilepsy were extracted from the original interview text . In addition, relevant aspects from interviews undertaken by aml, using open - ended questions, for the book leva med epilepsi were extracted . The two men taking part in these interviews with open - ended questions discussed issues of being a parent having epilepsy . These men were older than the other participants and they were included in the study to achieve a wider age range (m 52 and m 55). The text in the domain was analyzed in steps described by graneheim and lundman.15 first, all the authors read the transcripts several times, in order to get a sense of the whole and a good grasp of the content . In the next step, this analysis did not follow common grammatical or linguistic rules, but the text was divided when a shift in the sense of meaning could be found . In the next step, these meaning units were then concentrated without changing the inherent meaning and the implicit meaning in the text was interpreted . Following this the interpretations were grouped together and abstracted to themes and are presented in the results . The regional ethical committee of linkping, linkping, sweden, approved this study (dnr 2010/246 - 31). The aim of this paper is to describe aspects of what it means to be a parent with epilepsy, focusing the parent s perspective and their thoughts on having children . A qualitative method was used to obtain knowledge and understanding on this issue; this method is often used to start research on a new area . This method does not produce any numbers, but can help to understand more complex human behavior . In the study reported here, we reused preexisting data and performed a secondary analysis.2 heaton describes secondary analyses as a way of reworking and analyzes preexisting qualitative data by asking new and expanded questions of the text.13 focus - group interviews of young adults, aged 1835 years old, with epilepsy, treated in our clinics, that aimed to investigate the impact of memory problems in epilepsy, actually turned out to reveal much information about epilepsy and parenthood . Altogether, 18 young adults were invited to take part in the study, but four of them did not show up at the appointed time . Most of the participants were interested in meeting other young people with the same condition as themselves, and therefore wanted to join the study . The interviews were conducted by two of the authors (hg and aml) and took place in four groups . Each group contained three or four individuals, two groups with women and two groups with men . The participants have been described in a previous article2 and many of the participants had therapy - resistant epilepsy, but some of the participants were seizure free . The participants (male [m] 52 years old and m 55) who were interviewed for the book leva med epilepsi [to live with epilepsy]14 were interviewed in face - to - face interviews by one of the authors (aml). For demographic information see table 1 . The participants in focus - group interviews were asked open questions on living with epilepsy and subjective memory problems . If there were feelings the participants did not want to share in the group, they were informed they could meet the doctor confidentially after the interviews . There were no questions about being a parent with epilepsy, but since the participants were free to discuss subjects of importance to them, this subject was raised spontaneously in the groups . Such naturalistic data that have been collected with minimal interference by researchers, heaton13 describes as being very suitable for secondary analysis . Interviews by the same method, but without concentrating on cognitive problems, were also performed with people of different ages with epilepsy when preparing the book leva med epilepsi.14 the focus - group interviews were recorded and verbatim transcribed, which means that every word, sound, and silent period during the interviews was written down as a long text . Relevant areas and aspects covering the participants narratives and issues of being a parent with epilepsy were extracted from the original interview text . In addition, relevant aspects from interviews undertaken by aml, using open - ended questions, for the book leva med epilepsi were extracted . The two men taking part in these interviews with open - ended questions discussed issues of being a parent having epilepsy . These men were older than the other participants and they were included in the study to achieve a wider age range (m 52 and m 55). The text in the domain was analyzed in steps described by graneheim and lundman.15 first, all the authors read the transcripts several times, in order to get a sense of the whole and a good grasp of the content . In the next step, this analysis did not follow common grammatical or linguistic rules, but the text was divided when a shift in the sense of meaning could be found . In the next step, these meaning units were then concentrated without changing the inherent meaning and the implicit meaning in the text was interpreted . Following this the interpretations were grouped together and abstracted to themes and are presented in the results . The regional ethical committee of linkping, linkping, sweden, approved this study (dnr 2010/246 - 31). The discussions in the focus groups revealed the following key issues of being a parent with epilepsy: (1) a persistent feeling of insecurity, since a seizure may occur at any time and the child could be hurt; (2) a feeling of inadequacy of not being able to take full responsibility for one s child; (3) acknowledgment that one s children are forced to take more responsibility than other children do; and (4) a feeling of guilt of not being able to fulfill one s expectations of being the parent one would like to be . The participants in the focus - group interviews talked about the difficulties for and dangers to the child of a parent with epilepsy . They described that they were always aware of the possibility of a seizure and tried to foresee what the consequences would be in each and every situation, so that the child would be safe if a seizure did occur . The participants took great care to prevent the child from being harmed and some of them explained that they were never left alone with their child . They tried to care for their child on the floor or on a couch, preventing the child from falling if a seizure did happen, and also avoided carrying their child . One woman described that she concentrated hard on the safety of her child in every situation . If i will carry her or if i am walking with the stroller, it is really frightening . If i am carrying her or do something with her i really shape up, i try to concentrate so that nothing will happen . I always take care of my baby on the floor or on the couch so she cannot fall . (female [f] 26)i was really scared when i took care of the child . If i would fall the child would fall too, so i was never alone with the boy until he was like 5 years old . (m 32) i bite my tongue all the time i am with my baby . If i will carry her or if i am walking with the stroller, it is really frightening . If i am carrying her or do something with her i really shape up, i try to concentrate so that nothing will happen . I always take care of my baby on the floor or on the couch so she cannot fall . (female [f] 26) i was really scared when i took care of the child . If i would fall the child would fall too, so i was never alone with the boy until he was like 5 years old . (m 32) one of the men (m 24), who was expecting his first child, was at first not concerned about the possible dangers for the child (illustrated in the dialogue following). However after discussing with one of the other participants, he seemed to realize that this is a problem he must consider in the future: m 33: how will it be when it is just you and your baby? I think that is really difficult?m 24: just me and the baby; but that is not difficult?m 33: yes, i mean when you have to bathe the baby or walk with the stroller.m 24: i think i can take care of that; i am good with kids.m 33: yes, but i mean if you have a seizure.m 24: but i do not have many seizures now; i think it will be okay.m 33: i think it is so hard; i have just a few seizures, but am so afraid . A lot can happen if you have a seizure, even if you do not have them often [].m 24: i can understand that; i feel the same now . M 33: how will it be when it is just you and your baby? M 33: yes, i mean when you have to bathe the baby or walk with the stroller . M 24: i think i can take care of that; i am good with kids . M 24: but i do not have many seizures now; i think it will be okay . M 33: i think it is so hard; i have just a few seizures, but am so afraid . A lot can happen if you have a seizure, even if you do not have them often []. One father was not worried for his daughter when she was a small child, but in retrospect, he understood that the situation must have been difficult for her: we were divorced but there was something i really wanted: my daughter . I had a few seizures; but it is hard to know if my daughter was afraid . When she was older she got the telephone number for a nurse and could call if something happened . She was a clever girl and could make a phone call . At this time i used to have a couple of seizures every month . (m 55) we were divorced but there was something i really wanted: my daughter . I had a few seizures; but it is hard to know if my daughter was afraid . When she was older she got the telephone number for a nurse and could call if something happened . She was a clever girl and could make a phone call . At this time i used to have a couple of seizures every month . (m 55) the participants described a feeling of inadequacy when discussing parenthood in the group . They wished to take the same responsibility as other parents, but understood it was important to accept help from other people . They expressed that it was difficult to accept that they could not be part of all aspects of parenthood . For some participants this meant that they felt they did not have the same value or importance as other parents: i feel like i am not really grown up, i cannot even walk with the stroller . But it hurts, that i cannot and should not, take the full responsibility . I did not have the energy to do all the things that i wanted to and my opinion was not always asked for . (m 52) i feel like i am not really grown up, i cannot even walk with the stroller . But it hurts, that i cannot and should not, take the full responsibility . I did not have the energy to do all the things that i wanted to and my opinion was not always asked for . (m 52) the parents were also worried that the children had to take on a big responsibility and grow up too fast because of epilepsy, giving the parents the feeling that their children were not allowed to be children . They often trusted in their children and got help from them, but the fact that they had to lean on their children made them sad . The children were always alert to recognizing if their parent might have a seizure and some children even observed their parent and did not let them out of sight . The children learned to take own initiative; for example, by getting help from other people by calling them . In this way they had to take on a big responsibility even if they were very young: my daughters help me, with the seizures . They are children, but they are not allowed to be children, they are like adults actually . But i must try to let them be children now, as they are 8 and 9 years old . And i wake up after a seizure and i call on her to ask her to turn off the tv . She calls dad, but he does not answer and then she calls grandma instead . They are children, but they are not allowed to be children, they are like adults actually . But i must try to let them be children now, as they are 8 and 9 years old . And i wake up after a seizure and i call on her to ask her to turn off the tv . Shall i call dad? She calls dad, but he does not answer and then she calls grandma instead . (f 29) the parents in the focus - group interviews often felt guilty because they could not be the parents they wanted to be . They also felt guilty because of all the difficulties their children had to experience when witnessing a seizure . They thought about what the seizure would look like and wondered if the child would be afraid when observing it . The parents were also worried about how these experiences in childhood would affect their children in the long run . They discussed whether the seizures would scare the children and how the children would react to them . The participants also experienced subjective memory decline and they believed that this affected the situation of their children . They explained that they often forgot to keep their promises and forgot to give information and they regarded this as being difficult for their children . They felt that they often let their children down and the children were often disappointed: i have been worried and i am so anxious . How will it be when she gets older and how will she cope with it when i have a seizure? What will happen if i have a seizure, if it is just me and my children? I am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves, just because i am feeling bad . How will it be when she gets older and how will she cope with it when i have a seizure? What will happen if i have a seizure, if it is just me and my children? I am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves, just because i am feeling bad . (f 29) a friend of my daughter calls when my daughter is outside playing . The participants in the focus - group interviews talked about the difficulties for and dangers to the child of a parent with epilepsy . They described that they were always aware of the possibility of a seizure and tried to foresee what the consequences would be in each and every situation, so that the child would be safe if a seizure did occur . The participants took great care to prevent the child from being harmed and some of them explained that they were never left alone with their child . They tried to care for their child on the floor or on a couch, preventing the child from falling if a seizure did happen, and also avoided carrying their child . One woman described that she concentrated hard on the safety of her child in every situation . If i will carry her or if i am walking with the stroller, it is really frightening . If i am carrying her or do something with her i really shape up, i try to concentrate so that nothing will happen . I always take care of my baby on the floor or on the couch so she cannot fall . (female [f] 26)i was really scared when i took care of the child . If i would fall the child would fall too, so i was never alone with the boy until he was like 5 years old . (m 32) i bite my tongue all the time i am with my baby . If i will carry her or if i am walking with the stroller, it is really frightening . If i am carrying her or do something with her i really shape up, i try to concentrate so that nothing will happen . I always take care of my baby on the floor or on the couch so she cannot fall . (female [f] 26) i was really scared when i took care of the child . If i would fall the child would fall too, so i was never alone with the boy until he was like 5 years old . (m 32) one of the men (m 24), who was expecting his first child, was at first not concerned about the possible dangers for the child (illustrated in the dialogue following). However after discussing with one of the other participants, he seemed to realize that this is a problem he must consider in the future: m 33: how will it be when it is just you and your baby? I think that is really difficult?m 24: just me and the baby; but that is not difficult?m 33: yes, i mean when you have to bathe the baby or walk with the stroller.m 24: i think i can take care of that; i am good with kids.m 33: yes, but i mean if you have a seizure.m 24: but i do not have many seizures now; i think it will be okay.m 33: i think it is so hard; i have just a few seizures, but am so afraid . A lot can happen if you have a seizure, even if you do not have them often [].m 24: i can understand that; i feel the same now . M 33: how will it be when it is just you and your baby? M 33: yes, i mean when you have to bathe the baby or walk with the stroller . M 24: i think i can take care of that; i am good with kids . M 24: but i do not have many seizures now; i think it will be okay . I think it is so hard; i have just a few seizures, but am so afraid . A lot can happen if you have a seizure, even if you do not have them often []. M 24: i can understand that; i feel the same now . Being a single parent with epilepsy one father was not worried for his daughter when she was a small child, but in retrospect, he understood that the situation must have been difficult for her: we were divorced but there was something i really wanted: my daughter . I had a few seizures; but it is hard to know if my daughter was afraid . When she was older she got the telephone number for a nurse and could call if something happened . She was a clever girl and could make a phone call . At this time i used to have a couple of seizures every month . (m 55) we were divorced but there was something i really wanted: my daughter . I had a few seizures; but it is hard to know if my daughter was afraid . When she was older she got the telephone number for a nurse and could call if something happened . She was a clever girl and could make a phone call . At this time i used to have a couple of seizures every month . They wished to take the same responsibility as other parents, but understood it was important to accept help from other people . They expressed that it was difficult to accept that they could not be part of all aspects of parenthood . For some participants this meant that they felt they did not have the same value or importance as other parents: i feel like i am not really grown up, i cannot even walk with the stroller . But it hurts, that i cannot and should not, take the full responsibility . I did not have the energy to do all the things that i wanted to and my opinion was not always asked for . (m 52) i feel like i am not really grown up, i cannot even walk with the stroller . But it hurts, that i cannot and should not, take the full responsibility . I did not have the energy to do all the things that i wanted to and my opinion was not always asked for . The parents were also worried that the children had to take on a big responsibility and grow up too fast because of epilepsy, giving the parents the feeling that their children were not allowed to be children . They often trusted in their children and got help from them, but the fact that they had to lean on their children made them sad . The children were always alert to recognizing if their parent might have a seizure and some children even observed their parent and did not let them out of sight . The children learned to take own initiative; for example, by getting help from other people by calling them . In this way they had to take on a big responsibility even if they were very young: my daughters help me, with the seizures . They are children, but they are not allowed to be children, they are like adults actually . But i must try to let them be children now, as they are 8 and 9 years old . And i wake up after a seizure and i call on her to ask her to turn off the tv . Shall i call dad? She calls dad, but he does not answer and then she calls grandma instead . They are children, but they are not allowed to be children, they are like adults actually . But i must try to let them be children now, as they are 8 and 9 years old . And i wake up after a seizure and i call on her to ask her to turn off the tv . She calls dad, but he does not answer and then she calls grandma instead . The parents in the focus - group interviews often felt guilty because they could not be the parents they wanted to be . They also felt guilty because of all the difficulties their children had to experience when witnessing a seizure . They thought about what the seizure would look like and wondered if the child would be afraid when observing it . The parents were also worried about how these experiences in childhood would affect their children in the long run . They discussed whether the seizures would scare the children and how the children would react to them . The participants also experienced subjective memory decline and they believed that this affected the situation of their children . They explained that they often forgot to keep their promises and forgot to give information and they regarded this as being difficult for their children . They felt that they often let their children down and the children were often disappointed: i have been worried and i am so anxious . How will it be when she gets older and how will she cope with it when i have a seizure? What will happen if i have a seizure, if it is just me and my children? I am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves, just because i am feeling bad . How will it be when she gets older and how will she cope with it when i have a seizure? What will happen if i have a seizure, if it is just me and my children? I am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves, just because i am feeling bad . (f 29) a friend of my daughter calls when my daughter is outside playing . Parents in the focus - group interviews expressed, without any direct questioning on this subject, that they were very worried about the consequences of epilepsy affecting their children . These parents took great care to prevent any accidents that could harm their children because of epilepsy . It was always in their minds to figure out the safest way to take care of the child in case they had a seizure . We have not found any study examining the risk of accidents for children of parents with epilepsy . In a study examining children drowning or near drowning in baths in england, four out of 44 cases were related to epilepsy but every case affected children with epilepsy and none was caused by a parent with epilepsy.16 the parents themselves often suffered from a feeling of being an inadequate parent, forgetting about schedules, and being forced to rest instead of taking care of their children . One may interpret this situation as putting more demand on the spouse, and also on the children themselves . These results can be involved in a future discussion on different forms of support for pwe with children, especially if they are single parents or the spouse cannot support the identified needs . On the other hand, it is also important to strengthen the self - esteem in pwe, which obviously also is determined by their ability to care for their children . Consequently, this is a matter of balance between the quality of life and self - esteem of pwe and the safety of their children . Persons with epilepsy who have children seem to have a double trauma: first, the risk of getting seizures and the constant fear that this can create and, second, worries about generating psychological and physical problems for their children.2 the authors also suspect that there may be such risks for some children of pwe, that the pwe do not recognize themselves . However, parents who are concerned about the security of the child will, just like the parents in our study, try to foresee every possible risk associated with epilepsy . It is more dangerous if the parent does not acknowledge the possible risks associated with the seizure and ignores them . It is therefore important to scrutinize the attitude and knowledge of each parent with epilepsy . Parents can also fear that the child will be taken into custody if they expose the possible risks to the social authorities . It is essential that parents with epilepsy can get support in their homes if necessary, so that they do not have to conceal their worries for the child s safety . Interventions offered to pwe for supporting their children should be designed in a way that the person feels safe and the action taken should be beneficial to the whole family . Parents with epilepsy are aware of the difficulties of being a parent who can be affected by seizures, but it is important to identify those parents that ignore the risks . Cognitive profile is one factor that should be investigated in this situation; low performance may be a risk factor, but further research is needed to know this for certain . Support programs must be done in a way that respects the condition of the patient, knowing that the self - esteem of the patient is vulnerable in this disease . A previous study has shown that self - esteem among young adults with epilepsy decreases when they have passed adolescence and meet the different obstacles of adult life,17 such as getting a job and raising a child . Interventions should address both pwe but also their family members and the safety of the child must be discussed with the whole family . It is essential that information about the difficulties for parents with epilepsy also reaches the pediatrician, general practitioner, and social authorities . One possible method is to let professional patients persons with epilepsy who have been educated about the condition spread information about the difficulties of being a parent with epilepsy . The young man in our study who at first could not see any risks for his future child because of epilepsy got new perspectives about this when discussing the subject with another parent with epilepsy . To talk with someone that has experience can be important for understanding the issue . Even though this qualitative study is limited by the relatively small number of participants it shows that this is a field of importance to many pwe and further research could give more information . Since a qualitative study generates no numbers we do not know how frequent these problems are . Most participants in the interviews had therapy - resistant epilepsy and one could assume that patients who are seizure - free do not experience the same kinds of problems or find this issue as important . Another option would be to analyze groups of parents with epilepsy before and after extra support interventions and providing them with information . Material from the focus - group interviews suggests that parents with epilepsy are very concerned about the consequences of epilepsy affecting their children . The feeling of insecurity is persistent, as a seizure can happen at any time . The risk of seizures leads to a feeling of inadequacy and not being able to take full responsibility for the child . The parents take care to prevent accidents, but need support and guidance, especially when expecting their first child . Fear of not being approved as a custodian can prevent parents from discussing the possible risks for their child . Parents with epilepsy also feel the children must take on too much responsibility for their age and they feel guilty they cannot be the ideal parent . We believe it is essential that supportive programs are made available to parents with epilepsy, since fear for the safety of the child increases the psychosocial burden of the condition, and that interventions should address both pwe and family members . To arrange study circles, in which pwe get the opportunity to meet each other, is one possible strategy for sharing information about the difficulties of being a parent with epilepsy . Professional patients, who are persons with epilepsy who have been given education about the condition . Other family members, such as spouses and siblings, could also be offered to attend a group of their own . Associations for pwe could also recognize and work with this important aspect of living with epilepsy . This qualitative study on parents with epilepsy indicates that further research is of importance in this field.
Infection reported to the new south wales health department identified a probable s. enterica var . Java outbreak in a single local government area (population 57,000), and an investigation was initiated . We defined a case - patient as a person reported to health authorities during 20072009 who had had diarrhea for at least 24 hours, either lived in or had visited the local government area during the 7 days before the onset of diarrhea, and had provided a fecal sample from which s. enterica var . Seventy - five case - patients were identified: ages ranged from 1 month through 60 years (median age 2 years, 10 months . ); 34 were female . All isolates were sensitive to ampicillin, streptomycin, tetracycline, chloramphenicol, sulfathiazole, and spectinomycin . Results of phage typing by using standard techniques (7) were available for 74 isolates; 54 were classified as phage type dundee, 19 as a uniform reactions do not conform, which closely resembled dundee, and 1 as untypeable . Seventy - two isolates underwent multilocus variable number tandem repeat analysis (mlva) typing (8); 69 were classified as 1-(12 - 17)-0 - 0 - 493 and 3 as distinctly different types . This mlva type was unique to case - patients from this outbreak; it was not seen in isolates from other parts of new south wales . After an extensive investigation involving case - patient interviews and food and environmental sampling during 2007 and early 2008, exposure to playground sand at public parks and childcare centers was identified as the likely immediate source of the outbreak . Java was isolated from 50 of 207 sand samples taken from 39 locations; no other salmonella serotypes were detected . All 19 playgrounds with sandboxes from within the local government area were sampled, regardless of whether they were linked to case - patients . All 35 playground isolates came from 6 playgrounds that had received sand from a central depot within the past 12 months . Were isolated from surface and deep (as far as 50 cm below the surface) sand samples . Despite multiple samples being taken antimicrobial drug sensitivity testing, phage typing, and mlva typing of isolates produced results indistinguishable from those of the outbreak strain . One contaminated playground was closed to human access, left undisturbed, and sequentially sampled every 3 months . Nine months passed before all samples taken from this playground were clear of the bacterium . To confirm the hypothesis that sand from playgrounds contaminated with s. enterica var . Java was the immediate source of the outbreak, we performed an age - matched case control study of case - patients 1 month to 4 years of age involving 16 case - patients and 32 controls during may 2008 . Exposure to playgrounds with contaminated sand within 7 days of symptom onset was associated with illness (matched odds ratio 3.7, 95% ci 1.112.1). In may 2008, a substantial reduction in the number of case - patients reported occurred (figure 1), although new case - patients continued to be reported throughout the study period . Number of cases of salmonella enterica variant java infection and month of onset in children playing in sandboxes, australia, 20072009 . To better characterize the distribution of the bacterium in the local ecosystems, we collected fecal and cloacal samples from 261 free - ranging animals of various species (table). Java were identified: most were from a marsupial species native to the local area, the long - nosed bandicoot, perameles nasuta (figure 2). The australian registry of wildlife health had no recorded evidence of disease associated with the isolation of s. enterica var . Java from long - nosed bandicoots (k. rose, taronga conservation society australia, pers . Comm . ). * with the exceptions of samples from 1 bandicoot that reacted but did not conform (pt rdnc / a001), and 1 dog that was not tested, all phage types were dundee . Long - nosed bandicoot (perameles nasuta). Photograph courtesy of taronga zoo, sydney, new south wales, australia . Java from playground sand with the same phage type, mlva pattern, and antibiogram as that of human isolates supported the hypothesis that ingestion of sand from playgrounds was the human exposure pathway for this outbreak . The case control study found an association between infection in humans and exposure to at least 1 playground where an s. enterica var . Java isolate was found in the sand; these findings confirmed sand as the immediate source of infection . Although sand from the central depot was a common factor in all contaminated playgrounds where case - patients contracted the illness, the infection source for this facility remains unknown . It was located in a wild bushland setting, and it is feasible that transmission of the bacterium from local wildlife occurred . Native animals and wildlife have been implicated in previous community - wide outbreaks of salmonellosis (9,10). The isolation of s. enterica var . Java of common phage and mlva types from human, animal, and environmental samples implies that the organism can survive within multiple ecosystems . The organism probably has multiple transmission pathways, involving interactions among humans, animals, and the environment . The persistence of the bacterium in playground sand for up to 9 months demonstrates that the organism can survive for a relatively long period in this environment and might provide information about the natural history of the bacterium and how it can infect humans . Java with the outbreak phage type and mlva typing in cloacal swab specimens from 31% of native long - nosed bandicoots sampled (table); illness in the animals was not apparent . It is unclear whether the bacterium has a predilection for this species or whether the bandicoot exhibits a particular behavior that predisposes it to being colonized . The study identifies accidental sand ingestion as a previously unrecognized pathway for humans acquiring illness caused by s. enterica var . Java and provides further evidence for the need to manage this medium in playgrounds to protect public health . The emergence of human disease caused by s. enterica var . Java from this environmental source and the local colonization of wildlife with the same bacterium highlights the consequences of the interface between human and wildlife health . Further research and a more extensive systematic sampling program that includes the local government area that was the focus of this study are required to better understand the ecology of s. enterica var . Ultimate control of the outbreak might require a strategy that involves altering human behavior, the environment, and wildlife habitat.
Reagents - bovine serum albumin (bsa) was purchased from sigma (sigma chemical co, st . Alexa fluor 488-conjugated rabbit anti - mouse immunoglobulin g (igg) was purchased from molecular probes (carlsbad, ca, usa). Horseradish peroxidase (hrp)-conjugated rabbit anti - mouse igg was purchased from santa cruz biotechnology (santa cruz, ca, usa). Molecular weight markers (benchmark protein ladder, 10 - 220 kda) and the fluorescent dye hoechst 33342 trihydrochloride were purchased from invitrogen (eugene, or, usa). A polyclonal mouse antibody against t. cruzi glyceraldehyde 3-phosphate dehydrogenase (gapdh) was kindly provided by f morini [carlos chagas institute, oswaldo cruz foundation (fiocruz), state of paran, brazil]. Parasites - t. cruzi clone dm28c (contreras et al . 1988) epimastigote forms were grown at 28c in liver infusion tryptose (lit) medium (camargo 1964) supplemented with 10% foetal bovine serum (fbs), with weekly passages . Epimastigotes were differentiated in vitro into metacyclic trypomastigotes in triatomine artificial urine (tau)3aag medium (190 mm nacl, 17 mm kcl, 2 mm mgcl2, 2 mm cacl2 and 8 mm phosphate buffered saline (pbs) at ph 6.0 supplemented with 10 mm l - proline, 50 mm l - sodium glutamate, 2 mm l - sodium aspartate and 10 mm d - glucose) (contreras et al . Briefly, five - day - old cultured epimastigotes were harvested by centrifugation for 10 min at 8,500 g . The parasites were then incubated at a density of 5 x 10 cells / ml for 2 h at 28c in tau medium . Cells (at a 1:100 dilution) were further incubated for 96 h at 28c in culture flasks that contained no more than 1 cm deep of tau3aag medium . The number of living epimastigotes and metacyclic trypomastigotes was then determined by cell counting via a neubauer chamber after 24 h, 48 h and 72 h. the metacyclic trypomastigotes were purified from the 72 h - old cultures by deae-51 cellulose chromatography (contreras et al . 1985). To obtain amastigote forms, metacyclic trypomastigotes derived in vitro were used to infect vero cells (atcc crl-1586), which were then cultivated in dulbecco's modified eagle's medium (sigma) supplemented with 5% fbs and incubated in a humidified atmosphere with 5% co2 at 37c . After 10 days of infection, the amastigotes released into the supernatant were harvested by centrifugation at 1,000 g for 5 min . L. major promastigotes were grown at 28c in schneider's medium (sigma) supplemented with 10% fbs and 10 mg / l haemin . Brucei were cultivated at 28c in sdm79 medium (invitrogen) supplemented with 10% fbs and 10 mg / l haemin (brun & schonenberger 1979). Strigomonas culicis (formerly blastocrithidia culicis) (teixeira et al . 2011), angomonas deanei (formerly crithidia deanei) (teixeira et al . 2011) with its bacterial endosymbiont, crithidia fasciculata and herpetomonas samuelpessoai were grown at 28c in lit medium supplemented with 10% fbs with daily passages . Phytomonas serpens was grown at 28c in gypmy medium (itow - jankevicius et al . Cloning and expression of tcactin - the complete coding sequence of tcactin (dm28c clone) was amplified using synthetic primers that were based on the t. cruzi cl brener sequence (accession tc00.1047053510571.30) available from the t. cruzi genome database (genedb.org). The putative open reading frame of 1,131 bp, encoding a protein of 41.9 kda, was amplified by polymerase chain reaction (pcr) using forward primer 5'cggaattcatgtctgacgaagaacagtccgctatt3', reverse primer 5'attcgtcgactcattgttgtgcacaatgcttgggcctgcctcgtc3' and the genomic dna as a template . The pcr products, flanked by ecori and sal1 sites, were inserted into a vector (pgex-4t1, invitrogen) containing glutathione - s - transferase (gst). Positive clones were purified with a qiaprep spin miniprep kit (qiagen, valencia, ca, usa) and sequencing was performed at macrogen inc (seoul, korea). The amplified fragments inserted into the pgex-4t1 vector (invitrogen) were used to transform escherichia coli strain top 10 . Inclusion bodies containing the recombinant protein were isolated and the recombinant protein was purified by electro - elution . Polyclonal antiserum - a polyclonal antiserum against the expressed recombinant tcactin was produced in albino swiss mice . Approximately 50 g of purified, gst - tagged tcactin was mixed 1:1 with complete freund's adjuvant and inoculated intraperitoneally in mice . After 15 days, the animals received three consecutive boosts at two - week intervals, each containing an additional 20 g of the antigen and 77 l of alu - gel (serva, heidelberg, germany) as adjuvant . This study was carried out in strict accordance with the recommendations in the guide for animal use of the fiocruz and the protocol was approved by the committee on animal experimentation (p-0434/07). Western blot analysis - for immunoblotting analysis, all of the parasites' total protein extracts were prepared by resuspending the pbs - washed parasites (10 cells/l) in sodium dodecyl sulphate polyacrylamide gel electrophoresis (sds - page) sample buffer to lyse the cells (10 cells / lane). The proteins were fractionated in 13% polyacrylamide gels by sds - page and transferred onto nitrocellulose membranes (hybond c, amersham biosciences, england), according to standard protocols (sambrook et al ., the membranes were blocked with 5% non - fat milk and 0.05% tween-20 in pbs . The membranes were then incubated for 2 h with a blocking buffer containing the polyclonal antiserum raised against recombinant protein tcactin (1:200 dilution). After three washings with 0.05% tween-20 in pbs, the nitrocellulose was incubated for 1 h with hrp - conjugated rabbit anti - mouse igg (1:10,000 dilution). The membrane was again washed three times with 0.05% tween-20 in pbs and the reactive bands were visualised using the bcip - nbt solution, as described by the manufacturer . Furthermore, 15 g of the total proteins obtained from the t. cruzi cultured epimastigotes, metacyclic trypomastigotes and cell culture - derived amastigotes, as well as those from the vero cells, were resolved on sds - page (13%) gels . Following the transfer of the proteins to nitrocellulose, the membrane was incubated for 2 h with a blocking buffer containing both the polyclonal antiserum raised against recombinant protein tcactin (1:200 dilution) and a polyclonal antiserum against t. cruzi gapdh . After three washings with 0.05% tween-20 in pbs the relative amount of actin and gapdh (1:250 dilution) expressed by each developmental stage was estimated using imagej software (national institutes of health, bethesda, md, usa). Immunofluorescence assays - all of the parasites (including t. cruzi epimastigotes, amastigotes and metacyclic trypomastigotes) were washed and resuspended at a density of 10 cells / ml in pbs . The cells were fixed with 4% paraformaldehyde for 15 min at room temperature (rt), washed twice in pbs and then adhered to 0.1% poly - l - lysine - coated coverslips, which were themselves incubated for 20 min at rt . The cells were made permeable by 2 min of incubation with 0.1% triton x-100 in pbs; next, they were washed with pbs, blocked by incubation overnight with 1% bsa in pbs and incubated for 1 h with the polyclonal antiserum against tcactin (1:150 dilution). After another washing, the samples were incubated with alexa fluor 488-conjugated rabbit anti - mouse igg at a 1:800 dilution . After extensive washing, the coverslips were mounted onto glass microscope slides using n - propyl - gallate for anti - fading . The samples were examined using a leica sp5 confocal laser microscope (leica microsystems, mannheim, germany) and the images were processed for better contrast using adobe photoshop cs3 software . A polypeptide of approximately 41.9 kda, encoded by the entire sequence of the tcactin, was used to obtain a polyclonal tcactin antibody prepared in mice . When used in western blotting to probe for the presence of actin in trypanosomatids, this antibody reacted with a peptide of approximately 42 kda in the whole - cell lysates of multiple species (fig . 1a), including parasites targeting mammals (t. cruzi epimastigotes, t. brucei procyclic forms and l. major promastigotes), insects (a. deanei, c. fasciculata and s. culicis) and plants (p. serpens). Interestingly, two close weak bands near that weight were recognised in the p. serpens blot . A: different trypanosomatids were probed with detection of a single band of about 42 kda, except for phytomonas serpens (lane 7) where two close faint bands could be observed . Lanes 1 - 8 contained 10 cells (1: t. cruzi; 2: trypanosoma brucei; 3: leishmania major; 4: strigomonas culicis; 5: crithidia fasciculata; 6: angomonas deanei with symbiont; 7: phytomonas serpens; 8: herpetomonas samuelpessoai); b: different t. cruzi stages probed against the anti - tcactin antibody (upper bands) and an anti - glyceraldehyde 3-phosphate dehydrogenase antibody (lower bands) [1: culture epimastigote (ce) in liver infusion tryptose (lit) medium; 2: metacyclic trypomastigote (mt); 3: amastigote (am); 4: vero cells (actin control); 1 - 4 contained 15 g protein / lane]; c: actin expression level as evaluated by integrated density of protein bands (using gapdh band as normaliser) analysed by the imagej software (n = 3). To evaluate the actin expression in am, the vero cell band signal was subtracted from the am band signal; mw: molecular weight markers . The expression of actin was also analysed by western blotting in different life stages of t. cruzi, as well as in vero cells, using the tcactin antibody (fig . 1b, upper bands) in the whole - cell lysates of all tested t. cruzi stages (culture epimastigotes, metacyclic trypomastigotes and cell - derived amastigotes). A similar actin expression level was observed in all of the developmental forms, as confirmed by band densitometry analysis conducted using imagej software (fig . 1c). The gapdh banding pattern (fig . 1b, lower bands) confocal microscopy and the tcactin antibody were used to visualise the cellular distribution of actin in different trypanosomatids, both monoxenic (a. deanei with its bacterial endosymbiont, c. fasciculata, h. samuelpessoai and s. culicis) and heteroxenic (p. serpens). In the tested parasites, this antibody recognised the protein in all of the cells in the population (data not shown). The positive reaction was homogeneously dispersed throughout the cytoplasm of all the cells (fig . The labelling was more intense at the bacterial endosymbionts, which are located at the posterior cell region . 2actin localisation in different trypanosomatids by confocal microscopy by using the trypanosoma cruzi actin gene (tcactin) antibody (actin detection with tcactin mouse polyclonal antibody plus alexa fluor 488-conjugated rabbit anti - mouse immunoglobulin g; note the staining throughout the cell body). A - d: strigomonas culicis; dic: differential interference contrast images of the parasite body; e - h: crithidia fasciculata; i - l: angomonas deanei with symbiont; merge: merged hoechst and actin images; m - p: phytomonas serpens; n / kn: staining of nuclear (n) and kinetoplast (kn) dna with hoechst 33342; q - t: herpetomonas samuelpessoai . Bar = 5 m . In t. cruzi, punctate labelling for tcactin was found throughout the cytoplasm of epimastigotes, metacyclic trypomastigotes and amastigotes . No reaction was observed in microtubule - containing structures such as the flagellum and the plasma membrane (fig . Positive reactions were occasionally found in elongated structures that may represent the cytostome / cytopharynx (fig . 3actin localisation in trypanosoma cruzi by using the t. cruzi actin gene (tcactin) antibody (actin detection with tcactin mouse polyclonal antibody plus alexa fluor 488-conjugated rabbit anti - mouse immunoglobulin g). A - c: epimastigote form (note the positive labelling at an elongated structure that may represent the cytopharynx); d - f: amastigote form; g - i: trypomastigote form; n / kn: staining of nuclear (n) and kinetoplast (kn) dna with hoechst 33342; merge: merged hoechst and actin images . In the present study, a mouse tcactin polyclonal antibody was cross - reacted with different trypanosomatids, including some monoxenic species found in insects (a. deanei, c. fasciculata, h. samuelpessoai and s. culicis) as well as a plant species (p. serpens). Both the presence of actin genes and the expression of the encoded protein have previously been demonstrated in some pathogenic heteroxenic trypanosomatids, such as t. brucei (garca - salcedo et al . 2004), t. evansi (li et al . 2009), t. cruzi (de souza et al . 1983, mortara 1989, melo et al . The cross - reaction of our tcactin polyclonal antibody with t. brucei procyclic forms and l. major promastigotes, both of which are parasites known to express actin (garca - salcedo et al . These data indicate that actin is present and conserved throughout the trypanosomatidae family . In a previous work, an antiserum raised against the entire actin from t. cruzi recognised a single band in one - dimensional electrophoresis . However, five actin isoforms were identified by this antiserum in two - dimensional electrophoresis (cevallos et al . Therefore, it seems plausible that our polyclonal antibody (produced against the entire actin sequence) also recognised multiple actin isoforms within a single band generated by one - dimensional electrophoresis . The presence of two reacting bands in the p. serpens lysate suggests that this parasite possesses actin isoforms of different sizes . In a previous study, an anti- leishmania actin antibody was cross - reacted with cell lysates of various leishmania species as well as of t. cruzi . However, that antibody failed to recognise the actin bands in the whole - cell lysates of plasmodium falciparum, saccharomyces cerevisiae, bhk21 cells and human erythrocytes, indicating that the actin of trypanosomatids is divergent from that of other eukaryotic cells (sahasrabuddhe et al . Accordingly, a rabbit anti - human -actin polyclonal antibody readily recognised the actin band in whole - cell lysates of p. falciparum, s. cerevisiae, bhk21 cells and human erythrocytes, but did not cross - react with leishmania or trypanosoma actin (sahasrabuddhe et al . 2004). A polyclonal antibody against a conserved c - terminal peptide of rabbit actin only poorly recognised t. cruzi actin . However, an antibody against t. cruzi actin was not species - specific, as proteins of a similar size were also detected in lysates from l. mexicana procyclics, toxoplasma gondii sporozoites and trichomonas vaginalis trophozoites (cevallos et al . 2010). The homology levels of t. cruzi actin compared with the eukaryotic actins of l. major, t. brucei, p. falciparum, dictyostelium discoideum and homo sapiens are 95%, 99%, 71%, 69% and 86%, respectively (melo et al . Thus, the properties of trypanosomatid actin differ from those of the yeast, plasmodium and human actins . The major differences were confined to the amino acids located on the surfaces of the yeast and mammalian actins, including amino acid residues 42 - 46, which constitute the major self - association sites for actin filament formation (sahasrabuddhe et al . F - actin has not yet been clearly identified in trypanosomatids, which might be due to filament instability, deficient assembly or accentuated severing, events that are not yet understood (melo et al . 2008). With confocal microscopy, we found positive reactions for actin dispersed throughout the cytoplasm of all the tested trypanosomatids . (sahasrabuddhe et al . 2004), t. cruzi (de souza et al . 1983, mortara 1989, melo et al . 2008, cevallos et al . 2010) and t. brucei (garca - salcedo et al . A previous study described the subcellular localisation of actin in t. cruzi by using an antibody produced against an actin fragment containing the conserved n - terminal region (skklfvgdeaqakr), which is present in all three t. cruzi actin alleles available from genbank (melo et al . This experiment resulted in actin labelling throughout the parasite cell body . In the present work, we have confirmed the cellular localisation of actin in t. cruzi epimastigotes, trypomastigotes and amastigotes by using an antibody produced against the entire actin coding region . Furthermore, our data indicate that actin is expressed at similar levels in these developmental stages . It has previously been shown that actin is equally expressed in different evolutive forms of t. brucei (garca - salcedo et al . Thus, actin can act as an optional normaliser for protein expression studies investigating the t. cruzi differentiation process . This is the first study to describe actin localisation in t. cruzi metacyclic trypomastigotes, as previous works have analysed actin distribution only in cell - derived trypomastigotes (cevallos et al . Although similar in their distribution of cellular organelles, these forms constitute different stages of the parasite . Thus, the linear array of actin granules observed in metacyclic trypomastigotes is interesting and may represent a distinct actin arrangement . An increased signal was detected near the bacterial endosymbionts located at the posterior cell end of a. deanei, suggesting that some type of actin - based cytoskeleton might be related to the symbionts' positioning in this region . It has been previously speculated that such an actin - based cytoskeleton might also be related to anchoring rna granule components in t. cruzi, as granules that remain motionless were associated with actin filaments, whereas those that moved in the cytoplasm remained associated with microtubules (holetz et al . Some studies of trypanosomes showed that actin participates in endocytosis and intracellular transport in these organisms (garca - salcedo et al . Thus, a repression of actin expression by irna in the bloodstream forms of the african trypanosome t. brucei resulted in the cessation of growth, loss of the endocytic activity and termination of vesicular traffic from the flagellar pocket membrane (garca - salcedo et al . Whereas in procyclic forms, actin was uniformly distributed in the cytoplasm, in bloodstream forms, actin was primarily located at the posterior end of the cell, clearly concentrated between the nucleus and the kinetoplast, a site of highly active endocytic activity (garca - salcedo et al . 2004). A proteomic analysis of the american trypanosome t. cruzi indicated the presence of actin in the reservosome, an end organelle of the endocytic pathway (sant'anna et al . Thus far, the only demonstrated functional role of actin in t. cruzi has been related to endocytosis (bogitsh et al . 1995, garca - salcedo et al . 2004). These data reinforce evidence from other eukaryotic cells indicating the importance of an actin cytoskeleton during endocytosis (robertson et al . The possible localisation of actin at the cytostome / cytopharynx of t. cruzi epimastigotes would imply the presence of a contractile cytoskeleton at this region.
Development of methods and the determination of inhaled volumes are important for the protection of wearers from airborne contaminants and assignment of minimal expected respirator protection factors . Respirator protection factors are defined as contaminant concentration outside the facepiece divided by contaminant concentration inside the facepiece . These two concentrations are often measured by nondiscriminating particle counters that require a finite amount of time to reach a valid time - averaged measurement . Although this is a relatively simple measurement to make, it cannot be used accurately for rapidly changing particle counts . Particle count is also dependent upon placement within the facepiece, and sharp spatial discontinuities in contaminant concentrations may exist that lead to erroneous conclusions regarding representative facepiece concentrations . Concentration ratio is only valid as a measure of protection factor as long as there are no particle sources or sinks in the system . It is known that the respiratory system is a source for moisture particles, and these can be counted along with particles of the challenge substance . Deposition of particles within the respiratory system can also occur as air is inhaled, leading to apparent protection factors higher than they ought to be . Respirator protection factors may only be an approximate indication of inspiration of contaminants by the wearer . That is because contaminants penetrating the respirator facepiece may not reach the mouth to be inhaled . A more direct indicator of protection afforded by the respirator is wearer protection factor, which we have defined as the concentration of contaminant inhaled divided by ambient concentration . The difference between this and conventional protection factor use is that contaminants inside the respirator facepiece, but not inhaled, are measured conventionally but not for wearer protection factor . In addition, a tracer gas, such as co2, can be used to determine the eventual outcome of air supplied by a papr blower . This determination we have called blower effectiveness . A blower effectiveness with a value of 1.0 means that all blower air supplied during the inhalation portion of the breathing cycle would contribute to wearer inhaled gas . Some blower air may be lost to the environment directly through the exhalation valve; in this case, blower effectiveness would be calculated as less than 1.0 . A blower effectiveness of less than 1.0 would indicate that some inspired air had to come from the ambient, bypassing the blower through respirator leakage . A blower effectiveness greater than 1.0 indicates that some blower air contributed during the exhalation phase would be inhaled in the subsequent inspiration . An apr, without a blower, should have an equivalent blower effectiveness close to 1.0 . In this study, we investigated measurement of respirator protection factors using a different method of a challenge gas and collection of exhaled breath . It was intended that results from this approach could be a better assessment of protection factors actually experienced by the wearer of the respirator . Because this test used carbon dioxide as the tracer gas, it had to be conducted on a head form, but it did give quantitative assessments of wearer protection factors and blower effectivenesses . The co2 was traceable as originating in the ambient air surrounding the masked head form, and so could help to partition air supplied through the filter from air that bypassed the filter . Respirator leakage was determined by operating the respirator inside a chamber containing co2 as a tracer gas . Air supply to the respirator or papr blower came from the outside atmosphere containing a negligible concentration of the tracer gas . A breathing machine was used to simulate the effect of a human wearer, but exhaled air from the breathing machine was collected in a separate container . The presence of the tracer gas in the exhaled air was quantitative proof of papr inward leakage (figure 1). The chamber of dimensions 137 cm (54 in) by 76 cm (30 in) by 180 cm (71 in) was constructed of plywood and lexan transparent plastic for visibility . The mouth of the head form was connected to a breathing machine (krug life sciences, houston, tex, usa) outside the chamber by means of a 3.8 cm (1.5 in) flexible ventilator hose (a - m systems spiral tubing, carlsborg, wash, usa). Two one - way valves directed inhaled air from the respirator into the breathing machine and exhaled air into a separate container . The valves had been salvaged from u. s. army m17 air - purifying respirators the container to collect exhaled breath was constructed from several 2 l soft drink plastic bottles sealed with black electrical tape . The ability of the tracer gas to diffuse through the walls of the container was not investigated, but the short time between breaths, the type of plastic used for the containers, and the volume inside the container made significant concentration errors unlikely . The test chamber was filled with 6 - 7% co2 from a cylinder, and the gas concentration was monitored continuously with a mass spectrometer (model 1100, perkin - elmer, st . Louis, mo). Because co2 inside the test chamber was continuously being replaced with fresh air passing through the respirator, co2 was added continuously from the gas cylinder to maintain the target co2 concentration . The exhalation gas collection container began with a negligible co2 concentration, which proceeded to climb as exhaled air from more breaths displaced initial air . The air / co2 mixture was sampled continuously by the mass spectrometer and at 50/sec by the data acquisition system . When co2 concentration had reached its final steady - state value, this concentration was used as the value in exhaled air, and, by inference, inhaled air . There was no other place for co2 to go once it was inhaled than into the exhalation collection container . Respirators tested were the racal airmate 3 (racal, frederick, md, usa) loose - fitting papr, breathe easy (3 m, st . Paul, minn, usa) tight - fitting papr, butyl head cover with cape, #522 - 02 - 23 (3 m) loose - fitting hood, centurion max (martindale protection; thetford, norfolk, uk) multipurpose loose - fitting papr with scarfs in place, se 400 (sea, meadowlands, pa, usa) breath - responsive papr, and frm 40 (3 m) air - purifying respirator . Medgraphics (st . Paul, minn, usa) #5038773 pitot tube flowmeters were used to measure blower flow and breathing machine flow . These were carefully calibrated beforehand to ensure that they gave identical measurements for identical flow rates . Flowmeters were adapted to blower inlets for the racal, centurion, and sea devices . Flowmeters were placed in the connecting hose between blower and facepiece for the two 3 m powered devices . Papr blowers were operated with fully charged batteries, and each test lasted approximately 2 min . Hoses were attached to the inlets of each blower so that ambient air could be drawn from outside the chamber . Hose inlets were located about 1 m above the chamber, and excess gas was exhausted from the chamber floor in order not to cycle co2 from the chamber back into the respirator inlets (co2 is denser than air). The breathing machine was set to generate a minute volume of 112 l / min, tidal volume of 2.4 l, and a peak flow of 317 l / min . These settings have been used in this and previous experiments in order to induce respirator leakage if the respirator is going to leak at all . The breathing machine minute volume is nearly the same as most papr blower flow rates, but peak flows are much higher than blower flow rates . Data were collected with an analog - to - digital data acquisition board (national instruments, austin, tex, usa) connected to the universal serial bus (usb) of a pc computer . Custom software developed in labview 7 (national instruments, austin, tex, usa) recorded flow and concentration data, calculated flow differences, and exhaled volumes . The volume of inhaled co2 is the leakage volume times the concentration of co2 in the exhalation collection chamber atmosphere, which also equals the exhaled volume times the exhaled co2 concentration . Thus, leakage volume can be obtained as the exhaled volume times the ratio of co2 concentrations in the exhaled breath and chamber atmosphere . The leftmost column includes values obtained from the readings (v) of flowmeter #2 in figure 1 . Where there is a range of values, the blower flow rate varied throughout the breathing cycle . Inhaled volume (vinh) was obtained by integrating the flow signal (vinh) from flowmeter #1 during the inhalation portion of the breathing cycle . Exhaled volume (vexh) was obtained by integrating the flow signal (vexh) from flowmeter #1 during the exhalation portion of the breathing cycle . Normally, both inhaled volume and exhaled volume would have been expected to agree within the error rate of the measurement and integration process . There is a larger than expected difference of up to 10% between the two volumes, possibly attributed to some cooling of the air as it resided in the breathing machine or compression of the exhaled air as it left the breathing machine . Because of the differences between to two volumes, the appropriate volume was chosen to calculate additional derived values . The co2 ratio in table 1 is the ratio of co2 concentration measured in the captured exhaled air (cco2,exh) divided by the co2 concentration in the ambient air in the chamber surrounding the respirator (cco2,amb). The wearer protection factor was calculated as the inverse of the co2 ratio, (cco2,amb / cco2,exh). Leakage volume (vleak) represents the volume of air that leaked into the respirator facepiece and was subsequently inhaled by the breathing machine . This came from a co2 mass balance on the respirator: (1)amount of co2 inamount of co2 out+co2 generated = amount of co2 stored . The amount of co2 into the respirator was the net leakage volume times the co2 concentration in the ambient air in the chamber surrounding the respirator . Any leakage of air and co2 out of the respirator was already included in the net leakage of air containing co2 into the respirator . There was no co2 generated in this apparatus . The amount of co2 stored was the amount of co2 collected in the container positioned to accumulate exhaled air and equaled the exhaled volume times the co2 concentration in the collected exhaled volume . Thus, (1) became (2)vleak(cco2,amb)+0 + 0=vexh(cco2,exh),vleak = vexh(cco2,exhcco2,amb). The blower contribution to the inhaled volume was calculated from (3)vbl, inh = vinh[1cco2,inhcco2,amb]. This equation indicates that the blower air volume contribution (vbl, inh) to total inhaled volume (vinh) is the proportion of air not identified as leakage (1 cco2,inh / cco2,amb). The total volume of filtered air passing through the blower during the time for inhalation, labeled total blower volume (vbl, tot) in table 1, can be obtained from blower flow rate (vbl) measured by flowmeter #2 in figure 1, integrated over the total inhalation time (tinh). Blower effectiveness is the ratio of the blower contribution to inhaled air (vbl, inh) to total blower volume (vbl, tot) during the inhalation portion of the breathing cycle (4)eff = vbl, inhvbl, tot . In figure 2 are shown breathing machine flow rate, blower flow rate, and inhaled leakage volumes (labeled inhaled contaminant volumes) for the racal airmate 3 loose - fitting papr . This figure is intended to show that blower flow rate for this respirator is almost constant, and that inhaled contaminant volume (integrated breathing machine flow rate times co2 concentration in the captured exhaled breath) is slightly more than 2 l for a breathing machine tidal volume of 2.4 l. figure 3 is similar to figure 2 but shows that blower flow rate for the 3 m breathe easy tight - fitting papr varies throughout the inhalation phase of breathing . Figure 4 illustrates responses by the se 400 breath - responsive tight - fitting papr . Blower flow rate tracks breathing machine flow rate in an attempt to maintain positive pressure inside the facepiece . Again, inhaled volume of contaminants is zero . It has been seen previously in our lab that papr blower flow rates vary during the breathing cycle, and this is also reflected in the entries for blower flow rates . Exhaled tidal volumes were nearly constant at 2.32 to 2.42 l. the ratio of co2 concentrations in the exhaled breath and enclosing chamber is also shown . The inverses of these figures are the measured protection factors for each of the respirators as worn and used . In the column labeled leakage volume are found volumes of inhaled contaminant - laden air, obtained by multiplying the concentration ratios by exhaled volumes . These figures also represent nominal leakage volumes for the respirators . Despite advances in filter technology, contaminant levels inside respirators can still become unacceptably high if the respirators can leak ambient air through alternate pathways . In fact, weak links in wearer protection are the facial fit and the exhalation valve . The figure of merit for respiratory protection has been the protection factor (pf) defined as the concentration of contaminant outside the respirator divided by the concentration inside the respirator . In this study, we used an alternative means to measure protection factor as it is related to respirator leakage . If the respirator was operated in an atmosphere containing a tracer gas, but the supply of air to the respirator through the filter circuit was free of tracer gas, then the only means for the gas to enter the facepiece and be inhaled was if the gas leaked inward from some path different from the filter circuit . If this test was conducted with a breathing machine, then the tracer gas would neither be deposited nor absorbed in the machine . The average concentration of the gas in the collected exhaled breath should then be equal to the average concentration as presented to the mouth inside the facepiece, thus averaging regions of high and low concentrations due to preferred contaminant flow pathways . The ratio of tracer gas concentration in the collected exhaled breath to the gas concentration in the surrounding atmosphere should then be the inverse of pf, at least from the wearer's standpoint . It can be noted that, although the racal airmate 3 blower flow rate was higher than the centurion max blower flow rate, contaminant exposure with the racal is much higher and protection factor is much lower . With a protection factor nearly equal to 1.0, the racal loose - fitting papr gives almost no protection against airborne contamination; concentration of contaminant inside the respirator shield is nearly the same as outside the shield . The centurion max loose - fitting respirator gives somewhat better protection, but still not enough to be very effective . The se 400 breath - responsive respirator attempts to maintain positive pressure inside the facepiece . The se 400 blower flow can be seen to exceed the peak flow of 317 l / min produced by the breathing machine . When the blower was turned off, flow through the blower was much lower, and the respirator operated as an air - purifying respirator (apr). The frm 40 apr has a similar flow rate through its filter, but a somewhat lower protection factor . These were the 3 m hood, 3 m papr, and se 400 papr . In very demanding environments, these respirators would afford the best protection . Even if the power fails on the se 400, the 3 m hood was, in effect, a loose - fitting respirator, yet had enough dead volume within its enclosure that contaminants did not reach the mouth . Results from this study are not totally in agreement with some of the assigned protection factors published by osha . Our results for the frm 40 give a protection factor of 17, and for the unpowered se 400 a value of 20 . The osha value for full - face piece tight - fitting papr is 1000; our results for the 3 m papr and powered se 400 are extremely high, infinite in our tests . The osha value for the loose - fitting papr is 25; we obtained values of 1.1 for the racal, 4 for the centurion, and infinity for the 3 m hood . First is that contaminant concentration inside the respirator can be nonuniform, and, thus, the measurement can be dependent upon location . Recent studies on flow visualization inside respirator facepieces have shown that flow pathways can twist and curl, with clear delineation between contaminant - filled air and clean air over very short distances . Placing a contaminant - detection probe in a stagnant zone could yield measurements that probably underestimate contaminant concentration . Placing the probe in the flow pathway, where contaminant concentration might be particularly high, could overestimate average concentration in the facepiece . Present practice is to place the probe in front of the mouth; this somewhat corrects the placement problem, because this is the place where inhaled air is to be drawn but still does not solve the problem of time variation in contaminant levels at the place where they are likely to be inhaled . The second difficulty with pf is that some contaminants can deposit or be absorbed in the respiratory system, thus making the respiratory airways into a contaminant filter . Thus, it may not be surprising that results obtained in this study did not match those obtained with other methods . Dead volume within a respirator facepiece is often thought to be detrimental because it accumulates exhaled co2 and recycles it into the next inhaled breath and limiting physical work performance . Dead volume inside the facepiece, however, can be helpful if it acts as a buffer against leaked contaminants reaching the mouth . Dead volume can be protective especially if air during the exhalation phase of breathing purges the enclosed air of contaminants leaked during inhalation . This can happen with papr blowers, for instance, when they supply filtered air even during exhalation . Protective dead volumes of some of these respirators had previously been measured . For the centurion max, that value was about 1.4 l, and for the racal airmate, it was close to zero . Dead volume of the frm 40 is about 1.0 l, and the other two tight - fitting facepieces were presumed to have about the same amount . The protective dead volume of the 3 m hood was measured on a mannequin by connecting the inlet port at the mannequin mouth to a vacuum hose and the inlet hose from the blower was closed off . Mouth flow was recorded for the length of time for the fog to reach the mouth . As expected, fog entered the facepiece from below the ear and chin along the neck . The total volume of air inhaled before the fog reached the mouth was 2 l. how large should protective dead volume be? It could be made large enough so that no contaminated air would reach the mouth even under extreme circumstances . Inhaled tidal volumes during physical exertion are normally in the 1.5 l range, sometimes reach 2.0 l, and only rarely exceed 2.5 l. protective dead volumes greater than 2.53.0 l should then be at least as effective as continuous positive pressure in the face piece in providing wearer protection, as long as the blower can purge the dead volume during the exhalation phase of the breathing cycle . Dead volumes larger than 2.53.0 l require larger blower flow rates and may be unnecessary and undesirable . Comparing results from this and other recent fog flow visualization studies shows that protective respirator dead volume measurements are generally in agreement no matter what procedure is used . Using flow visualization with a breathing machine gave an inhaled volume before fog reached the mouth of about 1.4 l for the centurion max papr . Flow visualization with human subject breathing gave 1.1 l before fog reached the mouth for the same respirator . It is known that peak respiratory flows can often exceed blower flows [2, 49]. There has also been concern expressed when the pressure inside a respirator facepiece intended to be positive pressure that becomes negative momentarily . As long as positive pressure is maintained, it is asserted, any leakage would flow from inside the facepiece to the outside, and contaminated air would not enter the facepiece . If papr blowers and batteries were made powerful enough to perform up to peak flow levels, bulk of the devices would probably increase greatly, and the extra weight could reduce work performance . An alternate strategy, one that has just recently been realized, is to ensure a large enough protective dead volume that any contaminants entering the facepiece do not reach the mouth . Without accounting for exhalation air coming from the mouth, blower flow rate does not need to be any larger than that required to purge the dead volume of contaminants during the exhalation phase, so long as the distribution of blower air is wide enough to sweep the entire dead volume . Taking exhaled air into account reduces required blower flow rate even further, at least as far as contaminants are concerned . The net result is that peak inhalation flow rates do not have to be met by the blower as long as stored clean air is available inside the facepiece . Nevertheless, results in this and other recent experiments have shown that it is not necessary to maintain positive pressure inside the facepiece at all times just as long as contaminated (leakage) air never reaches the mouth . The blower must be able to remove contaminated air from the protective dead volume before the next negative pressure incident . Many of the newer hood - type loose - fitting respirators use the protective dead volume principle, and so can be considered at least as protective as aprs and tight - fitting paprs . They have the advantage over aprs in that there is no high resistance to breathe through but have the disadvantage compared to tight - fitting paprs that, should the blower be inoperable, there is no contaminant protection afforded . The tracer gas used in this study was co2, and we did not allow co2 to challenge the filter; each filter inlet was supplied by clean air . Hence, perfect filter efficiency was assumed, and we were mainly interested in respirator leakage . If a different gas was used, one that the filter should remove, then the inlet to the filter could be in contact with the same atmosphere that surrounds the respirator under test . Clayton et al . Calculated respirator protection factors for human wearers while they simulated asbestos removal operations . They used a method similar to that used in the present study, except that their subjects worked in a chamber containing a small concentration of sodium hexafluoride instead of carbon dioxide . They also continuously measured sf6 concentrations inside and outside the respirator, and thus, could measure protection factors as they varied throughout the breathing cycle . In the present study, we were more interested in knowing how much of the contaminated air was actually inhaled, so inhaled contamination (co2) was collected when it was expelled from the breathing machine . Obviously, co2 could not be used as a test gas with human test subjects; sf6 or ch4 might be a better choice . However, collecting exhaled gas and determining contaminant levels there rather than monitoring contaminant levels inside the respirator facepiece give the actual protection factor experienced by the wearer as compared to the respirator protection factor (insofar as there is no gas absorbed in the respiratory system). The average concentration of tracer gas in the exhaled breath would not be expected to equal the average concentration inside the facepiece . Rather, the average exhaled - breath concentration reflects the concentration of contaminant actually inspired . This means that regions of high flow leading to the mouth are weighted substantially more than regions of nearly - stagnant flow . In this respect, measurement of exhaled - breath concentration is an honest measure of the exposure of the wearer . One reason for this, of course, is that some facial configurations result in large leaks, and thus, lower protection factors . However, results from this study indicate another possible cause, and that is flow pathway of contaminated air . Different facial configurations could channel leakage flows differently in different people . Depending on the exact position of the particle counter used in those studies [1315], the counter could register higher average values or lower average values when contaminants were drawn into the respirator facepiece . Although several of these studies were conducted with half facepiece or filtering facepiece respirators [1317], there is no reason to suspect that preferential flow pathways discovered in studies with loose - fitting paprs or tight - fitting aprs are not also present in other types of respirators . Facial configuration, especially nose protrusion, could easily affect leakage flow pathway to the mouth . Calculation of net overbreathed volume as the integral of the difference between mouth flow and blower flow depends on the assumption that all the blower flow is captured within the facepiece . Likewise, the statement made earlier that the blower needed to supply a flow rate no larger than the facepiece dead volume divided by the exhalation time is contingent upon no blower flow escaping the face piece before it sweeps the facepiece . It is likely that some blower flow escapes directly to the outside, either through leaks or through the exhalation valve . This represents inefficient use of blower capacity . At present, there are no known published measurements of ineffectual blower flow, but these measurements are able to be made with the same method as used in this experiment . If contaminated air can leak from outside the facepiece into the inhaled breath, then blower air can flow directly out of the facepiece without contributing to clean air in the protective dead volume . This indicates that most of the air propelled by the blower does not contribute to the volume of air inhaled and is consistent with other data relating to protection factor in this study and previous studies . The 3 m breathe easy tight - fitting papr has a blower effectiveness of about 1.0, which indicates that nearly all of the blower flow contributes to inhalation . The same is true for the se 400 with blower turned off and frm 40 apr; nearly all the air flowing through the blower or filter pathway contributes to inhaled air . When the se 400 blower was turned on, positive pressure is maintained in the facepiece at least most of the time, and some of the blower air leaks out, probably through the exhalation valve . Blower effectivenesses for both the centurion max and 3 m hood were greater than 1.0 . In both of these cases, there apparently was enough protective dead volume that air supplied by the blowers during the exhalation phase of breathing contributed to inhaled volume . In these two cases, blowers conform to the recommendation we made that the blower need not supply all inhaled air volume but it does need to purge dead volume air during the exhalation interval . Thus, the blower can contribute to inhaled air volume even during exhalation, although data in table 1 indicates that not all contaminant is evacuated . The flow situation inside the respirator face piece is complex, involving air leaking in as well as out simultaneously . Breathing is periodic and not steady, and flow pathways inside the face piece most likely change between inhalation and exhalation, and probably over time within breathing phase as well . If significant physical movement accompanies work performance, then the respirator can shift on the face, or in the case of the hood, the volume of air inside the hood covering the torso can change greatly . Under extremely difficult breathing conditions, the facepiece itself can deform, which changes the boundary of the flow domain . At this point, successful determination of flow dynamics within a respirator has not been accomplished, to our knowledge . These results demonstrated that there was a large range of wearer protection factors among different types of respirators . Some of the respirators tested provided little to no protection to the wearer, whereas others provided extremely high amounts of protection . The results also showed that blowers have multiple contributions to papr performance, including providing inhalation air, cleaning contaminant from the respirator facepiece, and perhaps adding to papr leakage . The concept of blower effectiveness was introduced as a way to rate the ability of the blower to supply clean inhalation air to the wearer.
Alternative splicing (as) is increasingly emerging as a major mechanism in the expansion of transcript and protein complexity in eukaryotes . Indeed, recent experimental studies directed towards the characterization of human and mouse transcriptomes have revealed that as is a widespread phenomenon affecting> 60% (a constantly increasing estimate) of human genes (1). These discoveries imply that current microarray- or sage - based methods are not fully adequate for determining the cell specific expression profile of genes, since they do not take into account all of the possible alternative transcripts and thus can only provide a partial and incomplete estimate of the actual expression level of given gene isoform . Equally important, transcripts generated by as may differ both in the untranslated region (utr) and in coding regions (cds). It is also possible that certain transcribed isoforms may completely lack coding capacity but be involved in regulatory activities (2). A profound appreciation of the impact of as at the level of protein structure and protein interactions also represents a challenge in the understanding of the functional impact of as in cell metabolism . Recent descriptions of the functional implications of as in tissue - specificity (3), different biological processes (4) and tumor development (5) has generated an explosion of interest and activity in this field particularly with respect to the development of suitable computational methods for as prediction . Such methods are generally based on large - scale comparisons of transcript [mostly expressed sequence tags (ests)] and genomic sequences . A number of as databases, such as asd (6), asap (7) and ecgene (8), have been developed but these are often limited to a limited number of organisms, particularly human and mouse . Computational methods for as prediction can be subdivided into three groups: methods based on the comparison of expressed sequences to each other (9); methods based on the progressive alignment of expressed sequences to the genomic sequence (10); and methods that combine the previous two approaches thus avoiding their specific limitations (11,12). We have developed a new method for the prediction of splice sites and transcript isoforms . Our approach adopts an optimization procedure that considers multiple alignments of ests to the genomic sequence, minimizing the number of splice site predictions and of transcript isoforms . This method, implemented in the aspic software, has been shown to outperform other similar tools both in term of sensitivity and selectivity (11). In this manuscript we present the aspic web resource that allows the user to determine the splicing pattern of a user submitted gene and the relevant transcript and protein products . Input data can be retrieved from the ensembl and unigene databases to which the web resource is dynamically interconnected or directly provided by the user . Aspic adopts an optimization procedure that minimizes the set of splice sites compatible with the multiple alignments of all transcript data against the genomic sequence (11). This approach overcomes the limitations of methods that (erroneously) assume independence of single transcript - genome alignments . The alignment between genome and the transcript sequences is carried out by a specifically designed aligner that produces a factorization of all expressed sequences into high - quality alignments to the genomic sequence (exons or factors) and then finds the solution that minimizes the corresponding factors in the genomic sequence . As the occurrence of repeated sequences in the genomic sequences may induce an over - factorization a backtracking procedure is carried out for concatenating wrongly split exons . A maximum parsimony criterion is also used for the final assessment of intron exon boundaries whereby computed est factors (candidate exons) are merged whenever they differ at only a few positions likely because of sequencing errors . Furthermore, aspic implements specific algorithmic strategies to improve the quality of splice locations . More precisely, it applies an algorithm based on dynamic programming (dp), producing for regions close to splice sites, an alignment between the ests and the genomic sequence with a large gap of cost zero (the intron) and the minimum number of mismatches and insertions / deletions . Alternative alignments of the same quality (identity%) are differentially weighted by the dp procedure according to a scoring system using position frequency matrices of donor and acceptor splice sites (13). Following the determination of est factors and their corresponding genomic factors, the transview module of aspic generates the minimum set of non - mergeable transcripts supported by experimental evidence (provided by the previously determined genome - transcripts alignments). Briefly, the algorithm builds an assembly graph of est factorizations constructed by representing partial order relationships among spliced ests . More precisely, nodes of the graphs are spliced ests which are connected by edges if they overlap, i.e. They share at least one splice site ., an and t2 = b1, b2,, bm, then t2 overlaps t1, iff b1 is a suffix of aj for some 1 j n, bk is equal to aj+k1 for k = 2 n j, an is a prefix of bnj+1, n j + 1 m and an is not a terminal exon [i.e. Does not present a poly(a) tail]. The transview algorithm then generates the alternative full - length transcripts by exploring all distinct plausible and non - redundant paths of the assembly graph . To increase the accuracy of transcript assembly, only spliced ests with high - quality splice sites (i.e. Supported by more than two ests or showing perfect identity with the genomic sequence and canonical splices) are included in the graph . Cdna / est sequences with poly(a) tails are used to infer poly(a) cleavage sites (cs) in the assembled transcripts . (14) requiring at least eight or more consecutive as after the predicted cs at the 3 end of the transcript . To exclude internal priming artifacts the genomic sequence from 10 to + 10 with respect to the predicted cs should not contain more than six continuous as or more than seven as in a 10 nt window . Poly(a) css located within a 24 nt window are considered to be generated from heterogeneous cleavage of mrna and clustered together . To further support the occurrence of a poly(a) site the occurrence of a canonical polyadenylation site (aauaaa or auuaaa) the aspic input consists of the genomic sequence corresponding to a specific gene (and possibly some flanking sequences) and a collection of related transcribed sequences . The web interface allows the user to paste or upload both the genomic and transcript sequences, or more conveniently may automatically get all the relevant sequences (once the organism and the gene under investigation have been defined) from ensembl and unigene databases . Genomic sequences can be automatically retrieved by providing chromosomal ranges, or typing the ensembl gene i d (hugo i d is also allowed for human genes), if a gene i d is provided the transcribed sequences collected in the corresponding unigene cluster are automatically extracted . In addition to the unigene sequences, the user can input additional transcribed sequences by the paste and/or upload facility . Aspic outputs provide both graphical and tabular views of the splicing patterns of the gene under investigation . The nucleotide sequences of the inferred full - length isoforms as well as their structural and functional annotation are also produced . Two graphical views are generated: (i) the gene view and (ii) the transcript view . The gene view (figure 1a) shows a full snapshot of the splicing pattern of a gene showing all detected exons and introns . Intron scheme of the assembled full - length transcripts, where the 5-utr, cds, 3-utr and poly(a) site are annotated . Two tabular views are generated: (i) the intron table and (ii) the transcript table . The intron table (figure 2) reports the relative and absolute coordinates of each detected intron as well as the number of supporting ests and the alignment quality near to the intron boundaries . The transcript table (figure 3) shows the general structural features of all alternative full - length transcripts such as the length, the number of exons, the putative location of the cds, the length of the putative encoded protein and the transcript variant type . The variant type column reports for each full - length transcript the type of splicing event (e.g. Alternative 5 or 3 end, exon skipping), the affected exon or intron as well as its location in the coding and/or utrs of the transcript . Splicing variants are labeled in comparison with a reference transcript given by the longest inferred transcript containing a cds corresponding to the one annotated in the ccds database () for human or by the longest transcript with the longest open reading frame (orf) in other species . The cds in alternative full - length transcripts not containing the ccds start and stop codons is determined as the longest orf if longer than 100 codons . Finally, a full textual output of aspic analysis can be downloaded whereby exon, intron and transcript coordinates and sequences can be downloaded in gtf format . Php scripts () have been developed for job submission; they launch a java background program (that manages the whole run) and eventually plot dynamic web results . The architecture of the software system can be divided into two main parts: a pre - processing phase where the java program queries two web services (ws) built on simple object access protocol open standard and a core processing phase where c programs run to detect splicing sites . The two wss are called depending on input parameter selection: geneinfo () accepts a gene identifier, gives information on all the other available identifiers (hugo name, alias, ensembl, unigene) and downloads the ests cluster;ensjws () uses the ensembl java api to download the genomic sequence; it accepts an organism and a gene identifier or a chromosomal range, and returns the genomic sequence . Geneinfo () accepts a gene identifier, gives information on all the other available identifiers (hugo name, alias, ensembl, unigene) and downloads the ests cluster; ensjws () uses the ensembl java api to download the genomic sequence; it accepts an organism and a gene identifier or a chromosomal range, and returns the genomic sequence . A php part of the web interface related to the pre - processing phase has been developed with a service - oriented approach to enable users to download a huge amount of genomic sequence and related transcripts . The aspic web tool has been implemented on a 4-processor server (hp dl585). The web tool accessible at is implemented on a linux server (suse sless 9) running the apache web server version 2.0 (). The aspic input consists of the genomic sequence corresponding to a specific gene (and possibly some flanking sequences) and a collection of related transcribed sequences . The web interface allows the user to paste or upload both the genomic and transcript sequences, or more conveniently may automatically get all the relevant sequences (once the organism and the gene under investigation have been defined) from ensembl and unigene databases . Genomic sequences can be automatically retrieved by providing chromosomal ranges, or typing the ensembl gene i d (hugo i d is also allowed for human genes), if a gene i d is provided the transcribed sequences collected in the corresponding unigene cluster are automatically extracted . In addition to the unigene sequences, the user can input additional transcribed sequences by the paste and/or upload facility . Aspic outputs provide both graphical and tabular views of the splicing patterns of the gene under investigation . The nucleotide sequences of the inferred full - length isoforms as well as their structural and functional annotation are also produced . Two graphical views are generated: (i) the gene view and (ii) the transcript view . The gene view (figure 1a) shows a full snapshot of the splicing pattern of a gene showing all detected exons and introns . The transcript view (figure 1b) shows the overall exon intron scheme of the assembled full - length transcripts, where the 5-utr, cds, 3-utr and poly(a) site are annotated . Two tabular views are generated: (i) the intron table and (ii) the transcript table . The intron table (figure 2) reports the relative and absolute coordinates of each detected intron as well as the number of supporting ests and the alignment quality near to the intron boundaries . The transcript table (figure 3) shows the general structural features of all alternative full - length transcripts such as the length, the number of exons, the putative location of the cds, the length of the putative encoded protein and the transcript variant type . The variant type column reports for each full - length transcript the type of splicing event (e.g. Alternative 5 or 3 end, exon skipping), the affected exon or intron as well as its location in the coding and/or utrs of the transcript . Splicing variants are labeled in comparison with a reference transcript given by the longest inferred transcript containing a cds corresponding to the one annotated in the ccds database () for human or by the longest transcript with the longest open reading frame (orf) in other species . The cds in alternative full - length transcripts not containing the ccds start and stop codons is determined as the longest orf if longer than 100 codons . Finally, a full textual output of aspic analysis can be downloaded whereby exon, intron and transcript coordinates and sequences can be downloaded in gtf format . Php scripts () have been developed for job submission; they launch a java background program (that manages the whole run) and eventually plot dynamic web results . The architecture of the software system can be divided into two main parts: a pre - processing phase where the java program queries two web services (ws) built on simple object access protocol open standard and a core processing phase where c programs run to detect splicing sites . The two wss are called depending on input parameter selection: geneinfo () accepts a gene identifier, gives information on all the other available identifiers (hugo name, alias, ensembl, unigene) and downloads the ests cluster;ensjws () uses the ensembl java api to download the genomic sequence; it accepts an organism and a gene identifier or a chromosomal range, and returns the genomic sequence . Geneinfo () accepts a gene identifier, gives information on all the other available identifiers (hugo name, alias, ensembl, unigene) and downloads the ests cluster; ensjws () uses the ensembl java api to download the genomic sequence; it accepts an organism and a gene identifier or a chromosomal range, and returns the genomic sequence . A php part of the web interface related to the pre - processing phase has been developed with a service - oriented approach to enable users to download a huge amount of genomic sequence and related transcripts . The aspic web tool has been implemented on a 4-processor server (hp dl585). The web tool accessible at is implemented on a linux server (suse sless 9) running the apache web server version 2.0 (). As has been shown to be a key mechanism for the optimization of the information encoded by a single gene . A single gene may generate a large number of different transcripts and proteins through a combinatorial assortment of alternative exons and introns . Thus, many transcripts differing in 5- and 3-utrs and in the coding region may be generated from a single gene . Such transcripts may be subjected to different posttranscriptional regulatory pathways and may encode several proteins with different functional and structural features such as stability, intracellular localization or binding properties (4). Consequently, as offers an exceptionally versatile way to fine tune gene expression according to the specific cell type and physiological status . The aspic web resource provides biologists with a powerful tool for detecting the transcriptional profile of a specific gene using all the currently available genome and transcript data from a variety of species . Results thus obtained may contribute many new functional insights into known and novel genes and may suitably direct or focus further experimental studies . (a) snapshot of the gene view for the human hnrpr gene showing the gene structure and detected introns numbered progressively . (b) sample transcript view showing the inferred structure of assembled alternative transcripts starting from the reference transcript and reporting the annotation of the 5-utr, cds, 3-utr and poly(a) tail . Sample intron table for the human hnrpr gene showing the relative and absolute coordinates of each detected intron, their lengths, the number of supporting ests, the donor and acceptor sites and the alignment quality (overall mismatch percentage) near to intron boundaries . Transcript table for the first 10 alternative transcripts of the human hnrpr gene, showing: the transcript i d, number of exons, length, cds annotation, occurrence of the ccds start / stop, inferred protein length and variant type . The variant type provides information on the type of splicing events and their gene (e, exon; i, intron) and mrna locations (5utr, cds or 3utr).
Detecting primary crc and crlm at an early stage results in better outcomes . At a molecular level, crc consists of a heterogeneous group of diseases with molecularly, as well as clinically, distinct tumors based on the primary site of origin (eg, colon vs rectal, and right - sided vs left - sided). Chromosomal instability, deficient mismatch repair (dmmr) with resultant microsatellite instability (msi), aberrant dna methylation, as well as altered molecular signaling pathways all have been described in the transformation from normal mucosa to adenocarcinoma.12, 13, 14, 15, 16 the role of biologics in the adjuvant treatment of resected primary crc has been evaluated, including cetuximab for kirsten rat sarcoma viral oncogene (kras) wild - type cancers and the vascular endothelial growth factor inhibitor bevacizumab; however, these targeted treatments have not shown the benefit seen in the metastatic or advanced setting.17, 18, 19 more recently, those altered pathways and mutations have been used for therapy modification and patient stratification in metastatic crc based on the sidedness of the primary tumor, supporting the use of different biologic agents for distinct primary biology underlying the disease.17, 18, 19 chromosomal anomalies with demonstrated importance in tumorigenesis, including dna gains or losses, result in changes in gene expressions that might lead to a differential response to chemotherapeutic agents . This recently was studied in an analysis of cell - free dna (cfdna) showing acquired resistance to anti epidermal growth factor (egfr) therapies, as well as recent investigations reporting a correlation between dna copy number losses and an association with response to fluorouracil (5-fu), irinotecan, and capecitabine . Given the extensive molecular and clinical heterogeneity of crc, it is essential to individualize therapy on the basis of molecular profiling to avoid treatment - related toxicities without a realized survival benefit . Some of the strongest data to support the need for identification of high - risk cohorts among patients with crlm come from adjuvant trials for primary crc . The 2004 adjuvant the multicenter international study of oxaliplatin/5-fluorouracil / leucovorin in the adjuvant treatment of colon cancer (mosaic) trial assessed the impact of an oxaliplatin - containing systemic regimen (folinic acid, 5-fu, and oxaliplatin) for patients with resected primary crc compared with 5-fu alone in patients with stage ii and iii disease . A significant survival benefit for patients with stage iii disease was found and has been maintained in recently updated 10-year results . However, these benefits come with significant morbidity impacting patient quality of life . For patients with stage iii crc treated with folinic acid, 5-fu, and oxaliplatin, instead of 5-fu and leucovorin (lv), there is a consequent 4% decrease in mortality . However, to achieve this 4% reduction in mortality with oxaliplatin, 92% of those patients will suffer from treatment - associated peripheral neuropathy, with approximately 15% experiencing permanent neuropathy when followed up longitudinally for 2 years . It is clear that even among patients with stage iii disease there is an underappreciated disease heterogeneity that at present is being treated with an often - homogenous systemic approach . These data in the primary crc setting underscore the need for molecularly driven systemic treatment to avoid both the financial and quality - of - life costs to patients with liver - only metastatic crc . Work is ongoing to identify molecular subsets of patients with crlm to personalize targeted treatments to maximize therapeutic interventions . In this review, we describe the role of liquid biopsies (ie, analyses of tumor cells or tumor derived material that is circulating in the blood) along with novel cancer and immunologic cell populations to both surveil and assess treatment response in patients with crlm . We also propose using this information to guide the design and development of therapeutic strategies for liver - directed treatments . For patients with liver - only metastatic crc, there is a pressing need for a more robust molecular characterization of the primary and metastatic lesions to direct perioperative management of patients at highest risk for disease recurrence . In the primary disease setting, the focus has been directed toward patients with high - risk stage ii crc those patients with negative lymph nodes but other high - risk features such as t4 lesions, obstruction or perforation, cancers with lymphovascular invasion, and poorly differentiated histology . One of the early investigations on the impact of adjuvant treatment on stage ii crc was the 2007 quick and simple and reliable (quasar) trial, in which patients with stage ii crc were randomized to treatment with adjuvant 5-fu / lv or observation after curative resection of their primary cancer . The results of this trial showed an approximate 3% improvement in outcome when 5-fu / lv was given in the adjuvant setting . In other words, 97% of patients were exposed to chemotherapy without any benefit . Because standard stage ii patients do not benefit from adjuvant therapy as shown in the quasar, mosaic, and other trials, it is currently at the discretion of the treating clinician to decide if the high - risk features of the patient s primary crc support adjuvant treatment.22, 23, 26 according to the current national comprehensive cancer network guidelines the definition of high - risk stage ii colon cancer is clearly inadequate, because many patients with high - risk features do not have a recurrence whereas some patients deemed to be average - risk do . Furthermore, no data point to features that are predictive of benefit from adjuvant chemotherapy, and no data correlate risk features and selection of chemotherapy in patients with high - risk stage ii disease . The challenges of selecting patients with high - risk stage ii crc are remarkably similar to and parallel the issues of directing perioperative treatment in patients with crlm . Aside from the pathologic risk factors of stage ii crc, several investigators have sought a correlation between discrete gene signatures and higher - risk patient populations to stratify patients molecularly and to better direct adjuvant therapy . Efforts to improve patient stratification have been ongoing through comprehensive molecular characterization of hypermutated genes, microsatellite instability, and hypermethylated genes to characterize colon cancer stages into subtypes to better predict outcomes as well as to further refine chemotherapy selection.28, 29, 30 rodriguez et al reported that loss of corticotropin - releasing hormone receptor-2 expression in crc specimens a well - characterized neuropeptide that participates in the regulation of intestinal inflammation based on clinicopathologic data they were able to show that a decreased expression of corticotropin - releasing hormone receptor-2 in patients with crc was associated with an increased risk of distant metastasis and a worse 5-year survival after initiation of treatment . In 2016, dalerba et al reported on the expression of the caudal - type homeobox transcription factor 2 (cdx2), a critical regulator of intestinal development and oncogenesis, as a prognostic biomarker in patients with stage ii crc . Their work combined insights from basic science discoveries in normal colon stem cells and cancer stem cells, the availability of public databases of sequenced tumors (national center for biotechnology information gene expression omnibus and national cancer institute cancer diagnosis program), and the power of bioinformatics to query more than 2329 human samples . They identified 16 genes that were not present in colorectal epithelia that expressed high levels of the cancer stem cell marker, activated leukocyte cell adhesion molecule (alcam or cd166). Of these genes, they focused on cdx2, a protein already identified for pathologic assessments of resected crc specimens . In a discovery data set of patients with stage ii crc and a subsequent validation data set, the investigators went on to show that patients with cdx2-negative tumors had a worse 5-year disease - free survival (dfs) compared with patients with cdx2-positive cancers (49% among 15 patients with cdx2-negative tumors vs 87% among 191 patients with cdx2-positive tumors; p = .003). Furthermore, using a discovery data set of stage iii crc tumors, investigators identified an association of cdx2 expression and the treatment of adjuvant therapy with survival . Again, these findings were validated in a larger data set, in which the investigators found an increased 5-year dfs in patients treated with adjuvant chemotherapy in stage ii cdx2-negative tumors vs individuals who did not undergo adjuvant chemotherapy (91% vs 56%; p = .006). Although the study population was small, these data show an identifiable profile in crc patients who may achieve a survival benefit from adjuvant treatment that outweighs the treatment - associated morbidity . This work was updated most recently in the metastatic crc population,33, 34 in which patients with cdx2-negative metastatic crc were found to have a median os of 8 vs 39 months in individuals with cdx2-positive metastatic crc (hazard ratio, 4.04; 95% confidence interval, 2.496.54; p <.0001). Cdx2-negative patients were more likely to have right - sided primary tumors, poorly differentiated cancers, distant lymphatic metastasis, and be women . Although the prevalence of cdx2-negative disease is low, these insights continue to stratify a subgroup of patients with advanced crc who would derive a dfs benefit from adjuvant treatment after curative hepatic resection of their disease . The continued focus to elucidate the underlying biology driving disease recurrence in more diverse and larger subsets of patients will clarify the effective treatment for patients at all stages of disease . The majority of patients who have had an attempted curative hepatic resection of crlm will have recurrence of their disease . Historically, several clinicopathologic factors (nodal status of the primary cancer, preoperative carcinoembryonic antigen [cea] level, size of the largest liver lesion, and the number of hepatic metastases) have been shown to be independent predictors of both poor outcomes and intrahepatic recurrence of disease in patients with resected crlm and collectively comprise the clinical risk score . Similar to the tumor characteristics in patients with clinically high - risk stage ii crc, these factors unfortunately provide a limited description of the disease . In addition to the prediction models, oncologists now are using mutational data in the egfr pathways to select and treat patients who are most likely to respond to a given regimen (kras mutation status predicting poor response to anti - growth factor receptor therapies35, 36) and braf mutation status (conferring resistance to anti - egfr therapy given beyond first - line treatment and associated with an increased risk of peritoneal disease).37, 38, 39, 40 recent work has explored deriving cancer gene expression profiles as prognosticators of recurrence and survival for patients with crlm . Balachandran et al reported a gene - expression classifier to correlate disease - specific survival as well as liver dfs in patients with resected crlm . By using gene expression microarray on resected crlm the investigators were able to identify and validate 20 genes that were associated with os . Importantly, this so - called molecular risk score was shown to be an independent prognosticator of dfs, unlike the traditional clinical risk score . These findings suggest methods for identifying patients with high - risk primary crc and resected crlm who are at risk of recurrence and may benefit from directed and potentially prolonged adjuvant treatment . Further identification of patients with molecular subsets of crlm that underlie discrete tumor biology, and subsequently predict treatment response and improve os, are essential to realize the benefit of perioperative treatment with both biologic and cytotoxic therapy . In patients with crlm who undergo a hepatic resection with curative intent, it is estimated that approximately 75% of all recurrences both intrahepatic and extrahepatic occur within the first 2 years after surgery . Efforts over the past decades have sought to address the risk of recurrence, which is possibly the result of treatment - resistant micrometastatic disease . One avenue to obliterate micrometastatic disease in the liver focuses on maximizing locoregional therapy by exploiting basic tumor biology . Cancer cells from gastrointestinal malignancies, especially crc, hematogenously spread via the portal circulation, often making the liver the first site of metastasis . Once hepatic metastases grow to more than 2 mm in size, they derive their blood supply from the hepatic artery, while normal hepatocytes are perfused mostly from the portal circulation . Understanding this biologic difference has led to treating select patients with crlm using hepatic arterial infusion (hai) therapy . This intense locoregional treatment is based on the extraction of chemotherapy from the hepatic arterial circulation, resulting in high local drug concentrations with the goal of minimizing systemic toxicity . The ideal agent should have a high dose - response curve, high extraction, and rapid total body clearance once the infusion is discontinued . Of the various agents studied, hai - delivered floxuridine approximates this ideal with a short half - life (<10 min) and more than 90% hepatic extraction, resulting in a 16-fold higher concentration in hepatic tumors compared with venous administration.42, 43 by using floxuridine in combination with dexamethasone, patients with crlm can have their liver disease maximally treated with modest side effects compared with standard systemic treatment . Several prospective trials45, 46, 47, 48 have investigated using hai alone to circumvent the toxicity associated with systemic treatment of crlm, to maximize hepatic response in an effort to improve both os and progression - free survival, and potentially improve the patient s quality of life.49, 50 the role of hepatic arterial infusion for patients with resected crlm initially was tested without concurrent systemic therapy, which at the time of the initial trials did not include modern systemic agents such as oxaliplatin and irinotecan . To date, there have been no prospective randomized controlled trials comparing adjuvant hai with modern systemic therapy vs modern systemic therapy alone in patients with resected crlm . In 2016, kemeny et al reported on an analysis of 4 consecutive hai adjuvant trials for patients with resected crlm from 1991 to 2009 (n = 287). The patients were divided into 2 groups: those treated before and after 2003, corresponding to the incorporation of modern systemic oxaliplatin or irinotecan - containing regimens . With a median follow - up period of 11 years, the investigators reported that patients treated after 2003 had a 5- and 10-year os of 78% and 61%, respectively, with the median survival not being reached . Patients treated before 2003 had a 3- and 5-year dfs of 42% and 41%, respectively . Taken together, these data support that properly selected patients with crlm can have hepatic resection of their disease followed by adjuvant systemic therapy plus hai and achieve a 5-year survival as high as 78% . However, similar to toxicity associated with systemic therapy, treatment with hai has risks, including biliary sclerosis in less than 5% of patients, that needs to be balanced with the anticipated benefit of treatment . For treatments such as hai that seek to maximally treat the liver, it is imperative to begin integrating preoperative prognostic indicators that are predictive of a patient s risk of intrahepatic recurrence after hepatic resection to select patients for intensive treatment regimens . Ultimately, we must develop a noninvasive test to determine the risk for both local and distant recurrence of disease with monitoring the response to systemic therapy as well as an early signal for intrahepatic recurrence . In addition to discrete gene expression profiles that identify patients at high risk of recurrence, blood - based biomarkers for noninvasive monitoring of early detection of recurrent disease actively in development may serve as a more reliable marker to monitor response to treatment, and ultimately to monitor patients for recurrence of disease after curative treatment . Although newly identified gene signatures can identify at - risk patient populations for defined treatment regimens, a second approach for improving patient survival is in developing biomarkers with enhanced specificity and sensitivity for early detection of primary and recurrent disease . The goal of this approach is to identify recurrent or persistent disease at a point when traditional clinical indicators, such as radiographic signs, still are negative, and to treat or alter treatment of disease at the earliest time point this almost certainly will improve overall disease control . Genetic material sourced from blood - based material originating from primary and/or metastatic lesions can be used to inform noninvasive, blood - based biomarker discovery, and provide a nuanced view of the disease specifically the temporal evolution of disease over treatment to facilitate tailored therapy . The gold standard for a noninvasive early diagnosis test is the fecal occult blood test, but it has sensitivity limitations . Detection of the plasma - based factor cea also widely is used to monitor disease status longitudinally in patients with treated crc, but it also has limitations . To improve specificity and sensitivity, tumor biologists are pursuing a new generation of blood - based biomarkers that have correlative or biologic value, as well as providing tumor genomic information on which to alter treatment . Although still in development, these new factors, including new populations of circulating tumor cells (ctcs), cfdna, micro - rna (mirna), and exosomes have the potential for the further development of critical assays to surveil patients with crc and intervene at times that may improve disease control.53, 54 conventionally isolated ctcs, defined by cell surface expression of epithelial cell adhesion molecule (epcam) or cytokeratin (ck), and the absence of the pan - leukocyte marker, cd45 expression, have been shown to correlate with progression - free survival and os in patients with colorectal cancer, prostate cancer, and also with breast cancer . Although these data are predictive of prognosis, ctcs are rare entities in the circulation, and, more importantly, they have failed to provide biologic insights that may guide informed therapeutic treatment . Standard ctc detection methods rely on the expression of specific epithelial markers, ck and/or epcam, and the exclusion of leukocyte - specific markers, typically cd45 . Ctcs also have been isolated based on size, density, charge, or various other properties that positively or negatively enrich a specific cell population . Cellsearch (janssen diagnostics, raritan, nj) is the food and drug administration approved test to detect ctcs by magnetic separation of epcam cells followed by positive staining for ck and negative staining for cd45 . These existing approaches bias the subsets of ctcs captured, and may be excluding biologically relevant subpopulations . For example, zhang et al showed the high metastatic capability of an epcam ctc population isolated from patients with breast cancer in a mouse xenograft assay . This epcam ctc population may represent cancer cells that have undergone epithelial - to - mesenchymal transition, thereby losing expression of epcam, and therefore represent a more migratory and invasive cell . Indeed, in crc, ctcs that have lost epcam expression or gained n - cadherin, vimentin, or fibronectin expression are hypothesized to have undergone epithelial it reasons that to gain their full metastatic potential, tumor cells must cross several cellular barriers to travel through the circulation and seed metastatic sites . Such cells appear to have adapted by loss of epithelial differentiation and acquisition of advantageous phenotypes to modulate and balance differentiation, self - renewal, and homeostasis in the selected environment.53, 54 an additional population of ctcs that have not been well studied are those expressing the leukocyte marker cd45 . Peripheral blood cells from cancer patients, isolated by differential centrifugation and size exclusion, were found to harbor ctcs that expressed ck and cd45, yet conferred robust growth in culture . In addition, cd45ck ctcs were identified in patients with metastatic pancreatic cancer from an epcam - enriched population, and in metastatic breast cancer patients, even with partial cd45 depletion with magnetic beads . Interestingly, the breast cancer cd45 ctcs also expressed the macrophage marker cd68, indicating that ctc populations may acquire proteins typically expressed by macrophages, possibly through a cell fusion mechanism . To fully appreciate these cd45 ctcs, direct visualization would rule cancer - immune cell clusters that could be construed as a cd45 ctc by flow cytometry . If these cells arise from leukocyte - cancer fusion, this novel tumor biology may provide important insights that may guide therapy more effectively . Ongoing work is directed at investigating how these untapped and uninvestigated populations of ctcs potentially can contribute to our overall knowledge of disease and are being developed in parallel with the rapid advancements in other biomarker fields, such as that of cfdna . Cfdna is hypothesized to arise from cells that die, whether by necrosis, cell lysis, or apoptosis, releasing naked dna into the circulation and creating a residual fingerprint . Although cfdna was first detected in healthy individuals in the late 1940s, it was not until the 1970s1980s that neoplastic characteristics were identified and that cfdna was found to exist in higher concentrations in cancer patients relative to healthy controls.65, 66 although quantification of cfdna was useful in some disease states when used alongside classic blood tests (eg, cea), cfdna is being developed for the identification of gene mutations and microsatellite instability in early detection assays . Current technologic advancements in amplifying dna and in sequencing supports the relevance of this biologic material . For example, de kok et al showed concordance of kras point mutations between primary tumors and serum cfdna amplified by polymerase chain reaction in 14 crc patients . In addition to point mutations, microsatellite abnormalities have been detected in patient blood from breast cancer, head and neck cancer, lung cancer, melanoma, and crc.69, 70, 71, 72 isolated cfdna has many characteristics of tumor dna, including the presence of oncogenes and other global molecular classifiers such as msi, cpg island methylator phenotype, and chromosomal instability . El messaoudi et al conducted a multiparametric analysis correlating cfdna with os in metastatic crc patients (n = 97). Higher cfdna levels were associated with a statistically significant decrease in os (18.07 vs 28.5 mo; p = .0087). Furthermore, on multivariate analysis the investigators showed that a higher cfdna level is an independent prognostic factor (p = .034) and that high levels of cfdna fragmentation were associated with decreased os in the mutant kras / braf population . Newer technologies under development such as the plasmaselect assay (personal genome diagnostics, baltimore, md) allow for the identification of multiple mutations and genetic alterations resulting in a comprehensive genomic analysis of the tumor and the potential to track tumor evolution across treatment . Analyses of cfdna along with evaluation of novel ctc populations have great potential to provide novel noninvasive approaches to diagnosis cancer, facilitate early detection of disease and recurrent disease, assessment of the evolving tumor biology, and provide a foundation for tailored treatment . Aside from cfdna and ctcs, there are active investigations into tumor - derived or tumor microenvironment - derived exosomal stable mirnas that are released into the vasculature, glandular secretions, or waste excretions.77, 78, 79, 80 mirnas are a small, recently discovered class of highly conserved noncoding rnas that play key roles in the regulation of gene expression . In their transcriptional regulation, mirnas possess differential short nucleotide length sequence complementarity to confer combinatorial diversity to affect hundreds of targets in similar gene networks . In this framework, a single mirna exists in reciprocal inhibition with an entire network of functionally related genes . Thus, baseline activity or change in exosomal mirnas provides a molecular snapshot of intracellular activity from their tissue of origin . Additional information can be derived because the presence of exosomal mirnas dictates potential paracrine and endocrine roles that have been observed in a number of malignancies including crc.81, 82, 83 properties of exosomal mirnas have been highlighted in recent clinical studies to ascertain their utility as novel minimally invasive biomarkers.84, 85, 86, 87 in crc, ogata - kawata et al performed mirna microarray analyses on serum exosomes derived from 88 crc patients compared with healthy controls and identified a subset of 7 up - regulated diagnostic mirnas that outperformed conventional cea utility for surveillance of crc recurrence . In crlm, a similar study was performed in serum exosomes from both the liver metastases subgroup and the nonmetastatic group at different time points of treatment and resection . Microarray analyses showed a distinct subset of 6 tumor - derived exosomal micro rnas (mirna or mir), which were synchronized with liver metastasis development . Among this subset, exosomal mir-19a was found to be up - regulated compared with normal healthy volunteers, and the level of exosomal mir-19a was found to correlate with more aggressive disease including nodal involvement, liver metastases, and higher tnm stage . Taken together, these data provide a glimpse in the acquisition and analysis of exosomal mirna diagnostic and predictive biomarkers in primary and metastatic crc . Over the past 5 years, there has been burgeoning interest and now demonstrated efficacy in exploiting the tumor immune microenvironment as a viable and effective treatment option for many cancers that previously had been recalcitrant to treatment . It has become increasingly clear that the tumor microenvironment plays a key role in tumor progression and response to therapies across many different cancer types . Immune check - point inhibitors such as ipilimumab, pembrolizumab, and nivolumab are being widely studied in prospective trials in a variety of cancers, including in patients with liver - only metastatic crc . Several recent studies have highlighted the role of non - neoplastic cells, particularly stromal cells and immune cells, as prognostic markers in human crc.91, 92, 93, 94 immunologically, it has been shown that dmmr cancers harbor infiltrating tumor lymphocytes that actively are suppressed by immune - inhibitory signals such as the programmed death (pd) ligand-1 and pd-1 complexes . In 2015, le et al reported the results of a phase ii trial of patients with treatment - refractory progressive metastatic cancer treated with the anti the results for 32 patients with metastatic crc were stratified by dmmr crc compared with patients with proficient mmr tumors . For patients with dmmr crc, the immune - related objective response and immune - related progression - free survival were 40% and 78%, respectively, as compared with 0% and 11%, respectively, for patients with proficient mmr crc . These findings currently are being evaluated in the keynote-177 trial in patients with msi - high or dmmr metastatic crc who have been randomized to treatment with pembrolizumab vs standard therapy . Specific features of the tumor microenvironment such as an abundance of t - helper (th) 2 cytokines, proinflammatory molecules, pro - angiogenic molecules, and profibrotic molecules are immunosuppressive and considered protumorigenic . In contrast, an abundance of th1 cytokines, angiostatic factors, and immunostimulatory molecules, along with the mobilization and reinvigoration of the cd8 t cells, all are characteristic of a robust antitumorigenic microenvironment . Therefore, understanding the recruitment and function of leukocytes in the cancer will enable the development of both targeted therapies and biomarkers that can predict emergence of treatment resistance and recurrence of cancer . Interestingly, there are several nuances that dictate the function of even the same leukocyte subsets in different cancers.97, 98 for example, protumorigenic macrophages are regulated by th2-cd4 t cells in mammary carcinomas and b cells in pancreatic adenocarcinomas and squamous cell carcinomas . Similarly, the soluble mediators and signaling pathways that regulate this cellular cross - talk also are different, with il4/il13 and colony stimulating factor-1 playing key roles in driving macrophage function in mammary carcinomas whereas bruton tyrosine kinase and phosphoinositide 3-kinase regulating the macrophage function in pancreatic and squamous cell carcinoma . As such, it is possible that the immune checkpoint pathways also are regulated differently in different tissues, necessitating the development of tailored approaches to immunotherapy across different cancers . In this context, we propose that a multimodal biomarker - based approach would be optimal for immune - mediated cancer control and assessing treatment response . Such an approach would rely on biomarkers that measure the protumorigenic and antitumorigenic factors elaborated earlier and provide multiple avenues to mobilize and reinvigorate the cytotoxic t - cell responses . This could include a combination of strategies such as neutralizing the th2 responses, cytotoxic and targeted agents, immune checkpoint blockade, vaccines, and chimeric antigen - receptor t cells . This multimodal approach also will sample the microenvironment whenever the cancers escape and recalibrate the specific reprogramming strategy, specific immune checkpoints that can be targeted, and specific pathways that drive the microenvironment so cancer regression and control can be re - established . In summary, an approach that dynamically engages the immune system by constantly sampling the microenvironment to detect recurrence and relapse is essential to incorporate into the management of patients with advanced crc and direct novel immunologic therapies . Ultimately, the biology of the tumor both cell intrinsic and cell extrinsic underlies the clinical outcome for patients with metastatic crc . Indeed, the concept of liver - only metastatic disease by definition implies a different biologic subtype . This difference is readily clinically apparent and our attempts to exploit this biology are the basis of all liver - directed therapy . Future directions in treating patients with the crc liver - only subtype therefore must revolve around better molecular characterization and the development of improved therapeutic approaches . As liver - directed therapy continues to evolve with the development of other local treatment modalities including microwave ablation, irreversible electroporation, and transarterial radioembolization (eg, y-90)our ability to identify and understand this biology becomes paramount . Currently, clinicians use the biologic test of time to ascertain if a hepatic - only metastatic state can be maintained while first - line systemic agents are used and hence provide the rationale to attempt intensive liver - directed approaches, including hepatic resection and hai . Banking tissue from these patients for molecular and clinicopathologic analyses, and correlating molecular and cellular correlates with high - quality clinical data, is essential and has become an integral aspect of modern prospective clinical trials . Tissue samples collected and analyzed across the continuum of a patient s treatment are essential to facilitate discovery - based approaches to improve therapy . Specimens collected at several time points (eg, pretreatment, after each chemotherapeutic cycle, after completion of systemic therapy, and after hepatic resection) along with tissue from the surrounding hepatic parenchyma can be analyzed for a number of genomic and cellular alterations, including mutational analysis, copy number variability, and circulating biomarkers that have the potential to shed insight into evolving tumor biology that may predict treatment response . Data support that properly selected patients with crlm can have hepatic resection of their disease followed by adjuvant systemic therapy plus hai and achieve a 5-year os as high as 78% with a hepatic dfs of 62% at 5 years . The role of hai in the adjuvant treatment of patients with resected crlm additionally offers the unique opportunity to deliver novel agents in a liver - directed fashion . Although floxuridine has been used for decades and represents a pharmacokinetically ideal agent, our rapidly expanding knowledge of crc tumor biology and microenvironment begs for the development and study of novel agents coupled with the rational design of clinical trials that can exploit this knowledge in a liver - targeted fashion . Given the extensive molecular and clinical heterogeneity of the liver - only metastatic crc, it is of great importance to individualize targeted therapy on the basis of molecular profiling through logical implementation of biomarker assessment in liquid biopsies for early metastasis to monitor for intrahepatic recurrence . We are charged with moving beyond a blunt one - size - fits - all approach in treating patients with crlm . Ultimately, we believe that molecularly driven treatments will lead to improved os, a reduction in intrahepatic recurrence, and will decrease the toxicity of perioperative therapies.
, we started asking students to submit creative work on medical themes as part of a first year teaching unit . Rationale, recipes and results of this initiative are unpacked in an accompanying paper (http://www.med-ed-online.net/index.php/meo/article/view/5394). In brief, we postulated that asking students to work creatively with medical themes would help develop their sense of the individual in a curriculum centring on the generic, encouraging them to savour and express their emotional reactions and experience the intrinsic pleasure of creativity . The quality of the submitted work was often arresting in terms of its artistry or the poignancy of the issues with which it tried to grapple . A student would, for instance, write with honesty of their stubborn denial of incipient diabetes or submit a photograph of a snowman that they had crafted for a terminally ill patient who was unable to get outside in a gloucester blizzard . Another dreamt her way into the synaesthetic world of severe autism (box 1). Long unmown leaves tickling her feet, spinning . In the seeming silence, spinning . Amid the golden sun splashes . She cares not for garish plastic toys not for her daydreams of boys and teenage love . The world she can touch and taste and hear, related in ways she does not understand . But with a flicker of the eyes, and a slight opening of her arms, she invites you to join her . To sit and spin in the afternoon sun . I judged many works deserving of a wider audience and began planning a paper anthology . Poetry and prose work fine on paper, but mime and rap and sculpture do not . Though i realised the obvious benefits of a web - based anthology, the technical challenge felt daunting . The first was a chance meeting with an established artist with academic credentials and considerable sensitivity in working with non - professional art . Catherine lamont - robinson quickly grasped the spirit of the enterprise and has been shaping it ever since . The second was connecting with one of our medical students who had, in a previous life, been a professional web designer . Danny van de klee married industry - standard technical ability with an artist's eye for uncluttered design . Technical and financial backing from the university's elearning team suddenly created the possibility of progress . My artistic work can't get going unless it has a name, a central brightness around which the rest can gather . The student is immersed in other people's knowledge, the possessive pronoun asserts ownership: our heads, not anybody else's . Medics spend a lot of time in mental activity, but if we are out of our heads, where are we? In our hearts? We wanted to give these student artists the pleasure of seeing their works reach a wider audience . We also wondered if putting medically themed art into the public domain might positively influence public perceptions of medical education . Might the discovery that the art of medicine has a place in the curriculum encourage students who had thrived in the humanities? What insights would these fresh minds draw from their close and privileged exposure to the medical universe? We were interested, in particular, in what light they might shed on patients' experiences, their critiques of medical culture and their reflections on their emerging professional status . We needed to create a site that expressed within its form the nature of the work we were hoping to curate but, visually, it was hard to know where to begin . The form of the website needed to emerge from the artistic material rather than imposing on it . The student community would not only supply content, but be central to design decisions . Thirdly, the site would be iconic (i.e. Visual) rather than textual in its presentation . Each media object would be associated with the artist's reflections on the context, the creative process or both . This was important as some of the most impactful work might be judged as artistically naive but tackled issues of utmost poignancy . Visitors needed a means of making publicly visible comment and a mechanism by which new works could be submitted for inclusion . They also needed lots of flexibility in searching the site (by artist, title, subject, etc . ). The former were complicated because many student artists had already graduated and were out of easy e - mail contact . Most tales were generic, but some were so specific that a patient stumbling on the site might recognise themselves . We judged this to be an acceptable risk given that, in such cases, the students' treatments were invariably sympathetic . Near the end of a long and labyrinthine journey through the bristol medical curriculum, i found myself by a railway track digging on an allotment plot with dr . Discovering that prior to medical school i was once a professional web designer, he started talking about an idea for out of our heads a web - based archive of medical student creative work . At first i had reservations about returning to that stark internal landscape of hexadecimal and boolean algebra . But it seemed this project might provide me with some sort of creative and emotional resolution in combining my disparate identities of artist, programmer and now doctor . The curator, catherine lamont - robinson, was, by her own admission, wary of a look out of nothing, sprawled on the floor, drawing and playing with bits of plasticine . We wanted the student artwork to speak for itself through a simple, uncluttered, design . Additionally, we wanted the user interface to be minimal, playful and reveal itself rather than be obvious from the outset . After an initial idea for an interface using different shaped pills was abandoned, a tree was suggested . This provided a visual metaphor for the organic creative process, the complex branching systems of nerves, vessels and other structures within the body and a reference to the arbor vitae . The animated eyes, hanging like bizarre fruit from the branches, came from wanting to express the notion of mindful watchfulness . Medicine, it seemed, involved a lot of uneasy watching from one side or other of the medical fence, as patients, practitioners and third parties, such as students or relatives, peruse the unfolding drama . The eyes also suggest introspection and reflection and their uncanny juxtaposition against the outline of the tree is meant to be un - nerving (sic), mimetic of such feelings often encountered when dealing with mortality and the body . We found an archive in the university library of anatomy and medical texts dating back to the sixteenth century . These crumbling treasures provided a rich visual language and their intricate line drawings of things such as the vessels of the head and twin birthing conformations are used extensively but subtly in the design . This is also mirrored in the choice of the phrenological head as the logo for the site, highlighting medicine as one of the healing arts, and the diverse cultural and historic background informing its practice today . Trevor was keen to expand on novel features like sound effects, which is something i resisted, knowing from previous experience that there is a fine line between playfulness and annoyance . My focus was to get a functional, meaningful archive first and then develop these ideas later . I think we came to a happy medium, as the student artwork is itself full of humour and the site design does not detract from the stars themselves . As a creative facilitator in widely divergent communities and with a passion for the auto - biographical voice, handling suitcases full of raw data sparked both my narrative (1) and aesthetic sense of adventure . Gems were uncovered at each immersion and very few student works were without a glint of engagement beyond the requirement to submit . My job was to select the works for inclusion on the site, long before its design had taken form . Not wishing to be either hasty or woolly in my choices maybe, not quite sure why i am keeping this categories, and i began a parallel journal to document my thought processes as i continued to sift (2). So, what were the criteria? At root, a sense of integrity in the pieces, a particular insight, a breadth of perspective and, albeit only surfacing, an aesthetic integration, often hard - won . A sheet of lined - paper with spidery, almost indecipherable, text, set my heart pounding, swiftly executed pieces astounded me with the quality of their insight and resonance, while some beautifully presented and mannered works would deliver little of substance . We decided from the outset to present works according to emergent themes (rather than according to our own pre - determined categorisations (3)). The process of identifying these, which now seem so obvious, was a challenge, as was the attribution of any single work to one theme only . Sharing complementary creative fascinations and educational values, trevor and i crafted the over - arching concepts (such as home front or doors of perception) and sub - themes (such as my family and wounded healer) and devised category descriptors to illuminate the grouping of work . My family the ground from which we grow. (brother and sister) who am i? Where medics question their roles, values and identities . (dear diary) wounded healer being ill, receiving care and adapting to persistent problems . (daffodil) students' initiation into the medical practice comes to the fore does it have to be like this? The medical system and how it handles those in its clutches, in particular patients . What is it really like to be a patient? (a dance trapped in a diseased body) cut adrift the cord is cut (the meeting that made a difference) this section highlights powerful internal dialogues, shifts in perspective and extraordinary insights into the beauty and intricacy of body processes and forms bone - deep a selection of student work that is particularly rich in sensitivity to the aesthetic of embodiment . (life injecting it or sucking it away) heads and hearts the head says one thing and the heart says another . Perspective - shifting texts and art forms that push the boundaries of our assumptions as readers / viewers . (use your eq not just your iq) this section frames the student work . Arts in education presents the educational context from the perspective of both students and staff . Musing on the muse rolling over any of these reveals further optical accoutrements providing cues to what lies beyond . Clicking on a blinking eye reveals a filigree of cerebral vessels, foregrounding the generic icons of the next level, inspired by student nina beck's painting of a rose . Rolling the mouse over any rose, individual icons appear that are drawn from works residing in that particular category . For example, the category who am i? Was matched with an anatomical thumbprint from the archives . What i think is important is that i really enjoyed rummaging around and was constantly surprised by the things i found. This response highlights an interactive fluidity and playful ethos in the design . I added a curator's tour to facilitate navigation for those not inclined to go it alone . Students share aspects of their their lives in a secure group context, or even privately for the eyes of their tutors alone . Although general consent had been obtained at the time of original submission, we wanted to be doubly sure that students were comfortable about public exhibition . In response to my enquiries, several wanted their works rendered anonymous, and very few withdrew altogether . Throughout the development, we sought support and responses from others, including those outside medicine, academic colleagues and students . Dr louise younie, a gp and lecturer in bristol, helped me track student artists who had been through her elective module in the creative arts. Such students had often gone much further in developing their artistry (see for instance this), and reflected deeply on the process (and this). We convened informal focus groups of students to help us gauge the anticipated peer - group response and referred back regularly to the perspectives of will duffin, the student artist in the design team who guided us through the subtleties of what might and might not be cool. Medical staff from clinical departments have also voiced their appreciation of the opportunity to stand behind the creative lens of their students . One senior teacher confided that he had come across on the website creative work by a male student with whom he had had recent dealings of a disciplinary nature . The creative work showed him a sensitive side of that student which he could hardly have imagined, causing him to view the student in a different light . After attending a presentation about the developing website, a retired obstetrician was prompted to contribute some poetry he had written as a junior doctor (matthew john died aged 9 days) and several general practitioners have enquired about submitting pieces . Patients involved in a creative arts group at a local surgery, where i have been working as artist in residence, have shown a critical interest in the students' interpretation of medical conditions and remarked on the universal nature of the themes . Reassurance, one of the patient - artists observed this is a mirror of my life at the moment i am the hand being held passive and unable to give anything back. Some other responses to the website are included in box 3 . Art gives a new dimension to medicine, particularly with regard to modelling disease and its wider impact on the individual and society . Medicine can be a very objective subject and combining it with art has given students the ability to see medicine from differing perspectives . Such exercises broaden and develop the future professional mind that will seek in far - reaching places for possible solutions to an encountered problem a response to the piece the sun bather from a medical student attending another university an art gallery curator found the image spots of patients to be an informative and sophisticated visual representation of individual differences with regard to the presentation of symptoms . A year after viewing the preliminary selection of website images, an early - years educator vividly recalled a student's selection of a prescription pad as drawing material and the graphic spontaneity of the tolerant farmer. My fallback option of going into medicine was born out of the stark realisation that in order to make a living in music, i would need to be either extremely good or extremely lucky . As a medical student at bristol, i began to embrace my new identity as a scientist of the human body . However, simply discovering where everything went, what it did and what happened when it went wrong, proved wholly unfulfilling . I found myself losing the ability to feel, to empathise and to truly connect with the subject matter . I could hardly believe it when i looked at the lecture timetable and saw that sandwiched between pathology and biochemistry was a session on the art of medicine. We were being asked to produce something with a medical theme and share it with our colleagues in a group session . It's fair to say that most people had serious reservations about this compulsory creativity . Some were abhorred by the idea that they should be forced to produce a haiku or a watercolour, when this time could be spent memorising the divisions of the facial nerve . People came along to get their name on the register, as another hoop to jump through . We were amazed by the diversity of talent, from rap music and dance, through to huge oil paintings, which explored challenging and evocative themes . Classmates revealed hidden depths: the jack the lad, known for throwing paper planes from the back of lectures, stood and delivered a mournful and poignant poem about sibling love and loss of innocence . It soon became apparent that while everyone was pretending not to care, they had been secretly and ferociously painting, drawing and composing . When i learned that trevor thompson was planning to anthologise and showcase this wealth of creative talent, i was keen to be involved . We needed to make it accessible, non - pretentious, without having an obvious faculty presence . I wanted to see a site that was inclusive and open for comment and new contributions . In my book presenting the work in this format is a crucial step in creating a broader culture of creative expression in the medical community . The work produced shows medical students becoming intimately involved with the plight of patients they have met . Hayley penhale's the bold explorer depicts a man newly diagnosed with prostate cancer as a small yellow figure navigating a bleak landscape of shattered white fragments, tentatively planning his next, potentially perilous, step . Emily ashworth's painting the struggle is of a dancing couple: the male, powerful and commanding, takes the lead over the fawning female figure, representing the irrepressible dominance of physical illness over a patient's life ambitions . Now that i am finally a doctor, i can appreciate more than ever how vital it is for people to nurture an outlet for the powerful emotions and dilemmas that practicing medicine evokes, through music, art, drama or whatever form this takes . Failure to value the people and their unique stories beneath the disease processes is what ultimately leads to burnout and boredom . Johanna shapiro, a pioneer of creative approaches in medical education, highlights in her writing the this distance, which seems to grow rather than shrink through the clinical years, stems, she argues, from our collective discomfort with the sick . Medical education should help us to recognise and process this gulf through approaches that emphasise our common humanity . Our aspiration, in bringing creative endeavour to the bristol medical curriculum, has been to foster student awareness of the human stories that are everywhere in the enterprise . Patient stories, doctor stories, student stories, stories of systems going well and systems going to pot . In creating settings for students to divine these stories, and to reflect on their significance key to this process is the sharing of artistic work between students in established tutorial groups ., they may reveal a poignant personal narrative and, at least, some form of emotional response to a medical predicament . Such revelation is, of course, what we regularly expect of our patients and demands of the listener a willingness to authentically witness whatever it is that has to be shared . These group encounters do then model many of the features of the sensitive consultation . Of the several thousand artistic works that have been submitted by bristol students, we have judged some as extraordinary through their artistry or their ability to illuminate some awkward corner of the medical universe . Through the www.outofourheads.net website, we have sought to bring these particular works to a wider audience . On the one hand, much of the emotional power is lost outside the context of the groups where they were first revealed . On the other hand, we are now developing the site as an educational resource where students in different clinical specialities can link quickly to artistic works that foreground common themes . For instance, we have this and this on issues in early pregnancy and this and this on dementia . We have set students assignments to post considered responses to particular works and then used these responses as the focus for further discussion in tutorials . Anthologies of the creative work of a learning community are nothing new and the pleasure of seeing your own work in a real book is hard to better, but there is much to commend web - based curations . These allow exhibition in various media, including film, dance and rap, as well as the more typical poems, prose, cartoons, drawings and paintings . Visitors to the site can respond to the works and submit their own for consideration . The site can grow organically and be referenced in its entirety without the chore of tracking down paper copies . This site came into existence due to an unheralded synthesis of artistic, technical and academic passions . An example of this is the weaving throughout the site of images plucked from the university's collection of sixteenth and seventeenth century illustrated texts . These collaborate to create an intentionally disconcerting interface that seems to look out as much as invite you in, a world as peculiar as medicine itself . And where from here? We have secured funding to help us gather contributions from former students, current faculty, nhs patients (it's only fair!) And invited artists . We are forging links with other institutions and investing in elective modules where gifted students can develop ideas and nurture techniques under the supervision of professional artists.we are curious about how to research the messages these artistic works convey about the medical universe as viewed from the shifting neutrality of the student gaze, but mindful too of the ethical complexities of offering up the stories of others for such scrutiny . The insights conveyed on www.outofourheads.net are things at once peripheral and utterly central to the business of medicine; those moments, realisations and connections that lift us out of the mundane and highlight the privilege and poignancy of the enterprise . The out of our heads project received funding from university of bristol alumni foundation and funding and technical support from the university of bristol centre for medical education . We wish to acknowledge the particular contributions of jane williams, miranda whinney and dominic alder.
The religious cognitive emotional therapy is essentially a new form of cognitive theory based on religious approaches . According to cognitive theories, what we think (cognition), what we feel (emotion and affect) and how we act (behavior) the basic aim of the cognitive therapy is to identify irrational or maladaptive thoughts, assumptions and beliefs which are related to debilitating negative emotions to identify what is dysfunctional or just not helpful about them . Therefore, the patients must give away irrational and distorted thoughts and replace them with more realistic and self - helping alternatives (33). Two major theories in the cognitive approach are the cognitive behavior therapy (cbt) that was developed by aaron t. beck (34, 35) and rational emotive behavior therapy (rebt) that was proposed by albert ellis (36, 37). Beck (38) described a number of thinking errors, maladaptive, unhelpful and unrealistic thoughts about oneself, others and the world that he believed contribute to emotional distress and inappropriate behaviors of human beings . Some of the thinking errors described are as follows: black and white thinking, arbitrary inference, selective abstraction, overgeneralization, magnification and minimization . According to ellis (39), the belief system of people, not external events, determine their feelings and behaviors ., a therapist may point out irrational beliefs, but he or she teaches the patients how to challenge these beliefs in their daily life outside the therapy and provide them with exercises . The result of challenging self- defeating beliefs and replacing them with rational ones yields an effective new philosophy . The cbt and rebt are used widely, and the efficacy of these therapies in the treatment of psychological disorders has been shown in many researches (4042). However, these cognitive therapies emphasize more on the way individuals interpret ideas and events they face within their every day lives; they put less stress on basic beliefs which deepen philosophical roots of the individual's life . In religious cognitive- emotional therapy (rcet), psychotherapists must consider basic philosophical beliefs which relate to the meaning of human beings' lives . There are important questions about the self and existence in human's mind that must be answered; for example, what am i? What is the existence? Where does the existence come from? Who is the creator of the world and me? And many other questions that human beings seek answers for on the other hand, the rcet framework assumes that people through their lives find that things and events disagree with their desires . Their parents, intimate friends and dear ones die, and they may face disasters . Therefore, they ask themselves why they must tolerate these serious disasters and finally see the death of their dear ones? Why are they to live?, so they seek to find the meaning of life . Existential philosophers have already emphasized the importance of human being's search for the meaning of life . Existential psychology is partly based on the existential belief which state man is alone in the world . This loneliness leads to the feeling of meaninglessness that can be overcome only by creating self values and meanings (43). Frankl (44) said that individual's search to find meaning or a purpose for his or her life is the most fundamental need which has to be met; it is said that the striving to search for and to possess a meaning or a purpose for one's life is said to be the primary motivational force in man . According to frankl (44), when an individual cannot form a meaning or purpose of life for oneself, he or she suffers from an existential vacuum . These individuals experience despair and hopelessness, and do not know why they ought to live . For many years, i have faced many individuals that suffered from psychological disorders . All of them have had symptoms of existential vacuum, that was suggested by frankl . They were aimless, affected by the feeling of absurdity, despair, and hopelessness in their lives . These basic religious beliefs influence one's thinking about oneself, interpretation of life events, and determine the mental health (feeling and behavior) of people (45). Basic religious beliefs are psychological states in which individuals are convinced of truth in a proposition . These beliefs are rooted in religions . They are divided into three groups in rcet: god, existence and human beings . They can answer the essential questions about the self, others, world, god, and interactions between them . When people find answers to essential questions, they will achieve a good and stable sense of hopefulness towards the world, purpose and can distinguish the meaning of life, feel integrated with existence and accept realities . They understand why they live, how they should behave e and what they want in their lives . Three groups of basic religious beliefs are: 1-god: (a) there is no god except the unique god that is the creator of the world and existence. (b) god is almighty and all - knowing. (c) god is merciful, very kind and compassionate . These items are the most essential ones and believing in them can cause the most important effects on humans' mental life . The acceptance of the merciful, compassionate and almighty god gives the best direction to lives . They are to be resistant in solving the problems of lives; furthermore, relaxation is another result of believing in god . 2-human beings: (a) human being is the highest creation in the great chain of beings and it is the god's representative on earth . (d) when he dies, his life is not finished but it is transformed . These basic beliefs help people to gain high self - esteem or confidence, and to plan in their life and consider their worth . With these beliefs, they are not obsessed with death but try to be ready for it . 3-existence: (a) nothing is without any purpose or goal, and neither is the world . (b) the world and existence are created in a complex and wonderful way . They develop creative thinking to resolve the complexity of the world and to find the meaning of it, self and life . These beliefs are adapted from islamic references, but many of them are shared with other religions . In fact, i mentioned a few of basic religious beliefs, and there are more of them that can be used in psychotherapy sessions . Thus, in human psychopathology, we must pay attention to both physiological and psychological levels . For example, in anxiety disorders, there are a number of physiological reactions that occur automatically, such as increasing heart rates, pain in heart and shoulders and unpleasant sensations . These automatic emotional reactions are produced by classical conditioning . If a woman is faced with a snake, as a stimulus, the other neutral stimuli can be conditioned and produce a similar reaction in her at a future time . Therefore, according to the rcet theory, some individuals may suffer from anxiety or other psychological disorders, because they have suffered from physical injuries or physiological symptoms that are produced by classical conditioning . In addition, other psychotherapies, for example cognitive behavioral therapy (cbt), pay attention to physiological organs in treating psychological disorders (34, 46). Sometimes thoughts, anticipations, and interpretations of life events can produce unpleasant emotions or maladaptive behaviors in humans; therefore, in the second level of human psychopathology, the ways of one's thinking about every day problems are considered . Irrational beliefs that were suggested by albert ellis (37, 39) and thinking errors proposed by aaron beck (34, 35) are mental processes which cause emotional disturbance and maladaptive behaviors . Religious cognitive emotional theory (rcet) points out that if human beings have not physical health but their thoughts and everyday beliefs are realistic, they do not know their purpose and the meaning of life and do not answer the essential questions about their lives; they cannot have healthy emotions, behaviors and feeling of comfort and satisfaction in their lives . The questions such as:, where did we come from?why did we come to this world? Where are we going? Who created the world and existence? Who is god? Who is the creator of existence? And not being able to answer these questions and leading a meaningless life cause identity crisis and confusion . The rcet assumes that path of human beings development is toward the transcendence, and reaching to an acceptation and comfort feeling with self, world, and god . In the rcet, the intervention can be directed at three levels: physiological, cognitive and spiritual levels . The rcet therapist can use and emphasize the therapeutic levels based on every client's problem . For example, the person who suffers from gad, shares the physiological symptoms, thinking errors and feeling of worry, despair, worthlessness, nihilism, confusion, and loss of meaning of life . However, in a depressed person who has not any physical symptoms, the therapist must use cognitive and spiritual levels . The therapist, after initial clinical interviewing, explains the general model of the rcet, first, and delineates these three levels (physiological, cognitive, and spiritual) of psychopathology and treatment . The therapist describes the interaction between these three levels to determine the individual's health, emotions and behaviors (general mental health). In the physiological level, the therapist identifies the physical and emotional reactions of the client (such as increased heart rates, perspiration, feelings of pain in some area of body and so on) that have unpleasant sensations and are produced by classical conditioning . In this level, the therapist describes the automatic connection between the stimulus and the situation with these physiological symptoms . The therapeutic method in the physiological level is to teach relaxation and breath control which help the client to control his physiological reactions and reduce his unpleasant emotions . The rcet therapist, in the second level of treatment, considers the ways of thinking and interpreting events of the person's daily life . The therapist tries to identify and change distorted and unrealistic ways of thinking which cause emotional disturbance and maladaptive behavior in individuals . These beliefs are rigid explicit/ implicit demand and command that cause some extreme conclusions such as awfulness, overgeneralizations, depravation, frustration and low tolerance . The rcet also considers these irrational thoughts; and rcet therapist identifies and changes the client's self - defeating and irrational thoughts with more rational and self- constructive ones, which then are likely to cause healthier and more constructive emotions and behaviors . The thinking errors, such as black and white thinking, arbitrary inference, overgeneralization that were proposed by beck, (34, 35) are addressed in this level of treatment . One key tenet in the rcet framework is that although changing the irrational beliefs and negative thoughts into rational and positive ones is important, it is not enough and the process of treatment is not complete . Therefore, the third level of treatment is the spiritual level . At this level, the rcet therapist through purposeful questions examines the client's basic beliefs about the self, existence (world), god and the meaning of life . Most of those persons that suffer from depression, anxiety, and other emotional disturbances have nihilistic beliefs about the self, others and existence ., the therapist asks the clients to talk about themselves and others, and how they think about themselves as a human being . They have feeling of worthlessness, despair, and do not know why they have to live . The rcet therapist should challenge the clients' beliefs through proposing the basic religious beliefs and clarifying how these basic religious beliefs can help one to decrease their anxiety, depression or other unpleasant emotions, and promote the individual development and mental health . Human beings live in the world; so any beliefs and attitudes about the world and existence have important effects on one's mental health . In the second stage, the rcet therapist identifies the clients negative and nihilistic beliefs about the world and existence and helps them to change these beliefs into positive and purposeful one's, so that the clients acquire a new insight of existence . In the third stage when people accept god as the unique creator, they will gain the safe and reliable force in the world and feel relief in their lives . In summary, the therapist uses the basic religious beliefs about human beings, existence and god to help the client to gain a new insight and the meaning of life . The therapist should have a structured thinking and systematic planning in the process of treatment . The therapist must show the effects of the ten basic religious beliefs in the human life . Thus, the rcet therapist needs special training to apply physiological, cognitive and spiritual levels of treatment . In addition to the special method of the rcet, therapists must show sympathy and have a good rapport and positive attitude towards clients . He or she must bear in mind that human beings are privileged with free will . Therefore, the therapist must show positive functions of any basic religious beliefs to promote human's development and transcendence and help the patients to gain a good mental health without any insistence . Religion and its principles have always been important factors which effect humans' psyche and mind . Nevertheless, some of psychologists and psychotherapists reject the application of religion and spirituality in psychology . However, because the subject of religion and psychology is human beings, both of them try to show the ways of human development and well being . However, many psychologists believe that religions study the mankind with nonscientific methods and psychology, as a science, must use a rigorous scientific method . In recent years, science has undergone important changes, ranging from modernity to post modern paradigm, and scientific studies of spirituality and religion have increased . The studies of spirituality and religion in psychology have been developed in many topics.for example, the relationship between spirituality and mental health (7, 19, 49); receiving social support (50, 51); copying styles (10, 47, 52, 53); and spiritual interventions in psychotherapy (5, 8, 9, 54). Although many methods of religious psychotherapy have been proposed, there have not been any comprehensive theories in this field so far . Religious cognitive emotional therapy (rcet) is a new form of cognitive therapy that uses basic religious beliefs and insights in psychotherapy . Rcet is a new integration of cognitive, humanistic, and existential theories that is combined by religious beliefs and insights . Rcet is a new approach that can lead to a new field of treatment, research, and education in psychology and psychotherapy; and we need more researches in this field . Rcet is an effective method of psychotherapy for the treatment of persons that suffer from identity crisis, depression, anxiety and it can be developed to remove other psychological problems.
Hypothyroidism is a known consequence of external - beam radiotherapy to the neck encompassing a part or whole of the thyroid gland . Though hypothyroidism has a significant impact on the quality of life, assessment of thyroid function is not yet a part of continue follow - up of cancer patients even in long term survivors . As the survival of cancer patients are increasing, the quantification of the incidence of radiation - induced hypothyroidism is gaining importance . The most common clinical late - effect of the thyroid gland irradiation in patients exposed to therapeutic doses (30 - 70 gy) to the cervical region is primary hypothyroidism . The aetiology of radiation induced thyroid injury includes vascular damage, parenchymal cell damage and auto - immune reactions . In this non - randomized prospective study, we have tried to evaluate the response of the thyroid gland to radiation by assessing thyroid function before irradiation and at regular intervals after irradiation . The present study was conducted for a period of 2 years in which thyroid function was assessed in 59 patients managed in a tertiary care centre . Fifty nine euthyroid healthy control samples were also taken, who had not received the neck radiation . The patients / controls were followed periodically, after the completion of radiation therapy, (in case of patients) first at 3 months, then at 6 months, 12 months, 18 months, and finally at 24-month interval . The following patients were included in the study: patients with histologically proven non - thyroid malignancies, who were destined to receive ebrt to the primary site as well as to the neck and where radiation portals included a part or whole of the thyroid gland, and patients who euthyroid prior to radiation therapy . In this study, we present the incidence of long term hypothyroidism in malignancy patients after radiotherapy to the neck both serum thyroid stimulating hormone (tsh) and t4 levels were prospectively measured to reveal subclinical and clinical hypothyroidism . Serum thyroid stimulating hormone (tsh) and t4 levels were assayed by radioimmunoassay method using commercial kits . The radiotherapy technique employed in this study was the conventional ebrt technique using single daily fractions of 1.8 - 2.0 gy, with 5 fractions per week using teletherapy cobalt 60 units . Blood chemistry, complete blood count, abdominal ultrasonography, chest x - ray, ecg, and thyroid hormone levels (tsh, t4 levels), were evaluated regularly . If the patients presented with low t4 levels and clinical symptoms of hypothyroidism, thyroxine was prescribed to relieve the hypothyroidism with subsequent monitoring of serum t4 change at least every 3 months . Various predisposing factors as age, gender, tumor status, primary tumor site, treatment modality, total radiation dose, and chemotherapy were examined for any association with the development of hypothyroidism using chi - square tests, or student t - test as appropriate . Meier's method was used to estimate the time from the initiation of treatment to the development of hypothyroidism . In this study, we present the incidence of long term hypothyroidism in malignancy patients after radiotherapy to the neck . Both serum thyroid stimulating hormone (tsh) and t4 levels were prospectively measured to reveal subclinical and clinical hypothyroidism . Serum thyroid stimulating hormone (tsh) and t4 levels were assayed by radioimmunoassay method using commercial kits . The radiotherapy technique employed in this study was the conventional ebrt technique using single daily fractions of 1.8 - 2.0 gy, with 5 fractions per week using teletherapy cobalt 60 units . Blood chemistry, complete blood count, abdominal ultrasonography, chest x - ray, ecg, and thyroid hormone levels (tsh, t4 levels), were evaluated regularly . If the patients presented with low t4 levels and clinical symptoms of hypothyroidism, thyroxine was prescribed to relieve the hypothyroidism with subsequent monitoring of serum t4 change at least every 3 months . Various predisposing factors as age, gender, tumor status, primary tumor site, treatment modality, total radiation dose, and chemotherapy were examined for any association with the development of hypothyroidism using chi - square tests, or student t - test as appropriate . The kaplan meier's method was used to estimate the time from the initiation of treatment to the development of hypothyroidism . The incidence of hypothyroidism after ebrt to neck where radiation portals include part or whole of the thyroid gland was 16.94%, 7 cases had subclinical hypothyroidism (11.86%) and 3 cases had clinical hypothyroidism (5.08%) [table 1]. Incidence of hypothyroidism after ebrt and mean thyroid hormone levels of cases we found no effect of age, gender, primary tumor site, radiation dose and chemotherapy, whether neoadjuvant or concurrent on the development of hypothyroidism . Hypothyroidism covariates evaluated in cases we observed that 15.25% of patients who developed post therapy hypothyroidism did so within the 1 year . This high rate of early onset of hypothyroidism justifies a policy of early thyroid testing . The first reported case of hypothyroidism following external - beam radiotherapy for malignancy appeared in literature in 1961 . We evaluated the incidence of hypothyroidism in cases and controls, which was 16.94% in cases and 3.4% in controls . The association of hypothyroidism in the patients who had received radiotherapy to the neck was found to be statistically significant (p value 0.015). Both the hypothyroid patients in the control arm were of the subclinical type (3.4%). In the case arm, 7 patients (11.86%) were having subclinical hypothyroidism and 3 patients (5.08%) were having clinical hypothyroidism . Previous studies on the risk of hypothyroidism after neck irradiation have shown that hypothyroidism is more frequent in women than in men . However, in our cohort of patients, neither age nor sex was of statistical significance and was in consistence with the results of mercado . In our study, patients with age of <50 years were having a hypothyroidism incidence of 17.2% (5/29) and patients with age of 50 years having a hypothyroidism incidence of 16.7% (5/30) with a p value of 0.61 . Similarly, our incidence of hypothyroidism in male patients was 24% (6/25) and incidence of hypothyroidism in the female patients was 11.8% (4/34) with a p value of 0.18 . Radiation dose as a risk factor for the development of hypothyroidism remains controversial . In patients receiving radiotherapy for head and neck cancer, doses exceeding 60 gy were reported to be associated with an increased rate of hypothyroidism . However, in a prospective study, tell et al . Posner et al . Did not find the radiation dose to be a significant factor . Similarly, in our study, the patients who received radiation dose <45 gy to neck showed incidence of hypothyroidism to the tune of 33.2%, while those receiving radiotherapy doses of 45 gy were having the incidence of hypothyroidism of 15% with a p value of 0.26 which is statistically insignificant . In our study, 35 patients received chemotherapy in addition to radiation as part of their treatment schedule . Posner et al . Examined the effect of combination chemotherapy on hypothyroidism in patients with head and neck carcinoma and found no association . In the present study, we evaluated 59 patients; with 30 patients having breast carcinoma, 17 patients of head and neck cancer and 12 patients of lymphoma, who had received radiotherapy to the neck, encompassing a part or whole of the thyroid gland . We detected an incidence of 10%, 23.5% and 25% in breast ca, head and neck carcinoma and lymphoma, respectively . These findings are similar to the incidences of previously cited literature among the patients of head and neck tumors and hodgkin's disease . Any predilection of hypothyroidism to a particular tumor site was not statistically significant as our p value was 0.34 . In our study, tsh levels did not change in the first 3 months but significantly increased in the subsequent 3 months . Tamura et al . Reported that the incidence of high tsh increased from 26% after 2 years to 62% after 6 - 12 years . Thus, two kinds of radiation induced thyroid damage are proposed: subacute damage and late damage . The former develops in almost all patients, whereas the incidence of the latter varies considerably among different reports . We conclude from the study of thyroid function in cancer patients treated with radiotherapy to the neck that hypothyroidism (both subclinical and clinical) occurs with considerable and poorly acknowledged frequency . We believe that monitoring thyroid function should become a routine procedure in any oncology clinic managing these patients.
S6 kinases are members of the agc serine / threonine kinases of the rsk family, exhibit high homology within their catalytic domain, and are activated by the phosphorylation of a critical residue within the activation loop by phosphoinositide dependent kinase 1 (pdk1). Yeast contains one s6 kinase called sch9, and humans contain two isoforms called s6k1 and s6k2 . S6 kinases act downstream of phosphatidylinositol (3,4,5)-triphosphate (pip3) in the phosphatidylinositide 3-kinase (pi3k) pathway . Phosphorylation of serine and threonine residues in the c - terminal regulatory domain leads to the phosphorylation of a s6k activation loop residue by pdk1 (residue 252 on the longer splice variant of s6k1). In addition to pdk1, mtor is also involved in the activation of s6k1 and phosphorylates s6k1 at residue t412 . S6 kinases are associated with many cellular processes, including protein synthesis, mrna processing, cell growth, and cell survival . S6k1 and s6k2 phosphorylate and activate the 40s ribosomal protein s6, which promotes protein synthesis through an increased rate of mrna transcription . S6k1 also regulates cell size and progression through the cell cycle, in addition to promoting cell survival by inactivating the proapoptotic protein bad . The aberrant activation of s6 kinases has been shown to play a role in many disease conditions, including diabetes, obesity, aging, and cancer . Many melanoma cells harbor constitutive activation of the pi3k - akt pathway, which results in akt phosphorylation and leads to activation of the downstream targets mtor and s6k1 . Treatment with rapamycin, an allosteric mtor inhibitor, leads to significant dephosphorylation of s6k1 and decreased cell growth . However, treatment with mtor inhibitors abrogates feedback inhibition of other pathways, which in part leads to side effects such as hyperglycemia, hypercholesterolemia, and hyperlipidemia . Because of this, inhibition of s6k1 represents an alternative therapeutic strategy that may bypass the limitations of mtor inhibition . We have previously reported on the development of atp competitive organometallic kinase inhibitors with high potency and specificity . These inhibitors are structurally inspired by the class of indolocarbazole alkaloids, such as staurosporine, but use a transition metal ion that coordinates up to six ligands to replace the carbohydrate moiety of staurosporine . The scaffold design includes a bidentate ligand that is able to target the metal complexes to the atp - binding site . This mimics atp and conventional indolocarbazole inhibitors, while the increased size of the bulky transition metal complex allows for exploration of additional chemical space at the edges of the atp binding site specific to each kinase . Despite being conventional atp - competitive inhibitors, the combination of unusual globular shape and rigid characteristic of these complexes it is worth noting that the coordinative bonds to the transition metal are considered to be kinetically stable and are expected to remain intact when exposed to the biological environment, thus avoiding metal - related cytotoxicities . However, druglikeness of such complexes, including metabolic stability, bioavailability, and pharmacokinetic properties, is not established yet and is subject to current studies . Regardless, this strategy has led to the development of specific and potent kinase inhibitors for gsk3, pim1, pi3k, mst1, and braf . Here, we present data on the development of potent and specific organometallic s6k1 inhibitors, em5 and fl772 . We show that fl772 binds to s6k1 with an ic50 value in the single digit nanomolar range at 100 m atp and that the more potent fl772 compound has a greater than 100-fold specificity over s6k2 . Crystal structures of the s6k1 domain bound to the pan - kinase inhibitor staurosporine, em5, and fl772 reveal that the organometallic inhibitors bind in the atp binding pocket in a way that is distinct from staurosporine, likely explaining their more favorable potency and selectivity . Cellular data demonstrate that fl772 is able to inhibit s6k phosphorylation in yeast cells . The data provide an important starting point for the development of s6k inhibitors for possible therapeutic applications . Inhibitors for s6k1 were initially identified through millipore kinaseprofiler (supporting table 9). Ten different staurosporine - inspired organometallic ruthenium complexes were screened against a diverse panel of 283 protein kinases . This screen led to the identification of em5 as a potential inhibitor of s6k1, with 7% activity at a concentration of 100 nm in the presence of 10 m atp . Em6, a similar complex replacing the isothiocyanate functional group with an isocyanate (figure 1a), inhibited significantly less, exhibiting 54% activity under the same conditions . In the kinase panel, the em5 inhibitor inhibited only 41 kinases (16%) to less than 10% activity, including s6k1 and the related s6k family members rsk1, rsk2, rsk3, and rsk4 . First generation organometallic ruthenium inhibitors exhibit potency and specificity for s6k1 . (a) em5 and em6, two organometallic ruthenium compounds, use a similar structure to mimic the pan - kinase inhibitor, staurosporine . (b) a radioactive kinase assay was used to determine the activity of five different protein constructs of s6k1 . (c) staurosporine (dotted line), em5, and em6 were assayed against s6k1(1421, t412e) pdk1 activated in a radioactive kinase assay at 100 m atp . A radioactive kinase assay was used to determine the activity of s6k1 protein constructs prepared in baculovirus - infected insect cells in order to identify a construct that would be suitable for inhibitor testing . Initial tests showed that the full - length i isoform of s6k1 (s6k(1525)) and the isolated kinase domain (s6k(84384)) had low kinase activity, although the full - length kinase showed more activity than the kinase domain (figure 1b). We reasoned that the s6k1 protein constructs had low kinase activity because the full - length kinase contained the c - terminal autoinhibitory domain . To address this issue and express a more active kinase for further inhibitor studies, we prepared a s6k1(1421) construct including both the t252 and t412 phosphorylation sites, based on previous data from keshwani et al . Indicating that the catalytic domain of the s6k1 aii isoform (residues 1398) analogous to s6k1(1421) of the i isoform was highly expressed in insect cells . To further enhance the catalytic activity of s6k1(1421), we prepared the t412e mutant to mimic phosphorylation at this position and coexpressed the protein with pdk1 to promote phosphorylation of t252 . Preparation of the s6k1(1421, t412e, pdk1 activated) protein resulted in highly active kinase that was suitable for inhibition studies in vitro (figure 1b). Both em5 and em6 were assayed against s6k1(1421, t412e, pdk1 activated) in a radioactive kinase assay and determined to have ic50 values of 33.9 nm and 23.5 m, respectively, at 100 m atp (figure 1c). For comparison, we also determined the ic50 of the nonspecific kinase inhibitor staurosporine, which had an ic50 value of 64.1 nm under the same conditions . Given the apparent specificity and potency of em5, it became the lead structure for the development of second - generation organometallic s6k1 inhibitors . Our initial attempts to cocrystallize the s6k1 kinase domain (s6k1kd, residues 84384) bound to em5 using several factorial screens were unsuccessful . However, we were able to reproduce the crystals reported by sunami et al . Of the s6k1 kinase domain in complex with staurosporine . We then soaked these crystals with high concentrations of the em5 inhibitor in the hope of exchanging em5 for staurosporine in the crystals . The em5-soaked crystals diffracted to about 2.5 resolution and formed in space group p21 with two molecules per asymmetric unit . The structure was refined to rwork and rfree values of 19.15% and 22.21%, respectively, with excellent geometry (table 1). During the refinement process similar to the previously published structures of the s6k1 kinase domain, the kinase domain is bilobal, consisting of an n - lobe composed largely of -sheet and a c - lobe that is mostly -helical . The crystal structure revealed that one protein molecule in the asymmetric unit was bound to staurosporine, while the other molecule was bound to em5 in the same atp binding site . Fc difference peak corresponding to the ruthenium atom in the atp binding sites of one of the molecules before the inhibitor models were built into the electron density map (figure 2a). The staurosporine and em5-bound molecules in the asymmetric units are similar to each other with an overall rmsd of 0.68 for the shared atoms . (a) the electron density map of em5 (contoured at 12) corresponds to the ruthenium atom of the inhibitor . Hydrogen bonds are shown as a dashed line, while other interacting residues are labeled . (d) notable changes between the em5 and staurosporine bound structures are shown . This includes a change to the activation loop due to em5 interactions with g100 and v105 and a shortening of two turns to the d helix resulting from an interaction with e179 . (e) close - up around the c helix, which is more ordered in the em5-bound structure because of an interaction between f237 and l147, and a hydrogen bond between k123 and e143 . Although both staurosporine and em5 bind in the atp binding pocket, the more elaborate em5 compound makes more extensive interactions, correlating with its greater s6k1 potency than staurosporine . Staurosporine forms hydrogen bonds to s6k1 through the backbone oxygen of glu-222 of the kinase with the nitrogen of the methylamine of staurosporine, and the backbone nitrogen of leu-175 and backbone oxygen of glu-173 of the kinase hinge region contact the pyrrolidone oxygen and nitrogen of staurosporine, respectively . The ring system of staurosporine also makes van der waals contacts to leu-97, lys-99, gly-98, val-105, ala-121, tyr-174, glu-179, and met-225 (figure 2b). The em5 compound retains two hydrogen bonds between the backbone atoms of the hinge residues (glu-173 and leu-175) and the maleimide ring of em5 and all of the van der waals interactions with the em5 ring system (figure 2c). However, in addition to these contacts, em5 makes additional protein interactions between the ruthenium coordination sphere and the protein . In particular, the additional isothiocyanate group of em5 makes van der waals interactions with gly-100 and val-105 of the kinase p - loop while the trithiacyclononane ligand makes van der waals contacts to gly-100 of the p - loop and glu-179 and glu-222 across from the p - loop where the protein substrate is likely to bind and thr-235 and asp-236 of the activation loop . Notably, each of these residues (glu-179, glu-222, thr-235, and asp-236) undergoes a dramatic movement toward the em5 inhibitor relative to their positions in the staurosporine complex (figure 2d). The binding of em5 to s6k1 also introduces significant structural changes in the kinase relative to the staurosporine complex, and these structural changes appear to be indirectly caused by the 1,4,7-trithiacyclononane ligand of the em5 inhibitor . The d helix of the staurosporine complex is about two turns longer at its n - terminus than the corresponding helix of the em5 complex where the corresponding segment takes on a -strand conformation . This structural difference appears to be driven by the interaction of the tridentate ligand of em5 with glu-179 . On the opposite side of the inhibitor, the staurosporine complex contains an activation loop that is folded toward the atp active site in an inactive conformation and does not have an ordered c helix, as previously reported . Strikingly, the em5 complex contains a well - defined c helix of about two turns . The difference in disposition of the c helix in the two structures appears to be nucleated around the n - terminal region of the activation loop that undergoes about a 6 movement toward the em5 inhibitor relative to staurosporine . The movement of the activation segment toward the em5 inhibitor appears to be mediated by the van der waals interactions that are made between thr-235 and asp-236 with the trithiacyclononane ligand of em5 (figure 2d). This in turn provides enough room for the c helix to form and to be stabilized by van der waals interactions between phe-237 of the activation loop and leu-147 of the c helix and a hydrogen bonding between lys-123 of the small domain and glu-143 of the c helix (figure 2e). Interestingly, these interactions are characteristic of the active conformations of kinases, even though the activation segment is in an inactive conformation . In contrast, the more out conformation of the activation loop of the staurosporine structure places phe-237 and asp-236 in positions that sterically occlude formation of the c helix (figure 2d). Taken together, while staurosporine binding to s6k1 places it in the inactive conformation, the s6k1/em5 complex has characteristics of both the inactive and active kinase conformations . The em5 inhibitor bound to s6k1 with an ic50 value in the mid - nanomolar range, and a cocrystal structure confirmed that the inhibitor was binding in the atp pocket of the kinase domain . As a result, em5 was a promising lead structure for the design of more selective and potent s6k1 inhibitors . Previous data indicate that modifications to the pyridocarbazole moiety or the coordination sphere can have significant effects on binding affinities or kinase selectivity, and the structure of the s6k1/em5 complex indicated several positions where chemical elaboration could enhance specificity for the kinase . A series of 64 derivatives of em5 were designed with modifications at the pyridcarbazole heterocycle and the remaining ligand sphere and were tested for inhibition of s6k1 activity using both a radioactive kinase assay (supporting information figure 3a) and an adp - glo assay with 1 m compound . Twenty - five of these inhibitors were further screened using 250 nm compound (figure 3a). The eight compounds that inhibited s6k1 to less than 25% activity, the equivalent of em5, were assayed to determine their ic50 values (at 100 m atp). This analysis produced several compounds that inhibited s6k1 similarly or more potently than em5 including sek-222 (ic50 = 18.9 nm), sek-243 (ic50 = 15.9 nm), sek-214 (ic50= 14.8 nm), sek-220 (ic50= 7.7 nm), and fl772 (ic50 = 7.3 nm) (supporting information figure 3b). Compound fl772 (figure 3b) showed the most potent inhibition with an ic50 of 7.3 nm, (100 m atp and 2 nm of enzyme) (figure 3c). (a) the 25 top derivatives of em5 were assayed against s6k1 in a radioactive kinase assay, using 100 m atp and 250 nm s6k1 . (b) structure of the fl772 inhibitor, which showed the most potent inhibition of s6k1 . The 1,4,7-trithiacyclononane ligand of em5 is replaced by a 1,4,7-trithiacyclodecane bearing a methylated amino group in fl772 . (c) radioactive kinase assay of fl772 against s6k1 reveals an ic50 of 7.3 nm . (d) radioactive kinase assay of fl772 against s6k2 shows an ic50 of 975 nm . (e) radioactive kinase assay of pf-4708671 against s6k1 indicates an ic50 of 142.8 nm . Panels c, d, and e employed 100 m atp and 2 nm of the respective kinase . Testing the fl772 inhibitor at a range of concentrations from 1 m atp to 500 m atp resulted in an increase in the ic50 value concurrent with increasing atp concentrations from 3.91 nm at 1 m atp to 25.79 nm at 500 m atp, confirming that fl772 is an atp competitive inhibitor (supporting information figure 4). To assess the specificity of fl772 for the s6k1 isoform, we also assayed the fl772 compound against recombinant s6k2 (figure 3d), which resulted in an ic50 value of 975.0 nm, more than 100-fold greater than the ic50 value for s6k1 . This confirms that the fl772 is indeed specific for the s6k1 isoform over the s6k2 isoform . For comparison, we tested the published s6k1 inhibitor pf-4708671 against s6k1 using the radioactive kinase assay in order to compare the potency of our compound with another specific s6k1 inhibitor (figure 3e). The ic50 of pf-4708671 against s6k1 was determined to be 142.8 nm, nearly 20-fold higher than the ic50 of fl772 against s6k1 . To establish the kinase selectivity profile of fl772, we submitted the compound at a concentration of 100 nm to the kinomescan profiling of lead hunter discovery services using 456 kinases (supporting information table 10). Fl772 demonstrated a high degree of kinase selectivity, with only 10 of 456 (2.2%) kinases showing less than 10% activity and only 26 of 456 (5.7%) kinases showing less than 35% activity (supporting information figure 2). Like em5, fl772 showed binding to the cam, dap, flt, pim, and rsk family member kinases . Unexpectedly, s6k1 itself exhibited 71% activity in the kinomescan set of lead hunter discovery services with 70 of 456 (15.3%) showing a higher degree of binding than s6k1 . The potency of fl772 therefore appears to be greater against s6k1 prepared by us than s6k1 prepared by lead hunter discovery services . We hypothesize that the different s6k1 kinase preparation and/or phosphorylation state by lead hunter discovery services leads to the different fl772 potencies for s6k1 measured by us and lead hunter discovery services . Nonetheless, taking together our analysis of fl772 against s6k1 and the kinase profiling results, we conclude that fl772 exhibits a high degree of kinase selectivity . Fl772 is based on the em5 lead structure and differs by a methylated hydroxy group at the pyridocarbazole moiety and the thioether - containing tridentate ligand . The nine - membered ring of the symmetrical 1,4,7-trithiacyclononane ligand is replaced by a prochiral 1,4,7-trithiacyclodecane bearing a basic n - methylamino group in the 10-membered cyclic tridentate ligand . These structural changes in the tridentate ligand significantly increase the structural complexity of the inhibitor which is exemplified by the number of possible stereoisomers . To determine the molecular basis for the increased potency of fl772 over em5, we determined the x - ray crystal structure of fl772 in complex with s6k1 to 2.7 resolution (table 1). The overall structure for the fl772-bound s6k1 is very similar to the em5-bound structure, with an rmsd of 0.54 for all atoms . In particular the p - loop and activation loop and d and c helices take on nearly identical conformations, although the c - helix is about one turn shorter at its n - terminal end (figure 4a). In addition, the fl772 inhibitor retains all of the interactions made by em5 but makes some additional interactions including a hydrogen bond between the backbone carbonyl of lys-99 of the kinase p - loop with the amine ligand of the n - methyl-1,4,7-trithiacyclodecan-9-amine ligand while the methyl group makes a van der waals interaction with tyr-174 of the kinase hinge region (figure 4b). These additional interactions of fl772 likely contribute to the greater potency of fl772 over em5 . The protrusion of the amine ligand into the region where protein substrate binds for phosphorylation probably also contributes to the greater inhibitor potency . (a) comparison of the s6k1 structures with em5 and fl772 . The c helix of s6k1 is one turn shorter at its n - terminal end of the fl772-bound structure compared to the em5-bound structure . Hydrogen bonds are shown as a dashed line, while other interacting residues are labeled . Fl772-specific interactions that are not made on the em5-bound structure are highlighted in darker shade . This includes interactions between y174 and the ether methyl group and the k99 backbone carbonyl with the amine group of the tridentate ligand . After establishing that fl772 functions as a potent atp competitive s6k inhibitor in the in vitro radioactive kinase assay, we carried out studies to characterize its activity in cells . We first tested fl772 for overall cell cytotoxicity and downregulation of phosphorylation of s6 in the 451lu (braf mutant) and 451lu - mr (braf / mek - inhibitor resistant) melanoma cell lines . Cells were treated with vehicle or a dose of inhibitor ranging from 0.001 to 10 m for 22 h (figure 5a). The 451lu or 451lu - mr cell lines exhibited neither a significant decrease in s6 phosphorylation nor a decrease in cell viability as indicated by the absence of cleaved parp . There was also no change in total s6 or peef2k levels, indicating that mtor was not a target of fl772 . Fl772 does not inhibit s6 phosphorylation in human melanoma cells but does inhibit s6 phosphorylation in yeast cells . (a) 451lu or 451lu - mr cells were treated with increasing concentrations of fl772 or vehicle for 22 h. cells were lysed and blotted for ps6 and other downstream effectors of s6k1 . (b) 293 t cells were treated with fl772, fl1324 (a similar organometallic ruthenium compound), a previously reported s6k1 inhibitor, pf-671 (4708671), or a previously reported dual mtorc1 and mtorc2 inhibitor, azd8055, for 3 or 16 h. (c) western blot of yeast cells treated with fl772 . By4742 budding yeast cells were treated with fl772 for 4 h. cells were lysed and blotted for ps6 . Quantitative western blot signals were detected by li - cor, and the relative ps6 levels were calculated by normalizing raw ps6 measurements to gapdh signals . () p <0.05 (two - tailed student t test, n = 3). We also investigated the effect of fl772 in 293 t cells at both 3 and 16 h of treatment (figure 5b). As controls azd8055 is an atp - competitive dual mtorc1 and mtorc2 inhibitor that inhibits the phosphorylation of mtorc1 substrates s6k1 and 4ebp1 and the mtorc2 substrate akt . Pf-4708671 is a reported s6k1 inhibitor that does not affect the phosphorylation of akt . The compound fl1324 is an fl772 analogue identified in our screen that inhibited s6k1 with an ic50 of 11 nm (figure 3a). Fl1324 replaces the fluorine of em5 with a hydroxyl group and is thus a less polar molecule . Since previous studies using pf-4708671 demonstrated a significant reduction in s6 phosphorylation in 293 t cells in 30 min, we tried both a short (3 h) and long (16 h) time point for treatment . As expected, the azd8055 mtor inhibitor showed a significant decrease in ps6 levels at both the s235 and s240 sites, along with a decrease in pakt at t308 and s473 . The pf-4708671 compound showed a modest decrease in phosphorylation of s6 at the 3 h time point, but this phosphorylation returned to near basal levels by the 16 h time point . Notably, neither the fl772 nor the fl1324 compound inhibited phosphorylation of s6 or akt . Together, these results suggest either that the fl772 inhibitor has poor cell membrane permeability or that inhibition of s6k1 in cells does not significantly reduce s6 phosphorylation . The latter possibility is consistent with the fact that the structurally unrelated compound pf-4708671 also shows poor inhibition of s6 phosphorylation in cells and the observation that s6k2 also targets s6 for phosphorylation . To test if fl772 can inhibit s6 phosphorylation in a setting where s6k2 was not present, we investigated the ability of fl772 to inhibit s6 phosphorylation in budding yeast where a single kinase, sch9p, is orthologous to human s6k1 . We observed that treatment of wild - type budding yeast cells (by4742) with fl772 significantly decreased the level of phosphorylated s6 in a dose - dependent manner (figure 5c). At the highest dosage, these data suggest that fl772 functions as an inhibitor of s6 kinases in vivo in a yeast cellular system . In this study, we developed an organometallic ruthenium compound to inhibit s6k1 . Using the millipore kinaseprofiler and radioactive kinase assays, we showed that the em5 lead compound was a potent and selective s6k1 inhibitor, with 100 nm compound inhibiting 93% of s6k1 activity and only inhibiting 16% of 283 kinases by less than 90% . We found that the em6 analogue in which an isocyanate group replaces an isothiocyanate is about 1000-fold less potent, implying that potency and specificity could be further optimized . A crystal structure of em5 bound to s6k1 provided important molecular insights into em5 inhibition of s6k1 and led to the development of fl772, a compound containing a novel ligand scaffold with an ic50 in the single digit nanomolar range for s6k1 . A crystal structure of fl772 bound to s6k1 revealed the molecular basis for the compound s potent and selective inhibition of s6k1 . In order to investigate the efficacy of the fl772 inhibitor in cells, we evaluated the inhibitor in both human 293 t and braf mutant melanoma cells and in budding yeast . We found that fl772 was only able to inhibit s6 phosphorylation in yeast cells, suggesting that either the compound is unable to enter human cells, a significant shift in the ic50 of the compound occurs in the presence of physiological levels of atp, or the uninhibited activity of s6k2 in human cells was sufficient to maintain s6 phosphorylation . Given that ruthenium compounds similar to fl772 have been used to successfully target mst1, pak1, and pi3k in cells, we do not believe that the ruthenium compounds are unable to penetrate cells . The radioactive kinase assay prohibits measurements at physiological levels of atp, but we were able to assay the activity of fl772 against s6k1 using an atp range from 1 to 500 m . This analysis revealed that the ic50 values increased with increasing atp concentrations, consistent with fl772 binding competitively with atp, as also confirmed with the crystal structure of the s6k1/fl772 complex . Interestingly, the ic50 ranged from 3.91 nm at 1 m atp to only 25.79 nm (a 6-fold increase) at 500 m atp, suggesting that s6k1 binds atp relatively loosely and that fl772 is likely to displace atp even at the higher physiological concentration of atp . On the basis of these accumulated data, we propose that fl772 is unable to inhibit s6 phosphorylation in human cells because s6 is phosphorylated by the uninhibited s6k2 . S6k1 is closely related to s6k2, sharing 83% sequence identity in the catalytic domain . A study involving s6k1/2 knockdown in mice suggests that both s6k1 and s6k2 are required for full phosphorylation of s6 but that s6k2 may be the more important of the two for phosphorylation of s6 . The mek inhibitor azd6244 showed additive effects on decreasing the phosphorylation of s6 in vitro when treated in combination with sirna inhibition of both s6k1 and s6k2 combined, indicating the importance of s6k2 in the phosphorylation of s6 . Furthermore, while normal tissues often express low levels of s6k2, overexpression of s6k2 is more common than overexpression of s6k1 in cancer cells . Taking these data together suggests that targeting s6k2 either alone or in combination with s6k1 inhibition may be a more viable option for direct s6 inhibition in melanoma and potentially other cancers . Despite the similarities in the catalytic domain, homology modeling between s6k1 and s6k2 indicates an important difference in residue tyr-174 that plays an important role in fl772 binding and is a cysteine in s6k2 . This residue is located in the hinge region of s6k1 and makes an important van der waals interaction with the methyl group of the secondary amine, which would not be made with a cysteine residue, suggesting that fl772 may not be a potent inhibitor for s6k2 . Indeed, we confirmed in our study that fl772 inhibits s6k2 more than 100-fold more poorly than s6k1 . The lethality of s6k1/s6k2 knockout mice implies that s6k2 targeting may need to be selective for therapeutic value . To date, there are no commercially available s6k2-selective inhibitors, indicating a potential target for the next series of organometallic ruthenium inhibitors . Taken together, the studies reported here provide a potent and selective s6k1 inhibitor that should be useful to probe s6k1 function and as a starting point for the development of efficacious s6k inhibitors for therapeutic use . Protein kinase profiling of em5 was performed with the millipore kinaseprofiler in a panel of 263 human protein kinases . Percentage of kinase activities were determined for em5 and em6 at 100 nm in the presence of 10 m atp . Kinase profiling of fl772 was performed with the discoverx kinome screen using a panel of 456 kinases . Active - site - directed competition binding was determined in the presence of 100 nm fl772 . Em5 and em6 were synthesized in analogy to related compounds reported . A detailed synthesis and characterization of fl772 full length human s6k1 cdna (1525) was purchased from epitope (catalogue number ihs1380 - 97652397). S6k1 constructs (84384, 1421, 1421 t412e) were subcloned into the pfastbac htb vector for protein expression . Sf9 cells were transfected with the recombinant bacmid dna using cellfectin (invitrogen). Cells were harvested after being incubated for 48 h at 28 c and stored at 80 c . The 1421 t412e construct was coexpressed with pdk1 to phosphorylate the t412e residue (cloned from cdna purchased from openbiosystems). Frozen pellets of the s6k1 kinase domain, s6k1(84384) used for crystallography were resuspended in sonication buffer (50 mm kpi, ph 7.0, 250 mm nacl, 5% glycerol, 1:1000 pmsf) and sonicated at a power output of 5.5 for 120 s with 20 s intervals (misonix sonicator 3000). Lysates were cleared by high - speed centrifugation at 18 000 rpm for 35 min at 4 c . Equilibrated talon metal affinity resin (clontech) was added to cleared lysates and incubated at 4 c for 1 h with gentle shaking . The resin / lysate mixture was loaded into a gravity flow column, and the resin was extensively washed with wash buffer (50 mm kpi, ph 7.0, 250 mm nacl, 5% glycerol). Protein was then eluted with elution buffer (50 mm kpi, ph 7.0, 250 mm nacl, 500 mm imidazole, and 5% glycerol) in a single step . Pooled talon eluent was diluted 3.5-fold in dilution buffer (50 mm kpi, ph 7.0, 5% glycerol) and loaded onto an sp anion exchange column pre - equilibrated with buffer a (50 mm kpi, ph 7.0, 50 mm nacl, 5% glycerol). Protein was eluted with buffer b (50 mm kpi, ph 7.0, 500 mm nacl, 5% glycerol) in a single step . Elution after the q column was concentrated and loaded to a superdex s200 column equilibrated with 50 mm na citrate, ph 6.5, 300 mm nacl, 1 mm dtt, 5% glycerol . The eluent was collected and concentrated to 3 mg / ml before protein was flash frozen in dry ice and stored at 80 c . Purification of the 1421 t412e construct was completed as above, with gel filtration on the superdex s200 column using a buffer containing 25 mm tris, ph 7.5, 200 mm nacl, 1 mm edta, and 5% glycerol . Full - length human s6k2 cdna was purchased from ge healthcare dharmacon (rps6kb2, clone identification number 2959036). The s6k2 1423 construct, equivalent to s6k1 1421, was subcloned into the pfastbac htb vector for protein expression . Each reaction mixture contained 5 l of 5 reaction buffer (100 mm mops, ph 7.0, 150 mm mgcl2), 2 l of inhibitor in 50% dmso, 3.6 l of s6k1 substrate peptide (rrrlsslra), 1 l of bsa (20 mg / ml), 3.2 l of s6k1 (concentration as described in results), and 5 l of atp / atp * mix (concentration as described in results) in a total reaction volume of 25 l . Reaction mixtures were incubated for 1 h at room temperature before being transferred to whatman paper and washed with 0.75% phosphoric acid . Ic50 values were determined using sigmoidal dose response with a variable curve in prism, version 5 . The s6k1 kinase domain crystals were obtained using room temperature hanging drop vapor diffusion by mixing equal volumes of protein (15 mg / ml) preincubated with 1 mm staurosporine with 2025% (w / v) peg335, 0.1 m bis - tris (ph 5.55.7), and 0.2 m liso4 . Following the growth of crystals, crystal soaking was carried out by incubation with a final inhibitor concentration of 1 mm in cryoprotectant containing the well solution and 15% (w / v) glycerol for 4 h to overnight and flash frozen in liquid nitrogen . The structures were determined by molecular replacement using the reported s6k1/staurosporine complex (pdb accession code 3a60) as a search model with the staurosporine removed from the coordinate file and refined with cns and coot . Simulated annealing omit maps were employed to unambiguously confirm the modeled inhibitors . For the em5-soaked crystals, this revealed that one protein molecule in the asymmetric unit was bound to staurosporine while the other protein molecule was bound to em5 . For the fl772-soaked crystals, the asymmetric unit contained a single, domain - swapped monomer and only the fl772 inhibitor was modeled in the binding site . The structures were refined to convergence with a final rwork = 19.15% and rfree = 22.21% for the s6k1/em5 structure and a final rwork = 20.63% and rfree = 23.01% for the s6k1/fl722 structure with excellent geometry (table 1). Human cell lines were cultured in rpmi (10 - 040-cm; cellgro) supplemented with 5% fetal bovine serum and harvested at 70% confluence . For immunoblotting, cells were treated for the specified times with the indicated drugs, washed with cold phosphate buffered saline (pbs) containing 100 mm na3vo4, and lysed using tne buffer (150 mm nacl, 1% (v / v) np-40, 2 mm edta, 50 mm tris - hcl, ph 8.0) supplemented with protease inhibitors (11697498001; roche). Page and transferred to nitrocellulose membranes (9004700; biorad). After blocking for 1 h in 5% (wt / vol) dry milk / tris - buffered saline (tbs)/0.1% (v / v) tween-20, membranes were incubated overnight at 4 c with primary antibodies followed by incubation with alexa fluor - labeled secondary antibodies (irdye 680lt goat - anti - mouse or irdye 800cw goat - anti - rabbit antibodies (li - cor biosciences) for 1 h. -actin (a5441) and vinculin (v9131) antibodies were obtained from sigma . P - akt (4056, 4060), s6 (2317), p - s6 (4858, 5364), s6k1 (2708), p - s6k1 (9234), p - eef2k (3691), peif4b (3591), and cleaved parp (5625) were obtained from cell signaling technologies . Overnight cultures of wild - type yeast cells (by4742) were diluted in synthetic complete (sc) medium and regrown at 30 c to early log phase (od600 of 0.2). Fl772 was added to an aliquot of culture to the final concentration of 1, 10, 100, and 1000 nm . The treated cultures were further grown at 30 c for 4 h before harvesting . A culture of sch9 cells (ks68) was grown and harvested in parallel as a control . Yeast cell pellets were lysed by spinning down cultures at 3000 rpm for 3 min at 4 c, washing with ice - cold water, and broken in lysis buffer as previously described . Whole cell extracts were separated on a 412% bolt gel with mops running buffer (life technologies), followed by transfer to a pvdf membrane in a mini trans - blot cell (bio - rad) at 20 v overnight . The blot was blocked with 3% bsa at room temperature for 2 h and then at 4 c for 4 h, followed by incubation with primary antibodies, phospho - s6 (cell signaling, catalog no . Incubation with secondary antibodies (anti - rabbit - dylight-680 and anti - mouse - dylight-800, pierce, 1:10000 dilution) was carried out at room temperature for 1 h before imaging with li - cor odyssey.
It is well established that resistance training is good for adults health, regardless of age.13 increased strength and bone density, improved ability to complete activities of daily living, improvement in health - related quality of life, reduced signs and symptoms of chronic illness, and a reduction in sarcopenia are all benefits of regular participation in resistance (strength) training.4 the world health organization (who) and multiple national guidelines specifically include resistance training in their recommended physical activity guidelines, particularly the guidelines for those aged 60 years (older people).5,6 nevertheless, the proportions of older people participating are low.79 older populations across the world are growing, and it is expected that by 2050, there will be two billion people aged 60 years living worldwide, which is more than double the number in 2013.10 with this increase, it is important that older people stay as healthy as possible for as long as they can to avoid needing ongoing health and care services, hospitalization, or a move into residential aged care . Physical activity plays an essential role in staying healthy, maintaining independence, reducing the risk of falling, and allowing older people to live their later life well.11,12 the physical activity of choice for older people, particularly in australia is walking, with the majority of the older population participating only in this mode of exercise.13 studies have shown that fewer than 15% of older people participate in resistance training twice a week (the minimum guideline recommended frequency).14,15 a number of studies have explored motivators and barriers to older people participating (or commencing participation) in resistance training in an attempt to increase participation rates.1619 the main motivators specific to older people participating in resistance training were preventing deterioration or disability, building muscle, falls prevention, and feeling more alert or having better concentration.16 barriers are usually identified by asking participants who are not or have not participated in a given activity to provide their reasons for not taking part . For older people, barriers to participating in resistance training include the following: health issues, pain, tiredness or fatigue, lack of social support, and a lack of available exercise facilities.16 given the low uptake of resistance training by older people, it is important that strategies are implemented to support ongoing participation for those who commence such programs, so that they maintain long - term participation, which can assist to optimize health and well - being . Evidence from two systematic reviews that examined the effects of resistance training for improving physical function4 and exercise for improving balance20 found withdrawals after 12 months participating ranged between 20% and 48%, respectively . This highlights the importance not only for research to guide improved uptake or commencement of resistance training programs but also for retaining those who commence programs for the longer term . This study differs from other studies described as investigating barriers or reasons for ceasing participation because participants in these previous studies were still engaged in a resistance training program or had never participated.19,21,22 however, this study explores reasons why older people stop participating in a structured resistance exercise program by asking people who have recently made this choice . Exploring why this particular cohort ceases resistance training could benefit older people by assisting them to understand how to maintain their participation in resistance training . It is also important for gymnasium and fitness center owners, managers, and staff who provide such programs to better understand the reasons why older participants withdraw from attending resistance training programs after having commenced the program . Therefore, the aim of this study was to identify the reasons why older people who had been participating in a resistance training program chose to discontinue participation . This was a cross - sectional descriptive study, in which participants were surveyed by mail . Inclusion criteria were people aged 60 years who had been attending a structured, gymnasium - based, resistance training program specifically designed for older people (ie, living longer living stronger)23 and who within the previous 15 months decided to no longer attend . During august and september 2015, questionnaires were sent to participants who had ceased participation in a resistance training program between may 2014 and april 2015 . The managers from 15 gymnasiums advised the number of members who had ceased participation in their living longer living stronger resistance training programs (n=293) for the research team, to ensure an adequate number of surveys were provided to them for distribution . Due to confidentiality requirements, the managers could not provide actual contact details of these former participants to the research team . As a result, the researchers prepared 293 participant invitation letters, questionnaires, and reply paid envelopes into individual envelopes and posted them in bundles to each of the participating managers . The managers then added a name and address label to each individual envelope and posted them to past members meeting the study criteria . The participating gymnasiums were all delivering living longer living stronger resistance training programs specifically for seniors within their facility and agreed to be involved in the research . The questionnaire was developed by the researchers, research partners who came from a seniors advocacy organization, and a home care agency . Two consumer representatives (two older people, aged in their late 70s one who participated regularly in resistance training and one who did not) also assisted to develop the wording and format of the questionnaire . This study was one section of a larger research project, and the consumer representatives were part of the project team for a period of 2 years . Both consumer representatives had worked extensively in education (professorial level) and/or the sport industry in their previous working lives . Their role in this project was to provide feedback on the appropriateness of all research documents, methods, language, and so on to older people in the community . The lack of research in this area prevented the use of validated scales in the data collection, but the questionnaire was based on eliciting responses, which would explain the reasons why participants no longer attended the resistance training program . The questionnaire included participant demographics (eg, age, sex, area lived in, self - reported physical and mental health, and number of prescribed medications taken daily), physical activity levels, why they joined resistance training and for how long (including sessions per week), type of program they had attended, why they withdrew, and whether they would consider participating again in the future and, if so, why . Other questions related to how challenging they found the resistance training program, whether they noticed any physical or psychological changes due to participating, their perspectives on whether the program represented value for money, their confidence in completing sessions, support received, and motivation to participate . A combination of open and closed questions (likert scales) were utilized to avoid bias associated with checklists and to ensure opportunity for maximal responses . The physical activity level data in the questionnaire involved using the physical activity scale for the elderly (pase), which is a valid and reliable tool for determining physical activity levels of older people.24,25 scores on the pase can range from 0 to 400, where 0 being not active at all to 400 being very active . Statistical analysis was performed using statistical package for the social sciences (spss) (version 22). The qualitative data derived from the open - ended responses were analyzed using inductive content analysis . Content analysis is a research method for making replicable and valid inferences from data in a way which can generate new insights and can inform practical actions.26 inductive content analysis was used as it was felt that there was limited knowledge about barriers and enablers to resistance training in this specific cohort.27 these data were entered verbatim onto an excel spreadsheet (microsoft corporation, washington, dc, usa), and color highlights were used to code . Two researchers (eb and a - mh) coded the data independently, then compared and discussed the data until they reached a consensus . The results were then joined under higher order headings to reduce the number of categories through the collapse of like and unlike categories . The final data were presented using participant quotes to illustrate each category . To assist in clarifying connections among the categories, these data concept maps are graphical tools that are used for confirming relationships among concepts and validating ideas.28 the concept map was constructed with reference to the research question why do older people who had been participating in a resistance training program choose to discontinue? To minimize bias, the analyses were verified at each stage by a second independent researcher (a - mh). This was a cross - sectional descriptive study, in which participants were surveyed by mail . Inclusion criteria were people aged 60 years who had been attending a structured, gymnasium - based, resistance training program specifically designed for older people (ie, living longer living stronger)23 and who within the previous 15 months decided to no longer attend . During august and september 2015, questionnaires were sent to participants who had ceased participation in a resistance training program between may 2014 and april 2015 . The managers from 15 gymnasiums advised the number of members who had ceased participation in their living longer living stronger resistance training programs (n=293) for the research team, to ensure an adequate number of surveys were provided to them for distribution . Due to confidentiality requirements, the managers could not provide actual contact details of these former participants to the research team . As a result, the researchers prepared 293 participant invitation letters, questionnaires, and reply paid envelopes into individual envelopes and posted them in bundles to each of the participating managers . The managers then added a name and address label to each individual envelope and posted them to past members meeting the study criteria . The participating gymnasiums were all delivering living longer living stronger resistance training programs specifically for seniors within their facility and agreed to be involved in the research . The questionnaire was developed by the researchers, research partners who came from a seniors advocacy organization, and a home care agency . Two consumer representatives (two older people, aged in their late 70s one who participated regularly in resistance training and one who did not) also assisted to develop the wording and format of the questionnaire . This study was one section of a larger research project, and the consumer representatives were part of the project team for a period of 2 years . Both consumer representatives had worked extensively in education (professorial level) and/or the sport industry in their previous working lives . Their role in this project was to provide feedback on the appropriateness of all research documents, methods, language, and so on to older people in the community . The lack of research in this area prevented the use of validated scales in the data collection, but the questionnaire was based on eliciting responses, which would explain the reasons why participants no longer attended the resistance training program . The questionnaire included participant demographics (eg, age, sex, area lived in, self - reported physical and mental health, and number of prescribed medications taken daily), physical activity levels, why they joined resistance training and for how long (including sessions per week), type of program they had attended, why they withdrew, and whether they would consider participating again in the future and, if so, why . Other questions related to how challenging they found the resistance training program, whether they noticed any physical or psychological changes due to participating, their perspectives on whether the program represented value for money, their confidence in completing sessions, support received, and motivation to participate . A combination of open and closed questions (likert scales) were utilized to avoid bias associated with checklists and to ensure opportunity for maximal responses . The physical activity level data in the questionnaire involved using the physical activity scale for the elderly (pase), which is a valid and reliable tool for determining physical activity levels of older people.24,25 scores on the pase can range from 0 to 400, where 0 being not active at all to 400 being very active . Statistical analysis was performed using statistical package for the social sciences (spss) (version 22). The qualitative data derived from the open - ended responses were analyzed using inductive content analysis . Content analysis is a research method for making replicable and valid inferences from data in a way which can generate new insights and can inform practical actions.26 inductive content analysis was used as it was felt that there was limited knowledge about barriers and enablers to resistance training in this specific cohort.27 these data were entered verbatim onto an excel spreadsheet (microsoft corporation, washington, dc, usa), and color highlights were used to code . Two researchers (eb and a - mh) coded the data independently, then compared and discussed the data until they reached a consensus . The results were then joined under higher order headings to reduce the number of categories through the collapse of like and unlike categories . The final data were presented using participant quotes to illustrate each category . To assist in clarifying connections among the categories, these data concept maps are graphical tools that are used for confirming relationships among concepts and validating ideas.28 the concept map was constructed with reference to the research question why do older people who had been participating in a resistance training program choose to discontinue? To minimize bias, the analyses were verified at each stage by a second independent researcher (a - mh). Of the 293 questionnaires posted by the 15 gymnasiums, 56 were returned, a response rate of 19% . The mean age of respondents was 71.5 years (sd: 9.0), with over three quarters (79%, n=44) being female and 21% male (n=12). Almost all (95%, n=53) respondents lived in the metropolitan area . Over three quarters (79%, n=44) said that they had good (39%, n=22), very good (30%, n=17), or excellent (9%, n=5) physical health . The majority (87%, almost half were taking three or more prescribed medications (48%, n=27), with only 16% taking none (n=9). The mean pase score for the group was 119.5 (sd: 68.4), males: 156.8 (sd: 78.0) and females: 113.5 (sd: 63.2). Given the pase norms for 7075 year olds are males: 102.4 (sd:53.7) and females: 89.1 (sd:55.5),29 these groups were more physically active than others of a similar age . Over half (57.1%, n=32) of the respondents only 8.9% left in the first month (n=5), 12.5% during months 1 and 2 (n=7), 8.9% between months 2 and 3 (n=5), and 12.5% in months 3 and 4 (n=7). During the initial 4 months, most respondents attended class once (36.8%, n=21) or twice (47.4%, n=27) a week . Only eight respondents (14%) attended three classes a week and no one attended more than three . Many respondents attended a group session (53.6%, n=30) or a combination of group and individual work (10.7%, n=6), whereas 19.6% worked individually (n=11) and 16.1% had a personalized assessment (n=9). Ninety - three percent of respondents (n=52) were confident or very confident that they could complete the exercises included in the sessions . Only 7.2% were not confident (n=2) or not confident at all (n=2) in completing the exercises . Twelve percent described themselves as neither motivated nor not motivated (neutral) and 8.9% (n=5) as not or not at all motivated . The majority of respondents felt that they were given more than adequate (26.8%, n=15) or adequate (46.4%, however, 10% suggested that they were given inadequate (1.8%, n=1) or very inadequate (8.9%, n=5) support, and a further 16.1% (n=9) were neutral on this subject . Comments on where improvement could occur included: the instructor was more interested in their own exercise regime than considering the needs of their clients (n=2), the attention you received from the physio during the session depended on whether you were a patient at the practice or not and the instructors tended to respond to your questions rather than initiating any step - up in exercise . The instructor was more interested in their own exercise regime than considering the needs of their clients (n=2), the attention you received from the physio during the session depended on whether you were a patient at the practice or not and the instructors tended to respond to your questions rather than initiating any step - up in exercise . There were also a number of positive comments which included the following: staff being helpful and supportive (n=10), exercise individualized to my level and capabilities (n=4), and average group of 10 with an engaged and interested physio always present . Respondents were asked to rate the adequacy of the information provided about safety while they were participating in the resistance training program . In total, 88% said that the information was either adequate (n=25) or very adequate (n=20). Twelve percent rated safety information as inadequate (n=3) or very inadequate (n=3). These were coded into three subcategories, such as health, program / facility, and other . Injury (32.1%, n=18) was the most common reason to emerge for the respondents ceasing participation in a resistance training program . Table 1 shows the main categories, subcategories, and some example quotes from respondents . There were many reasons for discontinuing, and 22 of the 56 questionnaire respondents (39.3%) reported two or more reasons for withdrawing . The three most commonly reported reasons within the subcategories for withdrawing included illness, holidays, and the program not being suitable . Cost was only reported by two participants . Over three quarters of the respondents thought that the resistance training program was good (40.4%, n=23) or very good (36.8%, n=21) value for money . Ten percent found the cost barely acceptable (n=6), 1.8% poor (n=1), and 5.3% very poor (n=3). Only 36 respondents (64.3%) answered this question, the other 20 either left it blank (n=10) or reported none (n=10). Class time and places available within preferred classes were the most commonly identified negative aspects of the resistance training programs . Waiting for machines and equipment issues were also highlighted as well as poor staff support and the program not satisfying the participants . Table 2 shows the main categories, subcategories, and participant quotes of the most commonly reported negative aspects of participating in a resistance program . Although the blank responses cannot be interpreted, it is likely that those reporting the data were concept mapped to understand the flow of participation and withdrawal from the respondents (figure 1). This showed that there were several reasons why withdrawal occurred and there are opportunities to have older people participate again in the future . The map demonstrates the importance of the staff and facility in maintaining participation for this age group . When asked if they would like to return to the program in the future, 68.4% of the respondents (n=39) said that they would, 19.3% reported being unsure (n=11), and 12.3% were not interested (n=7) in participating again . The reasons given by those not interested in returning were time, not suitable, boring (waiting for machine and no interaction), cost, attending gym elsewhere, and not interested . The most common reasons why past participants said that they would like to return to a resistance training program in the future were enjoyment (26.3%, n=10), fitness (18.4%, n=7), gaining health benefits and exercises (13.2%, n=5 each), and if the instructor improved (7.9%, n=3). Other reasons provided by individual respondents included the following: in the new year when my health fund will pay more, i would like to join more general classes, possibly when i m not working and i intend to . In the new year when my health fund will pay more, i would like to join more general classes, possibly when i m not working and i intend to . Be able to return to the program at some point and around two thirds (67.3%, n=37) reported yes they would be able to, 21.8% were unsure (n=12), and 10.9% stated no (n=6). The reasons why respondents would return were similar to those described above, with additional reasons including: because i can or i am able to and if a class is available . Reasons given for not being able to return were the following: do nt want to, i m active in other areas, not with this set up at the center, and time and cost factors . Of the 293 questionnaires posted by the 15 gymnasiums, 56 were returned, a response rate of 19% . The mean age of respondents was 71.5 years (sd: 9.0), with over three quarters (79%, n=44) being female and 21% male (n=12). Almost all (95%, n=53) respondents lived in the metropolitan area . Over three quarters (79%, n=44) said that they had good (39%, n=22), very good (30%, n=17), or excellent (9%, n=5) physical health . The majority (87%, almost half were taking three or more prescribed medications (48%, n=27), with only 16% taking none (n=9). The mean pase score for the group was 119.5 (sd: 68.4), males: 156.8 (sd: 78.0) and females: 113.5 (sd: 63.2). Given the pase norms for 7075 year olds are males: 102.4 (sd:53.7) and females: 89.1 (sd:55.5),29 these groups were more physically active than others of a similar age . Over half (57.1%, n=32) of the respondents had attended the resistance program for> 4 months . Only 8.9% left in the first month (n=5), 12.5% during months 1 and 2 (n=7), 8.9% between months 2 and 3 (n=5), and 12.5% in months 3 and 4 (n=7). During the initial 4 months, most respondents attended class once (36.8%, n=21) or twice (47.4%, n=27) a week . Only eight respondents (14%) attended three classes a week and no one attended more than three . Many respondents attended a group session (53.6%, n=30) or a combination of group and individual work (10.7%, n=6), whereas 19.6% worked individually (n=11) and 16.1% had a personalized assessment (n=9). Ninety - three percent of respondents (n=52) were confident or very confident that they could complete the exercises included in the sessions . Only 7.2% were not confident (n=2) or not confident at all (n=2) in completing the exercises . Twelve percent described themselves as neither motivated nor not motivated (neutral) and 8.9% (n=5) as not or not at all motivated . The majority of respondents felt that they were given more than adequate (26.8%, n=15) or adequate (46.4%, n=26) support during their sessions . However, 10% suggested that they were given inadequate (1.8%, n=1) or very inadequate (8.9%, n=5) support, and a further 16.1% (n=9) were neutral on this subject . Comments on where improvement could occur included: the instructor was more interested in their own exercise regime than considering the needs of their clients (n=2), the attention you received from the physio during the session depended on whether you were a patient at the practice or not and the instructors tended to respond to your questions rather than initiating any step - up in exercise . The instructor was more interested in their own exercise regime than considering the needs of their clients (n=2), the attention you received from the physio during the session depended on whether you were a patient at the practice or not and the instructors tended to respond to your questions rather than initiating any step - up in exercise . There were also a number of positive comments which included the following: staff being helpful and supportive (n=10), exercise individualized to my level and capabilities (n=4), and average group of 10 with an engaged and interested physio always present . Respondents were asked to rate the adequacy of the information provided about safety while they were participating in the resistance training program . In total, 88% said that the information was either adequate (n=25) or very adequate (n=20). Twelve percent rated safety information as inadequate (n=3) or very inadequate (n=3). These were coded into three subcategories, such as health, program / facility, and other . Injury (32.1%, n=18) was the most common reason to emerge for the respondents ceasing participation in a resistance training program . Table 1 shows the main categories, subcategories, and some example quotes from respondents . There were many reasons for discontinuing, and 22 of the 56 questionnaire respondents (39.3%) reported two or more reasons for withdrawing . The three most commonly reported reasons within the subcategories for withdrawing included illness, holidays, and the program not being suitable . Thought that the resistance training program was good (40.4%, n=23) or very good (36.8%, n=21) value for money . Ten percent found the cost barely acceptable (n=6), 1.8% poor (n=1), and 5.3% very poor (n=3). Only 36 respondents (64.3%) answered this question, the other 20 either left it blank (n=10) or reported none (n=10). Class time and places available within preferred classes were the most commonly identified negative aspects of the resistance training programs . Waiting for machines and equipment issues were also highlighted as well as poor staff support and the program not satisfying the participants . Table 2 shows the main categories, subcategories, and participant quotes of the most commonly reported negative aspects of participating in a resistance program . Although the blank responses cannot be interpreted, it is likely that those reporting the data were concept mapped to understand the flow of participation and withdrawal from the respondents (figure 1). This showed that there were several reasons why withdrawal occurred and there are opportunities to have older people participate again in the future . The map demonstrates the importance of the staff and facility in maintaining participation for this age group . When asked if they would like to return to the program in the future, 68.4% of the respondents (n=39) said that they would, 19.3% reported being unsure (n=11), and 12.3% were not interested (n=7) in participating again . The reasons given by those not interested in returning were time, not suitable, boring (waiting for machine and no interaction), cost, attending gym elsewhere, and not interested . The most common reasons why past participants said that they would like to return to a resistance training program in the future were enjoyment (26.3%, n=10), fitness (18.4%, n=7), gaining health benefits and exercises (13.2%, n=5 each), and if the instructor improved (7.9%, n=3). Other reasons provided by individual respondents included the following: in the new year when my health fund will pay more, i would like to join more general classes, possibly when i m not working and i intend to . In the new year when my health fund will pay more, i would like to join more general classes, possibly when i m not working and i intend to . Be able to return to the program at some point and around two thirds (67.3%, n=37) reported yes they would be able to, 21.8% were unsure (n=12), and 10.9% stated no (n=6). The reasons why respondents would return were similar to those described above, with additional reasons including: because i can or i am able to and if a class is available . Reasons given for not being able to return were the following: do nt want to, i m active in other areas, not with this set up at the center, and time and cost factors . The respondents in this study stopped attending resistance training programs for a number of reasons . Most commonly reported reasons were the result of injury or illness, going away on holidays, and issues at the facility (eg, class not available including type, age range, and times; waiting for machines; and poor staff support). Previous research that explored the barriers preventing older people participating in resistance training and exercise, in general, also found injury and pain to be common reasons for nonparticipation, together with feeling too old and not being interested.16,17,30 it is unknown how many of the injuries occurred due to taking part in resistance training or for some other reason, such as falling downstairs on holiday . However, regardless of the reason and depending on the injury and also illness (which was the second most common response), it may be possible for the older person to still attend (either immediately following the injury or illness or after a period of time) but be given a modified program to accommodate any new exercise constraints associated with their injury or recovery . Illness for an older person can often make it difficult to bounce back and for some continuing with activities of daily living and living independently becomes challenging . Fitness center and other health professionals should be aware that this may occur and provide regular advice, support, and referral to the appropriate health professional . It is also recommended that facilities provide screening for past injuries to reduce the likelihood of previous injuries reoccurring . Regular physical activity and resistance training for improving strength, if appropriately moderated, can assist the older person to return to better health and fitness at a faster rate.4,31 indeed, national physical activity guidelines for older australians recommend older people who have stopped physical activity, or who are starting a new physical activity, should start at a level that is easily manageable and gradually build up the amount, type, and frequency of activity.32this study did not explore whether it is already common practice for fitness centers / others running resistance programs to follow - up those who cease participation and encourage them back with a program designed to help them regain fitness after injury or illness . This warrants further research, especially the costs and benefits for both the centers and participants . Older people who have stopped physical activity, or who are starting a new physical activity, should start at a level that is easily manageable and gradually build up the amount, type, and frequency of activity.32 holidays were the third most commonly reported reason for withdrawing from the resistance training program . Unlike people working full - time who receive 4 weeks annual leave a year (in australia and less elsewhere), some older people have the option of holidaying for much longer periods of time . A proportion of older people in australia are well known for taking driving holidays to the northern parts of australia for up to 34 months each year to avoid the cold winters.33 older people in the usa do something similar in moving to the southern states of the usa,33 and many british seniors have spent prolonged periods of time in spain.34 it may be that the lengths of these long breaks make it difficult to recommence resistance training when settling back home; especially, if it was necessary for the older person to withdraw rather than suspend their program membership when they were away . If this is the case, one strategy to help would be for gymnasiums and fitness centers to consider flexibility with their memberships, allow long suspensions, and make a personalized phone call to the older person on their return to encourage them back to the program . Of note, over 65% of the people were keen to return to the program so a personalized phone call or written invitation may well be a means of easily getting these people to return . Some of the participants also identified issues with the gymnasium or fitness center programs as being the reason(s) they stopped participating . These issues included distance to travel to the program, class times and availability not suitable, dissatisfaction with the instructor, the facility being overcrowded, and the program provided not being suitable . Older instructors are often more able to relate to this target group, and research has shown that using peer leaders (older instructors) can be beneficial.3538 using peer leaders could also provide a competitive point of difference for their business . There are obvious requirements for training and support for peer exercise trainers that would need to be considered . Fitness facilities staff often put sessions for older people in off - peak times (late morning, middle of the day, and early afternoon) thinking older people can attend at any time . Yet, many older people have multiple commitments and interests such as looking after grandchildren, doing volunteer or paid work, and attending classes, and as a result, prefer sessions to be held earlier in the mornings or later in the afternoon.21,39 with the projected increase in the proportion of people aged> 60 years in the forthcoming decades, businesses need to be flexible and consider the needs and preferences of this important and growing target group . This study had several limitations that need to be considered . The low - response rate to the questionnaire may limit the generalizability of the findings . Because of privacy reasons, we were not able to contact the participants directly to follow - up on their completion of the survey, to interview them as a form of member checking, or to explore their responses in more depth . Also, sections of the tool were nonvalidated because of this type of study not having been undertaken with this population previously; therefore, it was not possible to use a validated tool . The authors also had no knowledge about participants health and injury status prior to them commencing participation resistance training . Despite these limitations, this is the first study to actually look at a population of seniors who recently stopped attending a structured resistance training program of their own accord after having participated for a period, and we believe that it provides useful information for resistance training providers running programs for older people . The number of older people participating in the recommended minimum two resistance training sessions a week is currently fewer than one in six.79 this needs to increase so more older people can experience some of the many benefits that have been shown to be associated with resistance training . Providing those working in this area with as much information as possible about older people s needs, preferences, and motivations is, therefore, essential if this needs to be achieved . This study identified reasons why older people who had been participating in resistance training for a period of time ceased taking part . Injury, illness, holidays, and issues with the resistance training program, center, or staff were the most commonly reported reasons for stopping . To reduce the number of older people leaving resistance training programs, it is suggested that gymnasiums and fitness centers provide ongoing advice for prevention and return to training after injury and flexible programs and services (membership types) that accommodate older people s life choices in retirement.
Very rarely, haemorrhage caused by trauma or bleeding tendency forms cyst - like lesions in the potential space surrounding vessels . In the oral and maxillofacial region, these lesions are known by a variety of names, including traumatic bone cyst, solitary bone cyst and simple bone cyst, and intramedullary haemorrhage of the jaw is the most accepted pathogenetic theory . Most cases of maxillofacial haemorrhagic bone cysts are asymptomatic and do not cause expansion of the cortical bone; however, expansion of the maxillofacial cyst caused by intra - cystic bleeding presents with serious symptoms . A case of mandibular cyst causing paraesthesia of the mental region this incidental clinical state was caused by spontaneous haemorrhage into the pre - existing cyst . We report a case of maxillary cyst presenting with mid - facial deformity where the patient had previously undergone maxillary sinus surgery and later suffered trauma of the cheek region . We also discuss the pathogenesis of this unusual case and the outcome of our treatment . Epilepsy was diagnosed, and her history included bilateral caldwell luc surgery 21 years earlier and trauma to the left cheek region 4 years earlier . Nasal endoscopic surgery was performed 2 years after the injury, by an otolaryngologist, but her symptoms persisted after the surgery . Physical examination revealed a non - tender, hard swelling of the left nasal wing from which serosanguineous fluid was aspirated by fine needle (fig . 1). Intraoral examination showed a soft palatal expansion and on panoramic radiography, the identified cyst had no relation to the neighbouring teeth . Computed tomography showed a trilocular cyst in the left maxillary region (fig . 2). A clinical diagnosis of surgical ciliated cyst was made, and facial osteotomy and cyst enucleation were performed under general anaesthesia . Lateral rhinotomy provided excellent exposure of the expanded cortical bone, which was removed carefully with a bone chisel . Serosanguineous fluid filled the cyst cavity just below the surface; however, palatal and nasal cyst cavities contained straw - coloured fluid . The cyst was enucleated, and the facial wound was closed primarily (fig . Histopathological examination showed that all cyst walls were lined by ciliated columnar epithelium, which was consistent with surgical ciliated cyst (fig . The patient showed no signs of recurrence at the end of a 20-month follow - up, and the postoperative appearance was excellent (fig . Figure 1:appearance of the swelling in the left nasal wing at the initial examination . Figure 2:computed tomographic appearance . (a) axial computed tomographic section showed a well - defined trilocular cyst in the left maxillary region extending to the cortical plate . (b) three - dimensional computed tomographic image showing a defect in the nasal lateral wall haematoxylin and eosin staining showing pseudostratified ciliated epithelium lining the cyst wall (original magnification 200). Appearance of the swelling in the left nasal wing at the initial examination . Computed tomographic appearance . (a) axial computed tomographic section showed a well - defined trilocular cyst in the left maxillary region extending to the cortical plate . (b) three - dimensional computed tomographic image showing a defect in the nasal lateral wall . Haematoxylin and eosin staining showing pseudostratified ciliated epithelium lining the cyst wall (original magnification 200). Informed consent was obtained from the patient's family to publish the details of her case, including photographs and other identifying information . We report a unique case of a maxillary cyst that deformed the overlying mid - face, with buccal trauma as the initiating cause . Based on the patient's history, it is obvious that the buccal trauma led to the lesion presenting as an unusual tumour . External injury can cause radicular cysts; however, in this case, the affected maxillary region was not related to the neighbouring teeth . Histopathology findings confirmed that all cyst walls indicated a surgical ciliated cyst, which is one of the most common maxillary cysts in japan, and it can result from delayed complication of maxillary sinus surgery, trauma or infection . In cases that follow radical sinus surgery, the initial presentation is typically expansion of vestibular or palatine bone cortical plates with only mild clinical abnormalities of the face . Because the patient had a previous history of bilateral sinus surgery and 19 years had passed since the maxillary surgical procedure, it seems reasonable that the surgical ciliated cysts were already present at the time of the initial cheek injury . The lesion consisted of three cavities, and only the facial portion was found to contain haematoid fluid, suggesting that the increased intra - cystic pressure caused by traumatic haemorrhage induced expansion of the lesion . To our knowledge, ours is the first report of maxillary haemorrhagic cyst augmentation presenting with mid - facial deformity . Although this is a secondary phenomenon, we consider this is a haemorrhagic cyst in the broadest sense . There is fairly general agreement that marsupialization is an effective and less invasive treatment for surgical ciliated cyst; however, complete resolution followed by regeneration of normal bone requires an appreciable period . In our case, immediate correction of the facial deformity was absolutely necessary; therefore, facial osteotomy concurrent with the cyst enucleation was considered the best approach . Usually, resection of maxillary cysts is similar to the technique and approach used with the basic caldwell luc procedure, which is suitable for treatment of benign maxillary tumours, chronic empyema, fractures and exploration of the maxillary sinus; however, the caldwell luc procedure provides an inadequate approach to the nasal cavity . In our case, because the cyst extended to the middle meatus, good exposure of the nasal lateral wall was essential . The lateral rhinotomy approach allows wide access to the mid - facial region . Wide exposure minimizes the surgical invasion, bleeding is readily controlled and the postoperative appearance is excellent . We found that bleeding in a pre - existing maxillary cyst can potentially lead to expansion of the lesion and deformation of the face.
Pandemic and seasonal influenza result in significant morbidity, increase in hospitalization rate and mortality . Even though influenza is usually mild and self - limited disease, among certain population groups, such as elderly people, very young children and patients with different underlying medical conditions (diabetes, cardiovascular and pulmonary comorbidities, and other chronic diseases) the pandemic had started in april 2009 in mexico and spread worldwide . During 2010 - 2011 epidemic, according to the who report from countries of european union, about 90% of subtyped influenza viruses from the hospitalized cases were pandemic strain of a (h1n1), 1%-a(h3n2) and 10%-influenza b viruses . Unlike the seasonal influenza, during the 2009 pandemic the higher attack rates were documented among young adults compared to persons older than 60 [3, 4]. For both influenza seasons, neuraminidase inhibitors were recommended for treatment of pregnant women, children under two years, patients with severe, progressive disease, and for those having underlying chronic diseases . The objective of the study was to estimate mortality and underlying medical conditions among patients with influenza during 2009 - 2010 and 2010 - 2011 seasons in georgia . The country started influenza surveillance from 2007 when georgian national center for disease control and public health (ncdcph) became the national influenza center, a part of who global influenza surveillance network . We analyzed the data from ncdcph where the samples from outpatients with influenza - like illness (ili) and inpatients with severe acute respiratory syndrome (sari) from sentinel sites throughout the country are referred to be tested for influenza virus . The following case definitions were used: ili was defined as acute onset of fever> 38c, and cough and/or sore throat in the absence of other diagnosis . Sari was defined as acute onset of fever> 38c, cough and/or sore throat and signs of respiratory distress requiring hospitalization . For ili the time interval between sampling and onset of symptoms was defined as <72 hours . Each primary health care provider was responsible to collect specimens 2 times per week from all the patients seeking for medical assistance that day and who satisfied case definition . Specimens were placed into appropriate transport media and delivered to the laboratory using cold packs . Influenza virus rna was extracted from 140 l of each clinical specimen using qiamp viral rna mini kit (qiagen, germany) according to the manufacturer's instructions . Viral rna detection was performed using primers and probes provided by us centers for disease control and prevention . Cdc protocol for real - time rast - pcr was used for roche light cycle 2.0 . For the patients with lethal outcome detailed demographic and medical information collected medical data included underlying chronic disease, clinical diagnosis, and treatment and vaccination history . During the 2009 - 2010 influenza pandemic the total number of the laboratory - confirmed influenza cases was 1286 (table 1). The majority of registered cases were within the age groups of 514 and 1529 . During the 2010 - 2011 influenza epidemic the predominating virus was still h1n1 (51.4% of all registered cases) with 48.5% typed as influenza b. only one influenza case was related to h3n2 . The laboratory confirmation rates for patients with ili were 12.6% and 25% for 2009 - 2010 and 2010 - 2011 seasons, respectively . Among patients with sari laboratory confirmed influenza was diagnosed in 26% in 2009 - 2010 and 31% in 2010 - 2011 . The overall mortality among patients with laboratory confirmed influenza cases was 2.56% and 3.65% during 2009 - 2010 and 2010 - 2011 seasons, respectively . Among patients with influenza type a the proportion of lethal outcome was 3.25% and 2.57%for type b. the mean age of patients with influenza - associated deaths was 46.7 for type a influenza virus and 62.4 for type b virus (p = 0.012). The absolute number of deaths due to influenza a was highest in the age group of 3064 years (51.5% and 65.5%, resp ., out of total number of deaths in 2009 - 10 and 2010 - 11), but the case fatality ratio was highest in the age group 65 + during both seasons11.1% and 14.7%, for 2009 - 2010 and 2010 - 2011, respectively . For influenza type b absolute number of deaths as well as case fatality ratio was highest in the age group of 65 and older (67% out of total number of deaths with 18.8% case fatality ratio). Total numbers of influenza - related deaths were 33 and 44 during 2009 - 2010 and 2010 - 2011 seasons, respectively (table 1). At least one underlying medical condition was reported in 70.7% of deaths related to pandemic influenza strain and 96% of deaths related to influenza type b (table 2). 19% of patients with influenza type a and 68% of patients with influenza type b had coronary heart disease . Other predominating preexisting conditions among lethal cases with pandemic influenza strain were pregnancy (8.6%), diabetes (13.8%), obesity (10.3%), and neurological disorders (8.6%). Although the majority of individuals with lethal outcome (83%) were treated with neuraminidase inhibitors, none of them had received antiviral therapy within the first 48 hours of illness . Mortality data of the two influenza seasons demonstrate that younger patients were at risk for pandemic influenza a (h1n1) associated death compared to seasonal influenza b where most of the fatal cases were observed among elderly people . The finding is consistent with the data on pandemic influenza associated death from other countries, reporting that about 90% of death cases were registered among those younger than 65 . The majority of lethal cases occurred among patients with underlying medical conditions (only 21.7% of death among previously healthy people). Numerous studies report the similar finding of higher risk for influenza associated complications and hospitalizations among those with different chronic diseases [7, 8]. The us cdc clinical case series among patients hospitalized with a(h1n1) infection showed that 67% of patients had underlying medical condition . All these emphasize the public health importance of influenza vaccination among persons from high risk groups (such as pregnant women and patients with chronic diseases). As our study showed, none of the patients with influenza associated deaths were vaccinated . Influenza vaccine is available at the vaccination centers throughout the country, but it is underutilized and only small proportion of the population is usually vaccinated . No systematic approach is used to vaccinate high risk groups and health care workers . Besides, in all fatal cases the institution of antiviral therapy was delayed beyond the 48 hour threshold, possibly contributing to the grim outcome . Early antiviral treatment when indicated should be advocated among primary care physicians to promptly initiate the therapy in order to avoid complications and reduce the lethal outcomes.
Ulcerations are characterized by defects in the epithelium, underlying connective tissue, or both . Due to diversity of causative factors and presenting features, diagnosis of oral ulcerative lesions might be quite challenging [14]. This narrative review paper, however, focuses on the duration and the number of lesions in order to build a diagnostic decision tree . For the purpose of this article, if an ulcerative lesion lasts for two weeks or longer, it is considered chronic; otherwise, it is regarded as an acute ulcer [1, 2]. Recurrent ulcers, on the other hand, present with a history of similar episodes with intermittent healing . The term solitary indicates the presence of a single ulcerative lesion whereas the term multiple describes the presence of several ulcerative lesions . In order to arrive at a definitive diagnosis, this is the cognitive process of integrating logic and knowledge into a series of stepwise decisions . All lesions that cannot be excluded initially should be included in the differential diagnosis, followed by laboratory tests and additional investigations to narrow the diagnosis . According to the literature, many cases of oral malignant ulcerations were misdiagnosed as nonneoplastic lesions up to several months before the definite diagnosis was established [68]. Valente et al . Reported a case of squamous cell carcinoma misdiagnosed as a denture - related traumatic ulcer . Meanwhile, de sant' ana dos santos et al . Reported misdiagnosis of lip scc as actinic cheilitis . A case of gingival scc masquerading as an aphthous ulcer was also reported by kumari et al . . This time elapse might jeopardize patients' overall prognosis; therefore, attempts should be done to come to timely diagnosis via more logical routes such as decision trees rather than test - and - error methods . A decision tree is a flowchart that organizes features of lesions so that the clinician can make a series of orderly decisions to reach a logical conclusion . To use the decision tree, the clinician begins from the left side of the tree, makes the first decision, and proceeds to the far right of the tree, where the names of entities are listed [9, 10]. This narrative review article aims to introduce an updated decision tree for diagnosing oral ulcerative lesions on the basis of their diagnostic features . General search engines and specialized databases including pubmed, pubmed central, medline plus, ebsco, science direct, scopus, embase, and authenticated textbooks were used by the first author and the corresponding author to find relevant topics by means of mesh keywords such as oral ulcer, stomatitis, and mouth diseases . Related english - language articles published since 1983 to 2015 in both medical and dental journals including reviews, meta - analyses, original papers (randomized or nonrandomized clinical trials, prospective or retrospective cohort studies), case reports, and case series on oral ulcers, stomatitis, and oral disease were appraised . Out of a total of 105 relative articles, 34 were excluded due to lack of full texts or being written in languages other than english . Finally, 4 textbooks and 71 papers were selected including 32 reviews, 27 case reports or case series, and 12 original articles (figure 1). In this narrative review article, oral ulcerative lesions were categorized into three major groups: acute, chronic, and recurrent ulcers (tables 13) and into five subgroups: solitary acute, multiple acute, solitary chronic, multiple chronic, and solitary / multiple recurrent, based on the number and duration of lesions . In total, 29 entities were organized in the form of a decision tree (figure 2) in order to help clinicians establish a logical diagnosis by stepwise progression . The first decision to be made is whether the ulcerative lesion is of an acute, chronic, or recurrent nature; thereafter, the lesion(s) should be placed in one of the five subgroups . Then, the clinician can consult the list of diagnoses in the relevant category . They are caused by mechanical damage (contact with sharp foodstuff; accidental biting during mastication, talking, or even sleeping) and thermal, electrical, or chemical burns . Traumatic ulcers are most common on the tongue, lips, and buccal mucosa . According to chen et al ., traumatic lesions of the oral cavity were mostly seen on the buccal mucosa (42%), followed by the tongue (25%) and the lower lip (9%). Noteworthy, traumatic ulcers are more common in men than women (male: female ratio of 2.7: 1). These lesions may persist for a few days or even several weeks, especially in the case of tongue ulcers due to repeated insults to the tissues [5, 33]. The borders of traumatic ulcers are usually slightly raised and reddish, with a yellowish - white necrotic pseudomembrane that can be readily wiped off (figure 3). Traumatic ulcers normally become painless within three days after the injury had been eliminated and, in most cases, heal within 10 days . Necrotizing sialometaplasia . Necrotizing sialometaplasia (ns) is a self - limiting, benign, inflammatory disease of the salivary glands more frequently seen in middle - aged men . Although the main etiology is not clear; many authors believe that local infarction due to ischemia of the salivary tissue is the causative factor . Meanwhile, a number of potential predisposing factors have been suggested such as sharp direct local trauma (local anesthesia, intubation, and surgical procedures), use of ill - fitting dentures, violent or provoked vomiting (in patients with bulimia), upper respiratory infection, and radiotherapy [11, 34]. Ns appears as a crater - like ulcer with indurated and well - delineated borders . More than 75% of all cases occur on the posterior part of the palate, followed by the lower lip, retromolar pad, sublingual region, tongue, and larynx [11, 34]. The size of the lesion ranges from less than 1 cm to over 5 cm . However, complete healing is usually observed only after five to seven weeks [11, 34]. Primary herpetic gingivostomatitis . Primary herpetic gingivostomatitis is the most common pattern of symptomatic herpes simplex virus (hsv) infection . Over 90% of cases it can be asymptomatic or very mild in young patients but is associated with more severe general symptoms in the elderly . Most cases occur between the ages of six months and 5 years, with peak prevalence between 2 and 3 years . Oral manifestations consist of a generalized gingivitis followed, after 2 - 3 days, by pin - headed vesicles that readily rupture and give rise to painful ulcers covered by a yellowish pseudomembrane . Can be affected, and the number of the lesions is quite variable . In many cases, punched - out erosions along the free gingival margin have been reported . Submandibular lymphadenitis, halitosis, and difficulty in swallowing are noted in most cases [13, 35]. In addition, involvement of the oral mucosa anterior to waldeyer's ring is encountered in roughly 10% of patients . The ulcers usually heal spontaneously after 5 to 7 days, with no scarring, but may persist for two weeks in severe cases [13, 35, 36]. Herpes zoster infection (shingles). Herpes zoster infection (hzi) is a less common viral infection brought about by the reactivation of varicella zoster virus (vzv) [14, 37, 38], which may happen spontaneously or as a result of immune system deficiency . Increased age, trauma (from dental procedures), psychological stress, malignancy, radiotherapy, and immunocompromised conditions such as organ transplantation, immunosuppressive therapy, and hiv infection are contributory factors for vzv reactivation . The incidence of hzi is 1.53 cases per 1,000 persons, which increases to 10 per 1,000 in people over 75 years of age [15, 37]. Majority of hzi involve the thoracic and lumbar dermatomes, but nearly 13% of patients present with involvement of the trigeminal nerve branch, most commonly the ophthalmic branch . The condition is acutely painful and patients with involvement of the maxillary branch experience a prodromal phase of unilateral pain, burning, and tenderness, usually on the palate (figure 4). After several days, painful, clustered ulcers of 15 mm in diameter appear on the hard palate or buccal gingivae in a characteristic unilateral pattern . Development of blisters and ulcers on the mandibular gingivae and tongue is indicative of mandibular branch involvement . This entity is self - limiting, and management of oral lesions is directed toward pain control, supportive care, and hydration . Use of acyclovir, valacyclovir, or famciclovir is also effective in treating hzi when started within 72 hours of disease onset [3, 13]. Herpangina presents as multiple vesicular exanthema and ulcers of the oropharynx, soft palate, and tonsillar pillars [16, 17] (figure 5). Children under 10 years of age are usually affected, and outbreaks occur in epidemics in summer . Coxsackie virus a genotypes 110 (cav110), a12, a16, and a22 and coxsackie virus b genotypes (cbv25) and echo virus 18 and entero virus 71 identified as etiologic factors . It is a self - limiting disease and management directed toward control of oral pain and fever . Hand - foot - and - mouth disease (hfm) is one of the common causes of morbidity among children below 10 years of age [16, 39]. All of the patients have skin rash, especially on the hands and feet and 30% on the buttocks . Oral ulcers are usually located on the tongue, hard and soft palate, and buccal mucosa . It is characterized by irregular red macules, papules, and vesicles that coalesce with each other to grow larger and make plaques on the skin called target lesions . Oral lesions usually appear as erythematous macules on the lips and buccal mucosa, followed by bullae and ulcerations with irregular borders and inflammatory halo . Bloody encrustations can be observed on the lips, which is a diagnostic feature [18, 41]. Em can be triggered by medications such as sulfonamide, penicillin, cephalosporins, quinolones, analgesics, and nonsteroidal anti - inflammatory drugs (nsaids) or several infections (herpes simplex virus, epstein - barr virus, cytomegalovirus, varicella zoster virus, fungal agents, and parasites). Em typically affects young adults (2040 years) and teenagers, but the onset might be as late as 50 years of age or elder . There is a male predilection with male to female ratio of 3: 2 . According to recent evidence, em has been categorized as minor, major, steven - johnson syndrome or toxic epidermal necrolysis . Prodromal signs such as fever, lymphadenopathy, headache, malaise, cough, and sore throat may be noticed one week prior to onset of mucocutaneous erythema or blisters [18, 40, 41]. Treatment mainly depends on the severity of clinical presentations . In the mild forms, healing takes place within 10 to 20 days; therefore, patients only need local wound care, liquid diet, and topical analgesics or anesthetics for pain control [40, 41]. Necrotizing ulcerative gingivitis . It is characterized by punched - out ulcerations, and necrosis on the papillary and marginal gingivae (figure 6) as well as severe gingival pain and bleeding [19, 43]. There are some predisposing factors such as smoking, poor oral hygiene, preexisting gingivitis, malnutrition, psychological stress, and hiv infection . The above - mentioned factors usually lead to immunodysregulation including depressed polymorphonuclear leukocytes, antibody response, and lymphocyte mitogenesis . Nug usually affects young adults (1820 years of age), and it is estimated to be seen in 0.5% to 11% of the population [19, 43]. The diagnosis of nug is based on three essential symptoms: sore gums, bleeding gums, and, the most diagnostic criterion, ulceration and necrosis of the interdental papillae . Treatment is based on mechanical removal of tartar with local (chlorhexidine, 0.12% twice daily) and systemic (amoxicillin 250 mg and metronidazole 250 mg, three times a day for 7 days) delivery of antimicrobial agents . Healing is expected in a few days, whereas inadequate treatment can lead to deterioration of lesions in the form of necrotizing ulcerative periodontitis (nup) [19, 43]. Oral hypersensitivity reactions . Oral hypersensitivity reactions (ohrs) have a variety of manifestations: acute onset of em ulcers, red and white reticular lesions such as lichenoid reactions, fixed drug eruption (usually seen as ulcers on the lip vermilion after exposure to drugs with resolution on withdrawal and relapse on rechallenge), swelling of the lips, and oral allergy syndrome (itching with or without swelling of oral structures and oropharynx) [3, 44, 45]. Plasma cell stomatitis (pcs) was first described in the late 1960s and early 1970s as a hypersensitivity reaction and likely a contact stomatitis to a component of chewing gum . This entity usually occurs few days after exposure and presents as erythematous macular areas of oral cavity . Angular cheilitis with fissuring and dry atrophic lips have been found in patients with pcs . Nevertheless, pain control and anti - inflammatory agents can help diminish the healing time [3, 44, 45]. Chemotherapy - related ulcers . Bone marrow suppression and immune response of oral mucosa, which leads to bacterial, fungal, or viral infections, happen during indirect effect of chemotherapeutic agents . Other medications cause oral ulcerative lesions via direct impact on replication and growth of the oral epithelial cells [3, 46]. Kolbinson et al . Demonstrated that early changes in the oral mucosa such as erythema and ulceration appear between 5 and 7 days after onset of chemotherapy . It is also noted that these lesions are considered as risk factors for systemic infections . After completion of chemotherapy, the lesions resolve spontaneously; however, anti - inflammatory drugs may be useful in minimizing chemotherapy - related ulcers [3, 46]. Chronic injuries of oral mucosa may lead to solitary long standing ulcerative lesions; therefore, traumatic ulcer can also be classified as a chronic solitary ulcer . This entity has been reported by pattison as a self - inflicted gingival lesion in patients who were seeking prescriptions for narcotic drugs . Chronic traumatic ulcerations usually occur on the tongue, lips, and buccal mucosa as ulcerative areas surrounding a central removable, yellow fibrinopurulent membrane . In many cases, the lesion develops a raised, rolled border of hyperkeratosis immediately adjacent to the area of ulceration [11, 51, 52]. However, some lesions persist for several weeks because of continued traumatic insults, irritation by the oral liquids, or secondary infection . There are different treatment modalities, but coating the ulcerated surface with fluocinonide or triamcinolone acetonide in an emollient base after meals and before bed time usually relieves pain and decreases duration of healing . Although this lesion usually occurs on the palate, it can be seen anywhere from oral mucosa, which contains salivary glands including the retromolar trigon and the lips . Ns initially presents as a tender erythematous nodule, followed by a deep ulcer with a yellowish base . It resembles squamous cell carcinoma and ulcerated mucoepidermoid carcinoma to a large extent during its ulcerated phase . Ns is mainly a self - limiting lesion, and healing time may be varied from 2 to 12 weeks according to the severity of the lesion [5, 11, 34]. Therefore, ns can be classified as an acute or chronic solitary ulcer . Eosinophilic ulcer . Eosinophilic ulcer (eu) or traumatic ulcerative granuloma with stromal eosinophilia (tugse) is a chronic solitary ulcer of oral mucosa, which is most frequently seen in patients aged 4060 years, but occurs in young and elderly patients as well . Male to female ratio is 1: 1, or slightly more prevalent in women . The most frequently affected site is the tongue (about 60% of cases), followed by buccal mucosa, retromolar region, floor of the mouth, and lips [3, 21]. Eosinophilic ulcer manifests as a slow - healing ulcer with a rolled or elevated border mimicking a squamous cell carcinoma (figure 7). They ranged from 0.5 to several cm in size . In two - thirds of cases, the main etiology is not clear, but trauma has been elicited in 20% to 50% of cases . In addition, intralesional corticosteroids, oral corticosteroids, topical antibiotics, and cryotherapy have been also suggested . Ulcerative squamous cell carcinoma . Squamous cell carcinoma (scc) represents about 95% of all oral malignancies [22, 54]. It presents as a red, white, red - white, exophytic, or ulcerative lesion . Scc is a persistent ulcer in the oral cavity, which is of high importance especially on the lips . Scc is often asymptomatic; therefore, patients usually are not aware of it until it has become relatively progressive . The classic ulcerative scc is described as a craterlike lesion having a rolled, indurated border and a velvety base (figure 8). It may be covered with a crust when occurring on the vermilion [5, 22]. The mostly affected sites in the oral cavity are lower lip, floor of the mouth, and ventral and lateral borders of the tongue . Lesions are usually solitary, but in rare cases multifocal . According to wood and goaz, a lesion is most likely a scc if the patient is male, older than 40 years, smokes or drinks heavily, no evidence of trauma or systemic disease exists, serologic findings are negative, and the lesion is not located on the posterolateral region of the hard palate . Ulcerative form of scc is locally destructive; thereby timely and correct diagnosis of oral scc plays a key role in the improvement of patients prognosis and survival rate [3, 55]. There is no single treatment for oral scc; however, various therapeutic modalities from surgery, radiotherapy, and chemotherapy to combination different methods have been introduced . Cytomegalovirus - related ulcers occur more commonly under conditions of significant immunodeficiency, especially severe hiv disease [3, 55]. Oral ulcers are usually single, painful, large, and necrotic, with minimally rolled border, which affects keratinized and nonkeratinized mucosa . On rare occasions, some granulomatous diseases such as tuberculosis and leprosy can cause ulcerative lesions in the oral cavity [23, 56, 57]. The world health organization (who) has estimated 9.4 million incident cases and 11.1 million prevalent cases of tb globally [23, 57]. Tuberculosis rarely affects oral mucosa, roughly 1.4% of all tb cases with a male to female ratio of 4: 1 . The classic oral lesion presents as a solitary ulcer usually with an undermined edge most commonly on the tongue, followed by gingivae, floor of the mouth, palate, lips, and buccal mucosa . Meanwhile, it may be ragged and indurated and is often painful [24, 25]. The differential diagnosis of tuberculous ulcer includes traumatic ulcer, syphilitic ulcer, and oral scc . Primary syphilitic ulceration usually occurs as a result of orogenital or oroanal contact with an infectious lesion . Almost one to three weeks after acquisition, a chancre develops as a solitary ulcer usually on the lips or rarely on the tongue, pharynx, or tonsils . The upper lip is more commonly affected in males and the lower lip in females, probably due to the anatomy involved with fellatio and cunnilingus . The ulceration is usually deep, with a red purple or brown base ragged rolled border, and usually an accompanying cervical lymphadenopathy . Detailed history of sexual and social life style helps approach the diagnosis of primary syphilis [26, 58, 59]. Deep fungal ulceration (histoplasmosis, blastomycosis, and mucormycosis). Oral mucosal lesion in histoplasmosis is usually secondary to pulmonary involvement and occurs in a significant percentage of patients with disseminated histoplasmosis . The most frequent feature of oral blastomycosis is a nonspecific, painless, verrucous ulcer with indurated borders, often mistaken for oral scc . The most common oral sign of mucormycosis is ulceration of the palate, which results from necrosis due to invasion of a palatal vessel . Lesion has also been observed on the gingivae, lips, and alveolar ridge . Some vesiculobullous diseases such as pemphigus vulgaris (pv), mucous membrane pemphigoid (mmp), and bullous pemphigoid (bp) present as multiple and chronic oral ulcerative lesions . Pemphigus vulgaris (pv) is a chronic vesiculobullous mucocutaneous autoimmune disease characterized by loss of cell adhesion (acantholysis) and blister formation . About 90% of patients with pv develop oral lesions, and in more than 50% of cases they are the first sign of disease . The edge of lesions continues to extend over a period of weeks until they involve large areas of oral cavity . The lesions usually start on the buccal mucosa; however, palate and gingivae are other commonly affected sites . Gingival involvement might be in the form of desquamative gingivitis, which is a characteristic feature for pv . There is a small group of pv patients whose disease remains confined to the oral cavity . Early diagnosis is an important aspect of patient management when lower doses of medication can be used for shorter periods of time to control the disease . The mainstay of treatment remains high doses of systemic corticosteroids, usually given in dosages of 1 to 2 mg / kg / d [3, 60]. Mucous membrane pemphigoid (mmp) has been known by different names including benign mucous membrane pemphigoid, cicatricial (scarring) pemphigoid, and ocular cicatricial pemphigoid . Mmp is a common immune - mediated subepithelial blistering disease mainly affecting oral mucosa (over 90%); however, skin lesions are also present in 20% to 30% of cases . The most affected site in the oral cavity is gingivae followed by buccal mucosa and palate . It occurs twice as frequently in females and is generally seen in patients more than 50 years old [3, 5, 62, 63]. Desquamative gingivitis is the most common presentation of the disease, which can be the only feature of mmp . Blood blisters which result from bleeding into bullae are a diagnostic feature of mmp in the oral cavity . Bullous pemphigoid (bp) is the most common subepithelial blistering disease, which occurs chiefly in patients over the age of 60 . In this entity,, oral mucosal lesions are found in only 16.6% of cases, which are similar to pv but are smaller and less painful . Meanwhile, extensive labial involvement which is common in pv is not present in bp . Desquamative gingivitis has been mentioned as the most frequent oral manifestation in bp and gingivae may be the only affected site . Clinically, oral lesions are not distinguishable from pv or mmp, but early remission of bp is more common [64, 65]. Noteworthy, bp has been reported in conjunction with other diseases such as multiple sclerosis, malignancies, or medications particularly diuretics . Bullous pemphigoid is self - limiting and may last from a few months to 5 years . Topical clobetasol or betamethasone has been suggested in the management of localized oral lesions, whereas, in more extensive disease, use of systemic corticosteroids alone or in combination with immunosuppressive drugs is recommended [3, 64]. Lichen planus (lp). Lichen planus (lp) is a chronic, autoimmune, mucocutaneous disease . Most lp patients are middle - aged, and it is rare in children . The disease occurs more commonly in women than in men with a female / male ratio of approximately 2: 1 . The reported prevalence of lp is up to 5%, while the prevalence of oral lp (olp) is 0.1% to 2.2% [28, 66]. There are different subtypes of olp with different clinical presentations: reticular (lace - like keratotic mucosal configuration, wickham's striae), atrophic (keratotic changes combined with mucosal erythema), erosive / ulcerative (pseudomembrane covered ulcerations combined with keratosis and erythema), bullous (vesiculobullous presentation combined with reticular or erosive patterns), and popular / plaque like (keratotic changes with elevation adjacent to the normal mucosa) (figure 9). Reticular, popular, and plaque - like lesions are generally asymptomatic whereas bullous, erosive and ulcerative forms are generally associated with pain the most frequently affected site in the oral cavity is buccal mucosa, followed by the tongue, gingivae, palate, and vermilion border . The risk of malignancy has been estimated to be 0.4%3.7%, which often develops after 10 years . Topical or systemic corticosteroids are usually recommended in management of olp . Linear iga disease . Linear iga disease (lad) or linear iga dermatitis is an autoimmune subepithelial mucocutaneous disease . Peak of incidence is between sixth and seventh decades of life in adult patients, with a twofold predilection for females . The pediatric variant is called chronic bullous dermatitis of childhood or juvenile dermatitis herpetiform . Oral involvement in lad has been estimated to be between 5% and 70% in the form of vesicles, painful ulcerations or erosions, and erosive gingivitis / cheilitis . The most common affected site in the oral cavity is hard and soft palate, followed by tonsillar pillars, buccal mucosa, tongue, and gingivae . In a case report by chan et al . Oral lesions are usually managed with the use of topical steroids, but dapsone therapy for more severe cases is recommended . Recurrent aphthous stomatitis (ras) is the most common inflammatory disease of the oral mucosa with a global prevalence of 0.5% to 75% and female predilection . The lesions usually begin with prodromal burning sensation 2 to 48 hours before an ulcer appears . Oral aphthous ulcers typically occur as painful, symmetrically round fibrin - covered mucosal defects with an erythematous border and most commonly on nonkeratinized mucosa in healthy patients (figure 10). However, it can be seen on the keratinized mucosa especially in patients with immune deficiency . Three clinical types of ras have been identified: minor - type (mikulicz) is smaller than 1 cm in diameter (usually 2 - 3 mm) and heals spontaneously in two weeks . Major - type (sutton ulcer) is usually 13 cm in size, and lasts for 10 days to 6 weeks or even longer . Herpetiform aphthae appears as very small (1 - 2 mm), extremely painful, and numerous ulcers (up to 100 lesions). Laboratory evaluation is mandatory when (a) episodes of lesions become more severe, (b) lesions begin after the age of 25, and (c) general symptoms are accompanied by lesions . Ras is self - limiting, but in severe cases topical or systemic corticosteroids are recommended [70, 71]. Recurrent herpes stomatitis . Herpes simplex virus can establish latency in the trigeminal ganglia and periodically reactivate to cause recurrent herpetic stomatitis (rhs). There are two subgroups: recurrent herpes simplex labialis (hsl) (figure 11), which is more commonly seen in healthy subjects . It begins as vesicles that rupture soon, which leave superficial crusted ulcers and heal without scarring . However, rih in immune competent patients is limited to the keratinized mucosa, especially on the hard palate usually as clustered and unilateral vesicles . Common triggers of rhs are physical / emotional stress, uv light, cold weather, hormonal changes, upper respiratory tract illness, and lip / mouth trauma [3, 72]. Although the lesions are self - limiting, symptomatic treatment by using ice or lanolin is recommended . Applying acyclovir ointment 5% every 2 hours since the prodromal phase until the lesions subside has been suggested as well . Elective dental treatments should be deferred in patients with active lesions to prevent aerosolization of the virus . Erythema multiform (em) can be induced by several infectious agents, in particular hsv [73, 74]. According to ng et al ., hsv dna has been detected in 50% of patients with recurrent idiopathic em typically affecting young adults (2040 years) and is more common in men with the ratio of 3: 2 . It can be found several days or weeks following an episode of hsv, and the lips are mostly affected . The diagnosis is based on clinical features and is more straightforward when target lesions with preceding or coexisting hsv infection present . The duration of disease ranges from 2 to 36 years (mean of 10 years). Acyclovir (200 mg, 5 times a day, for 5 days) is recommended for management of lesions . Cyclic neutropenia (cn) is an immunodeficiency syndrome, characterized by regular periodic oscillations in the circulating neutrophil count from normal to neutropenic levels every 21 days, and lasting for 36 days . Patients with cyclic neutropenia are usually asymptomatic but during neutropenic episodes suffer from fever of unknown origin, gingivitis, stomatitis, aphthous - like ulceration, cellulitis, perirectal abscess, and severe systemic pyogenic infections . The severity and recurrence of oral ulcers in cn are similar to those of ulcers in major ras; additionally, periodontal destruction in cn is as severe as what is seen in aggressive periodontitis . Behet's disease (bd) is a systemic immune - mediated vasculitis characterized by the presence of recurrent oral and genital ulcers, ocular inflammation, and skin lesions . Bd can affect any age groups, but onset before puberty and after the sixth decade of life is relatively rare . The most common age of presentation is around the third decade of life, with a balanced male / female ratio . Recurrent and painful oral ulcers are present in 90% to 100% of patients with bd . Presence of recurrent oral aphthous - like ulcers (minor, major, or herpetiform ulcers, which recur at least three times within a period of 12 months) along with two of the following: genital ulcers, ocular lesions (anterior uveitis, posterior uveitis, vitreous cellularity, or retinal vasculitis), and skin lesions (erythema nodosum, pseudofolliculitis or papulopustular lesions, or acneiform papulae in postadolescent patients without any steroid treatment, and positive pathergy test) establishes the diagnosis [3032]. Glucocorticoids, colchicine, azathioprine, cyclosporine, tacrolimus, anti - tnf - alpha (infliximab and etanercept), thalidomide, and rituximab are all recommended for treatment . Oral ulcerative lesions are categorized into solitary acute, multiple acute, solitary chronic, multiple chronic, and recurrent lesions . Acute oral ulcerations result from traumatic insults, viral or bacterial infections, allergy, or cancer chemotherapy . Acute traumatic ulcers usually present as solitary lesions of nonspecific clinical shapes (figure 3) [11, 12], whereas viral stomatitis appear as multiple small symmetrical ulcers, which sometimes coalesce to form larger lesions with scalloped borders (figure 4) [11, 13]. Allergic stomatitis tend to involve any site intraorally with various clinical features usually with a history of synchronous exposure to contactants or systemic allergens [3, 44]. Although chemotherapy - induced stomatitis can be quite diffuse, its commencement is chronologically related to therapeutic agents, which differentiate it from other acute oral ulcerations [46, 47]. Some bacterial stomatitis present as either acute multiple punched- out necrotic ulcerations (e.g., nug and nup) (figure 6) in patients with malnutrition or immunocompromised state [19, 43], or single chronic ulceration of which tuberculous ulcer presents as an undermined lesion . When confronting a single chronic ulcer, it would appear to be prudent to preclude oral squamous cell carcinoma (figure 8) first due to its poor prognosis and grave morbidity [5, 22]. In addition, in the category of solitary chronic ulcers, history of lung disease or dealing with animals propose histoplasmosis or blastomycosis, while presence of debilitating disease such as diabetes mellitus suggest mucormycosis . On the other hand, multiple map - like or asymmetrical ulcerations suggest the presence of mucocutaneous vesiculobullous diseases; among them, pemphigus is of high potency for extension, which might lead to death [3, 27]. Despite chronic lesions with ongoing progression or sustained clinical features a history of repeated resolution and relapse prompts the clinician to rank recurrent oral ulcerations higher in the differential diagnosis . Recurrent aphthous stomatitis (figure 10) and recurrent herpes are two common entities in this category with the former being more frequent in the nonkeratinized mucosa and the latter in the keratinized mucosa [3, 27]. The newly updated decision tree includes 29 oral ulcerative lesions based on duration and number of lesions, which helps clinicians establish a stepwise method to rule out improbable conditions to arrive at a logical diagnosis.
Patients with unresectable or metastatic hepatocellular carcinoma (hcc), who are not candidates for local / regional treatment, have a very limited number of therapeutic options (1). To date, sorafenib is the only systemic therapy proven to prolong overall survival in patients with advanced hcc who are not candidates for surgical or local / regional therapies . However, the median survival achieved with sorafenib therapy was reported to be only 10.7 months compared with 7.9 months in the placebo arm (hazard ratio [hr], 0.69; 95% confidence interval [ci], 0.55 to 0.87; p<0.001), and was even shorter in asian patients (6.2 vs. 4.1 months; hr, 0.67; 95% ci, 0.49 to 0.93; p=0.0155) (2,3). For those patients who are not candidates for sorafenib treatment or for those who have had treatment failures after sorafenib, the only therapeutic option is systemic chemotherapy . However, there are no standard chemotherapy regimens that have been shown to improve overall survival . A large number of controlled and uncontrolled studies have been performed with most of the major classes of chemotherapy agents given as single or combination therapies . Single or combination regimens of other drugs, including doxorubicin, 5-fluorouracil (5-fu), capecitabine, cisplatin, gemcitabine, and mitoxantrone have elicited 0% to 27% response rates, 2 to 6 months time to progression (ttp) or progression - free survival, and 3 to 12 months of overall survival (os) (4 - 9). The most widely studied regimens in patients with advanced hcc are doxorubicin and cisplatin - based chemotherapies . Doxorubicin was associated with a single agent response rate of 0 - 15% (4,10). Doxorubicin as a single agent, when compared to the combination of cisplatin, interferon, doxorubicin, and 5-fu (piaf) in a phase iii randomized trial, caused a lower response rate (10.5% vs. 20.9%) but a similar os rate (6.83 vs. 8.67 months, p=0.83). Doxorubicin single agent used to be considered a standard treatment for patients with advanced hcc before the sorafenib era (11). Cisplatin - based combination regimens were reported in some studies to result in higher objective response rates than regimens excluding cisplatin . Cisplatin administration had an objective response rate of 15% as single - agent chemotherapy, and a higher response rate when combined with doxorubicin, 5-fu and gemcitabine (5 - 9,11,12). However, there are insufficient data to recommend any one regimen as the standard of care . Systemic chemotherapy loses efficacy due to the frequently observed development of multidrug tumor resistance, which is related to the high rate of expression of the multidrug resistance gene (mdr1), and p53 tumor suppressor gene mutations (13,14). Poor hepatic function in patients with advanced hcc results in higher toxicity and precludes systemic chemotherapy in many patients . Therefore, patient selection for those who would benefit from systemic chemotherapy is of vital importance before initiating systemic chemotherapy in patients with advanced hcc . The aim of this study was to determine the efficacy of cisplatin - based combination chemotherapy and identify a subgroup of patients with advanced hcc who would be candidates for cisplatin - based combination chemotherapy . The records of all consecutive patients with advanced hcc who received cisplatin - based combination chemotherapy at a single center, before the sorafenib era, were retrospectively analyzed by univariate and multivariate prognostic factor analyses . Between january 2003 and october 2009, consecutive patients with unresectable or metastatic hcc who received cisplatin - based combination as the first - line chemotherapy at seoul national university bundang hospital were retrospectively enrolled . Patients had disease progression after a curative resection or other local treatment procedures, such as radiofrequency ablation (rfa), cryoablation or transarterial chemoembolization (tace), or were not amenable to local / regional treatment . The diagnosis of hcc was confirmed by histopathology or by computed tomography (ct), magnetic resonance imaging (mri), and angiographic findings in addition to elevated values of alpha - fetoprotein (afp) using the guidelines proposed by the korea liver cancer study group (15). Using these criteria, a patient was diagnosed with hcc if one or more risk factors (hepatitis b virus [hbv] or hepatitis c virus [hcv] infection, or cirrhosis) were present, and one of the following was also present: a serum afp level>400 ng / ml and a positive result on at least one of the three typical liver imaging techniques (spiral ct, contrast enhanced dynamic mri or hepatic angiography); or a serum afp level<400 ng / ml and positive findings on at least two of the three imaging techniques . A positive finding for typical hcc with dynamic ct or mri is indicative of arterial enhancement followed by venous washout in the delayed portal / venous phase . Tnm stages were used for tumor staging and clinical stages were classified according to the cancer of the liver italian program (clip) staging system (16,17). The first - line chemotherapy regimens given to patients were cisplatin - based combination chemotherapy with doxorubicin (ap), 5-fu (fp), capecitabine (xp) and gemcitabine (gp). The ap regimen consisted of doxorubicin 60 mg / m delivered as an intravenous infusion over 30 minutes on day 1, followed by cisplatin 60 mg / m infused over 30 minutes on day 1 . The fp regimen consisted of 5-fu 1,200 mg / m administered continuously on days 1 to 4, and cisplatin 60 mg / m infused over 30 minutes on day 1 . The xp regimen consisted of capecitabine 2,000 mg / m orally administered on days 1 to 14, and cisplatin 60 mg / m infused over 30 minutes on day 1 . The gp regimen consisted of gemcitabine 1,200 mg / m infused on days 1 and 8, and cisplatin 60 mg / m infused over 30 minutes on day 1 . Response was assessed after every two cycles of chemotherapy by ct or mri scan using the response evaluation criteria in solid tumors (recist) criteria (18). Complete response (cr) was defined as the disappearance of all target and non - target lesions compared to baseline . Partial response (pr) was defined as at least a 30% decrease in the sum of the longest diameters of all target lesions, taking as a reference the baseline sum of the diameters with no new lesions appearing . Patients were considered to have progressive disease (pd) if any new lesion appeared, if the tumor size increased by at least 20% in the sum of the diameters of the target lesions, taking as reference the smallest sum on study, or if there was unequivocal progression of existing non - target lesions . A patient who failed to meet the definition of cr, pr or pd was classified as having stable disease (sd). The percentage of patients who had the best responses (other than pd) according to the recist criteria, and had those responses maintained for at least 28 days after the first radiologic evaluation, was defined as the disease control rate . Toxic effects of chemotherapy were evaluated according to the national cancer institute - common terminology criteria for adverse events version 3.0 . The ttp was calculated from the first day of chemotherapy to the day when progressive disease was documented . Os (in days) was calculated from the first day of chemotherapy to death by any cause . All survival distributions were calculated using the kaplan - meier method and the log - rank test was used for univariate analysis . The cox proportional hazard model was used to assess the prognostic factors by multivariate analysis . The study was approved by an independent review board at the seoul national university bundang hospital (irb approval number: b-1003 - 095 - 102). Between january 2003 and october 2009, consecutive patients with unresectable or metastatic hcc who received cisplatin - based combination as the first - line chemotherapy at seoul national university bundang hospital were retrospectively enrolled . Patients had disease progression after a curative resection or other local treatment procedures, such as radiofrequency ablation (rfa), cryoablation or transarterial chemoembolization (tace), or were not amenable to local / regional treatment . The diagnosis of hcc was confirmed by histopathology or by computed tomography (ct), magnetic resonance imaging (mri), and angiographic findings in addition to elevated values of alpha - fetoprotein (afp) using the guidelines proposed by the korea liver cancer study group (15). Using these criteria, a patient was diagnosed with hcc if one or more risk factors (hepatitis b virus [hbv] or hepatitis c virus [hcv] infection, or cirrhosis) were present, and one of the following was also present: a serum afp level>400 ng / ml and a positive result on at least one of the three typical liver imaging techniques (spiral ct, contrast enhanced dynamic mri or hepatic angiography); or a serum afp level<400 ng / ml and positive findings on at least two of the three imaging techniques . A positive finding for typical hcc with dynamic ct or mri is indicative of arterial enhancement followed by venous washout in the delayed portal / venous phase . Tnm stages were used for tumor staging and clinical stages were classified according to the cancer of the liver italian program (clip) staging system (16,17). The first - line chemotherapy regimens given to patients were cisplatin - based combination chemotherapy with doxorubicin (ap), 5-fu (fp), capecitabine (xp) and gemcitabine (gp). The ap regimen consisted of doxorubicin 60 mg / m delivered as an intravenous infusion over 30 minutes on day 1, followed by cisplatin 60 mg / m infused over 30 minutes on day 1 . The fp regimen consisted of 5-fu 1,200 mg / m administered continuously on days 1 to 4, and cisplatin 60 mg / m infused over 30 minutes on day 1 . The xp regimen consisted of capecitabine 2,000 mg / m orally administered on days 1 to 14, and cisplatin 60 mg / m infused over 30 minutes on day 1 . The gp regimen consisted of gemcitabine 1,200 mg / m infused on days 1 and 8, and cisplatin 60 mg / m infused over 30 minutes on day 1 . Response was assessed after every two cycles of chemotherapy by ct or mri scan using the response evaluation criteria in solid tumors (recist) criteria (18). Complete response (cr) was defined as the disappearance of all target and non - target lesions compared to baseline . Partial response (pr) was defined as at least a 30% decrease in the sum of the longest diameters of all target lesions, taking as a reference the baseline sum of the diameters with no new lesions appearing . Patients were considered to have progressive disease (pd) if any new lesion appeared, if the tumor size increased by at least 20% in the sum of the diameters of the target lesions, taking as reference the smallest sum on study, or if there was unequivocal progression of existing non - target lesions . A patient who failed to meet the definition of cr, pr or pd was classified as having stable disease (sd). The percentage of patients who had the best responses (other than pd) according to the recist criteria, and had those responses maintained for at least 28 days after the first radiologic evaluation, was defined as the disease control rate . Toxic effects of chemotherapy were evaluated according to the national cancer institute - common terminology criteria for adverse events version 3.0 . The ttp was calculated from the first day of chemotherapy to the day when progressive disease was documented . Os (in days) was calculated from the first day of chemotherapy to death by any cause . All survival distributions were calculated using the kaplan - meier method and the log - rank test was used for univariate analysis . The cox proportional hazard model was used to assess the prognostic factors by multivariate analysis . The study was approved by an independent review board at the seoul national university bundang hospital (irb approval number: b-1003 - 095 - 102). Between january 2003 and october 2009, 73 patients received systemic chemotherapy at seoul national university bundang hospital . Among the 73, we identified 46 who underwent cisplatin combination chemotherapy as the first - line chemotherapy . The diagnosis of hcc was confirmed by pathology in five patients; for the remaining 41 patients, the diagnosis was established by ct, mri, and angiographic findings in addition to elevated values of afp using the guidelines proposed by the korea liver cancer study group (15). A total of 46 patients with hcc were analyzed in this study, and their clinical characteristics are summarized in table 1 . The mean age of the patients was 53 years (range, 21 to 73 years) and the male to female ratio was 4.1: 1 . Hbv infection was documented in most of the patients (82.6%), hcv infection in a few (4.3%) and both infections in even fewer (2.2%). The majority of patients had an eastern cooperative oncology group (ecog) performance (ps) score of 0 - 1 (84.8%) with liver function classified as child - pugh classification a (69.6%). The sites of extrahepatic metastases included lung in 32 (69.6%), bone in 14 (30.4%) and lymph nodes in 31 (67.4%) patients . Previous treatments included surgery in 13 patients (28.3%), tace in 31 (67.4%), and rfa in six patients (13.0%). An afp level higher than 400 ng / ml was recorded in 23 (50.0%) patients, and 28 patients (60.9%) had portal vein thrombosis . The hbeag was positive in 10 patients (25.6% among hbv - positive patients). Eleven patients (23.9%) had a clip score of 0 or 1 points, 23 (50.0%) patients had 2 - 3 points, and 12 patients (26.1%) had 4 - 6 points . Patients received a mean of 2.3 cycles of cisplatin - based combination chemotherapy (range, 1 to 6 cycles): 10 patients received doxorubicin combination (ap); 32 fluoropyrimidine combination (fp and xp); and 4 patients received gemcitabine combination (gp) chemotherapy . The best responses to first - line chemotherapy are shown in table 2: no complete response was observed; two patients (4.3%) achieved partial remission; 14 (30.4%) had stable disease; and 30 (65.2%) had progressive disease . There were no significant differences in response rates among the different regimens (p=0.28). A mean of 2.8 cycles of chemotherapy (range, 1 to 6 cycles) was given . Two patients received anthracycline - based chemotherapy, 4 fluoropyrimidine - based, 10 gemcitabine - based, and 3 patients received sorafenib . The response rate was 5.3% (1/19) and the disease control rate was 47.4% (9/19). After a median follow - up duration of 5.5 months, the median time to progression for all patients was 1.8 months (95% ci, 1.1 to 2.5). There was no statistically significant difference in the time to progression among the regimens: 2.3 (95% ci, 0.2 to 4.4) months for the ap regimen, 1.8 months (95% ci, 0.8 to 2.2) for the fluoropyrimidine combination (fp, xp) and 1.9 (95% ci, 0.1 to 2.5) months for the gp regimen . The median os from the start of chemotherapy was 7.2 (95% ci, 3.0 to 11.5) months . The overall survival was 8.5 (95% ci, 3.0 to 13.9) months for the ap regimen, 4.1 months (95% ci, 2.3 to 5.8) for the fluoropyrimidine combination and 4.7 months (95% ci, cannot be calculated) for the gp regimen (table 2). On univariate analysis, poor ecog ps, child classification b compared to a, high clip score, and presence of portal vein thrombosis were statistically significant factors that indicated a poor prognosis for both ttp and os (table 3) (fig . 1). Based on multivariate analyses using a model with factors entered for a significance level of p0.05, poor ecog ps (hr, 4.51; 95% ci, 1.61 to 12.6; p=0.004) and the presence of portal vein thrombosis (hr, 2.12; 95% ci, 1.10 to 4.11; p=0.026) were independent poor prognosis factors for ttp . The presence of portal vein thrombosis (hr, 2.77; 95% ci, 1.36 to 5.62; p=0.005) was the only significant poor prognosis factor for os (table 4). Toxicities were mostly hematologic, with grade 3/4 leukopenia in six (13%), neutropenia in 14 (30.4%) and thrombocytopenia in five (10.9%) patients . A grade 3/4 elevation of the aminotransferases occurred in 11 (23.9%) patients, and jaundice in eight (17.4%) patients . There was no significant difference in hematologic and liver - related toxicities among the cisplatin - based combination (table 5) treatment . However, grade 3/4 neutropenia was more frequent in the gp and ap regimens . Between january 2003 and october 2009, 73 patients received systemic chemotherapy at seoul national university bundang hospital . Among the 73, we identified 46 who underwent cisplatin combination chemotherapy as the first - line chemotherapy . The diagnosis of hcc was confirmed by pathology in five patients; for the remaining 41 patients, the diagnosis was established by ct, mri, and angiographic findings in addition to elevated values of afp using the guidelines proposed by the korea liver cancer study group (15). A total of 46 patients with hcc were analyzed in this study, and their clinical characteristics are summarized in table 1 . The mean age of the patients was 53 years (range, 21 to 73 years) and the male to female ratio was 4.1: 1 . Hbv infection was documented in most of the patients (82.6%), hcv infection in a few (4.3%) and both infections in even fewer (2.2%). The majority of patients had an eastern cooperative oncology group (ecog) performance (ps) score of 0 - 1 (84.8%) with liver function classified as child - pugh classification a (69.6%). The sites of extrahepatic metastases included lung in 32 (69.6%), bone in 14 (30.4%) and lymph nodes in 31 (67.4%) patients . Previous treatments included surgery in 13 patients (28.3%), tace in 31 (67.4%), and rfa in six patients (13.0%). An afp level higher than 400 ng / ml was recorded in 23 (50.0%) patients, and 28 patients (60.9%) had portal vein thrombosis . The hbeag was positive in 10 patients (25.6% among hbv - positive patients). Eleven patients (23.9%) had a clip score of 0 or 1 points, 23 (50.0%) patients had 2 - 3 points, and 12 patients (26.1%) had 4 - 6 points . Patients received a mean of 2.3 cycles of cisplatin - based combination chemotherapy (range, 1 to 6 cycles): 10 patients received doxorubicin combination (ap); 32 fluoropyrimidine combination (fp and xp); and 4 patients received gemcitabine combination (gp) chemotherapy . The best responses to first - line chemotherapy are shown in table 2: no complete response was observed; two patients (4.3%) achieved partial remission; 14 (30.4%) had stable disease; and 30 (65.2%) had progressive disease . There were no significant differences in response rates among the different regimens (p=0.28). A mean of 2.8 cycles of chemotherapy (range, 1 to 6 cycles) was given . Two patients received anthracycline - based chemotherapy, 4 fluoropyrimidine - based, 10 gemcitabine - based, and 3 patients received sorafenib . The response rate was 5.3% (1/19) and the disease control rate was 47.4% (9/19). After a median follow - up duration of 5.5 months, the median time to progression for all patients was 1.8 months (95% ci, 1.1 to 2.5). There was no statistically significant difference in the time to progression among the regimens: 2.3 (95% ci, 0.2 to 4.4) months for the ap regimen, 1.8 months (95% ci, 0.8 to 2.2) for the fluoropyrimidine combination (fp, xp) and 1.9 (95% ci, 0.1 to 2.5) months for the gp regimen . The median os from the start of chemotherapy was 7.2 (95% ci, 3.0 to 11.5) months . The overall survival was 8.5 (95% ci, 3.0 to 13.9) months for the ap regimen, 4.1 months (95% ci, 2.3 to 5.8) for the fluoropyrimidine combination and 4.7 months (95% ci, cannot be calculated) for the gp regimen (table 2). On univariate analysis, poor ecog ps, child classification b compared to a, high clip score, and presence of portal vein thrombosis were statistically significant factors that indicated a poor prognosis for both ttp and os (table 3) (fig . 1). Based on multivariate analyses using a model with factors entered for a significance level of p0.05, poor ecog ps (hr, 4.51; 95% ci, 1.61 to 12.6; p=0.004) and the presence of portal vein thrombosis (hr, 2.12; 95% ci, 1.10 to 4.11; p=0.026) were independent poor prognosis factors for ttp . The presence of portal vein thrombosis (hr, 2.77; 95% ci, 1.36 to 5.62; p=0.005) was the only significant poor prognosis factor for os (table 4). Toxicities were mostly hematologic, with grade 3/4 leukopenia in six (13%), neutropenia in 14 (30.4%) and thrombocytopenia in five (10.9%) patients . A grade 3/4 elevation of the aminotransferases occurred in 11 (23.9%) patients, and jaundice in eight (17.4%) patients . There was no significant difference in hematologic and liver - related toxicities among the cisplatin - based combination (table 5) treatment . However, grade 3/4 neutropenia was more frequent in the gp and ap regimens . The results of this study confirmed the poor prognosis and poor response to cisplatin - based combination chemotherapy among patients with advanced hcc, who were not amenable to local / regional treatment outside of the clinical trial setting . In this study, cisplatin - based combination chemotherapy regimens had a response rate of 4.3%, a median ttp of 1.8 (95% ci, 1.1 to 2.5) months, and a median os of 7.2 (95% ci, 3.0 to 11.5) months . Our results are consistent with earlier studies that investigated the efficacy of cisplatin - based combination chemotherapy, although the results of our study are modest compared to prior studies with regard to ttp . The results of our study might more accurately reflect real clinical practice, with unselected patients . A high proportion of patients with metastases (89.1%) and portal vein thrombosis (60.9%) in this population may also explain the poor response rates . The combination of gemcitabine with cisplatin was reported to have a response rate of approximately 20% (7), a ttp of 18 weeks, and a median os of 21 weeks . The combination of capecitabine and cisplatin elicited a response rate of 6.3%, a ttp of 2 months, and a median os of 12.2 months (8). Although not statistically significant, the ap regimen had a longer ttp and os than the other regimens (fp, xp, gp) (table 2). There were no differences in clinical characteristics of patients who received ap compared to the other regimens in this study . (6) reported that the response rate and disease control rate associated with the ap regimen were 18.9% (7/37) and 35.1% (13/37), respectively, and the median ttp and os were 6.6 and 7.3 months . (12), found that the response rate and disease control rate of the ap regimen were, respectively, 58.6% (6/21) and 76.2% (46/21), and the median ttp and os were, respectively, 5.4 and 10.7 months . The os achieved with the ap regimen showed consistency across trials, 7.3 - 10.7 months, and compared favorably to the effects of sorafenib reported in an asian trial (3). Further study comparing cisplatin - based combination chemotherapy, especially the ap regimen, with sorafenib or a combination of cytotoxic regimens with sorafenib is needed in patients with advanced hcc . Based on the results of multivariate analysis, the only independent prognostic factors in this study population were ecog ps (p=0.004) and portal vein thrombosis (p=0.026) with regard to ttp, and portal vein thrombosis (p=0.005) with regard to os (table 4). Ecog ps, child - pugh classification, clip score and portal vein thrombosis were prognostic factors for ttp and os on univariate analysis . However, the child - pugh classification lost its statistical significance in the multivariate analysis, probably due to the small number of patients enrolled . The clip score was not included in the multivariate model, since the clip score represented a combination of other risk factors: child - pugh stage; tumor morphology and extension; serum afp levels; and portal vein thrombosis . The overall survival of patients associated with clip scores of 0 - 1, 2 - 3 and 4 - 6 were 13.3 (95% ci, 1.9 to 24.6), 7.6 (95% ci, 2.7 to 12.4) and 2.2 (95% ci, 1.6 to 2.7) months, respectively (table 3). The median os of patients in this study was shorter compared to os reported in other studies (17,19 - 22). All patients had disease progression after a curative resection or other local treatment procedures by enrollment criteria, and the os was assessed from day one of chemotherapy, not from the time of diagnosis, which may explain the short survival duration . However, the decrease in survival associated with high clip score remained consistent, validating the prognostic value of clip score in this advanced hcc population . The results of this study are consistent with the findings of prior studies regarding prognostic factors (23 - 25). (23) reported that the prognosis for patients with unresectable hcc after systemic chemotherapy depended on pre - treatment liver function and the stage of disease . Portal vein thrombosis causes stenosis or occlusion of the portal vein; as a result, the blood supply to the liver parenchyma is decreased and further deterioration of liver function can occur . Zhang et al . (24) reported that portal vein thrombosis was often associated with a poor prognosis, and suggested palliative 3-dimensional conformal radiotherapy, targeting the main portal vein thrombosis . (25) analyzed clinical prognostic factors in 397 untreated patients with hcc and found that poor performance status, presence of ascites, and high afp levels were statistically significant prognostic factors associated with decreased overall survival . If the prognostic factors associated with ttp identified in our study were used to select candidates for cisplatin - based combination chemotherapy (ecog ps 0 - 1 vs. 2, and presence of pvt), the patients who had no risk factors (ecog ps 0 - 1 without pvt) would have shown a statistically significant increase in ttp compared to patients with 1 or 2 poor prognostic factors (3.1 [95% ci, 1.8 to 4.3] vs. 1.3 [95% ci, 1.3 to 1.4] vs. 0.7 [95% ci, 0.5 to 0.9] months, p<0.0001) and also in os (14.5 [95% ci, 10.5 to 18.5] vs. 4.5 [95% ci, 0.0 to 9.8] vs. 2.2 (1.1 to 3.2) months, p<0.0001). These results suggest that patient selection based on the prognostic factors described above could aid in selecting candidates who would benefit from cisplatin - based combination chemotherapy . Fifteen patients (32.6%) in the current study had ecog ps 0 - 1 and no pvt, and their median ttp and os were, respectively, 3.1 months (95% ci, 1.8 to 4.3 months) and 14.5 months (95% ci, 10.5 to 18.5 months), which compares favorably with sorafenib data in an asian trial (3). On the other hand, six patients (13%) with ecog ps 2 and pvt in the current study had a very poor prognosis and could have been spared the toxicities of the cisplatin - based combination chemotherapy, if patient selection had been based on the above prognostic factors prior to commencing chemotherapy . In addition, the selection of the chemotherapy regimen was not randomly assigned, but rather decided based on physician and patient preference, which could have led to biased results . Furthermore, the small sample size might have contributed to a lack of power in comparing the different chemotherapy regimens with regard to their toxicity, efficacy, and prognostic value . Despite these limitations, our study confirmed the poor prognosis and efficacy of cisplatin - based combination chemotherapy in patients with advanced hcc in a real world setting . Our data suggest that selection of candidates for cisplatin - based combination chemotherapy based on prognostic factors - ecog ps, and presence of pvt- would benefit select patients with advanced hcc, while sparing the others the unnecessary toxicities of combination chemotherapy . Careful classification of patients according to these prognostic variables should be part of the study design of future investigations of hcc chemotherapies . Cisplatin - based combination chemotherapy in patients with advanced hcc showed a short ttp and a low response rate regardless of the chemotherapy regimen used . Patients with a good ecog performance status and absence of portal vein thrombosis had a longer ttp and os, and therefore can be considered as good candidates for cisplatin - based combination chemotherapy.
The ability of the food and pharmacological substances to interactions with free radicals is their important property (pawowska - gral et al ., 2013; rzepecka - stojko et al ., free radicals are responsible for a lot of negative effects in organism, and their inactivation is needed . Free radicals have unpaired electrons, which cause major biochemical reactions and destroy the structures in cells . Free radicals are dangerous during the diabetes, polyneuropathy, arteriosclerosis, and cancer (eaton et al ., 1998; the substances used in medicine should not contain free radicals, and they should be antioxidants . Pharmacological species as antioxidants react with free radicals, which loss their unpaired electrons and become diamagnetic . The activity of diamagnetic molecules is lower than paramagnetic free radicals, the risk of modification of chemical structures in tissues decreases, and their functions are not destroyed (jaroszyk, 2008; bartosz, 2006). The examination of contents of free radicals in food (pawowska - gral et al ., 2013), drugs (ramos et al ., 2013), herbs (kurzeja et al ., 2013), biopolymers (chodurek et al ., 2012), cells (pawowska - gral and pilawa, 2011), and tissues (eaton et al ., 1998; bartosz, 2006) by electron paramagnetic resonance (epr) is known . Tea (wawer and zawadzka, 2004), meat (sin et al ., 2005), dry fruits (yordanov and pachowa, 2006), and flour (shimoyama et al ., free radicals may appear in drugs during sterilization processes, and such conditions accompanied by production of these paramagnetic dangerous molecules should be reject . The interacting factors killing the microorganisms during sterilization of drugs are radiation or high temperature (skowroska et al ., 2012; wilczyski et al ., 2012) epr studies showed that gamma irradiation (wilczyski et al ., 2012) or heating of drugs (skowroska et al ., 2012; kocielniak - ziemniak and pilawa, 2012) or herbs (pawowska - gral et al ., 2013; kurzeja et al ., epr spectroscopy was used to determine the optimal condition of radiative (wilczyski et al ., 2012) and thermal sterilization of drugs (skowroska et al ., 2012; kocielniak - ziemniak and pilawa, 2012). Thermal sterilization of herbs also forms free radicals in their molecular units (pawowska - gral et al ., 2013; kurzeja et al ., 2012) and biradicals (najder - kozdrowska et al ., 2010) were found by epr method in melanin biopolymers, model melanins, and their complexes with metal ions and drugs (najder - kozdrowska et al ., 2010). Free radical concentration in melanins increased after adding diamagnetic metal ions, and it was lower after complex formation between melanin and paramagnetic metal ions (najder - kozdrowska et al ., 2010). Epr spectra were measured for tumor cells (pawowska - gral and pilawa, 2011) and tissues (eaton et al ., 1998; laser irradiation of tumor cells with photosensitizer changed parameters of their epr spectra, and the changes depended on type of cells (pilawa et al ., 2006). This information was obtained by comparative analysis of epr spectra of free radicals in food, drugs, or biological samples (pawowska - gral et al ., 2013; skowroska et al ., 2012 epr method is mainly used to study paramagnetic samples containing free radicals, but it is also possible to test antioxidant properties of diamagnetic samples by microwave absorption in this spectroscopy (arshad et al ., 2013; rzepecka - stojko et al ., 2012; the antioxidative interactions of the samples reflect the quench of epr line of the paramagnetic reference after addition to its environment the tested molecules (bartosz, 2006). For example, it is known as epr measurement of antioxidative properties of bee pollen extracts (rzepecka - stojko et al ., 2012) and the aim of this work was to show spectroscopic examination of the influence of uv irradiation on interactions of echinaceae purpureae with free radicals . The susceptibility of the antioxidative properties of tested drug on uv irradiation was checked to obtain practical knowledge about storage conditions for e.purpureae . Echinaceae purpureae is the most popular herbal immune adjuvant (ghedira et al ., 2008; e.purpureae preparations are consumed mainly in autumn and winter, when we need additional protection against bacteria and viruses . E. purpureae contains caffeic acid derivatives, flavonoids, polyacetylenes, polysaccharides, and small amounts of essential oil . E. purpureae also exhibits properties such as anti - inflammatory, antibacterial, antiviral, antifungal, antioxidant, diuretic, cholagogue, and antispasmodic, and stimulates the synthesis of collagen and elastin (koevar et al ., the herb is used as a natural body tonic and shortens it the duration of colds . It has the prophylactic effect and helps in the treatment of respiratory infections, flu, and tonsillitis . It is also recommended by recurrent infections of the urinary tract and inflammation of the ascending cholangitis (koevar et al . The herb is useful in healing wounds, ulcers, burns, frostbite, and pressure ulcers . It supports the treatment of acne, psoriasis, eczema and herpes, as well as inflammatory vagina and vulva (koevar et al ., 2012; moraes et al ., 2011; ghedira et al ., 2008; schapowal, 2013). The infusions used in the form of lotions relieve inflammation of the throat, mouth, and gums . In cosmetology, the herb is used as a moisturizer, regenerating, antioxidant, soothing irritation, and inflammation of the skin (koevar et al ., 2012; schapowal, 2013). We used the following times of irradiation: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, and 110 min . The irradiation was performed by the use of medison 250 lamp with four radiators with power of 20 w. the uva wavelengths () were in the range of 315400 nm . Epr spectroscopy with microwaves of frequency of 9.3 ghz from an x - band was applied in the examination of e. purpureae interactions with free radicals . The paramagnetic reference dpph (2,2-diphenyl-1-picrylo - hydrazyl)was used as the model source of free radicals . Epr spectra of free radicals of dpph in 10% ethyl alcohol solution were measured . These spectra were compared with epr spectra of dpph in ethyl solution after adding of the tested nonirradiated and uv - irradiated e. purpureae samples . The antioxidative properties of the tested samples cause the decrease of amplitude of epr line of dpph . The quenching of the epr lines of dpph after addition of e. purpureae to the solution was observed . The measurements were done for the samples placed in the thin - walled glass tubes with the external diameter of 1 mm . The empty tubes did not contain paramagnetic impurities, and the epr signals were not observed for them . Epr spectrometer with magnetic modulation of 100 khz produced by radiopan firm (pozna, poland) was used in this experiment . Microwave frequency was measured by mcm101 recorder of eprad firm (pozna, poland). Epr spectra of dpph were numerically detected as the first derivatives by the the rapid scan unit of jagmar firm (krakw, poland) linked with the epr spectrometer . The short time of acquisition of the individual epr line was equal to 1 s. to avoid microwave saturation of the epr lines, the spectra were detected with low microwave power of 2.2 mw, which corresponds to 15 db of attenuation . The total microwave power produced by klystron of the epr spectrometer was 70 mw . The epr spectrum of the reference dpph in ethyl solution is presented in fig . 1 . The analyzed lineshape parameters of this spectrum a1, a2, b1, and b2are shown in fig . 1 . Differences between a1 and a2, b1 and b2, indicate on asymmetry of the epr spectrum . The values of a1/a2, a1 a2, b1/b2, and b1 b2, were calculated . Amplitudes (a) of the epr spectra were obtained as a1 + a2 . Amplitude of the epr line increases with increasing of the free radical contents in the sample (wertz and bolton, 1986; weil and bolton, 2007). Linewidths (bpp) of the epr spectra were obtained as b1 + b2 . Linewidths depend on magnetic interactions in the sample (wertz and bolton, 1986; weil and bolton, 2007). This value was used to obtain g - factor of free radicals existing in the source of free radicalsdpph.fig . The parameters of a 1, a 2, b 1, and b 2 were used to analyze the asymmetry of epr spectra . The asymmetry parameters a 1/a 2, a 1 a 2, b 1/b 2, and b 1 b 2were calculated . B is the magnetic induction of the field produced by electromagnet of the epr spectrometer . B r is the resonance magnetic induction epr spectrum of the reference dpph in ethyl alcohol solution . The parameters of a 1, a 2, b 1, and b 2 were used to analyze the asymmetry of epr spectra . The asymmetry parameters a 1/a 2, a 1 a 2, b 1/b 2, and b 1 b 2were calculated . B is the magnetic induction of the field produced by electromagnet of the epr spectrometer . B r is the resonance magnetic induction g - factors were calculated from the paramagnetic resonance condition as (wertz and bolton, 1986) g = h/bbr, where h planck constant, microwave frequency, b bohr magneton, and br induction of resonance magnetic field . G - factor characterizes localization of unpaired electrons in the sample (wertz and bolton, 1986). The calculations were performed by the use of programs of jagmar firm (krakw, poland) and labview 8.5 of national instruments firm . Echinaceae purpureae is the most popular herbal immune adjuvant (ghedira et al ., 2008; e.purpureae preparations are consumed mainly in autumn and winter, when we need additional protection against bacteria and viruses . E. purpureae contains caffeic acid derivatives, flavonoids, polyacetylenes, polysaccharides, and small amounts of essential oil . E. purpureae also exhibits properties such as anti - inflammatory, antibacterial, antiviral, antifungal, antioxidant, diuretic, cholagogue, and antispasmodic, and stimulates the synthesis of collagen and elastin (koevar et al ., the herb is used as a natural body tonic and shortens it the duration of colds . It has the prophylactic effect and helps in the treatment of respiratory infections, flu, and tonsillitis . It is also recommended by recurrent infections of the urinary tract and inflammation of the ascending cholangitis (koevar et al . The herb is useful in healing wounds, ulcers, burns, frostbite, and pressure ulcers . It supports the treatment of acne, psoriasis, eczema and herpes, as well as inflammatory vagina and vulva (koevar et al ., 2012; moraes et al ., 2011; ghedira et al ., 2008; schapowal, 2013). The infusions used in the form of lotions relieve inflammation of the throat, mouth, and gums . In cosmetology, the herb is used as a moisturizer, regenerating, antioxidant, soothing irritation, and inflammation of the skin (koevar et al ., 2012; schapowal, 2013). We used the following times of irradiation: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, and 110 min . The irradiation was performed by the use of medison 250 lamp with four radiators with power of 20 w. the uva wavelengths () were in the range of 315400 nm . Epr spectroscopy with microwaves of frequency of 9.3 ghz from an x - band was applied in the examination of e. purpureae interactions with free radicals . The paramagnetic reference dpph (2,2-diphenyl-1-picrylo - hydrazyl)was used as the model source of free radicals . Epr spectra of free radicals of dpph in 10% ethyl alcohol solution were measured . These spectra were compared with epr spectra of dpph in ethyl solution after adding of the tested nonirradiated and uv - irradiated e. purpureae samples . The antioxidative properties of the tested samples cause the decrease of amplitude of epr line of dpph . The quenching of the epr lines of dpph after addition of e. purpureae to the solution was observed . The measurements were done for the samples placed in the thin - walled glass tubes with the external diameter of 1 mm . The empty tubes did not contain paramagnetic impurities, and the epr signals were not observed for them . Epr spectrometer with magnetic modulation of 100 khz produced by radiopan firm (pozna, poland) was used in this experiment . Microwave frequency was measured by mcm101 recorder of eprad firm (pozna, poland). Epr spectra of dpph were numerically detected as the first derivatives by the the rapid scan unit of jagmar firm (krakw, poland) linked with the epr spectrometer . The short time of acquisition of the individual epr line was equal to 1 s. to avoid microwave saturation of the epr lines, the spectra were detected with low microwave power of 2.2 mw, which corresponds to 15 db of attenuation . The total microwave power produced by klystron of the epr spectrometer was 70 mw . The epr spectrum of the reference dpph in ethyl solution is presented in fig . 1 . The analyzed lineshape parameters of this spectrum a1, a2, b1, and b2are shown in fig . 1 . Differences between a1 and a2, b1 and b2, indicate on asymmetry of the epr spectrum . The values of a1/a2, a1 a2, b1/b2, and b1 b2, were calculated . Amplitudes (a) of the epr spectra were obtained as a1 + a2 . Amplitude of the epr line increases with increasing of the free radical contents in the sample (wertz and bolton, 1986; weil and bolton, 2007). Linewidths (bpp) of the epr spectra were obtained as b1 + b2 . Linewidths depend on magnetic interactions in the sample (wertz and bolton, 1986; weil and bolton, 2007). This value was used to obtain g - factor of free radicals existing in the source of free radicalsdpph.fig . The parameters of a 1, a 2, b 1, and b 2 were used to analyze the asymmetry of epr spectra . The asymmetry parameters a 1/a 2, a 1 a 2, b 1/b 2, and b 1 b 2were calculated . B is the magnetic induction of the field produced by electromagnet of the epr spectrometer . B r is the resonance magnetic induction epr spectrum of the reference dpph in ethyl alcohol solution . The parameters of a 1, a 2, b 1, and b 2 were used to analyze the asymmetry of epr spectra . The asymmetry parameters a 1/a 2, a 1 a 2, b 1/b 2, and b 1 b 2were calculated . B is the magnetic induction of the field produced by electromagnet of the epr spectrometer . B r is the resonance magnetic induction g - factors were calculated from the paramagnetic resonance condition as (wertz and bolton, 1986) g = h/bbr, where h planck constant, microwave frequency, b bohr magneton, and br induction of resonance magnetic field . G - factor characterizes localization of unpaired electrons in the sample (wertz and bolton, 1986). The calculations were performed by the use of programs of jagmar firm (krakw, poland) and labview 8.5 of national instruments firm . The comparison of the epr spectra of dpph in ethyl solution and dpph in ethyl solution with e. purpureae indicates interactions between the tested herbs and free radicals . Epr spectrum of dpph in ethyl solution with nonirradiated e. purpureae is shown in fig . Amplitudes (a) and linewidth (bpp) of dpph line change upon interactions with e. purpureae (figs . 1, 2). Epr spectra of dpph in ethyl solution after adding of uv - irradiated e. purpureae for the herb exposed to electromagnetic waves during 10 and 110 min are presented in fig . The shape and parameters of the epr spectrum of dpph changed after the addition of e. purpureae to the solution . The parameters of the epr spectra of dpph as the reference, and dpph interacting with e. purpureae for the original nonirradiated herb and the herb uv irradiated are presented in table 1.fig . 2epr spectra of dpph in ethyl alcohol solution with e. purpureae nonirradiated (a), and uv irradiated during 10 (b), and 110 (c) minutes . B is the magnetic induction of the field produced by electromagnet of the epr spectrometertable 1the analyzed parameters of the epr spectra of the reference dpph interacting with nonirradiated and uv - irradiated e. purpureae sample a [a.u .] (0.1)b pp [mt] (0.02) a 1/a 2 (0.2) a 1 a 2 [a.u .] (0.2) b 1/b 2 (0.02) b 1 b 2 [mt] (0.04)dpph10.40.491.10.51.240.05nonirradiated echinaceae purpureae 0.80.481.20.10.620.11uv - irradiated echinaceae purpureae during time (t):10 min0.90.480.90.10.900.0320 min1.20.611.10.11.230.0630 min1.40.531.30.21.000.0040 min1.20.641.20.11.080.0350 min1.10.520.90.11.360.0860 min1.10.541.10.10.610.1370 min1.50.440.80.10.860.0380 min1.40.701.10.10.640.1590 min1.20.401.30.21.250.04100 min1.30.561.10.01.060.02110 min1.50.591.00.10.860.04 a amplitude of the epr spectra; bpp linewidth of the epr spectra; lineshape parameters: a 1/a 2, a 1 a 2, b 1/b 2, and b 1 b 2 . 1 . The times (t) of uv irradiation of the sample are in the range of 10110 min epr spectra of dpph in ethyl alcohol solution with e. purpureae nonirradiated (a), and uv irradiated during 10 (b), and 110 (c) minutes . B is the magnetic induction of the field produced by electromagnet of the epr spectrometer the analyzed parameters of the epr spectra of the reference dpph interacting with nonirradiated and uv - irradiated e. purpureae a amplitude of the epr spectra; bpp linewidth of the epr spectra; lineshape parameters: a 1/a 2, a 1 a 2, b 1/b 2, and b 1 b 2 . 1 . The times (t) of uv irradiation of the sample are in the range of 10110 min g - factors of 2.0036, typical for unpaired electrons localized on nitrogen atoms in dpph, were obtained . The amplitude (a) of epr lines of dpph in ethyl alcohol solution with nonirradiated e. purpureae was lower than the amplitude of epr signal of dpph in ethyl alcohol solution, before adding of the tested herb (table 1). Similar amplitude (a) characterizes uv - irradiated e. purpureae during time 10 min relative to the sample nonirradiated (table 1). The higher amplitudes (a) of dpph lines in ethyl alcohol solution were obtained for e. purpureae irradiated by uv longer than 10 min 20110 min (table 1). 3a, it is clearly visible that all the relative amplitudes (a / adpph) of epr lines with the solution containing the tested herb are lower than one (fig . 3b, the total amplitudes (a) of dpph interacting with nonirradiated and uv - irradiated e. purpureae are compared . The total amplitudes (a) are also lower for the uv - irradiated samples.fig . 3amplitudes of epr spectra of dpph in ethyl alcohol solution, and dpph interacting with nonirradiated and uv - irradiated e. purpureae in ethyl alcohol solution . A / adpph is the amplitude of epr line of dpph with the tested sample in alcohol solution divided by amplitude of epr line of the reference dpph in ethyl alcohol solution . The total amplitude a is the amplitude of epr line measured for dpph in ethyl alcohol solution . The times (t) of uv irradiation of the sample are in the range of 10110 min amplitudes of epr spectra of dpph in ethyl alcohol solution, and dpph interacting with nonirradiated and uv - irradiated e. purpureae in ethyl alcohol solution . The relative amplitudes a / adpph and the total amplitudes a are shown in fig . A / adpph is the amplitude of epr line of dpph with the tested sample in alcohol solution divided by amplitude of epr line of the reference dpph in ethyl alcohol solution . The total amplitude a is the amplitude of epr line measured for dpph in ethyl alcohol solution . The times (t) of uv irradiation of the sample are in the range of 10110 min the epr spectra of dpph in ethyl alcohol solution with e. purpureae were nonsymmetrical with the parameters of a1/a2 and b1/b2 which differ from 1, and the parameters of a1 a2 and b1 b2 differ from 0 (table 1). The parameters of lineshape of epr spectrum of dpph (a1/a2, b1/b2, a1 a2, and b1 b2) changed with the time of uv irradiation of e. purpureae (table 1). The linewidths (bpp) of epr spectra of dpph in ethyl alcohol solution both for nonirradiated and uv - irradiated e. purpureae had the high values (table 1; fig . 4). 4linewidth (bpp) of epr spectra of dpph in ethyl alcohol solution, and dpph interacting with nonirradiated and uv - irradiated e. purpureae ethyl solution . A / adpph is the amplitude of epr line of dpph with the tested sample in alcohol solution divided by amplitude of epr line of the reference dpph in ethyl alcohol solution . The total amplitude a is the amplitude of epr line measured for dpph in ethyl alcohol solution . The times (t) of uv irradiation of the sample are in the range of 10110 min linewidth (bpp) of epr spectra of dpph in ethyl alcohol solution, and dpph interacting with nonirradiated and uv - irradiated e. purpureae ethyl solution . A / adpph is the amplitude of epr line of dpph with the tested sample in alcohol solution divided by amplitude of epr line of the reference dpph in ethyl alcohol solution . The total amplitude a is the amplitude of epr line measured for dpph in ethyl alcohol solution . The times (t) of uv irradiation of the sample are in the range of 10110 min application of epr spectroscopy at the x - band (9.3 ghz) in food biophysics was confirmed . Epr spectra of the paramagnetic reference were used to determine antioxidative properties of the popular herb as e. purpureae (koevar et al ., 2012; moraes et al ., 2011; ghedira et al ., 2008; schapowal, 2013) with pharmacological interactions in human organism . The changes of shape and amplitudes of epr spectra of dpph in ethanol alcohol solution as the result of interactions of e. purpureae with free radicals of this reference were observed (table 1; figs . 2, 3, 4). The quenching of epr lines of the reference by the tested herb (fig . The proposed method of examination of interactions of the herbs with free radicals has a lot of advantages . Epr spectroscopy is a physical method, which uses the epr effect (wertz and bolton, 1986; weil and bolton, 2007). Epr effect is caused by zeemann splitting of energy levels in magnetic field, and absorption of microwaves by electrons of the tested samples is studied . The energy of microwaves is fitted to the distances between the energy levels of electrons in magnetic fields . Electrons after absorption of electromagnetic waves with the respective frequencies are excited, and after they relax via spin spin and spin lattice relaxation processes (wertz and bolton, 1986; weil and bolton, 2007). In practice, the magnetic field is produced by electromagnet of the epr spectrometer, and the tested samples are located in the resonance cavity . The type of free radicals and concentrations may be determined (wertz and bolton, 1986; weil and bolton, 2007). The economic costs of the epr measurements at x - band are very low, because only the cold water is used to decrease the temperature of electromagnet that is needed and the electrical current . The parameters of the epr spectra are analyzed numerically by the use of spectroscopic programs . Application of epr in food biophysics (pawowska - gral et al ., 2013; kurzeja et al ., 2013), pharmacy (skowroska et al ., 2012; wilczyski et al ., 2012), medicine (pawowska - gral and pilawa, 2011; pilawa et al ., 2006), biology (pawowska - gral et al ., 2013; kurzeja et al ., 2013), free radicals (chodurek et al ., 2012; najder - kozdrowska et al ., 2010), techniques (eaton et al ., 1998; wertz and bolton, 1986), and biotechnology (krzto et al ., 2009) is known . The obtained results broaden our knowledge about antioxidative properties of the famous herb e . The effect of uv irradiation on interactions of e. purpureae was not physically studied so far, and our proposition of epr analysis in this example has the innovatory character . The important result was obtained: the interactions of e. purpureae with free radicals decrease after uv irradiation (table 1; fig . Only the short time of uv irradiation (10 min) does not negatively influence on antioxidative properties of e. purpureae, when the epr lines of dpph did not increase relatively to the nonirradiated herb (table 1; fig . Epr parameters of dpph changed with time of uv exposition (table 1; figs . 3, 4) the interactions of e. purpureae with free radicals had a complex character, and this fact was reflected by the changes of linewidths (bpp) (fig . 4) and the asymmetry parameters (a1/a2, b1/b2, a1 a2, and b1 b2) of the dpph spectra with time of uv irradiation (table 1). The complex interactions are expected, because of the major transformations in e. purpureae under uv irradiation, when different chemical bonds may be broken and distances between unpaired electrons did not remain stable . The broadening of the epr lines of dpph interacting with e. purpureae is mainly caused by dipolar interactions between freer radicals . The obtained results proved the possibilities of epr studies of diamagnetic samples as e. purpureae by the use of paramagnetic probes dpph . The performed studies of e. purpureae by the use of an x - band (9.3 ghz) epr spectroscopy proved thatnonirradiated and uv - irradiated e. purpureae reveal antioxidant properties; it interacts with free radicals and as the result, it causes decrease of epr signal of the paramagnetic reference dpph in ethyl alcohol solution.uv irradiation changes interactions of e. purpureae with free radicals, and it decreases the antioxidative properties of this herb.the interactions of e. purpureae with free radicals depend on time of uv irradiation . The weaker interactions of e. purpureae with free radicals characterize the herb irradiated longer than 10 min (irradiated 20110 min).taking to account of the antioxidative properties, e. purpureae should be stored without exposition on uv irradiations.usefulness of electron paramagnetic resonance spectroscopy with paramagnetic reference of dpph to determine interactions of diamagnetic herbs with free radicals was confirmed . Nonirradiated and uv - irradiated e. purpureae reveal antioxidant properties; it interacts with free radicals and as the result, it causes decrease of epr signal of the paramagnetic reference dpph in ethyl alcohol solution . Uv irradiation changes interactions of e. purpureae with free radicals, and it decreases the antioxidative properties of this herb . The interactions of e. purpureae with free radicals depend on time of uv irradiation . The weaker interactions of e. purpureae with free radicals characterize the herb irradiated longer than 10 min (irradiated 20110 min). Taking to account of the antioxidative properties, e. purpureae should be stored without exposition on uv irradiations . Usefulness of electron paramagnetic resonance spectroscopy with paramagnetic reference of dpph to determine interactions of diamagnetic herbs with free radicals was confirmed.
In this pilot, multicenter, prospective, open - label, randomized study, we enrolled 90 adult patients admitted to general medicine and surgery services . Recruited patients had a known history of t2d with a blood glucose (bg) prior to randomization of between 140 and 400 mg / dl and a known history of t2d for> 3 months, were between 18 and 80 years of age, and were treated at home with diet alone, any combination of oral antidiabetic agents, or low - dose insulin therapy at a daily dose 0.4 units / kg prior to admission . On admission, we stopped oral antidiabetic agents and insulin therapy, and bg was measured before meals and bedtime . We excluded patients with any bg between admission and randomization of> 400 mg / dl or with a prior history of hyperglycemic crises; patients with hyperglycemia but without a known history of diabetes; patients admitted to or expected to require icu admission or cardiac surgery; patients with a history of pancreatitis or active gallbladder disease, corticosteroid therapy, clinically relevant hepatic disease, or impaired renal function (glomerular filtration rate [gfr] <30 ml / min or serum creatinine 3.0 mg / dl); and patients with a history of diabetic ketoacidosis (24), pregnancy, or any mental condition rendering the subject unable to give informed consent . Patients were randomized according to a 1:1:1 ratio into three regimens: sitagliptin once daily, sitagliptin and basal insulin (glargine lantus; sanofi) once daily, and basal bolus insulin with glargine once daily and lispro before meals (humalog; eli lilly and company). Patients treated with sitagliptin received a single dose of 100 mg / day (at any time of day) if gfr> 50 ml / min or 50 mg / day if gfr was between 30 and 50 ml / min . Patients in the sitagliptin and basal group received a starting total daily dose (tdd) of glargine of 0.25 units / kg / day, except for those patients 70 years of age and/or with a serum creatinine 2.0 mg / dl who received a starting tdd of 0.15 units / kg . Patients in the basal bolus group were started at a tdd of 0.5 units / kg divided half as insulin glargine once daily and half as insulin lispro before meals . In patients 70 years of age and/or with a serum creatinine 2.0 mg / dl, the starting tdd in the basal bolus group was reduced to 0.3 units / kg in the basal bolus group . Patients in all three groups received supplemental (correction) doses of insulin lispro before meals and bedtime for bg> 140 mg / dl . The goal of therapy was to maintain a fasting and premeal glucose concentration between 100 and 140 mg / dl . The doses of insulin were adjusted daily according to protocol (included in supplementary table 1). Treatment failure was arbitrarily defined as an average daily bg> 240 mg / dl or two consecutive values bg> 240 mg / dl (11,14). If this occurred, patients in the sitagliptin and sitagliptin plus glargine groups were switched to basal bolus regimen starting at a tdd of 0.5 units / kg . Bg was measured before each meal and at bedtime (or every 6 h if a patient was not eating) using a point - of - care glucose meter (accu - check; roche, indianapolis, in). In addition, bg was measured at any time if a patient experienced symptoms of hypoglycemia or if requested by the treating physician . The results of bg values are presented as premeal glucose, bedtime glucose, and mean daily bg during the hospital stay after day 1 . This study was conducted at grady memorial hospital (atlanta, ga), emory university hospital, and university of michigan health system . The study protocol and consent form were approved by the institutional review board at each participating institution . A research pharmacist at each institution according to a computer - generated randomization table coordinated the randomization and treatment assignment . All patients were managed for medical and surgical problem(s) by their primary care team who received a copy of the assigned treatment protocol . The primary outcome of the study was to determine differences in glycemic control as measured by mean daily bg concentration among treatment groups . Secondary outcomes included differences between treatment groups in any of the following measures: number of bg values within range, number of hypoglycemic events (bg <70 and <40 mg / dl), number of episodes of hyperglycemia (bg> 200 mg / dl) after the first day of treatment, ttd of insulin, length of hospital stay, hospital complications, and differences in glycemic control between medicine and surgery patients . This was a noninferiority study design based on the hypothesis that the difference in mean daily bg between basal plus sitagliptin and basal bolus regimens would be no greater than 18 mg / dl (1 mmol / l) (11,14). We compared baseline and clinical characteristics and outcomes, such as mean daily bg after day 1, occurrence of hypoglycemia, and occurrence of complications, among treatment groups and between medical and surgical patients . The comparisons were made with the use of one - way anova for continuous variables and tests (or fisher exact test) for discrete variables . The data were generally presented as mean sd for continuous variables and count (percentage) for discrete variables . The primary outcome of the study was to determine differences in glycemic control as measured by mean daily bg concentration among treatment groups . Secondary outcomes included differences between treatment groups in any of the following measures: number of bg values within range, number of hypoglycemic events (bg <70 and <40 mg / dl), number of episodes of hyperglycemia (bg> 200 mg / dl) after the first day of treatment, ttd of insulin, length of hospital stay, hospital complications, and differences in glycemic control between medicine and surgery patients . This was a noninferiority study design based on the hypothesis that the difference in mean daily bg between basal plus sitagliptin and basal bolus regimens would be no greater than 18 mg / dl (1 mmol / l) (11,14). We compared baseline and clinical characteristics and outcomes, such as mean daily bg after day 1, occurrence of hypoglycemia, and occurrence of complications, among treatment groups and between medical and surgical patients . The comparisons were made with the use of one - way anova for continuous variables and tests (or fisher exact test) for discrete variables . The data were generally presented as mean sd for continuous variables and count (percentage) for discrete variables . A total of 90 patients with t2d were consented (55 medicine and 35 surgery); 8 patients were excluded from further analysis because they received <24 h of insulin treatment, were transferred to the icu, or received corticosteroid therapy . A total of 27 patients in the sitagliptin alone group, 29 patients in the sitagliptin and glargine group, and 26 in the basal bolus group were included in the final analysis . There were no significant differences in the mean age, racial distribution, bmi, duration of diabetes, type of treatment prior to admission, or mean hospital length of stay (los) among groups . The most common admitting diagnoses in medicine patients were cardiovascular (14%), infectious (28%), and pulmonary (22%) disorders, whereas the most common types of surgery were orthopedic (28%), urologic (19%), thoracic (16%), and abdominal (9%) procedures . Clinical characteristics of study patients the admission bg, hba1c concentration, and changes in glycemic control during the hospital stay are shown in table 2 . The mean admission glucose for the entire cohort was 211.9 63 mg / dl and the mean hba1c was 8.2 2% . All treatment regimens resulted in prompt and similar improvement in mean daily bg concentration after the 1st day of therapy (fig . 1). The percentages of glucose readings within target range between 70 and 140 mg / dl were slightly higher in the sitagliptin and glargine (43%) and basal bolus (43%) regimens compared with sitagliptin (36%), but results were not statistically significant (p = 0.53) (table 2). Similarly, there were fewer bg readings> 200 mg / dl in the sitagliptin and glargine group compared with basal bolus and sitagliptin alone (13, 21, and 21%, respectively); however, the difference was not statistically significant (p = 0.23). In addition, there were no differences in the number of treatment failures (8 vs. 11 vs. 10%, respectively, p> 0.99). Glycemic control, insulin therapy, and hypoglycemic events in patients treated with sitagliptin alone or in combination with basal insulin and basal bolus regimen differences in glycemic control in medicine and surgery patients with t2d treated with sitagliptin alone or in combination with basal insulin and basal bolus regimen . A: mean daily glucose levels in patients treated with sitagliptin alone or in combination with basal (glargine) insulin and basal bolus (glargine + lispro) insulin regimens . All groups received supplemental (correction) doses of lispro before meals and bedtime for bg> 140 mg / dl . B: mean bg levels before meals and bedtime during the hospital stay in patients treated with sitagliptin alone or in combination with basal insulin and basal bolus insulin regimens . The tdd of insulin (units / day) was higher in the basal bolus group (39.8 22 units / day) than in the glargine plus sitagliptin (28.2 12 units / day) and sitagliptin (11.5 7 units / day) groups (p <0.001). There were no differences in the total dose of basal insulin between basal bolus (17 9 units / day) and sitagliptin and glargine (20 9 units / day) groups, but patients in the basal bolus group received three times the amount of lispro (22.4 15 units / day) before meals compared with the sitagliptin and glargine (7.9 6 units / day) and sitagliptin (11.5 7 units / day) groups (p <0.001) (table 2). Most patients received insulin supplements for correction of hyperglycemia during treatment with basal bolus 96%, glargine and sitagliptin 93%, and sitagliptin 100% (p = 0.65). In addition, patients in the basal bolus group received a higher number of insulin injections per day (2.4 0.8) than patients in the sitagliptin and glargine and sitagliptin groups (1.8 0.9 and 1.8 1.1, respectively, p <0.01) (table 2). A bg <70 mg / dl was reported in one patient in the sitagliptin group (4%), two patients (8%) in the basal bolus group, and two patients (7%) in the sitagliptin and glargine group (p = 0.86). There were no patients with severe hypoglycemia (<40 mg / dl). In all cases, hypoglycemia was corrected with oral dextrose, and none of these episodes were associated with adverse outcomes . The level of glucose at admission or at randomization was found to be a good predictor of glycemic control and treatment response during the hospital stay . Compared with patients with glucose 180 mg / dl, those with a bg> 180 mg / dl had significantly higher mean daily glucose levels after the 1st day of therapy (p <0.001). There were no differences in mean daily bg concentration or in the number of treatment failures among different treatment groups in patients with a randomization bg <180 mg / dl (supplementary fig . 2b); however, patients with a randomization bg> 180 mg / dl treated with sitagliptin alone had higher mean daily bg (182.7 30 mg / dl) compared with patients treated with basal bolus (168.1 31 mg / dl) and sitagliptin plus glargine (161.8 31 mg / dl) (p = 0.08). This pilot, multicenter, randomized clinical trial compared the efficacy and safety of a daily dose of sitagliptin alone or in combination with glargine insulin to a standard basal bolus regimen in general medicine and surgery patients with t2d . We observed similar improvements in glycemic control in all treatment groups with no differences in the mean daily bg, number of bg readings within target, number of treatment failures, hospital los, or number of hypoglycemic events . In addition, the total daily insulin dose and number of insulin injections were significantly less in the sitagliptin groups compared with the basal bolus regimen . The result of this preliminary study suggests that treatment with sitagliptin alone or in combination with basal insulin is safe and effective for the management of general medicine and surgery patients with t2d . The association between hyperglycemia and increased risk of hospital complications is well established in icu and non - icu patients (36,2527). Recent guidelines from professional organizations (1820) recommend the use of subcutaneous insulin as the preferred therapy for glycemic control in hospitalized patients in a non - icu setting . The two most common subcutaneous insulin regimens for inpatient glycemic management are sliding scale regular insulin (ssi) and basal bolus insulin therapy in combination with correction insulin scale . The use of basal bolus regimen is preferred as it improves glycemic control and reduces the rate of hospital complications (12,13). The rabbit 2 medicine trial (11) reported that a bg target of <140 mg / dl was achieved in two - thirds of patients treated with basal bolus regimen, whereas only one - third of those treated with ssi achieved target glycemia . The rabbit surgery trial also reported a higher percentage of glucose readings <140 mg / dl with basal bolus compared with ssi treatment (53 30 vs. 31 28%) (14). In this study, we report that sitagliptin alone or in combination with basal (glargine) insulin resulted in similar improvements in glycemic control compared with basal bolus regimen . In agreement with recent reports, the level of glucose at admission or at randomization was found to be a good predictor of glycemic control and treatment response during the hospital stay (25). Compared with patients with glucose> 180 mg / dl, those with a bg 180 mg / dl had a lower mean daily glucose and less treatment failures, independent of treatment regimen . In patients with an admission or randomization bg 180 mg / dl, we observed no differences in mean daily bg concentration or in the number of treatment failures among patients treated with sitagliptin plus supplements compared with patients treated with sitagliptin and glargine or basal bolus regimens (p = 0.63). Patients with a randomization bg> 180 mg / dl treated with sitagliptin alone had higher mean daily bg compared with sitagliptin and glargine or basal bolus regimens (p = 0.08). This observation indicates that sitagliptin plus rapid - acting supplements (correction) before meals is useful in patients with mild - to - moderate hyperglycemia, whereas treatment with sitagliptin plus basal insulin or basal bolus regimens should be considered in those with more severe hyperglycemia . As previously reported (11,14), we show that the use of basal insulin as part of a basal bolus regimen or in combination with sitagliptin is well tolerated with a low rate of hypoglycemia . In the rabbit medicine trial, 3% of patients in the basal bolus group had a bg <60 mg / dl and no patients had a value <40 mg / dl (11). In the rabbit surgery trial, 12% of patients treated with basal bolus had a bg <60 mg / dl and 4% had a value <40 mg / dl (14). In the current study, a bg <70 mg / dl was reported in 7% of patients treated with sitagliptin and glargine and in no patients treated with basal bolus or sitagliptin alone . Minimizing hypoglycemic events is of major importance in hospitalized patients because it has been shown to be an independent risk factor of poor outcome (26,27). We recruited a relatively small number of patients in this pilot study and excluded a large number of patients, which included those admitted to the icu, with clinically relevant hepatic disease, with pancreatitis, with serum creatinine 3.0 mg / dl or gfr <30 ml / min, with severe hyperglycemia (bg> 400 mg / dl), and receiving a total dose of insulin> 0.4 units / kg / day prior to admission . In such patients, a standard basal bolus approach may be the preferred approach in achieving glycemic control . In addition, our study was not powered to determine differences in hospital complications across the three groups . A large, prospective, randomized, multicenter trial of glycemic control comparing sitagliptin alone or in combination with basal insulin with the basal bolus approach is needed to address these important issues . In summary, these preliminary results indicate that the inpatient use of sitagliptin alone or in combination with basal insulin resulted in a similar improvement in glycemic control compared with a standard basal bolus insulin regimen . These results indicate that sitagliptin alone or in combination with basal insulin is an effective alternative to the basal bolus insulin regimen for general medicine and surgery patients with t2d.
All chemotherapy agents are potentially teratogenic and there is a potential long - term effect on the offspring . Concerns always exist regarding the mother s health . Chemotherapy is contraindicated in the first trimester because of the high rate of abortion and abnormal fetal development . Malformations were present in 83.3% of fetuses when chemotherapy was administered during the first trimester; in contrast, malformations have not been reported in most cases in which chemotherapy was administered during the second or third trimesters . Literature contains numerous reports regarding the use of different combinations of chemotherapeutic agents including the combination of cisplatin / carboplatin, cyclophosphamide and paclitaxel in pregnancy with untoward effects and with good response to therapy and subsequent delivery of healthy baby . We presented a case of 37-year old woman, on her sixth pregnancy (gravida 6), having three deliveries (para 3) and a history of 2 miscarriages was referred to the antenatal clinic at khartoum teaching hospital, sudan, with a routine 16 weeks ultrasound report showing: a 16 weeks single fetus, and bilateral asymptomatic multilocular - solid cystic adnexal masses with maximum diameter of 8x9 cm in the right ovary and 7x6 cm in the left ovary (figure 1). The patient had no remarkable medical problems and no previous family history of endometrial, ovarian, colorectal, or breast cancer . The laboratory tests performed were within normal range except elevated serum levels of lactate dehydrogenase . Biological markers: ca125 (normal range: <35 iu / ml), ca15 - 3 (normal range <35 iu / ml), and ca19 - 9 (normal range <35 iu / ml) levels were 1015 u / ml, 203 u / ml, and 26 u / ml, respectively . Multidisciplinary counseling was applied: surgical interventions and prospect of laparotomy findings, maternal and fetal risks, prospects of chemotherapy treatment during pregnancy and after delivery were discussed with patient and family . It showed the presence of bilateral ovarian masses (maximum diameter 9x10 cm in the right ovary and 7x6 cm in the left ovary) with intact capsules, and two omental nodules (maximum diameter 6 cm) (figures 2 and 3). Bilateral salpingo - oophorectomy, infracolic omentectomy, appendectomy, peritoneal washing, and multiple biopsies of the parietocolic and prevescical peritoneum, parieto - visceral adhesions, and diaphragm were performed . Histopathology assessment of the multilocular ovarian cysts, omentum nodules and lymph nodes showed: bilateral malignant tumors formed of wide trabeculae and sheet of small malignant cells with dark ovoid nuclei with many mitosis consistent with bilateral small cell ovarian carcinoma (grade 2), in both ovaries and the omental nodules . The patient was staged as having an international federation of gynecology and obstetrics (figo) stage iiic disease . Detailed counseling of the patient and her family with multidisciplinary staff has been done and written informed consent was obtained for initiation of chemotherapy with preservation of pregnancy . Following surgery the patient received adjuvant chemotherapy with cyclophosamide (600 mg / m intravenously on day one every four weeks for six cycles) and carboplatin (300 mg / m by intravenous injection on day 1 every four weeks for six cycles). The patient showed good tolerance to treatment with mild gastrointestinal and hematological toxicity observed in the last cycle of treatment . Ca125 levels dropped from 371 u / ml at the beginning of chemotherapy treatment, to normal levels (<35 u / ml) following the second course of treatment . Exploratory laparotomy with cesarean delivery followed by total hysterectomy, and multiple biopsies were carried out at 38 weeks of gestation . No apparent residual disease was documented at surgery, and final histopathological diagnosis revealed no secondary tumor tissues in the uterus, with section of omentum showing area of fibrosis and foreign body giant cells reaction with no secondary deposits . The outcome was a female infant 2900 g with apgar scores of 9 and 10 at 1 and 5 min, respectively . The placenta appeared normal at the time of delivery and showed no tumor at histology . The patient has been followed by ultra - sound and radiographically with computerized tomography scans of the abdomen and chest radiographs, all of which have been negative . In addition, clinical examinations and serum tumor markers (ca125) have been within normal limits . We report a rare case of small cell ovarian cancer during pregnancy to highlight the effect of the intervention in particular the chemotherapy on pregnancy outcome . The management of early - stage ovarian carcinoma diagnosed during pregnancy should be started without delay . With regard to the chemotherapy administration during pregnancy european society of medical oncology (esmo) guidelines recommended the following: the decision to administer chemotherapy should follow the same guidelines as in non - pregnant patients . In practice, it is possible to administer chemotherapy from 14 weeks gestational age onwards with specific attention to prenatal care . To allow the bone marrow to recover and to minimize the risk of maternal and fetal sepsis and hemorrhage, delivery should be planned at least 3 weeks after the last cycle of chemotherapy, and chemotherapy should not be given after 35 weeks since spontaneous labor becomes more probable ., it is suggested that in addition to gestational dating, routine ultra - sound examination of the adnexae should be considered . Because cancer with pregnancy is rare, there is limited number of researches to guide women and their doctors, however some reports showed that pregnancy has no deleterious effect on the prognosis, and that pregnancy should be preserved whenever possible and that prognosis and treatment success data of effect of chemotherapy during pregnancy was largely derived from case reports and case series, intra - uterine growth restriction and low birth weight, prematurity, fetal toxicity, miscarriage have been reported . Stated that chemotherapy in early pregnancy (during the period of organogenesis) is associated with a high risk of miscarriage and congenital malformation . These consequences will be of fewer incidences when treatments are initiated in the second trimester . However, an increased number of fetal complications are still observed even when chemotherapy is used in late pregnancy . Proved that the outcome of the children exposed to chemotherapy during pregnancy is not different from the general population, however in their report they found that prematurity was common and was associated with impaired cognitive development . Therefore, iatrogenic preterm delivery should be avoided when possible . The current standard regimen for adjuvant chemotherapy to treat epithelial ovarian carcinoma patients receiving carboplatin during the second trimester have been reported with no serious effect on the fetus . Termination of pregnancy must be considered in women presenting with advanced stage disease in early pregnancy warranting chemotherapeutic treatment . Until now, the long - term health effects on children exposed to chemotherapeutic agents in utero remain unknown as there are no long - term studies . No specific information is available regarding the teratogenic effects of carboplatin or paclitaxel in human studies (table 1). Potential long - term risks include: compromised physical and neurological development, an increased risk of malignancy in childhood and adult life, and the possibility of mutagenesis of germ - line tissue resulting in an increased risk of malignancy in future generations . Women must be counseled with regard to the administration of chemotherapy in pregnancy and should be advised of the necessary long- term follow up of their children . There is no convincing evidence that a synergistic increase in malformation occurs with the use of multi - agent regimes as opposed to treatment with one cytotoxic agent . Regarding the selection of chemotherapeutic agents in our case, multi - agents therapy with cyclophosamide and carboplatin cyclophosamide and platinum - based chemotherapy have been reported to be generally well tolerated and not associated with toxicity in the newborn . The addition of paclitaxel during pregnancy was also excluded not only in consideration of the recent controversies raised in some studies, but also because of major concerns expressed by the patient about the lack of the experience available at that time of the use of taxanes in her specific clinical situation . However many studies have shown that paclitaxel used alone or in combination with other agents in maternal ovarian cancers, has no significant fetal toxicity when used during the second or third trimester . In conclusion the findings from this case concluded that prognosis and quality of the patient s life should be a priority, chemotherapy during the second trimester seems to be safe however, potential risks of this interventions still has to be considered.
Floating seaweeds are an important habitat for many accompanying or attached animals in offshore waters . Among natural floating objects, several studies have highlighted the importance of rafting as a habitat for marine invertebrates and some fish species (safran and omori 1990; inglfsson 1995; sano et al . For example, ascophyllum nodosum and fucus vesiculosus have been abundantly reported from the north atlantic coasts (inglfsson 1995; vandendriessche et al . 2011) and macrocystis pyrifera along the californian and chilean coast (hobday 2000; hinojosa et al ., sargassum species are the dominant floating seaweeds, especially around japan (yoshida 1963). In the sargasso sea, floating seaweeds pass their entire life in floating state through vegetative reproduction (parr 1939). On the other hand, sargassum species growing on rocky coasts form a luxuriant forest in spring and a scanty one in summer in the northwestern pacific (komatsu et al . Thus benthic sargassum forests have great influences on marine environments in spring such as water temperature (komatsu et al . 1994), ph (komatsu and kawai 1986), dissolved oxygen content of seawater (komatsu 1989), downward illumination (komatsu 1989), and water flow (komatsu and murakami 1994). During their maturation season from winter to spring when they become longer, waves and currents detach the seaweeds above or with holdfast on the bottom . This is because their drag force becomes greater than the attachment force due to higher buoyancy of large individuals, produced by their numerous gas vesicles (yoshida 1963). Thus they contribute to the stocks of floating seaweeds in waters around japan (yoshida 1963), occasionally reaching similar extensions as observed in the sargasso sea (parr 1939). They serve as spawning substratum for flying fish and pacific saury (ikehara and sano 1986). Around japan, one of the commercially most important pelagic fish, the yellowtail seriola quinqueradiata, also associates with seaweed rafts for reproductive purposes . Juvenile s. quinqueradiata start to accompany floating seaweeds 1 month after hatching and leave them when their size attains 150 mm body length (safran 1990; sakakura and tsukamoto 1997). During the spring, fishermen catch wild juveniles accompanying floating seaweeds by scooping up these rafts together with the juvenile fishes, which are then used for aquaculture . This occurs especially in waters off kyushu island including the east china sea since1960s because the aquaculture of yellowtail depends on wild juveniles accompanying floating seaweeds . The dependence on wild seedstock is due to their cannibalism during its larvae and juvenile periods, which makes it difficult to produce artificial seedstock . Yellowtails spawn in the region between the continental shelf and the oceanic front of the kuroshio current in the east china sea from late winter to spring (yamamoto et al . 2007). The earliest yellowtail larvae hatch in the end of january . Yoshida (1963) reported that most floating seaweeds around japan are found in nearshore coastal waters, within 20 km from the shore, especially in areas where oceanic fronts come close to the coast . One important reason for the patchiness of floating items, such as macroalgae as well as any other floating objects, is their accumulation at fronts between two different water masses (witherington 2002; acha et al . However, senta (1965) reported that massive amounts of floating seaweeds could not be found in the front between coastal waters and kuroshio current in the east china sea . Recently, komatsu et al . (2007) surveyed seaweed rafts in the eastern east china sea in march and may and reported that they were distributed in waters on the continental shelf west of the kuroshio front (komatsu et al . Taking into account the yellowtail spawning season in the east china sea, the juvenile starts to accompany seaweed rafts in february . (1986) reported that survival rates of the juvenile reared with seaweed rafts or artificial seaweed rafts made by cellulose are higher than without rafts . Thus, it is very important to know the distributions of seaweed rafts in the east china sea in february and early march . However, it was not well known whether abundant patches of floating seaweeds can be found in the east china sea in february and early march . This study thus aimed to elucidate the distribution of floating seaweeds in the east china sea in february and march by visual census and towed net samples . Two research cruises using r / v tansei maru were organized to survey floating seaweeds in the east china sea in late winter to early spring . One was kt10 - 1 research cruise from 22 february to 6 march 2010 and the other was kt11 - 1 from 18 to 23 february 2011 . The observation course was planned to cover the waters west of kyushu islands and the area between the kuroshio current and the continental shelf in the eastern east china sea within the exclusive economic zone of japan . Visual census of seaweed rafts were conducted from the deck of r / v tansei maru at a height of 11.5 m above the sea surface under good conditions (i.e., wave height less than 1 m), and from sunrise to sunset during the two cruises . The vessel navigated along designed transects . The following information was recorded at each occurrence of floating seaweeds: time, perpendicular distance from the vessel to a seaweed raft, and its diameter . Seaweed rafts were sampled at 12 locations in february and march 2010 and 16 locations in february 2011 (fig . 1). Some seaweed rafts were sampled randomly by using dip net or towing an ori ring net, cone - shaped plankton net, with a diameter of 1.6 m, and mesh size 1 mm . Sampled floating seaweeds were divided into individual plants on the deck of the vessel to identify species composition . After species identification the wet weight of each individual plant was measured with the aid of a spring scale on the deck.fig . 1map showing sampling stations in the east china sea and pacific ocean south of shikoku island . Triangles and circles indicate stations in 2010 and 2011, respectively . Filled and open marks are stations where floating seaweed rafts consists of only s. horneri and many seaweed species, respectively map showing sampling stations in the east china sea and pacific ocean south of shikoku island . Triangles and circles indicate stations in 2010 and 2011, respectively . Filled and open marks are stations where floating seaweed rafts consists of only s. horneri and many seaweed species, respectively floating seaweed abundance was estimated by the line transect method using distance sampling (buckland et al . This method uses the perpendicular distance from the transect line to the object and diameter of the object to correct for visibility bias, and allows estimating the probability of detecting objects and corrected densities . The probability of floating seaweed detection was estimated with models combining density function (uniform, half - normal, and hazard - rate) with adjustments (cosine, simple, and hermite polynomials). (2002), we estimated the parameter \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{\mu} $$\end{document} called the effective strip half - width (esw), and defined as the maximum limit for distinction.1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{d}=\frac{n}{2\widehat{\mu}l} $$\end{document}where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{d} $$\end{document}, n, and l represent the abundance of seaweed rafts, the total number of rafts of floating seaweeds along a transect, and the length of the transect, respectively . In order to take into account the lack of homogeneity at sea and meteorological conditions between transects, the model was fitted to data separately for each transect . Akaike s information criterion (aic) provides an objective, quantitative method for model selection . Estimates from the model with the lowest aic [defined by eq . 2] were selected (buckland et al . 2001).2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{aic}=-2 {\log}_e\left(\varlambda \right)+2(q) $$\end{document}where is the maximized likelihood and q the number of estimated parameters . This number of estimated parameters was the number of parameters based on combination key - function and adjustment - term provided by the program distance . Rafts of floating seaweeds were classified into four classes depending on the perpendicular distances from the vessel to a raft, 010, 1020, 2030, and 3040 m. rafts more than 40 m distant from the vessel were neglected due to the uncertainty of measuring distance . The number of rafts within the effective strip half - width was obtained from the best fitted model . The population mean for the wet weight along each transect in the surveys of 2010 and 2011 was estimated by using the relation between diameter and wet weight of seaweed rafts collected during both surveys of 2010 and 2011 . The diameter of floating seaweeds was converted to wet weight using the equation representing this relation . The mean wet weight (m) of all rafts along each transects was calculated . Standing crop (sc) along a transect was calculated from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{d} $$\end{document}, the density of rafts, obtained by the program distance, and m, the mean wet weight of the rafts, estimated from the observation.\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{sc}\left(\mathrm{kg}\;\mathrm{ww}\;{\mathrm{km}}^{-2}\right)=\widehat{d}\left(\mathrm{raft}\ {\mathrm{km}}^{-2}\right)\times m\left(\mathrm{kg}\kern0.3em \mathrm{ww}\;{\mathrm{raft}}^{-1}\right) $$\end{document} the total biomass along a transect (tb) was calculated by multiplying the standing crop (sc) by the survey area (a).\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{tb}\left(\mathrm{kg}\;\mathrm{ww}\right)=\mathrm{sc}\left(\mathrm{kg}\;\mathrm{ww}\;{\mathrm{km}}^{-2}\right)\times a\left({\mathrm{km}}^{-2}\right) $$\end{document}where sc and a are standing crop of floating seaweeds along a transect and survey area obtained from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{\mu} $$\end{document} and l, respectively . Two research cruises using r / v tansei maru were organized to survey floating seaweeds in the east china sea in late winter to early spring . One was kt10 - 1 research cruise from 22 february to 6 march 2010 and the other was kt11 - 1 from 18 to 23 february 2011 . The observation course was planned to cover the waters west of kyushu islands and the area between the kuroshio current and the continental shelf in the eastern east china sea within the exclusive economic zone of japan . Visual census of seaweed rafts were conducted from the deck of r / v tansei maru at a height of 11.5 m above the sea surface under good conditions (i.e., wave height less than 1 m), and from sunrise to sunset during the two cruises . The vessel navigated along designed transects . The following information was recorded at each occurrence of floating seaweeds: time, perpendicular distance from the vessel to a seaweed raft, and its diameter . Seaweed rafts were sampled at 12 locations in february and march 2010 and 16 locations in february 2011 (fig . 1). Some seaweed rafts were sampled randomly by using dip net or towing an ori ring net, cone - shaped plankton net, with a diameter of 1.6 m, and mesh size 1 mm . Sampled floating seaweeds were divided into individual plants on the deck of the vessel to identify species composition . After species identification the wet weight of each individual plant was measured with the aid of a spring scale on the deck.fig . 1map showing sampling stations in the east china sea and pacific ocean south of shikoku island . Triangles and circles indicate stations in 2010 and 2011, respectively . Filled and open marks are stations where floating seaweed rafts consists of only s. horneri and many seaweed species, respectively map showing sampling stations in the east china sea and pacific ocean south of shikoku island . Triangles and circles indicate stations in 2010 and 2011, respectively . Filled and open marks are stations where floating seaweed rafts consists of only s. horneri and many seaweed species, respectively floating seaweed abundance was estimated by the line transect method using distance sampling (buckland et al . This method uses the perpendicular distance from the transect line to the object and diameter of the object to correct for visibility bias, and allows estimating the probability of detecting objects and corrected densities . The probability of floating seaweed detection was estimated with models combining density function (uniform, half - normal, and hazard - rate) with adjustments (cosine, simple, and hermite polynomials). (2002), we estimated the parameter \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{\mu} $$\end{document} called the effective strip half - width (esw), and defined as the maximum limit for distinction.1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{d}=\frac{n}{2\widehat{\mu}l} $$\end{document}where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{d} $$\end{document}, n, and l represent the abundance of seaweed rafts, the total number of rafts of floating seaweeds along a transect, and the length of the transect, respectively . In order to take into account the lack of homogeneity at sea and meteorological conditions between transects, the model was fitted to data separately for each transect . Akaike s information criterion (aic) provides an objective, quantitative method for model selection . Estimates from the model with the lowest aic [defined by eq . 2] were selected (buckland et al . 2001).2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{aic}=-2 {\log}_e\left(\varlambda \right)+2(q) $$\end{document}where is the maximized likelihood and q the number of estimated parameters . This number of estimated parameters was the number of parameters based on combination key - function and adjustment - term provided by the program distance . Rafts of floating seaweeds were classified into four classes depending on the perpendicular distances from the vessel to a raft, 010, 1020, 2030, and 3040 m. rafts more than 40 m distant from the vessel were neglected due to the uncertainty of measuring distance . The number of rafts within the effective strip half - width was obtained from the best fitted model . The population mean for the wet weight along each transect in the surveys of 2010 and 2011 was estimated by using the relation between diameter and wet weight of seaweed rafts collected during both surveys of 2010 and 2011 . The diameter of floating seaweeds was converted to wet weight using the equation representing this relation . The mean wet weight (m) of all rafts along each transects was calculated . Standing crop (sc) along a transect was calculated from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{d} $$\end{document}, the density of rafts, obtained by the program distance, and m, the mean wet weight of the rafts, estimated from the observation.\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{sc}\left(\mathrm{kg}\;\mathrm{ww}\;{\mathrm{km}}^{-2}\right)=\widehat{d}\left(\mathrm{raft}\ {\mathrm{km}}^{-2}\right)\times m\left(\mathrm{kg}\kern0.3em \mathrm{ww}\;{\mathrm{raft}}^{-1}\right) $$\end{document} the total biomass along a transect (tb) was calculated by multiplying the standing crop (sc) by the survey area (a).\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{tb}\left(\mathrm{kg}\;\mathrm{ww}\right)=\mathrm{sc}\left(\mathrm{kg}\;\mathrm{ww}\;{\mathrm{km}}^{-2}\right)\times a\left({\mathrm{km}}^{-2}\right) $$\end{document}where sc and a are standing crop of floating seaweeds along a transect and survey area obtained from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\widehat{\mu} $$\end{document} and l, respectively . Distribution of floating seaweeds in the east china sea, floating seaweeds were quite abundant in february and early march . Most floating seaweeds observed in both years were distributed in waters on the continental shelf less than 200 m deep, which is the western edge of the kuroshio current in the east china sea except in the waters south of kyushu island (fig . 2). Although floating objects were observed on all transects, no floating seaweeds occurred along the two transects located in waters east of kuroshio current (fig . 2visual survey transects for floating seaweed rafts (solid lines) in the east china sea during r / v tansei maru cruises of kt10 - 1 (a) and kt11 - 1 (b), and floating seaweed rafts (green circle) in intervals of 20 km distance of transect . Black dash line represents 200 m isobaths visual survey transects for floating seaweed rafts (solid lines) in the east china sea during r / v tansei maru cruises of kt10 - 1 (a) and kt11 - 1 (b), and floating seaweed rafts (green circle) in intervals of 20 km distance of transect . Black dash line represents 200 m isobaths in 2010, three species of sargassum, one rhodophyceae species and one ulvales species were observed at stn . . Nine sargassum species, one colpomenia species, and one seagrass species were present at stn . More than one algal species was observed in waters close to the japanese coast (shown as open triangle in fig . 1). F1, f3, f4, f5, f6, f8, f9, f10, f11, and all station on february 2011 (table 1 and 2). All these stations were included in the east china sea.table 1species of floating seaweed rafts and their number of individuals during kt10 - 1kt10 - 1species namestationf1f2f3f4f5f6f8f9f10f11f12f13 colpomenia sinuosa (mertens ex roth) derbes et solier1rhodophyceae sp1 sargassum filicinum harvey6 (4) s. fulvellum (turner) c. agardh s. fusiforme (harvey) setchell1 (1)1 s. horneri (turner) c. agardh2 25 10 13 5 21 60 136 51 111 36 (3) s. micracanthum endlicher1 s. muticum (yendo) fensholt1 s. patens c. agardh710 (1) s. siliquastrum (turner) c. agardh1 (1) s. fulvellum (turner) c. agardh15 (1) s. thunbergii (mertens ex roth) kuntze1 s. yamamotoi yoshida42 (34)138 (97) ulvales sp1 zostera marina l.9number in parenthesis shows number of individuals with holdfast dominant speciestable 2species of floating seaweed rafts and their stipe numbers during kt11 - 1kt11 - 1species namestationst1st2st3st4st5st6st7st8st9st10st11st12st13st14st15st16 s. horneri (turner) c. agardh2 4 2 1 5 2 10 10 15 6 9 7 16 2 14 2 no individuals with holdfast dominant species species of floating seaweed rafts and their number of individuals during kt10 - 1 number in parenthesis shows number of individuals with holdfast species of floating seaweed rafts and their stipe numbers during kt11 - 1 no individuals with holdfast some seaweeds at stns . F2, f12, and f13 still had their holdfasts (table 1). Distances of these stations to the nearest land are about 48, 4, and 12 km, respectively (fig . 1). On the other hand, s. horneri collected at all stations on kt10 - 1 and kt11 - 1 had no holdfasts, except at stn . F13 near the coast . Temperature of sampling stations ranged 16.8 to 22.8 c in 2010 and 15.3 to 18.4 c in 2011 . To obtain the relationship between the diameter of a raft and its weight, we applied various models to fit their distributions (fig . 3) the exponential model was selected as a suitable model to explain the relationship between diameter (di) and wet weight (wt) of seaweed rafts: wt = 368.64di + 379.25di + 1,755.1di (r = 0.796). This relationship permits us to estimate the mean wet weight of seaweed rafts based on the estimated diameter.fig . 3regression curve (r = 0.796) showing the relation between diameter (di) and wet weight (wt) of floating seaweed rafts collected during the r / v tansei maru cruises of kt10 - 1 (closed squares) and kt11 - 1 (open triangles) regression curve (r = 0.796) showing the relation between diameter (di) and wet weight (wt) of floating seaweed rafts collected during the r / v tansei maru cruises of kt10 - 1 (closed squares) and kt11 - 1 (open triangles) in february and march 2010, esw values for all transects ranged from 11.4 to 25.7 m (table 3). Raft density of floating seaweed along the transect on 2 march was highest among transects in 2010 (table 3). The mean wet weight per raft was 3.86 kg (table 3), and the estimated biomass for this transect was 100.36 kg ww km (fig . 4b).table 3results for models applied to the distribution of floating seaweed rafts along each transect during february and march 2010 by the program distance v6.0 r2datemodel (key + adjustment)eswlength of transect (km)number of raftsestimated mean wet weight (kg ww ind) of raftsdd lcld ucld cv22 febhalf + hermite11.486.8733.341.50.29.60.4523 febhalf + cos13.8179.74881.5817.714.122.30.1224 febunifo + cos25.7159.33141.861.71.12.70.2225 febhalf + hermite16.3117.64591.9015.212.418.60.102 marhalf + hermite16.0166.731373.8626.022.829.60.073 marhazard + cos15.9190.51951.4415.713.418.40.084 marunifo + simple17.2234.68162.491.91.52.60.13 aic akaike s information criteria, esw effective strip width, n total number of rafts within esw, d density of rafts, d lcl lower confidence limit of d, d ucl upper confidence limit of d, d cv coefficient of variation of d half, unifo, hermite, cos and hazard are half - normal, uniform, hermite, cosine and hazard - rate distributions, respectivelyfig . 4estimated biomass of floating seaweeds (kg ww km) along the observation transects (solid lines) during r / v tansei maru . Cruises of kt10 - 1 in february 2010 (a), march 2010 (b), and kt11 - 1 in february 2011 (c). (source: hydrographic and oceanographic department of japan coast guard, 2010 and 2011) results for models applied to the distribution of floating seaweed rafts along each transect during february and march 2010 by the program distance v6.0 r2 aic akaike s information criteria, esw effective strip width, n total number of rafts within esw, d density of rafts, d lcl lower confidence limit of d, d ucl upper confidence limit of d, d cv coefficient of variation of d half, unifo, hermite, cos and hazard are half - normal, uniform, hermite, cosine and hazard - rate distributions, respectively estimated biomass of floating seaweeds (kg ww km) along the observation transects (solid lines) during r / v tansei maru . Cruises of kt10 - 1 in february 2010 (a), march 2010 (b), and kt11 - 1 in february 2011 (c). (source: hydrographic and oceanographic department of japan coast guard, 2010 and 2011) in february 2011, esw values for all transects ranged from 11.0 to 17.8 m. density of floating seaweeds along the 21 february located southernmost in survey area of 2011 was extremely high (table 4). Total biomass of this transect was the highest, 504.12 kg ww km (fig . 4c).table 4results for models applied to the distribution of floating seaweed rafts along each transect during february 2012 by the program distance v6.0 r2datemodel (key + adjustment)eswlength of transect(km)number of raftsestimated mean wet weight (kg ww ind) of raftsdd lcld ucld cv18-febunifo/ cos14.779.9741.071.70.47.10.3419-febhazard / cos11.0134.16471.9816.06.340.60.4920-febhalf / cos17.8162.463512.6360.752.669.90.0721-febhalf / cos14.4138.468782.29220.2204.3237.40.0422-febhazard / cos17.1159.363971.6072.863.783.10.0723-febhalf / hermite17.4237.40201.692.41.73.50.18abbreviations are identical to the ones in table 3 results for models applied to the distribution of floating seaweed rafts along each transect during february 2012 by the program distance v6.0 r2 abbreviations are identical to the ones in table 3 in both surveys of 2010 and 2011, the maximum biomass of floating seaweeds consisting of only s. horneri was distributed in waters on the continental shelf west of the kuroshio current around 25 n and 127 e. in february and march 2010, esw values for all transects ranged from 11.4 to 25.7 m (table 3). Raft density of floating seaweed along the transect on 2 march was highest among transects in 2010 (table 3). The mean wet weight per raft was 3.86 kg (table 3), and the estimated biomass for this transect was 100.36 kg ww km (fig . 4b).table 3results for models applied to the distribution of floating seaweed rafts along each transect during february and march 2010 by the program distance v6.0 r2datemodel (key + adjustment)eswlength of transect (km)number of raftsestimated mean wet weight (kg ww ind) of raftsdd lcld ucld cv22 febhalf + hermite11.486.8733.341.50.29.60.4523 febhalf + cos13.8179.74881.5817.714.122.30.1224 febunifo + cos25.7159.33141.861.71.12.70.2225 febhalf + hermite16.3117.64591.9015.212.418.60.102 marhalf + hermite16.0166.731373.8626.022.829.60.073 marhazard + cos15.9190.51951.4415.713.418.40.084 marunifo + simple17.2234.68162.491.91.52.60.13 aic akaike s information criteria, esw effective strip width, n total number of rafts within esw, d density of rafts, d lcl lower confidence limit of d, d ucl upper confidence limit of d, d cv coefficient of variation of d half, unifo, hermite, cos and hazard are half - normal, uniform, hermite, cosine and hazard - rate distributions, respectivelyfig . 4estimated biomass of floating seaweeds (kg ww km) along the observation transects (solid lines) during r / v tansei maru . Cruises of kt10 - 1 in february 2010 (a), march 2010 (b), and kt11 - 1 in february 2011 (c). Light blue stripe represents the path of kuroshio current . (source: hydrographic and oceanographic department of japan coast guard, 2010 and 2011) results for models applied to the distribution of floating seaweed rafts along each transect during february and march 2010 by the program distance v6.0 r2 aic akaike s information criteria, esw effective strip width, n total number of rafts within esw, d density of rafts, d lcl lower confidence limit of d, d ucl upper confidence limit of d, d cv coefficient of variation of d half, unifo, hermite, cos and hazard are half - normal, uniform, hermite, cosine and hazard - rate distributions, respectively estimated biomass of floating seaweeds (kg ww km) along the observation transects (solid lines) during r / v tansei maru . Cruises of kt10 - 1 in february 2010 (a), march 2010 (b), and kt11 - 1 in february 2011 (c). (source: hydrographic and oceanographic department of japan coast guard, 2010 and 2011) in february 2011, esw values for all transects ranged from 11.0 to 17.8 m. density of floating seaweeds along the 21 february located southernmost in survey area of 2011 was extremely high (table 4). Total biomass of this transect was the highest, 504.12 kg ww km (fig . 4c).table 4results for models applied to the distribution of floating seaweed rafts along each transect during february 2012 by the program distance v6.0 r2datemodel (key + adjustment)eswlength of transect(km)number of raftsestimated mean wet weight (kg ww ind) of raftsdd lcld ucld cv18-febunifo/ cos14.779.9741.071.70.47.10.3419-febhazard / cos11.0134.16471.9816.06.340.60.4920-febhalf / cos17.8162.463512.6360.752.669.90.0721-febhalf / cos14.4138.468782.29220.2204.3237.40.0422-febhazard / cos17.1159.363971.6072.863.783.10.0723-febhalf / hermite17.4237.40201.692.41.73.50.18abbreviations are identical to the ones in table 3 results for models applied to the distribution of floating seaweed rafts along each transect during february 2012 by the program distance v6.0 r2 abbreviations are identical to the ones in table 3 in both surveys of 2010 and 2011, the maximum biomass of floating seaweeds consisting of only s. horneri was distributed in waters on the continental shelf west of the kuroshio current around 25 n and 127 e. floating seaweeds consist of several sargassum species in coastal waters of japan (yoshida 1963). Ohno (1984) observed floating seaweeds south of kyusyu and shikoku island and reported that those in the coastal waters were composed of two to six species . 2001) investigated seasonal changes of the species composition of floating seaweeds in the coastal waters of izu peninsular, central japan . They stated that the number of species of floating plants in one patch ranged from one to 11 . Hirosaki (1963) and gamo and matsuura (1975) also investigated seasonal changes in the species composition of floating seaweeds in coastal waters around japan, and found that floating seaweeds consisted of multiple seaweed species . On the other hand, komatsu et al . (2007) reported that floating seaweeds in offshore waters of the east china sea in mid march and may were only s. horneri . Thus, the floating seaweeds in offshore waters of the east china sea in february and early march are also characterized by s. horneri, same as those in mid march and may . S. horneri growing in benthic habitats along the coasts east of the east china sea are not distributed from south of kyushu island to taiwan through ryukyu archipelago (yoshida 1998) although the species composition of floating seaweeds in coastal waters around japan is affected by the flora of surrounding waters (hirata et al . 2001). Considering the benthic distribution of s. horneri along the coasts around the east china sea (tseng 1983) and the northeastward surface currents, such as the kuroshio current and taiwan warm current in offshore waters of the east china sea in spring (zhu et al . 2004), the possible origin of floating s. horneri in offshore waters of the east china sea in february and early march is suspected to be the chinese coast, similar as suggested by komatsu et al . It appears that the supply of floating seaweeds distributed in the east china sea depends on the benthic populations of s. horneri along the chinese coast . In previous surveys conducted in nearshore waters around japan, it is reported that floating seaweeds consisted of sargassum individuals with holdfasts (ohno 1984; yatsuya 2005). Our study showed that no holdfasts were found in offshore waters in the east china sea . Komatsu et al . (2007) deployed satellite tracking buoys attached to rafts of s. horneri from the chinese coast . It took about 1 to 2 months for the buoys to move from the chinese coast to offshore waters with currrents in the east china sea . This suggests that long - distance dispersal of floating sargassum is accompanied by damage and loss of gas vesicles . Since the holdfasts have negative buoyancy, it is possible that floating seaweeds of s. horneri with a holdfast have sunk before reaching offshore waters because of their negative densities caused by the loss of gas vesicles . Yatusya (2008) reported s. horneri had lower density and longer floating periods than other sargassum species . Consequently, the floating individuals of s. horneri without holdfast can be transported far from their original habitats on rocky shores . Studies on other floating macroalgae also show that at larger distances from potential source regions, these are more overgrown by epibionts and floating individuals are more disintegrated (rothusler et al . No floating seaweeds were observed along the two transects located in the kuroshio current and east of the kuroshio current in february to march of 2010 . This is also true in surveys of floating seaweeds in mid march of 2004 and may of 2002 (komatsu et al . 2008). Floating seaweeds apparently do not cross the kuroshio current from the continental shelf to outer waters east of the kuroshio current . Thus, they are generally retained in the convergence region between warmer water of the kuroshio current and colder waters of the continental shelf . The highest biomass of floating seaweeds was located at the southernmost transect on the continental shelf in surveys of 2010 and 2011 . Komatsu et al . (2008) reported that the biomass of floating seaweeds in the southernmost transect (20.35 kg ww km, around 30 n, 127 e) was greater than in the transect located west of kyushu (2.18 kg ww km) in mid march . In all of the surveyed month, there were floating seaweeds in offshore water in the east china sea much more than coastal water around kyusyu island in february and early march . In the east china sea, yellowtail starts to spawn in waters southeast of continental shelf edge in late january . Yellowtail juveniles have been collected in surface water temperatures between 14 and 26 c (yamamoto et al . Optimal growth rates of yellowtail juveniles are at a temperature of around 22 c (fujimoto et al . Since yellowtail juveniles were also collected with floating seaweeds in this study, it is suggested that the juveniles retained on the spawning grounds by eddies start to accompany floating seaweeds in waters southeast of the continental shelf where sea surface temperatures are optimal for their growth . Thus, yellowtail juveniles spawned earliest in the east china sea utilize floating seaweeds distributing on the continental shelf in the east china sea as their nursery in february and early march . Floating s. horneri in the east china sea plays an indispensable role as nursery habitat for commercially important species in february and early march . It is important to identify their source populations along the chinese coast and to conserve s. horneri beds that support the unique ecosystem of floating seaweeds in the east china sea.
Orthodontists traditionally consider restored oral health, function, and aesthetics as the principal therapeutic goals.1 however, improved aesthetics and its positive psychosocial impact are increasingly being accepted as important benefits of treatment.1,2 occlusal or orthodontic treatment need indices are available to classify the anatomical and aesthetic aspects of malocclusion . The best - known and most - used tools are the dental aesthetic index (dai) and index of orthodontic treatment need (iotn).3,4 however, they do not account for the influence of malocclusion on the patient's quality of life.5 tools that attempt to assess the oral health - related quality of life (ohrqol) offer information on the patient's perception of their welfare in relation to a particular oral condition.6 several authors have employed ohrqol assessment questionnaires together with normative indices to study the impact of malocclusion on the patient's quality of life.7,8 in the past, ohrqol research focused on adults with periodontal disease, tooth loss, or inadequate dentures.9 recently, however, the ohrqol of children and adolescents has aroused considerable interest,10 to some extent because adolescents usually show great concern about their appearance, which plays an important role in their psychosocial welfare.11,12 the psychosocial impact of dental aesthetics questionnaire (pidaq) is a valuable tool that provides information on one aspect of the ohrqol . This self - rating instrument was designed to assess the psychosocial impact of dental aesthetics in young adults.6 brazilian, chinese, and spanish versions of the pidaq have been published recently,13 - 15 so its global use is increasing . The aims of the present study were to evaluate the psychosocial impact of malocclusion, determine its relationship with the severity of malocclusion, and assess the influence of gender and social class on this relationship in adolescents . The study sample was composed of 627 adolescents aged 12 - 15 years in 42 schools chosen randomly from 1,200 subjects of all the schools in valencia, spain . The fieldwork was carried out in november and december 2010 . In each of the selected schools, 15 - 20 adolescents underwent intraoral examinations by three examiners, who were calibrated against a gold standard in the use of the iotn (intraexaminer and interexaminer kappa> 0.85). Adolescents with visible lesions on their anterior teeth due to caries, traumatic injury, or hypoplasia / fluorosis or those who wore orthodontic appliances were excluded . The study was approved by the human research ethical committee of the university of valencia (approval number h1352114553202) and complied with the recommendations of the declaration of helsinki . Written informed consent for the intraoral examinations and survey was obtained from the parents . The pidaq, a psychometric instrument containing 23 items, is composed of four subscales, representing four areas, one positive and three negative: aesthetic concern (ac, three items), psychological impact (pi, six items), social impact (si, eight items), and dental self - confidence (dsc, six items). A five - point likert scale is used for each item . The response options are as follows: 0 = not at all; 1 = a little; 2 = somewhat; 3 = strongly; and 4 = very strongly.5 each subscale score can be calculated separately and is obtained by summing the item scores.14 to calculate the total pidaq score, the dsc items were re - coded to align them with the other subscales . This index is composed of 2 parts: the dental health component (dhc) and the aesthetic component (ac).3,15 the iotn - dhc is assessed by the examiner and classified into five grades according to the therapeutic need: grade 1 = none (normal occlusion); grade 2 = little (minor malocclusion); grade 3 = borderline (moderate malocclusion); grade 4 = great (severe malocclusion); and grade 5 = very great (very severe malocclusion). The iotn - ac is assessed by the patient using 10 photographs that show the degrees of malocclusion ranging from the least severe to the most severe . The 10 iotn - ac grades are combined into three groups: grades 1 - 4, grades 5 - 7, and grades 8 - 10.3 the uk registrar - general's social class scale was employed . This scale groups the population into the following five categories: i = professionals and higher managerial and technical occupations; ii = lower managerial and technical occupations, trade; iii = intermediate supervisory and clerical occupations; iva = skilled manual workers; ivb = partly skilled manual workers; and v = unskilled workers.16 in this study, categories i and ii were considered the high social class, category iii was considered the middle social class, and the remaining categories were considered the low social class . Univariate descriptive statistics were used to calculate the means of the quantitative variables, proportions of the categorical variables, and confidence intervals of both . The means were compared by using student's t - test and analysis of variance (p <0.05). Stepwise linear regression models were employed to study the linear relationship between the pidaq data as the dependant variable and the iotn components, gender, and social class as the independent predictive variables . The study sample was composed of 627 adolescents aged 12 - 15 years in 42 schools chosen randomly from 1,200 subjects of all the schools in valencia, spain . The fieldwork was carried out in november and december 2010 . In each of the selected schools, 15 - 20 adolescents underwent intraoral examinations by three examiners, who were calibrated against a gold standard in the use of the iotn (intraexaminer and interexaminer kappa> 0.85). Adolescents with visible lesions on their anterior teeth due to caries, traumatic injury, or hypoplasia / fluorosis or those who wore orthodontic appliances were excluded . The study was approved by the human research ethical committee of the university of valencia (approval number h1352114553202) and complied with the recommendations of the declaration of helsinki . Written informed consent for the intraoral examinations and survey was obtained from the parents . The pidaq, a psychometric instrument containing 23 items, is composed of four subscales, representing four areas, one positive and three negative: aesthetic concern (ac, three items), psychological impact (pi, six items), social impact (si, eight items), and dental self - confidence (dsc, six items). A five - point likert scale is used for each item . The response options are as follows: 0 = not at all; 1 = a little; 2 = somewhat; 3 = strongly; and 4 = very strongly.5 each subscale score can be calculated separately and is obtained by summing the item scores.14 to calculate the total pidaq score, the dsc items were re - coded to align them with the other subscales . This index is composed of 2 parts: the dental health component (dhc) and the aesthetic component (ac).3,15 the iotn - dhc is assessed by the examiner and classified into five grades according to the therapeutic need: grade 1 = none (normal occlusion); grade 2 = little (minor malocclusion); grade 3 = borderline (moderate malocclusion); grade 4 = great (severe malocclusion); and grade 5 = very great (very severe malocclusion). The iotn - ac is assessed by the patient using 10 photographs that show the degrees of malocclusion ranging from the least severe to the most severe . The 10 iotn - ac grades are combined into three groups: grades 1 - 4, grades 5 - 7, and grades 8 - 10.3 the uk registrar - general's social class scale was employed . This scale groups the population into the following five categories: i = professionals and higher managerial and technical occupations; ii = lower managerial and technical occupations, trade; iii = intermediate supervisory and clerical occupations; iva = skilled manual workers; ivb = partly skilled manual workers; and v = unskilled workers.16 in this study, categories i and ii were considered the high social class, category iii was considered the middle social class, and the remaining categories were considered the low social class . The pidaq, a psychometric instrument containing 23 items, is composed of four subscales, representing four areas, one positive and three negative: aesthetic concern (ac, three items), psychological impact (pi, six items), social impact (si, eight items), and dental self - confidence (dsc, six items). A five - point likert scale is used for each item . The response options are as follows: 0 = not at all; 1 = a little; 2 = somewhat; 3 = strongly; and 4 = very strongly.5 each subscale score can be calculated separately and is obtained by summing the item scores.14 to calculate the total pidaq score, the dsc items were re - coded to align them with the other subscales . This index is composed of 2 parts: the dental health component (dhc) and the aesthetic component (ac).3,15 the iotn - dhc is assessed by the examiner and classified into five grades according to the therapeutic need: grade 1 = none (normal occlusion); grade 2 = little (minor malocclusion); grade 3 = borderline (moderate malocclusion); grade 4 = great (severe malocclusion); and grade 5 = very great (very severe malocclusion). The iotn - ac is assessed by the patient using 10 photographs that show the degrees of malocclusion ranging from the least severe to the most severe . The 10 iotn - ac grades are combined into three groups: grades 1 - 4, grades 5 - 7, and grades 8 - 10.3 this scale groups the population into the following five categories: i = professionals and higher managerial and technical occupations; ii = lower managerial and technical occupations, trade; iii = intermediate supervisory and clerical occupations; iva = skilled manual workers; ivb = partly skilled manual workers; and v = unskilled workers.16 in this study, categories i and ii were considered the high social class, category iii was considered the middle social class, and the remaining categories were considered the low social class . Univariate descriptive statistics were used to calculate the means of the quantitative variables, proportions of the categorical variables, and confidence intervals of both . The means were compared by using student's t - test and analysis of variance (p <0.05). Stepwise linear regression models were employed to study the linear relationship between the pidaq data as the dependant variable and the iotn components, gender, and social class as the independent predictive variables . By gender, 47.8% and 52.2% of the sample were boys and girls, respectively . In terms of social class, 49.3%, 38.7%, and 12.0% belonged to the low, middle, and high social classes, respectively . The mean total pidaq score was 32.2 (95% confidence interval = 31.1 to 33.3). The mean dsc score was 11.3 (10.8 to 11.7), si score was 6.1 (5.6 to 6.5), pi score was 5.9 (5.6 to 6.3), and ac score was 7.44 (7.2 to 7.7). In the iotn - dhc, 54.4% of the adolescents had grades 1 and 2, 27.4% had grade 3, and 18.2% had grades 4 and 5 . The iotn - ac distribution was 90.3% for grades 1 - 4, 6.4% for grades 5 - 7, and 3.3% for grades 8 - 10 . Table 1 shows the relationships of the pidaq and iotn data with gender and social class . The total and subscale pidaq scores showed no significant differences by gender, except the pi subscale, where girls had higher scores (p = 0.02). No significant differences by social class were noted . The iotn - ac presented significant differences by gender, with a greater number of girls having grades between 5 and 10 (p = 0.02). The total pidaq score and the si, pi, and ac scores presented a significant positive linear relationship and the dsc score presented a significant negative linear relationship with the iotn - dhc grades (table 2). Table 3 shows that the iotn - dhc was a predictive variable of the total and subscale pidaq scores . Neither gender nor social class was an independent predictive variable of the relationship between the pidaq scores and the iotn - dhc grades, except the pi subscale, where gender was a predictive variable in the linear model . The total pidaq and si and pi scores showed a significant positive linear relationship and the dsc score presented a significant negative linear relationship with the iotn - ac grades . The pidaq - ac scores did not exhibit significant differences in the iotn - ac grades (table 4). The iotn - ac was a predictive variable of the total pidaq and dsc, si, and pi scores . A linear relationship between the pidaq - ac scores and the iotn - ac grades could not be established (table 5). Table 6 shows a descriptive analysis of the main occlusal conditions requiring orthodontic treatment (iotn - dhc grades 3 - 5) and increasing the pidaq scores: increased overjet, impeded tooth eruption or submerged deciduous teeth, tooth displacement, and increased overbite . The present study included a randomized and representative sample, good reliability of the examiners, and a validated questionnaire to measure the psychosocial impact of malocclusion in adolescents . However, considering the age of the subjects, comparisons with other studies should be made cautiously . Many authors consider it more advisable to analyze the psychosocial impact of dental aesthetics in adults, who are emotionally stable and have a realistic view of dentofacial aesthetics, than in adolescents.17,18 cooper et al.19 observed that the perception of dental aesthetics changes and even improves with age . Tuominem et al.20 also concluded that the perceived orthodontic treatment need seems to lessen with age even if the patient does not undergo orthodontic treatment . Several authors agree that the iotn - dhc measures the severity of malocclusion,21 but the reliability of the iotn - ac has been questioned.22,23 indeed, many studies have shown that results differ considerably according to whether the treatment need is measured objectively with the iotn - dhc or subjectively with the iotn - ac.22,24,25 nevertheless, the present study showed a significant linear association between the pidaq scores and the grades of both the iotn components . The pidaq - ac was the only subscale that did not show a linear correlation with the iotn - ac . Although the pidaq - dsc showed a linear relationship with the iotn - dhc, this association was not much stronger than that of the other subscales . In agreement with other studies,8,17,26 this study showed that the psychosocial impact of dental aesthetics increased with the severity of malocclusion, so the pidaq has considerable validity . This finding confirms that malocclusion has a psychosocial impact in adolescents, which can considerably influence their self - confidence and social life.6,27 increased overjet, tooth displacement, and increased overbite were the occlusal conditions that had a higher psychosocial impact . Dahong et al.28 obtained similar results; they considered that the overjet might induce a protrusive or retrusive profile and further influence the psychology of patients . In this study, only angle's classification or the incisor classification was used . Only sardenberg et al.13 and lin et al.14 have analyzed the psychosocial impact of malocclusion, but neither study was conducted in adolescents using the pidaq . We related the pidaq with a normative index (iotn) that has been used by many authors . Sardenberg et al.13 used the dai as a normative index, but lin et al.14 did not use any objective index . Although some studies have shown a relationship between the aesthetic impact of malocclusion and social class,8 the present study showed no such association, as previously reported.29 noteworthily, the methods employed to obtain socioeconomic information differ among the relevant studies, so more research should be conducted with this aspect in mind . Other authors such as doan et al.30 also concluded that socioeconomic factors are unrelated to the perception of malocclusion . Although it did not influence three pidaq subscales (dsc, si, and ac), it affected the pi subscale . De oliveira and sheiham31 also found that the psychosocial impact of malocclusion is significantly greater in women than in men and affects their quality of life . Similarly, the present study showed that the girls' perception of their dental aesthetics was worse than that of the boys . Other studies have also indicated that men tend to be more satisfied with their dental aesthetics.22 we have observed lower punctuation than the brazilian version on the pidaq dsc subscale . Malocclusion has a psychological impact in adolescents and this impact increases with the severity of malocclusion . Social class may not influence this association, but gender has some effect, because the psychological impact is greater in girls.
With the rapid development of the economy and society, the incidence of tbi in china is rising year by year, and its mortality and morbidity rates remain high, making it a great burden for the patients families both mentally and economically . It has been revealed that tbi can be divided into two phases: the initial injury caused by violence, which is inevitable, and the secondary injury within hours or days after initial injury, caused by the inflammatory response, oxidative stress, calcium overload, and a series of other pathological processes, which is the major target of current interventions . Previous studies have demonstrated the effectiveness of hyperbaric oxygen therapy in treatments for secondary brain damage after trauma, but the mechanism has not been fully clarified . In this study, we investigated the efficacy of hyperbaric oxygen for secondary brain injury after trauma, with a focus on the tlr4/nf-b signaling pathway, in an effort to clarify the mechanism of its protective effect and to provide guidance for the safer and more efficient clinical use of hyperbaric oxygen . Sixty healthy adult male sd rats were randomly divided into 3 groups: the sham group, the untreated tbi group, and the hyperbaric oxygen - treated tbi group . A rat model of tbi the rats were anesthetized using chloral hydrate at 4 mg / kg and fixed on a bracket . After skin preparation, a 5 mm opening was made with an orthopedic drill at 3 mm to the right of the coronal suture and 3 mm behind the sagittal suture, keeping the dura intact . Then, a 40 g object was dropped from 15 cm high and vertically crashed into the exposed dura to make a 3 mm deep and 4 mm diameter hole . All of the experimental program and operation procedures in this study were approved by the experimental animal ethics committee . The rats were placed into the animal chamber, which was purged with pure oxygen for 10 min to ensure that the oxygen fraction in the chamber was> 95% . The sham control group and untreated tbi group were also placed in the same chambers and were subjected to the same experimental procedures, only without the hyperbaric oxygen treatment . At 24 h after injury, the rats were anesthetized, and 100 ml of normal saline was infused through the cardiac apex . Protein concentration was determined by bradford assay, and 1/4 volume of 5 loading buffer was added, followed by a boiling water bath for 20 min for denaturation . A sample consisting of 35 g of protein was loaded, separated by electrophoresis, transferred to membrane, blocked, and incubated with antibodies to tlr4, ib, p65, cleaved caspase-3, gapdh, or h3 (1:200, purchased from santa cruz, usa) at 4c on a shaker overnight, then washed, incubated with the corresponding hrp - conjugated secondary antibody, and washed again . Finally, ecl solution was added to reveal the bands, whose gray value was analyzed by image j software . Elisa assay kits for tnf-, il-6 and il-1 were all purchased from unitech biotechnology, and experiments were conducted according to the manufacturer s instructions . Paraffin - embedded brain tissue was cut into 4 m sections and analyzed by the tunel assay to determine apoptosis of the neurons . The tunel assay kit was purchased from roche, usa, and the experiment was conducted strictly according to the manufacturer s instructions . The tunel assay result for the tissue around the trauma was observed under an optical microscope, and 10 random visual sections under 400 magnification were evaluated for the percentage of tunel - positive cells . The neurological function of the rats was evaluated by the neurological severity scores (nss), including motor function, sensory function, balance ability, physiological reflex defect, and abnormal movement . For each of the 18 projects, the inability to complete a task or lack of corresponding response was scored 1 point . Cases with scores of 1318 points in total are regarded as severe injury, 712 points as moderate injury, and 16 points as mild injury . The spss 15.0 software was used for statistical analysis, and the data are presented as means standard deviation (xs). The neurological function scores were compared by the kruskal - wallis test, and comparisons among multiple groups were performed using one - way analysis of variation . Sixty healthy adult male sd rats were randomly divided into 3 groups: the sham group, the untreated tbi group, and the hyperbaric oxygen - treated tbi group . A rat model of tbi the rats were anesthetized using chloral hydrate at 4 mg / kg and fixed on a bracket . After skin preparation, a 5 mm opening was made with an orthopedic drill at 3 mm to the right of the coronal suture and 3 mm behind the sagittal suture, keeping the dura intact . Then, a 40 g object was dropped from 15 cm high and vertically crashed into the exposed dura to make a 3 mm deep and 4 mm diameter hole . All of the experimental program and operation procedures in this study were approved by the experimental animal ethics committee . The rats were placed into the animal chamber, which was purged with pure oxygen for 10 min to ensure that the oxygen fraction in the chamber was> 95% . The sham control group and untreated tbi group were also placed in the same chambers and were subjected to the same experimental procedures, only without the hyperbaric oxygen treatment . At 24 h after injury, the rats were anesthetized, and 100 ml of normal saline was infused through the cardiac apex . Protein concentration was determined by bradford assay, and 1/4 volume of 5 loading buffer was added, followed by a boiling water bath for 20 min for denaturation . A sample consisting of 35 g of protein was loaded, separated by electrophoresis, transferred to membrane, blocked, and incubated with antibodies to tlr4, ib, p65, cleaved caspase-3, gapdh, or h3 (1:200, purchased from santa cruz, usa) at 4c on a shaker overnight, then washed, incubated with the corresponding hrp - conjugated secondary antibody, and washed again . Finally, ecl solution was added to reveal the bands, whose gray value was analyzed by image j software . Elisa assay kits for tnf-, il-6 and il-1 were all purchased from unitech biotechnology, and experiments were conducted according to the manufacturer s instructions . Paraffin - embedded brain tissue was cut into 4 m sections and analyzed by the tunel assay to determine apoptosis of the neurons . The tunel assay kit was purchased from roche, usa, and the experiment was conducted strictly according to the manufacturer s instructions . The tunel assay result for the tissue around the trauma was observed under an optical microscope, and 10 random visual sections under 400 magnification were evaluated for the percentage of tunel - positive cells . The neurological function of the rats was evaluated by the neurological severity scores (nss), including motor function, sensory function, balance ability, physiological reflex defect, and abnormal movement . For each of the 18 projects, the inability to complete a task or lack of corresponding response cases with scores of 1318 points in total are regarded as severe injury, 712 points as moderate injury, and 16 points as mild injury . The spss 15.0 software was used for statistical analysis, and the data are presented as means standard deviation (xs). The neurological function scores were compared by the kruskal - wallis test, and comparisons among multiple groups were performed using one - way analysis of variation . Compared to the sham group (figures 1, 2; table 1), the tlr4, p65, and cleaved caspase-3 levels in peri - trauma tissue in the untreated tbi group were significantly elevated (p<0.05), while hyperbaric oxygen significantly inhibited the expression of tlr4, p65, and cleaved caspase-3 (p<0.05); in addition, hyperbaric oxygen significantly inhibited the degradation of ib after tbi (p<0.05). Compared to the sham group, the levels of tnf-, il-6 and il-1 in the untreated tbi group were significantly increased (table 2, p<0.05), while hyperbaric oxygen significantly inhibited expression of tnf-, il-6 and il-1 (table 2, p<0.05). Apoptotic neurons with condensed nuclei were stained brown in the tunel assay (figure 3), while normal cells were large, round, and not stained . In the sham group, few apoptotic neurons were observed; in the untreated tbi group, significantly more apoptotic neurons were observed (figure 3, table 2, p<0.05); and after hyperbaric therapy, the number of peri - trauma apoptotic neurons was significantly reduced (p<0.05). Compared with the sham group, the neurological function of rats of the tbi group decreased significantly (table 3, p<0.05), whereas hyperbaric oxygen significantly improved the neurological function of the rats after tbi (table 3, p<0.05). Compared to the sham group (figures 1, 2; table 1), the tlr4, p65, and cleaved caspase-3 levels in peri - trauma tissue in the untreated tbi group were significantly elevated (p<0.05), while hyperbaric oxygen significantly inhibited the expression of tlr4, p65, and cleaved caspase-3 (p<0.05); in addition, hyperbaric oxygen significantly inhibited the degradation of ib after tbi (p<0.05). Compared to the sham group, the levels of tnf-, il-6 and il-1 in the untreated tbi group were significantly increased (table 2, p<0.05), while hyperbaric oxygen significantly inhibited expression of tnf-, il-6 and il-1 (table 2, p<0.05). Apoptotic neurons with condensed nuclei were stained brown in the tunel assay (figure 3), while normal cells were large, round, and not stained . In the sham group, few apoptotic neurons were observed; in the untreated tbi group, significantly more apoptotic neurons were observed (figure 3, table 2, p<0.05); and after hyperbaric therapy, the number of peri - trauma apoptotic neurons was significantly reduced (p<0.05). Compared with the sham group, the neurological function of rats of the tbi group decreased significantly (table 3, p<0.05), whereas hyperbaric oxygen significantly improved the neurological function of the rats after tbi (table 3, p<0.05). Numerous studies have shown that hyperbaric oxygen can increase oxygen concentration, increase oxygen diffusion distance, and induce a variety of mechanisms to correct the acidosis neuroprotective effect . This study showed that hyperbaric oxygen can significantly reduce the rate of neuronal apoptosis after traumatic brain injury, significantly improving neurological function in rats, which is consistent with previous studies . Recent studies have also found that hyperbaric oxygen could suppress the inflammatory response after traumatic brain injury to exert neuroprotective effects . Tlr4 is an important member of the tlr family, a group of type i transmembrane molecules, consisting of an extracellular segment, a transmembrane segment and an intracellular tir segment . It plays an important role in hypoxic - ischemic brain injury, cerebral hemorrhage, spinal cord injury, and other acute injury of the central nervous system [68]. High expression of tlr4 has been observed in the tissue around brain trauma in both animal models and clinical studies, while tlr4 knockout mice showed significantly alleviated secondary brain injury after brain trauma, and a specific tlr4 inhibitor also significantly alleviated brain damage, suggesting that therapies targeting tlr4 have great potential in improving the prognosis of tbi . In this study, tlr4 protein expression significantly increased after tbi, and hyperbaric oxygen therapy significantly inhibited tlr4 expression, reduced apoptosis of neurons after tbi and improved the neurological function of the rats, suggesting that down - regulation of tlr4 is an important part of the neuron - protective effect of hyperbaric oxygen therapy . When bound by its receptor during tbi, tlr4 interacts with downstream myeloid differentiation factor 88 and activates ikk, which phosphorylates ib and leads to the degradation of ib . Then, nf-b p65 protein is released from ib and translocates from the cytoplasm to the nucleus to interact with the promoters of its target genes, regulating the expression of a series of inflammatory cytokines . Nf-b is the master regulator of a series of inflammatory cytokines and is significantly elevated in the tissue surrounding brain trauma, and specific nf-b inhibitors significantly reduced the expression of inflammatory cytokines after tbi and relieved secondary brain injury . In addition, recent studies have shown that hyperbaric oxygen therapy significantly inhibited microglia activation and inflammatory cytokine production in the central nervous system . In this study, we found that p65 expression was significantly increased in peri - trauma tissue after tbi, which is consistent with previous studies, and hyperbaric oxygen therapy significantly inhibited p65 expression in the nucleus . Taken together, it is speculated that the inhibition of nf-b signaling may be the basic mechanism in the neuroprotective effect of hyperbaric oxygen therapy . Hyperbaric oxygen therapy significantly reduces apoptosis in peri - trauma tissue after tbi, inhibits the expression of inflammatory cytokines, and significantly improves the neurological function of rats after tbi.
Transfusion - related acute lung injury (trali) is typically presented as pulmonary edema with bilateral pulmonary infiltrations on chest radiography and severe dyspnea, tachypnea and cyanosis which develops during or within 6 hr of transfusion (1). The diagnostic criteria was proposed by trali consensus conference in 2004 (table 1) (2). Most patients having suspected trali require supplemental oxygen and approximately 70% of affected patients require mechanical ventilation . Although the estimated incidence of trali is 1 in 5,000 and the mortality is 6%, the true frequency is not known (1, 3). Suspected cases of trali may have been misdiagnosed or underestimated until now due to the poor awareness or lack of laboratory evidence . Many studies revealed that the mechanism of trali is triggered by the presence of anti - human leukocyte antigen (anti - hla) or anti - human neutrophil antigen (anti - hna) antibodies present in plasma of donor and/or recipient . The identification of anti - hla or anti - hna antibodies in plasma of donor and/or recipient supports the diagnosis of trali (2). Although there are a few documented reports about trali in korea, the identification of immunopathogenic evidence was not performed sufficiently (4). Recently, we've experienced two cases of trali triggered by patients' anti - hla antibodies which were specific for hlas of transfused packed red blood cells (prbc). Clinical manifestations as well as the findings of donors' and patients' hla and anti - hla concordance strongly supported the diagnosis of trali triggered by minor pathogenesis . A 66-yr - old man having lung cancer with fibrosis was admitted through emergency room due to dyspnea on august 25, 2008 . The initial vital signs were blood pressure 97/56 mmhg, pulse rate 77/min, respiratory rate 22/min and body temperature 37.3 and laboratory findings were spo2 80% and 3,960/l-10.0 gm / dl-12410/l for white blood cells (wbc)-hemoglobin (hb)-platelet, respectively . On the second hospital day, pancytopenia became aggravated (2,810/l-7.8 gm / dl-7210/l for wbc - hb - platelet, respectively), so transfusion of 2 units of prbc was planned to correct anemia . Approximately 5 min after starting transfusion of the second unit of prbc, the patient presented dyspnea, cyanosis and shivering with elevation of body temperature (38), he developed severe respiratory failure (sao2 <50%, paco2 25.7 mmhg, pao2 25.8 mmhg, respiratory rate> 60/min) and hypotension (systolic blood pressure <70 mmhg). The chest radiograpy taken after intubation showed interval aggravation of bilateral diffuse ground glass opacity of lung parenchyma with pleural effusion but with normal cardiothoracic ratio (fig . The echocardiogram taken soon after the patient was transferred to the intensive care unit showed normal lv cavity size and moderate lv systolic dysfunction (lv ejection fraction was 39%) with mild aortic regurgitation . The patient did not have any clinical signs of transfusion associated - circulatory overload (taco) such as jugular venous distension, systolic hypertension or gallop . B - type natriuretic peptide (bnp) (triage, biosite, united kingdom) level measured an hour after the event of respiratory failure was 106 pg / ml which was slightly elavated (reference range 5 - 100 pg / ml). It has been suggested that if the level of bnp is higher than 250 pg / ml, it is indicative of congestive heart failure, but if less than 150 pg / ml, trali is more likely (5). Acute hemolytic transfusion reaction also has been excluded based on repeated compatible serologic cross - match result and absence of typical clinical features such as hemoglobinuria, decreased hemoglobin level or renal failure . One month ago, he had been transfused with 2 units of prbc without any adverse transfusion reactions . Since there were no angioedema, wheezing, strigor or urticaria, the diagnosis of anaphylactic transfusion reaction was also excluded . Patient's pre- and post - transfusion blood samples and remnants of 2 units of transfused prbc were subjected to further immunologic studies . Hla typing and tests for panel reactive antibody (pra) were performed by pcr - ssp (biotest, germany) and elisa (gti, usa), respectively . Prior to transfusion, the patient already had multiple anti - hla antibodies (anti - a32, anti - dr8) which were specific for hla type of prbc (first prbc: a*32/dr8 and second prbc: a*33/cregs). And the% pras of patient's serum after transfusion were further increased to 40% (anti - a1, -a25, -a32, -b37, -b45, -b51, -b63) and 37% (anti - dr8, -dr52) of anti - hla class i and ii antibodies, respectively . The spectrum of donor specific anti - hla antibodies became broadened and the titers were elevated (table 2). There was no clinical improvement in pulmonary complications and the patient could not wean ventilator support . A 62-yr - old woman was hospitalized for palliative treatment of rectal cancer with multiple lung metastasis on october 1 . On the 9th hospital day, she complained of mild dyspnea and had a radiological finding compatible with mild pulmonary edema (fig . Day, transfusion of 8 units of platelet concentrates (pc) and 2 units of prbc were planned to correct thrombocytopenia and anemia (7,880/l-8.0 g / dl-910/l for wbc - hb - platelet, respectively). 8 units of pc were transfused without any adverse transfusion reactions . However, after transfusion of approximately 30ml of the first unit of prbc, the patient complained of difficulty in breathing . A chest radiography taken shortly after the onset of symptoms showed aggravated bilateral lung infiltrations (fig . 2b). Patient's blood pressure was increased to 164/92 mmhg from 114/60 mmhg, but it became normalized to 105/61 mmhg after 2 and half hours . To differentiate taco, further echocardiogram or bnp blood test were not done . However, taco was less likely for worsening the patient's pulmonary symptoms and signs when considering the facts that blood pressure was decreased to the baseline level shortly after stopping transfusion and pulmonary edema with dyspnea was not improved by diuretics therapy during hospitalization . Other clinical entities which cause acute respiratory distress such as acute hemolytic transfusion reactions and anaphylactic transfusion reactions have been excluded in the same manner with the first case . Similarly with the first case, patient's serum after transfusion had multiple anti - hla antibodies (36.5% pra for hla class ii) including anti - dr4 which was specific for hla type of transfused prbc (table 2). Based on the clinical and laboratory findings including the presence of patient's anti - hla antibodies which potentially could have reacted with donor's leukocyte antigens, the diagnosis of trali that is responsible for worsening the patient's respiratory function which had pre - existing mild pulmonary edema has been made . A 66-yr - old man having lung cancer with fibrosis was admitted through emergency room due to dyspnea on august 25, 2008 . The initial vital signs were blood pressure 97/56 mmhg, pulse rate 77/min, respiratory rate 22/min and body temperature 37.3 and laboratory findings were spo2 80% and 3,960/l-10.0 gm / dl-12410/l for white blood cells (wbc)-hemoglobin (hb)-platelet, respectively . On the second hospital day, pancytopenia became aggravated (2,810/l-7.8 gm / dl-7210/l for wbc - hb - platelet, respectively), so transfusion of 2 units of prbc was planned to correct anemia . Approximately 5 min after starting transfusion of the second unit of prbc, the patient presented dyspnea, cyanosis and shivering with elevation of body temperature (38), he developed severe respiratory failure (sao2 <50%, paco2 25.7 mmhg, pao2 25.8 mmhg, respiratory rate> 60/min) and hypotension (systolic blood pressure <70 mmhg). The chest radiograpy taken after intubation showed interval aggravation of bilateral diffuse ground glass opacity of lung parenchyma with pleural effusion but with normal cardiothoracic ratio (fig . The echocardiogram taken soon after the patient was transferred to the intensive care unit showed normal lv cavity size and moderate lv systolic dysfunction (lv ejection fraction was 39%) with mild aortic regurgitation . The patient did not have any clinical signs of transfusion associated - circulatory overload (taco) such as jugular venous distension, systolic hypertension or gallop . B - type natriuretic peptide (bnp) (triage, biosite, united kingdom) level measured an hour after the event of respiratory failure was 106 pg / ml which was slightly elavated (reference range 5 - 100 pg / ml). It has been suggested that if the level of bnp is higher than 250 pg / ml, it is indicative of congestive heart failure, but if less than 150 pg / ml, trali is more likely (5). Acute hemolytic transfusion reaction also has been excluded based on repeated compatible serologic cross - match result and absence of typical clinical features such as hemoglobinuria, decreased hemoglobin level or renal failure . One month ago, he had been transfused with 2 units of prbc without any adverse transfusion reactions . Since there were no angioedema, wheezing, strigor or urticaria, the diagnosis of anaphylactic transfusion reaction was also excluded . Patient's pre- and post - transfusion blood samples and remnants of 2 units of transfused prbc were subjected to further immunologic studies . Hla typing and tests for panel reactive antibody (pra) were performed by pcr - ssp (biotest, germany) and elisa (gti, usa), respectively . Prior to transfusion, the patient already had multiple anti - hla antibodies (anti - a32, anti - dr8) which were specific for hla type of prbc (first prbc: a*32/dr8 and second prbc: a*33/cregs). And the% pras of patient's serum after transfusion were further increased to 40% (anti - a1, -a25, -a32, -b37, -b45, -b51, -b63) and 37% (anti - dr8, -dr52) of anti - hla class i and ii antibodies, respectively . The spectrum of donor specific anti - hla antibodies became broadened and the titers were elevated (table 2). There was no clinical improvement in pulmonary complications and the patient could not wean ventilator support . A 62-yr - old woman was hospitalized for palliative treatment of rectal cancer with multiple lung metastasis on october 1 . On the 9th hospital day, she complained of mild dyspnea and had a radiological finding compatible with mild pulmonary edema (fig . Day, transfusion of 8 units of platelet concentrates (pc) and 2 units of prbc were planned to correct thrombocytopenia and anemia (7,880/l-8.0 g / dl-910/l for wbc - hb - platelet, respectively). 8 units of pc were transfused without any adverse transfusion reactions . However, after transfusion of approximately 30ml of the first unit of prbc, the patient complained of difficulty in breathing . A chest radiography taken shortly after the onset of symptoms showed aggravated bilateral lung infiltrations (fig . Patient's blood pressure was increased to 164/92 mmhg from 114/60 mmhg, but it became normalized to 105/61 mmhg after 2 and half hours . To differentiate taco, further echocardiogram or bnp blood test were not done . However, taco was less likely for worsening the patient's pulmonary symptoms and signs when considering the facts that blood pressure was decreased to the baseline level shortly after stopping transfusion and pulmonary edema with dyspnea was not improved by diuretics therapy during hospitalization . Other clinical entities which cause acute respiratory distress such as acute hemolytic transfusion reactions and anaphylactic transfusion reactions have been excluded in the same manner with the first case . Similarly with the first case, patient's serum after transfusion had multiple anti - hla antibodies (36.5% pra for hla class ii) including anti - dr4 which was specific for hla type of transfused prbc (table 2). Based on the clinical and laboratory findings including the presence of patient's anti - hla antibodies which potentially could have reacted with donor's leukocyte antigens, the diagnosis of trali that is responsible for worsening the patient's respiratory function which had pre - existing mild pulmonary edema has been made . In 1983, popovsky and moore first identified " trali " as a distinct clinical entity (6). Recently trali has risen many concerns and awareness as the leading cause of transfusion - related mortality . Trali is defined as acute hypoxemia and non - cardiogenic bilateral lung infiltrations, which presents as severe dyspnea, tachypnea and cyanosis, and develops during or within 6 hr after completion of transfusion (1). Trali must be differentiated clinically from taco and a variety of other conditions including acute hemolytic transfusion reactions, anaphylactic transfusion reactions, pulmonary embolism, acute myocardial infarction and bacterial contamination of the transfused product (7). Like trali there are a lot of questions about the possibility of coexistence of trali and taco and the difficulties in assigning transfusion - associated respiratory failure to a single cause, even when taco can be demonstrated clearly (7, 8). Taco is defined by a combination of clinical signs such as post - transfusion hypertension, tachycardia, jugular vein distension, elevated central venous pressure and pulmonary artery occlusion pressure, pulmonary edema with cardiomegaly on chest radiography and the prompt response to diuretics or treatment of ischemia . Bnp and n - terminal pro - bnp (nt - pro - bnp), cardiac neurohormones specifically being secreted from the ventricles in response to volume expansion, pressure overload or hypoxemia, have been reported as useful markers for diagnosis or exclusion of taco (8). However, li and colleagues recently found that natriuretic peptides have limited diagnostic value in a differential diagnosis of pulmonary edema after transfusion in the critically ill patients . Because bnp and nt - pro - bnp secretions were attributed to stimulatory effect of hypoxemia, as well as volume expansion and pressure overload and accuracy of bnp tests could be affected by the timing of the blood collection and other underlying diseases (5). Therefore, we cannot totally depend on elevated bnp or nt - pro - bnp to differentiate trali from taco in patients presenting dyspnea and hypoxemia after transfusion . In our cases, the possibility of coexistence of trali and taco couldn't be excluded completely . All plasma containing blood components have been associated with development of trali, including whole blood, prbc, pc, fresh frozen plasma (ffp), and rarely, cryoprecipitate, iv immunoglobulin, and stem cell preparations . Plasma rich blood components, such as ffp and pc were known to be most commonly implicated in trali (9). It was reported that almost any blood component containing about 50ml or more of plasma could be implicated in trali . Recently, one report showed that estimated residual plasma volume as low as 10 - 20 ml which contains donor derived leukocyte antibodies might cause trali (10). The anti - hla and anti - hna antibodies and biologically active lipids in stored cellular blood components have been described (11). Most cases of trali has been so far considered to be caused by anti - hla class i, anti - hla class ii, or anti - hna antibodies in the donor's plasma, which is called the major pathogenesis . Transfusion of donor's antibodies into a recipient who has the cognate antigens leads to neutrophil activation and release of oxidative substances that damage the pulmonary endothelium . This injury to pulmonary endothelium may cause an imbalance between the amount of fluid entering the alveoli and being actively removed and then results in severe pulmonary edema (1, 3). However, fewer than 10% of trali cases involve the reverse mechanism in which the recipient has anti - hla or anti - hna antibodies against donor's leukocyte antigens (12). Due to relatively small number of leukocytes in the transfused blood components, it has been questioned whether trali can be caused by leukocyte antibodies in the patient's serum . The development of trali even with a relatively few leukocytes transfused in our cases might be explained by the activation of the recipient's own leukocytes either as a consequence of activating factors released by the small number of transfused leukocytes after antibody binding or by an abnormal binding of the recipient's alloantibodies to his / her own leukocytes . Leukocyte antibodies in the recipient reacting with leukocytes in the blood product have also been described in several studies (1, 13 - 15). Trali has traditionally been associated with the infusion of anti - hla class i antibodies in transfused blood components . However, trali caused by anti - hla class ii antibodies without simultaneous presence of anti - hla class i antibodies have rarely been described . In recent report, it has been suggested that anti - hla class ii antibodies play a critical role in initiating trali development (16). Proposed mechanism is that hla class ii - expressing cells, such as monocytes, may lead to the production of il-1, tnf- and tissue factors and release of these cytokines may result in the secondary activation of neutrophils and/or endothelial cells leading to endothelial damage, capillary leak, and eventually trali (12, 17, 18). Our second case supports the role of anti - hla class ii alone as the cause of trali . There has been international movement to reduce the risk of trali (11, 19). Most efforts are focusing on reducing of the use of plasma components from female donors . Since the donors of the implicated blood component in trali have been usually multiparous women who produced multiple antibodies against paternal leukocyte antigens during pregnancies . According to the 2008 annual serious hazards of transfusion (shot) report of uk, no case of trali due to ffp was reported in 2005, 2006 and 2007, following the introduction of preferential use of ffp from male donors since late 2003 . In 2008, observed rates of trali remain lower than those in 2003 - 2004 when trali risk reduction strategies were first initiated and no deaths occurred as a result of trali which is the lowest rate since 1996 . Base on these, shot organization emphasizes the need to achieve 100% use of male ffp and plasma for platelet pooling across the uk (20). In conclusion, trali must be considered as a serious but not infrequent adverse transfusion reaction which needs to be diagnosed promptly in a ways of clinical suspicion, and radiological, biochemical and immunological findings and treated appropriately.
Prostate cancer is the most common cancer among nigerian men and the second most common cause of death from cancer in men worldwide . Prostate cancer is more common in blacks and mixed race men compared to men of european or of asian descent . The primary goal of prostate cancer screening is to reduce deaths due to prostate cancer through early detection and prompt management . Men with screen - detected cancer can potentially fall into 1 of 3 categories: those whose cancer will result in death despite early diagnosis and treatment, those who will have good outcomes in the absence of screening, and those for whom early diagnosis and treatment improves survival . Recommended screening test for prostate cancer is the measurement of serum prostate specific antigen (psa) levels; other methods of screening such as digital rectal examination or ultrasonography are secondary . There are contradictions in the current guidelines by various medical organizations on screening for prostate cancer . The american urological association and the american cancer society recommended screening for all men aged 50 years and above with life expectancy more than 10 years and also men aged 4045 years who are at a high - risk for the condition like african americans and those with affected first degree relatives . However, the national cancer institute and the united states preventive service task force did not recommend routine screening for prostate cancer in the general population or in at - risk population group such as blacks . This is because evidence shows that psa - based screening programs result in the detection of many cases of asymptomatic prostate cancer that either will not progress or will progress so slowly that it would have remained asymptomatic for the man's lifetime . The terms over - diagnosis or pseudo - disease are used to describe both situations . Routine prostate cancer screening is not a common practice in nigeria despite the fact that it is the most common cancer in nigerian men . Awareness of prostate cancer among nigerian men is poor majority of our patients usually present in the hospital when the disease is already advanced . Previous local studies on prostate cancer highlighted the need to increase awareness and surveillance for the disease . Prevalence of prostate cancer as reported by different researchers across nigeria is between 2% and 11% . The country is also ranked third among countries with significant death from prostate cancers after the united states and india according to world health organization . The main aim of this study is sensitize adult males about prostate cancer and the available screening tests . Objectives of the study include assessing the level of awareness of prostate cancer among adult males attending our outpatient clinics, determining sources of information about the disease, proportion of participants who have had previous screening for prostate cancer, and the association between awareness of prostate cancer and sociodemographic characteristics of the study participants . The hospital is a tertiary health facility that is located in ikeja local government area of lagos state . The hospital is 484 bedded facility spaces that catered for patients from in and around lagos state . Consecutives consenting adults male, 40-year - old and above attending the various outpatient clinics at the departments of medicine, surgery and general outpatient of the hospital were included in the study . Excluded from the study were health care workers, patients already diagnosed with prostate cancer, acutely ill patients who were unable to fill or respond to the questionnaires and patients who were unwilling to participate . The estimated total sample size was 138, 50 patients were recruited from each of the three clinics (medical outpatient, surgical outpatient, and general outpatient), making a total of 150 participants . The questions were written in english language, the attending doctors in filling the questionnaires assisted patients who do not write or understand english . The questionnaire had 21 items and was designed to assess respondents awareness of prostate cancer, possible family history of prostate cancer, and history of previous screening for the disease . Information obtained from the participants was coded and no personal identifier was used in order to maintain confidentiality . Data obtained during the study was transferred from the questionnaires and saved in a database using the version 15 of statistical package for the social sciences (spss, inc ., associations between categorical variables were tested using the chi - square test; the level of significances was taken as p <0.05 . The mean age of participants that took part in the study was 58 years, with the age range of 4080 years . Assessment of level of education of participants showed that 48.6% had postsecondary education and only 2.7% had no formal education [table 1]. Demographic characteristics of study participants assessment of awareness showed that 47.3% of respondents were aware of prostate cancer, 52.7% have never heard of the disease . The sources of information about the disease revealed that 21.2% became aware of the disease through the media, 9% heard about the disease from health workers [table 2]. Sources of information about prostate cancer among the 47.3% participants who were aware of prostate cancer, 14.4% knew someone who has the disease; the other 32.9% though aware of the disease do not know anyone who has been diagnosed with the disease . Enquiry about the awareness of screening tests revealed that 13.7% of participants were aware of the availability of screening tests for the disease . Only 8.2% of the respondents had actually done any form of screening for the disease . Seven had a psa test, two had digital rectal examination, one had a biopsy and the remaining two cannot mention the screening test they did . The study did not show any association between age of participants and awareness of the disease . There was however association between the level of education and awareness, the better educated the participants the better their level of awareness [table 3]. This study showed that the level of awareness of prostate cancer, a condition which is the most common cancer among men aged 40 years and above in our environment is still low, only 47% of respondents from this study are aware of this disease . In a similar study, done in a rural community of ogun state in south - western nigeria this is lower than the awareness rate in our study but the fact that our survey took place in an urban setting and among hospital patients may account for the difference . Knowing the level of awareness about a disease condition is important for both the government and health care workers for the purpose of planning and organization of health care delivery to the group of people affected or to people at risk of developing the disease condition . The source of information about awareness of the disease showed that majority got their information about the disease from the news media, 45% (31/69) of those who are aware of the disease got their information from this source . It is therefore important in the dissemination of the information about the disease to take advantage of this channel of information for the purpose of health education activities . The fact that all the 146 participants in this study had contact with health care workers during this survey and despite this only 13 (8.9%) of them got any information about the disease from health care workers shows that more efforts still are still needed from the health care workers to educate people about the disease . There is a need for the health care workers to take advantage of their contact with adult males who are at risk of this disease to give them some information about the disease during their contact . Provision of information leaflets containing short information on the common diseases in our community in different languages and made available to all patients when they have contact with healthcare workers may help with improving level of awareness about such diseases among patients . The low level of awareness about the disease may explain the low number of respondents who have had any form of screening done for the disease . These studies have showed that early screening is important in the reduction of morbidity and mortality from the disease . However, awareness about the disease would be first step for the people to present themselves for screening . This study has showed that the level of awareness of prostate cancer among adult male patients attending hospital clinic at our center is low . The most common source of information about the disease among participants is the news media; our health care workers need to do more in disseminating information about the disease . More efforts are needed to encourage adults male who are at risk to go for voluntary screening as early detection have been shown to improve the disease outcome.
Amelogenesis imperfecta (ai) is a common group of inherited defects that presentquantitative or qualitative tooth enamel malformation in the absence of systemic manifestations . Ai is sometimes associated with different syndromes such as tricho - dento - osseous (tdo) syndrome (omim #190320) and cone rod dystrophy . According to population - base studies, the incidence of ai varies, from 1 in 700 to 1 in 15,000 (2). The phenotype of affected individuals is highly variable and can be divided based on whether the abnormality results in a reduced amount of enamel (hypoplasia), deficient calcification (hypocalcification), or deficient maturation of the enamel (hypomaturation) (1, 3). The mineralization level of enamel in the hypomaturation and hypocalcified ai is not normal and can be described as hypomineralized . Its genetic inheritance pattern is reported as either an x - linked or autosomal recessive (ar) or autosomal dominant (ad) (3, 4). In order to better understand how defective enamel formation occurs through development, two fundamental questions must be addressed (1) which candidate genes are responsible for various forms of ai (2) and how do these candidate genes and their protein partners work together in normal and abnormal enamel formation? So far, changes in several ameloblast specific genes have been detected including amelogenin (amelx) (57), ameloblastin (ambn) (8, 9), enamelysin (enam)(1017), kallikrein - related peptidase-4klk4(18, 19),family with sequence similarity 83 (fam83h) (6, 2022) and matrix metalloproteinase 20 (mmp20)(14, 2325). In the present study, we aimed to screen the genetic alterations in the most important candidate genes, enam, klk4, mmp20 and fam83h responsible for ai in five iranian families . This study was a case study based on genetic testing of affected patients and healthy people inclusion criteria for our study were as follows: 1) patients were required to have an isolated form of ai; 2) patients were included in this study with inheritance patterns . A total of 50 family members (22 affected and 28 unaffected) from five iranian families were studied . Five iranian families with ai were diagnosed at the pediatric dentistry department of tehran university of medical sciences (tums). The study was performed with the approval of the institutional review board (irb) and informed consent was obtained from each patient and controls before genetic testing . Was collected in test tubes containing 0.5 m edta from patients, unaffected members of the family and 100 healthy controls . Then, dna was extracted using dngplus kit (cinnagen, tehran - iran). The pcr amplification was typically carried out using primer pairs of exon - intron boundaries of enam, fam38h, mmp20 and klk4 genes (table 1), 0.2u taq dna polymerase (roche, mannheim, germany), 10pmole of each primer, 200 m of each dntps, 0.67l of 50 mm mgcl2, 60ng dna and 2.5 l of pcr buffer in 25l of pcr reactions . The pcr conditions included an initial denaturation step for 3 min at 95c, 30 sec at 95c, 45 sec at 64c with a 1c decrease every second cycle down to 55c, then 55c for 14 cycles, 1 min at 72c for extension, and finally 10 min at 72c . Subsequently, to determine any mutation the pcr product was subjected to direct sequencing (gene fanavaran, iran). Sequence data searches were performed in non - redundant nucleic and protein databases blast (http://www.ncbi.nlm.nih.gov/blast). This study was a case study based on genetic testing of affected patients and healthy people inclusion criteria for our study were as follows: 1) patients were required to have an isolated form of ai; 2) patients were included in this study with inheritance patterns . A total of 50 family members (22 affected and 28 unaffected) from five iranian families were studied . Five iranian families with ai were diagnosed at the pediatric dentistry department of tehran university of medical sciences (tums). The study was performed with the approval of the institutional review board (irb) and informed consent was obtained from each patient and controls before genetic testing . 5 ml peripheral blood was collected in test tubes containing 0.5 m edta from patients, unaffected members of the family and 100 healthy controls . Then, dna was extracted using dngplus kit (cinnagen, tehran - iran). The pcr amplification was typically carried out using primer pairs of exon - intron boundaries of enam, fam38h, mmp20 and klk4 genes (table 1), 0.2u taq dna polymerase (roche, mannheim, germany), 10pmole of each primer, 200 m of each dntps, 0.67l of 50 mm mgcl2, 60ng dna and 2.5 l of pcr buffer in 25l of pcr reactions . The pcr conditions included an initial denaturation step for 3 min at 95c, 30 sec at 95c, 45 sec at 64c with a 1c decrease every second cycle down to 55c, then 55c for 14 cycles, 1 min at 72c for extension, and finally 10 min at 72c . Subsequently, to determine any mutation the pcr product was subjected to direct sequencing (gene fanavaran, iran). Sequence data searches were performed in non - redundant nucleic and protein databases blast (http://www.ncbi.nlm.nih.gov/blast). After clinical examination, affected individuals from one family showed clinical features consistent with adhcai (fig . 1), while 4 consanguineous families with 18 affected members were diagnosed for arhpai . All affected individuals were clinically and radiographically examined and showed no signs of syndromic conditions or systemic illnesses associated with enamel malformation . In addition, dental examination of the unaffected members showed no evidence of any enamel defect and any syndromic signs . (a) the pedigree of the family represents an autosomal dominant pattern of inheritance with four affected patients . (e) dna sequencing revealed heterozygous in codon 342 for amino acid serine to threonine (c.1150t> a, p. ser 342thr).arrows indicate the proband and base subsituation the adhcai individuals were typically characterized by soft enamel, which wears off the tooth soon after eruption and following exposure to mastication forces . As it is shown in fig . 1c enamel cannot be distinguished from dentin by its opacity on radiographs; however, arhpai patients presented reduced enamel and spacing between teeth . Mutation screening in adhcai - affected members revealed one novel non - synonymous single - nucleotide substitution in the fam83h gene . This mutation was detected in codon 342 for amino acid serine to threonine (c.1150t> a, p. ser 342thr, fig . 1e) the mutation was identified in the affected members of the families with adhcai, but not in the unaffected individuals as well as in 100 healthy controls, indicating that this genetic change is not common variant in the iranian populations . The human fam83h gene is composed of five exons (orange boxes) and four introns (blue line). Arrows show the location of identified missense mutations in the c - terminal sequences moreover, although no significant mutations in enam, klk4 and mmp20 genes were detected in any probands, different polymorphisms were identified within non - coding or / and coding region sequences of these genes (table 2). Identified single nucleotide polymorphisms (snps) in this study after clinical examination, affected individuals from one family showed clinical features consistent with adhcai (fig . 1), while 4 consanguineous families with 18 affected members were diagnosed for arhpai . All affected individuals were clinically and radiographically examined and showed no signs of syndromic conditions or systemic illnesses associated with enamel malformation . In addition, dental examination of the unaffected members showed no evidence of any enamel defect and any syndromic signs . (a) the pedigree of the family represents an autosomal dominant pattern of inheritance with four affected patients . (e) dna sequencing revealed heterozygous in codon 342 for amino acid serine to threonine (c.1150t> a, p. ser 342thr).arrows indicate the proband and base subsituation the adhcai individuals were typically characterized by soft enamel, which wears off the tooth soon after eruption and following exposure to mastication forces . As it is shown in fig . 1c enamel cannot be distinguished from dentin by its opacity on radiographs; however, arhpai patients presented reduced enamel and spacing between teeth . Mutation screening in adhcai - affected members revealed one novel non - synonymous single - nucleotide substitution in the fam83h gene . This mutation was detected in codon 342 for amino acid serine to threonine (c.1150t> a, p. ser 342thr, fig . 1e) the mutation was identified in the affected members of the families with adhcai, but not in the unaffected individuals as well as in 100 healthy controls, indicating that this genetic change is not common variant in the iranian populations . The human fam83h gene is composed of five exons (orange boxes) and four introns (blue line). Arrows show the location of identified missense mutations in the c - terminal sequences moreover, although no significant mutations in enam, klk4 and mmp20 genes were detected in any probands, different polymorphisms were identified within non - coding or / and coding region sequences of these genes (table 2). Identified single nucleotide polymorphisms (snps) in this study in this study, we performed direct pcr sequencing for 5 families having at least two affected individuals with ai . Arhpai was diagnosed in 4 out of 5 families . The clinical features of hypoplastic ai in our patients were typically yellow - brown discoloration of the teeth and evidence of pathological enamel loss during wear as well as fracturing . The clinical characteristics of adhpcai usually presented with yellow - brown teeth discoloration and poorly mineralized enamel that have increased enamel proteins . Our mutation screening within coding sequences of three ai candidate genes including klk4, enam and mmp20 failed to detect any mutation in affected patients . However, several single nucleotide polymorphisms were found in the studied samples . In agreement with our results, several studies could not detect any mutation in the aforementioned genes involved in enamel defects in different populations (14, 15, 26). Ghandehari et al . Studied the mutations in mmp20, enam and klk4 genes in iranian families with generalized hypoplastic phenotypes; however, no mutations were detected in their samples (27). In addition, another study by kim et al . In 24 families with non - syndromic enamel defects found only a few disease - causing mutations (14). Although we were not able to identify any relevant mutation in the hypoplastic ai patients, one novel missense mutation in the fam83h gene, c.1150t> a, p. ser 342thr was detected in the adhpcai patients . The mutation was co - segregated among affected members of families with the disease phenotype but not in those that were unaffected . Mutations in the candidate genes, fam83h, klk4, mmp20 and enam have been suggested to be important in the etiology of ai (19, 21, 28). Even though our results are the first report that demonstrates the genetic alterations of fam83h in iranian patients, several mutations within this gene have been identified in ai patients in different ethnic groups (2022, 2933). Kim et al . (21) studied two families with autosomal - dominant hypocalcified ai and identified nonsense mutations (r325x and q398x) in the fam83h gene . In addition, a study previously described two nonsense transition mutations in a single allele of fam83h (c.1379g> a; g.5663g> a in the c - terminal exon 5) in the chinese population (34). More recently, wang et al . Identified disease - causing mutations (g.6930delg; c.245delg; p.gly82alafs*87) in their samples (19). Up to now, the majority of genetic alterations (14 mutations) have been reported in the last exon of fam83h, which encodes the c - terminal region . According to our findings as well as the literature published so far, two main questions needed to be addressed namely: 1) which parts of this gene induces more pathogenic effects and 2) how can we define the molecular characterization of the fam83h gene? To address the first question, as early pointed out, all disease - causing mutations in fam83h are located within exon 5 . Therefore, it seems that this part of fam83h gene could be the hotspot for genetic alterations . In order to address the second question, several molecular studies such as sub - cellular localization, using knockout mice experiments and bioinformatics strategies are required . It is believed that investigating biological functions of the genetic variations provide a great opportunity for understanding molecular bases of human diseases . Even though some features and their predicted functions of human fam83h have been previously reported the c - terminal region function(s) it has been suggested the implication of fam83h protein in normal and abnormal functions through either direct or indirect interactions with several protein partners . However, the exact mechanism(s) by which this gene acts in the pathogenesis of ai remains to be clarified . To define direct or indirect influences of fam83h on normal and abnormal enamel formation different techniques such as chromatin immunoprecipitation assay (chip assay) and protein - protein interaction using specific antibodies ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
Attention - deficit / hyperactivity disorder (adhd) is a widespread neurodevelopmental disorder, the prevalence and significance of which is rapidly growing . Increasing numbers of people the ever - increasing life s tempo, ever - growing stress, and last but not least, the onset of the ubiquitous electronic technology environment also tend to exacerbate adhd . The connection between adhd and time perception specifically using the methods laid out by zimbardo and sword and the zimbardo time perception inventory can bring a new and helpful tool in diagnosis and therapy of adhd.1,2 adhd is a disorder which is widely known and classically recognized in children but that is only recently getting studied in the adult population.3 simon et al report that prevalence of adult adhd is 2%3%.3 other sources state that adhd affects between 5%4 and 11%5 of the population aged 417 years in the us . Fayyad et al report that the prevalence of adhd is around 5.3% in the pediatric population and 3.4% in the adult population.6 however, recent data suggest even more dramatic occurrence of adhd: almost 1 in 5 teenage boys and 11% of all school - aged children have been diagnosed with adhd.7 adhd is a neurodevelopmental disorder . However, rather than by its neurological substance and causes, it tends to be described by observable behavioral manifestations . The marked symptoms of adhd include general inattention, hyperactivity, impulsivity, and difficulty with self - control . Adhd used to be classified as a childhood syndrome, but it has recently become a chronic, lifelong disorder with adhd, childhood adhd, and adult adhd defined as three different categories under diagnostic and statistical manual of mental disorders, fifth edition (dsm - v).4 in the dsm system, the child or teenager can be labeled with the diagnosis of predominantly inattentive, predominantly hyperactive impulsive, or a mix of the two categories (dsm); the symptoms can later be carried on to adulthood . Failure to observe a linear progression from childhood to adult adhd leads many to believe that with time, there is a catch up in development and the symptoms may remit into adulthood.8 the variety of causes and triggers is emphasized by the fact that the disorder can be managed to some extent by drug therapy and/or psychotherapy.9 the literature is abound with reports on the neurological and hormonal peculiarities of children with adhd.1012 furthermore, neuroimaging studies have shown developmental differences in children with adhd, especially disparity in the maturation of the cortex and the cerebellum.13,14 children and adults with adhd also seem to differ from non - adhd individuals in that various deficiencies in the striatum have been observed . This is specifically related to the dopaminergic system, the reward system and dopamine.15 dopamine is directly related to reward - seeking behavior, impulsivity, and addictions . However, to what degree dopamine serotonin interactions are at the source of adhd still remains a continuing debate.16,17 adhd was also found to have a genetic component.18,19 specific genetic differences have been reported which link adhd, impulsive behavior, delinquency, and also hedonism.20 it is also hypothesized that adhd may be connected with specific changes in physical growth.21,22 there is no single clinical picture of adhd . There are marked differences between the impulsive and inattentive types that have been isolated and described.23 although both the inattentive and hyperactive subtypes share the same diagnostic definition, they often manifest very different symptoms and comorbidities . According to grizenko et al, the two subtypes appear as almost separate diagnoses.24 while looking at comorbidities, these authors found that the hyperactive group displayed symptoms such as conduct disorder, while the inattentive group manifested different ones (mainly depression). Another example of a difference in comorbidities is that the inattentive group often shows comorbid obesity, whereas the hyperactive group does not.25 other comorbidities associated with the hyperactive / impulsive subtypes are drug abuse and addictive behavior.26 the literature from various sources (neurological, genetic, and behavioral disciplines) seems to concur that there is a close link between adhd and present - oriented behavioral patterns both in children and adults . This present - oriented behavior includes a wide array of behaviors which are hedonistically oriented: alcohol and drug abuse, compulsive gambling, dependence on electronic media, poor eating habits, higher rates of obesity and overall body weight in people, nicotinism, and others.27,28 analyses of populations of alcohol abusers and alcoholics indicate that up to 71% of the population have adhd and in the case of other drug abusers, the number is up to 25%.29,30 similarly, predominantly present hedonistically minded individuals were found to suffer from higher rates of drug and alcohol abuse.31 interestingly, one genetic expression the dopamine receptor genes (drd2, drd4) associated with adhd and impulsivity32 was also associated with alcoholism.33 in a prospective study, higher rates of alcohol consumption were found among present hedonistic and past negative individuals.34 impulsive drinking and drug abuse were directly correlated with adhd diagnosis in various studies.35,36 individuals with a diagnosis of childhood adhd and conduct disorder were found to be at much higher risk than controls for becoming drug abusers in adolescence.37 patients suffering from adhd as well as present hedonists often manifest very poor dietary choices . These include high consumption and often dependence on fatty foods, sweets, and fast food.38 a prospective study carried out in australia on 2868 children found a correlation between adhd and a western type diet that included fast food; this was compared with a healthy diet that included adequate amounts of fruits and vegetables . Howard et al noted that impulsive eating can also become an addictive behavioral pattern39 often seen in adhd.22 one major predictor of binge eating in adolescence was found to be childhood adhd.40 furthermore, a study by wilhelm et al analyzed the difference between overweight and adhd individuals and found more impulsiveness within the adhd group, especially at the beginning of the meal.41 binge eating itself may be addictive or it is conjointly linked with other addictions, nutritional or behavioral.24 a high correlation between binge eating / food addiction and cocaine abuse has been found, specifically for high fatty food intake.42 swanson et al43 and nigg26 attest that both binge eating and bulimia nervosa are connected with adhd, and the common comorbidity of eating disorders in adolescence is substance abuse . A great amount of research has been done on adhd and dietary habits, whereas the literature on present hedonism and lifestyle is just starting to emerge . Piu has been a topic of interest in psychiatric and clinical settings since the late 90s; this diagnosis had been proposed, but was later rejected by the dsm . The impulsive and addictive use of the internet has been deemed problematic for certain individuals and indeed clinically significant . The disorder met all the criteria for being identified as an impulse control disorder, which is marked by impulsive behavior.44 adhd is often associated with piu.45 a correlation was found between piu and alcohol abuse / dependence among adolescent populations in germany and korea.46 although internet use can well serve educational and recreational purposes, increasing evidence shows its excessive and addictive abuse . The incidence of piu has been estimated at 2%20% among young people and has been increasing.47 zimbardo and coloumbe highlight a wide range of negative consequences among boys and young men from excessive, socially isolated video gaming coupled with internet pornography viewing.48 in a korean study, adhd and depression turned out to be the biggest risk factors for developing online gaming addictions.49 in a turkish study, individuals with adhd were also more likely to use the internet impulsively.50 both chinese and korean research on internet addiction among adolescents found boys to be more likely to suffer from the condition than girls; risk factors for developing such dependence were adhd and impulsivity.51,52 this is congruent with the previous studies on the classical forms of addictions (ie, alcohol and other drugs). One possible shortcoming of the study was that there was no distinction between the subtypes of adhd . The authors of the study did not attempt to discover the differences between the adhd and depressed groups to see what the reasons for impulsive gaming were (such as for lowering depression or quenching the impulsivity). An american cross - sectional study on nearly 70,000 children has indicated the protective factors against adhd, which are: watching less than 1 hour of television / gaming a day, being active in sports teams, and a solid family structure.53 the unhealthy lifestyles learned from parents, especially from lower socioeconomic status households, should not be underestimated when looking at adhd and impulsiveness . It is very likely that the impulsive behaviors such as piu and excessive gaming are directly related to parenting styles and also inadequate care by school teachers . Deficits in social learning as a direct effect of parenting styles seem to play a very significant role in development of late - onset adhd . High emotional expression in parenting (particularly negative - reactive instead of positive parenting strategies) was associated with adhd54 as well as higher rates of aggressive behavior, fighting, and later impulsivity.55 similarly, research has found a direct correlation with the behaviors and parenting roles in time perspective studies . Specifically, when teenagers perceived their parents as psychologically controlling, the result was that they displayed predominantly present hedonistic behaviors . On the other hand, future - oriented teenagers perceived their parents as adequately responsive and giving ample autonomy.56 worrel et al reported the present hedonistic mindset to be closely associated with authoritarian and permissive parenting.57 furthermore, authoritarian parenting styles were correlated with disorders such as anxiety58 and drug abuse / addiction.59 incidentally, both are major, well - documented comorbidities associated with adhd.60,61 however, deeper analysis of these phenomena is methodologically challenging . Correlational studies tend to describe the vicious circle within the family instead of providing a deeper insight into the causality . In contrast to authoritarian and permissive parenting styles, authoritarian parenting, which is associated with clear roles and boundaries as well as healthy levels of communication, was found to have positive effects . Authoritative parenting styles were found to be the most advisable in managing adhd in family setting . Maintaining the communication and clear borders were also found to be essential along with medication in managing the symptoms and having healthy family relationships among those suffering from adhd.62 parenting styles, besides neurological and genetic disorders, are often related to aggressiveness among adhd patients as well as among present - oriented hedonists . In a 2016 study, stolarski et al administered the zimbardo time perspective inventory (ztpi) as well as the aggression questionnaire to 300 individuals and found that individuals with present hedonistic perspective were more likely to show aggressive and impulsive tendencies.63 the study did not assess for adhd symptoms, but it would most likely yield similar results with adhd being linked to both present hedonism and aggression . Likewise, during a neurological mapping study, adolescents with adhd have been observed to show low inhibition along with high levels of aggression and impulsivity . The study included 18 adhd diagnosed children and 18 controls, individuals from both groups had their brains scanned by fmri machines while playing a game specifically designed to elicit aggressive responses to fictitious opponents . The comorbidities in the adhd group included disruptive behavior disorder and conduct disorder.64 the study did not inquire about drug usage or any other lifestyle habits of the participants . Again, there was no differentiation between hyperactive impulsive individuals and generally inattentive subjects in this study . We can assume from the comorbidities and aggressiveness that this was most likely the hyperactive / impulsive group that we are associating with present hedonism . Generally, the respective behaviors tend to be related . Both in adhd and in present hedonists, overconsumption of fast food, alcohol as well as unhealthy media habits and internet use are not only signs of possible disorders but of poor discipline and inadequate parenting . Impulsivity and hedonism are often tied together by various behavioral addictions (ie, gambling, video games, nicotine). Presently, we see new forms of addictions emerge, which both the adhd group as well as present hedonists are likely to suffer from . Zimbardo developed a time perspective theory with a corresponding standardized questionnaire known as the ztpi . In this, subjects answer how much of their thoughts are spent in the past, present, and future and whether their time perspective tends to have a positive or negative accent . Past positive dimension relates to positive reminiscence, for example, certain stimuli bring forward pleasant memories of the past . Past negative dimension assesses the degree to which unpleasant and possibly traumatic past experiences are influencing the current life of the individual . Present fatalism expresses conviction that rather than by free will, individual lives are influenced by unexpected and uncontrollable forces, fate, luck, and so on . Future dimension assesses to what degree individuals are goal oriented, focusing on accomplishments and responsibilities to other people, and display what is known as a traditional protestant work ethic.30 these dimensions can be assessed individually or in their mutual relationship and balance . Examples include anxiety or posttraumatic stress when past negative orientation takes over, or risky behaviors and risk - taking in present hedonistic orientation.31 from the above - mentioned literature review of risky lifestyle habits and adhd comorbidities, we hypothesize a clear and definite correlation between adhd and present hedonistic time orientation . We hypothesize that adhd sufferers, especially from the hyperactive impulsive subtype, are most likely to be overwhelmingly anchored in the present hedonistic mindset . They will more likely engage in behaviors representative of present hedonistic time perspective which often leads to substance abuse, poor eating habits, and currently most popular modern addictions, especially piu, and overall dependence on the electronic media . As follows from the zimbardo theory, people with a prevalence of present hedonistic orientation are generally very focused on enjoying the present, feeling excited in their lives, and are therefore driven by what freud called the pleasure principle . Although healthy and well - adapted individuals may enjoy the present moments as well, the present hedonism in their case tends to be balanced with a realistic level of future orientation and reminiscence of the past . If present hedonism becomes the guiding principle, individuals may be more likely to engage in risky behaviors in order to seek strong sensations; this can possibly put the person at risk of developing addictions, whether classical (ie, alcoholism, overeating, nicotinism) or the newer, electronic versions, such as gaming or internet addiction.65,48 high levels of present hedonistic orientation are usual, especially among young males . Empirical data show that present hedonism sharply declines with age and it is lower in women . These phenomena are illustrated by the present hedonism ztpi scores of a national survey which we conducted in the czech republic . The target population included czech - speaking residents, almost exclusively czechs, seldom slovaks, and rarely other nationalities . The fieldwork was executed by the sociological institute of the czech academy of sciences (center for public opinion research). The sample involved n=2,201 respondents, consisting of 48.8% males and 51.2% females, aged 1589 years (44 years on average). The sample was proportional to the population regions and urban rural areas of the country . The ztpi data were collected by face - to - face (pen and paper) interview using quota - sampling methodology in two subsequent waves in 2003 and 2008 . The relationship between age and the hedonism scale was calculated from n=2,118 valid responses to the hedonism scale (ie, 96.2% of the total sample); almost all (n=2,199) respondents were included in the latent class analysis (lca). This study focused on ztpi and its 56 items and did not include any adhd indices at that point . The overall decline with age was statistically significant (high eta 0.367 for interval and cramer s v=0.248 for categorized age: beta=208 in multivariate regression). There were significant differences among all age groups, except the middle - age category of 3544 years; in the age group of 3544 years, the decline in present hedonism was not apparent . Higher present hedonism in men was confirmed by two - tailed non parametric statistics: both median and kolmogorov smirnov test of independent samples confirmed the difference on asymptotic significance level of 0.023 and 0.008, respectively . Lca used on the same czech sample yielded an even more dramatic depiction of the decline of present hedonism with age . Lca is able to identify subgroups of really existing respondents of ztpi who share similar patterns of time perspective . The age composition of this pattern / class is interesting: half of this group was represented by the youngest respondents aged 1524 years; older ages contributed to this group with radically declining frequency . Figure 2 shows the percentage of respondents from various age categories who constituted a latent class of present hedonists . Men predominated in the present hedonists lca class, as it consisted of 60% men and only 40% women . This corresponds to the gender difference observed in present hedonism illustrated in figure 1 and in other studies that find men more present hedonistic than women . As mentioned earlier, adhd symptoms, as well as present hedonism, are also most pronounced in the young age group.66 likewise, gender is a major variable to take into account for addictions, as males are more likely to show addictive behavior such as alcoholism . For example, 58% of men reported binge drinking on a monthly basis.5 binge drinking is an example of a present hedonistic behavior . Our article introduces both indicators and pieces of evidence showing that there is a substantial overlap between adhd and present hedonistic orientation . This leads us to hypothesize that present hedonism itself in all its various forms may well serve as a telling indicator of adhd or proneness to adhd . Furthermore, psychometric methods devised for assessment of present hedonism, such as ztpi by zimbardo, may prove particularly useful for this purpose . Even more importantly, zimbardo s temporal theory was elaborated into a systematic therapeutic approach time perspective therapy (tpt). So far, this approach has been used mainly to treat clients who are pathologically focused on their past negative experiences due to their traumatic past . These include especially war veterans who suffer from posttraumatic stress disorder, but also include survivors of abuse, accidents, assault, and neglect . In their case, tpt is being used to restore the temporal balance, to switch negativity to positivity, and to shift from the past to present and to future . Zimbardo et al2 provide a detailed description of the procedure in the time cure: overcoming ptsd with the new psychology of time perspective therapy, which is praised as a landmark book . Similar time perspective principles that take into account the ratio of the past, present, and future have been traditionally used in gerontology and geriatrics.67,68 similarly, patients suffering from depression and dwelling in negative past may profit from reframing their time perspective, which is an observation by bitsko et al who worked with depressive adolescent cancer patients.69 in contrast to the above - mentioned groups, most of which consist of patients stuck to the past, the adhd patients seem to suffer from being stuck in the present . Coincidentally, this is the core of the title that gruber et al used for their article about mania and its association with the present oriented time perspective.70 refugees are another group of clients who have been known to focus on the present to the relative exclusion of past and future71 or to suffer from atomism of a single time orientation.72 also, prisoners may suffer from a similar exclusive focus.73 and then, of course, intense orientation in the present time has been observed in a wide array of people who suffer from dependencies that are very often linked to adhd and that have been described above . Only sporadic reports mention the usefulness of time perspective as a useful framework or even as a possible direction of treatment . For example, henik and domino published an article entitled, alterations in future time perspective in heroin addicts.74 excessive players and pathological gamblers time perspective and the possible therapeutic uses thereof are mentioned in the reports of hodgins and engel75 and lukavska.76 finally, irrespective of diagnoses, stolarski et al63 point out the significance of balanced time perspective for a general satisfaction with life . Overall, it is surprising that although adhd tends to be viewed as a disorder which generally responds well to behavioral therapy,77 tpt in general or, specifically, the tpt approach by zimbardo and sword2 is not discussed and utilized more . This article reviews significant relationships between adhd and various factors from genetic and neurological to developmental and social . Attention is also paid to a range of manifestations of typical adhd lifestyle and comorbidities . It is concluded that zimbardo s time perspective approach suggests an important relationship between adhd and present hedonism . Although literature is available both on adhd and, to a lesser degree, on time perspective, many of the studies are methodologically limited . Many are based mostly on correlations, without a deeper concern for the direction of causality . Furthermore, the adhd studies typically do not differentiate between the two main types of adhd disorder . Although our focus is mostly on the hyperactive subtype of adhd, the differentiation between inattentive and hyperactive is not always properly recorded by clinicians and, as such, can create some confusion in the findings . Carelli and wiberg compared 30 adhd participants and 30 controls in a swedish study and found that adhd was associated with predominantly future positive time perspective.78 however, a major confounding factor was that the patients were already being pharmacologically treated for adhd . Perhaps, they had measured the effects of treatment rather than adhd itself . In any case, our hypothesis is that adhd individuals seem to live in a different time perspective than the general population . In principles of psychology, william james argued that time is a sensation.79 it appears that adhd individuals spend their waking state (possibly dream states as well) more often in present hedonism than other individuals to the detriment of their future . The modern era poses a particular challenge for adhd - prone individuals by the new electronic environment that is both widespread and intensive . At the same time, it is pointed out that modern psychology, namely, zimbardo s time perspective theory, provides a new paradigm which is useful as a new insight into the substance of adhd, the methodology of assessment of proneness to adhd, and finally, the possible therapeutic interventions based on the concept of balanced time perspective . It is surprising that all of the relevant literature only seldom mentions about the therapeutic use of time perspective . We hope this article will contribute to the eventual implementation of temporal interventions in therapy . Still, we realize that although the relationship between adhd and excessive focus on present hedonism seems to be straightforward, the relationship itself and the therapeutic interventions may not be that simple . Let us take an example from lukavska.76 she found in her study of online game players among others that present fatalistic tp [time perspective] was demonstrated to be a stronger predictor of extensive playing than present hedonistic tp . Such finding calls for replacing of simple correlational studies by more complex models which take into account mediating roles of multiple variables . The stressors leading to adhd are increasing, along with the enticing incentives of the brave new electronic world (even electronic schools) and with fast food, cigarette, pornography, and other industries . These industries are particularly focused on targeting ever - younger consumers.80 the instant gratification principle is facilitated by advertising to young people, appealing to adults not to deprive their loved ones, seducing young consumers by credit cards, and so on . The peer pressure is increased by use of electronic social media such as facebook and others . All this poses a grave threat to the public health not just in the developed countries but also in the developing countries . Thus, while adhd is one of the most diagnosed disorders, it is also one of the most misdiagnosed disorders . After all, the adhd lifestyle may often be just a symptom of novelty seeking, an expression of conforming social mimicry, or a defense mechanism to the overstimulated electronic state of consciousness in children and young adults . The search for new effective approaches to assessment and treatment of adhd in the current era is particularly topical . Zimbardo s time perspective perception approach seems to provide both a welcome theoretical basis as well as a practical tool . It becomes not only a medical and educational issue, but also a philosophical question as to how to utilize the current technology and at the same time promote sanity, harmony, and freedom, both individual and collective.
Posterior urethral trauma is classically associated with pelvic fractures with pelvic fracture incidence of approximately 20/100,000 in men and 29/100,000 in women in the western world . These posterior urethral injuries occur in 3.519% males and 06% females with an overall peak of 25% . The injury now is thought to be avulsion of the membranous urethra off the bulbous urethra, which may be partial or complete at the bulbo - membranous junction . Furthermore, the injury is not caused by pelvic fracture but due to disruption of the pelvic ring . Blood at the tip of the meatus is a cardinal sign of urethral trauma and is seen in 3793% of posterior urethral trauma and 75% of anterior urethral trauma . In female patients, blood is present at the vaginal introitus in more than 80% of cases of pelvic fractures coexisting with urethral injuries . Excision and spatulated end - to - end anastomosis is the gold standard for single short traumatic stricture of bulbous urethra and distraction defects of posterior urethra with success rates of 98.8%, 95%, 92%, and 69% in some series . This prospective study was to find out the outcome and complications in 87 patients who had delayed one stage perineal anastomotic urethroplasty post urethral rupture in two tertiary health institutions between january 2004 and january 2013 all the patients had preliminary urinary diversion by way of suprapubic cystostomy using size 22/24f two - way foley catheter . There was good history taking and thorough physical examination, more serious injuries were addressed and patient made stable before evaluation for urethral trauma . Micturating cystourethrogram and retrograde urethrogram were used to determine the site and extent of distraction defect / stricture . A detailed history of erectile function pre- and post - urethral trauma was sought and documented before urethroplasty . Trauma to the penile urethradefects / strictures> 3.5 cmassociated bladder / bladder neck injuries . Trauma to the penile urethra defects / strictures> 3.5 cm associated bladder / bladder neck injuries . Eighty - seven male patients who met the inclusion criteria had delayed one stage anastomotic urethroplasty via the perineum during the study period . Data collected from the patients during the study were analyzed using both descriptive and inferential statistical analytical tools viz . All the analyses were done using statistical package for social sciences (spss version 17.0 . Parentral antibiotics depending on the sensitivity pattern and metronidazole were given with anesthesia . Via a midline perineal skin incision, the later is separated with the bulbous urethra trauma in view [figure 1]. Membranous / bulbous urethra is mobilized and the strictured segment and scar tissue excised completely . Tension free mucosa to mucosa anastomosis of proximal and distal urethral ends is commenced at 12 oclock using 3/0 or 4/0 vicryl suture . After two anastomosis are carried out on either side, a size 16f 100% silicone catheter is introduced into the urinary bladder . The anastomosis is completed with the knots outside the urethral lumen [figure 2]. Urine drainage is through the suprapubic cystostomy catheter and is removed after satisfactory micturition on removal of the urethral stent . Bulbous urethra mobilized showing the stricture anastomosis completed pericatheter retrograde urethrogram is done in the 3 week after surgery to assess the integrity of the anastomosis [figure 3]. If there is no leakage, the catheter is removed by the 4 week . If there is leakage, the catheter is left and removed at 5 weeks after ensuring no urinary tract infection . Micturating cystourethrogram is done in patients who did not do pericatheter contrast study on removal of the urethral stent . Uroflowmetery is done on removal of the catheter, at 6 months and at 12 months . Trauma to the penile urethradefects / strictures> 3.5 cmassociated bladder / bladder neck injuries . Trauma to the penile urethra defects / strictures> 3.5 cm associated bladder / bladder neck injuries . Eighty - seven male patients who met the inclusion criteria had delayed one stage anastomotic urethroplasty via the perineum during the study period . Data collected from the patients during the study were analyzed using both descriptive and inferential statistical analytical tools viz . All the analyses were done using statistical package for social sciences (spss version 17.0 . Before embarking on urethroplasty, any identified urinary tract infection was eliminated using appropriate antibiotics . Parentral antibiotics depending on the sensitivity pattern and metronidazole were given with anesthesia . Via a midline perineal skin incision, the later is separated with the bulbous urethra trauma in view [figure 1]. Membranous / bulbous urethra is mobilized and the strictured segment and scar tissue excised completely . Tension free mucosa to mucosa anastomosis of proximal and distal urethral ends is commenced at 12 oclock using 3/0 or 4/0 vicryl suture . After two anastomosis are carried out on either side, a size 16f 100% silicone catheter is introduced into the urinary bladder . The anastomosis is completed with the knots outside the urethral lumen [figure 2]. Urine drainage is through the suprapubic cystostomy catheter and is removed after satisfactory micturition on removal of the urethral stent . Pericatheter retrograde urethrogram is done in the 3 week after surgery to assess the integrity of the anastomosis [figure 3]. If there is no leakage, the catheter is removed by the 4 week . If there is leakage, the catheter is left and removed at 5 weeks after ensuring no urinary tract infection . Micturating cystourethrogram is done in patients who did not do pericatheter contrast study on removal of the urethral stent . Uroflowmetery is done on removal of the catheter, at 6 months and at 12 months . The age range was 1168 years with a mean of 35.4 years and standard deviation 10.5 years . All had one stage anastomotic urethroplasty by perineal approach during the study period of 9 years . Posturethroplasty four (4.6%) patients experienced a decrease in the quality of penile erection that needed no treatment while 74 (85.1%) patients retained their potency . Road traffic accident caused a urethral rupture in 46 (53%) patients followed by straddle injuries in 17 (19.5%) patients [figure 4]. There were pelvic ring and sacroiliac joint disruptions in 31 (37%) patients [table 1]. The site of posttraumatic stricture was bulbo - membranous in 39 (44.8%) patients, membranous in 17 (19.5%) patients, and bulbous 31 (35.6%) patients . Road traffic accident caused traumatic stricture in both membranous and bulbous segments of the urethra accounting for 52.8% . The stricture / defect length range was 0.83.2 cm with a mean of 1.9 cm . Thirty - one (35.6%) patients had bulbo - membranous anastomosis while 21 (24.2%) patients had bulbo - prostatic anastomosis . The remaining 31 (35.6%) had bulbo - bulbar anastomosis [table 2]. On catheter removal, urine flow rate was> 20 ml / s in 85 (97.7%) patients with satisfactory micturition . Two (2.3%) patients had urine retention as a result of neurogenic bladder . At 6 months, 13 out of 21(62%) patients who had bulbo - prostatic anastomosis had satisfactory micturition with urine flow rate of> 15 ml / s and remained so for the next 12 months . Furthermore, 62 out of 66 (94%) patients who had both bulbo - bulbar and bulbo - membranous anastomosis at 6 months, had urine flow rate of> 17 ml / s, which was maintained till 12 months posturethroplasty . Thus, the success rates are 62% for bulbo - prostatic anastomosis and 94% for both bulbo - bulbar and bulbo - membranous anastomosis . At 5 years, 56 (64.3%) patients could be reached either through their mobile phones or at the urology clinic and micturition was satisfactory in all . Success in this study is satisfactory micturition with urine flow rate of> 15 ml / s posturethroplasty without further intervention either by dilatation or internal urethrotomy . Urethroplasty failure rate was 38.1% (8 patients) in those that that had bulbo - prostatic anastomosis and 6.1% (4 patients) in those that had both bulbo - bulbar and bulbo - membranous anastomosis . In these patients, micturition was unsatisfactory, and flow rate was <12 ml / s . The scrotal swelling was due to inflammatory edema arising from excessive dissection and handling of tissues during the urethroplasty . Wound infection in 5 (5.7%) patients, urinary tract infection in 11 (12.6%) patients, transient urinary incontinence in 7 (8%) patients, and re - stricture (8 membranous, 4 bulbous) in 12 (13.8%) patients urethral disruption following trauma is one of the most difficult conditions to manage in urology . These include dilatation, urethral stenting, optical urethrotomy, perineal, urethral anastomosis, elaborate perineal, and perineal - abdominal transpubic procedures and substitution urethroplasty . The procedure adopted depends on various factors such as the site, length of defect, the extent of peri - urethral fibrosis, and genuine urethral stricture versus a distraction defect . Optical urethrotomy is appropriate in true strictures without breach of urethral epithelium and not effective in distraction defects where the proximal and distal ends are separated by scar / fibrotic tissue . Tuner - warwick in the 1970s popularized a delayed one - stage perineal approach of bulbo - prostatic anastomosis to bridge defects of 2.5 cm . We adopted this procedure in a prospective fashion in 87 patients to determine the outcome . However, defects / strictures in both the posterior and anterior urethra not more than 3.5 cm were included in the study . Furthermore, only strictures posterior to the bulbo - penile junction were involved in the anastomosis . The main reason according to chapple is that you cannot simply excise a stricture and restore continuity as in the gut without considering the impact of the urethral shortening on penile curvature during erection . All the patients had suprapubic cystostomy using sizes 22/24f 2 way foley catheter pre delayed anastomosis . Use of such large caliber catheter makes it easy to pass a big size 30f sound via the cystostomy site with the tip palpated at the perineum before the commencement of the repair . Furthermore, the suprapubic catheter diverts urine from the injured urethra site while the patient stabilizes and recovers from associated injuries such as pelvic fracture, head injury before eventually facing the urologist with urethral defect / stricture, and its attendant problems of incontinence and impotence . Turner - warwick correctly asserted that it is the urologist who will have to share the burden of the ultimate disability with the patient when the thoracic, abdominal, and even the orthopedic aspects are probably long forgotten . Successful one stage anastomotic repair of 4.5 cm bulbous urethral stricture has been reported in other studies . The goal of urethroplasty for stricture is to provide an adequate caliber compliant and stable urethra . This is found in excision and end - to - end anastomosis and is regarded as gold standard . The elastic nature of the bulbous urethra makes it possible for a stretch of 24 cm to overcome a defect, even though 1 cm of this length is lost to spatulation . Adequate mobilization of the injured urethra was done in all the patients, excising all fibrous tissue before embarking on a tension free spatulated mucosa to mucosa anastomosis of proximal and distal urethral segments . The spatulation is critical in achieving a wide end to end anastomosis thereby overcoming any re - stenosis that may occur at the anastomotic site . Four (46%) patients posturethroplasty experienced a decrease in the quality of erection that needed no treatment . An advantage of the perineal approach is this, once the dissection is strictly maintained in the midline the vascular supply and innervations of the corpora cavernosa can be spared thus averting erectile dysfunction . It was observed during follow - up that four out of the nine patients who had erectile dysfunction post urethral trauma, regained sexual activity 712 months post urethroplasty while the other five remained impotent . Koraitim and other authors also documented posturethroplasty regain of sexual function in some of their patients . Furthermore the corpus spongiosus has a bipedal blood supply and is partially dependent on retrograde flow from the dorsal artery of the penis when mobilized and detached from its proximal vascular supply . Compromise of this distal circulation by trauma or distal urethral pathology leads to ischemic necrosis of the distal mobilized portion with obstructive sequelae of stricture . Timing of urethroplasty after the patient had stabilized from associated injuries was determined in some patients by their economic status and was up to 24 months . Change of suprapubic catheters in these patients was not regular due to poor patient compliance . Furthermore, complications of catheterization such as hematuria, encrustations, and urinary tract infection occurred with the emergence of pathogens resistant to most of the antimicrobial agents . However, all urinary tract infections were treated before embarking on urethroplasty and the sensitivity pattern informed the use of antibiotics during and after surgery . Success in this study was satisfactory urine flow rate 15 ml / s without any further intervention like dilatation or internal urethrotomy . This was noted in 13 (62%) out of 21 patients who had bulbo - prostatic anastomosis and in 62 (94%) out of 66 patients that had bulbo membranous, bulbo - bulbar anastomosis, respectively . Success rate for bulbo - prostatic anastomosis in this study is 62% when compared with the success rate of between 82% and 95% of the same operation in other studies . However, our success rate of 94% for bulbo - membranous and bulbous anastomosis in this study compared favorably with the success rates of between 91% and 98.8% for the same operation in other studies . The follow - up was up to 5 years in 56 (64.3%) patients who were seen in the clinic or contacted by a phone call and all had satisfactory micturition . However, there was a minimum follow - up of 14 months in all the patients posturethroplasty . Re - stricture is suspected when the patient at follow - up presents with lower urinary tract symptoms and urine flow rate of <15 ml / s . Any patient posturethroplasty can have a re - stricture even after 10 years and must be followed up for life . A multiple linear regression analysis on the explicability of re - stricture tendency of the urethroplasty performed on the patients showed that, among site of the stricture, etiology of injury, age, and stricture length / defect, only the site of the stricture where the injury occurred (membranous, bulbo - membranous and bulbous) is significant (beta 0.213, p <0.05) at 5% level of significant . This indicates that the initial site of the stricture had a significant impact on the patient's tendency of having a re - stricture after the urethroplasty . Other possible explanations for restricture are poor accessibility, inadequate excision of fibrous / scar tissue and inadequate mobilization of the distal bulbar segment resulting in anastomotic tension . Another critical factor favoring re - stricture in posterior urethroplasty in this study is nonuse of flexible cystoscope through the bladder neck during the surgery to visualize the proximal end of the urethral defect thus avoiding false passages . Meanwhile, out of the 12 (14%) patients who had re - stricture, eight were membranous while four others were bulbous . At ibadan, a recurrent rate of 12.5% out of 16 patients that had urethroplasty was recorded though the study was in children . Furthermore, a study at nnewi got a restricture rate of 16.7% out of 12 patients that had urethroplasty . Post urethroplasty urinary incontinence was noted in 7 (8%) patients and, which resolved within 7 months . The integrity of the distal sphincter is presumed to be compromised after posterior urethral trauma . The proximal bladder neck sphincter and the distal sphincter mechanisms function independent of the other, and each is competent and independently capable of maintaining continence in the absence of the other . However, some authorities have observed that function in the distal sphincter is preserved arguing that the site of urethral distraction is distal to it . Other minor complications noted in this study, include scrotal swelling, wound infection, urinary tract infection, and urethro - cutaneous fistulae . The high and enduring success rates, low re - stricture rates, and minimal complications associated with one stage perineal anastomotic urethroplasty make it very attractive and the gold standard . It is recommended for use in reconstructing the ruptured urethra when the defect / stricture length permits.
Motor dysfunction is the major neurological deficits after stroke, with 50% of patients suffering from hemiparesis and 30% remaining unable to walk independently . Transsynaptic degeneration of lower motor neurons secondary to upper motor neurons injury plays a role in muscle mass loss . It has been demonstrated that transsynaptic degeneration occurred wildly in nervous system after cerebral cortex injury, such as cerebellum, thalamus, and substantial nigra, whereas transsynaptic degeneration in motor system remains controversial . Clinical electrophysiological studies have shown that neurogenic injury could be detected in paretic limbs of patients with stroke, suggesting that there is lower motor neuron injury . Abnormal spontaneous activity (sa, including fibrillation potentials, and positive sharp waves) could be observed in hemiplegic muscles 23 weeks after stroke, lasting up to 1 year . Hara and associates reported that motor unit number estimation (mune) and the mean compound muscle action potential (cmap) amplitude on the paretic side was significantly lower in a period of 9 days to several months, after a unilateral cerebrovascular accident . Observed that mune and the maximal cmap amplitude were decreased as early as 4 hours after cerebral infarction . These studies indicate that upper motor neuron lesions may lead to lower motor neuron abnormality . Pathological evidence of anterior motoneurons degeneration in patients or rats after stroke is insufficient, and few studies had directly proved the degeneration of lower motor neurons . They observed inflammation and degeneration of myelinated corticospinal axons in the spinal cord . But neither study showed the number of anterior horn cells decreased . Experiments of wu and ling reported that in rats undergoing middle cerebral artery occlusion (mcao), all ventral horn motoneurons remained structurally intact in 3 and 5 days after mcao . Our work combined the electrophysiological and pathological assessments to investigate the existence transsynaptic degeneration in the motor system, and the relationship between electrophysiology and pathology . This study was carried out in strict accordance with the recommendations in the guide for the care and use of laboratory animals of the peking union medical college hospital (pumch). Sprague - dawley male rats were obtained from the animal center of pumch, weighing between 250 g and 380 g. animals were specific pathogen free, and raised in 2025c room temperature . Seventeen subjects were died of anesthesia accidents and cerebral hernia after mcao, and another nine subjects were found had subarachnoid hemorrhage and intracranial hemorrhage after sacrifice . Every 10 mcao rats were sacrificed for pathology tests, at 24 hours, 7 days, and 14 days after operation separately . All surviving subjects were evaluated by electrophysiology assessments and modified neurological severity score (mnss) at 0 day, 24 hours, 7 days, and 14 days after surgery . The permanent mcao procedure was based on the longa mcao logi after anesthesia with 34 ml / kg i.p . The internal carotid artery was also isolated and separated carefully from the adjacent vagus nerve, and the external carotid artery was ligated . Monofilament nylon suture (diameter: 2.63.0 mm) was introduced into the common carotid artery lumen through a puncture and advanced gently to the internal carotid artery lumen . After about 18 mm length of nylon suture had been inserted into artery lumen, resistance was felt, indicating that the suture had passed the middle cerebral artery origin and occluded the artery . All electrophysiology tests were performed using a portable electromyography (emg) machine (10ch medelec synergy, natus europe gmbh, germany). Rats were placed on the operation table after anesthesia, with bilateral lower limbs spread at an approximately 45 angle to the spine [figure 1a], under lamplight to stay warm . We chose the internal posterior tibial muscle group and sciatic nerve for both emg and motor nerve conduction studies (mncs). R1: the active recording electrode; r2: the reference recording electrode; s1: the cathode of the stimulating electrode; s2: the anode of stimulating electrode; g: the ground electrode . (b and c) compound muscle action potential and motor unit number estimation examples . Four points in the muscle group were selected to investigate sa, with more than 10-second observation at each point . Sweep duration was 10 ms / division, sensitivity was 100 v / division, and filter settings were 20 hz10 khz . The sciatic nerve was stimulated at the root of the hind limb, and the anode of the stimulating electrode was placed at anterior superior iliac spine . The active electrode was placed over the belly of the internal posterior tibial muscle group, while the reference electrode was positioned on the ankle . Sweep speed was 2 ms / division, and sensitivity was 20 mv / division . Mune [figure 1c] was performed by the standard incremental method after careful training . Mune was equal to the value of the maximal cmap amplitude divided the average of the 10 potentials amplitudes . Sweep speed was 2 ms / division, and sensitivity was 100 v to 20 mv / division . The brain and spinal cord were removed . Gross observation and hematoxylin and eosin staining were performed to identify the cerebral infarction . The lower lumbar spinal cord (l4s1) was cut into 3-m thick slides at l4, l5 and s1 levels . Neuron - specific nuclear protein (neun) that is nuclear protein specifically expressed by mature neuron was used here to mark neurons . B - cell lymphoma / leukaemia-2 (bcl-2) protein can prevent cell apoptosis, while bcl-2 associated x (bax) protein promotes apoptosis and has an antagonistic effect on bcl-2 . Neurons were stained with bcl-2 and bax to express their conditions, trend to alive or apoptosis . Only anterior motoneurons with visible staining nucleus and nucleolus were counted . Three nonoverlapping regions in the posterior horn were chosen to count neun positive cells, and the average number represented the number of neurons unit area in the posterior horn . The gfap positive astrocytes in anterior horn were counted in the same way of posterior horn neurons counting . We performed the statistical analysis of our data using spss for windows, version 17.0 (spss inc ., all data were expressed in the form of mean standard deviation (sd). The data were detected with shapiro - wilk test and levene test for normality and homogeneity of the variance respectively first . If the normality or homogeneity was not met, we adopted nonparametric statistical tests . Otherwise, we used paired t - test to compare bilateral electrophysiological and pathologic data, and independent - sample t - test for pairwise comparison in groups of pathologic data . Analysis of variance (anova) for repeated measurement data, or one - way anova was used for comparison of data over time . Group t - test was used to analyze the difference of mcao and control groups . The frequency of sa in different mnss groups was analyzed by the fisher's exact test . Sprague - dawley male rats were obtained from the animal center of pumch, weighing between 250 g and 380 g. animals were specific pathogen free, and raised in 2025c room temperature . Seventeen subjects were died of anesthesia accidents and cerebral hernia after mcao, and another nine subjects were found had subarachnoid hemorrhage and intracranial hemorrhage after sacrifice . Every 10 mcao rats were sacrificed for pathology tests, at 24 hours, 7 days, and 14 days after operation separately . All surviving subjects were evaluated by electrophysiology assessments and modified neurological severity score (mnss) at 0 day, 24 hours, 7 days, and 14 days after surgery . The permanent mcao procedure was based on the longa mcao logi after anesthesia with 34 ml / kg i.p . The internal carotid artery was also isolated and separated carefully from the adjacent vagus nerve, and the external carotid artery was ligated . Monofilament nylon suture (diameter: 2.63.0 mm) was introduced into the common carotid artery lumen through a puncture and advanced gently to the internal carotid artery lumen . After about 18 mm length of nylon suture had been inserted into artery lumen, resistance was felt, indicating that the suture had passed the middle cerebral artery origin and occluded the artery . After all possible bleedings were stopped, all electrophysiology tests were performed using a portable electromyography (emg) machine (10ch medelec synergy, natus europe gmbh, germany). Rats were placed on the operation table after anesthesia, with bilateral lower limbs spread at an approximately 45 angle to the spine [figure 1a], under lamplight to stay warm . We chose the internal posterior tibial muscle group and sciatic nerve for both emg and motor nerve conduction studies (mncs). R1: the active recording electrode; r2: the reference recording electrode; s1: the cathode of the stimulating electrode; s2: the anode of stimulating electrode; g: the ground electrode . (b and c) compound muscle action potential and motor unit number estimation examples . Four points in the muscle group were selected to investigate sa, with more than 10-second observation at each point . Sweep duration was 10 ms / division, sensitivity was 100 v / division, and filter settings were 20 hz10 khz . The sciatic nerve was stimulated at the root of the hind limb, and the anode of the stimulating electrode was placed at anterior superior iliac spine . The active electrode was placed over the belly of the internal posterior tibial muscle group, while the reference electrode was positioned on the ankle . Sweep speed was 2 ms / division, and sensitivity was 20 mv / division . Mune [figure 1c] was performed by the standard incremental method after careful training . Mune was equal to the value of the maximal cmap amplitude divided the average of the 10 potentials amplitudes . Sweep speed was 2 ms / division, and sensitivity was 100 v to 20 mv / division . The brain and spinal cord were removed . Gross observation and hematoxylin and eosin staining were performed to identify the cerebral infarction . The lower lumbar spinal cord (l4s1) was cut into 3-m thick slides at l4, l5 and s1 levels . Neuron - specific nuclear protein (neun) that is nuclear protein specifically expressed by mature neuron was used here to mark neurons . B - cell lymphoma / leukaemia-2 (bcl-2) protein can prevent cell apoptosis, while bcl-2 associated x (bax) protein promotes apoptosis and has an antagonistic effect on bcl-2 . Neurons were stained with bcl-2 and bax to express their conditions, trend to alive or apoptosis . Only anterior motoneurons with visible staining nucleus and nucleolus were counted . Three nonoverlapping regions in the posterior horn were chosen to count neun positive cells, and the average number represented the number of neurons unit area in the posterior horn . The gfap positive astrocytes in anterior horn were counted in the same way of posterior horn neurons counting . We performed the statistical analysis of our data using spss for windows, version 17.0 (spss inc ., all data were expressed in the form of mean standard deviation (sd). The data were detected with shapiro - wilk test and levene test for normality and homogeneity of the variance respectively first . If the normality or homogeneity was not met, we adopted nonparametric statistical tests . Otherwise, we used paired t - test to compare bilateral electrophysiological and pathologic data, and independent - sample t - test for pairwise comparison in groups of pathologic data . Analysis of variance (anova) for repeated measurement data, or one - way anova was used for comparison of data over time . Group t - test was used to analyze the difference of mcao and control groups . The frequency of sa in different mnss groups was analyzed by the fisher's exact test . Abnormal sa were detected in the paretic hind limb of 16.7% (5/30) mcao rats, including 3 at 24 hours after mcao (mnss: 9, 10, 11), 1 at 7 days after mcao (mnss: 4), and 1 at 14 days after mcao (mnss: 9). We divided each group into two subgroups according to mnss (mnss 7 and mnss> 7). The frequency of sa in mnss 7 group was 7.1% (1/14), while the frequency in mnss> 7 group was 25.0% (4/16) (p = 0.209). These results showed sa was more likely to occur in rats with a higher mnss, although there was no significant difference between the two groups . Changes of cmap amplitude are showed in table 1 and figure 2a . In the control group, there was no significant difference between bilateral cmap amplitudes and among cmap amplitudes over time . In mcao groups, cmap amplitude on paretic side was significantly lower than nonparetic side, at 24 hours and 7 days after operation (24 hours: 61.9 10.4 vs. 66.6 8.9, p <0.05; 7 days: 60.9 8.4 vs. 67.3 9.6, p <0.05) [table 1 and figure 2a]. The cmap amplitudes over time showed no significant difference, neither on the paretic side nor the nonparetic side . At the four given time points, we further divided the 7 days group into two subgroups (paretic cmap amplitude> 60.60 mv and 60.60 mv). The average mnss was 5.7 in group with cmap amplitude> 60.60 mv (n = 11), and 6.9 in group with cmap amplitude 60.60 mv (n = 10). The summary of cmap amplitude data in control and mcao rats (mean sd) * wilcoxon test . Sd: standard deviation; cmap: compound muscle action potential; mcao: middle cerebral artery occlusion . (a and b) the max difference of bilateral compound muscle action potential (cmap) amplitude and motor unit number estimation (mune) showed at 7 days after the operation . (c - e) the number of anterior / posterior horn neurons was decreasing over the time . The mune data are showed in table 2 and figure 2b . In the control group, there was no significant difference in mune between bilateral limbs at different duration . In mcao groups, however, mune on paretic side was significantly less than that on nonparetic side, at 7 days after operation (379.0 84.6 vs. 445.0 89.5, p there was no significant difference in munes of paretic limbs among four given time points, as well as a nonparetic side . The 7-day group was also divided into two subgroups (paretic mune> 381 and 381). The average mnss was 5.6 in group with mune> 381 (n = 10), and 6.9 in group with mune 381 (n = 10). The summary of mune data in control and mcao rats (mean sd) mcao: middle cerebral artery occlusion; sd: standard deviation; mune: motor unit number estimation . Cmap amplitude on paretic side was significantly lower than on the nonparetic side, at both 24 hours and 7 days after mcao, and mune on paretic side was significantly less than on nonpareticside at 7 days after mcao . These results revealed that cerebral infarction could cause spinal motor neurons abnormalities, and loss of functional anterior motor neurons . Compared with control group, the number of neun - positive anterior motor neurons [figure 3a] declined over time, and was significantly decreased in 14-day mcao group (5.3 0.7 vs. 7.3 1.8, p <0.05) [table 3 and figure 2c]. The expression of bcl-2 and bax in anterior motor neurons [figure 3b and 3c] at 24 hours after mcao was significantly increased (bcl-2: 5.6 0.8 vs. 2.8 1.5, p <0.05; bax: 5.0 1.1 vs. 2.1 0.8, p <0.05), while in 14 days mcao group, bax expression increased significantly again (4.3 0.7 vs. 2.1 0.8, p <0.05), with bcl-2 expression remained normal [table 3 and figure 2c]. These results revealed that in the early time after stroke, apoptosis of the spinal motor neurons were induced and seemed to be reversible for high expression of bcl-2 . After 14 days, high expression of bax alone and significantly decreased a number of anterior neurons indicated that anterior motor neurons were degenerated . (a - c) motoneurons with neuron - specific nuclear protein (immunohistochemical [ihc] staining, original magnification 40), b - cell lymphoma / leukaemia-2 (ihc, 100), b - cell lymphoma / leukaemia-2 associated x expressions (ihc, 100), respectively . Neurons of rexed layers i iii (white rome number) in three nonoverlapping areas (white rectangle) were counted (ihc, 100). (e) glial fibrillary acidic protein positive astrocytes (red arrow) (ihc, 200). The summary of histological data in control and mcao rats (mean sd) mcao: middle cerebral artery occlusion; sd: standard deviation; neun: neuron - specific nuclear protein; bcl-2: b - cell lymphoma / leukaemia-2; bax; bcl-2 associated x; gfap: glial fibrillary acidic protein . The number of neun positive posterior horn neurons [figure 3d] in 7 days and 14 days mcao group was significantly less than control (control vs. 7 days: 50.4 4.7 vs. 44.7 5.4, p <0.05; control vs. 14 days: 50.4 4.7 vs. 43.0 3.1, p <0.05) [table 3 and figure 2d]. There were more gfap positive astrocytes [figure 3e] in 24 hours group than in control (p = 0.050) [table 3 and figure 2e]. Astrocytes were activated at 24 hours, suggesting that the injury and inflammation occurs in the early time . Abnormal sa were detected in the paretic hind limb of 16.7% (5/30) mcao rats, including 3 at 24 hours after mcao (mnss: 9, 10, 11), 1 at 7 days after mcao (mnss: 4), and 1 at 14 days after mcao (mnss: 9). We divided each group into two subgroups according to mnss (mnss 7 and mnss> 7). The frequency of sa in mnss 7 group was 7.1% (1/14), while the frequency in mnss> 7 group was 25.0% (4/16) (p = 0.209). These results showed sa was more likely to occur in rats with a higher mnss, although there was no significant difference between the two groups . Changes of cmap amplitude are showed in table 1 and figure 2a . In the control group, there was no significant difference between bilateral cmap amplitudes and among cmap amplitudes over time . In mcao groups, cmap amplitude on paretic side was significantly lower than nonparetic side, at 24 hours and 7 days after operation (24 hours: 61.9 10.4 vs. 66.6 8.9, p <0.05; 7 days: 60.9 8.4 vs. 67.3 9.6, p <0.05) [table 1 and figure 2a]. The cmap amplitudes over time showed no significant difference, neither on the paretic side nor the nonparetic side . At the four given time points, we further divided the 7 days group into two subgroups (paretic cmap amplitude> 60.60 mv and 60.60 mv). The average mnss was 5.7 in group with cmap amplitude> 60.60 mv (n = 11), and 6.9 in group with cmap amplitude 60.60 mv (n = 10). The summary of cmap amplitude data in control and mcao rats (mean sd) * wilcoxon test . Sd: standard deviation; cmap: compound muscle action potential; mcao: middle cerebral artery occlusion . (a and b) the max difference of bilateral compound muscle action potential (cmap) amplitude and motor unit number estimation (mune) showed at 7 days after the operation . (c - e) the number of anterior / posterior horn neurons was decreasing over the time . The mune data are showed in table 2 and figure 2b . In the control group, there was no significant difference in mune between bilateral limbs at different duration . In mcao groups, however, mune on paretic side was significantly less than that on nonparetic side, at 7 days after operation (379.0 84.6 vs. 445.0 89.5, p there was no significant difference in munes of paretic limbs among four given time points, as well as a nonparetic side . The 7-day group was also divided into two subgroups (paretic mune> 381 and 381). The average mnss was 5.6 in group with mune> 381 (n = 10), and 6.9 in group with mune 381 (n = 10). The summary of mune data in control and mcao rats (mean sd) mcao: middle cerebral artery occlusion; sd: standard deviation; mune: motor unit number estimation . Cmap amplitude on paretic side was significantly lower than on the nonparetic side, at both 24 hours and 7 days after mcao, and mune on paretic side was significantly less than on nonpareticside at 7 days after mcao . These results revealed that cerebral infarction could cause spinal motor neurons abnormalities, and loss of functional anterior motor neurons . Compared with control group, the number of neun - positive anterior motor neurons [figure 3a] declined over time, and was significantly decreased in 14-day mcao group (5.3 0.7 vs. 7.3 1.8, p <0.05) [table 3 and figure 2c]. The expression of bcl-2 and bax in anterior motor neurons [figure 3b and 3c] at 24 hours after mcao was significantly increased (bcl-2: 5.6 0.8 vs. 2.8 1.5, p <0.05; bax: 5.0 1.1 vs. 2.1 0.8, p <0.05), while in 14 days mcao group, bax expression increased significantly again (4.3 0.7 vs. 2.1 0.8, p <0.05), with bcl-2 expression remained normal [table 3 and figure 2c]. These results revealed that in the early time after stroke, apoptosis of the spinal motor neurons were induced and seemed to be reversible for high expression of bcl-2 . After 14 days, high expression of bax alone and significantly decreased a number of anterior neurons indicated that anterior motor neurons were degenerated . (a - c) motoneurons with neuron - specific nuclear protein (immunohistochemical [ihc] staining, original magnification 40), b - cell lymphoma / leukaemia-2 (ihc, 100), b - cell lymphoma / leukaemia-2 associated x expressions (ihc, 100), respectively . Neurons of rexed layers i iii (white rome number) in three nonoverlapping areas (white rectangle) were counted (ihc, 100). (e) glial fibrillary acidic protein positive astrocytes (red arrow) (ihc, 200). The summary of histological data in control and mcao rats (mean sd) mcao: middle cerebral artery occlusion; sd: standard deviation; neun: neuron - specific nuclear protein; bcl-2: b - cell lymphoma / leukaemia-2; bax; bcl-2 associated x; gfap: glial fibrillary acidic protein . The number of neun positive posterior horn neurons [figure 3d] in 7 days and 14 days mcao group was significantly less than control (control vs. 7 days: 50.4 4.7 vs. 44.7 5.4, p <0.05; control vs. 14 days: 50.4 4.7 vs. 43.0 3.1, p <0.05) [table 3 and figure 2d]. There were more gfap positive astrocytes [figure 3e] in 24 hours group than in control (p = 0.050) [table 3 and figure 2e]. Astrocytes were activated at 24 hours, suggesting that the injury and inflammation occurs in the early time . This study showed that abnormal sa, decreased mune and cmap appeared on the paretic side in mcao rats, consistently with previous clinical studies, suggesting that lower motor neurons injury happened in the early time after stroke . And the pathology results showed that anterior motor neurons significantly decreased, indicating transsynaptic degeneration happened . However, we also found the asynchronization of electrophysiology and pathology changes . At 24 hours after cerebral infarction, sa appeared, cmap amplitude on paretic side declined, while bcl-2, bax, and gfap expressions were increased, with normal anterior motor neurons counting . Had reported that abnormal electrophysiology could be appeared in the paretic limb as early as 4 h after stroke, which may due to the cut - off of corticospinal nerve fibers and inflammation . Our study provided pathology evidence to this speculation . At 7 days after cerebral infarction, electrophysiology showed a significant decrease in paretic mune and cmap, while pathology results showed almost normal after the early stress reaction . At 14 days after cerebral infarction, the electrophysiology was back to normal, while anterior horn neurons decreased significantly with high expression of bax . Our study provided the pathology evidence of lower motor neurons dysfunction and degeneration after stroke, and the variation characteristics of electrophysiology and pathology . These results revealed that abnormal electrophysiology could be detected in the early time, when motor neurons were functionally impaired, suggesting electrophysiology was more sensitive than pathology . However, when lower motor neurons degenerated in the later stage, the abnormal electrophysiological changes could not be detected . The reason for this phenomenon might be complicated . We suspected that, the rats have strong self - repair ability and quick recovering from cerebral infarction, although there was decrease in motor neurons due to transsynaptic degeneration in pathological studies at the later stage, the denervated muscle fibers of those motor neuron may be reinnervated by the survived motor neurons, which may lead to the increase in cmap amplitude and mune . Clinical symptoms presented only when the number of lower motor neurons loss over 40%, while our study showed only about 20% loss of motor neurons . These results also indicated that electrophysiology may be more liable to be affected by dysfunction of motor neurons instead of the number of motor neurons at an early stage after mcao . We also found, significantly higher expression of bcl-2 and bax in anterior motoneurons, and gfap in astrocytes was observed at 24 hours after cerebral infarction . These results revealed that in the early time after stroke, apoptosis of the spinal motor neurons were induced and astrocytes were activated, suggesting that injury and inflammation have occurred, which may initiate the lower motor neurons impairments . Posterior horn neurons also declined, and even faster than anterior neurons, illustrating that transsynaptic degeneration also existed in the sensory system, which was consistent with the previous study . It was speculated that the anterior motor neurons received multiple inputs from other interneurons postsynaptic, which abating the influence from impaired corticospinal projections . Posterior horn neuron did not have many contacts with other cells, which made it more sensitive . However, some results need to be further discussed: (1) previous studies showed that sa appeared in hemiparetic stroke patients as early as 2 weeks after stroke, while in our experiment, sa appeared at 24 hours after mcao, which could be related to the short length of peripheral nerve in rats . The onset duration of sa is dependent on the distance of peripheral nerve lesion and the target muscle . It has been reported that sa could be observed at 36 h after cutting the sciatic nerve at the sciatic notch in rats . In previous research, when anterior motor neurons were functional impaired, the neuromuscular junctions were abnormal, which might lead to spontaneous exciting of the muscle fiber . (2) there was no significant difference in changes of cmap amplitude and mune among different duration after mcao, neither in cmap amplitude and mune between control and mcao groups . The electrophysiology could be affected by multiple factors, such as individual differences, electrode differences, and environmental temperature difference, as well as good recovering capacity in rats . Fortunately, bilateral sides will not be affected by these factors, that was more reasonable and powerful for detecting the electrophysiological changes . In conclusion, in the early time after cerebral infarction, functional disturbance in the lower motor neurons caused the abnormal electrophysiology results . In the later stage, anterior motor neurons declined, which provide the evidence of transsynaptic degeneration in the motor system . Our study combined the electrophysiology and pathology to provide the evidence of transsynaptic degeneration in the motor system . More researches were necessary for further exploring the mechanisms of the transsynaptic degenerations in the motor system . This study was funded by a grant of national natural science foundation of china (no . This study was funded by a grant of national natural science foundation of china (no.
Incidence of ami in female patients is increasing year by year after menopause, especially for type 2 diabetes mellitus (t2 dm) patients . Gender disparity in clinical outcome of ami patients with or without t2 dm is still elusive . Women with ami are more inclined to gain a poorer outcome than men [13]. Plasma glucose is often considered as an important predictor of mortality after ami [36]. But the impact of fasting plasma glucose (fpg) on early mortality and serious cardiovascular complications such as malignant arrhythmia, cardiac shock, heart failure, and reinfarction remains unclear . Plasma glucose level in the acute phase of ami is closely related to in - hospital mortality rate and serious complications of ami . Previous studies have demonstrated that there is a near - linear positive relationship between admission plasma glucose (apg) or hba1c and in - hospital mortality in diabetic and nondiabetic ami patients [7, 8]. However, other studies showed that the relationship is u - shaped in ami patients [911]. Limited data is available for association between fpg and clinical outcome of ami with or without t2 dm in female patients . To assess the relationship between fpg and ami prognosis in female patients, we conducted this retrospective analysis to determine the association between apg, fpg, and serious cardiovascular complications of female ami patients with or without diabetes . From january 2002 to february 2014, a total of 253 cases of consecutive female patients who were admitted to the fifth affiliated hospital of sun yat - sen university in china with their first ami diagnosis were enrolled into the retrospective study . Ami was defined by the following characteristics: chest pain consistent with ongoing myocardial ischemia persisting> 30 minutes, ischemic electrocardiographic changes, and positive biochemical cardiac necrosis markers measurement (peak creatinine kinase value> 2 times the normal upper limit or elevation of serum troponin i(ctni) or serum troponin t(ctnt)). Stemi was diagnosed if st - segment elevation 1 mm occurred in 1 lead or new left bundle branch block (lbbb) was found in ecg with biochemical evidence of myocardial necrosis . Nstemi was diagnosed in patients with 1 positive biochemical cardiac necrosis markers measurement without new st - segment elevation in ecg . Malignant arrhythmia is defined as fast or slow arrhythmia that significantly influences blood flow dynamics, including ventricular tachycardia, ventricular flutter, ventricular fibrillation, three - degree avb, and fast atrial fibrillation with unstable hemodynamic . Cardiogenic shock was defined as reduced blood pressure (sbp <90 mmhg or a drop of mean arterial pressure> 30 mmhg) and/or low urine output (<0.5 ml / kg / h), with a pulse rate> 60 bpm with or without evidence of organ congestion . Enrolled patients were divided into diabetic group and nondiabetic group based on their final diagnosis . Patients were thought to have diabetes if they had a previous or current diagnosis of diabetes, regardless of glycemic status on admission . The exclusion of t2 dm was confirmed by the measurement of nonfasting glucose and fasting glucose before discharge . Each group was divided into two prespecified groups based on apg level (<11.1 and 11.1 mmol / l) and fpg level (<7.0 and 7.0 <7.0 mmol / l) as nonhyperglycemia subgroup and the latter as hyperglycemia subgroup . This study excluded patients with a history of malignant tumor, chronic renal failure (creatinine> 451 mol / l), liver cirrhosis, serious infected diseases, and previous myocardial infarction . Clinical symptoms and signs including chest pain or painless, systolic blood pressure (sbp), diastolic blood pressure (dbp), and heart rate (hr) were recorded on admission . Blood samples, including apg, creatinine, and creatinine kinase (ck), were measured at the time of hospital admission . Fpg, total cholesterol (tc), triglyceride (tg), high - density lipoprotein cholesterol (hdl - c), and low - density lipoprotein cholesterol (ldl - c) were measured in the next day's morning after overnight fasting . According to the results of electrocardiograph (ecg), they were classified into non - st - segment elevation myocardial infarction (nstemi) or st - segment elevation myocardial infarction (stemi). The primary end point was all - cause in - hospital mortality; the second end points were serious cardiovascular complications such as malignant arrhythmia, cardiac shock, heart failure, and reinfarction . Continuous variables are expressed as mean sd or median interquartile range, and categorical variables were reported as numbers and percentages . Logistic regression analyses were used to determine the predictors of in - hospital mortality . In order to account for the influence of the risk factors on mortality rate, we performed a enter regression analysis with in - hospital death as outcome and the other risk factors (age, apg, fpg, sbp, dbp and hr at admission, blood lipid, and creatinine) as covariates . All 2-sided p values <from february 2002 to february 2014, a total of 253 female patients with their first ami diagnosis were enrolled in this study . Diabetic group included 87 patients (34%) and nondiabetic group included 166 patients (66%). They had average ages of 70.11 9.80 and 70.32 12.30 years old, respectively . There was no difference in the age between the two groups, as shown in figure 2 . Mean apg was significantly higher in diabetic patients than nondiabetic patients (13.9 6.2 versus 8.5 3.7 mmol / l, p <0.01). Besides, mean fpg was also remarkably higher in diabetic patients (9.1 3.5 versus 5.9 1.3 mmol / l, p <0.01). For the blood lipid profile, plasma triglyceride level was obviously higher and hdl - c was lower in diabetic group . Compared with the nondiabetic group, diabetic patients were more likely to have atypical clinical presentations of ami . The proportions of painless ami and nstemi were statistically higher among diabetic patients than the nondiabetic group . In addition, diabetic patients may have a greater reinfarction rate after the first ami than nondiabetic patients (13.79% versus 6.02%, p <0.05). However, the incidence rate of malignant arrhythmia in diabetes group was lower than nondiabetic group (2.3% versus 11.45%, p <0.05). The association between different blood glucose level (apg and fpg) and clinical characteristics and complications of ami was listed in tables 2 (two missing values for fpg in non - diabetic group) and 3 (11 missing values for fpg in non - diabetic group and six in diabetic group). A total of 34 deaths (13.44%) occurred during hospital stay in two groups (table 1). In - hospital mortality of diabetic group did not differ significantly from nondiabetic group (16.09% versus 12.05%, p = 0.37). But the mortality rate of nonhyperglycemia subgroup (apg <11.1 mmol / l, fpg <7.0 mmol / l) and hyperglycemia subgroup (apg 11.1 mmol / l, fpg 7.0 mmol / l) was dramatically different in the nondiabetic group (tables 2 and 3). There was a tendency towards a much higher in - hospital mortality rate in nondiabetic group with the rising apg level and fpg level (figure 1). When nondiabetic patients were subgrouped by apg level, the in - hospital mortality rate in nonhyperglycemia subgroup and hyperglycemia subgroup was 7.86% and 29.17%, respectively (p <0.01). Likewise, when subgrouped by fpg level, the in - hospital mortality rate was 4.32% and 43.75%, respectively (p <0.01). However, there was no significant difference between nonhyperglycemia subgroup and hyperglycemia subgroup in mortality rate in the diabetic group . Moreover, as shown in table 3, in the nondiabetic group, the incidence of cardiac shock in hyperglycemia subgroup is much higher than nonhyperglycemia subgroup (12.95% versus 56.25%, p <0.001). In order to analyze which factor was closely associated with in - hospital mortality, we did a multivariate logistic regression analysis to eliminate the influence of confounding factors . Our results showed that independent predictors of in - hospital mortality for nondiabetic patients with ami were fpg (or: 2.014; 95% ci: 1.2963.131, p <0.01) and creatinine (or: 1.011; 95% ci: 1.0041.017, p <0.01) (table 4). However, the predictors of in - hospital mortality in diabetic group were age (or: 1.160; 95% ci: 1.0041.342, p <0.05) and creatinine (or: 1.007; 95% ci: 1.0011.014, p <0.05) (table 5). Several previous studies have demonstrated that elevated apg and hba1c were powerful predictors of mortality and increased risk of cardiovascular complications in ami patients both with and without diabetes [1316]. They found that hyperglycemia was associated with larger infarct size, lower left ventricular ejection fraction (lvef), and poor prognosis . Previous reports also suggested that glycemic status, which poses a risk for cvd, differed in male and female individuals . The reason could be a difference in the basic mechanism of carbohydrate metabolism, hormone, and insulin sensitivity . But there were limited data on fpg and cardiovascular prognoses of female patients with ami . In the present study, we defined fasting hyperglycemia in acute myocardial infarction phase to be 7.0 mmol / l and admission hyperglycemia to be 11.1 mmol / l . Moreover, this cutoff point was recommended by worldwide standards for a tool for carbohydrate metabolism disorder diagnosis . Our study found that elevated fpg level in nondiabetic group was a strong and independent predictor of increased risk of mortality and cardiac shock in patients with ami, and elevated apg level was closely associated with higher mortality rate and plasma creatinine level . These results were in accordance with several previous studies including both men and women [21, 22]. In recent years reported a higher adjusted prevalence of in - hospital mortality among nondiabetic patients with elevated fpg, using a cutoff value of fpg> 6.1 mmol / l (110 mg / dl) for fasting hyperglycemia . Compared with patients categorized as having normal fpg, the adjusted or for 30-day mortality progressively increased with higher tertiles of elevated fpg (first tertile: 4.6; 95% ci: 1.7 to 12.7; second tertile: 6.4; 95% ci: 2.5 to 16.6; and third tertile: 11.5; 95% ci: 4.7 to 20.0). Yang et al . Reported the fpg - stratified hazard ratios of in - hospital mortality in female patients of 1.037 (95% ci: 0.8202.262) and 1.174 (95% ci: 0.9054.432) in mildly hyperglycemic and severely hyperglycemic group after multivariate adjustment . In our present study, we also found the prognostic value of apg in female nondiabetic patients with ami . T2 dm is already an established risk factor for patients with ami [2426]. However, in contrast to these findings, we found higher in - hospital mortality of ami in nondiabetic patients, contrary to the existing knowledge that the mortality of ami was common mainly in diabetics . Moreover, our study demonstrated that elevated fpg and apg levels in nondiabetic group were strong and independent predictors of increased risk of mortality with ami, but, in diabetic group, they were not . It showed that risk factors other than dm had a stronger association with the mortality of ami in these cases . These results were consistent with the findings in some studies [27, 28]. This phenomenon observed in the current study may be a result of several factors, including improved treatment in the acute phase of ami and increased long - term survival resulting from aggressive secondary prevention in diabetic patients . Besides, we found that the frequency of malignant arrhythmia in the nondiabetic group was much higher than diabetes group, suggesting that malignant arrhythmia may contribute to narrowing the gap of short - term mortality between nondiabetic and diabetic patients . Previous research indicated that hypoglycemia caused an acquired long qt syndrome and prolonged cardiac repolarization causes fatal cardiac arrhythmias . Besides, our study showed that the frequency of myocardial reinfarction was obviously higher in diabetic group, which indicated adverse long - term outcome in diabetic patients . Some studies also found that t2 dm may abolish the beneficial effect of primary pci on long - term risk of clinical reinfarction [30, 31]. For diabetic patients, undergoing primary pci had the similar reinfarction rate compared with those who received the thrombolysis treatment . Therefore, although t2 dm did not impact short - term mortality rate, it still influenced the long - term mortality rate of ami patients . The relationship of the cause and effect between hyperglycemia and in - hospital mortality of ami is still uncertain . On the one hand, serious ami can cause stress hyperglycemia, resulting from a surge of stress hormones such as adrenaline, noradrenalin, and cortisol which induce or exacerbate an insulin - resistant state . Relative insulin deficiency and excess catecholamine reduced glucose uptake by the ischemic myocardium and promoted lipolysis which increased circulating free fatty acids . Induction of endothelial dysfunction, oxidative stress, hypercoagulability, and impaired fibrinolysis may follow after hyperglycemia . But some animal experiments indicated that short - term hyperglycemia may protest against ischemic myocardium [33, 34]. More researches will need to deeply uncover the mechanisms . However, there are some reports contradicting our analysis and suggesting that the prognosis of diabetic patients may be significantly poor during the acute myocardial infarction phase . Presented a 2-fold higher hospital mortality rate in the subgroup of patients with dm and hyperglycemia in comparison to patients with dm without hyperglycemia . Likewise, scuteri et al . Reported higher in - hospital mortality rate in the group of patients with dm and hyperglycemia . Multivariate analysis showed 5-fold risk of death in patients with hyperglycemia over 300 mg / dl and 2.8-fold in patients with hyperglycemia over 218 mg / dl, in comparison to patients with blood glucose level below 161 mg / dl . In our analysis, the prognosis of patients without dm with concomitant hyperglycemia may, in part, be explained by the following differences in group characteristics . Firstly, patients with hyperglycemia were generally over 60 years, which agreed with a multivariate analysis showing that age was an independent factor of increased mortality rate in 1-year follow - up . In addition, nondiabetic patients with acute hyperglycemia showed an increased rate of inefficient fibrinolysis and the presence of multivessel coronary heart disease . These patients differed not only in the mentioned parameters but also in infarction severity including the concentration of myocardial necrotic markers and left ventricular ejection fraction from normal glucose patients . Hence, the importance of evaluation of plasma glucose during ami for a better prognosis during follow - up period cannot be disregarded . However, we should realize that blood glucose value (pfg and apg) is changeable in one day . Normally, the level of blood glucose changes within a limited range in non - diabetic patients . However, the inter- and intra - day glucose variability is relatively high in diabetic patients . In addition, blood glucose level is influenced by many other factors, such as diabetes status, serious complications and treatment . So before we analyse the association between hyperglycemia and complications of ami, those factors should be took into consideration . First, this was a single - center, nonrandomized, and retrospective study with a relatively small number of patients . Second, we did not evaluate long - term outcome of every ami patient, so the relationship between fpg and long - term prognosis was not exactly assessed.
, the explanation for the enhanced strength of the h - bonds between two sp hybridized monomers, such as adenine (a) and thymine (t) bases, has been attributed to a reinforcement by the electrons, the so - called resonanceassisted hydrogen bonding (rahb). But we prove rahb is not the reason for this enhanced h - bond strength . Instead, our analyses identify that the main reason is the more stabilizing covalent component in such h - bonds which occur in the a t dna base pair . Besides getting the bonding mechanism right and explaining an experimentally observed trend, our work also highlights the value of molecular orbital (mo) theory in the realm of supramolecular chemistry . It was an association of salvador dalis surrealistic paintings with our finding that electronic orbitals hold together the molecule of life . I learned about many of these paintings during my research stays in girona when i visited the dali museum in nearby figueres . There is a long - standing collaboration between our two theoretical chemistry institutes, and s. simon and i have been interested in h - bonds in general for a long time . Once, the idea arose to pinpoint the origin of the enhanced h - bonds in dna base pairs using kohn sham mo theory in combination with an approach in which, in a series of model systems, the aromatic nuclei of the dna bases are stepwise reduced and saturated . I am working on various quantum chemical studies about bonding mechanisms in different self - assembly processes in supramolecular chemistry . Self - assembly is based on weak interactions, such as halogen- and h - bonding, commonly conceived as caused exclusively by van der waals forces and/or electrostatic attraction . However, the stabilization associated with the aggregation process and the directionality of the resulting bonds are often driven by the covalent part of these interactions . A detailed understanding of the nature and bonding mechanism of halogen- and h - bonds can consolidate the theoretical foundation of supramolecular chemistry and provide valuable design principles.
Crohn's disease (cd) and ulcerative colitis (uc) are the two main types of inflammatory bowel disease (ibd), which is chronic inflammatory disease occurring in the intestine . Although their etiologies are still unknown, ibd is now a substantial health problem in many countries . The prevalence of ibd in japan has been rapidly increasing since the 1980s; in particular, the number of uc patients is much higher than that of cd . In western countries,, steroidal drugs are commonly used for the treatment of ibd; however, use of these agents is limited due to their adverse effects . Uc is a recurrent inflammatory disorder primarily involving the mucosa and submucosa of the colon . Neutrophil accumulation within epithelial crypts and in the intestinal mucosa directly correlates with clinical disease activity and epithelial injury in uc . Once large numbers of neutrophils and macrophages are activated, these cells enter the injured mucosa of the colon, leading to overproduction of reactive oxygen species (ros) such as superoxide radical (o2), hydrogen peroxide (h2o2), and hydroxyl radical (oh). When they are generated close to cell membranes, they induce oxidative stress and oxidized membrane phospholipids (lipid peroxidation) and dna, which could contribute to gene mutation and inflammation, finally causing cancer . It has been reported that low - dose irradiation induces activation of the biological defense system . For example, low - dose x- or -irradiation attenuates collagen - induced arthritis through suppression of proinflammatory cytokines and autoantibody production, suggesting the enhancement of anti - inflammatory function . In addition, we previously reported that low - dose (0.5 gy) x- or -irradiation increases antioxidant substances (e.g., superoxide dismutase (sod), catalase (cat), and glutathione (gsh)) and inhibits oxidative damage such as cold - induced brain edema in mice . It is highly possible that low - dose irradiation contributes to the inhibition or treatment of oxidative stress - related diseases such as diabetes . Therapy using radon (rn), which is volatilized from radon - enriched water and mainly emits -rays, is performed for ros - related diseases such as osteoarthritis and bronchial asthma in misasa, japan and badgastein, austria . To clarify the mechanism of the therapy we previously reported that radon inhalation induced antioxidant substances in many organs, such as the brain, heart, lung, liver, pancreas, kidney, and small intestine of mice . Moreover, we recently demonstrated that radon inhalation inhibited alcohol - induced hepatopathy, streptozotocin - induced type-1 diabetes, and carrageenan - induced inflammatory paw edema in mice . These findings suggested that radon inhalation has antioxidative and anti - inflammatory effects similar to low - dose x- or -irradiation; however, there has been no report of the effects of radon inhalation on antioxidative function in the colon . If radon inhalation activates antioxidative functions in the colon, its use is highly likely to be beneficial against colitis; however, there has been no report of the protective effects of radon inhalation against colitis . The dextran sulfate sodium (dss) model of colitis is widely perceived as a good model of experimental colitis because it has similarities to human uc . In this study, we examined the following biochemical and histological parameters to assess the effects of radon inhalation on dss - induced colitis: myeloperoxidase (mpo), nitric oxide (no), tumor necrosis factor - alpha (tnf-), sod, cat, total glutathione (tgsh), lipid peroxide (lpo) level, and histology . Male balb / c mice (7 weeks of age, approximately 23 g of body weight) were purchased from clea japan inc . They were housed in mice cages (4 mice in each) with wood chip bedding, controlled temperature (20 1c), and a preset light - dark cycle (12:12 h). They were fed oriental mf diet (oriental yeast co., ltd ., tokyo, japan) and normal drinking water ad libitum during all experimental periods . Ethics approval for the experimental design was obtained from the animal experimental committee of okayama university . Although the system is a kind of whole - body exposure, it allows the evaluation of the in vivo behavior of radon and its physiological effects . Concentration of radon progeny in the exposure box is quite low compared with the concentration of the coexisting radon . Although low - dose irradiation activates antioxidative functions in the early stage, these functions gradually come close to the normal level within a few days; however, continuous low - dose irradiation also activates antioxidative functions . In this study, mice continuously inhaled radon at a concentration of 2000 bq / m for 8 days except for 1 h during animal care every morning . The radon concentration in the mouse cages we previously reported that radon inhalation at the concentration of 1000 and 2000 bq / m have anti - inflammatory effects and it is better at 2000 bq / m than 1000 bq / m . The concentration was measured using a radon monitor (cmr-510; femto - tech inc ., after 7 days of acclimatization, mice were weighed and divided into four groups: sham inhalation only (control), radon inhalation only (rn), sham inhalation with dss administration (sham+dss), and radon inhalation with dss administration (rn+dss). Mice in each group were treated with air only (sham) or radon for 8 days . Mice in sham+dss and rn+dss groups were induced colitis by replacing normal drinking water with distilled water containing 3% dss (molecular weight, 4000; wako pure chemical industry, co., ltd ., all mice were killed on 7 days after dss administration by deep ether anesthesia and blood was collected from the heart for no and tnf- assay in plasma . Plasma was obtained by centrifugation at 3000 g for 5 min at 4c . The colon (from the ileocecal junction to the anal verge) was quickly excised and the length was measured using a vernier caliper . Dss administration at low molecular weight causes severe mucosal injury in proximal colon; therefore, the proximal colon from the middle was used to assay biochemical activity and histology . These samples were stored at 80c until use in the biochemical assays or fixed in 10% formalin for histological examination . To assess the severity of colitis, disease activity index (dai) score and weight gain were monitored daily . Briefly, the dai score was calculated as the sum of the diarrheal score and the bloody stool score (table 1). The rate of body weight gain in each mouse was defined by the following formula: (1)weight gain (%) = {(weight each day)(weight at day 0)weight at day 0} 100 tissue samples fixed in 10% formalin were embedded in paraffin . Six micrometer - thick tissue sections were prepared and stained with hematoxylin and eosin (he) to evaluate mucosal damage . Briefly, the damage score was calculated as the sum of three parameters: surface epithelial loss, crypt destruction, and inflammatory cell infiltration into the mucosa (table 2). The sections were also stained with alcian blue to evaluate the presence of goblet cells . We calculated the number of alcian blue - positive goblet cells per unit using imagej software (national institutes of health, bethesda, md, usa). Mouse colon was homogenized in 1 m tris - hcl buffer containing 5 mm ethylendiaminetetraacetic acid (edta) (ph 7.4) on ice . The homogenate was centrifuged at 12000 g for 45 min at 4c and the supernatant was used to assay the activity of sod and cat . Sod activity was measured by the nitroblue tetrazolium (nbt) reduction method using the wako - sod test (wako pure chemical industry, co., ltd ., briefly, the extent of inhibition of the reduction in nbt was measured at 560 nm using a spectrophotometer . Cat activity was measured as the h2o2 reduction rate at 37c and was assayed at 240 nm using a spectrophotometer . The assay mixture consisted of 50 l of 1 m tris - hcl buffer containing 5 mm edta (ph 7.4), 900 l of 10 mm h2o2, 30 l distillated water, and 20 l colon supernatant . The tgsh content was measured using the bioxytech gsh-420 assay kit (oxis health products, inc ., briefly, the colon was suspended in 10 mm pbs (ph 7.4), mixed with ice - cold 7.5% trichloroacetic acid solution, and then homogenized on ice . This assay is based on the formation of a chromophoric thione, the absorbance of which, measured at 420 nm, is directly proportional to the tgsh concentration . Lpo (malondialdehyde (mda)) levels were assayed using the bioxytech lpo-586 assay kit (oxis health products, inc ., briefly, the colon was homogenized in 20 mm pbs (ph 7.4) on ice . Before homogenization, 10 l of 0.5 m butylated hydroxytoluene in acetonitrile was added per 1 ml tissue homogenate . After homogenization, the homogenate was centrifuged at 15000 g for 10 min at 4c and the supernatant was used for the assay . The mda assay is based on the reaction of a chromogenic reagent, n - methyl-2-phenylidole, with mda at 45c . The optical density of the colored products was read at 586 nm using a spectrophotometer . Mpo activity was measured using the myeloperoxidase (mpo) colorimetric activity assay kit (biovision, inc ., briefly, the colon was homogenized in mpo assay buffer and the homogenate was centrifuged at 13000 g for 30 min at 4c . Supernatants were collected, mixed with mpo assay buffer and mpo substrate, incubated at room temperature for 1 h, and then mixed with tetramethylbenzidine probe . The protein content was measured by the bradford method using protein quantification kit - rapid (dojindo molecular technologies, inc . No was measured using the nitrate / nitrite colorimetric assay kit (oxford biomedical research, inc ., tnf- was measured by the enzyme linked immunosorbent assay (elisa) using the mouse tnf- elisa kit (shibayagi co., ltd ., data are presented as the mean standard error of the mean (sem). There were no significant differences in the water consumption in each group during colitis induction (data not shown). The dai score, an indicator of the severity of colitis, was almost 0 in the control group and rn group . In sham+dss group, similarly, in rn+dss group, the dai score significantly elevated within 2 days; however, the dai scores on day 3 to 7 were significantly lower in rn+dss group than in sham+dss group (figure 1(a)). The rate of body weight gain in sham+dss group significantly began to decrease on day 3 of colitis induction compared with control group . Similarly, the rate in rn+dss group significantly began to decrease on day 7 of colitis induction compared with control group . However, the rate on day 3 to 7 was significantly higher in rn+dss group than in sham+dss group (figure 1(b)). At the end of the experiment, there were no significant differences in colon length between rn group and control group . The colon length in sham+dss and rn+dss groups was significantly shortened by dss administration compared with control group; however, the length was significantly longer in rn+dss group than in sham+dss group (figure 1(c)). In he - stained sections, morphological changes of the colon the histological damage score in sham+dss and rn+dss groups was significantly increased by dss administration compared with control group; however, the score was significantly lower in rn+dss group than in sham+dss group (figure 2). In alcian blue - stained section, there were no significant differences in the number of goblet cells per unit between rn group and control group . The number in sham+dss group was significantly decreased by dss administration compared with control group; however, the number was significantly larger in rn+dss group than in sham+dss group (figure 3). To assess the effect of radon inhalation on the anti - inflammatory response, tnf- and mpo were assayed following radon inhalation . There were no significant differences in the tnf- level in plasma and the mpo activity in the colon between rn group and control group (figure 4). Tnf- level in plasma and mpo activity in the colon in sham+dss group were significantly increased by dss administration compared with control group; however, they were significantly lower in rn+dss group than in sham+dss group (figure 4). To assess the effect of radon inhalation on antioxidative functions, sod, cat, tgsh, lpo, and no were assayed following radon inhalation . Sod activity and tgsh content in the colon were significantly higher in rn group than in control group (figures 5(a) and 5(c)). There were no significant differences in cat activity in the colon and no level in plasma between rn group and control group (figures 5(b) and 5(e)). Lpo level, an indicator of oxidative damage, in the colon was significantly lower in rn group than in control group (figure 5(d)). Sod activity and tgsh content in the colon in sham+dss group were significantly decreased by dss administration compared with control group; however, they were significantly higher in rn+dss group than in sham+dss group (figures 5(a) and 5(c)). Lpo level in the colon and no level in plasma in sham+dss group were significantly increased by dss administration compared with control group; however, they were significantly lower in rn+dss group than in sham+dss group (figures 5(d) and 5(e)). Radon dissolved in blood entering the gas exchange compartment is transported to many tissues by the blood stream and has stimulus effects . We have demonstrated that radon inhalation activates some biological defense systems such as antioxidative functions and anti - inflammatory functions in various organs in mice; however, the physiological effects of radon inhalation on the colon have never been examined . Therefore, we examined for the first time the effects of radon inhalation on inflammation- and antioxidant - associated substances in the colon . Our results showed that radon inhalation significantly increased antioxidants such as sod in the colon, indicating the enhancement of antioxidative functions . These findings suggested that radon inhalation may contribute to preventing oxidative stress - related disease in the colon . Dss administration induces certain typical symptoms of colitis such as dai elevation, body weight loss, and a shortened colon [26, 27]. In this study, dss administration induced the symptoms described above; however, they were clearly suppressed by radon inhalation . Dss administration causes histological damage such as surface epithelial loss and inflammatory cell filtration into the mucosa . Loss of goblet cells is also one of the pathological features of dss - induced colitis . In this study, dss administration induced severe injury to the colon, represented by the elevated histological damage score and decreased goblet cells; however, they were clearly suppressed by radon inhalation . These findings further substantiated the claim that radon inhalation has protective effects on the colon . Infiltration of neutrophils into colonic tissue causes mucosal damage induced by ros that are released from activated neutrophils, and this damage further stimulates the infiltration of neutrophils through the induction of proinflammatory cytokines, especially tnf- [4, 28]. Tnf- is a primary mediator of the inflammatory response and closely linked to colonic inflammation of uc . Mpo is an enzyme found in neutrophils; thus, it is a good marker of inflammation in addition to tnf-. Our results showed that dss administration induced higher tnf- in plasma and mpo activity in the colon; however, they were significantly decreased by radon inhalation . These findings suggested that radon inhalation reduced mucosal damage and suppressed the further infiltration of neutrophils into the mucosa through the reduction of ros toxicity . To further clarify the mechanisms that suppressed colitis, antioxidant - associated substances in activated neutrophils induced by dss administration produce ros, which can cause peroxidation of the cell membrane phospholipids (lipid peroxidation). In addition, the relation between the severity of colitis and elevated no synthesis in uc patients and colitis model animals has received much attention . It was reported that tnf- induces the expression of inducible nitric oxide synthetase (inos), leading to a steep rise of no synthesis . In the case of sod deficiency or increased o2 production, o2 reacts with no to produce reactive nitrogen species (rns) such as peroxynitrite (onoo), which is a highly toxic agent that can cause oxidative / nitrosative stress and functional disorders in the cellular membranes and intracellular proteins . On the other hand, sod plays an important role in protecting cells from oxidative damage by converting o2 into h2o2 . For example, sod administration suppresses dss - induced colitis by decreasing ros level in the colon, and a similar result was reported in trinitrobenzene sulfonic acid- (tnbs) induced colitis model rats . These findings suggested that radon inhalation suppressed dss - induced colitis through the enhancement of antioxidative functions in the colon . Radon inhalation suppressed acute phase of dss - induced colitis; however, it is not clear whether radon inhalation is beneficial against chronic inflammation of the colon in ibd . For example, low - dose x - irradiation inhibits diabetes induced cardiac inflammation in a type-1 diabetes model mouse . In the clinical practices, the therapeutic effects of radon therapy on chronic inflammatory disease such as bronchial asthma have been reported . Radon inhalation has similar effects to low - dose irradiation; therefore, it may contribute to the treatment of chronic inflammation in ibd . Anezaki et al . Reported that interleukin-8 (il-8) level is closely correlated to mpo levels in the inflamed mucosa of uc . In uc patients, il-8 mrna was found mainly in macrophages, and also in neutrophils and colonic epithelial cells . Moreover, increased production of il-8 peptides and expression of il-8 mrna are observed in the inflamed mucosa of uc . These findings may suggest that il-8 is a neutrophil - activating substance to release ros from neutrophil . In this study, it was not clear whether radon inhalation suppressed dss induced colitis through the direct inhibition of neutrophil activation . More detailed studies from the viewpoint of immune factor in intestinal mucosa will be necessary for further clarification of the mechanism that radon inhalation suppressed dss - induced colitis . Radon has been recognized as a cause of lung cancer; however, most of the doses to the lung come from its short - lived progeny and not from radon itself . Moreover, lifestyle influences such as smoking is larger than radon exposure . In this study, the influence of radon progeny to mice is negligible . Absorbed dose into the lungs and colon of mice under our experimental condition were estimated both to be within the range of 0.671.2 gy according to our previous report . The international commission on radiological protection (icrp) expresses an opinion that a significant cancer risk associated with exposure under 100 msv has not been demonstrated . Based on the recommendations of the icrp, the risks associated with exposure to radon under our experimental condition are low . In fact, adverse or negative effects of radon therapy have not been reported in the past . In conclusion, radon inhalation activated antioxidative functions and suppressed oxidative damage and inflammation in the colon induced by dss administration . Beneficial effects of radon inhalation in the treatment of ibd patients are strongly expected . At present, steroidal drugs which have adverse effects are commonly used for the treatment of ibd . The introduction of radon inhalation for the treatment of ibd may contribute to reduce the drug dosage and its adverse effects . The data presented in this study provide a substantial basis for future studies aimed at assessing new radon - based therapies for the treatment of ibd in humans . In this study, we demonstrated that continuous radon inhalation suppressed dss - induced colitis; however, such long term inhalation is unsuitable for medical treatment . We aim to research the optimum condition for achieving the maximal effect under short time inhalation . In the future, more detailed studies of the following points will be necessary for further application of radon therapy to medical treatment: further clarification of the mechanisms of the health effects, research into new indications, determination of the optimum condition for achieving the maximal effect, and assessment of concomitant effects with drugs.
It is widely accepted that conditions exist for the evolution of a new strain of influenza virus with the potential to cause a human pandemic . The biggest challenge in planning for an influenza pandemic is the range of unknown factors; its nature and impact cannot be fully predicted until the pandemic virus actually emerges . Those planning for a pandemic must, therefore, work from a number of assumptions based on knowledge gained from previous pandemics and scientific modelling of a range of potential scenarios . The uk pandemic influenza plan sets out a range of possible scenarios for clinical attack rates and case fatality rates during a pandemic, including the potential for more than one wave . The base scenario assumes a clinical attack rate of 25% and a case fatality rate of 0.37%, giving rise to 53,700 excess deaths in the uk . A reasonable worst case scenario involves a cumulative clinical attack rate of 50% with 2.5% case fatality, causing 709,300 excess deaths . Similarly, the us department of health and human services predicts that in a " moderate " scenario based on a virus with 1968-like pathogenicity, 865,000 will require hospitalisation and 65,000 (7.5%) will require ventilation . They also outline a " severe " 1918-like scenario with 9.9 million hospitalisations and 743,000 patients requiring ventilation . An influenza pandemic will undoubtedly create a major increase in demand for critical care services . The majority of uk hospital intensive care units (icus) are already operating at> 98% bed occupancy . Integral to the success of any emergency planning strategy is' surge capability', incorporating the ability to scale up the delivery of appropriate specialist care to those that require it . Modelling of the impact of an influenza pandemic on uk critical care services has been carried out using the flusurge 1.0 programme developed at the us centers for disease control . With simulation of an 8-week epidemic and 25% attack rate the demand for critical care beds from patients with influenza would represent 208% of current combined level 2 (high - dependency unit) and level 3 (icu) bed capacity, and 231% of current level 3 capacity . Even allowing for optimistic estimates of other modulating factors (50% reduction in icu demand with use of neuraminidase inhibitors and 50% upgrade of level 2 to level 3 beds), level 3 bed occupancy due to the pandemic would remain at 75% . Furthermore, occupancy of level 3 beds by' flu patients' was unsustainable at approximately 50% in terms of care for other patients even in the most optimistic conditions . Although some research and modelling exists regarding hospital surge capacity for major incidents, this generally relates to' big bang' single incidents rather than' rising tide' prolonged problems [7 - 11]. The closest objective evidence for efficacy of critical care in the event of a flu pandemic is extrapolated from h5n1 influenza and the recent sars outbreak in toronto . Of the h5n1 admissions to hospital in thailand, 75% developed respiratory failure . Hospital mortality in these cases was 75% . During the toronto sars outbreak, up to 32% of cases were admitted to icu, 25% were mechanically ventilated and 28 day mortality for ventilated patients was 45% . In singaporean sars patients admitted to icu, 98% developed ards . Properly constructed plans for the delivery of critical care during an influenza pandemic must include the ability to deal with excessive demand, high and possibly extreme mortality, and the risk to the health of critical care staff . The consequences of a pandemic, both in terms of numbers of patients and the effect on the healthcare system, are likely to precipitate a' major incident' where special arrangements are needed to manage the system while it is under extreme pressure . It is anticipated that there will be an overwhelming demand for critical care services, not only for respiratory support through mechanical ventilation but also for a full range of care to manage multiorgan failure . Assuming that the next pandemic derives from the h5n1 strain, the epidemiological evidence to date suggests extremely high mortality and, although not precisely quantifiable, a significant risk to health care workers . Both of these will undermine the ability to deliver critical care to influenza patients even before consideration is given to the duty of care to other critically ill patients . Coherent incident response requires a robust command and control structure, with the ability to make rapid informed decisions across an organisation and also across a health economy . In the uk, health incident management is based on a' medallion' structure, with gold, silver and bronze corresponding to strategic, tactical and operational command levels . North american and asian health institutions tend to use the hospital emergency incident command system . The common theme in both systems is a clear command and control structure with which healthcare staff should be familiar [4,14,16 - 19]. Their generic hierarchical structure allows application to a wide range of incidents whilst retaining familiarity gained from training and exercises . The importance of familiarity with the command and control structure was highlighted in a recent delphi study and european survey . Critical care contingency planning guidance from the uk department of health places an expectation on providers to expand their level 3 bed capacity by a factor of 3 but no more . Provision of full multiorgan level 3 support is recognised to be unrealistic, but principally respiratory support is felt to be achievable . Cancellation of elective surgery to minimise alternative sources of demand for critical care, upgrading level 2 to level 3 facilities and recruitment of theatre recovery areas and even operating theatres may allow expansion of icu - like care capacity . Staff in these areas already have the competencies to manage sedated patients and those receiving respiratory support . Other staff may need to be redeployed and receive training in the management of critical care patients to support fully trained staff, permitting a dilution of the standard critical care nurse to patient ratio . The expansion of icu capacity to provide critical care in other areas will require the pre - emptive identification, tracing and maintenance of all usable equipment and potentially the stockpiling of key items to allow for rapid up - scaling of activity in response to demand . It is likely that there will be some variability in the prevalence of influenza across the country during a pandemic wave, with peaks in demand staggered across geographical areas . It may be possible to disperse some of the patient load by inter - facility transfer if this occurs to any significant extent . The expansion of icu facilities during the sars epidemic in hong kong and singapore was recently described . Infection control is recognised as an overriding priority for the delivery of critical care, including the ability, in the early stages, to cohort cases . This should ideally include the use of separate entrances and exits, isolation rooms with negative pressure ventilation and dedicated separate healthcare staff . The toronto experience identified 21 secondary cases of nosocomial transmission of sars in icu from an initial index case before infection control measures were introduced . Even following the introduction of extensive protective equipment, nine healthcare workers developed sars as a result of being present in the room during the intubation of a single patient . In terms of personal protection, planning and practice in the donning of protective equipment (ppe) and prior fit testing is essential . The practicalities of being able to manage patients when fully attired must be understood and consideration given to the fact that any procedure or task will take longer . This will impact on care efficiency and the staff to patient ratio . While beds can be scaled up and extra areas recruited to provide critical care, without trained staff the planning will be ineffective . Staff illness rates and the risk to staff must be factored into the planning process . In the uk, staff illness has been estimated at 30% with work absences of up to 8 days . Normal working patterns may need to be revised and facilities provided for staff to stay on site rather than go home to their families . Staff absence tends to be greater the longer special circumstances apply and the greater the impact on the lives of the staff . The preventive effectiveness of neuraminidase inhibitors may make focussed chemoprophylaxis a strategy for reducing staff illness in critical care areas . The evolution of a new pandemic strain of influenza will inevitably result in a major increase in demand for critical care services . It is likely that these services will rapidly reach their capacity and even their contingency arrangements for extended facilities will be overwhelmed . Excessive demand where resources are finite creates an ethical dilemma and many emergency plans apply a utilitarian approach of' best care for the greatest number' . There is a legitimate debate about how limited capacity can best be utilised, but a number of themes are recurrent . There needs to be a legal and ethical framework for the process decided in advance, the rationale for triage should be fair and transparent and it should meet the principles of distributive justice [30 - 32]. Triage can conflict with human rights legislation and even humanitarian laws but' accountability for reasonableness' can temper the disagreements about priority setting . Although there are a number of triage systems available for mass casualty incidents, there has been little validation of any of them in the field, and what there has been relates to' big bang' single incidents and the apparent unreliability of triage . While it does not need to be explicit ahead of time, the decision thresholds should be based on both the cumulative evidence about the disease process and prognosis, and the number of patients and severity of illness making the demands on the service . In effect, triage may result in a gradual degradation of care with the increasing scale of the incident and become a' societally mandated do not resuscitate order' . On these grounds the process needs to be carefully considered at an appropriately senior level and applied consistently . Allowing for the utilitarian approach, it is recognised that in mass casualty incidents, the standard of care for all patients, including those not immediately related to the incident, may need to be adjusted and reduced . While this may infringe individual rights, the higher ethical principle of' wellness of society as a whole' allows for the direction of resources to those where it is felt most effective . It may also allow for an expansion in the scope of practice of non - physicians . It may be unrealistic and impractical to expect that senior medical intensive care staff will make all decisions regarding instituting critical care and there will be a need to empower more referring general clinicians to do so . This is at odds with the need for decision making by the most senior person and will require a change in practice for many clinicians; it is not current practice in the uk . The use of track and triage protocols will be essential to direct this decision making and ensure its consistency . Ardagh has developed a set of pragmatic questions for the clinician facing acute problems of resource allocation; the only point lacking in his assessment process is a tool for the' ranking' of patients in terms of likelihood of benefit from the limited resources . We believe that the basic criteria for a system for triage to critical care in a pandemic are fourfold; it should identify patients sick enough to require higher level care at some stage in their illness, it should be able to recognise those patients who are too acutely or chronically unwell to benefit from critical care, it should be consistently applicable by healthcare professionals and support workers from a variety of backgrounds within the constraints of the pandemic and should ideally also be scalable to reflect any mismatch between need and capacity . In order to fairly allocate resources across both flu and non - flu patients it should also be disease non - specific and allow prognostic comparisons across disease categories . Although us guidelines emphasise the importance of triage in primary influenza, specific tools are only recommended for assessment of post - influenza bacterial pneumonia . The majority of available potential scores were developed as mortality indicators and perform less well for predicting critical care usage . Amongst icu admissions with community - acquired pneumonia in massachusetts in 1996 to 1997, 10/32 scored curb-65 1 or 2 (that is, low risk) and 5/32 were classified as psi (pneumonia severity index) class iii (intermediate risk). Even amongst patients with pneumonia included in the prowess study, only 90.5% were psi class iv or v, and only 70.3% had a curb-65 score of 3 or above . There is no guarantee that pandemic influenza will be primarily pneumonic in its presentation; case reports have documented h5n1 influenza presenting with diarrhoea and coma and a world health organisation summary has described absence of respiratory symptoms in a number of cases . The utility of disease - specific pneumonia scores may also be limited by mortality from comorbidities such as cardiovascular disease . A number of intensive care scoring systems have demonstrated their power in using physiological derangement to predict mortality or higher resource requirements, whatever the presenting diagnosis [45 - 49]. Physiological scores have also been demonstrated to be good predictors of requirement for higher level care on hospital wards, in medical assessment units and in the emergency department . We have demonstrated that a purely clinical score incorporating acute physiological derangement and chronic health and performance status can reliably predict requirement for critical care . It is inevitable that if an influenza pandemic reaches the scale of some predictions, some patients who, in normal circumstances, would benefit from critical care will not be offered it . Critical care triage will need to evolve from a process of identifying cases who need high level care to one that determines those patients most likely to benefit from the limited resources available and distinguishes them from those where care is likely to be futile . This is recognised by the emergency medicine community and the us administration in terms of disaster triage . The american thoracic society adopted the utilitarian principle a decade ago, stating that " the duty of health providers to benefit an individual patient has limits when doing so unfairly compromises the availability of resources needed by others " . The problem now facing policymakers and clinicians is defining a process for resource allocation that meets the requirements of distributive justice and accountability for reasonableness . As the working group on emergency mass critical care of the society for critical care medicine recognised, " an ideal triage system is based on data collected at hospital admission, requires little or no laboratory testing, and has been proven to predict hospital survival " . The ontario ministry of health long - term care working group have courageously taken the first steps in defining a triage protocol for critical care and their use of serial sequential organ failure assessment (sofa) scores to place a ceiling on care provided to non - responding patients is to be supported . However, it is unlikely to be feasible for all patients to have a trial of inotropes and/or ventilation and some way of screening out the sicker patients at ward / floor level will be required . We are not aware of the use of objective prognostic scores to allocate or refuse critical care resources at present and indeed most research demonstrates the ad hoc nature of admission decision - making . However, if, as is likely, review by experienced critical care physicians is impractical, decision support will be required for the non - critical care specialist . Emergency physicians, for example, had a positive predictive value (ppv) of only 73% in identifying those with a low chance of survival, as opposed to critical care fellows (ppv 83%) and the mortality probability model (mpm0; ppv 86%). Sofa scoring has previously been demonstrated on a multinational basis to predict high risk of mortality (a sofa score of over 15 was 98.9% specific for mortality). Other critical care scoring systems show comparable performance in mortality prediction; discrimination as measured by area under receiver operator characteristic (roc) curve was 0.825 to 0.901 for acute physiology and chronic health evaluation iii (apache iii) [62 - 65], 0.79 to 0.846 for simplified acute physiology score ii however, calibration of these scores to give absolute risks of mortality has not always been reliable and has required customisation for international use . Concentrated work is clearly required to amend and validate existing scoring systems so that they are suitable for use as triage tools . We suggest that this should be done on two levels . While disease specific scoring systems are valuable and should continue to be refined, there is a need to develop an appropriately generalisable scoring system for as unselected a group of patients as possible . To have the discriminating power, it will need to take place on a multi - centre or, preferably, on a multi - national basis . It is a general principle of major incident planning that procedures should not be changed at precisely the moment when the system or institution is under its greatest stress, so planning for pandemic flu needs to make use as much as possible of systems and procedures already in place . Development of a triage system and tool needs to be accompanied by planning for hospital command and control (to dictate scalability as related to available resources) and by training for staff whose roles may change . Researchers, clinicians and policymakers in the field need to analyse systems and scores already in existence and improve and validate them as triage tools (though this may not be the purpose for which they were originally developed). At the same time ethical principles require transparency and consistency in the decision - making process, and involvement of public in its development . In reality, perhaps the question we need to address is the action required when critical care services are overwhelmed . The scalability of triage tools may aid in decision making by objectively altering the threshold for admission to critical care . However, the time may come when we need realistically to evaluate the effectiveness of critical care in influenza . If survival with the benefit of critical care is marginal (for example, <10%) and there is a significant cross - infection risk, perhaps critical care should then close and concentrate its efforts on outreach to other areas, including wards . Direction and support from professional bodies and health departments will be required to support the medical staff with such difficult decisions possibly against a ground swell of media - driven public opinion . Dw is a member of the uk department of health critical care contingency planning working group . This article is part of a thematic series on disaster management edited by j christopher farmer.
Research over the last few decades has revealed that some dna and rna secondary structures modulate a variety of cellular events . One secondary structure in particular, the g - quadruplex regulates cellular events such as transcription, translation, pre - rna splicing, and telomerase elongation, all of which play roles in various serious diseases and cellular aging [26]. Systems capable of controlling dna and rna g - quadruplex structures would therefore be useful for the modulation of various cellular events for the purpose of producing biological effects . Because of their biological importance, many g - quadruplex - targeting ligands [7, 8] have been described, including phthalocyanine derivatives, porphyrin derivatives, and others [1114]. However, the next generation of binders should have more g - quadruplex sequence specificity, higher inducing or collapsing ability of the structure, and a greater degree of functionality including binding on - off switching, cellular penetration, and the ability to target organelles . De novo designed peptides (peptides not derived from domains of binding proteins) are promising next generation g - quadruplex binding candidates because of the following advantages they offer: (i) peptides are easier to design and synthesize than antibodies or recombinant proteins; (ii) they can mimic protein - g - quadruplex interactions; (iii) analyses based on peptide libraries can be used to elucidate binding properties of dnas; (iv) in addition to naturally occurring amino acids, various functional moieties (e.g., artificial amino acids) can be employed as building blocks in designed peptides; (v) because certain peptide sequences may exhibit transmembrane or hormonal properties, combining peptides with these functional sequences with g - quadruplex - binding peptides can produce multifunctional molecular systems useful in cell and tissue engineering . To increase the utility of the peptide library technology, we designed peptide microarrays composed of various secondary structures . Upon addition of various proteins to these peptide arrays, library peptides containing fluorescent probes showed different binding responses depending on the peptide sequence . (pfps), which can be used to establish the identity of a target protein and correlate the recognition properties of a target protein to a particular peptide [15, 16, 21]. In addition, by applying statistical analyses such as hierarchical clustering analysis (hca) and principal component analysis (pca) to pfps, researchers can draw high - confidence correlations between target proteins and biological function, based primarily upon peptide charge and hydrophobicity data [19, 21]. We successfully applied our system to screen for peptide ligands that tightly bind to a target protein and simultaneously control the function of a protein related to the target . This approach has several advantages, such as ease of peptide library design and robust selection of ligands with novel structures for the control of signaling pathways and/or cascades . Here, we demonstrate a model screening of binders to a particular g - quadruplex sequence using easily designed short peptides consisting of naturally occurring amino acids . We also examined the stability of the dna g - quadruplex structure upon addition of a g - quadruplex - binding peptide and checked whether the peptides could induce or collapse the g - quadruplex structure . This study illustrates how a peptide library can be designed and presents a screening guideline for the construction of next - generation ligands with increased specificity to particular g - quadruplexes and increased functionality, including on - off switching and the ability to penetrate cells and target organelles . All chemicals and solvents were of reagent or hplc grade and were used without further purification . Oligodeoxynucleotide samples purified by hplc were purchased from hokkaido system science (sapporo, japan). Hplc was performed on a gl-7400 hplc system (gl sciences, tokyo, japan) using an inertsil ods-3 (10 250 mm; gl science) column for preparative purification with a linear acetonitrile/0.1% trifluoroacetic acid (tfa) gradient at a flow rate of 3.0 ml / min . Peptides were analyzed using maldi - tof ms on an autoflex iii (bruker daltonics, billerica, ma, usa) mass spectrometer with 3,5-dimethoxy-4-hydroxycinnamic acid as the matrix . The designed peptide library was synthesized on fmoc - nh - sal - peg resin (watanabe chemical industries, hiroshima, japan) using an automatic synthesizer (advanced chemtech model 357 fbs) with fmoc chemistry using fmoc - aa - oh (4 eq ., watanabe chemical industries) according to the o-(7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (hatu, watanabe chemical) method . Side chain protections were as follows: t - butyl (tbu) for glu and tyr, trityl (trt) for his, and t - butyloxycarbonyl (boc) for lys . The peptides were cleaved from the resin and side chain protections were removed by incubating the peptides for 2 h in tfa (watanabe chemical industries)/h2o / triisopropylsilane (wako pure chemical industries, tokyo, japan) (20:1:1, v / v). The peptides were precipitated by addition of cold diethylether and then collected by centrifugation . The recovered peptides were dissolved in water to about 1 mm and stored at 4c . In order to determine the concentration of library peptide stock solutions, the absorbance at 280 nm (for trp (= 5500) and tyr (= 1490)) of a diluted solution of each peptide was measured on a u-1900 uv spectrometer (hitachi high - technologies, tokyo, japan). After a screening assay in 3.2, selected peptides were purified by rp - hplc and characterized by maldi - tof ms for further experiments in 3.33.5 . Purified peptides were dissolved in water to about 1 mm and their concentrations were measured by their absorbance at 280 nm, after which they were stored at 4c . Prior to analysis, each sample in 10 mm tris - hcl (ph 7.0) buffer containing 0.1 mm edta was heated to 85c for 5 min then gently cooled to room temperature at a rate of 1.0c min . Loading buffer (2 l) was mixed with 2 l of 5 m dna sample with / without 50 m library peptide in 10 mm tris - hcl (ph 7.0) buffer containing 0.1 mm edta . A 4 l aliquot of each sample was loaded onto the gel and electrophoresed at 10.0 v cm for 2 h at room temperature . Gels were stained with sybr gold nucleic acid gel stain (invitrogen, carlsbad, ca, usa) and imaged using a fla-7000 imager (fuji film, tokyo, japan). The bound dna percentage was calculated according to the following equation: {(intensity of dna band without peptide) (intensity of dna band with peptide)} / (intensity of dna band without peptide) 100 (%). Data were manipulated according to previously reported standard procedures to prepare the black - red - yellow color scale bar . Each grid position was first assigned a three whole - number code based on its rgb color - code response (0, 0, 0 = full black, lowest bound dna percentage; 255, 0, 0 = red, moderate percentage; 255, 255, 0 = yellow, highest percentage), which corresponds to all the bound dna percentages divided into 511 levels . The numbers of the grid were saved as a comma - separated - value (.csv) file including the three (or four) lines of the .ppm setting at the top of the file . The file was then saved in the portable - pixel - map format by simply adding a this file can be opened using graphic viewer software, resized, then saved in another file format, such as bitmap (.bmp). The euclidean distance [24, 25], a common measure of the distance between two vectors, was used to determine the similarity between two binding - color images obtained from different target dnas . After the similarities between the binding - color images were determined, hca was conducted . Ward's clustering algorithm was used and the dendrogram was obtained from the euclidean distances using the excel macro program . The horizontal axis represents the distance between vectors (left for high similarity and right for low similarity). Circular dichroism (cd) spectroscopy was performed using dna (1 m) and peptide no . 010 (0 or 100 m) in 20 mm tris - hcl (ph 7.0) containing 0.1 mm kcl and 0.1 mm edta . A j-820 spectropolarimeter (jasco, hachioji, japan) with a thermoregulator using a quartz cell with a 1 cm path length at 25c was used for cd measurements . Prior to analysis, each sample was heated to 85c for 5 min, then gently cooled to room temperature at a rate of 1.0c min . The uv absorbance was measured using a shimadzu 1800 spectrophotometer equipped with a temperature controller (shimadzu, kyoto, japan). Melting curves for the g - quadruplex structures were obtained by measuring the uv absorbance at 295 nm in 10 mm tris - hcl (ph 7.0) containing 0.1 mm kcl and 0.1 mm edta at a heating rate of 1.0c min . The melting temperature (tm) values for 5 m dnas with / without peptide no . 010 (100 m) were obtained from uv melting curves as described previously [27, 28]. We constructed a minilibrary consisting of 32 peptides of varying charge and/or hydrophobicity using the strategy shown in figure 1(a). We designed peptides in which four residues were added to the n - terminus of the kwk motif . Addition of a g or p at 4th residue allowed for varying the flexibility of the peptide main chain . Addition of an h, w, f, or y at residue x1 allowed for varying the aromatic character of the peptide, while addition of a k or e at residues z1 and z2 allowed for varying the peptide charge . Figures 1(b) and 1(c) show all the library peptide species . The column and row headings in figure 1(c) denote the aromatic residues (h, w, f, or y at x1) and numbers of amines (e, or k at z1 and z2; numbers of amines = 3, 4, or 5), respectively, and each cell displays the number of the synthesized peptide . Hence, the library consists of two series (a g series and a p series) of designed peptides, each of which contains 16 systematically designed peptides . Library peptides were assayed for their ability to bind to four different parallel g - quadruplex sequences from the promoter regions or the 5 untranslated regions of human protooncogenes (myc from c - myc, nras from nras, wnt from wnt 3, and fgf from fgf 3 [3032] (table 1)) using electrophoresis . The bound dna percentages varied according to the peptide sequence (figure 2), and the binding percentages ranged from high to low . To visualize the binding properties more clearly, these results were converted into black - red - yellow images as shown in figure 2(b). The color images correspond to two series of peptides (figure 1(c)), and the color of each cell indicates the binding response of each peptide against each dna . The rgb color codes represent the degree of binding: black (lowest percentage), to red (moderate percentage), to yellow (highest percentage), divided into 511 levels . Some peptides, such as nos . 008 and 032, bound to all dnas tested, while peptide no . The cells in the bottom portion of each series were colored in either yellow or red, indicating that dnas preferentially bind cationic peptides . In addition, while the myc g - quadruplex tended to bind to g - series peptides and the nras g - quadruplex tended to bind to p - series peptides, the fgf and wnt g - quadruplexes tended to bind to both peptide series . This result implies that imparting variation of flexibility to the peptides by adding a g and p to the middle of the sequence provides dna selectivity . Similarities between the peptides in their ability to bind dnas were analyzed quantitatively using hca with euclidean distances . As shown in figure 3(a), the library peptides could be sorted into five groups (groups a group a peptides exhibited a relatively high binding percentage for the fgf and wnt g - quadruplexes, but had less binding percentages for the myc and nras g - quadruplexes . Peptides classified into group b showed relatively low binding percentages for all dnas except the wnt g - quadruplex, to which they bound tightly . Peptides classified into group c had high binding percentages for the myc g - quadruplex, but lower binding percentages for the nras, fgf, and wnt g - quadruplexes . Peptides in group d demonstrated an intermediate binding percentage for all quadruplexes except myc, to which they did not bind . Finally, peptides classified into group e, which are characterized by 5 amines, bound to all the dnas tested with high binding percentages . Because peptides with 3 or 4 amines demonstrated diverse binding percentages, we concluded that a greater number of specific binders could be obtained by designing and synthesizing a wider array of peptides with 3 or 4 amines . Despite the small size of the library used in this study for example, our results show that peptides 009 and 010 are myc - specific binders, and peptides 003, 007, and 015 are wnt - specific binders . Similarities between g - quadruplex binding properties were analyzed quantitatively using the hca method . A clustering dendrogram (figure 3(b)) was generated by analysis of euclidean distances . The horizontal axis indicates the distance between the binding percentages of the g - quadruplexes for library peptides (left indicates high similarity and right indicates low similarity). The clustering dendrogram discriminated myc from the other g - quadruplexes, which tended to cluster . We suspect that some of the library peptides recognized a particular sequence (gggcggg) present in all the g - quadruplexes tested except for myc . Although much additional data regarding the binding of library peptides to various dna types are needed, these results imply that the statistical approaches used in this study could be used to characterize the binding properties of a variety of other g - quadruplexes . 010 as a myc - specific binder and after the peptide was purified, an electrophoresis assay was conducted to confirm no . 009 peptide did not strongly bind to myc (data not shown)). 010 strongly bound to myc, while the peptide weakly bound to nras and wnt or little bound to csmyc (complementary sequence of myc, 5-tccccaccctccccaccct-3) and telo (representative antiparallel g - quadruplex sequence from human telomeric dna, 5-agggttagggttagggttaggg-3). 010 bound only to the parallel g - quadruplex sequence, not to the antiparallel g - quadruplex sequence or to the other sequences, including the myc complementary sequence . Although additional assays and/or detailed confirmation experiments are needed, these results indicate that the electrophoresis in 3.2 is one of the promising tools for screening dna - binding peptides using peptide libraries . We performed cd experiments to investigate induction of structural and conformational changes in the myc g - quadruplex upon interaction with peptide no . 010 . The myc g - quadruplex yielded spectra that were characteristic of parallel quadruplexes, with a maximum at 260 nm and a minimum at 240 nm (figure 5(a)), a result that is consistent with a prior study . Interestingly, addition of peptide no . 010 led to an increase in the parallel g - quadruplex signature . Furthermore we performed cd experiments with the other g - quadruplex dnas upon addition of peptide no . 010 . The fgf g - quadruplex showed similar results to those of myc (figure 5(b)), whereas the nras and the wnt did not show significant changes upon addition of peptide no . 010 we investigated the effect of peptide binding on the thermodynamic stability of the dna g - quadruplexes . Table 2 shows the tm of the myc and fgf g - quadruplexes in the presence and absence of 100 m peptide no . 010 . Surprisingly, the myc g - quadruplex tm changed appreciably in the presence of the peptide, increasing by about 8c while the fgf g - quadruplex tm changed in the presence of the peptide, increasing by only about 4c . 010 binds to the myc g - quadruplex by a kind of specific association . Although we could not screen peptides with a high binding selectivity, despite the limited size of our library, we found that peptide no . 010 acts as a promising stabilizer of the g - quadruplex structure as well as a binder to myc . In this study, we demonstrated a novel designed peptide library method to screen for binders to a particular g - quadruplex and also demonstrated the mining of data generated from binding results using statistical methods such as hca . Our results suggest that the use of a designed peptide library enables the discrimination of g - quadruplex sequences and could therefore provide useful information for the design of peptides for targeting specific g - quadruplexes . Despite the small size of the library used in this study, some candidates of specific binders were identified . By improving the design of the library peptides and the screening methods, our system could be used to screen for peptides that bind to a particular g - quadruplex and alter its thermodynamic properties . It would then be possible to find binders with strong specificity to which specific functional attributes can be added, such as the ability to penetrate cells in order to control dna and/or rna events for the purposes of cell and tissue engineering.
Diabetic nephropathy (dn) is one of the most common microvascular complications of diabetes mellitus and leading causes of end - stage renal disease worldwide and accounts for a significant increase in morbidity and mortality in diabetic patients . Although dn is alleviated through conventional treatments, such as strict glycemic control, limited protein intake, blood pressure control, and renin - angiotensin - aldosterone system inhibition, these treatments cannot completely prevent the progression of dn in diabetic patients . Overt and subclinical hypothyroidism are associated with a low estimated glomerular filtration rate (egfr) and an increased risk of chronic kidney disease (ckd) [25]. These abnormalities are reversible, and improvement occurs after thyroid hormone replacement therapy is administered [2, 4]. Moreover, recent studies on euthyroid general population show that high normal levels of thyroid - stimulating hormone (tsh) and low normal levels of free triiodothyronine (ft3) are also associated with renal dysfunction, such as ckd and microalbuminuria [69]. Type 2 diabetic patients with subclinical hypothyroidism (sch) have been found to be associated with the high prevalence of dn in several studies [10, 11]. In 159 type 2 diabetic patients with euthyroidism and untreated sch, the serum tsh level has been reported to be an independent risk factor of albuminuria . In a recent study on patients with type 1 diabetes, rodacki et al . Found that the prevalence of renal failure is higher not only in patients with sch but also in those with high normal tsh levels, when compared with those with low normal tsh levels . This result suggests that the association between thyroid function and dn may extend into the euthyroid states . However, whether changes in normal thyroid function are related to dn in type 2 diabetic patients remains unknown . In the present research, a cross - sectional study was conducted to investigate the association of thyroid function with dn in euthyroid patients with type 2 diabetes . A total of 632 patients with type 2 diabetes treated at the shanghai jiao tong university affiliated shanghai first people's hospital from 2009 to 2012 were enrolled in this study . The inclusion criteria were patients with normal thyroid function [0.254.2 miu / l for tsh, 3.16.8 pmol / l for ft3, and 12.022.0 pmol / l for free thyroxine (ft4)] and negative for thyroid autoantibodies, such as thyroid peroxidase antibody (tpoab) and thyrotropin receptor antibody (trab). The following exclusion criteria were considered: current malignancy, pregnancy, acute intercurrent illness, nondiabetic renal problems, chronic liver disease, urinary tract infection, history of thyroid disease, or any thyroid medication (levothyroxine or antithyroid drugs). A total of 421 patients (213 men and 208 women, mean age of 61.06 10.35 years) were included in the final analysis . The study protocol was approved by the ethics committee of the shanghai first people's hospital . Patient data, including demographic characteristics, lifestyle habits (smoking and drinking), medical history, and medication use, were obtained via a standard questionnaire . Smoking habit was defined as the consumption of more than five cigarettes daily for at least one year . Height and body weight were measured using a digital scale, and body mass index (bmi) was calculated by dividing body weight (in kilograms) by height (in square meters). Blood pressure (bp) was measured twice using a mercury sphygmomanometer, with participants in a seated position after 5 min of rest . Two bp readings were obtained 1 min apart, and the mean was calculated . Hypertension was defined as systolic blood pressure (sbp) of 140 mmhg and/or diastolic blood pressure (dbp) of 90 mmhg, or treatment with antihypertensive drugs . Biochemical parameters, including the levels of fasting plasma glucose (fpg), serum creatinine (scr), serum total cholesterol (tc), serum triglyceride (tg), serum high - density lipoprotein cholesterol (hdl - c), and serum low - density lipoprotein cholesterol (ldl - c), were measured via routine laboratory methods by using a hitachi 7600 instrument (hitachi, tokyo, japan). Hba1c was detected through high - performance liquid chromatography (hemoglobin analyzer d-10, bio - rad laboratories, berkeley, usa). Egfr was calculated using the equation of the modification of diet in renal disease: egfr (ml / min/1.73 m) = 186 (scr/88.4) (age) (0.742 if female). Urinary albumin - to - creatinine ratio (uacr) was evaluated by obtaining the average of three uacr measurements . Before examination was conducted, the patients were instructed to avoid exercise for 1 h. urinary albumin concentration was measured using immunoturbidimetry (roche, basel, switzerland), and urinary creatinine concentration was determined by a modified jaffe method on an automatic analyzer (hitachi 7600, tokyo, japan). Uacr was calculated as urinary albumin concentration divided by creatinine concentration and expressed in mg / g . Dn was defined by an increased uacr of 30 mg / g in the absence of urinary tract infection or other renal abnormalities . All of the patients were assessed by an experienced ophthalmologist using a direct ophthalmoscope and a digital retinal camera (canon cr - dgi, tokyo, japan). Diabetic retinopathy (dr) was diagnosed according to the diagnostic code of the american academy of ophthalmology . The minimum criterion for the dr diagnosis was the presence of at least one microaneurysm in any photographed field . Serums ft3, ft4, tsh, tpoab, and trab levels were measured using an electrochemiluminescence analyzer (cobas e601, roche, basel, switzerland) with a mating reagent (the reference ranges of tsh, ft3, ft4, tpoab, and trab were 0.254.2 miu / l, 3.16.8, 12.022.0 pmol / l, <34 iu / ml, and <10 u / l, respectively). Continuous variables were expressed as mean standard deviation or median (interquartile range), and categorical variables were expressed as percentages . Continuous data were compared via student's t - test or mann - whitney u test, and categorical data were compared via chi - square test . Non - normally distributed variables, such as hba1c, tg, tsh, and uacr, were natural log - transformed or arctan - transformed into approximately normal distributed data before correlation and regression analysis were conducted . The correlation between serum thyroid hormone levels and related clinical variables was determined through partial correlation analysis . The independent determinants of uacr were identified through multiple linear regression analysis . A two - tailed p value of <0.05 was considered statistically significant . Data were analyzed using spss version 16.0 for windows (spss inc ., chicago, il, usa). Among the 421 patients, 203 (48.2%) were diagnosed with dn, and no difference was found between males and females (46.0% versus 50.5%, p> 0.05). The comparison results of the clinical characteristics between patients with and without dn are shown in table 1 . The patients with dn also experienced longer diabetic duration and exhibited higher bmi, sbp, and dbp, higher fpg, scr, tg, and tc levels, and lower serum hdl - c and egfr levels than those without dn . The patients with dn also showed a higher prevalence of hypertension and dr than those without dn . The former also used insulin, acei / arbs, and statin / fibrates to a higher extent than the latter . Furthermore, the patients with dn yielded significantly lower ft3 levels than those without dn . The former also showed higher tsh levels and lower ft4 levels than the latter; however, the obtained values were not statistically significant . To investigate the association of thyroid function with dn, we divided the patients into three groups according to the tertiles of ft3 (<3.68, 3.684.09, and> 4.09 pmol / l), ft4 (<16.03, 16.0317.72, and> 17.72 pmol / l), or tsh (<1.62, 1.622.40, and> 2.40 the prevalence of dn showed a significantly decreasing trend across the three tertiles based on ft3 levels (59.6%, 46.4%, and 38.6%, p <0.01 for the trend). The first ft3 quartile group showed a significantly higher prevalence of dn than the second and third groups (p = 0.03 and p <0.01, resp . ; figure 1(a)). The prevalence of dn was not significantly different among the groups based on the tertiles of ft4 or tsh levels (figure 1(a)). These results suggested that patients with low ft3 levels more likely develop dn than those with high ft3 levels . In our study, the prevalence of dr was not significantly different among ft3, ft4, and tsh tertiles (figure 1(b)). The relationship between thyroid function and related clinical variables in all of the diabetic patients was examined through partial correlation analysis . After adjustment for gender and age, ft3 levels were correlated positively with tg and egfr (p = 0.01 and p = 0.03, resp . ); by contrast, ft3 levels were correlated negatively with fpg, hba1c, and uacr (p = 0.04, p <0.01, and p <0.01, resp . ). Tsh levels were correlated positively with bmi and tg (p <0.01 for both); conversely, tsh levels were correlated negatively with diabetic duration and hdl - c (p <0.01 for both) (table 2). The independent variables associated with uacr were assessed through multiple linear regression analysis; these variables included all the potential confounding factors in this study, such as gender, age, diabetic duration, smoking habit, bmi, hypertension, sbp, dbp, fpg, hba1c, tg, tc, hdl - c, ldl - c, egfr, tsh, ft3, ft4, presence or absence of dr, insulin use, acei / arb intake, and statin / fibrate intake . We found that ft3 levels were independently associated with uacr (= 0.18, t = 3.70, and p <0.01). Other risk factors included diabetic duration, hypertension, dbp, presence or absence of dr, and fpg and egfr levels (table 3). Our results showed that the patients with dn yielded lower ft3 levels than those without dn . Moreover, the prevalence of dn decreased gradually as the quartiles of ft3 levels increased . Our results also indicated that ft3 levels were significantly correlated with uacr and egfr levels . The results of our multiple linear regression analysis further revealed that ft3 levels were inversely associated with uacr after adjustment for a wide spectrum of lifestyle and biochemical risk factors . Therefore, ft3 levels possibly show a significant association with dn in euthyroid patients with type 2 diabetes . Thyroid hormone plays an important role in the growth, development, and physiology of the kidneys . Thyroid dysfunction causes remarkable changes in renal blood flow, glomerular filtration rate, tubular secretory and absorptive capacity, electrolyte pumps, and kidney structure . The results of previous studies suggest that overt and subclinical hypothyroidism are both associated with reduced egfr and high prevalence of ckd and that these abnormalities can be normalized through thyroid hormone replacement therapy [25]. Moreover, thyroid hormone levels within the normal range are also found to be associated with the risk of ckd in the general population [68]. The relationship between the thyroid function and dn has also been reported by several previous studies . A study on 147 prediabetic subjects two cross - sectional studies on type 2 diabetic patients have shown that sch is independently associated with a high risk of dn [10, 11]. A small - scale study on type 2 diabetic patients with euthyroidism and untreated sch has found an independent association between levels of serums tsh and uacr; however, whether or not this association still holds in euthyroid patients with type 2 diabetes is not mentioned in the study . In a cross - sectional and multicentric study on patients with type 1 diabetes, rodacki et al . Found that patients with low normal tsh levels (0.42.5 miu / l) are associated with a lower risk of renal failure than patients with sch (tsh 4.5 miu / l) and high normal tsh levels (2.54.4 miu / l). This result suggests that alterations of the thyroid function in the normal range are also associated with dn . However, as far as we know, no studies have reported the association between thyroid hormone levels and dn in euthyroid patients with type 2 diabetes . The present study found that ft3 levels are inversely and independently associated with dn in euthyroid patients with type 2 diabetes . In agreement with our findings, those of zhang et al . Demonstrate that low ft3 levels, even in the normal range, are moderately associated with an increased risk of incident ckd in a large cohort study on euthyroid individuals . Zhou et al . Also found that low serum ft3 levels in the normal range are associated with the high prevalence of microalbuminuria in middle - aged and elderly chinese individuals . The above two studies both suggest that low normal ft3 levels are independently associated with kidney diseases . Nevertheless, the relationship between normal ft3 levels and dn has not been previously reported . In a previous study on type 2 diabetic patients with euthyroidism, ft3 levels are found to be correlated positively with egfr; however, this study did not provide information on uacr levels of patients, and the association between ft3 levels and egfr lost significance after adjustment for other metabolic factors . A small - scale study has shown that total triiodothyronine (tt3) level is significantly correlated with urine microalbumin levels . Unfortunately, whether or not thyroid hormones are within the normal range remains unclear in this study; ft3 levels also have not been detected . To the best of our knowledge, our study is the first to demonstrate that low ft3 levels are associated with dn in euthyroid patients with type 2 diabetes . The mechanism of the association between ft3 and dn can be explained by the following . Patients with sch experience endothelial dysfunction characterized by a reduction in nitric oxide (no) availability; this alteration is partially independent of dyslipidemia and can be reversed through levothyroxine supplementation . . Found that serum tsh levels in the upper reference range are also associated with impaired endothelial function measured through flow - mediated dilation . In patients with advanced nondiabetic kidney disease, low t3 level is confirmed as a marker of endothelial dysfunction . In experimental models, t3 influences endothelial function by inducing the relaxation of vascular smooth muscle cells through direct or indirect effects [2325]. . Also found that t3 can alleviate diabetic endothelial dysfunction in the arteries of diabetic rats . Endothelial dysfunction is associated with albuminuria in diabetes; therefore, endothelial dysfunction is a possible link between low ft3 level and albuminuria . Second, lin and sun found that t3 can attenuate albuminuria and improve renal structural damage in db / db diabetic mice by increasing phosphatidylinositol 3 kinase activity and by decreasing transforming growth factor-1 expression . Third, 3,5-diiodothyronine, a natural t3 metabolite via the deiodination pathway, can protect cells from renal damage in dn by inhibiting the activation of nf-b and jnk through enhancing of sirtuin 1 (sirt1) expression . Interestingly, our study fails to show a significant association between tsh levels and albuminuria in diabetic patients, which is different from the results of previous studies . The possible explanations are as follows: firstly, patients with positive tpoab are not excluded from most previous studies . In general, patients with positive tpoab have higher tsh levels than those without, even in the euthyroid state . Moreover, tpoab is also found to be associated with renal disease . Reported that endothelial dysfunction exists in hashimoto's thyroiditis patients with euthyroidism and that tpoab levels may be responsible for the endothelial dysfunction and subsequent microalbuminuria . . Also found a high prevalence of antithyroid antibodies in patients with antiglomerular basement membrane antibody - mediated disease, which suggests a possible pathogenic link between tpoab and renal disease . Therefore, these two findings both indicate that the presence of tpoab should be adjusted in the analysis of the association between high tsh and albuminuria . In the present study, we exclude patients with positive tpoab to avoid this bias . Secondly, metformin, a common antidiabetic drug, can induce a reduction in tsh levels in patients with type 2 diabetes [33, 34]. This finding suggests that tsh may be not a relevant parameter in assessing the thyroid function in diabetes . Similar to other studies [35, 36], the present study found that thyroid function is not associated with dr; thus, the protective function of ft3 in diabetic patients may be organ specific . In our study, ft3 levels were correlated positively with tg; by contrast, ft3 levels were correlated negatively with fpg and hba1c in euthyroid patients with type 2 diabetes . The ft3 level (at the upper limit of the normal range) of overweight and obese patients increases compared with that of subjects with normal weight [37, 38]; this finding provided a possible explanation for the positive relationship between ft3 and tg levels . In in vitro studies, t3 protects cells from apoptosis and induces -cell growth and proliferation in human and rodent insulinoma cell lines . A clinical study has also demonstrated that ft3 may stimulate insulin secretion in euthyroid individuals with normal glucose tolerance . These observations may account for the negative correlation of ft3 levels with fpg and hba1c in our study . As a limitation, this cross - sectional study investigated patients with type 2 diabetes treated with various medications . Further prospective and longitudinal studies should be conducted to confirm a causal relationship between ft3 levels and dn in diabetic patients, who are stratified with and without medications . In summary, our study suggests that serum ft3 levels are inversely associated with dn in euthyroid patients with type 2 diabetes, which is independent of other risk factors . Furthermore, our study can be used as a basis to establish effective prevention strategies.
Auditory verbal hallucinations (avhs) are among the core symptoms used in the diagnosis of schizophrenia, occurring in 6080% of schizophrenia patients . Characterizing the brain structural and functional features of specific symptoms can enhance our understanding of the etiology of schizophrenia and provide objective indictors for precision medicine . Some neuroimaging data regarding the avhs of schizophrenia have been obtained from structural magnetic resonance imaging (mri) and functional mri (fmri) studies . Structural imaging studies have found that schizophrenia patients with avhs usually exhibit gray matter volume reductions in the superior temporal gyrus . Complementary diffusion tensor imaging studies have found that the avhs of schizophrenia are associated with disruptions of white matter integrity in the left arcuate fasciculus bundle and interhemispheric auditory fiber bundles . Fmri studies have found that the avhs of schizophrenia are associated with abnormal activation within the default mode network (dmn) and auditory- and visual - associated resting - state (rs) networks . All the aforementioned findings advanced our understanding of the pathological traits of schizophrenic avhs to some extent . However, considering the high heterogeneity and complexity of avhs, for a comprehensive understanding of avhs, we must use multiple techniques to characterize the pathological features of avhs from different angles . Regional homogeneity (reho) measures the similarity of the time series of blood - oxygen - level - dependent (bold) signals of a given voxel to those of its nearest neighbors in a voxel - wise way, which reflects the local synchronization in the functional cluster . A specific region in the brain that is abnormal can be identified by reho; aberrant reho represents aberrant regional brain spontaneous activity in a specific region . In recent years, reho has been used to investigate functional modulations in the rs of patients with schizophrenia and other mental disorders . In the current study, we were interested in whether schizophrenic patients with avhs would demonstrate specific reho alterations and, if so, whether the brain regions (rs networks) with abnormal reho were specific to avhs . A total of 126 right - handed individuals were enrolled in the present study, including 76 schizophrenia patients and fifty healthy controls . The diagnosis of schizophrenia was determined by the consensus of two professional psychiatrists using the structured clinical interview for diagnostic and statistical manual of mental disorders, 4 edition (scid). All healthy controls were screened using the nonpatient edition of the scid to confirm a lifetime absence of psychiatric illnesses . Exclusion criteria for all subjects were a history of head trauma with consciousness disturbances lasting more than 5 min, a history of drug or alcohol abuse, pregnancy, and any physical illnesses, such as cardiovascular disease or neurological disorders, as diagnosed by an interview and medical records review . In addition, all healthy controls were interviewed to exclude individuals with a known history of psychiatric illness in first - degree relatives . Avh group (n = 35) included patients who experienced avhs at least once daily, and the non - auditory verbal hallucinations (navh) group (n = 41) included patients who had never experienced avhs or had not experienced avhs within 12 months before mri . Clinical symptoms of psychosis were quantified using the positive and negative syndrome scale (panss). The auditory hallucination rating scale was used to assess avh with seven characteristics such as frequency, reality, loudness, number of voices, length, attention dedicated to the hallucinations, and hallucination - induced arousal . The daily antipsychotic dosages (chlorpromazine equivalents) for two schizophrenia patient groups are listed in table 1 . The medical research ethics committee of tianjin medical university general hospital approved this study . After receiving a complete description of the study, demographic and clinical characteristics of the sample * one - way anova was used to test the difference in age across the three groups; chi - square test was used to test the difference in gender across the three groups; two - sample t - test was used to compare the differences in antipsychotic dosage, duration of illness and panss scores between two patient groups . Na: not applicable; panss: positive and negative syndrome scale; ahrs: auditory hallucination rating scale; avh: schizophrenia patients with auditory verbal hallucinations; navh: schizophrenia patients without auditory verbal hallucinations; sd: standard deviation . Mri data were acquired using a 3.0-tesla mr system (discovery mr750, general electric, milwaukee, wi, usa). Tight but comfortable foam padding was used to minimize head motion, and earplugs were used to reduce scanner noise . Sagittal three - dimensional t1-weighted images were acquired using a brain volume sequence with the following parameters: repetition time (tr) = 8.2 ms; echo time (te) = 3.2 ms; inversion time = 450 ms; flip angle (fa) = 12; field of view (fov) = 256 mm 256 mm; matrix = 256 256; slice thickness = 1 mm, no gap; 188 sagittal slices; and acquisition time = 250 s. rs functional bold images were acquired using a gradient - echo single - shot echo planar imaging sequence with the following parameters: tr / te = 2000/45 ms, fov = 220 mm 220 mm, matrix = 64 64, fa = 90, slice thickness = 4 mm, gap = 0.5 mm, 32 interleaved transverse slices, 180 volumes, and acquisition time = 370 s. all subjects were instructed to keep their eyes closed, relax, move as little as possible, think of nothing in particular, and not fall asleep during the scans . All mri were visually inspected to ensure that only images without visible artifacts were included in subsequent analyses . The first 10 volumes for each participant were discarded to allow the signal to reach equilibrium and the participants to adapt to the scanning noise . All participants bold data were within the defined motion thresholds (i.e., translational or rotational motion parameters <2 mm or 2). We also calculated frame - wise displacement (fd), which indexes the volume - to - volume changes in the head position . Several nuisance covariates (six motion parameters, their 1 time derivatives, the global brain signal, the white matter signal, and the cerebrospinal fluid signal) were regressed out from the data . The signal spike caused by head motion significantly contaminates the final rs fmri results even after regressing out the linear motion parameters . Therefore, we further regressed out spike volumes when the fd of the specific volume exceeded 0.5 . The datasets were then band - pass filtered in a frequency range of 0.010.08 hz . In the normalization step, individual structural images were linearly coregistered with the mean functional image; then, the transformed structural images were segmented into gray matter, white matter, and cerebrospinal fluid . The gray matter maps were linearly coregistered to the tissue probability maps in the montreal neurological institute (mni) space . Finally, each filtered functional volume was spatially normalized to the mni space using the parameters estimated during the linear coregistration and resampled into a 3-mm cubic voxel . Reho was defined as the kendall correlation coefficient (kcc) of the time series of a given voxel with those of its nearest neighbors (26 voxels) on a voxel - wise basis . The kcc can be computed by the following formula: where w is the kcc among given voxels, ranging from 0 to 1; ri is the sum rank of the i time point; is the mean of ri; k is the number of time series within a measured cluster (k = 27, one given voxel plus its 26 neighbors), and n is the number of ranks (n = 240). Then, each reho map was spatially smoothed with a gaussian kernel of 6 mm 6 mm 6 mm full width at half maximum . Finally, we normalized the reho of each voxel by dividing it by the mean reho value of the whole brain . Group differences in reho among the three groups were tested using a voxel - wise one - way analysis of covariance (ancova) with age and gender as covariates followed by post hoc intergroup comparisons . The post hoc intergroup comparisons were conducted within a mask showing reho differences from the ancova analysis . In general, gender could not be considered as a covariance in the ancova analysis; however, in our current study, our ancova analysis was performed using the general linear model (glm) implemented in spm8 . For glm, categorical variable including gender should also be taken as independent variable . Hence, in this study, we used the gender as a covariance in our current ancova analysis . Multiple comparisons were corrected using a false discovery rate (fdr) method with a significance threshold of p <0.05 . A total of 126 right - handed individuals were enrolled in the present study, including 76 schizophrenia patients and fifty healthy controls . The diagnosis of schizophrenia was determined by the consensus of two professional psychiatrists using the structured clinical interview for diagnostic and statistical manual of mental disorders, 4 edition (scid). All healthy controls were screened using the nonpatient edition of the scid to confirm a lifetime absence of psychiatric illnesses . Exclusion criteria for all subjects were a history of head trauma with consciousness disturbances lasting more than 5 min, a history of drug or alcohol abuse, pregnancy, and any physical illnesses, such as cardiovascular disease or neurological disorders, as diagnosed by an interview and medical records review . In addition, all healthy controls were interviewed to exclude individuals with a known history of psychiatric illness in first - degree relatives . Avh group (n = 35) included patients who experienced avhs at least once daily, and the non - auditory verbal hallucinations (navh) group (n = 41) included patients who had never experienced avhs or had not experienced avhs within 12 months before mri . Clinical symptoms of psychosis were quantified using the positive and negative syndrome scale (panss). The auditory hallucination rating scale was used to assess avh with seven characteristics such as frequency, reality, loudness, number of voices, length, attention dedicated to the hallucinations, and hallucination - induced arousal . The daily antipsychotic dosages (chlorpromazine equivalents) for two schizophrenia patient groups are listed in table 1 . The medical research ethics committee of tianjin medical university general hospital approved this study . After receiving a complete description of the study, demographic and clinical characteristics of the sample * one - way anova was used to test the difference in age across the three groups; chi - square test was used to test the difference in gender across the three groups; two - sample t - test was used to compare the differences in antipsychotic dosage, duration of illness and panss scores between two patient groups . Na: not applicable; panss: positive and negative syndrome scale; ahrs: auditory hallucination rating scale; avh: schizophrenia patients with auditory verbal hallucinations; navh: schizophrenia patients without auditory verbal hallucinations; sd: standard deviation . Mri data were acquired using a 3.0-tesla mr system (discovery mr750, general electric, milwaukee, wi, usa). Tight but comfortable foam padding was used to minimize head motion, and earplugs were used to reduce scanner noise . Sagittal three - dimensional t1-weighted images were acquired using a brain volume sequence with the following parameters: repetition time (tr) = 8.2 ms; echo time (te) = 3.2 ms; inversion time = 450 ms; flip angle (fa) = 12; field of view (fov) = 256 mm 256 mm; matrix = 256 256; slice thickness = 1 mm, no gap; 188 sagittal slices; and acquisition time = 250 s. rs functional bold images were acquired using a gradient - echo single - shot echo planar imaging sequence with the following parameters: tr / te = 2000/45 ms, fov = 220 mm 220 mm, matrix = 64 64, fa = 90, slice thickness = 4 mm, gap = 0.5 mm, 32 interleaved transverse slices, 180 volumes, and acquisition time = 370 s. all subjects were instructed to keep their eyes closed, relax, move as little as possible, think of nothing in particular, and not fall asleep during the scans . All mri were visually inspected to ensure that only images without visible artifacts were included in subsequent analyses . The first 10 volumes for each participant were discarded to allow the signal to reach equilibrium and the participants to adapt to the scanning noise . All participants bold data were within the defined motion thresholds (i.e., translational or rotational motion parameters <2 mm or 2). We also calculated frame - wise displacement (fd), which indexes the volume - to - volume changes in the head position . Several nuisance covariates (six motion parameters, their 1 time derivatives, the global brain signal, the white matter signal, and the cerebrospinal fluid signal) were regressed out from the data . The signal spike caused by head motion significantly contaminates the final rs fmri results even after regressing out the linear motion parameters . Therefore, we further regressed out spike volumes when the fd of the specific volume exceeded 0.5 . The datasets were then band - pass filtered in a frequency range of 0.010.08 hz . In the normalization step, individual structural images were linearly coregistered with the mean functional image; then, the transformed structural images were segmented into gray matter, white matter, and cerebrospinal fluid . The gray matter maps were linearly coregistered to the tissue probability maps in the montreal neurological institute (mni) space . Finally, each filtered functional volume was spatially normalized to the mni space using the parameters estimated during the linear coregistration and resampled into a 3-mm cubic voxel . Reho was defined as the kendall correlation coefficient (kcc) of the time series of a given voxel with those of its nearest neighbors (26 voxels) on a voxel - wise basis . The kcc can be computed by the following formula: where w is the kcc among given voxels, ranging from 0 to 1; ri is the sum rank of the i time point; is the mean of ri; k is the number of time series within a measured cluster (k = 27, one given voxel plus its 26 neighbors), and n is the number of ranks (n = 240). Then, each reho map was spatially smoothed with a gaussian kernel of 6 mm 6 mm 6 mm full width at half maximum . Finally, we normalized the reho of each voxel by dividing it by the mean reho value of the whole brain . Group differences in reho among the three groups were tested using a voxel - wise one - way analysis of covariance (ancova) with age and gender as covariates followed by post hoc intergroup comparisons . The post hoc intergroup comparisons were conducted within a mask showing reho differences from the ancova analysis . In general, gender could not be considered as a covariance in the ancova analysis; however, in our current study, our ancova analysis was performed using the general linear model (glm) implemented in spm8 . For glm, categorical variable including gender should also be taken as independent variable . Hence, in this study, we used the gender as a covariance in our current ancova analysis . Multiple comparisons were corrected using a false discovery rate (fdr) method with a significance threshold of p <0.05 . The three groups were well - matched in gender (chi - square test, = 0.308, p = 0.857) and age (one - way anova, f = 0.100, p = 0.905). There were no significant differences in antipsychotic dosage (two - sample t - test, t = 1.163, p = 0.248), duration of illness (two sample t - test, t = 0.916, p = 0.363), panss negative score (two sample t - test, t = 0.594, p = 0.555), panss general score (two sample t - test, t = 0.275, p = 0.784), or panss total score (two sample t - test, t = 0.893, p = 0.375) between the avh and the navh patients . A voxel - wise ancova revealed that the intergroup differences in reho were mainly located in the bilateral postcentral gyrus and thalamus, the left precuneus and putamen, and the right caudate, inferior temporal gyrus and inferior occipital gyrus (fdr corrected, p <0.05) [figure 1]. Specifically, the avh group exhibited significantly increased reho in the left precuneus relative to the navh group . Compared with the healthy controls, the avh patients showed significantly increased reho in the left precuneus and putamen and the right caudate and inferior temporal gyrus and decreased reho in the bilateral postcentral gyrus and thalamus and the right inferior occipital gyrus (fdr corrected, p <0.05) [figure 1]. In addition, the navh group had significantly increased reho in the right caudate and inferior temporal gyrus and decreased reho in the bilateral postcentral gyrus and thalamus and the right inferior occipital gyrus compared with the healthy controls (fdr corrected, p <0.05) [figure 1]. One - way analysis of covariance and post hoc two - sample t - tests were used for intergroup comparisons (p <0.05, false discovery rate corrected). Avh: schizophrenia patients with auditory verbal hallucinations; navh: schizophrenia patients without auditory verbal hallucinations; reho: regional homogeneity . Unfortunately, in brain regions demonstrating avh - specific reho alterations, we did not find any statistical correlation between reho and arhs score in the schizophrenia patients with avhs . The three groups were well - matched in gender (chi - square test, = 0.308, p = 0.857) and age (one - way anova, f = 0.100, p = 0.905). There were no significant differences in antipsychotic dosage (two - sample t - test, t = 1.163, p = 0.248), duration of illness (two sample t - test, t = 0.916, p = 0.363), panss negative score (two sample t - test, t = 0.594, p = 0.555), panss general score (two sample t - test, t = 0.275, p = 0.784), or panss total score (two sample t - test, t = 0.893, p = 0.375) between the avh and the navh patients . A voxel - wise ancova revealed that the intergroup differences in reho were mainly located in the bilateral postcentral gyrus and thalamus, the left precuneus and putamen, and the right caudate, inferior temporal gyrus and inferior occipital gyrus (fdr corrected, p <0.05) [figure 1]. Specifically, the avh group exhibited significantly increased reho in the left precuneus relative to the navh group . Compared with the healthy controls, the avh patients showed significantly increased reho in the left precuneus and putamen and the right caudate and inferior temporal gyrus and decreased reho in the bilateral postcentral gyrus and thalamus and the right inferior occipital gyrus (fdr corrected, p <0.05) [figure 1]. In addition, the navh group had significantly increased reho in the right caudate and inferior temporal gyrus and decreased reho in the bilateral postcentral gyrus and thalamus and the right inferior occipital gyrus compared with the healthy controls (fdr corrected, p <0.05) [figure 1]. Brain regions with altered reho across the avh, navh, and control groups . One - way analysis of covariance and post hoc two - sample t - tests were used for intergroup comparisons (p <0.05, false discovery rate corrected). Avh: schizophrenia patients with auditory verbal hallucinations; navh: schizophrenia patients without auditory verbal hallucinations; reho: regional homogeneity . Unfortunately, in brain regions demonstrating avh - specific reho alterations, we did not find any statistical correlation between reho and arhs score in the schizophrenia patients with avhs . To the best of our knowledge, the current study is the first study to investigate the alteration of local brain spontaneous neural activity specific to avhs in patients with schizophrenia by rs - fmri using reho as an index . We found that reho in the right caudate and inferior temporal gyrus was higher in both schizophrenic patient groups than in the healthy controls whereas reho in the bilateral postcentral gyrus and thalamus and the right inferior occipital gyrus was lower in both schizophrenic patient groups (fdr corrected, p <0.05). However, the key and novel finding of our current study is that the avh group demonstrated significantly increased reho in the left precuneus compared with the navh group . We found aberrant reho distributed in several brain regions in both schizophrenic patient groups, providing further evidence that local synchronization disturbances in the somatosensory cortex, visual processing related cortices, and some components of the limbic system may be the pathological features of schizophrenia . These synchronization disturbances were irrespective of the presence of avh and were mostly consistent with our previous meta - analysis and large - sample study findings . Our finding that schizophrenia patients with avh demonstrated higher reho in the left precuneus than the navh patients and the healthy controls, suggests that increased reho in the left precuneus may be a pathological feature exclusive to avh in schizophrenia . The precuneus is the key component of the dmn, and there is growing evidence that the dmn plays a pivotal role in cognitive, memory retrieval, and self - referential processing and also participates in the processing of monitor inner speech . All of the aforementioned processes modulated by dmn are involved in the generation and monitoring of speech and have been associated with the experience of avh . More importantly, converging evidence suggests that functional alterations in the dmn play a key role in the generation of avh . Recently, a new hypothesis that intrinsic dmn instability can account for the emergence of hallucination was proposed by jardri et al . According to this hypothesis, the dmn's spatial and temporal instability is related to the severity of the hallucination; however, spatial instability exists only in the course of hallucination activity and is negatively correlated with the severity of the hallucination . Conversely, temporal instability exists in both the symptom - active and symptom - free course . More importantly, hyperpower spectral density (an index of the default mode component's time course) in dmn is positively correlated with the severity of the hallucination . The functional disability of dmn subsequent to the intrinsic instability influences the transition between resting and active conscious sensory states, hence the emergence of hallucination . Our finding of increased reho in the left precuneus, one component of dmn, supports the hypothesis that intrinsic instability of the dmn participates in the generation of avhs . We did not find a correlation between the reho value of the left precuneus and the severity of auditory hallucinations in the avh patients . This finding likely indicates that aberrant reho is a pathological feature of avh schizophrenia, irrespective of its severity . This finding is partly consistent with the previous finding that the intrinsically temporal instability of dmn exists in both hallucination - active and -alleviated states . First, the majority of the participating patients received antipsychotic drug treatment, and its effect on the reho in schizophrenia remain unclear . However, there was no significant difference in antipsychotic dosage between the schizophrenia patients with and without avh, which can control for this confounder to some extent . Future studies focusing on first - episode drug - naive schizophrenia patients are needed to thoroughly control for this confounder . Second, we did not assess the status of hallucination symptoms during the mri, which means that some patients likely experienced avh, whereas others may not have, during the mri course . Instead, we assessed avh and other psychosis symptoms in all of the patients before the mri procedure to improve our ability to precisely characterize the exclusive features of avhs third, we enrolled patients who had not experienced avh within 12 months before mri scanning in the present study . These patients experienced auditory hallucinations only earlier in their psychotic illness or were in complete remission after treatment, which means that the findings of the present study probably do not comprehensively characterize the features of active hallucination when scanning . Fourth, we did not find a correlation between the reho value and the severity of avh, likely due to the complexity of the relationship between local spontaneous neural activity and avh severity beyond a simple linear correlation . Thus, more complex models, such as a quadratic regression model, can help us to clarify the relationship between them in a future study . First, we did not collect the panss score of healthy subjects; hence, unfortunately, we could not take the positive score as a covariate in the process of ancova analysis . Second, similar to many previous studies, healthy controls did not accept antipsychotic administration; hence, we also did not take the psychotics dosage as a covariate in the ancova analysis . In the future study, we will consider these factors in the process of statistics and provide more accurate information for enhancing the understanding of brain function alteration of schizophrenia . Collectively, in this study, we found that schizophrenia patients with and without avhs share common local spontaneous neural activity alterations in distributed brain regions that participate in somatosensory and visual processing and some regions of the limbic system . More importantly, we found that only schizophrenia patients with avh demonstrate increased reho in the pivotal component of the dmn (left precuneus). This finding provides new data for the development of hypotheses regarding schizophrenic avhs and suggests that the intrinsic instability in the dmn is associated with the generation of avhs . This work was supported by grants from the natural science foundation of china (no . 14zczdsy00018), the national key clinical specialty project and the china postdoctoral science foundation funded project (no . This work was supported by grants from the natural science foundation of china (no . 81425013, no . 91332113 and no . 81271551), the tianjin key technology r&d program (no . 14zczdsy00018), the national key clinical specialty project and the china postdoctoral science foundation funded project (no.
As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.
The goal of brachytherapy is to deliver a high dose of radiation to the target while minimising the dose to the surrounding normal tissues.1 prostate brachytherapy has been proposed as an alternative method to external beam radiotherapy as either a boost or monotherapy.2 there have been a number of single institution studies investigating the use of brachytherapy as a boost for intermediate risk prostate cancer with favourable results . The two most prominent trials to look at the benefit of brachytherapy boost for prostate cancer were the phase ii rtog03212 and the phase iii mt vernon trial.3 the mt vernon trial concluded that the brachytherapy boost group had a significant improvement in relapse - free survival compared to the external beam alone group with a 31% reduction in recurrence (p <0.01). Brachytherapy in hn cancer has three clinical uses; (1) primary treatment for small t1 and t2 squamous cell carcinomas, (2) used in conjunction with external beam radiotherapy and (3) retreatment of either recurrence or new primary . For the purpose of this work, we will only focus on retreatment of recurrence using brachytherapy.1 hdr brachytherapy following the paris rules is often used in combination with debulking surgery for recurrent hn cancer . The catheters are placed during surgery with a robust well vascularised skin flap in an attempt to avoid complications such as fistula, haemorrhage or wound breakdown . There are a number of different dwell position and time optimisation techniques available in the oncentra brachy (elekta brachytherapy solutions, veenendaal, the netherlands) treatment planning system . Geometrical optimisation only determines a relation between the dwell times, that is, prescription and normalisation must be completed separately . Graphical optimisation is an interactive method of optimisation where the user may manually manipulate the dose distribution using the mouse select and move isodose lines . Inverse planning by simulated annealing (ipsa) is the inverse algorithm available in oncentra brachy, it was designed to work with any kind of brachytherapy and can produce plans in a matter of seconds.4 ipsa starts by first describing the clinician's requests using dose constraints . The dose (di) calculated to a point i is converted into a penalty value wi (the cost function) through the following relation . Looking at the above relation, one can see that if the dose is within the specified range the penalty is zero . If the dose to point i is above or below the specified range, the penalty increases at rates of mmin and mmax . The purpose of this case study is to compare graphical and ipsa optimisation techniques for interstitial head and neck (hn) and prostate plans considering dosimetry, radiobiology and planning time . Ethics approval was granted by the local human research ethics executive committee for this radiotherapy quality improvement study and all patient data was de - identified . Four patients who had undergone hdr brachytherapy previously were retrospectively chosen for this study, two recurrent hn cancer patients from our local institution and two demonstration prostate patients provided by the manufacturer as our institution does not currently provide prostate hdr brachytherapy . The hn patients had previously received external beam imrt for advanced stage squamous cell carcinoma (scc) of the floor of mouth (hn_01) and tongue (hn_02). All patients were contoured and planned in the oncentra brachy treatment planning system on ct datasets with 23 mm slices . For the prostate patients, 19 gy was prescribed to be delivered in two fractions to the clinical target volume (ctv). Dose constraints from the rtog 0321 trial were employed during the planning process,2 whereby the goal was to deliver the prescription dose to at least 90% of the ptv, while reducing the dose to surrounding normal tissues . Normal tissue constraints consisted of ensuring the volume of bladder and rectum receiving 75% of the prescription dose was less than 1 cm (v75 <1 cc) and the volume of urethra receiving 125% of the prescription dose was less than 1 cm (v125 <1 cc). Gro involved optimising using point - based optimisation to the surface of the target and then manually adjusting the dose distribution to meet the clinical goals . The ipsa planning technique employed a class solution from ucsf5 as a starting point (table1) with allowances for adjusting the optimisation objectives to meet clinical goals . All plan optimisation was performed by a senior brachytherapy planner with 5 years experience, although as our institution does not provide a prostate hdr service prostate planning experience was limited . Ipsa class solution for generating hdr prostate plans.5 ipsa, inverse planning by simulated annealing; hdr, high dose rate . The hn patients were prescribed 24 gy to be delivered in eight fractions twice daily over 4 days . The planning goals included making sure the prescription dose was delivered to at least 90% of the ctv, while ensuring the v200 was less than 20% . Planning with gro involved first optimising using point - based optimisation to the surface of the target and then manually adjusting the dose distribution to meet the clinical goals . The ipsa planning technique employed a class solution developed locally (table2) with allowances for adjusting the optimisation objectives to meet clinical goals . Ipsa class solution for generating interstitial hdr head and neck plans ipsa, inverse planning by simulated annealing; hdr, high dose rate; ctv, clinical target volume . A number of dosimetric indices were calculated to assess the conformality and homogeneity to the target volumes69 these are listed in table3 . A number of dose - volume metrics were also calculated for the targets; v100, v150 and v200 and normal tissues; v75 and v125 . Definition of dosimetric indices used to assess target volumes piv, prescription isodose volume; ptv90, volume of ptv receiving at least 90% of prescription dose; d2, d98 and d50 dose received by 2%, 98% and 50% of the ptv, respectively . Before radiobiology metrics could be calculated dvh files were converted into standard effective doses in 2 gy fractions (eq . 2). 2where, d is the dose matrix for a given structure, x is the standard dose per fraction (2 gy in this instance), n is the number of fractions and (/) is a tissue parameter as described in the linear quadratic model . Tumor control probability (tcp) based on the logit model and normal tissue complication probability (ntcp) based on the relative seriality model were also calculated for the targets and normal structures, respectively,10 using equations 3 and 4 . 3where d50 is the dose for 50% control or complication, 50 is the slope of the dose response curve, vi is the normalised volume for voxel or dose bin being considered and di is the dose to the voxel or dose bin being considered . 4where s is the seriality parameter and n is the number of functional subunits and the other parameters are as described above . Parameter values used for the relative seriality11 and the tcplogit12 models used in this study /, tissue parameter as described in the linear quadratic model; s, seriality parameter; 50, the slope of the dose response curve; d50, the dose for 50% control or complication; ctv, clinical target volume . Planning time was quantified by recording the starting and finishing times of each planning session . Ethics approval was granted by the local human research ethics executive committee for this radiotherapy quality improvement study and all patient data was de - identified . Four patients who had undergone hdr brachytherapy previously were retrospectively chosen for this study, two recurrent hn cancer patients from our local institution and two demonstration prostate patients provided by the manufacturer as our institution does not currently provide prostate hdr brachytherapy . The hn patients had previously received external beam imrt for advanced stage squamous cell carcinoma (scc) of the floor of mouth (hn_01) and tongue (hn_02). All patients were contoured and planned in the oncentra brachy treatment planning system on ct datasets with 23 mm slices . For the prostate patients, 19 gy was prescribed to be delivered in two fractions to the clinical target volume (ctv). The brachytherapy planning target volume dose constraints from the rtog 0321 trial were employed during the planning process,2 whereby the goal was to deliver the prescription dose to at least 90% of the ptv, while reducing the dose to surrounding normal tissues . Normal tissue constraints consisted of ensuring the volume of bladder and rectum receiving 75% of the prescription dose was less than 1 cm (v75 <1 cc) and the volume of urethra receiving 125% of the prescription dose was less than 1 cm (v125 <1 cc). Gro involved optimising using point - based optimisation to the surface of the target and then manually adjusting the dose distribution to meet the clinical goals . The ipsa planning technique employed a class solution from ucsf5 as a starting point (table1) with allowances for adjusting the optimisation objectives to meet clinical goals . All plan optimisation was performed by a senior brachytherapy planner with 5 years experience, although as our institution does not provide a prostate hdr service prostate planning experience was limited . Ipsa class solution for generating hdr prostate plans.5 ipsa, inverse planning by simulated annealing; hdr, high dose rate . The hn patients were prescribed 24 gy to be delivered in eight fractions twice daily over 4 days . The planning goals included making sure the prescription dose was delivered to at least 90% of the ctv, while ensuring the v200 was less than 20% . Planning with gro involved first optimising using point - based optimisation to the surface of the target and then manually adjusting the dose distribution to meet the clinical goals . The ipsa planning technique employed a class solution developed locally (table2) with allowances for adjusting the optimisation objectives to meet clinical goals . Ipsa class solution for generating interstitial hdr head and neck plans ipsa, inverse planning by simulated annealing; hdr, high dose rate; ctv, clinical target volume . A number of dosimetric indices were calculated to assess the conformality and homogeneity to the target volumes69 these are listed in table3 . A number of dose - volume metrics were also calculated for the targets; v100, v150 and v200 and normal tissues; v75 and v125 . Definition of dosimetric indices used to assess target volumes piv, prescription isodose volume; ptv90, volume of ptv receiving at least 90% of prescription dose; d2, d98 and d50 dose received by 2%, 98% and 50% of the ptv, respectively . Before radiobiology metrics could be calculated dvh files were converted into standard effective doses in 2 gy fractions (eq . 2). 2where, d is the dose matrix for a given structure, x is the standard dose per fraction (2 gy in this instance), n is the number of fractions and (/) is a tissue parameter as described in the linear quadratic model . Tumor control probability (tcp) based on the logit model and normal tissue complication probability (ntcp) based on the relative seriality model were also calculated for the targets and normal structures, respectively,10 using equations 3 and 4 . 3where d50 is the dose for 50% control or complication, 50 is the slope of the dose response curve, vi is the normalised volume for voxel or dose bin being considered and di is the dose to the voxel or dose bin being considered . 4where s is the seriality parameter and n is the number of functional subunits and the other parameters are as described above . Parameter values used for the relative seriality11 and the tcplogit12 models used in this study /, tissue parameter as described in the linear quadratic model; s, seriality parameter; 50, the slope of the dose response curve; d50, the dose for 50% control or complication; ctv, clinical target volume . Planning time was quantified by recording the starting and finishing times of each planning session . Approximate planning times can be seen in table5, which represents the time taken from when all contouring has been completed to having an acceptable plan . Approximate planning times for each patient and optimisation technique ipsa, inverse planning by simulated annealing; gro, graphical optimisation . Screen captures of the dose distributions for each patient and planning technique are displayed in figure1 . What is obvious from these images is that the dose distributions are very similar with ipsa providing slightly better coverage in some areas . For the prostate cases side by side screen shots of dose distributions optimised, using gro (left column) and ipsa (right column). (a) prostate_01, (b) prostate_02, (c) hn_01 and (d) hn_02 . Ipsa, inverse planning by simulated annealing; gro, graphical optimisation; hn_01, head and neck, floor of mouth; hn_02, head and neck, tongue . Tables6 and 7 contain dosimetric and radiobiological results for the planning comparisons . For most metrics, calculated dose, volume and radiobiological metrics for gro and ipsa optimised prostate hdr plans prost, prostate; ipsa, inverse planning by simulated annealing; gro, graphical optimisation; vx%, volume receiving x% dose; iso90, the volume covered by the 90% isodose line; sed tcplogit, tumour control probability; sed ntcprs, normal tissue complication probability; ci, conformity index; cn, conformity number; hi, homogeneity index . Calculated dose, volume and radiobiological metrics for gro and ipsa optimised head and neck hdr plans hn, head and neck; ipsa, inverse planning by simulated annealing; gro, graphical optimisation; ctv, clinical target volume; vx%, volume receiving x% dose; iso90, the volume covered by the 90% isodose line; sed tcplogit, tumour control probability; sed ntcprs, normal tissue complication probability; ci, conformity index; cn, conformity number; hi, homogeneity index . For the prostate patients, the ntcp metrics for the parallel organs were zero or very close to zero as they received a relatively low does to small volume . The brachytherapy in this study was intended as a boost to external beam treatment and if those doses were included, the ntcp would have been higher . The external beam doses were not included as the aim of the study was to assess brachytherapy optimisation techniques . The urethra results were interesting, in that for each patient there was one optimisation technique that had 100% chance of complication . This was in both cases due to the dvh having a very long high dose tail . For prostate_01 this was 63.0 gy and for prostate_02 it was 75.8 gy although both plans met the rtog 0321 dose assessment criteria see figure2 . Ipsa, inverse planning by simulated annealing; gro, graphical optimisation there were also no significant differences in dosimetry between gro and ipsa for the hn patients, although the ipsa plan had better coverage with an average v100 of 94.8%, while the average gro v100 was 85.5% . This case study compared gro and ipsa optimisation techniques available in the oncentra brachy treatment planning system . Four patients were assessed, two hn and two prostate using dosimetry and radiobiological metrics . To our knowledge, this is first study comparing ipsa and gro for hn patients . Treatment planning times were compared for the two groups . Due to the small patient numbers in the study, there were no statistically significant differences between the two groups in terms of dosimetry and radiobiology although planning for ipsa were approximately 1/10 of that required for gro . Similar studies have been published for prostate brachytherapy . While the ntcp values were very low for the bladder and rectum and they are similar to those calculated by takam et al.11 takam et al . Calculated the average rectal ntcp values of 0.5 0.4% for hdr brachytherapy using the same model and parameters . The average urethral ntcp calculated in this study for all plans was 54 53% while takam et al . Found 11.2 3.9% for hd monotherapy delivered in four fractions of 9.5 gy . What this highlights is the importance of the high - dose tail for a relatively serial organ like the urethra . Dinkla et al.13 reported a comparison of optimisation techniques for hdr / pdr (pulsed dose rate) prostate brachytherapy treatment planning . Similar to the current study, all optimisation methods were comparable in terms of dvh parameters . Mean planning time for ipsa was 4.3 1.3 min compared to 7.6 2.5 for gro . The differences in planning times between the current study and those reported by dinkla et al . May be due to different number of catheters (dinkla et al . : median = 14, current study = 16 and 18), implant geometry and/or planner experience . While the dosimetric differences were statistically insignificant, the planning times were greatly reduced for ipsa . Planning times for ipsa were roughly 1/10 that required for gro to reach a similar dosimetrically acceptable plan . For this reason, ipsa makes for a useful planning tool in hn and prostate brachytherapy.
All surgical and experimental procedures were in accordance with the national institutes of health guide for the care and use of laboratory animals and approved by the harvard institutional animal care and use committee . We injected dat - cre and vgat - cre mice with adeno - associated virus carrying flex - chr2 into the vta and implanted a head plate and a microdrive containing six tetrodes and an optical fiber . While mice performed a classical conditioning task, we recorded spiking activity from vta neurons . We delivered pulses of light to activate chr2 and classified neurons as dopaminergic, gabaergic or unidentified.
In patients with liver metastases from colorectal cancer hepatic resection has proven survival benefits and is curative in a small proportion of cases . Patients whose metastases are small, few in number and metachronous have the best prognosis, but there is now good evidence that patients with more extensive disease can benefit from resection . The number, size and distribution of lesions are no longer limiting factors, provided all lesions are removed with adequate tumour - free margins and there is sufficient normal liver to maintain liver function postoperatively . Survival benefits are also well established in patients with neuroendocrine metastases and in a minority of patients with localised metastases from other primary sites which have a more indolent course . Treatment success, however, depends on the removal of all sites of intra - hepatic disease and the absence of disease outside the liver; incomplete resection does not prolong survival . Consequently, more patients are being referred for preoperative assessment and, since many have multiple small lesions, the role of imaging is increasingly challenging . Almost all metastases larger than 1 cm are demonstrated with current imaging techniques but the detection of smaller lesions is still relatively poor . Although the primary modalities for liver imaging are ultrasound and ct, recent studies have suggested that contrast - enhanced mri is the most sensitive method for detecting small metastases and mri is now considered the preoperative standard . Moreover, recent developments in mri hardware and software and the availability of novel mri contrast agents have improved small lesion detection . This article considers the current status of mr imaging techniques in the detection and characterisation of liver metastases and discusses the technical requirements for optimum performance . The accuracy and relative capability of various mr techniques for detecting sub - cm lesions is emphasised . Mr performance is primarily dependent on technique and the optimisation of pulse sequences . To date, liver mr has been most successful at a field strength of 1.5 t using high performance gradients, phased array multicoils and optimised imaging parameters . Signal - to - noise ratio (snr) is influenced by field strength and surface coil configuration whilst imaging speed and spatial resolution are influenced by gradient performance . With stronger gradient systems fast breathhold sequences with t1 and t2 weighting have become routine and motion - induced artifacts are no longer a significant problem . We recommend using breathhold sequences wherever possible since they are the most effective means of eliminating motion artifact . Moreover, breathhold versions of traditionally used sequences have been shown to have superior image quality and to be at least as good as non - breathhold versions for lesion detection . Lesion signal intensity (si) on unenhanced t1w and t2w images often provides an indication of the type of lesion and guides the selection of contrast media for a more definitive diagnosis . T2w images determine the fluid content of lesions and are invaluable for distinguishing solid and non - solid tumours . We currently use a single shot fast spin echo (fse) sequence with half - fourier reconstruction (haste) because motion artifacts are consistently absent even during free breathing and small cysts and fluid collections are well defined . In - phase (ip) and opposed - phase (op) t1w gre imaging (chemical shift imaging) provides a definitive diagnosis of focal or diffuse fatty infiltration . This is particularly important when patients are being considered for hepatic resection since fatty change the fatty liver has a clearly reduced si on opt1w compared with ipt1w images, so whilst the detection and characterisation of liver lesions by ultrasound and ct is handicapped by fatty change, chemical shift mr imaging allows accurate differentiation of metastases and focal fatty change or focal sparing in a fatty liver . In terms of lesion detection, low lesion - to - liver contrast on unenhanced sequences has resulted in rather poor detection rates for sub - cm metastases . Low - contrast lesions are particularly inconspicuous on breathhold t2w fse sequences and are often better depicted on t1w images (fig . Fse is insensitive to susceptibility so liver signal is slightly higher than with conventional spin echo imaging; magnetisation transfer (mt) effects which cause solid lesions to lose si are particularly marked on multi - slice fse sequences and become more pronounced with increasing echo train length; and fse is also subject to blurring of short t2 tissues because most of the high spatial frequencies are collected at the later echoes when there is relatively little remaining signal . Of the unenhanced sequences, breathhold stir is probably the most sensitive for depicting metastases although image quality is variable . The additive effects of t1 and t2 provide strong image contrast which improves the conspicuousness of small lesions (fig . Rapid sequential imaging with extra - cellular space (ecs) gadolinium (gd)-based contrast agents has been shown to be superior to unenhanced imaging and helical ct for detecting metastatic disease . Conventional 2d sequences have been widely used for dgei but they are handicapped by relatively thick sections and inter - section gaps, which limits the diagnosis of sub - cm lesions . The recent introduction of fast 3d t1w gre sequences has overcome many of these problems . Current 3d sequences result in a higher snr and thinner effective slice thickness than 2d methods without inter - slice gap or cross - talk and comfortably allow thin section coverage of the whole liver in a single breathhold (fig . 2). Such sequences are now available from most manufacturers (siemens vibe, philips wave, ge fame). Use of a short repetition time (4 ms), and echo time (1.6 ms) combined with interpolation algorithms, allows higher resolution matrices and a thinner effective slice thickness with minimal time penalties . The intermittent application of a chemically selective fat saturation (fs) pulse before each partition loop achieves homogeneous fat suppression . This is particularly important for dgei because effective fs increases the dynamic range within the image and accentuates gadolinium enhancement . A flip angle (fa) of approximately 15 is chosen to minimise the saturation of stationary tissues for the simultaneous display of liver parenchyma and hepatic vessels . Flexible parameters allow scan times to be adjusted to accommodate the breathhold capacity of individual patients, and can also be manipulated to produce isotropic voxels for optimum 3d reconstruction . Isotropic voxels are achieved at the expense of anatomic coverage but this is largely overcome by parallel imaging techniques . In most cases a parallel imaging factor of two enables isotropic imaging of the whole liver in approximately 20 s. imaging with gd should include baseline pre - contrast images and sequential acquisitions at arterial, portal and equilibrium phases . The arterial phase is the most crucial acquisition and the timing should be optimised by test bolusing wherever possible . Best results are obtained when the contrast is administered by a power injector at a rate of 24 ml per second followed by a saline flush . Hypervascular metastases are most conspicuous at the arterial phase when there is only minimal enhancement of background liver and many are only visible at this time . Most hypovascular lesions are best demonstrated at the portal phase when liver enhancement is maximum but these lesions usually exhibit a transient rim of enhancement which is highly specific for metastases and often only visible at the earlier arterial phase (fig . An optimised arterial phase is also important for identifying sub - cm metastases and distinguishing them from benign lesions . Compared with simple cysts which exhibit non - progressive enhancement and haemangiomas which show discontinuous and persistent enhancement, metastases have a progressive enhancement pattern and become either less conspicuous over time or more conspicuous as a result of delayed central enhancement due to non - specific accumulation of contrast within the lesion s extra - cellular space . Most small metastases become less distinct and apparently smaller on subsequent acquisitions . By the equilibrium phase contrast between normal and abnormal tissue delayed gd - enhanced imaging with fs is the technique of choice for demonstrating small metastases on the liver surface . Fat suppression not only accentuates gadolinium enhancement but also suppresses the competing high signal of intra - abdominal fat adjacent to the liver surface . Surface deposits are usually best seen on delayed images acquired 510 min after injection when they become hyperintense due to slow accumulation of contrast within the tumour (fig . 4). In patients with metastatic disease, however, the main role of dgei is probably to differentiate benign and malignant lesions . Dgei is the most reliable method for characterising lesions and is recommended in all surgical candidates with equivocal lesions in a location which is likely to influence the surgical approach . The perfusion and extraction characteristics of tissues at the different phases of enhancement allow the differentiation of cysts, haemangiomas, fnh and metastases and a specific diagnosis is possible in most patients . Liver - specific contrast agents were developed to increase and prolong lesion - liver contrast beyond that of the ecs agents . A minority of lesions have perfusion characteristics similar to normal liver and are occult on dgei . Also many small lesions are no longer visible by the equilibrium phase when contrast is evenly distributed between intravascular and extra - cellular spaces . All liver - specific agents produce high tissue contrast and have been shown significantly to improve the detection of metastases compared with unenhanced mr, with enhanced mr using ecs agents with 2d gre sequences and with contrast - enhanced ct . Agents which target the hepatocytes and produce positive enhancement on t1w images (gadobenate, gadoxetic acid, mangafodipir) and superparamagnetic iron oxide (spio) agents (ferumoxides, ferucarbotran), which target the kupffer cells and cause a marked signal loss on t2w gre images, are currently available . In terms of lesion detection, metastases are more conspicuous after contrast enhancement because malignant lesions lack functioning hepatocytes or kupffer cells; whilst lesion signal intensity is unchanged the surrounding liver becomes either hyperintense (t1 agents) or hypointense (spio). Gadobenate (gd - bopta, multihance, bracco) and gadoxetic acid (gd - eob - dpta, primovist, schering) have a biphasic enhancement profile . Both behave like ecs gd in the first few minutes after injection and exhibit hepatocyte selectivity on delayed phase images . Both phases are recommended to maximise sensitivity but the detection of small metastases is better on delayed images than on the early vascular phases (fig . Maximum contrast between normal and abnormal tissue occurs 40120 min and 1040 min after injection of gadobenate and gadoxetic acid respectively . Compared with unenhanced images mangafodipir trisodium (mn - dpdp, teslascan, nycomed amersham) also improves lesion detection . Lesion - to - tumour contrast is maximal between 15 min and 2 h after injection but some metastases may be most conspicuous on 24 h images due to delayed washout around their periphery (fig . 6). T1w gre imaging is recommended for all three hepatocyte agents . At the time of writing no comparative studies have evaluated the accuracy of these agents using high - resolution 3d t1w gre imaging but it is likely that the better spatial resolution provided by this sequence will improve the detection of sub - cm lesions compared with 2d sequences . Mri enhanced with spio is probably the most sensitive method for detecting hepatic metastases . In the few studies which have compared the different liver specific agents against each other, spio - enhanced mri has demonstrated varying degrees of superiority, particularly for small lesions . Two spio agents are available for liver mr, ferumoxides (ami-25, endorem, guerbet) and ferucarbotran (shu 555a, resovist, schering). Both agents have a particle size of 30200 nm which results in approximately 80% of the injected dose being taken up by the normal liver . When the particles are clustered within the kupffer cells they induce local field inhomogeneities which lead to rapid spin dephasing and a reduction in signal on both t1w and t2w images although the effect is most pronounced on t2w due to a high r2 /r1 ratio . While metastases retain their high si on t2w images the signal of the background liver is dramatically reduced, so tumour - to - liver contrast is markedly increased . Signal loss after spio increases with field strength and depends on the type of sequence used . The effect of spio is more pronounced on gre than fse sequences due to the greater sensitivity of gre to susceptibility effects . Conversely spio enhancement is less with fse sequences because multiple closely spaced refocusing pulses diminish the local field inhomogeneities induced by the spio particles . Mt effects which reduce the si of solid lesions are also a feature of fse but not gre sequences . Although the effect of spio is maximised with gre imaging, best results are obtained when parameters are optimised to minimise noise and maximise the signal from solid lesions . In a recent multi - observer study optimised t2w breathhold spio - enhanced fse and gre sequences were compared with unenhanced images, for the detection of surgically confirmed metastases . Whilst the best gre sequence achieved accuracies of 93% for all lesions and 82% for sub - cm lesions, enhanced fse was no better than unenhanced images and achieved accuracies of 82% and 64% for all lesions and sub - cm lesions respectively . On the basis of these results the authors now use only this optimised gre sequence with spio . However, in an attempt to improve the detection of sub - cm and surface lesions the sequence has been further refined by reducing the slice thickness from 10 to 6 mm and applying fat suppression (fig . 7) the details of this sequence are as follows: tr 148 ms, te14 ms, fa 30, bw 6580 hz /pixel, 65% phase resolution combined with a 68%75% rectangular 280400 mm field of view to achieve a 132256 matrix and flow compensation . The low bandwidth is used to minimise noise and increase snr whilst flow compensation gradients minimise flow artifact . The flip angle is based on the ernst angle (the fa at which maximum signal for any tissue occurs) for hepatic metastases at 1.5 t and a t1 of 1000 ms . More recently, this spio - enhanced sequence was compared with high - resolution 3d fs t1w dgei and thin - slice contrast - enhanced helical ct for detecting hepatic metastases using histopathology and surgery with ious as the reference standard . Overall the two mr techniques showed similar accuracies and both were significantly more accurate than ct, but the detection of lesions 1 cm or smaller was substantially improved with spio . Ferucarbotran is given by bolus injection and provides the opportunity to obtain dynamic t1w images in the first few minutes after injection . At this time, because the iron oxide particles are distributed within the intravascular space and less concentrated they produce t1w enhancement on t1w images . Liver - to - lesion contrast is maximum on delayed t2w images when the particles are clustered within the re cells and more concentrated, but we have found this early t1 enhancement on 3d fs t1w gre images to be particularly valuable for depicting small tumours . The t1 effect is usually considerably less than occurs with ecf gd agents but this is often beneficial in the context of metastatic disease . Liver and vessels often have a similar si which produces a virtual blank canvas against which small metastases are extremely conspicuous and reliably distinguished from vessels (fig . Experience the combination of thin - slice 3d t1w and t2w imaging after spio increases diagnostic confidence and is more accurate for small lesion detection than delayed t2w imaging alone, although there are currently no published data to support this view . We have also found that optimised fs t2w gre imaging after spio is of value in depicting extra - hepatic and peritoneal tumour deposits which are well seen against the suppressed signal of fat and the reduced liver signal after spio (fig . The most efficient method of fs involves the selective excitation of water protons using a binomial pulse sequence . Compared with the standard frequency selective method of fs this approach is less sensitive to magnetic field inhomogeneities and allows more slices to be obtained for a given acquisition time . We have found that, regardless of the position of the imaging slab, manual shimming close to the isocentre achieves homogeneous fs even at more peripheral levels where the main magnetic field is less homogeneous . All liver metastases start out as microscopic seedlings which eventually grow to a size where they become visible on imaging . According to surveillance studies the mean age of synchronous metastases at the time of surgery for the primary tumour is approximately 23 years . Most lesions larger than a centimetre are depicted on all imaging techniques but the detection of sub - cm metastases is still disappointing . Using optimum technique, high contrast lesions of 23 mm can be detected but metastases (which have low contrast) in this size range are rarely visualised . Although there is no expectation that current imaging techniques will depict metastases of millimetre size, detection rates of 85%90% are consistently reported for ct and mr . The literature on liver imaging is generally limited by inadequate methods for verifying findings and in most studies false negative lesions are not assessed . This inevitably means that reported sensitivities are overestimated and that the true incidence of disease is underestimated . Moreover, in more recent studies investigators have attempted to judge their results against more rigorous reference standards so there has been little if any improvement in apparent sensitivities despite continuing improvements in imaging techniques . It is also likely that these results continue to underestimate the problem of metastases in the millimetre size range and reported sensitivities remain falsely elevated . Even when histological examination of the resected liver is used as the gold standard the verification of very small lesions is questionable since most specimens are sectioned at 1 cm intervals . Furthermore, recent follow - up studies have confirmed that a proportion of small metastases are undetected by preoperative imaging and surgery with ious . In two studies referred to previously approximately 15% of patients were found to have it is likely that these metastases were present at the time of surgery but missed by preoperative imaging and by surgical inspection with ious . A meticulous correlation with surgery and histology of the resected specimen sectioned at 3 mm intervals showed that 24% and 18% of lesions 1 cm or smaller were not detected by any imaging technique . Moreover for the detection of small lesions, the results of both studies compared favourably with those of earlier studies in which a specific analysis of sub - cm lesions was performed . On state - of - the - art systems 3d sequences can achieve full liver coverage with isotropic voxels of 1 mm in a breathhold . However, snr decreases with decreasing voxel size so lesion contrast is degraded by noise . The higher snr provided by 3.0 t technology (snr at 3.0 t is twice that at 1.5 t) has the potential to improve contrast resolution but increased power deposition, decreased rf field uniformity and distortion artifacts due to increased susceptibility are problematic . Hepatocyte - specific agents used with 3d t1w sequences combine high tissue contrast with improved spatial resolution and may rival spio - enhanced t2w imaging for the detection of small metastases but they are unlikely to outperform spio when high - resolution t1w and t2w images are combined . Data on the use of diffusion weighted imaging (dwi) for liver lesion detection are limited . Variable image quality caused by motion artifacts and reduced snr have largely restricted applications to differentiating benign and malignant lesions (benign lesions have higher apparent diffusion coefficients than malignant lesions). Also, most diffusion weighted sequences are acquired with a slice thickness of 78 mm so the detection of small metastases is limited . However, recent work suggests that dwi using small b - values to produce black blood images improves the differentiation of small metastases and vessels on t2w images and is more sensitive than t2w fse sequences for lesion detection . Clearly, continuing improvements in imaging are allowing metastases to be identified at an earlier stage but a different approach is needed to improve the detection of metastases smaller than 2 mm . Hepatic perfusion indexing (hpi) using nuclear medicine and ultrasound techniques has had success in identifying metastases before they become evident on conventional imaging . Patients with liver metastases have increased arterial blood flow and a higher arterial /portal ratio (the hpi) than those with a normal liver . Several animal studies indicate that the increase in hepatic arterial fraction occurs shortly after metastatic seeding and reliably predicts the development of overt metastases . Early results in patients were promising but subsequent studies produced varied findings and showed substantial intra - observer variability so neither technique has found acceptance in routine practice . More recently mr has been used to measure hpi but the technique remains developmental and the best measurement method is still to be determined . Once the methodology is established rigorous multi - observer studies will be required to validate the technique and determine its impact on patient management . The author s experience has evolved in a centre which provides a supra - regional service for liver surgery . In patients who are candidates for hepatic resection our current practice is to perform unenhanced ip and opt1w gre and haste sequences followed by dynamic spio - enhanced 3d fs t1w gre imaging and delayed t2w gre sequences . If a lesion has benign characteristics on haste and a location which may influence the surgical approach we perform dgei immediately after spio - enhanced imaging for more reliable characterisation . In non - surgical patients or patients with rising tumour the author thanks professor p. j. robinson for his review of the manuscript and helpful comments and mrs s boyes for her help in preparing the manuscript . (b) in a second patient also with multiple small metastases, two left lobe lesions (arrows) are highly conspicuous on bh stir ((c) and (d)). Both lesions are visible on bh fse ((e) and (f)) and ipt1w ((g) and (h)) but with reduced liver - to - lesion contrast compared with stir . Two additional sub - cm lesions (arrows) are well seen on spio - enhanced 3d fs t1w (i) and t2w gre images (j) but only one is seen on the corresponding stir image (k). Several metastases larger than 1 cm are well seen on bh t2 fse (a) and ipt1w (b) images . Adjacent thin - slice (2.5 mm) portal phase post - gd 3d fs t1w gre images ((c) and (d)) obtained at the same level as ((a) and (b)) clearly show several additional previously undetected sub - cm metastases . Characteristic continuous rim enhancement is clearly seen on arterial phase post - gd 3d fs t1w gre images (a). The lesions are still conspicuous by the portal phase (b) but the enhancing rim is less apparent and the lesions appear smaller . Role of gd - enhanced delayed imaging with fat suppression for detecting small metastases on the liver surface . In a patient with colorectal cancer small surface deposits (arrows) are well seen on 3d fs t1w gre images obtained approximately 10 min after gd ((a) and (b)). The lesions are not visible on the earlier portal phase images ((c) and (d)). Surface lesions are also highly conspicuous on fs t2w gre images following spio ((e) and (f)). Multiple metastases improved detection with gd - eob - dtpa at the hepatocyte phase of enhancement . Compared with non - contrast t1w images (a) liver - to - lesion contrast is improved on 20 min post - contrast t1w images (b). Additional surgically confirmed sub - cm lesions (arrows) were only visible on hepatocyte phase images ((c) and (d)). Adapted with permission from robinson pja, ward j (2006) mri of the liver: a practical guide . Multiple metastases (arrows) are seen with high lesion - to - liver contrast on 20 min post - mangafodipir t1w 2d gre images (a). However several additional lesions are only visible on the corresponding images obtained 24 h after contrast (b) when the background liver signal has returned to normal, due to retained contrast in the compressed liver tissue at the periphery of the lesions . Improved detection of small metastases with optimised spio - enhanced t2w gre imaging . In a patient with colorectal metastases and a fatty liver, right and left lobe lesions (arrows) are well seen on haste (a) and ipt1w (b) images . The lesions are isointense against the reduced signal of the adjacent fatty liver on opt1w (c). Additional small metastases (arrows) not seen on (a c) are clearly seen on spio - enhanced t2w gre images (d) acquired with a 6 mm slice thickness and fat suppression . Multiple small metastases (many not visible on unenhanced images) are highly conspicuous on 3d fs t1w gre imaging (effective slice thickness 2.5 mm) obtained 45 s after bolus injection of ferucarbotran ((a) and (b)). Note the relatively weak t1 effect resulting in isointensity of the background liver and vessels . The lesions are also well seen on corresponding t2w gre images (c e) obtained 10 minutes after (a) and (b).
Prostate cancer is the second leading cause of cancer - related deaths in american men.1, 2 although hormonal and radiation therapy can be very effective for local disease, patients usually become refractory to hormonal therapy (castration resistant) within 13 years . This is usually associated with the transition to a more aggressive form of the disease, leading to the development of bone and organ metastases . The addition of combination chemotherapy in the late stages of the disease has limited benefit, increasing survival for only several months . These therapeutic strategies have employed oncolytic viruses, vaccines, adjuvant immune modulation therapies (checkpoint inhibitors) (slovin et al ., 2012, j. clin . Oncol, abstract), and adoptive immune cell (t cell) therapies . During the past 15 years, genetic engineering has been applied to more effectively direct t cells to tumor - expressing antigens, through the expression of specific chimeric antigen receptors (cars) on an individual patient s t cells.8, 9, 10 cars consist of a tumor antigen - binding domain that is fused to an intracellular signaling domains and costimulatory receptors capable of activating t cells.10, 11, 12 therefore, antigen - recognition is not mhc - restricted, as is the case for t cell receptor (tcr)-mediated antigen recognition . In vivo efficacy of car - modified effector human and murine t cells has been demonstrated,13, 14, 15, 16, 17, 18, 19, 20, 21, 22 and prostate - specific membrane antigen (psma) is a promising molecular marker for targeted therapy of prostate cancer . Psma is a glycosylated type - ii membrane protein that is upregulated during malignant transformation in more aggressive prostate cancer, resulting in abnormally high levels of it on the cell surface . We24, 25 and others21, 26, 27, 28 (slovin et al ., 2012, j. clin . Oncol, abstract) have participated in developing imaging approaches to visualize anti - hpsma car t cells and optimization of the structure of cars to achieve more profound effects in the targeting of tumors bearing the corresponding antigen (hpsma). Car t cell therapy in solid tumors has not achieved the clinical success that has been observed in hematologic malignancies.29, 30, 31 one reason for the poor treatment response is the failure of car t cells to accumulate and expand in the hostile tumor microenvironment.32, 33 the failure of a substantial car - mediated t cell response in solid tumors relates to a number of factors including car t cell inactivation and possible exclusion from the tumor mass, the reciprocal interactions between tumor and stromal cells,34, 35, 36 and propensity of cancer like prostate to disseminate preferentially to bone . Thus, preclinical studies that incorporate imaging to monitor t cell trafficking and activation are necessary to adequately explore the biology and efficacy of different treatment strategies designed to enhance t cell targeting and penetration of solid tumors . Several strategies have been employed to optimize the migration, survival, and effector functions of adoptive cell therapy (act) using tils (tumor - infiltrated lymphocytes). For example, (1) increasing cxcr2 expression resulted in the improvement of t cell migration to tumors, (2) genetic manipulation of il-12 production by transferred t cells extends t cell survival, and (3) the generation of novel car - based engineered t cells to improve tumor recognition and t cell activation39, 40 as well as the delivery of car t cells through specific polymer implants or local injection . Recently, it was demonstrated that car t cell therapy and programmed cell death protein 1 (pd-1) checkpoint blockade are a rational combination in a solid tumor model . Programmed death - ligand 1 (pd - l1)/pd-1-mediated t cell inhibition is involved in immune evasion in prostate cancer . Although only 1% pd - l1 cells were detected in prostate tumor samples,42, 43 immune cells (pd-1- and pd - l1-positive) were observed to surround prostate tumor nodules . More recently, a novel monoclonal rabbit antibody to pd - l1 revealed that 62% human prostate tumors stain positive for pd - l1 expression . The possibility that pd - l1/pd1-mediated t cell inhibition might be involved in immune evasion in prostate cancer is being explored in several clinical trials . Patients with metastatic castration - resistant prostate cancer (mcrpc) are being treated with anti - pd-1 antibody in two phase ii clinical trials, involving pembrolizumab (keytruda) and ct-011 (anti - pd-1 antibody; curetech).46, 47 the goal of this study was to study the efficacy of human hpsma car - directed t cell therapy in an appropriate animal model . We show that anti - hpsma car - directed t cell therapy of myc - cap: psma(+) tumors alone was unsuccessful, whereas the combination of anti - hpsma car - directed t cells plus anti - hpd1 mab immune modulation therapy provided a partial, short - duration and sub - optimal response . Several prostate tumor models, both human and murine origins, have been described and used to study the targeting of hpsma - car t cells, but some limitations have been identified.21, 24, 48, 49 we focused on murine cell lines, with prospective to utilize them in a syngeneic mouse model using immunocompetent mice . We chose a well established and studied murine prostate cancer cell line, myc - cap, for our initial studies . Myc - cap tumors are composed of sheets and indistinct lobules / nests of polygonal to oval cells separated by fine fibrovascular straie, as described previously . Necrosis is rare in small tumors; larger tumors have more extensive necrosis . The percentage of necrosis varied from 2% to 25%, depending on the overall tumor mass (figure 1). To generate an appropriate murine model for the anti - hpsma car t cell therapy, wild - type (wt) myc - cap cancer cells were stably transduced with a hpsma - containing retroviral vector and sorted as described in materials and methods (figure s1a).24, 51, 52 we compared the growth profiles of wild - type and hpsma(+) myc - cap tumors in mice, and found no significant difference in tumor doubling time, morphology, extent of necrosis (figure 1a), or level of tumor hypoxia (figure 1b). The only difference was that myc - cap: hpsma(+) tumors stained strongly positive for hpsma, whereas wt myc - cap: hpsma() tumors did not (figure 1b). T cells derived from human blood were isolated, activated, and transduced with a newly developed retroviral second - generation anti - hpsma car plg28z vector and with sfg - tdrfp / cbrluc vector . Reproducible levels of hpsma car expression on transduced human t cells were observed (figure s1b).24, 53 cytotoxicity studies revealed that hpsma targeted car t cells have a 13.8 + 5.9% cytolytic efficacy against myc - cap: hpsma(+) cells, when the ratio of the effector to the target is 40 to 1 . However, the same hpsma - targeted car t cells showed 2-fold higher cytotoxic activity toward a human prostate cancer cell line pc3/psma - ires - puromycin (pc3-pip) (figure s1c). Using two distinct luciferase reporter systems, we were able to image the location of myc - cap tumors with the renilla luciferase (rluc) reporter and image the trafficking of anti - hpsma car t cells with the tdrfp / cbrluc reporter . First, we assessed the capacity of systemically administered anti - hpsma car t cells to traffic and accumulate within established subcutaneous myc - cap: hpsma(+) tumors . When tumors reached 50100 mm size, mice were injected intravenously with 20 10 anti - hpsma car t cells (87% of t cells had anti - hpsma car expression, and 67% of car - positive t cells were also positive for the tdrfp / cbrluc fusion reporter). Injection of anti - hpsma car t cells was performed on 0, 1, 5, 9, and 12 days after administration . Initially, car t cells sequestered in the lungs for up to 910 days, as visualized by bli (figure s2a). Their presence in lungs was confirmed by cd3 immunohistochemistry (ihc) staining (figure s2b). A minimal bli signal was observed within myc - cap: hpsma(+) tumors during the first 48 hr, suggesting that some car t cells trafficked to the tumor . However, only a minimal (non - statistically - significant) response of anti - hpsma car t cell therapy was observed on tumor growth / volume, compared with control (no car - t cells treated) tumors (figure s2c). To further evaluate in vivo therapeutic efficacy of anti - hpsma car - transduced t cells anti - hpsma car t cells alone or mixed with myc - cap: hpsma(+) or myc - cap: hpsma() target cells were prepared just prior to subcutaneous inoculation into nod.scid il2rg/ (nsg) mice; the inoculum included a 1:10 tumor - to - t cell ratio, mixed in growth media and matrigel matrix (1:1) at 4c . The location of the tumor was identified using renilla luciferase bli (figure 2a). We also monitored tumor growth by bli (figure 2c) (in addition to caliper measurements; figure 2d) until the point where the tumors reached a size where the bli renilla luciferase signal was saturated and tumors showed evidence of necrosis (day 15; figure 2c). Progressive tumor growth was observed in the two control groups of mice: (1) mice injected with myc - cap: hpsma(+) tumors alone (without car t cells) and (2) myc - cap: hpsma() tumors (without hpsma expression) but mixed with anti - hpsma car t cells (figures 2a, 2c, 2d). A marked reduction in tumor growth rate was observed in the test group of mice: tumors that developed from the mixture of myc - cap: hpsma(+) cells and anti - hpsma car t cells (figures 2a, 2c, 2d). By day 26, the test group tumor size was 224 240 mm, whereas the size of control tumors without anti - hpsma car t cell inclusion was significantly larger, 1,676 406 mm (p <0.05). (winn assay) experiments clearly demonstrate that anti - hpsma car t cells can inhibit myc - cap: hpsma(+) tumor growth and that this inhibition is hpsma dependent . The persistence of anti - hpsma - targeted car t cells in the same winn assay described above; t cells were monitored by the cbrluc / luciferin bli signal generated from the reporter - transduced car t cells (figures 2b and 2e). We observed that anti - hpsma car t cells injected alone in matrigel matrix (control, in the absence of any tumor cells) were localized at the site of injection and were visualized over 8 days . However, the presence myc - cap tumor cells (with or without human psma / antigen) notably influenced the bli signal intensity at the injection site . Since the intensity of the bli signal has been used as indicator of the injected car t cells, the difference in bli signal suggested that the survival of car t cells was different in the three study groups . The bli signal from car t cells was visualized longest (8 days) when they were injected alone (non - tumor group), less in the hpsma() tumor group (6 days), and least in the hpsma(+) tumor group (4 days). These data suggest that bli detection and the survival of car t cells was shortened by the presence of hpsma(+) on tumor cells . It is known that t cells undergo a transition from a quiescent to a highly active effector phenotype upon stimulation / activation and transduction with the anti - hpsma car vector . This transition also involves a significant shift from oxidative to glycolytic metabolism . To study the metabolic status of t cells during activation, transduction, and proliferation, we measured the extracellular acidification rate (ecar) and the oxygen consumption rate (ocr) of these cells . The rate of glycolysis (ecar), as well as basal and maximal ocrs (an indicator of mitochondrial respiration), was assessed on days 2, 8, 10, and 15 of car t cell preparation (figure 3). Human t cells from three donors were isolated from buffy coat using ficoll separation . Forty - eight hours after phytohemagglutinin (pha) stimulation, cells were transduced with a retroviral vector bearing a car targeting hpsma . We obtained a measure of ecar in naive t cells, t cells stimulated by pha and hpsma car - transduced t cells (figure 3a). Naive non - stimulated t cells demonstrated low levels of glycolysis, whereas non - specific pha stimulation of t cells results in a significant (p <0.05) increase in glycolysis, that is maintained at high levels over the course of t cell transduction and expansion (figure 3a). The initial increase in a basal mitochondrial respiration after non - specific pha stimulation is followed by a progressive decline in mitochondrial function during subsequent procedures (figure 3b). Fccp (carbonyl cyanide p - trifluoromethoxy phenylhydrazone) was added to uncouple oxidative phosphorylation from the electron transport chain to measure the maximum respiratory capacity . The maximum respiratory rate (ocr) was significantly higher at day 2 after pha stimulation but declined by day 8 (figure 3c). Similar results were obtained for car - transduced t cells, showing low mitochondrial function following anti - hpsma car transduction (figures 3b and 3c). To assess the associations between pd - l1/pd-1 signaling and t cell targeting of myc - cap tumors, and the impact on tumor progression, we performed immunofluorescence staining for pd - l1 in (1) myc - cap: hpsma(+) tumors growing in nod.scid mice and (2) myc - cap wt tumors growing in immune - competent fvb / n . Both tumors stained positive for pd - l1 (figure 4a). The spatial distribution of cd3 t cells in myc - cap wt tumors (growing in fvb / n mice) was also examined; a predominance of t cells was observed along the invasive tumor margin (stromal - tumor edge), with reduced numbers in the center of the tumor (figures 4b and 5c, upper panel). We then evaluated whether anti - murine programmed death - ligand 1 (mpd-1) mab treatment increased the number of tumor - infiltrating lymphocytes in subcutaneous myc - cap tumors (fvb / n mice). We administrated 5 doses of 200 g of anti - mpd1 mab per mouse (on days 9, 11, 13, 15, and 17 after tumor cell injection) and observed a significant delay (p <0.05) in tumor growth (figure 5a), which continued even after mice stopped receiving anti - mpd1 therapy . Interestingly, tumors <50 mm responded to the anti - mpd1 mab treatment, whereas larger tumors failed to respond to the treatment (figure 5a). The density of cd3 t cells per square millimeter of tumor area (figures 5b and 5d), t cell size (figure 5d) and the correlation between these two parameters and t cells distribution along the tumor edge was evaluated (figure 5c). A marked increase (13-fold) in cd3 t cell density was observed in central tumor areas following anti - mpd1 therapy (figure 5d). We also noticed that t cell size increased in responder tumors from 40 15 m (igg treated) to 51 23 m (anti - mpd1 treated) but not in the non - responding tumor (42 15 m). A comparison of cd3 t cell distribution over the tumor sections showed that cd3 t cells predominantly localized along the rim of tumor nodules prior to and following anti - pd1 treatment, even though the restriction of cd3 t cells from the center of the tumor nodules was reversed (figure 5c). No significant difference was observed in cd31 blood vessel staining of the tumors (data not shown). Encouraged by the response of myc - cap wt tumors to anti - mpd1 mab treatment in fvb / n mice, we evaluated the effect of anti - hpd1 treatment combined with anti - hpsma car t cell adoptive therapy in the myc - cap: hpsma(+) and myc - cap: hpsma() tumor models . Anti - hpsma car t cells (transduced with the cbrluc reporter) were monitored by bli at different time points after i.v . Administration (days 0, 1, and 6) (figure 6b). Ten minutes following car t cell injection, the t cells were localized largely in the lungs of all animals, with a variable low intensity signal appearing in the area of the tumors (figure 6b). Interestingly, the highest tumor - associated t cell bli signal was observed in the myc - cap: hpsma() tumors (anti - hpd1-treated control group), and the lowest signal was observed in the myc - cap: hpsma(+) tumors (anti - hpd1-treated test group). Nevertheless, myc - cap: hpsma(+) tumor - bearing mice receiving the combined treatment (both anti - hpsma car t cells (10 10) and anti - hpd-1 mab; test group) had a significant (p = 0.03, p = 0.04) treatment response (tumor volume), when compared to the two control groups (figures 6c and 6d). The absence of a treatment response in myc - cap: psma() tumors (anti - hpd1 mab - treated control group), despite the more robust t cell trafficking - to and bli signal - in the tumor region is of particular interest . A comparison of car t cell bli signals from tumors and lungs during the first 24 hr showed that the bli signal in the tumors was more stable (figure s3a) compared with that in the lungs (figure s3b), where a decline in signal intensity was observed in all treatment groups . By day 6 after anti - hpsma car t cell injection, there was near total fading of the bli signal from the lungs, whereas a longer - lasting bli signal in the tumor areas was observed (figure 6b). Following the cessation of anti - hpd1 treatment (day 20), we observed an increase in tumor growth of hpsma(+) positive tumors treated with both anti - hpd1 mab (five doses) and anti - hpsma car t cells (one dose injection), comparable with other groups of mice (figure 6c). Staining of one tumor from each treatment group shows different levels of necrosis 24 hr after initiation of treatment (figure 7). Hpsma(+) tumors treated with both anti - hpd1 mab and anti - hpsma car t cells (test) showed the most necrosis (figure 7a), whereas both control tumors showed considerably less necrosis (figures 7b and 7c). The density of tunel positive cells showed a similar pattern; 54 tunel (+) cells / mm were detected for the test group (hpsma(+), anti - hpd1), whereas 29 and 26 tunel cells were observed in the anti - igg, hpsma(+) and anti - hpd1, psma() control groups, respectively (figure 7, far right column). The distribution and density of anti - hpsma car t cells was higher in the center of a hpsma(+) tumor treated with anti - hpd1 mab at day 6 compared to controls (figures s4 and s5), although more car t cells were localized along the periphery of these tumors (figure s4). In contrast, cd31 staining of the tumors following 6 days of combined treatment showed no difference in microvessel density (figure s5). Car t cell therapy for hematologic malignancies has shown some remarkable success in recent years.29, 30, 39, 57, 58 we focused on hpsma targeting in prostate tumors using human anti - hpsma car t cells, because of an existing clinical trial at our institution (mskcc) (clinical trial #nct01140373, https://clinicaltrials.gov) (slovin et al ., 2013,j . It has been shown that adoptive transfer of t cells modified with the anti - hpsma car could specifically mediate regression of pulmonary experimental lung metastasis in scid mice.21, 24, 49 however, this approach was ineffective against established subcutaneous tumors, unless the car t cells were injected locally . To evaluate the effectiveness of second - generation anti - hpsma car t cells in a pre - clinical setting, we developed the myc - cap (hpsma) tumor model in immune deficient mice (nod.scid il2rg, nsg). The myc - cap murine prostate cancer model was chosen to investigate hpsma - directed adoptive car t cell therapy for the following reasons: (1) myc - cap s.c . Tumors are slow - growing (allowing time for immune targeted therapy) and can be used in a syngeneic mouse model using immune competent mice; (2) moderate size tumors have little necrosis (reducing confounding factors in the interpretation of results); (3) a genetically modified myc - cap cell line with high cell - membrane localized psma expression was developed to allow direct comparisons between psma(+) and psma() tumors; (4) both psma(+) and psma() tumors had very similar growth and morphological characteristics (figure 1). This study focuses on the potential for enhancing the efficacy of hpsma car - directed t cell therapy using an immune checkpoint inhibitor (pd-1l / pd1 blockade) just prior to i.v . Our initial efforts to evaluate the effectiveness of second - generation anti - hpsma car t cells24, 53 were comparable to that of others (figure s2). Namely, anti - hpsma car t cell therapy alone was not effective against established subcutaneous myc - cap hpsma(+) tumors . Nevertheless, a winn assay demonstrated that anti - hpsma car t cells can inhibit myc - cap: hpsma(+) tumor growth in a scarce nutrient microenvironment, and that this inhibition is hpsma dependent . However, myc - cap: hpsma(+) tumors re - grew in 3 weeks after implantation (figures 2c and 2d). The finding that myc - cap tumors are pd - l1 positive in both an immunocompromised and immunocompetent mice raised the question whether the restriction of cd3 t cells from the interior of myc - cap wt tumors in fvb / n mice was related to pd - l1/pd1 engagement (figure 4b). A similar exclusion of cd3 t cells was described in metastatic melanoma and other types of cancer.60, 61 given that pd-1 receptor expression is increased on activated t cells following engagement with pd - l1 ligand and high pd - l1/pd1 expression is associated with t cell exhaustion,59, 62 we treated myc - cap wt tumors in fvb / n with anti - mpd1 mab and observed a significant, but only a partial delay in tumor growth (figure 5a). Although based on a small number of animals (n = 5), we observed a 13-fold increase in intratumoral cd3 t cell density following anti - pd1 inhibition (figure 5b), consistent with releasing the pd-1 immune checkpoint and leading to t cell proliferation, intratumoral infiltration and increased effector function . We also observed that t cells changed their morphology and increased in size following anti - mpd1 mab treatment, consistent with cell cycle activation and proliferation.64, 65 although this suggests that anti - mpd1 mab treatment resulted in increased cd3 t cell activation, proliferation, and effector functions, the response was limited and indicates other factors are involved . Nevertheless, the encouraging response of wild - type myc - cap tumors to anti - mpd1 mab treatment in immune competent fvb / n mice led us to evaluate the effect of anti - hpd1 mab treatment in combination with hpsma - targeted car t cells in the myc - cap: hpsma(+) tumor model . In these adoptive car t cell experiments, we first showed that combined treatment with anti - hpd1 antibody significantly inhibited myc - cap: hpsma(+) tumor growth (figure 6c) and that the antitumor response mediated by this combined therapy was both anti - hpd1 and hpsma specific . Namely, the igg - treated control group did not show an inhibitory effect, nor did tumors that were hpsma(). The blocking of hpd-1 enhanced the anti - tumor effect of hpsma - targeted car t cells (figure 6c), even in the presence of murine pd - l1 in the target tumors (figure 4). The treatment response was confirmed by h&e and tunel staining of the tumor 24 hr after initiation of treatment (figure 7a). These results suggest that there is a direct impact of pd-1 blockade on car t cell cytolytic function in these tumors . Anti - pd1 mab treatment of myc - cap wt tumors growing in immune - competent fvb / n mice had a more profound and prolonged effect, even following treatment withdrawal (figure 5a). This effect was greater than a single injection of anti - hpsma car t cells and five doses of anti - hpd1 mab treatment of myc - cap: hpsma(+) tumors growing in nsg mice (tumor growth was delayed for only 10 days). We suggest that anti - hpd1 antibody treatment combined with anti - hpsma car human t cells had enhanced killing capacity and cytokine function against myc - cap: hpsma(+) tumors, although the treatment response was comparatively short in duration . Recent literature40, 66 demonstrates that adoptive immunotherapy using genetically modified t cells in combination with pd-1 checkpoint blockade can enhance the antitumor effects of car t cells against established subcutaneous tumors in an immune compromised host . Nevertheless, our results indicate that other immune modulation mechanisms exist and restrict car t cell targeting, function, and persistence in hpsma expressing myc - cap tumors administered car t cells is well known.49, 67 nevertheless, the persistence of car t cells is well documented in the treatment of many liquid tumors,68, 69, 70 whereas the persistence of car t cells is not a common finding in the treatment of solid tumors . Previous studies have shown that the therapeutic efficacy of adoptive t cell transfer is correlated with the ability of t cells to proliferate and survive in vivo . To address this issue, we used bioluminescence reporter - gene imaging (bli) and immunofluorescence staining to track adoptively administered car t cells . In our bli studies, there was a clear difference in anti - hpsma car t cell trafficking to and initial persistence in myc - cap tumors (with and without the presence of the target antigen - hpsma), even during the first minutes after t cells injection (figures 6a and 6b). This difference in bli signal was present over days 0, 1, and 6 following car t cells injection (figure 6b). The seemingly contradictory t cell bli and treatment response observations (figures 2b, 2e, 6b, and 6c) and inconsistencies between t cell bli (figure 6) and cd3 staining for t lymphocytes (figure s5), can be explained in several ways . We performed our experiments thinking that cbrluciferase (cbrluc) bli could be used as a readout of car t cell number and persistence . To explain the above observations, we assumed the anti - hpsma car t cells were undergoing more rapid destruction in hpsma(+) myc - cap tumors compared to hpsma() tumors, since the t cells were bearing a second generation car . To confirm this hypothesis, we detected more apoptotic car t cells in co - culture experiments with hpsma(+), than with hpsma() myc - cap tumor cells (data not shown). Anti - hpsma car t cells in the absence of the hpsma are likely to remain in a non - activated (anergic) state and not be subject to psma antigen - induced activation leading to t cell death / destruction . Quiescent t cells could survive for a longer period of time and be visualized by bli . An additional and more plausible explanation is that following contact with tumor cell membrane - localized hpsma, the anti - hpsma car t cells undergo a transition from a quiescent to a highly active effector phenotype . This transition also leads to a significant shift in the metabolism of hpsma car t cells, from a tca cycle and oxidative phosphorylation oxyphos - based metabolism, to a more glycolysis - dependent metabolism to support macromolecule synthesis, proliferation, and effector function). These changes in the metabolism of car t cells transitioning from a quiescent to an activated state could directly affect cbrluc bli signal intensity . Recently, it was observed that activated tumor - infiltrating t cells display a phenotype of metabolic insufficiency, characterized by a persistent loss of mitochondrial function and mass . Additionally, it was shown that chronic activation of t cells (associated with an anti - cancer response) represses oxidative metabolism, concomitant with a loss of mitochondrial mass and function, and that a significant decrease / loss of atp was observed in activated cd8 t cells . In light of these observations and the data provided in figure 3 showing lower mitochondrial activity in car t cells, we suggest that activated t cells can be associated with a low bli readout (photons) using luciferin - luciferase - based reporter systems . The click beetle red luciferase (cbrluc) reporter is dependent on the presence of intra - cellular atp, since this reporter belongs to the class of oxidative enzymes catalyzing the reaction of luciferin+atp leading to formation of oxyluciferin, amp and light . Therefore, the cbrluc reporter (and other atp - dependent luciferases, including firefly luciferase) is dependent on the presence of saturable amounts of atp for reliable bli measurements of reporter - cell number and persistence . Interestingly, several other investigators have found that firefly luciferase is not an optimal reporter for tracking activated t cells78, 79 (as well as unpublished conversations with other investigators). First is the very short life of anti - hpsma car t cells in the presence of hpsma(+) myc - cap cells / tumors compared with hpsma() cells / tumors, which leads to their longer persistence in the winn assay (control group, hpsma() tumors). Second is a modest cytotoxicity of car t cells (figure s1) to murine cancer cells bearing hpsma, which leads to myc - cap: hpsma(+) tumor progression after 3 weeks in the winn assay (figures 2c and 2d) compared with total eradication of pc3/pip tumors (a human prostate tumor genetically modified to overexpress hpsma). The combination human car t cells (injected i.v .) And a murine prostate tumor transduced to express human psma may not be an optimal model to explore car t cell therapy . However, there is the potential for interaction between anti - hpd1 abs with mpdl-1, since pd1 shares 64% of protein identity between murine and human species, and pd - l1 shares 77% identity.80, 81 murine pd-1 binds in vitro to both murine and human pd - l1, and human pd-1 binds to the pd - l1 of each species . The structures of the murine pd-1 and human pd - l1 complexes and that of the murine pd-1 and murine pd - l2 have been published . Despite the high homology and the ability for binding between different species, interspecies differences are responsible for the variation in the affinity of human and mouse pd-1 for their ligands . Since human pd-1 is relatively flexible, consistent with prior studies,40, 85 we were able to enhance car t cells therapy when combined with pd-1 blockade . However, the treatment response was only partial, of short - duration and sub - optimal . Other second generation cars have been shown to be as or more effective, including the cd28- and 4 - 1bb - based mesothelin - targeted car t cells that achieved tumor eradication, but only following direct intra - pleural administration . We suggest that the limited response we observed also suggests that there are other mechanisms restricting car t cell trafficking and function in prostate solid tumors, which may extend to other solid tumors as well . We show that anti - hpsma - directed car t cell monotherapy of subcutaneous myc - cap: psma(+) tumors is ineffective, whereas the combination of anti - hpsma - directed car t cells plus anti - hpd1 mab immune modulation provides a short - duration, sub - optimal treatment response . These results also suggest that other immune modulation mechanisms need to be brought into play to further reverse the restriction to car t cell targeting and persistence in hpsma expressing myc - cap tumors and to provide optimal car t cell therapy . The results also suggest that atp - dependent luciferin - luciferase bioluminescence reporters should be used with caution in the monitoring of t cell trafficking and persistence, particularly when t cells transition to an activated state . The myc - cap androgen - dependent prostate cancer cell line, derived from a c - myc transgenic mouse with prostate cancer, was provided by dr . Charles sawyers and was cultured in dmem media supplemented with 10% fbs, 4 mm glutamine, and 5 mm glucose . Myc - cap cancer cells were transduced with a newly generated vector sfg - hpsma . A transgene containing human psma complementary dna (cdna) was amplified from total mrna derived from human prostate cancer cell line lncap using 5hpsma 5-acatgtggaatctccttcacgaaac-3 and 5-ggatcctcgagcttaggctacttcactcaaag-3 primers set . Human psma cdna was cloned into the sfg - based retroviral vector.24, 51, 53 human psma expression was assessed using anti - human psma rat antibody as described previously and cells were sorted using the fluorescence - activated cell sorter (facs) (bd bioscience, ca, usa) several times to achieve a 100% hpsma - positive population . Additionally, myc - cap: hpsma(+) and myc - cap: hpsma() cells were transduced with a sfg - rluc - ires - gfp vector to detect tumor location and its relative borders . A new sfg - tdrfp / cbrluc (rfp / cbr) retroviral vector was obtained by subcloning click beetle red luciferase (cbrluc) cdna from the pcbr basic vector (promega) into the sfg - tdrfp / renilla luciferase (rfp / rluc) retroviral vector by replacing the renilla luciferase gene . A new hpsma - specific car retroviral vector named sfg - pig28z was developed by inserting a ch2-ch3 domain from the human igg heavy chain in the noti restriction site between the anti - hpsma scfv and cd28 signaling motif in the sfg - p28z vector . It was performed for better detectability by facs staining with anti - human igg antibody which is specific for the inserted region (#2040 - 08; southern biotechnology associates). For transduction we have used the pg13 producer cell lines, bearing anti - hpsma car and sfg - tdrfp / cbrluc vectors . Retroviral particles were obtained using the gpg29 (h29) producer cell line and were used to infect target cells . Cells were stably transduced by incubating 50% confluent cell cultures with virus - containing medium for 12 hr in presence of polybrene (8 g / ml; sigma - aldrich). Cells were sorted using facs (bd biosciences) using gfp or tdrfp as fluorescence markers . Sfg - pig28z- and sfg - tdrfp / cbrluc- retroviral supernatants were produced as described above . Monocyte - depleted pbmcs were activated with anti - cd3/cd28 beads (dynabeads; thermo fisher scientific) in a 3:1 bead: cell ratio with 20 iu / ml il-2 for 7 days . Activated t cells were then retrovirally transduced on days 3 and 4, supernatants from the different vectors were mixed on transduction days at a 1:1 ratio . Transduction efficacy was confirmed by facs after staining with anti - human igg antibody (#2040 - 08; southern biotechnology associates) for the detection of cells bearing anti - hpsma vector and detection of tdrfp / cbrluc . To assess car t cell function we decided to follow the clinical protocol of car t cell preparation . Two sets of car t cells (from different donors) were obtained for the current study . One set of car t cells was utilized for the first car t cell trafficking experiment (figure s2) and a winn assay . To perform anti - hpd1 mab and anti - hpsma car t cell treatment we obtained another set of car t cells . Transduction efficiencies varied from 87% to 99.8% for the anti - hpsma marker after cell sorting, and between 67% and 34% for cells that were double - positive for both anti - hpsma marker and tdrfp / cbrluc . 2 cryopreserved medium composed of 7% plasma - lyte, 20% of rimso-50 (dmso; mylan institutional), 40% of albumin (human; grifols), and 33% (hespan [hetastarch]). Target tumor cells were loaded with 100 ci of cr for 1 hr, and then 10,000 tumor cells were co - incubated with car t cells for 6 hr at effector - to - target (e: t) ratios ranging from 40:1 to 1:1 . Percent lysis was calculated as follows: percent lysis = (experimental lysis spontaneous lysis)/(maximal lysis spontaneous lysis) 100%, where maximal lysis was induced by incubation in a 2% triton x-100 solution . The metabolic profiles were determined at steps of t cell stimulation and transduction to assess glycolytic function and mitochondrial respiration of t cells during stimulation, transduction and expansion . We performed a series of real - time measurements of the extracellular acidification rate (ecar) and ocr using a seahorse xf96 extracellular flux analyzer (agilent). The xf analyzer (seahorse biosciences) simultaneously measures energy producing pathways non - invasively in real - time . For the assessment of glycolysis, the first injection is a saturating concentration of glucose (25 mm), where glucose is taken up by the cells and catabolized through the glycolytic pathway to lactate, producing atp and protons . The extrusion of protons into the surrounding medium produces a rapid increase in ecar . In the mitochondrial respiration assay, basal ocr is measured under full media growing conditions followed by sequential addition of oligomycin, fccp, and antimycin a / rotenone with a measurement of changes in ocr . The resulting profiles show the relative contribution of non - respiratory chain oxygen consumption, atp - linked oxygen consumption and the maximal respiration after the addition of fccp . Data presented here represent two independent experiments at different days and were normalized to 350,000 cells . Nod.scid il2rg (nsg) mice were obtained from jackson laboratories and fvb / n male mice were from charles river laboratories . All mice were 56 weeks of age and all mice groups consisted of n = 5 per group . The animal protocol was approved by the memorial sloan kettering institutional animal care and use committee . Myc - cap: hpsma(+) or myc - cap: hpsma() cells in 1:1 ratio of matrigel to media in the right flank subcutaneously . Myc - cap wild - type cells (1 10) were injected into fvb / n mice . We reduced the number of car t cells for injection from 20 10 per mouse (figure s2) to 10 10, in later experiments . The first experiment included three mice per group, whereas the second experiment included five mice per group . The data are presented for the second and most representative experiment . For the combined treatment studies, anti - hpsma car t cells were thawed and reconstituted in standard t cell media for 24 hr . Anti - hpd1 mab or igg - control mab were administrated to three groups of mice 3 hours before i.v . Infusion of car t cells, and then every other day (between days 10 and 20 of tumor growth). Three groups of mice consisted of myc - cap: hpsma(+) igg group n = 5; myc - cap: hpsma() anti - pd1 group n = 5; and myc - cap: hpsma(+) anti - pd1 groups n = 5 and n = 3 . Myc - cap: hpsma(+) or myc - cap: hpsma() tumors in nod.cg-prkdc(scid)il2rg mice were treated with anti - hpd-1 (human, j110) and isotype mopc-21 (human, igg control) antibodies . Myc - cap wild - type tumors in fvb / n mice were treated with anti - mpd-1 (murine, clone rmp1 - 14), and isotype 2a3 (murine, igg control) antibodies when tumors reached a size of 50 mm, which occurred within 10 days after implantation of the tumor cells . Bli was performed with an ivis spectrum imaging system (perkin elmer) and analyzed as described previously . Tumor and lung tissue processing and staining was performed at molecular cytology core facility of memorial sloan kettering cancer center . The stained sections were digitized and scanned using a panoramic viewer (3dhistech) and analyzed with metamorph image analysis software (molecular devices). A fluorescence threshold was used to include only cell - specific signals and exclude background . Size and morphology filters have been applied to ensure only cells are counted (not cellular debris), and the number of immune cells were recorded . Cell sizes were obtained by applying the above thresholds and obtaining the area of each identified t cell . The data (area of individual t cels) were combined for group statistics (n = 3,621 t cells for the control group; n = 14,531 t cells for anti - pd1 group). Detailed information for cd31/pdl1, cd3, and tunel staining of tissues is provided in the supplemental material and methods . All data presented for t cells assessment using ifc staining were analyzed using graphpad prism (version 6.0; graphpad software) and are presented as mean sd . Results were analyzed using the unpaired student s t test, and statistical significance was defined as p <0.05 . Conception / design, i.s ., e.m ., v.p ., and r.b . ; acquisition of data, e.m ., i.s ., m. mane, and m. moroz; analysis and interpretation of data, e.m ., i.s . ; pathological diagnosis, analysis, and interpretation of the immunohistochemical data, i.s . And i.c . ; and carrying out experiments and analyzing data, e.m ., i.s ., m. moroz, and i.c
In 2005, researchers at yale university analyzed all the genes of targeted proteins published by the mammalian gene collection project (mgc). Moreover, they identified that the renalase gene has 9 exons spanning approximately 3.1110{bp, resides on chromosome 10 at q23.33, and encodes a protein with 342 aas with a molecular mass of 37.8 kda . Its structure has a signal peptide at the n - terminus (aas1 - 17), a fad - binding site (aas435), and an amine oxidase domain (aas75339). Some investigators speculate that hrenalase 3 and 4 have no amine oxidase function, because their structure has shortened amine oxidase domains . The crystal structure of hrenalase1 indicates that it is a member of the flavoprotein superfamily . However, renalase is not a monoamine oxidase; it effectively metabolizes the circulating catecholamines in a different way from those seen in mao that resides on the external membrane of mitochondria and degrades intracellular catecholamines [25]. Renalase, using nad(p)h as a cofactor, degrades circulating catecholamines (epinephrine> l - dopa> an immunohistochemistry study revealed that renalase can be detected in kidney, heart, skeletal muscle, small intestine, brain, and peripheral nervous system . Therefore, researchers conclude that renalase is significantly associated with human diseases [69]. Hypertension is a common cardiovascular disease, which arises from the action of multiple genetic and environmental factors . Catecholamines, such as epinephrine, norepinephrine, and dopamine, are involved in sympathetic activation . We was previously reported that renal denervation can lower blood pressure, perhaps due to the suppression of sympathetic nerves, the increase in plasma renalase level, and renalase expression in the kidney . After sprague - dawley (sd) rats were injected with exogenous recombinant renalase, their systolic pressure, diastolic pressure, and mean arterial pressure mildly or moderately decreased . The other authors had demonstrated that renalase regulated blood pressure; they used rnai to inhibit the renalase gene expression, and when the decrease of renalase gene expression reached 40%, the blood pressure increased by 13 mmhg . In addition, the intrarenal dopaminergic system also plays a critical role in regulating blood pressure . One study team reported that animals fed a high - phosphate diet had a significant increase in the activity of renal dopa (l - dihydroxyphenylalanine) decarboxylase and significant reductions in renalase . Their results indicated that the action of renalase may be attributed to the regulation of the intrarenal dopaminergic system . Another study found that renalase expression is modulated by salt intake, and recombinant renalase has a hypotensive effect on blood pressure in dahl salt - sensitive rats . To further confirm the association between the renalase and hypertension, a study recruited 1317 hypertensive patients and 1269 normotensive controls in a northern han chinese population, reporting that essential hypertension was highly associated with rs2576178 gg genotype and rs2296545 cc genotype . Another study investigated the genotype of rs2576178 polymorphism in 369 patients and rs10887800 polymorphism in 421 dialyzed patients, and they found an association between renalase gene polymorphisms and hypertension in dialyzed patients . According to these studies, we hypothesized that renalase regulates blood pressure by down - regulating sympathetic nervous system activity, or by degrading renal dopamine (which has both natriuretic and phosphaturic properties). These findings may provide novel genetic viewpoints and provide insight into the pathophysiology of hypertension . Despite recent substantial advances in the treatment of hypertension, blood pressure in most patients still remains suboptimally controlled . Therefore, the need for innovative strategies to lower blood pressure (bp) is emerging . The new therapeutic prospect of hypertension has arisen due to the unique function of renalase, which regulates blood pressure . Numerous in vitro experiments in animals have confirmed that renalase protects against ischemic myocardial damage, aki, and ischemic stroke . One study reported that a renalase gene knockout mouse model demonstrated higher plasma catecholamines level and blood pressure than in the control group . Although plasma aldosterone level, kidney function, and cardiac systolic function did not change, renalase gene knock - out model mice poorly tolerated cardiac ischemia and easily developed myocardial necrosis and apoptosis . This finding indicates that renalase can reduce cell damage caused by ischemia, improve cell tolerance to ischemia and reduce myocardial cell apoptosis . Another study genotyped the rs2296545 snp (glu37asp) in 590 caucasian subjects and demonstrated that the cc genotype had increased risk of inducible ischemia (or=1.49, 95% ci 0.992.24). The functional missense polymorphism in renalase (glu37asp) is associated with ischemia in persons with stable coronary artery disease . Animal experimental study has demonstrated that circulating renalase was remarkably low after renal ischemia - reperfusion injury, while plasma catecholamine level increased significantly . Moreover, renal tubular inflammation, necrosis, and apoptosis were more severe, and catecholamine levels were higher in a renalase deficiency model . Moreover, renalase may play a crucial role in ischemic stroke . To investigate the genetic association between renalase and ischemic stroke, a study group genotyped single - nucleotide polymorphisms of the renalase gene in 507 ischemic stroke patients and 503 sex - matched controls from a northern chinese han population and found that rs10887800 and rs2576178 were significantly associated with ischemic stroke with hypertension by logistic regression (p=0.041 and p=0.038, respectively). Another study suggested that renalase might be associated with stroke in hemodialyzed patients, probably due to sympathetic nervous system hyperactivity ., these data suggest that renalase protects against ischemic injury by some undefined mechanism, and that circulating renalase might be a new biomarker for ischemic diseases . Furthermore, recombinant renalase may be useful in the prevention and treatment of ischemic diseases . Our study team hypothesized that renalase may protect against ischemic diseases by reducing cell necrosis, apoptosis, and local inflammatory reactions . During cardiac dysfunction, sympathetic nervous system (sns) activity and levels of catecholamines were found to be increased as a compensatory attempt to augment the cardiac function, and this change had been associated with the prognosis of patients . To verify the relationship between renalase and circulating ne in heart failure the results of their study indicated that the reduced renal blood flow that occurs in heart failure result in down - regulation of the synthesis of renalase and consequently caused increased circulating ne . In another study, the authors showed that up - regulation of cardiac g - protein - coupled receptor kinase-2 (grk2) and ne could contribute to cardiac hypertrophy in nephrectomy rats . Moreover, compared to the preoperative level, the level of renalase obviously decreased postoperatively . The association between renalase and cardiac dysfunction has been shown in animal experiments as well as in several human studies . Researchers compared 590 participants who had different genotypes, and found that the cc genotype had increased risk for developing left ventricular hypertrophy (or=1.43, 95% ci 0.992.06), systolic dysfunction (or=1.72, 95% ci 1.012.94), diastolic dysfunction (or=1.75, 95% ci 1.052.93), and poor exercise capacity (or=1.61, 95% ci 1.052.47), indicating that a functional missense polymorphism in renalase (glu37asp) is associated with cardiac dysfunction . In addition, an in vitro heart perfusion study showed that exogenous recombinant renalase improved left ventricular function and reduced left ventricular pressure by means of an in vitro heart perfusion experiment . These findings suggest that renalase may participate in the pathophysiological mechanism of cardiac dysfunction by down - regulating the activity of sympathetic nervous system (sns) and degrading the level of catecholamines . However, on one hand a deeper and more accurate link between renalase and cardiac dysfunction need to be further researched, on the other hand whether or not renalase protein could be a new drug to improve the cardiac dysfunction should also need to be considered . Beyond its association with the renal, cardiac disease, some investigations have recently demonstrated that renalase may play an important role in the pathogenesis of hypertension after organ transplantation and may affect the prognosis of the procedure . Some studies had found that plasma renalase of hypertensive allograft recipients was significantly higher than in normotensives recipients, and renalase level could be predicted by renal function . In kidney transplant recipients, renalase correlated with age (r=0.29; p<.05), time after transplantation (r=0.34; p<.01), systolic blood pressure (r=0.28; p<.05), diastolic blood pressure (r=0.27; p<.05), serum creatinine (r=0.49; p<.001) [2830]. In another study, renalase was significantly dependent on kidney function, which deteriorated with time after heart transplantation among 130 heart transplant recipients . These findings demonstrate that renalase has a role in hypertension and renal function after transplantation . However, further studies are needed to explore possible novel targeted therapies in organ transplantation . Diabetes mellitus, a common and complex disease, arises from multiple genetic and environmental factors . One study analyzed 892 patients and 400 controls genotyped with 3 snps (rs2296545, rs2576178, and rs10887800) in the renalase gene, and reported that renalase gene polymorphisms are associated with hypertension in type 2 diabetes patients, and the g allele of this polymorphism might be useful in identifying diabetes patients at increased risk of stroke . In addition, using a genome - wide association study (gwas) in patients with type 1 diabetes, researchers have found 18 gene single - nucleotide polymorphisms that were associated with type 1 diabetes, one of which is renalase . Another study further confirmed that rs10509540 (renalase gene), which is located on chromosome 10q23.31, was strongly associated with type 1 diabetes . The evidence from recent research suggests that the renalase gene may correlate with dm, but the mechanism involved remains unclear . Renalase, a recently discovered amine oxidase, degrades circulating catecholamines and affects activity of the sympathetic nervous system and the intrarenal dopaminergic system . Mounting evidence from numerous studies demonstrates the capability of renalase recombinant proteins in lowing blood pressure as well as protecting myocardial cells from necrosis and apoptosis . The exact mechanism by which renalase regulates blood pressure and improves cardiac function is still unclear . However, renalase may be a potential drug or a novel therapeutic target for the prevention and treatment of hypertensive - ischemic cardiovascular diseases.
Correct chromosome segregation requires that one and only one kinetochore assembles on each chromosome . To achieve this, a subset of kinetochore proteins functions to specifically recognize and bind to centromeric dna . In budding yeast, centromeric dna is 125 bp long and is conserved among the different chromosomes (fitzgerald - hayes et al ., 1982). In contrast, metazoan centromeric dna can be megabases in length and does not contain easily identifiable dna consensus sequences (for review see choo, 1997). Despite the differences between yeast and metazoan centromeric dna, the kinetochores that assemble on this dna in both cases are organized around centromeric nucleosomes that contain specialized histone h3-like proteins (yeast cse4p or its metazoan homologue cenp - a [meluh et al ., 1998]). Since cse4p / cenp - a containing nucleosomes are found only at centromeres, there must be a mechanism to target these nucleosomes specifically to centromeric dna . Yeast have solved this problem in part through the activities of additional dna - binding kinetochore proteins . The yeast centromeric nucleosome binds to an 80-bp sequence (termed cdeii) that spans the middle of the centromere . The dna sequences on either side of cdeii (termed cdei and cdeiii) also serve as binding sites for distinct proteins . The most important of these is the cbf3 complex (ndc10p, cep3p, ctf13p, and skp1p), which binds to cdeiii (lechner and carbon, 1991). In the absence of cbf3, kinetochore function is abolished in vivo and in vitro (goh and kilmartin, 1993; sorger et al ., 1994), and the association of all known kinetochore proteins with the centromere, including cse4p (ortiz et al ., 1999), is disrupted . In contrast, the association of cbf3 with centromere dna in vivo does not require cse4p (measday et al ., 2002). Therefore, the specific binding of cbf3 to cdeiii helps define the position of the yeast kinetochore . Cdei serves as a binding site for a homodimer of cbf1p (mellor et al ., although cbf1p is not essential for kinetochore function, it induces the bending of dna (niedenthal et al ., 1993) and may therefore contribute to the higher order structure of the kinetochore . Cbf1p has structural similarity and limited sequence identity to cenp - b, which binds to metazoan centromeric dna and also induces dna bending (tanaka et al ., 2001). Physical and genetic evidence suggests that mif2p, a protein with similarity to metazoan cenp - c, also binds to centromeric dna near cbf1p (meluh and koshland, 1995, 1997). However, despite the presence of dna - binding motifs (meluh and koshland, 1995) mif2p has not been shown to bind directly to this dna sequence in vitro . Based on identified physical interactions, it appears that inner kinetochore proteins do not associate directly with microtubules or the microtubule - binding components of the outer kinetochore . One important central kinetochore component appears to be the ctf19 complex (ctf19p, mcm21p, and okp1p), which binds to each of the inner kinetochore components described above (ortiz et al ., 1999). By virtue of its two - hybrid interactions, the ctf19 complex also appears well positioned to link together the ctf3 complex (ctf3p, mcm16p, and mcm22p [measday et al ., 2002]) and the ndc80 complex (ndc80p, spc24p, spc25p, and nuf2p [janke et al . The ndc80 complex is especially important for kinetochore function, since mutants in this complex are completely defective for chromosome segregation, similar to cbf3 mutants . There are also a variety of kinetochore proteins which are less defined in terms of their physical interactions . Since these proteins have not been shown to bind to either microtubules or centromeric dna, we have tentatively classified them here as central kinetochore proteins . These include mtw1p, which is essential for kinetochore function with mtw1 - 1 mutants, showing highly abnormal dna segregation (goshima and yanagida, 2000). Other kinetochore proteins, including slk19p (zeng et al ., 1999), mcm19p (ghosh et al ., 2001), chl4p (roy et al ., 1997), and bir1p (yoon and carbon, 1999), are not essential for viability and therefore might play redundant or nonessential roles in kinetochore function or structural integrity . Although initial studies have indicated that bir1p, a homologue of the metazoan kinetochore passenger protein survivin, shows genetic and two - hybrid interactions with the cbf3 complex (yoon and carbon, 1999), future work will be required to establish the specific roles that these nonessential proteins play at the kinetochore . However, until recently it was unclear how yeast kinetochores attach to spindle microtubules . In metazoans, microtubule - associated motors, including cenp - e, dynein, and xkcm1, play roles in mediating kinetochore microtubule attachments and in subsequent chromosome movements during congression and anaphase a (for review see heald, 2000). However, yeast kip3p may be an xkcm1 homologue (severin et al ., 2001), suggesting that it may function at kinetochores . Cin8p, a bimc - related kinesin, associates with kinetochores in vivo (he et al ., 2001), and in vitro assays have suggested that the motor protein kar3p plays a role in kinetochore function (middleton and carbon, 1994). Although deletion of cin8, kar3, or kip3 individually does not dramatically affect chromosome segregation, cin8 kip3 and kip3 kar3 double mutants are inviable (miller et al ., 1998), possibly reflecting redundant roles for these motors at the kinetochore . Nonmotor microtubule - associated proteins (maps) * also appear to play roles in mediating kinetochore the first kinetochore - associated map to be identified was dam1p, a component of the dam1p complex (dam1p, duo1p, dad1p, spc19p, spc34p, dad2p, ask1p, dad3p, and dad4p [cheeseman et al . This complex localizes to kinetochores in an ndc10- and ndc80-dependent manner (enquist - newman et al ., 2001; jones et al ., 2001 phenotypic analyses of dam1 mutants showed that their spindles have monopolar attachments to paired sister chromatids (cheeseman et al ., 2001b; he et al ., 2001), possibly reflecting an inability to form new kinetochore microtubule attachments or a role in chromosome biorientation (janke et al ., 2002). The dam1p complex interacts physically with central kinetochore proteins of both the ctf3 and ndc80 complexes (fig . 2) (cheeseman et al ., 2001a; measday et al ., 2002). This model is based on the organization of the dna - binding proteins (espelin et al ., 1997; meluh and koshland, 1997; meluh et al ., 1998) and the known physical interactions of the different kinetochore proteins (cheeseman et al ., 2001a). Electron microscope studies of vertebrate kinetochores revealed that microtubule plus ends make end - on attachments with the kinetochore . Although there is no direct evidence for such an end - on attachment in yeast, bik1p, a member of the clip-170 family of plus - end tracking maps, does localize to kinetochores independent of its microtubule - binding activity (he et al . However, in polyploid cells, highly sensitive to disrupted kinetochore function because of numerous spindle connections, these bik1 mutants show defects in chromosome segregation (lin et al ., 2001). Binding map of the eb1 family, may also play a role in kinetochore function . In fact, bim1 mutants show genetic interactions with genes encoding a variety of kinetochore components (tong et al ., 2001). Additional studies have also implicated stu2p, a homologue of the microtubule stabilizing protein xmap215, in kinetochore function (he et al ., 2001). A similar role was suggested independently for the schizosaccharomyces pombe stu2p homologues, dis1 and mtc1 (nakaseko et al ., 2001). However, as with other maps that play multiple roles in spindle function the significance of these results is unclear . Although stu2 mutants show altered chromosome dynamics (he et al ., 2001), stu2p plays a key role in modulating microtubule dynamics (severin et al ., 2001). Therefore, altered chromosome dynamics may reflect microtubule defects instead of a role for stu2p in mediating kinetochore microtubule interactions . To ensure that the kinetochore proteins described above function properly, the conserved mitotic checkpoint (fig . Microtubule attachments and, in the event of an error, arrests a cell in metaphase (for review see amon, 1999). In budding yeast, the primary signal for this checkpoint is the absence of an attachment between the centromere and the spindle, implicating kinetochore proteins as the source of this signal . In fact, mutants in several kinetochore proteins, including ndc10p, ctf13p, cep3p, spc24p, and spc25p, are defective for the mitotic checkpoint (gardner et al ., 2001; janke et al ., 2001), indicating either that an intact kinetochore is required for checkpoint function or that these proteins signal to the mitotic checkpoint . In addition to sensing attachment defects, the yeast mitotic checkpoint also appears to monitor tension on the kinetochore . Bipolar attachments exert sufficient force on the kinetochore to pull centromeric regions apart before anaphase (goshima and yanagida, 2000; he et al ., 2000). Interestingly, a lack of tension can temporarily activate the yeast mitotic checkpoint even when kinetochore . Although the classically defined checkpoint components are necessary for this tension checkpoint, it additionally requires ipl1p (biggins and murray, 2001), an aurora protein kinase . Centromeres are positioned near the spindle poles throughout the cell cycle (jin et al ., 2000). This localization requires microtubules and functional kinetochores, suggesting that active attachments between the spindle and the kinetochore exist during the majority of the cell cycle . However, changes in kinetochore function may occur during events such as the assembly of a new kinetochore, during spindle assembly to facilitate the formation of bipolar attachments, and during anaphase a when kinetochores move to the spindle poles . Several proteins have been identified that may regulate these and other aspects of kinetochore function . The best characterized of these regulatory factors is the ipl1p protein kinase, which is essential for chromosome segregation . Ipl1p can associate with kinetochores (biggins and murray, 2001; kang et al ., 2001) and directly with microtubules (kang et al ., 2001). Ipl1p associates closely in vivo with sli15p, an incenp homologue that plays a role in activating ipl1p's kinase activity and possibly in substrate recognition (kang et al . Both ipl1 and sli15 mutants show high frequencies of chromosome missegregation and monopolar attachments of paired sister chromatids to the spindle (biggins et al ., 1999; microtubule attachments in vitro by phosphorylating the cbf3 subunit ndc10p (biggins et al ., 1999). In addition, ipl1p phosphorylates dam1p in vivo and in vitro (kang et al ., 2001), consistent with the indistinguishable chromosome missegregation phenotypes observed for mutants of each protein . Recently, it was shown that kinetochores are unable to detach from the spindle pole in ipl1 mutants, suggesting that a primary function for ipl1p is promoting the turnover of these attachments to facilitate sister chromatid biorientation (tanaka et al ., 2002). The work described here has led to the most detailed molecular picture of an intact kinetochore in any organism . 1 and 2 are an attempt to synthesize what is currently known about the protein composition of the budding yeast kinetochore and how these proteins associate with each other, centromeric dna, and the spindle . Although it is possible that some yeast kinetochore proteins remain unidentified, the diagram shown in fig . 2 provides a useful working model for understanding kinetochore function and should allow predictions to be made on the order of assembly of proteins at the kinetochore . Future work must address issues such as the specific functions of individual kinetochore proteins, how kinetochores move to the poles in anaphase a, how kinetochore assembly and function are regulated, and how unattached kinetochores activate the mitotic checkpoint . With a large list of kinetochore proteins in hand and with knowledge of the specific interactions and biological importance of many kinetochore components, the answers to these questions should now be accessible.
The dej is a complex interfacial zone that joins two highly dissimilar calcified tissues, enamel and dentin . Enamel covers the coronal portion of a tooth and is primarily composed of a defective carbonate rich apatite arrayed in rods or prisms 4 - 5 m in diameter . These rods are oriented to intersect the dej almost perpendicularly and contain highly oriented long apatite crystals [1, 2]. Dentin is a calcified tissue that is compositionally similar to bone and is based on collagen reinforced with apatite . Dentin underlies enamel and is composed of a series of dentin tubules approximately 1 m in diameter . These tubules contain fluid and odontoblastic cellular processes that are surrounded by columnar - like peritubular dentin cylinders approximately 0.51 m thick . The mechanical behavior of dentin is dominated by the behavior of intertubular dentin [48]. The dej plays a critical role in enhancing the biomechanical integrity and resistance to fracture [9, 10]. It has been found that the dej is more resistant to acid attacks and crack propagation than is enamel [9, 12, 13]. The dej also has been observed to display a remarkable ability to transfer loads between enamel and dentin such that cracks or fracture planes that are formed within enamel rarely propagate across the dej into the underlying dentin [9, 14]. The dej usually has been described as consisting of a series of 25100 m wide scallops, whose convexities are directed towards dentin and whose concavities are directed towards enamel [1, 2]. These scallops are further subdivided into a series of smaller microscallops, which contain finer structures . Methods used to understand the complex hierarchal structure of calcified tissues and interfaces including dentin and the dej have recently been reviewed . Large variations in width estimates of the dej have been reported in the literature . A variety of mechanical testing equipment, with increasingly smaller sampling sizes, has been used to estimate functional dej width based on its mechanical properties . Microhardness indentation profiles across the dej suggest that a broad gradation in mechanical properties exists . Studies using vickers microhardness measurements estimated the width of this interface as being between 27 to 100 m . Lin and lin and douglas determined a functional dej width in the range of 50 to 100 m . The apparent discrepancy among these measures may reflect a graded functional transition zone indicative of the dej region . Wang and weiner reported a functional transition zone width on the order of 200 m using a moir fringe technique on human teeth . Employed nanomechanical testing and reported dej width estimates in the range of 15 to 25 m, while marshall et al . Used similar technology and estimated a functional dej width of 11 to 13 m . Employed a nanoscratch technique and reported a very narrow linearly varying transitional zone of 13 m . Used afm - based force modulation to measure the dynamic viscoelastic properties of the dej region and estimated dej width at 2 to 3 m . The observations that the mechanical properties of the dej exhibit a broad transitional behavior stand in contrast with high - resolution imaging . Studies have indicated that a very narrow interfacial zone, if any, exists between mantle dentin and enamel . Data derived from light microscopy, and scanning and transmission electron microscopy, and atomic force microscopy suggest that the margins of the dej are sharply demarcated and that the interface is narrow [9, 12, 15, 16]. The small size of the dej, coupled with our inability to isolate this material, has made it a difficult tissue to study using conventional mechanical testing techniques . To date, bulk property measurements of the dej have not been obtained because conventional tensile, compressive and shear testing of the extremely small samples could produce complex geometries and nonuniform stress distributions . Pioch and stachle examined the shear strength of human and bovine teeth in the region of the dej and reported mean values of 39 mpa and 37.4 mpa, respectively . They reported that the fractures that occurred within dentin were not observed to occur at the dej, an indication of the scaling difficulties associated in working with this material . Raman microspectroscopy is a technique to characterize the spatial distributions of organic and inorganic compounds with resolution on the order of 1 m . The raman spectrum of enamel is dominated by peaks or bands attributed to the mineral apatite at 591, 961, and 1071 cm . The raman spectrum of dentin indicates the presence of a larger proportion of organic compounds . C h stretching bands at 2940 and 2880 cm are more intense than those found in enamel . Amide i and iii bands at 1670 and 1243 cm also have been identified . These bands correlate with those found in the ft raman spectra for bone and suggest a similar protein composition . The hypothesis of this study was that width estimates of the dej based on compositional changes in the organic and mineral content are related to the mechanical properties changes determined by nanoindentation . Five recently extracted noncarious human third molars were collected from the ucsf oral surgery clinic according to a protocol approved by the ucsf institutional committee on human research . Each tooth was maintained in a hydrated condition in physiologic saline solution (hanks bss) and gamma radiation sterilized according to a standard protocol . Each tooth was sagittally sectioned parallel to its buccal - lingual surface with a water - cooled diamond saw and hand - polished through a graded series of sic abrasive papers ending with 1200 grit and then final polishing with 0.05 m alumina paste . Each specimen was ultrasonically cleaned for 60 seconds in ice - cooled deionized water between polishing steps to minimize the possibility of cross - contamination and scratching . Following final polishing, each sample was affixed to a magnetic backing plate with cyanoacrylate cement . The sample was air dried by blasts with clean, dry compressed air until all surface moisture was removed . Nanoindentation testing and raman microspectroscopy imaging were subsequently performed across the same section of the dej of each tooth, in the region of its central pit . An afm - triboscope system was used for imaging, nanomechanical testing and placing sample orientation markers . The afm - triboscope system consisted of a nanoscope iii (veeco probes, santa barbara, ca) with its standard head replaced by a triboscope indenter system (hysitron inc ., the coupled afm - triboscope system is a force generating and depth - sensing instrument [12, 26]. The triboscope system consists of a three - plate capacitive force / displacement transducer in which a cube corner diamond tip is affixed via a central drive post to the middle plate . A voltage applied between the middle and the outer drive plates was used to generate an indentation force proportional to the square of the applied voltage . The system was capable of producing load - displacement curves at precisely selected locations with indentation loads ranging from 1 to 15 000 n . This tip was calibrated before and after testing and had a tip radius of 20 nm . A trapezoidal force loading profile with adjustments to maintain measurement validity was used for each measurement with a peak load of 300 n . Each indentation produced a load - deformation curve from which the reduced elastic modulus was calculated from the contact stiffness, s, defined as the slope of the linear portion of the force / displacement curve during unloading near the maximum load using the unloading portion of the curve based on the equation where a is the projected contact area between the tip and sample at the maximum load . Hardness was calculated as the maximum force divided by the projected contact area between the tip and the sample at the maximum load, in accordance with the methods of doerner and nix (2)h = fmax a. the same tip was used for imaging, nanomechanical testing and placing optically visible sample orientation markers . These markers were subsequently used to locate and orient the sample during raman microspectroscopy . In three of the samples, a single line of nanoindentation points, each having a length of at least 50 m, was placed across the dej at 2 m intervals to prevent interference with adjacent indentations . In the remaining two samples, two parallel lines of nanoindentation points, each with a length of at least 50 m, all lines were made perpendicular to the dej, and oriented so that their midpoint was roughly coincident with the expected middle of the dej . Trial indentation lines of greater overall lengths were placed across the dej to ensure baseline modulus and hardness levels were achieved in both enamel and dentin . At the start of each indentation line, these terminal points were used as orientation markers as they were visible with the optical microscopes of both the afm - triboscope and the raman microspectroscope . Figure 1 shows an afm image of the dej with the orientation markers (figure 1(a)) and typical spectra from the enamel and dentin on either side of the dej (figure 1(b)). An estimate of the functional width of the dej was then made for each indentation line according to the statistical methods described below . It is a noncontact nondestructive technique that identifies and quantifies the functional groups that are present . An hr-800 raman microspectrophotometer (jobin yvon, horiba, france) was used to define the raman spectra of enamel, dentin, and dej, as well as provide an estimate of the compositional width of the dej based on mineral and organic content differences . The hr-800 raman microspectrophotometer uses monochromatic radiation emitted by an he - ne laser having a wavelength of 632.8 nm and operating at 20 mw of power before entrance optics . The spot size is on the order of 0.5 m . In repeated tests we found that with 20 mw focused on 0.5 m spot on dentin no significant change in the peak intensity or shape spectra were measured at 1 m increments along lines across the dej in the same manner as for nanoindentation testing, yielding compositional information at half the sampling incremental distance of the nanoindentation study . Thus 50 spectra were obtained along each line of each specimen studied, and two or three lines were examined per specimen, so that 100150 spectra per sample were obtained . Raman microspectroscope imaging lines were oriented to coincide with the orientation points placed in the sample by the afm using the microspectroscope's 50x objective lens . The line of raman spectra was offset laterally by 5 m to avoid disturbances that might arise from the plastic deformation induced by the indents . Spectra were acquired for the phosphate (po4) band at 960 cm and the c h stretching mode was chosen for two reasons as described in our earlier work: (1) it had the potential to detect differences in noncollagenous proteins likely to be found in enamel or the dej as well as collagen in the dentin and (2) because the luminescence at the 2900 cm band is much smaller than at other organic band locations (1660 near amide i, 1442, and 1200 cm near amide iii). Thus the background could be subtracted more accurately due to better signal - to - noise ratio . These constituted functional groups from the mineral (phosphate) and organic constituents, respectively . In one sample, one sample that received nanomechanical testing was not examined by raman spectroscopy because of technical difficulties . An estimate of the compositional dej width was then determined for each imaging line using the statistical methods described below . The results were compared to each other and to the nanomechanical results . To avoid the arbitrariness of estimating dej width by viewing graphed data, two statistical methods were developed using the sas programming language . For each method, an algorithm was developed to select data inflection points based on deviations from linear models of the nanomechanical and raman response of dentin and enamel . An inflection point was defined as being the first data point that varied significantly from the linearly modeled response . For the first method, nanoindenter and raman data for dentin and enamel were defined to behave as linear models . To detect the dentin - dej junction, the algorithm was defined to begin at the dentin end of the data and move inward towards the dej . For each point considered, the algorithm determined if the point and the preceding three points were less than the value of the prior cut point, and if the following three points exceeded the value of the post cut point . The first such point under consideration that detected a difference the dej - enamel inflection point, or where the junction ends and enamel begins, was similarly determined . The second method for estimating dej width was based on detecting differences from linear models describing the dej's nanomechanical and raman behaviors . In this approach, mean values for the response of dentin and enamel were initially determined for each data line . The construction midpoint was calculated as the middle of the difference between the mean response values of dentin and enamel . The linear model of the dej's behavior was used for statistical testing to estimate the dentin - dej and dej - enamel borders . In this approach, each point was sequentially examined to determine if it was within the eighty percent confidence interval of the predicted value . Typical curves for normalized hardness, modulus, and intensities of the c h stretch and phosphate band data are shown in figures 2 and 3 . Mineral content was found to decrease monotonically from enamel to dentin, while organic content increased monotonically . Dej width estimates based on hardness were 6.1 (1.9) m according to statistical method 1 and 4.7 (1.2) m according to statistical method 2 . Dej modulus width estimates were 6.9 (1.9) m for method 1 and 4.9 (1.1) m for method 2, respectively . Tests of statistical difference between the mean widths as estimated by either indentation method for each statistical method indicated that the indentation results for hardness and modulus yielded similar and consistent estimates of the functional dej width . Since no statistical difference between the results was noted, we combined the indentation width estimates into a single technique width estimate of 6.4 (standard error 0.63, 95% confidence interval: 49) m according to method 1 and 4.6 (standard error 0.60, 95% confidence interval: 27) m for method 2 . These estimates from combined methods were provided by a general linear model that adjusted for multiple measures made on the same tooth and are contained in table 2 . Dej functional width estimates based on raman - microspectroscopy yielded a phosphate band estimate of 8.0 (3.2) m according to method 1 and 8.5 (3.1) m according to method 2 . H stretching mode width estimates were 7.6 (3.2) m for method 1 and 8.0 (2.6) m for method 2 . Tests of statistical difference between mean dej width estimates for the two raman methods showed no significant difference . As with the indentation data, we combined the two raman estimates into a single microspectroscopy estimate of 7.8 (standard error 0.86) m with a 95% confidence interval of 411 m according to method 1 . The combined estimate (table 2) provided by method 2 is 8.3 (standard error 0.74) m with a 95% confidence interval of 512 m . Dej width estimates based on the two types of measurements, nanoindenter and raman microspectroscopy, did not show a statistically significant difference with method 1, but did show a statistically significant difference according to method 2 (p - value = .035 from sas proc mixed). Taking the lower 95% confidence interval of the smallest estimate and the upper 95% confidence interval of the largest estimate gave a conservative estimate of the width of the dej for each instrumentation method based on multiple measurements . For the indenter data, this range was 29 m; for the raman data it was 412 m . The chemical composition and the mechanical behavior of the dej region were characterized using raman microspectroscopy and nanoindentation testing . Studies using nanoindenation revealed variations of microstructure in calcified tissues such as enamel [29, 30] and the dej . The coupled afm - triboscope system allowed site - specific mechanical property measurements to be made, affording estimates of the functional dej width by spatially mapping the nanomechanical response across the junction . Both instruments tested the same areas of each sample and allowed us to compare and contrast the results . Our current work found consistent mean functional dej width estimates using hardness and modulus of between 4.7 and 6.9 m . The nanoindentation dej width estimates based on hardness data were somewhat narrower than estimates obtained using modulus data, although the difference was not statistically significant . Hardness and modulus were found to vary linearly across the dej and were highest in enamel . The nanomechanical results represent a refinement in the functional width estimates from previous nanoindentation results [12, 13]. This may result from the use of an extremely sharp cube corner tip that allowed shallower indentation depths and smaller sampling volumes to be made . In our study, we also used the nanoindenter to place optically visible sample orientation markers that allowed comparison of the nanoindentation and raman microspectroscopy data . Relatively linear variations in the raman profiles for the phosphate and c h stretching mode peaks were observed across the dej . The phosphate peak, an indication of the mineral content present, was found to be highest in enamel and lowest in dentin . Estimates of dej width based on raman microspectroscopy produced results that were consistent and greater (by approximately 1 m) than those determined from nanomechanical property profiles . The variance of the spectroscopy width estimates was roughly twice that found using nanomechanical testing . The effect of testing direction was not determined for micro - raman width estimates due to insufficient data . The results indicate that the nanomechanical dej width estimates were narrower and less variable than those using raman microspectroscopy . The spectroscopic and indentation data showed monotonic mechanical and spectroscopic property variations across the dej . While it is possible that the observed variation in properties could represent the actual behaviors, it is more likely that what we observed is actually a superimposition or averaging of the dentin and enamel properties . It has a three - level structure consisting of 25100 m scallops that are subdivided by 25 m microscallops and smaller scale structures . Indentations and spectroscopy performed on such a three - dimensional structure may sample varying mixtures of the constituents bordering each side of the interface since sampling occurs over a finite volume . . Sample volumes consisting of two or more phases produce property measurements different from those of the bordering materials . Testing modalities that minimize sampling depth, width, and volume produce more accurate material property measurements having greater spatial resolution . For indentation testing, narrower dej width estimates are dependent upon minimizing indentation depth via the use of sharper indentation tips since they lead to decreased sample mixing and narrower step widths . In this study, we attempted to control the effect of the undulating scalloped architecture of the dej by orienting the sampling lines to cross the dej at a perpendicular angle . It is likely that sampling lines also crossed the scalloped dej at other angles, leading to increases in the size and variability of the functional dej width estimates . Additionally, since approximately 5 m of lateral offset between paired indentation and spectroscopic sampling lines were made, the material sampled by each method was slightly different . The sampling volume we used for raman microspectroscopy was on the order of 1 m . This is 4 to 20 times greater than the nanoindentation sample volumes that were used . The raman sampling volume was less defined than the plastically deformed zone indicative of nanomechanical testing . Coupling the increased sample volumes for raman imaging with the size of the dejs microscallops; it is evident that sample mixing was occurring more often than for nanoindentation testing . It is likely that this is responsible for the narrower dej width estimates obtained from mechanical testing despite the fact that the sampling interval was twice as great . Dej width estimates of 6.1 to 6.9 m based on nanomechanical testing, and 7.6 to 8.5 m based on micro - raman spectroscopic mapping were found for either statistical method used to analyze the results . It is probable that the dej's undulating three - leveled architecture is responsible for many of the observed behaviors . Our results are in line with earlier work and represent a mechanism for linking the physical properties to their composition.
Many different treatment modalities are available for the treatment of urethral stricture disease, such as dilatation, urethrotomy, stent placement, and single or two - stage urethroplasty . Visual internal urethrotomy (viu) is simple and safe, causes minimum inconvenience to the patient, and requires a short time off work . Holmium: yttrium - aluminum - garnet (ho: yag) laser endourethrotomy has an encouraging success rate, especially in those with short stricture segments and in those with primary strictures . The reported success rates after single viu range from 20 to 60% . Viu does not provide an epithelial approximation but rather aims to separate the scarred epithelium so that healing occurs secondarily . If epithelialization progresses completely before wound contraction significantly narrows the lumen, the internal urethrotomy may be successful . If wound contraction significantly narrows the lumen before the completion of epithelialization, the stricture recurs . Injection of steroids at the site of urethrotomy ostensibly prevents scar formation by enhancing endogenous collagenase and thus reducing the contracture rate . In this study we present our results for the use of intra - urethral steroid application simultaneously with ho: yag urethrotomy . After we received approval from the institutional ethical committee, a total of 50 patients with symptomatic urethral stricture (primary or secondary) presenting at our institute from july 2009 to june 2010 were treated by ho: yag urethrotomy with intralesional triamcinolone injection . Patients with completely obliterated urethral stricture and stricture length of more than 3 cm were excluded from the study . All patients were evaluated by complete history and physical examination, urine culture, uroflowmetry, and retrograde urethrography . Patients presenting for the first time for treatment were referred to as primary, whereas those who had undergone some procedure for the treatment of stricture prior to reporting to us were referred to as secondary . A holmium laser at an energy of 1,200 to 1,400 mj with a frequency of 10 to 15 hz was used . This setting of energy and frequency was chosen because it seems to result in a satisfactory compromise of low depth of tissue penetration and low coagulation effect . By use of a 22 f cystoscope and ho: yag laser, the stricture site was completely incised while sparing healthy mucosa . After laser urethrotomy, 80 mg of triamcinolone (diluted with normal saline to 10 ml) was injected by using a williams cystoscopic injection needle (5 f size and 23 g needle size, cook medical inc, bloomington, in, usa) at 10 sites, 1 ml each, along the site of urethrotomy and circumferentially . Retrograde urethrography was done in the postoperative period if the patient developed obstructive voiding symptoms or the flow rate was below 15 ml / sec . Any symptoms pertaining to recurrence were noted, such as reduced stream of urine, retention of urine, and burning micturition . The procedure was considered successful if the patient did not report any voiding difficulty and had a maximum flow rate> 15 ml / sec for a voided volume of at least 150 ml . Urethral calibration or urethroscopy was done in case of voiding symptoms or reduction in maximum flow . Chi - square tests of independence (with fisher exact test where required) were used to test the association of intervention groups with various categorical variables . The mean age of the patients was 42.9 years (range, 14 to 70 years). The baseline characteristics of the patients including etiology, type, location, and length of the stricture are given in table 1 . The mean preoperative qmax was 4.19 ml / sec and postoperative qmax was13.2 ml / sec . We found that decreased stream of urine, frequency, and burning micturition were the most common symptoms with which patients presented . The overall success rate after ho: laser urethrotomy and triamcinolone in our study was 76% . There were no significant perioperative complications related to the procedure . Of the 12 patients who experienced recurrence, 11 (42.3%) were patients with strictures of 1 to 3 cm in length and only 1 (4.2%) was a patient with a stricture length <1 cm (table 1). Thus, the success rate was significantly better in patients with a stricture length <1 cm than in those with a stricture length of 1 to 3 cm (p=0.002). Among the 12 patients in whom recurrence was seen, urine cultures were sterile in 7 of those (58.3%), whereas 33 of 38 successful cases (86.8%) had sterile urine cultures . This was found to be statistically significant by applying pearson's chi - square test (p=0.015). In the logistic regression analysis, in addition to the burden of the disease itself, therapy for strictures can be associated with further complications, the most important being recurrence . Etiologic factors for urethral stricture disease include perineal trauma, urethral catheterization, urologic instrumentation, chronic inflammatory diseases such as lichen sclerosus, and sexually transmitted diseases . However, most cases of urethral strictures are idiopathic, and most patients probably have unrecognized childhood trauma . The first identifiable change in urethral stricture disease is a change in the nature of the urethral epithelium from a pseudo - stratified columnar epithelium to a columnar epithelium that lacks the waterproofing quality of the pseudo - stratified variant . Consequently, urine can extravasate and induce fibrosis . If any medication or intervention can delay wound contraction at this stage, the probability of recurrent stricture may decrease . Steroids are known to decrease the amount of collagen fibers and fibroblasts and to inhibit the proliferation of fibroblasts in wound tissue . Endoscopic urethrotomy was introduced 37 years ago by sachse, who used the cold knife technique . Success rates are unsatisfactory owing to scar tissue, and recurrence rates between 35% and 60% have been reported . In our study including 50 male patients with urethral stricture disease, the success rate was 76%, being 95.8% for strictures less than 1 cm and 57.7% for strictures of 1 to 3 cm . The length of follow - up is very important when assessing the success of internal urethrotomy and the rate of stricture recurrence . Several authors have shown that there is an attrition rate of 10 to 20% per year, which could continue for up to 5 years after viu . Most reports show that if recurrence occurs it is most likely to do so within 3 to 12 months . Rapp et al . In their survey on management trends of urethral strictures found that when stricture length is less than 1 cm, 70% of urologists prefer viu, whereas in cases with stricture lengths of 3 cm or more, most urologists (56%) proceed directly to urethroplasty . For a stricture less than 1 cm with minimal associated spongiofibrosis, viu can have a long - term success rate . On the other hand, stricture excision and primary anastomosis as the initial treatment for a similar 2-cm stricture is highly efficacious (greater than 95%) but unfortunately incurs a higher initial surgical cost . It has been shown that the most cost - effective strategy for the management of short, bulbar urethral strictures is to reserve urethroplasty for patients in whom a single endoscopic attempt fails . For longer strictures for which the success rate of viu is expected to be less than 35%, urethroplasty as the primary therapy is cost - effective ., which investigated the effect of lasers in canine bladder . Over the past two decades matsuoka et al . Commented on the use of holmium lasers for antegrade incisions for various stricture lengths and stated that the lasers can ablate tissue through vaporization with minimal thermal damage to adjacent healthy tissue . Introduction of the holmium laser as a treatment modality for urethral stricture disease has produced good results . Kural et al . In their study on 13 patients reported a success rate of 69% and matsuoka et al in their study on 31 patients reported a success rate of 74% . Hayashi et al . Reported successful treatment of recurrent vesicourethral strictures after radical prostatectomy with a holmium laser . Xiao et al . In 2008 performed ho: yag laser urethrotomy on 38 patients with male urethral stricture disease and after 18 months of follow - up in 32 of those patients, recurrence was noted in only 6 patients, thus giving a success rate of 84% . In a randomized clinical trial, atak et al . Demonstrated the superiority of ho: yag laser urethrotomy over cold knife viu (81% vs. 53% success rate at 12 months, p=0.04). Previously, results have varied pertaining to the role of etiology in the outcome of laser urethrotomy . Higher success rates have been achieved with iatrogenic strictures than with posttraumatic or post - inflammatory etiology . In our study, the etiology of stricture was not found to be associated with the outcome of laser urethrotomy . In our study, the recurrence rate was found to be independent of the age of the patient, duration of symptoms, etiology of stricture, type of stricture (whether primary or secondary), and location of stricture (whether penile or bulbar urethra), whereas the factors that affected outcome were length of stricture and urinary infection . Long strictures are often associated with inflammatory diseases, repeated urethral dilations and instrumentations, history of prolonged urethral catheterization, and/or traumatic urethral distraction . Ninety - five percent of the total recurrences in our study were seen in patients with strictures of 1 to 3 cm in length . In the study by kamp et al ., most of the recurrences were seen in patients with long - segment strictures of> 1.5 cm . Our result of better outcome in strictures less than 1 cm is in accordance with a study done by rourke and jordan, who showed that initial therapy with direct urethrotomy would be beneficial in strictures less than 1 cm, with minimal associated spongiofibrosis . . Also reported better outcome in short strictures of <1 cm (recurrence 4.2%) as compared with longer ones (recurrence 42.9%). Several studies have shown that shorter strictures respond to endoscopic intervention more readily than do longer strictures, and success rates as high as 85 to 87% have been reported for strictures shorter than 1 cm . We included patients with strictures longer than 1 cm in our study only when they refused urethroplasty because of preference for minimally invasive surgery or socioeconomic reasons after the pros and cons of both options had been fully explained . Pansadoro and emiliozzi demonstrated a high recurrence rate for strictures greater than 1 cm in size . Recurrence rates range from 51 to 72% in the various studies [20 - 22]. Compared with these studies, the vaporization of the fibrotic segments by laser may have played a role in the lower recurrence than in other studies . However, these results need to be reproduced in other studies to validate the utility of this modality in the treatment of long - segment strictures . Urinary tract infection in the perioperative period was found to affect the results in our study . Five out of 12 total recurrences had positive urine cultures (41.7%), whereas only 5 of 38 successful patients had positive urine cultures (13.2%). Boccon gibod and le portz reported that length, location, cause of stricture, and urinary tract infection were factors affecting the outcome . Some of our patients continued to have positive urine cultures despite being treated with culture - specific antibiotics, because the stricture itself was the cause of the persistence of bacteriuria . It remains to be seen whether inserting a temporary suprapubic catheter to clear urinary tract infection before urethrotomy will improve success rates . The presence of prior colonization in the face of multiple interventions or the infection - related reaction of the local tissues may influence the extent of injury and reaction of the spongiosa and thus increase the incidence of spongiofibrosis . Previous interventions in the form of dilatations or urethrotomy have a significant effect on the outcome as shown in studies by niesel et al . And boccon gibod and boccon gibod . In our study of 29 primary cases, recurrence was seen in 5 patients (17.4%), whereas among 21 secondary cases, recurrence was seen in 7 patients (33%). However, the difference was not statistically significant . Moreover, 62% of the primary strictures were of <1 cm, whereas only 28.6% of secondary strictures were <1 cm . This could well explain the small difference in outcome in the patients with primary and secondary strictures . Various attempts have been made to reduce the recurrence noted with viu, such as repeated multiple incisions in the circumference of the stricture, combining urethrotomy with hydraulic self - dilatation, endoscopic resection of callus, intraurethral mitomycin c, intraurethral captopril gel, intraurethral hyaluronic acid, and urethrotomy combined with postoperative intermittent dilatation by clean intermittent self - catheterization . The mechanism of action of topical steroids remains largely unknown; the effect is probably due to the inhibition and down - regulation of collagen synthesis . Also, steroids increase the activity of collagenase enzyme, which breaks down collagen so that scars become less thick . Topical corticosteroids improve meatal elasticity, which in turn facilitates calibration / dilatation, and prevents the formation of meatal stenosis . Nabi and dogra supported the use of intralesional steroid with the nd: yag laser in the treatment of traumatic prostatic and supraprostatic strictures . In their study at a mean follow - up of 23 months, all three patients were asymptomatic and voiding well and were found to have normal results on cystoscopy, urethroscopy, and uroflowmetry done at 3 months . Compared patients undergoing clean intermittent catheterization with or without triamcinolone ointment following internal urethrotomy . At a follow - up of 12 months, recurrence was noted in 30% in the triamcinolone group compared with 44% in the other . In a small series of 24 patients, eltahawy et al . Used holmium laser bladder neck incision combined with steroid injection for anastomotic stenosis after radical prostatectomy and had a success rate of 83% . In our study, 21 patients had received treatment earlier in the form of dilatation or viu . Those patients had a reasonable success rate of 66%, thus proving the role of ho: yag laser and intralesional steroids in recurrent strictures also . The limitations of our study include a relatively small number of patients and a relatively short follow - up period . The mean follow - up of 16.4 months covered the critical period of stricture recurrence in the study by gucuk et al ., because the majority of recurrences were seen at 18 months . A further limitation is the absence of control groups . A larger, randomized controlled study with longer follow - up is required to confirm these findings and to establish the overall efficacy of triamcinolone and ho: yag laser urethrotomy . Ho: yag laser urethrotomy with intralesional triamcinolone is a safe and effective minimally invasive therapeutic modality for urethral strictures . The addition of triamcinolone to ho: laser therapy is easy and of low cost . This procedure has an encouraging success rate especially in those with short - segment strictures (<1 cm). The outcome of ho: yag laser urethrotomy does not depend on age, duration of symptoms, type of stricture, or location of stricture . Stricture length and preoperative positive urine culture have an important bearing on the outcome . For curative, long - term effects, this technique deserves to be tested on a large group of patients with special emphasis on objective verification of the safety and efficacy profile . The 66% success rate in patients who had received prior treatment in the form of dilatation or urethrotomy in our study shows that ho: yag laser urethrotomy can be reasonably effective in secondary strictures also . The precise tissue ablative property of the ho: yag laser along with the scar - preventing activity of triamcinolone by virtue of down - regulating collagen synthesis makes up an effective treatment modality for short - segment urethral stricture disease.
An increase in the consumption of fruits and vegetables is associated with a decrease in the incidence of cardiovascular disease and reduced risks of certain cancers . Citrus fruits and derived products have a beneficial effect on humans [1, 2]. Oranges are a rich source of flavonoids that are bioactive and may protect against age - related diseases . The absorption of orange flavanones may be affected by factors such as processing, plant species, and geographic sources . Additionally, the bioactivity of the absorbed phytochemicals depends on how they are metabolized during absorption . Several analytical methods have been applied to qualitative and quantitative flavonoid determination, especially hplc in conjunction with diode array detection and mass spectrometry, as in honey, citrus grandis, grapes and teas, scutellaria baclensis, glycyrrhiza uralensis, g. glabra and g. inata, blueberries, cultivars of clementine mandarin, satsuma mandarin, hybrid mandarin, navel orange, common orange, and pigmented orange, citrus species, grape cultivars, and orange and grapefruit juices . In the present paper, the flavanone contents (hesperidin, naringin, naringenin, and poncirin) of commercial and homemade orange juice originating from different places in brazil were evaluated . The data were processed using principal component analysis (pca) to test homogeneity of the analytical results as well as identify outliers that should be removed from the data set to obtain representative values for flavonoids in brazilian orange juice . In recent years, this technique has been used for the evaluation and characterization of different kinds of food [13, 14]. Standards for hesp (hesperitin-7-o - rutinoside or hesperidin), narg (naringenin), nar (naringenin-7-o - neohesperidoside or naringin), and pon (isosakuranetin-7-o - neohesperidoside or poncirin) were obtained from sigma (st . Louis). Methanol and acetic acid reagents were obtained from j. t. baker (phillipsburg, nj). All solvents employed were hplc - grade and ultrapure (milli - q) water was used . Six samples (16) of orange juice were hand - squeezed (domestic processing), six samples (3136) were obtained from a fresh - in - squeeze machine, and 24 industrial samples of orange juice were purchased from markets in the bahia and so paulo states (brazil). These 36 samples of orange juice were obtained during 2008 - 2009 and all belonged to the sinensis variety, a common orange juice source in brazil . The juice samples were prepared using the adapted liquid - liquid continuous extraction shown in figure 1 . Aliquots of 400 g of orange juice were mixed with 300 ml of ethyl acetate (etoac). After extraction, the analyte samples were obtained by evaporation to dryness at 40c under vacuum . After the residues were filtered through 0.22 m filters, they were dissolved in 10 ml of methanol before hplc detection . Hplc - dad analysis was performed on a shimadzu liquid chromatographic system (kyoto, japan) equipped with a rheodyne injection valve with a 1 l fixed loop, an scl-10 avp pump, and an autosampler . The flow rate was 0.3 ml / min, and a thermostated column oven was used with a reverse - phase c18 purospher star tracer 3 m (55 4 mm) (merck, germany) column with sample and column temperatures of 5 and 25c, respectively . Compounds were monitored at 240 and 280 nm using a uv - vis photodiode array detector (shimadzu model spd - md), and uv spectra were recorded from 200 to 400 nm and were controlled by a gpc / lc solution workstation (version 1.21 sp1). A gradient mobile phase consisting of methanol (solvent a) and acid h2o (1.0% acetic acid) (solvent b) was used for hplc analysis . The conditions were as follows: initial conditions of 20% a for 5 min, followed by an increase to 60% a for 10 min, 80% a for 20 min, and 60% a in the following 40 min, and then back to the initial conditions for 10 min . Compounds were identified by comparing their retention times (rt nar = 9.0 min; rt hesp = 15.0 min; rt pon = 17.0 min; rt narg = 22.0) and their uv - vis spectra with corresponding standards . Usa) was used to treat the data for basic statistical parameters and principal component analysis (pca). Each principal component is an eigenvector of the correlation matrix of the standardized original data and is a linear combination of the original variables . One - way anova was used to estimate significant differences for the calculated data means . The analytical curves were constructed using standard solutions in the 60300, 0.010.09, 0.050.25, and 0.050.30 mg 100 g ranges for hesperidin, naringin, naringenin, and poncirin, respectively . The analytical curves exhibited excellent linear behavior over the concentration range . The limits of detection (lod), calculated as the minimal concentration corresponding to 3.3 (sd / s), with sd being the standard deviation of the blank and s the slope of the standard curve, were 0.0037, 1.87, 0.0147, and 0.0066 mg 100 g for naringin, hesperidin, poncirin, and naringenin, respectively . The limits of quantification (loq), calculated as the minimal concentration corresponding to 10 (sd / s), with sd being the standard deviation of the blank and s the slope of the standard curve, were 0.0089, 7.84, 0.0302, and 0.0200 mg 100 g, respectively, for naringin, hesperidin, poncirin, and naringenin, respectively . The calculated values were confirmed with actual analytical values under the established chromatographic conditions . The accuracy of the method was verified in recovery tests using flavanone samples spiked with 60 mg 100 g of hesperidin and 0.30 mg 100 g of flavanone standards (naringin, naringenin, and poncirin). The mean recoveries were 101, 107, 103, and 98%, for naringin, hesperidin, poncirin, and naringenin, respectively . The linearity of the hplc method was checked in the 60300 mg 100 g range for hesperidin and the 0.010.09, 0.050.25, and 0.050.30 mg 100 g ranges for naringin, naringenin, and poncirin, respectively . Calibrations were performed by injection of the standard working solution in triplicate at five different concentrations for each flavanone based on the expected flavanone content ranges in the samples . All standard curves passed through the origin were linear in the concentration ranges expected for the samples and had coefficients of determination ranging from 0.9986 (for naringin) to 0.9999 (for naringenin). The flavonoids present in the brazilian orange juices were separated by hplc and the uv spectra of the different peaks were recorded . The chromatographic conditions allowed for good separation of most of the peaks in the chromatogram . A characteristic hplc - dad chromatogram of the etoac extract of orange juices recorded at 240 nm is presented in figure 2 . Diode array detection (uv spectra recorded from 200 to 400 nm) allowed characterization of the phenolics, which were mainly flavonoids . Definitive identification of some of the flavanones was performed by spiking experiments with authentic compounds . The results of the determinations of hesperidin, poncirin, naringin, and naringenin in the 36 orange juice samples are summarized in table 1 . Among these four analytes, the average content was 69.85 mg 100 g, and the concentration range found was from 18.80 to 139.00 mg 100 g. it is worth noting that the industrial orange juices showed high contents of hesperidin (samples 7 to 31). The presence of this compound is important for juice quality, as hesperidin is known to have antioxidant, anti - inflammatory, antiallergic, and immunomodulatory activities, while naringenin is involved in some pharmaceutical metabolism (e.g., dihydropyridines) and decreases the half - life of medicines that are dependent on cytochrome p450 [1517] and lower blood lipid and cholesterol [1820]. Naringin, naringenin, and poncirin showed lower concentration levels in the orange juices; the average contents and concentration ranges found were 0.019 and 0.010.30, 0.12 and 0.10.17, and 0.13 and 0.010.36 mg 100 g, respectively . The results of the flavanone determinations for the 36 juice samples were analyzed using the multivariate principal component analysis (pca) technique . This statistical tool was employed to evaluate the extraction tendencies and the quantification of the flavonoids . A data matrix was constructed using the flavanone concentrations as columns and the orange juice samples as rows . The results of the pca revealed that the first two principal components explained 79.34% of the total variance . Pc1 accounted for 47.72% of the variability in the data, mainly related to the poncirin, naringenin, and naringin concentrations . The score plot (figure 3) did not show well - defined data clustering of the samples with scores on pc1 (1, 2, and 3, all circled in figure 4). Finally, the second principal component (pc2, describing 31.62% of the total variance) was primarily associated with variations in the hesperidin and naringin concentrations . Thus, the samples corresponding to points located at the top of the score graph in figure 3 had high contents of these flavanones . According to gattuso et al . The distribution of the samples throughout pc2 was relatively uniform, showing that the concentrations of theses flavanones have continuous distributions throughout the juice samples . This paper reports determination of the flavanone composition (hesperidin, naringin, naringenin, and poncirin) in orange juice . The pca technique showed that poncirin, naringenin, and naringin were the principal elements that contributed to the variability in the samples . These results suggest that flavonoid contents are more expressive in industrial samples maybe due to the mechanical process of obtaining the juices.