title
list | over_18
list | post_content
stringlengths 0
9.37k
⌀ | C1
list | C2
list | C3
list |
|---|---|---|---|---|---|
[
"How does the human body get rid of particulate matter in the air?"
] |
[
false
] |
So I was spraying some DE into some spots in my house to get rid of some bugs and realized that there was a lot of dust being blown into the air. I did some research on the web to see if anything bad could happen and discovered this thing called Silicosis. Looking further, it made me wonder how the human body usually gets rid of the crap that we breathe into our lungs?
|
[
"Most particles (like dust) are quite large, and will be caught in mucous in upper areas of the airways. Generally I believe this will be expelled eventually as mucous, by coughing, sneezing, etc., but some may be ingested and excreted this way.",
"Very fine particles can penetrate deeper into the lungs, and those that infiltrate the alveoli can generally enter into the bloodstream from here. These are more difficult to speak generally about - depending on the substance, it may accumulate in the body, it may be easily excreted, or it may cause cellular effects before being excreted quickly or slowly.",
"For example, asbestos may enter into the cells in the lungs and cause destructive processes to occur to the chromosome of the cell, potentially causing cancer. It seems to be excreted mostly in the faeces in a relatively short period of time. However, you could in theory have fine particles of heavy metals, and other chemicals, that may accumulate in certain areas of the body, may be excreted very slowly, etc. etc.",
"But generally, unless you're talking about very fine particles, it gets caught in mucous in and around the bronchi, and this mucous gets swept up towards the mouth to be coughed out/ingested then excreted."
] |
[
"For example, asbestos may enter into the cells in the lungs and cause destructive processes to occur to the chromosome of the cell, potentially causing cancer. It seems to be excreted mostly in the faeces in a relatively short period of time. However, you could in theory have fine particles of heavy metals, and other chemicals, that may accumulate in certain areas of the body, may be excreted very slowly, etc. etc.",
"Asbestos fibres (depending on their geometry) can actually be retained because they are too ",
". They are too large to be phagocytysed and cause lasting inflammation/free radical generation and can cross into the pleura. This way asbestos can lead to cancer.",
"This paper contains a nice overview of how asbestos can cause harm: ",
"https://www.ncbi.nlm.nih.gov/books/NBK20336/"
] |
[
"I thought asbestos was small enough to enter deep areas of the lungs, and large enough to be retained inside cells? Or do you mean that they remain extra cellular the whole time? I didn’t study this much and haven’t read into it much since, so my understanding could well be very wrong. I’ll have a read of the paper now, thanks!"
] |
[
"If humans were to become a multi-planet species, could humans on Planet A and humans on Planet B eventually become two separate species over a vast length of time in two possibly different environments?"
] |
[
false
] | null |
[
"If humans were to become a multi-planet species then one would assume that they would be able to exchange genetic material between the populations on the various planets. The only way they would ever diverge into separate species is if the planets were somehow reproductively isolated from one another for a ",
" long time. Long enough for the two populations to somehow evolve innate barriers to reproduction. ",
"So the only way this could really happen would be if humans gained and then lost the ability to travel between planets. If all of the populations were reproductively isolated, then they would probably speciate given enough time. "
] |
[
"Not necessarily, it's more complicated than that.",
"Suppose humans exist on three planets. The humans on planets A and B can reproduce, and the humans on B and C can reproduce; but the humans on A and C cannot.",
"The problem is that \"are the same species\" is necessarily transitive (if A and B are the same species, and B and C are, then A and C must be). But ability to reproduce together is not. There are analogs of this situation among populations of animals on Earth."
] |
[
"Yes, although I'll leave it to a biologist to explain at what point we'd be considered different species. But obviously, so many creatures coming from common ancestors, there was a point at which we were the same species."
] |
[
"How is the evolution of animals such as bees and ants influenced by the low percentage of induviduals who can reproduce?"
] |
[
false
] | null |
[
"Pretty much the same way that evolution of multi cellular organisms are influenced by the low percentage of cells that reproduce.",
"Germ-line cells such as those that make sperm and eggs are the only cells in our body that make it to another generation. The Somatic cells, which contain the exact same genetic sequence, helps the overall fitness of the organism such that the genes are passed on.",
"In colonial organisms, you can think of the entire colony as a single organism. The mother (queen) makes a lot of children that serve her and the colony as a whole. Some of these offspring are able to reproduce, but the health of the colony is important for them to do so.",
"The genes that are active in the workers are not always identical to those in the young queens, but they are closely related. So genes which \"altruistically\" help the new queens survive to courtship often survive into the next generation anyway."
] |
[
"When you're talking about the evolution of bees and ants you're essentially thinking of every colony as a \"superorganism\", with all the inhabitants operating as a single entity and reproduction occurring via queens and drones. The fact that ants can sometimes select a new queen complicates the model somewhat. But the total number of colonies is still fairly large and the lifetime of a queen not particularly long, so it's not like they're falling behind evolutionarily compared to other animals."
] |
[
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2781879/",
" -- check out this article"
] |
[
"Do super symmetrical particals have antimatter counterparts?"
] |
[
false
] |
In the SS model, are anti-sleptons and anti-squarks a thing?
|
[
"Except for particles that are their own antiparticles, just like for normal particles."
] |
[
"Yes."
] |
[
"Wait what? How can that be a thing? I thought the whole point was they cancel out. Wouldnt that just be nothing? Or do they have energy cancel them out somehow?"
] |
[
"What causes the difference in sound heard between a rumbling and a crackling lightning strike?"
] |
[
false
] |
[deleted]
|
[
"Several factors affect the sound of thunder, most of which have to do with the path that the sound takes from the lightning bolt to your ears.",
"A lightning bolt can be several kilometers long, so the thunder generated from the point nearest to you can reach you as much as 20-30 seconds before that from the point furthest from you.",
"But that's assuming straight-line paths. Thunder can bounce several times off the ground, buildings, trees, even layers of air, before it reaches your ears. As a result, a big lightning discharge might trigger thunder that continues to roll for a minute or more.",
"In contrast, consider a lightning bolt that strikes perhaps a quarter of a kilometer away, with the lowest part of the bolt running roughly perpendicular to you. Since the entire nearest section is almost equidistant, all the thunder generated by that part of the flash will reach your ears at the same time less than a second later, with very little reflection due to the short straight-line distance. What you hear is less like a rumble and more like an earth-shattering kaboom.",
"Hope this is helpful."
] |
[
"Are higher frequencies somehow filtered away over distance",
"Yes, higher frequencies push the air molecules back and forth faster, so they lose more energy to dissipative effects."
] |
[
"That's exactly right. My bad, I'm so used to that concept that I think of it as self-evident.",
"As an aside, that's part of the reason why the positioning of tweeters/midrange speakers is critical in a home theater system, while the subwoofers can be placed almost anywhere."
] |
[
"Why is neutron decay inhibited by being in a nucleus?"
] |
[
false
] |
Title says it all. Why do protons stop neutrons from decaying?
|
[
"Pauli exclusion principle",
".",
"A free neutron decays because it forms a proton, electron, and electron anti-neutrino, which combined have lower energy than the original neutron.",
"But in a nucleus, with a bunch other protons hanging around, the exclusion principle limits the energy states the newly formed proton can occupy, forcing it to an orbital with a higher energy level. If that level is gives the decay products more energy than the original neutron, then the decay cannot occur."
] |
[
"I could not explain better. Although I can add a simple example to analyze the balance of energies, the deuteron (proton-neutron pair):\nIf the neutron in the deuteron were to decay to form a proton, electron and antineutrino, the combined mass energies of these particles would be\n2x(938.27 MeV) + 0.511 MeV = 1877.05 MeV\nBut the mass of the deuteron is 1875.6 MeV, implying that, upon energy grounds, it is stable agains such a decay! :D",
"The stability of the proton-neutron combination is fundamental to understanding the current configuration of the universe. In the early universe is assumed that there were equal numbers of protons and neutrons. This was because the energy was sufficient to induce the transformation of protons to neutrons, supplying neutrons transforming into protons. When the temperature/energy of the universe dropped to a point where the neutron and proton transformation was unusual neutrons should have disappeared in about 10.6 minutes, but by binding protons (which was already done possiblm by universe low energy ) they became stable, securing the current proton/neutron ratio."
] |
[
"Sorta-kinda yea. For small reasonably stable nuclei, one can approximate the nucleon-nucleon potential with a 3d harmonic oscillator potential which has discrete energy levels sort of like the 1/r atomic potential. The number of protons (or neutrons) to fill a shell is different than in the atomic 1/r potential, the first few numbers being 2, 8, and 20.",
"One can understand the stability of the helium nucleus as the equivalent of the \"1s\" state is filled by the 2 protons and the 2 neutrons.",
"As you move away from stability, this simple model becomes a poor approximation, and one has to use quantum many body theory, such as Hartree-Fock or density functional, and also take into account very significant 3 nucleon interactions."
] |
[
"What happens when a neutrino or antineutrino collides with a nucleus?"
] |
[
false
] |
We know in beta decay of the beta minus kind we have a neutron decaying to a proton, electron, and antineutrino of the electron flavor. Beta plus decay occurs with a proton decaying to a neutron, positron, and neutrino of the electron flavor. Are there any interactions associated with an electron neutrino or antineutrino interacting with a proton or neutron?
|
[
"When a neutrino or antineutrino encounters a nucleus, the chance of a non-trivial is interaction is small, but non-zero.",
"Two processes that can occur:",
"neutron + neutrino --> proton + electron ",
"proton + antineutrino --> neutron + positron"
] |
[
"It's worth noting that all (I think?) reactions in particle physics are reversible - you'll hopefully notice that both of fishify's interactions are the reverse of Beta decays!"
] |
[
"That would ",
"explain this"
] |
[
"How have scientists improved the efficiency of solar cells in the past, and how are scientists trying to improve the efficiency of solar cells today?"
] |
[
false
] |
Like, what specifically do solar researchers research on a day-to-day basis, and what strategies have they tried in the past? Also, what majors could I work toward in college if I wanted to help develop more efficient solar cells? (I'd guess electrical engineering or materials science, or even like physics or something, but I am not sure.) Thank you
|
[
"Broader absorption spectra (utilizing deeper absorption into UV and less selective about wavelengths in the visible spectrum) has increased the amount of raw energy collected. Otherwise, I'm sure advances electrical engineering has improved the efficiency of power distribution. ",
"If you want to work on solar technologies, I would recommend solid state physics and material science."
] |
[
"I've read of improvements in the surface area of the panel by making them bumpy",
"Why do you believe increasing the surface area of a cell would increase its performance? I mean, I'm pretty sure I know what you're referring to, which is the texturing of Si cells with an acid wash, but the purpose of that isn't to \"increase surface area\" but rather to both increase the chance of total internal reflection of light ALREADY in the cell that hasn't been absorbed and thus giving it a higher chance of not escaping and instead bouncing back in for another go at being absorbed and to allow reflection at the surface to potentially \"get another go\".",
"The purpose is for so-called \"light trapping\":",
"https://www.pveducation.org/pvcdrom/design-of-silicon-cells/light-trapping",
"It's not like a chemical reaction or something where you're trying to maximize surface area per crose-section."
] |
[
"Otherwise, I'm sure advances electrical engineering has improved the efficiency of power distribution.",
"Yep! Overall efficiency has had a more positive benefit, but in some markets (like home solar) the engineering has had a much larger impact. For instance ",
"MPPT controllers",
" and other smart improvements have increased the real-world efficiency a great deal. Solar cells are very quirky to use as a power source- the voltage changes over time, the efficiency drops off if you draw too much or too little current, and if you have a bunch of cells in series but a single cell is shadowed or covered by leaves then the efficiency of the whole array falls to single digits. Smart controllers solve all those problems, and there's still lots of room for improvement as scale of production increases and makes finer-grain controls affordable.",
"If you want to work on solar technologies, I would recommend solid state physics and material science.",
"And a ton of research work and probably a PhD. With a BS, masters or PhD in EE you could also do a lot in industry, but you'll probably need a doctorate for physics or materials in academia or industry (AFAIK)."
] |
[
"What do you all think about extraterrestrial life? Do you believe there is life outside of Earth? Not necessarily intelligent life, just any life at all."
] |
[
false
] |
Ive read some articles online which claim the discovery of microfossils with proof of life, but it seems to be a pretty hotly debated topic.
|
[
"It is incredibly naive to think that we could be the only life form outside of Earth."
] |
[
"I say yes, but I am not even close to an expert, it just seems that with the size of the universe and the amount of stars and planets that life has to be possible somewhere else."
] |
[
"There isn't any strong evidence for life on Martian meteorites - but with the sheer vastness of the universe, there is bound to be life out there somewhere."
] |
[
"How many live plants would I need to have in my house for there to be an appreciable improvement in air quality versus outside?"
] |
[
false
] |
Kind of a random question but I can't stop thinking about it
|
[
"It's speculated that, in an airtight room, you'd need around 300-500 decent sized plants. Each leaf gives around 5ml o2/hr, the safe level for a human is about 50 liters per hour. Seeing as you're not in airtight room, I'd say anything from 30-50 would be an improvement.",
"Some things to consider, though, it wouldn't be quality, as much as quantity. Plants don't do a great job at filtering impurities in the air.",
"Hope it helps."
] |
[
"http://en.wikipedia.org/wiki/NASA_Clean_Air_Study",
"I don't know if you were looking for increase in oxygen or increase in air filtration, but this wiki page has the chart of beneficial air plants tested by the NASA clean air study. It doesn't say how many you need per space, but I remember the official NASA report did go into those details. (though I can't remember where I saw the official report - sorry!)"
] |
[
"Until the oxygen levels become too high and then most organisms start dying off. That actually happened (one of the 5 major extinction events) a long time ago; high oxygen levels killed most of all life on earth because O2 is such a ridiculously reactive molecule. If you up the concentration enough you could clap your hands to cause ",
" sparks."
] |
[
"if you eat someone with HIV can you catch it? (serious question)"
] |
[
false
] |
I'm not joking. I've been trying to ask people this question for several years. I'm not planning on eating anyone, I'm just curious. I know HIV can be transmitted through sex or through injections with needles, but not from kissing etc. But what if the person's blood got inside your body, like if you drank it? I don't know that much about the digestive system, and it would be great if someone wanted to share his/her expertise.
|
[
"I thought that stomach ulcers was a possibility. thanks for the info. "
] |
[
"Hi! Welcome to ",
"/r/AskScience",
"!",
"In this subreddit, we enforce a policy where top-level comments (direct replies to the original post) must be factual answers to the question, preferably with citations, or follow-up questions. I know, I know, rules on the internet are boring, but it's part of what makes this particular community so great.",
"Check out the sidebar and ",
"guidelines",
" for more information! Or take a look at the ",
"Welcome",
" thread."
] |
[
"How is it not factual? I didn't cite my source? Cite a source where someone ate a person with HIV. This is a hypothetical question I would hope. Right? "
] |
[
"What is my width in the time dimension?"
] |
[
false
] |
[deleted]
|
[
"With the currently accepted definitions of \"past\" and \"exist,\" No. It's simply a measurement."
] |
[
"With the currently accepted definitions of \"past\" and \"exist,\" No. It's simply a measurement."
] |
[
"Let's assume your lifetime is 75 years. That's about 2.4E9 seconds. Since we're going to talk about spacetime, let's use a sensible system of units that measures spatial and temporal dimensions the same. Meters is fine for that, so we have to convert seconds to meters. The conversion factor to convert seconds to meters is 3.0E8 m/s. So your width in the time dimension is then 7.2E17 m. ",
"Bet you didn't know you were such a skinny worm in spacetime, did you?"
] |
[
"Why did I taste salt when my PICC line was flushed."
] |
[
false
] |
As the title says, I had a line and when it was flushed with saline solution, I could immediately taste salt. Literally the instant the nurse put her/his thumb on the plunger of the syringe, I could distinctly taste salt. Every doctor and nurse I talked to said that this was normal but no one seemed to have an explanation. Any thoughts?
|
[
"Saline solution injected through a PICC line would never come in contact with the tongue."
] |
[
"Saline solution injected through a PICC line would never come in contact with the tongue."
] |
[
"The same salt that activates your taste receptors on your tongue can activate them by carrying the substance through your bloodstream and to the receptors in the tongue.",
"DMSO is a cool chemical that does something similar. It acts as a penetrating agent where if you put it on your skin, it will penetrate through, get into your bloodstream, and wind up on your tongue giving a garlic taste."
] |
[
"When a charged particle accelerates under an applied electric field, what's 'pushing' it?"
] |
[
false
] |
I'm confused as to how a field mediated by photons would impart a force on a charged object. For instance, why should a larger charge result in a larger resultant force? What's actually going on when the particle starts to accelerate under the influence of the field?
|
[
"I absolutely love Feynman's explanation of this: ",
"https://www.youtube.com/watch?v=MO0r930Sn_8"
] |
[
"I absolutely love Feynman's explanation of this: ",
"https://www.youtube.com/watch?v=MO0r930Sn_8"
] |
[
"The electric field is created by charge, so other charges push the accelerating charge. The accelerator also pushes back, but charges in a wire for example have things to bump into and keep them trapped.",
"At the Feynman diagram level, an electron or quark emits/absorbs a (virtual) photon which the accelerating charge absorbs/emitted. This is responsible for pushing and pulling (virtual photons can carry momentum opposite their direction of travel)"
] |
[
"What time period show the first evidence of humans(or previous ancestors) wearing clothes or at least hiding their genitals?"
] |
[
false
] |
Title basically says it all.
|
[
"According to Scientific American approximately 83000-170 000 years ago (section Clothing in the middle of the text). ",
"http://blogs.scientificamerican.com/guest-blog/2011/02/14/of-lice-and-men-an-itchy-history/",
"The original study is here.\n",
"http://mbe.oxfordjournals.org/content/28/1/29.full"
] |
[
"If you're really interested, do some research on the molecular clock of divergent species of lice. I heard some stuff on a radio program or something, I honestly don't remember the source, but the gist of it was that by counting the mutations between head, body, and pubic lice, they got an idea as to when clothing made a separate environment for the separate populations of lice."
] |
[
"I came across similar information, but it was used to determine when most of our body hair was lost (creating separate niches for head lice and pubic lice), not when we started wearing clothes. Do you remember the logic behind the argument you heard?"
] |
[
"What's a good solvent to dissolve aspirin in and why?"
] |
[
false
] |
[deleted]
|
[
"I don't think an Asprin pill can be completely dissolved. It should dissolve in water, or warm/hot ethanol because the basic medicinal component is an acid and so is polar, but the filler that is used to bulk up the pill is something else and, honestly, it's probably water soluble too, but you may need to increase the temperature.",
"I bet that if you weighed the pill, crushed it up and boiled it in water for a while and then weighed the residue you'd probably find it weighed less than the original pill.",
"High school chemistry's a bitch ain't it?"
] |
[
"The filler in most pills (in the UK at least) is starch."
] |
[
"dichloromethane",
"But it is an excellent solvent, and we actually did an ASA purification lab, and this was the solvent we used. It is a volatile compound, has a low boiling point, it is also used to decaffeinate tea.",
"I am sure there is someone here who could explain in better terms why it is a good solvent."
] |
[
"Is there a specific amount of water that needs to be drunk to re-hydrate after drinking a shot of vodka?"
] |
[
false
] |
So, for example, if I drink 1.5 oz of 80 proof vodka (and I'm not sure if different vodkas would dehydrate one's body differently), is there a specific amount of water in ounces to drink to bring the body back to pre-vodka shot levels? Would different hard alcohols change that number?
|
[
"Your brain regulates the amount of water via your kidneys. Once you start drinking alcohol you interfere with these signals, basically giving your kidneys the command to \"flush\". So it is not a matter of water/alcohol, as any water you will drink whilst this function is not working properly will also be flushed out. "
] |
[
"To expand on this, alcohol inhibits vasopressin, which causes fewer aquaporins to be inserted in the collecting duct, thus less ability to reclaim water from urine on the way to the bladder. Most people will notice increased urine production higher than the amount of fluid consumed while drinking.",
"The precise amount of water lost would be dependent on the homeostatic state of the organism and not easily determinable."
] |
[
"Does this mean drinking water while getting drunk to prevent a hangover is an exercise in futility?"
] |
[
"Does the size or speed of an object have any effect on the sonic boom it creates (and we see/hear) when passing the sound barrier?"
] |
[
false
] | null |
[
"Just as interesting is subsonic objects can produce sonic booms as well. Depending on their shape, certain places can force the air to travel faster than the speed of sound around them causing shockwaves even if the object itself is traveling less than the speed of sound. "
] |
[
"Sure. The detailed geometry matters, too. In general everything that sticks out can produce its own sonic boom. The nose always sticks out, but there can be more. Two examples: The Space Shuttle produced a double sonic boom, the rocket boosters of Falcon 9 produce three sonic booms. ",
"Article discussing them",
". How loud a sonic boom is depends on the speed, size and shape of the object."
] |
[
"There is a misconception in your question, that an object creates a sonic boom when it passes through the sound barrier. In fact, one or more cones of compressed air (depending on the size and geometry) continually trail behind a supersonic object as it travels. When that cone (or cones) sweeps over your position on the ground, you hear a sonic boom."
] |
[
"Why when you turn the steering wheel of a car slightly at high speeds it makes a big difference yet not so much at slow speeds?"
] |
[
false
] | null |
[
"You get tricked by your brain.\nTurning the wheels on a car gives it a change in direction. But this change will only accour, if you travell in a direction. See it as change per meter travelled.\nAt higher speeds you travell a higher distance in the same time, therefore with constant change per meter travelled, you will see a higher total change in the same time as travelling with slower speeds.\nBut looking from above, you will not see any difference in the path the car takes with a constant change rate, it only takes longer to travel.\nSo, the whole point is the time the action needs causing you to think of it as a \"bigger\" difference."
] |
[
"I don't think this is really a case of being \"tricked\" by your brain. If you turn the wheel by a certain amount, you establish a turning radius (more or less). At a higher speed, you will move faster to the side, and you'll feel more acceleration.",
"If you look at a maneuver like a lane-change, it's true that the path the car takes is (ideally) the same, regardless of what your speed is. On the other hand, the amount of time it takes to change lanes is inversely-proportional to your speed. ",
"Say you turn the wheel a certain amount, which makes you travel 1 meter to the right for each 10 meters the car moves forward. If you're moving forward at 1 m/s (3.6 kph), it'd take 30 seconds to make a 3-meter lane change. The same displacement of the wheel at freeway speed (100 kph) will make the lane change in 1 second.",
"Since the centrifugal force is also proportional to the speed, you'll feel a definite pull when making a lane-change at freeway speed that you wouldn't at a lower speed. In fact, there are maneuvers that you can safely perform at low speeds that will exceed the grip of the tires if you're going too fast."
] |
[
"Short answer: yes.",
"Long answer: There will be differences if the speeds are to different, problems like understeering or oversteering, loosing friction(drifting or gliding) and some other wierd and wonderfull stuff."
] |
[
"Can blood vessels (particularly veins) feel pain?"
] |
[
false
] |
Literature seems to suggest that blood vessels do have nociceptive innervation, but Werner Forssman, the first person to insert a catheter into his heart from a vein in his arm reported feeling no pain, only a sensation of warmth. Some reports explain this by saying he was just learning that "nature keeps the veins devoid of nerve fibers".
|
[
"Could it be the location of the arterial blood gas is drawn causes more pain or the patient reporting more pain because of the anxiety that the procedure is not like drawing blood? ",
"I’ve had both and I find both to be equally painful, namely I just feel the pain of the needle piercing my skin."
] |
[
"Could it be the location of the arterial blood gas is drawn causes more pain or the patient reporting more pain because of the anxiety that the procedure is not like drawing blood? ",
"I’ve had both and I find both to be equally painful, namely I just feel the pain of the needle piercing my skin."
] |
[
"RN here. As I've had many patients complain about a burning feeling in their arms all along the I.V. infusion vein track when administering a potassium solution (and certain other medications as well, though it varies from patient to patient), I would have to say that yes, they do respond in some way to irritants painful reactions. How much it triggers the pain response, varies a great deal. Some patients can tolerate much more of a particular substance in the solution than others."
] |
[
"What is the most corrosive substance known to man and how is it stored/contained?"
] |
[
false
] |
Thanks!
|
[
"Fluorine technically has the highest oxidation potential of any substance known to man, so that is your answer. It is so corrosive, it will spontaneously ignite wood, water, and metal filings. ",
"It must be contained in nickel tanks, at no more than 45 psi.",
" "
] |
[
"Hmm...probably better to supply a link to ",
"Acid strength",
". All the strong acids in the first paragraph can be stored in glass bottles.",
"Fluoroantimonic acid",
" is pretty acidic. It's a kind of ",
"superacid",
"."
] |
[
"eh, just because its a strong lewis acid doesn't mean it will be terribly corrosive in the sense of this question. In fact, many metals are inert to superacids. \n",
"check this out"
] |
[
"What would our solar system and life on Earth be like if we had two suns instead of one?"
] |
[
false
] |
[deleted]
|
[
"The related question is yes, it is possible for some stars to orbit other stars, they are referred to as binary star systems. ",
"Sirius",
" is an example of this, as is ",
"Alpha Centauri",
". Both relativity close to our own solar system."
] |
[
"Ask an Astrophysicist (NASA) has a pretty good answer: ",
"http://imagine.gsfc.nasa.gov/docs/ask_astro/answers/980122c.html",
" as does Astrobiology: ",
"http://www.astrobio.net/pressrelease/3659/planets-orbiting-a-binary-system",
"."
] |
[
"Would we have a nighttime?",
"Yes, because in order to stably orbit two suns, we would have to be well outside their mutual orbit.",
"Is it possible for some stars to orbit denser, more massive stars? Would they orbit in a way similar to the way planets orbit the sun in our solar system?",
"Yes, in fact this is common. It turns out that many visible stars are paired -- double stars. Not necessarily orbiting closely, but orbiting."
] |
[
"Why do we have wisdom teeth if our mouths generally don't have enough room for them?"
] |
[
false
] |
Having just got mine out today I'm curious.
|
[
"Because the set of genes that create wisdom teeth are still floating around our gene pool. However, ",
"a subset of people have genes that suppress wisdom tooth formation",
", so it's quite plausible that the entire human species will some day lose its wisdom teeth."
] |
[
"Too few people are dying before procreating because of their wisdom teeth. Then again, no one is dying before procreating because they lack them either. It'll be a long process, if let to it's natural course. I think we'll be able to switch off these genes before natural selection does."
] |
[
"We evolved to have larger mouths and jaws to chew much tougher foods. Then Homo Erectus tamed fire and started cooking meat. Cooking food makes it break down, which means it take less force to chew it, and so our jaws got smaller and our brains got larger. The problem was, our jaws got smaller but the genes that control the number of teeth we have didn't change much, which means we have too many teeth for our mouths."
] |
[
"How come water seems to taste “better” when you are very thirsty?"
] |
[
false
] | null |
[
"Hi jroblul thank you for submitting to ",
"/r/Askscience",
".",
" Please add flair to your post. ",
"Your post will be removed permanently if flair is not added within one hour. You can flair this post by replying to this message with your flair choice. It must be an exact match to one of the following flair categories and contain no other text:",
"'Computing', 'Economics', 'Human Body', 'Engineering', 'Planetary Sci.', 'Archaeology', 'Neuroscience', 'Biology', 'Chemistry', 'Medicine', 'Linguistics', 'Mathematics', 'Astronomy', 'Psychology', 'Paleontology', 'Political Science', 'Social Science', 'Earth Sciences', 'Anthropology', 'Physics'",
"Your post is not yet visible on the forum and is awaiting review from the moderator team. Your question may be denied for the following reasons, ",
"/r/AskScienceDiscussion",
"There are more restrictions on what kind of questions are suitable for ",
"/r/AskScience",
", the above are just some of the most common. While you wait, check out the forum \n",
" on asking questions as well as our ",
". Please wait several hours before messaging us if there is an issue, moderator mail concerning recent submissions will be ignored.",
" ",
" "
] |
[
"‘Human Body’"
] |
[
"Human Body"
] |
[
"How is elevation expressed on Mars (or The Moon). Is there an agreed upon \"sea level\" equivalent?"
] |
[
false
] |
[deleted]
|
[
"While air pressure was used in the past to define the Martian equivalent sea level, a new Reference Surface (sea level) for Mars was developed using Mars Global Surveyor's MOLA Laser altimeter instrument in 1999-2000 (it's now defined in IAU2000, which also defines the coordinate systems and shapes of numerous solar system planets, moons and asteroids). ",
"The Martian reference surface is defined mathematically by a rotational ellipsoid with best-fit radial dimensions A = 3396.19 \nkm and B = 3376.20 km (where A is the equatorial and B is the polar radius). Altitudes are expressed as deviations from this reference surface. ",
"There's also a paper by Smith & Zuber (1999) where they compared the new MOLA reference surface with Martian air pressure, so older measurements can be converted to the new system.",
"The average air pressure at the new Martian reference surface is about 5.1 millibars.",
"References:",
"Duxbury, T., Kirk, R.L., Archinal, B.A., and Neumann, G.A., 2002, ",
"Mars Geodesy/Cartography Working Group Recommendations on Mars Cartographic Constants and Coordinate Systems",
" [pdf], in ISPRS, v. 34, part 4, GeoSpatial Theory, Processing and Applications, Ottawa.",
"Smith, D. E., & Zuber, M. T. (1999, September). ",
"The relationship of the MOLA topography of Mars to the mean atmospheric pressure",
". In Bulletin of the American Astronomical Society (Vol. 31, p. 1178). ",
"The MOLA topography of Mars is based on a new mean radius of the planet and new equipotential surface for the areoid. The mean atmospheric pressure surface of 6.1 mbars that has been used in the past as a reference level for topography does not apply to the zero level of MOLA elevations (Smith & Zuber, 1999).",
"Edit: Added quote and pressure.",
"Edit 2: Spelling"
] |
[
"But the triple point pressure of water is 611.73 Pa, not 610.5. And it's the same everywhere. If it wasn't, they wouldn't be using the triple point temperature to define the kelvin scale."
] |
[
"But the triple point pressure of water is 611.73 Pa, not 610.5. And it's the same everywhere. If it wasn't, they wouldn't be using the triple point temperature to define the kelvin scale."
] |
[
"Can we 'upgrade' our senses (vision specifically)?"
] |
[
false
] |
My question mostly revolves around sight, but would apply to any sense, I suppose. Simply, what is the limiting factor in our sight? Is it our eyes? Is it the brains ability to handle resolution? Something in between? Would there be a way to upgrade our eye to something that could see more resolution (and therefore more distance)? Is the reason I can't see something a mile away (even in clear view) because I physically cannot see enough detail to understand what it is, or because I cannot process information that small? What about something like better night vision? Infra-red? Other things (like polarization)? Please keep in mind I don't mean adding something on top of our eyes (like night vision goggles, binoculars, etc), but making it so we can natively see . Edit: this seems to be becoming more about what we can do now, vs what is technically possible. My question is mostly this: If we came up with a technically better optical device than our eyes, and found a way to replace our eye with it, would we be able to work? Would our mind not be able to handle better image quality? Is it our eyes or our mind that currently limit us...
|
[
"Evolutionarily speaking, human eyes are optimized for vision in the visible light spectrum, and the visible light spectrum only, due to our atmosphere and local conditions as life evolved - visible light provides the best resolution. Longer wavelengths would have poor resolution, if we could see them, and the shorter wavelengths may have better resolution, but we'd have to take into account the deposited energy (mutagenic?), as well as the optical properties of the biological materials that make up eyes. ",
"Humans have trichromatic vision via three types of cones, the S, M, and L types, each of which possess a photopsin variant that responds to a different range of visible light, with different peak wavelengths; blue, green, and red, respectively. Combining them allows for the range of colors we can see. There have been cases of people with four types of cones, for tetrachromatic vision, but as I understand it, those cases are few and far between. ",
"If we take the case of infrared, we lack the necessary receptor molecule that will respond to infrared, and even if we did, we lack the neural circuitry to interpret it. Plus, thermal noise from ",
" would also make it difficult to see things in infrared. And, the eye itself is an emission source - if we could see infrared, we'd likely see a constant, cloudy haze due to interference from the eye. ",
"On a semi-related note, some vertebrates possess a tapetum lucidum, a reflective layer in the back of the retina that increases the available light the photosensitive rods/cones, which enables them to have better night vision, but this is still operational only under the visible light spectrum. "
] |
[
"Theoretically speaking? Yes. If you check out ",
"this",
" 2010-2011 research article on a recent step forward in retinal implants, you'll understand a bit of the complexity of the problem.",
"Long story short, we ",
" have cameras that can see detail much better than our biological eyes, but that's mostly due to the complexity of the receiving light sensor, and the way we can use software to put the image together in a coherent way. ",
"The problem with human eyes that suffer diseases like age-related macular degeneration is that our rods/cones suffer destruction, but the underlying ganglion cells are intact - these are the cells that actually transmit impulses to the brain for interpretation. ",
"One of the roadblocks is the lack of complexity in stimulation - we have cameras that can see an image, but how do we fabricate a microelectrode array with the sufficient number of contacts that can adequately mimic the placement of the original rods/cones? How do we program the impulse driver with the right degree of complexity that'll drive the electrodes' stimulation of the ganglions, based on the received image from the camera? And if we want this device to be implantable and take up only the biological footprint of the original eye (a la the fictional eye implants from the popular game Deus Ex: Human Revolution), we're going to have make some innovative leaps in micro/nano-fabrication techniques if we want it to fit. "
] |
[
"So what happens if you get rid of the eye? If somehow you replaced the eye completely (like I've seen trials of with blind people now - ",
"something like this",
", although it is quite old).",
"If we could create a camera that was better than our eyes, and create a better interface to the brain (I think the interface is what is lacking in that example, not the camera) would we be able to make 'better' eyes?"
] |
[
"What governs how long an animal can go without essential vitamins/nutrients?"
] |
[
false
] |
Inspired by , why do deficiencies in certain essential vitamins and proteins seem to take so long to become symptomatic? It seems like test subjects go weeks without niacin without developing pellagra symptoms and months without while still surviving and recovering, weeks without vitamin C without scurvy, and probably some amount of time without the essential amino acids without just dropping dead. Are there stores of amino acids or essential vitamins a body can use in times without? Are the "essential" vitamins just "not that essential" on a short time line where the body can just go without them? I acknowledge there's probably a different answer for different nutrients, but I'd like to hear about any of the processes involved.
|
[
"Because while essential they aren't used in large amounts. Most are recycled when filtered in the kidneys so what is used is also reused. The filtration isn't perfect which is why we need more over longer times. There is also a lot of redundancy in most biological systems so lacking one vitamin, you may be able to use another as a replacement (though it wouldn't be as efficient). Some can even be synthesized from others especially when talking about amino acids. There is a lot of variability on how much of something is used based on normal usage and usage due to the environment of the organism. There is also variability in absorption and reuptake so how long you can go without a certain vitamin/mineral is highly variable depending on what you're talking about."
] |
[
"It's very dependent on the organism and specific vitamin. Know that a vitamin for humans is not necessarily a vitamin for another organism since the term 'vitamin' only means an essential molecule that you cannot make yourself. ",
"Using vitamin C, you can see that most animals can make it themselves, whereas humans cannot. So to look at vitamin C and why it takes so long to get scurvy, you need to look at what vitamin C ",
". Aside from biosynthesis of neurotransmitters (which is pretty big in-and-of itself), vitamin C also is a cofactor for transformation of prolyl hydroxylase and lysyl hydroxylase; these enzymes are needed to hydroxylate the proline and lysine amino acids in collagen.",
"So vitamin C deficiency also affects collagen synthesis, inhibiting the stability of the collagen by preventing proper cross-linking of the propeptides in it. Collagen is extremely important; it's pretty much the glue that holds your whole body together and is present almost everywhere. So if your collagen development is inhibited, eventually you will start seeing problems arise in different parts of the body depending on how much collagen is in those parts and the role collagen plays in those parts i.e. elasticity in bones, strength of blood vessels, preventing cataract formation in the lens of the eye, etc. As the collagen isn't able to be made/repaired properly, different parts of the body will degenerate and feel the effects more than others, until eventually your heart shuts down because it's made of muscle and muscle needs collagen. Since it takes a while to die from improper collagen formation, dying from vitamin C deficiency takes longer than Pellagra, which also affects cofactors, but different ones namely NAD and NADP with which the effects are more immediate than the cofactors involved with vitamin C.",
"Also, since vitamin C is also a water-soluble vitamin, it cannot be stored in the body with any kind of real efficiency, and thus, it needs to be a daily part of the diet. Other, fat-soluble vitamins can be stored easier in fatty tissue, so again it really depends on the specific vitamin. "
] |
[
"This is a really hard/ complex question to answer.",
"A lot of it really depends on the type of animal and it's corresponding metabolic rate. If an animal has a faster metabolic rate then of course it will not last as long when starved of nutrients. A lot of it also depends on the state of the animal before it entered a period of restriction. If the animal has managed to store lots of fats then it will last longer as initially any glucose/sugars will be burned, then it will move onto fats when sugars are exhausted and eventually to proteins (leading to muscle wastage and eventual consumption of organs). ",
"You can't really store amino acids efficiently, they get excreted. There are certain vitamins a body can make but many are essential so we need to incorporate them into our diet. \nThe body can last a surprisingly long time with vitamin and nutrient withdrawal, water is the biggie. "
] |
[
"Is there anything in the universe that has existed since the Big Bang continuously in the same form?"
] |
[
false
] |
Essentially I'm asking if there's anything that has existed forever. The universe seems to recycle itself into new and different forms (we all used to be star dust as the trope goes). Is there anything that has existed forever and hasn't changed form?
|
[
"Most of the visible matter in the universe (about 98% of it) is hydrogen and helium that has been around since the beginning. Most of it has never even been part of a star, it's just been floating around in the intergalactic medium, and a lot of it likely never will become stars."
] |
[
"I was using 'beginning' loosely based on my interpretation of OP's question.",
"Notice that I never used the word 'atom'. I didn't think that ionization and recombination are the sort of change OP was asking about (since they don't cause the nucleus or the electron(s) to cease existing), so I didn't discuss that.",
"And obviously if you want to take the question literally then nothing has existed 'forever' since the universe is only 13.8 billion years old."
] |
[
"I was using 'beginning' loosely based on my interpretation of OP's question.",
"Notice that I never used the word 'atom'. I didn't think that ionization and recombination are the sort of change OP was asking about (since they don't cause the nucleus or the electron(s) to cease existing), so I didn't discuss that.",
"And obviously if you want to take the question literally then nothing has existed 'forever' since the universe is only 13.8 billion years old."
] |
[
"Can secondary sexual features such as facial hair begin to develop after years of delay?"
] |
[
false
] |
Such in the instance of marijuana use, where testosterone and growth hormone are subdued by the present of THC in the body.
|
[
"That still doesn't really answer enough questions to be able to provide you an answer.",
"Are all characteristics delayed, or just a couple? It's likely that the delay in development is constitutional, but that is a stronger likelihood with family history, is there one?",
"If it's only facial hair that hasn't developed, 16.5 is a bit early for a number of racial phenotypes, depending upon the individuals background. I'd want to find out when the other men in the family had to start shaving regularly, hell, most young men don't need to shave every day until 30+, and some never do."
] |
[
"This really depends upon the cause of the delay, and the years to begin with. ",
"There are a number of ways puberty can be delayed, but they tend to fall within two groups.",
"Development is slow to start, and progress, but generally this seems to bear a certain family history, and resolves with no interventions favorably in time. It's widely accepted, but not proven, to be a result of a delay in the release of ",
"GnRH.",
"There are such a variety of chronic illnesses that can delay puberty, or certain characteristics that I could not possibly cover them here. It's important to determine if all characteristics are delayed, or just one or two. If it's all of them, we look at a specific set of differential diagnoses, and it's only a couple, it's unlikely to be a problem with puberty or growth itself, and likely a more isolated condition.",
"Does this help answer your question?"
] |
[
"Say 16.5 and heavy marijuana use. "
] |
[
"Where does the matter of a bamboo come from?"
] |
[
false
] |
If you put a bamboo (or other water based plants) in nothing but water, they'll grow. But where does the physical matter for the plant come from? Is the plant matter just an arrangement of hydrogen, carbon, and oxygen, made from water and air?
|
[
"Like most plants, bamboo obtains the majority of its matter from carbon dioxide extracted from the air!",
"This process, known as ",
", is part of the photosynthetic process. It happens during the Calvin cycle. ",
"For more on photosynthesis, see here.",
"You're in good company with your bamboo experiment. A similar experiment was first done in the 1600s by a gentleman named Johannes Baptiste van Helmont. ",
"Link"
] |
[
"Yeah, most people assume that plants get their material from soil. Because plants are solid, so they must be getting the material from a solid, right?",
"Nope. It's from the air. They do need other materials, including water, but a lot of the solid stuff is built out of carbon from CO2. So yes, in answer to the OP's question, a lot of the material that makes up a plan is \"just an arrangement of hydrogen, carbon, and oxygen, made from water and air\"."
] |
[
"The experiment where a guy figured this out was very cool too. Basically, this dude was wondering exactly what you were. So he put a plant in a pot and covered it with a wire grate so that only water and air could get through. Then we weighed the pot and all the water he put into it everyday so he had an exact tally of how much stuff was added to the pot each day. Eventually the pot started to weigh more than the starting weight plus the added water, and since nothing but water and air ever been added to the plant, the guy concluded that plants grow from the air.",
"Pretty neat, right?"
] |
[
"Why don't antibiotics work against viral infections?"
] |
[
false
] | null |
[
"Bacterial cells are living organisms. Anti-biotics (there are various types) end up destroying bacterial cells one way or another (destroying their cells walls, stopping the bacteria from making proteins needed for survival etc) ",
"Bacteria belong to the domain of prokaryotes. Mammals are Eukaryotes. Bacteria have primitive/different ribosomes (make protein) which can be specifically targeted without affecting Eurkaryotic cells. ",
"Virus' aren't classified as living. They have a envelope made of phospholipds/proteins derived from their host. Virus' need the host to reproduce.",
"Since viral envelopes have a completely different structure from bacterial cells walls, anti biotics don't target them. ",
"Virus' also do not have ribosomes that can be targeted (they use host cell machinery to reproduce) ",
"Soruce: Biology major "
] |
[
"Antibacterial drugs do not work on viruses because the cellular processes they target are not present in viruses. Penicillins, cephalosporins, and the other beta lactams target a peptidoglycan cell wall, which viruses do not possess. Tetracycline targets bacterial ribosomes, again viruses lack these. Another target is bacterial enzymes which synthesize folic acid, but viruses don't synthesize folic acid, they don't even need it because they're taking nucleic acids from their host cells when replicating! Hopefully you're sensing a pattern.",
"As difficult as it is to make antibacterial drugs, it's many orders of magnitude harder to make effective and safe antivirals. Much of the enzymes and structures used by viruses are host in origin, making them impossible to target with drugs without also harming host cells. The ability of an antimicrobial to damage pathogens without hurting host (human, in this case) cells is termed selective toxicity. Most decently selective antivirals target the one or two enzymes which viruses carry with them not normally produced by host cells. One example of this are HIV drugs called protease inhibitors which inhibit the enzyme HIV uses to cleave apart the proteins manufactured by the host ribosome into usable parts to form the viral capsid, among other things. In HAART, a multidrug cocktail is given which simultaneously inhibits several of these virus specific enzymes, effectively slowing or stopping replication and reducing the chances of developing resistance. But coming up with new antivirals that target viral replication without suppressing host cells replication is a major continuing challenge for drug makers.",
"Oh, back to the original point. Colloquially antibiotic is used even by many doctors (especially when talking to patients) to mean antibacterials. Which is why when you have a viral upper respiratory infection (which incidentally I do right now!) the doctor will hopefully not give you antibacterial drugs. Antivirals are available for influenza which are at least slightly better than placebo, but we don't currently have any antivirals for which the often significant side effects outweigh the benefits for mild viral URIs (i.e. colds). Hence we say that we don't have drugs to treat them."
] |
[
"It's just a naming convention. We have different types of drugs that target different types of pathogens, and for historical reasons the ones we call antibiotics are antibacterial and not antiviral.",
"The historical reason is that the first such drugs we discovered (such as penicillin) were antibacterial in nature, and when they were given name \"antibiotics\" in 1942 it was in an era when viruses were not well understood. ",
"A more modern view is that the historical semantic distinction between living bacteria and non-living viruses is both misguided and irrelevant; a more relevant perspective is that all viruses are obligate parasites, and there are many other (non-viral) obligate parasites. Today, the more apt terminology is \"antibacterial\" and \"antiviral\" (and \"antifungal\" and \"antihelminthic\", etc), or — more broadly — \"antimicrobial\", but \"antibiotic\" lingers on because of its historical significance.",
"This is problematic in many areas — for example, people talk about antibiotic resistance and often assume that resistance doesn't apply to other antimicrobial drugs, which is totally wrong. Antiviral resistance is also a big deal."
] |
[
"Can dove or duck see Hunter's Orange?"
] |
[
false
] |
I recently bought for hunting. I have always heard that it's "better safe than sorry" to wear hunter orange, but I want to know: can dove and duck see this color as anything other than black and white? If they can, I am afraid it totally ruins camouflage.
|
[
"Birds have ",
"tetrachromatic vision",
" as explained ",
"here",
". It's better than human vision.",
"They are also brightly coloured to attract females, and some of those colours are orange.",
"Donald Duck will definitely see you. Whether or not your hat works by confusing him into immobility is something I can't answer, but I think it's to stop your ",
" animal murdering buddy slotting you by mistake."
] |
[
"Thanks for the science-y reply. I follow bag limits (regulated to insure healthy populations of duck), so I don't feel very guilty about taking 6 ducks a day."
] |
[
"All birds have color vision, so yep."
] |
[
"If particles are point-like, how are they not gravitational singularities?"
] |
[
false
] |
I understand gravitational singularities are not a matter of mass, but density. I also understand that particle colliders have established an upper-limit to the volume of an electron. If the fundamental particles are truly point-like, then whatever their mass, they would necessarily form gravitational singularities. Would the event horizons of these particles themselves be extremely small? They would still undergo hawking radiation I presume, which would mean that they would evaporate rapidly..? I thought maybe the answer depends on quantum mechanics, that the wave-function means that though the particle is point-like its possible positions are distributed through space? But flipping the question around, what is the quantum state of a black hole? Does it too have a wave function, and is that wave function entirely contained within the event horizon? (apart from hawking radiation) Is this just the great unsolved problem in physics of reconciling gravity and quantum mechanics, the micro and the macro?
|
[
"Indeed, the true answer to this question must rely on a complete theory of quantum gravity which we don't have. But it's common to make a hand-waving argument based on quantum mechanics and general relativity separately.",
"Very simply, a particle of mass m has an associated quantum-mechanical length scale (Compton wavelength) equal to hbar/mc which is (in a vague sense) a measure of the quantum fuzziness of its position. A black hole of mass m has a radius of ~Gm/c",
". Combining these you find that a particle's Compton wavelength is smaller than its Schwarzschild radius (required for it to be a black hole) only if m is greater than the Planck mass, about 10",
" grams. Since all the known particles are much lighter than that, we ",
" (although we do not ",
" for sure) that fundamental particles are not black holes.",
"There are other reasons to suspect otherwise, such as the expectation that black holes violate certain conservation laws like baryon number which are obeyed by particle decays. But these are also not known for sure, just expected based on what we know about non-quantum gravity."
] |
[
"Because they don't really \"orbit\" in the traditional sense. They exist as a probability distribution around the atom. Because they're not accelerating, they don't radiate. Just to confuse things though, these probability distributions are called \"orbitals\"."
] |
[
"So it's kinda like that sphere that shoots little lightning bolts everywhere? Kinda random but once you touch it, they all come to your finger?",
"What counts as an interaction? Why is ust sitting there not enough activity for it to be measurable?"
] |
[
"Are we limited by heat when it comes to computers in space?"
] |
[
false
] | null |
[
"Space is a vacuum. Vacuum is the best temperature insulator. The only heat that can travel through vacuum is heat in the form of infrared ",
". There can't be any physically ",
" heat.",
"So yeah, I can imagine an object that constantly generates heat in an insulated system having difficulty with overheating.",
"And yes, convection would require some gravity to work. You can still have pumped liquid or fan-driven air cooling something but any such system will require a heatsink big enough to ",
" heat as infrared light at a rate at least equal to how much heat the computer generates. With a heat sink of great enough surface area, your computer can be as fast as you want, but I don't know how much surface area that requires. I assume it's pretty big and big usually means expensive when it comes to space travel.",
"Maybe in the future one could construct space modules that have pipes of liquid or air running along their skin, that hook into a computer so you can use the entire hull as one giant heat-sink. But with access to computers on Earth to crunch numbers for you, this is arguably not worth the trouble."
] |
[
"I think one interesting extra side point of currently using the earth as a big heatsink is that, assuming economic growth is tied to energy use growth and that computing is going to make up a major part of that, we'll have to at some point start hosting our data centers in space ",
"or the planet will overheat",
".",
"Of course, individual processors increase in energy efficiency, but that doesn't stop data centers consuming ever larger amounts of power."
] |
[
"Eh, I'm skeptical that our computing power will ever generate ",
" much heat. This is probably something that for us to even consider involves turning every bit of the Earth's surface into server rooms. I mean if we're generating ",
" much heat, we've got bigger environmental issues to worry about at that point.",
"More importantly, where is the energy for this heat going to come from? Remember, computers don't make heat from nothing, so where does the energy to overheat the Earth come from? You can't say solar, because that light is already going going to hit Earth and we're not making the sun brighter or dimmer. Fossil fuels will run out long before this even begins to be an option. Nuclear probably can't accomplish this overheating either (I think?). So I'm not worried about planetary overheating due to new energy waste and generation. The only way to reasonably overheat the Earth is by retaining more solar radiation by changing the atmosphere's composition."
] |
[
"Are there any promising New ways to fight antibiotic resistance in bacteria?"
] |
[
false
] |
I know there is some interesting research into new antibiotics for which there are no resistance yet, but what seems to be the most interesting tool aside from that to fight these bacteria?
|
[
"Funny you should ask, but there's a new tool in the works:",
"\"Shu Lam, a 25-year-old PhD student at the University of Melbourne in Australia, has developed a star-shaped polymer that can kill six different superbug strains without antibiotics, simply by ripping apart their cell walls.",
"This creates a lot of stress on the bacteria and causes it to start killing itself.",
"The research has been published in Nature Microbiology, and according to Smith, it's already being hailed by scientists in the field as a breakthrough that could change the face of modern medicine.\"",
"Edit to add link"
] |
[
"I just want to point out that they've only demonstrated efficacy with gram negative bacteria. MRSA, a gram positive bacteria, might not be affected. Obviously having a new weapon in the arsenal is great, but I think \"...change the face of modern medicine.\" is a bit over the top."
] |
[
"Most of our antibiotics that aren't protein synthesis inhibitors (macrolides, aminoglycosides, etc.) come from bacteria and fungi. Given that only 2% or so of bacteria can be successfully cultured in a lab, there is great potential to discover new, effective antibiotics in these thus-far-unculturable bacteria. A team led by Slava Epstein at Northeastern University has developed an interesting new device that may enable us to culture many, many more. You can read about that work ",
"here",
"."
] |
[
"The Wikipedia article for ECC memory states that neutron flux is 3.5 times higher at the common cruising altitude for most aircraft than at sea level. Why do common personal computers not encounter errors on airlines?"
] |
[
false
] |
is the article in reference. It goes on to state that the systems on the aircraft are specially designed to account for this (I presume they use ECC RAM). Why don’t laptops and phones with standard RAM encounter more memory errors during flights? Is it simply that they do but the user doesn’t realise it?
|
[
"They do, but it doesn't matter. Your laptop is on one flight for a few hours. Avionics may run for a month between reboots, and spend half that time in the air. Plus, if excel crashes on your laptop, it's not a big deal. Avionics crashing could lead to airplane crashing."
] |
[
"Your laptop computer has error correction too, but probably less than there is in the aircraft electronics. Aircraft electronics are in the sky all the time, so they have more exposure to cosmic radiation than your laptop does (unless you fly every day).",
"Cosmic radiation absolutely can be a cause of errors in your computer (",
"link",
"), even at sea-level. IBM estimated there is 1 cosmic-ray error per 256 MiB of RAM per month in 1996 (",
"link",
"). The rate has probably changed since then due to changes in manufacturing, but that should give you a rough idea of how common these errors are. Only a little bit of error correction is needed to catch these errors at sea-level, so it causes quite minor overhead for consumer electronics."
] |
[
"Here",
" is a web page of someone who actually took radiation readings during a commercial flight, and found that they are indeed higher, just as predicted. ",
"FAA Advisory Circular 120-618",
" gives details of expected radiation exposure on various routes and altitudes, though with a focus on human exposure rather than equipment problems. Increased radiation at altitude is definitely real.",
"There are a number of reasons why this doesn't translate to computer crashes on airplanes. First, the RAM in a modern >=8GB laptop is mostly not being used for any critical purpose at any given time. If you experience an error, chances are it was either in free memory, or in a piece of memory that, although allocated, you aren't using. (Maybe it flipped an instruction in the part of the code of Excel that deals with retrieving data from SQL databases, but you're not retrieving data from a SQL database so that code never got executed. Or many, many other such situations.)",
"Second, 3.5 times a very small number is still a very small number. Suppose the probabilities work out that at sea level, you're likely to see an actual, user-visible, cosmic-ray-induced error on your computer once every ten years. So you go flying at an altitude where the radiation is ten times higher. Now you're likely to see an error once a year. But if your flight is only a couple hours long, there's still only a very small chance it will actually happen during your flight.",
"And finally, as a practical matter, it's very difficult to know that this has happened. Computer failures happen pretty often for a lot of reasons: overheating, power supply noise, component failure, and most of all, software errors. If your computer blue screens or malfunctions in some way ",
", in a way that isn't repeatable, it is difficult-to-impossible to determine the cause. You're likely to just blame Microsoft and move on.",
"With the number of people using computers and computer-like devices on commercial airplanes, they surely ",
" experiencing, in the aggregate, an increased rate of cosmic ray induced failures.",
"This is a much more serious issue in the design of spacecraft and very high altitude military aircraft than it is with civilian aircraft, which operate at altitudes where they still get considerable protection from the atmosphere. So the on-board systems of commercial aircraft don't tend to use exotic computer components - instead they just shield the device or the avionics bay."
] |
[
"Why do Emergency Services use blue and red lights on the top of their vehicles?"
] |
[
false
] |
[deleted]
|
[
"It's been known since long before electric light that a lamp with a blue filter is most easily visible in fog, while a lamp with a red filter is most easily visible in sunlight. Both colors are sufficiently unusual in most environments to stand out against background lights and reflections.",
"Also, red and blue lights have opposite psychological effects, with red light having an exciting effect and blue light having a calming effect. The combination of red and blue lights grabs your attention far more effectively than either alone.",
"As for why they use them on the top of their vehicles, I'd have to observe that that's the most visible place to put them."
] |
[
"Per this study:",
"http://www.theiacp.org/LinkClick.aspx?fileticket=LV4uUua9uvY%3d&tabid=392",
"At least some of the reason seems to be the capacity of the colors to be recognized rapidly, one in daylight, one in the dark, for what they are, whereas other colors may be perceived less easily for the same power cost."
] |
[
"Concise, accurate, and a little smart at the end, enjoyed the read, and learned something. "
] |
[
"What do babies dream about, i.e. what are dreams made of when concepts don't exist in your mind yet?"
] |
[
false
] | null |
[
"We don't have a way of finding out the content of prelinguistic babies' dreams at the moment."
] |
[
"Thank you for your answer. Although we don't have the means, is it a subject that's being studied?"
] |
[
"Not really. In adults there are attempts to \"decode\" dream content from brain scans, but that's pretty nascent. "
] |
[
"In avian anatomy, do the wings directly correlate to our arms and the front legs of animals?"
] |
[
false
] | null |
[
"I believe you are refering to a ",
"homologous structure or trait",
". A homologous trait is shared between multiple species who share a common ancestor. The trait originated in a common ancestor thus linking all of its descendants who retained that trait in some form or function. ",
"For example, the limbs of tetrapods (e.g. veterbrates like birds, mammals, reptiles and amphibians) come from the same common ancestor. An early vertebrate had a four limb body structure (an ancient fish which had two limbs in the front, two in the back) - why? well I could get into hox genes, but its pretty complicated. But the long and short of it is four tended to work really well and there was no selective advantage to have more or less limbs. These limbs (or more appropriately fins) ",
"developed into the bony tetrapodal limbs we are so familiar with today as seen in the birds, mammals, reptiles and amphs",
". Thus all of the tetrapod limbs are related to one another through a common ancestor.",
"Here is a picture",
"\nYou can see that the bones in the front limbs of tetrapods are the same, yet some have undergone modification to suit the particular locomotion needs of that animal. Bats have very elongated finger bones compared to ours - but they are the same bone, arising from the same processes in development, originating from the same (albeit) distant ancestor. Sometimes species have lost limbs, like snakes, but retain ",
"vestigial structures",
" like ",
"small pelvic spurs in boas",
". Thus we know they once had four limbs, like all other tetrapods. ",
"Now you can also have ",
"analagous structures",
") meaning two traits which solve the same problem, but do ",
" have the same common ancestor. Two species developed a similar solution to a problem separately. Example: wings of a bat and wings of an insect - they are very different morphologically, and how they develop is quiet different as well. ",
"Scientists compare the number of homologous traits two species have in common, or that are different, to determine how closely related they are. Analogous traits can confuse this process. However, DNA technology has solved many of our problems with defining one species from another. ",
"Edit - fixed some of the origin of tetrapod stuff to make it more accurate by explaining it in detail"
] |
[
"Edit yeah I put fish in there by accident - realized this afterwards. ",
"But fish do have the four limb body structure",
" (two in front and two in back - pectoral/pelvic fins) which gave rise to the four tetrapod limbs we see today. I just sort of lumped it all together which isn't correct (but made sense in my head anyway)."
] |
[
"In a way, yes. They are somewhat homologous to our arms, however several bones in a bird's arms are fused together to strengthen them and make them lighter. "
] |
[
"Is there any feasible way to greatly increase a plants growth rate?"
] |
[
false
] |
I'm talking 300%+. Just a hypothetical question I was pondering while cultivating my new tomato plants, would it be possible at all, using modern or slightly futuristic technology, to accelerate a plant's growth greatly. For instance, allow a tomato plant to grow by around 3 or 4 inches per day?
|
[
"Yes, to an extent. There's a class of compounds called ",
"brassinosteroid",
"s, which are steroids for plants. They encourages cell division and thus makes many plants grow much faster than otherwise (sometimes with strange morphology like drooping leaves). ",
"There are even more potent synthetic versions which have effective doses at the picogram level (10",
" g), but I have no experience with either one of these in the growing things sense. Check out TG Back at UCalgary - he had some really stunning pics in his talks and they may be available in a publ",
" or website."
] |
[
"How much faster do these brassinosteriods cause plants to grow under ideal conditions? The wiki didn't really mention that. "
] |
[
"Grow it in a high CO2 environment."
] |
[
"Is life expectancy based on date of birth, or current year?"
] |
[
false
] |
[deleted]
|
[
"These other answers miss the mark a bit. Don't know where you are, but in the US, the Centers for Disease Control (CDC) calculates life expectancy based on age during a particular year. ",
"Here is a fact sheet",
" on what life expectancy is. ",
"You can see that life expectancy for people born in 2018 was 78.7 years. It is also further broken down by gender.",
"You can also see the life expectancy for people aged 65 in 2018, which is 19.5 additional years, again, further broken down by age as well."
] |
[
"Neither.",
"The life expectancy is calculated from current mortality tables: How many newborns die in their first year, how many 80 year olds die in the same year, and so on. How long would people live that have all these rates? You get a mixture of mortality rates that apply to completely different generations. This would only be the life expectancy of individuals if these mortality rates would not change during their life. But they do change.",
"Most people die when they are old (this is a somewhat recent development!), so you would mainly be interested in the life expectancy we calculate from 2060 on (but ignoring the mortality risks below 55). Something that's unknown at the moment."
] |
[
"The average life expectancy for ",
" alive at the moment (in whatever group you’re looking at — the US, for example) would be based on right now, which would be that 77.4 years. ",
"You’re younger than many alive in the US (at the moment) and so your specific life expectancy is longer, based on your being born in 2005."
] |
[
"Do photons decay as they travel through a vacuum?"
] |
[
false
] |
As you travel away from a star it gets dimmer. Is this just because of the photons spreading out, or do they also decay?
|
[
"Photons do not decay. As you travel away from a light source, it looks dimmer because of the inverse square law (for a pointlike source)."
] |
[
"There are telescopes that count the light they receive from a star in photons per minute. However, human eyeballs aren't quite that good and why stars appear to twinkle for us is a different explanation - it is purely an atmospheric distortion effect."
] |
[
"Eventually the scattering of the photons mean that as you get an extreme distance away, the object emitting the light will appear to start blinking. Then less and less regularly as you travel further away"
] |
[
"I can understand how natural selection for traits works. But how do complex processes (such as metamorphosis) come about through evolution?"
] |
[
false
] |
My friend and I were discussing evolution and we don't understand how processes that are so complicated and dependent on sequential events come about in the first place. From the molecular level (e.g. metabolic pathways) to the physiological level (e.g. metamorphosis), are there any general principles to explain this?
|
[
"Think of it this way: all changes to morphology have to occur through embryonic development or later developmental processes like sexual maturity. So rather than focusing on metamorphosis as a character to explain, it is the process that leads to derived characters. You can't have altered characteristics without altered development. Also, don't focus on the complexity of a metabolic pathway as a character to be explained. There are no endpoints that organisms were trying to reach through evolution. Life can only blindly stumble upon beneficial traits, or modify a pre-existing one. As a general concept, a character's current function may not have been what its precursors were selected for, i.e. the precursors might have had a different function."
] |
[
"The general principle is the same as the one that governs selection of traits. We have a pretty sound theory of how evolution works, but for the most part what we know about evolutionary history we know from the fossil record. The theory doesn't necessarily tell us that things like multicellularity and multi-stage life cycles are going to evolve, we just know that they did. We can make guesses about how they ",
" have evolved, and we can check our guesses against the theory and then check the relevant aspects of the theory against the observations, to see if our guesses are plausible, but there will always be other conceivable guesses that are equally plausible. We weren't there, so we don't know.",
"For particular cases, we have particular guesses. I can't give you a general rule for explaining large changes other than the same general rule that explains small changes. For a lot of things, we think large changes come about as the result of gradual accumulation of small changes over unimaginably vast stretches of time. Some things probably evolved as the result of single dramatic events",
" .",
"Metamorphosis is as old as animal life. The most \"primitive\" known animal life, sponges and jellyfish and the like (and the fossil record does suggest these are among the earliest animal forms) metamorphose at different stages in their life cycles. Why some animals don't undergo metamorphosis is the more interesting question from an evolutionary history perspective. Multicellular animal life resulted from single-celled lifeforms forming colonies for mutual benefit (the Portuguese man o' war is a living fossil in this respect, because it is not a true multicellular animal but a colony of single-celled organisms), and at that stage they wouldn't have had the mechanisms we do for ensuring genetic homogeneity in our cells, so there would be an incentive for some cells to cheat and try to get themselves instead of their neighbours into the reproductive material. I dimly recall that this is considered plausible as an account of the origin of specialised reproductive structures, and metamorphosis is an elaboration of the specialised reproductive structure.",
"Most metabolic pathways probably evolved in much the way you comprehend trait selection to work. The first stage in the pathway evolved first and it evolved because it was useful to the proto-cell (and all the major metabolic pathways, especially their early steps, are ancient even in the time-line of evolutionary history) in its own right. The second step evolved because it was an improvement, and so on for the third and fourth. At every step, it did something for the cell. None of it's just energy spent in the hope that one day another step will evolve that makes use of it."
] |
[
"Go look at the Arch in St. Louis. If you removed a section of it, it would collapse and cease to function. It is irreducibly complex. This must mean it was created whole, right?",
"Not exactly. When it was being built, there was reducibly complex scaffolding used that allowed the not-final-form arch to function. Once the arch reached its final form, the scaffolding could be removed, leaving an irreducibly complex system that was built via an incremental process.",
"The same sort of thing can be observed in biochemistry where incremental gains in enzyme efficiency along a pathway eventually surpass the pre-existing (reducibly complex) pathway and the old method, no longer being needed, eventually is evolved away leaving only the irreducibly complex final pathway.",
"Oh, and if you're thinking of pulling a \"Gotcha!\" with the St. Louis arch and it's method of construction being intelligently designed... first, ",
"don't",
", and second, I think you're deliberately missing the point."
] |
[
"Do cells/DNA have some sort of local GPS to know where they are and what sort of organ/cell they should become?"
] |
[
false
] | null |
[
"Nope. They have a slew of sensors which tell them all sorts of information about their local environment, but they have no access to an overhead map of sorts. They have to figure out where they are all based on very local information. Cells have sensors for chemical cues (to smell/taste), physical cues about the hardness or stiffness of their surroundings. Most cells are coated in proteins which can signal their ID to their neighbors.",
"It is only though a common, dna-programmed reaction to these signals that the cells know what to do. It's now appreciated that many 'cancers' are actually a cell getting confused about where it is, and thus, what it should do. It somehow either gets bad info, or the info gets interpreted improperly and you now might have a skin cell start to grow in the middle of a lung. And that skin cell - if not quickly taken care of - can lead other cells nearby to become similarly confused - and what you're left with is 'cancer.'",
"The study of how cells know what to do based on sensing their environment is called 'developmental biology'. Check it out."
] |
[
"You're thinking of either developmental biology which is to do with understanding how organisms develop (part of that is understanding how cells of different tissues differentiate) or cellular biology, the study of cells and cellular processes in general, including signalling pathways and such that lead to differentiation."
] |
[
"A skin cell wouldn't start growing in a cancerous lung. Cancer involves mutations in the cell's mitotic pathway (uncontrolled division) and the cell's apoptotic pathway (lack of cell death when marked for destruction). It is unlikely that one cell type would make a complete switch to another cell type except for teratomas (cancer that effects three germ layers, teeth and ears have been reported to grow in some cases of this type of cancer) which are incredibly rare."
] |
[
"What chemically defines an element as a metal?"
] |
[
false
] | null |
[
"If it exhibits something called ",
"metallic bonding",
"Short explanation:",
"The atoms bond together closely enough that their valence electrons are no longer localized to a single atom but instead can travel freely. These are often called \"free electrons\" and because they can travel from atom to atom this makes them conductive and gives metal it's most well-known and useful property of being conductive.",
"Long explanation:",
"In an atom you have electrons in various energy levels above the nucleus called orbitals. The electrons in the highest occupied level are called the valence electrons. There is another unoccupied energy level on top and electrons can get into those levels if they are energized or excited.",
"If you have two atoms bonded together their atomic orbitals overlap and the valence electrons reorganize into new levels in a shared molecular orbital between the atoms. In a bulk substance you have so many levels that they form bands of electrons across the bulk material.",
"Remember how i said there is an unoccupied level on top of the occupied level? those levels also overlap and form another band. If the electrons in the occupied band are excited, they can access the higher unoccupied band. There is an energy gap between the two bands called \"band gap\". The energy given to the electrons must be greater than this band gap for the electrons to cross into the unoccupied band.",
"Now for the fun part.",
"In non-metals the band gap is too great and there is essentially no way of accessing the unoccupied band without destroying the bulk material. These are insulators.",
"For other materials, the semi-metals, the gap is still there, but it's small enough that you can cross the gap thermally. So if you heat up a semi-metal it'll actually become more conductive as the electrons get enough energy to cross the gap. But this is not considered a metal yet.",
"In a true metal, there is no gap and the electrons can freely cross into the unoccupied band and conduct around the material. For this reason this unoccupied band is often called the \"conduction band\".",
"So a metal is a material where the conduction band and the valence band meet.",
"Interestingly enough. Some materials are non-metals under some conditions, but metals in others. An example of this is iodine. It's a nonmetallic halogen. But if subjected to extremely high pressure. The atoms are pressed together close enough that the electrons can cross over and the non-metallic iodine becomes metallic."
] |
[
"Metals have a ",
"crystal structure",
", where all the atom cores are arranged in a lattice. The exact makeup of this crystal structure - both in metals and alloys - decides stuff like how hard or how ductile the metal is. Additionally, all metals have some free electrons, which is to say that some of the electrons that would usually be bound to a single atom, are instead free to move around in the metal. This is the reason why metals are good conductors."
] |
[
"Interestingly enough. Some materials are non-metals under some conditions, but metals in others.",
"Just to add to this: by far, the most common metal in our universe is metallic hydrogen. By mass, Jupiter is ",
" liquid metallic hydrogen (it's what's responsible for its very intense magnetic field), as are the interiors of all brown dwarfs."
] |
[
"Why do my bicycle tires have to be inflated to a higher pressure than my car tires?"
] |
[
false
] |
Like I said, my bike tires (the skinny "road" type) need to be inflated to 95-115 PSI, whereas my car tires indicate a max PSI of 44. What's up with that?
|
[
"Think about the surface area of contact between your bike tires and the road when compared to the area underneath your car tires.",
"\nBecause of the much larger surface area, a car requires less pressure, even though it is so much heavier."
] |
[
"There's a few reasons. One, there is a MUCH smaller space between the rim of your bike wheel and the rim of your car tire. Added pressure prevents it from bottoming out and denting the rim on potholes Two, as was stated on shorthand, it does reduce rolling resistance to have firmer tires. The harder the tire, the less rolling resistance there is. And, just having less tire contact with the road means less to resistance. One of your biggest factors (as very eloquently explained by Sheldon Brown here \n ",
"http://sheldonbrown.com/tires.html",
" ) is traction. He explains it way better than I could, so I'd read that. "
] |
[
"The pressure determines the contact patch, which is how much of the tread is in contact with the road. It also determines rolling resistance. At higher pressures, the contact patch required to support the weight of the vehicle is smaller (pressure is force over area), so the tire does not deform as much (it stays rounder). This lesser amount of deformation reduces rolling resistance.",
"Traction is a function of contact patch area, so it's a tradeoff. A higher pressure reduces rolling resistance (makes it easier to keep moving), but a lower pressure gives better traction.",
"For car tires specifically, you will see a variety of pressures recommended for different applications. \"Hypermilers\" concerned with high gas mileage often overinflate tires to reduce rolling resistance and improve gas mileage. Drag racers, on the other hand, often underinflate tires to gain contact area and give them more traction during heavy acceleration.",
"The bike tire pressure is a function of the type of bike and tire. Mountain bikes typically have lower pressure tires with knobby treads for more grip on trails. Road bikes have higher pressure tires with smoother treads for lower rolling resistance on flat roads. As for why the bike tire pressures are higher than car tire pressures across the board, it has to do with the design of the tires and the weight of the vehicle. A car at 110psi would likely have a very hard time slowing down due to terrible traction, whereas a cyclist with 10psi tires would have a very hard time moving due to terrible rolling resistance."
] |
[
"Are there any more confirmed dimensions?"
] |
[
false
] |
We all know the dimensions length, height, depth and time. I once read that there are multiple dimensions in the universe, but from what I gather it's all hypothetical stuff to solve certain mathematical equations. Are there any other dimensions that we are aware of?
|
[
"No there are not. I can link you to some recent tests for them if you're interested."
] |
[
"It is popular belief that electricity and magnetism are two different forces. Physicists know they are not. They are one. So, the number of \"confirmed\" forces in this case would be 1, not 2.",
"I'm asking if length,width,height,time are similar \"popular\" conceptions of dimenionsality, but are not in fact \"confirmed\". ",
"IE: we know when you travel fast along a spatial dimentions your time dimension distorts. So, at best the 4 popular dimensions have a nonlinear relationship. They are not orthogonal as we suppose.",
"Are they in fact no even independent, so you couldn't consider them 4 distinct and measurable dimensions?"
] |
[
"The three spatial dimensions are indeed real. ",
"Here",
" is an interesting writeup on hypothetical systems other than our 3+1."
] |
[
"How can an emotion -such as stress- affect the physical body?"
] |
[
false
] |
According to this article , stress can damage DNA. How is this? Isn't stress just an emotion that is purely in the brain and not quantifiable?
|
[
"Long, possibly still incomplete answer: ",
"Emotions have a much more significant impact on the human body than many people realize. In the case of stress, there is a well-established physiological process known as the ",
"stress response",
". In cases where humans feel physically, emotionally or psychologically stressed, there are certain neurons within the brain (specifically the hypothalamus, which deals a lot with chemical balances) that act as sensors, and when they sense stress, they trigger a cascade of hormone release that ends with cortisol - also known as the stress hormone. ",
"In the short-term, cortisol release is a good thing in that it basically signals the body to increase its energy production, to help deal with whatever's stressing you out. But it also simultaneously damps down our immune system, making us more prone to sickness. In high levels it triggers other chemical releases like noradrenaline that can negatively impact ",
"memory formation and retrieval",
". It actually, physically, inhibits neuronal growth (known as neurogenesis) within parts of the brain, particularly the hippocampus, which plays a huge role in memory. So we can see that stress is able to cause physical effects within the body. ",
"The thing is that normally, chemical systems like this work on a negative feedback loop, so that when the situation is resolved or levels get too high, a signal is sent to stop cortisol production, and our body starts going through a series of steps to balance itself out again. In cases of chronic stress though, when the body continually synthesizes cortisol over long periods of time, it's theorized that the feedback systems involved gets overwhelmed and the loop stops functioning as it should. ",
"But on a molecular level? Like, how exactly does the release of cortisol translate into all these effects? We got no clue. I mean, we've got theories, sure, but nothing's been able to been conclusively proven. Emotion's still sort of a grey area for us, just because we still haven't quite figured out the brain yet and we don't always know exactly how mental and emotional processes translate into physiological processes. (Again, lots of theories, but.) We just know it does due to tons of scientific studies and observations. On a side note, this is why depression for example is still such a big problem. We've got people whose emotions are significantly impacted, to the point where its physically affecting the body and their daily life. We know for sure that emotional imbalances and stress is linked to an abnormal levels of several important neurotransmitters, but there's no actual ",
"biochemical marker",
". There's no blood test for depression (although we're ",
"working on it",
"). Scientists aren't sure exactly how or why antidepressants cause their anti depressive effects, which is also sort of why they're nowhere near as globally effective, as say, over-the-counter painkillers. "
] |
[
"Short, incomplete answer to the general question: hormones. Stress releases cortisol, which can be harmful to the body in cases of chronic stress. Saying that emotion is both purely in the brain and not quantifiable might even be a contradiction, as (I suppose debatably) brain states are all theoretically quantifiable, and presumably representative of most if not at all mental states such as emotions. That being said, brain states influence hormones primarily via the pineal gland, which is part of the endocrine system located near the brainstem."
] |
[
"Not adding to what other posters have said because I'm not qualified, but there's a critique I must make to your question. Stress isn't an emotion. Stress is a stimulus. Our bodies react to stimuli. This reaction is a physiological one, and we often label the experience of those reactions as emotions."
] |
[
"Why does the hole in the ozone layer always hang out over antarctica?"
] |
[
false
] |
Why Antarctica? Is there also a hole in the ozone layer over the north pole that no one ever talks about?
|
[
"Yes, there is but it's not as bad as the South Pole one. The reactions that cause ozone depletion operate everywhere in the atmosphere, but are catalyzed by surface reactions on really cold, high latitude ice clouds (Polar Stratospheric Clouds) which mostly form at very high latitudes."
] |
[
"Ozone is depleted where there are:",
"Those conditions only occur regularly in polar regions. Antarctica is colder than the Arctic, so ozone depletion is much worse there."
] |
[
"Both the Arctic and Antarctic can ave a \"polar vortex\", a cyclone around the poles, with air within the poles not mixing with that outside. But the Antarctic polar vortex is reliably stronger and more stable, whereas the Arctic vortex is more often weaker and disrupted allowing the air mass to move and mixing to occur.",
"It is within these polar vortexes that the conditions for severe ozone depletion occur. The polar night is important in allowing chlorine to build up from the breakdown of CFCs, and when the spring sunlight comes that chlorine \"strikes\" the ozone. In the Arctic this process is more likely to be disrupted due to that weaker polar vortex, and away from the poles it doesn't happen at all."
] |
[
"How do the pulse things that clip onto your finger measure oxygen saturation?"
] |
[
false
] |
I couldn't find anything searching because i don't know what they're called I know it has something to do with the light but i don't know what it's doing
|
[
"It has to do with the amount of light and infrared light being absorbed. There is a sensor on the other side of the pulse oximeter, which measures the amount of each type of light that passes through. Each light is absorbed by the hemoglobin differently, depending on how much oxygen it is carrying. ",
"It’s a bit more technical than that, but I don’t have my emt book handy, and that’s the best I could do. "
] |
[
"I'm going to approach this from the other side of things. I know a lot about IR spectroscopy but very little about the practice of medicine. This means I can tell you what the light does and how it works but I'm not claiming to be an expert on the device. ",
"I looked up an article about those devices and I learned that it emits two beams of light: one is a red LED (visible radiation), the other is a beam of infrared (IR) radiation. You can't see IR radiation, but it's on the same spectrum as visible radiation, just lower in energy. I read that oxygenated hemoglobin absorbs more IR light than red light, and that deoxygenated hemoglobin absorbs more red light than IR light. So, when you put your finger in the clip, the IR light and the red light shine through it. At the other end of the clip, there is a detector to detect the absorbance of IR and red light in your finger, specifically, the absorbance by the hemoglobin of your blood. Now this is the cool part -- absorbance is a really awesome quantity because we can directly calculate concentration from the absorbances we observe. So from that point, the device does a little math and can tell you the oxygen saturation by calculating the concentrations of oxygenated/deoxygenated hemoglobin from the absorbance of the IR and red light beams.",
"I'm a huge chem nerd so the fact that you medicine folk basically have little UV-Vis and IR spectrophotometers in a small three inch clip makes me pretty happy, haha. ",
"Let me know if you have any questions about my explanation. "
] |
[
"Also if your hemoglobin is low you could have a high saturation but still not have enough oxygen. That's why people get tired and sometimes out of breath when they are anemic. "
] |
[
"Why aren't there more huge canyons like the grand canyon?"
] |
[
false
] | null |
[
"There are, the Grand Canyon is simply the most famous canyon. ",
"It is not the biggest canyon.",
"The ",
"Yarlung Tsangpo Grand Canyon",
" in China is bigger and deeper, and recently an ",
"even bigger canyon underneath Greenland's ice sheet",
" was discovered. "
] |
[
"It's also true that you need a particular set of conditions to create a giant canyon; geological stability, sediments that are erodable enough to move, but stable enough to hold their shape, etc. It stands to reason that only a handful of places will meet those requirements, just as there will only be so many giant mountain ranges. "
] |
[
"It's not even the deepest canyon in the US, ",
"Hells Canyon",
" is significantly deeper."
] |
[
"Where do we get our gut bacteria from?"
] |
[
false
] |
As infants, where does our initial set of gut bacteria (and other symbiotic bacteria) come from? Initially we are human cells undergoing mitosis to form human organs and eventually a full human. We get nutrients from our mothers, but to my understanding that is purely nutrients, there is nothing else passed through. So where do these bacteria that are so critical for our existence come from at the start of our lives?
|
[
"Very interesting. Does anyone know how the bacteria gets there on the first place? Say for a c-section birth, does that child have the some of the required bacteria already? If so how does that get to the child’s gut inside the womb?"
] |
[
"Very interesting. Does anyone know how the bacteria gets there on the first place? Say for a c-section birth, does that child have the some of the required bacteria already? If so how does that get to the child’s gut inside the womb?"
] |
[
"You may find this Wikipedia page interesting as it gives a lot of information on types of bacteria in the human body and its purpose.",
"It seems like the answer is we get our gut bacteria from our environment, meaning that some of it passes to a baby from vaginal birth (not sure about C-sections) and as we age it comes from the things we are surrounded by. The article pointed out that gut bacteria can be affected by many different variables including traveling from one country to another."
] |
[
"Is there any reason you shouldn't eat the same foods every day provided they are healthy?"
] |
[
false
] |
Like a high school girl stressing about what to wear every day... I'm tired of deciding what to eat every day. I want to just eat the same thing every day. Stipulation is it must be easy to make in bulk, very healthy, and nutritionally complete. Any input is appreciated.
|
[
"Short answer, yes. Providing you maintain the correct balance of nutrients in the foods you eat and properly supplement any essential nutrients don't 'fit' into your diet plan, you can, in theory, live off the same diet daily. ",
"Longer answer, yes, but it's not a recommended strategy. If you simply want to reduce the stress of deciding day to day what to eat, a meeting with a dietitian (not a nutritionist, as that term is not protected, and just about anyone can tote that they're a nutritionist - a dietitian must undergo licensing and is person trusted to give medical/nutritional advice by other medical professionals) could help you sort out a limited menu/diet plan that would meet all your basic nutritional requirements. This could be something such as a monthly menu, weekly, and (although I've never heard of such a plan, but it is possible with proper supplementation) a daily meal plan.",
"Many populations of the world live on minimally varied diets, not as a choice, but generally due to socioeconomic standards. Now the health of these populations are sometimes severely deficient in some nutrients, but this is generally due to a lack of access to particular foods or the ability to supplement. ",
"As 'insanopointless' has already posted, a main issue with eating the same food day after day is boredom. There is also evidence that eating new and varied foods can help increase and regulate levels of important neurotransmitters such as dopamine and serotonin that have important roles in daily activities and mental health. So you may think you are reaping the benefits of lower stress in not having to 'decide' your daily menu, but you may in fact may have issues with increased stress, emotional instability, and lowered mood due to improper regulation of these neurotransmitters.",
"A bit of an aside, there is currently a belief in the dieting community that decreasing the variety in your diet can have benefits in decreasing your daily caloric intake, and the believed mechanism is that as you continue to eat the same food over and over, your desire for it decreases and you tend to eat less. Now I'm not sure if that is your intended goal with wanting to limit you dietary options, but thought I would include it as part of my comment.",
"Sorry for perhaps the long-winded response, and if you have any further questions I will try to provide any further information that I can. I do want to reiterate that before starting such a radical diet plan that it is best to seek professional advice with a medical professional that can give you advice that is specific to your situation. They will be able to better provide you with an individualized approach, and can take into account any special circumstances (chronic disease, athletic committments, etc) that may change the individual needs of your diet. They can also assist in helping to monitor changes in your health, so that if signs and/or symptoms of nutritional deficiency occur, they can work with you to modify your plan.",
"Best of luck, and hope that I was of some help.",
"My background is senior medical student and as part of my medical school training I did an elective rotation in nutritional science with the doctor that came up with 'glycemic index' and does a significant amount of research into whole wheat bread, and controlling cholesterol with lifestyle modification. ",
"This is my first post to Reddit so if any further information is required, or if you want more details let me know. I'm not sure if I'm suppose to include a source, but since a quick google search yielded a somewhat credible news source quoting an expert I'll link it here. Note that I wrote the above prior to seeking out a source, and am simply linking the top result in the google search as I thought it was an appropriate answer.",
"Source ",
"http://www.cnn.com/2009/HEALTH/expert.q.a/06/12/diet.repeating.foods.jampolis/index.html",
"Edit - Due to the criticism of my above source being secondary, I've linked the primary review article below as well as a few others that I thought were interesting reads. Like I said, first time poster so just let me know if there's anything else you want to know. ",
"Source (may need a University Library Access): ",
"http://www.ajcn.org/content/94/2/367.full",
"Study showing dietary diversity and its relationship to nutrients: ",
"http://www.jacn.org/content/25/4/354.short",
"Study comparing the eating habits of different European populations: ",
"http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=567816",
"Study linking food group restriction leading to increase in overall mortality: ",
"http://www.ajcn.org/content/57/3/434.short"
] |
[
"The problem would be finding something that satisfies the crazy panoply required nutrients of the human body. Fortunately, you are not the first person to wonder this. Here are some possible diets for you:",
"Jevity",
" is designed to do just what you are asking.",
"Ensure",
" claims to deliver complete nutrition.",
"One Square Meal",
" also claims this.",
"This person",
" lived on ",
"Optifast",
" for several months as part of a calorie restriction diet.",
"\"Monkey Chow\"",
" is designed to \"meet all the nutritional requirements of non-human primates.\" At least ",
"one human",
" has subsisted off it for a week.",
"Apparently the creator of Dilbert created a ",
"\"Dilberito\"",
" that meets all nutritional needs. Scott Adams is an asshole though, so let's move on to some real food diets.",
"Potatoes and Milk (with molybdenum supplements)",
"A diet of rice and beans meets most human dietary needs, supplementation with eggs for other trace nutrients and extra protein makes it basically complete.",
"One British nutritionist designed (and lived for several months on) a diet of ",
"bread, potatoes, and cabbage",
".",
"So, there's plenty of alternative for you. Your main challenge (as others have noted) will be mental."
] |
[
"OP was asking about something that would meet total nutritional needs. Rabbit Fever comes about due to a diet of basically pure protein with no fats or carbs, so it doesn't really apply here."
] |
[
"Since alternating current is truly \"alternating\" why are most 2 pronged plugs (U.S) built with one prong wider than the other, forcing it to be used in the socket in only one direction?"
] |
[
false
] | null |
[
"There is a ton of over complicated explanations and arguing over the relatively simple design of household AC circuits here. There is a very simple answer to this. ",
"In North America, the wider prong was added as a safety feature to ensure the neutral was connected where its supposed to be. Some appliances have relatively exposed connections that are intended to to be wired to the neutral, rather than the hot wire, ",
". There's no functional difference - the appliance will work either way - but it's safer to have the neutral terminal exposed.",
"An example is a table lamp. The bulb connection for the hot leg is fairly concealed and you'd have to deliberately jam your fingers in there to touch it. The bulb connection for the neutral on the other hand is the socket shell that the bulb screws into, and the second you put the bulb in, the metal on the bulb also becomes part of the circuit (whereas the hot isn't connected until the bulb is screwed in to the bottom of the three socket.) ",
"With the neutral connected to the shell, this doesn't matter. The neutral in modern homes is connected directly to the ground reference - the same as the ground wire, and all your electrical boxes, and most of your appliance frames, etc.",
"If you remove the wider prong from the connection, you can now connect the hot leg to the neutral connection by plugging it in backwards, and that largely exposed metal socket (and the metal on the bulb) now has 120VAC on it. "
] |
[
"Live is the wire that is ultimately connected to one of the phases at the generator making the electricity. Since that generator produces alternating current the live wires voltage potential compared to the neutral of the generator (and earth) will vary between minus 170v and 170v, 120 is the Root-Mean-Square (RMS) value. The neutral has zero potential compared to ground or neutral.",
"\nThe bottom line is that touching the live is dangerous.",
"\nDevices are designed with this in mind, that the live and neutral are on specific prongs, light fixtures e.g. have the live at the bottom so that only the small bottom lead would be live if the circuit were left energized. ",
"*Edit\nFixed voltage after ",
"/u/whitcwa",
" et others corrected me. "
] |
[
"will vary between minus 120v and 120v.",
"It is actually between minus 170v and plus 170v. 120 is the Root-Mean-Square (RMS) value. The peak value is √2 times the RMS. "
] |
[
"Do portable magnet detectors exist?"
] |
[
false
] |
[deleted]
|
[
"There are portable magnetic detectors, but a small REE magnet at 2 meters is... a lot to ask of them. Maybe a metal detector would be a better choice, but even that is going to have to be a hell of a lot close than 2 meters; you can't escape the rapid dropoff of EM intensity with distance. "
] |
[
"There is a magnetometer in most smart phones. Look for metal detector apps. Some of them will show a direction and magnitude of the field. The magnetometer is intended to sense Earth's magnetic field for the compass, so it's fairly sensitive. You'd probably get about 1ft of range. However, at 6 feet, I think you're going to need to spend some serious money.",
"I think you're looking for a ",
"survey magnetometer",
". There's a couple on ebay for about $1k."
] |
[
"I'm getting about a foot with a regular fridge magnet and a BSA compass. Inverse square law probably applies, so the neodymium will probably not boost the range much."
] |
[
"If the earth were to stop spinning and orbiting immediately, would people fly off the earth or stick to the ground?"
] |
[
false
] | null |
[
"This has been removed because it’s a commonly occurring question on ",
"/r/AskScience",
" or a question that can be answered easily through a single Google or Wikipedia search. To check for previous similar posts, please use the subreddit search on the right, or Google site:reddit.com",
"/r/askscience",
" ",
"For more information regarding this and similar issues, please see the ",
"FAQ."
] |
[
"Spinning, or orbiting? ",
"If it stopped rotating (spinning) suddenly, and whatever magical effect stopped it did not include us standing on its surface, we would continue moving in the direction of the rotation above the ground. Given that at the equator the speed of the rotation is around 1000 mph, if the earth suddenly stopped, we'd be flung at about 1000mph into whatever object/ground/air was ahead of us 'spinwards' and likely smear across the landscape quite dramatically, excepting that the landscape also would be possibly experiencing significant upheaval, depending on how this 'stop' manifests itself. ",
"In any case, a significant variable is the manifestation of this magical 'stopping' power and how it affects the earth and objects on it. "
] |
[
"http://www.universetoday.com/66570/what-would-happen-if-the-earth-stopped-spinning/",
"http://science.howstuffworks.com/science-vs-myth/what-if/what-if-earth-stopped-spinning2.htm"
] |
[
"Wouldn't a diver get serious hearing damage if he was to swim close to the pistol shrimp?"
] |
[
false
] |
The sound it emits is over 200dB... While a jet taking off is about 150dB, which is sufficient to rupture your ear drums...
|
[
"It's important to note that that 218 dB is at a distance of 4 cm, and is relative to 1 µPa. Now, first off, by convention the source level you quoted for a jet is equivalent to a measurement at a distance of 1 m. Taking that into account, the source level of the shrimp drops to 190 dB. Moreover, it's important to consider that dB is a relative scale of pressure. Sound Pressure Level and pressure are related through the reference pressure, by the equation P=Pref*10",
" where SPL is the sound pressure level in dB, and Pref is the standard underwater pressure reference of 1 µPa. Sound levels in air, on the other hand, are measured with respect to 20 µPa. If we make the appropriate conversion, we find that the appropriate sound pressure level should be 164 dB re 20 µPa @ 1 m.",
"That's still pretty high, right? Well, that's because we're talking about pressures. The thing that really matters is intensity, which is the amount of power per unit area of the wave. Well, since water and air have different acoustic impedances, even if the pressures are the same, the intensities will be different. If we take that effect into account, the level of the shrimp will be further reduced to SIL=128 dB re 10",
" W/m",
" So, the shrimp is quieter than a jet engine, but still pretty loud.",
"To take this a step further, the sound generated by a jet is a consistent sound, while the sound of a pistol shrimp is a loud POP. What if we compared this sound to a similar loud POP, like a gun? From wikipedia, the M1 Garand Rifle has a source level of 168 dB at a distance of 1 m. 128 dB, in comparison, carries about 1/10000th of the energy. So, while it would be loud, it wouldn't be instant deafness.",
"So, despite the very large looking number of 200 dB for a pistol shrimp, the actual amount of sound they put out is not excessively dangerous to nearby swimmers. ",
"this Express Letter from the Acoustical Society of America by Patynen"
] |
[
"200dB at what distance? Don't forget the inverse square law. "
] |
[
"Sound actually travels faster and far better through water than air due to density..."
] |
[
"If I peeled a banana or cut open a bell pepper, swabbed, and then cultured it, would anything grow? Essentially, are the insides of fruits and vegetables sterile?"
] |
[
false
] | null |
[
"We used to think that they were sterile, but recently (as in recent decades) we've found that there's fungi living inside all the tissues of almost all plants. They're are called endophytic fungi. I don't know of any research specifically looking at them inside fruits, but they are found inside seeds as well as the stems and leaves, so they're likely in the fruits, too.",
"The thing is, if you tried to culture them you wouldn't get anything. This is one of the things microbiologists and microbial ecologists have had to come to terms with: the vast majority of microbes just can't be cultured in the lab. Instead they're studied using metagenomics and in some cases ",
" culture, i.e. inside a living plant in which case they've been marked with some kind of radioactive isotope or fluorescent protein so that their growth can be visualized."
] |
[
"You can probably get a culture, you can get endophytes out of most leaves with a malt based media. Certainly nowhere close to all that's living in there, but there are usually a half dozen or so endophytes in your typical plant that are happy to live in a petri dish."
] |
[
"Hi jazerac thank you for submitting to ",
"/r/Askscience",
".",
" Please add flair to your post. ",
"Your post will be removed permanently if flair is not added within one hour. You can flair this post by replying to this message with your flair choice. It must be an exact match to one of the following flair categories and contain no other text:",
"'Computing', 'Economics', 'Human Body', 'Engineering', 'Planetary Sci.', 'Archaeology', 'Neuroscience', 'Biology', 'Chemistry', 'Medicine', 'Linguistics', 'Mathematics', 'Astronomy', 'Psychology', 'Paleontology', 'Political Science', 'Social Science', 'Earth Sciences', 'Anthropology', 'Physics'",
"Your post is not yet visible on the forum and is awaiting review from the moderator team. Your question may be denied for the following reasons, ",
"/r/AskScienceDiscussion",
"There are more restrictions on what kind of questions are suitable for ",
"/r/AskScience",
", the above are just some of the most common. While you wait, check out the forum \n",
" on asking questions as well as our ",
". Please wait several hours before messaging us if there is an issue, moderator mail concerning recent submissions will be ignored.",
" ",
" "
] |
[
"Why is it so hard to emulate a console ?"
] |
[
false
] | null |
[
"The problem isn't so much that emulating consoles is difficult -- it's ",
".",
"We have lots of consoles that are readily emulated on existing hardware",
". The problem tends to come in with getting the timing right to make the games actually playable. Different processors may have similar or identical instructions, but may have different processing times for them. Or your PC may not have suitable instructions to map to what a console processor has, and has to emulate that instruction. If it takes (for example) four PC instructions to emulate a console instruction, then the PC needs to be at least four times faster than the console to emulate that instruction at the same speed. At the same time, the PC may be faster at processing other instructions, so you have to artificially ",
" the PC instructions to try to get the timing right.",
"That a big part of the problem. The next problem has to do with the fact that most consoles don't have detailed public documentation on how they function. They have to be reverse-engineered to the best of the emulator developers ability -- and if there are special undocumented functions within the hardware, particularly ones rarely used, these may not be present in the emulator. This can sometimes be why an otherwise successful emulator can't run a specific game properly -- it may be relying on hardware specific timings, or undocumented functionality that is infrequently used to operate.",
"Lastly, for more modern consoles there may be the issue of encryption getting in the way. Without the encryption key, it may be that certain data formats may not be easy or possible to reverse engineer. This wasn't an issue with early consoles, but is becoming an issue with more modern consoles. On disc formats may be encrypted, along with hard disk filesystems, making it difficult to get at operating system internals to properly emulate whatever is going on.",
"HTH!"
] |
[
"Even worse, hardware bugs were often worked around in software, so if your emulator does not share the inconsistency, you may fail to emulate properly."
] |
[
"Or your PC may not have suitable instructions to map to what a console processor has, and has to emulate that instruction.",
"To add to that (since I actually work with consoles): while modern consoles are made of off PC compatible hardware, they have capabilities that can not easily be replicated on an actual PC. Most of these capabilities come from the fact that consoles use a fixed hardware and thus can expose some very low level features of said hardware without running in compatibility problems. ",
"Another thing is that, while the components themselves are similar to what you can get on PC, the whole system is not. All modern consoles have the CPU and GPU on a single chip and use a unified memory model (so there is only one bank of memory shared by both the CPU & GPU). This reduce the overhead of sending big blobs of data between the CPU and the GPU considerably but is extremely hard to emulate on non UMA machines ."
] |
[
"Is it true that vehicles (cars, semi-trucks, boats) have a tighter right-hand turning radius than a left-hand turning radius? Why is this?"
] |
[
false
] |
I remember watching a video ) about remote controlled cars and how some cars will take longer to make the same left turn as they did with a right turn. The guy in the video drove the car in a circle with it doing the tightest possible circle it could on each side, and
|
[
"Cheaper radio control cars tend to have different length steering arms on each side. This means you can make a tighter turn in one direction over the other.",
"The steering servo is central on the chassis but the moving output of servos is not in the centre of them. This means the steering arms don't connect to a central point so one is longer than the other. More expensive radio cars have extra linkages to allow the steering arms to have equal lengths letting the car turn equally in each direction. ",
"Full size vehicles have equal length steering arms so the cars and trucks you see on the road can turn equally left and right. "
] |
[
"It's true for ",
" vehicles. Aeroplanes with single large piston engines, especially rotary engines that spin the engine block rather than the crankshaft, can turn more easily in one direction than the other due to the gyroscopic effect of the engine. A notable example was the Sopwith Camel, a First World War fighter. Gyroscopic effects can also influence the handling of a car vehicle but it tends to be slight.",
"But as another poster mentioned, a much simpler explanation is the steering mechanism preventing the wheels from turning as sharply one way as they can the other."
] |
[
"Any spinning object will be subject to gyroscopic effects and the wheels are spinning objects. In particular, a spinning object will want to go through precession in a specific direction in relation to the direction of spin which makes it easier to turn them in one direction than the other."
] |
[
"Does tearing the grounds (the single prong out of the three prongs on power cords) cause any effects at all to the accessories?"
] |
[
false
] |
I know the the ground would be important in any circuit in order to achieve a voltage drop at the bottom of your circuit so if you remove this ground could you potentially damage your battery? I have been told by others that it doesn't matter at all though. I am wondering for a computer in specific.
|
[
"A two prong cord consists of a high voltage line (power) and ground. The power line is black, the ground line is white.",
"The purpose of the third wire is to provide a separate path for the electricity to take in the case of an unexpected event or overload. Think of it as a sort of lightning rod for your device when bad things happen with the circuitry.",
"I believe that these devices work by having an area outside of the circuitry that is connected to this wire, which is in turn connected to ground (literally). This will act as a shield if sparks start flying, they will tend towards ground, since there is a connection straight to ground nearby, the sparks will use this path as opposed to the one through your body.",
"Essentially, this is more for human protection than device protection. The protection is for when the electricity misbehaves (you spill water and short something, you jiggle it too hard, what have you). It is not necessary for any device to work, but it is recommended for safety."
] |
[
"Typically ground is only a safety requirement though some power supplies use it as a reference voltage. "
] |
[
"Under normal conditions, it really does nothing. The real ground prong (",
"the wider one",
") is what's taking all the current from mains.",
"If you do remove the third plug, though, your electrical device may become electrified during a power surge in such a way that you'll literally get shocked and potentially injured/killed."
] |
[
"What would happen if the sound barrier were broken underwater? Is it even possible?"
] |
[
false
] |
Breaking the sound barrier underwater, relative to the speed of sound through water. Would it have to be a solid object, or could it be done by a piloted vehicle? EDIT: Thank you all for replying with all of this information. This was really cool. And my first post ever. :D
|
[
"At typical pressures (say a small distance below the surface of a body of water) the issue is that accelerating the flow to supersonic speed will drop the water pressure locally to the point that it will change phase to water vapor (gas). Then you inevitably have a complex problem of cavitation between phases.",
"At very high absolute pressures (like the bottom of the ocean) the pressure won't drop enough to vaporize, and it won't conceptually be much different from the behavior of supersonic flow through a fluid like air."
] |
[
"There are designs that make use of this, such as ",
"supercavitating torpedoes",
" although current designs do not reach anything close to the speed of sound in water. "
] |
[
"they're going through a bubble of air",
"If we're being technical, it's water vapor, not air.",
"thus bypassing the issue of water density altogether.",
"Wouldn't the density of water still factor into the amount of thrust necessary to push it aside (even through a shield of water vapor)?"
] |
[
"What is the inverse laplace of s and s^2 ? Why is it not common in the s-domain?"
] |
[
false
] |
I can't find anything about the inverse laplace of s and s on google.
|
[
"The Laplace transform of delta(x) is f(s)=1. The Laplace transform of f",
"(x) is s",
"F(s) where F(s) is the Lapace transform of f(x) and f",
" is the nth derivative of f. The Laplace Transform of delta",
"(x) is then s",
". So the inverse Laplace Transform of s",
" is delta",
"(x)"
] |
[
"Isn't the delta function a 20th century innovation? What did Laplace do to compute the inverse transform of ",
" ? "
] |
[
"If you look at the definition of the Laplace transform and remember ",
"this",
". You should be able to see that the Laplace transform of the nth derivative of the dirac delta function is s",
"."
] |
[
"Had a sneezing fit shortly upon waking this morning, and the question dawned on me: do we sneeze in our sleep?"
] |
[
false
] | null |
[
"WebMD",
" has a fact sheet on sneezing and says you cannot sneeze in your sleep because the nerves that trigger a sneeze are not active when you are sleeping. "
] |
[
"As a regular sleepwalker shouldn't that hold true for a lot of the nerves that shouldn't be active when I sleepwalk as well though? Why would sneezing be exclusively impossible if I can get up and shower when I should be in bed?"
] |
[
". . . the trigeminal motoneuron pools that mediate the sneeze reflex are inhibited during NREM sleep and are actively suppressed during REM sleep as part of atonia. Which means it is much more difficult to sneeze during NREM sleep and nearly impossible in REM (without also causing waking).",
"http://www.reddit.com/r/askscience/comments/natrc/do_you_sneeze_when_you_sleep/c37rj3d"
] |
[
"Does electrolysis work to separate hydrogen and oxygen from salt water? or does it have to be purified first?"
] |
[
false
] | null |
[
"This page",
" has a good explanation of the processes involved in the electrolysis of brine (a saturated NaCl solution). You do create hydrogen gas via this reaction, but instead of O2 you will form Cl2 (chlorine gas) at the other electrode. "
] |
[
"Yes, electrolysis will still split water into H2 and O2. However, as this is an oxidation process, small amounts of chloride ions will be oxidized and combined to form Cl2, which renders the process slightly hazardous. "
] |
[
"thanks for the link, helped clear things up a lot. Do you know which would be more energy efficient for hydrogen extraction?"
] |
[
"Is there a difference in suicide rates between people who have already had children and those who haven't?"
] |
[
false
] |
Because on one hand, having children fulfills our biological goal so I'd imagine there would be less incentive to stick around if things came to that, but on the other hand there could be increased incentive to stick around to care for and protect the kids. Is there any discrepancy between the groups that becomes apparent on a large scale?
|
[
"Having children can be a protective factor, but it can also in some contexts increase suicide risk. A very large Danish study found that whereas parents were generally less likely to commit suicide than non-parents (especially parents of young children, for whom the risk was particularly low), parents who had recently lost a child were on the other hand at greatly increased risk of suicide, particularly if the deceased child had died from suicide. Parents of children who had been admitted to a psychiatric ward due to psychiatric problems were also at higher risk than non-parents. So it depends. When you adjust for other factors of interest (like income and ethnicity) parental status seems to lose a lot of its explanatory power when you look at 'the big picture'.",
"https://jamanetwork.com/journals/jamapsychiatry/fullarticle/207686"
] |
[
"Good summary except the statement about adjusting for other factors. From the results section of the paper you referenced: \"these effects exist even when adjusted for marital, socioeconomic, and psychiatric status; and their influences are much stronger in women than in men.\""
] |
[
"If you look at the confidence intervals in table 2 calculated in the adjusted analyses, none of the confidence intervals of male parents do not include an OR of 1, and this is only the case for female parents who have 3 or more children. The implicit effect size is slightly higher for women, but that's expected as the base rate is much lower (women are less likely to commit suicide). In the combined analysis, only very large families (5 or more children) have a (weak) protective effect in the adjusted analysis.",
"In the unadjusted ('crude') analysis, the total OR is 0.73 for parents with one child and 0.55 for parents with two children, whereas the adjusted ORs are in both cases 1.01. This means that in a standard two-parent family setting, you go from having almost half the suicide risk to having exactly the same suicide risk once you adjust for other variables of interest. If you look at the point where the negative effect is strongest, in the large-family setting, adjusting for other variables removes more than half of the risk reduction (the 0.49 OR in the unadjusted model turns into a 0.77 OR in the adjusted model in the 5-or-more-children group). I think it's perfectly fair to say based on that that: 'When you adjust for other factors of interest (like income and ethnicity) parental status seems to lose a lot of its explanatory power when you look at 'the big picture'.' "
] |
[
"If a substance of any kind gives off an odor then does that mean it's losing mass even if it's on a very small scale?"
] |
[
false
] |
Example -- If I have a container of poop and open the lid I start to smell poop. So my thinking is that if it smells like poop then it must have been a part of the substance in the container but is no more and free to roam about the air I breathe. So the original substance it came from must be lighter in weight because some of it is free and allowing me to smell it.
|
[
"Yes, this is exactly how smell works. Part of the substance volatilizes into the air and those molecules hit receptors in your nose and give smell signals. That means the substance itself is losing mass.",
"It should also be noted that generally this is small enough to be incredibly hard to notice. We can detect very low concentrations of many substances in the air and gas is pretty diffuse compared to a solid or liquid to begin with, which means that only very little of that substance needs to come off. ",
"Also, for complex things like organics it isn't necessarily all of the stuff that is coming off, just certain compounds. This means that over time those compounds may deplete and you will be left with something that doesn't smell anymore."
] |
[
"The different rates of volatilization are a subject of substantial research by consumer products megacorporations, such as SC Johnson and Reckitt Benckiser, that sell room fresheners, for example. Anyone who's ever bought a \"Plug-In\" knows that the smell is initially pleasantly complex, like a perfume. After a while, the most volatile substances (the \"top notes\") have fully evaporated, and all you're left with is a run-of-the-mill base lemon smell. Products such as the Air Wick were developed to avoid this degradation; instead of relying on thermal evaporation, they volatilize a slight bit of liquid every few seconds by atomizing it using an piezoelectric ultrasonic actuator, so that the formulation remains unchanged.",
"(Some of my previous research involves the controlled release of pharmaceuticals in microfabricated silicon chips. While working in industry, I meshed a bit with the consumer products aspect of controlled release of scents.)",
"I should add that everything, liquids and solids, is evaporating or sublimating all the time; it's just a matter of the rate of disappearance."
] |
[
"Seeing, smelling and tasting are ",
" as the electrical signals interpreted by our brains in response to stimulus. There is no other meaning to those words, what we are doing IS seeing, smelling and tasting. It can't get more real than it already is."
] |
[
"EMF interaction with matter?"
] |
[
false
] |
I seem to remember from school the rule that for an electromagnetic wave to interact with an object/matter, the object must be roughly equal in size to that of the EM wavelength? Is this true? I've tried to google information, but I must be querying the wrong information, because I'm returning no answers. Thanks!
|
[
"No, that's not really true. ",
"For an electromagnetic wave to interact ",
" with an object (rays bouncing off surfaces), the wave must have a wavelength much smaller than the object. ",
"For an electromagnetic wave to interact according to ",
", the wavelength must be much larger than than the object. Rayleigh scattering is much weaker than geometric scattering, so you could say that objects much smaller than the wavelength are nearly invisible to electromagnetic waves. For instance, when building a CAD model to load into a radar imaging solver code, you can leave out any features on the model that are smaller than a tenth of the wavelength and you still get the same answer. As another example, the holes in the metal screen of a microwave oven's window are much smaller than the wavelength of the microwaves in the oven, so very little energy can escape out of these holes.",
"If the wavelength is about the size of the object, you get interesting things such as resonance, interference, and creeping wave scattering. The phrases you should google are: \"Geometric scattering\", \"Geometric Optics\", \"Rayleigh scattering\", \"Mie scattering\", \"Physical Optics\"."
] |
[
"Thanks for the google suggestions! I was definitely searching the wrong terms :/"
] |
[
"There is a slight difference between interaction where the energy is absorbed and scattering where is is not.",
"chrisbaird's answer covers scattering, but for absorption/transmission, you may have heard the rule in the context of classical antennas, where for efficient absorption/transmission they should be ~the wavelength of the radiation.",
"See ",
"dipole antenna",
"."
] |
[
"What if I placed my arm/body part inside the hadron collider?"
] |
[
false
] |
So lets say the tube or path of the hadron collider or any other particle accelerator was narrow enough to fit an arm through one side and out the other, or a leg for that matter. What is going to happen to that body part when turned on?
|
[
"You go on to finish your PhD in physics"
] |
[
"So taken in total, I’m not sure what would happen. If the total energy of the beams were dumped into your hand all at once, it would act like dropping a bomb on you. (...) But depositing all that energy all at once may not be possible; protons are so small they may not all hit you and suddenly stop."
] |
[
"I like \"See also: Proton beam therapy\""
] |
[
"How does magnetic saturation limit current?"
] |
[
false
] |
[deleted]
|
[
"Magnetic Saturation happens when the increase Magnetic Field in a ferromagnetic material cannot increase the Flux Density in the material. Current is produced by the interaction of magnetic flux with a conductor (",
"See Ampere's Law",
"). So if you top off the amount of flux, you are basically topping off the amount of current too. "
] |
[
"If the flux attains a maximum, i.e. the material can have no more flux lines passing through it (which depends on the material), then B becomes more or less a constant even if we increase H. Now as I is the closed integral of B over a line, when B maxes out, the current maxes out. It is all mathematical and the limiting factor is the Material.",
"Note that the Emf might increase but so does the magnetic reluctance and thus the current remains constant I think, but I am not sure if this line is correct. I know the mathematical explanation and that is enough for me.\n(See ",
"Faraday's Law",
")."
] |
[
"If the flux attains a maximum, i.e. the material can have no more flux lines passing through it (which depends on the material), then B becomes more or less a constant even if we increase H. Now as I is the closed integral of B over a line, when B maxes out, the current maxes out. It is all mathematical and the limiting factor is the Material.",
"Note that the Emf might increase but so does the magnetic reluctance and thus the current remains constant I think, but I am not sure if this line is correct. I know the mathematical explanation and that is enough for me.\n(See ",
"Faraday's Law",
")."
] |
[
"Although they have no bones, is it still correct to say that a shark has a spine?"
] |
[
false
] | null |
[
"Yes sharks have a spine, and are vertebrates (In contrast to what TaslemGuy is claiming). The difference being sharks bones are cartilaginous. Think of it like this; the bones form the same structures (as in vertebral columns, jaws ect) and have a similar formation, ",
".",
"If there's anybody who knows about bone formation I'd like to hear from them, I think I heard somewhere that ossified bones are developed from cartilaginous bones, but can't remember any detail.",
"edit: ",
"http://en.wikipedia.org/wiki/Endochondral_ossification",
" - the change from cartilaginous to ossified bones in human fetal development."
] |
[
"In humans, bones ossify in three ways. Endochondral ossification is bone formation from a cartilaginous model. Almost all of our bones ossify endochondrally. Intermembranous ossification is when bone develops from a thick, fibrous membrane. Bones such as the mandible, clavicle, and the flat bones of the skull ossify intermembranously. The third way, ossification of tendons, usually results in ossicles (tiny bone). The patella, as well as some sesamoid bones found in the foot are ossified in this way."
] |
[
"That's not what their skeletons say. And it's not what Wikipedia says."
] |
[
"Why does our skin turn dark to protect itself against the sun if white reflects sunlight?"
] |
[
false
] |
It's summer here in the northern hemisphere so many people are getting their tan on and it got me thinking... From what I understand about tans, tanning is actually a way for your body to protect itself - a tan is actually you're skin strengthening itself for further sun exposure, correct? Well wouldn't it make sense for our skin to get lighter when it's exposed to the sun, therefore protecting it more?
|
[
"Melanin, the skin pigment, is a molecule that absorbs the dangerous UV rays so that they don't cause damage to your cells, or most importantly, damage to the DNA in the cells. Think of the pigment as a shield inside each cell that protects the important bits. It also happens to absorb visible wavelengths of light, causing the skin to darken in appearance. However, since only the UV rays from the sun are dangerous, that isn't dangerous. ",
"http://en.wikipedia.org/wiki/Melanin"
] |
[
"Another way to think about it: unpigmented skin is more transparent to UV light than pigmented skin. The light enters deeper into the tissue and can do more damage when skin is unpigmented. Yes, light colored skin would reflect more light than dark, but a lot of light would still enter the tissue.",
"Pigmented skin absorbs UV light and prevents more of the light from entering the tissue. Thus your skin better is protected."
] |
[
"is that the same stuff that gives my fair skin freckles only sometimes? if so, why doesn't it affect all the cells the same way? if not.. follow-up! please explain freckles! :)"
] |
[
"is nicotine itself bad?"
] |
[
false
] | null |
[
"Caffeine is both a vasodilator and a vasoconstrictor where as nicotine is a vasoconstrictor. Really anything in moderation. If you consume one or two 1mg nicotine lozenges a day there is going to be minimal effect of over all health. In fact certain reaction in the body and brain from nicotine reduce chances of Parkinson’s and other neurological issues. Coffee is the greatest source of antioxidants in western culture so again anything in moderation. Same with even wine or cannabis. Ying Yang."
] |
[
"Well there are lots of studies about caffeine and all cause mortality, but the first one I looked up was this one on 46,000 participants, published in Stroke.",
"https://www.ahajournals.org/doi/10.1161/STROKEAHA.120.032273"
] |
[
"This is interesting. I didn't know that about vasodilation and Caffeine."
] |
[
"Is biological and computer consciousness different?"
] |
[
false
] |
[deleted]
|
[
"Thanks, I will look into this more deeply now! ",
"Although the Turing test seems useful it is a bit subjective... Unless of course the \"Judge\" is a set of rules, rather than another conscious being. Again though, thanks. There seems to be quite little on the subject.",
"Edit: After watching the video I have high expectations for AI research in the future!"
] |
[
"Thanks, I will look into this more deeply now! ",
"Although the Turing test seems useful it is a bit subjective... Unless of course the \"Judge\" is a set of rules, rather than another conscious being. Again though, thanks. There seems to be quite little on the subject.",
"Edit: After watching the video I have high expectations for AI research in the future!"
] |
[
"The Chinese Room experiment is very interesting! It gets to point I was trying to make, that if Mind A(Brain) and Mind B(Computer). Mind B being an \"exact\" replica. Are they not both \"thinking\" in the same sense?",
"It begs the question then however, if you even can make an \"exact\" replica of a thinking mind(That is not made of grey matter and such). I don't agree with Searle when he said the programs thought depended on the conscious understanding of the Chinese speakers and programmers who designed it. But then Mind A(The human brain) depends on similar information.",
"Also, thanks again for the information! I added the book you recommended to my cart. I also seen Daniel Dennet mentioned a few times in the Chinese room experiment, so I might consider one of his books. Food for thought :D"
] |
[
"What is the most detailed lunar imagery that we have available to us?"
] |
[
false
] | null |
[
"China released lunar imagery with a scale of 7m/pixel:",
"http://sservi.nasa.gov/articles/china-releases-worlds-highest-resolution-lunar-images/",
"And the LRO team released an impressive pannable mosaic with an effective scale of 2m/pixel:",
"http://www.lroc.asu.edu/images/gigapan",
"According to the article, the LRO mosaic contains 680 gigapixels. From my reading, printing this mosaic at 300dpi would result in a printout larger than a football field. "
] |
[
"In photos like ",
"this",
" we can distinguish individual grains of sand. ",
"That's pretty good. "
] |
[
"Well, we put some pieces of the moon in an electron microscope, so probably that."
] |
[
"Do the antennas for technologies like 4G use the same scientific principle as the magnetron in my microwave?"
] |
[
false
] |
I'm a little shaky on how a magnetron generates microwaves in the first place, but I am really curious to know if the same resonating technique is used to generate the EM frequencies that let my Droid do 4G. Moreover, I can understand how a large cell tower might have enough power to send a signal to all the phones in it's range, but not quite sure how a single phone has enough power to send its signal all the way back to the cell tower.
|
[
"Microwave ovens use 2.4GHz waves. Cellular signals use several different carrier frequencies, including frequencies above, below and around 2.4GHz."
] |
[
"Microwave ovens use 2.4GHz waves. Cellular signals use several different carrier frequencies, including frequencies above, below and around 2.4GHz."
] |
[
"A magnetron is a type of cavity resonator used to generate high-power radiation at a desired frequency. Cavity resonators are not well-suited for small, mobile, low-power applications like cell phones. Other examples of frequency reference devices include crystal oscillators and surface acoustic wave devices, but I'm not sure what's generally used in modern cell phones.",
"Base stations and mobile devices are \"asymmetric\" - the tower can transmit at high power, making less work for the mobile to receive. The mobile broadcasts at lower power, so the tower requires more sensitive receiving equipment. This makes the towers more expensive, which is feasible since each one serves many users."
] |
[
"As sea levels continue to rise, will sand migrate to the \"new\" beach locations? Or will sandy beaches end up becoming a thing of the past?"
] |
[
false
] | null |
[
"In natural settings, (and where the conditions exist to support them currently) sand beaches would be expected to migrate with sea level rise. This is actually one of the ways we can recognize past sea level rises (or falls), i.e., the progression upward from fine grained (off shore) to sand (beach) in a vertical section of rock can indicate a former rise in sea level, i.e., ",
"Walther's law",
". The exception would be areas where there is infrastructure (e.g., sea walls etc) that would prevent the natural progression as sea levels rise."
] |
[
"sand is everywhere & it to some degree is always in motion unless it is buried. a beach or sandbar is just a place where it accumulates more than others & it always accumulates at points along the edges of large enough bodies of water to have waves and currents.",
"if the seal rise is gradual the sand just gets pushed to the new edge gradually as well, if it is rapid (think something like a river bank breech) sometimes you may \"lose\" the beach in the sense the water outruns the sand and the original sand may get swept elsewhere but as long as there are points on the shoreline with a low enough grade it will eventually accumulate again."
] |
[
"There is a beach beside me, I am there every day with the dogs. The sand on the beach changes, almost every day. About 10 years ago my 80 year old neighbour said it was the most sand he had ever seen. Sometimes there is almost no sand.",
"The next beach along had sand when I moved here 21 years ago. Then 19 years on zero sand, then 4 mounths of sand, now, none.",
"Sand moves."
] |
[
"How much energy would it take to boil all of Earth's oceans?"
] |
[
false
] |
Atlantic, Pacific, Indian, Arctic, and Southern Ocean
|
[
"/u/dinodares99",
" 's slight correction to ",
"/u/Crack-The-Skye",
" 's excellent answer got me thinking, and I realized:",
", if by \"boil\" you mean \"convert from a liquid to a gas\". Instead, you'll create a supercritical fluid. As you start to boil, the atmospheric pressure will increase. As it does, the boiling point temperature will rise, following the black line between \"liquid\" and \"vapor\" on ",
"this diagram",
". Eventually you will hit the \"critical point\", at which point the distinction between liquid and vapor ceases to exist: the water is all one phase, neither liquid nor gas. You can keep heating it if you like, but \"boiling\" isn't a thing anymore.",
"(Proof that you will reach the critical point: the hydrostatic pressure at the bottom of the atmosphere is equal to its weight divided by the surface area of the Earth. If the entire mass of the ocean is in the atmosphere, that's (1.35x10",
" kg * 9.8 m/s",
" / (4 * pi * (6300 km)",
" ) = ",
"265 bars.",
" The critical pressure of water is ",
"220 bars",
".) Since the Earth isn't flat, there will be some regions at the bottom of the former oceans where the pressure is quite a bit higher than what I calculated.",
"Since the final pressure is only slightly above the critical point, ",
"/u/Crack-The-Skye",
" 's answer is still in the right ballpark: my post is mostly just an excuse to talk about supercritical fluids, which are wonderfully weird."
] |
[
"Well, the oceans:",
"volume = 1.35 billion km",
" = 1.35x10",
" m",
" ",
"temperature = 10 C. (The surface is a little warmer in a lot of places, but the deep ocean is around 4C, and really we're not looking for that exact of number and more an order of magnitude so that's fine.)",
"And for water:",
"density = 1000 kg/m",
" (ignoring slight temperature dependence and salinity effects) ",
"specific heat capacity = 3.93 kJ/kg/K (for salt water, ignoring some other factors)",
"boils at 100 C (ignoring some factors)",
"latent heat of vaporization = 2300 kJ/kg",
"So the math would be: 1.35x10",
" kg (3.93 kJ/kg/K * (100-10 C) + 2300 kJ/kg) = 3.6x10",
" Joules. ",
"Edit: Or 995,000 ",
"PWh. The worlds year energy usage is around 100,000 TWh, so surprisingly we could boil all the oceans in ",
"10,000 years. ",
"Edit: Forgot to actually include the density in my math, as pointed out. 3.6x10",
" J or 995,000,000 TWh. "
] |
[
"By the way, the energy would be higher because the boiling point of seawater is actually about 0.6 degrees higher, which would give a difference of 597 TWh. Not large by any factor but still, for accuracy. And the latent heat of vaporization is 2257 kJ/kg. The density is also 1030 kg/m",
" There are more, but they are just nitpicks.",
"The biggest problem arises if we consider that this question is about boiling the oceans, not just that much hypothetical water. When we boil something, we are increasing the liquid's vapor pressure until it is equal to the pressure exerted on it by the surrounding atmosphere. That is why water will instantly boil in a vacuum but won't fully boil; the water vapors will exert a pressure on the liquid water, creating an eventual equilibrium. ",
"The same thing happens here, as we start pouring all this energy into the oceans, we start boiling the top layer off. If we assume water to a depth of 1m boils completely, that will release 3.6x10",
" m",
" of pure water into the air. That will also increase the salinity of the remaining water. Now we need more energy to boil the next meter of water, and even more the next. We would also need some way of stopping condensation, such as releasing heat into the atmosphere to heat up the vapors even more. ",
"An obvious solution is to accelerate our style of energy production today and wait. We'll be long dead before then, but at least we accomplished something! But wait, if we heat up the atmosphere to the degree that no water condenses on the now- barren Earth, that would cause the atmosphere to boil off. ",
"Thousands or millions of years later, an alien civilization would look at the Earth and see a planet with an unnatural percentage of water in its atmosphere and almost no life. "
] |
[
"Where do the various weather forecasts come from?"
] |
[
false
] |
There are dozens of websites on the Internet, where you can look up the weather forecast for the next few days for every place in the world. And most of the time, every page will give you an other forecast. Is every weather service running its own server that simulates the weather for the whole world or how do they get their data?
|
[
"Meteorologist here.",
"There are so many different forecasts because there are so many different people forecasting. Like mentioned before, Numerical Prediction Models (NAM and GFS are popular in the United States) are utilized by most. MOS (model output statistics) are quickly becoming the future of short term forecasting in my opinion. MOS uses previous similar weather conditions to create statistical output, meaning the results you see also come with a range. Seeing a high for tomorrow of 75 means that statistically speaking, the odds are that the high will be around 75, usually with a range of 5 degrees. Then it's also up to the specific forecaster. A good forecaster will know when to alter a MOS forecast and understand certain biases it holds. The way to beat MOS in forecasting is figuring out when to narrow the range of a forecasted temperature or precipitation amount based on a weather pattern that a human can take into account that the computer models don't fully comprehend.",
"Businesses, such as aviation companies, commodity traders, and energy companies will hire their own meteorologists or a private company that will forecast for their specific needs. The public forecasts can come from the National Weather Service, other online sites, or your local broadcast meteorologist. I've had the pleasure to intern for my local broadcasts meteorologist and I found that they really know what they're doing. All 4 of them majored in meteorology in college and have a BS in meteorology and atmospheric sciences. Generally, news stations will only hire qualified meteorologists nowadays."
] |
[
"This is what the model output looks like (today's OK City GFS). This data is manipulated into a forecast:",
" GFS MOS (MAV)\n KOKC GFS MOS GUIDANCE 5/23/2013 0600 UTC \n DT /MAY 23 /MAY 24 /MAY 25 / \n HR 12 15 18 21 00 03 06 09 12 15 18 21 00 03 06 09 12 15 18 00 06 \n X/N 82 63 81 65 85 \n TMP 64 70 77 79 75 69 66 65 64 69 76 79 75 70 67 66 66 73 80 81 71 \n DPT 58 61 62 63 63 62 61 60 60 62 63 64 65 63 62 62 62 64 65 63 64 \n CLD OV OV OV OV OV OV OV OV OV OV OV OV OV BK OV OV OV OV BK BK OV \n WDR 09 09 10 09 08 07 09 08 09 12 14 14 14 14 15 16 15 17 18 16 16 \n WSP 09 11 13 15 14 13 12 09 12 14 13 13 13 12 11 09 11 17 18 15 09 \n P06 13 6 24 43 11 5 3 7 9 3 7 \n P12 15 53 21 9 9 \n Q06 0 0 0 1 0 0 0 0 0 0 0 \n Q12 0 3 0 0 0 \n T06 27/11 20/36 40/22 57/13 16/ 2 17/16 21/21 28/10 11/ 4 22/25 \n T12 46/42 57/13 23/21 28/10 26/25 \n POZ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 \n POS 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 \n TYP R R R R R R R R R R R R R R R R R R R R R \n SNW 0 0 \n CIG 7 6 6 6 7 8 7 4 4 3 4 6 6 8 5 4 4 4 6 8 8 \n VIS 7 7 7 7 7 7 7 7 5 5 7 7 7 7 7 7 7 7 7 7 7 \n OBV N N N N N N N N BR BR N N N N N N N N N N N \n"
] |
[
"Several institutions run large Numerical Weather Prediction models. The output of these models is distributed to local tv stations and websites to make daily weather forecasts. Some of the big weather prediction centers are",
"National Centers for Environmental Prediction (NCEP)",
"European Centre for Medium-Range Weather Forecasts (ECMWF)",
"UK Met Office"
] |
[
"100 years ago, what were some technological advancements that we thought we would have today?"
] |
[
false
] | null |
[
"Hi jimdog10 thank you for submitting to ",
"/r/Askscience",
".",
" Please add flair to your post. ",
"Your post will be removed permanently if flair is not added within one hour. You can flair this post by replying to this message with your flair choice. It must be an exact match to one of the following flair categories and contain no other text:",
"'Computing', 'Economics', 'Human Body', 'Engineering', 'Planetary Sci.', 'Archaeology', 'Neuroscience', 'Biology', 'Chemistry', 'Medicine', 'Linguistics', 'Mathematics', 'Astronomy', 'Psychology', 'Paleontology', 'Political Science', 'Social Science', 'Earth Sciences', 'Anthropology', 'Physics'",
"Your post is not yet visible on the forum and is awaiting review from the moderator team. Your question may be denied for the following reasons, ",
"/r/AskScienceDiscussion",
"There are more restrictions on what kind of questions are suitable for ",
"/r/AskScience",
", the above are just some of the most common. While you wait, check out the forum \n",
" on asking questions as well as our ",
". Please wait several hours before messaging us if there is an issue, moderator mail concerning recent submissions will be ignored.",
" ",
" "
] |
[
"Technology"
] |
[
"Technology"
] |
[
"What is the \"youngest\" species we have discovered?"
] |
[
false
] |
If the title isn't clear, what I mean to say is, what is the species we know to have diverged most recently?
|
[
"According to ",
"this",
" BBC article, the answer may be senecio eboracensis, having originated mere decades ago. It's worth keeping in mind, though, that there's no clear set of guidelines for what makes an organism a separate species. The definition has been changed numerous times with new scientific discoveries, and will probably always be arbitrary. Single mutations that don't immediately leave the gene pool are enough to make the mutated line different, but wouldn't be considered a new species.",
"Ultimately, what makes a species a species is arbitrary, and the concept of species only exists to us humans. Just as there's no fundamental measurable \"Tuesday\" in the universe like there are neutrons or hydrogen, the concept of species is one we invented to try to keep track of a complex phenomenon. Also like days of the week, they aren't perfect, and as we continue to make new scientific discoveries (such as now knowing we need to add leap seconds to force our concept of days of the week to continue to work), \"species\" as a concept will almost certainly evolve and be redefined again."
] |
[
"Good point. Expanding on the example: In animalian species the line is generally drawn well within the 99th percentile of genomic similarity, whereas the amount of divergence even within, say, ",
" can be two-thirds of the bacterial genome. ",
"Now combine that with a replication rate of once every 20 minutes in ideal conditions; if we included microoganisms, the youngest species would be 'oh, right about now', all the time!"
] |
[
"Good point. Expanding on the example: In animalian species the line is generally drawn well within the 99th percentile of genomic similarity, whereas the amount of divergence even within, say, ",
" can be two-thirds of the bacterial genome. ",
"Now combine that with a replication rate of once every 20 minutes in ideal conditions; if we included microoganisms, the youngest species would be 'oh, right about now', all the time!"
] |
[
"Why does an atom need a neutron?"
] |
[
false
] |
It has no energy, why?
|
[
"Neutrons have no net charge, but they certainly have energy. There are no bound nuclei with A > 1 and N = 0. You can’t form matter like this. At best, you can only populate resonances that immediately fall apart."
] |
[
"Can this question be rephrased and turned around? \"Why do neutrons ",
" protons?",
"It's my understanding, as basic as it is, that free neutrons will naturally decay into a proton and an electron, but in a nucleus, the protons keep the neutron from decaying..."
] |
[
"Even if you could magically turn off the electric charge of protons, a proton-only nucleus with A > 1 would not have any bound states. We know this because neutron-only nuclei with A > 1 have no bounds states, and isospin is approximately a good symmetry of the nuclear force."
] |
[
"Does empty space or a void have a temperature, and if so what would be required to raise the temperature of a void?"
] |
[
false
] | null |
[
"If you require a perfect vacuum (no matter, no radiation), then you fully defined the system already. There is nothing you can change in it. How would a raised temperature look like?"
] |
[
"But note that the particle content is dependent on the observer. An accelerated observer will see non zero temperature particle content in the vacuum, see e.g. ",
"the Unruh effect",
" or ",
"Hawking radiation",
"."
] |
[
"Energy isn't an object. To add energy you need something that carries this energy. And with something in there you don't have a perfect vacuum any more."
] |
[
"How do cell towers send unique data streams to thousands of phones simultaneously?"
] |
[
false
] |
[deleted]
|
[
"The outbound from the cell tower to the phones is a comparatively easy problem. They cell tower sends out one or more big, fat, high-powered transmissions. Within these transmissions are packets addressed to whichever phone needs it, and the phones just look for the ones addressed to them.",
"The hard part is going from the phones back to the towers. As ",
"/u/bunky_bunk",
" said, there is FDMA and TDMA, but these have mostly been supplanted by using what's called CDMA (Code Division Multiple Access). CDMA is used for 3G and LTE.",
"In CDMA, all the phones can transmit simultaneously, and the tower can suss out each phone individually using some mathematical sleight of hand. It all depends on having a set of Orthogonal codes. Each handset in in a cell is given a unique pseudonoise code that it uses to modify its transmission. At the cell tower, I take in this wall of noise from the phones, and multiply it by all but one of the PN codes, and suddenly all but one of the phone transmissions disappears into the noise. It basically all boils down to the vector dot product.",
"It's a pretty slick system."
] |
[
"LTE does not use CDMA. It uses OFDM and SC-FDMA."
] |
[
"You can have more than one radio station or terrestrial television signal.",
"Same principle applies to mobile phones. Here is an overview of GSM:",
"FDMA: frequency division multiple access: phone A talks with the tower on a different frequency than phone B, one frequency slot has a bandwidth of 200khz",
"TDMA: time division multiple access; phone C uses 5ms, then phone D uses 5ms, then C again, etc on the same frequency to transmit data; 8 phones can share one frequency",
"The vast majority of phones that are not currently engaged in a conversation do not transmit anything to the tower, except for a keep alive message once every 30 minutes for example. If they want to use a channel, they first have to allocate one.",
"In a crowded city one cell tower usually serves only a small area. The more traffic there is in a given area, the more towers there are."
] |
[
"Peppers are hot because of capsaicin. Why is ginger root hot? What's the mechanism of action?"
] |
[
false
] | null |
[
"Gingerol is the most abundant active molecule in ginger. There's a few others that are similar. ",
"I don't have access to journals right now, but if I remember right, gingerol binds to a TRP ion channel (I think TRPV1, the same as capsaicin but not 100% sure on that) and has an MOA very similar to that of capsaicin. ",
"It makes sense when you look at the molecules, they are definitely similar and you can imagine them binding to the same relatively non-specific receptor:",
"Gingerol",
"Capsaicin",
" "
] |
[
"Correct, mostly. Gingerol is an agonist of both TRPV1 and TRPA1 channels.",
"source: Cortright et al, 2007. Trp channels and pain. PubMedID: 17467247",
"Fun diagram showing various common agonists and what channels they activate, also the temperatures at which these channels activate, as most of them are thermoreceptive as well, explaining why mint feels cool, and garlic, ginger, and hot peppers feel hot.",
"http://www.brauchilab.org/img/research/Figure%202.gif",
" I'm a grad student studying pain, I have spent a lot of time studying TRP channels."
] |
[
"TRPA1 receptor is indeed cold activated, in humans.\nSource: Jabba et al, 2014 Neuron PubmedID: 24814535",
"However, Isothiocyanates (active ingredient in wasabi and mustard oil) also activate TRPV1 receptors, which would make our experience a mix of hot and cold. In reality, things are a bit more complicated, and it looks like there is some debate as to the hyperalgesia (hypersensitivity) seen with mustard oil and other allyl isothiocynates.",
"Source: Alpizar et al, 2014. Pflugers Arch. PubmedID: 23955021"
] |
[
"How fast does scent travel? Why do some smells seem instantaneous while others seem gradual?"
] |
[
false
] |
[deleted]
|
[
"This depends on the rate/speed of diffusion of a certain gas. ",
"Diffusion is the net movement of gas/liquid molecules from a region of higher concentration to lower concentration. Some gases have higher rates of diffusion while others have lower rates. ",
"The rates in turn are described by Graham's Law, and they depend on how heavy/massive the molecule of a gas is. ",
"Graham's law states that the rate of diffusion of a gas is inversely proportional to the square root of its molecular weight."
] |
[
"Thank you! Do you have an example in miles per hour of diffusion rate of a common \"smell\"?"
] |
[
"It doesn't really work like that, diffusion rate isn't measured by the \"distance covered by the smell per unit time\".",
"Diffusion rate is measured in \"the amount of the substance that diffuses across a barrier per unit time\". The rate also depends on the difference in concentrations of molecules (the concentration gradient). Basically if the left side of the room contains 50% molecules of -say- Hydrogen and the right side contains 47% there wouldn't be a high rate of diffusion. However diffusion ratefrom a 80% concentration to 10% concentration would be higher."
] |
[
"How does contamination occur in other experiments with HeLa cells, and why is it such a problem?"
] |
[
false
] |
I was reading about HeLa cells, and the wikipedia mentioned contamination was a serious issue with this line. I always assumed biologists in this line worked aseptically, so... how do HeLa cells get into other cell cultures? How frequently does this happen, and what does it mean for the research when it does?
|
[
"I suspect this is not as serious a problem now as it once was. We have never had a problem with HeLa cell cross contamination in our lab or any other lab at out institute. ",
"Current tissue culture methods include the use of disposable culture plates and pipettes and cell lines are shipped to labs from the ATCC - an NIH run consortium that curates and tests cell lines. This prevents frequent cross contamination of experiments. "
] |
[
"dirtymirror is right on and as to how they get into other cultures: not using disposable pipetts/not changing tips. They survive cause they're hearty lil dudes."
] |
[
"Dudettes. :)"
] |
[
"Why doesn't working out coupled with starving yourself result in more weight loss than working out and eating a healthy diet?"
] |
[
false
] |
[deleted]
|
[
"Some say that if you eat too few calories (like, less than 800 calories per day) then your body thinks you're starving and lowers your metabolism in order to conserve energy.",
"This hypothesis, however, is controversial.",
"What's not controversial is that eating this few calories on a regular basis is ",
" in the long term. Your body needs a certain amount of protein in order to rebuild and maintain cells. Not all of the amino acids that your body needs to build protein can be synthesized by your body. Early symptoms of such a deficiency can include hair and toenail loss."
] |
[
"Do you have evidence to suggest that it doesn't?"
] |
[
"It does. Over the summer I was doing that on the weekends, working out in the morning (which for me is like 10:30am) with only a half glass of milk for breakfast, then sometimes skipping lunch. Lost a lot of weight that way."
] |
[
"What do physicists actually mean when they say that forces are unified at high energies?"
] |
[
false
] |
It has never been clear to me what is meant when physicists theorize that all forces were unified at the time of the big bang. The most common example I come across is the so-called electroweak force. At very high energies, electromagnetism and the weak force are apparently the same force? EM is carried by photons and Weak by W and Z bosons, so are they saying those force particles are also the same thing? And if these two forces are actually one in the same, why would they diverge into two things at some arbitrary energy? I've never understood this.
|
[
"What they mean is that the forces are actually different aspects of a single more-complicated-than-either-one thing that appears like two separate forces under ordinary circumstances. The Z bosons (which are to the weak force what the photon is to the electromagnetic force) come about from something called ",
" at low energies, and the broken symmetry is all that makes them different from the photon.",
"But that description is too fraught with meaning -- it's barely simpler, and much less satisfying, than ",
"/u/cougar2013",
"'s technical language about symmetry groups. So I'll back up and ELY5 unification in general. It's worth reading even if it's familiar to you (I hope...)",
"To understand unification of different theories, let's go on a small tangent. Imagine a 2-D world in which you could identify a pattern of certain types of shape in nature -- say, red squares and rectangles everywhere. You might study them and observe some patterns in the population of red squares and rectangles, and develop a theory of the red rectangles -- under what conditions they stretch, why some special ones happen to be squares, why some of them (\"failed rectangles?\") are actually trapezoids. Someone else might identify some other similar-but-different shapes - say, a bunch of red triangles - and develop a theory of the red triangles: what causes them, why some triangles seem to have slightly different shapes than others, etc. You both might be aware that there are, under rare circumstances, red hexagons to be found here and there - but never red octagons or circles or whatever. Eventually someone might come along and point out that really the world just has a bunch of red cubes in it, and both your red rectangles and your rival's red triangles are really just cross sections of those red cubes, taken at particular angles. Likewise, certain special cross sections of the cubes happen to be hexagons. That unified theory is very simple (\"the world has cubes in it, and we perceive cross sections of them\") and explains the existence of squares, rectangles, triangles, ",
" the rare hard-to-find hexagons. The complexity of all those particular different types of polygon arises from breaking the deep symmetry of the cube in strange ways -- by cutting the oh-so-simple cube in various oddball directions you get all the different weird cross sections observed in that 2-D world: triangles, rectangles, and hexagons (but never pentagons or octagons).",
"A good example of theory unification from the actual history of physics is the unification of the electric and magnetic forces. For years electricity and magnetism were studied as completely independent things. It took over a century of systematic study before folks recognized that they were related. The real unification of electricity and magnetism into ",
" happened in the mid 1800s. A guy named James Clerk Maxwell collected the four then-known empirical laws describing the electric and magnetic fields, and noticed they were slightly inconsistent. He added a too-small-to-measure correction term (the famous-to-physicists \"displacement current\" term) to the magnetic induction equation that describes how electromagnets work. That small term changed the theory of electricity and magnetism into a unified theory of electromagnetism including things like wave optics, radio, and even obscure bizarreness like zilch (an electromagnetic quantity that is conserved in vacuum). ",
"The displacement current in electromagnetism is a quite-small magnetic effect produced by a changing electric field. It's invisible to 19th century technology, though it can be measured using 20th century equipment. But its existence shows that the electric and magnetic fields are more intimately connected than is immediately obvious -- they are different aspects of a single phenomenon that is simpler, and more highly symmetric, than the two descriptions separately. The separation of the electromagnetic field into \"E\" and \"B\" components is not an intrinsic phenomenon (fundamental to the world), it's an accidental phenomenon (that just happened to work out that way) due to the types of measurement that are easy to make using wires and magnets and such -- in a deep sense, the E field and B field are cross sections of a more complex, symmetric \"electromagnetic field\" just like the triangles and rectangles and hexagons were cross sections of the red cubes up above.",
"So a big part of fundamental physics in the modern world is trying to identify similar effects to the displacement current, in different circumstances. We know of four (three now, really) force laws that, together, seem to describe almost everything that goes on in the world. To what degree are those separate force laws just aspects of some larger, more symmetric phenomenon? ",
"The electroweak unification is different from the electromagnetic unification, because it involves a different kind of symmetry breaking. The E/B symmetry is broken mostly by the types of measurement that are easy to make, but the electroweak symmetry is broken by something called \"spontaneous symmetry breaking\". Some systems have deep symmetry that is only obvious when the system is excited, and that symmetry collapses into an accidental asymmetric system when the system relaxes. A good example is the shape of a spring-steel wire. Consider a straight piece of piano wire (which is a very springy material), natural length ",
", anchored between two fasteners. If the fasteners are farther apart than ",
", the wire remains highly symmetric, although it is under tension. If the fastners are exactly ",
" apart, then the wire will also remain symmetric even though there is no tension. It may even remain symmetric if the fasteners are ",
" closer than ",
". But if you push them even closer together, the wire becomes statically unstable. The symmetric (straight) solution still exists, and in a perfectly symmetric system the wire would compress just like it stretched in the farther-than-",
" case. But in the real world it will spontaneously break symmetry and bow in a particular direction, making an arc of steel that is approximately ",
" long even though the endpoints are closer than ",
".",
"The electromagnetic and weak forces are in a state like that: at high interaction energies, charged particles undergo highly symmetric interactions via something called the \"electroweak\" force. In general, quantum mechanical calculations are very hard to do, so we humans use first order perturbation theory to understand how the vacuum and the things in it interact with each other. The perturbation terms that are most natural turn out to act like particles, so the Z and photon are particularly shaped perturbations on the vacuum field. The Z is different from the photon because the vacuum's symmetry breaks spontaneously at low energy, just like the wire's symmetry breaks spontaneously at low fastener spacing. The two particles are just differently-shaped distortions of the vacuum system - they're analogous to small bending distortions of the piano wire in the last paragraph, say one in the radial direction and one in the lateral direction. They have different character only because the 'wire' itself is bent and asymmetric.",
"If you use second-order perturbation theory on the vacuum, you find that the natural first-order perturbations change their character as you increase the energy of interaction. Very high energy photons (which have as much or more energy as the rest mass of a Z) start to act more like a Z, and vice versa. That sounds deep, and it is, but it harks back to your first-year calculus class where you learned about limits. It really is just a matter of noticing that some terms in the equation of motion happen to be small, and then just ignoring those terms altogether.",
"So when a physicist tells you that, at high energies, the electric and weak forces are unified, they mean something very specific and complex: the electric and weak forces are really aspects of the same thing, just like the electric and magnetic forces, but unlike the E and B fields the \"W field\" (that mediates the weak force) is actually different from the E and B fields in the everyday world. That difference is reflected in the mass of the Z mediation particle compared to the photon. But it's an ",
" difference and not an ",
" one. Further, at high interaction energies the different masses of the electric and weak charge carriers (e.g. electrons and Ws), and the mediation particles (e.g. photons and Zs) cease to be important, and they act more and more the same.",
" If you didn't want to read it, what are you doing in AskScience anyway? Go read ",
"/r/funny",
"."
] |
[
"Here is an image of a cube being cut into a square, rectangle, hexagon, triangle for illustrative purposes.",
"http://mathworld.wolfram.com/images/eps-gif/CubeCutByPlanes_1100.gif"
] |
[
"Getting to the last part made me feel as if I had just found an Easter egg at the end of some random TOS."
] |
[
"Twins and DNA tests"
] |
[
false
] |
As an identical twin and as someone that shamelessly watches the Maury Show this question always lingered in the back of my mind: If twin A fathers a child, and both twins were given a paternity test, would it say that both twins are the father? I know that twins have the same DNA but is expressed differently through the phenotype. But could this test say that both are the father?
|
[
"There are small DNA level differences between monozygotic twins that can be tested for - epigenomic changes (environment changing DNA expression) or differences in copy-number variations.",
"However, most paternity tests look at only a few parts of an individual's genome, and wouldn't be sensitive enough to differentiate the twins. They look at your \"DNA fingerprint,\" choosing genes that are highly likely to vary between individuals. Monozygotic twins would have the same DNA fingerprint."
] |
[
"This is correct. ",
"The DNA fingerprint anthracis mentions is the number of repeats of specific DNA sequences in what are known as STR (short tandem repeat) loci. These repeats are usually 4 or 5 bases long.",
"For example you might have a sequence that looks like:",
"GATAGATAGATAGATAGATAGATAGATAGATA with 8 repeats of the GATA sequence. Someone else might have 7 or 9 repeats of GATA in the same region of their chromosome.",
"So we look for regions of the DNA that are known to have these STRs, and then we look for the different numbers of repeats between individuals. Not all STRs have different numbers of repeats, the ones that do are called STRPs (STR polymorphisms - indicating that there are multiple varieties of the specific STR). ",
"Forensic analysis usually looks at 11 or 13 different places on the genome where STRPs are known to be found, and then looks at the number of repeats. Close relatives will have similar, but not identical, numbers of repeats at most of their STR loci (locations on the genome with STRPs) while unrelated individuals will have very different numbers of repeats at their STR loci. There is an essentially 0 chance of you and an unrelated person having the same number of repeats at ALL of your STR loci. Monozygotic, or identical, twins however, have DNA that is very nearly identical. There is a very high (near 100% chance) that they will have the same number of repeats at ALL the STR loci that are commonly tested for. "
] |
[
"As a follow on to the original question, and to clarify from the worthies already answering, is the following true:",
"A child born to parents that are each part a of two sets of twins will, genetically, be a sibling of a child born to parents that a each part b of the same sets of twins."
] |
[
"Is the three polarized filter experiment really a demonstration of quantum uncertainty or is there a much more simple explanation?"
] |
[
false
] |
I just watched where I've just now learned of the polarizing filter experiment demonstrating Bell's theorem. But it's done my head in a bit because my immediate thought was simply that the experiment is flawed and the light is just in a reflection loop. Light passes through filter A, half of it continues through filter B toward C. The other half is reflected back toward filter A where half of it passes through in the opposite direction and the remaining half of the bounced light again reflects back toward filter B where half of it continues through toward filter C making it brighter. Upon each reflection, the light is slightly scattered and its directionality will be altered allowing it to pass. Add to that that a large amount of light was bounced off of C initially which will have gone through the same reflection paths. This goes in a decreasing loop adding brightness to C until you get the significant boost their experiments observed. To me, this doesn't appear to be a great demonstration of quantum uncertainty because it is explainable through a more certain physical process. My question is this: what am I missing? Why do scientists go so far down the quantum rabbit hole to explain this "strange" phenomenon that seems perfectly reasonable to me and why is my explanation not reasonable? Thank you!
|
[
"The filters don’t reflect the light that doesn’t go through. They aren’t mirrored, or even partially mirrored. Instead, they block (absorb) the light that doesn’t pass through. That’s clearly stated in the video you linked.",
"Even if they WERE mirrored, the mirroring wouldn’t change the orientation of waveform when it bounced back to reinter the filter again."
] |
[
"Awesome, thanks for the explanation!"
] |
[
"I would assume that the energy becomes heat within the filter, itself. The filter would just warm up more than, say, a transparent glass would. But I've already gotten myself into trouble with assumptions here, ha ha."
] |
[
"What makes China (and presumably its surrounding areas) such an ideal location for fossil excavation?"
] |
[
false
] |
[deleted]
|
[
"I think it's important to first identify that the reason for China having somme exceptional preservation is that because China is huge, so the chances of there being a good fossiliferous deposit there were higher than for many other countries. The actual extent of excellent preservation is no higher than elsewhere in the globe. Just because China happens to have a good lithology for it, does not mean the surrounding regions will; these lithologies are often very restricted (for example, limited to the location of an ancient lake site).",
"There are also fantastic fossiliferous deposits known in, for example, the US and Germany.",
"The more technical geological 'why' is simply that high quality preservation requires a plethora of conditions which not only enable the initial fossilisation to be preserved but also then not alter it while it sits around, and finally bringing it back to the surface for us to find it in this narrow window of time our species is here. ",
"TLDR - there's nothing special about China ",
", it just so happens we have identified a few locations of outstanding preservation around the world and China hosts at least one of them."
] |
[
"A lot of these amazing fossils are coming out of ",
"Liaoning Province",
" in NE China. As crazy as it sounds, they're being dug up in farmers' fields. Unfortunately that means a lot of them end up being sold illegally by farmers. They lose all information about where they were found, which provides important geologic context, and scientists never see them.",
"The excavations started fairly recently, in the 1990s. This was mostly due to the political climate in China. Any fossils that were found were kept largely under wraps and scientists outside the country never saw them. The earliest work was actually done by the Japanese when they occupied the area, I believe, but I think those specimens were lost. The fossils are from a really interesting time right at the origin of birds, modern mammals (like ",
" and ",
", and even the first flowering plants). ",
"The preservation happens to be incredible. The fossils are generally coming from areas with very fine-grained sediments, most of which I believe are lacustrine (formed in a lake). They're formed mostly of volcanic ash, and there are a lot of basalts known from the region as well. The environment was one that allowed for the preservation of feathers, hair, stomach contents, and even twigs with leaves on them. ",
"In many ways this is similar to the Solnhofen formation that ",
" is from, although Solnhofen is older, the paleoenvironment was more like a lagoon, and the formation is comprised of limestone. Excavations there have been ongoing for much longer. ",
" was discovered in 1861. The Green River Formation in Wyoming, which is Eocene in age, also has similar preservation (it's a lacustrine limestone) and has feathered birds, although not as many. Most of the Green River fossils are fish. The birds are not as flashy as the feathered dinosaurs from China just based on their age; they're not that sexy bird-dino link. There are a lot of interesting unstudied specimens from there, though!"
] |
[
"China has large swaths of land that haven't ever really been used for much industrially, and a generally-temperate-ish climate, meaning that expeditions are easier. Canada would likely also be a good choice during the summer (or, as they call it, daytime), or Siberia. ",
"The other big reason is that large parts of China are still unexplored for fossils, relative to most of the rest of the world, so there's still lots of 'low-hanging fruit', as it were."
] |
[
"How does chickenpox recur as shingles?"
] |
[
false
] | null |
[
"Chickenpox is caused by a virus. When this virus infects you, you will develop the typical symptoms of chickenpox, which are the spots across your body; the fever; and the general feeling of malaise. Once the infection subsides, the virus isn't gotten rid of, but rather it lays hidden (or dormant) within a section of some of the nerve cells in your body. ",
"These specific nerve cells are the nerves that come out of your spine, and they each supply an area of skin on your body. These areas are called ",
"dermatomes.",
"The left nerves supply the left, and the right supply the right, and each ends at the midline of your body. ",
"Now in certain periods, such as those where you're under high stress, or scenarios where your immune system may be dampened for any reason, these viruses which are inside your nerves will reawaken, and the infection will start again. ",
"However, because they're now simply confined to a nerve path, we don't see the whole body rash anymore, but rather we see a rash that follows the trail of whatever bit of skin is supplied by that nerve - or simply put - the dermatome. This recurrence is called Shingles."
] |
[
"That’s kind of correct. The nature of the virus is that it’s never fully eliminated from your body when your symptoms stop. Once that virus enters your body, the next port of call for it is a section of the nerves that I was talking about. The section of the nerve is called the dorsal ganglion, and you can think of it as the nerve ‘hub’ for lack of a better analogy. Under normal circumstances, that virus will just stay there until death, but in certain specific circumstances like I mentioned in my previous comment, it can reactivate again. ",
"There are definite links with a reduced chance of getting shingles if you have the vaccine, however there are also links with getting shingles earlier in life if you get the vaccine. ",
"Ultimately, it’s still an area that’s being researched, and without having read the specific papers, this is all I can say off the top of my head for now. I’ll have a read of the literature tomorrow though, and if you have any other questions I’ll be happy to get back to you with more detail!"
] |
[
"Chickenpox is a viral skin infection that normally happens in children. After one has had chicken pox, the virus remains dormant in nerve cells. It's unclear what activates the virus after being dormant, but some risk factors include stress, age, and a compromised immune system. The fact that the virus recurs from the nerve cells is what makes shingles significantly more painful than chicken pox."
] |
[
"Why is lead always the element used to protect us from radiation?"
] |
[
false
] |
To expand a bit, what properties does lead have that make it so good at protecting from radiation. How does it actually keep the radiation from touching us? What is happening at the atomic level?
|
[
"Lead is not ",
" the element you want to use for shielding radiation. What you use to shield against radiation depends on the kind of radiation and its energy. ",
"Lead is good for shielding electromagnetic radiation (x-rays and gamma rays) because it has a high atomic number.",
"High energy photons primarily interact with matter via three processes: the photoelectric effect, Compton scattering, and pair production. The probabilities of all of these interactions increase with the atomic number of the material (see ",
"Table 1",
")."
] |
[
"gamma rays) because it has a high atomic number.",
"And because it's pretty cheap and abundant compared to the other elements with high atomic numbers, I assume? I mean, it would make sense if it's not just the atomic number, but the relationship between it and the price. "
] |
[
"Tungsten is a common one to use. I worked on a medical cancer Xray treatment source. We made tungsten powder loaded sheet rubber as a blanket to protect the medical staff when it was used."
] |
[
"When a fly or any flying insect lands on my flat screen tv; how come the on screen movements do not spook them, but they fly away as soon as I move towards them?"
] |
[
false
] | null |
[
"They probably were blinded the first time you did it and now can't tell anymore. Seriously, don't shine laser pointers in your pets eyes!"
] |
[
"They probably were blinded the first time you did it and now can't tell anymore. Seriously, don't shine laser pointers in your pets eyes!"
] |
[
"Their sight isn't that 'good' in the sense it's nothing like ours - for what the fly must do to reproduce, its eyes are great.",
"In fact, ",
" (order of a 100...so, centisecond? Sounds weird) ",
" ",
".",
"The business about the flies sensing the moving air as something comes to hit them is news to me, and I've never seen it before.",
"I suspect there are holes in fly swatters not to disguise some kind of pressure signature, but to decrease air resistance and increase speed of swat."
] |
[
"Could we eliminate the Flu if we all got vaccinated for the flu and wore masks during flu season?"
] |
[
false
] |
Masks have been pretty effective at keeping my family healthy this year and I was wondering if some viruses like the flu are so endemic that there will always be substantial spread, or if mask use would be effective at isolating or eliminating the flu?
|
[
"No, there are large reservoirs of flu in bird and swine populations. It’s probably more helpful to think of “flus” not “flu”. Being vaccinated against one or a few doesn’t do much if you get exposed to a different strain. Each year health authorities try and predict which strains will be the major ones."
] |
[
"Well... technically, we could ",
" flu with with vaccines, distancing, and masks but we wouldn't be able to ",
" flu due to the wild and domestic animal reservoirs."
] |
[
"In China, introducing a poultry vaccine for several strains of influenza virtually eliminated ",
" cases of H7N9 for several years. H7N9 is a strain of avian influenza that infected over 1500 people, with a 39% mortality rate, between 2013 and 2017. The Chinese began aggressively vaccinating chickens in 2017, and since then there have only been a handful of human cases."
] |
[
"What creature is this skeleton?"
] |
[
false
] |
I stumbled (literally) upon this skeleton while walking in a public park. This park has peacocks, skunks, and cats walking about in it. There is also a river nearby. Any idea what this creature is? I was thinking it was a bat, but there are no wings and the feet look different.
|
[
"Looks to me like the partial remains of a cat. Just based on the skull.",
"The pictures are a bit blurry so its hard to say."
] |
[
"Yes, it's a cats ",
"shoulders, neck and head."
] |
[
"There are 2 bones in the lower portion of the front legs used to rotate the cats paws slightly, though in the picture they are incorrectly positioned. The large flat bone areas are the shoulder blades. The legs are most likely connected dried blood and entwined hair. It appears to have been white/grey by the looks of the remaining fur. I don't see hands in the photo, but if you can get a closer photo of the appendages I would be interested in seeing it. "
] |
[
"If scientists can detect gamma ray bursts happening all the time, how have we not been hit by one?"
] |
[
false
] |
I'm watching a documentary on gamma ray bursts, and the narrator is talking about how often they occur. Then he says they can be detected from across the entire universe. That doesn't sound possible to me, could somebody more knowledgable than me shed some light on this subject?
|
[
"In theory, we're hit by them all the time. That's how they're observed, as quick flashes of gamma rays coming from a single point in the sky. Of course, I should mention that they are observed by space telescopes designed to pick up these wavelengths, you won't be seeing them down here. ",
"Basically, GRBs are like lasers. Whatever produces a gamma ray burst ends up spitting out all of those photons on a very narrow path. Of course it's not perfect and it disperses a little (so maybe 'cone' is better than 'path'), which is why we can get hit by a gamma ray burst on the other side of the universe and not get fried. ",
"Oh, and I mean ",
" GRBs put out as much energy as the sun will in its entire lifetime in seconds. If a nearby GRB got a direct hit on the earth, it would be a gunshot to the head of the planet: everyone would die pretty much instantly, the atmosphere would be stripped, etc etc. ",
"Anyway, in the same way that you wouldn't want to stand too close to the fire, you don't want to be too close to a GRB if you have to get hit by it. ",
"So basically, it's a statistical thing. Given the odds of a gamma ray burst happening, and given the volume of space that the gamma ray burst cone can obliterate (before the beam is no longer focused enough to do any real damage), what are the chances that the earth will be hit? The odds turn out to be pretty good (which is pretty terrifying). The odds are half decent that the earth has already been hit by a GRB at some point in it's history, and this has even been put forward as ",
"a hypothesis to explain the Ordovician–Silurian extinction event.",
" Of course, this doesn't seem particularly falsifiable- how the hell would you ever confirm this? ",
"Fun fact: This is actually one explanation for the ",
" of observed life in the universe. ",
"Maybe life would be more abundant if frequent GRBs wouldn't keep sterilizing huge chunks of galaxies.",
" Whether or not that fact is ",
" depends pretty strongly on your definition of fun."
] |
[
"Once you factor out your own mortality, the wonders of the universe are always fun."
] |
[
"Right, GRBs aren't ",
" like a laser, but I think the analogy illustrates the concept of collimation quite well, which is the first thing I think a nonscientist might associate with 'laser.' ",
"It's an interesting idea that GRBs are proposed as the explanation for the lack of observed life in the universe, although I don't agree with it.",
"As an idea, I think it's amusing too. The problem is falsifying it. "
] |
[
"Are there any theories on macro physics?"
] |
[
false
] |
There are descriptions of physics and quantum physics, but how about theories of physics on a scale larger than the known universe?
|
[
"The large scale structure of the universe is described by general relativity via the Lambda-Cold Dark Matter model."
] |
[
"What's \"larger than the known universe\"? To me it seems as meaningful as asking what the legal moves are for chess \"outside the chessboard.\""
] |
[
"I saw a show a little while back on the science channel (i think). That talked about how it seems like our universe is being pulled in 1 direction as if an external gravitational force is pulling on it. It went on talking about how this could mean there is something else outside of our universe. The main question is any theories of things that we cannot explain with physics we know now, but might be explained on a super macro level in the same manner that quantum explains the super micro side."
] |
[
"Can thermodynamic state be defined for non-equilibrium systems?"
] |
[
false
] |
Normally we need two thermodynamic properties (like T and p) to define the state and find u, h, s, g etc. for equilibrium systems. Can a thermodynamic state can be defined for non-equilibrium systems like for equilibrium systems. Specific systems I'm thinking about are metastable states like superheated/cooled liquids, unstable states like transition state in reacting systems, or systems with some kind of gradient.
|
[
"Yes and no. Generally, classical thermodynamics does not deal with non-EQ systems. The way you get away with this is by using only state variables, which are path-independent (i.e. we don't care how we got to the second state, so we don't care about the non-equilibrium process; we just assume it was sufficient to get us to the required state). But this of course creates an issue when we want to study non-EQ systems - we don't have the required tools to do so in classical thermo because we assumed the problem away. Namely, in non-EQ systems time becomes an important variable (the rate of a reaction process, etc.) and if you notice, we never use t as a state variable in classical thermo (although we'd need to in order to capture all of those transient states you mentioned). ",
"So this is where non-classical thermodynamics comes in. If you want to study transition states of reacting systems, you can use kinetics assumptions and/or statistical thermodynamics. Or, if you have a good reason to assume your non-equilibrium process is in steady state, this can also help you analyze it. ",
"So, short answer is no, not in classical thermo. Long answer is yes - we have to study non-equilibrium systems for gas dynamics, combustion, etc, and we do this by essentially adding in more/different variables to help us describe the system."
] |
[
"What about metastable systems like supercooled liquids, if some T and p are we able to define other state variables like u, g, h etc. like an normal EQ system?",
"For a non-EQ system at steady state (say with some gradient), would we still be able to define the state locally (i.e. find properties are point locations using T and p at that point)?",
"For a general non-EQ system, if we freeze time at some arbitrary point, would we still need >> 2 variables to fix the other thermodynamic properties (i.e. there will be multiple u,h,g etc. for some T and p)?",
"My takeaway is that one cannot generalize non-EQ systems like we can for equilibrium systems; it depends on the specific systems being studied, is this correct?"
] |
[
"I'm not too familiar with metastable systems, unfortunately, but my gut tells me that if you can assume that the system is stable for long enough such that it's in equilibrium, then you can essentially treat it as you would any other system? Someone else more qualified would probably be able to give you a better answer here. ",
"For a non-EQ system at steady state, if you have the gradients, I believe there are equations that can tell you your state - they involve flux densities and other things that aren't typically found in your average Gibbs equation thermodynamics. Probably Wikipedia would be your friend here; sorry I can't be of more use. ",
"The time-frozen non-EQ system is an interesting question. I think there would still be multiple values for your state variables no matter how you slice it - otherwise the system would be in EQ kind of by definition. However, freezing time indirectly can come in handy, say when you're analyzing the extent of a reaction. ",
"In general though - yes, non-EQ systems are much harder to deal with and it very much depends on the types of things you can assume about your system if you want to come to a closed form solution. As a side note: Non-EQ thermo is still very much being studied; I don't think we've solved all the problems yet. So if you're interested in it, go do it! I guarantee there's lots of equations and principles, still undiscovered, just begging for your last name ;)"
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.