title
list
over_18
list
post_content
stringlengths
0
9.37k
C1
list
C2
list
C3
list
[ "How does the human body get rid of particulate matter in the air?" ]
[ false ]
So I was spraying some DE into some spots in my house to get rid of some bugs and realized that there was a lot of dust being blown into the air. I did some research on the web to see if anything bad could happen and discovered this thing called Silicosis. Looking further, it made me wonder how the human body usually ...
[ "Most particles (like dust) are quite large, and will be caught in mucous in upper areas of the airways. Generally I believe this will be expelled eventually as mucous, by coughing, sneezing, etc., but some may be ingested and excreted this way.", "Very fine particles can penetrate deeper into the lungs, and thos...
[ "For example, asbestos may enter into the cells in the lungs and cause destructive processes to occur to the chromosome of the cell, potentially causing cancer. It seems to be excreted mostly in the faeces in a relatively short period of time. However, you could in theory have fine particles of heavy metals, and ot...
[ "I thought asbestos was small enough to enter deep areas of the lungs, and large enough to be retained inside cells? Or do you mean that they remain extra cellular the whole time? I didn’t study this much and haven’t read into it much since, so my understanding could well be very wrong. I’ll have a read of the pape...
[ "If humans were to become a multi-planet species, could humans on Planet A and humans on Planet B eventually become two separate species over a vast length of time in two possibly different environments?" ]
[ false ]
null
[ "If humans were to become a multi-planet species then one would assume that they would be able to exchange genetic material between the populations on the various planets. The only way they would ever diverge into separate species is if the planets were somehow reproductively isolated from one another for a ", " ...
[ "Not necessarily, it's more complicated than that.", "Suppose humans exist on three planets. The humans on planets A and B can reproduce, and the humans on B and C can reproduce; but the humans on A and C cannot.", "The problem is that \"are the same species\" is necessarily transitive (if A and B are the same ...
[ "Yes, although I'll leave it to a biologist to explain at what point we'd be considered different species. But obviously, so many creatures coming from common ancestors, there was a point at which we were the same species." ]
[ "How is the evolution of animals such as bees and ants influenced by the low percentage of induviduals who can reproduce?" ]
[ false ]
null
[ "Pretty much the same way that evolution of multi cellular organisms are influenced by the low percentage of cells that reproduce.", "Germ-line cells such as those that make sperm and eggs are the only cells in our body that make it to another generation. The Somatic cells, which contain the exact same genetic se...
[ "When you're talking about the evolution of bees and ants you're essentially thinking of every colony as a \"superorganism\", with all the inhabitants operating as a single entity and reproduction occurring via queens and drones. The fact that ants can sometimes select a new queen complicates the model somewhat. Bu...
[ "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2781879/", " -- check out this article" ]
[ "Do super symmetrical particals have antimatter counterparts?" ]
[ false ]
In the SS model, are anti-sleptons and anti-squarks a thing?
[ "Except for particles that are their own antiparticles, just like for normal particles." ]
[ "Yes." ]
[ "Wait what? How can that be a thing? I thought the whole point was they cancel out. Wouldnt that just be nothing? Or do they have energy cancel them out somehow?" ]
[ "What causes the difference in sound heard between a rumbling and a crackling lightning strike?" ]
[ false ]
[deleted]
[ "Several factors affect the sound of thunder, most of which have to do with the path that the sound takes from the lightning bolt to your ears.", "A lightning bolt can be several kilometers long, so the thunder generated from the point nearest to you can reach you as much as 20-30 seconds before that from the poi...
[ "Are higher frequencies somehow filtered away over distance", "Yes, higher frequencies push the air molecules back and forth faster, so they lose more energy to dissipative effects." ]
[ "That's exactly right. My bad, I'm so used to that concept that I think of it as self-evident.", "As an aside, that's part of the reason why the positioning of tweeters/midrange speakers is critical in a home theater system, while the subwoofers can be placed almost anywhere." ]
[ "Why is neutron decay inhibited by being in a nucleus?" ]
[ false ]
Title says it all. Why do protons stop neutrons from decaying?
[ "Pauli exclusion principle", ".", "A free neutron decays because it forms a proton, electron, and electron anti-neutrino, which combined have lower energy than the original neutron.", "But in a nucleus, with a bunch other protons hanging around, the exclusion principle limits the energy states the newly forme...
[ "I could not explain better. Although I can add a simple example to analyze the balance of energies, the deuteron (proton-neutron pair):\nIf the neutron in the deuteron were to decay to form a proton, electron and antineutrino, the combined mass energies of these particles would be\n2x(938.27 MeV) + 0.511 MeV = 187...
[ "Sorta-kinda yea. For small reasonably stable nuclei, one can approximate the nucleon-nucleon potential with a 3d harmonic oscillator potential which has discrete energy levels sort of like the 1/r atomic potential. The number of protons (or neutrons) to fill a shell is different than in the atomic 1/r potential, t...
[ "What happens when a neutrino or antineutrino collides with a nucleus?" ]
[ false ]
We know in beta decay of the beta minus kind we have a neutron decaying to a proton, electron, and antineutrino of the electron flavor. Beta plus decay occurs with a proton decaying to a neutron, positron, and neutrino of the electron flavor. Are there any interactions associated with an electron neutrino or antineutri...
[ "When a neutrino or antineutrino encounters a nucleus, the chance of a non-trivial is interaction is small, but non-zero.", "Two processes that can occur:", "neutron + neutrino --> proton + electron ", "proton + antineutrino --> neutron + positron" ]
[ "It's worth noting that all (I think?) reactions in particle physics are reversible - you'll hopefully notice that both of fishify's interactions are the reverse of Beta decays!" ]
[ "That would ", "explain this" ]
[ "How have scientists improved the efficiency of solar cells in the past, and how are scientists trying to improve the efficiency of solar cells today?" ]
[ false ]
Like, what specifically do solar researchers research on a day-to-day basis, and what strategies have they tried in the past? Also, what majors could I work toward in college if I wanted to help develop more efficient solar cells? (I'd guess electrical engineering or materials science, or even like physics or something...
[ "Broader absorption spectra (utilizing deeper absorption into UV and less selective about wavelengths in the visible spectrum) has increased the amount of raw energy collected. Otherwise, I'm sure advances electrical engineering has improved the efficiency of power distribution. ", "If you want to work on solar...
[ "I've read of improvements in the surface area of the panel by making them bumpy", "Why do you believe increasing the surface area of a cell would increase its performance? I mean, I'm pretty sure I know what you're referring to, which is the texturing of Si cells with an acid wash, but the purpose of that isn't ...
[ "Otherwise, I'm sure advances electrical engineering has improved the efficiency of power distribution.", "Yep! Overall efficiency has had a more positive benefit, but in some markets (like home solar) the engineering has had a much larger impact. For instance ", "MPPT controllers", " and other smart improv...
[ "What do you all think about extraterrestrial life? Do you believe there is life outside of Earth? Not necessarily intelligent life, just any life at all." ]
[ false ]
Ive read some articles online which claim the discovery of microfossils with proof of life, but it seems to be a pretty hotly debated topic.
[ "It is incredibly naive to think that we could be the only life form outside of Earth." ]
[ "I say yes, but I am not even close to an expert, it just seems that with the size of the universe and the amount of stars and planets that life has to be possible somewhere else." ]
[ "There isn't any strong evidence for life on Martian meteorites - but with the sheer vastness of the universe, there is bound to be life out there somewhere." ]
[ "How many live plants would I need to have in my house for there to be an appreciable improvement in air quality versus outside?" ]
[ false ]
Kind of a random question but I can't stop thinking about it
[ "It's speculated that, in an airtight room, you'd need around 300-500 decent sized plants. Each leaf gives around 5ml o2/hr, the safe level for a human is about 50 liters per hour. Seeing as you're not in airtight room, I'd say anything from 30-50 would be an improvement.", "Some things to consider, though, it wo...
[ "http://en.wikipedia.org/wiki/NASA_Clean_Air_Study", "I don't know if you were looking for increase in oxygen or increase in air filtration, but this wiki page has the chart of beneficial air plants tested by the NASA clean air study. It doesn't say how many you need per space, but I remember the official NASA re...
[ "Until the oxygen levels become too high and then most organisms start dying off. That actually happened (one of the 5 major extinction events) a long time ago; high oxygen levels killed most of all life on earth because O2 is such a ridiculously reactive molecule. If you up the concentration enough you could clap ...
[ "if you eat someone with HIV can you catch it? (serious question)" ]
[ false ]
I'm not joking. I've been trying to ask people this question for several years. I'm not planning on eating anyone, I'm just curious. I know HIV can be transmitted through sex or through injections with needles, but not from kissing etc. But what if the person's blood got inside your body, like if you drank it? I don't ...
[ "I thought that stomach ulcers was a possibility. thanks for the info. " ]
[ "Hi! Welcome to ", "/r/AskScience", "!", "In this subreddit, we enforce a policy where top-level comments (direct replies to the original post) must be factual answers to the question, preferably with citations, or follow-up questions. I know, I know, rules on the internet are boring, but it's part of what ma...
[ "How is it not factual? I didn't cite my source? Cite a source where someone ate a person with HIV. This is a hypothetical question I would hope. Right? " ]
[ "What is my width in the time dimension?" ]
[ false ]
[deleted]
[ "With the currently accepted definitions of \"past\" and \"exist,\" No. It's simply a measurement." ]
[ "With the currently accepted definitions of \"past\" and \"exist,\" No. It's simply a measurement." ]
[ "Let's assume your lifetime is 75 years. That's about 2.4E9 seconds. Since we're going to talk about spacetime, let's use a sensible system of units that measures spatial and temporal dimensions the same. Meters is fine for that, so we have to convert seconds to meters. The conversion factor to convert seconds to m...
[ "Why did I taste salt when my PICC line was flushed." ]
[ false ]
As the title says, I had a line and when it was flushed with saline solution, I could immediately taste salt. Literally the instant the nurse put her/his thumb on the plunger of the syringe, I could distinctly taste salt. Every doctor and nurse I talked to said that this was normal but no one seemed to have an explanat...
[ "Saline solution injected through a PICC line would never come in contact with the tongue." ]
[ "Saline solution injected through a PICC line would never come in contact with the tongue." ]
[ "The same salt that activates your taste receptors on your tongue can activate them by carrying the substance through your bloodstream and to the receptors in the tongue.", "DMSO is a cool chemical that does something similar. It acts as a penetrating agent where if you put it on your skin, it will penetrate thro...
[ "When a charged particle accelerates under an applied electric field, what's 'pushing' it?" ]
[ false ]
I'm confused as to how a field mediated by photons would impart a force on a charged object. For instance, why should a larger charge result in a larger resultant force? What's actually going on when the particle starts to accelerate under the influence of the field?
[ "I absolutely love Feynman's explanation of this: ", "https://www.youtube.com/watch?v=MO0r930Sn_8" ]
[ "I absolutely love Feynman's explanation of this: ", "https://www.youtube.com/watch?v=MO0r930Sn_8" ]
[ "The electric field is created by charge, so other charges push the accelerating charge. The accelerator also pushes back, but charges in a wire for example have things to bump into and keep them trapped.", "At the Feynman diagram level, an electron or quark emits/absorbs a (virtual) photon which the accelerating...
[ "What time period show the first evidence of humans(or previous ancestors) wearing clothes or at least hiding their genitals?" ]
[ false ]
Title basically says it all.
[ "According to Scientific American approximately 83000-170 000 years ago (section Clothing in the middle of the text). ", "http://blogs.scientificamerican.com/guest-blog/2011/02/14/of-lice-and-men-an-itchy-history/", "The original study is here.\n", "http://mbe.oxfordjournals.org/content/28/1/29.full" ]
[ "If you're really interested, do some research on the molecular clock of divergent species of lice. I heard some stuff on a radio program or something, I honestly don't remember the source, but the gist of it was that by counting the mutations between head, body, and pubic lice, they got an idea as to when clothing...
[ "I came across similar information, but it was used to determine when most of our body hair was lost (creating separate niches for head lice and pubic lice), not when we started wearing clothes. Do you remember the logic behind the argument you heard?" ]
[ "What's a good solvent to dissolve aspirin in and why?" ]
[ false ]
[deleted]
[ "I don't think an Asprin pill can be completely dissolved. It should dissolve in water, or warm/hot ethanol because the basic medicinal component is an acid and so is polar, but the filler that is used to bulk up the pill is something else and, honestly, it's probably water soluble too, but you may need to increas...
[ "The filler in most pills (in the UK at least) is starch." ]
[ "dichloromethane", "But it is an excellent solvent, and we actually did an ASA purification lab, and this was the solvent we used. It is a volatile compound, has a low boiling point, it is also used to decaffeinate tea.", "I am sure there is someone here who could explain in better terms why it is a good solven...
[ "Is there a specific amount of water that needs to be drunk to re-hydrate after drinking a shot of vodka?" ]
[ false ]
So, for example, if I drink 1.5 oz of 80 proof vodka (and I'm not sure if different vodkas would dehydrate one's body differently), is there a specific amount of water in ounces to drink to bring the body back to pre-vodka shot levels? Would different hard alcohols change that number?
[ "Your brain regulates the amount of water via your kidneys. Once you start drinking alcohol you interfere with these signals, basically giving your kidneys the command to \"flush\". So it is not a matter of water/alcohol, as any water you will drink whilst this function is not working properly will also be flushed ...
[ "To expand on this, alcohol inhibits vasopressin, which causes fewer aquaporins to be inserted in the collecting duct, thus less ability to reclaim water from urine on the way to the bladder. Most people will notice increased urine production higher than the amount of fluid consumed while drinking.", "The precis...
[ "Does this mean drinking water while getting drunk to prevent a hangover is an exercise in futility?" ]
[ "Does the size or speed of an object have any effect on the sonic boom it creates (and we see/hear) when passing the sound barrier?" ]
[ false ]
null
[ "Just as interesting is subsonic objects can produce sonic booms as well. Depending on their shape, certain places can force the air to travel faster than the speed of sound around them causing shockwaves even if the object itself is traveling less than the speed of sound. " ]
[ "Sure. The detailed geometry matters, too. In general everything that sticks out can produce its own sonic boom. The nose always sticks out, but there can be more. Two examples: The Space Shuttle produced a double sonic boom, the rocket boosters of Falcon 9 produce three sonic booms. ", "Article discussing them",...
[ "There is a misconception in your question, that an object creates a sonic boom when it passes through the sound barrier. In fact, one or more cones of compressed air (depending on the size and geometry) continually trail behind a supersonic object as it travels. When that cone (or cones) sweeps over your positio...
[ "Why when you turn the steering wheel of a car slightly at high speeds it makes a big difference yet not so much at slow speeds?" ]
[ false ]
null
[ "You get tricked by your brain.\nTurning the wheels on a car gives it a change in direction. But this change will only accour, if you travell in a direction. See it as change per meter travelled.\nAt higher speeds you travell a higher distance in the same time, therefore with constant change per meter travelled, yo...
[ "I don't think this is really a case of being \"tricked\" by your brain. If you turn the wheel by a certain amount, you establish a turning radius (more or less). At a higher speed, you will move faster to the side, and you'll feel more acceleration.", "If you look at a maneuver like a lane-change, it's true that...
[ "Short answer: yes.", "Long answer: There will be differences if the speeds are to different, problems like understeering or oversteering, loosing friction(drifting or gliding) and some other wierd and wonderfull stuff." ]
[ "Can blood vessels (particularly veins) feel pain?" ]
[ false ]
Literature seems to suggest that blood vessels do have nociceptive innervation, but Werner Forssman, the first person to insert a catheter into his heart from a vein in his arm reported feeling no pain, only a sensation of warmth. Some reports explain this by saying he was just learning that "nature keeps the veins de...
[ "Could it be the location of the arterial blood gas is drawn causes more pain or the patient reporting more pain because of the anxiety that the procedure is not like drawing blood? ", "I’ve had both and I find both to be equally painful, namely I just feel the pain of the needle piercing my skin." ]
[ "Could it be the location of the arterial blood gas is drawn causes more pain or the patient reporting more pain because of the anxiety that the procedure is not like drawing blood? ", "I’ve had both and I find both to be equally painful, namely I just feel the pain of the needle piercing my skin." ]
[ "RN here. As I've had many patients complain about a burning feeling in their arms all along the I.V. infusion vein track when administering a potassium solution (and certain other medications as well, though it varies from patient to patient), I would have to say that yes, they do respond in some way to irritants...
[ "What is the most corrosive substance known to man and how is it stored/contained?" ]
[ false ]
Thanks!
[ "Fluorine technically has the highest oxidation potential of any substance known to man, so that is your answer. It is so corrosive, it will spontaneously ignite wood, water, and metal filings. ", "It must be contained in nickel tanks, at no more than 45 psi.", " " ]
[ "Hmm...probably better to supply a link to ", "Acid strength", ". All the strong acids in the first paragraph can be stored in glass bottles.", "Fluoroantimonic acid", " is pretty acidic. It's a kind of ", "superacid", "." ]
[ "eh, just because its a strong lewis acid doesn't mean it will be terribly corrosive in the sense of this question. In fact, many metals are inert to superacids. \n", "check this out" ]
[ "What would our solar system and life on Earth be like if we had two suns instead of one?" ]
[ false ]
[deleted]
[ "The related question is yes, it is possible for some stars to orbit other stars, they are referred to as binary star systems. ", "Sirius", " is an example of this, as is ", "Alpha Centauri", ". Both relativity close to our own solar system." ]
[ "Ask an Astrophysicist (NASA) has a pretty good answer: ", "http://imagine.gsfc.nasa.gov/docs/ask_astro/answers/980122c.html", " as does Astrobiology: ", "http://www.astrobio.net/pressrelease/3659/planets-orbiting-a-binary-system", "." ]
[ "Would we have a nighttime?", "Yes, because in order to stably orbit two suns, we would have to be well outside their mutual orbit.", "Is it possible for some stars to orbit denser, more massive stars? Would they orbit in a way similar to the way planets orbit the sun in our solar system?", "Yes, in fact this...
[ "Why do we have wisdom teeth if our mouths generally don't have enough room for them?" ]
[ false ]
Having just got mine out today I'm curious.
[ "Because the set of genes that create wisdom teeth are still floating around our gene pool. However, ", "a subset of people have genes that suppress wisdom tooth formation", ", so it's quite plausible that the entire human species will some day lose its wisdom teeth." ]
[ "Too few people are dying before procreating because of their wisdom teeth. Then again, no one is dying before procreating because they lack them either. It'll be a long process, if let to it's natural course. I think we'll be able to switch off these genes before natural selection does." ]
[ "We evolved to have larger mouths and jaws to chew much tougher foods. Then Homo Erectus tamed fire and started cooking meat. Cooking food makes it break down, which means it take less force to chew it, and so our jaws got smaller and our brains got larger. The problem was, our jaws got smaller but the genes that c...
[ "How come water seems to taste “better” when you are very thirsty?" ]
[ false ]
null
[ "Hi jroblul thank you for submitting to ", "/r/Askscience", ".", " Please add flair to your post. ", "Your post will be removed permanently if flair is not added within one hour. You can flair this post by replying to this message with your flair choice. It must be an exact match to one of the followi...
[ "‘Human Body’" ]
[ "Human Body" ]
[ "How is elevation expressed on Mars (or The Moon). Is there an agreed upon \"sea level\" equivalent?" ]
[ false ]
[deleted]
[ "While air pressure was used in the past to define the Martian equivalent sea level, a new Reference Surface (sea level) for Mars was developed using Mars Global Surveyor's MOLA Laser altimeter instrument in 1999-2000 (it's now defined in IAU2000, which also defines the coordinate systems and shapes of numerous sol...
[ "But the triple point pressure of water is 611.73 Pa, not 610.5. And it's the same everywhere. If it wasn't, they wouldn't be using the triple point temperature to define the kelvin scale." ]
[ "But the triple point pressure of water is 611.73 Pa, not 610.5. And it's the same everywhere. If it wasn't, they wouldn't be using the triple point temperature to define the kelvin scale." ]
[ "Can we 'upgrade' our senses (vision specifically)?" ]
[ false ]
My question mostly revolves around sight, but would apply to any sense, I suppose. Simply, what is the limiting factor in our sight? Is it our eyes? Is it the brains ability to handle resolution? Something in between? Would there be a way to upgrade our eye to something that could see more resolution (and therefore mor...
[ "Evolutionarily speaking, human eyes are optimized for vision in the visible light spectrum, and the visible light spectrum only, due to our atmosphere and local conditions as life evolved - visible light provides the best resolution. Longer wavelengths would have poor resolution, if we could see them, and the shor...
[ "Theoretically speaking? Yes. If you check out ", "this", " 2010-2011 research article on a recent step forward in retinal implants, you'll understand a bit of the complexity of the problem.", "Long story short, we ", " have cameras that can see detail much better than our biological eyes, but that's mostly...
[ "So what happens if you get rid of the eye? If somehow you replaced the eye completely (like I've seen trials of with blind people now - ", "something like this", ", although it is quite old).", "If we could create a camera that was better than our eyes, and create a better interface to the brain (I think the...
[ "What governs how long an animal can go without essential vitamins/nutrients?" ]
[ false ]
Inspired by , why do deficiencies in certain essential vitamins and proteins seem to take so long to become symptomatic? It seems like test subjects go weeks without niacin without developing pellagra symptoms and months without while still surviving and recovering, weeks without vitamin C without scurvy, and probably ...
[ "Because while essential they aren't used in large amounts. Most are recycled when filtered in the kidneys so what is used is also reused. The filtration isn't perfect which is why we need more over longer times. There is also a lot of redundancy in most biological systems so lacking one vitamin, you may be able to...
[ "It's very dependent on the organism and specific vitamin. Know that a vitamin for humans is not necessarily a vitamin for another organism since the term 'vitamin' only means an essential molecule that you cannot make yourself. ", "Using vitamin C, you can see that most animals can make it themselves, whereas hu...
[ "This is a really hard/ complex question to answer.", "A lot of it really depends on the type of animal and it's corresponding metabolic rate. If an animal has a faster metabolic rate then of course it will not last as long when starved of nutrients. A lot of it also depends on the state of the animal before it ...
[ "Is there anything in the universe that has existed since the Big Bang continuously in the same form?" ]
[ false ]
Essentially I'm asking if there's anything that has existed forever. The universe seems to recycle itself into new and different forms (we all used to be star dust as the trope goes). Is there anything that has existed forever and hasn't changed form?
[ "Most of the visible matter in the universe (about 98% of it) is hydrogen and helium that has been around since the beginning. Most of it has never even been part of a star, it's just been floating around in the intergalactic medium, and a lot of it likely never will become stars." ]
[ "I was using 'beginning' loosely based on my interpretation of OP's question.", "Notice that I never used the word 'atom'. I didn't think that ionization and recombination are the sort of change OP was asking about (since they don't cause the nucleus or the electron(s) to cease existing), so I didn't discuss that...
[ "I was using 'beginning' loosely based on my interpretation of OP's question.", "Notice that I never used the word 'atom'. I didn't think that ionization and recombination are the sort of change OP was asking about (since they don't cause the nucleus or the electron(s) to cease existing), so I didn't discuss that...
[ "Can secondary sexual features such as facial hair begin to develop after years of delay?" ]
[ false ]
Such in the instance of marijuana use, where testosterone and growth hormone are subdued by the present of THC in the body.
[ "That still doesn't really answer enough questions to be able to provide you an answer.", "Are all characteristics delayed, or just a couple? It's likely that the delay in development is constitutional, but that is a stronger likelihood with family history, is there one?", "If it's only facial hair that hasn't...
[ "This really depends upon the cause of the delay, and the years to begin with. ", "There are a number of ways puberty can be delayed, but they tend to fall within two groups.", "Development is slow to start, and progress, but generally this seems to bear a certain family history, and resolves with no intervent...
[ "Say 16.5 and heavy marijuana use. " ]
[ "Where does the matter of a bamboo come from?" ]
[ false ]
If you put a bamboo (or other water based plants) in nothing but water, they'll grow. But where does the physical matter for the plant come from? Is the plant matter just an arrangement of hydrogen, carbon, and oxygen, made from water and air?
[ "Like most plants, bamboo obtains the majority of its matter from carbon dioxide extracted from the air!", "This process, known as ", ", is part of the photosynthetic process. It happens during the Calvin cycle. ", "For more on photosynthesis, see here.", "You're in good company with your bamboo experimen...
[ "Yeah, most people assume that plants get their material from soil. Because plants are solid, so they must be getting the material from a solid, right?", "Nope. It's from the air. They do need other materials, including water, but a lot of the solid stuff is built out of carbon from CO2. So yes, in answer to ...
[ "The experiment where a guy figured this out was very cool too. Basically, this dude was wondering exactly what you were. So he put a plant in a pot and covered it with a wire grate so that only water and air could get through. Then we weighed the pot and all the water he put into it everyday so he had an exact tal...
[ "Why don't antibiotics work against viral infections?" ]
[ false ]
null
[ "Bacterial cells are living organisms. Anti-biotics (there are various types) end up destroying bacterial cells one way or another (destroying their cells walls, stopping the bacteria from making proteins needed for survival etc) ", "Bacteria belong to the domain of prokaryotes. Mammals are Eukaryotes. Bacteria h...
[ "Antibacterial drugs do not work on viruses because the cellular processes they target are not present in viruses. Penicillins, cephalosporins, and the other beta lactams target a peptidoglycan cell wall, which viruses do not possess. Tetracycline targets bacterial ribosomes, again viruses lack these. Another targe...
[ "It's just a naming convention. We have different types of drugs that target different types of pathogens, and for historical reasons the ones we call antibiotics are antibacterial and not antiviral.", "The historical reason is that the first such drugs we discovered (such as penicillin) were antibacterial in nat...
[ "Can dove or duck see Hunter's Orange?" ]
[ false ]
I recently bought for hunting. I have always heard that it's "better safe than sorry" to wear hunter orange, but I want to know: can dove and duck see this color as anything other than black and white? If they can, I am afraid it totally ruins camouflage.
[ "Birds have ", "tetrachromatic vision", " as explained ", "here", ". It's better than human vision.", "They are also brightly coloured to attract females, and some of those colours are orange.", "Donald Duck will definitely see you. Whether or not your hat works by confusing him into immobility is somet...
[ "Thanks for the science-y reply. I follow bag limits (regulated to insure healthy populations of duck), so I don't feel very guilty about taking 6 ducks a day." ]
[ "All birds have color vision, so yep." ]
[ "If particles are point-like, how are they not gravitational singularities?" ]
[ false ]
I understand gravitational singularities are not a matter of mass, but density. I also understand that particle colliders have established an upper-limit to the volume of an electron. If the fundamental particles are truly point-like, then whatever their mass, they would necessarily form gravitational singularities. Wo...
[ "Indeed, the true answer to this question must rely on a complete theory of quantum gravity which we don't have. But it's common to make a hand-waving argument based on quantum mechanics and general relativity separately.", "Very simply, a particle of mass m has an associated quantum-mechanical length scale (Comp...
[ "Because they don't really \"orbit\" in the traditional sense. They exist as a probability distribution around the atom. Because they're not accelerating, they don't radiate. Just to confuse things though, these probability distributions are called \"orbitals\"." ]
[ "So it's kinda like that sphere that shoots little lightning bolts everywhere? Kinda random but once you touch it, they all come to your finger?", "What counts as an interaction? Why is ust sitting there not enough activity for it to be measurable?" ]
[ "Are we limited by heat when it comes to computers in space?" ]
[ false ]
null
[ "Space is a vacuum. Vacuum is the best temperature insulator. The only heat that can travel through vacuum is heat in the form of infrared ", ". There can't be any physically ", " heat.", "So yeah, I can imagine an object that constantly generates heat in an insulated system having difficulty with overhea...
[ "I think one interesting extra side point of currently using the earth as a big heatsink is that, assuming economic growth is tied to energy use growth and that computing is going to make up a major part of that, we'll have to at some point start hosting our data centers in space ", "or the planet will overheat",...
[ "Eh, I'm skeptical that our computing power will ever generate ", " much heat. This is probably something that for us to even consider involves turning every bit of the Earth's surface into server rooms. I mean if we're generating ", " much heat, we've got bigger environmental issues to worry about at that po...
[ "Are there any promising New ways to fight antibiotic resistance in bacteria?" ]
[ false ]
I know there is some interesting research into new antibiotics for which there are no resistance yet, but what seems to be the most interesting tool aside from that to fight these bacteria?
[ "Funny you should ask, but there's a new tool in the works:", "\"Shu Lam, a 25-year-old PhD student at the University of Melbourne in Australia, has developed a star-shaped polymer that can kill six different superbug strains without antibiotics, simply by ripping apart their cell walls.", "This creates a lot o...
[ "I just want to point out that they've only demonstrated efficacy with gram negative bacteria. MRSA, a gram positive bacteria, might not be affected. Obviously having a new weapon in the arsenal is great, but I think \"...change the face of modern medicine.\" is a bit over the top." ]
[ "Most of our antibiotics that aren't protein synthesis inhibitors (macrolides, aminoglycosides, etc.) come from bacteria and fungi. Given that only 2% or so of bacteria can be successfully cultured in a lab, there is great potential to discover new, effective antibiotics in these thus-far-unculturable bacteria. A t...
[ "The Wikipedia article for ECC memory states that neutron flux is 3.5 times higher at the common cruising altitude for most aircraft than at sea level. Why do common personal computers not encounter errors on airlines?" ]
[ false ]
is the article in reference. It goes on to state that the systems on the aircraft are specially designed to account for this (I presume they use ECC RAM). Why don’t laptops and phones with standard RAM encounter more memory errors during flights? Is it simply that they do but the user doesn’t realise it?
[ "They do, but it doesn't matter. Your laptop is on one flight for a few hours. Avionics may run for a month between reboots, and spend half that time in the air. Plus, if excel crashes on your laptop, it's not a big deal. Avionics crashing could lead to airplane crashing." ]
[ "Your laptop computer has error correction too, but probably less than there is in the aircraft electronics. Aircraft electronics are in the sky all the time, so they have more exposure to cosmic radiation than your laptop does (unless you fly every day).", "Cosmic radiation absolutely can be a cause of errors in...
[ "Here", " is a web page of someone who actually took radiation readings during a commercial flight, and found that they are indeed higher, just as predicted. ", "FAA Advisory Circular 120-618", " gives details of expected radiation exposure on various routes and altitudes, though with a focus on human exposu...
[ "Why do Emergency Services use blue and red lights on the top of their vehicles?" ]
[ false ]
[deleted]
[ "It's been known since long before electric light that a lamp with a blue filter is most easily visible in fog, while a lamp with a red filter is most easily visible in sunlight. Both colors are sufficiently unusual in most environments to stand out against background lights and reflections.", "Also, red and blue...
[ "Per this study:", "http://www.theiacp.org/LinkClick.aspx?fileticket=LV4uUua9uvY%3d&tabid=392", "At least some of the reason seems to be the capacity of the colors to be recognized rapidly, one in daylight, one in the dark, for what they are, whereas other colors may be perceived less easily for the same power ...
[ "Concise, accurate, and a little smart at the end, enjoyed the read, and learned something. " ]
[ "What do babies dream about, i.e. what are dreams made of when concepts don't exist in your mind yet?" ]
[ false ]
null
[ "We don't have a way of finding out the content of prelinguistic babies' dreams at the moment." ]
[ "Thank you for your answer. Although we don't have the means, is it a subject that's being studied?" ]
[ "Not really. In adults there are attempts to \"decode\" dream content from brain scans, but that's pretty nascent. " ]
[ "In avian anatomy, do the wings directly correlate to our arms and the front legs of animals?" ]
[ false ]
null
[ "I believe you are refering to a ", "homologous structure or trait", ". A homologous trait is shared between multiple species who share a common ancestor. The trait originated in a common ancestor thus linking all of its descendants who retained that trait in some form or function. ", "For example, the limbs ...
[ "Edit yeah I put fish in there by accident - realized this afterwards. ", "But fish do have the four limb body structure", " (two in front and two in back - pectoral/pelvic fins) which gave rise to the four tetrapod limbs we see today. I just sort of lumped it all together which isn't correct (but made sense in...
[ "In a way, yes. They are somewhat homologous to our arms, however several bones in a bird's arms are fused together to strengthen them and make them lighter. " ]
[ "Is there any feasible way to greatly increase a plants growth rate?" ]
[ false ]
I'm talking 300%+. Just a hypothetical question I was pondering while cultivating my new tomato plants, would it be possible at all, using modern or slightly futuristic technology, to accelerate a plant's growth greatly. For instance, allow a tomato plant to grow by around 3 or 4 inches per day?
[ "Yes, to an extent. There's a class of compounds called ", "brassinosteroid", "s, which are steroids for plants. They encourages cell division and thus makes many plants grow much faster than otherwise (sometimes with strange morphology like drooping leaves). ", "There are even more potent synthetic versio...
[ "How much faster do these brassinosteriods cause plants to grow under ideal conditions? The wiki didn't really mention that. " ]
[ "Grow it in a high CO2 environment." ]
[ "Is life expectancy based on date of birth, or current year?" ]
[ false ]
[deleted]
[ "These other answers miss the mark a bit. Don't know where you are, but in the US, the Centers for Disease Control (CDC) calculates life expectancy based on age during a particular year. ", "Here is a fact sheet", " on what life expectancy is. ", "You can see that life expectancy for people born in 2018 was 7...
[ "Neither.", "The life expectancy is calculated from current mortality tables: How many newborns die in their first year, how many 80 year olds die in the same year, and so on. How long would people live that have all these rates? You get a mixture of mortality rates that apply to completely different generations....
[ "The average life expectancy for ", " alive at the moment (in whatever group you’re looking at — the US, for example) would be based on right now, which would be that 77.4 years. ", "You’re younger than many alive in the US (at the moment) and so your specific life expectancy is longer, based on your being born...
[ "Do photons decay as they travel through a vacuum?" ]
[ false ]
As you travel away from a star it gets dimmer. Is this just because of the photons spreading out, or do they also decay?
[ "Photons do not decay. As you travel away from a light source, it looks dimmer because of the inverse square law (for a pointlike source)." ]
[ "There are telescopes that count the light they receive from a star in photons per minute. However, human eyeballs aren't quite that good and why stars appear to twinkle for us is a different explanation - it is purely an atmospheric distortion effect." ]
[ "Eventually the scattering of the photons mean that as you get an extreme distance away, the object emitting the light will appear to start blinking. Then less and less regularly as you travel further away" ]
[ "I can understand how natural selection for traits works. But how do complex processes (such as metamorphosis) come about through evolution?" ]
[ false ]
My friend and I were discussing evolution and we don't understand how processes that are so complicated and dependent on sequential events come about in the first place. From the molecular level (e.g. metabolic pathways) to the physiological level (e.g. metamorphosis), are there any general principles to explain this?
[ "Think of it this way: all changes to morphology have to occur through embryonic development or later developmental processes like sexual maturity. So rather than focusing on metamorphosis as a character to explain, it is the process that leads to derived characters. You can't have altered characteristics without a...
[ "The general principle is the same as the one that governs selection of traits. We have a pretty sound theory of how evolution works, but for the most part what we know about evolutionary history we know from the fossil record. The theory doesn't necessarily tell us that things like multicellularity and multi-sta...
[ "Go look at the Arch in St. Louis. If you removed a section of it, it would collapse and cease to function. It is irreducibly complex. This must mean it was created whole, right?", "Not exactly. When it was being built, there was reducibly complex scaffolding used that allowed the not-final-form arch to f...
[ "Do cells/DNA have some sort of local GPS to know where they are and what sort of organ/cell they should become?" ]
[ false ]
null
[ "Nope. They have a slew of sensors which tell them all sorts of information about their local environment, but they have no access to an overhead map of sorts. They have to figure out where they are all based on very local information. Cells have sensors for chemical cues (to smell/taste), physical cues about th...
[ "You're thinking of either developmental biology which is to do with understanding how organisms develop (part of that is understanding how cells of different tissues differentiate) or cellular biology, the study of cells and cellular processes in general, including signalling pathways and such that lead to differe...
[ "A skin cell wouldn't start growing in a cancerous lung. Cancer involves mutations in the cell's mitotic pathway (uncontrolled division) and the cell's apoptotic pathway (lack of cell death when marked for destruction). It is unlikely that one cell type would make a complete switch to another cell type except for t...
[ "What chemically defines an element as a metal?" ]
[ false ]
null
[ "If it exhibits something called ", "metallic bonding", "Short explanation:", "The atoms bond together closely enough that their valence electrons are no longer localized to a single atom but instead can travel freely. These are often called \"free electrons\" and because they can travel from atom to atom thi...
[ "Metals have a ", "crystal structure", ", where all the atom cores are arranged in a lattice. The exact makeup of this crystal structure - both in metals and alloys - decides stuff like how hard or how ductile the metal is. Additionally, all metals have some free electrons, which is to say that some of the elec...
[ "Interestingly enough. Some materials are non-metals under some conditions, but metals in others.", "Just to add to this: by far, the most common metal in our universe is metallic hydrogen. By mass, Jupiter is ", " liquid metallic hydrogen (it's what's responsible for its very intense magnetic field), as are th...
[ "Why do my bicycle tires have to be inflated to a higher pressure than my car tires?" ]
[ false ]
Like I said, my bike tires (the skinny "road" type) need to be inflated to 95-115 PSI, whereas my car tires indicate a max PSI of 44. What's up with that?
[ "Think about the surface area of contact between your bike tires and the road when compared to the area underneath your car tires.", "\nBecause of the much larger surface area, a car requires less pressure, even though it is so much heavier." ]
[ "There's a few reasons. One, there is a MUCH smaller space between the rim of your bike wheel and the rim of your car tire. Added pressure prevents it from bottoming out and denting the rim on potholes Two, as was stated on shorthand, it does reduce rolling resistance to have firmer tires. The harder the tire, th...
[ "The pressure determines the contact patch, which is how much of the tread is in contact with the road. It also determines rolling resistance. At higher pressures, the contact patch required to support the weight of the vehicle is smaller (pressure is force over area), so the tire does not deform as much (it stays ...
[ "Are there any more confirmed dimensions?" ]
[ false ]
We all know the dimensions length, height, depth and time. I once read that there are multiple dimensions in the universe, but from what I gather it's all hypothetical stuff to solve certain mathematical equations. Are there any other dimensions that we are aware of?
[ "No there are not. I can link you to some recent tests for them if you're interested." ]
[ "It is popular belief that electricity and magnetism are two different forces. Physicists know they are not. They are one. So, the number of \"confirmed\" forces in this case would be 1, not 2.", "I'm asking if length,width,height,time are similar \"popular\" conceptions of dimenionsality, but are not in fact \"c...
[ "The three spatial dimensions are indeed real. ", "Here", " is an interesting writeup on hypothetical systems other than our 3+1." ]
[ "How can an emotion -such as stress- affect the physical body?" ]
[ false ]
According to this article , stress can damage DNA. How is this? Isn't stress just an emotion that is purely in the brain and not quantifiable?
[ "Long, possibly still incomplete answer: ", "Emotions have a much more significant impact on the human body than many people realize. In the case of stress, there is a well-established physiological process known as the ", "stress response", ". In cases where humans feel physically, emotionally or psychologic...
[ "Short, incomplete answer to the general question: hormones. Stress releases cortisol, which can be harmful to the body in cases of chronic stress. Saying that emotion is both purely in the brain and not quantifiable might even be a contradiction, as (I suppose debatably) brain states are all theoretically quantifi...
[ "Not adding to what other posters have said because I'm not qualified, but there's a critique I must make to your question. Stress isn't an emotion. Stress is a stimulus. Our bodies react to stimuli. This reaction is a physiological one, and we often label the experience of those reactions as emotions." ]
[ "Why does the hole in the ozone layer always hang out over antarctica?" ]
[ false ]
Why Antarctica? Is there also a hole in the ozone layer over the north pole that no one ever talks about?
[ "Yes, there is but it's not as bad as the South Pole one. The reactions that cause ozone depletion operate everywhere in the atmosphere, but are catalyzed by surface reactions on really cold, high latitude ice clouds (Polar Stratospheric Clouds) which mostly form at very high latitudes." ]
[ "Ozone is depleted where there are:", "Those conditions only occur regularly in polar regions. Antarctica is colder than the Arctic, so ozone depletion is much worse there." ]
[ "Both the Arctic and Antarctic can ave a \"polar vortex\", a cyclone around the poles, with air within the poles not mixing with that outside. But the Antarctic polar vortex is reliably stronger and more stable, whereas the Arctic vortex is more often weaker and disrupted allowing the air mass to move and mixing to...
[ "How do the pulse things that clip onto your finger measure oxygen saturation?" ]
[ false ]
I couldn't find anything searching because i don't know what they're called I know it has something to do with the light but i don't know what it's doing
[ "It has to do with the amount of light and infrared light being absorbed. There is a sensor on the other side of the pulse oximeter, which measures the amount of each type of light that passes through. Each light is absorbed by the hemoglobin differently, depending on how much oxygen it is carrying. ", "It’s a bi...
[ "I'm going to approach this from the other side of things. I know a lot about IR spectroscopy but very little about the practice of medicine. This means I can tell you what the light does and how it works but I'm not claiming to be an expert on the device. ", "I looked up an article about those devices and I lea...
[ "Also if your hemoglobin is low you could have a high saturation but still not have enough oxygen. That's why people get tired and sometimes out of breath when they are anemic. " ]
[ "Why aren't there more huge canyons like the grand canyon?" ]
[ false ]
null
[ "There are, the Grand Canyon is simply the most famous canyon. ", "It is not the biggest canyon.", "The ", "Yarlung Tsangpo Grand Canyon", " in China is bigger and deeper, and recently an ", "even bigger canyon underneath Greenland's ice sheet", " was discovered. " ]
[ "It's also true that you need a particular set of conditions to create a giant canyon; geological stability, sediments that are erodable enough to move, but stable enough to hold their shape, etc. It stands to reason that only a handful of places will meet those requirements, just as there will only be so many gian...
[ "It's not even the deepest canyon in the US, ", "Hells Canyon", " is significantly deeper." ]
[ "Where do we get our gut bacteria from?" ]
[ false ]
As infants, where does our initial set of gut bacteria (and other symbiotic bacteria) come from? Initially we are human cells undergoing mitosis to form human organs and eventually a full human. We get nutrients from our mothers, but to my understanding that is purely nutrients, there is nothing else passed through. So...
[ "Very interesting. Does anyone know how the bacteria gets there on the first place? Say for a c-section birth, does that child have the some of the required bacteria already? If so how does that get to the child’s gut inside the womb?" ]
[ "Very interesting. Does anyone know how the bacteria gets there on the first place? Say for a c-section birth, does that child have the some of the required bacteria already? If so how does that get to the child’s gut inside the womb?" ]
[ "You may find this Wikipedia page interesting as it gives a lot of information on types of bacteria in the human body and its purpose.", "It seems like the answer is we get our gut bacteria from our environment, meaning that some of it passes to a baby from vaginal birth (not sure about C-sections) and as we age ...
[ "Is there any reason you shouldn't eat the same foods every day provided they are healthy?" ]
[ false ]
Like a high school girl stressing about what to wear every day... I'm tired of deciding what to eat every day. I want to just eat the same thing every day. Stipulation is it must be easy to make in bulk, very healthy, and nutritionally complete. Any input is appreciated.
[ "Short answer, yes. Providing you maintain the correct balance of nutrients in the foods you eat and properly supplement any essential nutrients don't 'fit' into your diet plan, you can, in theory, live off the same diet daily. ", "Longer answer, yes, but it's not a recommended strategy. If you simply want to red...
[ "The problem would be finding something that satisfies the crazy panoply required nutrients of the human body. Fortunately, you are not the first person to wonder this. Here are some possible diets for you:", "Jevity", " is designed to do just what you are asking.", "Ensure", " claims to deliver complete nu...
[ "OP was asking about something that would meet total nutritional needs. Rabbit Fever comes about due to a diet of basically pure protein with no fats or carbs, so it doesn't really apply here." ]
[ "Since alternating current is truly \"alternating\" why are most 2 pronged plugs (U.S) built with one prong wider than the other, forcing it to be used in the socket in only one direction?" ]
[ false ]
null
[ "There is a ton of over complicated explanations and arguing over the relatively simple design of household AC circuits here. There is a very simple answer to this. ", "In North America, the wider prong was added as a safety feature to ensure the neutral was connected where its supposed to be. Some appliances hav...
[ "Live is the wire that is ultimately connected to one of the phases at the generator making the electricity. Since that generator produces alternating current the live wires voltage potential compared to the neutral of the generator (and earth) will vary between minus 170v and 170v, 120 is the Root-Mean-Square (RMS...
[ "will vary between minus 120v and 120v.", "It is actually between minus 170v and plus 170v. 120 is the Root-Mean-Square (RMS) value. The peak value is √2 times the RMS. " ]
[ "Do portable magnet detectors exist?" ]
[ false ]
[deleted]
[ "There are portable magnetic detectors, but a small REE magnet at 2 meters is... a lot to ask of them. Maybe a metal detector would be a better choice, but even that is going to have to be a hell of a lot close than 2 meters; you can't escape the rapid dropoff of EM intensity with distance. " ]
[ "There is a magnetometer in most smart phones. Look for metal detector apps. Some of them will show a direction and magnitude of the field. The magnetometer is intended to sense Earth's magnetic field for the compass, so it's fairly sensitive. You'd probably get about 1ft of range. However, at 6 feet, I think you'r...
[ "I'm getting about a foot with a regular fridge magnet and a BSA compass. Inverse square law probably applies, so the neodymium will probably not boost the range much." ]
[ "If the earth were to stop spinning and orbiting immediately, would people fly off the earth or stick to the ground?" ]
[ false ]
null
[ "This has been removed because it’s a commonly occurring question on ", "/r/AskScience", " or a question that can be answered easily through a single Google or Wikipedia search. To check for previous similar posts, please use the subreddit search on the right, or Google site:reddit.com", "/r/askscience", "...
[ "Spinning, or orbiting? ", "If it stopped rotating (spinning) suddenly, and whatever magical effect stopped it did not include us standing on its surface, we would continue moving in the direction of the rotation above the ground. Given that at the equator the speed of the rotation is around 1000 mph, if the eart...
[ "http://www.universetoday.com/66570/what-would-happen-if-the-earth-stopped-spinning/", "http://science.howstuffworks.com/science-vs-myth/what-if/what-if-earth-stopped-spinning2.htm" ]
[ "Wouldn't a diver get serious hearing damage if he was to swim close to the pistol shrimp?" ]
[ false ]
The sound it emits is over 200dB... While a jet taking off is about 150dB, which is sufficient to rupture your ear drums...
[ "It's important to note that that 218 dB is at a distance of 4 cm, and is relative to 1 µPa. Now, first off, by convention the source level you quoted for a jet is equivalent to a measurement at a distance of 1 m. Taking that into account, the source level of the shrimp drops to 190 dB. Moreover, it's important to ...
[ "200dB at what distance? Don't forget the inverse square law. " ]
[ "Sound actually travels faster and far better through water than air due to density..." ]
[ "If I peeled a banana or cut open a bell pepper, swabbed, and then cultured it, would anything grow? Essentially, are the insides of fruits and vegetables sterile?" ]
[ false ]
null
[ "We used to think that they were sterile, but recently (as in recent decades) we've found that there's fungi living inside all the tissues of almost all plants. They're are called endophytic fungi. I don't know of any research specifically looking at them inside fruits, but they are found inside seeds as well as th...
[ "You can probably get a culture, you can get endophytes out of most leaves with a malt based media. Certainly nowhere close to all that's living in there, but there are usually a half dozen or so endophytes in your typical plant that are happy to live in a petri dish." ]
[ "Hi jazerac thank you for submitting to ", "/r/Askscience", ".", " Please add flair to your post. ", "Your post will be removed permanently if flair is not added within one hour. You can flair this post by replying to this message with your flair choice. It must be an exact match to one of the followi...
[ "Why is it so hard to emulate a console ?" ]
[ false ]
null
[ "The problem isn't so much that emulating consoles is difficult -- it's ", ".", "We have lots of consoles that are readily emulated on existing hardware", ". The problem tends to come in with getting the timing right to make the games actually playable. Different processors may have similar or identical ins...
[ "Even worse, hardware bugs were often worked around in software, so if your emulator does not share the inconsistency, you may fail to emulate properly." ]
[ "Or your PC may not have suitable instructions to map to what a console processor has, and has to emulate that instruction.", "To add to that (since I actually work with consoles): while modern consoles are made of off PC compatible hardware, they have capabilities that can not easily be replicated on an actual P...
[ "Is it true that vehicles (cars, semi-trucks, boats) have a tighter right-hand turning radius than a left-hand turning radius? Why is this?" ]
[ false ]
I remember watching a video ) about remote controlled cars and how some cars will take longer to make the same left turn as they did with a right turn. The guy in the video drove the car in a circle with it doing the tightest possible circle it could on each side, and
[ "Cheaper radio control cars tend to have different length steering arms on each side. This means you can make a tighter turn in one direction over the other.", "The steering servo is central on the chassis but the moving output of servos is not in the centre of them. This means the steering arms don't connect to ...
[ "It's true for ", " vehicles. Aeroplanes with single large piston engines, especially rotary engines that spin the engine block rather than the crankshaft, can turn more easily in one direction than the other due to the gyroscopic effect of the engine. A notable example was the Sopwith Camel, a First World War fi...
[ "Any spinning object will be subject to gyroscopic effects and the wheels are spinning objects. In particular, a spinning object will want to go through precession in a specific direction in relation to the direction of spin which makes it easier to turn them in one direction than the other." ]
[ "Does tearing the grounds (the single prong out of the three prongs on power cords) cause any effects at all to the accessories?" ]
[ false ]
I know the the ground would be important in any circuit in order to achieve a voltage drop at the bottom of your circuit so if you remove this ground could you potentially damage your battery? I have been told by others that it doesn't matter at all though. I am wondering for a computer in specific.
[ "A two prong cord consists of a high voltage line (power) and ground. The power line is black, the ground line is white.", "The purpose of the third wire is to provide a separate path for the electricity to take in the case of an unexpected event or overload. Think of it as a sort of lightning rod for your devi...
[ "Typically ground is only a safety requirement though some power supplies use it as a reference voltage. " ]
[ "Under normal conditions, it really does nothing. The real ground prong (", "the wider one", ") is what's taking all the current from mains.", "If you do remove the third plug, though, your electrical device may become electrified during a power surge in such a way that you'll literally get shocked and potent...
[ "What would happen if the sound barrier were broken underwater? Is it even possible?" ]
[ false ]
Breaking the sound barrier underwater, relative to the speed of sound through water. Would it have to be a solid object, or could it be done by a piloted vehicle? EDIT: Thank you all for replying with all of this information. This was really cool. And my first post ever. :D
[ "At typical pressures (say a small distance below the surface of a body of water) the issue is that accelerating the flow to supersonic speed will drop the water pressure locally to the point that it will change phase to water vapor (gas). Then you inevitably have a complex problem of cavitation between phases.", ...
[ "There are designs that make use of this, such as ", "supercavitating torpedoes", " although current designs do not reach anything close to the speed of sound in water. " ]
[ "they're going through a bubble of air", "If we're being technical, it's water vapor, not air.", "thus bypassing the issue of water density altogether.", "Wouldn't the density of water still factor into the amount of thrust necessary to push it aside (even through a shield of water vapor)?" ]
[ "What is the inverse laplace of s and s^2 ? Why is it not common in the s-domain?" ]
[ false ]
I can't find anything about the inverse laplace of s and s on google.
[ "The Laplace transform of delta(x) is f(s)=1. The Laplace transform of f", "(x) is s", "F(s) where F(s) is the Lapace transform of f(x) and f", " is the nth derivative of f. The Laplace Transform of delta", "(x) is then s", ". So the inverse Laplace Transform of s", " is delta", "(x)" ]
[ "Isn't the delta function a 20th century innovation? What did Laplace do to compute the inverse transform of ", " ? " ]
[ "If you look at the definition of the Laplace transform and remember ", "this", ". You should be able to see that the Laplace transform of the nth derivative of the dirac delta function is s", "." ]
[ "Had a sneezing fit shortly upon waking this morning, and the question dawned on me: do we sneeze in our sleep?" ]
[ false ]
null
[ "WebMD", " has a fact sheet on sneezing and says you cannot sneeze in your sleep because the nerves that trigger a sneeze are not active when you are sleeping. " ]
[ "As a regular sleepwalker shouldn't that hold true for a lot of the nerves that shouldn't be active when I sleepwalk as well though? Why would sneezing be exclusively impossible if I can get up and shower when I should be in bed?" ]
[ ". . . the trigeminal motoneuron pools that mediate the sneeze reflex are inhibited during NREM sleep and are actively suppressed during REM sleep as part of atonia. Which means it is much more difficult to sneeze during NREM sleep and nearly impossible in REM (without also causing waking).", "http://www.reddit.c...
[ "Does electrolysis work to separate hydrogen and oxygen from salt water? or does it have to be purified first?" ]
[ false ]
null
[ "This page", " has a good explanation of the processes involved in the electrolysis of brine (a saturated NaCl solution). You do create hydrogen gas via this reaction, but instead of O2 you will form Cl2 (chlorine gas) at the other electrode. " ]
[ "Yes, electrolysis will still split water into H2 and O2. However, as this is an oxidation process, small amounts of chloride ions will be oxidized and combined to form Cl2, which renders the process slightly hazardous. " ]
[ "thanks for the link, helped clear things up a lot. Do you know which would be more energy efficient for hydrogen extraction?" ]
[ "Is there a difference in suicide rates between people who have already had children and those who haven't?" ]
[ false ]
Because on one hand, having children fulfills our biological goal so I'd imagine there would be less incentive to stick around if things came to that, but on the other hand there could be increased incentive to stick around to care for and protect the kids. Is there any discrepancy between the groups that becomes appar...
[ "Having children can be a protective factor, but it can also in some contexts increase suicide risk. A very large Danish study found that whereas parents were generally less likely to commit suicide than non-parents (especially parents of young children, for whom the risk was particularly low), parents who had rece...
[ "Good summary except the statement about adjusting for other factors. From the results section of the paper you referenced: \"these effects exist even when adjusted for marital, socioeconomic, and psychiatric status; and their influences are much stronger in women than in men.\"" ]
[ "If you look at the confidence intervals in table 2 calculated in the adjusted analyses, none of the confidence intervals of male parents do not include an OR of 1, and this is only the case for female parents who have 3 or more children. The implicit effect size is slightly higher for women, but that's expected as...
[ "If a substance of any kind gives off an odor then does that mean it's losing mass even if it's on a very small scale?" ]
[ false ]
Example -- If I have a container of poop and open the lid I start to smell poop. So my thinking is that if it smells like poop then it must have been a part of the substance in the container but is no more and free to roam about the air I breathe. So the original substance it came from must be lighter in weight because...
[ "Yes, this is exactly how smell works. Part of the substance volatilizes into the air and those molecules hit receptors in your nose and give smell signals. That means the substance itself is losing mass.", "It should also be noted that generally this is small enough to be incredibly hard to notice. We can det...
[ "The different rates of volatilization are a subject of substantial research by consumer products megacorporations, such as SC Johnson and Reckitt Benckiser, that sell room fresheners, for example. Anyone who's ever bought a \"Plug-In\" knows that the smell is initially pleasantly complex, like a perfume. After a w...
[ "Seeing, smelling and tasting are ", " as the electrical signals interpreted by our brains in response to stimulus. There is no other meaning to those words, what we are doing IS seeing, smelling and tasting. It can't get more real than it already is." ]
[ "EMF interaction with matter?" ]
[ false ]
I seem to remember from school the rule that for an electromagnetic wave to interact with an object/matter, the object must be roughly equal in size to that of the EM wavelength? Is this true? I've tried to google information, but I must be querying the wrong information, because I'm returning no answers. Thanks!
[ "No, that's not really true. ", "For an electromagnetic wave to interact ", " with an object (rays bouncing off surfaces), the wave must have a wavelength much smaller than the object. ", "For an electromagnetic wave to interact according to ", ", the wavelength must be much larger than than the object. Ray...
[ "Thanks for the google suggestions! I was definitely searching the wrong terms :/" ]
[ "There is a slight difference between interaction where the energy is absorbed and scattering where is is not.", "chrisbaird's answer covers scattering, but for absorption/transmission, you may have heard the rule in the context of classical antennas, where for efficient absorption/transmission they should be ~th...
[ "What if I placed my arm/body part inside the hadron collider?" ]
[ false ]
So lets say the tube or path of the hadron collider or any other particle accelerator was narrow enough to fit an arm through one side and out the other, or a leg for that matter. What is going to happen to that body part when turned on?
[ "You go on to finish your PhD in physics" ]
[ "So taken in total, I’m not sure what would happen. If the total energy of the beams were dumped into your hand all at once, it would act like dropping a bomb on you. (...) But depositing all that energy all at once may not be possible; protons are so small they may not all hit you and suddenly stop." ]
[ "I like \"See also: Proton beam therapy\"" ]
[ "How does magnetic saturation limit current?" ]
[ false ]
[deleted]
[ "Magnetic Saturation happens when the increase Magnetic Field in a ferromagnetic material cannot increase the Flux Density in the material. Current is produced by the interaction of magnetic flux with a conductor (", "See Ampere's Law", "). So if you top off the amount of flux, you are basically topping off the...
[ "If the flux attains a maximum, i.e. the material can have no more flux lines passing through it (which depends on the material), then B becomes more or less a constant even if we increase H. Now as I is the closed integral of B over a line, when B maxes out, the current maxes out. It is all mathematical and the li...
[ "If the flux attains a maximum, i.e. the material can have no more flux lines passing through it (which depends on the material), then B becomes more or less a constant even if we increase H. Now as I is the closed integral of B over a line, when B maxes out, the current maxes out. It is all mathematical and the li...
[ "Although they have no bones, is it still correct to say that a shark has a spine?" ]
[ false ]
null
[ "Yes sharks have a spine, and are vertebrates (In contrast to what TaslemGuy is claiming). The difference being sharks bones are cartilaginous. Think of it like this; the bones form the same structures (as in vertebral columns, jaws ect) and have a similar formation, ", ".", "If there's anybody who knows about ...
[ "In humans, bones ossify in three ways. Endochondral ossification is bone formation from a cartilaginous model. Almost all of our bones ossify endochondrally. Intermembranous ossification is when bone develops from a thick, fibrous membrane. Bones such as the mandible, clavicle, and the flat bones of the skull ossi...
[ "That's not what their skeletons say. And it's not what Wikipedia says." ]
[ "Why does our skin turn dark to protect itself against the sun if white reflects sunlight?" ]
[ false ]
It's summer here in the northern hemisphere so many people are getting their tan on and it got me thinking... From what I understand about tans, tanning is actually a way for your body to protect itself - a tan is actually you're skin strengthening itself for further sun exposure, correct? Well wouldn't it make sense f...
[ "Melanin, the skin pigment, is a molecule that absorbs the dangerous UV rays so that they don't cause damage to your cells, or most importantly, damage to the DNA in the cells. Think of the pigment as a shield inside each cell that protects the important bits. It also happens to absorb visible wavelengths of ligh...
[ "Another way to think about it: unpigmented skin is more transparent to UV light than pigmented skin. The light enters deeper into the tissue and can do more damage when skin is unpigmented. Yes, light colored skin would reflect more light than dark, but a lot of light would still enter the tissue.", "Pigmente...
[ "is that the same stuff that gives my fair skin freckles only sometimes? if so, why doesn't it affect all the cells the same way? if not.. follow-up! please explain freckles! :)" ]
[ "is nicotine itself bad?" ]
[ false ]
null
[ "Caffeine is both a vasodilator and a vasoconstrictor where as nicotine is a vasoconstrictor. Really anything in moderation. If you consume one or two 1mg nicotine lozenges a day there is going to be minimal effect of over all health. In fact certain reaction in the body and brain from nicotine reduce chances of Pa...
[ "Well there are lots of studies about caffeine and all cause mortality, but the first one I looked up was this one on 46,000 participants, published in Stroke.", "https://www.ahajournals.org/doi/10.1161/STROKEAHA.120.032273" ]
[ "This is interesting. I didn't know that about vasodilation and Caffeine." ]
[ "Is biological and computer consciousness different?" ]
[ false ]
[deleted]
[ "Thanks, I will look into this more deeply now! ", "Although the Turing test seems useful it is a bit subjective... Unless of course the \"Judge\" is a set of rules, rather than another conscious being. Again though, thanks. There seems to be quite little on the subject.", "Edit: After watching the video I have...
[ "Thanks, I will look into this more deeply now! ", "Although the Turing test seems useful it is a bit subjective... Unless of course the \"Judge\" is a set of rules, rather than another conscious being. Again though, thanks. There seems to be quite little on the subject.", "Edit: After watching the video I have...
[ "The Chinese Room experiment is very interesting! It gets to point I was trying to make, that if Mind A(Brain) and Mind B(Computer). Mind B being an \"exact\" replica. Are they not both \"thinking\" in the same sense?", "It begs the question then however, if you even can make an \"exact\" replica of a thinking mi...
[ "What is the most detailed lunar imagery that we have available to us?" ]
[ false ]
null
[ "China released lunar imagery with a scale of 7m/pixel:", "http://sservi.nasa.gov/articles/china-releases-worlds-highest-resolution-lunar-images/", "And the LRO team released an impressive pannable mosaic with an effective scale of 2m/pixel:", "http://www.lroc.asu.edu/images/gigapan", "According to the arti...
[ "In photos like ", "this", " we can distinguish individual grains of sand. ", "That's pretty good. " ]
[ "Well, we put some pieces of the moon in an electron microscope, so probably that." ]
[ "Do the antennas for technologies like 4G use the same scientific principle as the magnetron in my microwave?" ]
[ false ]
I'm a little shaky on how a magnetron generates microwaves in the first place, but I am really curious to know if the same resonating technique is used to generate the EM frequencies that let my Droid do 4G. Moreover, I can understand how a large cell tower might have enough power to send a signal to all the phones in ...
[ "Microwave ovens use 2.4GHz waves. Cellular signals use several different carrier frequencies, including frequencies above, below and around 2.4GHz." ]
[ "Microwave ovens use 2.4GHz waves. Cellular signals use several different carrier frequencies, including frequencies above, below and around 2.4GHz." ]
[ "A magnetron is a type of cavity resonator used to generate high-power radiation at a desired frequency. Cavity resonators are not well-suited for small, mobile, low-power applications like cell phones. Other examples of frequency reference devices include crystal oscillators and surface acoustic wave devices, but ...
[ "As sea levels continue to rise, will sand migrate to the \"new\" beach locations? Or will sandy beaches end up becoming a thing of the past?" ]
[ false ]
null
[ "In natural settings, (and where the conditions exist to support them currently) sand beaches would be expected to migrate with sea level rise. This is actually one of the ways we can recognize past sea level rises (or falls), i.e., the progression upward from fine grained (off shore) to sand (beach) in a vertical ...
[ "sand is everywhere & it to some degree is always in motion unless it is buried. a beach or sandbar is just a place where it accumulates more than others & it always accumulates at points along the edges of large enough bodies of water to have waves and currents.", "if the seal rise is gradual the sand just gets...
[ "There is a beach beside me, I am there every day with the dogs. The sand on the beach changes, almost every day. About 10 years ago my 80 year old neighbour said it was the most sand he had ever seen. Sometimes there is almost no sand.", "The next beach along had sand when I moved here 21 years ago. Then 19 year...
[ "How much energy would it take to boil all of Earth's oceans?" ]
[ false ]
Atlantic, Pacific, Indian, Arctic, and Southern Ocean
[ "/u/dinodares99", " 's slight correction to ", "/u/Crack-The-Skye", " 's excellent answer got me thinking, and I realized:", ", if by \"boil\" you mean \"convert from a liquid to a gas\". Instead, you'll create a supercritical fluid. As you start to boil, the atmospheric pressure will increase. As it doe...
[ "Well, the oceans:", "volume = 1.35 billion km", " = 1.35x10", " m", " ", "temperature = 10 C. (The surface is a little warmer in a lot of places, but the deep ocean is around 4C, and really we're not looking for that exact of number and more an order of magnitude so that's fine.)", "And for water:", ...
[ "By the way, the energy would be higher because the boiling point of seawater is actually about 0.6 degrees higher, which would give a difference of 597 TWh. Not large by any factor but still, for accuracy. And the latent heat of vaporization is 2257 kJ/kg. The density is also 1030 kg/m", " There are more, but th...
[ "Where do the various weather forecasts come from?" ]
[ false ]
There are dozens of websites on the Internet, where you can look up the weather forecast for the next few days for every place in the world. And most of the time, every page will give you an other forecast. Is every weather service running its own server that simulates the weather for the whole world or how do they get...
[ "Meteorologist here.", "There are so many different forecasts because there are so many different people forecasting. Like mentioned before, Numerical Prediction Models (NAM and GFS are popular in the United States) are utilized by most. MOS (model output statistics) are quickly becoming the future of short term ...
[ "This is what the model output looks like (today's OK City GFS). This data is manipulated into a forecast:", " GFS MOS (MAV)\n KOKC GFS MOS GUIDANCE 5/23/2013 0600 UTC \n DT /MAY 23 /MAY 24 /MAY 25 / \n HR 12 15 18 21 00 03 06 09 12 15 18 21 0...
[ "Several institutions run large Numerical Weather Prediction models. The output of these models is distributed to local tv stations and websites to make daily weather forecasts. Some of the big weather prediction centers are", "National Centers for Environmental Prediction (NCEP)", "European Centre for Medium...
[ "100 years ago, what were some technological advancements that we thought we would have today?" ]
[ false ]
null
[ "Hi jimdog10 thank you for submitting to ", "/r/Askscience", ".", " Please add flair to your post. ", "Your post will be removed permanently if flair is not added within one hour. You can flair this post by replying to this message with your flair choice. It must be an exact match to one of the follow...
[ "Technology" ]
[ "Technology" ]
[ "What is the \"youngest\" species we have discovered?" ]
[ false ]
If the title isn't clear, what I mean to say is, what is the species we know to have diverged most recently?
[ "According to ", "this", " BBC article, the answer may be senecio eboracensis, having originated mere decades ago. It's worth keeping in mind, though, that there's no clear set of guidelines for what makes an organism a separate species. The definition has been changed numerous times with new scientific discove...
[ "Good point. Expanding on the example: In animalian species the line is generally drawn well within the 99th percentile of genomic similarity, whereas the amount of divergence even within, say, ", " can be two-thirds of the bacterial genome. ", "Now combine that with a replication rate of once every 20 minutes ...
[ "Good point. Expanding on the example: In animalian species the line is generally drawn well within the 99th percentile of genomic similarity, whereas the amount of divergence even within, say, ", " can be two-thirds of the bacterial genome. ", "Now combine that with a replication rate of once every 20 minutes ...
[ "Why does an atom need a neutron?" ]
[ false ]
It has no energy, why?
[ "Neutrons have no net charge, but they certainly have energy. There are no bound nuclei with A > 1 and N = 0. You can’t form matter like this. At best, you can only populate resonances that immediately fall apart." ]
[ "Can this question be rephrased and turned around? \"Why do neutrons ", " protons?", "It's my understanding, as basic as it is, that free neutrons will naturally decay into a proton and an electron, but in a nucleus, the protons keep the neutron from decaying..." ]
[ "Even if you could magically turn off the electric charge of protons, a proton-only nucleus with A > 1 would not have any bound states. We know this because neutron-only nuclei with A > 1 have no bounds states, and isospin is approximately a good symmetry of the nuclear force." ]
[ "Does empty space or a void have a temperature, and if so what would be required to raise the temperature of a void?" ]
[ false ]
null
[ "If you require a perfect vacuum (no matter, no radiation), then you fully defined the system already. There is nothing you can change in it. How would a raised temperature look like?" ]
[ "But note that the particle content is dependent on the observer. An accelerated observer will see non zero temperature particle content in the vacuum, see e.g. ", "the Unruh effect", " or ", "Hawking radiation", "." ]
[ "Energy isn't an object. To add energy you need something that carries this energy. And with something in there you don't have a perfect vacuum any more." ]
[ "How do cell towers send unique data streams to thousands of phones simultaneously?" ]
[ false ]
[deleted]
[ "The outbound from the cell tower to the phones is a comparatively easy problem. They cell tower sends out one or more big, fat, high-powered transmissions. Within these transmissions are packets addressed to whichever phone needs it, and the phones just look for the ones addressed to them.", "The hard part is go...
[ "LTE does not use CDMA. It uses OFDM and SC-FDMA." ]
[ "You can have more than one radio station or terrestrial television signal.", "Same principle applies to mobile phones. Here is an overview of GSM:", "FDMA: frequency division multiple access: phone A talks with the tower on a different frequency than phone B, one frequency slot has a bandwidth of 200khz", "T...
[ "Peppers are hot because of capsaicin. Why is ginger root hot? What's the mechanism of action?" ]
[ false ]
null
[ "Gingerol is the most abundant active molecule in ginger. There's a few others that are similar. ", "I don't have access to journals right now, but if I remember right, gingerol binds to a TRP ion channel (I think TRPV1, the same as capsaicin but not 100% sure on that) and has an MOA very similar to that of capsa...
[ "Correct, mostly. Gingerol is an agonist of both TRPV1 and TRPA1 channels.", "source: Cortright et al, 2007. Trp channels and pain. PubMedID: 17467247", "Fun diagram showing various common agonists and what channels they activate, also the temperatures at which these channels activate, as most of them are therm...
[ "TRPA1 receptor is indeed cold activated, in humans.\nSource: Jabba et al, 2014 Neuron PubmedID: 24814535", "However, Isothiocyanates (active ingredient in wasabi and mustard oil) also activate TRPV1 receptors, which would make our experience a mix of hot and cold. In reality, things are a bit more complicated, ...
[ "How fast does scent travel? Why do some smells seem instantaneous while others seem gradual?" ]
[ false ]
[deleted]
[ "This depends on the rate/speed of diffusion of a certain gas. ", "Diffusion is the net movement of gas/liquid molecules from a region of higher concentration to lower concentration. Some gases have higher rates of diffusion while others have lower rates. ", "The rates in turn are described by Graham's Law, and...
[ "Thank you! Do you have an example in miles per hour of diffusion rate of a common \"smell\"?" ]
[ "It doesn't really work like that, diffusion rate isn't measured by the \"distance covered by the smell per unit time\".", "Diffusion rate is measured in \"the amount of the substance that diffuses across a barrier per unit time\". The rate also depends on the difference in concentrations of molecules (the concen...
[ "How does contamination occur in other experiments with HeLa cells, and why is it such a problem?" ]
[ false ]
I was reading about HeLa cells, and the wikipedia mentioned contamination was a serious issue with this line. I always assumed biologists in this line worked aseptically, so... how do HeLa cells get into other cell cultures? How frequently does this happen, and what does it mean for the research when it does?
[ "I suspect this is not as serious a problem now as it once was. We have never had a problem with HeLa cell cross contamination in our lab or any other lab at out institute. ", "Current tissue culture methods include the use of disposable culture plates and pipettes and cell lines are shipped to labs from the ATCC...
[ "dirtymirror is right on and as to how they get into other cultures: not using disposable pipetts/not changing tips. They survive cause they're hearty lil dudes." ]
[ "Dudettes. :)" ]
[ "Why doesn't working out coupled with starving yourself result in more weight loss than working out and eating a healthy diet?" ]
[ false ]
[deleted]
[ "Some say that if you eat too few calories (like, less than 800 calories per day) then your body thinks you're starving and lowers your metabolism in order to conserve energy.", "This hypothesis, however, is controversial.", "What's not controversial is that eating this few calories on a regular basis is ", "...
[ "Do you have evidence to suggest that it doesn't?" ]
[ "It does. Over the summer I was doing that on the weekends, working out in the morning (which for me is like 10:30am) with only a half glass of milk for breakfast, then sometimes skipping lunch. Lost a lot of weight that way." ]
[ "What do physicists actually mean when they say that forces are unified at high energies?" ]
[ false ]
It has never been clear to me what is meant when physicists theorize that all forces were unified at the time of the big bang. The most common example I come across is the so-called electroweak force. At very high energies, electromagnetism and the weak force are apparently the same force? EM is carried by photons a...
[ "What they mean is that the forces are actually different aspects of a single more-complicated-than-either-one thing that appears like two separate forces under ordinary circumstances. The Z bosons (which are to the weak force what the photon is to the electromagnetic force) come about from something called ", "...
[ "Here is an image of a cube being cut into a square, rectangle, hexagon, triangle for illustrative purposes.", "http://mathworld.wolfram.com/images/eps-gif/CubeCutByPlanes_1100.gif" ]
[ "Getting to the last part made me feel as if I had just found an Easter egg at the end of some random TOS." ]
[ "Twins and DNA tests" ]
[ false ]
As an identical twin and as someone that shamelessly watches the Maury Show this question always lingered in the back of my mind: If twin A fathers a child, and both twins were given a paternity test, would it say that both twins are the father? I know that twins have the same DNA but is expressed differently through t...
[ "There are small DNA level differences between monozygotic twins that can be tested for - epigenomic changes (environment changing DNA expression) or differences in copy-number variations.", "However, most paternity tests look at only a few parts of an individual's genome, and wouldn't be sensitive enough to diff...
[ "This is correct. ", "The DNA fingerprint anthracis mentions is the number of repeats of specific DNA sequences in what are known as STR (short tandem repeat) loci. These repeats are usually 4 or 5 bases long.", "For example you might have a sequence that looks like:", "GATAGATAGATAGATAGATAGATAGATAGATA with 8...
[ "As a follow on to the original question, and to clarify from the worthies already answering, is the following true:", "A child born to parents that are each part a of two sets of twins will, genetically, be a sibling of a child born to parents that a each part b of the same sets of twins." ]
[ "Is the three polarized filter experiment really a demonstration of quantum uncertainty or is there a much more simple explanation?" ]
[ false ]
I just watched where I've just now learned of the polarizing filter experiment demonstrating Bell's theorem. But it's done my head in a bit because my immediate thought was simply that the experiment is flawed and the light is just in a reflection loop. Light passes through filter A, half of it continues through filter...
[ "The filters don’t reflect the light that doesn’t go through. They aren’t mirrored, or even partially mirrored. Instead, they block (absorb) the light that doesn’t pass through. That’s clearly stated in the video you linked.", "Even if they WERE mirrored, the mirroring wouldn’t change the orientation of waveform ...
[ "Awesome, thanks for the explanation!" ]
[ "I would assume that the energy becomes heat within the filter, itself. The filter would just warm up more than, say, a transparent glass would. But I've already gotten myself into trouble with assumptions here, ha ha." ]
[ "What makes China (and presumably its surrounding areas) such an ideal location for fossil excavation?" ]
[ false ]
[deleted]
[ "I think it's important to first identify that the reason for China having somme exceptional preservation is that because China is huge, so the chances of there being a good fossiliferous deposit there were higher than for many other countries. The actual extent of excellent preservation is no higher than elsewhere...
[ "A lot of these amazing fossils are coming out of ", "Liaoning Province", " in NE China. As crazy as it sounds, they're being dug up in farmers' fields. Unfortunately that means a lot of them end up being sold illegally by farmers. They lose all information about where they were found, which provides important ...
[ "China has large swaths of land that haven't ever really been used for much industrially, and a generally-temperate-ish climate, meaning that expeditions are easier. Canada would likely also be a good choice during the summer (or, as they call it, daytime), or Siberia. ", "The other big reason is that large part...
[ "How does chickenpox recur as shingles?" ]
[ false ]
null
[ "Chickenpox is caused by a virus. When this virus infects you, you will develop the typical symptoms of chickenpox, which are the spots across your body; the fever; and the general feeling of malaise. Once the infection subsides, the virus isn't gotten rid of, but rather it lays hidden (or dormant) within a section...
[ "That’s kind of correct. The nature of the virus is that it’s never fully eliminated from your body when your symptoms stop. Once that virus enters your body, the next port of call for it is a section of the nerves that I was talking about. The section of the nerve is called the dorsal ganglion, and you can think o...
[ "Chickenpox is a viral skin infection that normally happens in children. After one has had chicken pox, the virus remains dormant in nerve cells. It's unclear what activates the virus after being dormant, but some risk factors include stress, age, and a compromised immune system. The fact that the virus recurs from...
[ "Why is lead always the element used to protect us from radiation?" ]
[ false ]
To expand a bit, what properties does lead have that make it so good at protecting from radiation. How does it actually keep the radiation from touching us? What is happening at the atomic level?
[ "Lead is not ", " the element you want to use for shielding radiation. What you use to shield against radiation depends on the kind of radiation and its energy. ", "Lead is good for shielding electromagnetic radiation (x-rays and gamma rays) because it has a high atomic number.", "High energy photons primaril...
[ "gamma rays) because it has a high atomic number.", "And because it's pretty cheap and abundant compared to the other elements with high atomic numbers, I assume? I mean, it would make sense if it's not just the atomic number, but the relationship between it and the price. " ]
[ "Tungsten is a common one to use. I worked on a medical cancer Xray treatment source. We made tungsten powder loaded sheet rubber as a blanket to protect the medical staff when it was used." ]
[ "When a fly or any flying insect lands on my flat screen tv; how come the on screen movements do not spook them, but they fly away as soon as I move towards them?" ]
[ false ]
null
[ "They probably were blinded the first time you did it and now can't tell anymore. Seriously, don't shine laser pointers in your pets eyes!" ]
[ "They probably were blinded the first time you did it and now can't tell anymore. Seriously, don't shine laser pointers in your pets eyes!" ]
[ "Their sight isn't that 'good' in the sense it's nothing like ours - for what the fly must do to reproduce, its eyes are great.", "In fact, ", " (order of a 100...so, centisecond? Sounds weird) ", " ", ".", "The business about the flies sensing the moving air as something comes to hit them is news to me, ...
[ "Could we eliminate the Flu if we all got vaccinated for the flu and wore masks during flu season?" ]
[ false ]
Masks have been pretty effective at keeping my family healthy this year and I was wondering if some viruses like the flu are so endemic that there will always be substantial spread, or if mask use would be effective at isolating or eliminating the flu?
[ "No, there are large reservoirs of flu in bird and swine populations. It’s probably more helpful to think of “flus” not “flu”. Being vaccinated against one or a few doesn’t do much if you get exposed to a different strain. Each year health authorities try and predict which strains will be the major ones." ]
[ "Well... technically, we could ", " flu with with vaccines, distancing, and masks but we wouldn't be able to ", " flu due to the wild and domestic animal reservoirs." ]
[ "In China, introducing a poultry vaccine for several strains of influenza virtually eliminated ", " cases of H7N9 for several years. H7N9 is a strain of avian influenza that infected over 1500 people, with a 39% mortality rate, between 2013 and 2017. The Chinese began aggressively vaccinating chickens in 2017, an...
[ "What creature is this skeleton?" ]
[ false ]
I stumbled (literally) upon this skeleton while walking in a public park. This park has peacocks, skunks, and cats walking about in it. There is also a river nearby. Any idea what this creature is? I was thinking it was a bat, but there are no wings and the feet look different.
[ "Looks to me like the partial remains of a cat. Just based on the skull.", "The pictures are a bit blurry so its hard to say." ]
[ "Yes, it's a cats ", "shoulders, neck and head." ]
[ "There are 2 bones in the lower portion of the front legs used to rotate the cats paws slightly, though in the picture they are incorrectly positioned. The large flat bone areas are the shoulder blades. The legs are most likely connected dried blood and entwined hair. It appears to have been white/grey by the looks...
[ "If scientists can detect gamma ray bursts happening all the time, how have we not been hit by one?" ]
[ false ]
I'm watching a documentary on gamma ray bursts, and the narrator is talking about how often they occur. Then he says they can be detected from across the entire universe. That doesn't sound possible to me, could somebody more knowledgable than me shed some light on this subject?
[ "In theory, we're hit by them all the time. That's how they're observed, as quick flashes of gamma rays coming from a single point in the sky. Of course, I should mention that they are observed by space telescopes designed to pick up these wavelengths, you won't be seeing them down here. ", "Basically, GRBs are l...
[ "Once you factor out your own mortality, the wonders of the universe are always fun." ]
[ "Right, GRBs aren't ", " like a laser, but I think the analogy illustrates the concept of collimation quite well, which is the first thing I think a nonscientist might associate with 'laser.' ", "It's an interesting idea that GRBs are proposed as the explanation for the lack of observed life in the universe, al...
[ "Are there any theories on macro physics?" ]
[ false ]
There are descriptions of physics and quantum physics, but how about theories of physics on a scale larger than the known universe?
[ "The large scale structure of the universe is described by general relativity via the Lambda-Cold Dark Matter model." ]
[ "What's \"larger than the known universe\"? To me it seems as meaningful as asking what the legal moves are for chess \"outside the chessboard.\"" ]
[ "I saw a show a little while back on the science channel (i think). That talked about how it seems like our universe is being pulled in 1 direction as if an external gravitational force is pulling on it. It went on talking about how this could mean there is something else outside of our universe. The main questi...
[ "Can thermodynamic state be defined for non-equilibrium systems?" ]
[ false ]
Normally we need two thermodynamic properties (like T and p) to define the state and find u, h, s, g etc. for equilibrium systems. Can a thermodynamic state can be defined for non-equilibrium systems like for equilibrium systems. Specific systems I'm thinking about are metastable states like superheated/cooled liquids,...
[ "Yes and no. Generally, classical thermodynamics does not deal with non-EQ systems. The way you get away with this is by using only state variables, which are path-independent (i.e. we don't care how we got to the second state, so we don't care about the non-equilibrium process; we just assume it was sufficient to ...
[ "What about metastable systems like supercooled liquids, if some T and p are we able to define other state variables like u, g, h etc. like an normal EQ system?", "For a non-EQ system at steady state (say with some gradient), would we still be able to define the state locally (i.e. find properties are point locat...
[ "I'm not too familiar with metastable systems, unfortunately, but my gut tells me that if you can assume that the system is stable for long enough such that it's in equilibrium, then you can essentially treat it as you would any other system? Someone else more qualified would probably be able to give you a better a...