title
list
over_18
list
post_content
stringlengths
0
9.37k
C1
list
C2
list
C3
list
[ "Can we get proper scientific articles (not sensationalist news stories) that talk about NOAA's \"mystery sounds\", like Upsweep, Bloop, etc.?" ]
[ false ]
[deleted]
[ "here's a PDF link to the official summary of the research done using the Equatorial Pacific Ocean autonomous hydrophone array", ", as well as the ", "abstract", "It explains the various characteristics and origins of the sounds detected by the hydrophone array. As for the unknown sounds, very little progress has been made towards explanations. It has been argued that many of the sounds result from large masses of ice in Antarctica either calving, splitting, or scraping the surface. Such vibrations from the friction in the ice are of very low frequencies. Sadly, I can't find any peer-reviewed papers attempting to explain the origins of the sounds, so for now we only have speculation from the scientists involved in the research.", "Edit: As a bonus, ", "Watch this video", ", then imagine that happening on a continental scale. The larger size of ice-masses along the coast of antarctica may produce similar sounds at a much lower frequency, which is where the speculation of ice calving and scraping likely comes from." ]
[ "Fixed links:", "Article", "Abstract" ]
[ "Science doesn't speculate in the absence of data. There simply isn't enough data about Bloop and mysteries like it to do anything but make guesses. While we are waiting for more data and additional incidences, they will take a backburner for the time being." ]
[ "If I got all my hair permanently removed with laser hair removal, what would my body do with all the protein that it would have otherwise gone into hair growth?" ]
[ false ]
null
[ "The human body doesn't exactly store proteins like it does with sugars and fats. Under most situations, an excess of protein or amino acids will result in them being excreted ", "[Source]", "." ]
[ "When you intake food your body breaks it down to essentially the macronutrient level. Your body can then utilize or store the new macros. Additionally there are metabolic cycles that can basically switch, say carbs, into certain amino acids (protein subunits) depending on the body's given demands, now or in the future post-storage. ", "So the protein you're asking about has no predetermined destiny; it's like gas still at the station waiting to be put into a vehicle. Maybe fueling muscles during exercise or building new cells for hair and skin. If you laser away your hair follicles, they growing hair and therefore stop requesting fuel, so those proteins just stay part of the core source." ]
[ "Cool, thanks!" ]
[ "If the fourth dimension is time/duration, than what is a hypercube?" ]
[ false ]
null
[ "A hypercube is a cube in a space with more than three dimensions. You can define a geometry however you want independent of the actual universe." ]
[ "I dislike when people refer to time as the 'fourth dimension'. Rather, we believe the universe to have 3 spatial dimensions and one temporal one." ]
[ "Draw a point. Now draw another point. Now connect them. You've got a line.", "Now draw another identical line. Connect them by the vertices. You've got a square.", "Now draw another identical square. Connect them by the vertices. You've got a cube!", "(Now it gets tricky). Draw another cube. Connect them by the vertices. You've got a hypercube. (Kind of...there are issues with embedding a 4 dimensional object on a two dimensional surface.)", "To a mathematician, or at least a pedantic one, a point is a zero dimensional cube, a line is a one dimensional cube, a square is a two dimensional cube, and so on. An n-cube (where, say, a 3-cube is a cube and a 4-cube is a hypercube: the n denotes dimensionality) is just a generalized cube.", "Note that if you spend a lot of time in the company of mathematicians, you'll often hear references to \"three spheres\" and \"four spheres\" and occasionally even \"2 spheres,\" possibly followed by an embarassed \"err, circles.\" Or depending on the level of education, maybe not even that addendum! " ]
[ "Does a Photon Have a Set Amplitude? Does it Make Sense to Ask That Question?" ]
[ false ]
For a while now I've had a couple issues with my interpretation of light. My fundamental picture of light is a vibration in the electromagnetic field. I tend to imagine a ripple in a sheet or something similar propagating out. My main questions: Is a photon just that? A ripple in the electromagnetic field? Do different energy photons have different amplitudes as well as frequencies? When explaining light waves are we talking about the same 'ripple' in the EM filed as I take a photon to be? My confusion stemmed mainly from when I saw a gif showing a sine wave made up of little balls (photons) that was supposed to be demonstrating what light 'is' I'm not very confident in my conception of light. Anyone able to clear some stuff up would be much appreciated!! THANKS P.S When talking about QFT are the ripples in the fields that make up the particles the same thing I'm talking about ^ up there ^ or something more abstract to do with probability functions?
[ "A photon's single-particle ", " (which might or might not be kosher, depending on how strict you wanna be - see my comments ", "here", " ) has a set amplitude, which would correspond to probability of measuring it at some point in space (in x-representation, at least). A classical EM wave amplitude (which is related to its energy) is determined by the ", " of photons.", "Do different energy photons have different amplitudes as well as frequencies?", "Not necessarily. A single photon's wave function will have amplitude such, that it's integral over the whole space will be equal to 1.", "When explaining light waves are we talking about the same 'ripple' in the EM filed as I take a photon to be?", "A photon can be though a a single \"ripple\" (realistically a plane wave) with a set frequency/energy, classical light wave is a superposition of (infinitely) many photons.", "My confusion stemmed mainly from when I saw a gif showing a sine wave made up of little balls (photons) that was supposed to be demonstrating what light 'is'", "Hard to tell without you showing the picture, but a photon is ", ".", "When talking about QFT are the ripples in the fields that make up the particles the same thing I'm talking about ^ up there ^ or something more abstract to do with probability functions?", "Probabilistic detection of many photons has to reduce to results of classical electromagnetism, so those two are kinda the same, even if it might not look like that." ]
[ "Yes, I think with some difficulty you can write down a coordinate-space wavefunction for a photon, but that’s not usually how things are done in QFT." ]
[ "The “amplitude” of a single photon is not really a meaningful thing. If you have a classical light wave, consisting of many photons, the amplitude of that wave is related to the number of photons (really the average number, because a classical light wave doesn’t have a definite number of photons)." ]
[ "If the universe is only 13.8 billion years old, but the observable universe has a diameter of 93 billion light-years, doesn't that imply that stuff at some point traveled faster than the speed of light? What am I missing? :(" ]
[ false ]
null
[ "This is the first question in the Astronomy FAQ. " ]
[ "I see why you say that, but the \"soccer ball\" analogy in the FAQ doesn't explain how the distance between two points could be more than double the age of the universe in light-years. I should have done a better job wording my question... Basically, if two objects move in opposite directions at the speed of light for 14 billion years, they will only end up 28 billion light-years apart. But there are objects in the universe that are more than 90 billion light-years away from each other, and it's my understanding that 14 billion years ago, those objects were in roughly the same place. So my question is, how did they get so far apart in such a short time?", "The answer offered in the FAQ doesn't address this." ]
[ "Thank you for your submission! Unfortunately, your submission has been removed for the following reason(s):", "/r/AskScience", "To check for previous similar posts, please use the subreddit search on the right, or Google site:reddit.com", "/r/askscience", " ", "Also consider looking at ", "our FAQ", ".", "For more information regarding this and similar issues, please see our ", "guidelines.", "If you disagree with this decision, please send a message to the moderators." ]
[ "What are the real world obstacles to tackling megafauna extinction through poaching by genetically modifying elephants/rhinos not to produce ivory?" ]
[ false ]
Is it doable technically? How might a herd adapt, or would they?
[ "I remember reading about a national park or some such in Africa where they removed the horns from some rhinos (or possibly de-tusked elephants) manually in an attempt to hinder poaching.", "The poachers, presumably pissed off after spending a long time tracking down a rhino only to find it had no horn, shot and killed it anyway. So that's a possible problem.", "Also we know little about the genetics of these species, it takes a long time for them to grow up (so it would be years before such a project could be successful) and we might negatively affect aspects of their biology (like breeding success, ability to defend from nonhuman predators, etc)" ]
[ "I've heard some talk about elephants' tusks getting shorter over time due to poaching. The elephants with the biggest tusks have been targeted for the past 200 years pretty heavily so as time goes on they're being selectively bred to have smaller tusks.", "Here's one site that talks about it:", "http://www.environmentalgraffiti.com/ecology/elephants-evolve-smaller-tusks-due-to-poaching/711", "but it's not a peer reviewed journal or anything so take what it says with a grain of salt. " ]
[ "Oh man, that makes me so angry...! But thanks very much for the reply :)" ]
[ "Is homosexuality a mental illness?" ]
[ false ]
null
[ "No." ]
[ "what do you believe are the reasons?" ]
[ "The DSM defines a mental illness as something that impairs function (see ", "here", "). That does not describe sexual orientation. " ]
[ "If the Pfizer and Moderna vaccines are essentially the same, why do they have different waits between 1st & 2nd doses? And why is the age limit different for the two?" ]
[ false ]
null
[ "With vaccine prime/boost regimens, either a 3 or a 4 week interval is common and the extra week makes little or no difference. The goal is to give a long enough period for the first immune response to go to completion and start to contract, which takes around 2 weeks plus. After that, you have a window of a few weeks when it’s easy to boost the response. A slightly longer wait ", " be a little better for the immune response, but if you wait too long, you risk having partially immunized people with low resistance for a longer time (and you also risk losing people who will just forget to come back if the lag is too long). It’s basically arbitrary which you choose - there are tradeoffs, but they are all very minor. ", "As for the age groups, I assume you’re asking about the 16-18 year old age group, which Pfizer is EUA approved for and Moderna is not. That’s because Pfizer had data on that group, while Moderna didn’t yet. The reason Pfizer had data is that in the fall, they asked for and received permission to expand their trial to include 16-18 year olds, based on the safety profile they were seeing in the 18-plus age groups. Moderna could probably have done the same, but probably preferred not to add the extra complication to their trial. Both companies have extended trials to 12-year-olds and up now, so presumably they’ll both look for approval for that age group as they get more data. (Why didn’t they start with younger people? Because children are given special protection where possible and regulatory agencies wanted to see evidence of safety before extending to protected groups.)" ]
[ "As I said, there’s no difference. 21 days and 28 days are the same, for all purposes here. It has nothing to do with the immune response. It’s a checkbox on a clipboard when planning the clinical trial." ]
[ "Thank you for your time! Do you happen to know why the period of time required for the first immune response to go to completion is different in the case of these two vaccines specifically? I guess what I’m asking is, if they’re fighting the same virus, and are both using the same process, what specifically would make one take longer than the other to do so?", "Edit: *what specifically would make one take longer than the other to complete the first immune response?", "And yes, that’s exactly what I meant about the age groups. That makes a lot of sense now. Thank you!" ]
[ "If I had a tube that stretched from the surface of the Earth into space would the vacuum of space pull air out of the atmosphere?" ]
[ false ]
[deleted]
[ "There would be a negative pressure from the vacuum, but also a positive pressure as a result of the Earth's gravity. Nothing would happen, thankfully, otherwise our atmosphere would leave us together. ", "As a side note, our atmosphere is being lost to space at a small rate." ]
[ "Fun fact: a perfect vacuum will only be able to lift water about 34 ft, under atmospheric pressure\n", "http://en.wikipedia.org/wiki/Atmospheric_pressure" ]
[ "Examine the Earth as it is right now. The atmosphere is already exposed to the vacuum of space, but gravity pulls the air together and keeps (most of) it in place." ]
[ "Why do I remember my dreams clearest when I first wake up, but I gradually forget them during the day?" ]
[ false ]
null
[ "This may be connected with ", "state dependent memory", ". I don't see anything about sleep-state studies in those articles though." ]
[ "You also forget your dreams while you sleep. During the night you may go through five or more sleep cycles including a dream sequence. When you wake up, you can only remember your most recent dream. If you do not write it down or rehearse it a few times, you'll forget that one too just as if you were asleep. If you are awakened just after one of your middle of the night dreams, then you can remember that one for a short time too. " ]
[ "Thanks.", "As a followup, do you know why we forget dreams so easily? What confuses me is that I can remember my dreams quite clearly when I wake then later in the day it will be completely gone. If it was something else, for example if I was thinking about a list of things I could do as I woke up, if I tried to remember that list an hour later I'd probably still remember most of it, but not with a dream. How come?" ]
[ "Why do we sneeze, get a runny nose and eyes, and a sore throat when we are ill? What is going on inside? And why do the symptoms seem to appear immediately and them disappear only gradually?" ]
[ false ]
Could you explain in simple terms what's going on inside to make these things happen? And if there are any legitimate ways of feeling better while your body fights whatever you have? Also, why does resting help?
[ "Sneezing, coughing and a running nose are all the response of the immune system with the intent of mechanically removing pathogens. By violently expelling infected mucous, the body reduces the amount of pathogens it must fight. \nUnfortunately for us many viruses and bacteria evolved to use this as a method of transmission and infect more hosts." ]
[ "So in essence, when we have a cold, do we want to sneeze and cough as much as possible to enhance your body performance to fighting it off?" ]
[ "Sneezing and coughing are the body's response to irritants; an attempt to physically expel offending objects or particles or, yes, bacteria/viruses. Coughing especially is a great way to clear clumps of infected mucus/debris and we totally encourage clearance in most of our patients, especially really sick ones!" ]
[ "If an intelligent species evolves somewhere, odds are it will be... what ?" ]
[ false ]
I'm not sure if there is any way of making even an educated guess here, but say there's a planet which isn't fundamentally different from ours, and an intelligent species evolves. Is it possible for it to be, say, an insect, or reptile, or something microscopic ? Or are mammals superior in some way ?
[ "We couldn't even fathom what it may be. It may transcend everything we can currently classify. Everything we call life is based off of our models here on earth, a sentient being from somewhere else may not fit our descriptions at all.", "Sorry this doesn't answer your question." ]
[ "Agreed. They may not even have heads, abdomen and legs like most living things on earth do. The reason mammals, birds, reptiles, and amphibians these things is because of a group of highly conserved genes that generate body segments (called hox genes) that we got from our shared ancestor. There's no reason that life on another planet would need genes like this though. It might be entirely possible that they wouldn't heads, legs, and torsos. There's also biochemical processes in our bodies that we share across taxa that are entirely inefficient when it comes to doing what it's supposed to do. E.g. Hemoglobins affinity for oxygen is actually pretty sucky. If life on another planet needed oxygen, it would be pretty unlikely that they'd evolve the same way as us.", "Edit: I just wanted to add that everything that has happened on our planet that lead us to be the \"most intelligent species\" happened by chance in an ever-changing environment that shaped us to be who we are today and shaped every other living thing on our planet." ]
[ "It's too bad that this question is being downvoted, because it's actually a fun question.", "Consider just one aspect of your life that is incredibly important to your perception of ", ": the amount of time that you spend consciously alive.", "Imagine what would be different if you only lived for one day. Or if you lived for 100,000 years.", "How would living for 100,000 years affect your speech? How would it affect reproduction? How would it affect the formation and sustainability of societies?", "You say \"intelligent\". You have to address what you mean by that in order to answer this question. Some people think that \"intelligence\" (or more specifically consciousness) is an emergent property of complexity.", "See this: ", "http://en.wikipedia.org/wiki/China_brain", " for a thought experiment.", "It's likely that there is intelligent life on other planets. It's also likely that we wouldn't recognize it as intelligent life." ]
[ "When a jet breaks the sound barrier, is it silent in the cockpit?" ]
[ false ]
[deleted]
[ "Not 100% sure, I'm not a pilot", "Please avoid speculation. If you are unsure about something, find citations/sources that back up your assertion rather than saying it anyway, since it may be incorrect." ]
[ "Not 100% sure, I'm not a pilot", "Please avoid speculation. If you are unsure about something, find citations/sources that back up your assertion rather than saying it anyway, since it may be incorrect." ]
[ "Apparently not. See ", "this", ", by a supersonic pilot." ]
[ "How does patient zero happen for the cold or flu virus?" ]
[ false ]
Is it just a handful of viruses that keeps moving and mutating? Or is does it start with something like a patient zero early in the season?
[ "A lot of these things start in an animal population and then that somehow infects a person. That’s a rare event. That is patient zero. But it may not be recognized unless that person infects another person. That’s an even rarer event." ]
[ "Unlikely, because they also have animal reservoirs." ]
[ "The flu also circulates in birds and pigs (mainly). Bird flu can not infect humans (generally speaking) but pigs can be infected by both bird and human/mammalian flu. This allows the different strains to mix, producing a bird flu that can infect human (putting it simply). That pig passes it on to a human and there is you patient zero for a potential new pandemic strain (ala swine flu from a few years back). ", "Other strains just bounce around between humans and don’t cause much fuss, so they are perpetually maintained, perhaps mutating enough to evade previous immunity and make the rounds again. These are the primary seasonal strains you can get immunised for every year." ]
[ "What determines whether or not a soda/pop/coke has caffeine, when they're all essentially carbonated water, HFCS, and flavorings? Do they add it? And if yes, where do they get it from?" ]
[ false ]
null
[ "In nature caffeine is found in varying quantities in the seeds, leaves, and fruit of some plants", "For most beverages it comes with the flavorings, like in some types of cola (and other similarly flavoured beverages) the caffeine as well as the taste derive from the ", "kola nut", ". Other sources of caffeine (some used in energy drinks) include ", "yerba maté", " (Club-Mate), ", "guarana", " berries (e.g. Monster Energy), ", "guayusa", ", and the ", "yaupon holly", ".", "Caffeine can be produced synthetically but as it's available as a byproduct of decaffeination (e.g. decaf coffee) it does not have to be." ]
[ "Caffeine can be produced synthetically but as it's available as a byproduct of decaffeination (e.g. decaf coffee) it does not have to be.", "Just to add to that: Every reaction step in an organic synthesis tends to require one or more purification steps, since virtually all organic reactions will result in one or more unwanted by-products. Those by-products might interfere with future steps if you don't remove them. Even if they don't, you'd likely be left with an exponentially-increasing number of byproducts, making the final purification of the desired product that much harder. On top of that, agricultural products tend to be pretty cheap compared to pure, refined organic chemicals. ", "So as a rule, any time you can extract an organic compound from plant matter (or even animal matter, in the form of meat by-products), it's usually ", " more economical to do so. Since that's basically just some purification. ", "In other words, even in a world where nobody drank decaf, we'd probably still be getting caffeine from coffee beans. Although if it was a world where nobody drank coffee ", ", we'd probably use a different source. If you're growing for caffeine alone, there probably exists some other plant which would yield caffeine more cheaply. (Or, it might be more economical then to use tea leaves, which although they have a relatively small caffeine content, are produced in pretty enormous quantities)" ]
[ "It's an added ingredient. It is possible to synthesise chemically, but it is usually easier and cheaper to decaffeinate tea leaves or coffee beans, and get the caffeine that way" ]
[ "Since moons can be larger than planets, have magnetospheres, tectonic activity, and substantial atmospheres (e.g. certain moons in our own solar system), is there any reason not to consider moons in our hunt for habitable 'planets'?" ]
[ false ]
It seems like they can quack like planets but nonetheless get sort of written off when thinking about places where life could flourish or even places humans could colonize in the distant future. Should programs like Kepler consider moons too?
[ "No one is writing off moons, it's just that they're ", " harder to detect.", "Of the two most common ways to detect planets, radial velocity will only tell you the total mass of the planet/moon system, which we just assume to be essentially entirely due to the planet. It's just about impossible to tell via RV if a planet has moons or how big they would be.", "The transit method is probably best for detecting moons, but it's still exceptionally hard. Probably the most well known search is the Kipping group running the ", "HEK (Hunt for Exomoons with Kepler)", " project. They've been at it a few years but haven't come up with anything yet.", "Since moons are so hard to detect, and we don't even know how common they are/if they even exist in enough numbers to consider seriously, they don't get too much attention. But astronomers are aware it's a possibility to consider in the future if we get sensitive enough equipment to start finding them.", "One potential problem with moons could be radiation though. The moons of Jupiter for instance get exposed to very high levels of radiation due to Jupiter's radiation belt. I believe it's almost too high for spacecraft to operate properly, let alone humans or life to live easily." ]
[ "Regarding the potential frequency of exomoons, it's important to keep in mind is that here in the Sol system, we have between 8 and ~15 data points from which to extrapolate, rather than the one data point we had regarding exoplanets prior to the advent of 51 Pegasi and the RV technique. Based on this, I don't think it's unreasonable to believe that moons would be relatively common around exoplanets, though this does not say much for their potential habitability." ]
[ "If the planet had a magnetosphere could that protect its moons from cosmic and solar radiation? Or can non-rocky planets not have magnetosphere because the pressure on the core is too high for circulating liquid iron?" ]
[ "How do blood tests actually happen?" ]
[ false ]
Hi! I'm curious as to what are the processes involved in running a blood test, as in what is done with the extracted blood to determine the levels of a certain parameter. Why do they actually take so long? Thanks in advance
[ "There are machines and things that they use. For many tests, we have to separate the serum. This involves putting the tube in a centrifuge and spinning it down. We use a serum separator tube for collecting these samples, so it ends up that the red blood cells are on the bottom, separated from the serum by the gel in the tube. Then the serum is drawn off and used for tests.", "I know that for troponin, a test that looks for evidence of a heart attack, they put the sample on a special cassette, and if it changes colour, that's positive. When I was in my final practicum in nursing school an older lady came in with chest pain. (Rural hospital so I was doing acute care and ER.) The lab tech came and showed me the troponin cassette with a positive result - the patient had had a heart attack. (She did survive. I believe she recovered well.)" ]
[ "To go more in depth, for troponin there's a very popular analyzer that uses immunochemistry. Basically, antibodies against troponin are added to the patient's serum. These antibodies have a tag so we can find them later. Then magnetic beads are added, which the antibodies attach to (streptavidin-biotin interaction), then a small electric current is applied. The antibody-troponin-bead complex emits a glow, which we compare to a standard calibration curve to report a precise concentration.", "Other tests can be done using other methods. We also do PCR, enzyme-linked immunoassays, chromatography, mass spec, colorimetry. Most tests do have fancy instruments, but many do not, and many that do are still frequently done manually, like counting cell types in blood (differentials). The website Lab Tests Online is published by the American Association for Clinical Chemistry, a highly respected professional organization, and is designed to help patients understand tests.", "/u/gforec", " feel free to DM about any specific test you had in mind." ]
[ "Blood test times vary depending on what test is ordered.\nLike the previous commenter said, Troponin is one of these tests. On a chemistry analyzer, it takes around 15 minutes at the fastest so long as the test was ordered STAT, which Troponin usually is. It also depends on the facility running the test. If the Troponin is a critical result, some labs will rerun the test to verify that it is a trhe critical value before calling the patient's nurse/clinic/doctor, which means this can take up to 30 minutes, plus phone calls, plus relaying the message to the doctor who is likely dealing with other patients.", "Slme tests take forty-five minutes to analyze, some tests, like Chlamydia, can have an hour and forty-five minutes.\nRemember, in hospitals, the emergency room and patient's in the hospital will likely be STAT orders. Other places like clinics may not be ordered STAT because some of these patients will be a bit healthier.", "There are also tests that do not use machines or cassettes that require the laboratory scientist to manually look for blood cells and organisms under the microscope which means the test takes much longer. Also, when checking for organisms in blood or urine, this can take days due to allowing the bacteria or yeast to grow on plates before being able to be identified.", "There are many factors to take into account." ]
[ "What is the law for the amount of momentum transferred in a collision of two elementary particles ?" ]
[ false ]
Is there a law for the probability of transferring some amount of momentum between two ( lets say ) electrons, given some initial conditions ? Do they simply switch momenta or ( what i think ) is it random, depending on e.g. the angle ? What is the law ?
[ "Conservation of energy and momentum." ]
[ "Thank you for your answer. \nCan you give an example? Like the distribution of outcomes for a specific, simple case or, if ist possible, a formula for the distribution of a more general case, where the type of particles is fixed ( e.g. electrons ) but the initial and final positions and energies are variable in some way. " ]
[ "Thank you for your answer. \nCan you give an example? Like the distribution of outcomes for a specific, simple case or, if ist possible, a formula for the distribution of a more general case, where the type of particles is fixed ( e.g. electrons ) but the initial and final positions and energies are variable in some way. " ]
[ "Why do some metals rust and some dont?" ]
[ false ]
null
[ "A better scientific term for metals that don't oxidize easily is ", "noble metals", ". ", " refers to their economic value, which is highly correlated with their resistance to oxidation, but not strictly linked." ]
[ "All metals except precious metals will oxidize when exposed to electrolyte and oxygen. If you are referring to stuff like stainless steel, it has chromium in it which reacts with atmospheric oxygen, forming a protective layer that protects the steel." ]
[ "Only iron and its alloys rust. Rust is specifically iron oxide, a compound formed when iron and oxygen combine chemically.", "Stainless steel doesn't rust quickly because the alloying elements form a protective oxide layer that is chemically inert and greatly reduces the ability of the iron to mix with oxygen.", "Non-ferrous metals will oxidize to varying degrees depending on their ability to bond with oxygen and their crystal structures. Some don't readily combine with oxygen, the noble metals, and some produce protective oxide layers. Aluminum is one example of a metal that forms a protective oxide layer." ]
[ "How do we know that Lucy is a direct human ancestor?" ]
[ false ]
Hey - fairly simple question I'm having trouble googling. How do we know that Lucy is a direct human ancestor and not just some other random ape/hominid? Besides the fact that her body fits our theories for a transition from ape to human, is there some other kind of evidence that proves Lucy is a part of our ancestry and not some random offshoot of another ape line? (If that makes sense).
[ "In a sense, we don't. There's nothing dictating that Lucy was a great-great-great-[...]-grandparent of the common ancestor of humans, since it's basically impossible for us to map out a complete individual-level family tree through the fossil record. This is the pitfall of the \"linear\" model of evolutionary thinking.", "Lucy has, however, a lot of traits that characterize her as being a member of the Hominini. So, Lucy is really ultimately probably just an offshoot of the hominin lineage, but she can still give us a lot of insight into the development of characteristically \"modern\" traits in this lineage. " ]
[ "Got it - I was mainly curious if there was some evidence besides the similar skeletal structure, etc. Not sure what it would've been but thanks for answering!" ]
[ "Got it - I was mainly curious if there was some evidence besides the similar skeletal structure, etc. Not sure what it would've been but thanks for answering!" ]
[ "When we say an atom is stable as it has achieved an octet electronic configuration,what do we exactly mean by stable?" ]
[ false ]
null
[ "An atom is stable if it has a full set of electrons. How many is a full set? 2(N", " ) where N is the row on the periodic table. When you do the mathematics to solve the hydrogen atom, you find that electrons will distribute themselves into energy levels. The problem is, we can really only solve the hydrogen atom, because problems involving 3 or more items are very very complex. However we use that model (and it has shown good results) of the original hydrogen atom to show that the shells are full at 2(N", " ). The \"2\" comes from the fact the electrons can be spin up or spin down. N", " is from solving the equation for a Hydrogen Atom. Now where does all the 8s, 18s, etc come from? Those are the \"sub-shells\" They also can be shown to be part of the mathematics due to angular momentum. The first one, or \"s\" shell holds 2, the p shell holds 6, d 10 and so on. The trick is the subshell has to be less than the man shell. So for N=1, only the first sub shell exists (s). For N=2, both s and p exist.", "But regardless of the subshells, when you reach the 2(N", " ) number of electrons, the main shell is \"full\" That is why Helium, Ne, etc form gasses as their shells are full, the have no desire to shed or gain an electron and are electrically neutral.", "As for always looking like the outer shell is 8, due to a quirk of all the interference, the s shells of the next level up have lower energy than the d and f shells. So for N=3, we should need 18 + 8 + 2, but Argon sneaks in there at 18--that is because the 3d level energy is actually higher than the 4s energy level. That is why you see some counting that may be different than the 2,8,18,32.... for energy levels. When you break into sub-shells, they overlap." ]
[ "Stability is in comparison to the reactants that make it up. For example, the ions of Na+ and Cl- in NaCl are more stable than their corresponding atoms Na and Cl in Cl2. This is because with the electron transfer from Na to Cl, both have a full outer electron shell. ", "A compound where all the atoms have a full outer shell can still be highly reactive. For example, most covalent compounds have atoms with a full outer shell but can still be extremely reactive (ex: HCl). ", "The stability refers to relative stability compared to the individual components before the formation. " ]
[ "Oh wow! Thank you so much for taking the time to answer my question! I genuinely appreciate it alot! Cheers buddy!!! :)" ]
[ "How do biologists estimate the population of endangered species?" ]
[ false ]
Bonus points for explaining how they estimate marine populations, given how large in every dimension our oceans are. (An article I just read quoted a specialist saying there are "roughly 468 Right Whales" remaining. How do you arrive at such a specific number with confidence?)
[ "There are various techniques; which one is most relevant will boil down to the species. Mostly it boils down to estimating the density of that species, then multiplying it by the area of suitable habitat.", "Densities can be estimated by methods such as transects - walk (or drive) a path, counting any individuals you detect, or sometimes counting signs of the animal such as droppings or nests. Repeat a number of times across potentially suitable habitat (each transect is a sample).", "Then there will normally be some data processing - for example, you might need to estimate how far away you are likely to have successfully detected the animal; you might need to estimate the number of individuals required to produce the number of droppings observed; you might need a modifier if (for example) only males sing, or juveniles and adults have different behaviours. If you recorded details of the habitat or other environmental features, you might need to model density across the entire potential habitat as a function of those features (e.g. density might be highest at higher altitude). And so on...", "For ", " rare species, especially those with small habitats on islands, it may be possible to attempt to simply count the entire population.", "For large marine mammals, the same principals apply, but the 'transect' might be carried out by observation from a plane, or boat. Alternative methods could include acoustic methods - whale song can be heard for miles, and individuals ", " be identifiable from their song.", "If you browse the ", "IUCN Red List", " you can often find references for population estimates; these will include methods. For example, ", "one paper", " cited for the North Atlantic Right Whale states:", "Right whales in the North Atlantic have been individually\nidentified and catalogued since the 1950s using the callosity\npatterns and scars found on their heads and bodies. Right whale identification photographs have been obtained through both aerial and shipboard surveys over the last twenty years. [...] In the present paper, population estimates were obtained\nin two ways. The total catalogued population minus the\ncumulative numbers of presumed dead for that year was\nchosen as a lower estimate. [...] The second estimate was obtained using the back-calculating method of Knowlton et al. (1994) for the entire period, but assuming zero presumed mortalities.", "(quote cleaned slightly for ease of reading)" ]
[ "Thank you for the in-depth response! I have no follow-up because that pretty much covered everything." ]
[ "Another way to estimate a population is by using a technique called ", ". In this method, you sample the population multiple times. Each time, you record the number of individuals you've captured and then mark them in some way (e.g. banding the foot of a bird, clipping the pelvic fin of a fish). From the second time onward, you would distinguish between how many \"new\" individuals you've captured versus ones that you have already marked. You continue until a certain point, where you only see marked individuals and no new individuals. There are then multiple ways you can use the data to calculate an estimate of total population. Here is further reading on the mark and recapture method from the ", "Polar Bear Specialist Group", ".", "A less invasive version of this method would be to use camera traps placed at various locations of your site of study and then distinguishing each individual by unique characteristics (such as coat patterns and markings or wounds and scars, so this would be more easily done in mammals). There is a recent article by ", "Alonso et al. 2015", " on such a method.", "There's also ", ", where you count the number of individuals you encounter within a specific area (e.g. in a 10m x 10m plot of land). Then, you simply multiply the number of individuals by the number of such a plot you have within your overall area. Here is a ", "handout from Dartmouth", " on the subject." ]
[ "Would gravitational lensing allow for an infinite number of stars and not result in a white sky?" ]
[ false ]
If gravitational lensing causes light to become scattered, than it seems that the light that is farther out will have a greater chance of being diverted before reaching us so that we can detect it. I am not asking whether or not that light exists in the first place, I am asking if my thinking is correct or if there are potential problems with my hypothesis. Also, is there a better subreddit for asking scientifically speculative questions such as this?
[ "This is pretty much the subreddit for scientifically speculative questions. And no, gravitational lensing would not solve Olbers' Paradox, since the light still has to go somewhere (same total amount of light in the universe, regardless of whether/how it's lensed). Also, gravitational lenses actually magnify the objects behind them." ]
[ "If a celestial body absorbs light, it's going to re-radiate it (generally at a longer wavelength). But that's completely and utterly unrelated to gravitational lensing. Lensing does not destroy or create light, just redirects it, and there is no possible way for the total effect of gravitational lensing to be a decrease in light." ]
[ "My reasoning behind it is that there may be enough celestial bodies to absorb a large portion of light over those log distances, along with the scattering due to gravitational effects, that light has a much lower chance of reaching over super long distances.", "I would like to give an example. If you have ever watched \"The Price Is Right\", there is a game on there called \"Plinko.\" Now imagine this version is highly modified. In this version, the pegs are much farther apart. The pegs are also magnetic. The pegs will absorb any pucks that touch them. Just like light, the chance that the puck still exists is lower as it passes farther along.", "I am wondering if my analogy holds up for light passing through the universe. It would seem to me that because of lensing there is less line of sight to further stars, along with a higher chance that light has been absorbed (not to mention that the diameter means that there is much less light anyway).", "Edited for clarity." ]
[ "What exactly are polynomials used for?" ]
[ false ]
So I have been learning about polynomials in school for the past couple of weeks (graphing them) and our teacher told us that we won't need to actually use them later in life. So what exactly are they used for? Edit: thankyou guys so much. You have taught me almost more than what school has taught me about this. Thankyou :)
[ "our teacher told us that we won't need to actually use them later in life.", "Ugh. What a shitty thing for a teacher to say. I also know the pain of having had horrible K-12 teachers.", "It's probably true that most people in your class will \"never need to use them later in life\", but that's true of a lot of things you learn in school. Anyone that ends up doing ", " in applied science/math/engineering absolutely will use polynomials for a ton of things. The \"real world\" applications are too numerous to state, but a couple things:", "Say you took a bunch of data from an experiment, like the black dots in this plot.", "Polynomial fitting like that is essential in literally any field where you take data. You should be doing something like this in a high school physics class. (When fitting data you can choose to fit to any kind of equation you like, e.g. if it were periodic data you'd probably use periodic functions like fourier series instead of polynomials.)", " Similar to the above. If you're fitting data and instead of doing the \"least squares\" approach where you fit a simple function to a lot of data, and instead construct the unique polynomial that goes exactly through all the data points, ", "you have the Lagrange interpolating polynomial.", " I use these all the time -- you end up with some really nice properties. Want to know what the value is between two points? There's a nice closed equation for it.", " ", "Gauss quadrature.", " Exactly integrating functions can be difficult, impractical, or impossible. Similar to the above, you can approximate your function by constructing special polynomials and sampling your data at particular locations, and by multiplying the values at those locations by some weights and adding them you can get an arbitrarily accurate approximation of the integral. In similar ways you can also get accurate approximations of derivatives.", " You can always exactly express \"nice\" functions by a ", "Taylor series.", " Formally a Taylor series is an ", " series so it's technically not a polynomial, but we frequently ", " the terms, just keeping the first couple terms in the series, and that is a polynomial that approximates the original function. Check out their approximation of sin(x), approximated by x-x", " /3! + x", " /5! - x", " /7!. This is really nice, because in many cases an algebraic polynomial like this is much easier to work with than the original function.", " Related to the above, the formal mathematical definitions for many common functions are actually in terms of infinite series, something you might not have been exposed to. ", "For example the formal definition of the exponential function.", " Again to be technically accurate an ", " series is not truly a \"polynomial\", although if you truncate to a finite number of terms these are polynomials that approximate the original function.", "I'd say my entire field could be summed up as ", " And that can be summed up as ", " Basically anyone that ever uses a computer for math/science is using polynomials in \"real life.\"", "These are just a couple examples off the top of my head where I use polynomials on a daily basis. I'm sure others can provide lots of other real world examples." ]
[ "In addition to all the very important practical things mentioned by ", "/u/Overunderrated", " , polynomials are also very fun. It's okay to learn things for the sake of learning, without considering any practical concerns. A sign of a highly cultured society is the opportunities for it's citizens to learn without having to be concerned about practical things. ", "Polynomials have occupied the lives of some of the most interesting people of all time. So they ", " to be intrinsically interesting. It's just a plus that they are so amazing that they can be used to understand other intrinsically interesting things, like Fluid Mechanics. ", "Evariste Galois", " was a French revolutionary who divided his time working with polynomials and political protest, which involved lots of guns in that time. From wikipedia: ", "On the following Bastille Day (14 July 1831), Galois was at the head of a protest, wearing the uniform of the disbanded artillery, and came heavily armed with several pistols, a rifle, and a dagger. He was again arrested. On 23 October he was sentenced to six months in prison for illegally wearing a uniform.[10][11] He was released on 29 April 1832. During his imprisonment, he continued developing his mathematical ideas.", "At the age of 20, after he proved that polynomials of degree 5 or higher do not have a formula analogous to the Quadratic Formula, using techniques that have shaped all of math afterwards, he got in a dual and died.", "Try to find find what is ", " about polynomials. Every time I teach college algebra, I'm amazed at all the really interesting stuff about polynomials that is technically in the curriculum, but gets glossed over and reduced to something pitiful enough for students to get by with only memorization. For instance, try to see how polynomials and integers are actually pretty similar: You can add, subtract and multiply them, and you can also do Division-with-Remainder. In fact, long division of polynomials is actually lot easier than long division of integers. But all of this ", " stuff can tell us about how they behave as functions, which is something that integers don't have. Division with remainder can tell you how a function evaluates (the Remainder Theorem). The zeros of the function correspond exactly to how the function factors. Imagine '15' being a \"function\" that is zero only at '3' and '5', this is crazy for integers, but it's reality for polynomials. The coefficients of the polynomial can help you find factorizations and zeros.", "It's really a failure of our education system that people are missing out on the greatness of polynomials, and it sounds like your teacher may be part of the problem and I'm sorry about that." ]
[ "The thing that I think everyone is glossing over is the following:", "A function is any \"box\" which takes in an input and spits out a unique output. A box which takes in teacups and spits out their primary color is a function from the set of teacups to the set of colors. ", "Most functions you study in mathematics take in real numbers and spit out real numbers. The simplest possible examples of these are polynomials. So, this is why we study them. When studying any class of object, it makes sense to start simple. That's why you'll shade cubes and spheres in an art class before you tackle life drawing. ", "Yet miraculously, even though polynomials are simple, they are still robust enough to have interesting properties, and we can ask a lot of interesting questions about them, like, if they're so simple, are most functions \"close\" to a polynomial? (Smooth functions, at least). ", "There are tons of interesting properties of polynomials and interesting uses, but the reason you're studying them is because they are the simplest examples of functions, and functions are fundamental objects in mathematics and beyond." ]
[ "Can wasps/flies detect the difference between real sugar and aspartame?" ]
[ false ]
If so, do they selectively prefer the real stuff? Struck me that insects that go after sweet liquids might be able to tell the real from the fake - if they can, any insight into the mechanism by which this occurs would be greatly appreciated.
[ "They will be attracted to it but because they can't be metabolized which means they provide no sustenance to the bug.", "This is the same reason hummingbird feeders explicitly say not to use artificial sweeteners- the birds will eat it, get 0 calories, and starve to death with a full belly. " ]
[ "what's the sensory component here? do they \"smell\" sweet in the same way we do? " ]
[ "Not as different as one may think. There are plenty of examples of various genes that are conserved between vertebrates and insects. ", "However... ", "you seem to be correct about the divergence of chemoreceptors.", " (ps sorry about the paywall if you are not going through a university library system)", "The odorant/taste receptors are an interesting case. Despite having different molecular mechanisms between the clades, the qualitative aspects are conserved (i.e. we all can taste 'bitter', 'sweet', 'umami' , 'salty', and 'sour'). ", "EDIT: I just read your username. Awesome. ", " " ]
[ "Would extreme time dilation make it possible to travel to a distant galaxy in one human lifetime (from the traveler's perspective), assuming you were going fast enough?" ]
[ false ]
I remember reading about this idea in in a book awhile ago, but was wondering if it had any credence.
[ "That page also mentions another show-stopping problem with fuel, if you plan to slow down by the time you reach the other galaxy, rather than zipping through it at near the speed of light. ", "Their calculation for reaching Andromeda requires 4.2 billion tonnes of fuel for each kilogram of payload, and that's assuming pure 100% efficiency conversion of fuel mass to energy. ", "Assuming your payload is 100,000kg (probably very conservative, considering the stuff you'd need to keep you alive to decades, the mass of the drives, etc.), you're talking about something like the mass of one of the largest asteroids.", "So you could take a suitable asteroid, attach antimatter rocket engines to it, and use its mass as a fuel source. But, because of the shielding problem, you might try taking a bigger body and using its sheer bulk as a shield. You would live underground on the trailing side, \"below\" the engines, and the leading side would evaporate away as you blast through space. To get the kind of additional bulk needed for that, you'd probably need to use a planet like Mercury.", "In short, it's a bit of a project." ]
[ "See the ", "relativistic rocket", ". They show how much time and fuel needed to go anywhere in the universe at a constant acceleration g. You could go to Andromeda (2Mly away) in 28 years." ]
[ "Yes, you can go what a appears (in the earth's frame of refence) to be an arbitrarily long distance in what feels like (in your frame of reference) an arbitrarily short amount of time.", "However, from the perspective of the earth, the trip will still take you (distance)*(speed of light) + a little bit of time. And if you want to come back, everyone you ever knew will be dead (or aged a lot, assuming we vastly extend lifespans). " ]
[ "If I am trapped at sea, to what extent can I extend my Freshwater supply by mixing it with seawater?" ]
[ false ]
To the extent of my knowledge, Medical saline is something like 0.9% NaCl and human fluids are isotonic at somewhere around 0.6% Most seawater appears to be in the 3.5%-4.0% range. What is the "safe" ratio that I can mix seawater with my freshwater supply without suffering from excessive salinity?
[ "I did some math, and I came up with 1:9, which is Salt water to Fresh water. \nThe ratio of 1:9 would be tolerable for a human to survive out at sea. Therefore, if you mixed 1 Liter/Gallon/etc, with 9 liters/gallons/etc, you would have 10 of the units specified above to drink. ", "Work: \nHumans can tolerate 800ppm-2500 (I chose the 800 for this one currently, in worse case)\nSaltwater has 3500ppm\nFreshwater has less than 500ppm (again worst case)", "Basic chart that looked something like this: ", "http://gyazo.com/b54d08fb3132ee3cb6bbbd09762b7347", "\nand there we go.\nEDIT ABOVE WAS BEST CASE FOR CLEANEST WATER. \nIf you want water that a human can barely tolerate, your ratio would be 1:0.5, but don't expect to be in top notch condition. You'll be barely passing by. ", "edit: Please respond if I answered your question.\nHowever, I wouldn't recommend trying this because salt water does tend to not be the best thing to drink, as it has various other forms of contamination. Especially if you live near a sewage plant of some sort. Life or death, or if you're stranded in the ocean where the concentration would be dilute. " ]
[ "The concentration of medical saline was chosen to be isotonic with the body, so that's the highest concentration of fluid you can consume without losing water. Some simple math shows a concentration of 25% seawater, or one part of seawater to 3 parts of freshwater.", "If you're actually stuck at sea, you might want to increase the ratio to 1:4 or 1:5 to be safe." ]
[ "I made a comment showing your numbers but with extremes. For best physical condition 1:9 should be done (Salt to fresh), and to have the extreme minimal it would be 1:0.5. Work shown above. The average would be around 1:4.5 which is spot on with your calculations. " ]
[ "Why is recommended that humans eat a varied diet while pets generally do fine with the same meal every day?" ]
[ false ]
null
[ "Pet food is specially formulated to give the pet all the nutrients it needs. There are also owner-comfort considerations involved - such as making food that results in a more solid stool because pet owners don't like mopping up diarrhea. ", "The reason we're encouraged to eat a balanced diet is because we don't want an all-inclusive food like your dog has. We could do it, but there's not much of a market for it. You might find a few people who would be eager to stop eating normal food and instead just eat dry-kibble human chow for every meal, but they'd be in the extreme minority. Most of us just wouldn't want to give up the enjoyable experience of eating a variety of foods.", "In fact, there is an all-in-one nutritional food substance that comes pretty close to what you're talking about. It's called nutraloaf, and it's fed to unruly prisoners as punishment. It's bland (and sometimes worse than bland) and prisoners hate it so much that lawsuits have been filed in several states over prisons making them eat it. And that's a good example of why we don't have human kibble - people would hate it, and not eat it.", "There's another product, MannaPackRice, that's also an all-in-one nutrition source. It's fed to people in 3rd world countries by charity organizations like ", "Feed My Starving Children", " (ingredient list in the link). It's designed to give kids (and others) all the nutrition they need at minimal cost to maximize how much of it can be made and shipped where needed. On a personal note, I've tried it (they have volunteer food packers try the stuff before they get to work). It tastes kind of like a cross between a very thin gruel and unsalted instant Ramen. This would be great if you were starving, but when you have access to a variety of foods, you'd tire of this stuff very quickly." ]
[ "General Mills is one of the companies that worked on the development of the MannaPacks. The concern for food aid to people who are literally starving is getting them nutrition. Flavor takes a distant back seat to just getting the food in them, and keeping it in them. These are kids who sometimes haven't eaten in a week or more. The Mannapacks are designed to be inoffensive enough not to cause problems in digestive systems that haven't seen food in a long time. Adding flavor means adding things like spices, etc, and that could derail the main goal of getting the nutrition into them. Not only that, adding flavor means adding ingredients, and that means adding cost. The more an individual pack costs, the fewer packs you can make and ship. That said, the dried vegetables add some flavor as does a flavoring powder - that's the stuff that gives it the vaguely Ramen-esque note. ", "Backpackers have a variety of food such as Mountain House which actually tastes surprisingly good, and it's very light weight and packs small. The MannaPacks are pretty big - a little larger than a paving brick, and they weigh a lot. Backpackers might want an all-in-one nutrition solution in theory, but about 2 days into the trail they wouldn't exactly be looking forward to mealtime. ", "As for a good emergency food supply, go down to the Army Surplus store, or sometimes outdoors stores, and get some MRE's. They taste. . OK. Some of them are fairly good and some of them are pretty disgusting. But they have all the stuff you need for a day, including waterproof matches, etc, and are designed to be stored in very hostile conditions. They're also designed to be self-heating - you pour water into a bag and stick the entree inside, and it heats the food for you. Even the MannaPacks won't do that. " ]
[ "That's very interesting! I'm surprised there hasn't been much interest in making something like this more palatable, especially if you remove the cost aspect or the punishment aspect. I would that if General Mills or Kelloggs took up the project, they could figure out how to add enough sweetener and artificial flavor to make kids want it. ", "And I would think there would be quite a few markets for it. For example, backpackers and other travelers don't want to have to worry about packing enough for balanced meals. It seems like it would make a great emergency food supply (that's actually one reason I'm curious to know if something like this exists and is palatable)." ]
[ "What happens to DNA after it is split in half (parts of it at least) during RNA transcription?" ]
[ false ]
Do the hydrogen bonds reform? Does it just become useless from then on? Does it matter if they stay separate?
[ "It comes back together. When DNA is being transcribed it typically does not involve the entire genome at one time, so pieces of the DNA will open up for the gene that need to be expressed at that time while other locations stay stuck together. When the gene is done being transcribed, the strands can link back together." ]
[ "Just want to add that the area that's \"open\" is called the transcription bubble. " ]
[ "In short the hydrogen bonds reform.", "first a good model is PCR to answer this question I think, in which pieces of double stranded DNA are used. In PCR we replicate DNA by first separating through heating, we then lower the temperature enough to allow a primer to associate and bond with the single strands and the strand is replicated by polymerase enzymes. We now have two new double stranded DNAs. We can again heat the solution to separate the strands, after this would cold replicate again, or simple cool the solution and allow the strands to congeal into a dsDNA again.", "This should illustrate two things. The first is that it takes energy to separate double stranded DNA and second that single DNA naturally 'wants' to be hydrogen bonded with its proper inverse strand.", "Now if we look at transcription, ", "for specifics and ezyme names", " we will see that it takes energy to separate dsDNA, and keep DNA separated, ", "ssDNA binding proteins in replication are a good example of this", ", and once the machinery for transcription, and RNA, is displaced dsDNA is reformed.", "Does it matter if they stay separate? I would say yes, but that is speculation and how it might matter I cannot speculate, it may not." ]
[ "Emission lines of elements. Why the trend?" ]
[ false ]
I'm looking at the emission lines of elements on the periodic table. It is obvious that heavier elements emit K-alpha and K-beta rays of higher energies. Why is this so? I'm guessing it's something to do with the electrostatic charges between the nucleus and electrons to be greater in heavier elements?
[ "Yes. If you look at hydrogen-like atoms (a single electron) then all energies scale with the squared charge of the nucleus. For the innermost orbitals this is a good approximation to the energy even with more than one electron. For the other orbitals this approximation gets worse, but not enough to change the general trend." ]
[ "Moseley's law, for those who want to look it up." ]
[ "👍 thanks!!" ]
[ "What happens when two black holes collide/combine?" ]
[ false ]
This was asked in shittyaskscience, but I'm genuinely interested. Anything more interesting than just "a really big black hole"?
[ "http://www.youtube.com/watch?v=mHwHM5KjSVE" ]
[ "Almost a FAQ here.", "One interesting thing is that \"the resulting black hole can have a \"kick\" imparted to it, possibly on the order of 1000s of km/s.\".", "One person thought to study black holes professionally suggested that depending on something (spin? charge?) they might result in an infinite number of event horizons (whatever that means):", "http://www.reddit.com/r/science/comments/h5hh8/some_black_holes_may_be_older_than_time/", "RobotRollCall", "I said somewhere else that the models of black-hole merger are hideously complex. The aberration terms are just ridiculous. It's possible to construct a set of initial conditions that yield an infinite number of event horizons. The details are still being worked out, because numerical relativity is hard.", "Other physicists then tried to determine if she was talking about numerical inaccuracies or models actually predicting that..", "This is one of the better answers on the internet:\n", "http://www.quora.com/What-happens-when-two-black-holes-collide", "*", " exactly what happens is really complicated, and figuring it out involves hard math" ]
[ "Brilliant, thanks!" ]
[ "Does 'padding' a file before encryption, by artificially increasing its size, it make it more secure against cracking?" ]
[ false ]
I wasn't sure if this was more of a computing or math question. But, for example, say I have 'secretfile.txt' and I want to encrypt it. Say it's 5kb in size and I want to encrypt it with AES using GPG or whathaveyou. But, before I encrypt the file, I create a 50MB file of zeroed data, call it zero.bin, and then tar both 'secretfile.txt' and 'zero.bin' together. I then encrypt the tared file, resulting in a ~50MB encrypted file. Would this offer any extra protection against cracking than if I was to just encrypt the 5kb file by itself? In other words, does the size of the original data matter when it comes to the strength of the encryption? If it's not applicable to AES, are their other ciphers besides AES that this would be true?
[ "No. The mathematical requirement for a block cipher to be considered secure is that all plaintexts will result in ciphertexts that are indistinguishable (by a computationally bound attacker). To any attacker, there would be no statistical way of being able to distinguish a file that was 50.5 megabytes worth of random data, 50.5 megabytes worth of regular file that was AES encrypted, or 50 megabytes of zeros and .5 megabytes of regular file. This is called semantic security.", "There is no cipher suite that you can download for which padding with any kind of data (zeroes, ones, random data) will result in something more secure than what it was originally. If that were the case, then the cipher suite is by definition insecure, and thus broken. Alternatively, if there were any cipher suite for which padding with data would make it ", ", then this is ", " broken.", "With a modern cipher, you can throw in whatever you want, and mathematically we can show that if the underlying system is sound, so is the data. " ]
[ "Would it further increase security if you could add random data to the plaintext which a human being could know to ignore, but the machine would encrypt as though it's meaningful?" ]
[ "In short, yes and no. Yes, padding can increase the security; No, adding 0's to a 5KB file to make a 50MB file doesn't increase the security. ", "For a basic analogy, think about the last time you played hangman. Whether or not you realize it, you definitely use number of letters in the word to help you make a guess. If you are given a game with 5 blanks, then you can immediately eliminate all words that are 6 letters or more. That makes it much easier for you to arrive at the correct solution. Padding so that there are 16 blanks, regardless of if the word is 16 letters or 5 letters, makes it more difficult for you to guess the word.", "However, your file is going to have 5KB of data, which is ~40,000 bits and most encryption algorithms work on blocks of data. In the case of AES, the minimum size is 32 bit blocks. So in the minimum 32 bit block size case, at most, the first 31 zeros you add will be used in the encryption. After that, you're just encrypting 0's for no added security.", "The wikipedia article on AES", " actually does a really good job of explaining the steps in non-technical terms and with good visuals." ]
[ "How can the atmosphere of planets create false positives for life?" ]
[ false ]
I saw it mentioned in twitter, and was wondering how that worked.
[ "The point being made in that tweet is that unless we have some kind of monumental event like a signal from or encounter with extraterrestrial life, what we're looking for will be pretty hard to confirm as a definite sign of life.", "So we can, for example, analyze the composition of the atmosphere of exoplanets if the planet transits its star. The spectrum of light that comes from the planet in that situation allows us to make some inferences about the chemicals that are present in that atmosphere. So based on where we know life can exist so far (Earth), we can look at a planet's atmosphere and say that it is or isn't suitable for life. With some degree of confidence. Maybe.", "At the end of the day, we don't know if life can exist in forms completely, wait for it, ", " to what we have here on earth, and even if we found some atmospheric signatures that are very similar to those created by or hospitable to life here on earth, we still couldn't be completely certain that there is actually life on that planet." ]
[ "There are other processes that can create oxygen gas, so it'd be an exciting, but still not totally conclusive find. The same goes for many organic gasses." ]
[ "Thanks for the detailed answer :)" ]
[ "Considering that the earth is a few billion years old, how are elements with a half-life of a few million years naturally found?" ]
[ false ]
Logically wouldn't they all decay down to their most stable forms considering how long the planet has been around since most of them were created in the early solar system?
[ "Short lived (compared to the age of the Earth / Solar System), naturally occurring radioactive isotopes are produced in a few different ways. Some occur as part of decay chains, e.g. ", "U (245,000 year half life) and ", "Th (75,000 year half life) occur as part of the ", "U decay chain on its way to ", "Pb", " and ", "Pa (32,000 year half life) occurs as part of the ", "U decay chain on its way to ", "Pb", ". There are also a wide array of ", "cosmogenic isotopes", " which are produced by interaction of particular elements with high energy cosmic rays / particles. Some common ones that are reasonably long lived are ", "Be (1.4 million year half life), ", "Al (700,000 year half life), ", "Cl (300,000 year half life) and ", "C (5,700 year half life)." ]
[ "It wasn't. This is the reason why we have to calibrate our dating methods, e.g. with dendrochronology. ", "Edit: I am currently in a lecture, so please excuse my short answer." ]
[ "A young-earth creationist was trying to debunk the 14C radiometric by affirming that the production of new 14C was not uniform, so the calculus is wrong.", "As others mentioned the variations are both well-known (so the argument fails completely) and small (even if they wouldn't be considered they would still rule out YEC), but arguing with facts against a position that was never based on facts is usually pointless.", "There are trees older than YEC thinks the universe is." ]
[ "Why does water start bubbling before boiling point?" ]
[ false ]
Is 100C just an average boiling point? Or are there some molecules (sorry if I've used the wrong description) that already have a higher amount of energy than others and so boil sooner? If so, what's the minimum boiling point for each individual molecule?
[ "Adding to the other answers that have mentioned non-homogenous heating: the bubbles come from the dissolved gasses in water. Dissolved gasses are less soluble in hot water, so they \"bubbles out\" at elevated temperature. ", "The solubility is not linear, however, and has a noticeable drop near 80", " C. Around that point is when you start to see bubbles forming (the water is not boiling yet). This is one of the reason why when you heat up an electric kettle, it can \"bubble\" for a minute before the temperature sensor catches it to be \"boiling\" and stop the heating." ]
[ "Fun fact about the Leidenfrost effect: It works on a basis of temperature DIFFERENTIAL, rather than just our perception of \"hot and cold\", such that our hand is blazing hot to a droplet of liquid nitrogen. So, you can skid beads of LN2 on the palm of your hand with no ill effects in the exact same way water droplets dance on a hot skillet." ]
[ "Fun fact about the Leidenfrost effect: It works on a basis of temperature DIFFERENTIAL, rather than just our perception of \"hot and cold\", such that our hand is blazing hot to a droplet of liquid nitrogen. So, you can skid beads of LN2 on the palm of your hand with no ill effects in the exact same way water droplets dance on a hot skillet." ]
[ "Are there any molecules that are connected mechanically? (like two links in a chain)" ]
[ false ]
If so, do these have any special properties? Can they be used to create nano-scale machines?
[ "Yes there are. They are called ", "catenanes", ". I read one paper where they used loops of DNA to build up networks of nanoparticles." ]
[ "That sounds pretty neat! Are they able to rotate around each other, or are they pretty much locked in place?" ]
[ "You might be able to design small molecule catenanes (like the ones on the wiki page) that wiggle a bit but van der waals and electrostatic interactions usually lock things down pretty well. However, larger polymers like DNA can form knots, plectonemes, and catenanes that are very dynamic. ", "This paper", " shows single molecule recordings of plectonemes that diffuse and move within a DNA molecule." ]
[ "Would it be possible to harvest stem cells?" ]
[ false ]
So, from what I've read... Stem cells are used in cloning, repair, etc. because they have the ability to transform into any specific type of cell. I've also read that before the cells change they continue to reproduce and won't die off. Taking this into account, would it be possible for someone to harvest stem cells?
[ "It depends on what type of stem cell. A process that is done almost routinely nowadays is harvesting of \"bone marrow stem cells\" and then transplanting them into a patient with leukemia (cancer of the blood). These bone marrow stem cells can either be harvested directly out of the bones, I believe usually from the upper leg/hip area, but this is a quite invasive process and not so easy on the donor patient (obviously).", "Another way is to give the donor patient a special growth factor (GM-CSF, unless I mix things up) which leads to bone marrow stem cells being released into the blood stream. Then they can be harvested by dialysis of the blood and subsequent separation of cells. There won't be a whole lot though, but it seems to work well enough to help patients.", "Source: Me. I donated bone marrow stem cells a couple years back and injected myself for about a weeks 2 times daily with GM-CSF, then underwent dialysis for 2 days, 4-5 hours each." ]
[ "Some minor corrections. The growth factor used is ", "G-CSF", " (granulocyte colony stimulating factor). ", "GM-CSF", " exists as well but it is a different factor. The harvesting is done using a process called ", "apheresis", "; the process looks like dialysis but it's fundamentally different." ]
[ "Thanks for correcting!" ]
[ "Does the length of our day account for the fact that we're moving around the sun too? How about when we talk about other planets?" ]
[ false ]
[deleted]
[ "Have a look at ", "sidereal time" ]
[ "You have it backwards. The Earth takes 23 hours 56 minutes to rotate. It takes 24 hours to return to pointing back at the sun. Think about the stars behind the sun who won't be moving relative to your viewpoint. In 23 hours 56 minutes, they'll be exactly where they were in the sky (this is why astronomers use sidereal time). Because the Earth has traversed part of its orbit in that time, it takes a little bit more time to have the sun at the same point in the sky, so a solar day is slightly longer. " ]
[ "You have it backwards. The Earth takes 23 hours 56 minutes to rotate. It takes 24 hours to return to pointing back at the sun. Think about the stars behind the sun who won't be moving relative to your viewpoint. In 23 hours 56 minutes, they'll be exactly where they were in the sky (this is why astronomers use sidereal time). Because the Earth has traversed part of its orbit in that time, it takes a little bit more time to have the sun at the same point in the sky, so a solar day is slightly longer. " ]
[ "Does vaso-constriction or dilation aid more in uptake of a solute in the blood?" ]
[ false ]
This is one of those questions I could debate for either side, but science doesn't work that way, so here we go; vasoconstriction would mean a higher arterial wall surface area to blood flow volume ratio while dilation probably results in a higher rate of blood circulation. But, then again, vasoconstriction usually accompanies a peak in blood pressure (and vice-versa), so maybe blood flow stays nearly the same in spite of the diameter of the pipes. But then AGAIN, there are many different sized veins in the body, and we all know that cubic growth (flow) is outpaced by square-ular (couldn't think of the word) growth (surface area) for a short window probably represented in tiny skin blood vessels as opposed to the big arteries, and blood vessels make up a large part of our body's transport systems. I had this thought after taking a melatonin after smoking a cigarette (solute and vasoconstriction, respectively) and could not for the life of me reach a conclusion. That being said, it's very late at night so it's possible I don't make any sense in my reasoning anyway. There is more than likely a simple answer/explanation and thus you will collectively call me stupid. I do look forward to some closure, however. Thanks in advance, . You're one of my favorite reddits.
[ "I can't remember the case for intestinal absorption; however alveolar respiration I do remember.", "The lung attempts to keep CO2 & O2 concentrations constant throughout the lung. One way it does this is by dilating alveolar blood vessels that are high in [CO2] to allow for more gas exchange. Thus, dilation leads to better solute transport.", "Source: college mammalian physiology course" ]
[ "The largest factor is transit time. If the rate at which blood flows past is faster, less diffusion can occur. In the case of the lungs it's also important to note that if an area of the lung is underventilated (receiving little to no fresh air) that the vasculature there constricts in order to allow great blood flow to areas that receive adequate ventilation. ", "This describes both in detail.", "In the case of the GI system, as soon as we eat a meal the vasculature relaxes, as the parasympathetic system takes over. The tiredness we feel after eating is referred to as ", "postprandial somnolence.", "Vasodilation will increase uptake, as you're making the lumen of the vessel larger, and increasing the surface area for materials to cross. It's important to note that the vessels do ", " become more permeable themselves as a result of only vasodilation, in the case of histamine release it is the opening of special pores that allows fluid to leave the vasculature." ]
[ "Thank you both for your in depth responses. " ]
[ "Is there a distance from earth at which all stars are guaranteed to have expired by the time we see them in the present day?" ]
[ false ]
I was curious whether there was a constant for this earlier so I did some searching, but can't find anything on the subject. Is there any knowledge of a distance from earth at which an object in space is guaranteed to be 'dead' while being observed from here in the present day? As a side note (and somewhat along these lines), how far would an object have to be from earth for its light to have never been seen from earth up to the present day? Apologies if these questions are nonsensical, illogical, or overly simplistic.
[ "No. Red dwarfs have lifetimes on the order of hundreds of billions of years; therefore, a red dwarf which formed in the very beginning of the universe would still be shining today, and would continue to shine for many dozens of billions of years.", " This assumes that population III low-mass stars are possible. If the very first stars were of a necessity high-mass, then there was a time when every star was high-mass and hence short-lived." ]
[ "They very first stars may have been high-mass because they were zero-metallicity and formed in dense environments.", "However, while massive stars were almost certainly more common, it would be surprising if there weren't at least one red dwarf from that time period." ]
[ "I just want to be sure I follow this train of thought correctly: the very first stars may have, of necessity, been high mass because concentrations of matter were all much higher than they are today?", "If that's the case, how long would it have been before these stars \"burned out\" and low mass stars like red dwarfs became possible? Multiple stellar life cycles?", "Am I asking you to speculate on matters which we lack the evidence necessary to make well-informed guesses about?" ]
[ "Are there any \"good\" viruses?" ]
[ false ]
[deleted]
[ "On the question of 'good' viruses, I guess you could count most bacteriophages (see link at end) as 'good'. These are viruses that infect bacteria. During the 20th century, there have been some efforts to use phages to fight infections, initially with mixed results. They kind of fell out of the limelight once we discovered antibiotics, but were continued to be used in Soviet Union. They're making something of a comeback (as in paying more attention to) with the rise of antibiotic resistance bacteria.", "(As a note, one reason why we haven't jumped into phages with mad enthusiasm is that phages typically can only target specific strains, as opposed to antibiotics which can typically target entire swathes of bacteria) ", "http://en.wikipedia.org/wiki/Bacteriophage" ]
[ "HIV-derived lentiviruses are routinely used in the lab to introduce target genes to mammalian cells. For example, the creation of induced pluripotent stem (iPS) cells was performed using lentivirus. Although these types of virus are not naturally occurring, they are certainly \"good\" in the sense that they have become a powerful tool in molecular biology. ", "Many people also suspect that transposons and viruses may contribute to horizontal gene transfer, which has likely promoted important genetic changes in the evolution of many species." ]
[ "Yes, there are a few examples of \"good\" viruses.", "\"Seneca Valley-001\"", "Vaccinia", "latent herpesviruses can be protective against plague", "less serious viruses can alter the course of harmful viruses.", "theoretical possibility", "Typhoid Mary" ]
[ "Is it possible for organic matter to be blown off earth during an asteroid strike and land on the moon?" ]
[ false ]
I recently came across a Joe Rogan episode on why he changed his stance on the moon landing. One part of it was talking about a "moon rock" given as a gift that turned out to be petrified wood. While this instance is theft or deceit, it got me thinking about the asteroid impact that caused our last mass extinction. Was there enough force in that impact to Launch debris into space? Would the speed required to leave our atmosphere vaporize any organic matter traveling with it? I guess my main question is if a piece of wood were left on the moon for an extended period of time, what would it's aging process look like? How would it differ depending on if it were sitting on the surface or had been driven into the ground? I assume that due to less gravity nothing would be under the same amount of pressure that it is here on Earth.
[ "We have ", "some meteorites which we believe to be of Martian derivation", ", so at least conceptually, it might be possible for a meteorite of Terrestrial derivation with some kind of signature indicating the presence of life to have been thrown out into space at some point.", "But I'd add a couple of ", " to that:", "the overwhelming majority of terrestrial meteoric impacts of any importance occured during the Late Heavy Bombardment, 4.1 to 3.8 Ga ago. If it happened at all, in all likelyhood it happened at this time - in view of your example: there were no trees back then. The recently announced discovery of ", "trace fossils in the Nuvvuagittuq greenstone belt, dated at about 3.8 Ga", ", would be about the right age, and consist of Archean/Bacterian remains and imprints.", "a meteor strike large enough to project terrestrial material out of Earths orbit would profoundly modify and transform the primary textures and mineralogy of the rocks it displaced. ", "Shock textures, brecciation and metamorphism would overprint a lot of the features such a rock might preserve", " (compare figures 4.3 to 4.5 to get a feel of how a large impact will affect a rock). Recognizing organic structures or materials in a rock transformed by such an impact would not be a straightforward exercice for a layperson (such as picking up a bit of petrified wood and recognizing growth rings). The most likely hints of organic origins would come from the presence of organic carbon compounds (provided any survived), total carbon content, and stable isotope signatures. ", "So ... if there are such rocks out there, projected by massive meteor strikes into the great unknown, they are likely to be far older than the apparition of metazoans, and whatever structures might have been present are unlikely to be easily recognized as traces of life by a layperson." ]
[ "Earth also has stronger gravity and a thicker atmosphere, both of which will reduce the amount of material than can escape, compared to Mars." ]
[ "Life on Earth has been known to be around from very early on for quite some time. The Nuvvuagittuq critters merely represent an incremental pushing back of the earliest data known for living things; the previous holders of the title were dated at about 3.7 Ga. However ", "carbon with isotopic signatures indicative of living processes was found in material from 4.1 Ga.", " - You may have a look at the ", "Wikipedia entry", ", it's as good a primer as any for a quick overview.", "Heh! We've been busy, us geologists!" ]
[ "If two people with the same contagious illness are confined together, is it likely that it’ll take longer for them to get better than if they were separated?" ]
[ false ]
null
[ "Not necessarily. In fact, this is called cohorting and is sometimes practiced as a way to prevent the spread of disease. For example, if you have two patients with the same antibiotic-resistant organism, sometimes they will be put in isolation in the same room. They both have the same thing, so they can't really infect each other, and this means that we won't need to put someone not infected in the room with one infected person and put them at risk." ]
[ "While an additional infection would result in a competition for resources, since ", " are the resource, you would be 'sicker quicker.' In contrast, the microbes on the skin have a beneficial effect because the resources they compete for are not your cells; this idea works for some situations, just not an internal infection. ", "However, somethings of interest that are related to your idea: ", "1) ", "Treatment", " via a ", "bacteriophage", ": Basically, a virus infects the bacteria infecting you. ", "2) ", "Hypertumors", ": If you have cancer, a second cancer comes and drains resources from the first, suppressing both via competition." ]
[ "Silly idea, but can you theoretically infect someone with a non-resistant strain of the same bacteria, so it will compete with resources with the resistant organism? I know it's largely useless, because as soon as you start the antibiotics you're back where you started, but now I'm wondering if \"similar infections competing for resources\" are a thing or whether that's just going to make people sicker quicker." ]
[ "[Biology] How much control does our mind (active thoughts) have over our body?" ]
[ false ]
null
[ "Hard to answer this one, its a mix between everything and various organs. I can tell you that GI track is defiantly altered by the brain as is the hormone system. How far into this 'control,' can be described before I start talking about potential of healing? Where does the \"placebo\" capacities end and begin? I am only using the word placebo to show that many things are altered by the brain but its not easily expressed in a study." ]
[ "In regards to the mind working on the body, active thinking(consciousness), I consider that a top-down method, which seems more difficult to make the body react. If we were talking about a subconsciousness, this can effect everything seemingly. But it seems the top-down method does work.\nIf I concentrate on basic emotions, anxiety or pleasure, we can see how these basic emotions control the GI track. Anxiety will cause cramping, or a reduction of blood to the stomach, the expulsion of wastes, or sweating. Pleasure can cause plenty of physical reactions, an erection, increased fluids, sweating.\nOf those two emotions, its difficult to bring them about simply by active thinking, of course, the interesting fact is that this proves a pathway, or 'mental roadmap' to using the top-down method to cause a change in the body. If you look at various meditation practices, its obvious that the mind can make the body do almost anything within its normal operations, including homeostasis or immune reactions. Certain drugs or hormones (adrenaline, LSD) can cause massive and temporary strength increases. \nA famous Dutch Buddhist ", "Wim Hof", " can alter his immune system as well as raise his temperature at will. These are very rare human abilities, this man, and certain monks have been training for a Very Long Time. ", "http://youtu.be/BqsvJedwUyg?t=7m37s", " \nSo to answer your initial question, finding a hard limit in the average population will seem much different than people who have trained their mind. Is it possible to raise my body temperature by mental ability alone? Thru training, yes it seems that way. Can I alter the rate of fingernail growth if I concentrate, or can I alter my immune system and cause my body attack a cancerous tumor in my chest? These are unknown to me. Current science says no. Maybe someone already has" ]
[ "That's actually pretty cool. Thanks!" ]
[ "Lily zombie growing in basement w/no sun, very minimal, very intermittent incandescent light and no H2O... Is this normal?" ]
[ false ]
[deleted]
[ "Bring the poor thing into the light!", "Lilies, and many plants can have a dormant phase. It's possible that the dark cool basement triggered a 'winter', and the plant is trying to grow again. It is using the energy in the bulb to keep growing without light, but it won't last forever. It is white because it is not wasting energy to produce chloroplasts (which are green and do the photosynthesis) until there is light to use.", "Many plants will try to grow without light, if you leave a box on your lawn, you'll see strange long, white grass growing underneath, desperately trying to reach the light." ]
[ "You might be surprised just how much lilies will grow without any light. Easter Lilys usually have enough stored energy to make it all the way to flowering with zero light. Here's a ", "picture", " of an easter lily grown in complete darkness next to a normal one. " ]
[ "I'd say other way 'round. The long one attempts to grow to reach light, assuming that it's in the shade. The short one is perfectly content with the light it gets, and so produces more chloroplasts (hence its darker colour)." ]
[ "How strong are pulsar electric fields?" ]
[ false ]
I had come across papers describing the model for which electric fields are produced from pulsars and the coherent radiation arising from such pulsars. Based on a simple analysis of I = (1/2)cε<E^2> and observed luminosities of pulsars being L ~ 10 J/s, then if I ~ L/A (where I assumed A ~ 10 m simply based on a pulsar radius of 10 km), we have E_avg ~ 10 V/m. I can't help but think my calculations here are extremely crude. But are expected pulsars really emitting electric fields of such strength? Higher (e.g. closer to the Schwinger limit) or much lower? (Please let me know of any heinous approximations I made in my calculation, such as the area of the surface in which this electric field is being produced and emitted.)
[ "The rough electric field strength can be given by RΩB/c (see ", "here", " or ", "here", " when r=R or the Handbook of Pulsar Astronomy equation 3.18). In our typically obnoxious ", "Gaussian cgs units", " (since there's probably some other factors that are missing), the first link describes the electric field for a typical pulsar (periods of order a second) as 3x10", " ", "statvolt/cm", " (I think I got the units right, it's a bit late so apologies if not...) which should be 9x10", " V/m. The Schwinger limit is at the 10", " V/m level though.", "FYI, magnetars, and I believe even some pulsars, can come close to or even exceed the QED limit on the magnetic field side of things." ]
[ "Thank you for the response. So if were to convert this electric field to an intensity, we would get I ~ 10", " W/m", " But then if we're further considering a uniform field and a a neutron star's surface as the area (with radius 10", " m which is likely quite a bit lower than the true area of the radiating region), the total luminosity will be L ~ 10", " W which is ", "a few orders of magnitude larger than the upper estimate of L ~ 10", " W given here." ]
[ "For one, the emission is beamed so you're not supposed to take the whole surface area of the star (though you may need to move farther away and consider the magnetosphere where the emission occurs, thus changing r as well). However, the more important point is that this is the ", "local intensity", ", i.e., deriving from the local energy density, which is separate from the power output that's actually sent off into space, or what we consider the radio emission. Put another way, there's internal energy and the actual luminous energy. That luminosity is well understood as a conversion from rotational energy (per time) into light in the form of magnetic dipole radiation (see ", "6A2 of Essential Radio Astronomy", " and thereafter). The third fact for the number they give is the radio luminosity only, not the total luminosity. You'll see in ERA that they talk about the total rotational luminosity but then also the radio pulse luminosity and those are many orders of magnitude different." ]
[ "Human vision only focuses on a small area in the field clearly and the rest is blurry. Are there any animals that can focus on everything at once?" ]
[ false ]
null
[ "The ", "cuttlefish eye", " is considered one of the most developed in the animal kingdom*, and it has multiple ", "fovea", " as compared to our single one.", "In general, though, the answer is no, for the reason that neural processing power is metabolically expensive, and having only as much acuity as you need has been strongly selected for across the animal kingdom. ", "(* it's not the top one, though. That belongs to the ", "mantis shrimp", ". Its visual system's capabilities are incredible.)" ]
[ "Well, no eye is considered \"the most developed\", and cuttlefish ", "can't see color (or at least can't match it)", ".", "I'll also add that neural processing is not the only limitation. In vertebrate eyes, the neural encoding happens in front of the photoreceptors. They then have to leave the eye through a hole in the retina (our blindspot) and travel along the optic nerve to brain. This limitation on the size of that bundle of neurons places a big constraint on information flow.", "Some birds have two fovea. One to focus on where they're flying, and another to focus on ground prey.", "Some fish like the ", "Lethrinus", " swim along the ocean floor and have a horizontal streak of high acuity instead of a spot. Rabbits have a similar horizontal streak.", "The ", "scallop's eye", " has two retinas and a mirror instead of a lens. One retina is smaller and in focus.", "The box jellyfish has 4 sets of ", "6-eye clusters", " (24 total!). One eye in the cluster has a lens is that considered one of the most optically perfect eyes to exist! It can focus light better than it can see (we don't understand why yet).", "TL;DR: There's a LOT of variety in eye evolution.", " ", "Ivan Schwab", " has great book on the topic of eye evolution." ]
[ "What evolutionary advantage is there to having our optical nerves configured in such a fashion?", "That is a very good question, and the answer is \"None whatsoever.\"", "Living systems are full of workarounds like this. The torturous route of the ", "recurrent laryngeal nerve", " in tetrapods is one of my favorite examples. :) (not my blog, but a great link.)" ]
[ "[Computer Science] How does formal verification not \"solve\" the halting problem? Or does it?" ]
[ false ]
I don't understand how it's possible have a given input program, hold it to a set of rules (rules in this case being the software language/grammar), and guarantee that it will compile and run "as intended" based upon the input program spec? Wouldn't that be saying, in essence, "any valid program in <given language> is computable and doesn't go into an eternal loop"? And if you were making that guarantee, didn't you solve the halting problem? Or is the halting problem only "solved" for the subset of programs that can be written in <given language>? Or am I totally off-base in some other fashion?
[ "You are right, that question is equivalent to the halting problem.", "But the issue with the halting problem is not that you can't decide if a ", " program will halt; the issue is that there is no way to decide is an ", " program will halt.", "For some specific programs, there are specific techniques that you can use to prove that they work as intended. (This is where formal verification comes into play.)", "However, one consequence of the halting problem is that no matter of what formal verification techniques you come up with, the full set of programs that you can verify with all your fancy techniques will never be as powerful as the full set of programs a Turing machine can execute. (Because otherwise your techniques would solve the halting problem.)" ]
[ "The halting problem says that you can't make an algorithm that for certain can divide (turing complete) programs into terminating and not-terminating without error. What you can do is divide programs into terminating and maybe-not-terminating. In fact there is a trivial solution that simply puts every program in the later category. In practice you can make the divide arbitrarily close to, but there will always be some programs put into the maybe-not-terminating that is actually terminating. ", "There are also languages that simply isn't turing complete. " ]
[ "So basically you might get some acceptable level of false positives in the \"maybe-not-terminating\" category as a tradeoff to not bumping into any infinite loops? Cool!" ]
[ "What did early man do to deal with his fingernails?" ]
[ false ]
This might be a tough one to answer, but I was clipping my fingernails recently and got to thinking: if we need to trim our nails, what the heck did pre-tool hominids do deal with their nail growth? : Thanks for the gold!
[ "Reminder: this is AskScience, so please do not post speculative answers or anecdotes. Any answers should be based on peer-reviewed science." ]
[ "This is not just a human problem. Other primates have fingernails instead of claws. ", "Our fingernails are very similar to Chimpanzees", ". Chimpanzees treat fingernails in different ways. Some allow them to grow until they break off. Others bite them and some even use rough stones as natural fingernail files. Great apes in captivity often need some form of supplemental nail care. ", "Non-human primates often use their forelimbs for locomotion so they may get more wear than humans or any hominid that walked upright. " ]
[ "Related - but what about toenails? After suffering through three ingrown toenails (most painful thing I've ever experienced) I wondered \"how did early man deal with this crap? ", "Ingrown toenails seems like something that should have been Darwined out of us by now as anyone with an ingrown toenail is both easy fodder for carnivores (can't run) + not terribly attractive procreate material (the site of this festering mess is enough to kill any mood)." ]
[ "How does a ship turning create a region of flat water?" ]
[ false ]
In WW2, floatplanes launched from ships were recovered by taxiing the plane in flat water created by the ship entering a turn. My question is, how does this region of flat water get created if a ship's wake is supposed to be turbulent? example:
[ "Turbulence and smoothness of water are not mutually exclusive. Turbulence is ", " the same thing as chaotic surface waves. Turbulence actually ", " the amount of surface waves that can transmit through a region of water. Unfortunately, I don't have any more information than that, but hopefully it covers your question." ]
[ "When a ship travels forwards, the keel slices through the water, and the water flows past easily.", "In a turn, the keel pushes against the water amd causes it to create rolling turbulence. As the above comment explains, the turbulence of the turn prevents eaves from travelling over the area. The plane will then not be buffetted by surface waves." ]
[ "Sorry for late reply, but thanks." ]
[ "How was Avogadro's number derived?" ]
[ false ]
We know that there is 6.02x10 atoms in 12 grams of carbon-12, but how was this number came up from?
[ "Someone gave a good response that quoted from Wikipedia, but I'd like to share how Avogadro's constant (N_0) came about.", "​", "Avogadro coined this idea in 1811, when he first proposed that the volume of a gas is somehow proportional to the number of atoms/molecules in the gas.", "Jean Perrin defined it as the number of atoms in 32 grams of oxygen in 1909, because the contemporaries of the era wanted to make the ", " be numerically equal to the mass of X, relative to the mass of a hydrogen atom. Jean Perrin used several methods to calculate this number, but he wasn't the first person to explore this idea.", "​", "If we look further back, we find that Loschmidt was the first scientist to measure this number in 1865, albeit indirectly. Loschmidt's constant (henceforth referred to as ", ") is the number of particles in a mole of an ideal gas. This is related to Avogadro's constant by the ideal gas law, by ", " = p*N_0/(RT).", "Loschmidt deduced his constant from Maxwell's definition of the mean free path (i.e. the average distance between two molecules), which he manipulated into producing an elegant relationship: d = 8*l*V_liquid/V_gas, where d is the effective diameter of a molecule, l is the mean free path, and V_liquid/V_gas is the ratio between the volume of a mole of gas after it has been condensed, and before it has been condensed. Loschmidt initially came up with a crude estimate, but this was quickly refined by Maxwell in 1873, and as we know, Jean Perrin calculated the number we now know as Avogadro's constant in 1909.", "​", "Robert Millikan later refined this through Faraday's work on electrolysis, where Faraday defines Faraday's constant as the total charge in a mole of electrons. Faraday's constant is used in Faraday's law, which states that the mass (m) of material electroplated is equal to the total electric charge (Q) multiplied by the molar mass of the material (M), divided by the product of the ionic charge of the ion (z) responsible and Faraday's constant. In other words, m = QM/Fz.", "Faraday electroplated silver using a constant current, so this quickly rearranges to m/M = It/Fz. Since the molar mass and the ionic charge of silver is known, and the current and time taken is controlled by Faraday, we can quickly determine Faraday's constant.", "Millikan measured the charge of a single electron in 1910 through his Nobel Prize-winning oil drop experiment, where he suspended a precisely weighed drop of oil between two charged plates by balancing the force of gravity and electrostatic repulsion on the droplet of oil. By doing so, he was also able to determine Avogadro's constant to an astounding accuracy.", "​", "As far as I know, there were few improvements to this method until the International Bureau of Weights and Measures decided to redefine it as the number of atoms in a mole of carbon-12 in 1971. By defining Avogadro's constant as such, we effectively declare that the mass of a mole of carbon-12 is precisely equivalent to the number of atoms in carbon-12, but this does not necessarily hold true for other elements.", "In 2017, the IBPM tweaked the definition of a mole to be \"the amount of substance containing exactly 6.02214076×10^23 elementary entities\". This subtle change meant that the mass of a mole of carbon-12 atoms is no longer exactly 12 grams, but this also put an end to the constant quest of a precise measurement of the number of molecules in a mole of " ]
[ "Because mass was always defined against a platinum-iridium ingot kept in France and that changed mass a couple times over the centuries so they had to stop doing that." ]
[ "Because mass was always defined against a platinum-iridium ingot kept in France and that changed mass a couple times over the centuries so they had to stop doing that." ]
[ "Why doesn't every chess game that Google's AI alpha zero plays against itself end up in a stalemate?" ]
[ false ]
From what I've heard Google's AI alpha zero has a training period, where it plays against itself to become better.At those games specifically how come that even though its opponent has the same knowledge and same resources the game doesn't always end up in a stalemate? Thanks in advance!
[ "Chess isn't an easy game to force a stalemate with. While it can be done easily ", " when you are trying to do so, most competitive stalemates occur when one player is fighting hard against a loss and forces it.", "Because Alpha Zero is playing millions of games, memorizing the outcomes, and moving on, it doesn't get stuck in a situation where it \"only finds tied games\" like Joshua in WarGames.", "Tic-Tac-Toe is a game where two grandmasters will tie every time. Because once you understand the game, there is only one move you each can make.", "Chess is a much larger board, with many more pieces, that work in many more ways, with many more win conditions. Unless Alpha Zero finds a \"Hand of God\" (a play algorithm that can not be beaten, regardless of the other player's actions), it will never reach a point where playing against itself is always a tie." ]
[ "Because the game isn't symmetrical.", "We can prove that one of the players can either always win or at worst force a draw against the other.", "We don't know which one but it's wildy believed to be white and experiments support it." ]
[ "You can think of a learning algorithm as having a massive set of dials that control its behaviour, which is governed by its architecture. When it's learning, it randomly tunes the dials and sees whether this moves its behaviour in the desired direction or not. When it's playing itself the dials are set to different values and so it's behaviour is different. When one behaviour wins those dual settings are changed slightly in random ways and used in future games and the victors among those are taken and changed slightly again, etc. making smaller, finer adjustments each time until the desired behaviour is achieved." ]
[ "What are the base pairing rules for DNA, what is it that makes bases pair? And how does this carry over to DNA to mRNA and tRNA?" ]
[ false ]
null
[ "Adenine (A) can pair up with uracil (U) or thymine (T). Guanine (G) pairs up with cytosione (C).", "You find U in RNA, T in DNA, they carry the same information, and the pairs work the same way.", "It's hydrogen bonding, like what you get in water. ", "Because of the way the molecules are shaped, G has three specific places where there is a partial charge; 2 positive and 1 negative. C also has three partial charges, 2 negative and one positive. This, coupled with the shape of the bases, allows then to fit together neatly. A & T fit together similarly, but with only 2 charge locations, one of each.", "The DNA is \"read\" and \"transcribed\" into RNA. Basically, and enzyme reads along an unwound strand of DNA and makes an RNA copy:", "ATGATCCATTGATATTAGCCATTA", "is transcribed into ", "UACUAGGUAACUAUAAUCGGUAAU", "by stringing together the bases that pair up with the DNA template.", "For more, read ", "this", "." ]
[ "For DNA, it's always adenine (A) with thymine (T) and guanine (G) with cytosine (C). When DNA is transcribed to RNA, the only difference is that thymine is replaced with uracil (U) so it's A-U, G-C.", "Adenine and guanine are classified as purines because of their double ringed structure while cytosine, thymine, and uracil are single ringed structures called pyrimidines. Purines are only complementary to pyrimidines because the structure of the molecule simply does not allow hydrogen bonds to form between two similar molecules (ex an purine and a purine) because of what's known as overlap repulsion (ie the molecules are too close together). " ]
[ "You're forgetting about wobble pairs and modified/irregular bases.\nG-U is a very common pairing for tRNA and mRNA.\nInosine (I) is a common base in tRNA." ]
[ "What exactly happens in fission and fusion reactions? and how are fission chain reactions sustained?" ]
[ false ]
[deleted]
[ "Neutron irradiation is one convenient way to induce fission reactions on heavy targets. This is what is used in fission reactors and bombs.", "In a thermal neutron induced fission reaction, the heavy target nucleus (something like uranium-235 or plutonium-239) captures a thermal (meaning relatively slowly-moving) neutron and forms a compound nucleus, in this case uranium-236 or plutonium-240.", "The compound nucleus can be in a highly excited state, which immediately splits apart into two heavy fragments.", "In this case it's the uranium-236 compound nucleus splitting apart like a water droplet that got too large for surface tension to hold it together (with additional complications due to electric charge, and nuclear shell structure).", "The actual microscopic dynamics of fission and fusion reactions is very complicated. But people can theoretically model them using techniques like ", "density functional theory", " and ", "time-dependent Hartree-Fock", "." ]
[ "Fission involves a nucleus splitting into two or more \"heavy\" fragments (heavy typically meaning nuclides with mass numbers higher than an alpha particle).", "Fusion reactions are compound nuclear reactions where two reactants come together and form a heavier system, possibly losing a few particles in the process.", "There are various kinds of both fission and fusion reactions, and this is about all that can be said in general about them." ]
[ "Thanks for the reply, but regarding fission, how is an atom split? I've read something that says it's to do with being hit with neutrons, is this true? Is there a more scientific explanation?(most probably) " ]
[ "Would it be possible to charge a phone battery faster if lifespan of the battery wasn't accounted for?" ]
[ false ]
null
[ "Reply to the above ", "/u/AskScienceModerator", " comment with any of the following (without quotes):", "'Computing', 'Economics', 'Human Body', 'Engineering', 'Planetary Sci.', 'Archaeology', 'Neuroscience', 'Biology', 'Chemistry', 'Medicine', 'Linguistics', 'Mathematics', 'Astronomy', 'Psychology', 'Paleontology', 'Political Science', 'Social Science', 'Earth Sciences', 'Anthropology', 'Physics'" ]
[ "Hi saturatedmorning thank you for submitting to ", "/r/Askscience", ".", " Please add flair to your post. ", "Your post will be removed permanently if flair is not added within one hour. You can flair this post by replying to this message with your flair choice. It must be an exact match to one of the following flair categories and contain no other text:", "'Computing', 'Economics', 'Human Body', 'Engineering', 'Planetary Sci.', 'Archaeology', 'Neuroscience', 'Biology', 'Chemistry', 'Medicine', 'Linguistics', 'Mathematics', 'Astronomy', 'Psychology', 'Paleontology', 'Political Science', 'Social Science', 'Earth Sciences', 'Anthropology', 'Physics'", "Your post is not yet visible on the forum and is awaiting review from the moderator team. Your question may be denied for the following reasons, ", "/r/AskScienceDiscussion", "There are more restrictions on what kind of questions are suitable for ", "/r/AskScience", ", the above are just some of the most common. While you wait, check out the forum \n", " on asking questions as well as our ", ". Please wait several hours before messaging us if there is an issue, moderator mail concerning recent submissions will be ignored.", " ", " " ]
[ "How do I add flair? I'm on mobile." ]
[ "Why doesn't the use of constants with dimensions invalidate dimensional analysis?" ]
[ false ]
For example, in Newton's law of gravitation, we have F = (GmM)/r which gives the dimensions of Newton's gravitational constant as L /(MT ). If we choose constants to have certain dimensions so that our equations balance, then what use is dimensional analysis in validating these relationships? Or does the fact that we have to introduce such constants simply indicate a lack of deeper understanding of the situation? Are the equations governing more advanced theories like General Relativity dimensionally consistent while only using dimensionless constants?
[ "From a fundamental perspective you're right, and in practice some branches of physics like high-energy physics use systems of ", "natural units", ", in which distance, time, and mass are all converted into one common unit using factors of the speed of light c, plank's constant h, and the gravitational constant G, and the Botlzman constant K", ".", "So for example distance can be expressed as a time, using the conversion d = ct. Mass can be expressed as an inverse time (frequency) via E = mc", " and E = hf, giving m = hf/c", ". Similarly temperature can be a frequency because E = K", "T.", "However, in a more practical day-to-day situation, dimensional analysis with the usual units can still be useful with a bit of common sense. If you're talking about the compression of a spring, you can be confident that the gravitational constant is not going to be invoked.", "But note that even then and even in natural units, dimensional consistency won't guarantee an equation is correct. There may be multiple ways to combine the relevant variables to get the same units, or there could be unitless constants like 2 or π involved." ]
[ "Basically I'm saying \"its usefulness is limited\" and providing you some related information.", "I know G isn't going to show up in a spring calculation because springs are a non-gravitational phenomenon. As one does a lot of calculations, they learn when various constants might appear. It's a handy tool for shortcuts, and not really something to use in rigorous situations." ]
[ "If we make an equation like F=x, that doesn't tell you much of anything by itself. But then, through experimentation with gravity, we determine that F decreases by the square of the distance. Ok, now we say that F=x/r", " What is x though? Well, we could stop there, but then we would realize that it doesn't let us calculate much in the real world. So, we dig deeper, and we notice through more experimenting, that F is also a function of two masses. So, now we say that F=x*mM/r", ". 'x' could be anything, but then we determine that the ratio of F to mM/r", " is always identical, no matter the values of m, M and r. So, x=G. It's a constant because the universe as we know it dictates it so (on this scale). ", "Dimensional analysis is really just a sort of engineering tool to make sure you didn't make any mistake in your calculations. Whether or not a constant has a dimension is nothing special. What makes it a constant is that it doesn't operate as a variable. That's all there is to it. The fact that we assign it dimensions is merely because we need it to balance dimensionally. It does not have any bearing on our level of understanding, but merely is a demonstration of our limited ability to depict the system on paper. " ]
[ "How did people keep their teeth from falling out before modern oral hygiene practices?" ]
[ false ]
Nowadays, it's pretty common for people to see a dentist twice a year for a cleaning/checkup. Before modern dental practices (let alone toothpaste), how did people manage to keep their teeth from rotting out during the span of their life? Thanks for the help!
[ "Additionally, their diets had significantly less sugar and acids than modern processed foods do." ]
[ "Additionally, their diets had significantly less sugar and acids than modern processed foods do." ]
[ "Basically they didn't need to before we started adding sugar to stuff. People's teeth were mostly fine dealing with normal foods.", "The period between the inventions of sugar and modern dentistry were pretty nasty though." ]
[ "What is the social behavior of tardigrades? Do and if so, how do tardigrades interact with one another?" ]
[ false ]
Googling doesn't answer that question and the literature on Google Scholar and pubmed is too high of a threshold to dig through for me as a layperson.
[ "There are multiple species of tardigrade. Some are hermaphrodite, many are predominantly female. It appears that they are mostly solitary, with no real evidence of social behavior aside from mating. Many reproduce parthenogenically.", "\"Normally the individuals do live separately. They crawl on the vegetable underground with no apparent relation to each other.\nNone of their movements can be interpretated as social recognizing or some kind of social interaction.\nBut from time to time this indifferent behaviour changes, in particular but not only when the females undergo a moulting process and when eggs are existing in the ovary.\nUnder those circumstances it was not rare to find a male close to a female. When the male was separated from the female for about the distance of a body length by means of a needle the male tried to come closer to the female again. The male crawled around the female in a circular pathway whereas the female didn't move much. Finally the male climbed on the back of the female and touched its head with its mouth. The partners remained in this position for some time. So we can suspect that the buccal gland might have functions that are not known yet...it must be assumed that mating was performed in this position.\"", "Hermann Baumann: Der Lebenslauf von Hypsibius (H.) convergens Urbanowicz (Tardigrada). Zoologischer Anzeiger 167 (1961) p. 362 - 381.", "Found on ", "this site" ]
[ "In such cases do we know how the female indicates she's fertile? Is there a chemical or behavioral signal?" ]
[ "These types of questions frustrate me in the best way. As soon as science realized tardigrades’ extremophile properties all of the basic research and ecological studies that come with studying a species were overlooked. It’s not as flashy to study tardigrades as a pioneer species as it is to be the guy who crack the code on their DNA. ", "For most other animals we would have detailed info to answer your question, especially for a creature found all over the planet, less so but still for the microscopic organisms as well.", "From every study I’m aware of they don’t communicate or work together past mating (which can last hours). That’s also pretty useful for a pioneer species like tardigrades because they are independent. ", "I’m not an expert but have been involved in basic research and ecological studies on tardigrades recently." ]
[ "If the gene that codes for six digits is dominant, why do so few people have six digits?" ]
[ false ]
null
[ "You're confusing dominance with frequency. Dominance refers to the phenotype of heterozygotes. If a gene, like the one for achondroplasial dwarfism is simple mendelian dominant it means that heterozygotes (those people with one copy of the A.D. allele and one copy of the wildtype/normal allele) have the same phenotype (in this case short stature etc) as those with two copies of the A.D. allele. Allele frequency is how common an allele is in the population. Dominant traits will be expressed somewhat more often than recessive traits ", " but whether an allele is dominant or not says nothing about what that frequency is. In a two allele system, the frequency of the phenotype of a dominant trait is the number of homozygotes for the dominant allele + the number of heterozygotes. For the recessive phenotype, the frequency is the number of homozygotes for the recessive allele. If an allele is dominant but rare ... well then, it's rare." ]
[ "Because very few people have that gene.\nA person with 6 fingers will likely have 1 copy of the 6 finger gene, and one copy of the 5 finger gene. That means they have a 50% chance of passing that on to a child. \nIf they do pass it on, the child will have 6 fingers.", "If both parents have 6 fingers, both parents have a 50% chance of passing on the gene! which still gives a 25% chance that a child has 5 fingers.", "But, most people have 0 copies of the gene, and do not pass it on." ]
[ "Many rare genetic disorders are in fact dominant. There is a table here ", "http://www.nature.com/scitable/topicpage/rare-genetic-disorders-learning-about-genetic-disease-979", " listing just a sampling of the many examples (anything that is listed as \"autosomal dominant\" fits in to the category you are interested in). Also see ", "http://en.wikipedia.org/wiki/Category:Autosomal_dominant_disorders", " for many more if you want to get really freaked out." ]
[ "Does DNA change over time?" ]
[ false ]
Does the human DNA genome change as a person ages? By this I mean could you test the DNA of a child and get an exact full profile match to the same person when they have reached old age?
[ "Every cell division can result in random mutations. Also DNA of single cells can mutate due to radiation and other events. So you would not get a 100% match in a DNA test, wenn you sequence a single cell. Certain cell types also change their DNA permanently (B and T lymphocytes to be able to produce the same antibodies permanently). However, when you sequence a sample of a lot of cells these mutations won't be visible in the results because it would be just noise. So overall, the result should be close to 100% but there will always be sequencing errors as well.. And there are telomers sequences, which get shorter every cell division. So these will be different as well. \nOn the other hand when you look at tumor/cancer the DNA can be very different. But this is a topic for itself.\nI hope this helped!" ]
[ "To coattail on this, there is also the issue of telomere shortening and the potential of DNA methylation that can also change DNA from it's \"original\" state." ]
[ "You should also look up epigenetics if you're interested.", "Short explanation is that it's the study of external factors (lifestyle, disease environment or just normal development) that alter gene expression without directly altering DNA and how those changes can be heritable.", "It sorta explains how some individuals become more susceptible to certain types of cancer over time because of these changes.", "https://www.eurekalert.org/news-releases/929026" ]
[ "Do larger people have larger organs?" ]
[ false ]
null
[ "Yes. It all starts with your skeleton. A larger frame needs larger muscles to move it. Larger muscles will need more nourishment. This leads to a larger digestive tract and a circulatory system with more volume. A larger circulatory system has more RBC's which need a larger spleen to filter them, has more fluid which needs larger kidneys to filter it, and carries more oxygen which needs larger lungs to supply it. Of course, all your RBC's are made in your bone marrow, which needs to be larger to make them, which completes the circle.", "That's the logic behind it, but the real reason is simply that your growth hormones act in equal proportions on all of the parts of your body. " ]
[ "Depends on the body composition. Height and weight are not the only estimator of organ sizes. Age and sex are also strong predictors of organ size. For instance the equations for total lung capacity gives around 20% extra volume to males compared to females.", "This is important in thoracic organ transplantation where organ sizes mismatch can result in poorer outcomes. For instance height but not weight is a good indicator of lung sizes whilst heart size is better predicted by both body weight and height in addition to age and gender (body weight affects the total volume of circulation, hence the heart pumps harder).", "Likewise, abdominal organs are more related to height and lean body weight than actual body weight since muscle and fat mass affect body weight much more than the size of organs. If you ever seen a CT scan of a morbidly obese person, you often find that the internal organs are no different to most people of the same height." ]
[ "Yes and no. Sometimes people who have gigantism or dwarfism can actually have \"average\" sized organs which can cause health issues because they aren't directly proportionate to how the body needs to use them. But as for someone who doesn't have either of those genetic traits, it seems to vary for your size. " ]
[ "Why aren’t induction cooktops compatible with non-ferromagnetic pots?" ]
[ false ]
I always assumed they would work with any conductive pots, since they use electromagnetic induction to generate eddy currents. Today, when I was explaining to somebody about induction cooktops, I found that I was wrong. It turns out they are only compatible with pots made of iron/stainless, not aluminum or copper. I’m really curious to know why. Does iron’s high magnetic permeability play a role here?
[ "It seems like your question hasn't been answered properly (+wrong infomation). So I will give it a try..", "​", "Eddy currents are only one contributing factor to inductive heating that would actually favor copper over iron. However in iron as a magnetic material you will generate heat through so called hysteresis losses which is basically caused by reversing the magnetization of the iron with the frequency of the external field." ]
[ "Hi, thanks answering my question. Hysteresis loss is a factor I wasn't considering even vaguely, so I was really excited when I read your answer.", "But Wikipedia article \"Induction cooking\" states that heat produced by hysteresis loss accounts for less than ten percent of total heat generated. So I can't say I'm convinced yet." ]
[ "So I can't say I'm convinced yet. ", "There is one thing that I have left out so far and that is the so called skin effect. In an AC magnetic field the induced current will flow at the surface of the material. The skin depth depends on the material and impacts the heating ability.", "The whole thing is pretty complicated as other parameters like the frequency matter as well." ]
[ "What is the feasibility of creating a Jarvis-like AI for your home, office, etc.?" ]
[ false ]
Just channel surfing and came across Iron Man (which I always have to watch). Just wondering what is the possibility/feasibility of creating a Jarvis like system/assistant for a person's house, office, or whatever? Is this something that is at least somewhat in the realm of possibility?
[ "The problems with AI right are as much about design as they are processing power. We haven't figured out how human-style intelligence works yet, so even having ultra powerful computers wouldn't help us. It's all super complicated (which is not to say impossible) but there are multiple limiting factors." ]
[ "Not possible with today's tech. AI so far is a pipe dream and we are a looong way from making one. ", "Who knows what the future will bring though? Chances are whatever it is it will be some different tech than our current crop of computers. Quantum computers perhaps.", "They are within the realm of possibility...afterall we are here and one could think of our brains as a fancy processing unit. Just because they are biological doesn't change the fact that a brain is essentially a machine (lots of little pieces working together in some fashion to do something impressive)." ]
[ "It depends on how smart you want it.\nVoice recognition can be done, and lots of people automate their homes in clever ways.\nBut AI technology is in infancy, so you can't make something that is very smart." ]
[ "How is it possible for so many dialects of English to form in the United Kingdom?" ]
[ false ]
Here in the good 'ol US of A moving out of state is not so uncommon, even moving from one side of the country to the other, allowing for a healthy mix of accents to occur. So I am curious as to how this strange phenomenon to happen.
[ "There's a lot of stuff going on here. Much like the center of human genetic diversity is located in Africa, where the species originated, the center of English linguistic diversity is located in the UK, where English originated. The UK has been home to English speakers for a good 1000 years, and the modern phenomenon of mobility is incredibly new. When two communities go for a long time with a minimum of contact and regular exchange, their members aren't under much pressure to keep their speech varieties very similar. This can lead to what linguists call ", "a dialect continuum", ", where two nearby communities in a region can easily understand each other, but the further you go from a particular starting point the more distinct the local speech becomes.", "Linguistic diversity is somewhat less pronounced in North America for a couple of reasons. There are founder effects: basically, small and fairly linguistically homogeneous communities moved here, and there hasn't really been the time for the same kind of diversity to grow.", "In Western North America, Anglo immigrants were somewhat more diverse, and immigration has continued more or less apace for some time. This has meant that there's been some fairly regular leveling of local innovations with immigrant speech (though it's definitely not the case that West Coast English is identical to the Midwestern 'standard')." ]
[ "A good thing to note:", "Linguistic diversity is ", " less pronounced in North America ... ", "Although there's certainly a lot more dialectal variation in the UK, Ireland, and Scotland, that still leaves a lot of variation. See ", "this map", ", for instance, where groups of a large number of lines running together more or less indicate dialect boundaries. (", "source", ")", "If anyone knows of an equivalently detailed map for England, I'd love to see it." ]
[ "Pretty sure there's more... Sunderland is different from Geordie and Lancashire from Mancunian, just at a glance. Eg in lancs they say pewer and dewer instead of poor and door. Mancs definitely don't. My Grandad used to say \"thou makes a bitter dewer than a windewer\" if i blocked the tv. I did not understand a word that man said." ]
[ "What are the ramifications of wearing anti-perspirant every day for say like, 40 years?" ]
[ false ]
null
[ "One of the comments below got me thinking about the topical absorption of aluminum chorohydrate and I found this abstract:", "http://www.ncbi.nlm.nih.gov/m/pubmed/11267710/", "One of the last lines: \n\"[the amount of aluminum absorbed from the antiperspirant] is about 2.5% of the aluminium typically absorbed by the gut from food over the same time period.\"" ]
[ "Most soda cans contain aluminum too, but that doesn't mean the aluminum in the can is doing anything bad to you. Is there any evidence that putting aluminum in your armpits causes it to build up in your body?", "EDIT - ", "I looked it up", ", and it appears that there is evidence that aluminium chlorohydrat does NOT cause a buildup in the body when used in anti-persperant." ]
[ "That's really shaky. You have to actually consume Aluminum for it to be toxic, and there needs to be a lot of it since only a very small percentage (like, 0.3%) will get absorbed.", "It's also important to remember that just because something is toxic in high doses doesn't mean it's going to hurt you at lower concentrations. Arsenic is a deadly poison but it occurs naturally in some fruits and vegetables. It won't hurt you because our bodies are great at dealing with stuff like that. We wouldn't live very long if we were that fragile." ]
[ "How can splitting and fusion of atoms both create energy?" ]
[ false ]
[deleted]
[ "For a particular atom, you only get energy by going in one direction. ", "Here", " is a plot showing the binding energy per nucleon for various nuclei. You can get energy out if you go from a nucleus with a certain binding energy per nucleon to one that has more binding energy per nucleon. For nuclei lighter than iron, that means fusion. For nuclei heavier than iron, that means fission. ", "EDIT: more/less... it's all a sign convention. " ]
[ "If I'm reading this right, does that mean that both fission and fusion result in a loss of energy with iron? I'm assuming that's also why stars stop fusing at iron." ]
[ "Nuclear fission and nuclear fusion don't ", " emit net energy. Nuclear fission only emits net energy if the nuclei are very large. Nuclear fusion only emits net energy if the nuclei are very light. Trying to fuse together two uranium atoms is not going to release net energy, and splitting a helium atom will not emit release net energy.", "In physics, we describe systems in terms of energy states in an energy landscape. If the system transitions to a lower energy state, it must emit energy in order to keep the law of energy conservation valid. You can think of the energy landscape as hilly terrain. A ball transitions to a lower energy state by rolling downhill. So, the energy landscape of atomic nuclei looks a bit like a valley. In terms of fission/fusion, light elements are up high on a hillside on one side of the valley, and heavy elements are up high on a hillside on the other side of the valley. Light elements go downhill in the energy landscape, and therefore emit energy, by fusing to heavier elements. Heavy elements go downhill by splitting into lighter elements. The bottom of the valley is iron. If the conditions are right that fission and fusion are likely and no net energy is being pumped in, all elements eventually end up as iron, since it is at the bottom of the valley.", "Here is an image of the energy valley", ". Note that it is typically shown upside-down because of the way binding energy is defined. The highest point of the curve (iron) is actually the lowest energy state that a nucleus can be in.", "All this leads to the question: why does the nuclear energy landscape have a \"U\" shape? The answer is that there are two competing forces in a stable nucleus: the attractive nuclear force and the repulsive electric force. The electric force is weaker than the nuclear force, but it is longer range. When a nucleus is small, the protons and neutrons are close together, and the nuclear force dominates. As the nucleus gets bigger, the protons get farther apart, and the repulsive electric force gets stronger. So, the low-point in the energy landscape (iron) is the point where the electric force and nuclear force balance. ", "Note that instead of going up and down the list of elements by adding or removing protons, you can also go sideways in the energy landscape by adding or removing neutrons. In the sideways direction, the energy landscape is also a \"U\" shape, so that unstable nuclear isotopes tend to decay and transition to the stable isotopes in the middle of the valley. Here are some images showing this concept:", "Image 1", "Image 2" ]
[ "What is the most recent common ancestor between Bananas and Humans?" ]
[ false ]
null
[ "The deeper sections of the Eukaryote family tree are still a bit of a mystery, but generally speaking we would be talking about a protist living well over a billion years ago." ]
[ "I would guess, that the one, whose direct offspring turned into animal and plant cells respectivelly. Because since these organisms are in different kingdoms, that of course can't interbreed, there couldn't be any more recent common ancestor. So their shared ancestor would have lived around 2 billion years ago (maybe a bit less) and would have been a single celled eukariote." ]
[ "To be clear, this would be the same organism as the most recent common ancestor of ", " animal and ", " plant.", "We know almost nothing about what this organism looked like or how it lived. According to calculations based on DNA comparisons and when in the fossil record the first recognizable plants and animals appear, it will have lived somewhere between one billion and two billion years ago. It will probably have been unicellular, because we know plants and animals evolved multicellularity separately (while early animal evolution is very poorly understood, the evolution of land plants from green algae can be decently inferred just from looking at the diversity of groups existing today). Based on what commonalities exist between plant and animal cells (as well as what's shared with other, related groups), we can say a few things. It probably swam using cilia or flagella; these structures exist in both plants and animals. It had mitochondria but no chloroplasts, so it didn't photosynthesize, but rather got its energy from consuming organic matter. In fact it's quite likely that it was a predator, hunting bacteria or other eukaryotic cells, given that the ancestor of plants would go on to consume a cyanobacterium that later evolved into the chloroplasts we know today.", "In other words, a ", " is that the most recent common ancestor of plants and animals (and hence between humans and bananas) was an organism that looked something like the single-celled, bacteria-feeding eukaryotes we find today, like for example a ", "ciliate", "." ]
[ "How do food companies calculate kJ/kCal calculations for each food item?" ]
[ false ]
[deleted]
[ "They burn it. And I mean burn it to ashes.", "A calorie used to be defined as the amount of energy needed to raise one CC (one gram) of water by one degree Celsius.", "To determine the amount of energy in say, a Snickers bar, they put a piece of it in a device called a bomb calorimeter, and ignite it. They know how much energy they are putting in, so they can discern how much energy is released.", "For kilocalories, it's how much energy would it take to raise the temperature of one kilogram of water." ]
[ "Actually, this was the process a long time ago. ", "Now they use industry-standard/USDA calorie and nutrient tables for the basic nutrients and calculate the totals from there.", " ", "Here is the USDA database." ]
[ "They do this by using an apparatus called a bomb calorimeter. What they do is they take this container and place in it a certain mass of the food. Then they submerge this container into a slightly larger container of water whose mass is known. They will then proceed to burn the food using electrical sparks or some other form of ignition until all that is left is carbon and gasses. ", "By measuring how much the temperature of the water changes, they can calculate how much energy was released by the food. This is done using the conservation of energy principle. The energy lost by the food through burning equals the energy gained by the water. This is described as such:", "heat=mass * specific heat * change in temperature ", "Therefore ", "Mass of water * specific heat of water * change in temperature of water = energy inside food sample. ", "This calculation will give a certain number of Joules, a unit of energy just like calories. From this number, you can convert it to kilocalories (denoted as Calories, 1 Calorie = 1000 calories, the capitalization is the distinction) using a conversion factor. ", "Once you know how much energy was in that specific mass of the food sample, you can then find out how many Calories are in one serving. " ]
[ "Botanists and geologists of Reddit, I need your help: I planted small bonsai in large holes I drilled in feather rock. The plants are all suddenly dying, any idea why?" ]
[ false ]
I bough some at a local hardware store to use as starter bonsai pots - it's a glassy, abrasive, very porous volcanic rock. I drilled large 2 inch diameter holes in the rock and use then for some small starter bonsai (I made sure to drill a drainage hole). I figured the rock would keep the roots from getting too hot in the sun and the porous nature of the rock would retain moisture for the plants so the roots didn't dry out. All the plants I placed in these pots have been doing really well, grew leaves, no signs of stress, etc. Then last week one of the plants looked sickly and is now dead. Last night I went outside and noticed that one of the plants which looked fine the day before is dying - the leaves were all wilted. I have lost 3 plants that were potted in this rock and wanted to see if anyone on reddit could shed light on the issue. I have a few theories but I don't know enough about botany and geology to come to a conclusion. I figure it might be due to: The plant roots are finally reaching the abrasive surface of the drilled rock and causing damage to the roots which leads to death or There are some chemicals in the rock that are being leeched into the soil which is killing the plants. In any case, the plants die suddenly and rapidly and do not give signs of illness or stress before hand. Plants I planted in feather rock are suddenly dying with no symptoms before hand
[ "I have no idea what 'feather rock' is. What you have there looks like it might be a volcanic tuff.", "There's nothing intrinsically bad about tuff - in fact it forms the basis of some of the greatest vineyards on the planet. However, it is extremely porous, and can be hydrophilic. Is the soil plug still moist? It's possible the water has been drawn out and the plants are simply drying out.", "That's dependant on a very vague rock ID based on your picture though. " ]
[ "I'm not 100% convinced that is natural, but iIf it is, then it's just a glassy pumice/scoria (the stuff you get in tuff). Again, shouldn't pose any issues short of dehydration." ]
[ "I haven't been able to find a technical name for feather rock unfortunately. It doesn't look the same as volcanic tuff, it looks more glassy and sharper. ", "Here", " is a website with close up photos of feather rock.", "The hydrophilicity may have been a problem, but I watered the plants just about every other day - they were all quite happy for about 3-4 months and then... suddenly death.", " this type of rock is quite common (at least in my area) as a landscape stone. You can buy big boulders of the stuff and Orchard Supply Hardware sells smaller (< 1ft", " ) sizes." ]
[ "Two questions about aquifers: 1. Could the use of the aquifers be making a meaningful contribution to sea level rise? 2. Do aquifers replenish themselves at anything like the rate we use them?" ]
[ false ]
null
[ "About three times as much water exists in glaciers compared to groundwater." ]
[ "I can't answer the first part of your question, I don't know the volumes of water stored globally, however, the majority of groundwater levels has dropped significantly over the past fifty or so years - and is doing so an an exponential rate. In some places in California, Texas and India groundwater levels have dropped hundreds of feet, while the Punjab region of India, levels have dropped 10 meters since 1979 (Source Upmanu Lall. \"Punjab: A tale of prosperity and decline\". Columbia Water Center. Retrieved 2009-09-11.).", "We are using a heck of a lot more than is being replenished through natural cycles. If we stopped, it would take many years to replenish to prebore levels.", "You can read a lot more detail of issues and the like on the ", "groundwater article", " on Wiki - especially under the \"Issues\" section." ]
[ "It really depends on the aquifer. Most heavily monitored aquifers are near large urban areas. In general the aquifers are not just monitored, but managed. As such they are generally lower than they were before civilization arrived, but fairly stable.", "I doubt their use affect sea level much at all." ]
[ "How do squids propel themselves without using the tentacles?" ]
[ false ]
So, I just saw some gif about a giant squid here on and you can clearly see some kind of ""jets"" [citation needed] from the main body.
[ "Jets is the right term. Squids have a moveable opening in their mantle cavity which they can use to direct a jet of water to quickly propel themselves. They usually use the flaps on the side of their bodies for smaller movement." ]
[ "It's basically a squirt gun. The opening is called a hyponome, and it's basically a muscular tube. When it's relaxed, then water flows in. Then it contracts very quickly, and the water squirts out and pushes the squid along. Squirt gun." ]
[ "Well thanks for answering. Do you happen to know how they work?" ]
[ "Would gases in carbon capture programs that inject gas into the ground change states eventually? Would the gas eventually settle into a liquid or solid?" ]
[ false ]
null
[ "This is completely wrong. ", "These sequestration wells are drilled into specific geological formations that can trap CO2 and prevent its migration. You cannot get a permit to start drilling without a thorough vetting process from multiple state and federal agencies.", "These wells are drilled to depths of thousands of feet. Here's a DOE study as an example where the test wells were drilled to over 5,000 ft. Groundwater is 100 to 1000 ft.", "https://www.osti.gov/servlets/purl/1509818", "CO2 is a liquid at reasonable temperatures around 950-1000 psig. Well pressure would be more like 4000 psig.", "Edit to add groundwater depth for comparison." ]
[ "This is completely wrong. ", "These sequestration wells are drilled into specific geological formations that can trap CO2 and prevent its migration. You cannot get a permit to start drilling without a thorough vetting process from multiple state and federal agencies.", "These wells are drilled to depths of thousands of feet. Here's a DOE study as an example where the test wells were drilled to over 5,000 ft. Groundwater is 100 to 1000 ft.", "https://www.osti.gov/servlets/purl/1509818", "CO2 is a liquid at reasonable temperatures around 950-1000 psig. Well pressure would be more like 4000 psig.", "Edit to add groundwater depth for comparison." ]
[ "TL;DR: Generally, it's already a liquid when they inject it.", "Geological carbon capture and sequestration currently means pressurizing CO2 until it's a liquid, then injecting it into a geological formation that is sufficiently impermeable to contain it.", "It is worth noting that the field is in a state of active development, and there are relatively few active and running projects, so the answer may change over time as the technologies involved are developed further." ]
[ "If I practice exerting the exact same amount of force, can I train myself to control the outcome of a coin flip?" ]
[ false ]
or if I can't do it myself, can I make a machine that exerts a precise amount of force on the coin to flip it in a predictable way?
[ "The biggest hurdle would be random variables such as atmospheric pressure etc. Most variables could be predicted and controlled for or minimized though, so if you're keeping the thing in the same room etc, I'm sure you could get an insanely high accuracy with a machine. ", "And as someone else mentioned, if you're trying to go for a large number of in-air flips, it would get harder because small variations start to add up. If you're only going for 4 or 5 flips, it probably wouldn't be very hard." ]
[ "The biggest hurdle would be random variables such as atmospheric pressure etc. Most variables could be predicted and controlled for or minimized though, so if you're keeping the thing in the same room etc, I'm sure you could get an insanely high accuracy with a machine. ", "And as someone else mentioned, if you're trying to go for a large number of in-air flips, it would get harder because small variations start to add up. If you're only going for 4 or 5 flips, it probably wouldn't be very hard." ]
[ "An easier method of rigging a coin toss is to loss it and flip it on the back of your hand (edit: actually you dont need to flip it on the back of your hand, you can flip it in the same hand with your thumb) ", "In between catching it and placing it on the back of your hand, run your thumbnail over the surface of the coin and feel the texture. One side usually the tail side has a more detailed texture and thus feels more 'lumpy' than the other. If you practice this enough and get used to the feeling you can win a coin toss 100% of the time. ", "You toss a coin, your friend calls Heads.\nToss - Catch - thumb:", "If thumbnail feels tails, flip the coin in your hand placing headside down showing tail", "else thumb feels head, place head on back of hand showing tail", "You win.", "A quick search on youtube gives me ", "this" ]
[ "What are some documented changes that have resulted from a single point mutation?" ]
[ false ]
I'm an ecology student, and I love evolution and the vibrant examples from it - however, the farther away from the organismal level I get, the harder I find it to conceptualize. The farthest of these are the chemistry-heavy aspects of mutation, which I am not well versed in. What are some examples of how powerful a point mutation can be, in terms of change and how that would effect fitness? How powerful can an amino acid change be in a protein? I have trouble visualizing what kind of change can be created to the point that it would dramatically effect fitness. Let me know if I can clairify at all! Thanks! Interdisciplinary for Biology/Chemistry.
[ "If you look at the ", "codon table", ", you can see that single nucleotide changes can switch the amino acid quite dramatically - either encoding a new amino acid that is very structurally different (eg CAU -> CAA ", "histidine", " -> ", "glutamate", "), or even prematurely terminate a peptide via a stop codon. So the array of potential changes is vast. As an aside, note that there is some redundancy - for example, all codons starting with GG_ result in glycine. This sort of thing helps reduce the impact of point mutations ", ".", "A classic example of a point mutation resulting in serious disease is ", "cystic fibrosis", " - the ", "ΔF508", " (deletion of the phenylalanine at position 508) is responsible for most cases of the disease. ", "List of other examples of point mutation disease here.", " ", "More visual/graphic representation here.", "Edit: doh, see comments below re: dF508 NOT being a point mutation. Major brainfart there, thanks to those that caught it. " ]
[ "Point mutations are potentially very powerful. There are countless examples of how a single mutation can cause disease, but I think you're asking about ", " point mutations, or more generally, how small mutations can act beneficially. ", "Small tweaks to proteins on the surface of cells that can deny entry to a virus (like influenza), which can grant some immunity", ".", "For bacteria (the most well-studied organisms due to molecular accessiblity and fast generation times), ", "point mutations are linked to antibiotic resistance.", " Though not great news for human medicine, these are beautiful examples of protein-level adaptation. ", "In another bacteria example, ", "small changes can help bacteria break down new chemical variations to sugars.", "At a cell biology/molecular level, the ", "motor proteins", " that walk along the cytoskeleton (responsible for everything from properly positioning neurotransmitters to muscle movement) need only ", "single amino acid changes", " to increase the stability of their \"grip\" on the cytoskeleton to nearly perfect when induced in cells. Fascinatingly, these mutations that \"improve\" the grip are NOT found in nature, meaning the for some reason, the \"perfect\" grip is likely selected AGAINST at a population level. Though it may not seem clear how something so small could effect whole animals, remember that all muscle-mediated movement is achieved by the coordination of thousands upon thousands of these motor proteins working together, and every single neuron requires them to function correctly. ", "Human milk tolerance is another beautiful example of a small change that ", "allowed some people to continue generating lactase into adulthood.", "Note that the last example wasn't a change to the actual protein, but rather ", " (i.e., when it was produced). This is actually the mind-blowing piece of the answer. It's not intuitive at all how small tweaks to individual proteins could produce the huge variety of organisms we see. However, if we consider that small mutations can alter ", " events happen in a growing, developing organism, the supposition sounds more reasonable. ", "a single mutation produced in a laboratory can convert a flies antennas into legs.", "This is a somewhat new field called ", "Evolution and Development", ", or ", "Evo-Devo", ". ", " The complex combination of these effects and how they are selected upon at the population level produces the great diversity of organisms we see today. ", "Said even shorter:", "\"Evolution is the control of development by ecology…\" -Dr. Leigh Van Valen", "edits: formatting " ]
[ "Delta F508 is a deletion of a whole codon, not a single point mutation. Sickle cell disease is caused by a single point mutation, an A->T mutation in the beta-globin gene which causes a glutamate to valine amino acid change." ]
[ "Why do humans smile when they're happy?" ]
[ false ]
[deleted]
[ "From an evolutionary perspective, the smile originates in our primate ancestors. They smile for one of two reasons", "To mediate aggression: Primates will expose their K9 in a \"smile\" to show how powerful they are (mouth open). This potentially diffuses and aggressive situation, effectively telling the other animals to \"back off\"", "A submissive sign: In some primates, they expose their teeth to show submission (with the mouth closed). In this way they can avoid an aggressive encounter with a higher ranking individual, and avoid conflict and pain.", "The idea is that smiling in humans is adapted from the submissive signal. Its a way to tell others that you are not a threat and that you mean no harm. Smiling is not a learned behaviour - in some very awful experiments from the early 1900's, babies deprived of parents and emotional stimuli smiled none the less when the researcher entered the room to give them food (the researcher did not interact with the babies). From this, we know that smiling is an innate behaviour. So you smile when you are happy because you are showing a submissive signal. Now of course, humans diverged from our last common ancestor with chimps some 4-6 million years ago. Since then unique meanings may have developed, even different cultures (while at the base of it smiling conveys the same meaning) it may have slight variation in expression. ", "Here is an article on smiling, very informative:", "http://www.scientificamerican.com/article.cfm?id=it-seems-that-in-almost-a", "You can also look up \"smiling in primates\" and lots of stuff comes up." ]
[ "How do you expose your teeth with your mouth closed?", "I am honestly confused here. I'm not sure if this is a stupid question or what..." ]
[ "Sorry I could have done a better explanation, submissive - keep your teeth together", "Human\n", "http://www.kristinaevey.com/wp-content/uploads/2010/01/smile2.jpg", "Primate\n", "http://us.123rf.com/400wm/400/400/phinizrl/phinizrl0810/phinizrl081000009/3747749-trained-baboon-giving-a-big-smile.jpg", "vs and open mouth threat: aggression", "Human\n", "http://t2.gstatic.com/images?q=tbn:ANd9GcT5LwfW1nFIS_8u64AgiI0V-iwIj6EhqUXJ6ToX2_ckcXOqLUws", "Primate\n", "http://www.nairaland.com/attachments/69733_baboon_jpg6ca7c69e006e254be88258e8985afd7d" ]
[ "What is the difference in gravity between the lowest and highest points on earth, and would it be noticeable to the average human?" ]
[ false ]
null
[ "It's more complicated than that because the Earth is not a uniform perfect sphere (for example, how does its spheroidal bulge at the equator affect gravity at the poles?). According to a ", "recent survey", ", gravity on the surface varies from 9.76 to 9.83 N/kg, or about 1%." ]
[ "The radius of the Earth is about 6400 km. The highest point on Earth is at an altitude of nearly 9km (Mt. Everest). The lowest point on Earth on dry land is about .4km below sea level, next to the Dead Sea; the lowest point covered by water is the Marianas Trench, nearly 11km below sea level. [Figures from ", "here", "]", "The difference in gravitational force between the top of Mt. Everest and the shore of the Dead Sea would be about 0.3%. If you could be at the bottom of the Marianas Trench and neglect the water pressure above you, the difference between the gravitational force there and at the top of Mt. Everest is about 0.6%." ]
[ "It's even more complicated than that because the gravitational gradient is notonly affeted by altitude, but also by the density of the underlying rocks. " ]
[ "Is there any basis for going gluten-free, if you don't have for-realsies-been-tested celiac's disease?" ]
[ false ]
My guess is no. But I figured I'd ASK SCIENCE!
[ "for-realsies-been-tested", "Ahh, the issue of diagnosis is a trickier one than you might imagine. The statistics are miserable: 97% of statistically expected cases are undiagnosed, and the average time to diagnosis for the \"lucky 3%\" is about 10-12 years of chronic pain.", "The \"gold standard\" test is a upper-small intestine biopsy. Problem is, this procedure can cost thousands of dollars and returns a lot of false negatives unless there is so much damage done that the patient is already at risk for complications of malnutrition. ", "The blood serum tests are relatively new, and they're also... less than precise. A lot of conditions and quirks can lead to general immune deficiencies, and there are a lot of non-IgG immune responses that can potentially be triggered. For example, some people have Dermatitis Herpetiformis (mediate by an IgA response to gluten) but few or no digestive complaints (IgG mediated).", "Now, for someone who is chronically ill with the complications of a gluten intolerance, it is tough to hold a job and even tougher to get insurance. This is where self-diagnosis comes in, and it isn't so far-fetched because the elimination diet is pretty much the only way the disease was diagnosed for the first 20 years after discovery. If you're strongly sensitive to a particular type of food and remove it completely from your diet, you'll feel a real difference and have no desire to go back on the stuff.", "Of course, since the tests record actual damage done and/or antibody levels, you can't get an actual diagnosis unless you've been eating lots of wheat for several months prior. Many people who begin to recover on an elimination diet have no incentive to feel sick for 12 weeks to make ", " feel better about the diagnosis of their condition." ]
[ "I have crappy (ha!) ibs type symptoms, and been tested for everything under the sun (all negative), and have only recently found that if I remove all sources of Fructans (fructose-based starch-like compounds), I feel much better. The diet I'm on strongly resembles a gluten free diet, and I suspect a lot of people who find relief from gluten free diets may in fact have a sensitivity to Fructans or other compounds from a group called \"FODMAPs\" that can cause ibs symptoms. " ]
[ "Gluten intolerance is similar to lactose intolerance in that the body reacts to gluten.", "No... they're incredibly different. ", "Lactose intolerance is related to the lack of an enzyme, lactase, that breaks milk sugar in to simple sugars. ", "Gluten intolerance is an immune reaction other than IgE (allergy) that has been linked to all kinds of auto-immune diseases and complications." ]
[ "Is there anything that can make the moon red-colored aside from lunar eclipses?" ]
[ false ]
I live in Japan and tonight I observed a reddish-colored moon, similar to what I've seen during lunar eclipses ( ). It seems that the last lunar eclipse was about a week ago from now, so I am somewhat puzzled. What am I seeing? What makes the moon appear red this time? Another interesting thing is that it seems that the moon tends to appear reddish around this time of the year in japan. Here's I captured about a month ago on June 19th. Are these all delayed(?) lunar eclipses? Strange weather conditions? Or something else?
[ "The moon is often red near the horizon for the same reason that the sun is red near the horizon (at sunrise and sunset): ", "Rayleigh Scattering", ". A small fraction of light that passes through the atmosphere is scattered off the air molecules. The shorter (bluer) wavelengths are scattered more often than longer (redder) wavelengths, so as light travels through more and more atmosphere (as it does when the light source is closer to the horizon), the initially-white light will appear more and more red. The effect is amplified when there is more water vapor and/or haze in the atmosphere, which would explain why it is more common in the warm summer months.", "This is actually the same process that causes the eclipsed moon to appear red, but for the opposite reason: When the moon is eclipsed, the only light that is reaching it is light that has been scattered though the atmosphere at a low angle: which, as we already discussed, is preferentially red due to rayleigh scattering! So when the moon is low in the sky, it reflects white sunlight towards our eyes which turns reddish as it passes through the atmosphere, while during a lunar eclipse, it reflects sunlight that has passed through a lot of atmosphere and so is ", " red when it hits the moon!" ]
[ "Ohh I see, thanks for the thorough reply!" ]
[ "Same reason sunsets are pretty. Its the light scattering from the atmosphere. Here is a link from cornell on the blood moon effect ", "http://curious.astro.cornell.edu/about-us/46-our-solar-system/the-moon/observing-the-moon/142-why-are-the-moon-and-sun-sometimes-orange-or-red-beginner" ]
[ "How would two moons affect our earth?" ]
[ false ]
null
[ "Planetary Sci" ]
[ "Planetary Sci" ]
[ "Such hypothetical / speculative / open-ended questions are better suited for our newish sistersub ", "/r/asksciencediscussion", ". Please post there instead." ]
[ "Are there anti photons?" ]
[ false ]
Are there anti photons and if there are what do they do differently from normal photons?
[ "The photon is its own antiparticle." ]
[ "A photon and an antiphoton are the same thing. If you apply the operation that changes a photon into an antiphoton, the state stays the same." ]
[ "All known chargeless particles with integer or zero spin are their own antiparticles...or, as I prefer to think of it, ", ". This is partly due to their charge being 0 because +0 and -0 are the same thing." ]
[ "Shortest wavelength humans can construct and how?" ]
[ false ]
null
[ "At the LHC the colliding protons can eventually lead to photons that have wavlengths much smaller than the size of a proton." ]
[ "You seem to be confusing frequency of emitted light with the power of a laser. While the two are related, they are not equivalent. The power of a laser is determined both by its frequency (how much energy is carried by each photon) and its intensity (how many photons per second are emitted). It's relatively easy to increase laser intensity. Indeed, the ", "national ignition facility", " operates some of the most powerful lasers in existence- about 200 lasers operated together that produce a combined 500 TW of power, or about 30 times the (time-averaged over a year) power consumption of the entire earth, for a very short period. Those unarguably \"super powerful\" lasers operate at 1053 nm - infrared frequencies, actually less energetic than visible light." ]
[ "could we use a large enough capacitor bank (theoretically) to produce any gamma ray we wanted? why don't we see super powerful lasers? " ]
[ "Serious question. Why does it seem like so many more people are allergic to so many more things?" ]
[ false ]
I'm sorry if this is a silly question. I'd just really like to know if there is any scientific proof, data, or reasoning behind this. It seems like we are constantly being warned now about peanut, shellfish, gluten, etc. I'm 29 now and do not remember hearing anything about any of these growing up. Does anyone have any thoughts? Thanks!
[ "Allergies have ", "increased significantly", " in western nations over the last 30 years.", "There are multiple lines of evidence pointing to the idea that our immune system is disregulated in the absence of parasites to fight. Specifically, This concept is called the ", "hygene hypothesis.", "There is even an experimental therapy for autoimmune disease that involves intentionally ", "infecting patients with worms.", "Keep in mind that there may be multiple factors contributing to the situation." ]
[ "There is likely to be an element of bias here too. As medical knowledge has expanded, and diagnostic methods and tools have improved, we are likely to diagnose more things that previously went unnoticed. So a portion of the growth is going to be due to us identifying things as allergic reactions.", "I doubt that would explain more than a small portion of the trend though." ]
[ "Thank you very much. That was very informative. I appreciate you taking the time to elaborate so much.", "The reason I created this thread is because my daughter will be starting kindergarten in just under two weeks and her school is VERY strict about what food can be packed for lunch. I was amazed. I mean, I remember eating peanut butter and jelly, etc, all the time at school. The times they are a changin' I guess...." ]
[ "Could we force an eruption of Yellowstone if we buried a nuke underground and set it off?" ]
[ false ]
null
[ "I'm going to piggy back off his question to ask my own.", "Could we relieve the pressure built up in the volcano? In a controlled way?" ]
[ "I'll hop on this one.", "Relieving pressure in a volcano would be extremely difficult because of the properties of the magma itself. Lets say you drill into a magma chamber with a low amount of pressure. The resulting relief of pressure allows magma to flow up the newly formed tunnel, however it will cool as it does so and cork itself.", "That said, you won't find a magma chamber that doesn't have a great deal of pressure already in place. In the case of a ", "pyroclastic flow", ", you end up with enormous amounts of pressure where no matter what kind of relief you provide, it's going to result in an enormous eruption with amazing amount of potential energy being released.", "There is a company called Ormat Technologies that I read about a while back who drilled into a magma chamber in Hawaii resulting in the corking I mentioned earlier, and even then the magma in the Hawaiian islands tends to produce a great deal of ", "mafic lava", " with particularly low viscosity, so if that failed to vent pressure it suggests that if the material were more viscous it would be even more difficult to manage.", "I hope this helped!" ]
[ "That said, you won't find a magma chamber that doesn't have a great deal of pressure already in place. In the case of a pyroclastic flow, you end up with enormous amounts of pressure where no matter what kind of relief you provide, it's going to result in an enormous eruption with amazing amount of potential energy being released.", "Only one problem. Pyroclastic flows are the result of eruptions. Secondly, the pyroclastic flows that would result from a destabilization of a caldera as large as Yellowstone would be enormous, and would dwarf the pyroclastic flows that could be output by a strata volcano.", "the magma in the Hawaiian islands tends to produce a great deal of mafic lava with particularly low viscosity, so if that failed to vent pressure it suggests that if the material were more viscous it would be even more difficult to manage.", "All magma produced from the Hawaiian islands is of mafic to ultra-mafic in composition. This is not only because Hawaii is a hotspot, but also because it's a hotspot in the middle of an oceanic plate. The difference between mafic lavas (those that are low in silica content) and felsic lavas (those that are high in silica content) is that mafic lavas are smooth, are of low viscosity, and as such, are not prone to being 'sticky' or holding together due to the presence and trapping of large amounts of gas bubbles. Felsic lavas are sticky and tend to have high amounts of explosive force associated with them. Same with felsic magma. Such magma present underneath Yellowstone's caldera, are as a result of an injection of mafic magma from the asthenosphere penetrating the continental plate at the point of the hotspot and subsequently crystallizing via fractional crystallization, thereby increasing silica content, increasing % gas trapped in the magma, and increasing viscosity of the magma. Partial melting of the above layers of continental crust is occurring as well as pressure increases within the magma chamber, thereby increasing the silica content and viscosity of the already felsic magma even further.", " Here's a ", "picture", " showing the position of the hotspot underneath Yellowstone National Park. As the North American Plate ventures to the Southwest, the hotspot, staying in the same place, will appear to move to the northeast, into Montana. This will take a couple million years before the yellowstone caldera stops getting a magma feed from the hotspot. It is likely that Yellowstone will erupt sooner rather than later, and will erupt at least once before the magma feed has ceased." ]
[ "Could the poles of a planet ever be warm enough to inhabit comfortably?" ]
[ false ]
Under what conditions would a planet have warm enough poles for people to live there comfortably? Is this even possible? The reason I ask is I saw a photo of the aurora borealis over barren arctic terrain and imagined a cityscape in the background. One thing led to another and here I am wondering about this. I know "inhabit comfortably" is a vague description, but I do seek a broad range of answers (if this is, in fact, possible).
[ "For much of Earth's history the temperature at the poles was much warmer than it is today. We just happen to be in an ice age right now.", "If the CO2 level in the atmosphere became high enough, the greenhouse effect would again result in less temperature difference between the poles and lower latitudes." ]
[ "A - \"Comfortably\" is a very relative term - The Inuit live in the high arctic and consider their territory an eminently comfortable place to inhabit.", "B - If by comfortably, you mean comparable to conditions in the seasonal temperate zone, there were elaborate forests, with redwoods and mixed hardwood-conifer assemblages growing on Ellesmere Island during the Eocene, about 30 My ago (see:", "http://www.thecanadianencyclopedia.com/articles/fossil-plants", "). As you can see on this map, Ellesmere was in an Arctic position at the time: ", "http://eas.unl.edu/~tfrank/History%20on%20the%20Rocks/Nebraska%20Geology/Cenozoic/cenozoic%20web/2/Timescale.html#6", " .", "C - Worth remembering: the effect of oceanic currents such as the Gulf Stream on actual climate is tremendous. As an example, consider the respective positions of Kuujjuaq and, say, Thurso in northern Scotland. Kuujjuaq is at the edge of the treeline with a definitely arctic climate, while the vicinity of Thurso is surrounded by fields denoting agricultural activity which would be unimaginable in Kuujjuak.", "As far as your vision of aurorae above cityscapes, we see some quite regularly in southern Canada, around Montréal for instance provided you can get far away from the city lights and its light pollution. You might want to have a look in northern cities such as Oslo, St-Petersburg, Murmansk, Arkhangelsk and Edinburgh.", "Also, keep in mind that aurorae do not form at the pole ", ", but in a ring centered on the poles. " ]
[ "I bet even the poles on Mercury are hotter than a comfortable temperature...", "I think it is always possible for the poles to be hotter, but I'm not sure if something large enough to be a planet could have a comfortable temperature at the poles and the equator. Perhaps a planet that has less/different land mass than earth could have better ocean currents to smooth out the temperature more effectively..." ]
[ "Why don't we ever have super storms on the West Coast?" ]
[ false ]
null
[ "The west coast has a cold current and significant upwelling along the coast, pulling up cold deep-water. There's no scientific definition of a \"superstorm\", but it seems like what the media is talking about is the extratropical transition of a hurricane. Without sufficiently warm sea surface temperatures, you have no hurricane activity. However, the west coast does get hammered by some pretty intense frontal systems and is subject to wind storms." ]
[ "I'm going to remove this question and refer you to this slightly more generally worded question posted within a few minutes of yours: ", "http://www.reddit.com/r/askscience/comments/12h80e/why_dont_we_ever_have_super_storms_on_the_west/" ]
[ "Awesome, thanks!" ]
[ "Is it possible that General Relativity is simply not a full picture of gravity?" ]
[ false ]
Perhaps I'm thinking about it wrong, but the idea is that General Relativity is our best description for gravity to date, and it works really well with most things. But then it seems to not work so well on the scale of galaxies which is why we have the theory for dark matter. Newton's laws of gravity work to a certain extent, but it's not complete. the math of relativity covers a larger scale. Is it possible that there is simply a larger theory of gravity that relativity is just not ecompassing? Could the idea of a spacetime fabric be wrong/incomplete? Is the only next step in improving the theory to unite gravity with quantum mechanics? Wouldn't this still leave dark matter unexplained anyways?
[ "Is it possible that there is simply a larger theory of gravity that relativity is just not ecompassing? Could the idea of a spacetime fabric be wrong/incomplete?", "Yes. Many theoretical physicists are working on this.", "Is the only next step in improving the theory to unite gravity with quantum mechanics? Wouldn't this still leave dark matter unexplained anyways?", "The media and most popular physics books may only talk about the grand quest to unite general relativity with quantum field theory, and while there are physicists who are thinking about those things (especially string theorists), that unification is expected to occur at extremely high scales of energy that we won't be able to probe with particle accelerators for many, many years. Perhaps centuries.", "I'd say that the vast majority of theoretical particle physicists are focusing on physics at and just above the current reach of our particle accelerators. (This includes me.) Some of these proposed theories offer explanations for dark matter as a new particle or set of particles we haven't yet been able to create in the particle accelerators. ", "Some astrophysicists and cosmologists are working on modifications to general relativity that explain the anomalous astronomical findings. But it seems that recent observations disfavor this viewpoint." ]
[ "Sure, this is very possible. In fact, we know pretty much for certain that at the quantum scale it can't be the full picture of gravity, and there's a whole lot of work dedicated to figuring that out. But there's also quite a few people (hi!) who are looking into its behavior on larger scales, to answer, as you suggested, mysteries like dark energy and inflation.", "I'd note that while there do exist modified gravity theories meant to explain dark matter, none of them are very convincing or elegant, and practically all of them now require you to have some amount of dark matter in order to fit the data anyway, which makes them (in my mind) practically useless. One striking observation which I've found to be a real challenge for modified gravity alternatives to dark matter to explain is the ", "Bullet Cluster", ". This is a pair of galaxy clusters on a collision course with one another, and when galaxy clusters collide, the matter within them gets thrown every which way. Dark matter doesn't interact electromagnetically so if these clusters have it, the dark matter will be flung far out, while gas and stars will be slowed down on their way out by friction. Sure enough, observations of the Bullet Cluster reveal that the majority of the mass (the blue in that image) is offset from the place where all of the light is coming from (the pink part). This is completely in line with predictions from dark matter. However, if dark matter were explained by a modification to gravity, you would expect the gravity to follow the luminous matter, not a seemingly-empty patch of space. So it seems that dark matter is here to stay, which is fine, because there are ", " of fundamental particles out there, and it wouldn't be surprising if just one of them turned out to be a) very abundant and b) weakly interacting.", "But there are plenty of reasons to consider modified gravity to consider inflation and dark energy, two rather similar periods of accelerated expansion at very early and very late times, respectively. These could be explained by adding new matter into the picture, usually an exotic type of matter called a scalar field, but they might also have a more natural or elegant explanation as a sign of new gravitational physics. This is somewhat complicated by an interesting little problem in which essentially any such modification to general relativity can actually be recast, by a simple change of coordinates (or just rearranging Einstein's equation!), as general relativity with some sort of non-trivial matter, so in a certain philosophical sense the distinction between changing gravity and changing matter becomes almost semantic." ]
[ "unification is expected to occur at extremely high scales of energy that we won't be able to probe with particle accelerators for many, many years. Perhaps centuries.", "Which is why you need cosmologists.", "You're welcome." ]
[ "Is ATP transported in the blood or between cells?" ]
[ false ]
Each cell must make its own ATP, right? Dumb question that I know I should really know. I have a very sketchy understanding of biochemistry. What about other intermediates in the various pathways leading up to the citric acid cyle eg. pyruvate, acetyl CoA? For some reason, I can't find any definitive answer to this on the internet or in textbooks. Many thanks !
[ "ATP is released from damaged or dying cells. It can also be released through exocytosis. There are some receptors on the surface of cells that use ATP as a ligand like ", "P2X", ". It's not what you're looking for but ATP can be broken down into adenosine and then taken up by the cell by ", "ENTs", " or ", "CNTs", ". ", "ATP can be released by ", "hemichannels and transferred between cells with gap junctions though.", "As for the other intermediates: ", "citrate, succinate, and a-ketoglutarate are imported into cells via SLC13", " (", "glutathione too!", "). Acetyl-CoA is imported by the ", "SLC33 family", ".", "Basically if you want to see if a small molecule is imported into the cell you could try looking through the list of ", "SLCs", "." ]
[ "it would split into ADP and a phosphate ion shortly after being made anyway", "This is entirely false. ATP isn't stable in an unbuffered condition like water, but in buffered neutral/blood pH ranges it's stable for a very long time.", "If it wasn't stable then most molecular biology wouldn't work because there would be no ATP in PCR reactions or in enzymatic reactions (like restriction enzymes) we run for 16+ hours." ]
[ "no, ATP is a very unstable molecule which is why it's used as a store of energy by your cells. there are no known channels for ATP to leave the cell and it would split into ADP and a phosphate ion shortly after being made anyway.", "I asked my Biology teacher a similar question on whether ATP injections could increase cellular activity but it's simply too unstable to exist for long which is why your cells use it immediately after it is produced" ]
[ "Why is protein an information sink?" ]
[ false ]
null
[ "In ", "communication theory every transmitted message has at least a source and a sink", ". The sink is the place where the information is actually put to use.", "As outlined ", "here", " the source of the information is the genome, and after encoding and decoding steps during translation and transcription the protein performs the actual function intended by the source. Or to put it another way, the protein is where the transmission of information ends, so the information sinks out of the tramission system to perform a task." ]
[ "Note that this picture is likely to get more complicated in the future. Epigenetic studies have shown that there appears to be some sort of communication from protein back to the genome. A scent receptor protein that proves to be important to an individual will be more highly expressed in the next generations via epigenetic changes. How this information is communicated back upstream is still a complete mystery." ]
[ "So essentially DNA is the source of information, RNA transcribes that information into proteins which then use that information to perform a task, ending the chain of information?" ]
[ "If a brown dwarf collided with a dying star, would that star be 'revived'?" ]
[ false ]
A star starts to die because it losses/depletes all its helium/hydrogen and it is unable to create fusion anymore. So, if a gas giant big enough collided with a dying star, would that star now have the materials necessary to live for another few million/billion years?
[ "losses/depletes all its helium/hydrogen", "No.", "It depletes (fuses into larger nuclei) the hydrogen in its core. It has plenty of hydrogen left in the outer layers.", "So, a dwarf would only speed up the death of the star as the core will be depleted even faster." ]
[ "Didn't think about that.", "It likely won't make a difference though, since once the red dwarf \"dies\" it will have too much metals in it to be able to fuse the hydrogen in a sustained manner. At least, that's what my understanding is." ]
[ "Red dwarfs aren't hot enough to fuse helium, so they end their life as a white dwarf that's basically a big ball of hot helium. These can undergo fusion if you add more material.", "Larger stars like our sun fuse helium during their lifetime (the dramatic \"helium flash\"), so their white dwarf remnants are made of heavier elements, which require greater temperatures to fuse. These won't undergo fusion, as you say.", "All of the white dwarfs today are the result of larger stars, because red dwarfs haven't had time to die yet. But eventually most white dwarfs will be red dwarf remnants, because there's a lot more red dwarfs than other types of stars. So the answer to OP's question depends on the timeframe. Today, stellar remnant collisions won't produce fusion; in the far future, they might!" ]
[ "Why some people, when drunk, are mellow and merry, and some people are quite the opposite - abusive, aggressive, and violent?" ]
[ false ]
null
[ "It's about the context of the situation\n", "http://www.newyorker.com/reporting/2010/02/15/100215fa_fact_gladwell" ]
[ "Hard to answer in non-anecdotal way. You know what they say - alcohol removes inhibitions. One can say it reveals the \"true\" (in a sense) personality." ]
[ "Before we answer this, we should ask: what contributes to different personalities/behaviours when people aren't drunk?" ]
[ "How come other planets have visible craters from space and Earth doesn't?" ]
[ false ]
null
[ "Several reasons:", "Earth has a reletively thick atmosphere, meaning that most astroids vaporize before they hit the ground.", "Earth has liquid water, meaning that natural erosion and terraforming happens relatively quickly.", "Earth has a lot of flora and fauna that change the landscape naturally over time." ]
[ "I agree with what has already been said but add tectonics, the constant recycling of the Earths surface. It's not quick, but a lot or craters we see on other planets are in the billions of years old range. Also keep in mind that we have massive oceans and humans constantly rework large portions of the exposed land.", "Also important, there are craters on Earth that are visible from space." ]
[ "I'll add that Earth has active plate tectonics, which means that the crust is constantly being recycled and replaced by new material, unlike other celestial bodies such as the moon.", "That being said, Earth does have craters. Just not as many as bodies with older surfaces and no plate tectonics.", "Consider ", "Manicouagan crater", ", ", "Pingualuit crater", " and the ", "Barringer crater", "." ]
[ "Several questions about CERN and the LHC" ]
[ false ]
I've always wondered a couple really basic things about experiments at CERN, the LHC, and similar facilities. I realize that these experiments are on an incredibly small scale, but the sheer amount of energy must have some kind of recognizable impact on humans. Thanks!
[ "Atlas", " scientist here.", "I think 1 and 2 were answered appropriately by gaze. (But feel free to ask more).", "On 3: The kinetic energy of one of the protons at full energy in the LHC is about the same as a few mosquitoes in full flight. While that is an insane amount of energy for a single proton to have, you wouldn't expect the ground to shake when those mosquitoes hit a wall. Also, we are producing a lot of these collisions, the final goal is to produce 800,000,000 per second, although we are still some way away from that. So what you'd hear, if you do hear anything would be more like a continuous noise than individual bangs.", "The final answer though, is that I really don't know if you can hear the difference between collisions occurring and not occurring. The detector cavern is bathed in radioactivity while we're running, so it's not allowed to be down there to listen. We do have webcams down there, but I'm not sure if the sound in the detector is being recorded. ", "I'll try and find out by asking some of the accelerator engineers or something, but it'll probably take a while." ]
[ "ABlackSwan works at CERN and did ", "a wonderful AMA", " that may help you and if not, drop a note there " ]
[ "Thanks! I didn't realize the energy was that size. It's great to have someone right from the source respond. " ]
[ "Why do whales breach water?" ]
[ false ]
I saw a post on in which a humpback whale throws itself into the air and then 'bellyflops' on the surface. Is there some biological reason that do this or do they just do it for fun?
[ "I don't think we've nailed this one down yet - some possibilities I've read about include dislodging pests or scratching and itch. They also slap their fins and tails on the surface water, perhaps to let other whales know who's boss (bigger whales make bigger splashes). One site suggested that since breaching is often done in rough seas, the whale may be attempting to rise above the mist over the water to catch less moisture when taking a breath. That one seems a stretch, but we'd have to ask a whale to be sure!" ]
[ "The full reasons for why whales breach isn’t fully known. ", "Whales seem to do so more on windy or rough days, when the sound of their voices might not be as effective. A loud crash into the water, however, might be just what they need to communicate with far off groups. ", "They appear to breach most when other whales are somewhat near but a bit far away. They slap their tail into the water when others are nearish. ", "Ultimately, breaching takes a lot of energy. While some of it may be fun, particularly for small or younger whales, there appears to be a kind of communication. It’s possible they’re using it to communicate location, or social interaction, to nearby groups as they meet up. ", "We ultimately haven’t resolved the issue though. What, exactly, are they saying? Why expend that much energy saying it? We don’t know, but we do know they do it most when their voices are drowned out by surface sounds and when they’re far apart." ]
[ "The answers to many of the really interesting questions is \"we don't know\" -- if you find that you're asking a lot of questions that no one knows the answer to, you're probably doing something right in terms of creative thinking and observing the world." ]
[ "Will an abundance of Oxygen benefit human beings or harm us?" ]
[ false ]
I am aware the troposphere (our ground level) is made up of approx. 75% Nitrogen and 25% oxygen. We breath in mostly nitrogen, but our body only makes use of the littles oxygen that is inhaled. If the ratio were to be switched, would it benefit humans, or harm us?
[ "The greatest danger to humans would not be biological. The greatest danger is the risk of and intensity of fire in an oxygen enriched environment.", "Oxygen Gas Risks - Oxygen Enrichment" ]
[ "People are often given 100% oxygen in hospitals and as treatment for decompression sickness (the bends) so it's safe to breath for a short time at least. But, at higher partial pressures (above about 1.6 atmospheres) oxygen is toxic and caused convulsions/seizures. ", "Incidentally atmospheric oxygen concentration is a little under 21%. Giving a partial pressure of 0.2 bar so oxygen toxicity is only really an issue for divers." ]
[ "Anecdotally, breating pure oxygen makes me feel ... exhausted. It feels great for short time, but it is tiring. I think of it as the oxygen making my body run too fast (have no idea if this is correct - probably not - but it's how I feel. So I think it would harm us. ", "More scientifically, there are two kinds of oxygen toxicity. When breathed at high partial pressure it causes immediate convulsions and seizures. At lower partial pressures (above atmospheric, but below 1 bar) it is toxic more slowly, over a period of several hours." ]
[ "If most predators have front-facing eyes, why doesn’t the same rule apply for predators like sharks or orcas?" ]
[ false ]
[deleted]
[ "Long distance vision isn’t nearly as useful underwater because light doesn’t travel as far, but vibrations/sound/scent trails do because water is so much thicker and less compressible than air. ", "So it makes sense that in an environment where it’s easier to detect distant prey by hearing, feeling, and smelling them than by using eyesight, the predators would find more success with, and evolve to prefer, those detection methods." ]
[ "This seems sensible.", "Also: on land the main area of interest is a narrow band along the horizon, while in the water both threats and prey can be anywhere within the field of view, so trading off depth perception for an increase in coverage makes sense." ]
[ "Visibility above 5 metres is unusual underwater. Binocular vision won't be a good way of positioning prey in these conditions. Image clarity is a better guide. ", "Also interesting: This lack of long distance vision makes having a big brain that does planning a waste of energy. What you see is what you get. So, this may be why fish can have fast reactions but they are basically pretty dumb. ", "The smartest animals in the sea are marine mammals that have brains that evolved on land. These mammals use echo location to avoid this problem and can \"see\" large distances through murky water." ]
[ "How do we know what wavelengths other eyes can see?" ]
[ false ]
[deleted]
[ "You can actually record activity from photoreceptors using microelectrodes and measure their responses to different wavelengths of light. Photoreceptors don't just respond to individual colors; they respond at various strengths to a continuous set of wavelengths. See for example ", "this chart", ".", "The range of light an animal can respond to is a function of the number of distinct photoreceptor populations and their response curves. You can sort of figuratively extrapolate what \"colors\" an animal could see from that, or at least which colors they can differentiate. What the actual color experience of the animal is (or, frankly, any other human besides me) is probably not knowable." ]
[ "Firstly, you can assess it behaviorally. Humans don't respond to UV, but bee's for example, do. ", "Secondly, you can examine the eye itself. Human rods and cones only absorb the 'visible spectrum'. Other animal eyes absorb more." ]
[ "As was already said here, we can do behavioral tests (show an animal different lights and observe their reactions) as well as analyse their eyes/retinas at the cellular level (to discover how many receptor types there are and to what part of the spectrum they are sensitive).", "However, that only tells us what part of the electromagnetic spectrum an animal can perceive, it does not tell us what an animal ", " sees. For that, we'd need a good understanding of all the relevant brain processes.", "Keep in mind that color is not the same as wavelength. Color is a perception created by the brain, based on the activities of the photoreceptors, which in turn are stimulated by light. We can measure the light's spectral power distribution (which wavelengths it contains), measure the photoreceptors' spectral sensitivity curves (which wavelengths they react to), but we cannot as easily measure what the brain eventually makes of it." ]
[ "What makes a metal lustrous? Also, what is the most lustrous/shiny metal?" ]
[ false ]
null
[ "This is correct, although here's a quick followup bit of information in regards to the \"most lustrous/shiny metal\".", "You would think that since the mathematics of the free electron model implies that higher conductivity induces a smaller skin depth would imply that a metal like gold would be the shiniest. In fact, this is not the case.", "The reason is because gold's plasma frequency is in the visible spectrum (see ", "here", " for more information on how this works), and as a result, a significant part of the spectrum is, in fact, not reflected by gold.", "The most reflective metals are those with both high conductivity as well as a plasma resonance at frequencies higher than those within the visible range.", "On a side note, plasmonics is a really cool field (speaking as someone who just finished a course in nanophotonics)." ]
[ "A metal is a lattice of metal 'ions' in a 'sea' of delocalised electrons - ", "mobile electrons", ".", "Photons of light do not penetrate very far into the surface of a metal and are typically reflected, or bounced off, the metallic surface, by the mobile electrons and what you get is metallic reflection, which is lustrous." ]
[ "Keep in mind that many things would be lustrous if smooth enough. You're toilet would be lustrous if you polished it a bit. Metals are simply easy to polish because they are soft, so you see more polished metal pieces.", "As far as the 'most' lustrous metal there really isn't one. The reflectivity of metals below a critical frequency ends up being 1 (a.k.a 100% reflected light) so most metals don't reflect more or less light then other metals. It would come down to the best polishing you could do, not the optical properties of the metal. " ]
[ "Equilibrium question" ]
[ false ]
So we did a lab on equilibriums and formed this reaction: Fe (aq) + SCN (aq) <-> FeSCN (aq) using colorless Fe(NO3)3 and colorless KSCN to get the Fe and K ions. The reaction was orange-red envelope color. My question is, did KNO3 form as a combination of those ions and if it did, is it responsible for the red-orange color change? And considering that answer, what ion combination must be responsible for that color change?
[ "KNO3 is soluble in water, so in the sense that you mean it, KNO3 did not form. The ion responsible for the red is FeSCN(H20)_5", " (", "Wikipedia", ")." ]
[ "Wait, so the KNO3 did not form at all? When the KSCN and Fe(NO3)3 reacted, didn't the K+ and (NO3)3- dissociate though? " ]
[ "The KSCN dissociates to become K+ and SCN-, and the Fe(NO3)3 dissociates as well. Once dissociated, equilibrium favors the K", " and NO3", " not precipitating out.", "The reaction here is between the SCN", " and Fe", " ", " both ions have gone into solution individually." ]
[ "WHY do gases, such as Helium & Hydrogen INCREASE in temperature when subject to Joule-Thomson effect?" ]
[ false ]
Most of the gases I've dealt with, when subject to a shock pressure difference, cool to such an extent that they nearly freeze. However, several gases (hydrogen, helium etc.) actually increase in temperature when suddenly going from a higher pressure to a lower pressure. I'm also aware that in some cases (extremely cold temperatures and relatively low pressures) that hydrogen and helium do decrease in temperature. What causes this, and how is it different to a gas like Nitrogen (which obviously decreases in temperature) in most circumstances?
[ "It has to do with the balance between attractive and repulsive intermolecular forces of the gas in question. Larger molecules have more electrons and thus a greater tendency to attract each other via the Van der Waals interaction, so the attractive forces are dominant. These gases behave as you would expect and cool on expansion because as the molecules get further apart they slow down, much the same way a ball would slow down if you threw it straight up away from the Earth. With hydrogen and helium, however, repulsive forces are more prevalent. When packed close together, their molecules can only run so far away from each other before colliding with another molecule that slows it down. If the gas is allowed to expand the molecules have extra room to get away from each other, and so the temperature increases." ]
[ "But as a gas expands the average distance between molecules increases and van de waals forces are very short range interactions (they decay as 1/r", " so why would the potential energy increase in such a case? " ]
[ "If we assume potential energy reaches a maximum after a certain distance, then only molecules that are within that distance will serve to reduce the total potential. A gas in a larger volume will have a longer mean free path and a greater fraction of molecules out of range at any given time. More molecules are at maximum potential, so overall kinetic energy decreases." ]
[ "What does the Partition Function actually mean in a physical sense? Why does it contain all the information for the thermodynamical properties of the system?" ]
[ false ]
I mean this from the perspective of statistical mechanics: I get that the partition function is the "Normalization factor" of the probability calculation for the different states. But I don't get why does that mean that we can derive a system's energy, etc. so easily from it. Is this just a result of some algebraic miracle (that somehow the calculation for the average energy by traditional methods coincides with the one using the partition function)? Or is there some deeper meaning to the partition function that makes it as useful as it is?
[ "Just look at what the derivatives of the log of the partition function are and compare then with the definitions of the statistical average.", "You can see that d(ln Z)/dβ has the same form as <E>.", "I’m not sure what kind of intuition there is to be had, outside of just looking at the mathematical definitions." ]
[ "You're missing a minus sign, but, yes, I agree that there really isn't much intuition here. If you simply write down the probabilistic definition of expected value and the definition of Z, then you get the desired relationship right away. It's more or less a combination of the following:" ]
[ "The partition function certainly doesn't know everything about the system, but just many of the system's ``average'' properties. For thermodynamics, these are the quantities physicists care about. Here's a more mathematical way to think about it. The partition function is a sort of ", "moment-generating function", ". One of the essential properties of such a function is that it contains ", " of the moments (i.e. expectation values). Therefore, the partition function is more than a measure. It's a physical quantity which knows about many of the system's average values.", "As an aside, the partition function (and its generalizations) is an essential tool to probe quantum systems at zero temperature as well. In such theories, it can play an even more pivotal role as well. For instance, in two dimensions the partition function of a conformal field theory (CFT) on the torus is typically required to be modular invariant. Modular invariance of the partition function leads to stringent constraints on allowed quantum systems; e.g., the high energy states are universally constrained by the existence of a vacuum state." ]